7 CFR 1412.45 - Reducing or terminating base acreage.

Science.gov (United States)

2010-01-01

... 7 Agriculture 10 2010-01-01 2010-01-01 false Reducing or terminating base acreage. 1412.45 Section... and Peanuts 2008 through 2012 § 1412.45 Reducing or terminating base acreage. (a)(1) Subject to the limitation in paragraph (a)(2) of this section, a permanent reduction of all or a portion of a farm's base...

Chain propagation and termination mechanisms for polymerization of conjugated polar alkenes by [Al]-based frustrated Lewis pairs

KAUST Repository

He, Jianghua; Zhang, Yuetao; Falivene, Laura; Caporaso, Lucia; Cavallo, Luigi; Chen, Eugene You Xian

2014-01-01

key parts: structural characterization of active propagating intermediates, propagation kinetics, and chain-termination pathways. Zwitterionic intermediates that simulate the active propagating species in such polymerization have been generated

A novel pseudo-complementary PNA G-C base pair

DEFF Research Database (Denmark)

Olsen, Anne G.; Dahl, Otto; Petersen, Asger Bjørn

2011-01-01

Pseudo-complementary oligonucleotide analogues and mimics provide novel opportunities for targeting duplex structures in RNA and DNA. Previously, a pseudo-complementary A-T base pair has been introduced. Towards sequence unrestricted targeting, a pseudo-complementary G-C base pair consisting...

Terminal location planning in intermodal transportation with Bayesian inference method.

Science.gov (United States)

2014-01-01

In this project, we consider the planning of terminal locations for intermodal transportation systems. For a given number of potential terminals and coexisted multiple service pairs, we find the set of appropriate terminals and their locations that p...

Nanoswitches based on DNA base pairs: why adenine-thymine is less suitable than guanine-cytosine

NARCIS (Netherlands)

Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.

2006-01-01

Substituted Watson-Crick guanine-cytosine (GC) base pairs were recently shown to yield robust three-state nanoswitches. Here, we address the question: Can such supramolecular switches also be based on Watson-Crick adenine-thymine (AT) base pairs? We have theoretically analyzed AT pairs in which

Envisaging quantum transport phenomenon in a muddled base pair of DNA

Science.gov (United States)

Vohra, Rajan; Sawhney, Ravinder Singh

2018-05-01

The effect of muddled base pair on electron transfer through a deoxyribonucleic acid (DNA) molecule connected to the gold electrodes has been elucidated using tight binding model. The effect of hydrogen and nitrogen bonds on the resistance of the base pair has been minutely observed. Using the semiempirical extended Huckel approach within NEGF regime, we have determined the current and conductance vs. bias voltage for disordered base pairs of DNA made of thymine (T) and adenine (A). The asymmetrical behaviour amid five times depreciation in the current characteristics has been observed for deviated Au-AT base pair-Au devices. An interesting revelation is that the conductance of the intrinsic AT base pair configuration attains dramatically high values with the symmetrical zig-zag pattern of current, which clearly indicates the transformation of the bond length within the strands of base pair when compared with other samples. A thorough investigation of the transmission coefficients T( E) and HOMO-LUMO gap reveals the misalignment of the strands in base pairs of DNA. The observed results present an insight to extend this work to build biosensing devices to predict the abnormality with the DNA.

Differential stabilities and sequence-dependent base pair opening dynamics of Watson-Crick base pairs with 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine.

Science.gov (United States)

Szulik, Marta W; Pallan, Pradeep S; Nocek, Boguslaw; Voehler, Markus; Banerjee, Surajit; Brooks, Sonja; Joachimiak, Andrzej; Egli, Martin; Eichman, Brandt F; Stone, Michael P

2015-02-10

5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson-Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T(8)X(9)G(10)-3' sequence of the DDD, were compared. The presence of 5caC at the X(9) base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A(5):T(8), whereas 5caC did not. At the oxidized base pair G(4):X(9), 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C(3):G(10). No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G(4):X(9); each favored Watson-Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N(4) exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.

Differential Stabilities and Sequence-Dependent Base Pair Opening Dynamics of Watson–Crick Base Pairs with 5-Hydroxymethylcytosine, 5-Formylcytosine, or 5-Carboxylcytosine

Science.gov (United States)

2016-01-01

5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5′-CG-3′ sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5′-T8X9G10-3′ sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A5:T8, whereas 5caC did not. At the oxidized base pair G4:X9, 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C3:G10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G4:X9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes. PMID:25632825

Thermodynamic and structural properties of the specific binding between Ag⁺ ion and C:C mismatched base pair in duplex DNA to form C-Ag-C metal-mediated base pair.

Science.gov (United States)

Torigoe, Hidetaka; Okamoto, Itaru; Dairaku, Takenori; Tanaka, Yoshiyuki; Ono, Akira; Kozasa, Tetsuo

2012-11-01

Metal ion-nucleic acid interactions have attracted considerable interest for their involvement in structure formation and catalytic activity of nucleic acids. Although interactions between metal ion and mismatched base pair duplex are important to understand mechanism of gene mutations related to heavy metal ions, they have not been well-characterized. We recently found that the Ag(+) ion stabilized a C:C mismatched base pair duplex DNA. A C-Ag-C metal-mediated base pair was supposed to be formed by the binding between the Ag(+) ion and the C:C mismatched base pair to stabilize the duplex. Here, we examined specificity, thermodynamics and structure of possible C-Ag-C metal-mediated base pair. UV melting indicated that only the duplex with the C:C mismatched base pair, and not of the duplexes with the perfectly matched and other mismatched base pairs, was specifically stabilized on adding the Ag(+) ion. Isothermal titration calorimetry demonstrated that the Ag(+) ion specifically bound with the C:C base pair at 1:1 molar ratio with a binding constant of 10(6) M(-1), which was significantly larger than those for nonspecific metal ion-DNA interactions. Electrospray ionization mass spectrometry also supported the specific 1:1 binding between the Ag(+) ion and the C:C base pair. Circular dichroism spectroscopy and NMR revealed that the Ag(+) ion may bind with the N3 positions of the C:C base pair without distorting the higher-order structure of the duplex. We conclude that the specific formation of C-Ag-C base pair with large binding affinity would provide a binding mode of metal ion-DNA interactions, similar to that of the previously reported T-Hg-T base pair. The C-Ag-C base pair may be useful not only for understanding of molecular mechanism of gene mutations related to heavy metal ions but also for wide variety of potential applications of metal-mediated base pairs in various fields, such as material, life and environmental sciences. Copyright © 2012 Elsevier

Structure of 2,4-Diaminopyrimidine - Theobromine Alternate Base Pairs

Science.gov (United States)

Gengeliczki, Zsolt; Callahan, Michael P.; Kabelac, Martin; Rijs, Anouk M.; deVries, Mattanjah S.

2011-01-01

We report the structure of clusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate nucleobase pairs, geometrically equivalent to guanine-cytosine. We have found the four lowest energy structures, which include the Watson-Crick base pairing motif. This Watson-Crick structure has not been observed by resonant two-photon ionization (R2PI) in the gas phase for the canonical DNA base pairs.

Hoogsteen base pairs proximal and distal to echinomycin binding sites on DNA

International Nuclear Information System (INIS)

Mendel, D.; Dervan, P.B.

1987-01-01

Forms of the DNA double helix containing non-Watson-Crick base-pairing have been discovered recently based on x-ray diffraction analysis of quionoxaline antibiotic-oligonucleotide complexes. In an effort to find evidence for Hoogsteen base-pairing at quinoxaline-binding sites in solution, chemical footprinting (differential cleavage reactivity) of echinomycin bound to DNA restriction fragments was examined. The authors report that purines (A>G) in the first and/or fourth base-pair positions of occupied echinomycin-binding sites are hyperreactive to diethyl pyrocarbonate. The correspondence of the solid-state data and the sites of diethyl pyrocarbonate hyperreactivity suggests that diethyl pyrocarbonate may be a sensitive reagent for the detection of Hoogsteen base-pairing in solution. Moreover, a 12-base-pair segment of alternating A-T DNA, which is 6 base pairs away from the nearest strong echinomycin-binding site, is also hyperreactive to diethyl pyrocarbonate in the presence of echinomycin. This hyperreactive segment may be an altered form of right-handed DNA that is entirely Hoogsteen base-paired

[Under what conditions does G.C Watson-Crick DNA base pair acquire all four configurations characteristic for A.T Watson-Crick DNA base pair?].

Science.gov (United States)

Brovarets', O O

2013-01-01

At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.

Tunnel conductance of Watson-Crick nucleoside-base pairs from telegraph noise

International Nuclear Information System (INIS)

Chang Shuai; He Jin; Lin Lisha; Zhang Peiming; Liang Feng; Huang Shuo; Lindsay, Stuart; Young, Michael

2009-01-01

The use of tunneling signals to sequence DNA is presently hampered by the small tunnel conductance of a junction spanning an entire DNA molecule. The design of a readout system that uses a shorter tunneling path requires knowledge of the absolute conductance across base pairs. We have exploited the stochastic switching of hydrogen-bonded DNA base-nucleoside pairs trapped in a tunnel junction to determine the conductance of individual molecular pairs. This conductance is found to be sensitive to the geometry of the junction, but a subset of the data appears to come from unstrained molecular pairs. The conductances determined from these pairs are within a factor of two of the predictions of density functional calculations. The experimental data reproduces the counterintuitive theoretical prediction that guanine-deoxycytidine pairs (3 H-bonds) have a smaller conductance than adenine-thymine pairs (2 H-bonds). A bimodal distribution of switching lifetimes shows that both H-bonds and molecule-metal contacts break.

Shelter-based palliative care for the homeless terminally ill.

Science.gov (United States)

Podymow, Tiina; Turnbull, Jeffrey; Coyle, Doug

2006-03-01

The homeless have high rates of mortality, but live in environments not conducive to terminal care. Traditional palliative care hospitals may be reluctant to accept such patients, due to behavior or lifestyle concerns. The Ottawa Inner City Health Project (OICHP) is a pilot study to improve health care delivery to homeless adults. This is a retrospective analysis of a cohort of terminally ill homeless individuals and the effectiveness of shelter-based palliative care. As proof of principle, a cost comparison was performed. 28 consecutive homeless terminally ill patients were admitted and died at a shelter-based palliative care hospice. Demographics, diagnoses at admission and course were recorded. Burden of illness was assessed by medical and psychiatric diagnoses, addictions, Karnofsky scale and symptom management. An expert panel was convened to identify alternate care locations. Using standard costing scales, direct versus alternate care costs were compared. 28 patients had a mean age 49 years; average length of stay 120 days. DIAGNOSES: liver disease 43%, HIV/AIDS 25%, malignancy 25% and other 8%. Addiction to drugs or alcohol and mental illness in 82% of patients. Karnofsky performance score mean 40 +/- 16.8. Pain management with continuous opiates in 71%. The majority reunited with family. Compared to alternate care locations, the hospice projected 1.39 million dollars savings for the patients described. The homeless terminally ill have a heavy burden of disease including physical illness, psychiatric conditions and addictions. Shelter-based palliative care can provide effective end-of-life care to terminally ill homeless individuals at potentially substantial cost savings.

Mechanisms of DNA replication termination.

Science.gov (United States)

Dewar, James M; Walter, Johannes C

2017-08-01

Genome duplication is carried out by pairs of replication forks that assemble at origins of replication and then move in opposite directions. DNA replication ends when converging replication forks meet. During this process, which is known as replication termination, DNA synthesis is completed, the replication machinery is disassembled and daughter molecules are resolved. In this Review, we outline the steps that are likely to be common to replication termination in most organisms, namely, fork convergence, synthesis completion, replisome disassembly and decatenation. We briefly review the mechanism of termination in the bacterium Escherichia coli and in simian virus 40 (SV40) and also focus on recent advances in eukaryotic replication termination. In particular, we discuss the recently discovered E3 ubiquitin ligases that control replisome disassembly in yeast and higher eukaryotes, and how their activity is regulated to avoid genome instability.

Unnatural base pair systems toward the expansion of the genetic alphabet in the central dogma.

Science.gov (United States)

Hirao, Ichiro; Kimoto, Michiko

2012-01-01

Toward the expansion of the genetic alphabet of DNA, several artificial third base pairs (unnatural base pairs) have been created. Synthetic DNAs containing the unnatural base pairs can be amplified faithfully by PCR, along with the natural A-T and G-C pairs, and transcribed into RNA. The unnatural base pair systems now have high potential to open the door to next generation biotechnology. The creation of unnatural base pairs is a consequence of repeating "proof of concept" experiments. In the process, initially designed base pairs were modified to address their weak points. Some of them were artificially evolved to ones with higher efficiency and selectivity in polymerase reactions, while others were eliminated from the analysis. Here, we describe the process of unnatural base pair development, as well as the tests of their applications.

Covering All the Bases in Genetics: Simple Shorthands and Diagrams for Teaching Base Pairing to Biology Undergraduates

Directory of Open Access Journals (Sweden)

Sergei Kuchin

2011-03-01

Full Text Available Explaining base pairing is an important element in teaching undergraduate genetics. I propose a teaching approach that aims to close the gap between the mantra “A pairs with T, and G pairs with C” and the “intimidating” chemical diagrams. The approach offers a set of simple “shorthands” for the key bases that can be used to quickly deduce all canonical and wobble pairs that the students need to know. The approach can be further developed to analyze mutagenic mismatch pairing.

Predictive labeling with dependency pairs using SAT

NARCIS (Netherlands)

Koprowski, A.; Middeldorp, A.; Pfenning, F.

2007-01-01

This paper combines predictive labeling with dependency pairs and reports on its implementation. Our starting point is the method of proving termination of rewrite systems using semantic labeling with infinite models in combination with lexicographic path orders. We replace semantic labeling with

Signature scheme based on bilinear pairs

Science.gov (United States)

Tong, Rui Y.; Geng, Yong J.

2013-03-01

An identity-based signature scheme is proposed by using bilinear pairs technology. The scheme uses user's identity information as public key such as email address, IP address, telephone number so that it erases the cost of forming and managing public key infrastructure and avoids the problem of user private generating center generating forgery signature by using CL-PKC framework to generate user's private key.

Dynamic Energy Consumption and Emission Modelling of Container Terminal based on Multi Agents

Directory of Open Access Journals (Sweden)

Hou Jue

2017-01-01

Full Text Available Environmental protection and energy saving pressure press the increasing attention of container terminal operators. In order to comply with the more and more strict environmental regulation, reducing energy consumption and air pollution emissions, meanwhile, optimizing the operation efficiency, which, is an urgent problem to container terminal operator of China. This paper based on the characteristic of Container Terminal Operation System (CTOS, which includes several sections of container product processes, consist of berth allocation problem, truck dispatching problem, yard allocation problem and auxiliary process. Dynamic energy consumption and emissions characteristic of each equipment and process is modelled, this paper presents the architecture of CTOS based on the multi agent system with early-warning model, which is based on multi-class support vector machines (SVM. A simulation on container terminal is built on the JADE platform to support the decision-making of container terminal, which can reduce energy consumption and air pollution emissions, allows the container terminal operator to be more flexible in their decision to meet the Emission Control Area regulation and Green Port Plan of China.

Triple helical DNA in a duplex context and base pair opening

Science.gov (United States)

Esguerra, Mauricio; Nilsson, Lennart; Villa, Alessandra

2014-01-01

It is fundamental to explore in atomic detail the behavior of DNA triple helices as a means to understand the role they might play in vivo and to better engineer their use in genetic technologies, such as antigene therapy. To this aim we have performed atomistic simulations of a purine-rich antiparallel triple helix stretch of 10 base triplets flanked by canonical Watson–Crick double helices. At the same time we have explored the thermodynamic behavior of a flipping Watson–Crick base pair in the context of the triple and double helix. The third strand can be accommodated in a B-like duplex conformation. Upon binding, the double helix changes shape, and becomes more rigid. The triple-helical region increases its major groove width mainly by oversliding in the negative direction. The resulting conformations are somewhere between the A and B conformations with base pairs remaining almost perpendicular to the helical axis. The neighboring duplex regions maintain a B DNA conformation. Base pair opening in the duplex regions is more probable than in the triplex and binding of the Hoogsteen strand does not influence base pair breathing in the neighboring duplex region. PMID:25228466

Rapid Acquisition of Choice and Timing and the Provenance of the Terminal-Link Effect

Science.gov (United States)

Kyonka, Elizabeth G. E.; Grace, Randolph C.

2010-01-01

Eight pigeons responded in a concurrent-chains procedure in which terminal-link schedules changed pseudorandomly across sessions. Pairs of terminal-link delays either summed to 15 s or to 45 s. Across sessions, the location of the shorter terminal link changed according to a pseudorandom binary sequence. On some terminal links, food was withheld…

Accurate interaction energies of base pairing and base stacking. The final chapter

Czech Academy of Sciences Publication Activity Database

Šponer, Jiří; Jurečka, Petr; Hobza, Pavel

2005-01-01

Roč. 22, č. 6 (2005), s. 767 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : base pairing * base stacking * nucleic acids Subject RIV: BO - Biophysics

AudioPairBank: Towards A Large-Scale Tag-Pair-Based Audio Content Analysis

OpenAIRE

Sager, Sebastian; Elizalde, Benjamin; Borth, Damian; Schulze, Christian; Raj, Bhiksha; Lane, Ian

2016-01-01

Recently, sound recognition has been used to identify sounds, such as car and river. However, sounds have nuances that may be better described by adjective-noun pairs such as slow car, and verb-noun pairs such as flying insects, which are under explored. Therefore, in this work we investigate the relation between audio content and both adjective-noun pairs and verb-noun pairs. Due to the lack of datasets with these kinds of annotations, we collected and processed the AudioPairBank corpus cons...

Molecular dynamics study of some non-hydrogen-bonding base pair DNA strands

Science.gov (United States)

Tiwari, Rakesh K.; Ojha, Rajendra P.; Tiwari, Gargi; Pandey, Vishnudatt; Mall, Vijaysree

2018-05-01

In order to elucidate the structural activity of hydrophobic modified DNA, the DMMO2-D5SICS, base pair is introduced as a constituent in different set of 12-mer and 14-mer DNA sequences for the molecular dynamics (MD) simulation in explicit water solvent. AMBER 14 force field was employed for each set of duplex during the 200ns production-dynamics simulation in orthogonal-box-water solvent by the Particle-Mesh-Ewald (PME) method in infinite periodic boundary conditions (PBC) to determine conformational parameters of the complex. The force-field parameters of modified base-pair were calculated by Gaussian-code using Hartree-Fock /ab-initio methodology. RMSD Results reveal that the conformation of the duplex is sequence dependent and the binding energy of the complex depends on the position of the modified base-pair in the nucleic acid strand. We found that non-bonding energy had a significant contribution to stabilising such type of duplex in comparison to electrostatic energy. The distortion produced within strands by such type of base-pair was local and destabilised the duplex integrity near to substitution, moreover the binding energy of duplex depends on the position of substitution of hydrophobic base-pair and the DNA sequence and strongly supports the corresponding experimental study.

DFT study on metal-mediated uracil base pair complexes

Directory of Open Access Journals (Sweden)

Ayhan Üngördü

2017-11-01

Full Text Available The most stable of metal-mediated uracil base pair complexes were determined. Method was used density functional theory, B3LYP. The calculations of systems containing C, H, N, O were described by 6-311++G(d,p and cc-PVTZ basis sets and LANL2DZ and SDD basis sets was used for transition metals. Then Egap values of complexes were calculated and the electrical conductivity of the complexes for single nanowires was studied by band theory. Metal-mediated uracil base pair complexes which will be used as conductive wires in nanotechnology were predicted. In nanoworld, this study is expected to show a way for practical applications.

