WorldWideScience

Sample records for test af metoder

  1. Test af metoder til marine vegetationsundersøgelser

    DEFF Research Database (Denmark)

    Krause-Jensen, D.; Laursen, J. S.; Dahl, K.

    in order to assess methods of optimising monitoring of benthic marine macrophytes in Danish waters. The investigations focused on qualitative and semi-quantitative analyses of different macroalgal and eelgrass communi-ties. The tests were performed on three different types of communi-ties in three...... at developing a sampling strategy to de-scribe temporal and spatial variation in macroalgal communities. The tests measured precision of the methods and reproducibility among observers. Sampling was performed to identify the occurring species and estimation of percentage cover of each species. Individual stones...... were used as sampling units and one sampling included 8-10 stone replicates. In order to reduce sampling variation, a stone size of 30-40 cm was used throughout the tests. The samples were analysed with multivariate statistics. This method allowed statistically significant vertical separation...

  2. En kvantitativ metode til analyse af radio

    Directory of Open Access Journals (Sweden)

    Christine Lejre

    2014-06-01

    Full Text Available I den danske såvel som den internationale radiolitteratur er bud på metoder til analyse af radiomediet sparsomme. Det skyldes formentlig, at radiomediet er svært at analysere, fordi det er et medie, der ikke er visualiseret i form af billeder eller understøttet af printet tekst. Denne artikel har til formål at beskrive en ny kvantitativ metode til analyse af radio, der tager særligt hensyn til radiomediets modalitet – lyd struktureret som et lineært forløb i tid. Metoden understøtter dermed både radiomediet som et medie i tid og som et blindt medie. Metoden er udviklet i forbindelse med en komparativ analyse af kulturprogrammer på P1 og Radio24syv lavet for Danmarks Radio. Artiklen peger på, at metoden er velegnet til analyse af ikke kun radio, men også andre medieplatforme samt forskellige journalistiske stofområder.

  3. Evaluering af metoder til risikovurdering af kombinationseffekter og etablering af PBTK/TD modeller for pesticider - et ph.d.-projekt

    DEFF Research Database (Denmark)

    Reffstrup, Trine Klein

    2012-01-01

    I dette ph.d.-projekt ved DTU Fødevareinstituttet er den nuværende viden om metoder til risikovurdering af kombinationseffekter af kemiske stoffer med fokus på pesticider gennemgået. Endvidere undersøgtes, hvordan man kan implementere matematiske computermodeller som et værktøj i vurderingen af...

  4. Test af Software

    DEFF Research Database (Denmark)

    Dette dokument udgør slutrapporten for netværkssamarbejdet ”Testnet”, som er udført i perioden 1.4.2006 til 31.12.2008. Netværket beskæftiger sig navnlig med emner inden for test af indlejret og teknisk software, men et antal eksempler på problemstillinger og løsninger forbundet med test af...... administrativ software indgår også. Rapporten er opdelt i følgende 3 dele: Overblik. Her giver vi et resumé af netværkets formål, aktiviteter og resultater. State of the art af software test ridses op. Vi omtaler, at CISS og netværket tager nye tiltag. Netværket. Formål, deltagere og behandlede emner på ti...

  5. Test af spørgeskema

    DEFF Research Database (Denmark)

    Hermansen, Jonathan

    2017-01-01

    Denne bog gennemgår alle surveyarbejdets faser og giver en praktisk indføring i •design af undersøgelsen og udvælgelse af stikprøver, •formulering af spørgeskemaer samt indsamling og kodning af data, •metoder til at analysere resultaterne....

  6. Sammenligning af laboratorieforsøg med kemiske, biologiske og termiske metoder til oprensning af residual fri fase under grundvandsspejlet i Kærgård Plantage

    DEFF Research Database (Denmark)

    Christophersen, Mette; Christensen, Jørgen Fjeldsø; Jørgensen, Torben H.

    , sulfonamider, barbiturater, anilin, cyanid og kviksølv, og det har resulteret i en meget kompleks forurening. Efter afgravning af 4000 tons meget forurenet jord ned til grundvandsspejlet i to af de seks gruber er næste skridt afprøvning af forskellige metoder til fjernelse af den kraftige grundvandsforurening...

  7. Den positive psykologis metoder

    DEFF Research Database (Denmark)

    Andersen, Frans Ørsted; Mørck, Line Lerche; Nissen, Poul Erik

    En antologi der giver en introduktion til en række af de metoder der anvendes til forskning, assessment, test, udviklingsarbejde og intervention indenfor den positive psykologi.......En antologi der giver en introduktion til en række af de metoder der anvendes til forskning, assessment, test, udviklingsarbejde og intervention indenfor den positive psykologi....

  8. Kombineret laser Doppler flowmetri og spectrophotometri som metode til vurdering af mikrocirculation

    DEFF Research Database (Denmark)

    Berggren Olsen, Mette; Sørensen, Hanne Birke; Houlind, Kim Christian

    Kombineret laser Doppler flowmetri og spectrophotometri som metode til vurdering af mikrocirculation Berggren, MB, reservelæge, Karkirurgisk Afdeling, Kolding, mette.marie.berggren.olsen@slb.regionsyddanmark.dk; Houlind, K, lektor, afdelingslæge, Ph.d., Karkirurgisk afdeling, Kolding, kim...

  9. Aktionslæring som metode til udvikling af inkluderende praksis

    DEFF Research Database (Denmark)

    Olsson, Janne; Maltzahn, Lene Nyboe

    2014-01-01

    Kapitlet handler om, hvordan genkendelige hverdagspraksisser i daginstitutioner i nogle tilfælde ekskluderer børn, mens andre praksisser understøtter, at børn kan tage del i fællesskaber. Med afsæt i en konkret case argumenteres der for, at aktionslæring som metode kan gøre det muligt for pædagog...

  10. Metoder til måling af ketose hos søer

    DEFF Research Database (Denmark)

    Olesen, Anja Kibsgaard; Theil, Peter Kappel; Kristensen, Niels Bastian

    2010-01-01

    kunne være en laboratoriebaseret, enzymatisk målemetode på plasma eller serum. Denne metode kræver dog, at der udtages blodprøver af søerne, samt at disse prøver sendes til et laboratorium og centrifugeres. Denne form for analyse er dermed meget ressourcekrævende, og resultaterne fås ikke samme dag. Der...

  11. Online lektiehjælp – Udvikling af en vejledningsdidaktik med pædagogisk designforskning som metode

    Directory of Open Access Journals (Sweden)

    Jens Jørgen Hansen

    2016-05-01

    Full Text Available Lektievejledning er en pædagogisk praksis i rivende udvikling med fokus på at støtte elever i at forstå og håndtere udfordringer i deres lektiearbejde. Lektievejledning er på den politiske dagsorden i skole og ungdomsuddannelser og tilbydes både internt af uddannelsesinstitutionerne samt af private og offentlige aktører. Men lektievejledning er ikke etableret som et teoretisk felt eller som en særlig vejledningskompetence. Der er således behov for at begrebsliggøre og udvikle teori om, hvad lektievejledning er, og hvordan vejledningsformen didaktisk kan håndteres. Mere konkret er ud-fordringen at udvikle et nuanceret fagsprog samt en modellering af feltet til forklaring af lektievejledningens komplekse praksis med det mål at udvikle og kvalificere lektievejledning som pædagogisk teori og pædagogisk prak-sis. Denne artikel præsenterer resultatet af et forskningsprojekt, hvis mål er at udvikle en vejledningsdidaktik, herunder metoder, modeller og materialer for lektievejledning i regi af Lektier Online. Lektier Online er en organisation ved Statsbiblioteket i Århus, der tilbyder en online lektiecafe, hvor bl.a. gymnasie-elever kan få hjælp af frivillige universitetsstuderende. Dette didaktiske de-sign er et eksempel på, hvordan digitalisering og ny teknologi er en katalysator for udvikling af nye innovative læringsmiljøer og læringstilbud, der åbner fleksible og stedsuafhængige rum for læring, giver mulighed for samspil med aktører uden for skolens formelle rammer, og som er båret af integration af digitale teknologier i læringssituationen. Artiklen beskriver forskningsproces-sen med at indkredse en vejledningsdidaktik for lektiehjælp samt udviklingen, konceptualiseringen, afprøvningen og evalueringen af en række vejlednings-modeller på grundlag af forskningsmetoden Pædagogisk designforskning og dens tradition for brugerdreven innovation. Artiklen beskriver for det første resultatet af forskningsprocessen i form

  12. Pædagogisk brug af test

    DEFF Research Database (Denmark)

    Nordenbo, Sven Erik; Allerup, Peter; Andersen, Hanne Leth

    Publikationen er resultatet af et systematisk review foretaget i regi af Dansk Clearinghouse for Uddannelsesforskning. Reviewets grundspørgsmål er: Hvordan kan grundskolelæreres individ- og klassecentrerede brug af data fra test forbedre læreres didaktiske og/eller fagdidaktiske tiltag i klasser...... med almindelige elever? Spørgsmålet vedrører alene testtyper, som indgår i nationale test i de nordiske lande. Og hvordan indvirker indførelsen af testning på læreres didaktiske beslutninger og elevers læringsadfærd? Vi fandt frem til at grundskolelæreres individ- og klassecentrerede brug af testdata...... i klasser med almindelige elever forbedres, når de didaktiske og/eller fagdidaktiske tiltag bygger på test, som lærerne oplever et medejerskab for. Vi fandt fremtil, at introduktion af test fra instanser over klasseniveau med det formål at indvirke på undervisning og elevers læringsadfærd har...

  13. Den juridiske metode

    DEFF Research Database (Denmark)

    Hansen, Lone Louring; Werlauff, Erik

    DEN JURIDISKE METODE – en introduktion (2. udgave 2016) er en brugervenlig og praktisk bog om den juridiske metode. Den kan læses af både studerende og læsere uden juridiske forkundskaber. Bogen omhandler juridisk metode gennem 2000 år, retsområderne, udstedelse af retsregler, domstolene og deres...

  14. Test af to versioner af Modflow-LGR til simulering af grundvandsstrømninger i områder med begravede dale – syntetisk studie

    DEFF Research Database (Denmark)

    Vilhelmsen, Troels Norvin; Christensen, Steen

    .eks. findes i begravede dale. Manglende opløsning af geologiske aflejringer på lokal skala kan potentielt resultere i fejlagtige prædiktioner af konsekvensen af grundvandsindvinding på kildeplads niveau. For i højere grad at kunne forvalte disse grundvandsressourcerne skal nye metoder undersøges. Dette er...... specielt gældende for komplekse begravede dalsystemer, som interagerer med omkringliggende regionale grundvandsystemer. I dette syntetiske studie er to versioner af MODFLOW - Local Grid Refinment (LGR) testet til simulering af grundvandsstrømninger i områder med begravede dale. Forsøgene er gennemført som...

  15. Metoder til miljøkonsekvensvurdering af økonomisk politik

    DEFF Research Database (Denmark)

    Møller, F.

    I rapporten gøres der rede for, hvilke forhold der skal beskrives for at miljøkonse-kvensvurdere forskellige former for økonomisk politik. Endvidere beskrives mulig-hederne for at gennemføre miljøkonsekvensvurderingen gennem brug af national-regnskabets input-output tabeller samt ved brug...

  16. Metoder til kortlægning og måling af fysiske ressourcer

    DEFF Research Database (Denmark)

    Nielsen, Niels Christian

    2010-01-01

    for det. Diskussionen gik, som den nu skal, på kryds og tværs af temaer og definitioner, men jeg vil her afgrænse mig fra opgørelser af de sociale, erhvervsmæssige og økonomiske ressourcer i et lokalområde, som de to andre oplægsholdere har beskrevet. I oplægget til workshoppen udfoldedes ideen om, at en...... kort - og efterfølgende observere og sammentælle. At det ikke er helt så enkelt i virkeligheden, kommer næppe som den store overraskelse, men jeg vil i det følgende prøve at reflektere over dels hvad det egentlig vil sig at kortlægge i og omkring et lokalsamfund og dels hvilke informationer som man kan...

  17. Metoder til indsamling af internetmateriale og deres effekt på senere analyser - med Facebook som eksempel

    DEFF Research Database (Denmark)

    Laursen, Ditte; Brügger, Niels; Sandvik, Kjetil

    2017-01-01

    enhver forsker og studerende vil møde, når Facebook i dets dynamiske online form bliver gjort til analyseobjekt gennem arkivering. Konkret illustreres det, hvordan fire specifikke arkiveringsmetoder af webmateriale på hver deres måde giver både begrænset og privilegeret adgang til de originale data og......I dette kapitel undersøges og diskuteres der, hvordan forskellige former for arkivering af digitalt materiale har forskellige implikationer for, hvilke analyser der kan foretages. Dette eksemplificeres med udgangspunkt i webstedet Facebook, og kapitlet diskuterer de metodologiske udfordringer, som...

  18. Metode Barbeau Test dalam Menilai Keutuhan Arteri Radialis Pascaintervensi Koroner Perkutan

    Directory of Open Access Journals (Sweden)

    Nurhusna N

    2017-08-01

    Full Text Available Page Header User Username Password Remember me Editorial Team Editor Policies Mechanism & Ethics Author Guideline Reference Tools: About The Authors Nurhusna N Indonesia F Sri Susilaningsih Purwo Suwigjo Article Tools Print this article Indexing metadata How to cite item Finding References Review policy Email this article (Login required Email the author (Login required Information For Readers For Authors For Librarians Journal Content Search Search Scope Browse By Issue By Author By Title Home About Login Register Search Current Archives Announcements Register Index Contact Us Home > Vol 2, No 1 (2014 > N Metode Barbeau Test dalam Menilai Keutuhan Arteri Radialis Pascaintervensi Koroner Perkutan Nurhusna N, F Sri Susilaningsih, Purwo Suwigjo Abstract Radial artery occlusion merupakan salah satu komplikasi vaskular postkateterisasi jantung trans radial. Kompresi lokal menggunakan alat kompresi setelah tindakan kateterisasi jantung trans radial dapat menurunkan angka kejadian komplikasi vaskular Radial Artery Occlusion(RAO. Penelitian ini bertujuan untuk mengetahui perbandingan antara metode Barbeau test dan metode pengamatan klinik dalam menilai keutuhan arteri radialis selama proses kompresi pada pasien postprosedur kateterisasi jantung trans radial. Penelitian ini merupakan penelitian kuantitatif dengan desain studi komparatif. Subjek penelitian adalah 20 pasien yang menjalani prosedur kateterisasi jantung dengan akses arteri radialis. Pengukuran dilakukan secara bertahap menit ke-15 dan setelah tiga jam menggunakan alat kompresi stepty-p. Uji komparasi menggunakan uji McNemar. Data univariat dianalisis menggunakan distribusi frekuensi. Hasil uji statistik menunjukkan ada perbedaan penilaian keutuhan arteri radialis antara metode Barbeau testdengan metode pengamatan klinik pada menit ke-15 (p=0.035 dan ke-30 (p=0.035. Namun secara keseluruhan hasil uji statistik menunjukkan tidak ada perbedaan yang bermakna dalam menilai kepatenan arteri pada

  19. Auto-fotografi som metode

    DEFF Research Database (Denmark)

    Mogensen, Mette

    2014-01-01

    Artiklen sætter fokus på auto-fotografi som metode i arbejdsmiljøforskningen. Den organisationsæstetiske tilgang, som metoden ofte forbindes med, udfordres med afsæt i en performativ og aktørnetværks-teoretisk position. Gennem en analyse af et enkelt auto-fotografi vises hvordan en artikulation af...

  20. Metoder i livskvalitetsforskning

    DEFF Research Database (Denmark)

    Grønvold, Mogens

    2008-01-01

    Der er udviklet en omfattende forskningsmetodologi til belysning af den videnskabelige kvalitet af spørgeskemaer om helbredsrelateret livskvalitet. Da denne metodologi kan udforske vigtige aspekter af spørgeskemaers validitet og reliabilitet, er det centrale spørgsmål ikke længere, om spørgeskema...... spørgeskemaundersøgelser er valide, men om, hvor tilstrækkeligt deres validitet ved givne anvendelser er undersøgt. Med nyere statistiske metoder ses et skift i retning af interaktive, individualiserede spørgeskemaer. Udgivelsesdato: 2008-Mar-3...

  1. Pilotprojekt - In situ test af stimuleret aerob nedbrydning til oprensning af pesticidpunktkilder

    DEFF Research Database (Denmark)

    Tsitonaki, Katerina; Roost, Sandra; Larsen, Lars

    Denne rapport omhandler et pilotforsøg i felten, hvor det er undersøgt, hvorvidt aerob nedbrydning af phenoxysyre-pesticider kan stimuleres ved tilsætning af ilt suppleret med tilsætning af specifikke pesticidnedbrydende bakterier. Forsøget er udført på en forurenet lokalitet, Skelstofte, hvor der...

  2. Sistem Scoring Conversion TOEFL Paper Based Test (PBT Politeknik Negeri Cilacap Menggunakan Metode User Centered Design

    Directory of Open Access Journals (Sweden)

    Cahya Vikasari

    2017-06-01

    Full Text Available Sistem komputer interaktif untuk dipakai oleh useruntuk mendukung pekerjannya. User merupakan object yang penting didalam pengembangan dan pembangun sistem. User adalah personal-personal yang terlibat langsung dalam pemakaian aplikasi. Konsep dari UCD adalah user sebagai pusat dari proses pengembangan sistem, dan tujuan/sifat-sifat, konteks dan lingkungan sistem semua didasarkan dari pengalaman pengguna Pembangunan sistem skoring test TOEFL paper based test (PBT di UPT bahasa politeknik negeri cilacapmenggunakan metode UCD. Dengan menggunakan metode UCD sistem dapat   mempermudah dan mempercepat pendaftaran oleh calon pendaftar dengan tampilan antarmuka yang user friendly , mempermudah proses pengelolaan data dan rekap data pendaftar, mempermudah pengkonversian skor TOEFL yang dilakukan secara otomatis, serta  meminimalisir terjadinya kesalahan, duplikasi data dan duplikasi kegiatan.

  3. Livscyklusvurdering af basiskemikalier

    DEFF Research Database (Denmark)

    Olsen, Stig Irving

    1998-01-01

    Dette resumé af metoder og væsentlige erfaringer fra erhvervsforskerprojektet Livscyklusvurdering af basiskemikalier er skrevet i erkendelse af, at hovedrapporten er for omfattende til en hurtig introduktion i problemstillingerne. Formålet med denne rapport er derfor at give et kort overblik over...

  4. Kreative metoder i verbal supervision

    DEFF Research Database (Denmark)

    Jacobsen, Claus Haugaard

    2013-01-01

    , bevægelser i rummet, etc.) og 4) der primært kommunikeres via verbal-sproglige udvekslinger. Efter en diskussion af forholdet mellem kreativitet og kreative metoder, fokuseres der på relevansen af og måder til adgang til ubevidste manifestationer. Sproget non- og paraverbale betydning inddrages. Et centralt...

  5. Test af et satellitbaseret kørselsafgiftssystem

    DEFF Research Database (Denmark)

    Sørensen, Simon Bojer; Lahrmann, Harry

    2007-01-01

    I dette paper beskrives opbygningen af en model af et takstsystem, som skal fungere i et satellitbaseret kørselsafgiftssystem. Modellen er forholdsvis simpel og bygger på et buffersystem, og der anvendes således ikke nogen avanceret map matching. Det beskrives, hvordan modellen afprøves med tilfæ...

  6. Sammenligning af kvaliteten af kommunernes sagsbehandling

    DEFF Research Database (Denmark)

    Rasmussen, Martin

    flere forskellige spørgsmål fra praksis¬undersøgelser i samme sammenligning. Vi foreslår også, at metoder til såkaldte ’multi¬ple sammenligninger’ bruges til dele af undersøgelserne. Det er en ældre og ikke særlig kendt metode, men den er særdeles relevant både i den konkrete anvendelse og i andre...

  7. Evaluering af afdeling H

    DEFF Research Database (Denmark)

    Kjær Minke, Linda; Birkmose, Sofie Meldal

    2016-01-01

    Som led i Kriminalforsorgens flerårsaftale 2013-2016 blev det åbne statsfængsel Søbysøgård i januar 2015 udvidet med 42 lukkede pladser i den nybyggede afdeling H. Nærværende evaluering kortlægger de erfaringer personalet og indsatte har gjort sig i løbet af det første år. Etableringen af den...... lukkede fængselsafdeling H giver en unik mulighed for at følge henholdsvis hvilke faktorer, der bidrager til udvikling af fængselskultur, og hvordan de respektive faktorer influerer på udvikling af fængselskulturen. Evalueringens metoder består af kvalitative og kvantitative metoder såsom dokumentanalyse...

  8. Beregning af luftlydisolation mellem to rum

    DEFF Research Database (Denmark)

    Donovan, A.

    Meddelelsen bringer resultaterne af en forundersøgelse af to beregningsmetoder. Den ene metode belyses nærmere gennem nogle forenklede eksempler, der viser omfanget af regnearbejdet og peger på nogle af de vanskeligheder det vil indebære at opstille en praktisk anvendelig beregningsmetode....

  9. Evaluasi Performansi Jaringan UMTS di Kota Semarang menggunakan Metode Drive Test

    Directory of Open Access Journals (Sweden)

    HASANAH PUTRI

    2018-02-01

    Full Text Available ABSTRAK Saat ini penggunaan telepon seluler tidak hanya untuk komunikasi suara, melainkan juga untuk komunikasi data. Kota Semarang merupakan salah satu kota besar dengan jumlah pengguna telepon seluler yang banyak. Kondisi ini membutuhkan dukungan kualitas jaringan yang optimal dan kecepatan akses yang tinggi.  Pada penelitian ini dilakukan pengujian kualitas sinyal jaringan UMTS di kota tersebut. Pengukuran dilakukan dengan metode drive test menggunakan software TEMS dan Map info dalam pengolahan datanya. Ada beberapa parameter pengamatan dalam kegiatan pengukuran kualitas jaringan UMTS ini diantaranya RSCP (Receive Signal Code Power, Ec/No, Throughput dan KPI (Key Performance indicator. Setelah dilakukan pengukuran dan analisis perlu dilakukan proses simulasi optimasi yang dilakukan menggunakan software Atoll 3.2.1. Dari hasil pengukuran diperoleh nilai parameter RSCP, Ec/No, dan Throughput berturut-turut sebesar 68,45%, 91%, dan 52.2%. Setelah dilakukan simulasi optimasi terjadi peningkatan nilai parameter RSCP dan Ec/Noberturut-turut sebesar 97.28% dan 99.74%. Kata kunci: UMTS, Drive Test, Map Info, Atoll, KPI. ABSTRACT Today the use of mobile phone is not only for voice communication but also for data communications (mobile Internet. There are a lot of mobile phone users in Semarang, so that it requires the support of a good network quality and high-speed access. In this research, it will test and measure the signal quality UMTS network. The measurement is done with drive test method by using TEMS and Map Info software. There are several parameters of observation in quality measurement of UMTS network. They are RSCP (Received Signal Code Power, Ec/No , Throughput and KPI (Key Performance Indicator. After measurement and analysis it is needed to simulate the optimization recommendations process by using Atoll 3.2.1. to the observation’s parameters. From the measurement results obtained parameter values RSCP, Ec/No , and Throughput

  10. Evaluasi Performansi Jaringan UMTS di Kota Semarang menggunakan Metode Drive Test

    Directory of Open Access Journals (Sweden)

    HASANAH PUTRI

    2017-07-01

    Full Text Available ABSTRAKSaat ini penggunaan telepon seluler tidak hanya untuk komunikasi suara, melainkan juga untuk komunikasi data. Kota Semarang merupakan salah satu kota besar dengan jumlah pengguna telepon seluler yang banyak. Kondisi ini membutuhkan dukungan kualitas jaringan yang optimal dan kecepatan akses yang tinggi.  Pada penelitian ini dilakukan pengujian kualitas sinyal jaringan UMTS di kota tersebut. Pengukuran dilakukan dengan metode drive test menggunakan software TEMS dan Map info dalam pengolahan datanya. Ada beberapa parameter pengamatan dalam kegiatan pengukuran kualitas jaringan UMTS ini diantaranya RSCP (Receive Signal Code Power, Ec/No , Throughput dan KPI (Key Performance indicator. Setelah dilakukan pengukuran dan analisis perlu dilakukan proses simulasi optimasi yang dilakukan menggunakan software Atoll 3.2.1. Dari hasil pengukuran diperoleh nilai parameter RSCP, Ec/No , dan Throughput berturut-turut sebesar 68,45%, 91%, dan 52.2%. Setelah dilakukan simulasi optimasi terjadi peningkatan nilai parameter RSCP dan Ec/No berturut-turut sebesar 97.28% dan 99.74%.Kata kunci: UMTS, Drive Test, Map Info, Atoll, KPI.ABSTRACTToday the use of mobile phone is not only for voice communication but also for data communications (mobile Internet. There are a lot of mobile phone users in Semarang, so that it requires the support of a good network quality and high-speed access. In this research, it will test and measure the signal quality UMTS network. The measurement is done with drive test method by using TEMS and Map Info software. There are several parameters of observation in quality measurement of UMTS network. They are RSCP (Received Signal Code Power, Ec/No , Throughput and KPI (Key Performance Indicator. After measurement and analysis it is needed to simulate the optimization recommendations process by using Atoll 3.2.1. to the observation’s parameters. From the measurement results obtained parameter values RSCP, Ec/No , and Throughput

  11. Benchmarking af kommunernes sagsbehandling

    DEFF Research Database (Denmark)

    Amilon, Anna

    Fra 2007 skal Ankestyrelsen gennemføre benchmarking af kommuernes sagsbehandlingskvalitet. Formålet med benchmarkingen er at udvikle praksisundersøgelsernes design med henblik på en bedre opfølgning og at forbedre kommunernes sagsbehandling. Dette arbejdspapir diskuterer metoder for benchmarking...

  12. Energioptimering af bæredygtighedscertificeringsprocesserne

    DEFF Research Database (Denmark)

    Christensen, Dorthe Holmberg; Carlsen, Mads; Alon, Shlomo Nevo

    2014-01-01

    Større fokus på bæredygtighedscertificeringer som DGNB har yderligere øget kompleksiteten af designet af bygninger. Introduktionen af teknologier som building information modelling (BIM) og proces metoder som integreret design proces (IDP) kan hjælpe med at reducere kompleksiteten og bedre...

  13. Projektarbejdets metoder

    DEFF Research Database (Denmark)

    2010-01-01

    11 tematisk orienterede videocasts produceret i samarbejde med Carsten Storgaard RUC it services / it-pædagogik. En dynamisk 'site' blev designet, hvorfra samtlige ressourcer kan tilgås. 1. Projektarbejdets metoder (08:32 min.) 2. Hovedelementer (14:03 min.) 3. Meta (17:31 min.) 4. Didaktik (17:1...

  14. Pædagogiske metoder på rejse

    DEFF Research Database (Denmark)

    Nielsen, Jeppe Agger

    2016-01-01

    Nye pædagogiske metoder byder sig konstant til som appellerende måder, hvorpå eksisterende undervisningspraksis kan styrkes. Med afsæt Skandinavisk oversættelsesteori er omdrejningspunktet i artiklen, hvordan undervisningsinstitutioner tilpasser, modificerer og udvikler pædagogiske metoder i takt...

  15. Fracture Mechanics Testing of Titanium 6AL-4V in AF-M315E

    Science.gov (United States)

    Sampson, J. W.; Martinez, J.; McLean, C.

    2016-01-01

    The Green Propellant Infusion Mission (GPIM) will demonstrate the performance of AF-M315E monopropellant on orbit. Flight certification requires a safe-life analysis of the titanium alloy fuel tank to ensure inherent processing flaws will not cause failure during the design life of the tank. Material property inputs for this analysis require testing to determine the stress intensity factor for environment-assisted cracking (KEAC) of Ti 6Al-4V in combination with the AF-M315E monopropellant. Testing of single-edge notched, or SE(B), specimens representing the bulk tank membrane and weld material were performed in accordance with ASTM E1681. Specimens with fatigue pre-cracks were loaded into test fixtures so that the crack tips were exposed to AF-M315E at 50 C for a duration of 1,000 hours. Specimens that did not fail during exposure were opened to inspect the crack surfaces for evidence of crack growth. The threshold stress intensity value, KEAC, is the highest applied stress intensity that produced neither a failure of the specimen during the exposure nor showed evidence of crack growth. The threshold stress intensity factor for environment-assisted cracking of the Ti 6Al-4V forged tank material was found to be at least 22 ksivin and at least 31 ksivin for the weld material when exposed to AF-M315E monopropellant.

  16. Pendugaan Umur Simpan Fruit Leather Nangka (Arrtocarpus Heterophyllus) Dengan Penambahan Gum Arab Menggunakan Metode Accelerated Shelf Life Test (Aslt) Model Arrhenius

    OpenAIRE

    Rahmanto, Sandy Agus; Parnanto, Nur Her Riyadi; Nursiwi, Asri

    2014-01-01

    Penelitian ini bertujuan untuk mengetahui umur simpan fruit leather nangka dengan Accelerated Shelf Life Testing (ASLT) metodeberdasarkan model Arrhenius. Menentukan umur simpan dengan menggunakan Accelerated Shelf Life Test (ASLT) dilakukandengan mempercepat proses degradasi atau reaksi dalam percobaan, yaitu meningkatkan suhu penyimpanan pada beberapa suhu diatas suhu kamar, sehingga mempercepat umur simpan analisis waktu. Metode ASLT yang digunakan dalam menentukan masakadaluwarsanya fruit...

  17. Laparoskopi af 100 konsekutive patienter med 128 ikkepalpable testes

    DEFF Research Database (Denmark)

    Cortes, D; Thorup, J M; Lenz, K

    1996-01-01

    . No intratubular germ cell neoplasia (carcinoma in situ) was proved. Germ cell hypoplasia or aplasia was demonstrated in 95% of cases with testicular parenchyma. We recommend laparoscopy as a safe procedure which leads to a diagnosis in patients with impalpable testes; the advent of laparoscopic procedure makes...... definitive treatment possible in about 50% of such cases....

  18. Pengujian Fitokimia dan Toksisitas Ekstrak Etanol Jantung Pisang Kepok (Musa paradisiaca LINN. dengan Metode Brine Shrimp Lethality Test (BSLT

    Directory of Open Access Journals (Sweden)

    Meytij Jeanne Rampe

    2016-05-01

    Full Text Available Telah dilakukan pengujian fitokimia dan toksisitas ekstrak etanol jantung pisang kepok (Musa Paradisiaca Linn. dengan metode Brine Shrimp Lethality Test (BSLT.  Pengujian dilakukan untuk mencari beberapa senyawa kimia dari ekstrak jantung pisang Musa Paradisaca. Linn serta mengetahui efek toksik terhadap larva udang Artemia salina. Leach.  Maserasi jantung pisang kepok dilakukan dengan menggunakan etanol. Ekstrak etanol yang diperoleh dilakukan pengujian fitokimia dan toksisitas. Hasil pengujian fitokimia menunjukkan ekstrak etanol jantung pisang Musa paradisiaca. Linn memiliki komposisi senyawa flavonoid, kumarin dan senyawa fenolik lainnya. Ekstrak etanol jantung pisang kepok memberikan efek toksik terhadap larva udang Artemia salina. Leach dengan nilai LC50 sebesar 806,8 μg/mL.Kata kunci: jantung pisang kepok, fitokimia, toksisitas, BSLT.

  19. Visuelle data og metoder i narrativ forskning

    DEFF Research Database (Denmark)

    Faber, Stine Thidemann; Nielsen, Helene Pristed

    2016-01-01

    I kapitlet giver vi eksempler på og diskuterer, hvordan forskellige former for visuelle data og metoder kan kombineres med en forskningsmæssig interesse i fortællinger eller narativer. Vi giver en kort indføring i nogle af de overordnede pointer og væsentlige skillelinjer, der kendetegner den vis...

  20. Digitale metoder

    DEFF Research Database (Denmark)

    Birkbak, Andreas; Munk, Anders Kristian

    Digitaliseringen af sociale omgangsformer giver både nye muligheder og udfordringer for samfundsvidenskabelig og humanistisk forskning. Det er blevet relativt enkelt at høste meget store datamængder fra sociale medier og lignende internetteknologier, men det er et åbent spørgsmål, hvad man stille...

  1. Fracture Growth Testing of Titanium 6AL-4V in AF-M315E

    Science.gov (United States)

    Sampson, Jeffrey W.; Martinez, Jonathan; McLean, Christopher

    2015-01-01

    The Green Propellant Infusion Mission (GPIM) will demonstrate the performance of AF-M315E monopropellant in orbit. Flight certification requires a safe-life analysis of the titanium alloy fuel tank to ensure inherent flaws will not cause failure during the design life. Material property inputs for this analysis require testing to determine the stress intensity factor for environmentally-assisted cracking (K (sub EAC)) of Ti 6Al-4V in combination with the AF-M315E monopropellant. Testing of single-edge notched specimens SE(B) representing the bulk tank membrane and weld material were performed in accordance with ASTM E1681. Specimens with fatigue pre-cracks were loaded into test fixtures so that the crack tips were exposed to the monopropellant at 50 degrees Centigrade for a duration of 1,000 hours. Specimens that did not fail during exposure were opened to inspect the crack surfaces for evidence of crack growth. The threshold stress intensity value, KEAC, is the highest applied stress intensity that produced neither a failure of the specimen during the exposure nor showed evidence of crack growth. The threshold stress intensity factor of the Ti 6Al-4V forged tank material when exposed to AF-M315E monopropellant was found to be at least 22.0 kilopounds per square inch. The stress intensity factor of the weld material was at least 31.3 kilopounds per square inch.

  2. Digital portfolio som metode og pædagogik

    DEFF Research Database (Denmark)

    Toft, Hanne; Luplau Schnefeld, Mette

    2004-01-01

    Artiklen præsenterer erfaringer med digital portfolio som didaktik og metode. Fokus er på kobling mellem didaktiske læreprocesser på en grunduddannelse og så understøttelse af disse via brug af en digital portfolio. Portfolioen adskiller en række forskellige dokumentsamlinger i privat og offentlig...

  3. Analyse og design af produktionssystemer

    DEFF Research Database (Denmark)

    Johansen, John; Riis, Jens Ove; Arlbjørn, Jan Stentoft

    lys, men til vores store glæde og overraskelse har vi erfaret, at dele af materialet stadigvæk er anvendt på en del ingeniør- og økonomiuddannelser i Danmark. Nogle af de tanker og metoder som blev udviklet i ViPSprogrammet har overlevet og opfattes fortsat som relevante og anvendelige også til...

  4. Hot-Fire Testing of a 1N AF-M315E Thruster

    Science.gov (United States)

    Burnside, Christopher G.; Pedersen, Kevin; Pierce, Charles W.

    2015-01-01

    This hot-fire test continues NASA investigation of green propellant technologies for future missions. To show the potential for green propellants to replace some hydrazine systems in future spacecraft, NASA Marshall Space Flight Center (MSFC) is continuing to embark on hot-fire test campaigns with various green propellant blends. NASA completed a hot-fire test of a 1N AF-M315E monopropellant thruster at the Marshall Space Flight Center in the small altitude test stand located in building 4205. The thruster is a ground test article used for basic performance determination and catalyst studies. The purpose of the hot-fire testing was for performance determination of a 1N size thruster and form a baseline from which to study catalyst performance and life with follow-on testing to be conducted at a later date. The thruster performed as expected. The result of the hot-fire testing are presented in this paper and presentation.

  5. PERKIRAAN UMUR SIMPAN KACANG RENDAH LEMAK DILAPISI DENGAN CARBOXYMETHYL CELLULOSE MENGGUNAKAN METODE ACCELERATED SHELF-LIFE TEST (ASLT

    Directory of Open Access Journals (Sweden)

    Yudi Pranoto

    2013-03-01

    Full Text Available Shelf-life Prediction of Partially Defatted Peanut Coated with Carboxymethyl Cellulose Using Accelerated Shelf-Life Test (ASLT Method Yudi Pranoto, Djagal Wiseso Marseno, Haryadi ABSTRAK Produk kacang tanah goreng rendah lemak yang dibuat dengan mengurangi kandungan minyaknya sebagian sebelumpenggorengan diketahui memiliki umur simpan yang relatif pendek dan mudah tengik apabila dibandingkan dengankacang goreng biasa. Penelitian ini bertujuan untuk memperpanjang umur simpannya dengan melakukan pelapisan(coating pada kacang goreng rendah lemak menggunakan carboxymethyl cellulose (CMC dengan penyemprotan.Umur simpan ditentukan menggunakan metode Accelerated Shelf-Life Test (ASLT dengan model Arrhenius. Pengujiandilakukan pada suhu 25oC, 35 oC dan 45oC hingga 15 hari untuk melihat tingkat oksidasi melalui bilangan thiobarbituricacid (TBA. Hasil penelitian menunjukkan bahwa metode ASLT dapat dipakai untuk memperkirakan umur simpankacang goreng rendah lemak yang kerusakan utamanya disebabkan oleh reaksi oksidasi. Umur simpan kacang rendahlemak tanpa pelapisan (kontrol adalah selama 34 hari dan yang dilapisi CMC adalah selama 52 hari. Pelapisan ediblecoating pada kacang goreng rendah lemak mampu memperpanjang umur simpan hingga 18 hari dengan perannyadalam menekan reaksi ketengikan.Kata kunci: Kacang rendah lemak, umur simpan, pelapisan, CMC, ASLT ABSTRACT Partially deffated peanut product made by reducing partial oil content before frying is known to have short shelf-lifeand easily rancid in comparison to regular friend peanut. This project was aimed to extend its shelf-life by introducingcoating on fried partially defatted peanut with carboxymethyl cellulose (CMC by spraying. Shelf-life was determinedusing Accelerated Shelf-Life Test (ASLT with Arrhenius model. Experiment was conducted at temperature of 25 oC,35 oC and 45oC until 15 days to follow oxidation level through thiobarbituric acid (TBA value. Results showed thatASLT method could be used to

  6. Identifikation af forkullet lig ved hjælp af ganeaftryk og koralnyresten

    DEFF Research Database (Denmark)

    Leth, Peter Mygind; Bindslev, Dorthe Arenholt; Kristensen, Ingrid Bayer

    1997-01-01

    En retstodontologisk undersøgelse af en dødfunden, uidentificeret person, bygger almindeligvis på en undersøgelse af tandsættet. Hvis personen er tandløs må andre identifikationsmetoder tages i anvendelse. Fingeraftryk er et almindelig kendt eksempel på en alternativ metode, som bygger på, at cri...

  7. Anvendelse af MIP ved kildekarakterisering og vurdering af nedbrydning af chlorerede opløsningsmidler

    DEFF Research Database (Denmark)

    Broholm, Mette Martina; Janniche, Gry Sander; Damgaard, Ida

    2014-01-01

    Membrane Interface Probing (MIP) er et 'direct push' screeningsværktøj, som kan anvendes ved karakterisering af forurenede grunde. Karakterisering af kildeområder med chlorerede opløsningsmidler (som DNAPL) udgør et vigtigt led i udviklingen af den konceptuelle forståelse, som er essentiel...... for risikovurdering og valg af afværgestrategi. Integreret karakterisering med en række metoder for direkte såvel som indirekte dokumentation af DNAPL i moræneler, herunder MIP, er beskrevet i Kerrn-Jespersen et al. (2013). Det samlede DNAPL-karakteriseringsprojekt er beskrevet i detaljer i Janniche et al. (2013). En...... vurdering af anvendte detektorer for MIP er foretaget af Olsson (2013). Ved karakterisering af forurening med bl.a. chlorerede opløsningsmidler er der behov for en vurdering af forureningssammensætning og nedbrydning. Tilsvarende vurdering er nødvendig, når udviklingen af stimuleret reduktiv dechlorering...

  8. Udvikling af materialer til affaldsforbrænding – Nye materialer til overlagssvejsning

    DEFF Research Database (Denmark)

    Tiedje, Niels Skat

    Denne del af projektet havde til formål at udvikle en metode til hurtig benchmarking af nye legeringer til overlagssvejsning og at anvende metoden i kombination med termodynamisk modellering af mikrostrukturer i svejste Ni–baserede legeringer. På baggrund af disse analyser skulle der udvikles nye...

  9. Måling af stress hos mink

    DEFF Research Database (Denmark)

    Malmkvist, Jens

    2010-01-01

    Sammendrag Stress indgår som et element ved vurdering af dyrevelfærd. Endvidere kan stress mål anvendes i undersøgelser, hvor forskellige typer af avl, burmiljø og pasning af mink sammenlignes. Men hvad er stress egentlig og hvordan måles det? Er unormal adfærd koblet til stress hos mink? På...... temadagen præsenteres nye resultater og metoder til at vurdere stress hos mink. I en metode måles koncentrationen af nedbrydningsprodukter af hormonet cortisol i gødning fra mink. Der er en række fordele ved denne metode, frem for blodprøvetagning. Forsøg viste, at hovedparten af cortisol udskilles i fæces...... (83 %) frem for i urin (17 %), samt at omsætningen af radioaktivt mærket cortisol ikke er forskellig mellem mink med hhv. lav og høj forekomst af stereotypi. Denne viden kan bruges til bedre at forstå koblingen f.eks. unormal adfærd og stress hos mink....

  10. Uji Toksisitas Ekstrak Tinta Cumi-Cumi (Photololigo Duvaucelii) Dengan Metode Brine Shrimp Lethality Test (Bslt)

    OpenAIRE

    Kurniansyah, Wendra

    2015-01-01

    During this people considers that squid ink is not useful so that if processing squid, the ink was removed. Based on research conducted by Sasaki and colleagues Jin'ichi of Hirosaki University in northern Japan, squid ink can activates white blood cells to fight cancer. The compound is thought to have anti-cancer activity should be tested first in animals before being developed further. The purpose of this study are determining and comparing the toxicity of the components of biological akti...

  11. Metode Tracer Test untuk Mencari Hubungan Antar Sistem Sungai Bawah Tanah Di Akuifer Karst

    Directory of Open Access Journals (Sweden)

    Harjito Harjito

    2015-08-01

    Full Text Available Problem yang umum dijumpai di kawasan karst adalah mengenai ketersediaan air, mengingat kondisi hidrologi kawasan karst yang berbeda dengan kawasan lain. Ditinjau dari sisi lain, masyarakat di sekitar kawasan rencana perluasan eksploitasi masih memanfaatkan mata air yang daerah tangkapannya berasal dari perbukitan batu gamping untuk memenuhi kebutuhan air domestik dan irigasi pertanian. Dengan demikian, perlu adanya penelitian hidrologi karst lebih lanjut terutama mengenai keberadaan sistem jaringan yang saling terhubung di dalam kawasan rencana perluasan eksploitasi dan sekitarnya. Studi ini diharapkan dapat menjadi pertimbangan terhadap kebijakan yang akan diambil sebagai upaya untuk dapat melakukan pengelolaan potensi tersebut sebaik-baiknya. Tracer test dilakukan sebagai bentuk follow-up dari survei gua dan sinkhole yang ada di sekitar area tambang. Tracer test dilakukan untuk mengetahui konektivitas aliran pada sistem gua berair dan mata air Cipintu. Berdasarkan hasil penelitian potensi debit air di Mata air Cipintu sebesar 18,55 liter/s dan mengindikasikan adanya konektivitas antara gua berair dengan Mata air Cipintu. Kata kunci : karst, hidrologi, tracer test, eksploitasi

  12. Modellering og måling af metan-emission fra kvæg

    DEFF Research Database (Denmark)

    Storm, I; Hellwing, Anne Louise Frydendahl; Nielsen, N I

    2011-01-01

    Udvikling af og kendskab til de metoder, der bruges til måling af kvægs metan-emission udgør en vigtig del af forskningen indenfor området. I dette indlæg præsenteres de mest anvendte metoder til måling og estimation af kvægs metan-emission, herunder modeller, in vitro inkubation, kammer-metoder,......-metoder, SF6-metoden og CO2-metoden. De enkelte metoder beskrives og fordele, ulemper og anvendelsesområder sammenlignes. Dette er vigtig baggrundsinformation for forståelse og fortolkning af øvrige forskningsresultater og for at kunne planlægge fremtidige projekter.......Udvikling af og kendskab til de metoder, der bruges til måling af kvægs metan-emission udgør en vigtig del af forskningen indenfor området. I dette indlæg præsenteres de mest anvendte metoder til måling og estimation af kvægs metan-emission, herunder modeller, in vitro inkubation, kammer...

  13. Pendugaan Umur Simpan Benih Kedelai Menggunakan Metode Accelerated Shelf-life Testing (ASLT

    Directory of Open Access Journals (Sweden)

    Suci Rahmi

    2016-04-01

    Full Text Available The aim of this study is to estimate the shelf-life of soybean seed using Accelerated Shelf-life Testing (ASLT model. Seed germination was used as parameter to predict the shelf-life of soybean seed. ASLT method was performed using five different temperature treatments 35oC, 40oC, 45oC, 50oC, and 55oC respectively with 80 % Relative Humidity (RH. Another parameter measured in identifying decrease of soybean seed quality was moisture content. The results showed that moisture content of soybean seed during storage at all temperatures was increased. On the other hand, the seed germination decreased during period of accelerated storage. Based on data from decreasing soybean seed germination, the estimated shelf-life of seeds stored at room temperature of 25oC was 431 days or 14.3 months and 160 days or 5.3 months when stored on 300C.

  14. Marte Meo Metode som magtteknologi

    DEFF Research Database (Denmark)

    Sørensen, Nelli Øvre

    2015-01-01

    Pårørendeskole til pårørende for at forbedre kommunikation og samvær med familiemedlemmer med demens. Ægtefæller fortalte, at de oplevede at skulle påtage sig større ansvar, end de allerede havde, og at de gjorde modstand mod undervisernes formidlingsmåde og fortolkning af Marte Meo, der blev......, at der mellem undervisere og pårørende foregår et biopolitisk magtspil, med intentioner om at de pårørende tilføres ressourcer ved at lære Marte Meo metoden, men at den får funktion af selvteknologiske redskaber i 'subjektiverings processer', hvor de pårørende ledes mod at tage øget ansvar for eget og...... for ægtefællens liv og for hjemmehjælperes brug af Marte Meo metode- og sprog....

  15. NIR: optimerer produktionen af gammeldags modnede sild

    DEFF Research Database (Denmark)

    Svensson, T.; Bro, Rasmus; Nielsen, Henrik Hauch

    2005-01-01

    Måling med nærinfrarødt (NIR) lys er et godt supplement til de nuværende metoder til at følge modningen af sild saltede i tønder. Det viser resultaterne af et forskningsprojekt udført i samarbejde mellem Lykkeberg A/S, Danmarks Fiskeriundersøgelser og Den Kgl Veterinær- og Landbohøjskole. Ved hjælp...... af avanceret matematik er det nemt og hurtigt at bestemme modningsgraden af sild direkte fra en NIR måling....

  16. Health Information in Somali (Af-Soomaali )

    Science.gov (United States)

    ... and Wound Healing - Af-Soomaali (Somali) Bilingual PDF Health Information Translations Fasting Blood Sugar Test - Af-Soomaali (Somali) Bilingual PDF Health Information Translations GTT (Glucose Tolerance Test) - Af-Soomaali ( ...

  17. Sansning som redskab og metode for faget Modedesign

    DEFF Research Database (Denmark)

    Ræbild, Ulla

    2009-01-01

      Abstract / dansk Intentionen i denne afhandling er at undersøge, hvornår og hvordan designere anvender sansemæssig viden og kompetence i deres arbejdsproces, for igennem denne afdækning at kunne foretage en eksplicitering og artikulation af sansning som redskab og metode i designprocessen. Afha...

  18. AKURASI HITUNG JUMLAH ERITROSIT METODE MANUAL DAN METODE OTOMATIS

    Directory of Open Access Journals (Sweden)

    Neni Oktiyani

    2017-12-01

    Full Text Available Hitung jumlah eritrosit dilakukan dengan menggunakan metode manual dan metode otomatis. Metode manual menggunakan alat Hemositometer dapat memberikan hasil yang dipercaya dan akurat tergantung keahlian dari teknisi laboratorium. Metode otomatis memberikan hasil yang lebih mudah, cepat dan teliti dibandingkan dengan cara manual. Tujuan penelitian untuk membandingkan akurasi hitung jumlah eritrosit metode manual dan metode otomatis. Jenis penelitian yang digunakan adalah survey analitik dengan rancangan cross sectional. Penelitian ini membandingkan data hasil hitung jumlah eritrosit antara metode manual dengan metode otomatis dengan menggunakan 3 jenis darah kontrol hitung jumlah eritrosit high, normal, dan low dengan 9 kali pengulangan. Hasil penelitian menunjukkan nilai rerata hitung jumlah eritrosit darah kontrol high metode manual sebesar 7,08 juta/µl dengan nilai bias 1,4% dan metode otomatis sebesar 7,03 juta/µl dengan nilai bias 0,7%. Rerata hitung jumlah eritrosit darah kontrol normal metode manual sebesar 4,50 juta/µl dengan nilai bias 0,9% dan metode otomatis sebesar 4,43 juta/µl dengan nilai bias 2,4%. Rerata hitung jumlah eritrosit darah kontrol low metode manual sebesar 1,72 juta/µl dengan nilai bias 4,4% dan metode otomatis sebesar 1,67 juta/µl dengan nilai bias 1,2%. Uji statistik menunjukkan tidak ada perbedaan akurasi yang bermakna antara hitung jumlah eritrosit metode manual dengan metode otomatis.

  19. Den positive psykologis metoder

    DEFF Research Database (Denmark)

    Bogen introducerer til de mange metoder, som anvendes i positiv psykologi. dette sker ud fra en reflekteret tilgang, der ligeledes rummer bidrag fra kritisk psykologi med det formål at nuancere den positive psykologis forståelser...

  20. IMPLEMENTASI METODE RETINEX UNTUK PENCERAHAN CITRA

    Directory of Open Access Journals (Sweden)

    Murinto Murinto

    2009-07-01

    Full Text Available Data atau informasi tidak hanya disajikan dalam bentuk teks, tetapi juga dapat berupa gambar, audio, dan video. Citra/gambar mempunyai karakteristik yang tidak dimiliki oleh teks, yaitu citra kaya dengan informasi. Dewasa ini penggunaan citra digital semakin meningkat karena kelebihan-kelebihan yang dimiliki oleh citra digital tersebut, antara lain kemudahan dalam mendapatkan gambar, memperbanyak gambar dan pengolahan gambar. Situasi dan kondisi pada saat pengambilan citra digital sangat berpengaruh terhadap hasil citra digital yang diperoleh. Kurangnya intensitas cahaya pada saat pengambilan citra dapat menyebabkan kualitas citra menjadi tidak baik, seperti citra menjadi gelap atau perubahan warna dari gambar. Perlu suatu metode untuk memperbaiki kualitas citra dengan mempertahankan warna asli citra. Penelitian ini menggunakan metode Retinex untuk meningkatkan kecerahan citra. Jenis gambar yang digunakan berekstensi *.jpg berformat 24 bit dengan ukuran pixel yang tidak dibatasi. Citra tersebut kemudian dimasukan ke dalam program lalu diproses dengan menggunakan metode Retinex. Adapun parameter yang digunakan adalah citra hasil, histogram, dan signal-to-noise (SNR. Pengujian dilakukan dengan metode White Box Tes dan Alpha Test. Penelitian yang dilakukan menghasilkan suatu aplikasi pengolahan citra untuk meningkatkan kecerahan Citra Menggunakan Metode Retinex” yang dapat bekerja untuk mencerahkan citra. Peningkatan kecerahan citra dengan menggunakan metode retinex menghasilkan citra yang lebih cerah, nilai SNR yang lebih tinggi dan histogram dengan nilai intensitas pixel yang tinggi dan terdistribusi secara merata. Hasil uji coba menunjukan bahwa aplikasi ini dapat meningkatkan kecerahan dan kualitas citra menjadi lebih baik. Kata Kunci: Pengolahan Citra, Retinex, Histogram, SNR. 

  1. IMPLEMENTASI METODE RETINEX UNTUK PENCERAHAN CITRA

    Directory of Open Access Journals (Sweden)

    Murinto Kusno

    2012-05-01

    Full Text Available Data atau informasi tidak hanya disajikan dalam bentuk teks, tetapi juga dapat berupa gambar, audio, dan video. Citra/gambar mempunyai karakteristik yang tidak dimiliki oleh teks, yaitu citra kaya dengan informasi. Dewasa ini penggunaan citra digital semakin meningkat karena kelebihan-kelebihan yang dimiliki oleh citra digital tersebut, antara lain kemudahan dalam mendapatkan gambar, memperbanyak gambar dan pengolahan gambar. Situasi dan kondisi pada saat pengambilan citra digital sangat berpengaruh terhadap hasil citra digital yang diperoleh. Kurangnya intensitas cahaya pada saat pengambilan citra dapat menyebabkan kualitas citra menjadi tidak baik, seperti citra menjadi gelap atau perubahan warna dari gambar. Perlu suatu metode untuk memperbaiki kualitas citra dengan mempertahankan warna asli citra. Penelitian ini menggunakan metode Retinex untuk meningkatkan kecerahan citra. Jenis gambar yang digunakan berekstensi *.jpg berformat 24 bit dengan ukuran pixel yang tidak dibatasi. Citra tersebut kemudian dimasukan ke dalam program lalu diproses dengan menggunakan metode Retinex. Adapun parameter yang digunakan adalah citra hasil, histogram, dan signal-to-noise (SNR. Pengujian dilakukan dengan metode White Box Tes dan Alpha Test. Penelitian yang dilakukan menghasilkan suatu aplikasi pengolahan citra untuk meningkatkan kecerahan  Citra Menggunakan Metode Retinex” yang dapat bekerja untuk mencerahkan citra. Peningkatan kecerahan citra dengan menggunakan metode retinex menghasilkan citra yang lebih cerah, nilai SNR yang lebih tinggi dan histogram dengan nilai intensitas pixel yang tinggi dan terdistribusi secara merata. Hasil uji coba menunjukan bahwa aplikasi ini dapat meningkatkan kecerahan dan kualitas citra menjadi lebih baik

  2. Perbandingan Hasil Deteksi Plagiarisme Dokumen dengan Metode Jaro-Winkler Distance dan Metode Latent Semantic Analysis

    Directory of Open Access Journals (Sweden)

    Tinaliah Tinaliah

    2018-01-01

    Full Text Available Various methods are applied in the application of plagiarism detection to help check the similarity of a document. Jaro-Winkler Distance can measure the distance between two strings. However, this method basically depends on the position of the word. Latent Semantic Analysis emphasizes the words contained in the document regardless of its linguistic character. This study compares the results of plagiarism detection using the Jaro-Winkler Distance and the Latent Semantic Analysis method. From comparing results of  Jaro-Winkler Distance method and Latent Semantic Analysis method, Jaro-Winkler Distance method is better than Latent Semantic Analysis method if using the same test data. Jaro-Winkler Distance method will give plagiarism result 100% and Latent Semantic Analysis method will give plagiarism result 97,14%. Beragam metode diterapkan dalam aplikasi deteksi plagiarisme untuk membantu mengecek tingkat kesamaan sebuah dokumen. Metode Jaro-Winkler Distance dapat mengukur kesamaan antara dua buah string dan sangat bergantung pada urutan atau posisi kata. Latent Semantic Analysis mementingkan kata-kata yang terkandung di dalam dokumen tanpa memperhatikan karakter linguistiknya. Penelitian ini melakukan perbandingan hasil deteksi plagiarisme dengan menggunakan metode Jaro-Winkler Distance dan metode Latent Semantic Analysis. Hasil pendeteksian plagiarisme dokumen menggunakan metode Jaro-Winkler Distance memberikan hasil yang lebih baik daripada metode Latent Semantic Analysis, yaitu jika data yang dibandingkan sama persis maka akan menghasilkan nilai plagiat sebesar 100%, sedangkan metode Latent Semantic Analysis menghasilkan nilai plagiat sebesar 97,14%.