Energetics and dynamics of the non-natural fluorescent 4AP:DAP base pair

KAUST Repository

Chawla, Mohit

2018-01-02

The fluorescent non-natural 4-aminophthalimide (4AP) base, when paired to the complementary 2,4-diaminopyrimidine (DAP) nucleobase, is accommodated in a B-DNA duplex being efficiently recognized and incorporated by DNA polymerases. To complement the experimental studies and rationalize the impact of the above non-natural bases on the structure, stability and dynamics of nucleic acid structures, we performed quantum mechanics (QM) calculations along with classical molecular dynamics (MD) simulations. QM calculations were initially focused on the geometry and energetics of the 4AP:DAP non-natural pair and of H-bonded base pairs between 4AP and all the natural bases in their classical Watson-Crick geometries. The QM calculations indicate that the 4AP:DAP pair, despite the fact that it can form 3 H-bonds in a classic Watson-Crick geometry, has a stability comparable to the A:T pair. Then, we extended the study to reverse Watson-Crick geometries, characteristic of parallel strands. MD simulations were carried out on two 13-mer DNA duplexes, featuring a central 4AP:DAP or A:T pair, respectively. No major structural deformation of the duplex was observed during the MD simulation. Snapshots from the MD simulations were subjected to QM calculations to investigate the 4AP:DAP interaction energy when embedded into a duplex structure, and to investigate the impact of the two non-natural bases on the stacking interactions with adjacent bases in the DNA duplex. We found a slight increase in stacking interactions involving the 4AP:DAP pair, counterbalanced by a moderate decrease in H-bonding interactions of the 4AP:DAP and of the adjacent base pairs in the duplex. The results of our study are in agreement with experimental data and complement them by providing an insight into which factors contribute positively and which factors contribute negatively to the structural compatibility of the fluorescent 4AP:DAP pair with a B-DNA structure.

Analysis of the genome sequence of the pathogenic Muscovy duck parvovirus strain YY reveals a 14-nucleotide-pair deletion in the inverted terminal repeats.

Science.gov (United States)

Wang, Jianye; Huang, Yu; Zhou, Mingxu; Zhu, Guoqiang

2016-09-01

Genomic information about Muscovy duck parvovirus is still limited. In this study, the genome of the pathogenic MDPV strain YY was sequenced. The full-length genome of YY is 5075 nucleotides (nt) long, 57 nt shorter than that of strain FM. Sequence alignment indicates that the 5' and 3' inverted terminal repeats (ITR) of strain YY contain a 14-nucleotide-pair deletion in the stem of the palindromic hairpin structure in comparison to strain FM and FZ91-30. The deleted region contains one "E-box" site and one repeated motif with the sequence "TTCCGGT" or "ACCGGAA". Phylogenetic trees constructed based the protein coding genes concordantly showed that YY, together with nine other MDPV isolates from various places, clustered in a separate branch, distinct from the branch formed by goose parvovirus (GPV) strains. These results demonstrate that, despite the distinctive deletion, the YY strain still belongs to the classical MDPV group. Moreover, the deletion of ITR may contribute to the genome evolution of MDPV under immunization pressure.

Covalent Bonding of Pyrrolobenzodiazepines (PBDs) to Terminal Guanine Residues within Duplex and Hairpin DNA Fragments

Science.gov (United States)

Mantaj, Julia; Jackson, Paul J. M.; Karu, Kersti; Rahman, Khondaker M.; Thurston, David E.

2016-01-01

Pyrrolobenzodiazepines (PBDs) are covalent-binding DNA-interactive agents with growing importance as payloads in Antibody Drug Conjugates (ADCs). Until now, PBDs were thought to covalently bond to C2-NH2 groups of guanines in the DNA-minor groove across a three-base-pair recognition sequence. Using HPLC/MS methodology with designed hairpin and duplex oligonucleotides, we have now demonstrated that the PBD Dimer SJG-136 and the C8-conjugated PBD Monomer GWL-78 can covalently bond to a terminal guanine of DNA, with the PBD skeleton spanning only two base pairs. Control experiments with the non-C8-conjugated anthramycin along with molecular dynamics simulations suggest that the C8-substituent of a PBD Monomer, or one-half of a PBD Dimer, may provide stability for the adduct. This observation highlights the importance of PBD C8-substituents, and also suggests that PBDs may bind to terminal guanines within stretches of DNA in cells, thus representing a potentially novel mechanism of action at the end of DNA strand breaks. PMID:27055050

Type-based homeomorphic embedding for online termination

DEFF Research Database (Denmark)

Albert, Elvira; Gallagher, John Patrick; Gómez-Zamalloa, Miguel

2009-01-01

that the computations supervised are performed over a finite signature, i.e., the number of constants and function symbols involved is finite. However, there are many situations, for example numeric computations, which involve an infinite signature and thus HEm does not guarantee termination. Some extensions to HEm...... for the case of infinite signatures have been proposed which guarantee termination. However, the existing techniques either do not provide systematic means for generating such extensions or the extensions are too simplistic and do not produce the expected results in practice. We propose Type-based Homeomorphic...... Embedding (TbHEm) as an extension of the standard, untyped, HEm. By taking static information about the behavior of the computation into account, expressed as types, TbHEm allows obtaining more precise results than those of the previous extensions to HEm for the case of infinite signatures. We show...

Base pair mismatches and carcinogen-modified bases in DNA: an NMR study of G x T and G x O4meT pairing in dodecanucleotide duplexes

International Nuclear Information System (INIS)

Kalnik, M.W.; Kouchakdjian, M.; Li, B.F.L.; Swann, P.F.; Patel, D.J.

1988-01-01

High-resolution two-dimensional NMR studies have been completed on the self-complementary d(C-G-C-G-A-G-C-T-T-G-C-G) duplex (designated G x T 12-mer) and the self-complementary d(C-G-C-G-A-G-C-T-O 4 meT-G-C-G) duplex (designated G x O 4 meT 12-mer) containing G x T and G x O 4 meT pairs at identical positions four base pairs in from either end of the duplex. The exchangeable and nonexchangeable proton resonances have been assigned from an analysis of two-dimensional nuclear Overhauser enhancement (NOESY) spectra for the G x T 12-mer and G x O 4 meT 12-mer duplexes in H 2 O and D 2 O solution. The guanosine and thymidine imino protons in the G x T mismatch resonate at 10.57 and 11.98 ppm, respectively, and exhibit a strong NOE between themselves and to imino protons of flanking base pairs in the G x T 12-mer duplex. The large upfield chemical shift of this proton relative to that of the imino proton resonance of G in the G x T mismatch or in G x C base pairs indicates that hydrogen bonding to O 4 meT is either very weak or absent. This guanosine imino proton has an NOE to the OCH 3 group of O 4 meT across the pair and NOEs to the imino protons of flanking base pairs. Taken together with data from the NMR of nonexchangeable protons, this shows that both G and O 4 meT have anti-glycosidic torsion angles and are stacked into the duplex. Comparison of the intensity of the NOEs between the guanosine imino proton and the OCH 3 of O 4 meT as well as other protons in its vicinity demonstrates that the OCH 3 group of O 4 meT adopts the syn orientation with respect to N3 of the methylated thymidine. The authors propose an alternate base pairing mode stabilized by one short hydrogen bond between the 2-amino group of guanosine and the 2-carbonyl group of O 4 met

Subwavelength-Sized Narrow-Band Anechoic Waveguide Terminations

DEFF Research Database (Denmark)

Santillan, Arturo Orozco; Ærenlund, Emil; Bozhevolnyi, Sergey I.

2016-01-01

We propose and demonstrate the use of a pair of detuned acoustic resonators to efficiently absorb narrowband sound waves in a terminated waveguide. The suggested configuration is relatively simple and advantageous for usage at low frequencies, since the dimensions of the resonators are very small...

Micromechanics of base pair unzipping in the DNA duplex

International Nuclear Information System (INIS)

Volkov, Sergey N; Paramonova, Ekaterina V; Yakubovich, Alexander V; Solov’yov, Andrey V

2012-01-01

All-atom molecular dynamics (MD) simulations of DNA duplex unzipping in a water environment were performed. The investigated DNA double helix consists of a Drew-Dickerson dodecamer sequence and a hairpin (AAG) attached to the end of the double-helix chain. The considered system is used to examine the process of DNA strand separation under the action of an external force. This process occurs in vivo and now is being intensively investigated in experiments with single molecules. The DNA dodecamer duplex is consequently unzipped pair by pair by means of the steered MD. The unzipping trajectories turn out to be similar for the duplex parts with G⋅C content and rather distinct for the parts with A⋅T content. It is shown that during the unzipping each pair experiences two types of motion: relatively quick rotation together with all the duplex and slower motion in the frame of the unzipping fork. In the course of opening, the complementary pair passes through several distinct states: (i) the closed state in the double helix, (ii) the metastable preopened state in the unzipping fork and (iii) the unbound state. The performed simulations show that water molecules participate in the stabilization of the metastable states of the preopened base pairs in the DNA unzipping fork. (paper)

NOTE TAKING PAIRS TO IMPROVE STUDENTS‟ SENTENCE BASED WRITING ACHIEVEMENT

Directory of Open Access Journals (Sweden)

Testiana Deni Wijayatiningsih

2017-04-01

Full Text Available Students had skill to actualize their imagination and interpret their knowledge through writing which could be combined with good writing structure. Moreover, their writing skill still had low motivation and had not reached the standard writing structure. Based on the background above, this research has purpose to know the influence Note Taking Pairs in improving students‘sentence based writing achievement. The subject of this research was the second semester of English Department in Muhammadiyah University of Semarang. It also used statistic non parametric method to analyze the students‘ writing achievement. The result of this research showed that Note Taking Pairs strategy could improve students‘sentence based writing achievement. Hopefully this research is recommended into learning process to improve students‘writing skill especially in sentence-based writing subject.

AT base pair anions versus (9-methyl-A)(1-methyl-T) base pair anions.

Science.gov (United States)

Radisic, Dunja; Bowen, Kit H; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej

2005-05-04

The anionic base pairs of adenine and thymine, (AT)(-), and 9-methyladenine and 1-methylthymine, (MAMT)(-), have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)(-) found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)(-) was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)(-) and a resulting (MAMT)(-) configuration that was either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)(-) occurred at a completely different electron binding energy than had (AT)(-). Moreover, the VDE value of (MAMT)(-) was in agreement with that predicted by theory. The configuration of (MAMT)(-) and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced DNA alterations, BFPT in the WC/HS configurations of (AT)(-) is not feasible.

AT Base Pair Anions vs. (9-methyl-A)(1-methyl-T) Base Pair Anions

International Nuclear Information System (INIS)

Radisic, Dunja; Bowen, Kit H.; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej S.

2005-01-01

The anionic base pairs of adenine and thymine, (AT)-, and 9-methyladenine and 1-methylthymine, (MAMT)-, have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)- found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration that was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)- was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)- and a resulting (MAMT)- configuration that wa s either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)- occurred at a completely different electron binding energy than had (AT)-. Moreover, the VDE value of (MAMT)- was in agreement with that predicted by theory. The configuration of (MAMT)- and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced damage, BFPT in the WC/HS configurations of (AT)- is not feasible

An atlas of RNA base pairs involving modified nucleobases with optimal geometries and accurate energies

KAUST Repository

Chawla, Mohit

2015-06-27

Posttranscriptional modifications greatly enhance the chemical information of RNA molecules, contributing to explain the diversity of their structures and functions. A significant fraction of RNA experimental structures available to date present modified nucleobases, with half of them being involved in H-bonding interactions with other bases, i.e. ‘modified base pairs’. Herein we present a systematic investigation of modified base pairs, in the context of experimental RNA structures. To this end, we first compiled an atlas of experimentally observed modified base pairs, for which we recorded occurrences and structural context. Then, for each base pair, we selected a representative for subsequent quantum mechanics calculations, to find out its optimal geometry and interaction energy. Our structural analyses show that most of the modified base pairs are non Watson–Crick like and are involved in RNA tertiary structure motifs. In addition, quantum mechanics calculations quantify and provide a rationale for the impact of the different modifications on the geometry and stability of the base pairs they participate in.

An atlas of RNA base pairs involving modified nucleobases with optimal geometries and accurate energies

KAUST Repository

Chawla, Mohit; Oliva, R.; Bujnicki, J. M.; Cavallo, Luigi

2015-01-01

Posttranscriptional modifications greatly enhance the chemical information of RNA molecules, contributing to explain the diversity of their structures and functions. A significant fraction of RNA experimental structures available to date present modified nucleobases, with half of them being involved in H-bonding interactions with other bases, i.e. ‘modified base pairs’. Herein we present a systematic investigation of modified base pairs, in the context of experimental RNA structures. To this end, we first compiled an atlas of experimentally observed modified base pairs, for which we recorded occurrences and structural context. Then, for each base pair, we selected a representative for subsequent quantum mechanics calculations, to find out its optimal geometry and interaction energy. Our structural analyses show that most of the modified base pairs are non Watson–Crick like and are involved in RNA tertiary structure motifs. In addition, quantum mechanics calculations quantify and provide a rationale for the impact of the different modifications on the geometry and stability of the base pairs they participate in.

Hole-assisted fiber based fiber fuse terminator supporting 22 W input

Science.gov (United States)

Tsujikawa, Kyozo; Kurokawa, Kenji; Hanzawa, Nobutomo; Nozoe, Saki; Matsui, Takashi; Nakajima, Kazuhide

2018-05-01

We investigated the air hole structure in hole-assisted fiber (HAF) with the aim of terminating fiber fuse propagation. We focused on two structural parameters c/MFD and S1/S2, which are related respectively to the position and area of the air holes, and mapped their appropriate values for terminating fiber fuse propagation. Here, MFD is the mode field diameter, c is the diameter of an inscribed circle linking the air holes, S1 is the total area of the air holes, and S2 is the area of a circumscribed circle linking the air holes. On the basis of these results, we successfully realized a compact fiber fuse terminator consisting of a 1.35 mm-long HAF, which can terminate fiber fuse propagation even with a 22 W input. In addition, we observed fiber fuse termination using a high-speed camera. We additionally confirmed that the HAF-based fiber fuse terminator is effective under various input power conditions. The penetration length of the optical discharge in the HAF was only less than 300 μm when the input power was from 2 to 22 W.

Validation of a Crowdsourcing Methodology for Developing a Knowledge Base of Related Problem-Medication Pairs.

Science.gov (United States)

McCoy, A B; Wright, A; Krousel-Wood, M; Thomas, E J; McCoy, J A; Sittig, D F

2015-01-01

Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes.

Estimating the Per-Base-Pair Mutation Rate in the Yeast Saccharomyces cerevisiae

OpenAIRE

Lang, Gregory I.; Murray, Andrew W.

2008-01-01

Although mutation rates are a key determinant of the rate of evolution they are difficult to measure precisely and global mutations rates (mutations per genome per generation) are often extrapolated from the per-base-pair mutation rate assuming that mutation rate is uniform across the genome. Using budding yeast, we describe an improved method for the accurate calculation of mutation rates based on the fluctuation assay. Our analysis suggests that the per-base-pair mutation rates at two genes...

Data communication between data terminal equipment and the JPL administrative data base management system

Science.gov (United States)

Iverson, R. W.

1984-01-01

Approaches to enabling an installed base of mixed data terminal equipment to access a data base management system designed to work with a specific terminal are discussed. The approach taken by the Jet Propulsion Laboratory is described. Background information on the Jet Propulsion Laboratory (JPL), its organization and a description of the Administrative Data Base Management System is included.

The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone

DEFF Research Database (Denmark)

Kumar, P.; Sharma, P. K.; Madsen, Charlotte S.

2013-01-01

Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.......Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand....

Higher order structural effects stabilizing the reverse watson-crick guanine-cytosine base pair in functional RNAs

KAUST Repository

Chawla, Mohit

2013-10-10

The G:C reverse Watson-Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. 2013 The Author(s).

DNA base dimers are stabilized by hydrogen-bonding interactions including non-Watson-Crick pairing near graphite surfaces.

Science.gov (United States)

Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain

2012-10-11

Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.

Validation of a Crowdsourcing Methodology for Developing a Knowledge Base of Related Problem-Medication Pairs

Science.gov (United States)

Wright, A.; Krousel-Wood, M.; Thomas, E. J.; McCoy, J. A.; Sittig, D. F.

2015-01-01

Summary Background Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. Objective We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. Methods We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. Results The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. Conclusions We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes. PMID:26171079

Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

Science.gov (United States)

Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

2004-03-01

A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non

Lewis pair polymerization by classical and frustrated Lewis pairs: Acid, base and monomer scope and polymerization mechanism

KAUST Repository

Zhang, Yuetao

2012-01-01

Classical and frustrated Lewis pairs (LPs) of the strong Lewis acid (LA) Al(C 6F 5) 3 with several Lewis base (LB) classes have been found to exhibit exceptional activity in the Lewis pair polymerization (LPP) of conjugated polar alkenes such as methyl methacrylate (MMA) as well as renewable α-methylene-γ-butyrolactone (MBL) and γ-methyl- α-methylene-γ-butyrolactone (γ-MMBL), leading to high molecular weight polymers, often with narrow molecular weight distributions. This study has investigated a large number of LPs, consisting of 11 LAs as well as 10 achiral and 4 chiral LBs, for LPP of 12 monomers of several different types. Although some more common LAs can also be utilized for LPP, Al(C 6F 5) 3-based LPs are far more active and effective than other LA-based LPs. On the other hand, several classes of LBs, when paired with Al(C 6F 5) 3, can render highly active and effective LPP of MMA and γ-MMBL; such LBs include phosphines (e.g., P tBu 3), chiral chelating diphosphines, N-heterocyclic carbenes (NHCs), and phosphazene superbases (e.g., P 4- tBu). The P 4- tBu/Al(C 6F 5) 3 pair exhibits the highest activity of the LP series, with a remarkably high turn-over frequency of 9.6 × 10 4 h -1 (0.125 mol% catalyst, 100% MMA conversion in 30 s, M n = 2.12 × 10 5 g mol -1, PDI = 1.34). The polymers produced by LPs at RT are typically atactic (P γMMBL with ∼47% mr) or syndio-rich (PMMA with ∼70-75% rr), but highly syndiotactic PMMA with rr ∼91% can be produced by chiral or achiral LPs at -78 °C. Mechanistic studies have identified and structurally characterized zwitterionic phosphonium and imidazolium enolaluminates as the active species of the current LPP system, which are formed by the reaction of the monomer·Al(C 6F 5) 3 adduct with P tBu 3 and NHC bases, respectively. Kinetic studies have revealed that the MMA polymerization by the tBu 3P/ Al(C 6F 5) 3 pair is zero-order in monomer concentration after an initial induction period, and the polymerization

Predicting the Mechanism and Kinetics of the Watson-Crick to Hoogsteen Base Pairing Transition

NARCIS (Netherlands)

Vreede, J.; Bolhuis, P.G.; Swenson, D.W.H.

2016-01-01

DNA duplexes predominantly contain Watson-Crick (WC) base pairs. Yet, a non-negligible number of base pairs converts to the Hoogsteen (HG) hydrogen bonding pattern, involving a 180° rotation of the purine base relative to Watson-Crick. These WC to HG conversions alter the conformation of DNA, and

Series Production of 13 kA Current Leads with Dry and Compact Warm Terminals

CERN Document Server

Andersen, T P; Vullierme, B

2005-01-01

For the LHC magnet test benches 13 pairs of conventional helium vapour-cooled 13 kA current leads are required. The current leads have been designed and built by industry. Attention was given to economical and reliable design and to a design of the warm terminal in order to avoid any condensation. Three pairs of them were tested at CERN. The dry warm terminal enables voltage test at 4.1 kV at cold condition. The paper describes construction details and compares calculated and measured values of the main parameters.

Base Pair Opening in a Deoxynucleotide Duplex Containing a cis-syn Thymine Cyclobutane Dimer Lesion

Science.gov (United States)

Wenke, Belinda B.; Huiting, Leah N.; Frankel, Elisa B.; Lane, Benjamin F.; Núñez, Megan E.