  3. Digital visualisering i udbygning af Roskilde Universitetscenter

    DEFF Research Database (Denmark)

    Sørensen, Nils Lykke

    Rapporten beskriver tre forsøg med 3D-visualisering i forbindelse med konkurrencer vedrørende udbygning af Roskilde Universitetscenter. Første forsøg var en metode til hurtigt at skabe en række digitale modeller i højt abstraktionsniveau. Forsøget resulterede i 15 små animationer, der blev benyttet...... af dommerkomiteen til volumenstudier af bygningskonkurrencens indsendte forslag. Andet forsøg var afprøvning af et modelleringsarbejde i lavere abstraktionsniveau, som resulterede i en animation af vinderprojektet. I sidste forsøg blev de praktiske erfaringer fra de to første forsøg implementeret hos...

  4. Evaluering af ordning med psykologbehandling af personer med let til moderat depression

    DEFF Research Database (Denmark)

    Fjeldsted, Rita; Christensen, Kaj Sparle

    Herværende rapport evaluerer den pr. 1.4.2008 indførte ordning med mulighed for henvisning til psykologbehandling med 60 % tilskud for patienter med let til moderat depression. Evalueringen har betjent sig af flere gensidigt supplerende metoder: spørgeskemaundersøgelser overfor patienter, psykolo......Herværende rapport evaluerer den pr. 1.4.2008 indførte ordning med mulighed for henvisning til psykologbehandling med 60 % tilskud for patienter med let til moderat depression. Evalueringen har betjent sig af flere gensidigt supplerende metoder: spørgeskemaundersøgelser overfor patienter...... tidligere evaluering af forsøgsordning af psykologbehandling af depression i perioden 2005-06. 18.419 personer i alderen 18-37 år blev henvist til psykolog i den undersøgte ordning i perioden 1.2.2009 – 31.1.2010, svarende til en henvisningshyppighed på 1,6 % af baggrundsbefolkningen i samme aldersgruppe....... Ordningen giver mulighed for én rehenvisning, og 9 % blev rehenvist i perioden. Spørgeskemaresultater viser, at kun 33 % af de henviste falder ind under henvisningskriteriet ” let til moderat depression” på tidspunktet for opstart af psykologbehandling, 39 % har ingen tegn på depression, og 28 % har svær...

  5. En kvalitativ undersøgelse af gravides valg af nakkefoldscanning

    DEFF Research Database (Denmark)

    Sørensen, Stina Lou; Dahl, Katja; Beck risør, Mette

    2007-01-01

    valg. Vi ønskede at undersøge informationens rolle i den gravides forståelse og valg af nakkefoldskanning. Materiale og metoder: Seksogtyve gravide blev interviewet efter første svangrekonsultation og igen efter misdannelseskanningen. Undersøgelsesresultaterne i denne artikel stammer primært fra første...

  6. Fremtidssikring af kloaknet

    DEFF Research Database (Denmark)

    Hansen, Ernst Jan de Place

    2008-01-01

    Beskrivelse af hvordan man ved udbygning af eksisterende kloaknet og ved nytænkning af planlægning af nye bydele kan sikre sig langsigtet mod konsekvenserne af klimaændinger og kraftigere nedbør...

  7. Bidrag til automatisering af ortofotomosaikfremstilling

    DEFF Research Database (Denmark)

    Vestergaard, Jacob Schack; Andersen, Simon G.; Nielsen, Allan Aasbjerg

    Mosaikker af nabo-ortofotos, der udgør et vigtigt element i dagens automatiske kortfremstilling og -opdatering, laves i dag ved håndkraft. Her vil vi vise en vigtig byggeklods til automatisering af denne proces. Der findes metoder, der baserer sig på den såkaldte “bidirectional reflectance...... bestemt ortofoto typisk vil skulle kalibreres til flere nabo-ortofotos. Disse flere kalibreringer vil iblandt være i modstrid med hinanden. For eksempel kan en kalibrering til et ortofoto mod nord udsige, at pixels i ortofotoet skal have en højere værdi samtidigt med, at ortofotoet mod vest kræver en...

  8. Medicinsk teknologivurdering af akupunktur til gravide

    DEFF Research Database (Denmark)

    Feenstra, Maria Monberg; Johansen, Marianne; Sørensen, Lisbeth Falborg

    -, organisatorisk- og økonomisk perspektiv. Metode: Der blev udarbejdet en medicinsk teknologivurdering (MTV). En alsidig og systematisk litteraturgennemgang af akupunkturbehandling til gravide med emesis/hyperemesis gravidarum, bækkenrelaterede smerter eller depression/angst blev udført. Den udvalgte litteratur...... behandlingen udføres korrekt af TCM-uddannet sundhedspersonale. Undersøgelser har vist høj patienttilfredshed blandt gravide ved akupunkturbehandling. Økonomiske beregninger dokumenterer, at akupunktur er et billigt behandlingstilbud. Konsekvenser for praksis: Det anbefales, at tilbyde gravide med emesis...

  9. Lessons learned from the fire test of Westinghouse's new type AF package, the traveller: (nothing like the real thing)

    International Nuclear Information System (INIS)

    Malloy, J.; Hempy, B.; Utlak, R.; Kent, N.

    2004-01-01

    Satisfying the thermal test requirements is a significant part of licensing a Type AF package. Regulations allow the thermal test requirements to be satisfied by several means including thermal analysis, thermal test inside a furnace, pool fire test, test using a scale model of the package, test using a segment or portion of a package, or test using a full-scale package. It was decided that a pool fire test using a full-scale package was the only way to adequately test the many features of the Traveller. Items crucial to criticality safety are more subject to damage during the thermal test. The Traveller design includes a substantial amount of neutron moderating material built into the packaging. This is so that criticality safety would not be dependent on moderation by HAC immersion. A full-scale fire test proved to be the only method to verify that the moderator survives. The Traveller also features a unique impact limiter system inside the packaging that is designed to lessen the impact of the contents in an end drop. It was determined that the full-scale fire test would be the only way to verify that the limiters would not ignite and burn inside the package. Actual pool fire temperatures are more severe than the 800 C minimum required in the regulations. Also it is impossible to model distortions and stresses caused by an actual fire, and these have a significant impact on any thermal analysis. This paper describes the many exploratory and scoping tests that preceded the final fire tes t. The lessons learned, though perhaps not new to those regularly employed in the fire testing profession, proved to be valuable to the licensee in completing the Traveller design

  10. AF Sites

    Science.gov (United States)

    AF Bands Air Force Band Recordings Air National Guard Band of the Midwest Air National Guard Band of U.S. Air Force Bands U.S. Air Force Heartland of America Band U.S. Air Force Heritage of America Band U.S. Air Forces in Europe Band US Air Forces Central Command Band Medical 42d Medical Group 59th

  11. Metoder for Modellering, Simulering og Regulering af Større Termiske Processer anvendt i Sukkerproduktion. Methods for Modelling, Simulation and Control of Large Scale Thermal Systems Applied in Sugar Production

    DEFF Research Database (Denmark)

    Nielsen, Kirsten Mølgaard; Nielsen, Jens Frederik Dalsgaard

    The subject of this Ph.D. thesis is to investigate and develop methods for modelling, simulation and control applicable in large scale termal industrial plants. An ambition has been to evaluate the results in a physical process. Sugar production is well suited for the purpose. In collaboration...... simulator has been developed. The simulator handles the normal working conditions relevant to control engineers. A non-linear dynamic model based on mass and energy balances has been developed. The model parameters have been adjusted to data measured on a Danish sugar plant. The simulator consists...... of a computer, a data terminal and an electric interface corresponding to the interface at the sugar plant. The simulator is operating in realtime and thus a realistic test of controllers is possible. The idiomatic control methodology has been investigated developing a control concept for the evaporation...

  12. Cloud computing og den strafferetlige beskyttelse af data

    DEFF Research Database (Denmark)

    Mathiasen, Peter Dueholm

    2013-01-01

    Cloud computing er blevet en populær metode for bl.a. at opbevare data. Muligheden for eksempelvis at placere forretningskritiske data på teknisk udstyr, som ejes af den udbyder, der driver cloud computing tjenesten, gør det aktuelt at forholde sig til, om straffeloven i sådanne tilfælde yder et...

  13. Immediat indsættelse af enkelttandsimplantater i privat praksis

    DEFF Research Database (Denmark)

    Hartlev, Jens; Kohberg, Peter; Ahlmann, Søren

    2015-01-01

    metode – I alt 55 patienter med 55 enkelttandsimplantater blev inkluderet i undersøgelsen. Behandlingen involverede tandekstraktion, implantatindsættelse, påsætning af et endeligt, individuelt abutment og en provisorisk krone I samme behandlingsseance. Den endelige krone blev efterfølgende påsat efter en...

  14. Dimensionering af stålrammebygninger mod kipning

    DEFF Research Database (Denmark)

    Borchersen, E.; Frederiksen, J.O.; Skov, K.

    Rapporten beskriver en metode til dimensionering af stålrammebygninger mod kipning. Metoden er baseret dels på elasticitetsteoretiske overvejelser, dels på forsøg udført med 3-charniers stålrammmer i fuld skala....

  15. Medieetnografi og kvalitativ metode

    Directory of Open Access Journals (Sweden)

    Tove Arendt Rasmussen

    1993-09-01

    Full Text Available Udviklingen af et metodisk fællesskab mellem samfundsvidenskab og humaniora op gennem 80´erne har haft gode vækstbetingelser inden for medieetnografien. Artiklen gennemgår i hovedtræk den prægnan- te udvikling modtagerforskningen med rod i humaniora og cultural studies-traditionen har gennemgået. Hvor den tidligere var funderet i interessen for at afdække sammenhænge mellem medieindhold og seeroplevelse, har medieetnografien udviklet en sensibilitet over for TV-sening som en mangfoldig, kulturel proces. Artiklens tyngdepunkt ligger i en diskussion af de metodiske problemer, forskeren konfron- teres med, når mangfoldigheden af tekstuelle, situationelle og kontek- stuelle perspektiver på receptionsproces og betydningsdannelse på én gang inddrages i de medieetnografiske studier.

  16. Test af viden og færdigheder øger indlæring

    DEFF Research Database (Denmark)

    Kromann, Charles; Koefoed, Mette Juul; Jensen, Morten

    2012-01-01

    Test-enhanced learning is an evidence-based pedagogical tool for enhancing retention of both knowledge and skills. The phenomenon is independent of external factors such as feedback and intention to learn. The mechanism is complex and possibly related to stress and gender. Tests immediately after...... learning are most effective - and formats that support test-enhanced learning most effectively involve composing an answer or actively performing a skill. Use of tests in education should be integrated in the curriculum ensuring that the tests relevantly complement and enhance learning of knowledge...

  17. Energirenovering af parcelhuse

    DEFF Research Database (Denmark)

    Aggerholm, Søren

    af de tre huse består i efterisolering af lofter op til 300 mm, udskiftning af almindelige termoruder til energiruder, og installation af solvarmeanlæg til produktion af varmt brugsvand. I de tre huse er der ved energirenoveringen opnået en reduktion af energiforbruget på 16-22 procent. Rapporten...

  18. Anvendelse af alternative isoleringsmaterialer

    DEFF Research Database (Denmark)

    Hansen, Ernst Jan de Place

    2003-01-01

    Resume af By og Byg Anvisning 207 om anvendelse af alternative isoleringsmaterialer, udarbejdet af Statens Byggeforskningsinstitut under udviklingsprogrammet "Miljø- og arbejdsmiljøvenlig isolering"......Resume af By og Byg Anvisning 207 om anvendelse af alternative isoleringsmaterialer, udarbejdet af Statens Byggeforskningsinstitut under udviklingsprogrammet "Miljø- og arbejdsmiljøvenlig isolering"...

  19. PENDUGAAN UMUR SIMPAN DENGAN METODE ACCELERATED SHELF-LIFE TESTING PADA PRODUK BANDREK INSTAN DAN SIRUP BUAH PALA (MYRISTICA FRAGRANS

    Directory of Open Access Journals (Sweden)

    Didah Nur Faridah

    2014-12-01

    Full Text Available Traditional beverages can be made from the spices and can be processed further as instant powder drinks such as bandrek drink. The expiration date statement on the food packaging is a mandatory according to the Food Act No.7/1996 and the Government Regulation No. 69/1999 about Food Labelling and Advertising. The aim of this research was to estimate or to predict the shelf-life of instant bandrek drink produced at Sinarsari village and nutmeg syrup at Dramaga village, Dramaga district, Bogor regency. Shelf-life estimation of the two products was done by accelerated shelf-life testing method. Instant bandrek was predicted to have shelf-life for 341 days (11 months when stored at 80% RH, 30 °C, while the nutmeg syrup would be expired in 34-47 days when stored at 30 °C.

  20. Tatalaksana Teknologi Informasi Metode Cobit

    OpenAIRE

    Hamzah, Ardi

    2006-01-01

    Metode COBIT perlu diterapkan dalam pengelolaan perusahaan agar penggunaan Teknologi Informasi (TI) sesuai dengan kebutuhan perusahaan dan menghasilkan kinerja yang efisien dan efektif serta mencegah atau meminimalisir adanya risiko terhadap penggunaan TI. Penggunaan dan pengelolaan TI juga mempertimbangkan integrasi dimana perangkat keras, perangkat lunak dan perangkat manusia membangun intergrasi.Kata kunci: metode COBIT, teknologi informasi, perangkat keras, perangkat lunak dan perangkat m...

  1. Metode til optimering af patientforløb

    DEFF Research Database (Denmark)

    Rud, Kirsten; Jakobsen, Mette; Hjort Jakobsen, Dorthe

    2012-01-01

    . Implementation 3. Quality assurance 4. Fine tuning. The method complies with the four steps in the Danish Quality Model and systematic evidence-based practices. This is described using a total of 16 patient trajectories with accompanying clinical guidelines found at the unit’s website www.periopsygepleje. dk......The Unit for Perioperative Nursing (EPS) has developed a “workshop– clinical practice method” in connection with implementing principles for accelerated patient trajectories. The “workshop–clinical practice method” is a systematic procedure consisting of four steps 1. Preparations and consensus 2....... The “workshop–clinical practice method” represents a break with conventional working procedures in the health sector, because the method promotes interdisciplinary collaboration across organisations and professions, and thereby an innovative interdisciplinary working process that links cutting edge research...

  2. Test af viden og færdigheder øger indlæring

    DEFF Research Database (Denmark)

    Kromann, Charles; Koefoed, Mette Juul; Jensen, Morten

    2012-01-01

    Test-enhanced learning is an evidence-based pedagogical tool for enhancing retention of both knowledge and skills. The phenomenon is independent of external factors such as feedback and intention to learn. The mechanism is complex and possibly related to stress and gender. Tests immediately after...

  3. De nationale test og læreres konstruktion af dygtighed i læsning

    DEFF Research Database (Denmark)

    Holm, Lars

    2015-01-01

    In order to examine the effects for teachers of the introduction of new national testing instrument in literacy in Denmark this article takes its point of departure in a social practice perspective on testing and argues for a research strategy inspired by Latours´ Actor Network Theory (ANT...

  4. Penyembunyian Data pada File Video Menggunakan Metode LSB dan DCT

    Directory of Open Access Journals (Sweden)

    Mahmuddin Yunus

    2014-01-01

    Full Text Available Abstrak Penyembunyian data pada file video dikenal dengan istilah steganografi video. Metode steganografi yang dikenal diantaranya metode Least Significant Bit (LSB dan Discrete Cosine Transform (DCT. Dalam penelitian ini dilakukan penyembunyian data pada file video dengan menggunakan metode LSB, metode DCT, dan gabungan metode LSB-DCT. Sedangkan kualitas file video yang dihasilkan setelah penyisipan dihitung dengan menggunakan Mean Square Error (MSE dan Peak Signal to Noise Ratio (PSNR.Uji eksperimen dilakukan berdasarkan ukuran file video, ukuran file berkas rahasia yang disisipkan, dan resolusi video. Hasil pengujian menunjukkan tingkat keberhasilan steganografi video dengan menggunakan metode LSB adalah 38%, metode DCT adalah 90%, dan gabungan metode LSB-DCT adalah 64%. Sedangkan hasil perhitungan MSE, nilai MSE metode DCT paling rendah dibandingkan metode LSB dan gabungan metode LSB-DCT. Sedangkan metode LSB-DCT mempunyai nilai yang lebih kecil dibandingkan metode LSB. Pada pengujian PSNR diperoleh databahwa nilai PSNR metode DCTlebih tinggi dibandingkan metode LSB dan gabungan metode LSB-DCT. Sedangkan nilai PSNR metode gabungan LSB-DCT lebih tinggi dibandingkan metode LSB.   Kata Kunci— Steganografi, Video, Least Significant Bit (LSB, Discrete Cosine Transform (DCT, Mean Square Error (MSE, Peak Signal to Noise Ratio (PSNR                             Abstract Hiding data in video files is known as video steganography. Some of the well known steganography methods areLeast Significant Bit (LSB and Discrete Cosine Transform (DCT method. In this research, data will be hidden on the video file with LSB method, DCT method, and the combined method of LSB-DCT. While the quality result of video file after insertion is calculated using the Mean Square Error (MSE and Peak Signal to Noise Ratio (PSNR. The experiments were conducted based on the size of the video file, the file size of the inserted secret files, and

  5. Bestemmelse af spormetaller i organisk materiale

    DEFF Research Database (Denmark)

    Tjell, Jens Christian; Palfeldt, Kirsten

    Behovet for pålidelige analysemetoder til bestemmelse af spormetalindhold i organiske materialer, f.eks. planter, slam og dyrevæv er stigende på grund af den stigende erkendelse af disse stoffers betydning for organismers fysiologi, både hvor disse stoffer optræder i uønskede koncentrationer som...... der over de sidste år udviklet en analyseprocedure hvorefter det er muligt at analysere for metallerne Mn, Cu, Ni, Co, Cr, Zn, Cd og Pb i planter, dyrevæv, jord, slam og andre materialer med standardafvigelser på mellem 5 og 10%. Der gøres rede for denne metode....

  6. Midtvejsrapport – Udvikling, test og validering af QTI-spørgsmål i en dansk gymnasiekontekst

    DEFF Research Database (Denmark)

    Lund, Lea; Lund, Rolf Lyneborg

    Rapporten omhandler specifikt udviklingen af en dansk version af spørgsmålene i ’Questionnaire on Teachers Interaction’ (QTI), som er et element af projektet ”Relationskompetence og Klasseledelse i gymnasiet” (ROK). QTI er et empirisk velafprøvet og udbredt spørgeskema til elever, som giver et blik...... Utrecht Universitet til stadighed ændrer på begrebsbetegnelserne i deres modeller for MITB (The Model for Interpersonal Teacher Behavior), som er grundlaget for QTI. Det er vores håb med denne rapports gennemsigtighed omkring spørgsmålsudviklingen og fremlæggelsen af alle data og den endeligt statistisk...

  7. Test

    DEFF Research Database (Denmark)

    Bendixen, Carsten

    2014-01-01

    Bidrag med en kortfattet, introducerende, perspektiverende og begrebsafklarende fremstilling af begrebet test i det pædagogiske univers.......Bidrag med en kortfattet, introducerende, perspektiverende og begrebsafklarende fremstilling af begrebet test i det pædagogiske univers....

  8. Simulasi dan Analisis Transmisi Multihop Mobile WiMAX Dengan Metode Hybrid

    Directory of Open Access Journals (Sweden)

    Muhamad Asvial

    2016-06-01

    Full Text Available Makalah ini membahas tentang pengembangan relay station untuk transmisi downlink Mobile WiMAX dengan menggunakan metode hybrid, yaitu metode transmisi yang menggunakan tiga buah transmisi. Ketiga transmisi tersebut yaitu dua buah transmisi yang melewati relay station terlebih dahulu baru ke receiver dan satu buah transmisi langsung dari pengirim ke penerima. Pada relay station ada dua kondisi yang berlaku, yaitu Decode and Forward (DF dan Amplify and Forward (AF. Hasil simulasi menunjukkan bahwa ketika Relay Station dalam mode forwarding Amplify and Forward (AF akan memperoleh BER yang kecil sehingga throughput besar dan merupakan perfomansi yang terbaik. Ketika masing-masing relay station diatur agar menggunakan mode forwarding yang berbeda, misalnya AF pada relay station 1 dan DF pada Relay Station 2 atau sebaliknya akan memperoleh hasil yang sama. Sedangkan ketika kedua relay station diatur untuk menggunakan mode forwarding Decode and Forward (DF, maka BER yang dihasilkan besar dan throughput-nya pun kecil, dan kondisi ini merupakan yang terburuk.

  9. Pole Soccer - Implementering af netværksmodul

    OpenAIRE

    Knudsen, Frank B; Kierkegaard, Jakob R; Hirszhorn, Andreas J

    2005-01-01

    Abstrakt Målet med dette projekt er at designe og implementere et netværksmodul til spillet PoleSoccer, som er et spil udviklet i det foregående semester. Fokus i implementeringen er at opn°a bedst mulig synkronisering klienterne imellem. Programmet er udviklet i programmeringssproget Java. I rapporten diskuteres valg af netværksarkitektur, transportlagsprotokol samt hvilke metoder Java tilbyder til netværkskommunikation, med vægt på Sockets. Ydermere beskrives metoder vi har anvendt til at o...

  10. Restaurering af Skjern Å

    DEFF Research Database (Denmark)

    Jessen, K.; Boysen Larsen, B.; Bundgaard, P.

    Denne rapport indeholder resultaterne af den natur- og miljøovervågning, der blev iværksat som en del af naturgenopretningen af Skjern Å 1999-2002. Ved projektet ophørte den kunstige afvanding af den vestlige del af Skjern Å dalen. Størstedelen af de dyrkede arealer ændredes til ekstensive græsni...

  11. Nye metoder til geobranchen

    DEFF Research Database (Denmark)

    Aanæs, Henrik; Nielsen, Allan Aasbjerg

    2010-01-01

    Kortlægning er for alvor kommet ind i det 21 århundrede og er et af de områder, hvor den digitale revolution har haft den største effekt. Derfor taler vi ikke længere så meget om kortlægning, men om geoinformatik, hvilket afspejler branchens vilje og evne til at omfavne de informations......-teknologiske muligheder. Den digitale revolution er stadig i gang, hvilket for nuværende bl.a. indebærer en udvikling hen imod mere information i kortene, flere produkter som Street View og 3D-bymodeller samt mere automatisering i kortproduktionen....

  12. Energirenovering af større bygninger

    DEFF Research Database (Denmark)

    Mortensen, Lone Hedegaard; Birck Laustsen, Jacob; Vorre, Mette Havgaard

    involverede parter i et renoveringsprojekt om, hvordan energirenoveringsprojekter gennemføres i alle faser. SBi-anvisning 269 kan bruges som styringsredskab for bygherrer og kravgrundlag for rådgivere, entreprenører og andre parter, der leverer ydelser til bygherren. For institutioner, der stiller kapital til......​SBi-anvisning 269 omhandler metode og proces for gennemførelse af energirenoveringsprojekter for større bygninger fra idefase til driftsfase. Større bygninger omfatter etageboliger, bygninger til privat handel- og service samt offentlige institutioner. Anvisningen giver vejledning for de...

  13. Forskningsoversigt - Effekterne af Cooperative Learning

    DEFF Research Database (Denmark)

    Larsen, Lea Lund

    Kan Cooperative Learning - en undervisningsform hvor lærerens tid ved tavlen mindskes og hvor de lærende samarbejder om stoffet - maksimere de lærendes indlæring og medvirke til en forbedring af deres interpersonelle og kommunikative kompetencer, samt øge deres motivation for læring? Den megen...... forskning fra USA viser, at Cooperative Learning øger lærerens bevidsthed om, hvilken adfærd, han er medvirkende til at skabe blandt de lærende. Og den øger lærerens bevidsthed omkring interaktioner i klasserummet, og giver god plads og taletid til hver enkelt lærende. Set i lyset heraf kan Cooperative......, at Cooperative Learning har lige så høj grad af positiv effekt, som den viser sig at have på grundskoleområdet. Det er sigtet med denne oversigt over den empiriske forskning. Til start præsenteres Cooperative Learning som metode, dens rødder og udvikling, dernæst skitseres den omfattende forskning omkring...

  14. Kortlægning af luftkvalitet langs motor- og landeveje i Danmark

    DEFF Research Database (Denmark)

    Jensen, Steen Solvang; Im, Ulas; Ketzel, Matthias

    2016-01-01

    Denne artikel beskriver resultaterne af en kortlægning af luftkvaliteten langs motor- og landeveje i hele Danmark. Det er første gang, at der skabes et nationalt datasæt af modellerede luftkvalitetsdata langs hele statsvejnettet. Beregningerne er gennemført for årsmiddelkoncentrationer i 2012 af ...... sundheds-relaterede stoffer NO2, PM2.5 og PM10. Kortlægningen er gennemført med OML-Highway luftkvalitets-modellen, og anvendte metoder og datagrundlag er beskrevet. Endvidere er beregningerne sammenholdt med tidligere gennemførte målinger og beregninger....

  15. 6 belysninger af vejledning

    DEFF Research Database (Denmark)

    Toft, Helle Mary; Jessing, Carla Tønder; Nymann, Anette

    Artiklerne belyser vejledning af unge og vejledning af voksne. I relation til unge drejer det sig om: 1. vejledning af unge med vanskeligheder i forhold til uddannelse - her unge med særlige vejledningsbehov, og mentorordninger for unge, og 2. vejledning af unge i ungdomsuddannelser og i erhvervs...

  16. Undervisning af tosprogede elever

    DEFF Research Database (Denmark)

    Horst, Christian

    2003-01-01

    Artiklen fremdrager hovedresultaterne fra Virginia P. Collier's og Wayne P. Thomas's længdeundersøgelser af tosprogede elever i USA, som formentlig er de mest omfattende undersøgelser af undervisningen af tosprogede elever overhovedet. Resultaterne diskuteres i relation til udviklingen af en...

  17. Lyden-af-Leg

    DEFF Research Database (Denmark)

    Toft, Herdis

    Præsentation af seniorforsker-projekt Lyden-af-Leg i et traderingsperspektiv og med indledende fokus på YouTube som traderings-platform.......Præsentation af seniorforsker-projekt Lyden-af-Leg i et traderingsperspektiv og med indledende fokus på YouTube som traderings-platform....

  18. Energirenovering af Sems Have

    DEFF Research Database (Denmark)

    Jensen, Søren Østergaard; Rose, Jørgen; Mørck, Ove

    Nærværende rapport udgør en del af afrapporteringen af PSO ELFORSK projektet Vejledning for energirenovering af boligblokke til lavenergiklasse 2015 og 2020. Arbejdet har været finansieret af PSO midler via ELFORSK, projekt: 347-023. Formålet med projektet er at udvikle en vejledning for dybtgående...

  19. Energirenovering af Traneparken

    DEFF Research Database (Denmark)

    Rose, Jørgen; Thomsen, Kirsten Engelund; Mørck, Ove

    Nærværende rapport udgør en del af afrapporteringen af PSO ELFORSK projektet Vejledning for energirenovering af boligblokke til lavenergiklasse 2015 og 2020. Arbejdet har været finansieret af PSO midler via ELFORSK, projekt: 347-023. Formålet med projektet er at udvikle en vejledning for dybtgående...

  20. Beregning af nitratudvaskning

    DEFF Research Database (Denmark)

    Petersen, Jens; Petersen, Bjørn Molt; Blicher-Mathiesen, Gitte

    2006-01-01

    I forbindelse med kommunalreformen ønskes en ensartet forvaltning af reglerne for vurdering af virkninger på miljøet (VVM) ved ansøgninger om udvidelse af husdyrbrug, herunder beregning af nitratudvaskningen. Rapporten foreslår et beregningskoncept, der bygger på den ansøgende bedrifts samlede kv...

  1. Metode til kompetenceevaluering af speciallaeger--validering af 360-graders-skema

    DEFF Research Database (Denmark)

    Nørgaard, Kirsten; Pedersen, Juri; Ravn, Lisbeth

    2010-01-01

    Assessment of physicians' performance focuses on the quality of their work. The aim of this study was to develop a valid, usable and acceptable multisource feedback assessment tool (MFAT) for hospital consultants.......Assessment of physicians' performance focuses on the quality of their work. The aim of this study was to develop a valid, usable and acceptable multisource feedback assessment tool (MFAT) for hospital consultants....

  2. Analyse af problemstillinger i moderne produktionssystemer ved hjælp af operationsanalytiske metoder

    DEFF Research Database (Denmark)

    Paulli, Jan

    This PhD thesis consists of 6 volumes, the first being the above-mentioned Resumé. Vol. 2: Some Aspects of Applying Simulated Annealing and Tabu Search to the Quadratic Assignment Problem. Vol. 3: A Hierarchical Approach for the FMS Scheduling Problem Vol. 4: Solving the General Multiprocessor Job-shop...... Scheduling Problem (co-author: S. Dauzèrérès) Vol. 5: A Global Tabu Search Procedure for the General Multiprocessor Job-shop Scheduling Problem (co-author: S. Dauzère-Pérès) Vol. 6: Makespan Estimations in Flexible Manufacturing Systems (co-author: J.C. Fransoo, T.G. de Kok)...

  3. STUDI KOMPARASI HASIL BELAJAR SISWA DENGAN PENERAPAN METODE PEMBELAJARAN TEAM ASSISTED INDIVIDUALIZATION (TAI DAN METODE PEMBELAJARAN CERAMAH BERVARIASI BERBANTUAN KARTU SOAL KOMPETENSI DASAR JURNAL KHUSUS

    Directory of Open Access Journals (Sweden)

    Devina Asri Laras

    2016-03-01

    Full Text Available Tujuan penelitian ini yaitu untuk mengetahui: adanya peningkatan hasil belajar siswa dengan penerapan metode Team Assisted Individualization berbantuan kartu soal pada kompetensi dasar jurnal khusus. Penelitian ini termasuk penelitian quasi experiment nonequivalent control group. Populasi penelitian ini adalah seluruh siswa kelas XII IPS SMA N 2 Purbalingga. Sampel penelitian adalah XII IPS 1 sebagai kelas eksperimen dan XII IPS 2 sebagai kelas kontrol. Metode pengumpulan data yaitu dengan metode tes dan metode observasi. Pengujian hipotesis menggunakan independent sample t-test dan paired sample t-test. Hasil penelitian menunjukkan adanya peningkatan hasil belajar siswa setelah diterapkan metode TAI sebesar 22,23. Rata-rata hasil belajar siswa dengan metode TAI sebesar 84,11 lebih tinggi dibandingkan dengan metode ceramah bervariasi sebesar 79,88. Kesimpulan penelitian ini adalah penerapan metode TAI lebih efektif meningkatkan hasil belajar siswa dibandingkan metode ceramah bervariasi berbantuan kartu soal. The purpose of this study is to determine: the improvement of student learning achievement with Team Assisted Individualization using card question about the basic competence special journal. This study is a quasi-experimental nonequivalent control group. The study population was all students in class XII IPS SMA N 2 Purbalingga. The samples were XII IPS 1 as the experimental class and class XII IPS 2 as a control. The method of collecting data in this study is the test and observation method. Hypothesis testing using independent sample t-test and paired sample t-test. The results showed an increase in student learning achievement after treatment TAI method of 22.23. Average student learning outcomes with TAI method of 84.11 is higher than the lecture method varies by 79.88. The conclusion of this research is the application of the method is more effective TAI improve student learning outcomes than the lecture variation method using question

  4. PERBANDINGAN ESTIMASI KEMAMPUAN LATEN ANTARA METODE MAKSIMUM LIKELIHOOD DAN METODE BAYES

    Directory of Open Access Journals (Sweden)

    Heri Retnawati

    2015-10-01

    Full Text Available Studi ini bertujuan untuk membandingkan ketepatan estimasi kemampuan laten (latent trait pada model logistik dengan metode maksimum likelihood (ML gabungan dan bayes. Studi ini menggunakan metode simulasi Monte Carlo, dengan model data ujian nasional matematika SMP. Variabel simulasi adalah panjang tes dan banyaknya peserta.  Data dibangkitkan dengan menggunakan SAS/IML dengan replikasi 40 kali, dan tiap data diestimasi dengan ML dan Bayes. Hasil estimasi kemudian dibandingkan dengan kemampuan yang sebenarnya, dengan menghitung mean square of error (MSE dan korelasi antara kemampuan laten yang sebenarnya dan hasil estimasi. Metode yang memiliki MSE lebih kecil dikatakan sebagai metode estimasi yang lebih baik. Hasil studi menunjukkan bahwa pada estimasi kemampuan laten dengan 15, 20, 25, dan 30 butir dengan 500 dan 1.000 peserta, hasil MSE belum stabil, namun ketika peserta menjadi 1.500 orang, diperoleh akurasi estimasi kemampuan yang hampir sama baik estimasi antara metode ML dan metode Bayes. Pada estimasi dengan 15 dan 20 butir dan peserta 500, 1.000, dan 1.500, hasil MSE belum stabil, dan ketika estimasi melibatkan 25 dan 30 butir, baik dengan peserta 500, 1.000, maupun 1.500 akan diperoleh hasil yang lebih akurat dengan metode ML. Kata kunci: estimasi kemampuan, metode maksimum likelihood, metode Bayes     THE COMPARISON OF ESTIMATION OF LATENT TRAITS USING MAXIMUM LIKELIHOOD AND BAYES METHODS Abstract This study aimed to compare the accuracy of the estimation of latent ability (latent trait in the logistic model using maximum likelihood (ML and Bayes methods. This study uses a quantitative approach that is the Monte Carlo simulation method using students responses to national examination as data model, and variables are the length of the test and the number of participants. The data were generated using SAS/IML with replication 40 times, and each datum is then estimated by ML and Bayes. The estimation results are then compared with the

  5. Somatisk embryogense og kryopræservering af eg og bøg

    DEFF Research Database (Denmark)

    MMH Kristensen, Michel; Find, Jens; Krogstrup, Peter

    Somatisk embryogenese og kryopræservering af eg og bøg Traditionel vegetativ formering af eg og bøg er vanskeligt, dyrt og har ingen større praktisk anvendelse i skovbruget. Opbevaring af agern og bog i frøbanker erligeledesproblematiskidetspiringsevnenfalderdramatiskalleredeiløbetafdetoførsteåre......Somatisk embryogenese og kryopræservering af eg og bøg Traditionel vegetativ formering af eg og bøg er vanskeligt, dyrt og har ingen større praktisk anvendelse i skovbruget. Opbevaring af agern og bog i frøbanker...... holdbarheden er flere hundrede år. Arbejdet med eg og bøg er en del af et større projekt, Videreudvikling af bioteknologiske metoder, med henblik på forædling og opbevaring af plantegenetiske ressourcer for skovtræer i Danmark 2003- 2006. Det overordnede formål med projektet var at udvikle metoder til...

  6. God hygiejne vigtig ved brug af råmælksbank

    DEFF Research Database (Denmark)

    Børsting, Christian Friis; Røntved, Christine M.; Martin, Henrik L

    2009-01-01

    Undersøgelse viste højere bakterieindhold i råmælken end forventet, hvilket har fået afgørende betydning for håndteringen af råmælk på KFC. Artiklen beskriver en metode til brug i praksis til bestemmelse af bakterieindholdet i mælk og stiller skarpt på kritiske punkter for at undgå bakterieproble......Undersøgelse viste højere bakterieindhold i råmælken end forventet, hvilket har fået afgørende betydning for håndteringen af råmælk på KFC. Artiklen beskriver en metode til brug i praksis til bestemmelse af bakterieindholdet i mælk og stiller skarpt på kritiske punkter for at undgå...

  7. Evaluering af 'Styrket indsats overfor anbragte børn’

    DEFF Research Database (Denmark)

    Hansen, Helle; Sandoy, Tróndur Møller; Mehlsen, Line

    2017-01-01

    14 døgntilbud har over en periode på 2 år arbejdet med at øge anbragte børns muligheder for uddannelse med udgangspunkt i metoden ’Positiv afvigelse’. ’Positiv afvigelse’ adskiller sig som metode ved at fokusere på de positive historier og på, hvad organisationen kan lære af disse. Kernen i proje...

  8. For eller imod vaccination? Om forældres beslutningstagen I forbindelse med Calmette-vaccination af deres nyfødte barn

    DEFF Research Database (Denmark)

    Thybo Pihl, Gitte

    Sygehus, Rigshospitalet og Hvidovre Hospital, fra oktober 2012 til november 2013. I alt 4184 familier blev randomiseret i Calmette-studiet. Ad formål 1: Før Calmette-studiets begyndelse blev fem fokusgrupper gennemført med formålet at undersøge forældres overvejelser, når de skal tage stilling til, om...... Kolding blev efterfølgende telefon-interviewet med en dansk valideret udgave af "The Decisional Conflict Scale" med det formål at undersøge, hvor trygge de var ved beslutningen og om socio-demografiske faktorer havde betydning for deres oplevelse af tvivl. Ad formål 3: Spørgsmål om forældres...... kvantitativ metode, idet der anvendes statistiske tests af socio-demografiske faktorers betydning for The Decisional Conflict Score, ligesom selve scoren opgøres statistisk. Formål 3 er undersøgt i et miks af statistiske opgørelser af svarene fra telefon-interview kombineret med uddybende perspektiver fra...

  9. Lyden af musik - er lyden af idealisme

    DEFF Research Database (Denmark)

    Eigtved, Michael

    2015-01-01

    Programartiklen til Det Ny Teaters opsætning af Rodgers & Hammersteins The Sound of Music, undersøger musicalgenrens - og især de konkrete ophavsmænds- affinitet til fremstillingen af såvel idealistiske som ideologiske universer.......Programartiklen til Det Ny Teaters opsætning af Rodgers & Hammersteins The Sound of Music, undersøger musicalgenrens - og især de konkrete ophavsmænds- affinitet til fremstillingen af såvel idealistiske som ideologiske universer....

  10. Styring af kommunal digitalisering

    DEFF Research Database (Denmark)

    Jæger, Birgit

    2017-01-01

    Digitalisering af både interne arbejdsprocesser og kommunikation med borgere og virksomheder har længe været en vigtig faktor i moderniseringen af den offentlige sektor. Derfor er der stort fokus på styring af digitaliseringen. Denne artikel undersøger, dels hvordan digitaliseringen i den kommunale...... sektor styres, og dels hvilke styringsparadigmer der kan identificeres. Med udgangspunkt i en konkret kommune analyseres styringen af digitalisering gennem et hierarki af offentlige digitaliseringsstrategier. Gennem udvikling af en helt ny form for organisering, en såkaldt Digitaliseringsforening...

  11. KOMPARASI BEBERAPA METODE ESTIMASI KESALAHAN PENGUKURAN

    Directory of Open Access Journals (Sweden)

    Catharina Sri Wahyu Widayati

    2013-09-01

    Full Text Available Penelitian ini bertujuan untuk mendeskripsikan besarnya estimasi kesalahan pengukuran perangkat soal Ujicoba Ujian Nasional mata pelajaran Biologi SMA. Analisis data dalam penelitian ini didasarkan pada respons siswa peserta tes ujicoba di kabupaten Bantul tahun pelajaran 2007/2008. Sumber data berupa lembar jawaban siswa yang diambil dengan teknik stratified proportional random sampling sebanyak 842 respons siswa dari 9 SMA negeri. Metode estimasi kesalahan pengukuran yang digunakan dalam penelitian ini adalah 1 metode Thorndike, 2 metode Polynomial, 3 pendekatan Binomial Lord dengan modifikasi Keats, 4 pendekatan compound Binomial, 5 metode analisis varians, dan 6 metode teori respons butir. Hasil analisis data menunjukkan bahwa besarnya estimasi kesalahan pengukuran perangkat soal tes ujicoba ujian nasional mata pelajaran biologi SMA tahun pelajaran 2007/2008 dengan menggunakan metode Thorndike, Polynomial, Binomial dengan modifikasi Keats, Compound Binomial, Analisis Varians, dan teori respons butir berturut-turut sebagai berikut: 2,96, 2,99, 2,87, 2,87, 2,83, dan 2,81, sedangkan hasil perhitungan root mean square error (RMSE untuk masing-masing metode berturut-turut sebagai berikut: 0,02869, 0,02904, 0,02891, 0,02873, 0,02854, dan 0,02848. Harga RMSE terkecil diperoleh dengan metode teori respons butir, sehingga metode ini merupakan metode yang paling tepat. Kata kunci: metode estimasi kesalahan pengukuran

  12. EFEKTIFITAS METODE PREVIEW, QUESTION, READ, REFLECT, RECITE, REVIEW DAN METODE KONVENSIAL TERHADAP HASIL BELAJAR

    Directory of Open Access Journals (Sweden)

    Resi Mayangsari

    2012-06-01

    Full Text Available Tujuan yang hendak dicapai dalam penelitian ini adalah untuk mengetahui apakah penggunaan metode (PQ4R dapat meningkatkan hasil belajar dan aktivitas belajar siswa kelas X SMA PGRI Gumelar Kab. Banyumas tahun pelajaran 2011/2012 dan untuk mengetahui apakah penggunaan metode (PQ4R lebih efektif dibandingkan dengan metode konvensional. Adapun hipotesis dalam penelitian ini adalah penggunaan metode (PQ4R pada mata pelajaran IPS ekonomi satndar kompetensi uang dan lembaga keuangan efektif untuk dapat meningkatkan hasil belajar dan aktivitas belajar siswa kelas X SMA PGRI Gumelar Kab. Banyumas tahun pelajaran 2011/2012. Hasil penelitian menunjukan bahwa, penggunaan metode (PQ4R lebih efektif daripada metode konvensional pada pembelajaran IPS ekonomi standar kompetensi uang dan lembaga keuangan pada siswa kelas X SMA PGRI Gumelar kab. Banyumas tahun pelajaran 2011/2012. Hal ini dapat dibuktikan dari nilai rata- rata post test untuk kelas eksperimen sebesar 78,57 dan kelas kontrol sebesar 75,31. Simpulan dalam penelitian ini yaitu penggunaan metode (PQ4R dapat meningkatkan hasil belajar dan aktivitas siswa, dan lebih efektif dibandingkan metode konvensional terhadap hasil belajar siswa dalam pembelajaran IPS ekonomi standar kompetensi uang dan lembaga keuangan pada siswa kelas X SMA PGRI Gumelar kabupaten Banyumas tahun pelajaran 2011/2012. Saran dalam penelitian ini yaitu pembelajaran dengan model pembelajaran (PQ4R dapat dijadikan sebagai alternatif pembelajaran bagi guru dalam rangka menambah variasi model mengajar karena efektif dalam meningkatkan hasil belajar dan aktivitas siswa, perlu adanya belajar kelompok yang efektif untuk melatih tingkat sosial siswa, dan perlu adanya penelitian lebih lanjut dalam rangka untuk meningkatkan hasil belajar dan aktivitas siswa. Goals to be achieved in this study was to determine whether the use of the method (PQ4R can improve learning outcomes and learning activities of high school class X PGRI Gumelar

  13. Skoling af lyst

    DEFF Research Database (Denmark)

    Bjerg, Helle

    2011-01-01

    På baggrund af interview med tre elevgenerationer fremanalyseres skolens virkningsfuldhed i skoling af lyst i et historisk perspektiv. I afhandlingen udvikles to teoretisk-analytiske optikker: Skolen som ideologisk rum - med inspiration fra Slavoj Zizeks ideologikritik, samt Skolen som affektivt...

  14. Om distributionen af hvidhed

    DEFF Research Database (Denmark)

    Frello, Birgitta

    2007-01-01

    Med udgangspunkt i John Fords Western, Forfølgeren fra 1956, præsenteres en analyse af repræsentationer af race og overskridelse af raceskel, særligt i relation til konstitueringen af subjektpositioner, hvorfra spørgsmål om hvidhed og ikke-hvidhed kan afgøres.......Med udgangspunkt i John Fords Western, Forfølgeren fra 1956, præsenteres en analyse af repræsentationer af race og overskridelse af raceskel, særligt i relation til konstitueringen af subjektpositioner, hvorfra spørgsmål om hvidhed og ikke-hvidhed kan afgøres....

  15. Udforskning af journalistiske moralnormer

    DEFF Research Database (Denmark)

    Mogensen, Kirsten

    2010-01-01

    Kirsten Mogensen beskriver professionelle journalistiske normer. Med udgangspunkt i amerikansk tv's dækning af begivenhederne 11. september kombinerer Kirsten Mogensen kvalitative interviews og tekstanalyse for på den måde at beskrive professionelle journalistiske normer. Metoden er en kombinatio...... af halvstrukturerede, udforskende interviews med både kvantitative og kvalitative analyser af den faktiske dækning, og er primært udledt af Alf Ross' essay om normer og direktiver....

  16. En verden af medier

    DEFF Research Database (Denmark)

    Tække, Jesper

    2009-01-01

    Bogen: 'En verden af medier – Medialiseringen af politik, sprog, religion og leg' anmeldes. Anmeldelsen kan læses på: http://ojs.statsbiblioteket.dk/index.php/mediekultur/article/view/1370/1499 Udgivelsesdato: 2009......Bogen: 'En verden af medier – Medialiseringen af politik, sprog, religion og leg' anmeldes. Anmeldelsen kan læses på: http://ojs.statsbiblioteket.dk/index.php/mediekultur/article/view/1370/1499 Udgivelsesdato: 2009...

  17. Ensretning af historieundervisningen

    DEFF Research Database (Denmark)

    Rønhede, Søren

    2008-01-01

    "Det er ikke kun i Putins Rusland, at statsmagten vil dirigere historieundervisningen." (Politiken havde fokuseret på "ensretning af historieundervisningen" i Rusland) "Kanonen fra 2006 er undfanget af Udvalget til Styrkelse af Historie i Folkeskolen. Dette udvalg havde regeringen nedsat; men bid...... bidrager kanonen til faglig styrkelse?" spørges der. Det vises, at flere kanonpunkter ikke er fagligt funderede, men af mytologisk art....

  18. Behandling af elmesyge

    DEFF Research Database (Denmark)

    Thomsen, Iben Margrete; Kristoffersen, Palle

    2004-01-01

    Ingen midler er p.t. godkendt og dermed lovlige til bekæmpelse af elmesyge i Danmark. Lovprisning af nye behandlinger ses f.eks. på internettet, men dokumentation mangler. Økonomien og nytten ved en kemisk bekæmpelse frem for sanering af syge træer skal afvejes nøje....

  19. Globalisering af uddannelse

    DEFF Research Database (Denmark)

    Jensen, Henning Høgh

    2005-01-01

    Det globale marked for uddannelse er i voldsom vækst og er ved at blive et af Danmarks vigtigste vareområder. Hvorledes kan KVL agere i globaliseringen af uddannelse for at sikre en høj kvalitet af egne kandidater med gode jobmuligheder?...

  20. Digital formidling af kulturarv

    DEFF Research Database (Denmark)

    En af tidens store kulturelle dagsordner drejer sig om digital tilgængeliggørelse af kulturarv. Fortidens spor dukker op i nye former på nettet - næsten alle kulturinstitutioner arbejder med, og befolkningen har fået helt nye muligheder for at se med og deltage. Digital formidling af kulturarv...

  1. Af Upraktiske Grunde

    DEFF Research Database (Denmark)

    Vaaben, Nana Katrine

    2001-01-01

    som både Claude Levi-Strauss lægger op til i sine klassiske studier af "den vilde tanke", og som Jean Baudrillard siden har lagt op til i sine analyser af samlere som en slags ekstreme forbrugere, der er i færd med at komplettere deres identitet gennem besiddelser af genstande. Imidlertid tillægger...

  2. Multi-centre testing and validation of current protocols for the identification of Gyrodactylus salaris (Monogenea)

    DEFF Research Database (Denmark)

    Shinn, A.P.; Collins, C.; García-Vásquez, A.

    2010-01-01

    Tilgængelige metoder til diagnose af G. salaris er blevet afprøvet i en række laboratorier Udgivelsesdato: September......Tilgængelige metoder til diagnose af G. salaris er blevet afprøvet i en række laboratorier Udgivelsesdato: September...

  3. Optimering af model for spredning af luftforurening

    DEFF Research Database (Denmark)

    Pedersen, Jens Christian

    2008-01-01

    De nuværende luftforureningsmodeller har problemer med at bevare massen af diverse kemiske stoffer og med at der ind i mellem optræder negative værdier. Derfor arbejder specialestuderende Ayoe Buus Hansen på om at forbedre den model DMU bruger til at beskrive transport og spredning af luftforuren...... luftforurening på alle skalaer på den nordlige halvkugle ved at sammenligne tre alternative beregningsmodeller. ...

  4. Metodik til studiet af strategiske ledelsesprocesser i organisationer

    Directory of Open Access Journals (Sweden)

    Jørgen Gulddahl Rasmussen

    2010-10-01

    Full Text Available Denne artikel handler om at skabe viden om en hverdagspraksis, der sjældent er sat ord på. Den behandler de ledelsesprocesser, der i virksomheder producerer strategi og omsætter sådanne strategier i produktive handlinger. Det er processer, der i små og mellemstore virksomheder er præget af intuition og af meget uformelle samspil mellem virksomhedsledere og medarbejdere. Metodikken er en videreudvikling af de metoder til produktion af kvalitative data, som FIRM-gruppen har eksperimenteret med gennem nogle år. Artiklen kan ses som en afrapportering af et flerårigt metodeudviklingsarbejde. Da erfaringer fra sådanne virksomheder viser, at strategiske processer i høj grad udvikler sig gennem uformel kommunikation, og at lederes intuition spiller en meget stor rolle, arbejder metodikken med en struktureret udviklingsdialog mellem et mindre antal virksomhedsledere med strategiske opgaver og forskere. Denne udviklingsdialog har til formål at følge og forstå de processer, der skaber ledernes egne praksisrelaterede ”teorier” for strategisk handling. Efter en præsentation af temaet gennemgås metodikkens praktiske fremgangsmåde med undersøgelser i en række virksomheder, opbygning af cases i samarbejde med ledere fra disse virksomheder, diskussion af disse og foreløbige konklusioner hen mod de næste trin i metodikken. Artiklen er skrevet samtidigt med arbejdet på et igangværende forskningsprojekt og vil derfor både være en præsentation og en udvikling af muligheder og vanskeligheder i metodikken.

  5. ARCgame - gamification af undervisning

    DEFF Research Database (Denmark)

    Jensen, Camilla Gyldendahl

    2014-01-01

    Gamification er et begreb, der anvendes til at beskrive brugen af spilelementer i andre miljøer for at forbedre brugernes oplevelse. Følgende tekst har til formål at behandle emnet i forhold til af opnå en forståelse for de elementer der indvirker på en ”gamification af et undervisningsforløb”, her...

  6. Hvad griner du af?

    DEFF Research Database (Denmark)

    Lorenzen, Tobias Hiort

    2012-01-01

    latterliggørelse indenfor en sådan teori. Sociologiens begreb om ”un-laughter” angives som en mulig udvej af dette problem. I forlængelse af dette kritiseres den moderne humor-psykologis lære om populationers humor-patologi og til slut argumenteres der for at en moderne dannelse af humor må have en moralsk...

  7. Ledelse af projektmyldret

    DEFF Research Database (Denmark)

    større arbejdsgrupper, og det kan være selvorganiserede store udviklingsprogrammer. Et projekt kører sjældent alene, og derfor er der ikke kun tale om projektledelse, men i lige så høj grad om ledelse af projekter. Ledelse af virksomhedens mylder af projekter er ikke let, og forfatterne gennemgår derfor...

  8. Strategisk ledelse af evalueringskulturen

    Directory of Open Access Journals (Sweden)

    Gitte Orlowitz

    2016-02-01

    Full Text Available Hvis evaluering skal anvendes til at udvikle uddannelser, er en af ledelsen vigtigste opgaver at udvikle en strategi for udvikling af evalueringskulturen – herunder strategier for udvikling af kommunikation og evalueringskapacitet. Den strategiske ledelse kan i den sammenhæng anvendes til at håndtere de ofte modsatte krav, som eksterne og interne interessenter stiller til evaluering.

  9. Ledelse af Organisationens Kreativitet

    DEFF Research Database (Denmark)

    Hedemann, Lars

    2008-01-01

    forskel, så er man som leder nødt til at arbejde mere målrettet med de medarbejdere som forventes at præstere et kreativt udbytte. Inspireret af analyseværktøjet "KEYS, Assessing the Work Environment for Creativity" udviklet af den amerikanske psykolog og ledelsesforsker ved Harvard University, Teresa...... Amabile, blev en undersøgelse derfor gennemført i udviklingsafdelingerne, Idéland og Idélab hos Bang og Olufsen, for at få et indblik i anvendeligheden af KEYS som inspirationskilde for succesfuld ledelse af organisationens kreativitet....

  10. Forbedring af GIS data til trafikmodeller

    DEFF Research Database (Denmark)

    Hansen, Stephen; Landex, Alex; Nielsen, Otto Anker

    2005-01-01

    indbyggere og arbejdspladser er meget inhomogen. Dette er især tilfældet for zonerne i Frederiksborg og Roskilde Amter. For at opnå mere detaljerede resultater er det nødvendigt at opdele disse zoner. I artiklen præsenteres forskellige GIS-baserede metoder, der er blevet benyttet til at forbedre og kombinere...... eksisterende GIS-baserede datakilder, så der er opnået en hidtil uset nøjagtighed i trafikmodellernes geografiske data. Herefter beskrives, hvordan der med udgangspunkt i disse forbedrede data er foretaget analyser af zonerne i modellen, og hvordan zoner som ikke lever op til den ønske detaljegrad, er splittet...

  11. Coaching af dit studieliv

    DEFF Research Database (Denmark)

    Hansen, Rasmus Thorning

    2008-01-01

    En generel beskrivelse af de problemer specialestuderende sidder med og hvorledes coaching kan hjælpe med at (gen)skabe motivation og fokus......En generel beskrivelse af de problemer specialestuderende sidder med og hvorledes coaching kan hjælpe med at (gen)skabe motivation og fokus...

  12. Dialektisk billede af Benjamin

    DEFF Research Database (Denmark)

    Bøggild, Jacob

    2004-01-01

    Anmeldelse af Lars Brückner: "Løse blade. Læseren, kritikeren og fortælleren Walter Benjamin"......Anmeldelse af Lars Brückner: "Løse blade. Læseren, kritikeren og fortælleren Walter Benjamin"...

  13. Administration af informationsmodeller

    DEFF Research Database (Denmark)

    Hundebøl, Jesper

    2013-01-01

    En informationsmodel er i denne sammenhæng en digital repræsentation af et givent byggeri. Både offentlige og private bygherrer anvender informationsmodeller, når der 'bygges digitalt'. I denne artikel undersøges det, hvilke konkrete udfordringer der følger af digitaliseringen, hvor gennemgribend...

  14. Raman af hvide pigmenter

    DEFF Research Database (Denmark)

    Reeler, Nini Elisabeth Abildgaard; Nielsen, Ole Faurskov; Sauer, Stephan P. A.

    2013-01-01

    Et samspil mellem kunst og kemi. I et samarbejde mellem Statens Museum for Kunst og Kemisk Institut på KU er Ramanspek-troskopi brugt til at definere sammensætningen af blandinger af blyhvidt og calcit i maleriers hvide pigmenter....

  15. Midtvejsevaluering af EGA handlingsplanen

    DEFF Research Database (Denmark)

    Møller, Niels; Hasle, Peter; Christiansen, Jørgen Møller

    Center for Alternativ Samfundsanalyse (CASA) og Institut for Teknologi og Samfund ved Danmarks Tekniske Universitet har gennemført denne midtvejsevaluering af arbejdsmarkedets parters handlingsplan mod reduktion af ensidigt gentaget arbejde. Undersøgelsen viser, at der er sket en betydelig...

  16. Anvendelse af genmodificerede planter

    DEFF Research Database (Denmark)

    Møller, F.

    I rapporten vurderes mulighederne for at gennemføre velfærdsøkonomiske analyser af anvendelsen af genmodificerede planter. Der gøres rede for kravene til konse-kvensbeskrivelsen og for mulighederne for at prissætte såvel de markedsrelaterede som de ikke-markedsrelaterede konsekvenser. Mulighederne...

  17. Kvalitetsvurdering af sundhedsoplysende materiale

    DEFF Research Database (Denmark)

    Osler, Merete; Bech, Lars; Sybille, Bojlén

    1990-01-01

    Lægeforeningens Hygiejnekomités arbejdsgruppe vedrørende sundhedsoplysning har udarbejdet en "huskeliste" til brug for en kvalitetsvurdering af skriftligt sundhedsoplysende materiale......Lægeforeningens Hygiejnekomités arbejdsgruppe vedrørende sundhedsoplysning har udarbejdet en "huskeliste" til brug for en kvalitetsvurdering af skriftligt sundhedsoplysende materiale...

  18. Implementering af evidensbaseret praksis

    DEFF Research Database (Denmark)

    Scheel, Linda Schumann; Tewes, Marianne; Petersen, Preben Ulrich

    2015-01-01

    Projektet omhandler implementering af den kliniske retningslinje om identifikation, forebyggelse og behandling af delirium – i denne sammenhæng relateret til hjertepatienter. Projektet foregår på to hospitaler i Hjertecentret på Rigshospitalet, et intensivt afsnit og et sengeafsnit, i tæt...

  19. Implementering af evidensbaseret praksis

    DEFF Research Database (Denmark)

    Scheel, Linda Schumann; Hansen, Ida Rode

    2014-01-01

    Projektet omhandler implementering af den kliniske retningslinje om identifikation, forebyggelse og behandling af delirium – i denne sammenhæng relateret til hjertepatienter. Projektet foregår på to hospitaler i Hjertecentret på Rigshospitalet, et intensivt afsnit og et sengeafsnit, i tæt...

  20. Fundering af mindre bygninger

    DEFF Research Database (Denmark)

    Larsen, J.; Ballisager, C.C.

    Denne SBI-anvisning indeholder en gennemgang af de jordbunds- og grundvandsforhold, som er bestemmende for funderingen af en bygning. Specielt gennemgås de betingelser, der skal være opfyldt, for at man på forsvarlig måde kan fundere en mindre bygning i traditionel udformning. Publikationen...

  1. Coaching af nystartede universitetsstuderende

    DEFF Research Database (Denmark)

    Spaten, Ole Michael; Løkken, Lillith Olesen; Kyndesen, Anna Imer

    2011-01-01

    ). Kvalitative interviews med fire deltagere før og efter coaching interventionen. Metode: Ni erfarne coaches gennemførte fire sessioner med 52 første semesters studerende fra Aalborg universitet. Deltagerne udfyldte DASS-21, Subjective Wellbeing Scale og Adult Hope Scale før og efter coaching interventionerne...

  2. Sundhedseffekter af luftforurening-beregningspriser

    DEFF Research Database (Denmark)

    Andersen, M. S.; Frohn, L. M.; Jensen, S. S.

    Denne rapport afrapporterer det fortsatte arbejde med udvikling af miljøøkonomiske beregningspriser. På grundlag af EcoSense 4.0 fra ExternE-projektet, er der foretaget nye beregninger af eksternaliteter ved luftforurening med sundhedseffekter. Samtidig giver rapporten en vurdering af luftspredni......Denne rapport afrapporterer det fortsatte arbejde med udvikling af miljøøkonomiske beregningspriser. På grundlag af EcoSense 4.0 fra ExternE-projektet, er der foretaget nye beregninger af eksternaliteter ved luftforurening med sundhedseffekter. Samtidig giver rapporten en vurdering af...

  3. UJI TOKSISITAS (Brine Shrimp Lethality Test DAN AKTIVITAS ANTIOKSIDAN DARI DAUN SINTRONG (Crassocephalum Crepidioides DENGAN METODE 2,2-diphenyl-1-picrylhidrazil (DPPH

    Directory of Open Access Journals (Sweden)

    Fiktor Boni Pasilala

    2016-11-01

    Full Text Available The phytochemical test, brine shrimp lethality test and antioxidant activity test on secondary metabolits of terap (Artocarpus odoratissimus B. leaves has been completed. The leaves samples are extracted by masseration method that is concentrated by using rotary evaporator. The total extract are fractioned with n-hexane and ethyl acetate. Based on secondary metabolits phytochemical test of terap (Artocarpus odoratissimus B. leaves showed that total extract and Ethyl Acetat fraction extract contains alkaloids, phenolics, flavonoids, saponins, steroids and triterpenoids. N-hexane fraction extract contain alkaloids, steroids and tritepenoids. In brine shrimp lethality test, the increase larvae death data was recorded and processed using SAS Probit Analysis to determine the Lethal Concentration 50 % (LC50 value. The results of this test showed that the most active extract is metanol extract with LC50 value of 88.0227 ppm. Based on the antioxidant activity by scavenging activity of DPPH used spectrophotometry was obtained that Inhibition Concentration 50% (IC50 of total extract is 369.0833 ppm, extract of n-hexane fraction is 1532.267 ppm and extract of ethyl acetat fraction is 82.89003 ppm.

  4. En undersøgelse af de 253 første nyrestensbehandlinger med 3. generations Siemens Lithoskop™

    DEFF Research Database (Denmark)

    Kruckow, Line; Eldrup, Jesper

    Introduktion: Kandidatspecialets formål er at undersøge et års behandlinger af nyresten ved ny stenknuser, Siemens Lithoskop. Undersøgelsen fokuserer på hvorvidt stenstørrelse, BMI og stenplacering har indflydelse på stenfrihedsraten. Metode: Mellem 6/12-11 og 11/12-12 blev 253 behandlinger og...

  5. APLIKASI METODE-METODE AGGLOMERATIVE DALAM ANALISIS KLASTER PADA DATA TINGKAT POLUSI UDARA

    Directory of Open Access Journals (Sweden)

    Dewi Rachmatin

    2014-09-01

    Full Text Available ABSTRAK   Analisis Klaster merupakan analisis pengelompokkan data yang mengelompokkan data berdasarkan informasi yang ditemukan pada data. Tujuan dari analisis klaster adalah agar objek-objek di dalam satu kelompok memiliki kesamaan satu sama lain sedangkan dengan objek-objek yang berbeda kelompok memiliki perbedaan. Analisis klaster dibagi menjadi dua metode yaitu metode hirarki dan metode non-hirarki. Metode hirarki dibagi menjadi dua, yaitu metode agglomerative (pemusatan dan metode divisive (penyebaran. Metode-metode yang termasuk dalam metode agglomerative adalah Single Linkage Method, Complete Linkage Method, Average Linkage Method, Ward’s Method, Centroid Method dan Median Method. Pada artikel ini dibahas metode-metode agglomerative tersebut yang diterapkan pada data tingkat polusi udara. Masing-masing metode tersebut memberikan jumlah klaster yang berbeda.   Kata Kunci : Analisis Klaster, Single Linkage Method, Complete Linkage Method, Average Linkage Method, Ward’s Method, Centroid Method dan Median Method.     ABSTRACT Cluster analysis is an analysis of the data classification based on information found in the data.The objective of cluster analysis is that the objects in the group have in common with each other, while the different objects have different groups. Cluster analysis is divided into two methods : the method of non-hierarchical and hierarchical methods.Hierarchical method is divided into two methods, namely agglomerative methods (concentration and divisive methods (deployment. The methods included in the agglomerative method is Single Linkage Method, Complete Linkage Method, Average Linkage Method, Ward 's Method, Method and Median Centroid Method. In this article discussed the agglomerative methods were applied to the data rate of air pollution. Each of these methods provides a different number of clusters.   Keywords: Cluster Analysis , Single Linkage Method, Complete Linkage Method, Average Linkage Method, Ward

  6. Pengaruh unsur Tembaga (Cu terhadap fluiditas paduan Al-Si 11.8 wt% (ADC 12 dengan metode Vacuum Suction Test

    Directory of Open Access Journals (Sweden)

    Bambang Suharno

    2012-11-01

    Full Text Available Al-Si 11.8 wt% alloy which classified to eutectic Al-Si composition usually used to produce a flat casting product with high pressure die casting process. Alloying element become an important things to determine behavior and characteristic of aluminum. Copper added into aluminum to improve strength and hardness, but there has no many studies on the effect of copper on fluidity. This fluidity study is using vacuum suction test method and the microstructure is observed with SEM/EDS. Spectrometer test has been used to find out chemical composition of sample. The result of this study shows that with copper addition from 2.25 wt% to 3.11 wt%, the fluidity value has increased 24.11% on 680oC pouring temperature. On 3.11 wt% copper composition, fluidity value has increased 14.38% from 640oC pouring temperature to 700oC pouring temperature.

  7. Kajian pendahuluan uji toksisitas ekstrak air miselia dan tubuh buah jamur shitake (Lentinus edodes) dengan metode brine shrimp lethality test (BTS)

    OpenAIRE

    Noor Erma NS; Tri Sundari; Arie Ika Susanty; Dwi Riani Octavia Palupi; Isnaeni Isnaeni; Sukardiman Sukardiman

    2012-01-01

    Shiitake mushroom (Lentinus edodes) is one of the wood mushroom types that can be consumed as a food as well as for a medicalpurpose. Lentinan, a polysaccharide contained in shiitake, is well known for its use on cancer medication. Mycelium of Shiitake mushroomcontains lentinan the same as other part of the mushroom like fruity body. Toxicity of the lentinan in mycelium compare to the fruitybody has been first conducted by using Brine Shrimp Lethality Test (BST). Using Potato Dextrose Broth m...

  8. Avaliação da inteligência com testes não-verbais em afásicos

    Directory of Open Access Journals (Sweden)

    Janete Simiema Ceschin

    1979-09-01

    Full Text Available Foram estudados 8 pacientes com quadro clínico de acidente vascular cerebral e afasia, internados logo após o ictus. Foram avaliados os aspectos clínico, neuropsiquiátrico, eletrencefalográfico e neuroradiológico. Os pacientes foram submetidos à avaliação psicológica e fonoaudiológica. Este trabalho correlaciona a lesão neurológica às alterações estruturais da inteligência, às alterações práxicas e estereognósicas e também aos distúrbios da linguagem. Para a classificação do nível intelectual foram usados os critérios da Organização Mundial da Saúde e a classificação genética de Jean Piaget. Este estudo mostra que a inteligência, medida pelo teste não-verbal de Leither, está melhor preservada em alguns tipos de afásicos.

  9. På sporet af innovation

    DEFF Research Database (Denmark)

    Strandgaard, Lone Bak

    organisationen blandt ledere og medarbejdere samt eksternt, uden for organisationen, hos dens kunder. Ph.d.-afhandlingen På sporet af innovation har som formål at bidrage til forståelse af, hvordan organisationers arbejde med digital selvbetjening kan fremmes, set i et innovationsteoretisk perspektiv. Foruden en...... indføring i innovationsteorien og dens udvikling belyser afhandlingens resultater hvordan at innovationspotentialet kan styrkes gennem organisatorisk åbenhed og samarbejde i alle dele af den innovative proces. Dette gælder ved både idéudvikling, realisering og spredning af nye digitale løsninger.......Flere og flere private og offentlige servicer digitaliseres, så kunder, borgere og virksomheder, i øget grad betjener sig selv. Digital selvbetjening kan potentielt effektivisere driften og skabe bedre kundeservice. Men processen har udfordringer, da den kan kræve omfattende omstilling internt i...

  10. Supervision af psykoterapi

    DEFF Research Database (Denmark)

    SUPERVISION AF PSYKOTERAPI indtager en central position i uddannelsen og udviklingen af psykoterapeuter. Trods flere lighedspunkter med psykoterapi, undervisning og konsultation er psykoterapisupervision et selvstændigt virksomhedsområde. Supervisor må foruden at være en trænet psykoterapeut kende...... supervisionens rammer og indplacering i forhold til organisation og samfund. En række kapitler drejer sig om supervisors opgaver, roller og kontrolfunktion, supervision set fra supervisandens perspektiv samt betragtninger over relationer og processer i supervision. Der drøftes fordele og ulemper ved de...... forskellige måder, hvorpå en sag kan fremlægges. Bogens første del afsluttes med refleksioner over de etiske aspekter ved psykoterapisupervision. Bogens anden del handler om de særlige forhold, der gør sig gældende ved supervision af en række specialiserede behandlingsformer eller af psykoterapi med bestemte...

  11. Effekten af absolut kumulation

    DEFF Research Database (Denmark)

    Kyvsgaard, Britta; Klement, Christian

    2012-01-01

    Som led i finansloven for 2011 blev regeringen og forligspartierne enige om at undersøge reglerne om strafudmåling ved samtidig pådømmelse af flere kriminelle forhold og i forbindelse hermed vurdere konsekvenserne af at ændre de gældende regler i forhold til kapacitetsbehovet i Kriminalforsorgens...... samlet bødesum ved en absolut kumulation i forhold til en modereret kumulation, som nu er gældende....

  12. Genlyden af et nej

    DEFF Research Database (Denmark)

    Östman, Lars

    2011-01-01

    Europa og den vestlige verden er ramt af en økonomisk krise. Det er en krise, der er anderledes, end den vi har været vant til fx fra 1980'erne.......Europa og den vestlige verden er ramt af en økonomisk krise. Det er en krise, der er anderledes, end den vi har været vant til fx fra 1980'erne....

  13. Evaluering af kollegial supervision

    DEFF Research Database (Denmark)

    Petersen, Anne Line Bjerre Folsgaard; Bager, Lene Tortzen; Jørgensen, Mette Eg

    2015-01-01

    Videoen er en evaluering af arbejdet med en metodisk tilgang til kollegial supervision på VIA Ergoterapeutuddannelsen gennem et par år. Evalueringen sætter fokus på selve metoden, der er anvendt til kollegial supervision. Derudover er der fokus på erfaringer og udbytte af at arbejde systematisk med...... kollegial supervision blandt undervisere på VIA Ergoterapeutuddannelsen....

  14. PENENTUAN UMUR SIMPAN MINUMAN FUNGSIONAL SARI AKAR ALANG – ALANG DENGAN METODE ACCELERATED SHELF LIFE TESTING (ASLT (Studi Kasus di UKM “R.ROVIT” Batu - Malang

    Directory of Open Access Journals (Sweden)

    Hesti Anagari

    2016-11-01

    Full Text Available This study aims to determine the shelf life of reed roots extracts beverages with Accelerated Shelf Life Testing (ASLT method based on Arrhenius model, the model equations to express the relationship of temperature on the level of product damage. Determining shelf life by using the Accelerated Shelf Life Testing (ASLT is done by speeding up the process of degradation or reaction in the experiment, namely raising the storage temperature on some level temperature above room temperature, thus speeding up analysis time shelf life. ASLT method used in determining the shelf-life reed roots extracts beverage using the parameter values of acidity (pH and color (brightness. reed roots extracts beverage stored for 35 days, at a temperature of 20oC, 30oC and 40oC. From the Arrhenius model calculations with values obtained Ea (activation energy for the parameters pH value of 9010.68 cal/mol, while the color parameters (brightness of 4110.16 cal/mol, then the parameters used as the basis for determining the shelf life of reed roots extracts beverage is a parameter that has the smallest activation energy value, ie parameter color value (brightness. Shelf life of reed roots extracts beverage estimated  for 44 days at 27oC and 41 days at 30oC.

  15. Studi Kompresi Data dengan Metode Arithmetic Coding

    OpenAIRE

    Santoso, Petrus

    2001-01-01

    In Bahasa Indonesia : Ada banyak sekali metode kompresi data yang ada saat ini. Sebagian besar metode tersebut bisa dikelompokkan ke dalam salah satu dari dua kelompok besar, statistical based dan dictionary based. Contoh dari dictionary based coding adalah Lempel Ziv Welch dan contoh dari statistical based coding adalah Huffman Coding dan Arithmetic Coding yang merupakan algoritma terbaru. Makalah ini mengulas prinsip-prinsip dari Arithmetic Coding serta keuntungan-keuntungannya dibandi...

  16. Kajian pendahuluan uji toksisitas ekstrak air miselia dan tubuh buah jamur shitake (Lentinus edodes dengan metode brine shrimp lethality test (BTS

    Directory of Open Access Journals (Sweden)

    Noor Erma NS

    2012-02-01

    Full Text Available Shiitake mushroom (Lentinus edodes is one of the wood mushroom types that can be consumed as a food as well as for a medicalpurpose. Lentinan, a polysaccharide contained in shiitake, is well known for its use on cancer medication. Mycelium of Shiitake mushroomcontains lentinan the same as other part of the mushroom like fruity body. Toxicity of the lentinan in mycelium compare to the fruitybody has been first conducted by using Brine Shrimp Lethality Test (BST. Using Potato Dextrose Broth media with the growth rate of3.88% did mycelium multiplications. Probit analysis showed that the toxicity of the mushroom’s cap, stem, and mycelium of Shiitakemushrooms is LC50 = 648.76507 mg/ml LC50 = 489.39444 mg/ml, and LC50 = 481.16941 mg/ml respectively.

  17. Streaming video - præsentation af trailere over internettet

    DEFF Research Database (Denmark)

    Jensen, Ole Riis; Forchhammer, Søren

    1998-01-01

    interaktiv tjeneste baseret på realtidsfremvisning af videotrailere, såkaldt streaming video og audio, og hvor brugeren kan få information om en film der tænkes udbudt på en pay-per-view kanal. Der i arbejdets forløb blevet opbygget en demo, der implementerer en sådan tjeneste.......Som et led i Tele Danmark Kabel TV's markedsføring ønsker man at kunne præsentere filmtrailere og andet materiale i form af levende billeder til kunderne via Wold Wide Web (WWW). Dette projekts hovedformål er at undersøge eksisterende metoder og udvikle redskaber til at præsentere en tilsvarende...

  18. PENGARUH ABDOMINAL MUSCLE STRENGTHENING DENGAN METODE PILATES

    Directory of Open Access Journals (Sweden)

    Bambang Trisnowiyanto

    2016-12-01

    Full Text Available Seseorang yang memiliki kebiasaan melakukan aktivitas pasif seperti duduk lama saat bekerja dapat meningkatkan resiko terjadinya muscle power imbalance pada otot-otot penyangga tubuh yang pada akhirnya mudah mengalami nyeri pada punggung bagian bawah, sehinga bila melakukan aktifitas atau pekerjaan yang melebihi kapasitas fisik yang dimiliki, akan mudah mengalami kelelahan dan bila dipaksakan dapat terjadi cedera, seperti terjadinya spasme atau kram pada otot perut. Peningkatan kekuatan otot perut, salah satunya dapat dicapai dengan latihan Pilates yang memiliki keunggulan memiliki fokus latihan yang bertujuan menguatkan otot-otot core stability diantaranya adalah otot perut. Tujuan: Untuk mengetahui pengaruh latihan Pilates terhadap peningkatan kekuatan otot perut. Subyek Penelitian Sebanyak 34 terdiri dari ibu-ibu rumah tangga dengan rentang usia antara 30–50 tahun. Metode Penelitian: Eksperimen dengan rancangan one group pre-post test with control dengan kriteria inklusi dan ekslusi. Bentuk latihan pilates yang dipilih adalah khusus gerakan yang ditujukan untuk latihan otot-otot perut sebanyak 16 gerakan, program latihan diberikan selama 2 bulan, dengan durasi selama 45 menit/sesi latihan, 2 kali/minggu. Pengukuran kekuatan otot perut menggunakan curl up test. Analisis Statistik: Uji beda pre-post test dengan Wilcoxon Test, didapatkan p=0,000 (p<0.05 dan uji beda pre-pre test dan post-post test dengan Mann-whitney U Test kedua kelompok p=0,849(p<0.05  dan post-post test kedua kelompok p=0,007 (p<0.05. Kesimpulan: Latihan Pilates berpengaruh terhadap peningkatan kekuatan otot perut.

  19. Karakteristik og vurdering af Time-Driven Activity-Based Costing på baggrund af ABC’s udvikling

    DEFF Research Database (Denmark)

    Israelsen, Poul; Kristensen, Thomas Borup

    2015-01-01

    Artiklen giver en beskrivelse af Activity Based Costings udvikling i fire varianter. Disse benyttes som grundlag for at karakterisere og vurdere de ændringer, som foretages i Time-Driven ABC (TDABC). Det konkluderes at TDABC i nogle tilfælde griber tilbage til omkostningskalkulation forud for ABC......’s tilblivelse (f.eks. homogene afdelinger i stedet for aktiviteter), i andre tilfælde til ABC’s oprindelse (f.eks. brug af transaktionsdrivere i stedet for mere sofistikerede drivere), og på andre områder til metoder uden for ABC’s normale anvendelse (f.eks. “standard variable costing”). Alt i alt argumenteres...

  20. RUMUSAN METODE DETEKSI PENCURIAN LISTRIK MEMANFAATKAN PERANGKAT WSN

    Directory of Open Access Journals (Sweden)

    A Sony

    2017-03-01

    Full Text Available Mendeteksi kasus pencurian listrik di Indonesia memerlukan usaha dan biaya yang besar. PLN saat ini masih menggunakan metode lama dalam mendeteksi kasus pencurian yaitu dengan memeriksa pola tagihan listrik yang didapatkan dari pencatatan secara manual oleh petugas. Penelitian ini mengajukan suatu metode deteksi pencurian listrik dengan memanfaatkan perangkat WSN yang dipasangkan dimeteran pelanggan untuk memonitor jumlah pemakaian listrik. Logika pendeteksian adalah dengan membandingkan data konsumsi pada pelanggan dengan data jumlah listrik yang disalurkan oleh gardu penyalur pada suatu cakupan wilayah. Hasil penelitian berupa simulasi dengan bantuan perangkat lunak Excel, hasil simulasi menunjukkan keefektifan penggunaan metode yang diajukan dengan tingkat akurasi yang tinggi.Detecting theft electricity in Indonesia require enormous amount of efforts and money. PLN until these days still using the old school method to detect this case by checking the pattren of customers electricity bills manualy by the PLN employee. Purposed method in this research is to detect leak of electricity by spreading WSN devices inside each customers meteran to monitor total power consumtion. Logic of the method is compare sum of power consumtion in a testing area with amount of electricity flow in that area by monitor the gardu penyalur conductor. Result of this research is excel simulation, simulation outcome shows that using the purposed to decided system status is effective in the system operational with high accuracy with the actual condition.        

  1. Numerisk modellering af formfyldning ved støbning i selvkompakterende beton

    DEFF Research Database (Denmark)

    Spangenberg, Jon

    dækker over mange emner. I denne afhandling er der fokuseret på tre af dem ved hjælp af Finite Difference Method (FDM) / Finite Volume Method (FVM) baserede Computational Fluid Dynamics (CFD) modeller udviklet i både FLOW-3D og MATLAB. Den første undersøgelse fokuserer på de komplikationer der er knyttet...... til at forudse separation under fyldning i SKB støbninger. De to FDM/FVM baserede CFD modeller afviger fra hinanden via deres tilslags repræsentation, som var en diskret metode (envejs momentum kobling) for den første og en skalar metode for den anden. Det viste sig, at det var mindst omfattende...

  2. Pengaruh Suhu dan Metode Perlakuan Panas terhadap Sifat Fisika dan Kualitas Finishing Kayu Mahoni

    Directory of Open Access Journals (Sweden)

    Ragil Widyorini

    2016-03-01

    Full Text Available Perlakuan panas dikenal sebagai metode yang dapat digunakan untuk meningkatkan stabilitas dimensi dan menurunkan higroskopisitas. Di sisi lain, perlakuan panas dapat membuat warna kayu menjadi lebih gelap, penurunan sifat mekanika kayu, dan sifat wetabilitas kayu. Oleh karena itu, penelitian mengenai perlakuan panas pada kondisi yang optimum sangat menarik untuk dilakukan agar menghasilkan kayu dengan kualitas yang lebih baik. Tujuan penelitian ini adalah mengetahui pengaruh interaksi suhu dan metode perlakuan panas terhadap sifat fisika dan kualitas finishing kayu mahoni. Contoh uji perlakuan dibuat dari kayu mahoni yang berasal dari industri penggergajian kayu rakyat. Penelitian ini menggunakan 2 metode perlakuan panas yaitu metode oven dan penguapan (steaming pada variasi suhu 90°C, 120°C, dan 150°C selama 2 jam waktu efektif. Pengujian sifat fisika diuji berdasarkan standar ASTM, yang meliputi : kadar air seimbang, perubahan dimensi, perubahan warna, dan wetabilitas. Pengujian finishing meliputi cross cut test, uji delaminasi, dan uji kekilapan (glossy test. Hasil penelitian menunjukkan bahwa interaksi antara suhu dan metode perlakuan panas berpengaruh sangat nyata terhadap perubahan warna, serta berpengaruh nyata terhadap penyusutan radial, cross cut test, dan uji delaminasi. Metode oven menghasilkan contoh uji dengan kadar air dan pengembangan radial yang lebih rendah, warna yang lebih terang, serta uji delaminasi yang lebih baik dibandingkan dengan metode penguapan. Kata kunci: perlakuan panas, metode oven, metode penguapan, suhu, finishing   Effect of temperature and heat treatment on physical properties and finishing quality of mahagony wood Abstract Heat treatment is well known as a method for increasing dimensional stability and reducing hygroscopicity of wood. However, heat tratment can cause the color of wood become darker and reduce the wettability, as well as its mechanical properties. Therefore, the optimum condition of heat

  3. Soja og palmeolie – certificeringsordninger til dokumentation af bæredygtighed i forbindelse med produktion

    DEFF Research Database (Denmark)

    Hermansen, John Erik; Knudsen, Marie Trydeman; Sørensen, Janni Merete

    Danmark importerer betydelige mængder soja og palmeolieprodukter, der er produceret under vilkår, der ikke er godkendt i EU, og som kan have væsentlige negative konsekvenser for landbefolkningens sundhed samt miljø- og naturforhold. I nærværende rapport fra DCA – Nationalt Center for Fødevarer og...... Jordbrug, Aarhus Universitet, der er udarbejdet på anmodning fra Fødevareministeriet, gennemgås foreliggende dokumentation om produktionsforholdene samt aspekter vedrørende certificering af forbedrede metoder i forbindelse med produktion af soya og palmeolie...

  4. Anvendeligheden af GIS

    DEFF Research Database (Denmark)

    Winstrup, Mie; Levin, Gregor

    2011-01-01

    Fragmentering af naturen er en trussel mod biodiversiteten, og etablering af økologiske forbindelser/korridorer mellem naturområderne er én måde hvorved nedgangen i biodiversitet kan stoppes. Med Næstved Kommune som case-område har jeg undersøgt, hvordan analyser i GIS kan bruges til at udvælge...... omdannet til reelle korridorer, hvor bredden afhænger af arealdækket som forbindelserne krydser. I implementerings øjemed er det anvendeligt at vide om nogle forbindelser er særlig vigtige for at skabe mere sammenhængende natur. GIS er anvendeligt hertil, idet GIS kan bruges til at bestemme den enkelte...

  5. Videoanalyse af social interaktion

    DEFF Research Database (Denmark)

    Igennem de sidste 40 år er videooptagelser af praksis blevet anvendt som et redskab i forskning af social interaktion inden for f.eks. læring, design, mediering, kommunikationstræning og i sundhedsvæsenet. Videoanalyse af social interaktion giver et stærkt metodisk, teoretisk og praktisk blik ind i...... videoanalyse og viser, hvordan man som forsker og studerende kan bruge videoanalyse til at undersøge social interaktion. Bogens temaer og spørgsmål udgør således en grundsten i arbejdet med videoanalyse på professions-, universitets- og forskeruddannelser såvel som i forskning mere generelt og omfatter: - de...

  6. Realisering af Vision 2020

    DEFF Research Database (Denmark)

    Bertelsen, Niels Haldor; Hansen, Ernst Jan de Place

    Repræsentanter for byggesektoren har på 11 dialogmøder drøftet Erhvervs- og Byggestyrelsens "Vision 2020 - Byggeri med mening". Drøftelserne førte til formulering af en lang række initiativforslag til realisering af visionen. Den mest centrale udfordring bliver at reducere fejl og mangler i...... byggeriet. Branchen lægger også vægt på, at styringen af Vision 2020s reaisering sker i byggesektoren. Initiativforslagene er i rapporten samlet under 3 hovedområder. Det første hovedområde lægger vægt på bygningerne, brugerbehov og det globale samfund. Det andet omhandler processen og leverancesystemet...

  7. Identifikasi Boraks dalam Bakso di Kelurahan Bahagia Bekasi Utara Jawa Barat dengan Metode Analisa Kualitatif

    OpenAIRE

    Mega Efrilia; Tria Prayoga; Nur Mekasari

    2016-01-01

    Already a research identification of boraks in meatball a sell is Kelurahan Bahagia, Nort Bekasi East Java. A research as a purpose for identification boraks in meatball with a metode analysis kualitatif that is a burn of fire a testing colour with a turmeric paper with ake use AgNO3, and BaCl2. Sampel in take by metode random sampel plainin meatball a sell a is Kelurahan Bahagia Nort Bekasi. On a test result, the testing in apprearance meatball of in point negatif contain boraks because meat...

  8. Centralisering af FM organisationer

    DEFF Research Database (Denmark)

    Nielsen, Susanne Balslev

    2016-01-01

    Centralisering af FM organisationer kan let føre til mange frustrerende arbejds- dage for medarbejdere og deres ledere. Denne artikel giver et bud på hvad kom- muner og andre kan gøre for at komme bedre igennem en omorganisering.......Centralisering af FM organisationer kan let føre til mange frustrerende arbejds- dage for medarbejdere og deres ledere. Denne artikel giver et bud på hvad kom- muner og andre kan gøre for at komme bedre igennem en omorganisering....

  9. Kuratering af Samtidskunst

    DEFF Research Database (Denmark)

    Kuratering af Samtidskunst er den første bogudgivelse i Danmark, der fokuserer på kuratering som fag og praksis. Kuratering spiller en stadig større rolle i samtidskunsten. Bogen er en introduktion til skiftende forståelser af udstillings- og kuratorpraksisser og deres udfordringer, indkredset ge...... Kofod Olsen, Teresa Gleadowe, Helle Ryberg, Kirse Junge-Stevnsborg, Malene Natascha Ratcliffe, Pelin Uran, Jacob Fabricius, Lotte Juul Petersen, Jacob Lillemose, Solvej Helweg Ovesen, Frederikke Hansen & Tone Olaf Nielsen (kuratorisk aktion) og Temporary Services....

  10. Penentuan Rute Patroli Sekuriti Optimal Dengan Menggunakan Metode Nearest Neighbour Dan Insertion (Studi Kasus : South Processing Unit PT. X

    Directory of Open Access Journals (Sweden)

    Fuaddillah Fuaddillah

    2017-03-01

    Full Text Available South Processing Unit (SPU merupakan salah satu lapangan migas di PT. X dengan estimasi harian produksi gas sekitar 450 gas (MMscf/d dan 5000 kondensat (BOPD. Gas dan kondesat yang terpisah dari masing-masing sumur produksi akan dikumpulkan ke dalam satu stasiun pengumpul yang disebut Gathering and Testing Satellite (GTS. Karena statusnya sebagai objek vital nasional, melakukan patroli sekuriti di laut antara GTS yang satu dengan GTS lainnya wajib dilakukan. Proses patroli sekuriti dengan seatruck pada kawasan SPU PT. X masih menggunakan intuisi dari supir seatruck dimana rute yang dipilih adalah rute yang dirasa lebih dekat, lebih nyaman dilalui, dan lebih familiar dengan pengetahuan supir sendiri sehingga menghasilkan total jarak tempuh yang lebih jauh. Penelitian ini bertujuan untuk menerapkan dan membandingkan metode intuitif yang dilakukan oleh supir seatruck dengan metode nearest neighbour dan metode insertion dalam permasalahan penentuan rute patroli sekuriti yang optimal di PT. X pada lokasi SPU. Hasil penelitian menunjukkan bahwa total jarak tempuh dengan menggunakan metode intuitif yang telah diterapkan oleh supir seatruck adalah 72,76 km. Sedangkan, total jarak tempuh yang didapatkan dari menggunakan metode nearest neighbour yaitu 67,67 km dengan persentase penghematan jarak sebesar 6,9%. Dengan metode insertion, didapatkan total jarak tempuh sebesar 61,40 km, dengan persentase penghematan jarak sebesar 15,6% dibandingkan dengan metode intuitif supir seatruck.

  11. PEMERIKSAAN BAKTERI LEPTOSPIRA PADA SAMPEL DARAH MANUSIA SUSPECT LEPTOSPIROSIS MENGGUNAKAN METODE PCR (POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Sefrita Tri Utami

    2014-01-01

    Full Text Available ABSTRACTLeptospirosis is a zoonotic disease, which is caused by leptospira. Leptospirosis cases often show no specificclinical symptoms and is difficult to diagnose without testing samples in the laboratory. Testing using PCR(Polymerase Chain Reaction is considered more accurate than the other methods. Components required in theexamination Leptospira bacteria in human blood samples using PCR method is DNA template, DNA polymeraseenzyme, forward primer (PU1 and SU1 and reverse primer (Lep R1, nuclease free water, Mg 2 +, and dNTPs.Examination of Leptospira bacteria in human blood samples include sampling, DNA isolation, examination byPCR, and electrophoresis running.Key words: leptospirosis, Leptospira, PCR methodsABSTRAKLeptospirosis adalah penyakit zoonosis yang disebabkan oleh bakteri Leptospira. Kasus leptospirosis seringtidak menunjukkan gejala klinis yang spesifik dan sulit didiagnosis tanpa pengujian sampel di laboratorium.Pengujian dengan menggunakan metode PCR (Polymerase Chain Reaction dinilai lebih akurat dibandingkandengan metode yang lain. Komponen-komponen yang dibutuhkan dalam pemeriksaan bakteri Leptospira padasampel darah manusia menggunakan metode PCR adalah DNA template, enzim polymerase, Primer PU 1 danPrimer SU 1, Primer Lep R1, air, Mg2+ , dan dNTP. Pemeriksaan bakteri Leptospira pada sampel darah manusiameliputi pengambilan sampel, isolasi DNA, pemeriksaan dengan metode PCR, dan running elektroforesis.Kata kunci: leptospirosis, Leptospira, metode PCR

  12. Evaluering af naturfaglige kompetencer

    DEFF Research Database (Denmark)

    Dolin, Jens; Nielsen, Jan Alexis; Tidemand, Sofie

    2017-01-01

    Artiklen skitserer kort de sidste 40-50 års udvikling i naturfagene op til det nuværende fokus på undersøgelsesbaseret undervisning og udvikling af kompetencer. Den påpeger hvorledes mange traditionelle evalueringsformer, især brugt ved eksamen, ikke er i stand til at indfange de ønskede kompeten...

  13. Opfindelsen af naturen

    DEFF Research Database (Denmark)

    Thomsen, Torsten Bøgh

    2016-01-01

    Kritisk omtale og kontekstualisering af Andrea Wulfs, "The Invention of Nature: Alexander von Humboldt’s New World". Der er en direkte forbindelse imellem oplysningstidens naturforståelse og den nuværende klimakrisevirkelighed. Alexander von Humboldt opfandt ikke bare naturen, han påpegede også det...

  14. Digitalisering af undervisning

    DEFF Research Database (Denmark)

    Christiansen, René B.; Hansen, Søren; Rossen, Svend

    2010-01-01

    Rapporten er et bestillingsarbejde fra FU (Forskning og Udvikling) og viser en række eksempler på hvorledes undervisningsforløb kan konstrueres online. Herunder ved brug af både LMS-systemer og web 2.0-værktøjer...

  15. Definition af et landdistrikt

    DEFF Research Database (Denmark)

    Søgaard, Villy

    2008-01-01

    Forskellige lande arbejder med meget forskellige definitioner af begrebet landdistrikt. Arbejdspapiret diskuterer først en række generelle krav til definitioner og anbefaler på den baggrund konkrete justeringer i forhold til den hidtidige danske praksis på området. Arbejdspapiret er blevet til i...

  16. En verden af medier

    DEFF Research Database (Denmark)

    Hjarvard, Stig

    selvstændig institution, der forvalter samfundets fælles kommunikation, sætter de spillereglerne for andre aktører, og de er samtidig en selvfølgelig del af hverdagslivets kommunikation mellem familie, venner og kolleger. I samspillet mellem de gamle massemedier og nye interaktive medier opstår forandringer...

  17. Anmeldelse af: Gruppepsykologi

    DEFF Research Database (Denmark)

    Christensen, Bodil

    2009-01-01

    , kreativitet og nytænkning. Det er her, videnskabens virkelige fremskridt sker.” Sådan lyder et citat af Albert Einstein, som Lars Svedberg bruger for at sætte sin faglige fremstilling om gruppepsykologi i perspektiv. Gruppeorganisationen er nemlig ofte rum for/ eller kan være rum for denne synergieffekt, der...

  18. En skygge af modernitet

    DEFF Research Database (Denmark)

    Skov, Christian Egander

    2015-01-01

    Artiklen vil kort skitsere forskellige, samtidige konservative reaktioner på teknikken, hvis destruktive potentiale var blevet åbenbart i og med Første Verdenskrig, og derefter gennem en læsning af Drachmanns politiske og skønlitterære forfatterskab identificere nøgleelementer og begreber i Drach...

  19. Konsekvensanalyse af Kulturby 96

    DEFF Research Database (Denmark)

    Fridberg, Torben; Koch-Nielsen, Inger

    1997-01-01

    Rapporten om Kulturby 96 indeholder en beskrivelse af kulturbyårets aktiviteter og responsen herpå fra publikum, turister, presse og samarbejdspartnere i øvrigt. Der redegøres for projektets organisatoriske struktur, herunder Kulturbysekretariatets organisation og rolle. Rapporten indeholder...

  20. På kanten af ungdomslivet

    DEFF Research Database (Denmark)

    Sørensen, Niels Ulrik; Pless, Mette

    2015-01-01

    ). Parallelt hermed fortælles moderne ungdomsliv (i ungdomssociologien) frem gennem ”…theoretical frameworks based on urban experiences which capture neither the lives of rural young people nor the spatial dimensions of the structures and cultures that make up contemporary youth.” (Farrugia 2013......, at yderområder er hårdt ramt af ungdomsarbejdsløshed (Bjørnsted & Andersen 2013), at områderne er præget af høj koncentration af unge med arbejderklassebaggrund (Ottosen et a 2010), mens de uddannelsesorienterede og ressourcestærke unge er tilbøjelige til at flytte væk og ind til byerne (Helve 2003). Og ser man...... stedstilknytning og stedbundne ressourcer. Teoretiske perspektiver, der peger på vigtigheden af en mere ”..spatialised youth sociology that is sensitive to macro-level processes producing different spaces, as well as the local, emplaced ways in which young people are responding to social changest hat shape...

  1. Boligboblen pustes op af bankerne

    DEFF Research Database (Denmark)

    Ravn, Ib

    2017-01-01

    Den aktuelle boligboble blæses i vejret af bankerne, der gennem opkøb af realkreditobligationer skaber nye penge og dermed presser boligpriserne i vejret - en kreditfinansieret bolig- eller finansboble....

  2. Pendugaan Struktur Patahan Dengan Metode Gaya Berat

    Directory of Open Access Journals (Sweden)

    Ibrahim Sota

    2011-12-01

    Full Text Available Telah dilakukan penelitian tentang pendugaan struktur patahan mengguankan metode gayaberat. Kontras densitas tersebut berasosiasi dengan ketebalan sedimen dan keberadaan struktur patahan atau lipatan. Untuk mengetahui lokasi patahan dan lipatan maka anomali residual terlebih dahulu dipisahkan dari anomali total (anomali Bouguer dengan metode perata-rataan bergerak. Kontur anomali residual memperlihatkan keberadaan lipatan dan patahan secara kualitatif sedangkan interpretasi kuantitatif dengan pemodelan kedepan 2D memperlihatkan secara jelas lokasi patahan. Dari hasil penelitian diperoleh bahwa lokasi patahan/sesar naik berada di bagian timurlaut yang berorientasi baratlaut-tenggara sedangkan patahan/sesar normal tersebar secara lokal yang juga berorientasi baratlaut-tenggara.

  3. METODE FUTURE PACING HYPNOTHERAPY UNTUK MENURUNKAN TINGKAT KECEMASAN PADA MAHASISWA BARU

    Directory of Open Access Journals (Sweden)

    Zahro Varisna Rohmadani

    2017-09-01

    Full Text Available Penelitian ini bertujuan untuk mengetahui efektivitas metode future pacing hypnotherapy dalam menurunkan tingkat kecemasan pada mahasiswa baru. Subjek penelitian adalah 20 mahasiswa/i baru, 10 mahasiswa di kelompok eksperimen dan 10 mahasiswa di kelompok kontrol. Peserta mendapatkan penanganan untuk penurunan kecemasan dengan metode berupa future pacing hypnotherapy. Metode analisis data yang digunakan adalah statistik nonparametrik teknik Wilcoxon Signed Rank Test untuk menguji perbedaan skor cemas kelompok subjek saat pretest dan posttest serta Mann Whitney U untuk melihat perbedaan penurunan kecemasan pada kelompok eksperimen dan kelompok kontrol. Hasil Wilcoxon Signed Rank Test menunjukkan bahwa future pacing hypnotherapy efektif dalam menurunkan kecemasan dengan p=0,012. Sedangkan hasil Mann Whitney U menunjukkan bahwa future pacing hypnotherapy efektif dalam menurunkan kecemasan dengan p=0,003 dan kelompok eksperimen mengalami penurunan kecemasan yang lebih besar dengan mean rank = 14,25.Kata kunci : future pacing hypnotherapy, kecemasan, mahasiswa baru

  4. Dannelsen af den ansvarlige elev

    DEFF Research Database (Denmark)

    Larsen, Jesper

    2010-01-01

    Denne artikel handler om den del af lærergerningen, der har at gøre med udarbejdelse af elevplaner. Der tages udgangspunkt i en foucaultsk forståelse, hvor beskrivelsen af den enkelte elev udtrykker et særligt normativt ideal om, hvilke former for elevhed der er de ønskværdige i den danske...

  5. Udlejers godkendelse af ny erhvervslejer

    DEFF Research Database (Denmark)

    Munk-Hansen, Carsten

    2009-01-01

    I artiklen er taget udgangspunkt i den »klassiske« afståelsessituation, hvor en lejer vil afhænde den i de lejede lokaler drevne virksomhed, og lejeren har afståelsesret til en af udlejer godkendt lejer, uden at kravene til den ny lejer er specificeret. På baggrund af Vestre Landsrets dom af 9/2 ...

  6. Anmeldelse af Evolution, Literature and Film

    DEFF Research Database (Denmark)

    Grodal, Torben Kragh

    2011-01-01

    Diskussion af basisproblemer i evolutionær fiktionsteori med udgangspunkt i en anmeldelse af Evolution, Literature and Film......Diskussion af basisproblemer i evolutionær fiktionsteori med udgangspunkt i en anmeldelse af Evolution, Literature and Film...

  7. En genlæsning af John Rawls i lyset af hans diskussion af forholdet til fremtidige generationer

    DEFF Research Database (Denmark)

    Lübcke, Poul

    2009-01-01

    På grundlag af en konsekventialistisk rekonstruktion af Rawls' politiske position gøres der rede for Rawls eksplicitte og implicitte vurdering af vores ansvar over for fremtidige generationer......På grundlag af en konsekventialistisk rekonstruktion af Rawls' politiske position gøres der rede for Rawls eksplicitte og implicitte vurdering af vores ansvar over for fremtidige generationer...

  8. Metodologi Penelitian dalam Kajian Islam (Suatu Upaya Iktisyaf Metode-Metode Muslim Klasik

    Directory of Open Access Journals (Sweden)

    Duski Ibrahim

    2016-03-01

    Full Text Available Makalah ini mengkaji tentang metode-metode penelitian dalam kajian-kajian Islam. Hal ini berlandaskan bahwa Islam tidaklah meletakan ilmu itu dalam kerangka dikotomis. Yang membedakannya adalah nilai-nilai manfaat dan maslahat. Munculnya pemikiran yang diklaim sebagai paham dikotomis ilmu agamawi dan duniawi, secara historis, tampaknya salah satu konsekuensi dari era disintegrasi. Kelanjutannya, muncul statemen bahwa ilmu yang agamawi (ilmu-ilmu agama harus mendapat perhatian yang lebih ketimbang ilmu yang duniawi (ilmu-ilmu dunia. Kemudian, pahala ilmu agamawi dipandang lebih banyak dibanding ilmu-ilmu duniawi. Statemen dan pandangan semacam ini tentu saja tidak memiliki dasar pijakan atau dalil yang jelas. Sedangkan metode-metode penelitian dalam kajian-kajian Islam ada empat macam, yakni: metode bayani, metode burhani, metode tajribi, metode ‘irfani. This paper examined about the methods of research in Islamic studies. It was based on that Islam did not put science in a dichotomous framework. What distinguished it was the benefit values and benefit. The emergence of thought which was claimed as a dichotomous understanding of the science of religious and secular, historically, it seemed one of the consequences of the era of disintegration. The sequel, appear statement that the science of religion (religious sciences should receive more attention than the secular science (science world. Then, the reward of religion science was seen more than secular sciences. Such statements and views certainly did not have a foundation or a clear proposition. While the methods of research in Islamic studies there were four kinds, namely: bayani method, the method Burhani, tajriibi method, the method of 'Irfani.

  9. Karakterisasi Serbuk Hasil Produksi Menggunakan Metode Atomisasi

    Directory of Open Access Journals (Sweden)

    M. Halim Asiri

    2015-07-01

    Full Text Available Abstrak : Metalurgi serbuk (powder metallurgy,yaitu merupakan teknologi produksi logam dengan bahan dasar Aluminum dengan unsur lain Ti,Mn,Mg,Si,sebagai unsur penguat sebelum diproses pencairan terlebidahulu melakukan pengujian sifat mekanik antara lain uji struktur makro dan mikro kemudianuji kekerasan (hardness tes, uji kekuatan (tensile strength. Setelah selesai diadakan pengujian sifat-sifat mekanik terhadap logam dasar, maka proses selanjutnya mencairkan logam dasar denganmelalui dapur peleburan (fornaices dengan temperature panas sekitar 1200 s/d 1350? dan titik cair logam aluminum 650?. Setelah mencair kemudian di holding time selama 20 menit selanjutnya pembuatan proses granulasi (pembutiran dengan menggunakan sistim Atomisasi Air (water atomization dengan menggunakan variasi tekanan penyemprotan sebesar 20 s/d 25 Psi, dengan debit 4 l/s,variasi waktu yg digunakan 6 s/d 8 detik. Hasil dari proses sistim metode Atomisasi ini kita dapatkan macam-macam karakteristik bentuk butiran mulai dari Mesh 8 (2360????m,mesh 16 (1180????m, mesh 30(600????m, mesh 50(300????????,mesh 100 (150????m,mesh 200 (75????m. Untuk mengetahui data-data ini melalui pengamatan dengan menggunakan mikroskop makro dan mikro.Selanjutnya bisa juga melakukan pengujian dengan menggunakan alat uji SEM dan X – Ray (XRD.Kata kunci: uji sifat – sifat mekanik, sifat bahan, komposisi kimia dan porositas (civitis Abstract : Powder metallurgy (powder metallurgy, which is a production technology with basic materialsAluminum metal with other elements Ti, Mn, Mg, Si, as a reinforcement agent before beingprocessed casting prior testing of mechanical properties among others, macro and micro structuraltest then hardness test, test of strength. After completion of the testing of mechanical properties ofthe base metal, then the next process with the base metal melt through the furnace with atemperature of about 1200 s / d in 1350 and the melting point of aluminum is 650C. After melt

  10. RODZAJE METOD SEKWESTRACJI CO2

    Directory of Open Access Journals (Sweden)

    Zofia LUBAŃSKA

    Full Text Available Z pojęciem ochrony środowiska wiąże się bardzo szeroko w ostatnim czasie omawiane zagadnienie dotyczące ograniczenia emisji CO2. Konsekwencją globalnych zmian klimatu wywołanego przez ludzi jest wzrost stężenia atmosferycznego gazów cieplarnianych, które powodują nasilający się efekt cieplarniany. Wzrasta na świecie liczba ludności, a co za tym idzie wzrasta konsumpcja na jednego mieszkańca, szczególnie w krajach szeroko rozwiniętych gospodarczo. Protokół z Kioto ściśle określa działania jakie należy podjąć w celu zmniejszenia stężenia dwutlenku węgla w atmosferze. Pomimo maksymalnej optymalizacji procesu spalania paliw kopalnianych wykorzystywanych do produkcji energii, zastosowania odnawialnych źródeł energii zmiana klimatu jest nieunikniona i konsekwentnie będzie postępować przez kolejne dekady. Prognozuje się, że duże znaczenie odegra nowoczesna technologia, która ma za zadanie wychwycenie CO2 a następnie składowanie go w odpowiednio wybranych formacjach geologicznych (CCS- Carbon Capture and Storage. Eksperci są zgodni, że ta technologia w niedalekiej przyszłości stanie się rozwiązaniem pozwalającym ograniczyć ogromną ilość emisji CO2 pochodzącą z procesów wytwarzania energii z paliw kopalnych. Z analiz Raportu IPCC wynika, iż technologia CSS może się przyczynić do ok. 20% redukcji emisji dwutlenku węgla przewidzianej do 2050 roku [3]. Zastosowanie jej napotyka na wiele barier, nie tylko technologicznych i ekonomicznych, ale także społecznych. Inną metodą dającą ujemne źródło emisji CO2 jest możliwość wykorzystania obszarów leśnych o odpowiedniej strukturze drzewostanu. Środkiem do tego celu, oprócz ograniczenia zużycia emisjogennych paliw kopalnych (przy zachowaniu zasad zrównoważonego rozwoju może być intensyfikacja zalesień. Zwiększanie lesistości i prawidłowa gospodarka leśna należy do najbardziej efektywnych sposobów kompensowania

  11. På sporet af sprogpsykologi

    DEFF Research Database (Denmark)

    2005-01-01

    Sprogpsykologi beskæftiger sig med, hvordan sprog og mennesker hænger sammen, og hvilke følger sammenhængen får for vore forståelser af verden og os selv. Denne antologi henvender sig til den sproginteresserede, der ønsker at gå et lag dybere end sprogets grammatiske sider. Sprog er ikke kun et l...

  12. Tilbagebetaling af sociale ydelser

    DEFF Research Database (Denmark)

    Hielmcrone, Nina Elisabeth von

    konstateres, at der foreligger fejl og forsømmelser hos både modtager og myndighed. Dermed stilles der også spørgsmålstegn ved de såkaldt "objektive" tilbagebetalingsbestemmelser som f.x. i boligstøttelovens § 47 stk. 1 og 2.       Bogen behandler desuden de mange og vanskelige fortolkningsproblemer, der...... knytter sig til anvendelsen af tilbagebetalingsbestemmelserne i de sociale love....

  13. Hvordan integration af it?

    DEFF Research Database (Denmark)

    Toft, Herdis

    2008-01-01

    Fokus i artiklen er den måde, hvorpå børn positionerer sig på i skolerummet, og på, hvordan børn gennem brug af it opbygger og integrerer digital kompetence forstået som færdigheder, kundskaber og holdninger, der skal sætte dem i stand til at agere i det lærende samfund. Med udgangspunkt i et Bou...

  14. Desain Sistem Semantic Data Warehouse dengan Metode Ontology dan Rule Based untuk Mengolah Data Akademik Universitas XYZ di Bali

    Directory of Open Access Journals (Sweden)

    Made Pradnyana Ambara

    2016-06-01

    Full Text Available Data warehouse pada umumnya yang sering dikenal data warehouse tradisional mempunyai beberapa kelemahan yang mengakibatkan kualitas data yang dihasilkan tidak spesifik dan efektif. Sistem semantic data warehouse merupakan solusi untuk menangani permasalahan pada data warehouse tradisional dengan kelebihan antara lain: manajeman kualitas data yang spesifik dengan format data seragam untuk mendukung laporan OLAP yang baik, dan performance pencarian informasi yang lebih efektif dengan kata kunci bahasa alami. Pemodelan sistem semantic data warehouse menggunakan metode ontology menghasilkan model resource description framework schema (RDFS logic yang akan ditransformasikan menjadi snowflake schema. Laporan akademik yang dibutuhkan dihasilkan melalui metode nine step Kimball dan pencarian semantic menggunakan metode rule based. Pengujian dilakukan menggunakan dua metode uji yaitu pengujian dengan black box testing dan angket kuesioner cheklist. Dari hasil penelitian ini dapat disimpulkan bahwa sistem semantic data warehouse dapat membantu proses pengolahan data akademik yang menghasilkan laporan yang berkualitas untuk mendukung proses pengambilan keputusan.

  15. Innovation af innovation

    DEFF Research Database (Denmark)

    Harste, Gorm

    2009-01-01

    , at innovation af innovationen forsøges gennemført på en måde, hvor tiden kræves at forholde sig til sin egen tidslighed i form af fremtid, nutid, fortid og ikke mindst i form af samtidighed. I tiden skal vi iagttage, hvordan vi iagttager tiden. Vi dobbelt-koder tiden på samme måde, som forskning forsker i...... organisationssystemerne. De to typer systemer kan noget helt bestemt med fænomenet tid. De kan synkronisere. Analyseres organisationssystemer ser vi, imidlertid at innovation kræver ro. Stærkt innovative systemer er militærsystemet og kunstsystemet, der også inddrages, og hvor vi ser paradokset mellem innovation og...... involution. Tid er med et medium og ikke et lufttomt rum. Tid er end ikke en gasart, men udgør et solidt fluidum, som samfundet bader i og flyder i, konstant i bevægelse. Reformer forudsætter former, og innovation forudsætter involution. Kun sådan muliggøres evolution....