2014-01-01

The cis-syn thymine cyclobutane dimer is a DNA photoproduct implicated in skin cancer. We compared the stability of individual base pairs in thymine dimer-containing duplexes to undamaged parent 10-mer duplexes. UV melting thermodynamic measurements, CD spectroscopy, and 2D NOESY NMR spectroscopy confirm that the thymine dimer lesion is locally and moderately destabilizing within an overall B-form duplex conformation. We measured the rates of exchange of individual imino protons by NMR using magnetization transfer from water and determined the equilibrium constant for the opening of each base pair Kop. In the normal duplex Kop decreases from the frayed ends of the duplex toward the center, such that the central TA pair is the most stable with a Kop of 8×10−7. In contrast, base pair opening at the 5’T of the thymine dimer is facile. The 5’T of the dimer has the largest equilibrium constant (Kop =3×10−4) in its duplex, considerably larger than even the frayed penultimate base pairs. Notably, base pairing by the 3’T of the dimer is much more stable than by the 5’T, indicating that the predominant opening mechanism for the thymine dimer lesion is not likely to be flipping out into solution as a single unit. The dimer asymmetrically affects the stability of the duplex in its vicinity, destabilizing base pairing on its 5’ side more than on the 3’ side. The striking differences in base pair opening between parent and dimer duplexes occur independently of the duplex-single strand melting transitions. PMID:24328089

Comparable stability of Hoogsteen and Watson-Crick base pairs in ionic liquid choline dihydrogen phosphate.

Science.gov (United States)

Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

2014-01-08

The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.

Comparable Stability of Hoogsteen and Watson–Crick Base Pairs in Ionic Liquid Choline Dihydrogen Phosphate

Science.gov (United States)

Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

2014-01-01

The instability of Hoogsteen base pairs relative to Watson–Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson–Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson–Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo. PMID:24399194

A quantum theoretical study of reactions of methyldiazonium ion with DNA base pairs

International Nuclear Information System (INIS)

Shukla, P.K.; Ganapathy, Vinay; Mishra, P.C.

2011-01-01

Graphical abstract: Reactions of methyldiazonium ion at the different sites of the DNA bases in the Watson-Crick GC and AT base pairs were investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Display Omitted Highlights: → Methylation of the DNA bases is important as it can cause mutation and cancer. → Methylation reactions of the GC and AT base pairs with CH 3 N 2 + were not studied earlier theoretically. → Experimental observations have been explained using theoretical methods. - Abstract: Methylation of the DNA bases in the Watson-Crick GC and AT base pairs by the methyldiazonium ion was investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Methylation at the N3, N7 and O6 sites of guanine, N1, N3 and N7 sites of adenine, O2 and N3 sites of cytosine and the O2 and O4 sites of thymine were considered. The computed reactivities for methylation follow the order N7(guanine) > N3(adenine) > O6(guanine) which is in agreement with experiment. The base pairing in DNA is found to play a significant role with regard to reactivities of the different sites.

Agent-based Security and Efficiency Estimation in Airport Terminals

NARCIS (Netherlands)

Janssen, S.A.M.

We investigate the use of an Agent-based framework to identify and quantify the relationship between security and efficiency within airport terminals. In this framework, we define a novel Security Risk Assessment methodology that explicitly models attacker and defender behavior in a security

Charge transfer in DNA: role of base pairing

Czech Academy of Sciences Publication Activity Database

Kratochvílová, Irena; Bunček, M.; Schneider, Bohdan

2009-01-01

Roč. 38, Suppl. (2009), S123-S123 ISSN 0175-7571. [EBSA European Biophysics Congress /7./. Genoa, 11.07.2009-15.07.2009] Institutional research plan: CEZ:AV0Z10100520; CEZ:AV0Z50520701 Keywords : DNA * charge transport * base pairing Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.437, year: 2009

Studies of base pair sequence effects on DNA solvation based on all-atom molecular dynamics simulations.

Science.gov (United States)

Dixit, Surjit B; Mezei, Mihaly; Beveridge, David L

2012-07-01

Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization were observed in these simulations. The results were compared to essentially all known experimental data on the subject. Proximity analysis was employed to highlight the sequence dependent differences in solvation and ion localization properties in the grooves of DNA. Comparison of the MD-calculated DNA structure with canonical A- and B-forms supports the idea that the G/C-rich sequences are closer to canonical A- than B-form structures, while the reverse is true for the poly A sequences, with the exception of the alternating ATAT sequence. Analysis of hydration density maps reveals that the flexibility of solute molecule has a significant effect on the nature of observed hydration. Energetic analysis of solute-solvent interactions based on proximity analysis of solvent reveals that the GC or CG base pairs interact more strongly with water molecules in the minor groove of DNA that the AT or TA base pairs, while the interactions of the AT or TA pairs in the major groove are stronger than those of the GC or CG pairs. Computation of solvent-accessible surface area of the nucleotide units in the simulated trajectories reveals that the similarity with results derived from analysis of a database of crystallographic structures is excellent. The MD trajectories tend to follow Manning's counterion condensation theory, presenting a region of condensed counterions within a radius of about 17 A from the DNA surface independent of sequence. The GC and CG pairs tend to associate with cations in the major groove of the DNA structure to a greater extent than the AT and TA pairs. Cation association is more frequent in the minor groove of AT than the GC pairs. In general, the

Photochemical selectivity in guanine-cytosine base-pair structures

Czech Academy of Sciences Publication Activity Database

Abo-Riziq, A.; Grace, L.; Nir, E.; Kabeláč, Martin; Hobza, Pavel; Vries de, M. S.

2005-01-01

Roč. 102, č. 1 (2005), s. 20-23 ISSN 0027-8424 R&D Projects: GA ČR(CZ) GA203/05/0009 Grant - others:NSF(US) CHE-0244341 Institutional research plan: CEZ:AV0Z40550506 Keywords : DNA base pairs * IR-UV spectroscopy * phytochemistry Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 10.231, year: 2005

String pair production in non homogeneous backgrounds

Energy Technology Data Exchange (ETDEWEB)

Bolognesi, S. [Department of Physics “E. Fermi” University of Pisa, and INFN - Sezione di Pisa,Largo Pontecorvo, 3, Ed. C, 56127 Pisa (Italy); Rabinovici, E. [Racah Institute of Physics, The Hebrew University of Jerusalem,91904 Jerusalem (Israel); Tallarita, G. [Departamento de Ciencias, Facultad de Artes Liberales,Universidad Adolfo Ibáñez, Santiago 7941169 (Chile)

2016-04-28

We consider string pair production in non homogeneous electric backgrounds. We study several particular configurations which can be addressed with the Euclidean world-sheet instanton technique, the analogue of the world-line instanton for particles. In the first case the string is suspended between two D-branes in flat space-time, in the second case the string lives in AdS and terminates on one D-brane (this realizes the holographic Schwinger effect). In some regions of parameter space the result is well approximated by the known analytical formulas, either the particle pair production in non-homogeneous background or the string pair production in homogeneous background. In other cases we see effects which are intrinsically stringy and related to the non-homogeneity of the background. The pair production is enhanced already for particles in time dependent electric field backgrounds. The string nature enhances this even further. For spacial varying electrical background fields the string pair production is less suppressed than the rate of particle pair production. We discuss in some detail how the critical field is affected by the non-homogeneity, for both time and space dependent electric field backgrouds. We also comment on what could be an interesting new prediction for the small field limit. The third case we consider is pair production in holographic confining backgrounds with homogeneous and non-homogeneous fields.

String pair production in non homogeneous backgrounds

International Nuclear Information System (INIS)

Bolognesi, S.; Rabinovici, E.; Tallarita, G.

2016-01-01

We consider string pair production in non homogeneous electric backgrounds. We study several particular configurations which can be addressed with the Euclidean world-sheet instanton technique, the analogue of the world-line instanton for particles. In the first case the string is suspended between two D-branes in flat space-time, in the second case the string lives in AdS and terminates on one D-brane (this realizes the holographic Schwinger effect). In some regions of parameter space the result is well approximated by the known analytical formulas, either the particle pair production in non-homogeneous background or the string pair production in homogeneous background. In other cases we see effects which are intrinsically stringy and related to the non-homogeneity of the background. The pair production is enhanced already for particles in time dependent electric field backgrounds. The string nature enhances this even further. For spacial varying electrical background fields the string pair production is less suppressed than the rate of particle pair production. We discuss in some detail how the critical field is affected by the non-homogeneity, for both time and space dependent electric field backgrouds. We also comment on what could be an interesting new prediction for the small field limit. The third case we consider is pair production in holographic confining backgrounds with homogeneous and non-homogeneous fields.

Measurement and theory of hydrogen bonding contribution to isosteric DNA base pairs.

Science.gov (United States)

Khakshoor, Omid; Wheeler, Steven E; Houk, K N; Kool, Eric T

2012-02-15

We address the recent debate surrounding the ability of 2,4-difluorotoluene (F), a low-polarity mimic of thymine (T), to form a hydrogen-bonded complex with adenine in DNA. The hydrogen bonding ability of F has been characterized as small to zero in various experimental studies, and moderate to small in computational studies. However, recent X-ray crystallographic studies of difluorotoluene in DNA/RNA have indicated, based on interatomic distances, possible hydrogen bonding interactions between F and natural bases in nucleic acid duplexes and in a DNA polymerase active site. Since F is widely used to measure electrostatic contributions to pairing and replication, it is important to quantify the impact of this isostere on DNA stability. Here, we studied the pairing stability and selectivity of this compound and a closely related variant, dichlorotoluene deoxyriboside (L), in DNA, using both experimental and computational approaches. We measured the thermodynamics of duplex formation in three sequence contexts and with all possible pairing partners by thermal melting studies using the van't Hoff approach, and for selected cases by isothermal titration calorimetry (ITC). Experimental results showed that internal F-A pairing in DNA is destabilizing by 3.8 kcal/mol (van't Hoff, 37 °C) as compared with T-A pairing. At the end of a duplex, base-base interactions are considerably smaller; however, the net F-A interaction remains repulsive while T-A pairing is attractive. As for selectivity, F is found to be slightly selective for adenine over C, G, T by 0.5 kcal mol, as compared with thymine's selectivity of 2.4 kcal/mol. Interestingly, dichlorotoluene in DNA is slightly less destabilizing and slightly more selective than F, despite the lack of strongly electronegative fluorine atoms. Experimental data were complemented by computational results, evaluated at the M06-2X/6-31+G(d) and MP2/cc-pVTZ levels of theory. These computations suggest that the pairing energy of F to A

Controlled and Efficient Polymerization of Conjugated Polar Alkenes by Lewis Pairs Based on Sterically Hindered Aryloxide-Substituted Alkylaluminum

Directory of Open Access Journals (Sweden)

Xiaojun Wang

2018-02-01

Full Text Available Reported herein is the development of an effective strategy for controlled and efficient Lewis pair polymerization of conjugated polar alkenes, including methyl methacrylate (MMA, n-butyl methacrylate (nBuMA, and γ-methyl-α-methylene-γ-butyrolactone (γMMBL, by the utilization of sterically encumbered Al(BHT2Me (BHT: 2,6-di-tert-butyl-4-methylphenol as a Lewis acid that shuts down intramolecular backbiting termination. In combination with a selected N-heterocyclic carbene (NHC as a Lewis base, the polymerization of MMA exhibited activity up to 3000 h−1 TOF and an acceptable initiation efficiency of 60.6%, producing polymers with high molecular weight (Mn up to 130 kg/mol and extremely narrow dispersity (Đ = 1.06~1.13. This controlled polymerization with a living characteristic has been evidenced by chain-extension experiments and chain-end analysis, and enabled the synthesis of well-defined diblock copolymers.

Principles of RNA base pairing: Structures and energies of cis and trans-Watson-Crick/Sugar Edge base pairs revealed by quantum chemical calculations

Czech Academy of Sciences Publication Activity Database

Šponer, Judit E.; Leszczynski, J.; Šponer, Jiří

2005-01-01

Roč. 22, č. 6 (2005), s. 826 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : RNA base pairing * DNA * Watson-Crick/Sugar Edge Subject RIV: BO - Biophysics

Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide-protein complexes.

Science.gov (United States)

Kondo, Jiro; Westhof, Eric

2011-10-01

Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.

Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide–protein complexes

Science.gov (United States)

Kondo, Jiro; Westhof, Eric

2011-01-01

Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide–protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson–Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson–Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues. PMID:21737431

Angle Control-Based Multi-Terminal Out-of-Step Protection System

Directory of Open Access Journals (Sweden)

Antans Sauhats

2017-03-01

Full Text Available From time to time a sequence of unexpected and overlapping contingencies may lead to power system angular instability and even blackouts if not addressed adequately by means of an out-of-step (OOS protection system. The motivation of the paper is an attempt to develop a workable prototype of the OOS protection system. The deficiencies of the protection currently used in the Latvian Power System network are highlighted and a new protection structure is proposed. The protection system comprises of several strategically located terminals, exchanging information in real time by means of a communication network. The OOS condition detection method is based on system-wide generation sources, electromotive forces, vectors, and angle control. The network splitting decision is based on generator coherence evaluation. Protection terminals determine online the groups of coherent generators and choose the splitting boundary from a predefined transmission lines (TLs cut sets list. The protection system structure, algorithm of operation, and possible IEC 61850 communication standard-based implementation are described.

Intense charge transfer surface based on graphene and thymine-Hg(II)-thymine base pairs for detection of Hg(2.).

Science.gov (United States)

Li, Jiao; Lu, Liping; Kang, Tianfang; Cheng, Shuiyuan

2016-03-15

In this article, we developed an electrochemiluminescence (ECL) sensor with a high-intensity charge transfer interface for Hg(2+) detection based on Hg(II)-induced DNA hybridization. The sensor was fabricated by the following simple method. First, graphene oxide (GO) was electrochemically reduced onto a glassy carbon electrode through cyclic voltammetry. Then, amino-labeled double-stranded (ds)DNA was assembled on the electrode surface using 1-pyrenebutyric acid N-hydroxysuccinimide as a linker between GO and DNA. The other terminal of dsDNA, which was labeled with biotin, was linked to CdSe quantum dots via biotin-avidin interactions. Reduced graphene oxide has excellent electrical conductivity. dsDNA with T-Hg(II)-T base pairs exhibited more facile charge transfer. They both accelerate the electron transfer performance and sensitivity of the sensor. The increased ECL signals were logarithmically linear with the concentration of Hg(II) when Hg(2+) was present in the detection solution. The linear range of the sensor was 10(-11) to 10(-8)mol/L (R=0.9819) with a detection limit of 10(-11)mol/L. This biosensor exhibited satisfactory results when it was used to detect Hg(II) in real water samples. The biosensor with high-intense charge transfer performance is a prospect avenue to pursue more and more sensitive detection method. Copyright © 2015 Elsevier B.V. All rights reserved.

Solvent effects on hydrogen bonds in Watson-Crick, mismatched, and modified DNA base pairs

NARCIS (Netherlands)

Poater, Jordi; Swart, Marcel; Guerra, Celia Fonseca; Bickelhaupt, F. Matthias

2012-01-01

We have theoretically analyzed a complete series of Watson–Crick and mismatched DNA base pairs, both in gas phase and in solution. Solvation causes a weakening and lengthening of the hydrogen bonds between the DNA bases because of the stabilization of the lone pairs involved in these bonds. We have

KlenTaq polymerase replicates unnatural base pairs by inducing a Watson-Crick geometry.

Science.gov (United States)

Betz, Karin; Malyshev, Denis A; Lavergne, Thomas; Welte, Wolfram; Diederichs, Kay; Dwyer, Tammy J; Ordoukhanian, Phillip; Romesberg, Floyd E; Marx, Andreas

2012-07-01

Many candidate unnatural DNA base pairs have been developed, but some of the best-replicated pairs adopt intercalated structures in free DNA that are difficult to reconcile with known mechanisms of polymerase recognition. Here we present crystal structures of KlenTaq DNA polymerase at different stages of replication for one such pair, dNaM-d5SICS, and show that efficient replication results from the polymerase itself, inducing the required natural-like structure.

Ferrocene-based Lewis acids and Lewis pairs: Synthesis and ...

Indian Academy of Sciences (India)

The design and synthesis of molecules containing non-interacting Lewis base and Lewis acid groups. [Frustrated Lewis pairs (FLP's)] have received intense attention due to their potential applications in the area of molecular catalysis.1–3. For example,. Stephen's and co-workers have demonstrated that the unquenched ...

Concealed d-wave pairs in the s± condensate of iron-based superconductors.

Science.gov (United States)

Ong, Tzen; Coleman, Piers; Schmalian, Jörg

2016-05-17

A central question in iron-based superconductivity is the mechanism by which the paired electrons minimize their strong mutual Coulomb repulsion. In most unconventional superconductors, Coulomb repulsion is minimized through the formation of higher angular momentum Cooper pairs, with Fermi surface nodes in the pair wavefunction. The apparent absence of such nodes in the iron-based superconductors has led to a belief they form an s-wave ([Formula: see text]) singlet state, which changes sign between the electron and hole pockets. However, the multiorbital nature of these systems opens an alternative possibility. Here, we propose a new class of [Formula: see text] state containing a condensate of d-wave Cooper pairs, concealed by their entanglement with the iron orbitals. By combining the d-wave ([Formula: see text]) motion of the pairs with the internal angular momenta [Formula: see text] of the iron orbitals to make a singlet ([Formula: see text]), an [Formula: see text] superconductor with a nontrivial topology is formed. This scenario allows us to understand the development of octet nodes in potassium-doped Ba1-x KXFe2As2 as a reconfiguration of the orbital and internal angular momentum into a high spin ([Formula: see text]) state; the reverse transition under pressure into a fully gapped state can then be interpreted as a return to the low-spin singlet. The formation of orbitally entangled pairs is predicted to give rise to a shift in the orbital content at the Fermi surface, which can be tested via laser-based angle-resolved photoemission spectroscopy.

Roles of the Amino Group of Purine Bases in the Thermodynamic Stability of DNA Base Pairing

Directory of Open Access Journals (Sweden)

Shu-ichi Nakano

2014-08-01

Full Text Available The energetic aspects of hydrogen-bonded base-pair interactions are important for the design of functional nucleotide analogs and for practical applications of oligonucleotides. The present study investigated the contribution of the 2-amino group of DNA purine bases to the thermodynamic stability of oligonucleotide duplexes under different salt and solvent conditions, using 2'-deoxyriboinosine (I and 2'-deoxyribo-2,6-diaminopurine (D as non-canonical nucleotides. The stability of DNA duplexes was changed by substitution of a single base pair in the following order: G•C > D•T ≈ I•C > A•T > G•T > I•T. The apparent stabilization energy due to the presence of the 2-amino group of G and D varied depending on the salt concentration, and decreased in the water-ethanol mixed solvent. The effects of salt concentration on the thermodynamics of DNA duplexes were found to be partially sequence-dependent, and the 2-amino group of the purine bases might have an influence on the binding of ions to DNA through the formation of a stable base-paired structure. Our results also showed that physiological salt conditions were energetically favorable for complementary base recognition, and conversely, low salt concentration media and ethanol-containing solvents were effective for low stringency oligonucleotide hybridization, in the context of conditions employed in this study.

OPF-Based Optimal Location of Two Systems Two Terminal HVDC to Power System Optimal Operation

Directory of Open Access Journals (Sweden)

Mehdi Abolfazli

2013-04-01

Full Text Available In this paper a suitable mathematical model of the two terminal HVDC system is provided for optimal power flow (OPF and optimal location based on OPF such power injection model. The ability of voltage source converter (VSC-based HVDC to independently control active and reactive power is well represented by the model. The model is used to develop an OPF-based optimal location algorithm of two systems two terminal HVDC to minimize the total fuel cost and active power losses as objective function. The optimization framework is modeled as non-linear programming (NLP and solved by Matlab and GAMS softwares. The proposed algorithm is implemented on the IEEE 14- and 30-bus test systems. The simulation results show ability of two systems two terminal HVDC in improving the power system operation. Furthermore, two systems two terminal HVDC is compared by PST and OUPFC in the power system operation from economical and technical aspects.