  16. Undersøgelse af mulighederne for anvendelse af open source Integrated Library Systems (ILS) i universitetsbiblioteket

    DEFF Research Database (Denmark)

    Greve, Eli; Bøgh Pedersen, Kasper

    Dette projekt har til formål, at to biblioteker med meget forskellige profiler gennemfører test af konkrete open source baserede ILS systemer, formidler resultaterne til FFU-bibliotekerne og deres interessenter, og herved bidrager til en nuancering af beslutningsprocesserne i de kommende år omkring...

  17. Development and testing of mini heat pump for low-energy houses. Final report; Udvikling og test af minivarmepumpe til lavenergihuse. Slutrapport

    Energy Technology Data Exchange (ETDEWEB)

    Pedersen, Per Henrik; Madsen, Claus; Frederiksen, Klaus; Andreasen, Marcin Blazniak (Teknologisk Institut, Koele- og Varmepumpeteknik, Taastrup (Denmark))

    2010-11-15

    New residential houses are better insulated, and this reduces the need for heat during the winter period. In addition to this many new houses have floor heating systems. This combination is favourable for small heat pumps which can produce heat to central water systems with low water temperatures in the area 25 to 35 C. 4 prototypes of mini heat pumps of the brine/water type was build and tested in the refrigeration laboratory at the Danish Technological Institute (DTI). The prototypes are using a variable speed compressor (Danfoss SLV12) which originally is developed for plug-in supermarket cabinets. The heating capacity of the prototypes can vary between 1.0 and 2.1 kW. The refrigerant charge is 150 grams of R290 (propane). Two prototypes are charged with 375 grams of R134a. Tests were conducted following EN14511 at 0/+35 C and COP was measured to between 3.2 and 3.6 depending of the compressor speed and the type of plate heat exchangers used. This is quite good for such small machines. One of the prototypes was installed in the Energy Flex House which is a new highly insulated test house build at the DTI. The house was equipped with two heat pumps: 1. An exhaust air heat pump taking energy from exhaust air and producing hot tap water and heating the intake air; 2. A mini heat pump for floor heating taking energy from ground source outside the house. A family with four persons lives in the house. During the cold winter 2009/2010 the mini heat pump showed good performance and the COP varies between 2.0 and 4.0. The lower value was caused by a fault in the floor heating hoses, which made it necessary to increase the temperature of the central heating water, which decreased the efficiency of the heat pump during the coldest winter period. The floor heating system has been repaired, and a new prototype heat pump with a slightly bigger compressor has been installed for the heating season 2010/2011. A heat pump manufacturer is now producing this combination of exhaust

  18. Dannelse som basis for udvikling af moderne matematikundervisning

    Directory of Open Access Journals (Sweden)

    Julie Marie Isager

    2013-09-01

    Full Text Available I denne artikel omtales ambitionerne, opbygningen og resultaterne af et nyt pædagogisk projekt om forbedring af undervisningen i matematik for førsteårsstuderende på Økonomisk Institut ved Københavns Universitet. Initiativet er siden efteråret 2007 blevet udbygget og har hentet væsentlige elementer fra klassisk Kant-Humboldtsk dannelsesteori og moderne universitetspædagogik. Efter at initiativet er iværksat, har de studerende ændret studieadfærd: De er blevet mere aktive og engagerede, og eksamensresultaterne er væsentligt forbedret. Initiativet er ikke fagspecifikt, så andre fag vil kunne lade sig inspirere af vores tanker og metoder.   This article considers the ambitions, design, and results of a new education project intended to improve the teaching of mathematics to first-year students in the Department of Economics at the University of Copenhagen. The initiative, which has been in development since 2007, was inspired by the classical Kantian-Humboldtian theory of Bildung and by modern theories of tertiary teaching methodology. Observations made following the intervention reveal that the students have changed their behaviour; they have become increasingly active and engaged, and the examination results have improved considerably. The initiative is not subject specific and other fields of study may find inspiration in our thoughts and methods.

  19. Metode Komunikasi Persuasif sebagai Upaya Meningkatkan Sikap Wanita Usia Subur Tentang GAKI

    Directory of Open Access Journals (Sweden)

    Asih Setyani

    2015-01-01

    pendidikan kesehatan menggunakan metode komunikasi persuasif. Tujuan penelitian ini adalah untuk mengukur pengaruh metode komunikasi persuasif terhadap perubahan sikap wanita usia subur tentang GAKI di Kecamatan Kepil, Kabupaten Wonosobo. Jenis penelitian ini adalah quasi eksperiment dengan non equivalent (pre test and post test control group design. Subjek adalah wanita usia subur di Desa Pulosaren. Jumlah sampel sebanyak 68 orang. Sampel ini bagi menjadi 2 kelompok, yaitu kelompok eksperimen dan kelompok kontrol. Kelompok eksperimen mendapat metode komunikasi persuasif, kelompok kontrol mendapat metode penyuluhan. Besar sampel berdasar kriteria inklusi. Data diambil menggunakan kuesioner dan dianalisa menggunakan t-test untuk data yang terdistribusi secara normal, dan   Mann-Whitney, Wilcoxon untuk data yang tidak terdistribusi secara normal. Metode komunikasi persuasif lebih efektif meningkatkan sikap wanita usia subur tentang GAKI dibanding metode penyuluhan dalam waktu sebulan setelah intervensi. Efektivitas dibuktikan dari perbedaan peningkatan sikap yang secara statistik signifikan, pada kelompok yang mendapat metode komunikasi persuasif (5.65, dibanding kelompok yang mendapat metode penyuluhan (2.03. Metode komunikasi persuasif lebih efektif meningkatkan sikap wanita usia subur tentang GAKI dibanding metode penyuluhan. Kata kunci : sikap, GAKI, metode komunikasi persuasif

  20. Relevansen af Aristoteles' etik for konceptionen af eksistentiel terapi

    DEFF Research Database (Denmark)

    Dræby, Anders

    Siden sin undfangelse i begyndelsen af det 20. århundrede har den eksistentielle terapi repræsenteret et filosofisk funderet alternativ til de former for terapeutisk praksis, der er funderet i den funktionalistiske medicinske metafysik. Anvendelse af elementer fra Aristoteles' etik muliggør en...... fremhævelse af den eksistentielle terapi som en praktisk eksistensfænomenologisk livskunst, hvis anliggende er en frembringelse af det enkelte menneskes muligheder fra det skjulte og ind i det uskjulte, så mennesket viser sig som det er ved sig selv...

  1. PENERAPAN METODE MIND MAPPING (PETA PIKIRAN UNTUK MENINGKATKAN KEMAMPUAN BERPIKIR KREATIF MATEMATIK SISWA SMP

    Directory of Open Access Journals (Sweden)

    Rijal Darusman

    2014-09-01

    Full Text Available ABSTRAK Masalah yang melatar belakangi penelitian ini adalah masih rendahnya kemampuan berpikir kreatif matematik siswa Sekolah Menengah Pertama (SMP, sehingga diperlukan metode pembelajaran untuk mengatasi masalah tersebut. Metode yang diterapkan adalah Metode Mind Mapping, dikarenakan dengan metode pembelajaran mind mapping kemampuan berpikir kreatif matematik siswa  lebih baik jika dibandingkan dengan metode pembelajaran biasa.Berdasarkan latar belakang tersebut maka penelitian ini bertujuan untuk mengetahui apakah kemampuan berpikir kreatif matematik siswa yang pembelajarannya menggunakan metode mind mapping lebih baik daripada siswa yang pembelajarannya biasa. Penelitian ini merupakan kuasi eksperimen berbentuk kelompok kontrol pretes-postes, dengan perlakuan metode pembelajaran mind mapping dan pembelajaran biasa (konvensional. Pengumpulan data dalam penelitian ini berupa tes uraian sebanyak 4 soal, kemudian data skor kemampuan berpikir kreatif matematik siswa tersebut dianalisis dengan statistik deskriptif dan inferensial dengan menggunakan uji perbedaan dua rata-rata. Berdasarkan hasil analisis data diperoleh kesimpulan bahwa peningkatan kemampuan berpikir kreatif matematik siswa SMP yang pembelajarannya menggunakan metode mind mapping lebih baik daripada cara biasa.  Kata Kunci    : Berpikir Kreatif Matematik, Mind Mapping   ABSTRACT The problem of the background of this research is still low ability to think creatively mathematical school students (SMP, so that the necessary learning methods to overcome these problems. The method applied is Mind Mapping method, because the mind mapping method of learning mathematics students' creative thinking ability is better when compared to the learning method biasa.Berdasarkan this background, this study aims to determine whether the ability of creative thinking of students learning mathematics using mind mapping better than the usual student learning. This research is a form of quasi

  2. Energiforbrug til opvarmning af bygninger

    DEFF Research Database (Denmark)

    Budde, J.; Pedersen, D.O.

    Rapporten giver oplysninger om enhedsforbrug til varme og varmt brugsvand i forskellige typer af bygninger baseret på en analyse af et omfattende datamateriale. Formålet med undersøgelsen har været at ajourføre denne del af grundlaget for både landsdækkende og lokal varmeplanlægning i Danmark....

  3. Dokumenterede metoder i bostøtteindsatsen over for mennesker med psykiske lidelser

    DEFF Research Database (Denmark)

    Amilon, Anna; Mehlsen, Line; Bengtsson, Steen

    , som kan bistå borgeren efter forløbets afslutning. Konklusion/resultater: Overordnet set viser evalueringen, at borgerne profiterer af CTI-indsatsen. Der sker en statistisk signifikant forbedring af CTI-gruppens mentale trivsel fra første måling til 9-måneders-målingen. Borgernes funktionsniveau er...... blevet målt på tre livsområder: arbejde/uddannelse, socialt liv og familieliv/hjemlige forpligtelser. Resultaterne viser, at borgerne udvikler sig signifikant i positiv retning (oplever færre begrænsninger) efter 9 måneders forløb sammenholdt med ved forløbets opstart. Derudover viser resultaterne fra....... Indsatsborgerne oplevede forbedret psykisk trivsel, forbedret funktionsevne samt fik et stærkere socialt netværk. Baggrund: Evalueringen af metoden Critical Time Intervention (CTI), er udarbejdet som led i satspuljeinitiativet ’Dokumenterede metoder i bostøtteindsatsen over for mennesker med psykiske lidelser...

  4. MENENTUKAN HARGA MOBIL BEKAS DENGAN MENGGUNAKAN METODE FUZZY MAMDANI DAN METODE JARINGAN SYARAF TIRUAN

    Directory of Open Access Journals (Sweden)

    Suria Sandi Winarto

    2012-10-01

    Full Text Available Sejak ditemukannya mobil sebagai alat transportasi, gerak hidup manusia berubah menjadi lebih mudah dan dinamis. Dengan banyaknya keluaran mobil terbaru ditambah dengan semakin gencarnya iklan tentang mobil-mobil terbaru, membuat sebagian konsumen tertarik dan terdorong untuk dapat menukar atau menjual mobilnya dan menggantinya dengan mobil keluaran terbaru, sehingga hal ini menciptakan mobil bekas yang masih layak pakai untuk kembali diperjualbelikan kepada konsumen lainya. Dalam penentuan harga beli sebuah mobil bekas merupakan suatu hal yang bisa dikatakan tidak sulit dan juga tidak mudah bagi penjual dan pembeli.  Untuk menentukan  harga beli mobil bekas setidaknya ada dua faktor yang harus diperhatikan antara lain : harga beli mobil baru dan kondisi . Padahal dalam menentukan harga mobil bekas tersebut tidak hanya dipengaruhi oleh dua faktor itu saja, misalnya dari warna mobil, transmisi, dan tahun keluaran mobil.  Tujuan dari penelitian ini adalah membuat sistem untuk menguji kemampuan metode logika fuzzy mamdani dan metode jaringan syaraf tiruan dalam menentukan harga mobil bekas toyota avanza. Metode penelitian dalam penelitian ini menggunakan metode wawancara dengan mengambil data langsung dari sumbernya yaitu UD. Dito Motor.Dari pengujian data tersebut, diperoleh output yaitu  hasil prediksi harga mobil bekas. Kemudian hasil output dari kedua metode tersebut  akan diuji dengan menggunakan MAPE (Mean Absolute Percentage Error sehingga akan diketahui rata – rata persentase kesalahan absolute. Kata kunci : Harga Mobil Bekas, Fuzzy Mamdani , Jaringan Syaraf Tiruan, Prediksi, MAPE

  5. Benchmarking for controllere: metoder, teknikker og muligheder

    DEFF Research Database (Denmark)

    Bukh, Per Nikolaj; Sandalgaard, Niels Erik; Dietrichson, Lars Grubbe

    2008-01-01

    Benchmarking indgår på mange måder i både private og offentlige virksomheders ledelsespraksis. I økonomistyring anvendes benchmark-baserede indikatorer (eller nøgletal), eksempelvis ved fastlæggelse af mål i resultatkontrakter eller for at angive det ønskede niveau for visse nøgletal i et Balanced...... Scorecard eller tilsvarende målstyringsmodeller. Artiklen redegør for begrebet benchmarking ved at præsentere og diskutere forskellige facetter af det, samt redegør for fire forskellige anvendelser af benchmarking for at vise begrebets bredde og væsentligheden af at klarlægge formålet med et...... benchmarkingprojekt. Dernæst bliver forskellen på resultatbenchmarking og procesbenchmarking behandlet, hvorefter brugen af intern hhv. ekstern benchmarking, samt brugen af benchmarking i budgetlægning og budgetopfølgning, behandles....

  6. PRIMERJAVA GEODETSKIH METOD NA ZAHTEVNEM GRADBENEM OBJEKTU

    OpenAIRE

    Reberčnik, Matic

    2017-01-01

    V projektni nalogi smo v uvodnih poglavjih predstavili različne načine izvajanja geodetskih meritev, ki jih v gradbeništvu uporabljamo pri analizi pomikov in deformacij gradbenih konstrukcij ter terena, na katerem so le-te postavljene. V nadaljevanju opisujemo terestične in GNSS (globalni navigacijski satelitski sistem) metode, ki smo jih uporabljali pri izvajanju meritev na izbranem premostitvenem objektu avtocestnega odseka v Sloveniji (zaradi varovanja podatkov ga imenujemo Objekt 1). Pod...

  7. Implementasi Cloud Computing Menggunakan Metode Pengembangan Sistem Agile

    Directory of Open Access Journals (Sweden)

    Much Aziz Muslim

    2015-05-01

    Full Text Available Cloud computing merupakan sebuah teknologi yang menyediakan layanan terhadap sumber daya komputasi melalui sebuah jaringan. Sumber daya yang di sediakan di dalam cloud computing meliputi mesin, media penyimpanan data, sistem operasi dan program aplikasi. Fitur dari cloud computing dipercaya akan jauh lebih hemat dan memuaskan. Masalah yang muncul adalah bagaimana mengimplementasi Cloud Computing dengan menggunakan Windows Azure Pack dan bagaimana provisioning Windows Azure Pack SQL Database. Fokus pada penelitian ini adalah pada proses deploying dan provisioning SQL Database Server. Pengimplementasian cloud computing menggunakan metode pengembangan sistem agile dengan langkah-langkah meliputi perencanaan, implementasi, pengujian (test, dokumentasi, deployment dan pemeliharaan. Untuk menjalankan proses tersebut kebutuhan perangkat yang dipersiapkan meliputi perangkat keras seperti PC Server Cisco UCS C240 M3S2, Hardisk 8753 GB, 256 GB RAM, bandwith minimal 1 Mbps dan kebutuhan perangkat lunak meliputi Windows Server 2012 R2, VMM, Windows Azure Pack, IIS, SQL Server 2012 dan Web Patform Installer. Hasil dari implementasi cloud computing menggunakan metode pengembangan sistem agile adalah terbentuknya sebuah sistem cloud hosting provider dengan menggunakan Windows Azure Pack dan SQL Server 2012 sebagai sistem utama dan pengelolaan database menggunakan Microsoft SQL Server Management 

  8. Coaching af sygedagpengemodtagere

    DEFF Research Database (Denmark)

    Coop Henriksen, Annemette

    SFI gennemførte i foråret 2008 til foråret 2009 en pilotundersøgelse om coaching. Undersøgelsen var designet som et lodtrækningsforsøg og omfattede 42 kvindelige sygedagpengemodtagere fra Rødovre Jobcenter, der var sygemeldt med psykiske lidelser i form af stress, depression eller udbrændthed eller...... med lidelser i bevægeapparatet. Undersøgelsen er bestilt og finansieret af Rødovre Jobcenter. I rapporten undersøges, om coaching kan bidrage til at bringe sygedagpengemodtagere i arbejde eller tættere på arbejdsmarkedet målt ved, om deltagerne får fx øget motivation, mere selvtillid, øget afklaring...... og færre symptomer på sygdom. Undersøgelsen viser, at gruppen, der har modtaget coaching, oplever en positiv udvikling i forhold til stress, depression og udbrændthed. Gruppen, der modtog coaching, har den tydeligste positive udvikling, men begge grupper har oplevet en helbredsmæssig fremgang i...

  9. Implementering af ny standard for forebyggelse af delir i forhold til ældre svagelige patienter > 65 år med hoftefraktur

    DEFF Research Database (Denmark)

    Bagger, Bettan; Rehder, Bente; Pedersen, Niels

    2013-01-01

    Baggrund: Pro-hip er et inter-regionalt projekt www.prohip.eu der blandt andet har til formål at evidensbasere den rehabiliterende sygepleje til hoftepatienten i forhold til indsatsområderne; ernæring, urinretention/UVI, delir og tryksår. Delirium er et hyppigt forekommende problem blandt patienter...... standard. Intentionen er således at udvikle en evidensbaseret standard eller instruks, der har til formål at opspore tidlige symptomer på konfusion og dermed forebygge udviklingen af deliriøs tilstand hos patienten med hoftefraktur. Metode: Der er udarbejdet et systematisk review med henblik på...

  10. Overførsel af viden ved flytning af produktion

    DEFF Research Database (Denmark)

    Madsen, Erik Skov; Riis, Jens Ove; Wæhrens, Brian Vejrum

    2010-01-01

    Empiriske studier i tre industrielle virksomheder har afsløret, at selv virksomheder med mange års erfaring i at overføre produktion til andre lande hovedsagelig fokuserer på planlægning af den fysiske overflytning af produktionsudstyr og fokuserer på den eksplicitte viden, der er tilknyttet prod...

  11. På tværs af grænser og metoder

    DEFF Research Database (Denmark)

    Singla, Rashmi; Hansen, Tia G. B.; Gulbrandsen, Knut Arild

    2008-01-01

    Tværkulturel psykologi handler om mangfoldighed, og forskningen i tværkulturel psykologi er selv mangfoldig. Forfatterne introducerer eksempler fra feltet, som kan have interesse i en dansk kontekst....

  12. Video som metode til undersøgelser af fødebiologi hos Stor Hornugle

    DEFF Research Database (Denmark)

    Nielsen, Jesper Stern; Larsen, Joachim Westergaard; Larsen, Trine Bork

    2015-01-01

    Live streaming from bird nests has become increasingly popular for educational purposes, but may also hold a research potential by enabling direct observations of food provisioning and social interactions. We used video recordings from an Eagle Owl nest to investigate diet composition and prey...... delivery patterns as a function of date, time of day and weather. A total of 72 deliveries were observed with 41 prey items (57%) being identified to species and 18 (25%) to a higher taxonomic group. Birds accounted for 22 individuals (37%) and mammals for 37 individuals (63%). We found a significant...

  13. Reporting emissions on EMEP grid. Methods and principles; Rapportering af luftemissioner paa grid. Metoder og principper

    Energy Technology Data Exchange (ETDEWEB)

    Tranekjaer Jensen, M.; Nielsen, Ole-Kenneth; Hjorth Mikkelsen, M.; Winther, M.; Gyldenkaerne, S.; Viuf OErby, P.; Boll Illerup, J.

    2008-03-15

    This report explains methods for reporting emissions on EMEP grid with a resolution of 50km x 50km for the reporting years 1990, 1995, 2000 an 2005. The applied and geographical distributed emission data on grid represents the latest delivery (per March 2007) to UNECE LRTAP (United Nations Economic Commission for Europe Long-range Transboundary Air Pollution). Thus data represents the latest recalculation of historical values. The reporting of emissions on EMEP grid with a resolution of 50km x 50km is a part of the Danish submission under the above mentioned convention (UNECE LRTAP). Emission inventories on grid are reported every fifth year and involves all sectors under UNECE LRTAP. The reporting of emissions on grid includes 14 mandatory emission components, which are: SO{sub 2}, NOx NH{sub 3}, NMVOC, CO, TSP, PM{sub 10}, PM{sub 2.5}, Pb, Cd, Hg, Dioxin, PAH and HCB. It is furthermore possible to make additional reporting for a range of components. The report summarizes the most crucial principles and considerations according to work with distributing air emissions on grid within predefined categories for gridding defined by the United Nations (UN 2003). For each of the reported categories, the report gives a detailed explanation of the specific level for distributing emissions spatially. For most reporting categories the process of distributing emissions has been carried out at the highly detailed SNAP level, whereas for others it has been a necessity to make aggregates of several SNAP categories for spatial distribution. The report present final maps for selected air pollutants (SOx, NOx and NH{sub 3}) and discuss shortly possible reasons for variations within time and space. Based on current experience, the report finally gives some recommendations for improving future reporting of gridded emission data. The recommendations pin point, that the EMEP program should provide harmonized and well-documented basic spatial data sets for gridding, to encourage each country to deliver high quality and consistent data. At the moment the guidelines for reporting emission data under UNECE LRTAP are undergoing an extensive revision. The updated guidelines will be published in: Guidelines for Estimating and Reporting Emission Data under the Convention on Long-range Transboundary Air Pollution. As something quite new a special section concerning spatial mapping is included in the revised guidelines. The content describes methods and available spatial data for spatially distribution of emission data at different levels. (au)

  14. Nye metoder til evaluering af sensoriske, biomekaniske og motoriske funktioner i mave-tarm-kanalen

    DEFF Research Database (Denmark)

    Drewes, Asbjørn Mohr

    2009-01-01

    The article gives a review of new methods in gastroenterology. The >>functional lumen imaging probecompetence of sphincter regions during distension. The axial force probe can measure forces in the oesophagus during swallowing and give new information about...... patients with motor disorders of the oesophagus. The >>multimodal probe

  15. Retrograd intrarenal stenkirurgi--en minimalinvasiv metode til behandling af nyresten

    DEFF Research Database (Denmark)

    Jung, Helene U; Osther, Palle J S

    2009-01-01

    Retrograde intrarenal stone surgery (RIRS) is a safe and effective minimally invasive method for the treatment of minor (ESWL-resistant kidney stones where resistance is due e.g. to anatomical abnormalities or stones...

  16. Crowdsourcing er en ny metode til indsamling af data til videnskabelige undersøgelser

    DEFF Research Database (Denmark)

    Bækgaard, Josefine Stokholm; Hallas, Peter

    2015-01-01

    as diagnosis of rare conditions. CS techniques are rapid, low cost and geographically independent - traits lacking in traditional types of study design. However, CS as a method has not yet found its place in the evidence rating scale and a standard for conducting and reporting CS studies does not yet exist.......Crowdsourcing (CS) is a rapidly emerging method in scientific research. In CS, large groups of people generate new data or try to find solutions to specific research questions, mainly by online collaboration. Examples of the current use of CS in medicine include disease surveillance as well...

  17. Kommunikation på hospital ved hjælp af standardiseret metode

    DEFF Research Database (Denmark)

    Ydemann, Mogens

    2012-01-01

    We know from the aviation industry and several studies, that efficient and safe communication is extremely important, especially in emergencies. This study evaluated the use of the "identification, situation, background, analysis and recommendation" (ISBAR) checklist, when doctors from the depart......We know from the aviation industry and several studies, that efficient and safe communication is extremely important, especially in emergencies. This study evaluated the use of the "identification, situation, background, analysis and recommendation" (ISBAR) checklist, when doctors from...

  18. Arbejdsmiljøseminarer som et redskab til at skabe motivation, ansvarlighed og ejerskab til arbejdet omkring forebyggelse af ulykker i små-, mellemstore og store virksomheder, såvel blandt ansatte som deres ledere

    DEFF Research Database (Denmark)

    Pedersen, Louise; Kines, Pete

    2009-01-01

    af arbejdsulykker. Vellykkede arbejdsmiljøseminarer kan være en metode til skabe motivation, ansvarlighed og ejerskab samt at mindske den modstand, der kan være imod forandringerne. Med andre ord at arbejde med nogle af de processer, som kan være svære at få indblik i og overskud til at arbejde med i...

  19. Organisering af basal uddannelse i laparoskopisk kirurgi

    DEFF Research Database (Denmark)

    Lund, Lars; Høj, Lars; Poulsen, Johan

    2010-01-01

    evalueringsmetode er anvendt objective structured clinical examination (OSCE-test) og objective structured assessment of technical skills (OSATS-test). Resultater: Af de 106 læger er der færdigtrænet 80 læger på modul 1 og 2. Deltagernes fordeling på specialer var ved modul 1: kirurgi 47 læger, urologi 14 læger og...

  20. Perbandingan Metode Binomial dan Metode Black-Scholes Dalam Penentuan Harga Opsi

    Directory of Open Access Journals (Sweden)

    Surya Amami Pramuditya

    2016-04-01

    Full Text Available ABSTRAKOpsi adalah kontrak antara pemegang dan penulis  (buyer (holder dan seller (writer di mana penulis (writer memberikan hak (bukan kewajiban kepada holder untuk membeli atau menjual aset dari writer pada harga tertentu (strike atau latihan harga dan pada waktu tertentu dalam waktu (tanggal kadaluwarsa atau jatuh tempo waktu. Ada beberapa cara untuk menentukan harga opsi, diantaranya adalah  Metode Black-Scholes dan Metode Binomial. Metode binomial berasal dari model pergerakan harga saham yang membagi waktu interval [0, T] menjadi n sama panjang. Sedangkan metode Black-Scholes, dimodelkan dengan pergerakan harga saham sebagai suatu proses stokastik. Semakin besar partisi waktu n pada Metode Binomial, maka nilai opsinya akan konvergen ke nilai opsi Metode Black-Scholes.Kata kunci: opsi, Binomial, Black-Scholes.ABSTRACT Option is a contract between the holder and the writer in which the writer gives the right (not the obligation to the holder to buy or sell an asset of a writer at a specified price (the strike or exercise price and at a specified time in the future (expiry date or maturity time. There are several ways to determine the price of options, including the Black-Scholes Method and Binomial Method. Binomial method come from a model of stock price movement that divide time interval [0, T] into n equally long. While the Black Scholes method, the stock price movement is modeled as a stochastic process. More larger the partition of time n in Binomial Method, the value option will converge to the value option in Black-Scholes Method.Key words: Options, Binomial, Black-Scholes

  1. Udvikling af The Dementia Carer Needs Assessment Questionnaire

    DEFF Research Database (Denmark)

    Clemmensen, Trine Holt; Lauridsen, Henrik Hein; Kristensen, Hanne Kaae

    redskab til at identificere behov for støtte blandt pårørende til personer med demens - the Dementia Carer Needs Assessment Questionnaire (DCNAQ). Redskabet skal udvikles til at være selvrapporteret og let anvendeligt i klinisk praksis. Metode Projektet er tilrettelagt som et tre-årigt Ph.d. forløb, hvor......Baggrund Demens er en sygdom som påvirker hele familien, og pårørende bidrager i høj grad med omsorg for personen med demens i hverdagen. At være pårørende til en person med demens kan være belastende både fysisk, psykisk og socialt (1-4). I praksis mangler der standardiserede redskaber til...... der tages udgangspunkt i WHO’s Internationale Klassifikation af funktionsevne, funktionsevnenedsættelse og helbredstilstand (ICF) (7). Projektet gennemføres som to delstudier. Studie 1 - udvikling Materiale og metode: 32 pårørende til personer med demens og 16 sundhedsprofessionelle inviteres til...

  2. Identifikasi Boraks dalam Bakso di Kelurahan Bahagia Bekasi Utara Jawa Barat dengan Metode Analisa Kualitatif

    Directory of Open Access Journals (Sweden)

    Mega Efrilia

    2016-03-01

    Full Text Available Already a research identification of boraks in meatball a sell is Kelurahan Bahagia, Nort Bekasi East Java. A research as a purpose for identification boraks in meatball with a metode analysis kualitatif that is a burn of fire a testing colour with a turmeric paper with ake use AgNO3, and BaCl2. Sampel in take by metode random sampel plainin meatball a sell a is Kelurahan Bahagia Nort Bekasi. On a test result, the testing in apprearance meatball of in point negatif contain boraks because meatball not a springy, bases in one day, colour not white, and slimy in one day. in akualitatif this testing 15 sample meatball with test burn of fire, by test colour a using turmeric paper, and BaCl2 negatif contain a boraks.

  3. Deteksi Fraud Menggunakan Metode Model Markov Tersembunyi Pada Proses Bisnis

    Directory of Open Access Journals (Sweden)

    Andrean Hutama Koosasi

    2017-03-01

    Full Text Available Model Markov Tersembunyi merupakan sebuah metode statistik berdasarkan Model Markov sederhana yang memodelkan sistem serta membaginya dalam 2 (dua state, state tersembunyi dan state observasi. Dalam pengerjaan tugas akhir ini, penulis mengusulkan penggunaan metode Model Markov Tersembunyi untuk menemukan fraud didalam sebuah pelaksanaan proses bisnis. Dengan penggunaan metode Model Markov Tersembunyi ini, maka pengamatan terhadap elemen penyusun sebuah kasus/kejadian, yakni beberapa aktivitas, akan diperoleh sebuah nilai peluang, yang sekaligus memberikan prediksi terhadap kasus/kejadian tersebut, sebuah fraud atau tidak. Hasil ekpserimen ini menunjukkan bahwa metode yang diusulkan mampu memberikan prediksi akhir dengan evaluasi TPR sebesar 87,5% dan TNR sebesar 99,4%.

  4. Virkelighedsflugt og masser af sex

    DEFF Research Database (Denmark)

    Lorentzen, Rasmus Fink

    2011-01-01

    I artiklen laves en læsning af ungdomsromanen "6" (2010) af Ronni Andersen. Dernæst udfoldes en række litteraturpædagogiske forslag tilen undervisning i romanen i skolens ældste klasser. Arbejdsforslagene er baseret på en kompetencetilgang til danskfaget og rummer fire værksteder hvor eleverne sk...

  5. I Frans af Assisis fodspor

    DEFF Research Database (Denmark)

    Bonde, Lisbeth

    2015-01-01

    En fodrejse fra Assisi til Rom i Frans af Assisis fodspor sætter gang i tankerne og giver anledning til nye ideer......En fodrejse fra Assisi til Rom i Frans af Assisis fodspor sætter gang i tankerne og giver anledning til nye ideer...

  6. Ledelse af forandringer i folkeskolen

    DEFF Research Database (Denmark)

    Kjer, Mikkel; Rosdahl, Anders

    2016-01-01

    Dette notat bygger på kvalitative interview på seks folkeskoler i efteråret 2015. Skolerne ligger i forskellige egne af landet og i landområder, mindre og store byer. Skolerne er af forskellig størrelse, og deres elevgrundlag, dvs. forældrenes sociale baggrund, varierer også. Notatet bygger primæ...

  7. Forhastet regulering af de store

    DEFF Research Database (Denmark)

    Thomsen, Steen

    2013-01-01

    Christiansborg gennemfører sandsynligvis en markant skærpet regulering af de store finansielle virksomheder. Det vil virke kontraktivt og medvirke til erhvervslivets kredittørke.......Christiansborg gennemfører sandsynligvis en markant skærpet regulering af de store finansielle virksomheder. Det vil virke kontraktivt og medvirke til erhvervslivets kredittørke....

  8. Masser af information uden betydning

    DEFF Research Database (Denmark)

    Brier, Søren

    en diskussion af informationsteorien i Tor Nørretranders "Mærk verden" og en skitse til et alternativ baseret på anden ordens kybernetik og semiotik......en diskussion af informationsteorien i Tor Nørretranders "Mærk verden" og en skitse til et alternativ baseret på anden ordens kybernetik og semiotik...

  9. Anbefalinger til organisering af uddannelserne

    DEFF Research Database (Denmark)

    Andersen, Lars; Andersen, Lars Døvling; Hornemann, Birte C.

    2009-01-01

    Notatet sammenfatter de diskussioner, som det af fakulteterne nedsatte udvalg vedrørende nye undervisnings- og eksamensformer har haft, og de anbefalinger til en omlægning af vores uddannelsessystem, som udvalget har valgt at give. Notatet er samtidig en begyndelse på en erfaringsudveksling om ny...

  10. Kontrolstrategi til frigørelse af kraftværkers reguleringsevne

    DEFF Research Database (Denmark)

    Mortensen, J. H.

    . Styrbare input er valgt til fødevandsmængden og brændselsmængden, hvilke kobler kraftigt til HT-damptrykket, hvorfor denne er medtaget i regulerings-strategien for ikke at forværre reguleringen af HT-damptrykket. Yderligere er der indført feedforward-kompensering fra lasten. Dette er tydeligvist et...... reguleringssystem. En i forhold til lasten scheduleret multivariabel LQG-regulator er blevet anvendt. Schedulering er anvendt da det har vist sig at de dominerende ulineariteter er lastafhængige. To forskellige metoder til indføring af feedforward-kompensering er blevet behandlet. I den ene metode er feedforward...... multivariabelt reguleringsproblem. Afprøvninger af en LQG-regulator med integreret feedforward-kompensator på SVS2-simulato*ren viser at udsvingene i damptemperaturen før 1. sprøjte kan reduceres betragteligt un*der lastændringer samtidig med at en mindre reduktion i udsving i HT-damptrykket er op*nået. Sta...

  11. Modeller af komplicerede systemer

    DEFF Research Database (Denmark)

    Mortensen, J.

    emphasizes their use in relation to technical systems. All the presented models, with the exception of the types presented in chapter 2, are non-theoretical non-formal conceptual network models. Two new model types are presented: 1) The System-Environment model, which describes the environments interaction...... with conceptual modeling in relation to process control. It´s purpose is to present classify and exemplify the use of a set of qualitative model types. Such model types are useful in the early phase of modeling, where no structured methods are at hand. Although the models are general in character, this thesis......This thesis, "Modeller af komplicerede systemer", represents part of the requirements for the Danish Ph.D.degree. Assisting professor John Nørgaard-Nielsen, M.Sc.E.E.Ph.D. has been principal supervisor and professor Morten Lind, M.Sc.E.E.Ph.D. has been assisting supervisor. The thesis is concerned...

  12. Anmeldelse af World Drug Report 2005

    DEFF Research Database (Denmark)

    Møller, Kim

    2005-01-01

    Internationale udfordringer i spændingsfeltet mellem organiseret kriminalitet og narkotika. Værdien af det illegale narkotikamarked. Skabelsen af et Illicit Drug Index. Ny organisationsstruktur bag udgivelsen af denne WDR. Udgivelsesdato: December......Internationale udfordringer i spændingsfeltet mellem organiseret kriminalitet og narkotika. Værdien af det illegale narkotikamarked. Skabelsen af et Illicit Drug Index. Ny organisationsstruktur bag udgivelsen af denne WDR. Udgivelsesdato: December...

  13. METODE YASINIYAH SEBAGAI METODE PEMBELAJARAN MEMBACA AL-QUR’AN

    Directory of Open Access Journals (Sweden)

    Munir Munir

    2010-06-01

    Full Text Available Abstract This article is research report on the implementation of Yasiniyah method in learning of reading al-Qur’an. The research use theories of phenomenology–symbolic-interactionism for understanding reality in application of this method. For anlyzing the meaning  of reality, it need the approach of social-psichology with contrast analysis, verification and comparation with another different reality. Yasiniah method, philosophically, is based on pesantren’s classic tradition. The characteristic of Yasiniah method can be seen in its system of implementation, i.e. : 1 recruitment system of new student; 2 system of class management; 3 learning material; 4 strategy implemented; 5 system of evaluation use test or directly oral examination  by facing mustahiq individually, and who can pass the exam will be given the certificate at alumni’s release ceremony in  every end of academic year.Kata Kunci: Yasiniyah method, learning of al-Qur’an  reading, pesantren tradition. 

  14. Intelligent styring af dynamisk LED belysning

    DEFF Research Database (Denmark)

    Thorseth, Anders; Corell, Dennis Dan; Hansen, Søren Stentoft

    Denne slutrapport giver en kort beskrivelse af arbejdet, der er udført af DTU Fotonik i projektet ”Intelligent styring af dynamisk LED belysning” støttet af EUDP. Arbejdet er udført i perioden 2011‐2012 i samarbejde med Lighten.......Denne slutrapport giver en kort beskrivelse af arbejdet, der er udført af DTU Fotonik i projektet ”Intelligent styring af dynamisk LED belysning” støttet af EUDP. Arbejdet er udført i perioden 2011‐2012 i samarbejde med Lighten....

  15. Nyttigt bidrag til professionalisering af revisionsudvalg

    DEFF Research Database (Denmark)

    Thomsen, Steen

    2009-01-01

    Anmeldelse af: KPMG. 2009, Audit Committee Institute. Revisionsudvalg i Praksis. 2. reviderede udgave.......Anmeldelse af: KPMG. 2009, Audit Committee Institute. Revisionsudvalg i Praksis. 2. reviderede udgave....

  16. ADAPTIVE WEB SITE DENGAN METODE FUZZY CLUSTERING

    Directory of Open Access Journals (Sweden)

    Muchammad Husni

    2004-01-01

    Full Text Available Normal 0 false false false IN X-NONE X-NONE MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin:0cm; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} Ledakan pertumbuhan dan perkembangan informasi dalam dunia maya menjadikan personalisasian informasi menjadi isu yang penting. Personalisasi informasi yang akan diberikan oleh situs web akan sangat mempengaruhi pola dan perilaku pengguna dalam pencarian informasi, terutama pada perdagangan elektronis (e-commerce. Salah satu pendekatan yang memungkinkan dalam personalisasian web adalah mencari profil pengguna (user profile dari data historis yang sangat besar di file web log. Pengklasifikasian data tanpa pengawasan (unsupervised clasification atau metode metode clustering cukup baik untuk menganalisa data log akses pengguna yang semi terstruktur. Pada metode ini, didefinisikan "user session" dan juga ukuran perbedaan (dissimilarity diantara dua web session yang menggambarkan pengorganisasian sebuah web site. Untuk mendapatkan sebuah profil akses pengguna, dilakukan pembagian user session berdasarkan pasangan ketidaksamaan menggunakan algoritma Fuzzy Clustering. Kata kunci : Adaptive Website, Fuzzy Clustering, personalisasi informasi.

  17. Komparasi Metode Penyetaraan Tes Menurut teori Respons Butir

    Directory of Open Access Journals (Sweden)

    Erna Miyatun

    2004-01-01

    Full Text Available Penelitian ini bertujuan menemukan metode penyetaraan tes dengan teori respons butir yang paling akurat. Sebelum dilakukan pengujian keakuratan metode penyetaraan tes, terlebih dahulu dilakukan: 1 Pemeriksaan setara atau tidaknya perangkat tes, 2 Penemuan persamaan konversi antarpaket soal yang tidak setara dan 3 Estimasi parameter butir. Penentuan metode penyetaraan tes yang akurat didasarkan pada besarnya kesalahan standar penyetaraan (SEE; yang paling akurat adalah metode penyetaraan tes yang mempunyai SEE paling kecil. Dalam penelitian ini, terdapat dua macam objek penelitian yaitu paket soal dan jawaban peserta EBTANAS. Soal EBTANAS terdiri dari 3 paket soal utama, 1 paket soal susulan, dan 1 paket soal cadangan. Peserta EBTANAS SLTP di Jawa Tengah Tahun Ajaran 1998/1999 terdiri dari 370.187 siswa. Teknik Purposive Sampling digunakan untuk menentukan sampel paket soal, yaitu ketiga paket soal utama terpilih sebagai sampel penelitian. Teknik Cluster Stratified Systematic Random Sampling digunakan untuk menentukan sampel jawaban peserta EBTANAS. Jawaban peserta sebanyak 8.251, terpilih sebagai sampel penelitian. Paket soal EBTANAS SLTP bidang studi Matematika dan data jawaban peserta tes, diperoleh melalui pengambilan data dokumentasi. Keparalelan tes diuji dengan analisis varians, uji Scheffe, dan uji Levene. Penyetaraan tes dilakukan dengan metode: Rerata dan Sigma, Rerata dan Sigma Tegar, dan Kurva Karakteristik. Estimasi parameter butir dilakukan dengan analisis program Bilog. Hasil analisis menunjukkan, pasangan paket soal utama-1 dan 2 serta pasangan paket soal utama-1 dan 3 tidak paralel, sehingga diperlukan proses penyetaraan. Pasangan paket soal utama-2 dan paket soal utama-3 bersifat paralel. Oleh karena itu tidak diperlukan proses penyetaraan. Penyetaraan paket soal utama-1 ke paket soal utama-2, dengan metode Rerata dan Sigma didapatkan persamaan konversi X2 - 1,19495 X] + 0,25766; dengan metode Rerata dan Sigma Tegar, X2 = 0

  18. Modellering af elforbrug til netanalyse

    DEFF Research Database (Denmark)

    Østergaard, Jacob

    I denne rapport undersøges mulighederne for at etablere en model for elforbruget, der kan anvendes ved analyser af det østdanske transmissionsnet. Rapporten henvender sig til ingeniører og beslutningstagere, der ønsker viden om betydningen af en nøjagtig elforbrugsmodel og om mulighederne for i p...... simuleringsresultater med mindre usikkerhed, og der opnås en integration mellem eksisterende systemer, idet data fra en række systemer bl.a. Panda, elforbrugsprognoser, elforbrugspaneler og stationsprognoser kan udnyttes til etableringen af en model....

  19. METODE DATA MINING UNTUK KLASIFIKASI DATA SEL NUKLEUS DAN SEL RADANG BERDASARKAN ANALISA TEKSTUR

    Directory of Open Access Journals (Sweden)

    Toni Arifin

    2016-03-01

    Full Text Available ABSTRACT - The Pap Smear test is done to see the presence of infection or changes in cells that can turn into cancer cells. In this research is using data on analysis results of texture image processing on previous research that is using a nucleus cell and inflammation cell in the image Pap Smear cell. The purpose of this research is to find the best method for classifying the nucleus cell and inflammation cell based on texture analysis GLCM (Gray Level Co-occurrence Matrix in this research used of method Decision tree (C 4.5, Naive Bayes and k-Nearest Neighbour. The results of this research brings about the best methods for classification of the data nucleus cell and inflammation cell that is a method of Decision tree (C4.5 with accuracy 97,56% whereas results for Naive Bayes 90,89% and k-Nearest Neighbour 95,97%. Keywords: Data mining, classification, Pap Smear cell, Texture Analysis ABSTRAKSI - Tes Pap Smear dilakukan untuk melihat adanya infeksi atau perubahan sel-sel yang dapat berubah menjadi sel kanker. Pada penelitian ini menggunakan data analisis tekstur yang didapatkan dari hasil pengolahan citra pada penelitian sebelumnya yaitu menggunakan sel nukleus dan sel radang pada citra sel Pap Smear. Tujuan dari penelitian ini adalah mencari metode terbaik untuk mengklasifikasikan sel nukleus dan sel radang berdasarkan analisa teksur GLCM (Gray Level Co-occurrence Matrix Metode yang digunakan dalam penelitian ini adalah metode Decision tree (C4.5, Naive Bayes dan k-Nearest Neighbour. Hasil dari penelitian ini didapatkan metode terbaik untuk klasifikasi data sel nukleus dan sel radang yaitu metode Decision tree (C4.5 dengan akurasi 97,56% sedangkan hasil untuk Naive Bayes 90,89% dan k-Nearest Neighbour 95,97%. Kata Kunci: Data mining, Klasifikasi, Sel Pap Smear, Analisa Tekstur

  20. Antologi om Visuelle Felt-& Analyse Metoder

    DEFF Research Database (Denmark)

    Lundberg, Pia

    andet baseret på det poetiske princip, af Edgar Allan Poe, som blev udgivet posthumt i 1850. Derudover anvendes antropologerne Victor Turner & Edward Bruners teoretiske arbejder om forskellige kulturæstetiske fænomener og udtryk (fx Bruner 1986). Sidst men ikke mindst anvendes de kulturvidenskabelige...

  1. Dansk oversættelse af MiDAS, et redskab til assessment af musikterapi for personer med demens

    DEFF Research Database (Denmark)

    Ridder, Hanne Mette Ochsner; Lykkegaard, Chris; McDermott, Orii

    2018-01-01

    DAS explored which procedures is used for outcome measure translation and cultural adaptation, and based on this recommended a ten-step procedure. We applied this procedure in order to translate MiDAS and hereby develop the Danish MiDAS-DK. The Danish MiDAS version has been tested by more than 20 professionals......) musikterapeuten umiddelbart efter sessionen for at vurdere forandringer i selve sessionen. Der har været stor interesse for at anvende MiDAS i flere Europæiske lande, herunder Danmark. Derfor undersøgte udviklerne af MiDAS hvilke procedurer der anvendes til oversættelse og kulturel tilpasning af...... assessmentredskaber, og anbefalede på den baggrund en ti-trins procedure. Vi anvendte denne procedure til oversættelsen af MiDAS og således udviklingen af den danske MiDAS-DK. Den danske version af MiDAS er afprøvet af mere end 20 fagpersoner på baggrund af 296 udfyldte MiDAS-skemaer. Målet med artiklen er...

  2. Rating af banker og banksystemer

    DEFF Research Database (Denmark)

    Grosen, Anders

    2010-01-01

    Banksystemer over hele verdenen er med nød og næppe blevet reddet af diverse statslige hjælpepakker. Derfor er der i disse år øget fokus på banker og banksystemers rating. Denne interesse bliver ikke mindre af, at de statslige garantier til bankerne i mange lande udløber i de kommende år. Rating ...

  3. Kants Kritik af dømmekraften

    DEFF Research Database (Denmark)

    Introduktion til Kants Kritik af dømmekraften bestående af otte artikler, der følger værkets egen tematiske opbygning......Introduktion til Kants Kritik af dømmekraften bestående af otte artikler, der følger værkets egen tematiske opbygning...

  4. Bilag til forskningsoversigt - Effekterne af Cooperative Learning

    DEFF Research Database (Denmark)

    Larsen, Lea Lund

    Ved en opsamling af de empiriske studier vedrørende effekten af CL inden for voksenundervisningsfeltet ses en overvægt af studier, som rapporterer en positiv effekt af CL i forhold til de voksne lærendes faglige udbytte. En meta-analyse over 168 amerikanske undersøgelser på universitetsniveau vis...

  5. På sporet af de gyldne opskrifter?

    DEFF Research Database (Denmark)

    Poulfelt, Flemming

    2015-01-01

    Børsen Ledelse. Markedet for kogebøger er stort. For der produceres hvert år et hav nye af slagsen. Nogle udgives af kendte kokke, nogle af særlige eksperter inden for kost og motion, og andre af personer, der har en ægte interesse inden for gastronomi og mad. På ledelsesområdet findes en...

  6. Udvikling af systemleverancer, parametri og BIM

    DEFF Research Database (Denmark)

    Kortegaard, Per

    2016-01-01

    Seminaret rummede indlæg fra både nogle af projektets tidligere ph.d.-studerende og forskellige kompetente professionelle personer fra forskellige grene af praksis. Seminaret gav samlet et fint billede af status indenfor udviklingen af systemleverancer og deres anvendelse i relation til BIM...

  7. Professor: Lær af Canada

    DEFF Research Database (Denmark)

    Greve, Carsten

    2013-01-01

    Transportdebatten: En mulig finansiering af fremtidige infrastrukturprojekter kunne være OPP. Danmark bør tage ved lære af erfaringer fra Canada.......Transportdebatten: En mulig finansiering af fremtidige infrastrukturprojekter kunne være OPP. Danmark bør tage ved lære af erfaringer fra Canada....

  8. Fremtidens biblioteksbetjening af børn

    DEFF Research Database (Denmark)

    Høyrup, Helene

    2008-01-01

    Rapporten er resultatet af et tværministerielt udvalgsarbejde nedsat af Kulturministeriet.  Kommissoriet har været at nytænke biblioteksbetjeningen af børn, så den passer til vidensamfundet.  Udvalgsarbejdet munder ud i ti bud for fremtidens biblioteksbetjening af børn....

  9. Regulering af det psykiske arbejdsmiljø

    DEFF Research Database (Denmark)

    Nielsen, Klaus T.

    nationale informationer om reguleringen af det psykiske arbejdsmiljø. Rapport er bygget op med ◊ et internationalt overblik over regulering af psykisk arbejdsmiljø ◊ en bredere diskussion af reguleringens dilemmaer ◊ en gennemgang af den aktuelle danske udvikling ◊ udfordringerne på området...

  10. Implementering af MultifunC

    DEFF Research Database (Denmark)

    Henze-Pedersen, Sofie; Kohl, Katrine Syppli; Oldrup, Helene

    (MultifunC), som allerede havde vist lovende resultater i Norge og Sverige. I 2011 og 2012 åbnede to danske MultifunC-institutioner derfor i henholdsvis København og Aarhus. Denne rapport undersøger, hvordan implementeringen af MultifunC-programmet er forløbet i Danmark. Undersøgelsen viser, at ingen af de...... to danske institutioner lykkedes med at implementere MultifunC tilfredsstillende i løbet af implementeringsperioden. Det har fx været vanskeligt at implementere det tætte tværfaglige samarbejde mellem medarbejdere med forskellige fagprofessionelle baggrunde, som behandlingsprogrammet indebærer. Det har...... desuden været særdeles vanskeligt for de danske MultifunC-institutioner at få etableret det eksterne samarbejde med de sociale myndigheder i kommunerne, politiet, skoler og praktiksteder samt fritidstilbud i nærområdet, som også er en væsentlig del af behandlingsprogrammet. Undersøgelsen af finansieret af...

  11. RFiD tracking af brugeres adfærd i bygningsrum

    DEFF Research Database (Denmark)

    Suenson, Valinka; Harder, Henrik

    2011-01-01

    dette felt. Forude venter derfor flere forsøg, førend forskningsfeltet kan siges at være metodisk veletableret. Radio Frequency Identification (RFID), videoovervågning og Bluetooth er alle metoder, der bliver forsket i. Adfærdsanalyser i bygninger er med andre ord et både levende og dynamisk felt, og...... metoderne fornyr sig i takt med, nye teknologier opstår. I nærværende artikel vil det blive belyst hvordan RFID teknologien kan bruges til at gennemføre en adfærdsanalyse af et eller flere bygningsrum. Forskningen anvender teknologien til at sige noget om brugen af bygningen. Hvordan bruges den? Hvem bruger...

  12. Pengaruh Perawatan Metode Kanguru terhadap Perubahan Berat Badan Bayi Lahir Rendah

    Directory of Open Access Journals (Sweden)

    Silvia ,

    2017-02-01

    Full Text Available Berat Badan Lahir Rendah (BBLR adalah bayi dengan berat badan  bayi lahir kurang dari 2500 gram tanpa memandang masa gestasi. Tujuan penelitian ini adalah untuk mengetahui Pengaruh Perawatan Metode Kanguru Terhadap Perubahan Berat Badan Bayi BBLR di ruang inap perinatology  RSUD Dr.Achmad  Mochtar Bukittinggi tahun 2014.  Penelitian ini menggunakan desain  Quasi Eksperimental dengan rancangan one group pretest posttest design, dan pengambilan sampel menggunakan teknik purposive  sampling dengan  sampel 10 orang. Hasil penelitian  di dapatkan rata-rata berat badan bayi sebelum perawatan metode kanguru adalah 1738,60 gram, sedangkan setelah dilakukan perawatan metode kanguru berat badan bayi meningkat menjadi 1766,90 gram, dengan peningkatan berat badan sebanyak 28,30 gram dimana  p value = 0.00 <  Dapat disimpulkan bahwa terdapat pengaruh perawatan metode kanguru terhadap perubahan berat badan bayi BBLR di ruang inap perinatologi RSUD dr.Achmad Mochtar Bukittinggi tahun 2014. Dan disarankan kepada ibu-ibu untuk melakukan perawatan metode kanguru secara rutin dan pemberian ASI yang cukup terhadap bayi BBLR.Kata kunci: Perawatan Metode Kanguru, Berat Badan bayi. Low Birth Weight (LBW is a baby with a birth weight less than 2500 grams regardless of gestation. This research used a quasi-experimental design with one group pretest posttest design. The samples were taken using purposive sampling technique. The results showed that all respondents experienced weight gain. The weight of babies before applying kangaroo care method was 1738.60 grams in average. While after applying the kangaroo care method, the baby's weight increased to 1766.90 grams. After using a statistical test of dependent t-test (paired t-test, pvalue gotten was 0.000, with standard error (α 0.05. It means that there is a significant difference between the average weight before and after the treatment of kangaroo care methods with weight gain as much as 28.30 gram. Based

  13. Fokus på fremme af livskvalitet og trivsel hos personer med demens gennem læringsmodel med musikterapi og Dementia Care Mapping som det fælles omdrejningspunkt

    DEFF Research Database (Denmark)

    Ottesen, Aase Marie

    . Beskrivelse af den metode som er anvendt Metodisk er projektet tilrettelagt som et casestudie af et musikterapiforløb. I læringsmodellen tages afsæt i Tom Kitwoods teori og værdigrundlag om en personorienteret omsorg. Dementia Care Mapping (DCM) anvendes i læringsforløbet til at belyse de relationelle møder......, der opstår i musikterapien. Samtidig anvendes DCM som pædagogisk metode i feedbackprocessen med omsorgsgiverne, hvor der arbejdes på at give omsorgsgiverne redskaber til at bruge musik aktivt i deres interaktion med personer med demens i forskellige samværssituationer. Projektets teoretiske...

  14. Et litteraturstudie over tilgange til evaluering af økologi med fokus på økonomisk værdisætning og multikriterieanalyser

    DEFF Research Database (Denmark)

    Christensen, Tove; Olsen, Søren Bøye; Dubgaard, Alex

    komplekse begreber, og multikriteriemetoder er derfor strengt nødvendige for at gennemføre relevante analyser af området. Selv om der stadig er mange uløste problemer tilbage, så har økonomisk teori mange metoder, der kan bruges til sådanne analyser. En kombination af økonomisk værdisætning/cost-benefit...... opfordrer beslutningstagerne til eksplicit at tage stilling til hvilke vægte, de tillægger forskellige hensyn. Det forventes derfor, at anvendelse af multikriterietilgangen vil være et godt bidrag til at øge forståelsen af økologiens komplekse struktur. Der ligger dog samtidig betydelige udfordringer i...

  15. Processer og metoder i det fejlfrie byggeri

    DEFF Research Database (Denmark)

    Jørgensen, Kirsten; Schultz, Casper Siebken; Bonke, Sten

    -sjusk. I 2006 kunne BEC, Byggeriets Evaluerings Center, vise den første reelle opgørelse over registrere-de mangler ved aflevering blandt de evaluerede byggerier. Det førte til en offentlig debat og en del reaktioner fra byggeriets parter. I en efterfølgende dialog mellem Sven Bertelsen fra Lean Construc...... erfaringsbaseret for-ståelsesgrundlag for, ”hvordan de bedste projektledere gennemfører den gode byggeproces”. Med andre ord en beretning om ’best practice’, set ud fra et bestemt aktørperspektiv. Undervejs kom der øget fokus på betydningen af forskellige entrepriseformer, hvilket gav anledning til inddragelse af...

  16. Brug af alternativ isolering i forbindelse med renovering af ældre etageejendomme

    DEFF Research Database (Denmark)

    Hansen, Ernst Jan de Place

    2003-01-01

    Resume af rapport om praktiske erfaringer med brug af alternative isoleringsmaterialer i en renoveringsopgave, udarbejdet af Byfornyelse København m.fl. under Energistyrelsens udviklingsprogram "Miljø- og arbejdsmiljøvenlig isolering"...

  17. STUDI METODE-METODE EKSTRAKSI PEWARNA MAKANAN ALAMI ANNATTO DARI BIJI KESUMBA (Bixa orellana

    Directory of Open Access Journals (Sweden)

    Johnner Parningotan Sitompul

    2012-05-01

    . Annatto merupakan pewarna alami makanan yang didapatkan melalui ekstraksi dari biji pohon kasumba (Bixa orellana dengan komponen pewarna utamanya adalah bixin. Keberadaan ikatan rangkap terkonjugasi menyebabkan bixin dan norbixin  larut dalam sebagian besar pelarut organik. Ciri struktur kimia dari bixin ini yang menjadi dasar dalam pemilihan pelarut untuk ekstraksi pewarna annatto. Tujuan makalah ini adalah studi metode-metode ekstraksi terhadap perolehan bixin, metode Soxhlet pada temperatur didih pelarut dan metoda ultrasonic bath pada temperatur kamar, dengan dua tempat sumber biji kasumba, Bandung dan Duri. Pelarut yang digunakan adalah etil asetat dan aseton. Pengujian dilakukan dengan mengukur kadar pigmen yang dihasilkan menggunakan spektrofotometri pada panjang gelombang tertentu. Dari penelitian ini, didapatkan data yield (perolehan bixin dari berbagai variasi percobaan. Perolehan bixin (terhadap biji yang didapat dari ekstraksi ultrasonic bath lebih tinggi yaitu rata-rata sebesar 0,584%, dibanding dengan metode soxhlet yang rata-rata sebesar 0,443%. Ekstraksi menggunakan metode ekstraksi ultrasonic bath, dan menggunakan pelarut etil asetat lebih tinggi yaitu rata-rata 0,602% daripada menggunakan aseton yang rata-rata 0,565%. Sedangkan dengan metode soxhlet menunjukkan perolehan bixin berbeda, dengan pelarut aseton 0,460%, sedangkan untuk pelarut etil asetat adalah 0,427%. Biji yang berasal dari 2 tempat berbeda, ketika diekstraksi dengan dua metode tersebut tidak memberikan perbedaaan hasil bixin yang signifikan

  18. Børn af veteraner

    DEFF Research Database (Denmark)

    Frederiksen, Signe; Lausten, Mette

    Siden starten af 1990’erne har Danmark sendt over 30.000 soldater og andet personel på internationale missioner – langt de fleste til Eks-Jugoslavien, Afghanistan og Irak. Denne undersøgelse handler om de børn, hvis fædre har været udsendt på militære missioner i udlandet. For hvordan håndterer...... spørgsmål er fokus for undersøgelsen. Undersøgelsen bygger på en spørgeskemaundersøgelse blandt børn af veteraner på henholdsvis 7, 11 og 15 år. Undersøgelsen er gennemført for og i samarbejde med Veterancentrets Videncenter, som er en del af Forsvarsministeriets Personalestyrelse....

  19. Styring af international transfer pricing

    DEFF Research Database (Denmark)

    Reuther, Peter; Rossing, Christian Plesner

    2011-01-01

    Nærværende artikel introducerer international transfer pricing, dels som et skatteretligt fænomen og dels som et værktøj til planlægning og økonomisk styring af koncernforbundne selskaber i en multinational virksomhed (MNV). Med udgangspunkt i en case-analyse af MNV’en gives der et konkret eksempel...... på hvordan transfer pricing håndteres i praksis. Artiklens formål er at give et praktisk eksempel på at transfer pricing handler om at efterleve regler, ikke omgå dem. På baggrund af case-analysen argumenteres der for, at såvel akademikere som praktikere bør tage virksomhedens tilgang til...... international transfer pricing i betragtning, når økonomiske styringssystemer i en MNV skal anvendes til planlægning og opfølgning....

  20. Strategi til udbredelse og udvikling af aquaponik

    OpenAIRE

    Bartholin, Aline; Nielsen, Per

    2014-01-01

    Denne rapport omhandler, hvorledes aquaponik i fremtiden skal udbredes med henblik på at produktionsmetoden bliver en del af den etablerede fødevaresektor. Ud fra et interview med PlanteLaboratoriet som er en del af foreningen Akvaponisk Selskab, samt observationer af en workshop afholdt af PlanteLaboratoriet forsøger vi at kortlægge den førte strategi til udbredelse og udvikling af aquaponik, samt undersøge hvorledes aquaponik som innovation bliver taget imod af mulige adoptere. Empirien sam...

  1. Kortlægning af evalueringer og undersøgelser af vejledning knyttet til vejledning af unge i UU-regi

    DEFF Research Database (Denmark)

    Skovhus, Randi Boelskifte; thomsen, rie

    2013-01-01

    Kortlægning af evalueringer og undersøgelser af vejledning knyttet til vejledning af unge i UU-regi 2004-2013. Et arbejdspapir......Kortlægning af evalueringer og undersøgelser af vejledning knyttet til vejledning af unge i UU-regi 2004-2013. Et arbejdspapir...

  2. Logning af teledata i lyset af Tele2-dommen

    DEFF Research Database (Denmark)

    Lentz, Lene Wacher

    2017-01-01

    De danske teleudbydere har siden 2007 været underlagt en pligt efter logningsbekendtgørelsen til at registrere data om al telekommunikation for at sikre at data er tilgængelige ved en eventuel senere efterforskning. Logningspligten må nu revideres og i vidt omfang afvikles som følge af EU-domstol...

  3. Undersøgelse af kommunernes administration af bygningsreglementets elevatorkrav

    DEFF Research Database (Denmark)

    Grangaard, Sidse

    Denne rapport undersøger kommunernes praksis omkring administrationen af bygningsreglementets krav om elevator ved nybyggeri og ombygning. Blandt de 26 kommuner, der har deltaget i undersøgelsen, var der generelt konsensus om at stille krav om elevator ved nybyggeri. Kommunerne modtager kun meget...

  4. Betydningen af pesticider for forekomsten af vilde bier

    DEFF Research Database (Denmark)

    Bruus, Marianne; Dupont, Yoko Luise; Grant, Ruth

    Både i Danmark og andre steder er der observeret en nedgang i de insekter, der bestøver landmandens afgrøder og de vilde planter. Tilbagegangen falder sammen med, at landbrugsdriften er blevet mere intensiv, og anvendelsen af pesticider er øget. Vi ved imidlertid ikke, hvilken rolle pesticiderne ...

  5. Forekomst af resistente bakterier og forbrug af antibiotika til hunde

    DEFF Research Database (Denmark)

    Pedersen, Karl; Pedersen, Kristina; Jensen, Helene

    2007-01-01

    ), Pasteurella multocida (n=25), Bordetella bronchiseptica (n=14), Proteus spp. (n=29), og E. coli (n=449). I undersøgelsen anvendtes data fra VetStat databasen. Størstedelen af de antibiotika, der bruges til hunde er bredspektrede. Penicilliner med udvidet spektrum, cephalosporiner samt sulphonamider...

  6. Transkateterlukning af venstre atriums aurikel til forebyggelse af apoplexia cerebri

    DEFF Research Database (Denmark)

    Loupis, Anastasia M; De Backer, Ole; Ihlemann, Nikolaj

    2014-01-01

    In patients with atrial fibrillation (AF) and increased risk of stroke, oral anticoagulation (OAC) is the standard treatment for stroke prevention - however, this therapy also carries a high risk of bleeding. Percutaneous closure of the left atrial appendage (LAA) has been suggested to be an alte...

  7. PENINGKATAN KUALITAS LAYANAN RESTORAN MENGGUNAKAN MODIFIKASI METODE DINESERV DAN TRIZ

    OpenAIRE

    Anggraeni, Ira Tania; Daryanto, Yosef

    2014-01-01

    Pasta Banget merupakan salah satu restoran yang mengusung menu makanan Italia di Yogyakarta. Banyaknya pesaing sejenis menuntut Pasta Banget selalu melakukan peningkatan kualitas layanan. Untuk itu, perusahaan perlu mengetahui atribut layanan yang dinilai belum memuaskan oleh pelanggan dan mencari solusi perbaikannya. Metode yang digunakan untuk mengukur kualitas layanan adalah modifikasi dari DINESERV. Metode ini mengandung 32 atribut untuk mengukur kualitas pelayanan berdasarkan 5 dimensi k...

  8. KEEFEKTIFAN METODE SCHOOLYARD INQUIRY TERHADAP PENINGKATAN PEMAHAMAN SCIENCE VOCABULARY

    Directory of Open Access Journals (Sweden)

    S.D. Pamelasari

    2014-10-01

    Full Text Available Tantangan yang harus dihadapi dalam mengajar Bahasa Inggris di pada mahasiswa selain jurusan Bahasa Inggris adalah tingkat pemahaman kosakata yang rendah. Hal tersebut berpengaruh pada pemahaman materi mereka, berdasarkan permasalahan tersebut metode schoolyard inquiry digagas untuk membantu meningkatkan pemahaman mereka dalam memahami science vocabulary sebagai metode alternative untuk membantu mereka belajar. Schoolyard inquiry adalah metode belajar kosakata secara mandiri di luar kelas. Hasil analisis menunjukkan bahwa pemahaman science vocabulary mahasiswa Pendidikan IPA FMIPA Unnes mengingkat secara signifikan dan mencapai tingkat tinggi pada level pemahamannya. Melalui metode ini mahasiswa juga dapat mengintegrasikan pembelajaran Bahasa Inggris dengan metode saintifik. Mahasiswa juga memberikan respon positif terhadap metode schoolyard inquiry  ini. The challenge that should be faced of teaching English for non English department students is the low level of students’ vocabulary mastery. It affects their comprehension of material, therefore to help students to master the science vocabulary schoolyard inquiry method was proposed to be used as alternative method to improve students’ vocabulary mastery. Schoolyard inquiry is a method of independent learning that is conducted outside the class. The result showed that the students’ science vocabulary mastery improved significantly most of students reached high level of science vocabulary mastery. Through Schoolyard Inquiry method Students were be able to learn English by applying the scientific skill. The students also gave positive responses of learning vocabulary by using alternatif method of schoolyard inquiry.

  9. Har lægers risikovillighed og symptomer på udbrændthed betydning for brugen af PSA-tests?

    DEFF Research Database (Denmark)

    Pedersen, Anette Fischer; Carlsen, Anders Helles; Vedsted, Peter

    2016-01-01

    Denne artikel er baseret på undersøgelsen "Association of GP's risk attitudes, level of empathy, and burnout status with PSA testing in primary care, som er publiceret i British Journal of General Practice, December 2015; 65(44): 845-851......Denne artikel er baseret på undersøgelsen "Association of GP's risk attitudes, level of empathy, and burnout status with PSA testing in primary care, som er publiceret i British Journal of General Practice, December 2015; 65(44): 845-851...

  10. ANALISIS PERBANDINGAN PENENTUAN HARGA CALL OPTION DENGAN MENGGUNAKAN METODE BLACK-SCHOLES DAN METODE SIMULASI MONTE CARLO

    Directory of Open Access Journals (Sweden)

    Krishna Kusumahadi

    2016-03-01

    Full Text Available Abstract - This study was conducted to determine the accuracy of the Black-Scholes method compared with the Monte Carlo simulation method to predict the price of a call option on KOMPAS 100 Index at maturity in 1 month, 2 months, and 3 months. The method used in this research is descriptive analysis by using historical data and perform price comparisons with absolute error value to determine whether the Black-Scholes method is more accurate than the method of Monte Carlo simulation in maturities. Result from this research; found that the price value at maturity absolute error for 1 month is 3.76 and the Black-Scholes method for Monte Carlo simulation method is 0:03. Value price absolute error at maturity for 2 months is 3.76 and the Black-Scholes method for Monte Carlo simulation method is 0.03. Value price absolute error on the maturity using Black-Scholes method for 3 months is 3.48 and 2.99 for the Monte Carlo method. Judging from the data obtained that the Monte Carlo method is more accurate than the Black-Scholes method to predict the price of the call option KOMPAS 100 Stock Index in the period of 1 month, 2 months, and 3 months. Implications for investors and capital market participants is when investors want to invest in stocks included in the KOMPAS 100 Index, Monte Carlo simulation method could be use to predict the price of the call option.  It is also advisable to compare with other methods such as GARCH, Neural Network, etc.   Keywords: Black-Scholes, Monte Carlo, Garch, and Artificial Neural Networks.   Abstrak - Penelitian ini dilakukan untuk mengetahui keakuratan Metode Black Scholes dibandingkan dengan Metode Simulasi Monte Carlo dalam memprediksi harga call option Indeks KOMPAS 100 pada saat jatuh tempo 1 bulan, 2 bulan, dan 3 bulan. Metode penelitian yang digunakan dalam penelitian ini adalah deskriptif analitis dengan menggunakan data-data historis, dan melakukan perbandingan nilai price absolute error untuk mengetahui

  11. Ledelse af ledelse i udviklingssamtaler

    DEFF Research Database (Denmark)

    Ryberg, Birgit

    2012-01-01

    Hvem sætter dagsorden for udvikling? Udviklingssamtaler er præget af forskellige ledende interessser, der ikke blot konkurrerer om at vinde indflydelse, men også skaber tvetydigheder og doublebind, som ledere og medarbejdere må forholde sig til....

  12. Kvalifikation af skattesubjekter og traktatbeskyttelse

    DEFF Research Database (Denmark)

    Bolander, Jane

    2014-01-01

    Artiklen er baseret på generalrapporten og den danske nationalrapport om emnet “Qualification of taxable entities and treaty protection”, der er udarbejdet til IFA-kongressen 2014 i Mumbai. Artiklen opsummerer konklusionerne fra generalrapportens komparative studier, og forhold af særlig dansk...

  13. Afgivelse af formue til trusts

    DEFF Research Database (Denmark)

    Feldthusen, Rasmus Kristian

    2009-01-01

    Kravet om at en stifter skal have foretaget en "uigenkaldelig og effektiv udskillelse" for at dansk skatteret vil anerkende at der foreligger en trust vurderes. Kravet er senest lagt til grund i SKM 2009.249 SR. Forfatteren opfordrer til, at SKAT i stedet foretager en konkret vurdering af selve...

  14. Digitalisering af det eksisterende byggeri

    DEFF Research Database (Denmark)

    Sørensen, Nils Lykke; Øien, Turid Borgestrand

    2010-01-01

    Digitalisering af det eksisterende byggeri er en vanskelig og uendelig opgave. Det giver kun mening at digitalisere eksisterende byggeri, når man har et konkret behov, og da kun at indhente og lagre de informationer, som man strategisk eller konkret har behov for. Erhvervs og Byggestyrelsen har i...

  15. Evaluering af Animationsbaseret Sketching Workshop

    DEFF Research Database (Denmark)

    Vistisen, Peter; Hautopp, Heidi

    2017-01-01

    Formålet med workshoppen var at styrke forskere fra Ild-Lab i at anvende animationsbaseret sketching og prototyping i deres undervisning således, at undervisningen understøtter designbaserede tilgange, der er mere produkt- og teknologiorienteret. På denne led kan vi styrke materialiseringen af hu...

  16. Udredning af xerostomi og hyposalivation

    DEFF Research Database (Denmark)

    Pedersen, Anne Marie Lynge; Dynesen, Anja Weirsøe; Jensen, Siri Beier

    2011-01-01

    Mundtørhed kræver grundig undersøgelse Xerostomi er ofte associeret til betydelig nedsat spytsekretion, men kan forekomme, uden at der objektivt kan påvises nedsat spytsekretion. Udredning af patienter, som klager over mundtørhed, bør således altid inkludere en omhyggelig anamnese, en detaljeret ...

  17. Danskernes brug af nyhedsmedier 2018

    DEFF Research Database (Denmark)

    Schrøder, Kim Christian; Ørsten, Mark; Eberholst, Mads Kæmsgaard

    Hvis der er ét begreb, der i 2018 er blevet slået fast med syvtommersøm i den offentlige debat verden over, så er det ’fake news’! Bekymringen over fænomenet er vokset eksplosivt, samtidig med at det er blevet mere og mere uklart, hvad ’fake news’ egentlig dækker over. I dette års analyse af...... brugen af nyhedsmedier sætter Reuters Institute Digital News Report, og også denne specialrapport om Danmark, analytisk fokus på ’fake news’ og kaster lys over borgernes opfattelse af fænomenet på en måde, så vi får nuancerne i det komplekse begreb med. Et andet emne, der er blevet diskuteret...... for fake news og egne oplevelser af fake news, og danskernes viden om, hvordan nyheder bliver lavet (nyheds-literacy)....

  18. Overholdelse af kravene i bygningsreglementet

    DEFF Research Database (Denmark)

    Christensen, Toke Haunstrup; Jensen, Jesper Ole; Gram-Hanssen, Kirsten

    Denne rapport undersøger, hvorvidt bestemmelserne i bygningsreglementet BR10 omkring energieffektivisering ved renoveringen af bygninger bliver overholdt. Der fokuseres især på parcelhuse, da problemet med manglende overholdelse menes at være størst her, ligesom potentialet for energibesparelser...

  19. Ledelsesroller i globalisering af cleantech

    DEFF Research Database (Denmark)

    Knudsen, Poul Frøjk; Tambo, Torben

    2011-01-01

    nyeste teknologier, globalisering af salg, installation og produktion, og at vækstdagsordenen er blevet fastholdt. Den globale satsning på cleantech sætter disse ledelsesmæssige kvaliteter under pres. Dette studie ser på en mellemstor komponentleverandør til vindindustrien, og dennes kamp...

  20. Virksomhedernes opfattelse af arbejdsmarkedets "restgrupper"

    DEFF Research Database (Denmark)

    Larsen, Christian Albrekt

    2010-01-01

    Artiklen beskriver, hvorledes danske arbejdsgivere opfatter ældre ledige, ledige indvandrere og ledige med lang forudgående ledighed. Det teoretiske udgangspunkt er, at arbejdsmarkedets fundamentale informationsproblemer fører til brug af statistisk diskrimination og frygt for «lemons». Analyserne...

  1. På sporet af fremtidens konkurrenceevne

    DEFF Research Database (Denmark)

    Boje Rasmussen, Martin Møller

    2013-01-01

    Michael Porter og Harvard Business School står bag nyt banebrydende initiativ, Social Progress Index, som måler et samfunds evne til at skabe livskvalitet for borgerne. Dette aktualiserer debatten om udviklingen af helt nye konkurrencemodeller. Der er tale om et valg mellem tre forskellige typer...

  2. PEMBUATAN PERANGKAT LUNAK DATA MINING UNTUK PENGGALIAN KAIDAH ASOSIASI MENGGUNAKAN METODE APRIORI

    Directory of Open Access Journals (Sweden)

    Leo Willyanto Santoso

    2003-01-01

    Full Text Available There are many theories and approaches that have been developed to find pattern and association rule. One of the methods that have been developed is apriori method. Any method previously finds itemset using graph approaches that have weakness on huge memory usage. The lack of memory will affect many item that able to process. Further, many approaches use internal data structure that very complex and need resource addition to do this computation. In this research, apriori method was used to get association rule that describe relation between items in transactional database. The database that used is three kinds that have different in total transactional. Based on the empirical test, can be concluded that computational time to get asociation rule is influenced by the number of transaction and using "tidlist" data structure in apriori methods can reduce time because only read database one time. Abstract in Bahasa Indonesia : Banyak teori dan pendekatan yang dikembangkan untuk memperoleh hasil penemuan kaidah asosiasi dan pola. Salah satu metode yang dikembangkan yaitu dengan menggunakan metode apriori. Beberapa dari metode sebelumnya melakukan pencarian itemset dengan pendekatan graf asosiasi yang memiliki kelemahan pada penggunaan memori yang besar. Keterbatasan memori jelas akan mempengaruhi banyaknya item yang bisa diproses. Lebih jauh lagi, sebagian besar pendekatan menggunakan struktur data internal sangat rumit yang tidak bersifat lokal dan membutuhkan tambahan sumber daya dan banyak komputasi. Pada riset ini, metode apriori digunakan untuk memperoleh kaidah asosiasi yang menggambarkan hubungan antar item pada database transaksional. Database yang digunakan ada tiga buah yang masing-masing memiliki jumlah transaksi yang berbeda. Dari hasil pengujian empiris dapat ditarik kesimpulan bahwa waktu komputasi untuk menghasilkan kaidah asosiasi dipengaruhi oleh jumlah transaksi dan Penggunaan struktur data "tidlist" pada algoritma apriori

  3. PENGAJARAN POKOK BAHASAN PESAWAT SEDERHANA DENGAN METODE EKSPERIMEN PADA SISWA SEKOLAH DASAR

    Directory of Open Access Journals (Sweden)

    Z. Muna

    2011-09-01

    Full Text Available Penelitian ini bertujuan untuk mengetahui apakah penerapan metode eksperimen pada pengajaran pokok bahasan pesawatsederhana dapat meningkatkan hasil belajar siswa sekolah dasar. Penerapan metode ini dilakukan pada siswa kelas V semester 2SD Negeri Tayu Wetan 02. Penelitian dilaksanakan dalam bentuk tindakan kelas yang dilaksanakan dalam tiga siklus denganmateri yang berbeda. Setiap siklus terdiri dari 4 tahap, yaitu: perencanaan, pelaksanaan, observasi dan refleksi. Data hasil belajarkognitif diperoleh melalui postest pada akhir siklus, hasil belajar afektif dan psikomotorik diperoleh melalui lembar observasi,sedangkan tanggapan siswa diperoleh malalui angket. Hasil penelitian menunjukkan bahwa pengajaran pokok bahasan pesawatsederhana dengan metode eksperimen yang dilakukan dapat meningkatkan hasil belajar siswa.  The research aimed to investigate whether the implementation of an experimental method on the topic of simple mechanic toolsable to improve primary school students' achievement. The method implemented on grade V second semester student of StatePrimary School 02 Tayu Wetan. The study is conducted through classroom action research in three cycles with different lessonmaterials. Each cycle consisted of four states, namely: planning, conducting, observation, and reflection. The cognitive dataobtained by the post test at the end of each cycle, the affective and psychomotorics from the observation sheets, and the student'sresponses through questionnaire. The study proves that implementing the experiment method of the instructions on simplemechanic tools topic is proven able to improve student learning achievement.Keywords: instructions; experiment method; simple mechanic tools

  4. Sygeplejestuderendes brug af portfolio i klinisk undervisning

    DEFF Research Database (Denmark)

    Hjorth, Anne Charlotte Overgaard; Bruhn, Helle

    2014-01-01

    Brugen af portfolio var mangelfuld, men et udviklingsprojekt i samarbejde med den kommunale sygepleje motiverede både sygeplejestuderende og kliniske vejledere til at anvende læringsdelen af portfolio aktivt.......Brugen af portfolio var mangelfuld, men et udviklingsprojekt i samarbejde med den kommunale sygepleje motiverede både sygeplejestuderende og kliniske vejledere til at anvende læringsdelen af portfolio aktivt....

  5. Udviklingen af rumopfattelsen 1600-2000

    DEFF Research Database (Denmark)

    Brock, Steen

    2010-01-01

    Hovedtræk af rumopfattelsens idehistorie fra Descartes til Wittgenstein med speciel vægt på Kant, værkbegrebet, modelbegrebet og den fænomenologiske opfattelse af rummet som handlingens sted......Hovedtræk af rumopfattelsens idehistorie fra Descartes til Wittgenstein med speciel vægt på Kant, værkbegrebet, modelbegrebet og den fænomenologiske opfattelse af rummet som handlingens sted...

  6. Final environmental impact statement for the Nevada Test Site and off-site locations in the State of Nevada. Volume 1, Appendices A-F

    International Nuclear Information System (INIS)

    1996-08-01

    This sitewide EIS evaluates the potential environmental impacts of four possible land-use alternatives being considered for the Nevada Test Site (NTS), the Tonopah Test Range, and the formerly operated DOE sites in the state of Nevada: the Project Shoal Area, the Central Nevada Test Area, and portions of the Nellis Air Force Range Complex. Three additional sites in Nevada-Eldorado Valley, Dry Lake Valley, and Coyote Spring Valley-are evaluated for collocation of solar energy production facilities. The four alternatives include Continue Current Operations (No Action, continue to operate at the level maintained for the past 3 to 5 years); Discontinue Operations 1 (discontinue operations and interagency programs); Expanded Use (increased use of NTS and its resources to support defense and nondefense programs); and Alternate Use of Withdrawn Lands (discontinue all defense-related activities at NTS; continue waste management operations in support of NTS environmental restoration efforts; expand nondefense research). Environmental impacts were assessed for each alternative by analyzing, to the extent possible, the discrete and cumulative environmental impacts associated with Defense Waste Management, Environmental Restoration, Nondefense Research and Development, and Work for Others Programs. A framework for a Resource Management Plan is included as Volume 2 of this EIS and represents the development of an ecosystem based planning process closely integrated with the National Environmental Policy Act process. This EIS, among other things, analyzed the impacts of transportation of low level waste, and site characterization activities related to the Yucca Mountain Project but did not analyze the suitability of the site as a repository. This EIS does not analyze the suitability of the Yucca Mountain site as a repository as this is an action beyond the scope of the EIS. Volume 3 of this EIS contains the public comments and the responses to the comments

  7. APLIKASI TES KEPRIBADIAN UNTUK PENEMPATAN KARYAWAN MENGGUNAKAN METODE MBTI (MYERS-BRIGGS TYPEINDICATORBERBASISWEB (STUDI KASUS: PT. WINATA PUTRA MANDIRI

    Directory of Open Access Journals (Sweden)

    Fiftin Noviyanto

    2012-04-01

    Full Text Available Penempatan karyawan merupakan salah satu fungsi terpenting dalam Manajemen Sumber Daya Manusia. Penempatan karyawan yang tepat sesuai dengan harapan, bakat dan kepribadian karyawan, akan mampu meningkatkan motivasi, produltifitas dan kepuasan kerja. Salah satu tes penunjang penempatan karyawan adalah tes kepribadian. Tes kepribadian yang dilakukan menggunakan metode Myers-Briggs Type Indicator (MBTI. Pelaksanaan tes yang dilakukan manual dan terpisah antara kantor pusat dan kantor cabang membuat PT. Winata Putra Mandiri memerlukan waktu yang lama untuk melihat keseluruhan hasil tes seluruh karyawan. Tujuan penelitian ini membuat aplikasi tes kepribadian yang dapat diakses melalui internet adalah agar karyawan dapat melihat hasil tes kepribadian secara langsung dan cepat serta dapat mengintegrasikan hasil tes dari kantor pusat dan kantor cabang. Pengumpulan data dilakukan dengan berbagai metode antara lain : Studi kepustakaan, metode interview dan browsing. Model proses yang digunakan adalah waterfall yang terdiri dari analisa kebutuhan sistem, perancangan, implementasi dan pengujian. Pada perancangan sistem dimulai dari perancangan proses, perancangan tabel, perancangan menu dan perancangan interface. Pada tahap implementasi menggunakan PHPMyAdmin untuk membangun basisdata dan PHP untuk teknologi Serverside. Tahap terakhir adalah pengujian sistem yang dilakukan dengan Black Box Test dan Alpha Test. Hasil penelitian ini berupa aplikasi tes kepribadian menggunakan metode Myers- Briggs Type Indicator (MBTI berbasis web yang dapat membantu PT. Winata Putra Mandiri dalam mengintegrasikan hasil tes seluruh karyawan baik dari kantor pusat maupun kantor cabang

  8. Succesfulde virksomheder ledes af mænd - Ikke succesfulde af kvinder?

    DEFF Research Database (Denmark)

    Madsen, Mona Toft; Madsen, Henning; Neergaard, Helle

    fra amerikanske og britiske undersøgelser (Schein, 1973, 75, 96; Ryan et al., 2005a) ved at teste dem i et kulturelt miljø karakteriseret af mere feminine ledertræk (Hofstede, 1991). Undersøgelsen tager udgangspunkt i et sæt af person-karakteristika, der er blevet anvendt til at undersøge sammenfald...... mellem mandlige karakteristika og succesfuld ledelse (Schein, 1973, 75, 96). På lige fod med nyere britiske undersøgelser (Ryan et al. 2005a), er den aktuelle undersøgelse imidlertid udvidet til også at omhandle lederes perceptioner i forhold til ledelse i virksomheder uden succes. Resultaterne viser...

  9. Identifikation af referencevandløb til implementering af vandrammedirektivet i Danmark

    DEFF Research Database (Denmark)

    Kristensen, Esben Astrup; Baattrup-Pedersen, Annette; Skriver, Jens

    Definition og beskrivelse af referencetilstanden er centralt for implementering af vandrammedirektivet, da bedømmelse af den økologiske tilstand sker som afvigelsen fra den upåvirkede referencetilstand. I denne rapport præsenteres analyser af danske, udenlandske og historiske data med det formål...

  10. Aspekter af integrationsindsatsen i 6 kommuner

    DEFF Research Database (Denmark)

    Rosdahl, Anders

    Dette arbejdspapir præsenterer resultaterne af en mindre kvalitativ undersøgelse af kommuners indsats for at bringe nyankomne flygtninge og indvandrere i beskæftigelse. Undersøgelsen er en opfølgning på en kvantitativ benchmarkanalyse, som er gennemført af Amternes og Kommunernes Forskningsinstit...

  11. Registrering af biometriske og biologiske personoplysninger

    DEFF Research Database (Denmark)

    Blume, Peter Erik; Herrmann, Janne Rothmar

    2009-01-01

    Med udgangspunkt i menneskeretsdomstolens Marper dom drøftes i artiklen indretningen af dansk rets regler om registrering af fingeraftryk og dna-profil med tilhørende biologisk materiale, og om dommen nødvendiggør ændringer af disse regler....

  12. Delegation af lovgivningsmagt: risiko for ringere regulering?

    DEFF Research Database (Denmark)

    Pedersen, Morten Jarlbæk; Christensen, Geert Laier; Ravn, Jacob

    2016-01-01

    kortsigtetede, politiske incitamenter. Samtidig underlægges delegation ikke samme grad af kvalitetskontrolmekanismer som almindelig lovgivning; dette kunne ellers kompensere for den mere politiserede delegation. En øget brug af bekendtgørelser kan derfor betyde en stigende risiko for regulering af lavere...

  13. Registrering og Benchmarking af Modus 2 Forskning

    DEFF Research Database (Denmark)

    Duus, Henrik Johannsen; Jørgensen, Jens E.

    2004-01-01

    Fremvæksten af modus 2 forskning stiller krav om en revurdering af højere læreanstalters evaluerings- og meriteringspraksis. Den endimensionale prioritering af modus 1 forskning såvel som dennes ligeså endimensionale evaluering via publikationer må afvises som utidssvarende. Som en konsekvens her...

  14. Regulering af jødiske kroppe

    DEFF Research Database (Denmark)

    Schleicher, Marianne

    2014-01-01

    på teori dels af Michel Foucault om, hvordan kultur sikrer sin egen overlevelse ved at indsamle viden om bl.a. kroppe med henblik på at regulere brugen af dem, dels af Judith Butler, der bl.a. forklarer, hvordan kultur trods alt er åben for såkaldt subversion, idet det bidrager til at udvide og...

  15. Magtens repræsentation af danskhed

    DEFF Research Database (Denmark)

    Madsen, Carsten

    2016-01-01

    Med udgangspunkt i Maurice Charlands begreb om konstitutiv retorik og Jacques Derridas dekonstruktion af repræsentationslogik foretager artiklen en kritisk analyse og fortolkning af repræsentationen af dansk nationalidentitet, sådan som den kommer til udtryk i Dronning Margrethes nytårstaler...

  16. Prøvetagning af grundvand

    DEFF Research Database (Denmark)

    Sørensen, Inga

    Bogen fokuserer på prøveatgning af grundvand og drikkevand til forskellige formål såsom undersøgelse af forurenede grunde, grundvandsmonitering samt produktion af drikkevand. Da grundvand i sagens natur findes under jordoverfladen, beskriver bogen også væsentlige forhold om hydrogeologi og...

  17. Modelanalyser af mobilitet og miljø

    DEFF Research Database (Denmark)

    Christensen, Linda; Gudmundsson, Henrik

    Begrebet bæredygtig transport diskuteres og ved hjælp af persontrafikmodellen ALTRANS belyses mulighederne for at fremme bæredygtig udvikling gennem en række scenarier. Desuden præsenteres en mere detaljeret analyse af ændringer i CO2-belastningen ved forbedring af den kollektive trafiks servicen...

  18. Hærdeteknologi og Holdbarhed af Betonkonstruktioner

    DEFF Research Database (Denmark)

    Sørensen, Eigil V.

    Kurset Hærdeteknologi og Holdbarhed af Betonkonstruktioner afholdes i 1. og 2. periode af forårssemesteret 2006. Kurset sigter på at give de studerende en grundlæggende forståelse af, hvorledes man designer og udfører holdbare betonkonstruktioner....

  19. Påvisning af PCV2

    DEFF Research Database (Denmark)

    Neumann, Katrine; Buse, Katja Strøm; Hjulsager, Charlotte Kristiane

    2018-01-01

    Mængden af PCV2-virus i poolede serumprøver kan anvendes til at finde grise med meget PCV2-virus, hvorimod mængden af PCV2-virus i spyt og fæces er velegnede til at vurdere tilstedeværelsen af eller tidspunktet for en begyndende PCV2-infektion...

  20. Påvisning af PCV2

    DEFF Research Database (Denmark)

    Neumann, Katrine; Buse, Katja Strøm; Hjulsager, Charlotte Kristiane

    Mængden af PCV2-virus i poolede serumprøver kan anvendes til at finde grise med meget PCV2-virus, hvorimod mængden af PCV2-virus i spyt og fæces er velegnede til at vurdere tilstedeværelsen af eller tidspunktet for en begyndende PCV2-infektion...

  1. Development and testing af a model for the supergene distribution of uranium and accompanying elements around a known uranium deposit associated with an alkaline intrusion

    International Nuclear Information System (INIS)

    Rose-Hansen, J.; Soerensen, H.

    1983-01-01

    The Ilimaussaq intrusion may be characterized as a geochemically abnormal region, since its rocks are strongly enriched in a number of rare elements, including elements which accompany uranium in deposits in other parts of the world. Examples are the rare earth metals, Nb, Ta, Be, Li, and metals as Cu, Pb, Zn, Mo and Sn. It was proposed to develop and test a model for the supergene distribution of uranium and accompanying elements around a known uranium deposit associated with an alkaline intrusion. The most promising results are those obtained by the PCA technique. For a more preliminary study of a region fjord and river sediments might be the sampling target. These sediments were found to be mixtures in which the proportion of material from the Ilimaussaq U-deposit could be evaluated by the PCA technique involving a distance function related to the loadings in the first principal dimen- sion of the elements characterizing the Ilimaussaq Intrusion. One of the major features of the material sampled in this study is the general high degree of preservation in the sub-arctic environment of the primary igneous mineralogy in the sediments, and in other areas, the structure of data should be investigated in order to test them in this respect. One obvious way is X-ray diffraction analysis. It was indicated that uranium is selectively absorbed on the organic material in lakes and is able to reflect the concentration of U in the lake waters, informing the ultimate potential of the drainage areas in question. It is however yet to be established whether the correlation of uranium and the organic material of the lake sediments actually reflects the long term U concentrations of the lake water. The use of the cluster analysis and discriminant analysis techniques proved to be of lesser value in this project. (author)

  2. METODE ANALYTICAL HIERARCHY PROCESS: SISTEM REKOMENDER DATABASE SOFTWARE

    Directory of Open Access Journals (Sweden)

    Doni Purnama Alam Syah

    2014-09-01

    Full Text Available Abstract - Rekomender electoral system is a database software application that can be used to look for alternative software database selection strategy, the method of analytical hierarchy process (AHP. Rekomender systems needed by companies that have a large enough data processing such as the Bureau of Bina Sarana IT Information, expensive investments in the provision of Information Technology (IT makes IT Bina Sarana Information Bureau to be more careful in determining the selection of database software. This study focuses on research of database software selection system with the method of analytical hierarchy process (AHP, a case study of IT Bureau Bina Sarana Infromatika with the observation unit administrator. The results of the study found that there are two (2 main criteria, namely the selection of technology and a user with an alternative strategy My SQL, Oracle and SQL Server. Having tested the system rekomender My SQL result that the top priority in the selection of database software with a 41% weighting, followed by SQL Server and Oracle 39% 21%. The end result of a system that has been created rekomender concluded that the Bureau of Bina Sarana Informatics IT can define strategy alternatives before determining database software to be used more effectively and efficiently. Abstrak¬¬ - Sistem rekomender pemilihan database software merupakan aplikasi yang dapat digunakan untuk mencari alternatif strategi pemilihan database software, dengan metode analytical hierarchy process (AHP. Sistem rekomender dibutuhkan oleh perusahaan yang memiliki pengolahan data yang cukup besar seperti Biro TI Bina Sarana Informatika, mahalnya investasi pada penyediaan Teknologi Informasi (TI membuat Biro TI Bina Sarana Informatika lebih berhati-hati dalam menentukan pemilihan database software. Penelitian ini berfokus kepada penetilian tentang sistem pemilihan database sofware dengan metode analytical hierarchy process (AHP, studi kasus Biro TI Bina Sarana

  3. Prednosti metode Montessori pri obravnavi oseb z demenco

    Directory of Open Access Journals (Sweden)

    Andreja Ljubič

    2017-03-01

    Full Text Available Uvod: Demenca je kronično obolenje s tendenco upadanja kognitivnih sposobnosti obolelega. Uporaba metod za obvladovanje in trening osnovnih življenjskih aktivnosti, ki omogočajo daljše obdobje samostojnega življenja pacienta z demenco, je v tujini uveljavljena z različnimi novejšimi koomplementarnimi pristopi. Ena izmed uveljavljenih metod je pristop Marie Montessori, prilagojen odraslim pacientom z demenco. V članku je predstavljena metoda montessori pri obravnavi pacienta z demenco in njeni učinki na kakovost življenja pacienta z demenco. Metode: Uporabljena je bila deskriptivna raziskovalna metodologija s pregledom domače in tuje literature. Za prikaz pregleda petih preko spleta dostopnih podatkovnih baz in odločanja o uporabnosti pregledanih virov je bila uporabljena metoda PRISMA. V končni pregled literature je bilo ključenih 19 člankov, objavljenih do maja 2016. Za obdelavo podatkov je bil uporabljen model analize konceptov. Večina zajetih raziskav je bila izvedena v Združenih državah Amerike. Rezultati: Po pregledu raziskav so bila identificirana tri tematska področja: (1 vpliv metode montessori na sodelovanje in prizadevanje, (2 vpliv metode montessori na vedenje, povezano s hranjenjem, in (3 vpliv metode montessori na širšo skupino kognitivnih sposobnosti. Diskusija in zaključek: Kljub majhnemu številu člankov, ki opisujejo uporabo metode montessori pri obravnavi pacientov z demenco, metodo lahko predstavimo kot učinkovito. Avtorji raziskav ugotavljajo, da pristop ne le omogoča ohranjanje kognitivnih sposobnosti, temveč le-te celo izboljšuje.

  4. Produktion og afsætning af nicheprodukter

    DEFF Research Database (Denmark)

    Jensen, Jonas Baungaard; Hansen, Henning Otte

    2016-01-01

    . Egnsmærker opnår generelt en merpris på 20-30 pct. Det er dog bemærkelsesværdigt, at landmanden “kun” har omkring 13 pct. af forbrugerkronen på Lammefjords-kartofler. Her er der tale om unikke produkter, hvor det i praksis udelukkende er landmanden og landmandens placering og produktion, som skaber de unikke...

  5. Barrierer for ibrugtagning af videooptaget universitetsundervisning

    DEFF Research Database (Denmark)

    Rattleff, Pernille

    2009-01-01

    tilgængelige for studerende og andre interesserede. Der kan således iagttages nogle barrierer i forhold til ibrugtagning af videooptaget undervisning på universitetsniveau, idet underviserne for en umiddelbar betragtning tilsyneladende for det første har nogle forbehold af psykologisk, for det andet af...... begrebsafklaring, præsenterer forfatterne i denne artikel erfaringerne med tilbud af videostreamet og podcastet universitetsundervisning til studerende på Danmarks Pædagogiske Universitetsskole med henblik på en diskussion af de potentialer og især de barrierer, der kan iagttages i forhold til en mere systematisk...

  6. Kunst som metode i interaktiv forskning

    DEFF Research Database (Denmark)

    Jensen, Julie Borup

    for at påvirke feltet og skabe ny viden i interaktionsprocesser, bygger dette på en antagelse om, at interaktion mellem mennesker betjener sig af såkaldte medier for kommunikation og læring (Säljö 2003:196, Bruner 1996:76). I denne forståelse kan et medium eksempelvis være sproget, skriften, praksisrutiner, men...... et medium kan også være kunst og kunstværker. Kunstværker kan ses som et udtryk for en given kulturs antagelser om virkeligheden (Bruner 1996:), men også som en provokation eller udfordring til denne virkelighedsopfattelse (Darsø 2004). I forlængelse heraf kan kunst og kunstværker ses som...

  7. Domesticeringen af Ford i Danmark

    DEFF Research Database (Denmark)

    Wagner, Michael

    2011-01-01

    Det amerikanske automobilfirma Ford Motor Company (1903) med hovedkvarter i Detroit begyndte at drive forretning i Danmark omkring 1906. Dermed havde Ford tidligt fået et stærkt fodfæste i Nordeuropa, som udviklingen i salget af Ford automobiler de næste årtier til fulde skulle demonstrere....... Artiklen har fokus på Ford Motor Companys aktiviteter som agent for fordismen i en dansk kulturel kontekst. Hvordan reagerede de danske forretningsforbindelser, politikere, arbejdere og deres fagforeninger, samt forbrugerne på fordismen og de amerikanske forretningsmetoder. På hvilken måde blev forbrugeren...... defineret og inklineret af Ford Motor Company og de danske forhandlere gennem annoncer og andre marketingstiltag, og hvordan blev Ford automobilet kulturelt iscenesat som en ’dansk’ bil....

  8. Vaccination af slagtekalve mod BRSV

    DEFF Research Database (Denmark)

    Graumann, Anne Mette; Larsen, Lars Erik

    2009-01-01

    Rspiratory Suncytial Virus) blev fundet til at være den typisk fundne virus, der forårsager lungebetændelse. Vacciner imod BRSV er tilgængelige på markedet, men de er aldrig blevt afprøvet systematisk under danske forhold. Formålet med dette forsøg er at undersøge effekten af to forskellige...

  9. Domesticeringen af Ford i Danmark

    DEFF Research Database (Denmark)

    Wagner, Michael

    forstand voksede sig stor og stærk i den selv samme periode som Ford Motor Company gennem udbredelse af bilismen. Det var især FDM's medlemsblad MOTOR, som løbende bragte en stor mængde artikler om Ford Motor Company og reklamer for firmaets produkter i hele perioden 1906-1940. De to store aktører...

  10. Resumé af Forskning

    DEFF Research Database (Denmark)

    Grøn, Sisse

    2009-01-01

      I forfatternes egen forskning har de brugt den meget anvendte kulturteoretiker, Geert Hofstedes metode til at analysere kultur. Det gør næsten alle som beskæftiger sig med kultur i de maritime fag i disse år, men til forskel fra de fleste andre, diskuterer de hvor anvendelig Hofstedes 40 år gamle...... kategorier er. Desuden sammenligner de indflydelsen fra hans kategorier med ledelsens indflydelse, og analyserer hvad som spiller mest ind. Det gør sidstnævnte. Derfor er dette studie vigtigt fordi det viser at det ikke er den kultur medarbejderne kommer med, som får dem til at arbejde usikkert, men derimod...

  11. Resumé af forskning

    DEFF Research Database (Denmark)

    Grøn, Sisse

      I forfatternes egen forskning har de brugt den meget anvendte kulturteoretiker, Geert Hofstedes metode til at analysere kultur. Det gør næsten alle som beskæftiger sig med kultur i de maritime fag i disse år, men til forskel fra de fleste andre, diskuterer de hvor anvendelig Hofstedes 40 år gamle...... kategorier er. Desuden sammenligner de indflydelsen fra hans kategorier med ledelsens indflydelse, og analyserer hvad som spiller mest ind. Det gør sidstnævnte. Derfor er dette studie vigtigt fordi det viser at det ikke er den kultur medarbejderne kommer med, som får dem til at arbejde usikkert, men derimod...

  12. ANTICOAGULANT TREATMENT OF AF: FOCUS ON THE WARFARIN DOSAGE

    Directory of Open Access Journals (Sweden)

    Y. Kovbasniuk

    2015-10-01

      Summary Authors analyzed the results of some studies of AF and warfarin dosing. Than investigation of 75 patient with AF (permanent type was performed. According to demographic, anthropometric data and related conditions (diabetes mellitus type 2, myocardial infarction, acute cerebrovascular ischemia, pulmonary embolism, alcohol abuse - drinking more than one ounce of ≥3 weekly predictive model of warfarin dosing was developed: warfarin dose = 0.097 * BMI - 0.03 * AGE + 0.30 *ASS.Status+ 0.02 *WC+ 1, 88. After testing of final model authors concluded what derived formula was representative, to determine the optimal dose of warfarin given to patient based on demographic characteristics. Considering all of the abovementioned, this model can be recommended for use determining the treatment strategy in patients with AF. Keywords: anticoagulant treatment, warfarin, atrial fibrillation.

  13. Fermentering af korn øger fordøjeligheden af næringsstoffer

    DEFF Research Database (Denmark)

    Pedersen, Anni Øyan; Jørgensen, Henry Johs. Høgh; Knudsen, Knud Erik Bach

    2010-01-01

    Et fordøjelighedsforsøg har vist, at energiværdien af byg og hvede steg ved fermentering. Effekten var størst ved fermentering af byg, hvor fordøjeligheden af organisk stof for enden af tyndtarmen steg statistisk sikkert med 9 %. Ved fermentering af hvede steg fordøjeligheden af organisk stof...... af vand og dels CO2-produktion og dermed tørstoftab. Anbefaling om beregning af energiværdi i fermenteret korn vil blive foretaget ud fra resultaterne af et produktionsforsøg med slagtesvin, som er under publicering. Fosforudnyttelse i fermenteret korn undersøges yderligere i et produktionsforsøg med...

  14. OPTIMALISASI PEMECAHAN MASALAH TRANSPORTASI MENGGUNAKAN METODE NWC, INPEKSI, DAN VAM

    Directory of Open Access Journals (Sweden)

    Ni Ketut Kertiasih

    2013-08-01

    Full Text Available Sistem optimalisasi dalam pemecahan masalah transportasi menggunakan metode NWC (north west corner, INPEKSI (matrik minimum, dan VAM (Vogel Approximation Method adalah sebuah sistem yang dibangun dan difungsikan sebagai sistem yang diharapkan mampu mengetahui biaya paling minimum dalam pengalokasian barang dengan membandingkan tiga metode tersebut. Sistem ini memiliki kelebihan dalam proses input, keakuratan proses perhitungan dan proses pengerjaan lebih cepat dari proses perhitungan secara manual. Sistem ini digunakan untuk melakukan proses input jumlah gudang, input jumlah pabrik, biaya satuan dari tiap-tiap pabrik menuju tiap-tiap gudang, hasil produksi tiap pabrik, dan kapasitas gudang, selanjutnya dilakukan proses perhitungan dengan menggunakan ketiga metode tersebut. Sistem ini dibangun dengan menggunakan visual basic 6.0 dan microsoft office accsess 2007 sebagai basis datanya. Sistem ini diharapkan dapat mempermudah pengguna dalam penyelesaian masalah pendistribusian barang dari pabrik ke masing-masing gudang.   Kata-kata  kunci :  Optimalisasi, NWC, INPEKSI dan VAM

  15. PENERAPAN METODE SELEKSI FITUR UNTUK MENINGKATKAN HASIL DIAGNOSIS KANKER PAYUDARA

    Directory of Open Access Journals (Sweden)

    Elvira Sukma Wahyuni

    2016-04-01

    Full Text Available Tujuan utama penelitian ini adalah untuk meningkatkan peforma klasifikasi pada diagnosis kanker payudara dengan menerapkan seleksi fitur pada beberapa algoritme klasifikasi. Penelitian ini menggunakan database kanker payudara Wisconsin Breast Cancer Database (WBCD. Metode seleksi fitur F-score dan Rough Set akan dipasangkan dengan beberapa algoritme klasifikasi yaitu SMO (Sequential Minimal Optimization, Naive Bayes, Multi layer Perceptron, dan C4.5. Penelitian ini menggunakan 10 fold cross validation sebagai metode evaluasi. Hasil penelitian menunjukkan algoritme klasifikasi MLP dan C4.5 mengalami peningkatan peforma klasifikasi secara signifikan setelah dipasangkan dengan seleksi fitur rough set dan F-score, Naive Bayes menunjukan peforma terbaik ketika dipasangkan dengan metode seleksi fitur F-score saja, sedangkan SMO tidak menunjukkan peningkatan peforma klasifikas ketika dipasangkan pada kedua seleksi fitur. Kata kunci: kanker payudara, seleksi fitur, klasifikasi.

  16. Sistem Pakar Analisis Kepribadian Diri dengan Metode Certainty Factor

    Directory of Open Access Journals (Sweden)

    Putu Veda Andreyana

    2015-08-01

    Full Text Available Kepribadian adalah sifat dan tingkah laku khas seseorang yang membedakan seseorang dengan orang lain. Salah satu metode yang digunakan psikolog adalah Big Five Personality untuk mendapatkan jenis-jenis kepribadian. Sistem pakar adalah sistem informasi yang berisi pengetahuan dari pakar yang dapat melakukan analisa seperti seorang pakar. Sistem Pakar Kepribadian Diri dengan metode Big Five dapat memudahkan seseorang melakukan tes kepribadian tanpa psikolog, dan memudahkan psikolog dalam melakukan tes kepribadian karena tanpa melakukan perhitungan manual. Sistem Pakar Kepribadian Diri merupakan sistem berbasis web yang memberikan hasil tes kepribadian seseorang dan juga memberikan informasi tentang jenis-jenis kepribadian yang ada. Sistem ini diimplementasikan menggunakan metode forward chaining untuk mendapatkan kesimpulan dari suatu kepribadian. Output sistem pakar tes kepribadian berupa jenis-jenis kepribadian berdasarkan Big Five Personality. Persentase kepercayaan yang diperoleh berdasarkan kuesioner terhadap sistem pakar ini yaitu tingkat akurasi 74%. Kata kunci: Sistem Pakar, Kepribadian, Big Five Personality, Certainty Factor, Forward Chaining

  17. Perbaikan Metode Penghitungan Debit Sungai Menggunakan Cubic Spline Interpolation

    Directory of Open Access Journals (Sweden)

    Budi I. Setiawan

    2007-09-01

    Full Text Available Makalah ini menyajikan perbaikan metode pengukuran debit sungai menggunakan fungsi cubic spline interpolation. Fungi ini digunakan untuk menggambarkan profil sungai secara kontinyu yang terbentuk atas hasil pengukuran jarak dan kedalaman sungai. Dengan metoda baru ini, luas dan perimeter sungai lebih mudah, cepat dan tepat dihitung. Demikian pula, fungsi kebalikannnya (inverse function tersedia menggunakan metode. Newton-Raphson sehingga memudahkan dalam perhitungan luas dan perimeter bila tinggi air sungai diketahui. Metode baru ini dapat langsung menghitung debit sungaimenggunakan formula Manning, dan menghasilkan kurva debit (rating curve. Dalam makalah ini dikemukaan satu canton pengukuran debit sungai Rudeng Aceh. Sungai ini mempunyai lebar sekitar 120 m dan kedalaman 7 m, dan pada saat pengukuran mempunyai debit 41 .3 m3/s, serta kurva debitnya mengikuti formula: Q= 0.1649 x H 2.884 , dimana Q debit (m3/s dan H tinggi air dari dasar sungai (m.

  18. Game Blok Bakar Berbasis Android Menggunakan Metode LCG dan LFSR

    Directory of Open Access Journals (Sweden)

    Kadek Adi Praptha

    2015-11-01

    Full Text Available Blok Bakar merupakan permainan kartu tradisional Bali yang menggunakan kartu domino. Konsep utama dari game adalah memilih blok kartu yang terdiri dari 2 buah kartu yang sudah diacak. Namun seiring perkembangan jaman peminat permainan Blok Bakar dari tahun ke tahun mengalami penurunan, sehingga diperlukan sebuah sarana sebagai media pelestarian Budaya Bali. Penelitian ini menyajikan suatu aplikasi game Blok Bakar berbasis Android dengan mengkombinasikan metode pengacakan Linear Congruential Generators (LCG dan Linear Feedback Shift Register (LFSR agar minat masyarakat terhadap game Blok Bakar dapat meningkat. Kombinasi metode digunakan untuk memperoleh kartu acak dan meminimalisir kemunculan kartu yang sama. Game Blok Bakar dibuat dengan menggunakan software Corona SDK dengan bahasa pemrograman Lua. Hasil dari kombinasi metode LCG dan LFSR memberikan perbandingan kemenangan dan kekalahan Bandar sebesar 52% berbanding 48% untuk kondisi taruhan dan 60% berbanding 40% untuk kondisi jumlah kartu. Kata kunci: Blok Bakar, Budaya Bali, game kartu, LCG, LFSR.

  19. PENERAPAN METODE PENDEKATAN TEKNIK UNTUK MENINGKATKAN KEANDALAN SISTEM DISTRIBUSI

    Directory of Open Access Journals (Sweden)

    Rukmi Sari Hartati

    2010-07-01

    Full Text Available Metode pendekatan teknik dipergunakan untuk meningkatkan keandalan sistem distribusi dengan menentukan lokasi recloser yang optimal pada penyulang- penyulang yang akan ditingkatkan keandalannya, sehingga diperoleh nilai indeks keandalan yang lebih baik. Telah dilakukan penelitian dengan menggunakan metode tersebut untuk meningkatkan keandalan pada penyulang Penebel dan Marga untuk memenuhi target PLN ke depan yakni mencapai WCS (World Customer Service serta WCC (World Class Company yaitu SAIFI = 3 kali/pelanggan/tahun dan SAIDI = 100 menit/pelangggan/tahun. Dari hasil penelitian pada 2 penyulang tersebut diperoleh nilai indeks keandalan SAIDI dan SAIFI untuk kedua penyulang tersebut sudah mendekati target WCS dan jauh lebih baik dibandingkan dengan kondisi sebelum dipasang recloser. Sehingga dapat disimpulkan bahwa penggunaan metode pendekatan teknik untuk meningkatkan keandalan sistem distribusi cocok untuk diterapkan, terutama pada sistem distribusi di Bali.