An entropy-based improved k-top scoring pairs (TSP) method for ...

African Journals Online (AJOL)

An entropy-based improved k-top scoring pairs (TSP) (Ik-TSP) method was presented in this study for the classification and prediction of human cancers based on gene-expression data. We compared Ik-TSP classifiers with 5 different machine learning methods and the k-TSP method based on 3 different feature selection ...

Parameter Selection and Performance Analysis of Mobile Terminal Models Based on Unity3D

Institute of Scientific and Technical Information of China (English)

KONG Li-feng; ZHAO Hai-ying; XU Guang-mei

2014-01-01

Mobile platform is now widely seen as a promising multimedia service with a favorable user group and market prospect. To study the influence of mobile terminal models on the quality of scene roaming, a parameter setting platform of mobile terminal models is established to select the parameter selection and performance index on different mobile platforms in this paper. This test platform is established based on model optimality principle, analyzing the performance curve of mobile terminals in different scene models and then deducing the external parameter of model establishment. Simulation results prove that the established test platform is able to analyze the parameter and performance matching list of a mobile terminal model.

Thermodynamic stability of Hoogsteen and Watson-Crick base pairs in the presence of histone H3-mimicking peptide.

Science.gov (United States)

Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki

2011-03-14

We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.

Watson-Crick base pairing controls excited-state decay in natural DNA.

Science.gov (United States)

Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang

2014-10-13

Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Performance of various density functionals for the hydrogen bonds in DNA base pairs

NARCIS (Netherlands)

van der Wijst, T.; Fonseca Guerra, C.; Swart, M.; Bickelhaupt, F.M.

2006-01-01

We have investigated the performance of seven popular density functionals (B3LYP, BLYP, BP86, mPW, OPBE, PBE, PW91) for describing the geometry and stability of the hydrogen bonds in DNA base pairs. For the gas-phase situation, the hydrogen-bond lengths and strengths in the DNA pairs have been

RNAHelix: computational modeling of nucleic acid structures with Watson-Crick and non-canonical base pairs.

Science.gov (United States)

Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju

2017-02-01

Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.

Aviram–Ratner rectifying mechanism for DNA base-pair sequencing through graphene nanogaps

International Nuclear Information System (INIS)

Agapito, Luis A; Gayles, Jacob; Wolowiec, Christian; Kioussis, Nicholas

2012-01-01

We demonstrate that biological molecules such as Watson–Crick DNA base pairs can behave as biological Aviram–Ratner electrical rectifiers because of the spatial separation and weak hydrogen bonding between the nucleobases. We have performed a parallel computational implementation of the ab initio non-equilibrium Green’s function (NEGF) theory to determine the electrical response of graphene—base-pair—graphene junctions. The results show an asymmetric (rectifying) current–voltage response for the cytosine–guanine base pair adsorbed on a graphene nanogap. In sharp contrast we find a symmetric response for the thymine–adenine case. We propose applying the asymmetry of the current–voltage response as a sensing criterion to the technological challenge of rapid DNA sequencing via graphene nanogaps. (paper)

Positive cooperativity of the specific binding between Hg2+ ion and T:T mismatched base pairs in duplex DNA

International Nuclear Information System (INIS)

Torigoe, Hidetaka; Miyakawa, Yukako; Ono, Akira; Kozasa, Tetsuo

2012-01-01

Highlights: ► Hg 2+ specifically bound with the T:T mismatched base pair at 1:1 molar ratio. ► The binding constant between Hg 2+ and the T:T mismatched base pair was 10 6 M −1 . ► The binding constant was larger than those for nonspecific metal–DNA interactions. ► The binding constant for the second Hg 2+ was larger than that for the first Hg 2+ . ► The positive cooperative binding was observed between Hg 2+ and multiple T:T. - Abstract: Metal-mediated base pairs by the interaction between metal ions and artificial bases in oligonucleotides have been developed for their potential applications in nanotechnology. We recently found that a natural T:T mismatched base pair bound with Hg 2+ ion to form a novel T–Hg–T base pair. Here, we examined the thermodynamic properties of the binding between Hg 2+ and each of the single and double T:T mismatched base pair duplex DNAs by isothermal titration calorimetry. Hg 2+ specifically bound with the T:T mismatched base pair at 1:1 molar ratio with 10 6 M −1 binding constant, which was significantly larger than those for nonspecific metal ion–DNA interactions. In the Hg 2+ –double T:T mismatched base pair interaction, the affinity for the second Hg 2+ binding was significantly larger than that for the first Hg 2+ binding. The positively cooperative binding may be favorable to align multiple Hg 2+ in duplex DNA for the application of the metal-mediated base pairs in nanotechnology.

Antenna Correlation From Input Parameters for Arbitrary Topologies and Terminations

DEFF Research Database (Denmark)

Alrabadi, Osama; Andersen, Jørgen Bach; Pedersen, Gert Frølund

2012-01-01

The spatial correlation between pairs of antennas in a system comprised of N RF ports is found by extending the N × N scattering matrix to (N + 1)×(N + 1) spatial scattering matrix, where the extra space dimension accounts for the reference port patterns. The lossless property of the spatial...... scattering matrix in a 3D uniform field is employed for expressing the spatial correlation between the port patterns at arbitrary complex terminations merely from the reference scattering parameters and the complex terminations without any far-field calculation....

The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.

Science.gov (United States)

Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul

2013-06-17

Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Visualizing RNA Secondary Structure Base Pair Binding Probabilities using Nested Concave Hulls

OpenAIRE

Sansen , Joris; Bourqui , Romain; Thebault , Patricia; Allali , Julien; Auber , David

2015-01-01

International audience; The challenge 1 of the BIOVIS 2015 design contest consists in designing an intuitive visual depiction of base pairs binding probabilities for secondary structure of ncRNA. Our representation depicts the potential nucleotide pairs binding using nested concave hulls over the computed MFE ncRNA secondary structure. Thus, it allows to identify regions with a high level of uncertainty in the MFE computation and the structures which seem to match to reality.

Terminal structures of West Nile virus genomic RNA and their interactions with viral NS5 protein

International Nuclear Information System (INIS)

Dong Hongping; Zhang Bo; Shi Peiyong

2008-01-01

Genome cyclization is essential for flavivirus replication. We used RNases to probe the structures formed by the 5'-terminal 190 nucleotides and the 3'-terminal 111 nucleotides of the West Nile virus (WNV) genomic RNA. When analyzed individually, the two RNAs adopt stem-loop structures as predicted by the thermodynamic-folding program. However, when mixed together, the two RNAs form a duplex that is mediated through base-pairings of two sets of RNA elements (5'CS/3'CSI and 5'UAR/3'UAR). Formation of the RNA duplex facilitates a conformational change that leaves the 3'-terminal nucleotides of the genome (position - 8 to - 16) to be single-stranded. Viral NS5 binds specifically to the 5'-terminal stem-loop (SL1) of the genomic RNA. The 5'SL1 RNA structure is essential for WNV replication. The study has provided further evidence to suggest that flavivirus genome cyclization and NS5/5'SL1 RNA interaction facilitate NS5 binding to the 3' end of the genome for the initiation of viral minus-strand RNA synthesis

Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine.

Science.gov (United States)

Bhamra, Inder; Compagnone-Post, Patricia; O'Neil, Ian A; Iwanejko, Lesley A; Bates, Andrew D; Cosstick, Richard

2012-11-01

8-Nitro-2'-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2'-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2'-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson-Crick pair.

Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine†

Science.gov (United States)

Bhamra, Inder; Compagnone-Post, Patricia; O’Neil, Ian A.; Iwanejko, Lesley A.; Bates, Andrew D.; Cosstick, Richard

2012-01-01

8-Nitro-2′-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2′-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2′-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson–Crick pair. PMID:22965127

High-Resolution Crystal Structure of a Silver(I)-RNA Hybrid Duplex Containing Watson-Crick-like C-Silver(I)-C Metallo-Base Pairs.

Science.gov (United States)

Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

2015-11-02

Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Non-Watson Crick base pairs might stabilize RNA structural motifs in ...

Indian Academy of Sciences (India)

Watson Crick base pairs, internal loops and pseudoknots have been the highlighting feature of recent structural determination of RNAs. The recent crystal structure of group-I introns has demonstrated that these might constitute RNA structural ...

Tuning smart microgel swelling and responsive behavior through strong and weak polyelectrolyte pair assembly.

Science.gov (United States)

Costa, Eunice; Lloyd, Margaret M; Chopko, Caroline; Aguiar-Ricardo, Ana; Hammond, Paula T

2012-07-03

The layer-by-layer (LbL) assembly of polyelectrolyte pairs on temperature and pH-sensitive cross-linked poly(N-isopropylacrylamide)-co-(methacrylic acid), poly(NIPAAm-co-MAA), microgels enabled a fine-tuning of the gel swelling and responsive behavior according to the mobility of the assembled polyelectrolyte (PE) pair and the composition of the outermost layer. Microbeads with well-defined morphology were initially prepared by synthesis in supercritical carbon dioxide. Upon LbL assembly of polyelectrolytes, interactions between the multilayers and the soft porous microgel led to differences in swelling and thermoresponsive behavior. For the weak PE pairs, namely poly(L-lysine)/poly(L-glutamic acid) and poly(allylamine hydrochloride)/poly(acrylic acid), polycation-terminated microgels were less swollen and more thermoresponsive than native microgel, whereas polyanion-terminated microgels were more swollen and not significantly responsive to temperature, in a quasi-reversible process with consecutive PE assembly. For the strong PE pair, poly(diallyldimethylammonium chloride)/poly(sodium styrene sulfonate), the differences among polycation and polyanion-terminated microgels are not sustained after the first PE bilayer due to extensive ionic cross-linking between the polyelectrolytes. The tendencies across the explored systems became less noteworthy in solutions with larger ionic strength due to overall charge shielding of the polyelectrolytes and microgel. ATR FT-IR studies correlated the swelling and responsive behavior after LbL assembly on the microgels with the extent of H-bonding and alternating charge distribution within the gel. Thus, the proposed LbL strategy may be a simple and flexible way to engineer smart microgels in terms of size, surface chemistry, overall charge and permeability.

Time series regression-based pairs trading in the Korean equities market

Science.gov (United States)

Kim, Saejoon; Heo, Jun

2017-07-01

Pairs trading is an instance of statistical arbitrage that relies on heavy quantitative data analysis to profit by capitalising low-risk trading opportunities provided by anomalies of related assets. A key element in pairs trading is the rule by which open and close trading triggers are defined. This paper investigates the use of time series regression to define the rule which has previously been identified with fixed threshold-based approaches. Empirical results indicate that our approach may yield significantly increased excess returns compared to ones obtained by previous approaches on large capitalisation stocks in the Korean equities market.

A rule of seven in Watson-Crick base-pairing of mismatched sequences.

Science.gov (United States)

Cisse, Ibrahim I; Kim, Hajin; Ha, Taekjip

2012-05-13

Sequence recognition through base-pairing is essential for DNA repair and gene regulation, but the basic rules governing this process remain elusive. In particular, the kinetics of annealing between two imperfectly matched strands is not well characterized, despite its potential importance in nucleic acid-based biotechnologies and gene silencing. Here we use single-molecule fluorescence to visualize the multiple annealing and melting reactions of two untethered strands inside a porous vesicle, allowing us to precisely quantify the annealing and melting rates. The data as a function of mismatch position suggest that seven contiguous base pairs are needed for rapid annealing of DNA and RNA. This phenomenological rule of seven may underlie the requirement for seven nucleotides of complementarity to seed gene silencing by small noncoding RNA and may help guide performance improvement in DNA- and RNA-based bio- and nanotechnologies, in which off-target effects can be detrimental.

Fuzzy Sets-based Control Rules for Terminating Algorithms

Directory of Open Access Journals (Sweden)

Jose L. VERDEGAY

2002-01-01

Full Text Available In this paper some problems arising in the interface between two different areas, Decision Support Systems and Fuzzy Sets and Systems, are considered. The Model-Base Management System of a Decision Support System which involves some fuzziness is considered, and in that context the questions on the management of the fuzziness in some optimisation models, and then of using fuzzy rules for terminating conventional algorithms are presented, discussed and analyzed. Finally, for the concrete case of the Travelling Salesman Problem, and as an illustration of determination, management and using the fuzzy rules, a new algorithm easy to implement in the Model-Base Management System of any oriented Decision Support System is shown.

Multi-terminal memtransistors from polycrystalline monolayer molybdenum disulfide

Science.gov (United States)

Sangwan, Vinod K.; Lee, Hong-Sub; Bergeron, Hadallia; Balla, Itamar; Beck, Megan E.; Chen, Kan-Sheng; Hersam, Mark C.

2018-02-01

Memristors are two-terminal passive circuit elements that have been developed for use in non-volatile resistive random-access memory and may also be useful in neuromorphic computing. Memristors have higher endurance and faster read/write times than flash memory and can provide multi-bit data storage. However, although two-terminal memristors have demonstrated capacity for basic neural functions, synapses in the human brain outnumber neurons by more than a thousandfold, which implies that multi-terminal memristors are needed to perform complex functions such as heterosynaptic plasticity. Previous attempts to move beyond two-terminal memristors, such as the three-terminal Widrow-Hoff memristor and field-effect transistors with nanoionic gates or floating gates, did not achieve memristive switching in the transistor. Here we report the experimental realization of a multi-terminal hybrid memristor and transistor (that is, a memtransistor) using polycrystalline monolayer molybdenum disulfide (MoS2) in a scalable fabrication process. The two-dimensional MoS2 memtransistors show gate tunability in individual resistance states by four orders of magnitude, as well as large switching ratios, high cycling endurance and long-term retention of states. In addition to conventional neural learning behaviour of long-term potentiation/depression, six-terminal MoS2 memtransistors have gate-tunable heterosynaptic functionality, which is not achievable using two-terminal memristors. For example, the conductance between a pair of floating electrodes (pre- and post-synaptic neurons) is varied by a factor of about ten by applying voltage pulses to modulatory terminals. In situ scanning probe microscopy, cryogenic charge transport measurements and device modelling reveal that the bias-induced motion of MoS2 defects drives resistive switching by dynamically varying Schottky barrier heights. Overall, the seamless integration of a memristor and transistor into one multi-terminal device could

Prediction of plant promoters based on hexamers and random triplet pair analysis

Directory of Open Access Journals (Sweden)

Noman Nasimul

2011-06-01

Full Text Available Abstract Background With an increasing number of plant genome sequences, it has become important to develop a robust computational method for detecting plant promoters. Although a wide variety of programs are currently available, prediction accuracy of these still requires further improvement. The limitations of these methods can be addressed by selecting appropriate features for distinguishing promoters and non-promoters. Methods In this study, we proposed two feature selection approaches based on hexamer sequences: the Frequency Distribution Analyzed Feature Selection Algorithm (FDAFSA and the Random Triplet Pair Feature Selecting Genetic Algorithm (RTPFSGA. In FDAFSA, adjacent triplet-pairs (hexamer sequences were selected based on the difference in the frequency of hexamers between promoters and non-promoters. In RTPFSGA, random triplet-pairs (RTPs were selected by exploiting a genetic algorithm that distinguishes frequencies of non-adjacent triplet pairs between promoters and non-promoters. Then, a support vector machine (SVM, a nonlinear machine-learning algorithm, was used to classify promoters and non-promoters by combining these two feature selection approaches. We referred to this novel algorithm as PromoBot. Results Promoter sequences were collected from the PlantProm database. Non-promoter sequences were collected from plant mRNA, rRNA, and tRNA of PlantGDB and plant miRNA of miRBase. Then, in order to validate the proposed algorithm, we applied a 5-fold cross validation test. Training data sets were used to select features based on FDAFSA and RTPFSGA, and these features were used to train the SVM. We achieved 89% sensitivity and 86% specificity. Conclusions We compared our PromoBot algorithm to five other algorithms. It was found that the sensitivity and specificity of PromoBot performed well (or even better with the algorithms tested. These results show that the two proposed feature selection methods based on hexamer frequencies

Easy design of colorimetric logic gates based on nonnatural base pairing and controlled assembly of gold nanoparticles.

Science.gov (United States)

Zhang, Li; Wang, Zhong-Xia; Liang, Ru-Ping; Qiu, Jian-Ding

2013-07-16

Utilizing the principles of metal-ion-mediated base pairs (C-Ag-C and T-Hg-T), the pH-sensitive conformational transition of C-rich DNA strand, and the ligand-exchange process triggered by DL-dithiothreitol (DTT), a system of colorimetric logic gates (YES, AND, INHIBIT, and XOR) can be rationally constructed based on the aggregation of the DNA-modified Au NPs. The proposed logic operation system is simple, which consists of only T-/C-rich DNA-modified Au NPs, and it is unnecessary to exquisitely design and alter the DNA sequence for different multiple molecular logic operations. The nonnatural base pairing combined with unique optical properties of Au NPs promises great potential in multiplexed ion sensing, molecular-scale computers, and other computational logic devices.

A statistic to estimate the variance of the histogram-based mutual information estimator based on dependent pairs of observations

NARCIS (Netherlands)

Moddemeijer, R

In the case of two signals with independent pairs of observations (x(n),y(n)) a statistic to estimate the variance of the histogram based mutual information estimator has been derived earlier. We present such a statistic for dependent pairs. To derive this statistic it is necessary to avail of a

NMR and molecular modeling evidence for a G·A mismatch base pair in a purine-rich DNA duplex

International Nuclear Information System (INIS)

Li, Ying; Wilson, W.D.; Zon, G.

1991-01-01

1 H NMR experiments indicate that the oligomer 5'-d(ATGAGCGAATA) forms an unusual 10-base-pair duplex with 4 G·A base pairs and a 3' unpaired adenosine. NMR results indicate that guanoxine imino protons of the F·A mismatches are not hydrogen bonded but are stacked in the helix. A G→ I substitution in either G·A base pair causes a dramatic decrtease in duplex stability and indicates that hydrogen bonding of the guanosine amino group is critical. Nuclear Overhauser effect spectroscopy (NOESY) and two-dimensional correlated spectroscopy (COSY) results indicate that the overall duplex conformation is in the B-family. Cross-strand NOEs in two-dimensional NOESY spectra between a mismatched AH2 and an AH1' of the other mismatched base pair and between a mismatched GH8 and GNH1 of the other mismatch establish a purine-purine stacking pattern, adenosine over adenosine and guanosine over guanosine, which strongly stabilizes the duplex. A computer graphics molecular model of the ususual duplex was constructed with G·A base pairs containing A-NH 2 to GN3 and G-NH 2 to AN7 hydrogen bonds and B-form base pairs on both sides of the G·A pairs [5'-d(ATGAGC)]. The energy-minimized duplex satisfies all experimental constraints from NOESY and COSY results. A hydrogen bond from G-NH 2 of the mismatch to a phosphate oxygen is predicted

Efficient and Provable Secure Pairing-Free Security-Mediated Identity-Based Identification Schemes

Directory of Open Access Journals (Sweden)

Ji-Jian Chin

2014-01-01

Full Text Available Security-mediated cryptography was first introduced by Boneh et al. in 2001. The main motivation behind security-mediated cryptography was the capability to allow instant revocation of a user’s secret key by necessitating the cooperation of a security mediator in any given transaction. Subsequently in 2003, Boneh et al. showed how to convert a RSA-based security-mediated encryption scheme from a traditional public key setting to an identity-based one, where certificates would no longer be required. Following these two pioneering papers, other cryptographic primitives that utilize a security-mediated approach began to surface. However, the security-mediated identity-based identification scheme (SM-IBI was not introduced until Chin et al. in 2013 with a scheme built on bilinear pairings. In this paper, we improve on the efficiency results for SM-IBI schemes by proposing two schemes that are pairing-free and are based on well-studied complexity assumptions: the RSA and discrete logarithm assumptions.