  20. EFEKTIVITAS PEMBELAJARAN MATEMATIKA DENGAN METODE PROBLEM POSING BERBASIS PENDIDIKAN KARAKTER

    Directory of Open Access Journals (Sweden)

    Eka Lia Susanti

    2012-06-01

    Full Text Available Abstract Tujuan penelitian ini adalah untuk mengetahui apakah pembelajaran matematika dengan metode Problem Posing berbasis pendidikan karakter di laboratorium TeenZania pada materi garis singgung lingkaran efektif. Populasi dalam penelitian ini adalah peserta didik di SMP N 2 Pati. Sampel dalam penelitian ini diambil dengan teknik cluster random sampling. Variabel dalam penelitian ini yaitu keaktifan sebagai variabel independen dan prestasi belajar sebagai variabel dependen. Cara pengambilan data dengan lembar pengamatan dan tes. Data diolah dengan uji banding t dan uji pengaruh regresi. Hasil penelitian menunjukkan bahwa prestasi belajar kelas eksperimen (82,74 secara statistik melebihi KKM (75. Dengan uji regresi linear sederhana diperoleh persamaan regresi ?=-15,847 + 1,194X dan R^2=0,829. Koefisien X merupakan bilangan positif sehingga keaktifan berpengaruh positif pada prestasi belajar sebesar 82,9%. Rata-rata prestasi belajar kelas eksperimen (82,74 dan rata-rata prestasi belajar kelas kontrol (72,91. Secara uji stastistik prestasi belajar kelas eksperimen lebih baik daripada prestasi belajar kelas kontrol. Berdasarkan hasil analisis disimpulkan (1 pembelajaran mencapai tuntas belajar; (2 adanya pengaruh positif pada keaktifan terhadap prestasi belajar; dan (3 prestasi belajar kelas eksperimen lebih baik daripada prestasi belajar kelas kontrol; sehingga pembelajaran matematika dengan metode problem posing berbasis pendidikan karakter di laboratorium TeenZania merupakan pembelajaran yang efektif. The purpose of this study was to determine whether the learning of mathematics by Problem Posing method in a TeenZania laboratory based character education in circle tangent material effectively. The population in this study were students in SMP N 2 Pati. The sample in this study were drawn by cluster random sampling technique. The variables in this study is the activity as an independent variable and learning achievement as the dependent variable

  1. IMPLEMENTASI METODE HISTOGRAM EQUALIZATION UNTUK MENINGKATKAN KUALITAS CITRA DIGITAL

    Directory of Open Access Journals (Sweden)

    Isa Akhlis

    2012-02-01

    Full Text Available Radiografi dapat digunakan untuk membantu mendiagnosis penyakit dalam bidang medis. Umumnya citra radiograf masih tampak kabur sehingga memerlukan pengolahan untuk menghilangkan atau mengurangi kekaburan tersebut. Tujuan penelitian ini adalah mendesain perangkat lunak untuk meningkatkan kualitas citra digital foto Roentgen yaitu dengan meningkatkan kontras citra tersebut. Salah satu metode untuk meningkatkan kontras citra digital adalah dengan menggunakan metode histogram equalization. Metoda tersebut membuat tingkat keabuan citra tersebar merata pada semua tingkat keabuan. Hasil penelitian menunjukkan bahwa metoda histogram equalization dapat digunakan untuk meningkatkan kontras citra.  Hal ini dapat langsung dilihat pada layar monitor.   Kata kunci: citra radiograf,  histogram equalization

  2. PENGUKURAN BEBAN KERJA MENTAL DALAM SEARCHING TASK DENGAN METODE RATING SCALE MENTAL EFFORT (RSME)

    OpenAIRE

    Ari Widyanti; Addie Johnson; Dick de Waard

    2012-01-01

    Metode pengukuran beban kerja mental meliputi metode obyektif dan subyektif. Metode pengukuran beban kerja mental secara subyektif yang banyak diaplikasikan di Indonesia adalah Subjective Workload Assessment Technique (SWAT) dan NASA TLX (NASA Task Load Index). SWAT dan NASA TLX adalah pengukuran subyektif yang bersifat multidimensional (multidimensional scaling) yang relatif membutuhkan waktu dalam aplikasinya. Sebagai alternatif SWAT dan NASA TLX, Rating Scale Mental Effort (...

  3. Effekter af koordineret hjerneskaderehabilitering. Et systematisk litteraturreview

    DEFF Research Database (Denmark)

    Glintborg, Chalotte; Hansen, Tia G. B.

    beskrevet. Der er ingen klar dansk definition af koordination. Begrebet bliver ofte brugt inkonsistent, og koordination er meget forskelligt tilrettelagt. Derfor kan man ikke generelt dokumentere, om koordinatorfunktioner er en sikker vej til forbedring af komplekse rehabiliteringsforløb. Sundhedsstyrelsen......Forskningsprojekt udvikler ny definition af begrebet koordination Som et led i forskningsprojektet ”Bio-psyko-sociale effekter af koordineret hjerneskaderehabilitering” er der udviklet en ny definition af koordinationsbegrebet. Forskningsprojektet ”Bio-psyko-sociale effekter af koordineret...... senhjerneskadeområdet – initiativer, der skal fremme en sammenhængende og helhedsorienteret rehabiliteringsindsats. Men hvad dækker begrebet koordination egentlig over? Det har et nyt forskningsprojekt set på og kommer med et bud på en ny definition. Dansk definition mangler Indholdet i koordination har været upræcist...

  4. Depressive patienters oplevelse af at modtage ECT

    DEFF Research Database (Denmark)

    Jensen, Christine Damsbo

    Dette studie handler om, hvordan det opleves for den voksne depressive patient at gennemgå et ECT-behandlingsforløb (electroconvulsive therapy). Formålet med projektet er dels at undersøge, hvordan processen omkring ECT-behandlingen udspiller sig og dels at undersøge patienternes oplevelse......, reaktioner og tanker omkring ECT-behandlingen. Studiet bygger på den eksisterende viden om patienters oplevelse af ECT. Metoden er feltforskning med deltagende observation og etnografisk interview. Dette suppleres af to spørgeskemaer. Der blev inkluderet 8 patienter i undersøgelsen. Analysen udspringer af...... konstruktivistisk epistemiologisk vinkel. Ved en teoristyret analyse fremkom 2 overordnede temaer: Anspændthed og tryghed. Disse temaer blev behandlet i en procesorienteret forståelse af ECT-forløbet. Denne proces bestod af: Betingelser, interaktion og konsekvenser. Diskussionen er en kritisk diskussion af fund og...

  5. Gennemgang af den danske samfundsregulering

    DEFF Research Database (Denmark)

    Falch, Morten

    investeringer hos en bred række af markedsaktører’1. Midlet til at opnå dette mål har været at skabe et regelsæt der gør det lettere for nye virksomheder at komme ind på det nye telemarked, og konkurrere på lige fod med TDC. Herudover, har man hjulpet de nye operatører på vej gennem en såkaldt asymmetrisk...

  6. Rekruttering og fastholdelse af seniorer

    DEFF Research Database (Denmark)

    Luccat, Dorte

    Denne undersøgelse har til formål at afdække holdninger, praksis, barrierer og muligheder i forhold til rekruttering og fastholdelse af seniorer. Undersøgelsen er baseret på 19 kvalitative interviews med henholdsvis tillidsrepræsentanter og personaleledere på 13 forskellige arbejdspladser. De...... udvalgte arbejdspladser repræsenterer såvel den offentlige som den private sektor samt større (mindst 50 ansatte) og mindre (under 50 ansatte) arbejdspladser. Vi har endvidere besøgt virksomheder, der henholdsvis har og ikke har seniorer ansat, for at indsamle information om holdninger og praksis fra flere...

  7. Bekæmpelse af elmesyge

    DEFF Research Database (Denmark)

    Thomsen, Iben Margrete; Kristoffersen, Palle; Ravn, Hans Peter

    2004-01-01

    Elmesygen kom til Danmark i 1970’erne. Efter 1985 er udbredelsen gået stærkt, og elmesygen har været katastrofal for bestanden af bytræer og træer i landskabet. Bekæmpelse består fortrinsvis af sanering, dvs. fjernelse af syge og billeangrebne træer inden 1. maj....

  8. Offentliggørelse af kursrelevante oplysninger

    DEFF Research Database (Denmark)

    Werlauff, Erik; Schaumburg-Müller, Peer

    2013-01-01

    Artiklen analyserer, særligt på baggrund af EU-Domstolens dom af 28. juni 2012 i C-19/11, Daimler AG, hvilken betydning en række mellemliggende trin, der fører frem til en kursrelevant og offentliggørelsespligtig begivenhed, har for tidspunktet for indtrædelsen af pligten til offentliggørelse. De...

  9. Konceptuelt design og udvikling af Intergomus

    DEFF Research Database (Denmark)

    Ellebæk, P.; Pedersen, T.; Stendal, Karsten

    1999-01-01

    Denne rapport gennemgår udviklingsforløbet af et træningsapparat til genoptræning af læderede fingre. Rapporten omhandler kun den mekaniske del af udstyret. Opgaven er blevet løst i samarbejde med Ergoterapien på Køge Amtssygehus, Procare, Centret forAvanceret Teknologi og flere afdelinger på RIS...

  10. Forsegling af okklusal dentincaries i permanente molarer

    DEFF Research Database (Denmark)

    Qvist, Vibeke; Borum, Mette Kit; Dynes Møller, Kirsten

    2017-01-01

    Der findes ingen eksakte tal for forekomsten af fødevareallergi i den danske befolkning. Den kumulerede forekomst af fødevareallergi hos børn i de første tre leveår skønnes at være på 7-8 %, hvoraf hovedparten vokser sig fra det. Punktprævalensen af diagnosticeret fødevareallergi hos voksne er 3 ...

  11. Lean på sygehuset - del II: Teori og metode

    DEFF Research Database (Denmark)

    Laursen, Martin Lindgaard; Gertsen, Frank

    Denne forskningsrapport er anden del afrapporteringen fra et forskningsprojekt baseret på case studier af Lean principper anvendt på Skejby Sygehus. Rapporten indeholder projektets teoretiske grundlag og detaljering af forskningsspørgsmål. Endvidere diskuteres de metodiske udfordringer i case...

  12. Evaluering af FIU`s akademiuddannelser

    DEFF Research Database (Denmark)

    Hansen, Agnete Meldgaard; Nielsen, Kurt Aagaard

    I rapporten præsenteres en empirisk evaluerinf af to nye uddannelser i FIUs regi. I forlængelse af evalueringen præsenteres en forskningsmæssig analyse a uddannelsernes rolle i fagbevægelsens modernisering......I rapporten præsenteres en empirisk evaluerinf af to nye uddannelser i FIUs regi. I forlængelse af evalueringen præsenteres en forskningsmæssig analyse a uddannelsernes rolle i fagbevægelsens modernisering...

  13. Didaktisk design af et pervasive learning game

    DEFF Research Database (Denmark)

    Oldenskov, Joakim; Westergren, Jens; Frank, Anders Bredahl

    2010-01-01

    Projektet er et studie i det teoretiske grundlag for, og en empirisk undersøgelse, af en prototype for et didaktisk design af et pervasive learning game. Der arbejdes overordnet med udviklingen af et didaktisk design af et læringsspil som kombinerer mobile teknologier, det fysiske rum og eleverne...... game med en analyse af legen og motivationen iboende spillet. I det læringsteoretiske felt inddrages og diskuteres forskellige tilgange til læring og pervasive games, som alle repræsenterer et socialkonstruktivistisk syn på læring. Det didaktiske design danner grundlag for et prototypedesign af et...... funktionalitet som en del af undervisningen. Det er afgørende at teknologien er pålidelig og er let at gå til, da det er kernefunktionen i denne type af spil. Legens rolle er vigtig for motivationen, men må ikke overtage de formelle krav til den undervisning, som spillet er del af. Det var entydigt omkring...

  14. Omsætning af fast ejendom

    DEFF Research Database (Denmark)

    Edlund, Hans Henrik

    Bogen er en systematisk gennemgang af lov om omsætning af fast ejendom, der regulerer ejendomsmægleres virke. Følgende emner er bl.a. behandlet: Hvem kan drive ejendomsmæglervirksomhed og ejendomsmæglernes pligter og ansvar.......Bogen er en systematisk gennemgang af lov om omsætning af fast ejendom, der regulerer ejendomsmægleres virke. Følgende emner er bl.a. behandlet: Hvem kan drive ejendomsmæglervirksomhed og ejendomsmæglernes pligter og ansvar....

  15. Analisa Kemampuan Saluran Berdasarkan Metode Contingency N-1 Analysis

    OpenAIRE

    Syukriyadin,; Susanti, Rahmi

    2010-01-01

    Sistem transmisi memegang peranan yang sangatpenting dalam proses penyaluran daya. Oleh karena itupengamanan pada saluran transmisi perlu mendapatperhatian yang serius dalam perencanaannya. Analisakemampuan saluran merupakan aplikasi untuk mempelajarikestabilan sistem. Analisa kemampuan saluran dalampenelitian ini menggunakan metode contingency N-1 analysis.Contingency N-1 analysis merupakan sebuah program untukmemperhitungkan berbagi kondisi yang mungkin terjadidalam sistem dimasa yang akan ...

  16. Vergelyking van twee metodes vir die bepaling van vitamien A ...

    African Journals Online (AJOL)

    Vergelyking van twee metodes vir die bepaling van vitamien A. J.J. Erasmus. Abstract. No Abstract. Full Text: EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT · AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's ...

  17. Snit af målinger: VK afhængig af DF og NA

    DEFF Research Database (Denmark)

    Thomsen, Søren Risbjerg

    2007-01-01

    ANALYSE: Ekstra Risbjerg-snit af meningsmålinger grundet fortsat valgrummel - VK-regeringen vil blive afhængig af både DF og NA. Udgivelsesdato: 21. august 2007......ANALYSE: Ekstra Risbjerg-snit af meningsmålinger grundet fortsat valgrummel - VK-regeringen vil blive afhængig af både DF og NA. Udgivelsesdato: 21. august 2007...

  18. Peramalan trafik SMS Area Jabotabek Dengan Metode ARIMA

    Directory of Open Access Journals (Sweden)

    Lusi Alvina Tofani

    2012-09-01

    Full Text Available Dalam dunia telekomunikasi, pertukaran informasidituntut memiliki performansi yang baik. Salah satu layanantelekomunikasi yang banyak digunakan adalah SMS (ShortMessage Service. Dalam tugas akhir ini akan dilakukanpemodelan dan peramalan trafik SMS pada jaringan GSM(Global System for Mobile Communication area Jabotabekmenggunakan metode ARIMA. Penelitian ini dipusatkan denganmengambil data dari 2 lokasi SMSC (Short Message ServiceCenter yaitu SMSC yang menampung transaksi SMS peer topeer GSM-T dan SMSC yang menampung transaksi SMS alloperator. Data tersebut merupakan trafik harian selama 4 bulandari bulan Maret hingga Juni 2011 yang akan digunakan untukpemodelan dan Bulan Juli 2011 yang akan digunakan sebagaidata testing. Ada 2 kategori pemodelan yaitu untuk tipe SMSCall operator pada selang waktu 0-15 sec dan 16-30 sec sedangkantipe yang kedua yaitu tipe SMSC peer to peer GSM-T padaselang waktu 0-15 sec dan 16-30 sec. Dari penelitian ini diperoleh4 model dari data selama 4 bulan yaitu model ARIMA untuk alloperator 0-15 sec adalah ([6,9],1,2, model ARIMA untuk alloperator 16-30 sec adalah (1,0,[1,4,5], model ARIMA untuk peerto peer GSM-T 0-15 sec adalah (1,0,[1,7], dan model ARIMAuntuk peer to peer GSM-T 16-30 sec adalah ([1,5],0,5. Kemudianuntuk hasil peramalan dari 4 model tersebut didapatkan nilaiMAPE terendah yaitu pada model ARIMA untuk trafik alloperator GSM-T 0-15 sec sebesar 0,32883%. Hasil peramalan iniyang akan digunakan sebagai prediksi trafik kedepan.

  19. PENGHILANGAN NOISE PADA CITRA BERWARNA DENGAN METODE TOTAL VARIATION

    Directory of Open Access Journals (Sweden)

    Anny Yuniarti

    2006-01-01

    Full Text Available Normal 0 false false false IN X-NONE X-NONE MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin:0cm; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} Saat ini multimedia telah menjadi teknologi yang cukup dominan. Tukar menukar informasi dalam bentuk citra sudah banyak dilakukan oleh masyarakat. Citra dengan kualitas yang baik sangat diperlukan dalam penyajian informasi. Citra yang memiliki noise kurang baik digunakan sebagai sarana informasi, oleh karena itu diperlukan suatu metode untuk memperbaiki kualitas citra. Metode yang digunakan dalam penelitian ini adalah metode total variation untuk penghilangan noise yang dapat diterapkan untuk model warna nonlinier, yaitu Chromaticity-Brightness (CB dan Hue-Saturation-Value (HSV. Filter total variation disebut filter yang bergantung pada data citra karena koefisien filternya diperoleh dari pemrosesan data citra dengan rumusan yang baku. Sehingga filter mask untuk masing-masing piksel memiliki kombinasi koefisien yang berbeda. Metode ini menggunakan proses iterasi untuk menyelesaikan persamaan dasar yang nonlinier. Uji coba dilakukan dengan menggunakan 30 data dengan berbagai jenis noise, yaitu gaussian, salt and pepper dan speckle. Uji coba pembandingan dengan metode filter median dan filter rata-rata. Dari percobaan ini menunjukkan bahwa metode total variation menghasilkan citra yang lebih baik daripada metode

  20. Hvad er ledelse af brugerinddragelse?

    DEFF Research Database (Denmark)

    Holm-Petersen, Christina; Navne, Laura Emdal

    2015-01-01

    Brugerinddragelse i det danske sundhedsvæsen står højt på den politiske dagsorden, men det er stadig en udfordring at implementere visionen i klinisk praksis. Ledelse af brugerinddragelse bliver aktuelt udpeget som en central nøgle til at føre visionen ud i livet. Samtidig er der kun relativt lidt......, at brugerinddragelse skal implementeres i en verden, hvor der allerede er en række andre mål tilstede. En central ledelsesudfordring er derfor, at nogle af målene med brugerinddragelse forudsætter nye måder at organisere ikke bare arbejdet og kompetencer på, men også relationer til patienter og pårørende. En væsentlig...... that organize relations Patient involvement in the health services in Denmark is high on the political agenda, though continues to be a challenge to implement. It is increasingly said that leadership is crucial to the implementation process. However, research into the role of leaders in patient involvement...

  1. Midler til lindring af mundtørhed og stimulation af spytsekretion

    DEFF Research Database (Denmark)

    Dynesen, Anja Weirsøe; Pedersen, Anne Marie Lynge; Jensen, Allan Bardow

    2013-01-01

    effekt. I relation til risikoen for at udvikle caries, der er forhøjet hos den mundtørre patient, er det dog væsentligt at anbefale produkter uden sukker. Ligesom produktets indhold af syre og dermed det erosive potentiale er af betydning i forhold til udviklingen af dentale erosioner. Systemisk...

  2. Fluorerede stoffer i mademballage af pap og papir

    DEFF Research Database (Denmark)

    Trier, Xenia; Cederberg, Tommy Licht; Jensen, Lisbeth Krüger

    andre typer af madbokse. Prøverne er blevet analyseret for flere forskellige typer af fluorerede stoffer, der anvendes til at imprægnere disse typer af emballager, så de ikke suger fedt eller vand. I ingen af prøverne er der fundet indhold af fluorerede stoffer, der overstiger analysemetodens...

  3. Perpaduan Konsep Islam dengan Metode Montessori dalam Membangun Karakter Anak

    Directory of Open Access Journals (Sweden)

    Aprilian Ria Adisti

    2016-09-01

    Full Text Available Studi ini menguraikan perpaduan antara konsep Islam dan metode Montessori terutama untuk membangun karakter yang baik bagi anak-anak. Metode pendidikan Montessori adalah salah satu metode yang populer sebagai salah satu metode terbaik di Barat, terutama untuk mengajar anak-anak. Dalam al-Quran, sebagai sumber kehidupan masyarakat muslim, telah disebutkan semua laporan Montessori. Ada lima konsep dalam metode pendidikan Montessori yang bisa dipadukan dengan teori mengajar anak-anak dalam al-Quran dan al-Hadits; Konsep Kebebasan dengan konsep "Fitrah", Struktur dengan konsep Langkah demi langkah, Realitas dan Alam dengan konsep Mencintai Alam dan Makhluk Hidup, Keindahan dan Nuansa sejalan dengan konsep Kebersihan dan Keindahan Islam, dan Materi Montessori dengan Proses Konsep Pembelajaran Hidup. Hasil perpaduan nilai-nilai tersebut dapat membangun karakter yang baik untuk anak-anak, terutama menjadikan mereka orang beragama dengan sikap yang baik untuk masa depan mereka.   This study simply reveals about the assimilation of Islamic education values and Montessori education method especially to build the good character for children. Montessori education method is one of the method which really popular as one of the best method in Western, especially for teaching children. In al-Quran, as the source of Moslem people’s life, has mentioned all the statements of Montessori. There are five aspects in Montessori education methods that we collaborate with the theory of teaching children in al-Quran and al-Hadits; Concept of Freedom with Concept of “Fitrah”, Structure and Order with Concept of Step by Step, Reality and Nature with Concept of Loving the Nature and Living Being, Beauty and Nuance in line with Concept of Cleanness and Beauty of Islam, and Montessori Materials with Concept Process of Life Learning. The result of collaboration those methods can build the good character for children, especially create them to be religious person with the

  4. Investigation af a solar heating system for space heating and domestic hot water supply with a high degree of coverage

    DEFF Research Database (Denmark)

    Vejen, Niels Kristian

    1999-01-01

    A solar storage tank for space heating and domestic hot water supply was designed and testet in af laboratory test facility.......A solar storage tank for space heating and domestic hot water supply was designed and testet in af laboratory test facility....

  5. Opfattelser af integration blandt unge med migrantbaggrund

    DEFF Research Database (Denmark)

    Skytte, Marianne; Bryderup, Inge

    2014-01-01

    I artiklen formidles analyser af otte interview med unge med migrantbaggrund. Der er fokus på de unges oplevelser og opfattelser af integration. Der er tale om komplekse processer og vekselvirkninger i forholdet mellem de samfundsmæssige kategoriseringer og individernes selvopfattelser. De unge o...

  6. Optimalt design af fødevarer

    DEFF Research Database (Denmark)

    Bech, Anne C.; Engelund, Erling; Juhl, Hans Jørn

    1993-01-01

    Udformningen af fødevarer opfattes som et designproblem, det består i at omsætte markedskrav, belyst gennem markedsanalyser, til egenskaber ved de fremstillede produkter under hensyntagen til de dermed forbundne omkostninger. Denne oversættelse af forbrugerønsker antages at kunne ske effektivt ge...

  7. Prioriteringer af efterretninger i kampen mod terror

    DEFF Research Database (Denmark)

    Nielsen, Thomas Galasz

    2015-01-01

    Efterretningstjenesterne indsamler stadig flere informationer i forsøget på at opdage og imødegå terrorister. Men mængden af informationer gør det ikke nødvendigvis lettere at forudsige terrorhandlinger. Efterretningstjenesterne bør derfor prioritere bearbejdning af oplysningerne højere, end de g...

  8. En bid af ældres hverdagsliv

    DEFF Research Database (Denmark)

    Bundgaard, Karen Marie; Top Christensen, Boye

    2000-01-01

    Undersøgelsen har udforsket hjemmeboende ældres egen forståelse og oplevelse af måltiddsaktiviteters betydning, og hvilke behov aktiviteterne dækker hos de ældre. Aktiviteterne har betydninger der knytter sig til maden men aktiviteterne har også betydninger i sig selv. Undersøgelsen er en af fler...

  9. Lokal integration af førtidspensionister

    DEFF Research Database (Denmark)

    Jacobsen, Joannes; Lindstrøm, Maia

    Denne rapport kortlægger livsvilkårene for en bred gruppe af førtidspensionister med fokus på deres hverdag og de vilkår, som omgiver dem. Derudover identificerer rapporten en gruppe af førtidspensionister, der selv ønsker mere social interaktion og indhold i hverdagen. Undersøgelsen viser, at de...

  10. Udforskning af dialoger om et regnehul

    DEFF Research Database (Denmark)

    Lindenskov, Lena

    2007-01-01

    Med introduktionen af det danske begreb 'regnehuller' om matematikvanskeligheder bliver det muligt at udforske dialoger i klasserummet med brug af værktøjer fra Augusto Boals Forumteater. Principperne i Boals tre faser præsenteres som værktøjer for læreres refleksive praksis. Ud fra datamateriale...

  11. Udvikling af pille-doserings teknologi

    DEFF Research Database (Denmark)

    Brændgaard, Rikke; Churchill, Inge-Lise; Bolvig Poulsen, Søren

    2015-01-01

    Lab. X har i samarbejde med Brønderslev Kommune og Firmaet LT Automation i et idegenereringsforløb omhandlende viden om "pillens vej", indhentet viden om udfordringer og barrierer i forbindelse med udlevering af medicin fra apoteket til den afslutningsvis indtages af borgeren. Formålet med unders...

  12. Revisionsklienters anvendelse af serviceleverandører

    DEFF Research Database (Denmark)

    Kjersgaard, Lisbeth; Kiertzner, Lars

    2011-01-01

    Artiklen præsenterer det overordnede indhold af den ajourførte ISA 402 om revisionsmæssige overvejelser ved revision af regnskaber for virk somheder, der anvender service-leverandører. Artiklen er opbygget efter de tre grundlæggende elementer i revisionsprocessen - planlægning, udførelse og rappo...

  13. Fastholdelse af erhvervsskoleelever i det danske erhvervsuddannelsessystem

    DEFF Research Database (Denmark)

    Nielsen, Klaus; Jørgensen, Christian Helms; Koudahl, Peter

    2013-01-01

    Forskningsprojektet ”Retention of Vocational Students in the Danish VET System” undersøger de påvirkelige faktorer, der kan bidrage til at mindske frafaldet på de erhvervsfaglige uddannelser (EUD). For etablering af en sådan viden er dannet et konsortium bestående af såvel forskere med stor...

  14. Forført af hjernen?

    DEFF Research Database (Denmark)

    Lieberoth, Andreas

    2013-01-01

    Blandingen af offentlig interesse, gode mediehistorier og smarte sælgere har ført til sejlivede neuromyter, der ikke bare distraherer almindelige mennesker, men også fører til udbredte misforståelser blandt professionelle som lærere og plejepersonale. I bedste fald leder neuromyter til spild af t...

  15. Økonomisk vurdering af energibesparende foranstaltninger

    DEFF Research Database (Denmark)

    Johnsen, Kjeld; Andersen, Hans Skifter

    Anvisningen gennemgår detaljeret hvordan man gennemfører analyser af lønsomhed og likviditetsvirkninger som led i udarbejdelsen af det teknisk-økonomiske grundlag for beslutninger om energibesparende investeringer. Anvisningen indeholder blandt andet en række enkle skemaer, der kan lette og syste...

  16. Tema 1: Programmering af robotenheder i grundskolen

    Directory of Open Access Journals (Sweden)

    Stine Ejsing-Duun

    2016-01-01

    Full Text Available I denne artikel undersøger vi potentialerne for at lære matematik gennem programmering af robotter. Vi foreslår en model med tre indbyrdes afhængige læringspotentialer, som programmering fordrer. Det omfatter elevens evne til at; (1 tænke i algoritmer, (2 producere viden og artefakter gennem brug af matematik og (3 foretage abstraktion og indkapsling. Programmering er blevet en del af grundskolens læringsmål i flere lande. I Danmark er programmering et læringsmål i forenklede fælles mål for Fysik/Kemi og desuden en del af den nationale undervisningsvejledning for matematik. En analyse af potentialerne i at anvende programmering i forbindelse med disse fag er derfor væsentlig. I denne artikel fokuserer vi på samspillet mellem matematik og programmering gennem litteraturstudier og analyse af empiriske situationer fra undervisning i programmering af LEGO Mindstorms. Teoretisk anvendes den instrumentelle tilgang til teknologi i matematikundervisning. Analysen viser en række måder, hvorpå didaktisk opmærksomhed på epistemisk forhandling kan understøtte læring af matematik gennem programmering.

  17. Professionel udvikling af naturfagslærere

    DEFF Research Database (Denmark)

    Krogh, Lars Brian

    2016-01-01

    & Hollingsworth, 2002) som model for tænkning omkring TPD, samt anvende en mange-lags evalueringsoptik i overensstemmelse med Guskey (2002). Den eksisterende viden om, hvad der skal til for at professionelle udviklingsaktiviteter får virkning opsummeres som afsæt for en drøftelse af TPD-design. Endelig...

  18. Sproget afhænger af stedet

    DEFF Research Database (Denmark)

    Monka, Malene

    2014-01-01

    I artiklen præsenteres resultaterne af et ph.d.-projekt ved Nordisk Forskningsinstitut ved Københavns Universitetet, der undersøger sammenhænge mellem sted og sprogforandring. Projektet er en undersøgelse af sprogforandring i virkelig tid, hvor gamle og nye optagelser med 23 informanter fra tre j...

  19. Måling af virksomheders administrative byrder

    DEFF Research Database (Denmark)

    Langsted, Lars Bo

    2004-01-01

    Selskabsstyrelsen har offentliggjort rapporten: "Rapport om måling af virksomhedernes administrative byrder ved årsregnskabsloven og rapport om revisionshonorar for B-virksomheder."......Selskabsstyrelsen har offentliggjort rapporten: "Rapport om måling af virksomhedernes administrative byrder ved årsregnskabsloven og rapport om revisionshonorar for B-virksomheder."...

  20. Beskrivelse og modellering af produktionssystemer, Tulip

    DEFF Research Database (Denmark)

    Jacobsen, Peter

    1997-01-01

    produktionssystemer til brug ved optimering af drift og planlægning/udvikling af nye produktionssystemer. For at opnå et nødvendigt informationsgrundlag udføres projektet i samarbejde med udvalgte virksomheder.Rapporten er udført i samarbejde med Tulip International A/S i Vejle, hvor den del, der omfatter...

  1. Evaluering af en sygeplejestyret hjertesvigtsklinik

    DEFF Research Database (Denmark)

    Streym, Súsanna við

    2008-01-01

    den helbredsrelaterede livskvalitet målt ved hjælp af Minnesota Living with Heart Failure Questionnaire (MLHF) ved baseline og efter der minimum var gået 10 uger. Genindlæggelseshyppigheden og gennemsnitsindlæggelsestiden, blev målt ved at sammenligne alle førstegangsindlæggelser fra 1. marts 2006 til...... tilbuddet om fysisk træning, ville have taget imod det (n=18). Konklusion: Den helbredsrelaterede livskvalitet var signifikant forbedret efter opfølgende undersøgelse. Dog kan dette studie ikke påvise, eksakt hvilke interventioner der har haft indflydelse på forbedringen. Der er ingen forskel på...

  2. Om Hegels opfattelse af Gorgias, set på baggrund af tidligere filosofihistorikeres fremstilling

    DEFF Research Database (Denmark)

    Huggler, Jørgen

    2010-01-01

    En undersøgelse af Hegels tolkning af sofisten Gorgias giver anledning til at se på receptionen af sofisterne hos notable filosofihistorikere i det 18. århundrede. En sådan undersøgelse viser, at Hegel har en original og velvillig tolkning af sofisterne koncentreret omkring begrebet Bildung og det...... at give grunde for noget. Hegels udlægning af Gorgias bygger på hans tolkning af eleaterne, især af Zenon. Når Hegel har en særlig tolkning af eleaterne, skyldes det hans egne mangeårige filosofiske bestræbelser, og en identificering af en særlig, immanent objektiv dialektik hos Zenon, som han finder......, at Gorgias fører videre. Hegels filosofiske forståelse er tilstrækkelig udviklet til at kunne knytte positive kommentarer til alle dele af diskussionen i Gorgias' ræsonnement Om det ikkeværende, eller Om naturen. Det lykkes dog bedst i forhold til de to første af Gorgias' tre underteser. I hegelsk perspektiv...

  3. Sygehuse bør i højere grad anvende kvalitative metoder til forbedring af patientoplevet kvalitet

    DEFF Research Database (Denmark)

    von Bülow, Lene; Blom, Ane; Gerdes, Ulrik

    2015-01-01

    of observational studies, solo interviews with patients and the use of ''personas'' in the final workshop (health personnel and patients) to facilitate shared reflections on possible improvements. The process led to better ownership and specific, realistic suggestions for improvements, i.e. better information etc....

  4. Anvendelse af koldpresset rapsolie på varebiler

    DEFF Research Database (Denmark)

    Nielsen, Claus Suldrup; Ivarsson, Anders; Schramm, Jesper

    Denne rapport sammenfatter resultaterne af undersøgelserne omkring anvendelse af koldpresset rapsolie på varebiler. Undersøgelsen, som er udført af Danmarks Tekniske Universitet, Institut for Mekanisk Teknologi, er en del af et større projekt, som er finansieret af Trafikstyrelsens (tidligere Fær...... Færdselsstyrelsen) tilskudsordning til forsøg med biodiesel. Projektet har været administreret af Odense Kommune....

  5. Typebestemmelse af de danske M. bovis stammer

    DEFF Research Database (Denmark)

    Kokotovic, Branko

    Mycoplasma bovis er en af de mest betydningsfulde mykoplasma i kvægbruget på verdensplan. Bakterien findes oftest i forbindelse med mastitis, lunge- og ledbetændelse, men andre kliniske manifestationer kan også forekomme. Der findes ikke præcise, nyere beregninger over konsekvenser af M. bovis...... relateret sygdomme, men det anses, at infektionen hvert år globalt set pålægger en økonomisk byrde til kvægbruget i en multimillion skala. M. bovis blev for første gang påvist i Danmark i 1981 og gennem 1980’erne har bakterien forårsaget store udbrud af mastitis. I de følgende årtier blev bakterien isoleret...... sporadisk fra mange forskellige kvægbesætninger, men på trods af en tilsyneladende stigende forekomst i 1990’erne, blev der ikke registret omfattende sundhedsmæssige problemer som følge af M. bovis smitte. Siden 2011 er M. bovis dog kommet i fokus igen på grund af alvorlige udbrud af især ledbetændelse, men...

  6. Distribution af video – lige meget hvordan?

    Directory of Open Access Journals (Sweden)

    Diba Markus

    2009-04-01

    Full Text Available Artiklen omhandler løsninger til distribution af video og de faktorer, der kan være udslagsgivende, når man som underviser eller universitet skal vælge, hvilken man vil gøre brug af. De kommercielle løsninger såsom YouTube m.fl. er kendt af de fleste. Hvad færre måske ved er, at der eksisterer alternativer. På europæisk plan har en række institutioner og forskningsnet, herunder det danske, således valgt at lave deres egne løsninger. Der er afgørende forskelle i disse hhv. kommercielle og ikke-kommercielle videodistributionstjenesters tilgange til problemstillinger vedrørende adgangsbegrænsning, ophavsret, metadatering og bevaring samt kvalitetssikring af indhold - forskelle, der for en stor del udspringer af deres respektive opdrag og muligheder for brugerautentificering. Kun de færreste af alternativerne kan bruges af danske studerende og universitetsansatte. Som der argumenteres for i artiklen, er disse problemstillinger imidlertid vigtig baggrundsinformation, når der skal tages stilling til, hvordan man bedst distribuerer videoressourcer. I artiklen beskrives overordnede fællestræk ved hhv. de kommercielle og de ikke-kommercielle distributionsløsninger, og de helt grundliggende forskelle mellem dem diskuteres.

  7. Metode Pengumpulan dan Analisis Data : Lang Kah Vital Proses Penelitian

    OpenAIRE

    Suprapto, Agus .

    2005-01-01

    The process of data collection and. analysis is one of chains in scientific method that should be done in a research. This part later on will determine the right method in searching and analyzing a way in solving a problem. The data collected should be the ones which are relevant which the essence of research problems, so that the next interpreted data will eventually be concluded as valid. keywords: Pengumpulan data, analisis data,dan metode ilmiah

  8. Penetapan Kadar Protein Pada Kecap Dengan Metode Kjeldahl

    OpenAIRE

    Muhammad, Mahatir

    2015-01-01

    Kecap merupakan pelengkap makanan dan masakan yang hampir setiap hari di konsumsi oleh masyarakat di negara kita. Kualitas dari kecap ditentukan dari kadar/kandungan proteinnnya. Protein merupakan zat makanan yang berguna pada tubuh karena zat ini berfugsi sebagai bahan bakar juga sebagai zat pembangun dalam tubuh. Kecap harus melalului serangkaian pengujian untuk menentukan kualitas kecap tersebut. Salah satunya adalah penetapan kadar dengan metode kjeldahl. Tujuan pengujian ini adalah untuk...

  9. Aplikasi Diagnosis Kelainan Refraksi Mata Dan Tips Perawatan Mata Dengan Metode Forward Chaining Berbasis Web

    Directory of Open Access Journals (Sweden)

    Sayyidah Fathimah

    2015-11-01

    Full Text Available Diagnosis merupakan penentuan jenis-jenis penyakit berdasarkan penelitian sesuai dengan gejala-gejala yang dialami. Gejala gangguan penglihatan yang sering dialami adalah rabun. Rabun dapat berupa rabun melihat benda jauh, rabun melihat benda pada jarak dekat dan lain-lain. Semua jenis rabun mata pada intinya merupakan gangguan memfokuskan bayangan benda yang dilihat atau kelainan refraksi (Ametropia. Untuk mengetahui kelainan refraksi pada mata di Rosya Optikal masih menggunakan cara manual yaitu dengan pasien datang ke Rosya Optikal melakukan pendaftaran, pemeriksaan mata, refraksionis optisien mendiagnosis dan memberikan hasil diagnosisnya, memberikan tips perawatan mata beserta resep pembuatan kacamata diberikan kepada pasien. Cara ini merupakan hal yang biasa dilakukan, namun tidak semua orang mempunyai waktu dan kesempatan untuk melakukan pemeriksaan mata dikarenakan kesibukan pekerjaan yang harus dilakukan. Melihat alasan diatas, maka diperlukan pembuatan alat bantu untuk diagnosis kelainan refraksi pada mata dan memberikan tips perawatan mata. Pembuatan Aplikasi Diagnosis Kelainan Refraksi Pada Mata dan Tips Perawatan Mata dengan Metode Forward Chaining yaitu metode pencarian atau teknik pelacakan ke depan yang dimulai dengan informasi yang ada dan penggabungan rule untuk menghasilkan suatu kesimpulan atau tujuan. Pengujian aplikasi menggunakan black box testing yang dilakukan hanya mengamati hasil eksekusi melalui data uji dan memeriksa fungsional dari perangkat lunak.Dengan adanya alat bantu ini, pengguna dapat mengetahui kelainan mata yang dialami, mendapatkan tips perawatan mata sehingga dapat merawat dan mencegah penyakit mata yang berkelanjutan dan solusi jenis kacamata jika diperlukan.

  10. DESAIN KAPAL LCU TNI-AL MENGGUNAKAN METODE OPTIMISASI

    Directory of Open Access Journals (Sweden)

    Hasanudin Hasanudin

    2015-02-01

    Full Text Available Landing Craft Utility (LCU mempunyai peranan yang penting bagi Tentara Nasional Angkatan Laut (TNI-AL digunakan sebagai kapal amphibious mendaratkan: pasukan, logistik dan kendaraan. Desain  LCU TNI-AL mengunakan metode optimasi belum pernah dilakukan, desain kapal umumnya menggunakan metode spiral design yang berlangsung beberapa putaran secara manual yang membutuhkan waktu yang lama dan seringkali tidak mencapai hasil yang optimal. Untuk mengatasi masalah tersebut dalam makalah ini digunakan metode Non Linier Constrains Optimization sehingga perlu satu putaran untuk menyelesaikannya yaitu pada tahap preliminary design. Pemodelan optimasinya dilibatkan ukuran utama dan hull form secara bersamaan sehingga tidak diperlukan pembuatan lines plan. Variables yang dicari adalah ukuran utama dan propulsi kapal; constrains adalah ukuran utama, rasio ukuran utama, stabilitas dan propulsi; objective functions adalah meminimalkan biaya pembanguan.  Dari hasil perhitungan didapatkan Landing Craft Utility yang optimal adalah: bentuk round bilge, Lpp=46,76m, B=9,63m, T=2,56m, H=4,63m, dan Vs= 11knot.

  11. MODEL PENGEMBANGAN APLIKASI PEMBAYARAN ANGSURAN PINJAMAN ONLINE MENGGUNAKAN PHP-MYSQL DENGAN METODE OBJECT ORIENTED PROGRAMMING

    Directory of Open Access Journals (Sweden)

    Whisnumurti Adhiwibowo

    2017-12-01

    Full Text Available Sistem pembayaran angsuran berbasis web pada suatu koperasi merupakan sistem yang bersifat dinamis dalam arti akan selalu berkembang dan kompleks. Metode Pemrograman prosedural memiliki kelemahan saat mengembangkan aplikasi yang kompleks. Ketika terjadi permasalahan, penanganannya menjadi sulit karena porgram terdiri dari banyak fungsi dan pada saat mengubah suatu fungsi akan mengubah fungsi fungsi yang lain. Tidak hanya saat terjadi permasalahan, suatu sistem berbasis pemrograman prosedural juga susah apabila akan dikembangkan. Oleh karena itu di pendang perlu untuk mengembangan Sistem dengan metode object Oriented Programming (OOP, merupakan metode pemrograman berorientasi obyek.  Sistem yang di bangun dengan metode ini terdiri dari banyak obyek yang saling berhubungan. Perancangan yang dipakai menggunakan Unified Modeling Language (UML, suatu metodologi untuk mengembangkan sistem dengan pendekatan OOP. Pengembangan Sistem ini menggunakan Hypertext Prepocessor (PHP. Metode pengembangan sistem yang digunakan adalah Waterfall. Hasil dari penelitian ini adalah terbentuknya sistem pembayaran transaksi berbasis web dengan metode OOP, sehingga dapat lebih mudah pemeliharaan dan pengembangannya

  12. Penerapan Metode Dempster Shafer Untuk Mendiagnosa Penyakit Dari Akibat Bakteri Salmonella

    Directory of Open Access Journals (Sweden)

    Mikha Dayan Sinaga

    2016-12-01

    Full Text Available Infeksi dari bakteri Samonella dapat menyerang saluran gastrointestin yang mencakup perut, usus halus, dan usus besar atau kolon. Beberapa spesies salmonella dapat menyebabkan infeksi melalui makanan. Termasuk ke dalamnya adalah Salmonella Typhi yang mengakibatkan penyakit tifus, dan Salmonella Shigella yang mengakibatkan penyakit disentri dan diare. Masih banyak orang yang belum mengetahui gejala-gejala dari infeksi bakteri ini serta bagaimana cara untuk mendiagnosa dengan nilai kepastian yang tinggi. Untuk dapat mengetahui tingkat kepastian infeksi bakteri ini peneliti menggunakan metode Dempster-Shafer. Metode ini dipilih karena metode ini dianggap mampu untuk memberikan tingkat kepastian yang tinggi. Metode Dempster-Shafer adalah representasi, kombinasi dan propogasi ketidakpastian, dimana teori ini memiliki beberapa karakteristik yang secara instutif sesuai dengan cara berfikir seorang pakar, namun dasar matematika yang kuat. Hasil dari penelitian ini adalah untuk membuat aplikasi sistem pakar yang dapat mendiagnosa bakteri dari akibat bakteri salmonella dengan menggunakan metode Dempster Shafer. Kata Kunci  : Sistem Pakar,Metode Dempster Shafer, Bakteri Salmonella.

  13. Pengaruh Metode Student Teams Achievement Division (STAD dan Pemahaman Struktur Kalimat terhadap Keterampilan Menulis Narasi

    Directory of Open Access Journals (Sweden)

    Sigit Widiyarto

    2017-02-01

    Full Text Available Tujuan penelitian ini  untuk mengetahui pengaruh metode Teams Achievment Division dan pemahaman  struktur kalimat terhadap keterampilan menulis Bahasa kalimat narasi. Metode penelitian ini menggunakan metode eksperimen dengan analisis dua jalur (Anova.Data  di lapangan  memakai hasil tes. Sampel diambil pada kelas VII SMP Swasta Future Gate Jatikramat Kota Bekasi. Jumlah siswa pada kelas kontrol dan eksperimen sebanyak 50 siswa. Berdasarkan analisis data yang dihitung dengan memakai Spss 22 dapat disimpulkan : 1.   Terdapat pengaruh signifikan metode Student Teams Achievment Division( STAD terhadap keterampilan menulis. 2 Tidak terdapat Pengaruh Struktur Kalimat terhadap Keterampilan menulis narasi. . 3. Tidak terdapat pengaruh  Metode STAD dan pemahaman  struktur kalimat secara bersama-sama terhadap keterampilan menulis narasi Kata Kunci  :  metode STAD, Penguasaan struktur kalimat dan keterampilan menulis narasi 

  14. Vurdering af omfang og konsekvenser af sprøjtning og gødskning af § 3-beskyttede naturarealer

    DEFF Research Database (Denmark)

    Strandberg, Morten Tune; Bak, Jesper Leth; Bladt, Jesper Stentoft

    2012-01-01

    Det er overvejende de ferske enge, der gødskes og sprøjtes, hvorimod dette kun undtagelsesvist er konstateret på andre naturtyper som overdrev og heder m.m. De ferske enge er samtidig den mest udbredte § 3-naturtype. Behandling i form af gødskning og sprøjtning foregår anslået på op til 20 % af a...

  15. Etnografisk ekklesiologi – om forstyrrelse og fremmedhed i studier af Folkekirken

    DEFF Research Database (Denmark)

    Lorensen, Marlene Ringgaard

    2017-01-01

    anden frugt afdette samarbejde er det Nordisk Homiletiske Netværk. Deltagerne idette netværk har gennem mange år primært mødtes på konferencer i USA på det,der er blevet kaldt akademikernes svar på Roskilde Festival – nærmere betegnetAmerican Academy of Religion og Academy of Homiletics. Gennem de...... betydning i Folkekirken,folks oplevelser af gudstjenester og ritualer mm. Flygtningesmøde med Folkekirken Som led i seminaretvar undertegnede blevet bedt om at præsentere et forskningsprojekt omflygtninges møde med Folkekirken, som Gitte Buch-Hansen og jeg påbegyndte i2014. Præsentationen bar titlen „De nye...... for at lære attænke i dialog med denne. Med den empiriske metode arbejder vi, på den eneside, på at forstyrre den form for tænkning, som tror, den kan tale på allesvegne. På den anden side skal vi vare os for ikke at ‘go native’ – ibetydningen af, at blive ét med det felt, vi undersøger. I stedet er...

  16. PUSAT PENGEMBANGAN METODE PENDIDIKAN KECERDASAN JAMAK DI MAKASSAR

    Directory of Open Access Journals (Sweden)

    St. Aisyah Rahman

    2016-12-01

    Full Text Available Abstrak— Kurangnya pelatihan mengenai metode pendidikan kecerdasan jamak dan belum adanya pedoman operasional sebagai landasan mengajar dapat menjadi faktor kecerdasan jamak belum banyak diterapkan di Makassar. Untuk mengembangkan pengetahuan serta mengenalkan metode pendidikan kecerdasan jamak kepada masyarakat di Kota Makassar, dibutuhkan sarana atau tempat yang dapat mewadahi kegiatan pengembangan berupa pemberian informasi mengenai kecerdasan jamak ataupun pengembangan dan pelatihan metode-metode atau cara pengajaran agar para pendidik dapat merangsang dan mengaktifkan kecerdasan jamak kepada anak-anak di Makassar sesuai dengan potensi dan bakat yang mereka miliki. Tujuan perancangan ini mendesain gedung Pusat Pengembangan Metode Pendidikan Kecerdasan Jamak di Makassar dengak kosep Arsitektur Ekologis. Hasil dari perancangan ini mengurai hal-hal yang spesifik dari bangunan yaitu penentuan lokasi, pengolahan tapak, yang terdiri dari; analisis view, kebisingan, aksesibilitas tapak, sirkulasi dalam tapak, orientasi matahari dan angin, zoning, dan tata massa, konsep bentuk dan fasad bangunan, sistem struktur dan material bangunan, sistem utilitas, dan sistem teknologi terkhusus pemanfaatan energi surya sebagai salah satu bagian dari arsitektur ekologis. Kata kunci: Pendidikan, Kecerdasan Jamak, Makassar, Arsitektur Ekologis. Abstract- Lack of training in recognizing plural intellegence of education methods and lack of operational guidelines as the basic for teaching can be a factor why plural intelligence has not been widely applied in Makassar yet. To develop the knowledge and introduce the educational methods of intelligence plural to the public in Makassar, needed a means or a place that can accommodate development activities by giving information about plural intelligence or developing and training of methods or thr way of teaching in order to the education can stimulate and activate the plural intelligence to Makassar’s children

  17. Optimering af byggeprocessen via bedre/forøget brug af digitale modeller

    DEFF Research Database (Denmark)

    Carlsen, Mads; Grøn, Dorte Marie Frilund; Alon, Nevo

    2013-01-01

    Projektet klarlægger nødvendigheden for, og muligheder i, en struktureret og konsekvent planlægning ved anvendelsen af BIM i relation til projektering, udførelse og drift af byggeri. Der er udarbejdet et planlægningsværktøj, der muliggør en sådan planlægning. Samtidig kortlægges de nødvendige data......, der kan udtrækkes af en BIM model ved gennemførelsen af en LCA simulering. Projektet afsluttes med en præsentation af en udviklet demonstratorapplikation til gennemførelse af LCA simuleringer koblet med BIM modellen....

  18. Aromatic hydrocarbons in produced water from offshore oil and gas production. Test of sample strategy; Aromatiske kulbrinter i produceret vand fra offshore olie- og gas industrien. Test af proevetagningsstrategi

    Energy Technology Data Exchange (ETDEWEB)

    Hansen, A.

    2005-07-01

    In co-operation with the Danish EPA, the National Environmental Research Institute (NERI) has carried out a series of measurements of aromatic hydrocarbons in produced water from an offshore oil and gas production platform in the Danish sector of the North Sea as part of the project 'Testing of sampling strategy for aromatic hydrocarbons in produced water from the offshore oil and gas industry'. The measurements included both volatile (BTEX: benzene, toluene, ethylbenzene and xylenes) and semi-volatile aromatic hydrocarbons: NPD (naphthalenes, phenanthrenes and dibenzothiophenes) and selected PAHs (polycyclic aromatic hydrocarbons). In total, 12 samples of produced water were sampled at the Dan FF production platform located in the North Sea by the operator, Maersk Oil and Gas, as four sets of three parallel samples from November 24 - December 02, 2004. After collection of the last set, the samples were shipped to NERI for analysis. The water samples were collected in 1 L glass bottles that were filled completely (without overfilling) and tightly closed. After sampling, the samples were preserved with hydrochloric acid and cooled below ambient until being shipped off to NERI. Here all samples were analysed in dublicates, and the results show that for BTEX, levels were reduced compared to similar measurements carried out by NERI in 2002 and others. In this work, BTEX levels were approximately 5 mg/L, while similar studies showed levels in the range 0,5 - 35 mg/L. For NPD levels were similar, 0,5 - 1,4 mg/L, while for PAH they seerred elevated; 0,1 - 0,4 mg/L in this work compared to 0,001 - 0,3 mg/L in similar studies. The applied sampling strategy has been tested by performing analysis of variance on the analytical data. The test of the analytical data has shown that the mean values of the three parallel samples collected in series constituted a good estimate of the levels at the time of sampling; thus, the variance between the parallel samples was not

  19. Air Emissions/IGD: EF_AFS

    Data.gov (United States)

    U.S. Environmental Protection Agency — EF_AFS is a subset of facilities from FRS_INTEREST and FRS_FACILITY_SITE which are updated on a monthly basis as part of the Locational Reference Tables (LRT)...

  20. Crowdings betydning for antallet af tvangsfikseringer

    DEFF Research Database (Denmark)

    Bak, Jesper; Nielsen, Lea Marie; Hæssum, Birte

    2017-01-01

    I denne artikel vil vi beskrive et par af resultaterne fra forskningsprojektet ”Mechanical restraint. Preventive Factors in Theory and Practice” samt et eksempel fra praksis om crowdings betydning for hvor meget der bliver tvangsfikseret....

  1. Kortlægning af Hadforbrydelser

    DEFF Research Database (Denmark)

    Drud Jensen, Mads Ted; Kromand, Rolf; Birgit, Lindsnæs

    Kortlægning af hadforbrydelser baserer sig på selvrapporteret udsathed for kriminalitet samt e-survey gennemført blandt minoritetsgrupper, der antages at være særlig udsat for hadforbrydelser....

  2. AKTIVITAS PROTEOLITIK PAPAIN KASAR GETAH BUAH PEPAYA DENGAN BERBAGAI METODE PENGERINGAN

    Directory of Open Access Journals (Sweden)

    Deivy Andhika Permata

    2016-09-01

    Full Text Available Papain merupakan enzim golongan protease yang banyak digunakan di industri. Salah satu proses penting dalam menghasilkan produk papain kasar adalah pengeringan. Penelitian ini bertujuan untuk mengetahui kadar air, kadar abu, kadar protein, dan aktivitas proteolitik papain kasar getah buah pepaya dengan berbagai metode pegeringan. Metode pengeringan yang digunakan pada penelitian ini, yaitu pengeringan matahari (solar drying, pengeringan kabinet (cabinet drying, pengeringan vakum (vacuum drying dan pengeringan beku (freeze drying. Berdasarkan hasil penelitian yang dilakukan disimpulkan bahwa metode vakum menghasilkan aktivitas proteolitik tertinggi dibanding metode lainnya.