Efficient and provable secure pairing-free security-mediated identity-based identification schemes.

Science.gov (United States)

Chin, Ji-Jian; Tan, Syh-Yuan; Heng, Swee-Huay; Phan, Raphael C-W

2014-01-01

Security-mediated cryptography was first introduced by Boneh et al. in 2001. The main motivation behind security-mediated cryptography was the capability to allow instant revocation of a user's secret key by necessitating the cooperation of a security mediator in any given transaction. Subsequently in 2003, Boneh et al. showed how to convert a RSA-based security-mediated encryption scheme from a traditional public key setting to an identity-based one, where certificates would no longer be required. Following these two pioneering papers, other cryptographic primitives that utilize a security-mediated approach began to surface. However, the security-mediated identity-based identification scheme (SM-IBI) was not introduced until Chin et al. in 2013 with a scheme built on bilinear pairings. In this paper, we improve on the efficiency results for SM-IBI schemes by proposing two schemes that are pairing-free and are based on well-studied complexity assumptions: the RSA and discrete logarithm assumptions.

The design of remote intelligent terminal based on ARM

International Nuclear Information System (INIS)

Zhang Bin; Liu Zixin

2014-01-01

This paper introduces the function and principle of the remote intelligent terminal. It was designed on SmartARM 2200, uses uC/OS-II operating system and MiniGUI. And then,it gives a method to realize it. Introduces the work flow of remote intelligent terminal, and the function module of the system are analyzed in detail, and then the terminal of the principle has carried on the preliminary study. (authors)

The Influence of Square Planar Platinum Complexes on DNA Bases Pairing. An ab initio DFT Study

Czech Academy of Sciences Publication Activity Database

Burda, J. V.; Šponer, Jiří; Leszczynski, J.

2001-01-01

Roč. 3, č. 19 (2001), s. 4404-4411 ISSN 1463-9076 R&D Projects: GA MŠk LN00A032 Institutional research plan: CEZ:AV0Z4040901 Keywords : DNA base pairing * platinated base pairs * ab initio DFT study Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 1.787, year: 2001

Simulation evaluation of TIMER, a time-based, terminal air traffic, flow-management concept

Science.gov (United States)

Credeur, Leonard; Capron, William R.

1989-01-01

A description of a time-based, extended terminal area ATC concept called Traffic Intelligence for the Management of Efficient Runway scheduling (TIMER) and the results of a fast-time evaluation are presented. The TIMER concept is intended to bridge the gap between today's ATC system and a future automated time-based ATC system. The TIMER concept integrates en route metering, fuel-efficient cruise and profile descents, terminal time-based sequencing and spacing together with computer-generated controller aids, to improve delivery precision for fuller use of runway capacity. Simulation results identify and show the effects and interactions of such key variables as horizon of control location, delivery time error at both the metering fix and runway threshold, aircraft separation requirements, delay discounting, wind, aircraft heading and speed errors, and knowledge of final approach speed.

Enhanced Stability of DNA Nanostructures by Incorporation of Unnatural Base Pairs.

Science.gov (United States)

Liu, Qing; Liu, Guocheng; Wang, Ting; Fu, Jing; Li, Rujiao; Song, Linlin; Wang, Zhen-Gang; Ding, Baoquan; Chen, Fei

2017-11-03

Self-assembled DNA nanostructures hold great promise in the fields of nanofabrication, biosensing and nanomedicine. However, the inherent low stability of the DNA double helices, formed by weak interactions, largely hinders the assembly and functions of DNA nanostructures. In this study, we redesigned and constructed a six-arm DNA junction by incorporation of the unnatural base pairs 5-Me-isoC/isoG and A/2-thioT into the double helices. They not only retained the structural integrity of the DNA nanostructure, but also showed enhanced thermal stability and resistance to T7 Exonuclease digestion. This research may expand the applications of DNA nanostructures in nanofabrication and biomedical fields, and furthermore, the genetic alphabet expansion with unnatural base pairs may enable us to construct more complicated and diversified self-assembled DNA nanostructures. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Hydrogen bond disruption in DNA base pairs from (14)C transmutation.

Science.gov (United States)

Sassi, Michel; Carter, Damien J; Uberuaga, Blas P; Stanek, Christopher R; Mancera, Ricardo L; Marks, Nigel A

2014-09-04

Recent ab initio molecular dynamics simulations have shown that radioactive carbon does not normally fragment DNA bases when it decays. Motivated by this finding, density functional theory and Bader analysis have been used to quantify the effect of C → N transmutation on hydrogen bonding in DNA base pairs. We find that (14)C decay has the potential to significantly alter hydrogen bonds in a variety of ways including direct proton shuttling (thymine and cytosine), thermally activated proton shuttling (guanine), and hydrogen bond breaking (cytosine). Transmutation substantially modifies both the absolute and relative strengths of the hydrogen bonding pattern, and in two instances (adenine and cytosine), the density at the critical point indicates development of mild covalent character. Since hydrogen bonding is an important component of Watson-Crick pairing, these (14)C-induced modifications, while infrequent, may trigger errors in DNA transcription and replication.

Andreev bound states probed in three-terminal quantum dots

Science.gov (United States)

Gramich, J.; Baumgartner, A.; Schönenberger, C.

2017-11-01

Andreev bound states (ABSs) are well-defined many-body quantum states that emerge from the hybridization of individual quantum dot (QD) states with a superconductor and exhibit very rich and fundamental phenomena. We demonstrate several electron transport phenomena mediated by ABSs that form on three-terminal carbon nanotube (CNT) QDs, with one superconducting (S) contact in the center and two adjacent normal-metal (N) contacts. Three-terminal spectroscopy allows us to identify the coupling to the N contacts as the origin of the Andreev resonance (AR) linewidths and to determine the critical coupling strengths to S, for which a ground state (or quantum phase) transition in such S-QD systems can occur. In addition, we ascribe replicas of the lowest-energy ABS resonance to transitions between the ABS and odd-parity excited QD states, a process we call excited state ABS resonances. In the conductance between the two N contacts we find a characteristic pattern of positive and negative differential subgap conductance, which we explain by considering two nonlocal processes, the creation of Cooper pairs in S by electrons from both N terminals, and a transport mechanism we call resonant ABS tunneling, possible only in multiterminal QD devices. In the latter process, electrons are transferred via the ABS without effectively creating Cooper pairs in S. The three-terminal geometry also allows spectroscopy experiments with different boundary conditions, for example by leaving S floating. Surprisingly, we find that, depending on the boundary conditions and the device parameters, the experiments either show single-particle Coulomb blockade resonances, ABS characteristics, or both in the same measurements, seemingly contradicting the notion of ABSs replacing the single-particle states as eigenstates of the QD. We qualitatively explain these results as originating from the finite time scale required for the coherent oscillations between the superposition states after a single

Uncertainty evaluation for three-dimensional scanning electron microscope reconstructions based on the stereo-pair technique

DEFF Research Database (Denmark)

Carli, Lorenzo; Genta, G; Cantatore, Angela

2011-01-01

3D-SEM is a method, based on the stereophotogrammetry technique, which obtains three-dimensional topographic reconstructions starting typically from two SEM images, called the stereo-pair. In this work, a theoretical uncertainty evaluation of the stereo-pair technique, according to GUM (Guide to ...

600 a Current Leads with Dry and Compact Warm Terminals

CERN Document Server

Andersen, T P; Vullierme, B

2002-01-01

For the LHC magnet test benches 26 pairs of conventional helium vapour-cooled 600 A current leads are required. The first pair of 600 A current leads has been designed and built by industry and tested at CERN. The main component of the lead is the heat exchanger, which consists of two concentric copper pipes. Special attention was also given to the design of the warm terminal in order to avoid any condensation and to resist at an electrical test of 2 kV. The paper describes construction details and compares calculated and measured values of the main parameters.

Hydrogen Bonding in DNA Base Pairs: Reconciliation of Theory and Experiment

NARCIS (Netherlands)

Fonseca Guerra, C.; Bickelhaupt, F.M.; Snijders, J.G.; Baerends, E.J.

2000-01-01

Up till now, there has been a significant disagreement between theory and experiment regarding hydrogen bond lengths in Watson - Crick base pairs. To investigate the possible sources of this discrepancy, we have studied numerous model systems for adenine - thymine (AT) and guanine - cytosine (GC)

Amperean Pairing and the Pseudogap Phase of Cuprate Superconductors

Science.gov (United States)

Lee, Patrick A.

2014-07-01

The enigmatic pseudogap phase in underdoped cuprate high-Tc superconductors has long been recognized as a central puzzle of the Tc problem. Recent data show that the pseudogap is likely a distinct phase, characterized by a medium range and quasistatic charge ordering. However, the origin of the ordering wave vector and the mechanism of the charge order is unknown. At the same time, earlier data show that precursive superconducting fluctuations are also associated with this phase. We propose that the pseudogap phase is a novel pairing state where electrons on the same side of the Fermi surface are paired, in strong contrast with conventional Bardeen-Cooper-Schrieffer theory which pairs electrons on opposite sides of the Fermi surface. In this state the Cooper pair carries a net momentum and belongs to a general class called pair density wave. The microscopic pairing mechanism comes from a gauge theory formulation of the resonating valence bond (RVB) picture, where spinons traveling in the same direction feel an attractive force in analogy with Ampere's effects in electromagnetism. We call this Amperean pairing. Charge order automatically appears as a subsidiary order parameter even when long-range pair order is destroyed by phase fluctuations. Our theory gives a prediction of the ordering wave vector which is in good agreement with experiment. Furthermore, the quasiparticle spectrum from our model explains many of the unusual features reported in photoemission experiments. The Fermi arc, the unusual way the tip of the arc terminates, and the relation of the spanning vector of the arc tips to the charge ordering wave vector also come out naturally. Finally, we propose an experiment that can directly test the notion of Amperean pairing.

Effect of base-pair inhomogeneities on charge transport along the DNA molecule, mediated by twist and radial polarons

International Nuclear Information System (INIS)

Palmero, F; Archilla, J F R; Hennig, D; Romero, F R

2004-01-01

Some recent results for a three-dimensional, semi-classical, tight-binding model for DNA show that there are two types of polarons, namely radial and twist polarons, which can transport charge along the DNA molecule. However, the existence of two types of base pairs in real DNA makes it crucial to find out if charge transport also exists in DNA chains with different base pairs. In this paper, we address this problem in its simple case, a homogeneous chain except for a single different base pair, which we call a base-pair inhomogeneity, and its effect on charge transport. Radial polarons experience either reflection or trapping. However, twist polarons are good candidates for charge transport along real DNA. This transport is also very robust with respect to weak parametric and diagonal disorder

DFT study on the attacking mechanisms of H and OH radicals to G-C and A-T base pairs in water

Energy Technology Data Exchange (ETDEWEB)

Okutsu, N.; Shimamura, K.; Shimizu, E.; Kurita, N., E-mail: kurita@cs.tut.ac.jp [Department of Computer Science and Engineering, Toyohashi University of Technology, Toyohashi, Aichi, 441-8580 (Japan); Shulga, S. [Institute for Food Biotechnology and Genomics, National Academy of Sciences of Ukraine, Kyiv (Ukraine); Danilov, V. I. [Institute of Molecular Biology and Genetics, National Academy of Sciences of Ukraine, Kyiv (Ukraine)

2016-02-01

To elucidate the effect of radicals on DNA base pairs, we investigated the attacking mechanism of OH and H radicals to the G-C and A-T base pairs, using the density functional theory (DFT) calculations in water approximated by the continuum solvation model. The DFT calculations revealed that the OH radical abstracts the hydrogen atom of a NH{sub 2} group of G or A base and induces a tautomeric reaction for an A-T base pair more significantly than for a G-C base pair. On the other hand, the H radical prefers to bind to the Cytosine NH{sub 2} group of G-C base pair and induce a tautomeric reaction from G-C to G*-C*, whose activation free energy is considerably small (−0.1 kcal/mol) in comparison with that (42.9 kcal/mol) for the reaction of an A-T base pair. Accordingly, our DFT calculations elucidated that OH and H radicals have a significant effect on A-T and G-C base pairs, respectively. This finding will be useful for predicting the effect of radiation on the genetic information recorded in the base sequences of DNA duplexes.

DFT study on the attacking mechanisms of H and OH radicals to G-C and A-T base pairs in water

International Nuclear Information System (INIS)

Okutsu, N.; Shimamura, K.; Shimizu, E.; Kurita, N.; Shulga, S.; Danilov, V. I.

2016-01-01

To elucidate the effect of radicals on DNA base pairs, we investigated the attacking mechanism of OH and H radicals to the G-C and A-T base pairs, using the density functional theory (DFT) calculations in water approximated by the continuum solvation model. The DFT calculations revealed that the OH radical abstracts the hydrogen atom of a NH 2 group of G or A base and induces a tautomeric reaction for an A-T base pair more significantly than for a G-C base pair. On the other hand, the H radical prefers to bind to the Cytosine NH 2 group of G-C base pair and induce a tautomeric reaction from G-C to G*-C*, whose activation free energy is considerably small (−0.1 kcal/mol) in comparison with that (42.9 kcal/mol) for the reaction of an A-T base pair. Accordingly, our DFT calculations elucidated that OH and H radicals have a significant effect on A-T and G-C base pairs, respectively. This finding will be useful for predicting the effect of radiation on the genetic information recorded in the base sequences of DNA duplexes

Nonlinear modelling and dynamic stability analysis of a flexible Cartesian robotic manipulator with base disturbance and terminal load

Directory of Open Access Journals (Sweden)

J. Ju

2017-07-01

Full Text Available The flexible Cartesian robotic manipulator (FCRM is coming into widespread application in industry. Because of the feeble rigidity and heavy deflection, the dynamic characteristics of the FCRM are easily influenced by external disturbances which mainly concentrate in the driving end and the load end. Thus, with the influence of driving base disturbance and terminal load considered, the motion differential equations of the FCRM under the plane motion of the base are constructed, which contain the forced and non-linear parametric excitations originated from the disturbances of base lateral and axial motion respectively. Considering the relationship between the coefficients of the motion differential equations and the mode shapes of the flexible manipulator, the analytic expressions of the mode shapes with terminal load are deduced. Then, based on multiple scales method and rectangular coordinate transformation, the average equations of the FCRM are derived to analyze the influence mechanism of base disturbance and terminal load on the system parametric vibration stability. The results show that terminal load mainly affects the node locations of mode shapes and mode frequencies of the FCRM, and the axial motion disturbance of the driving base introduces parametric excitation while the lateral motion disturbance generates forced excitation for the transverse vibration model of the FCRM. Furthermore, with the increase of the base excitation acceleration and terminal load, the parametric vibration instability region of the FCRM increases significantly. This study will be helpful for the dynamic characteristics analysis and vibration control of the FCRM.

Dye-sensitized solar cell with a pair of carbon-based electrodes

International Nuclear Information System (INIS)

Kyaw, Aung Ko Ko; Demir, Hilmi Volkan; Sun Xiaowei; Tantang, Hosea; Zhang Qichun; Wu Tao; Ke, Lin; Wei Jun

2012-01-01

We have fabricated a dye-sensitized solar cell (DSSC) with a pair of carbon-based electrodes using a transparent, conductive carbon nanotubes (CNTs) film modified with ultra-thin titanium-sub-oxide (TiO x ) as the working electrode and a bilayer of conductive CNTs and carbon black as the counter electrode. Without TiO x modification, the DSSC is almost nonfunctional whereas the power conversion efficiency (PCE) increases significantly when the working electrode is modified with TiO x . The performance of the cell could be further improved when the carbon black film was added on the counter electrode. The improved efficiency can be attributed to the inhibition of the mass recombination at the working electrode/electrolyte interface by TiO x and the acceleration of the electron transfer kinetics at the counter electrode by carbon black. The DSSC with a pair of carbon-based electrodes gives the PCE of 1.37%. (paper)

Single base pair mutation analysis by PNA directed PCR clamping

DEFF Research Database (Denmark)

Ørum, H.; Nielsen, P.E.; Egholm, M.

1993-01-01

A novel method that allows direct analysis of single base mutation by the polymerase chain reaction (PCR) is described. The method utilizes the finding that PNAs (peptide nucleic acids) recognize and bind to their complementary nucleic acid sequences with higher thermal stability and specificity...... allows selective amplification/suppression of target sequences that differ by only one base pair. Finally we show that PNAs can be designed in such a way that blockage can be accomplished when the PNA target sequence is located between the PCR primers....

PandA : pairings and arithmetic

NARCIS (Netherlands)

Chuengsatiansup, C.; Naehrig, M.; Ribarski, P.; Schwabe, P.; Cao, Z.; Zhang, F.

2014-01-01

This paper introduces PandA, a software framework for Pairings and Arithmetic. It is designed to bring together advances in the efficient computation of cryptographic pairings and the development and implementation of pairing-based protocols. The intention behind the PandA framework is to give

Lazy Productivity via Termination

NARCIS (Netherlands)

Endrullis, J.; Hendriks, R.D.A.

2011-01-01

We present a procedure for transforming strongly sequential constructor-based term rewriting systems (TRSs) into context-sensitive TRSs in such a way that productivity of the input system is equivalent to termination of the output system. Thereby automated termination provers become available for

Capturing alternative secondary structures of RNA by decomposition of base-pairing probabilities.

Science.gov (United States)

Hagio, Taichi; Sakuraba, Shun; Iwakiri, Junichi; Mori, Ryota; Asai, Kiyoshi

2018-02-19

It is known that functional RNAs often switch their functions by forming different secondary structures. Popular tools for RNA secondary structures prediction, however, predict the single 'best' structures, and do not produce alternative structures. There are bioinformatics tools to predict suboptimal structures, but it is difficult to detect which alternative secondary structures are essential. We proposed a new computational method to detect essential alternative secondary structures from RNA sequences by decomposing the base-pairing probability matrix. The decomposition is calculated by a newly implemented software tool, RintW, which efficiently computes the base-pairing probability distributions over the Hamming distance from arbitrary reference secondary structures. The proposed approach has been demonstrated on ROSE element RNA thermometer sequence and Lysine RNA ribo-switch, showing that the proposed approach captures conformational changes in secondary structures. We have shown that alternative secondary structures are captured by decomposing base-paring probabilities over Hamming distance. Source code is available from http://www.ncRNA.org/RintW .

Simulation-Based Optimization for Storage Allocation Problem of Outbound Containers in Automated Container Terminals

Directory of Open Access Journals (Sweden)

Ning Zhao

2015-01-01

Full Text Available Storage allocation of outbound containers is a key factor of the performance of container handling system in automated container terminals. Improper storage plans of outbound containers make QC waiting inevitable; hence, the vessel handling time will be lengthened. A simulation-based optimization method is proposed in this paper for the storage allocation problem of outbound containers in automated container terminals (SAPOBA. A simulation model is built up by Timed-Colored-Petri-Net (TCPN, used to evaluate the QC waiting time of storage plans. Two optimization approaches, based on Particle Swarm Optimization (PSO and Genetic Algorithm (GA, are proposed to form the complete simulation-based optimization method. Effectiveness of this method is verified by experiment, as the comparison of the two optimization approaches.