  3. Penambahan Bulking Agent untuk Meningkatkan Kualitas Kompos Sampah Sayur dengan Variasi Metode Pengomposan

    Directory of Open Access Journals (Sweden)

    Moh. Rohim

    2017-01-01

    Full Text Available Bahan utama pengomposan dalam penelitian ini adalah sayur dan sabut kelapa sebagai bulking agent. Kedua bahan tersebut digunakan karena ketersediannya yang melimpah di lokasi penelitian yaitu Pasar Puspa Agro, Sidoarjo. Variabel yang digunakan dalam penelitian ini adalah penambahan bulking agent dan metode pengomposan. Penambahan bulking agent yang digunakan yakni 40%, 50% dan 60% yang mana persentase tersebut diperoleh dari hasil perhitungan rasio C/N campuran dari kedua bahan yang masuk rentang 25-40. Sedangkan metode pengomposan yang dipakai adalah metode 1 (tidak dicacah, dilapis, metode 2 (dicacah, dicampur dan metode 3 (dicacah, dilapis. Dimensi pengomposan yaitu 0,5x0,5x1 m dan pembalikan untuk metode 1 dan 3 yakni 3 hari sekali selama 2 minggu pertama, seminggu sekali sampai minggu keenam dan 2 minggu sekali sampai kompos matang. Sedangkan pada metode 2, pembalikan dilakukan 3 hari sekali sampai kompos matang. Parameter kualitas kompos yang digunakan mengacu pada SNI 19-7030-2004 meliputi suhu, pH, kadar air, kadar C-organik, N total dan rasio C/N. Hasil dari penelitian ini adalah jika ditinjau dari penambahan bulking agent kualitas kompos yang paling baik yaitu dengan penambahan 60%. Apabila ditinjau dari metode pengomposan, kualitas kompos yang paling baik yaitu menggunakan metode 3 (dicacah, dilapis.

  4. Danskernes brug af business case og gevinstrealisering

    DEFF Research Database (Denmark)

    Ernst, Martin

    2013-01-01

    Business case og gevinstrealisering har længe været faste begreber, når man taler effektivisering, implementering af strategi etc. Mange bruger det, flere brugere det delvist, og nogle bruger det slet ikke.......Business case og gevinstrealisering har længe været faste begreber, når man taler effektivisering, implementering af strategi etc. Mange bruger det, flere brugere det delvist, og nogle bruger det slet ikke....

  5. Selskaberne er en del af staten

    DEFF Research Database (Denmark)

    Hein Jessen, Mathias

    2016-01-01

    Lækket af Panama Papers fremhæver endnu engang den paradoksale rolle, ikke mindst multinationale selskaber spiller i politik og økonomi: De er både skabt af staten, og fremstår stadig som uden for og i opposition til staten. Hvis vi vil gøre noget ved problemet, må vi forstå, hvordan stat og...

  6. Arbejdsmiljø ved udbud af busdrift

    DEFF Research Database (Denmark)

    Wiegmann, Inger-Marie; Mathiesen, Karin; Hasle, Peter

    En undersøgelse af sammenhængen mellem arbejdsmiljø og udbud af busdrift i tre trafikselskabet. Resultaterne peger på at arbejdsmiljøet går fra udelukkende til at være et anliggende mellem arbejdsgiver og arbejdstager til et trepartsforhold hvor også udbyder (trafikselskabet) får et ansvar og har...

  7. Omrids af en trækultur

    DEFF Research Database (Denmark)

    Rauff Greisen, Johannes

    2007-01-01

    høje prioritering af de fysiske rammer kan aflæses i de store linjer såvel som i de redelige detaljer. Artiklens spørgsmål er, hvorledes håndværkstraditionens kvaliteter og kerne kan overleveres til det moderne byggeri, der også i Vorarlberg i stigende grad præges af industrialiseringen, samt i hvilke...

  8. Forekomst af parodontitis og FORL hos perserkatte

    DEFF Research Database (Denmark)

    Flørnæs, Maria L. Topholm; Lund, Mette; Kortegaard, Hanne Ellen

    2007-01-01

    I dette studie er omfanget af tandrelaterede sygdomme heriblandt parodontitis og feline odontoklastiske resorptions læsioner (FORL) blandt 19 perserkatte (heraf 2 exotics) på 3 til 9 år undersøgt både klinisk og radiografisk. Ingen af kattene havde tidligere fået renset tænder i anæstesi. Alle ka...

  9. Blended Learning Analytics Model for Evaluation (BLAME). Et case-studie af universitetsunderviseres brug af Blackboard

    DEFF Research Database (Denmark)

    Musaeus, Peter; Bennedsen, Andreas Brændstrup; Hansen, Janne Saltoft

    2015-01-01

    I denne artikel vil vi præsentere en strategi til inddragelse af læringsanalytik (learning analytics) ved evaluering af universitetsunderviseres brug af et nyt LMS på Aarhus Universitet: Blackboard. Vi diskuterer en model (BLAME: Blended Learning Analytics Model of Evaluation) for, hvordan...... kategorisering af kurser og data om læringsanalytik indsamlet på Blackboard kan integreres. Endvidere belyser vi, hvilke implikationer en sådan læringsanalytik kan have for blended learning ved at analysere to forskellige uddannelses-cases/illustrationer. Dernæst diskuterer vi pædagogisk udvikling i forbindelse...

  10. Kontrol af konventionelle våben i Europa

    DEFF Research Database (Denmark)

    Hoffmann, Rune; Kierulf, John; Pradhan-Blach, Flemming

    Rapporten indledes med en historisk gennemgang af tilblivelsen og udviklingen af Traktat om Konventionelle Væbnede Styrker i Europa (CFE), som blev iværksat af NATO og det tidligere Warszawapagten i 1973. Traktaten fastsætter et loft for antallet af kampvogne, pansrede kampkøretøjer, artilleripje...

  11. Tællinger af vandfugle i Danmark 1998-99

    DEFF Research Database (Denmark)

    Pihl, S.; Laubek, B.

    1999-01-01

    Denne rapport præsenterer Miljø- og Energiministeriets seks feltstationer med beskrivelse af deres historie, naturforhold og overvågningsprogram. Resultaterne af fugleobservationer i 1997 beskrives i sammenhæng med tidligere års udvikling. Desuden præsenteres resultater af tre undersøgelser af he...

  12. Erfaringer fra nedrivning af boligblok i Rødbyhavn

    DEFF Research Database (Denmark)

    Eriksen, Søren Skibstrup; Hansen, Klaus; Krogh, Hanne

    Denne meddelelse indeholder en beskrivelse af nedrivningen af et betonelementbyggeri. Der er foretaget en registrering af energiforbrug i forbindelse med nedrivningen og bortskaffelsen samt en registrering af de miljøbelastende stoffer i bygningsaffaldet. Inden bebyggelsen blev revet ned, blev de...

  13. Kommentarer til love og ændringer af love

    DEFF Research Database (Denmark)

    Møgelvang-Hansen, Peter

    2002-01-01

    folkeoplysende foreningsarbejde og Folkeuniversitetet (folkeoplysningsloven) og ophævelse af lov om daghøjskoler m.v. og lov om den fri ungdomduddannelse samt ændring af lov om refusion af udgifter til uddannelse i forbindelse med aktivering m.m. samt ændring af forskellige love (Reform for daghøjskolerne...

  14. DVD anmeldelse - En Verden af Lyd og Musik

    DEFF Research Database (Denmark)

    Holck, Ulla

    2006-01-01

    Anmeldelse af DVD-udgivelse af Claus Bang (2005): En Verden af Lyd og Musik. Musikterapi for døve, hørehæmmede og multihandicappede børn og unge. Al tale med undertekst eller tegnsprogstolkning. DVD-boks med 3 stk. dobbeltlag DVD beregnet til afspilning på PC. Udgivet af Musikterapi-foreningen En...

  15. Læring som improviseret udvikling af praksis

    DEFF Research Database (Denmark)

    Brinck, Lars

    2010-01-01

    Med afsæt i forfatterens fænomenografiske studie af amerikanske musikeres oplevelse af det at jamme diskuterer artiklen, hvorvidt jam-bandets spontant improviserende praksis kan give ny forståelse af rytmiske musikeres læring som et overordnet socialt fænomen. Ved at betragte jam-bandets praksis i...

  16. Om den sociale og symbolske funktion af uddannelsesevalueringer

    DEFF Research Database (Denmark)

    Nørholm, Morten

    Ph.d.-afhandlingen handler om evalueringer, om evalueringer af uddannelse med et fokus og perspektiv som er begrænset til en afdækning af forhold om evalueringer, til en formulering af en teori om evalueringer. I afhandlingens analyser og diskussioner anvendes teorier af Émile Durkheim, Pierre...

  17. Miljørigtig ombygning af Mallinggård

    DEFF Research Database (Denmark)

    Hansen, Ernst Jan de Place

    2002-01-01

    Resume af rapport om den byggetekniske anvendelse af alternativ isolering ved en ombygning af Mallinggårds lade til undervisningslokaler, udarbejdet af Bent Møller fra Rudolf Steiner Skolen i Skanderborg under Energistyrelsens udviklingsprogram "Miljø- og arbejdsmiljøvenlig isolering"...

  18. Selektiv avl af racehunde og -katte

    DEFF Research Database (Denmark)

    Sandøe, Peter; Meyer, Iben Helene Coakley; Fredholm, Merete

    2014-01-01

    Dette kapitel ser nærmere på de velfærdsmæssige problemstillinger, der opstår som følge af måden, hvorpå racehunde og -katte påvirkes gennem selektiv avl. Først beskrives, hvordan avlen af racehunde og -katte er organiseret. Dernæst gøres der rede for de dyrevelfærdsmæssige konsekvenser heraf....... Selektiv avl af hunde og katte tjener til at vedligeholde en stor racemæssig diversitet. De racemæssige forskelle gør det muligt for mennesker at vælge især hunde, der har nogle egenskaber, som passer til individuelle behov og ønsker. Desværre er der også en række bivirkninger for de pågældende dyrs...... problemer, som knytter sig til selektiv avl af racehunde og -katte, gennemgås og diskuteres mulige praktiske tiltag, som kan trække udviklingen i retning af at reducere forekomsten af disse problemer....

  19. Enzymatisk omestring til produktion af biodiesel

    DEFF Research Database (Denmark)

    Fjerbæk, Lene

    2007-01-01

      Biodiesel er i dag sammen med bioethanol et bud på, hvordan transportsektoren kan nedbringe sin netto CO2-emission til atmosfæren og lagrene af fossilt brændstof kan strækkes. På verdensplan forventes der en produktion af biodiesel på 7,9 mio. tons i 2007. Ved den industrielle fremstilling af...... biodiesel benyttes i dag kemiske katalysatorer såsom H2SO4, NaOH, MeONa eller KOH, der efterfølgende fjernes fra den producerede biodiesel med store mængder vand og derved produceres store mængder spildevand. Ved at benytte enzymer i processen kan man reducere mængden af spildevand, der skal renses. Enzymer...... benyttes ikke i de eksisterende processer, men det forventes, at udviklingen af processerne vil øge deres anvendelse i biodieselproduktion. I artiklen præsenteres fordele og ulemper ved anvendelse af enzymer til biodiesel produktion....

  20. STUDI PERBANDINGAN ANALISIS UNSUR PLUMBUM (PB DARI HASIL ELEKTROLISIS ANTARA METODE LASER- INDUCED BREAKDOWN SPECTROSCOPY (LIBS DENGAN METODE KONVENSIONAL

    Directory of Open Access Journals (Sweden)

    H. S. Suyanto

    2014-07-01

    Full Text Available Penelitian ini bertujuan menganalisis unsur Pb hasil proses elektrolisis dengan metode alternatif laser-induced breakdown spectroscopy (LIBS dan metode konvensional. Elektrolisis menggunakan tembaga (Cu sebagai katoda dan karbon sebagai anoda. Unsur Pb yang terdeposisi pada katoda diirradiasi laser Nd-YAG (model CFR 200, 1064nm dan emisinya (Pb I 405.7 nm ditangkap spektrometer HR 2500++ yang kemudian ditampilkan dalam intensitas fungsi panjang gelombang. Hasil penelitian menunjukkan bahwa energi laser, arus listrik dan waktu deposisi proses elektrolisis yang optimum untuk karakterisasi unsur Pb masing - masing adalah 100 mJ, 5,28 mA dan 15 menit. Aplikasi metode ini untuk analisis kuantitatif larutan Pb dengan membuat kurva kalibrasi dari kosentrasi 300 ppm sampai kosentrasi terendah yaitu 0,5 ppm, serta diperoleh deteksi limit sebesar 0,44 ppm. Sebagai perbandingan metode deteksi dengan LIBS ini telah dilakukan analisis dengan metode konvensional dengan menentukan selisih massa katoda sebelum dan sesudah elektrolisis dan diperoleh hasil yang sebanding.ABSTRACTThe aim of this research was to compare between a method of laser-induced breakdown spectroscopy (LIBS and the conventional one to analyse of Plumbum (Pb element resulted from electrolysis process. Electrolysis used copper (Cu and carbon (C as cathode and anode respectively. Plumbum element which was deposited on cathode was irradiated by Nd-YAG laser (model CFR 200, 1064nm and its emission intensity of neutral Pb I 405.7 nm in the plasma was captured by HR 2500++ spectrometer and displayed in a form of intensity as a function of wavelength. The experiment result showed that the optimum condition parameters of electrolysis: laser energy, electric current and electrolysis time duration were 100 mJ, 5.28 mA and 15 minutes respectively. An application of these conditions was done to make calibration curve of Pb element in liquid sample from 300 ppm to 0.5 ppm and resulted a limit of

  1. Biotransformering af pyren i havbørsteormen Nereis virens

    DEFF Research Database (Denmark)

    Jørgensen, Anne; Giessing, Anders; Juul Rasmussen, Lene

    føden og ved overførsel over epithelet. Graden af systemisk akkumulering af PAHer afhænger af optaget men ligeledes af effektiviteten af biotransformering i den pågældende organisme. N. virens er kendt for effektivt at biotransformere PAHer. I nærværende undersøgelse blev biotransformering undersøgt med......-glucuronid er den fase II metabolit der primært produceres ved biotransformering af pyren. Dette indikerer at de vigtigste enzymer i biotransformering af pyren i N. virens er CYP enzymer og glucuronosyl transferase enzymer....

  2. Digital innovation af folkeskolernes åbenhed og sammenlignelighed

    DEFF Research Database (Denmark)

    Andersen, Kim Normann; Henriksen, Helle Zinner; Agger Nielsen, Jeppe

    2013-01-01

    Denne artikel præsenterer en normativ model (Public Sector Process Rebuilding, PPR), som kan indfange, hvor innovativt offentlige organisationer anvender digitale løsninger. Optag af digital innovation anskues ofte i litteraturen binært – enten er innovationen anskaffet eller ikke anskaffet. Vores...... argument er imidlertid, at optag af digitale innovationer kan gradbøjes. Vores sigte er derfor at få fokus væk fra anskaffelse og mere i retning af udnyttelse af digitaliseringen med henblik på at skabe forbedring af kerneydelserne og gavne slutbrugerne. Med empirisk afsæt i danske folkeskolers tolkning af...

  3. METODE BERMAIN PUZZLE BERPENGARUH PADA PERKEMBANGAN MOTORIK HALUS ANAK USIA PRASEKOLAH

    Directory of Open Access Journals (Sweden)

    Lilis Maghfuroh

    2018-03-01

    Full Text Available Pre-school is a period to increase fine motor development of children. This research aims to determine the increasing of fine motor development using the puzzle for preschoolers. his research is using one-group pre-post test design without control and procedures for statistical analysis through Wilcoxon Sign Rank Test with a confidence level of 95% and α: 5%. The subjects of this study were 40 children. The results of the analysis showed that there was effect of the intervention method by playing puzzle through the development of fine motor skills at pre-school children in mind that the value of Z sign p = 0.001 where significant value of p <0.05. Puzzle play method can improve child language development. The results of this research can be used as the basic for doing the puzzles therapy in children because it can improve fine motor skills development of children. Masa prasekolah merupakan masa peningkatan perkembangan motorik halus. Motorik halus adalah gerakan yang dilakukan oleh sekelompok otot-otot kecil seperti jari-jemari. Pada survey awal hampir sebagian anak mengalami perkembangan motorik suspek. Penelitian ini untuk mengetahui pengaruh metode puzzle terhadap perkembangan motorik halus anak pra sekolah. Penelitian ini menggunakan one-group pra-post test design tanpa control dan analisis statistik menggunakan Uji Wilcoxon Sign Rank Test dengan tingkat  kepercayaan 95% dan α : 5%. Populasi penelitian 50 anak dan sample 40 anak dengan tehnik Simple Random Sampling. Setelah data terkumpul dengan menggunakan DDST selanjutnya dianalisa. Hasil penelitian ini menunjukkan ada pengaruh metode bermain puzzle terhadap perkembangan motorik halus diketahui p sign = 0,001 dimana nilai signifikan p < 0,05. Hasil penelitian ini dapat dijadikan dasar untuk melakukan terapi puzzle pada anak untuk meningkatkan perkembangan motorik halus anak.

  4. Efektifitas Penerapan Metode Pembelajaran TAI (Team Assisted Individualization Berbantuan Modul Pembelajaran terhadap Hasil Belajar Ekonomi

    Directory of Open Access Journals (Sweden)

    Siti Fiki Ikmah

    2012-06-01

    Full Text Available Tujuan penelitian ini adalah mengetahui efektifitas penerapan model pembelajaran kooperatif tipe TAI berbantuan modul pembelajaran dibandingkan dengan metode ceramah bervariasi terhadap hasil belajar ekonomi akuntansi siswa kelas XI IPS SMA Negeri 1 Bergas Kabupaten Semarang Tahun Ajaran 2011/2012. Penelitian ini menggunakan Quasi eksperimental design postest only control group design. Fokus yang diteliti adalah hasil belajar dari segi proses (afektif dan psikomotor maupun hasil berupa pemahaman siswa (kognitif. Penelitian ini menggunakan teknik pengumpulan data dokumentasi, observasi dan tes sebagai dan dianalisis dengan teknik deskriptif persentase, dan uji statistik. Keaftifan siswa kelas eksperimen secara keseluruhan lebih aktif (77,78% di bandingkan kelas kontrol (70,14%. Pada aspek kemahiran kelas kontrol dan kelas eksperimen sama-sama naik 12,5%, namun dari aspek kesiapan kelas eksperimen naik lebih unggul (25% dibanding kelas kontrol(12,5%. Rata-rata nilai hasil post test kelas eksperimen lebih tinggi (81 dibandingkan kelas kontrol (73. Penerapan metode TAI berbantuan modul lebih efektif dibandingkan metode ceramah bervariasi terlihat dari pencapain ketuntasan nilai KKM sebesar 78,79% siswa tuntas. Model pembelajaran kooperatif tipe TAI berbantuan modul efektif dalam meningkatkan hasil belajar siswa baik dari segi proses maupun hasil dibandingkan dengan metode ceramah bervariasi (ceramah, tanya jawab dan penugasan. Guru disarankan menerapkan model pembelajaran kooperatif tipe TAI berbantuan modul pembelajaran pada pokok bahasan penyusunan laporan keuangan perusahaan jasa karena telah terbukti efektif, siswa disarankan belajar mandiri menggunakan modul terlebih dahulu sebelum pembelajaran klasikal. � The aim of this study� are compare effectiveness between implementation TAI collaboration with learning module and implementation conventional learning method at economic lesson achievement of XI IPS, SMA Negeri 1 Bergas 2011/2012 period

  5. Nationale Test

    DEFF Research Database (Denmark)

    2009-01-01

    Hvad er egentlig formålet med de nationale test? Bliver eleverne klogere af at blive testet? Og er der en sammenhæng mellem bandekrig og nationale test? Fysisk medie: dpu.dk/tv......Hvad er egentlig formålet med de nationale test? Bliver eleverne klogere af at blive testet? Og er der en sammenhæng mellem bandekrig og nationale test? Fysisk medie: dpu.dk/tv...

  6. PENGARUH METODE STRATAGEM MELALUI PEMBELAJARAN KOOPERATIF TERHADAP PEMAHAMAN KONSEP MATEMATIS SISWA KELAS VIII SMP NEGERI 20 PADANG

    Directory of Open Access Journals (Sweden)

    Alfi Yunita

    2016-10-01

    Full Text Available The goal of this research was to know: “Was the students’ understanding of mathematics concept who were taught by using ‘Stratagem’ Method through cooperative learning better than conventional Method.” The research method was Quasi Experimental Research, Post-test Only Control Design. Data was collected from the test. From data data analysis, it was found that the students’ understanding of mathematics concept who were taught by using ‘Stratagem’ Method through cooperative learning was better than conventional Method. Kata kunci: metode stratagem, pembelajaran kooperatif, pemahaman konsep matematis

  7. Rancang Bangun Sistem Pakar Untuk Mendiagnosis Gangguan Kepribadian Histerik Menggunakan Metode Certainty Factor

    Directory of Open Access Journals (Sweden)

    Tri Nur Oktavia

    2015-01-01

    Full Text Available Abstrak Gangguan kepribadian histerik atau yang biasa dikenal dengan gangguan kepribadian histrionik merupakan gangguan kepribadian dengan karakter emosi yang meluap-luap, termasuk keinginan berlebihan untuk mendapatkan pujian. Penderita gangguan kepribadian histerik mempunyai tingkah laku yang dramatik dan bereaksi terhadap sesuatu secara berlebihan, serta selalu ingin diperhatikan. Banyak orang yang mengalami gangguan ini, terutama kalangan remaja. Namun sebagian besar dari penderita gangguan ini kurang menyadari kondisinya dan menolak untuk melakukan konsultasi ke psikolog atau psikiater. Oleh sebab itu, dibutuhkan suatu sistem pakar yang dapat membantu untuk mendiagnosis secara mandiri gangguan kepribadian histerik dan mampu memberikan solusi penanganan yang tepat. Sistem tersebut dibangun dengan menggunakan metode waterfall dan metode certainty factor sebagai metode kepakarannya. Hasil dari penelitian ini adalah sistem pakar berbasis web untuk mendiagnosis tingkat gangguan kepribadian histerik. Sistem akan menampilkan nilai kepastian dan tingkat gangguan kepribadian histerik yang dialami pengguna, serta solusi penanganannya. Uji hasil kepakaran dilakukan dengan cara membandingkan hasil diagnosis dari sistem dengan hasil diagnosis dari pakar. Hasil uji kepakaran menunjukkan bahwa hasil diagnosis sistem sudah mendekati kebenaran dari diagnosis seorang pakar. Nilai prosentase sistem sebesar 83,01% dan nilai prosentase pakar sebesar 83,3%. Dengan adanya sistem pakar ini, masyarakat umum dapat melakukan diagnosis mandiri untuk mengetahui tingkat gangguan kepribadian histerik yang dialami serta penanganannya dengan mudah tanpa harus datang ke psikolog. Abstract Histrionic personality disorder is a personality disorder which has caharcteristic like overflowing emotion and excessive desire for praise. They always want to be noticed. Many people are suffered from this disorder, especially teenagers. The majority of people who suffer from this

  8. PROSFEKTIF METODE SAMPEL DARAH KERING DALAM BIOANALISIS

    Directory of Open Access Journals (Sweden)

    Supandi Supandi

    2017-08-01

    Full Text Available Biosampling of dried blood spot method became lately very interested in bioanalysis, some of the advantages given in this method compared to conventional venous canulla (venipuncture; less invasive making it more pleasant for the patient or subject, requires small volume, requires simple transportation process and storage did not need special equipment, suod stabilizes analit and reduces risk of infection. The method of dried blood spot is done by invasive light on the finger or heel prick and then spike on filter paper and dried at room temperature or under nitrogen flow with controlled humidity and stored in bag with desiccant packages, than it analyzed using validation bioanalyzing method. Dried blood spot method can be applied on bioanalysis test for pharmacokinetic, toksikokinetic , epidemiologic and Teurapeutic drug monitoring.

  9. SIFAT FUNGSIONAL ISOLAT PROTEIN ‘BLONDO’ (COCONUT PRESSCAKE DARI PRODUK SAMPING PEMISAHAN VCO (VIRGIN COCONUT OIL DENGAN BERBAGAI METODE

    Directory of Open Access Journals (Sweden)

    Siti Permatasari

    2015-11-01

    OHC tidak menunjukkan perbedaan yang signifikan antar metode (p≤ 0,05. Hasil penelitian ini menyimpulkan bahwa metode fisik menghasilkan sifat fungsional terbaik. Kata kunci: Sifat fungsional, isolat protein, blondo, VCO

  10. Test, dannelse og faglighed

    DEFF Research Database (Denmark)

    Schou, Lotte Rahbek

    2013-01-01

    Erfaringer fra blandt andet USA viser, at indførelse af obligatoriske nationale test får stor betydning for, hvilke former for faglighed der bliver dominerende i skolens undervisning. Hensigten har været at styrke de former for viden, som faktisk kan testes – ikke på bekostning af andre vidensfor...... vidensformer og indsigter - men simpelthen for blot at blive bedre til de dele af fagligheden, som kan testes. Forskning peger dog på, at obligatoriske test ikke blot styrker dele af fagligheden, men snarere bliver fuldstændig determinerende for hele fagligheden.......Erfaringer fra blandt andet USA viser, at indførelse af obligatoriske nationale test får stor betydning for, hvilke former for faglighed der bliver dominerende i skolens undervisning. Hensigten har været at styrke de former for viden, som faktisk kan testes – ikke på bekostning af andre...

  11. International fragmentation af produktionen og vertikal disintegration af styringsformer i produktionskæderne

    DEFF Research Database (Denmark)

    Refslund, Bjarke

    Stigende international økonomisk integration har betydet en stigende fragmentering af produktionen, hvor store dele udføres i forskellige lande. Dertil kommer en stigende disintegration af vertikale styringsformer i produktions-værdikæder (Global Value Chains). Dette konferencepaper diskutere...

  12. For bestemmelse af drivhusgasudledning ved udtagning/Ekstensivering af landbrugsjorder på kulstofrige lavbundsjorder

    DEFF Research Database (Denmark)

    Gyldenkærne, Steen; Greve, Mogens Humlekrog

    Sammenfatning: Rapporten beskriver hvordan man kan beregne ændringen i drivhusgasemissionen ved omlægning af landbrugsjord til naturarealer. Rapporten er primært rettet mod tilskudsordningen vedr. udtagning af organiske lavbundsjorde, men kan også anvendes i andre sammenhænge. Rapporten anvender de...

  13. Fermentering af korn øger fordøjeligheden af næringsstoffer

    DEFF Research Database (Denmark)

    Pedersen, Anni Øyan; Jørgensen, Henry; Bach Knudsen, Knud Erik

    2010-01-01

    foderblandingerne med ikke-fermentet korn var dog lavere end normalt, hvilket kan have påvirket resultaterne, så effekten af fermentering er større i dette forsøg, end hvad der normalt kan forventes. Kornet var groft formalet (ca. 30 % under 1 mm), hvilket kan have påvirket resultaterne. Ved finere formaling af...

  14. Eksperimentelt design og dets konsekvenser for fortolkningen af stimuli

    DEFF Research Database (Denmark)

    Christensen, Marie Herget

    2015-01-01

    Ved hjælp af text change-¬paradigmet kan man teste hvorvidt læsere bemærker ændringer i allerede processeret tekst når de præsenteres for den igen (Sturt et al. 2004). Som udgangspunkt har vi tilbøjelighed til at overse mindre ændringer i tekststimuli, men sproglige faktorer så som fokus og...... de udfordringer der er ved konstruering af relevante items til sådan et forsøg. Jeg vil koncentrere mig om de strukturelle forhold i dansk der giver udfordringer når man vil undersøge hvilken rolle artikler spiller i processering af tekster. I særdeleshed giver det udfordringer at forsøge......teori om grammatisk status. Master, Københavns Universitet. HANSEN, E. & HELTOFT, L. 2011. Grammatik over det danske sprog. Bind 2 : Syntaktiske og semantiske helheder, København: Det danske Sprog- og Litteraturselskab. HARDER, P. 2008. Determiners and definiteness. Essays on Nominal Determination: From...

  15. IMPLEMENTASI METODE PEMBELAJARAN BERBALIK (RESIPROCAL TEACHING PADA MATA PELAJARAN AKUNTANSI

    Directory of Open Access Journals (Sweden)

    J Titik Haryati

    2011-05-01

    Full Text Available The objective of the researches is to know wether resiprocal teaching learning can improve understanding accounting subject on the topic transaction journal cooperative accounting. Population in this research where XII IPS students in SMA Negeri 1 Tegal. Sample in this research where XII IPS 1 students in SMA Negeri 1 Tegal. Result of this research show reciprocal teaching learning implementation can improve understanding accounting subject on the topic transaction journal cooperative accounting. This can be should 80% students can reach the target. Based on the result, it is suggested that teacher can implement reciprocal teaching learning, and to use relevan literature. Key Words: Metode pembelajaran berbalik (reciprocal teaching, prestasi belajar

  16. Estimering af bilers brændstofforbrug ved brug af eksisterende GPS data

    DEFF Research Database (Denmark)

    Andersen, Ove; Lahrmann, Harry; Torp, Kristian

    2012-01-01

    GPS data opsamles i mange sammenhænge f.eks. for at finde køretider i vejnettet. I denne artikel vises, hvorledes eksisterende GPS data kan bruges til at estimere brændstofforbruget for en tur. En metode til at estimere brændstofforbruget for en enkelt tur generaliseres til at kunne estimere...

  17. Does an interdisciplinary outpatient atrial fibrillation (AF) clinic affect the number of acute AF admissions?

    DEFF Research Database (Denmark)

    Frydensberg, Vivi Skibdal; Brandes, Axel

    2018-01-01

    AIMS AND OBJECTIVES: To investigate the impact of a multidisciplinary outpatient clinic for patients with atrial fibrillation (AF-clinic) on the number of acute hospitalizations for atrial fibrillation compared with usual outpatient care for this condition before the establishment of the AF-clinic....... BACKGROUND: Guidelines recommend a structured outpatient clinic follow-up in multidisciplinary teams for patients with atrial fibrillation due to fewer hospitalizations and death. However the evidence base is weak. DESIGN: The study is a retrospective cohort study including a total of 129 patients from...... the cardiac outpatient clinic at a large Danish University Hospital. The study population consisted of two groups: a usual care group before a dedicated AF-clinic was established (n=73) and the AF-clinic group (n=56). The primary endpoint was acute hospitalization for AF. METHODS: Cox regression was used...

  18. PENERAPAN METODE MIND MAPPING PADA PEMBELAJARAN MATEMATIKA

    Directory of Open Access Journals (Sweden)

    Rahma Faelasofi

    2016-09-01

    Full Text Available The objectives of this research was to solve how to increase students learning mathematic achievments on the subject of statistic. This study aims to determine whether the students learning mathematic achievments of the student SMP Muhammadiyah 1 Gadingrejo in the academic year of 2014-2015 using learning method mind mapping on the subject of statistics can be higher than the students’ learning mathematic achievments without using learning method mind mapping. This research is a quantitative approach. The population was all of the students in first grade of the SMP Muhammadiyah 1 Gadingrejo in the academic year of 2014- 2015. The samples of the research were taken by using the cluster random sampling technique. Based on hypothesis test, it can be included that there are differences in the average student learning achievments between using learning method mind mapping and learning method lecture on the subject of Statistics of the student in first grade of the SMP Muhammadiyah 1 Gadingrejo in the academic year of 2014-2015. Keywords: learning method mind mapping, students’ learning mathematic achievments

  19. Identifikasi Urat (Vein) Sulfida Menggunakan Metode Induksi Polarisasi di Daerah Kemawi

    OpenAIRE

    Wibowo, Alamsyah

    2014-01-01

    Metode induksi polarisasi merupakan pengembangan dari metode tahanan jenis yang didasarkan pada pengukuran efek polarisasi yang terjadi akibat induksi arus. Pada penelitian ini dilakukan pengolahan, analisis dan interpretasi data pengukuran induksi polarisasi untuk mengidentifikasi sebaran mineralisasi sulfida pada daerah Kemawi, Jawa Tengah. Data yang digunakan berjumlah 11 lintasan dengan spasi 200 meter antar lintasan dan spasi elektroda 50 meter. Pengukuran dilakukan dalam domain...

  20. Perkembangan Riset Etnografi Di Era Siber : Tinjauan Metode Etnografi Pada Dark Web

    OpenAIRE

    Kautsarina Kautsarina

    2017-01-01

    Setiap tindakan manusia bermuatan kultural, begitu juga seluruh aktivitas manusia yang berkaitan dengan penggunaan internet. Bersama para pengguna internet lainnya, netizen mempertukarkan gagasan yang kemudian menghasilkan baik karya cipta maupun karsa di dunia maya. Etnografi merupakan metode penelitian yang dikhususkan untuk memahami aspek kultural dalam masyarakat. Penggunaan metode etnografi ini dinilai relevan untuk mengkaji kultur pengguna dan masyarakat dalam dunia maya. Selain interne...

  1. Kolaborasi Metode Ceramah, Diskusi dan Latihan Pada Materi Perkembangan Teknologi Untuk Meningkatkan Prestasi Belajar

    Directory of Open Access Journals (Sweden)

    Maski Maski

    2014-02-01

    Full Text Available Metode pembelajaran adalah cara yang digunakan guru dalam mengadakan interaksi antara guru dengan siswa. Setiap metode pembelajaran memiliki kelebihan dan kelemahan masing-masing. Oleh karena itu, dalam praktek pembelajaran mustahil menggunakan satu metode saja. Kombinasi (kolaborasi penggunaan beberapa metode merupakan keharusan dalam praktek pembelajaran. Terkait dengan parktek pembelajaran di kelas, peneliti selaku guru kelas mengalami permasalahan dalam pelajaran IPS mendeskripsikan materi “Perkembangan Teknologi” pada siswa kelas IVB yang berdampak pada rendahnya prestasi siswa. Penyebab kegagalan tersebut yaitu metode yang digunakan kurang tepat dan kurangnya motivasi siswa dalam mendiskripsikan persoalan. Oleh karena itu peneliti mencoba menggunakan kolaborasi metode ceramah, diskusi dan latihan. Berdasarkan hasil penelitian tindakan kelas yang dilakukan terhadap siswa kelas IVB SDN Pinggir Papas 1 selama dua siklus, kolaborasi metode ceramah, diskusi dan latihan dapat meningktkan prestasi belajar siswa. Untuk prestasi belajar siswa yang tuntas secara indvidu mulai dari siklus I sebanyak 22 siswa (73% dengan nilai rata-rata 74, pada siklus II bertambah menjadi 27 orang (90% dengan nilai rata-rata 87. Sedangkan untuk  aktivitas belajar siswa pada siklus I mendapat penilaian 60% meningkat menjadi 93,3% pada siklus II, maka dapat dikatakan bahwa pada siklus II ini perbaikan pembelajaran yang dilakukan guru dengan menggunakan kolaborasi metode ceramah, diskusi dan latihan telah berhasil menjadikan siswa aktif dalam mengikuti kegiatan pembelajaran.

  2. PEMANFAATAN SOFTWARE MATLAB DALAM PEMBELAJARAN METODE NUMERIK POKOK BAHASAN SISTEM PERSAMAAN LINEAR SIMULTAN

    Directory of Open Access Journals (Sweden)

    ani muanalifah

    2016-02-01

    Dalam pembelajaran metode Numerik khususnya pada pokok bahasan Sistem Persamaan Linear Simultan diperlukan perhitungan iterasi dengan menggunakan Komputer.  Software yang digunakan untuk perhitungan Numerik salah satunya adalah MATLAB.  Dengan peman- faatan software ini ternyata sangat membantu pemebelaja- ran metode numerik

  3. Penentuan Harga Jual Produk dengan Menggunakan Metode Cost Plus Pricing pada Ud. Vanela

    OpenAIRE

    Mawikere, Lidia; Ilat, Ventje; Woran, Reza

    2014-01-01

    Harga jual yang ditetapkan harus mampu menentukan semua biaya yang menghasilkan laba jangka panjang. Cost plus pricing adalah penetapan harga dengan menambahkan sejumlah (persentase) tertentu dari harga jual atau biaya sebagai keuntungannya. Tujuan penelitian ini adalah untuk mengetahui bagaimana Perusahaan menentukan harga jual produk dengan menggunakan metode cost plus pricing pada UD. Vanela. Dalam penganalisaan data digunakan metode deskriptif kuantitatif. Hasil penelitian menunjukan UD. ...

  4. Optisk scanning af spørgeskemaer

    DEFF Research Database (Denmark)

    Paulsen, Aksel

    / 1000 felter= 0.370 (95% CI: 0.160-0.729), (p= 0.020)). Der var ingen statistisk forskel mellem optisk scanning (fejl/ 1000 felter= 0.046 (95% CI: 0.001-0.258)) og manuel dobbelt indtastning (p=1.000). Konklusioner: Optisk scanning er et godt alternativ til manuel dobbelt indtastning for spørgeskema med......Formål og baggrund: Patient rapporterede outcomes i form af spørgeskemaer bruges i øgende grad i sundhedssektoren både i klinisk praksis og forskning. Ofte bruges spørgeskemaer i papirformat. Manuel dobbelt indtastning er defineret som guld standard for overføring af data til et elektronisk format......, men processen er tidkrævende. Optisk scanning af spørgeskemaer med automatisk registrering af svar kan være et alternativ, men videre validering af metoden er nødvendig. Design: 200 patienter blev tilfældigt udvalgt fra en kohorte på 5777 patienter der tidligere havde svaret på to forskellige...

  5. Laboratoriediagnostik af infektion forårsaget af Borrelia burgdorferi

    DEFF Research Database (Denmark)

    Dessau, Ram B; Bangsborg, Jette M; Jensen, Tove P Ejlertsen

    2006-01-01

    The laboratory diagnosis of Lyme disease in Denmark is reviewed with recommendations for serological testing. In Denmark the laboratory testing is performed with an ELISA technique. Most laboratories use an assay based on purified flagella antigen. The two-tier approach with Western Blot...... as confirmatory testing is not recommended since the contribution to the diagnostic specificity is only marginal. Predictive values of Lyme serology are presented, based on the estimated prevalence of the different stages of Lyme disease in Denmark....

  6. ADAPTIVE BACKGROUND DENGAN METODE GAUSSIAN MIXTURE MODELS UNTUK REAL-TIME TRACKING

    Directory of Open Access Journals (Sweden)

    Silvia Rostianingsih

    2008-01-01

    Full Text Available Nowadays, motion tracking application is widely used for many purposes, such as detecting traffic jam and counting how many people enter a supermarket or a mall. A method to separate background and the tracked object is required for motion tracking. It will not be hard to develop the application if the tracking is performed on a static background, but it will be difficult if the tracked object is at a place with a non-static background, because the changing part of the background can be recognized as a tracking area. In order to handle the problem an application can be made to separate background where that separation can adapt to change that occur. This application is made to produce adaptive background using Gaussian Mixture Models (GMM as its method. GMM method clustered the input pixel data with pixel color value as it’s basic. After the cluster formed, dominant distributions are choosen as background distributions. This application is made by using Microsoft Visual C 6.0. The result of this research shows that GMM algorithm could made adaptive background satisfactory. This proofed by the result of the tests that succeed at all condition given. This application can be developed so the tracking process integrated in adaptive background maker process. Abstract in Bahasa Indonesia : Saat ini, aplikasi motion tracking digunakan secara luas untuk banyak tujuan, seperti mendeteksi kemacetan dan menghitung berapa banyak orang yang masuk ke sebuah supermarket atau sebuah mall. Sebuah metode untuk memisahkan antara background dan obyek yang di-track dibutuhkan untuk melakukan motion tracking. Membuat aplikasi tracking pada background yang statis bukanlah hal yang sulit, namun apabila tracking dilakukan pada background yang tidak statis akan lebih sulit, dikarenakan perubahan background dapat dikenali sebagai area tracking. Untuk mengatasi masalah tersebut, dapat dibuat suatu aplikasi untuk memisahkan background dimana aplikasi tersebut dapat

  7. PENINGKATAN AKTIVITAS DAN HASIL BELAJAR POKOK BAHASAN PASAR DENGAN METODE RESITASI PADA SISWA KELAS VIII SMP NEGERI 24 SEMARANG TAHUN AJARAN 2013/2014

    Directory of Open Access Journals (Sweden)

    Diinul Qoyyimah

    2013-11-01

    Full Text Available Aktivitas siswa kelas VIII pada mata pelajaran ekonomi SMP Negeri 24 Semarang pada pokok bahasan pasar masih rendah sehingga berdampak pada hasil belajar siswa yang masih dibawah KKM. Salah satu penyebabnya karena guru masih menerapkan metode belajar yang sama dalam waktu yang lama sehingga mengakibatkan rendahnya perolehan hasil belajar. Melalui penerapan metode ceramah bervariasi dan resitasi diharapkan siswa dapat belajar dengan santai dan senang dalam mengikuti proses pembelajaran. Penelitian ini bertujuan untuk mengetahui penerapan metode resitasi, dapat meningkatkan aktivitas dan hasil belajar siswa. Metode penelitian menggunakan penelitian tindakan kelas. Prosedur penelitian dilakukan dimulai dengan perencanaan, pelaksanaan, observasi dan refleksi. Metode pengumpulan data dengan dokumentasi dan tes. Hasil penelitian menyatakan bahwa ada peningkatan aktivitas siswa dan hasil belajar siswa materi pasar pada kelas VIII SMP Negeri 24 Semarang tahun 2013/2014. The students’ activity in VIII class of economic subject in SMP Negeri 24 Semarang in the subject matter of market topic is still low so it has the impact on the students’ learning outcome which is still under KKM requirements. One of the causes is because the teachers are still apply the same learning method in a long time so it resulted in low learning outcomes acquisition.through the application of various conventional methods and recitation are expected that students can learn easily and pleasure in participating of learning process. This study aims to determine the application of recitation method which can improve the activity and students’ learning outcomes. The research method using classroom action research. The research procedure begins with planning, implementation, observation and reflection. Methods of data collection carried out by documentation and test. The result of research states that there is an increasing activity and students’ learning outcomes in the

  8. E1AF degradation by a ubiquitin-proteasome pathway

    International Nuclear Information System (INIS)

    Takahashi, Akiko; Higashino, Fumihiro; Aoyagi, Mariko; Yoshida, Koichi; Itoh, Miyuki; Kobayashi, Masanobu; Totsuka, Yasunori; Kohgo, Takao; Shindoh, Masanobu

    2005-01-01

    E1AF is a member of the ETS family of transcription factors. In mammary tumors, overexpression of E1AF is associated with tumorigenesis, but E1AF protein has hardly been detected and its degradation mechanism is not yet clear. Here we show that E1AF protein is stabilized by treatment with the 26S protease inhibitor MG132. We found that E1AF was modified by ubiquitin through the C-terminal region and ubiquitinated E1AF aggregated in nuclear dots, and that the inhibition of proteasome-activated transcription from E1AF target promoters. These results suggest that E1AF is degraded via the ubiquitin-proteasome pathway, which has some effect on E1AF function

  9. Lejere der bliver sat ud af deres bolig

    DEFF Research Database (Denmark)

    Christensen, Gunvor; Nielsen, Torben Heien

    Antallet af lejere, der bliver sat ud af deres bolig, er steget i perioden 2002-06. I 2006 blev 2600 husstande, svarende til 0,1 pct. af samtlige husstande i Danmark, sat ud af deres bolig. Stigningen er især sket i de fem største byer: København, Århus, Odense, Ålborg og Esbjerg. I dette...... skal give viden om, hvilke årsager der er til, at nogle lejere bliver sat ud af deres bolig, og hvorfor der er sket en stigning i antallet af udsættelser. Den endelige afrapportering af undersøgelsen af udsættelser i Danmark vil ske i foråret 2008. Undersøgelsen er finansieret af Socialministeriet....

  10. Produktudvikling af fødevarer med Quality Function Deployment

    DEFF Research Database (Denmark)

    Bech, Anne C.

    1998-01-01

    Produktudvikling af fødevarer stiller stadig større krav til virksomhedernes kompetencer. QFD filosofien kan bidrage til at skabe en fælles forståelse af grundlaget for udvikling af nye produkter. Udgangspunktet er en forståelse af forbrugernes behov i relation til virksomhedens muligheder...... konkurrentprodukter. Efterfølgende faser handler om at generere forskellige mulige løsninger, inden der træffes valg af løsningsalternativ. Anvendelse af QFD modellen for produktudvikling betyder, at forbrugernes behov er centrale i hele produktudviklingsforløbet, samt at det udviklede produkt sigter mod at opfylde...... væsentlige identificerede behov set fra forbrugernes synspunkt. At virksomheden ser implementering af QFD som en investering, medarbejdernes commitment og målrettet projekt, er væsentlig for en succesfuld implementering af QFD til produktudvikling. QFD tankegangen illustreres med et eksempel på udvikling af...

  11. Undersøgelsen af brugernes evaluering af kontorpakker på Århus Sygehus og i Psykiatrien i Århus

    DEFF Research Database (Denmark)

    Hørlück, Jens

    En analyse af brugernes opfattelse af kvaliteten af tre office pakker: MS Office 2003 / 2007 og OpenOffice.  ......En analyse af brugernes opfattelse af kvaliteten af tre office pakker: MS Office 2003 / 2007 og OpenOffice.  ...

  12. Nationale test i naturfag

    DEFF Research Database (Denmark)

    Andreasen, Karen Egedal; Jensen, Lars Bang

    2015-01-01

    Kapitlet rummer en analyse og diskussion af test inden for naturfagsområdet og de fagforståelser de afspejler med fokus på de nationale test.......Kapitlet rummer en analyse og diskussion af test inden for naturfagsområdet og de fagforståelser de afspejler med fokus på de nationale test....

  13. Laboratoriediagnostik af infektion forårsaget af Borrelia burgdorferi

    DEFF Research Database (Denmark)

    Dessau, Ram B; Bangsborg, Jette M; Jensen, Tove P Ejlertsen

    2006-01-01

    The laboratory diagnosis of Lyme disease in Denmark is reviewed with recommendations for serological testing. In Denmark the laboratory testing is performed with an ELISA technique. Most laboratories use an assay based on purified flagella antigen. The two-tier approach with Western Blot as confi......The laboratory diagnosis of Lyme disease in Denmark is reviewed with recommendations for serological testing. In Denmark the laboratory testing is performed with an ELISA technique. Most laboratories use an assay based on purified flagella antigen. The two-tier approach with Western Blot...... as confirmatory testing is not recommended since the contribution to the diagnostic specificity is only marginal. Predictive values of Lyme serology are presented, based on the estimated prevalence of the different stages of Lyme disease in Denmark. Udgivelsesdato: 2006-Aug-21...

  14. Laboratoriediagnostik af infektion forårsaget af Borrelia burgdorferi

    DEFF Research Database (Denmark)

    Dessau, Ram; Bangsborg, Jette Marie; Jensen, Tove P Ejlertsen

    2006-01-01

    The laboratory diagnosis of Lyme disease in Denmark is reviewed with recommendations for serological testing. In Denmark the laboratory testing is performed with an ELISA technique. Most laboratories use an assay based on purified flagella antigen. The two-tier approach with Western Blot as confi......The laboratory diagnosis of Lyme disease in Denmark is reviewed with recommendations for serological testing. In Denmark the laboratory testing is performed with an ELISA technique. Most laboratories use an assay based on purified flagella antigen. The two-tier approach with Western Blot...... as confirmatory testing is not recommended since the contribution to the diagnostic specificity is only marginal. Predictive values of Lyme serology are presented, based on the estimated prevalence of the different stages of Lyme disease in Denmark....

  15. Evaluering af 'Tankerne på plads og hverdagen tilbage' - et kursusforløb for modermærkekræftramte

    DEFF Research Database (Denmark)

    Haslam, Trine Lolk

    af modermærkekræft til at genvinde trygheden og kontrollen i deres liv, ved at gøre dem bedre i stand til at forstå, acceptere og håndtere deres sygdom og behandling, samt at reducere de modermærkekræftramtes brug af sundhedsvæsenet til det nødvendige. Således ønskes det at påvirke adfærd på kort og...... behandlingen samt give en tilbagemelding på operationsforløbet. På kurset underviser desuden en psykolog, der behandler de psykologiske aspekter ved det at få en livstruende sygdom, hvilket ligeledes er af stor betydning for kursisterne. Desk study underbygger dette ved at pointere, at patientskole med...... formidling af viden via forskellige metoder, giver positiv effekt. Analysen i forbindelse med programteori 2 underbygger at kurset er tilrettelagt og gennemført som gruppebaseret undervisning, hvilket jf. desk study bidrager til øget egenomsorg. Den procesorienterede dialogiske tilrettelæggelse og...

  16. Penerapan Metode Particle Swarm Optimization Pada Optimasi Prediksi Pemasaran Langsung

    Directory of Open Access Journals (Sweden)

    Yuni Eka Achyani

    2018-04-01

    Full Text Available Abstrak Dalam persaingan ketat saat ini, promosi yang baik dapat memberikan kredibilitas untuk produk baru. Promosi perlu mendapat perhatian lebih dan serius, karena dalam kehidupan sehari-hari timbul produk unggulan, jika tidak mengetahuinya, kemungkinan produk yang ditawarkan kepada konsumen kurang ditanggapi oleh pasar, oleh karena itu perusahaan harus mengupayakan produknya, meyakinkan dan mempengaruhi konsumen untuk menciptakan permintaan akan produk ini. Langkah yang bisa dilakukan oleh perusahaan untuk melakukannya adalah dengan melakukan pemasaran langsung. Peningkatan akurasi prediksi pemasaran langsung dapat dilakukan dengan cara melakukan seleksi terhadap atribut, karena seleksi atribut mengurangi dimensi dari data sehingga operasi algoritma data mining dapat berjalan lebih efektif dan lebih cepat. Dalam penelitian ini akan digunakan metode support vector machine dan akan dilakukan seleksi atribut dengan menggunakan particle swarm optimization untuk prediksi pemasaran langsung. Setelah dilakukan pengujian maka hasil yang didapat adalah support vector machine menghasilkan nilai akurasi sebesar 88,71 %, nilai precision 89,47% dan nilai AUC sebesar 0,896. Kemudian dilakukan seleksi atribut dengan menggunakan particle swarm optimization dimana atribut yang semula berjumlah 16 variabel prediktor terpilih 12 atribut yang digunakan. Hasil menunjukkan nilai akurasi yang lebih tinggi yaitu sebesar 89,38%, nilai precision 89,89% dan nilai AUC sebesar 0,909 dengan nilai akurasi klasifikasi sangat baik (excellent clasiffication. Sehingga dicapai peningkatan akurasi sebesar 0,67 %, dan peningkatan AUC sebesar 0,013. Kata Kunci: Particle Swarm Optimization, Pemasaran Langsung, Seleksi Atribut Abstract In the current intense competition a good promotion can provide credibility for a new product. Promotion needs to get more attention and serious, because in everyday life arise a prime product, if not find out, the possibility of products offered to

  17. PELACAKAN DAN PENGENALAN WAJAH MENGGUNAKAN METODE EMBEDDED HIDDEN MARKOV MODELS

    Directory of Open Access Journals (Sweden)

    Arie Wirawan Margono

    2004-01-01

    Full Text Available Tracking and recognizing human face becomes one of the important research subjects nowadays, where it is applicable in security system like room access, surveillance, as well as searching for person identity in police database. Because of applying in security case, it is necessary to have robust system for certain conditions such as: background influence, non-frontal face pose of male or female in different age and race. The aim of this research is to develop software which combines human face tracking using CamShift algorithm and face recognition system using Embedded Hidden Markov Models. The software uses video camera (webcam for real-time input, video AVI for dynamic input, and image file for static input. The software uses Object Oriented Programming (OOP coding style with C++ programming language, Microsoft Visual C++ 6.0® compiler, and assisted by some libraries of Intel Image Processing Library (IPL and Intel Open Source Computer Vision (OpenCV. System testing shows that object tracking based on skin complexion using CamShift algorithm comes out well, for tracking of single or even two face objects at once. Human face recognition system using Embedded Hidden Markov Models method has reach accuracy percentage of 82.76%, using 341 human faces in database that consists of 31 individuals with 11 poses and 29 human face testers. Abstract in Bahasa Indonesia : Pelacakan dan pengenalan wajah manusia merupakan salah satu bidang yang cukup berkembang dewasa ini, dimana aplikasi dapat diterapkan dalam bidang keamanan (security system seperti ijin akses masuk ruangan, pengawasan lokasi (surveillance, maupun pencarian identitas individu pada database kepolisian. Karena diterapkan dalam kasus keamanan, dibutuhkan sistem yang handal terhadap beberapa kondisi, seperti: pengaruh latar belakang, pose wajah non-frontal terhadap pria maupun wanita dalam perbedaan usia dan ras. Tujuan penelitiam ini adalah untuk membuat perangkat lunak yang menggabungkan

  18. METODE PELAKSANAAN DEWATERING YANG RAMAH LINGKUNGAN PADA PROYEK THE NEST CONDOTEL

    Directory of Open Access Journals (Sweden)

    I Wayan Intara

    2016-03-01

    Full Text Available Proyek Pembangunan The Nest Condotel merupakan salah satu upaya untuk memenuhi sarana dan prasarana pariwisata khusunya daerah Nusa Dua-Bali. Proyek ini dibangun di tengah-tengah pemukiman penduduk dan berdekatan dengan Pengolahan Limbah BTDC. Setelah dilaksanakan survei lapangan ada permasalahan yang dihadapi pada pembangunan proyek ini yaitu pada pengerjaan struktur basement. Kondisi muka air tanah lebih tinggi daripada rencana pemukaan galian lantai basement yang akan dibuat. Di samping itu, kondisi tanah yang kurang baik dengan kondisi tanah yang berpasir. Berdasarkan permasalahan di atas perlu adanya pemilihan perencanaan metode penanganan muka air tanah yang paling tepat dalam pekerjaan  galian basement. Dewatering adalah proses penurunan muka air tanah pada suatu area tertentu dengan cara pemompaan dari sebuah sumur ataupun saluran. Tujuannya adalah untuk menjaga area galian tetap kering dalam proses konstruksi dan menjaga kestabilan lereng galian. Pemompaan dilakukan melalui sumur-sumur dewatering (dewatering well atau well point atau saluran-saluran (sump dengan menggunakan pompa submersible (submersible pump. Dengan demikian penggalian basement bisa dikerjakan dengan baik. Penelitian ini adalah menentukan metode pelaksanaan pekerjaan dewatering yang paling tepat dari metode-metode pelaksanaan yang mungkin untuk dilaksankan berdasarkan biaya, waktu, dan dampak terhadap lingkungan. Metodelogi yang digunakan untuk analisis data adalah menganalisis metode-metode pelaksanaan yang ada dan dari hasil analisis akan ditetapkan metode pelaksanaan terbaik. Hasil analisis dari beberapa metode pelaksanaan yang ada untuk pekerjaan dewatering digunakan adalah predrainage dan open pumping, metode yang terpilih yaitu open pumping adalah metode terbaik untuk dilaksanakan pada proyek tersebut dengan biaya yang terendah, waktu pelaksanaan yang lebih cepat, dan dampak lingkungan yang dapat diminimalisir

  19. Aplikasi Prediksi Usia Kelahiran dengan Metode Naive Bayes

    Directory of Open Access Journals (Sweden)

    Naisha Rahma Indraswari

    2018-04-01

    Full Text Available Umumnya kelahiran bayi sehat cukup bulan berada pada minggu 38-42 kehamilan. Namun ada banyak bayi yang terlahir pada usia kelahiran yang kurang mencukupi bahkan lahir dalam usia kelahiran yang lewat waktu. Hal ini menjadi hal yang serius mengingat banyak terjadi kematian bayi akibat usia kelahiran yang kurang mencukupi atau yang lewat waktu. Penelitian ini bertujuan untuk membuat aplikasi prediksi yang nantinya akan dapat membantu pasien dalam mengetahui usia kelahirannya dan mengantisipasi hal yang tidak diinginkan kedepannya. Metode yang digunakan merupakan metode Naïve Bayes dengan variable inputan faktor-faktor yang dialami oleh ibu hamil, diantaranya: usia ibu, tekanan darah, jumlah bayi, riwayat persalinan, riwayat abortus/ kuretase, malnutrisi, penyakit bawaan sebelum hamil dan masalah saat kehamilan. Hasil dari penelitian ini merupakan sebuah aplikasi yang dapat memprediksi usia kelahiran dengan nilai akurasi aplikasi tertinggi pada angka 78,69%, nilai precision tertinggi ada pada angka 70.14% dan nilai recall tertinggi ada pada angka 63.64%. Kata kunci: aplikasi, naïve bayes, prediksi, usia kelahiran.