Design and Implementation of Terminal Logistics Distribution System Based on IOS Platform

Directory of Open Access Journals (Sweden)

Zhuang Yufeng

2017-01-01

Full Text Available The logistics companies often face inefficient distribution and a multitude of customer complaints on the shopping festival. This paper will find out the existing terminal logistics distribution problems, and put forward some suggestions for improvement according to these problems. Combined with the suggestions, an application for the optimization of terminal logistics distribution based on IOS is designed and developed. The application can mainly be divided into order module, map navigation module and communication module. Couriers login the application, process the orders by using bar code technology and get the best solution of delivery by the map. It can improve the distribution efficiency and customer satisfaction to some extent.

[Quantum-chemical investigation of tautomerization ways of Watson-Crick DNA base pair guanine-cytosine].

Science.gov (United States)

Brovarets', O O; Hovorun, D M

2010-01-01

A novel physico-chemical mechanism of the Watson-Crick DNA base pair Gua.Cyt tautomerization Gua.Cyt*Gua.CytGua*.Cyt (mutagenic tautomers of bases are marked by asterisks) have been revealed and realized in a pathway of single proton transfer through two mutual isoenergetic transition states with Gibbs free energy of activation 30.4 and 30.6 kcal/mol and they are ion pairs stabilized by three (N2H...N3, N1H...N4- and O6+H...N4-) and five (N2H...O2, N1H...O2, N1H...N3, O6+H...N4- and 06+H...N4-) H-bonds accordingly. Stable base pairs Gua-Cyt* and Gua*.Cyt which dissociate comparably easy into monomers have acceptable relative Gibbs energies--12.9 and 14.3 kcal/mol--for the explanation of the nature of the spontaneous transitions of DNA replication. Results are obtained at the MP2/6-311++G(2df,pd)//B3LYP/6-31 1++G(d,p) level of theory in vacuum approach.

Replication termination and chromosome dimer resolution in the archaeon Sulfolobus solfataricus.

Science.gov (United States)

Duggin, Iain G; Dubarry, Nelly; Bell, Stephen D

2011-01-05

Archaea of the genus Sulfolobus have a single-circular chromosome with three replication origins. All three origins fire in every cell in every cell cycle. Thus, three pairs of replication forks converge and terminate in each replication cycle. Here, we report 2D gel analyses of the replication fork fusion zones located between origins. These indicate that replication termination involves stochastic fork collision. In bacteria, replication termination is linked to chromosome dimer resolution, a process that requires the XerC and D recombinases, FtsK and the chromosomal dif site. Sulfolobus encodes a single-Xer homologue and its deletion gave rise to cells with aberrant DNA contents and increased volumes. Identification of the chromosomal dif site that binds Xer in vivo, and biochemical characterization of Xer/dif recombination revealed that, in contrast to bacteria, dif is located outside the fork fusion zones. Therefore, it appears that replication termination and dimer resolution are temporally and spatially distinct processes in Sulfolobus.

Site-Specific Incorporation of Functional Components into RNA by an Unnatural Base Pair Transcription System

Directory of Open Access Journals (Sweden)

Rie Kawai

2012-03-01

Full Text Available Toward the expansion of the genetic alphabet, an unnatural base pair between 7-(2-thienylimidazo[4,5-b]pyridine (Ds and pyrrole-2-carbaldehyde (Pa functions as a third base pair in replication and transcription, and provides a useful tool for the site-specific, enzymatic incorporation of functional components into nucleic acids. We have synthesized several modified-Pa substrates, such as alkylamino-, biotin-, TAMRA-, FAM-, and digoxigenin-linked PaTPs, and examined their transcription by T7 RNA polymerase using Ds-containing DNA templates with various sequences. The Pa substrates modified with relatively small functional groups, such as alkylamino and biotin, were efficiently incorporated into RNA transcripts at the internal positions, except for those less than 10 bases from the 3′-terminus. We found that the efficient incorporation into a position close to the 3′-terminus of a transcript depended on the natural base contexts neighboring the unnatural base, and that pyrimidine-Ds-pyrimidine sequences in templates were generally favorable, relative to purine-Ds-purine sequences. The unnatural base pair transcription system provides a method for the site-specific functionalization of large RNA molecules.

Expression of the VP2 protein of murine norovirus by a translation termination-reinitiation strategy.

Directory of Open Access Journals (Sweden)

Sawsan Napthine

2009-12-01

Full Text Available Expression of the minor virion structural protein VP2 of the calicivirus murine norovirus (MNV is believed to occur by the unusual mechanism of termination codon-dependent reinitiation of translation. In this process, following translation of an upstream open reading frame (ORF and termination at the stop codon, a proportion of 40S subunits remain associated with the mRNA and reinitiate at the AUG of a downstream ORF, which is typically in close proximity. Consistent with this, the VP2 start codon (AUG of MNV overlaps the stop codon of the upstream VP1 ORF (UAA in the pentanucleotide UAAUG.Here, we confirm that MNV VP2 expression is regulated by termination-reinitiation and define the mRNA sequence requirements. Efficient reintiation is dependent upon 43 nt of RNA immediately upstream of the UAAUG site. Chemical and enzymatic probing revealed that the RNA in this region is not highly structured and includes an essential stretch of bases complementary to 18S rRNA helix 26 (Motif 1. The relative position of Motif 1 with respect to the UAAUG site impacts upon the efficiency of the process. Termination-reinitiation in MNV was also found to be relatively insensitive to the initiation inhibitor edeine.The termination-reinitiation signal of MNV most closely resembles that of influenza BM2. Similar to other viruses that use this strategy, base-pairing between mRNA and rRNA is likely to play a role in tethering the 40S subunit to the mRNA following termination at the VP1 stop codon. Our data also indicate that accurate recognition of the VP2 ORF AUG is not a pre-requisite for efficient reinitiation of translation in this system.

Transport in a three-terminal graphene quantum dot in the multi-level regime

International Nuclear Information System (INIS)

Jacobsen, Arnhild; Simonet, Pauline; Ensslin, Klaus; Ihn, Thomas

2012-01-01

We investigate transport in a three-terminal graphene quantum dot. All nine elements of the conductance matrix have been independently measured. In the Coulomb blockade regime, accurate measurements of individual conductance resonances reveal slightly different resonance energies depending on which pair of leads is used for probing. Rapid changes in the tunneling coupling between the leads and the dot due to localized states in the constrictions have been excluded by tuning the difference in resonance energies using in-plane gates which couple preferentially to individual constrictions. The interpretation of the different resonance energies is then based on the presence of a number of levels in the dot with an energy spacing of the order of the measurement temperature. In this multi-level transport regime, the three-terminal device offers the opportunity to sense if the individual levels couple with different strengths to the different leads. This in turn gives qualitative insight into the spatial profile of the corresponding quantum dot wave functions. (paper)

Passivity-Based Control of Multi-Terminal HVDC Systems under Control Saturation Constraints

NARCIS (Netherlands)

Doria-Cerezo, Arnau; Olm, Josep M.; Scherpen, Jacquelien M.A.

2015-01-01

This paper proposes a decentralized, passivity-based control design for power stations in a multi-terminal High Voltage Direct Current transmission system. The control algorithm is shown to asymptotically stabilize the closed-loop system when the voltage set points are appropriately selected. The

Ultraviolet Absorption Induces Hydrogen-Atom Transfer in G⋅C Watson-Crick DNA Base Pairs in Solution.

Science.gov (United States)

Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M

2015-12-01

Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Laser driven electron-positron pair creation-kinetic theory versus analytical approximations

International Nuclear Information System (INIS)

Smolyansky, S.A.; Prozorkevich, A.V.; Bonitz, M.

2013-01-01

The dynamical Schwinger effect of vacuum pair creation driven by an intense external laser pulse is studied on the basis of quantum kinetic theory. The numerical solutions of these kinetic equations exhibit a complex time dependence which makes an analysis of the physical processes difficult. In particular, the question of secondary effects, such as creation of secondary annihilation photons from the focus spot of the colliding laser beams, remains an important open problem. In the present work we, therefore, develop a perturbation theory which is able to capture the dominant time dependence of the produced electron-positron pair density. The theory shows excellent agreement with the exact kinetic results during the laser pulse, but fails to reproduce the residual pair density remaining in the system after termination of the pulse. (copyright 2013 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

1,8-Naphthyridine-2,7-diamine: a potential universal reader of Watson-Crick base pairs for DNA sequencing by electron tunneling.

Science.gov (United States)

Liang, Feng; Lindsay, Stuart; Zhang, Peiming

2012-11-21

With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A : T and G : C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs.

Paired structures and other opposite-based models

DEFF Research Database (Denmark)

Rodríguez, J. Tinguaro; Franco, Camilo; Gómez, Daniel

2015-01-01

, that we will assume dependent on a specific negation, previously determined. In this way we can define a paired fuzzy set as a couple of opposite valuation fuzzy sets. Then we shall explore what kind of new valuation fuzzy sets can be generated from the semantic tension between those two poles, leading...... to a more complex valuation structure that still keeps the essence of being paired. In this way several neutral fuzzy sets can appear, in particular indeterminacy, ambivalence and conflict. Two consequences are then presented: on one hand, we will show how Atanassov´s Intuitionistic Fuzzy Sets can be viewed...

A microprocessor based exchange data collection and analysis terminal application to A.E.A. PABX

International Nuclear Information System (INIS)

Mohammed, F.A.; Ezzat, A.K.; Ayad, N.M.A.

1978-01-01

The traffic data acquisition and analysis comprises micro-processer based data collection, terminals (MBDCT) and a centralized computer. The MBDCT's can communicate with the computer through a data set system. Each (MBDCT) remote terminal is connected to about two hundreds subscriber lines. It scans the trunk lines to detect the on/off hook states and to calculate the call time and the called number. If the called subscriber is not from the 200 local lines, its status should be detected though the computer communication with the two terminals. The data collected by the terminal can be slightly analysed using the microprocessor programming capability. More-over short quality performance reports can be printed on a printer interfaced to the microprocessor. Also, data can be transmitted to the central computer for further data traffic investigation. The analysis outcome can be utilized for telephone line maintenance and reorganization. This report is concerned with the terminal details as applied to the A-E-A. PABX. It consists mainly of five external lines and about 300 internal lines

On the conformational stability of the smallest RNA kissing complexes maintained through two G·C base pairs

International Nuclear Information System (INIS)

Chu, Wally; Weerasekera, Akila; Kim, Chul-Hyun

2017-01-01

Two identical 5′GACG3′ tetra-loop motifs with different stem sequences (called H2 and H3) are found in the 5′ end region of Moloney Murine Leukemia Virus (MMLV) genomic RNA. They play important roles in RNA dimerization and encapsidation through two identical tetra-loops (5′GACG3′) forming a loop-to-loop kissing complex, the smallest RNA kissing complex ever found in nature. We examined the effects of a loop-closing base pair as well as a stem sequence on the conformational stability of the kissing complex. UV melting analysis and gel electrophoresis were performed on eight RNA sequences mimicking the H2 and H3 hairpin tetra-loops with variation in loop-closing base pairs. Our results show that changing the loop-closing base pair from the wildtype (5′A·U3′ for H3, 5′U·A3′ for H2) to 5′G·C3’/5′C·G3′ has significant effect on the stability of the kissing complexes: the substitution to 5′C·G3′ significantly decreases both thermal and mechanical stability, while switching to the 5′G·C3′ significantly increases the mechanical stability only. The kissing complexes with the wildtype loop-closing base pairs (5′A·U3′ for H3 and 5′U·A3′ for H2) show different stability when attached to a different stem sequence (H2 stem vs. H3 stem). This suggests that not only the loop-closing base pair itself, but also the stem sequence, affects the conformational stability of the RNA kissing complex. - Highlights: • Thermodynamic parameters of the smallest RNA kissing interactions were measured. • The effects of loop-closing base pairs on the RNA kissing complex was investigated. • Changing the base pair to 5′CG3′ decreases the stability of the kissing complex. • Changing it to 5′GC3′ increases the mechanical resilience of the kissing complex. • Difference in its stem sequence also affects the stability of the kissing complex.

DNA electronic circular dichroism on the inter-base pair scale

DEFF Research Database (Denmark)

Di Meo, Florent; Nørby, Morten Steen; Rubio-Magnieto, Jenifer

2015-01-01

A successful elucidation of the near-ultraviolet electronic circular dichroism spectrum of a short double-stranded DNA is reported. Time-dependent density functional theory methods are shown to accurately predict spectra and assign bands on the microscopic base-pair scale, a finding that opens...... the field for using circular dichroism spectroscopy as a sensitive nanoscale probe of DNA to reveal its complex interactions with the environment. (Chemical Equation Presented)....

Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

KAUST Repository

Das, Shubhajit

2015-09-17

We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

KAUST Repository

Das, Shubhajit; Samanta, Pralok Kumar; Pati, Swapan

2015-01-01

We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

Structural context effects in the oxidation of 8-oxo-7,8-dihydro-2'-deoxyguanosine to hydantoin products: electrostatics, base stacking, and base pairing.

Science.gov (United States)

Fleming, Aaron M; Muller, James G; Dlouhy, Adrienne C; Burrows, Cynthia J

2012-09-12

8-Oxo-7,8-dihydroguanine (OG) is the most common base damage found in cells, where it resides in many structural contexts, including the nucleotide pool, single-stranded DNA at transcription forks and replication bubbles, and duplex DNA base-paired with either adenine (A) or cytosine (C). OG is prone to further oxidation to the highly mutagenic hydantoin products spiroiminodihydantoin (Sp) and 5-guanidinohydantoin (Gh) in a sharply pH-dependent fashion within nucleosides. In the present work, studies were conducted to determine how the structural context affects OG oxidation to the hydantoins. These studies revealed a trend in which the Sp yield was greatest in unencumbered contexts, such as nucleosides, while the Gh yield increased in oligodeoxynucleotide (ODN) contexts or at reduced pH. Oxidation of oligomers containing hydrogen-bond modulators (2,6-diaminopurine, N(4)-ethylcytidine) or alteration of the reaction conditions (pH, temperature, and salt) identify base stacking, electrostatics, and base pairing as the drivers of the key intermediate 5-hydroxy-8-oxo-7,8-dihydroguanine (5-HO-OG) partitioning along the two hydantoin pathways, allowing us to propose a mechanism for the observed base-pairing effects. Moreover, these structural effects cause an increase in the effective pK(a) of 5-HO-OG, following an increasing trend from 5.7 in nucleosides to 7.7 in a duplex bearing an OG·C base pair, which supports the context-dependent product yields. The high yield of Gh in ODNs underscores the importance of further study on this lesion. The structural context of OG also determined its relative reactivity toward oxidation, for which the OG·A base pair is ~2.5-fold more reactive than an OG·C base pair, and with the weak one-electron oxidant ferricyanide, the OG nucleoside reactivity is >6000-fold greater than that of OG·C in a duplex, leading to the conclusion that OG in the nucleoside pool should act as a protective agent for OG in the genome.

A time-based concept for terminal-area traffic management

Science.gov (United States)

Erzberger, Heinz; Tobias, Leonard

1986-01-01

An automated air-traffic-management concept that has the potential for significantly increasing the efficiency of traffic flows in high-density terminal areas is discussed. The concept's implementation depends on techniques for controlling the landing time of all aircraft entering the terminal area, both those that are equipped with on-board four-dimensional (4D) guidance systems as well as those aircraft types that are conventionally equipped. The two major ground-based elements of the system are a scheduler which assigns conflict-free landing times and a profile descent advisor. Landing time provided by the scheduler is uplinked to equipped aircraft and translated into the appropriate 4D trajectory by the-board flight-management system. The controller issues descent advisories to unequipped aircraft to help them achieve the assigned landing times. Air traffic control simulations have established that the concept provides an efficient method for controlling various mixes of 4D-equipped and unequipped, as well as low- and high-performance, aircraft. Piloted simulations of profiles flown with the aid of advisories have verified the ability to meet specified descent times with prescribed accuracy.

Pairing symmetries of several iron-based superconductor families and some similarities with cuprates and heavy-fermions

Directory of Open Access Journals (Sweden)

Das Tanmoy

2012-03-01

Full Text Available We show that, by using the unit-cell transformation between 1 Fe per unit cell to 2 Fe per unit cell, one can qualitatively understand the pairing symmetry of several families of iron-based superconductors. In iron-pnictides and iron-chalcogenides, the nodeless s±-pairing and the resulting magnetic resonance mode transform nicely between the two unit cells, while retaining all physical properties unchanged. However, when the electron-pocket disappears from the Fermi surface with complete doping in KFe2As2, we find that the unit-cell invariant requirement prohibits the occurrence of s±-pairing symmetry (caused by inter-hole-pocket nesting. However, the intra-pocket nesting is compatible here, which leads to a nodal d-wave pairing. The corresponding Fermi surface topology and the pairing symmetry are similar to Ce-based heavy-fermion superconductors. Furthermore, when the Fermi surface hosts only electron-pockets in KyFe2-xSe2, the inter-electron-pocket nesting induces a nodeless and isotropic d-wave pairing. This situation is analogous to the electron-doped cuprates, where the strong antiferromagnetic order creates similar disconnected electron-pocket Fermi surface, and hence nodeless d-wave pairing appears. The unit-cell transformation in KyFe2-xSe2 exhibits that the d-wave pairing breaks the translational symmetry of the 2 Fe unit cell, and thus cannot be realized unless a vacancy ordering forms to compensate for it. These results are consistent with the coexistence picture of a competing order and nodeless d-wave superconductivity in both cuprates and KyFe1.6Se2.

Effectiveness of a Barge-Based Ballast Water Treatment System for Multi-Terminal Ports

Directory of Open Access Journals (Sweden)

Lovro Maglić

2015-10-01

Full Text Available The paper presents outcomes of the discrete event simulation of the ballast water management in a multi-terminal port. The simulation includes ship’s manoeuvring, cargo and ballast operations and a barge-based ballast water treatment system operating within all terminal areas. The barge-based ballast water treatment system is used by ships unable to use their own equipment, not equipped with an appropriate ballast treatment system or non-compliant with the Ballast Water Management (BWM Convention 2004 for whatever reason. The main goal is to estimate the productivity and cost effectiveness of such systems as an option to support ships not able to comply with the BWM Convention, once it enters into force. The model was built and tested in Arena simulation software. Process parameters are based on real traffic data for the port of Rijeka. The results indicate that barge-based ballast treatment facility will be heavily underutilized, and that such systems are cost-effective only in ports where large volumes of ballast water need to be delivered to shore treatment systems.

Pairing and recombination features during meiosis in Cebus paraguayanus (Primates: Platyrrhini

Directory of Open Access Journals (Sweden)

Garcia-Cruz Raquel

2009-06-01

Full Text Available Abstract Background Among neotropical Primates, the Cai monkey Cebus paraguayanus (CPA presents long, conserved chromosome syntenies with the human karyotype (HSA as well as numerous C+ blocks in different chromosome pairs. In this study, immunofluorescence (IF against two proteins of the Synaptonemal Complex (SC, namely REC8 and SYCP1, two recombination protein markers (RPA and MLH1, and one protein involved in the pachytene checkpoint machinery (BRCA1 was performed in CPA spermatocytes in order to analyze chromosome meiotic behavior in detail. Results Although in the vast majority of pachytene cells all autosomes were paired and synapsed, in a small number of nuclei the heterochromatic C-positive terminal region of bivalent 11 remained unpaired. The analysis of 75 CPA cells at pachytene revealed a mean of 43.22 MLH1 foci per nucleus and 1.07 MLH1 foci in each CPA bivalent 11, always positioned in the region homologous to HSA chromosome 21. Conclusion Our results suggest that C blocks undergo delayed pairing and synapsis, although they do not interfere with the general progress of pairing and synapsis.

Non-standard base pairing and stacked structures in methyl xanthine clusters

Czech Academy of Sciences Publication Activity Database

Callahan, M. P.; Gengeliczki, Z.; Svadlenak, N.; Valdes, Haydee; Hobza, Pavel; de Vries, M. S.

2008-01-01

Roč. 10, č. 19 (2008), s. 2819-2826 ISSN 1463-9076 R&D Projects: GA MŠk LC512 Grant - others:NSF(US) CHE-0615401 Institutional research plan: CEZ:AV0Z40550506 Keywords : non-standard base pairing * stacked structures * in methyl xanthine Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 4.064, year: 2008

Electrostatics Explains the Position-Dependent Effect of G⋅U Wobble Base Pairs on the Affinity of RNA Kissing Complexes.

Science.gov (United States)

Abi-Ghanem, Josephine; Rabin, Clémence; Porrini, Massimiliano; Dausse, Eric; Toulmé, Jean-Jacques; Gabelica, Valérie

2017-10-06

In the RNA realm, non-Watson-Crick base pairs are abundant and can affect both the RNA 3D structure and its function. Here, we investigated the formation of RNA kissing complexes in which the loop-loop interaction is modulated by non-Watson-Crick pairs. Mass spectrometry, surface plasmon resonance, and UV-melting experiments show that the G⋅U wobble base pair favors kissing complex formation only when placed at specific positions. We tried to rationalize this effect by molecular modeling, including molecular mechanics Poisson-Boltzmann surface area (MMPBSA) thermodynamics calculations and PBSA calculations of the electrostatic potential surfaces. Modeling reveals that the G⋅U stabilization is due to a specific electrostatic environment defined by the base pairs of the entire loop-loop region. The loop is not symmetric, and therefore the identity and position of each base pair matters. Predicting and visualizing the electrostatic environment created by a given sequence can help to design specific kissing complexes with high affinity, for potential therapeutic, nanotechnology or analytical applications. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Treatment of pairing correlations based on the equations of motion for zero-coupled pair operators

International Nuclear Information System (INIS)

Andreozzi, F.; Covello, A.; Gargano, A.; Ye, L.J.; Porrino, A.

1985-01-01

The pairing problem is treated by means of the equations of motion for zero-coupled pair operators. Exact equations for the seniority-v states of N particles are derived. These equations can be solved by a step-by-step procedure which consists of progressively adding pairs of particles to a core. The theory can be applied at several levels of approximation depending on the number of core states which are taken into account. Some numerical applications to the treatment of v = 0, v = 1, and v = 2 states in the Ni isotopes are performed. The accuracy of various approximations is tested by comparison with exact results. For the seniority-one and seniority-two problems it turns out that the results obtained from the first-order theory are very accurate, while those of higher order calculations are practically exact. Concerning the seniority-zero problem, a fifth-order calculation reproduces quite well the three lowest states

Ultrafast deactivation processes in the 2-aminopyridine dimer and the adenine-thymine base pair: Similarities and differences

International Nuclear Information System (INIS)

Ai Yuejie; Zhang Feng; Cui Ganglong; Fang Weihai; Luo Yi

2010-01-01

2-aminopyridine dimer has frequently been used as a model system for studying photochemistry of DNA base pairs. We examine here the relevance of 2-aminopyridine dimer for a Watson-Crick adenine-thymine base pair by studying UV-light induced photodynamics along two main hydrogen bridges after the excitation to the localized 1 ππ* excited-state. The respective two-dimensional potential-energy surfaces have been determined by time-dependent density functional theory with Coulomb-attenuated hybrid exchange-correlation functional (CAM-B3LYP). Different mechanistic aspects of the deactivation pathway have been analyzed and compared in detail for both systems, while the related reaction rates have also be obtained from Monte Carlo kinetic simulations. The limitations of the 2-aminopyridine dimer as a model system for the adenine-thymine base pair are discussed.

Highly Stable Double-Stranded DNA Containing Sequential Silver(I)-Mediated 7-Deazaadenine/Thymine Watson-Crick Base Pairs.

Science.gov (United States)

Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A

2016-05-17

The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Type I-E CRISPR-Cas Systems Discriminate Target from Non-Target DNA through Base Pairing-Independent PAM Recognition

Science.gov (United States)

Datsenko, Kirill A.; Jackson, Ryan N.; Wiedenheft, Blake; Severinov, Konstantin; Brouns, Stan J. J.

2013-01-01

Discriminating self and non-self is a universal requirement of immune systems. Adaptive immune systems in prokaryotes are centered around repetitive loci called CRISPRs (clustered regularly interspaced short palindromic repeat), into which invader DNA fragments are incorporated. CRISPR transcripts are processed into small RNAs that guide CRISPR-associated (Cas) proteins to invading nucleic acids by complementary base pairing. However, to avoid autoimmunity it is essential that these RNA-guides exclusively target invading DNA and not complementary DNA sequences (i.e., self-sequences) located in the host's own CRISPR locus. Previous work on the Type III-A CRISPR system from Staphylococcus epidermidis has demonstrated that a portion of the CRISPR RNA-guide sequence is involved in self versus non-self discrimination. This self-avoidance mechanism relies on sensing base pairing between the RNA-guide and sequences flanking the target DNA. To determine if the RNA-guide participates in self versus non-self discrimination in the Type I-E system from Escherichia coli we altered base pairing potential between the RNA-guide and the flanks of DNA targets. Here we demonstrate that Type I-E systems discriminate self from non-self through a base pairing-independent mechanism that strictly relies on the recognition of four unchangeable PAM sequences. In addition, this work reveals that the first base pair between the guide RNA and the PAM nucleotide immediately flanking the target sequence can be disrupted without affecting the interference phenotype. Remarkably, this indicates that base pairing at this position is not involved in foreign DNA recognition. Results in this paper reveal that the Type I-E mechanism of avoiding self sequences and preventing autoimmunity is fundamentally different from that employed by Type III-A systems. We propose the exclusive targeting of PAM-flanked sequences to be termed a target versus non-target discrimination mechanism. PMID:24039596

Efficient Implementation of the Pairing on Mobilephones Using BREW

Science.gov (United States)

Yoshitomi, Motoi; Takagi, Tsuyoshi; Kiyomoto, Shinsaku; Tanaka, Toshiaki

Pairing based cryptosystems can accomplish novel security applications such as ID-based cryptosystems, which have not been constructed efficiently without the pairing. The processing speed of the pairing based cryptosystems is relatively slow compared with the other conventional public key cryptosystems. However, several efficient algorithms for computing the pairing have been proposed, namely Duursma-Lee algorithm and its variant ηT pairing. In this paper, we present an efficient implementation of the pairing over some mobilephones. Moreover, we compare the processing speed of the pairing with that of the other standard public key cryptosystems, i. e. RSA cryptosystem and elliptic curve cryptosystem. Indeed the processing speed of our implementation in ARM9 processors on BREW achieves under 100 milliseconds using the supersingular curve over F397. In addition, the pairing is more efficient than the other public key cryptosystems, and the pairing can be achieved enough also on BREW mobilephones. It has become efficient enough to implement security applications, such as short signature, ID-based cryptosystems or broadcast encryption, using the pairing on BREW mobilephones.

Structural Context Effects in the Oxidation of 8-Oxo-7,8-dihydro-2’-deoxyguanosine to Hydantoin Products: Electrostatics, Base Stacking, and Base Pairing

Science.gov (United States)

Fleming, Aaron M.; Muller, James G.; Dlouhy, Adrienne C.; Burrows, Cynthia J.

2012-01-01

8-Oxo-7,8-dihydroguanine (OG) is the most common base damage found in the cell where it resides in many structural contexts including the nucleotide pool, single-stranded DNA at transcription forks and replication bubbles, and in duplex DNA base paired with either A or C. OG is prone to further oxidation to the highly mutagenic hydantoin products, spiroiminodihydantoin (Sp) and 5-guanidinohydantoin (Gh) in a sharply pH-dependent fashion within nucleosides. In the present work, studies were conducted to determine how the structural context affects OG oxidation to the hydantoins. These studies revealed a trend in which the Sp yield was greatest in unencumbered contexts, such as nucleosides, while the Gh yield increased in oligodeoxynucleotide (ODN) contexts or at reduced pH. Oxidation of oligomers containing hydrogen bond modulators (2,6-diaminopurine, N4-ethylcytidine) or alteration of the reaction conditions (pH, temperature, and salt) identify base stacking, electrostatics and base pairing as the drivers of the key intermediate 5-hydroxy-8-oxo-7,8-dihydroguanine (5-HO-OG) partitioning along the two hydantoin pathways, allowing us to propose a mechanism for the observed base pairing effects. Moreover, these structural effects cause an increase in the effective pKa of 5-HO-OG following an increasing trend from 5.7 in nucleosides to 7.7 in a duplex bearing an OG•C base pair, which supports the context-dependent product yields. The high yield of Gh in ODNs underscores the importance of further study on this lesion. The structural context of OG also determined its relative reactivity toward oxidation for which the OG•A base pair is ~2.5-fold more reactive than an OG•C base pair, and with the weak one-electron oxidant ferricyanide, the OG nucleoside reactivity is >6000-fold greater than that of OG•C in a duplex, leading to the conclusion that OG in the nucleoside pool should act as a protective agent for OG in the genome. PMID:22880947

Synthesis of 1,1-Diborylalkenes through a Bronsted Base Catalyzed Reaction between Terminal Alkynes and Bis(pinacolato)diboron

OpenAIRE

Morinaga, Akira; Nagao, Kazunori; Ohmiya, Hirohisa; Sawamura, Masaya

2015-01-01

A method for the synthesis of 1,1-diborylalkenes through a Bronsted base catalyzed reaction between terminal alkynes and bis(pinacolato)diboron has been developed. The procedure allows direct synthesis of functionalized 1,1-diborylalkenes from various terminal alkynes including propiolates, propiolamides, and 2-ethynylazoles.

Hidden in Plain Sight: Subtle Effects of the 8-Oxoguanine Lesion on the Structure, Dynamics, and Thermodynamics of a 15-Base-Pair Oligodeoxynucleotide Duplex†

Science.gov (United States)

Crenshaw, Charisse M.; Wade, Jacqueline E.; Arthanari, Haribabu; Frueh, Dominique; Lane, Benjamin F.; Núñez, Megan E.

2011-01-01

The base lesion 8-oxoguanine is formed readily by oxidation of DNA, potentially leading to G→T transversion mutations. Despite the apparent similarity of 8-oxoguanine-cytosine base pairs to normal guanine-cytosine base pairs, cellular base excision repair systems effectively recognize the lesion base. Here we apply several techniques to examine a single 8-oxoguanine lesion at the center of a nonpalindromic 15-mer duplex oligonucleotide in an effort to determine what, if anything, distinguishes an 8-oxoguanine-cytosine base pair from a normal base pair. The lesion duplex is globally almost indistinguishable from the unmodified parent duplex using CD spectroscopy and UV melting thermodynamics. The DNA mismatch-detecting photocleavage agent Rh(bpy)2chrysi3+ cleaves only weakly and nonspecifically, revealing that the 8oxoG-C pair is locally stable at the level of the individual base pairs. NMR spectra are also consistent with a well-conserved B-form duplex structure. In the 2D NOESY spectra, base-sugar and imino-imino crosspeaks are strikingly similar between parent and lesion duplexes. Changes in chemical shift due to the 8oxoG lesion are localized to its complementary cytosine and to the 2–3 base pairs immediately flanking the lesion on the lesion strand. Residues further removed from the lesion are shown to be unperturbed by its presence. Notably, imino exchange experiments indicate that the 8-oxoguanine-cytosine pair is strong and stable, with an apparent equilibrium constant for opening equal to that of other internal guanine-cytosine base pairs, on the order of 10−6. This collection of experiments shows that the 8-oxoguanine-cytosine base pair is incredibly stable and similar to the native pair. PMID:21902242

Base pairing and structural insights into the 5-formylcytosine in RNA duplex

Science.gov (United States)

Wang, Rui; Luo, Zhipu; He, Kaizhang; Delaney, Michael O.; Chen, Doris; Sheng, Jia

2016-01-01

Abstract 5-Formylcytidine (f5C), a previously discovered natural nucleotide in the mitochondrial tRNA of many species including human, has been recently detected as the oxidative product of 5-methylcytidine (m5C) through 5-hydroxymethylcytidine (hm5C) in total RNA of mammalian cells. The discovery indicated that these cytosine derivatives in RNA might also play important epigenetic roles similar as in DNA, which has been intensively investigated in the past few years. In this paper, we studied the base pairing specificity of f5C in different RNA duplex contexts. We found that the 5-formyl group could increase duplex thermal stability and enhance base pairing specificity. We present three high-resolution crystal structures of an octamer RNA duplex [5′-GUA(f5C)GUAC-3′]2 that have been solved under three crystallization conditions with different buffers and pH values. Our results showed that the 5-formyl group is located in the same plane as the cytosine base and forms an intra-residue hydrogen bond with the amino group in the N4 position. In addition, this modification increases the base stacking between the f5C and the neighboring bases while not causing significant global and local structure perturbations. This work provides insights into the effects of 5-formylcytosine on RNA duplex. PMID:27079978

Metalophillic attraction in the consecutive T-HgII-T DNA base pairs

Czech Academy of Sciences Publication Activity Database

Benda, Ladislav; Straka, Michal; Bouř, Petr; Tanaka, Y.; Sychrovský, Vladimír

2012-01-01

Roč. 12, č. 1 (2012), s. 50-50 ISSN 1210-8529. [10th Discussions in Structural Molecular Biology. 22.03.2012-24.03.2012, Nové Hrady] Institutional research plan: CEZ:AV0Z40550506 Keywords : T-HgII-T * DNA base pairs Subject RIV: CF - Physical ; Theoretical Chemistry

Mobile Termination and Mobile Penetration

OpenAIRE

Hurkens, Sjaak; Jeon, Doh-Shin

2009-01-01

In this paper, we study how access pricing affects network competition when subscription demand is elastic and each network uses non-linear prices and can apply termination-based price discrimination. In the case of a fixed per minute termination charge, we find that a reduction of the termination charge below cost has two oppos- ing effects: it softens competition but helps to internalize network externalities. The former reduces mobile penetration while the latter boosts it. We find that fi...

Mobile termination and mobile penetration

OpenAIRE

Hurkens, Sjaak

2009-01-01

In this paper, we study how access pricing affects network competition when subscription demand is elastic and each network uses non-linear prices and can apply termination-based price discrimination. In the case of a fixed per minute termination charge, we find that a reduction of the termination charge below cost has two opposing effects: it softens competition but helps to internalize network externalities. The former reduces mobile penetration while the latter boosts it. We find that firm...

Graphic terminal based on storage tube display with microcomputer

International Nuclear Information System (INIS)

Leich, H.; Levchanovsky, F.; Nikulnikov, A.; Polyntsev, A.; Prikhodko, V.

1981-01-01

This paper describes a graphic terminal where a microcomputer realizes functions like the generation of picture elements (points, symbols, vectors), display control, processing of data received from keyboard and trackball, communication with a host computer and others. The terminal has been designed for operating in a local network as well as in autonomous control systems for data acquisition and processing in physical experiments [ru

Free energy landscape and transition pathways from Watson–Crick to Hoogsteen base pairing in free duplex DNA

Science.gov (United States)

Yang, Changwon; Kim, Eunae; Pak, Youngshang

2015-01-01

Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson–Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine–thymine (A–T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. PMID:26250116

Multi-pair states in electron–positron pair creation

Directory of Open Access Journals (Sweden)

Anton Wöllert

2016-09-01

Full Text Available Ultra strong electromagnetic fields can lead to spontaneous creation of single or multiple electron–positron pairs. A quantum field theoretical treatment of the pair creation process combined with numerical methods provides a description of the fermionic quantum field state, from which all observables of the multiple electron–positron pairs can be inferred. This allows to study the complex multi-particle dynamics of electron–positron pair creation in-depth, including multi-pair statistics as well as momentum distributions and spin. To illustrate the potential benefit of this approach, it is applied to the intermediate regime of pair creation between nonperturbative Schwinger pair creation and perturbative multiphoton pair creation where the creation of multi-pair states becomes nonnegligible but cascades do not yet set in. Furthermore, it is demonstrated how spin and helicity of the created electrons and positrons are affected by the polarization of the counterpropagating laser fields, which induce the creation of electron–positron pairs.

Multi-pair states in electron–positron pair creation

Energy Technology Data Exchange (ETDEWEB)

Wöllert, Anton, E-mail: woellert@mpi-hd.mpg.de; Bauke, Heiko, E-mail: heiko.bauke@mpi-hd.mpg.de; Keitel, Christoph H.

2016-09-10

Ultra strong electromagnetic fields can lead to spontaneous creation of single or multiple electron–positron pairs. A quantum field theoretical treatment of the pair creation process combined with numerical methods provides a description of the fermionic quantum field state, from which all observables of the multiple electron–positron pairs can be inferred. This allows to study the complex multi-particle dynamics of electron–positron pair creation in-depth, including multi-pair statistics as well as momentum distributions and spin. To illustrate the potential benefit of this approach, it is applied to the intermediate regime of pair creation between nonperturbative Schwinger pair creation and perturbative multiphoton pair creation where the creation of multi-pair states becomes nonnegligible but cascades do not yet set in. Furthermore, it is demonstrated how spin and helicity of the created electrons and positrons are affected by the polarization of the counterpropagating laser fields, which induce the creation of electron–positron pairs.

Multi-pair states in electron–positron pair creation

International Nuclear Information System (INIS)

Wöllert, Anton; Bauke, Heiko; Keitel, Christoph H.

2016-01-01

Ultra strong electromagnetic fields can lead to spontaneous creation of single or multiple electron–positron pairs. A quantum field theoretical treatment of the pair creation process combined with numerical methods provides a description of the fermionic quantum field state, from which all observables of the multiple electron–positron pairs can be inferred. This allows to study the complex multi-particle dynamics of electron–positron pair creation in-depth, including multi-pair statistics as well as momentum distributions and spin. To illustrate the potential benefit of this approach, it is applied to the intermediate regime of pair creation between nonperturbative Schwinger pair creation and perturbative multiphoton pair creation where the creation of multi-pair states becomes nonnegligible but cascades do not yet set in. Furthermore, it is demonstrated how spin and helicity of the created electrons and positrons are affected by the polarization of the counterpropagating laser fields, which induce the creation of electron–positron pairs.

Silver-mediated base pairings: towards dynamic DNA nanostructures with enhanced chemical and thermal stability

International Nuclear Information System (INIS)

Swasey, Steven M; Gwinn, Elisabeth G

2016-01-01

The thermal and chemical fragility of DNA nanomaterials assembled by Watson–Crick (WC) pairing constrain the settings in which these materials can be used and how they can be functionalized. Here we investigate use of the silver cation, Ag + , as an agent for more robust, metal-mediated self-assembly, focusing on the simplest duplex building blocks that would be required for more elaborate Ag + –DNA nanostructures. Our studies of Ag + -induced assembly of non-complementary DNA oligomers employ strands of 2–24 bases, with varied base compositions, and use electrospray ionization mass spectrometry to determine product compositions. High yields of duplex products containing narrowly distributed numbers of Ag + can be achieved by optimizing solution conditions. These Ag + -mediated duplexes are stable to at least 60 mM Mg 2+ , higher than is necessary for WC nanotechnology schemes such as tile assemblies and DNA origami, indicating that sequential stages of Ag + -mediated and WC-mediated assembly may be feasible. Circular dichroism spectroscopy suggests simple helical structures for Ag + -mediated duplexes with lengths to at least 20 base pairs, and further indicates that the structure of cytosine-rich duplexes is preserved at high urea concentrations. We therefore propose an approach towards dynamic DNA nanomaterials with enhanced thermal and chemical stability through designs that combine sturdy silver-mediated ‘frames’ with WC paired ‘pictures’. (paper)

Cardiac re-entry dynamics and self-termination in DT-MRI based model of Human Foetal Heart

Science.gov (United States)

Biktasheva, Irina V.; Anderson, Richard A.; Holden, Arun V.; Pervolaraki, Eleftheria; Wen, Fen Cai

2018-02-01

The effect of human foetal heart geometry and anisotropy on anatomy induced drift and self-termination of cardiac re-entry is studied here in MRI based 2D slice and 3D whole heart computer simulations. Isotropic and anisotropic models of 20 weeks of gestational age human foetal heart obtained from 100μm voxel diffusion tensor MRI data sets were used in the computer simulations. The fiber orientation angles of the heart were obtained from the orientation of the DT-MRI primary eigenvectors. In a spatially homogeneous electrophysiological monodomain model with the DT-MRI based heart geometries, cardiac re-entry was initiated at a prescribed location in a 2D slice, and in the 3D whole heart anatomy models. Excitation was described by simplified FitzHugh-Nagumo kinetics. In a slice of the heart, with propagation velocity twice as fast along the fibres than across the fibers, DT-MRI based fiber anisotropy changes the re-entry dynamics from pinned to an anatomical re-entry. In the 3D whole heart models, the fiber anisotropy changes cardiac re-entry dynamics from a persistent re-entry to the re-entry self-termination. The self-termination time depends on the re-entry’s initial position. In all the simulations with the DT-MRI based cardiac geometry, the anisotropy of the myocardial tissue shortens the time to re-entry self-termination several folds. The numerical simulations depend on the validity of the DT-MRI data set used. The ventricular wall showed the characteristic transmural rotation of the helix angle of the developed mammalian heart, while the fiber orientation in the atria was irregular.