  20. Optimalisasi Produksi Di Industri Garment Dengan Menggunakan Metode Simpleks

    Directory of Open Access Journals (Sweden)

    Rizal Rachman

    2017-04-01

    Full Text Available Abstrak Aplikasi optimalisasi Produksi dan Keuntungan pada perusahaan Garment ini dibangun untuk mengatasi permasalahan tersebut. Aplikasi ini memiliki kemampuan dalam mengolah data bahan baku benang, data waktu kerja, data kebutuhan produksi dan data beban untuk dilakukan perhitungan pengoptimalan. Adapun dasar perhitungan yang dilakukan meliputi perhitungan optimasi menggunakan metode Simpleks dan Visual Basic 6. Hasil keluaran dari aplikasi ini adalah banyak yang diproduksi berdasarkan sumber daya benang yang ada, biaya total beban pengeluaran yang dikeluarkan saat proses produksi serta keuntungan kotor dan bersih dari penjualan. Aplikasi ini dapat meningkatkan keuntungan perusahaan dan tingkat prosentase keuntungan bergantung pada besar harga perbandingan penjualan antara produk yang satu dengan yang lainnya. Kata kunci : Optimasi, Metode simpleks, Linier Programming, Abstract Application optimization of Production and Profits in Garment company is built to overcome these problems. This application has the ability to process data yarn materials, work time data, the data needs of production and expense data for calculation optimization. The basis of calculation was conducted on the optimization calculations using the Simplex method and Visual Basic 6. The output of this application is many are produced based on the resources existing threads, the total cost of expenditure incurred during the production process as well as gross and net profits from sales. This application can increase corporate profits and the percentage of large profits depend on the price comparison between the sale of one product to another. Keywords: optimization, simplex method, Linear Programming.

  1. IMPLEMENTASI METODE INQUIRY UNTUK MENINGKATKAN HASIL BELAJAR BIOLOGI

    Directory of Open Access Journals (Sweden)

    T. H. Agustanti

    2012-04-01

    Full Text Available Tujuan penelitian ini adalah untuk meningkatkan hasil belajar biologi pada siswa kelas VIIE SMP N 2 Wonosobo semester 1 tahun pelajaran 2010/2011 pada mata pelajaran biologi melalui Implementasi Metode Inquiry. Dari hasil penelitian dapat disimpulkan bahwa Implementasi Metode Inquiry dapat meningkatkan hasil belajar siswa pada mata pelajaran Biologi. Dari penelitian ini disarankan agar guru-guru mencari inovasi-inovasi baru yang dapat merangsang sehingga proses pembelajaran lebih bermakna. The purpose of this research is to improve the learning result for first semester students of SMP N 2 Wonosobo VIIE class in the academic year 2010/2011 in the Biology subject using Inquiry method. From the research, it can be concluded that the implementation of Inquiry method can improve the learning result in the Biology subject. Base don the research result it can be suggested that the teacher can find the new innovation to stimulate students’ motivation in order to make the learning process to be more significant.

  2. SISTEM PENDUKUNG KEPUTUSAN PEMILIHAN GADGET ANDROID MENGGUNAKAN METODE PROMETHEE

    Directory of Open Access Journals (Sweden)

    Gunawan Gunawan

    2013-05-01

    Full Text Available Kebutuhan informasi dan teknologi menjadi hal yang penting bagi kehidupan manusia. Ponsel saat ini bukan hanya digunakan untuk telepon dan berkirim pesan, seiring perkembangan teknologi ponsel sudah dapat melakukan sama dengan apa yang bisa dilakukan komputer mulai dari internet, email, chating, video dan sebagainya. Teknologi Android merupakan teknologi hasil karya google yang dihadirkan pada telepon pintar atau gadget. Seiring perkembangan teknologi sistem operasi android dan perkembangan gadget pada smartphone dan tablet mengakibatkan banyaknya gadget yang beredar dengan berbagai merek dan spesifikasi yang beragam. Gadget android yang ada di pasar sekarang sudah berjumlah lebih dari 70 jenis yang mengakibatkan kebingungan bagi calon pembeli. Pertimbangan yang digunakan bagi calon pembeli meliputi kriteria dan spesifikasi yang kompleks membuat calon pembeli sulit dalam menentukan gadget yang dirasa tepat sesuai yang diinginkan. Penelitian ini dilakukan dengan memanfaatkan teknologi informasi dengan cara membuat sebuah sistem pendukung keputusan terhadap gadget android dengan menggunakan metode promethee. Dari hasil penelitian dengan metode promethee dihasilkan perankingan rekomendasi terhadap gadget android sesuai yang di inginkan oleh calon pembeli berdasarkan kriteria dan spesifikasi sehingga dapat membantu calon pembeli dalam menentukan gadget yang diinginkan. Dari hasil tersebut diharapkan dapat membantu calon pembeli dalam menentukan gadget yang tepat sesuai kriteria dan spesifikasi yang diinginkan. Kata Kunci: teknologi, gadget,  Android, promethee, sistem.

  3. Svingningsundersøgelse af betonskorsten

    DEFF Research Database (Denmark)

    Dalgaard, Lars-Bo; Kristensen, Peter

    Dette projekt omhandler en teoretisk og en eksperimentel undersøgelse af svingningsforholdene for en 110 meter høj betonskorsten. Skorstenen tilhører I/S Nordjyllands elektricitetsforsyning(NEFO) og er opført i forbindelse med en udbygning af Vendsysselværket med en sektion II med en turbine effe...... på 300 MW. Vendsysselværkets sektion I og II er afbilledet i figur 1.1.1, hvor værket er set fra nordøst med den undersøgte skorsten til højre i billedet. Skorstenen er projekteret af firmaet Rambøll og Hannemann og taget i brug i foråret 1977....

  4. MR-AFS: a global hierarchical file-system

    International Nuclear Information System (INIS)

    Reuter, H.

    2000-01-01

    The next generation of fusion experiments will use object-oriented technology creating the need for world wide sharing of an underlying hierarchical file-system. The Andrew file system (AFS) is a well known and widely spread global distributed file-system. Multiple-resident-AFS (MR-AFS) combines the features of AFS with hierarchical storage management systems. Files in MR-AFS therefore may be migrated on secondary storage, such as roboted tape libraries. MR-AFS is in use at IPP for the current experiments and data originating from super-computer applications. Experiences and scalability issues are discussed

  5. Leagile Manufacturing - implementering af modulariserede produktplatforme

    DEFF Research Database (Denmark)

    Bjarnø, Ole-Christian

    2003-01-01

    Lean og Agile (Leagile) Manufacturing indebærer ikke blot den rette balance (dekobling) mellem lean producerede komponenter og agile konfigurerede færdigvarer, og dermed til levering af individualiserede produkter til konkurrencedygtige priser og høj kvalitet, men også til effektivitet og...... fleksibilitet i produktudvikling og produktion. For at opnå integrationen mellem agile og lean kan der arbejdes med en vifte af integrationsmekanismer inden for organisatoriske og teknologiske virkemidler. Projektet har til formål at identificere, strukturere og modellere de centrale analyse- og...

  6. Supervision af psykologkandidater i privat praksis

    DEFF Research Database (Denmark)

    Petersen, Birgitte

    et litteratur review over relevante temaer i supervisionslitteraturen samt overvejelser om læring i supervision. Afhandlingens empiriske resultater vil blive belyst og diskuteret med udgangspunkt i tilsvarende fænomener i supervisionslitteraturen. Resultaterne af undersøgelsen viser, at der er en...... række vigtige elementer ved supervision, der skal være opfyldt, hvis den skal opleves som udviklende og lærerig af praksiskandidaterne. Det er elementer som kontraktetablering, rådgivning og teoretisk refleksion, en tydelig teoretisk referenceramme samt støtte og anerkendelse fra supervisor. Det...

  7. Design og analyse af eksperimenter i R

    DEFF Research Database (Denmark)

    Dahl, Malte Rokkjær

    2017-01-01

    eksperimentelle studier med afsæt i statistikprogrammet R. Det er håbet, at notatet vil være en hjælp til at reflektere over, designe, og analysere eksperimenter i forbindelse med bachelorprojekter eller specialer - og forhåbentligt også i arbejde med eksperimenter uden for instituttets mure. Notatet berører......, herunder balancetest, hypotesetest med og uden kovariatjustering, interaktioner samt udledning af konfidensintervaller. Det antages, at læseren har et grundlæggende kendskab til R samt til *potentiel outcomes*-frameworket. De indledende kapitler i Gerber & Green (2012) eller Imbens & Athey (2017) er gode...

  8. Epichlorhydrin og bisphenol A i mat-kontaktmaterialer af epoxylakeret metal og/eller af plast

    DEFF Research Database (Denmark)

    Petersen, Jens Højslev; Pedersen, Gitte Alsing; Foverskov, Annie

    Det er ikke længere tilladt af bruge bisphenol A baseret polycarbonatplast til fremstilling af tåteflasker. Mattilsynet udtog i vinteren 2012/2013 7 typer af sutteflasker som blev kontrolleret for om de indeholdt polycarbonatbaserede plastdele. I alt 28 enkeltdele blev kontrolleret ved infrarød...... spektrometri. Herudover blev 6 tutekopper, bestående af 38 enkeltdele, analyseret med samme teknik. Der blev ikke påvist bisphenol A baseret plast ved analyserne. Dåser, bægre, tuber og skruelåg kan være lakeret på matkontaktsiden med epoxylakker fremstillet af monomererne epichlorhydrin og bisphenol A. Alle...... 50 enkeltdele fra disse prøver blev undersøgt ved infrarød spektrometri og 9 af prøverne viste tegn på at indeholde epoxylak. Disse prøver blev undersøgt ved en ”worst case” ekstraktionstest hvor der kunne påvises små indhold af bisphenol A i ekstrakterne mens der ikke kunne påvises epichlorhydrin...

  9. PERBANDINGAN METODE PEMBELAJARAN NUMBERED HEAD TOGETHER (NHT DENGAN THINK PAIR SHARE (TPS PADA HASIL BELAJAR KEWIRAUSAHAAN

    Directory of Open Access Journals (Sweden)

    M. Maulani Subhi

    2016-11-01

    diatas dapat disimpulkan bahwa perbandingan metode pembelajaran Numbered Head Together (NHT lebih tinggi dari pada metode pembelajaran Think Pair Share (TPS pada hasil belajar siswa kelas X SMK Islam Roulotus Saidiyyah. Education means interaction educator to learners in order to help learners master the objectives of education. Education will be successful, if the learning process is progressing well. The learning process will take place either if the teaching methods are applied in accordance with the state of the student. During this learning process is still done conventionally. As a result, seing on previsious result of student learning outcomes in vocational Islam Roudlotus Saidiyyah still many students who have not completed value yet. To avoid this, one of the efforts to implement a Learning Numbered Head Together Method (NHT and Think Pair Share (TPS. The formulation of the problem is there a difference between the results of studies of learning methods Numbered Head Together (NHT with Think Pair Share (TPS on learning outcomes kewirausahaan subjects of class X SMK Islam Roudlotus Saidiyyah Semarang.The research method used is a quasi experimental. Population in this students of class X SMK Islam Roudlotus Saidiyyah. Samplingtechnique used is sampling quotas, thus taking a sample of 32 students, class X TKJ as the first experimental class and the class as a class X PS second experiment. Methods of data collection using the documentation, test and questionnaire and analyzed using t-test.Based on the results of test calculations independent sample t-test found the Sig. (2-tailed for 0,009 student motivation, the Sig. (2-tailed for 0,035 student responses, the Sig. (2-tailed for student learning outcomes 0.03. Based on the value of Sig. (2-tailed, we can conclude that there are differences in student learning outcomes NHT class to class TPS. The average level of 73.8% of student motivation, siswa72,0% response rate, and student learning outcomes in grade 71

  10. SISTEM PAKAR BERBASIS ATURAN DALAM BIMBINGAN PENASEHAT AKADEMIK MENGGUNAKAN METODE FORWARD CHAINING

    Directory of Open Access Journals (Sweden)

    Bayu Febriadi

    2016-02-01

    Full Text Available AbstrakPenasehat Akademik merupakan Proses Pengisian kartu rencana study bagi mahasiswa yang akan mengambil matakuliah apa yang akan diambil untuk semester selanjutnya. Sebelum terjadinya proses belajar mengajar (PBM berlangsung pada awal semester, kegiatan rutin yang dilakukan adalah adalah penyusunan matakuliah bagi mahasiswa. rancangan sistem ini menggunakan inference forward chaining, dengan implementasi sistem menggunakan sistem database MySQL dan bahasa pemrograman PHP. Forward Chaining adalah metode inference enggine yang mencocokan fakta atau pernyataan dimulai dari bagian sebelah kiri (IF dulu. Dengan kata lain, penalaran dimulai dari fakta terlebih dahulu untuk menguji kebenaran hipotesis. Tesis ini membangun suatu sistem pakar berbasis aturan dalam penyusunan Kartu Rencana Study (KRS bagi mahasiswa khususnya yang akan mengambil matakuliah menggunakan metode forward chaining. Tujuan untuk membantu mahasiswa yang belum tahu dalam pengisian kartu rencana study tanpa langsung bertemu dengan dosen pembimbing akademik nya dalam pengambilan matakuliah.Kata kunci : sistem pakar, forward chaining, matakuliahAbstractAcademic adviser is a card charging process study plans for students who will take courses which will be taken for the next semester. Prior to the teaching and learning process (PBM took place at the beginning of the semester, is a routine activity undertaken is the preparation course for students. The system design uses forward chaining inference, with the implementation of the system using MySQL database system and the PHP programming language. Forward Chaining is a method of inference enggine that match facts or statements starting from the left (first IF. In other words, reasoning from facts first started to test the truth of the hypothesis. This thesis build a rule-based expert system in preparation Card Study Plan (KRS for students who will take courses in particular using forward chaining method. Aim to help students who do

  11. Global opvarmning neutraliserer effekten af parasitisme på strandsnegles konsumption af makroalger

    DEFF Research Database (Denmark)

    Larsen, Martin H.; Mouritsen, Kim Nørgaard

    Det er veldokumenteret, at parasitter kan påvirke værternes adfærd, overlevelse, reproduktion, fysiologi og evolution. Disse parasit-vært interaktioner kan føre til radikale ændringer af naturlige samfunds struktur og diversitet. Eksperimenter har eksempelvis vist, at trematoder indirekte kan ændre...... strukturen af makroalgesamfund ved at reducere konsumptionsraten hos den herbivore strandsnegl Littorina littorea. Det er endvidere vist, at produktionen af trematode-larver (cercarier) i sneglens fordøjelseskanal og gonade kompleks øges kraftigt når vandtemperaturen stiger. Man kan derfor forvente...

  12. Domesticeringen af Ford i Danmark:Den kulturelle tilegnelse af Ford og fordismen, 1920-1940

    OpenAIRE

    Wagner, Michael

    2009-01-01

    Det amerikanske automobilfirma Ford Motor Company med hovedkvarter i Detroit begyndte at drive forretning i Danmark omkring 1906. De første aktiviteter blev konsolideret samme år ved udnævnelsen af motorforhandleren F. Bülow & Co. til salgsagent i Danmark og importør af Ford automobiler til det skandinaviske marked. Dermed havde Ford tidligt fået et stærkt fodfæste i Nordeuropa, som udviklingen i salget af Ford autobiler de næste årtier til fulde skulle demonstrere. Ford Motor Company er ...

  13. Degradation of AF1Q by chaperone-mediated autophagy

    International Nuclear Information System (INIS)

    Li, Peng; Ji, Min; Lu, Fei; Zhang, Jingru; Li, Huanjie; Cui, Taixing; Li Wang, Xing; Tang, Dongqi; Ji, Chunyan

    2014-01-01

    AF1Q, a mixed lineage leukemia gene fusion partner, is identified as a poor prognostic biomarker for pediatric acute myeloid leukemia (AML), adult AML with normal cytogenetic and adult myelodysplastic syndrome. AF1Q is highly regulated during hematopoietic progenitor differentiation and development but its regulatory mechanism has not been defined clearly. In the present study, we used pharmacological and genetic approaches to influence chaperone-mediated autophagy (CMA) and explored the degradation mechanism of AF1Q. Pharmacological inhibitors of lysosomal degradation, such as chloroquine, increased AF1Q levels, whereas activators of CMA, including 6-aminonicotinamide and nutrient starvation, decreased AF1Q levels. AF1Q interacts with HSPA8 and LAMP-2A, which are core components of the CMA machinery. Knockdown of HSPA8 or LAMP-2A increased AF1Q protein levels, whereas overexpression showed the opposite effect. Using an amino acid deletion AF1Q mutation plasmid, we identified that AF1Q had a KFERQ-like motif which was recognized by HSPA8 for CMA-dependent proteolysis. In conclusion, we demonstrate for the first time that AF1Q can be degraded in lysosomes by CMA. - Highlights: • Chaperone-mediated autophagy (CMA) is involved in the degradation of AF1Q. • Macroautophagy does not contribute to the AF1Q degradation. • AF1Q has a KFERQ-like motif that is recognized by CMA core components

  14. Degradation of AF1Q by chaperone-mediated autophagy

    Energy Technology Data Exchange (ETDEWEB)

    Li, Peng; Ji, Min; Lu, Fei; Zhang, Jingru [Department of Hematology, Key Laboratory of Cardiovascular Remodeling and Function Research, Qilu Hospital, Shandong University, Jinan 250012 (China); Li, Huanjie; Cui, Taixing; Li Wang, Xing [Research Center for Cell Therapy, Key Laboratory of Cardiovascular Remodeling and Function Research, Qilu Hospital, Shandong University, Jinan 250012 (China); Tang, Dongqi, E-mail: tangdq@sdu.edu.cn [Research Center for Cell Therapy, Key Laboratory of Cardiovascular Remodeling and Function Research, Qilu Hospital, Shandong University, Jinan 250012 (China); Center for Stem Cell and Regenerative Medicine, The Second Hospital of Shandong University, Jinan 250033 (China); Ji, Chunyan, E-mail: jichunyan@sdu.edu.cn [Department of Hematology, Key Laboratory of Cardiovascular Remodeling and Function Research, Qilu Hospital, Shandong University, Jinan 250012 (China)

    2014-09-10

    AF1Q, a mixed lineage leukemia gene fusion partner, is identified as a poor prognostic biomarker for pediatric acute myeloid leukemia (AML), adult AML with normal cytogenetic and adult myelodysplastic syndrome. AF1Q is highly regulated during hematopoietic progenitor differentiation and development but its regulatory mechanism has not been defined clearly. In the present study, we used pharmacological and genetic approaches to influence chaperone-mediated autophagy (CMA) and explored the degradation mechanism of AF1Q. Pharmacological inhibitors of lysosomal degradation, such as chloroquine, increased AF1Q levels, whereas activators of CMA, including 6-aminonicotinamide and nutrient starvation, decreased AF1Q levels. AF1Q interacts with HSPA8 and LAMP-2A, which are core components of the CMA machinery. Knockdown of HSPA8 or LAMP-2A increased AF1Q protein levels, whereas overexpression showed the opposite effect. Using an amino acid deletion AF1Q mutation plasmid, we identified that AF1Q had a KFERQ-like motif which was recognized by HSPA8 for CMA-dependent proteolysis. In conclusion, we demonstrate for the first time that AF1Q can be degraded in lysosomes by CMA. - Highlights: • Chaperone-mediated autophagy (CMA) is involved in the degradation of AF1Q. • Macroautophagy does not contribute to the AF1Q degradation. • AF1Q has a KFERQ-like motif that is recognized by CMA core components.

  15. DESAIN PRIMER UNTUK AMPLIFIKASI FRAGMEN GEN inhA ISOLAT 134 MULTIDRUG RESISTANCE TUBERCULOSIS (MDR-TB DENGAN METODE POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Luk Ketut Budi Maitriani

    2015-10-01

    Full Text Available ABSTRAK    : Penelitian ini bertujuan untuk memperoleh sepasang primer terbaik hasil desain secara in silico menggunakan program Clone Manager Suite 6 (University of Groningen. Primer ini didesain untuk digunakan dalam mengamplifikasi fragmen gen inhA isolat klinis Multidrug Resistance Tuberculosis (MDR-TB mencakup kodon 94 (nukleotida 280-282. Kodon 94 gen inhA merupakan posisi yang sering mengalami mutasi dan mengakibatkan koresisten terhadap isoniazid dan ethionamid. Desain primer menggunakan sekuen gen inhA Mycobacterium tuberculosis yang diperoleh dari situs www.ncbi.nlm.nih.gov (GenBank : AF106077. Hasil desain diperoleh sepasang primer terbaik dan diuji secara in vitro menggunakan metode Polymerase Chain Reaction (PCR. Template DNA yang digunakan adalah isolat klinis MDR-TB. Proses amplifikasi diawali dengan denaturasi awal pada 95°C selama 15 menit dan diikuti oleh 45 siklus amplifikasi (denaturasi pada suhu 94°C selama 1 menit, annealing pada 56°C selama 1 menit 20 detik dan elongasi pada 72°C selama 2 menit serta diakhiri dengan elongasi akhir pada 72°C selama 10 menit. Produk PCR dideteksi menggunakan elektroforesis gel agarosa 1,5%. Kesimpulan penelitian adalah diperoleh sepasang primer terbaik berdasarkan kriteria pada program Clone Manager Suite 6 (University of Groningen, meliputi: panjang primer, %GC, Tm (melting temperature, interaksi primer (dimers dan hairpins, stabilitas primer, repeats, runs dan false priming. Primer tersebut meliputi, primer forward (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3’ dan primer reverse (pR-inhA 5’ CGACCGTCATCCA-GTTGTA 3’ dengan ukuran produk 460 pb.   ABSTRACT: The aim of this study was to obtain the best pair of primer as result in silico design using Clone Manager Suite 6 program (University of Groningen. The primer was designed for amplifying inhA gene fragment of Multidrug Resistance Tuberculosis (MDR-TB clinical isolates include codon 94 (nucleotide 280-282. Codon 94 of inhA gene is

  16. Konsep dan Metode Garap dalam Penciptaan Tepak Kendang Jaipongan

    Directory of Open Access Journals (Sweden)

    Asep Saepudin

    2013-03-01

    Full Text Available ABSTRACT   This article aims to explore the process of creation of Tepak Kendang Jaipongan by Suwanda. The idea of Tepak Kendang was obtained through four processes: 1 the direct participation of the creator (Suwanda into the popular arts; 2 the appreciation results of various kinds of art; 3 the stimulation of various kinds of dance movement; and 4 the inspiration of the songs which are sung by the singers (Sinden. Tepak Kendang Jaipongan was sourced from various kinds of genre, namely Ketuk Tilu, Topéng Banjét, Wayang Golék, Kiliningan, Bajidoran, Pencak Silat and Tarling. The many kinds of Sundanese Tepak Kendang were arranged with the concept of ‘freedom’ and ‘novelty’. The method which is used to create Tepang Kendang Jaipongan is ‘ngolah nu aya maké cara: salambar langsung saayana tinu heubeul, ‘janten ku nyalira’, ngarobah nu aya (‘ditambah’, ‘dikurangan’, ‘dipotong’, ‘dikerepan’, ‘dicarangan’.   Keywords: Method of creation, Tepak Kendang Jaipongan     ABSTRAK   Tulisan ini bertujuan untuk menggali proses penciptaan tepak kendang jaipongan dari kreatornya yakni Suwanda. Ide tepak kendang diperoleh melalui empat proses yaitu Suwan- da terjun langsung ke dalam jenis kesenian yang sedang populer, hasil apresiasi terhadap berbagai jenis kesenian, terangsang oleh ragam gerak tari, serta karena terinspirasi lagu yang dibawakan oleh pesindén. Tepak kendang jaipongan bersumber dari berbagai jenis ke- tsenian seperti Ketuk Tilu, Topéng Banjét, Wayang Golék, Kiliningan, Bajidoran, Penca Silat dan Tarling. Kekayaan ragam tepak kendang Sunda digarap dengan konsep “kebebasan dan ‘ke- baruan’. Metode yang digunakan untuk menciptakan tepak kendang jaipongan adalah “ngo­ lah nu aya maké cara: salambar langsung saayana tinu heubeul, ‘janten ku nyalira’, ngarobah nu aya (‘ditambah’, ‘dikurangan’, ‘dipotong’, ‘dikerepan’, ‘dicarangan’”.   Kata kunci: Metode garap, Tepak

  17. CUSTOMER SEGMENTATION DENGAN METODE SELF ORGANIZING MAP (STUDI KASUS: UD. FENNY

    Directory of Open Access Journals (Sweden)

    A. A. Gde Bagus Ariana

    2012-11-01

    Full Text Available Saat ini persaingan bisnis pada perusahaan retail tidak hanya dengan menggunakan perangkat sistem informasi namun sudah dilengkapi dengan sistem pendukung keputusan. Salah satu metode sistem pendukung keputusan yang digunakan adalah data mining. Data mining digunakan untuk menemukan pola-pola yang tersembunyi pada database. UD. Fenny sebagai perusahaan retail ingin menemukan pola segmentasi pelanggan dengan menggunakan model RFM (Recency, Frequency, Monetary. Metode data mining untuk melakukan proses segmentasi adalah metode clustering. Clustering merupakan proses penggugusan data menjadi kelompok-kelompok yang memiliki kemiripan secara tidak terawasi (unsupervised. Sebelum melakukan proses clustering, dilakukan proses persiapan data dengan membuat datawarehouse menggunakan skema bintang (star scema. Selanjutnya dilakukan proses clustering dengan menggunakan metode Self Organizing Map (SOM/Kohonen. Metode ini merupakan salah satu model jaringan saraf tiruan yang menggunakan metode unsupervised. Dari hasil percobaan metode SOM melakukan proses clustering dan menggambarkan hasil clustering pada SOM plot. Dengan melakukan proses clustering, pihak pengambil keputusan dapat memahami segmentasi customer dan melakukan upaya peningkatan pelayanan customer.

  18. Gymnasie ikke absolut fravalg af EUD

    DEFF Research Database (Denmark)

    Juul, Tilde Mette; Pless, Mette

    2015-01-01

    Den faldende søgning til erhvervsuddannelserne har i medierne og den politiske debat ofte været begrundet med, at de unge ikke ser erhvervsuddannelserne som prestigefyldte. Nyt forskningsprojekt fra Center for Ungdomsforskning viser, at de unges opfattelser af erhvervsuddannelserne er mere nuance...

  19. Coaching af ph.d.-studerende

    DEFF Research Database (Denmark)

    Godskesen, Mirjam Irene

    Rapporten danner grundlag for at etablere et koncept for ph.d.-coaching. Erfaringerne fra et 2-årigt projekt om ph.d.-coaching i SCKK regi beskrives. De centrale temaer er tilrettelæggelse af den individuelle coaching, typiske temaer i coachingen og arbejdsdeling mellem coach og vejleder. Der er...

  20. Indeklimamærkning af byggevarer

    DEFF Research Database (Denmark)

    Nielsen, P.A.; Wolkoff, P.

    I denne rapport beskrives på prototypeniveau en frivillig indeklimamærkningsordning for byggevarer. Ordningen er baseret på bestemmelse af byggevarernes afgasningsprofil, fastlagt ud fra laboratoriemålinger. Ved modelberegning bestemmes dernæst koncentrationsprofilen i et standardrum, og der udfø...

  1. Retsplejelovens regulering af politiets adgang til teledata

    DEFF Research Database (Denmark)

    Lentz, Lene Wacher

    2017-01-01

    Politiet kan som led i en strafferetlig efterforskning få adgang til en række data om telekommunikation efter retsplejeloven, hvis regulering nu må revideres i lyset af ”Tele2-sagen”, hvor EU-domstolen fandt, at en generel logningspligt for teleudbyderne til at sikre teledata til brug for eventue...

  2. Brands som brikker i konstruktionen af identitet

    DEFF Research Database (Denmark)

    Hermansen, Judy

    2008-01-01

    Forbrug spiller en vigtig rolle i produktionen af mening og værdier, som kan skabe og vedligeholde både forbrugerens personlige og sociale verden - og derfor er reklame også en vigtig kilde til disse symbolske betydninger. Udgivelsesdato: juni...

  3. Topological ferrimagnetic behaviours of coordination polymers containing manganese(II) chains with mixed azide and carboxylate bridges and alternating F/AF/AF'/AF'/AF interactions.

    Science.gov (United States)

    Wang, Yan-Qin; Liu, Hou-Ting; Qi, Yan; Gao, En-Qing

    2014-08-21

    Two Mn(ii) complexes with azide and a new zwitterionic tetracarboxylate ligand 1,2,4,5-tetrakis(4-carboxylatopyridinium-1-methylene)benzene (L(1)), {[Mn5(L(1))2(N3)8(OH)2]·12H2O}n () and {[Mn5(L(1))2(N3)8(H2O)2](ClO4)2·6H2O}n (), have been synthesized and characterized crystallographically and magnetically. and contain similar alternating chains constructed by azide and carboxylate bridges. The independent sets of bridges alternate in an ABCCB sequence between adjacent Mn(ii) ions: (EO-N3)2 double bridges (EO = end-on) (denoted as A), [(EO-N3)(OCO)2] triple bridges (denoted as B) and [(EO-N3)(OCO)] double bridges (denoted as C). The alternating chains are interlinked into 2D coordination networks by the tetrapyridinium spacers. Magnetic studies demonstrate that the magnetic coupling through the double EO azide bridges is ferromagnetic and that through mixed azide/carboxylate bridges is antiferromagnetic. The unprecedented F/AF/AF'/AF'/AF coupling sequence along the chain dictates an uncompensated ground spin state (S = 5/2 per Mn5 unit) and leads to one-dimensional topological ferrimagnetism, which features a minimum in the χT versus T plot.

  4. Digitalisering af ældre menneskers hverdag

    DEFF Research Database (Denmark)

    Borchorst, Ditte Stilling; Sillesen, Agnete; Sommer, Finn M.

    2016-01-01

    Mange kommuner har inddraget frivillige som led i implementeringen af den offentlige digitaliseringsstrategi, der forpligter alle borgere til at kommunikere digitalt med offentlige myndigheder. Artiklen diskuterer erfaringer med at inddrage frivillige til at vejlede ældre mennesker i at anvende d...

  5. Karakterisering af Materialer fra atom til makro

    DEFF Research Database (Denmark)

    Brøndsted, Povl; Somers, Marcel A.J.

    2002-01-01

    Denne årbog er udgivet i forbindelse med Dansk Metallurgisk Selskabs Vintermøde, der fandt sted på Hotel Koldingfjord, Kolding i dagene 2. til 4. januar 2002. Bogen indeholder de foredrag, der blev præsenteret på Vintermødet. Emnet for mødet var " Karakterisering af Materialer - fra atom til makro...

  6. Den teoretiske udvikling af Supply Chain Strategimodeller

    DEFF Research Database (Denmark)

    Arvad Johansen, Jens

    2011-01-01

    segmentering via postponement-princippet, har givet mærkbare forbedringer. Det beskrives endvidere, hvordan produkternes livscyklus påvirker valget af supply chain design. Begrebet Demand Chain Management( DCM), hvormed strategimodeller bruger klassiske marketingelementer sammen med Supply Chain Management...... (SCM), bliver behandlet og der udvikles en DCM-strategimodel....

  7. Så lyt dog til kritikken af Sundhedsplatformen

    DEFF Research Database (Denmark)

    Bansler, Jørgen P.; Søgaard, Jes

    2017-01-01

    Det er på tide, at Region Hovedstaden tager klinikernes bekymringer og kritik af Sundhedsplatformen alvorligt. Tiden er ikke inde til 'gevinstrealisering', men til at løse de alvorlige problemer, man kæmper med ude på hospitalerne...

  8. Konsolidering af læring

    DEFF Research Database (Denmark)

    Kirkegaard, Preben Olund; Geisnæs, Dorthe

    2016-01-01

    . Opbyggelse af konsolideringsstrategier er en langvarig proces. Processen er lang, fordi vidensabstraktion tager tid. Vidensopbyggelsen skal være så velkendt for eleven, at det er muligt for eleverne at genkende og hermed anvende viden til at kunne analysere fremtidige opgaver. https://www.youtube...

  9. Social praksisteoretiske analyser af unge i partnerskaber

    DEFF Research Database (Denmark)

    Mørck, Line Lerche; Munkholm, Merete

    Denne bog analyserer lokale partnerskaber mellem produktionsskoler og virksomheder, institutioner og civilsamfund. Bogen illustrerer, hvordan vi med social praksis teori kan forstå partnerskaber som grænsefællesskaber, hvor partnerskaber arrangeres i og på tværs af forskellige fællesskaber og han...

  10. Livsvalg konceptualiseret som dynamisk realisering af livsbaner

    DEFF Research Database (Denmark)

    Schnieber, Anette

    2009-01-01

    De valgsituationer, man i daglig tale kender som ”tilværelsens store valg”, mangler definition i den psykologiske litteratur, og det er således ikke klart, hvorvidt og evt. hvorledes disse valg adskiller sig fra andre typer. I artiklen gives en definition af ”de store valg”, og de adskilles fra...

  11. Måling af radon i bygninger

    DEFF Research Database (Denmark)

    Rasmussen, Torben Valdbjørn

    endvidere til at vurdere radon­eksponeringen i forhold til det nationale referenceniveau. Anvisningen dækker radonmåling i boliger og andre bygninger, fx kontorer, skoler og institutioner. Den henvender sig til bygningsejere, bygherrer, projekterende og brugere af bygninger. Desuden henvender anvisningen...

  12. Udvikling af universitetsundervisning - rammer, barrierer og muligheder

    DEFF Research Database (Denmark)

    Horst, Sebastian; Jensen, Ane; Johannsen, Bjørn Friis

    2011-01-01

    Dansk Universitetspædagogisk Netværk (DUN) afholdt sin årlige konference i 2011 den 30.-31. maj med temaet “Udvikling af universitetsundervisning - rammer, barrierer og muligheder”. På konferencen arbejdede ca. 100 personer fra alle niveauer i universitetsverdenen på at beskrive hvordan vi kan...

  13. På sporet af magtspillet om dansk naturfagsundervisning

    DEFF Research Database (Denmark)

    Schmidt, Jette Reuss

    Den neoliberale diskurs med tilhørende konkurrencemoment har længe været under beskydning i internationale forskningssammenhænge. Men der savnes konkrete eksempler på, hvordan neoliberal styring kommer til udtryk i nationale uddannelser. I denne afhandling følges derfor nogle af neoliberalismens...

  14. En tegning af æstetik 2013

    DEFF Research Database (Denmark)

    Buhl, Mie; Ejsing-Duun, Stine

    2013-01-01

    Denne artikel fremstiller skredet fra det individuelle fokus til den sociale forhandling omkring en situation, som er det nye perspektiv indenfor æstetik. Derigennem identificeres tendenser som er med til at udgøre platformen for børn og unges kulturer, hvor det handler om, at et æstetisk system er...... selvproducerende og stiller sig til rådighed for erkendelse. Disse kulturer udfolder sig i formater, som skolen ikke er gearet til at imødekomme. Som eksempel ville DrawSomething vanskeligt kunne begrundes i forhold til billedkunstfagets af ministeriet fastsatte ”fælles mål” – eller kan det? En central udfordring...... er, hvordan der skal arbejdes med æstetiske praksisformer i en nutidig læringskontekst, når børn og unges kulturer udfolder og udvikler sig i formater, der er præget af foranderlighed og flygtighed; af en uendelig skaben for nogen og med nogen og af situationer, der bebos med attituder? Vi diskuterer...

  15. Hvorfor lejere bliver sat ud af deres bolig

    DEFF Research Database (Denmark)

    Nielsen, Torben Heien; Christensen, Gunvor

    Antallet af lejere, der bliver sat ud af deres bolig, er steget fra 1499 i 2002 til 2589 i 2006. Lejere kan blive sat ud af deres bolig, hvis de ikke betaler deres husleje til tiden, eller hvis de ikke overholder husordenen det sted de bor. Denne rapport beskriver årsager til, at lejere bliver sat...... ud af deres boliger og baggrunden for stigningen i antallet af udsættelser. desuden beskriver rapporten konsekvenser af en udsættelse og kommer med en række anbefalinger til indsatsområder. Af afgørende betydning for, at lejere bliver sat ud af deres bolig, er lav indkomst, lavt rådighedsbeløb, stor...

  16. Subregional innovation – indikatorer til optimering af den erhvervsrettede innovationspolitik

    DEFF Research Database (Denmark)

    Mortensen, Peter Stendahl; Graversen, Ebbe Krogh; Haase, Sanne Schioldann

    områder tilgodeses bedst muligt. Desuden kan en differentieret, subregional innovations-politik give erhvervslivet bedre udbytte end en samlet regional eller national innovationspolitik. Selvom Danmark er et lille land, er der store geografiske forskelle internt i landets erhvervsstruktur og i...... virksomhedernes innovationsaktiviteter. Som resultat af en udvidelse af den danske del af CIS 2006-undersøgelsen2 med ekstra virksomheder kan der gives en betydeligt mere nuanceret karak-teristik af virksomheder helt ned på subregionalt niveau. Analysen underbygger, at de innovations-politiske tiltag, der sættes......, lokal brug af resultaterne er nødvendig. Først gennemgås de valgte målepunkter. Det primære er en opdeling i praksis- og forsknings-orientering af virksomheders innovationstilgang, hvorved der identificeres fire grupper af innovationsaktive virksomheder. Det andet er korrektion af de anvendte...

  17. Vidensledelse og den sociale dimension i deling af viden

    DEFF Research Database (Denmark)

    Lauring, Jakob

    2004-01-01

    imidlertid et alternativt syn på viden som i højere grad inddrager den sociale dimension ved vidensdeling - den socialkonstruktivistiske opfattelse. I denne artikel vil jeg beskæftige mig med den socialkonstruktivistiske opfattelse af viden og beskrive, hvorledes denne synsvinkel kan rette fokus mod nogle...... meget væsentlige problemstillinger ved organisatorisk adfærd, som man ofte kommer til at ignorere, hvis man i for høj grad baserer ledelsen på en funktionalistisk opfattelse af viden. Delingen af viden er en aktuel udfordring for anvendelse af viden i forretningssammenhæng. Det er hovedsageligt det, som...... gør vidensbegrebet interessant i forhold til ledelse af virksomheder. - Fokus på de sociale barrierer for deling af viden Jeg vil i det kommende illustrere, hvilke betydninger den sociale dimension i deling af viden kan have for videnledelse. Det vil jeg gøre gennem beskrivelser af to forskellige...

  18. PENERAPAN METODE BERMAIN BALOK DALAM MENGEMBANGKAN NILAI KOGNITIF ANAK USIA DINI PADA PAUD NUANSA KOTA BANDUNG

    Directory of Open Access Journals (Sweden)

    Eni Rohaeni

    2018-01-01

    Full Text Available Penggunaan metode bermain balok di dalam proses pembelajaran di pendidikan anak usia dini belum dikuasai oleh setiap guru PAUD. Berdasarkan masalah tersebut, maka tujuan dari penelitian ini adalah untuk mendeskripsikan bagaimana langkah-langkah mekanisme penerapan metode bermain balok dalam mengembangkan nilai kognitif anak usia dini, untuk mengetahui bagaimana strategi penerapan metode bermain balok dalam mengembangkan nilai kognitif anak usia dini, dan untuk mengetahui bagaimana tingkat efektivitas penerapan metode bermain balok dalam mengembangkan nilai kognitif anak usia dini pada PAUD Nuansa di kota Bandung. Landasan teori yang dipergunakan sebagai bahan kajian dalam penelitian ini adalah konsep bermain sambil belajar, konsep pembelajaran, konsep anak usia dini, dan konsep kognitif anak.Penelitian ini menggunakan metode kualitatif yang diharapkan dapat menghasilkan suatu gambaran tentang objek yang diteliti secara utuh dengan teknik pengumpulan data melalui observasi, wawancara, studi dokumentasi, dan studi kepustakaan.Hasil penelitian dipaparkan sebagai berikut: penerapan metode bermain balok dilaksanakan oleh tutor dalam mengembangkan nilai kognitif anak, strategi bermain balok dengan diadakannya simulasi atau praktek penyusunan balok, dan efektivitas metode bermain balok yang sangat menunjang terhadap pengembangan nilai kognitif anak usia dini.Kesimpulan penelitian adalah metode bermain balok dapat meningkatkan kemampuan daya kreatifitas dan berpikir anak usia dini serta dapat melatih berpikir anak secara terstruktur atau konstruktif. Sedangkan Rekomendasi, meskipun dari penerapan metode bermain balok dalam mengembangkan nilai kognitif pada anak usia dini masih belum memenuhi harapan padahal secara potensial PAUD ini memiliki guru-guru yang terlatih dan fasilitas yang memadai, oleh karena itu perlu adanya peningkatan kemampuan pengembangan kreatifitas dalam membuat kontruksi melalui pelatihan ataupun penataran dan perlu adanya

  19. Uddrag af Ph.d.-afhandlingen Den groteske modernisme

    DEFF Research Database (Denmark)

    Lübker, Henrik

    2011-01-01

    Om forholdet mellem "det groteske" og "den groteske modernisme" eksemplificeret i en læsning af E.A. Poes "The Fall of the House of Usher" og flere af Francis Bacons malerier.......Om forholdet mellem "det groteske" og "den groteske modernisme" eksemplificeret i en læsning af E.A. Poes "The Fall of the House of Usher" og flere af Francis Bacons malerier....

  20. Portræt af litteraturkritikeren som ungt menneske

    DEFF Research Database (Denmark)

    Schatz-Jakobsen, Claus

    2004-01-01

    Artiklen præsenterer den amerikanske litteraturkritiker Geoffrey Hartmans tidlige forfatterskab og fremdrager dets selvbiografiske undertekst som nødvendig effekt af den unge Hartmans fascination af den engelske romantiker William Wordsworths forfatterskab.......Artiklen præsenterer den amerikanske litteraturkritiker Geoffrey Hartmans tidlige forfatterskab og fremdrager dets selvbiografiske undertekst som nødvendig effekt af den unge Hartmans fascination af den engelske romantiker William Wordsworths forfatterskab....

  1. Anmeldelse af Eigil Lego Andersen: Dirigent og generalforsamling

    DEFF Research Database (Denmark)

    Werlauff, Erik

    2011-01-01

    Artiklen er en anmeldelse af advokat, adj. professor, dr. jur. Eigil Lego Andersens juridiske monografi om dirigenten og generalforsamlingen, herunder med lancering af en række nye afstemningsmetoder til brug for generalforsamlingen i (større) aktieselskaber.......Artiklen er en anmeldelse af advokat, adj. professor, dr. jur. Eigil Lego Andersens juridiske monografi om dirigenten og generalforsamlingen, herunder med lancering af en række nye afstemningsmetoder til brug for generalforsamlingen i (større) aktieselskaber....

  2. Udvikling af en internetsøgestrategi til identifikation af ny medicinsk teknologi inden for prostatacancer

    DEFF Research Database (Denmark)

    Thygesen, Marianne; Vondeling, Hindrik; Douw, Karla

    2007-01-01

    internetsider efter efficiens. Her er efficiens forstået som mindst antal minutter brugt pr. fund af information om en ny væsentlig medicinsk teknologi. Resultater: Strategien består af ti sider, som bør benyttes i følgende rækkefølge: YahooHealth, DoctorsGuide, The National Electronic Library for Medicines...

  3. Metode Hermeunetik dalam Penafsiran Al-Qur'an

    Directory of Open Access Journals (Sweden)

    Akhyar Hamzah

    2013-05-01

    Full Text Available Memahami teks al-qur'an dengan hanya dari segi gramatika, asal-usul kala, aspek sastra, dan aspek linguistik lainnya tidak cukup untuk menjawab kebutuhan pemahaman atas teks itu sendiri. karena sangat memungkinkan untuk memberikan peluang beberapa kosa kata yang baru dapat dipahami belakangan setelah munculnya teks kauniyah maupun humaniora. Hal ini berarti memberikan lndikasi bahwa sesungguhnya kemajuan ilmu pengetahuan memiliki peran penting dalam upaya memahami teks­ teks al -Our'an. Oleh karena itu penggunaan metode hermeneutik dalam penafsiran al-Qur'an bertujuan untuk menghayati dunia teks yang bernuansa masa lalu dengan dunia empiris saat ini. Hal ini bertujuan untuk mendekatkan keduanya agar dapat menjawab semua persoalan yang terjadi ditengah-tengah masyarakat saat ini

  4. SISTEM PENGAMBILAN KEPUTUSAN KREDIT RUMAH DENGAN METODE FUZZYSAW MADM

    Directory of Open Access Journals (Sweden)

    Marganda Simarmata

    2015-07-01

    Full Text Available Persetujuan Kredit Perumahan oleh pelanggan pada sebuah bank sering terhambat dan lama karena proses persetujuan dilakukan dengan manual karena harus dikerjakan secara hati-hati sesuai dengan kriteria yang ditentukan. Kelemahan manual ini menjadi alasan perlunya Sistem Pengambilan Keputusan untuk menyetujui persetujuan KPR pada salah satu Bank. Dalam penelitian inisistem yang dibangun menggunakan metode Fuzzy Simple Additive Weighting Multiple Atribut Decission Making.Perancangan program aplikasi ini dibuat dengan menggunakan bahasa pemrograman Visual Studio 6.0dan  perancangan database menggunakan Microsoft Accses2007 sertaSeagate Crystal Report 8,5 untuk pembuatan laporan atau output yang diperlukan.Hasil yang diperoleh dari sistem yang dirancang dapat membantu para manager perusahaan atau para pengambil keputusan untuk memutuskan calon pelanggan KPR dengan cepat, mudah dan akurat. Kata kunci : SistemPendukung Keputusan, Kredit Perumahan, Fuzzy Simple Additive Weighting

  5. Pemisahan Campuran Etanol-Oktanol-Air dengan Metode Distilasi dalam Structured Packing

    Directory of Open Access Journals (Sweden)

    Adesya Abdullah

    2014-09-01

    Full Text Available Keberadaan bahan bakar minyak (BBM yang merupakan bahan bakar berbahan fosil sudah menjadi suatu kebutuhan utama masyarakat dunia, namun keberadaannya saat ini semakin menipis. Salah satu potensi yang relatif besar adalah pengembangan bioetanol menggunakan metode fermentasi ekstraktif. Hasil bioetanol dari metode fermentasi ekstraktif masih rendah, yaitu sekitar 15% sehingga diperlukan penelitian untuk pemurniannya. Tujuan dari penelitian ini adalah mendapatkan kadar etanol tertinggi dengan metode distilasi dalam structured packing. Dari hasil penelitian didapatkan pada variabel suhu 80ᵒC pada porositas 20%, 40% dan 60% didapatkan kadar etanol sebesar 88,24% ; 91,95% dan 85,85%.

  6. IMPLEMENTASI METODE QUALITY FUNCTION DEPLOYMENT (QFD GUNA MENINGKATKAN KUALITAS KAIN BATIK TULIS

    Directory of Open Access Journals (Sweden)

    Jono Jono

    2006-08-01

    Full Text Available Pemilihan dan pengoptimalan suatu metode yang lebih baik untuk meningkatkan mutu suatu produk atau jasa yang dihasilkan sangat diperlukan oleh perusahaan dewasa ini. Dalam permasalahan ini yang penting untuk diperhatikan oleh suatu perusahaan adalah kesesuaian suatu produk atau jasa yang dihasilkan dengan keinginan dan kepuasan konsumen sehingga dapat berkelanjutan menjadi pelanggan. Salah satu metode untuk mengetahui kebutuhan dan keinginan pelangan adalah Quality Function Deployment. Metode ini digunakan oleh industri batik di Nambangan Lor Kotamadya Madiun untuk menentukan technical respon yang harus dilakukan.

  7. Ekstraktion af æteriske olier fra oregano

    DEFF Research Database (Denmark)

    Ellitsgaard Jakobsen, Jens; Ankerfeldt, Dorte; Jensen, Morten Busch

    2010-01-01

    med keratin - Ammoniakforurening reduceres med ny teknologi - Genvinding og genanvendelse af ammoniak fra spildevand og husdyrgødning - Ginseng - en virkningsfuld medicinplante - Ekstraktion af æteriske olier fra oregano "Biotek" er udviklet med udgangspunkt i originalartikler udarbejdet af forskere...

  8. Eksperimentel bakteriofagterapi til behandling af kronisk Pseudomonas aeruginosaotitis hos hund

    DEFF Research Database (Denmark)

    Moodley, Arshnee; Mølgaard, Jesper

    2016-01-01

    Vi beskriver en case med anvendelsen af bakteriofager til behandling af kronisk otitis forårsaget af multiresistente Pseudomonas aeruginosa som en sidste behandlingsmulighed før aflivning. Trods gentagne behandlinger, både topikalt og systemisk, med op til seks forskellige antibiotika over en...

  9. Når ledelse af ledelse rettes mod selvet

    DEFF Research Database (Denmark)

    Krause-Jensen, Niels Henrik

    2012-01-01

    Der fokuseres på det nye selvledelsesforhold som ledelse af ledelse er med til at fremkalde. Ud fra et signalement af det nye arbejdsliv beskrives det hvordan ledelse af ledelse skal forvalte en indgriben i medarbejderens selvforhold, hvor både magt og afmagt vil gøre sig gældende....

  10. Arbejdsmiljøet ved udbud af renovationsarbejde

    DEFF Research Database (Denmark)

    Busck, Ole Gunni

    Forfatteren gennemførte 2003-2005 en undersøgelse for Branchearbejdsmiljådet for transport af danske kommuners praksis i forbindelse med udbud og udlicitering af renovationsopgaver. Formålet var at kortlægge og analysere erfaringerne med varetagelse af arbejdsmiljøhensyn i kommunernes udbud og dr...

  11. Måling af lydisolation og efterklangstid i praksis

    DEFF Research Database (Denmark)

    Kristensen, J.

    Meddelelsen omhandler undersøgelser af mulighederne for at forbedre reproducerbarheden ved måling af luftlydisolation, trinlydniveau og efterklangstid under betingelser, der svarer til måling i den indflytningsfærdige bygning. Der omtales resultater fra måling med to forskellige udformninger af h...

  12. Benchmarking af udsættelser i kommunerne

    DEFF Research Database (Denmark)

    Christensen, Gunvor; Jeppesen, Anders Gade; Markwardt, Kristoffer

    2015-01-01

    nuværende tidspunkt stadig mangler relevante forhold i benchmarking-modellen. Eksempelvis antallet af stofmisbrugere, antallet af borgere med psykiatriske indlæggelser samt forekomsten af projekter med henblik på at forebygge udsættelser (fx gældsrådgivning). Disse data er først tilgængelige i 2015....

  13. Anmeldelse af: Afghantsy. The Russians in Afghanistan 1979-89

    DEFF Research Database (Denmark)

    Vestenskov, David

    2012-01-01

    Baseret på nyligt afklassificeret materiale fra arkiverne i Moskva samt fremstillinger af russiske historikere, tegnes et anderledes og mere nuanceret billede af de sovjetiske erfaringer fra Afghanistan. De første spadestik til opgøret med den amerikanske stempling af den sovjetiske ageren i...

  14. Antitrombotisk behanding af patienter med valvulær atrieflimren

    DEFF Research Database (Denmark)

    Bovin, Ann; Christensen, Thomas Decker; Grove, Erik Lerkevang

    2017-01-01

    with valvular AF. Although the definition of valvular AF is disputed, the lack of evidence regarding the use of NOACs for these patients is not. We discuss the definition of valvular AF, the risk of thromboembolism, and the antithrombotic treatment for stroke prevention in these patients....

  15. Effektivitet af naturligt drevne radontiltag året rundt

    DEFF Research Database (Denmark)

    Haker Høegh, Britt; Rasmussen, Torben Valdbjørn

    Denne rapport omhandler projektet Effektivitet af naturligt drevne radontiltag året rundt. Projektet er et spireprojekt finansieret af Innovationsnetværket InnoBYG og Forsknings- og Innovationsstyrelsen. Projektet er gennemført af Teknologisk Institut i samarbejde med Statens Byggeforskningsinsti...

  16. Barriere for Studerendes Læring af Holistisk Systemudvikling

    DEFF Research Database (Denmark)

    Levinsen, Karin; Madsen, Sabine

    Ud fra aktionsforskning af faget Informationsbehandling på bachelorprogrammet HA/DØK ved Copenhagen Business School undersøger vi i denne artikel hvilke barriere de studerende oplever i forbindelse med læring af holistisk systemudvikling og hvorfor. Siden 1980'erne har man i (dele af) litteraturen...

  17. Afståelsesbeskatning ved flytning af DEMPE-funktioner

    DEFF Research Database (Denmark)

    Kjærsgaard, Louise Fjord; Bundgaard, Jakob

    2017-01-01

    OECD har i den senest opdaterede version af Transfer Pricing Guidelines fastsat en definition af immaterielle aktiver og har samtidig indført konceptet DEMPE-funktioner, der omfatter visse vigtige funktioner relateret til immaterielle aktiver. SKAT synes at være af den opfattelse, at DEMPE...

  18. Koncept til måling af udvaskning fra markstakke af dybstrøelse

    DEFF Research Database (Denmark)

    Østergaard, Hans Spelling; Vinther, Finn Pilgaard

    2008-01-01

    Rapport om kvælstofudvaskning fra markstakke Resumé og konklusioner: Der er gennemført et projekt om kvælstofudvaskning fra markstakke. Undersøgelserne er udført med henblik på at fastsætte en metode, der kan anvendes til at påvise evt. udvaskningstab. Projektets gennemførelse Dansk Landbrugsrådg...

  19. Vurdering af postoperativ kognitiv funktion

    DEFF Research Database (Denmark)

    Funder, Kamilia S; Steinmetz, Jacob; Rasmussen, Lars S

    2010-01-01

    Postoperative cognitive dysfunction (POCD) is a frequent complication to surgery. Studies show considerable disagreement concerning the definition of POCD and the methods used for its -assessment. Objectivity may be obtained through neuro-psychological testing, contrary to the use of questionnair...

  20. Uveitis--manifestation af syfilis

    DEFF Research Database (Denmark)

    Andersen, Ellen Sloth; Kofoed, Kristian; Andersen, Mads Varis Nis

    2007-01-01

    We describe two cases of neurosyphilis whose diagnosis was based on ocular symptoms. Both patients were treated in the Eye Department for bilateral uveitis, and they were tested serologically positive for syphilis. The diagnoses of neurosyphilis were confirmed by demonstration of CSF pleocytosis ...