Array based Discovery of Aptamer Pairs (Open Access Publisher’s Version)

Science.gov (United States)

2014-12-11

Array-based Discovery of Aptamer Pairs Minseon Cho,†,‡ Seung Soo Oh,‡ Jeff Nie,§ Ron Stewart,§ Monte J. Radeke,⊥ Michael Eisenstein ,†,‡ Peter J...ac504076k | Anal. Chem. 2015, 87, 821−828827 (24) Cho, M.; Oh, S. S.; Nie, J.; Stewart, R.; Eisenstein , M.; Chambers, J.; Marth, J. D.; Walker, F

4D Flexible Atom-Pairs: An efficient probabilistic conformational space comparison for ligand-based virtual screening

Science.gov (United States)

2011-01-01

Background The performance of 3D-based virtual screening similarity functions is affected by the applied conformations of compounds. Therefore, the results of 3D approaches are often less robust than 2D approaches. The application of 3D methods on multiple conformer data sets normally reduces this weakness, but entails a significant computational overhead. Therefore, we developed a special conformational space encoding by means of Gaussian mixture models and a similarity function that operates on these models. The application of a model-based encoding allows an efficient comparison of the conformational space of compounds. Results Comparisons of our 4D flexible atom-pair approach with over 15 state-of-the-art 2D- and 3D-based virtual screening similarity functions on the 40 data sets of the Directory of Useful Decoys show a robust performance of our approach. Even 3D-based approaches that operate on multiple conformers yield inferior results. The 4D flexible atom-pair method achieves an averaged AUC value of 0.78 on the filtered Directory of Useful Decoys data sets. The best 2D- and 3D-based approaches of this study yield an AUC value of 0.74 and 0.72, respectively. As a result, the 4D flexible atom-pair approach achieves an average rank of 1.25 with respect to 15 other state-of-the-art similarity functions and four different evaluation metrics. Conclusions Our 4D method yields a robust performance on 40 pharmaceutically relevant targets. The conformational space encoding enables an efficient comparison of the conformational space. Therefore, the weakness of the 3D-based approaches on single conformations is circumvented. With over 100,000 similarity calculations on a single desktop CPU, the utilization of the 4D flexible atom-pair in real-world applications is feasible. PMID:21733172

Flexibility of short DNA helices with finite-length effect: From base pairs to tens of base pairs

International Nuclear Information System (INIS)

Wu, Yuan-Yan; Bao, Lei; Zhang, Xi; Tan, Zhi-Jie

2015-01-01

Flexibility of short DNA helices is important for the biological functions such as nucleosome formation and DNA-protein recognition. Recent experiments suggest that short DNAs of tens of base pairs (bps) may have apparently higher flexibility than those of kilo bps, while there is still the debate on such high flexibility. In the present work, we have studied the flexibility of short DNAs with finite-length of 5–50 bps by the all-atomistic molecular dynamics simulations and Monte Carlo simulations with the worm-like chain model. Our microscopic analyses reveal that short DNAs have apparently high flexibility which is attributed to the significantly strong bending and stretching flexibilities of ∼6 bps at each helix end. Correspondingly, the apparent persistence length l p of short DNAs increases gradually from ∼29 nm to ∼45 nm as DNA length increases from 10 to 50 bps, in accordance with the available experimental data. Our further analyses show that the short DNAs with excluding ∼6 bps at each helix end have the similar flexibility with those of kilo bps and can be described by the worm-like chain model with l p ∼ 50 nm

Link-based quantitative methods to identify differentially coexpressed genes and gene Pairs

Directory of Open Access Journals (Sweden)

Ye Zhi-Qiang

2011-08-01

Full Text Available Abstract Background Differential coexpression analysis (DCEA is increasingly used for investigating the global transcriptional mechanisms underlying phenotypic changes. Current DCEA methods mostly adopt a gene connectivity-based strategy to estimate differential coexpression, which is characterized by comparing the numbers of gene neighbors in different coexpression networks. Although it simplifies the calculation, this strategy mixes up the identities of different coexpression neighbors of a gene, and fails to differentiate significant differential coexpression changes from those trivial ones. Especially, the correlation-reversal is easily missed although it probably indicates remarkable biological significance. Results We developed two link-based quantitative methods, DCp and DCe, to identify differentially coexpressed genes and gene pairs (links. Bearing the uniqueness of exploiting the quantitative coexpression change of each gene pair in the coexpression networks, both methods proved to be superior to currently popular methods in simulation studies. Re-mining of a publicly available type 2 diabetes (T2D expression dataset from the perspective of differential coexpression analysis led to additional discoveries than those from differential expression analysis. Conclusions This work pointed out the critical weakness of current popular DCEA methods, and proposed two link-based DCEA algorithms that will make contribution to the development of DCEA and help extend it to a broader spectrum.

Investigation on the ion pair amphiphiles and their in vitro release of amantadine drug based on PLGA–PEG–PLGA gel

International Nuclear Information System (INIS)

Yang, Xiaoxia; Ji, Xiaoqing; Shi, Chunhuan; Liu, Jing; Wang, Haiyang; Luan, Yuxia

2014-01-01

The amantadine drug and oleic acid surfactant are used to form amantadine-based ion pair amphiphiles based on proton transfer reaction between the drug and the surfactant molecules. The ion pair amphiphiles are characterized by 1 H-nuclear magnetic resonance, Fourier transform infrared spectroscopy, and X-ray diffraction. Self-assembly properties of amantadine-based ion pair amphiphiles are studied by surface tension determination, transmission electron microscopy, zeta potential, and dynamic light scattering. The aggregation behavior studies indicate that the as-prepared ion pair amphiphiles can self-assemble into vesicles with the size of 200–300 nm in aqueous solution. The drug release results show that the amantadine release rate could be well controlled by incorporating the amantadine-based ion pair vesicles in poly (lactic-co-glycolic acid)-poly (ethylene glycol)-poly (lactic-co-glycolic acid) (PLGA–PEG–PLGA) copolymer hydrogel. The drug release from the AT–OA vesicle-loaded PLGA–PEG–PLGA hydrogel is significantly inhibited in comparison with the AT-loaded PLGA–PEG–PLGA hydrogel. The present work thus demonstrates that the vesicle-loaded hydrogel is a good candidate for the drug delivery system with long-term controlled drug release behavior

Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA.

Science.gov (United States)

Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J

2017-07-06

The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.

Crystal structure of metallo DNA duplex containing consecutive Watson-Crick-like T-Hg(II)-T base pairs.

Science.gov (United States)

Kondo, Jiro; Yamada, Tom; Hirose, Chika; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

2014-02-24

The metallo DNA duplex containing mercury-mediated T-T base pairs is an attractive biomacromolecular nanomaterial which can be applied to nanodevices such as ion sensors. Reported herein is the first crystal structure of a B-form DNA duplex containing two consecutive T-Hg(II)-T base pairs. The Hg(II) ion occupies the center between two T residues. The N3-Hg(II) bond distance is 2.0 Å. The relatively short Hg(II)-Hg(II) distance (3.3 Å) observed in consecutive T-Hg(II)-T base pairs suggests that the metallophilic attraction could exist between them and may stabilize the B-form double helix. To support this, the DNA duplex is largely distorted and adopts an unusual nonhelical conformation in the absence of Hg(II). The structure of the metallo DNA duplex itself and the Hg(II)-induced structural switching from the nonhelical form to the B-form provide the basis for structure-based design of metal-conjugated nucleic acid nanomaterials. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

JCO criticality accident termination operation

OpenAIRE

金盛 正至

2010-01-01

In 2001, we summarized the circumstances surrounding termination of the JCO criticality accident based on testimony in the Mito District Court on December 17, 2001. JCO was the company for uranium fuels production in Japan. That document was assembled based on actual testimony in the belief that a description of the work involved in termination of the accident would be useful in some way for preventing nuclear disasters in the future. This year is the tenth year of the JCO criticality acciden...

Controlling chaos based on a novel intelligent integral terminal sliding mode control in a rod-type plasma torch

International Nuclear Information System (INIS)

Khari, Safa; Rahmani, Zahra; Rezaie, Behrooz

2016-01-01

An integral terminal sliding mode controller is proposed in order to control chaos in a rod-type plasma torch system. In this method, a new sliding surface is defined based on a combination of the conventional sliding surface in terminal sliding mode control and a nonlinear function of the integral of the system states. It is assumed that the dynamics of a chaotic system are unknown and also the system is exposed to disturbance and unstructured uncertainty. To achieve a chattering-free and high-speed response for such an unknown system, an adaptive neuro-fuzzy inference system is utilized in the next step to approximate the unknown part of the nonlinear dynamics. Then, the proposed integral terminal sliding mode controller stabilizes the approximated system based on Lyapunov’s stability theory. In addition, a Bee algorithm is used to select the coefficients of integral terminal sliding mode controller to improve the performance of the proposed method. Simulation results demonstrate the improvement in the response speed, chattering rejection, transient response, and robustness against uncertainties. (paper)

Directed evolution of the TALE N-terminal domain for recognition of all 5' bases.

Science.gov (United States)

Lamb, Brian M; Mercer, Andrew C; Barbas, Carlos F

2013-11-01

Transcription activator-like effector (TALE) proteins can be designed to bind virtually any DNA sequence. General guidelines for design of TALE DNA-binding domains suggest that the 5'-most base of the DNA sequence bound by the TALE (the N0 base) should be a thymine. We quantified the N0 requirement by analysis of the activities of TALE transcription factors (TALE-TF), TALE recombinases (TALE-R) and TALE nucleases (TALENs) with each DNA base at this position. In the absence of a 5' T, we observed decreases in TALE activity up to >1000-fold in TALE-TF activity, up to 100-fold in TALE-R activity and up to 10-fold reduction in TALEN activity compared with target sequences containing a 5' T. To develop TALE architectures that recognize all possible N0 bases, we used structure-guided library design coupled with TALE-R activity selections to evolve novel TALE N-terminal domains to accommodate any N0 base. A G-selective domain and broadly reactive domains were isolated and characterized. The engineered TALE domains selected in the TALE-R format demonstrated modularity and were active in TALE-TF and TALEN architectures. Evolved N-terminal domains provide effective and unconstrained TALE-based targeting of any DNA sequence as TALE binding proteins and designer enzymes.

Solid state radiation chemistry of co-crystallized DNA base pairs studied with EPR and ENDOR

International Nuclear Information System (INIS)

Nelson, W.H.; Nimmala, S.; Hole, E.O.; Sagstuen, E.; Close, D.M.

1995-01-01

For a number of years, the authors' group has focused on identification of radicals formed from x-irradiation of DNA components by application of EPR and ENDOR spectroscopic techniques to samples in the form of single crystals. With single crystals as samples, it is possible to use the detailed packing and structural information available from x-ray or neutron diffraction reports. This report summarizes results from two crystal systems in which DNA bases are paired by hydrogen bonding. Extensive results are available from one of these, 1-methyl-thymine:9-methyladenine (MTMA), in which the base pairing is the Hoogsteen configuration. Although this configuration is different from that found by Watson-Crick in DNA, nonetheless the hydrogen bond between T(O4) and A(NH 2 ) is present. Although MTMA crystals have been studied previously, the objective was to apply the high-resolution technique of ENDOR to crystals irradiated and studied at temperatures of 10 K or lower in the effort to obtain direct evidence for specific proton transfers. The second system, from which the results are only preliminary, is 9-ethylguanine:1-methyl-5-fluorocytosine (GFC) in which the G:C bases pair is in the Watson Crick configuration. Both crystal systems are anhydrous, so the results include no possible effects from water interactions

Integrated phononic crystal resonators based on adiabatically-terminated phononic crystal waveguides

Directory of Open Access Journals (Sweden)

Razi Dehghannasiri

2016-12-01

Full Text Available In this letter, we demonstrate a new design for integrated phononic crystal (PnC resonators based on confining acoustic waves in a heterogeneous waveguide-based PnC structure. In this architecture, a PnC waveguide that supports a single mode at the desired resonance frequencies is terminated by two waveguide sections with no propagating mode at those frequencies (i.e., have mode gap. The proposed PnC resonators are designed through combining the spatial-domain and the spatial-frequency domain (i.e., the k-domain analysis to achieve a smooth mode envelope. This design approach can benefit both membrane-based and surface-acoustic-wave-based architectures by confining the mode spreading in k-domain that leads to improved electromechanical excitation/detection coupling and reduced loss through propagating bulk modes.

Experimental study on the 4H-SiC-based VDMOSFETs with lightly doped P-well field-limiting rings termination

Science.gov (United States)

He, Yan Jing; Lv, Hong Liang; Tang, Xiao Yan; Song, Qing Wen; Zhang, Yi Meng; Han, Chao; Zhang, Yi Men; Zhang, Yu Ming

2017-03-01

A lightly doped P-well field-limiting rings (FLRs) termination on 4H-SiC vertical double-implanted metal-oxide-semiconductor field-effect transistors (VDMOSFETs) has been investigated. Based on the simulation, the proposed termination applied to 4H-SiC VDMOSFET could achieve an almost same breakdown voltage (BV) and have the advantage of lower ion-implantation damage comparing with P+ FLRs termination. Meanwhile, this kind of termination also reduces the difficulty and consumption of fabrication process. 4H-SiC VDMOSFETs with lightly doped P-well (FLRs) termination have been fabricated on 10 μm thick epi-layer with nitrogen doping concentration of 6.2 × 1015 cm-3. The maximum breakdown voltage of the 4H-SiC VDMOSFETs has achieved as high as 1610 V at a current of 15 μA, which is very close to the simulated result of 1643 V and about 90% of the plane parallel breakdown voltage of 1780 V. It is considered that P-well FLRs termination is an effective, robust and process-tolerant termination structure suitable for 4H-SiC VDMOSFET.

Free energy landscape and transition pathways from Watson-Crick to Hoogsteen base pairing in free duplex DNA.

Science.gov (United States)

Yang, Changwon; Kim, Eunae; Pak, Youngshang

2015-09-18

Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Wavelet Based Protection Scheme for Multi Terminal Transmission System with PV and Wind Generation

Science.gov (United States)

Manju Sree, Y.; Goli, Ravi kumar; Ramaiah, V.

2017-08-01

A hybrid generation is a part of large power system in which number of sources usually attached to a power electronic converter and loads are clustered can operate independent of the main power system. The protection scheme is crucial against faults based on traditional over current protection since there are adequate problems due to fault currents in the mode of operation. This paper adopts a new approach for detection, discrimination of the faults for multi terminal transmission line protection in presence of hybrid generation. Transient current based protection scheme is developed with discrete wavelet transform. Fault indices of all phase currents at all terminals are obtained by analyzing the detail coefficients of current signals using bior 1.5 mother wavelet. This scheme is tested for different types of faults and is found effective for detection and discrimination of fault with various fault inception angle and fault impedance.

A Simulation Based Approach to Optimize Berth Throughput Under Uncertainty at Marine Container Terminals

Science.gov (United States)

Golias, Mihalis M.

2011-01-01

Berth scheduling is a critical function at marine container terminals and determining the best berth schedule depends on several factors including the type and function of the port, size of the port, location, nearby competition, and type of contractual agreement between the terminal and the carriers. In this paper we formulate the berth scheduling problem as a bi-objective mixed-integer problem with the objective to maximize customer satisfaction and reliability of the berth schedule under the assumption that vessel handling times are stochastic parameters following a discrete and known probability distribution. A combination of an exact algorithm, a Genetic Algorithms based heuristic and a simulation post-Pareto analysis is proposed as the solution approach to the resulting problem. Based on a number of experiments it is concluded that the proposed berth scheduling policy outperforms the berth scheduling policy where reliability is not considered.

Determination of the pairing-strength constants in the isovector plus isoscalar pairing case

Science.gov (United States)

Mokhtari, D.; Fellah, M.; Allal, N. H.

2016-05-01

A method for the determination of the pairing-strength constants, in the neutron-proton (n-p) isovector plus isoscalar pairing case, is proposed in the framework of the BCS theory. It is based on the fitting of these constants to reproduce the experimentally known pairing gap parameters as well as the root-mean-squared (r.m.s) charge radii values. The method is applied to some proton-rich even-even nuclei. The single-particle energies used are those of a deformed Woods-Saxon mean field. It is shown that the obtained value of the ratio GnpT=0/G npT=1 is of the same order as the ones, arbitrary chosen, of some previous works. The effect of the inclusion of the isoscalar n-p pairing in the r.m.s matter radii is then numerically studied for the same nuclei.

Two-terminal video coding.

Science.gov (United States)

Yang, Yang; Stanković, Vladimir; Xiong, Zixiang; Zhao, Wei

2009-03-01

Following recent works on the rate region of the quadratic Gaussian two-terminal source coding problem and limit-approaching code designs, this paper examines multiterminal source coding of two correlated, i.e., stereo, video sequences to save the sum rate over independent coding of both sequences. Two multiterminal video coding schemes are proposed. In the first scheme, the left sequence of the stereo pair is coded by H.264/AVC and used at the joint decoder to facilitate Wyner-Ziv coding of the right video sequence. The first I-frame of the right sequence is successively coded by H.264/AVC Intracoding and Wyner-Ziv coding. An efficient stereo matching algorithm based on loopy belief propagation is then adopted at the decoder to produce pixel-level disparity maps between the corresponding frames of the two decoded video sequences on the fly. Based on the disparity maps, side information for both motion vectors and motion-compensated residual frames of the right sequence are generated at the decoder before Wyner-Ziv encoding. In the second scheme, source splitting is employed on top of classic and Wyner-Ziv coding for compression of both I-frames to allow flexible rate allocation between the two sequences. Experiments with both schemes on stereo video sequences using H.264/AVC, LDPC codes for Slepian-Wolf coding of the motion vectors, and scalar quantization in conjunction with LDPC codes for Wyner-Ziv coding of the residual coefficients give a slightly lower sum rate than separate H.264/AVC coding of both sequences at the same video quality.

What is a "good enough" termination?

Science.gov (United States)

Gabbard, Glen O

2009-06-01

In Freud's technique papers, he failed to develop a systematic approach to termination. Much of the existing literature is based on psychoanalytic mythologies about the way patients are expected to end analysis. The models described in the literature are often starkly at odds with what one sees in clinical practice. A wish for idealized versions of termination underlies much of what has been written, and we need to shift to a conceptual model involving "good enough" termination. A number of different endings to psychoanalysis may, in the long run, lead to productive outcomes; these models are examined, as are various approaches to the dilemmas presented at the time of termination.

Investigations on therapeutic glucocerebrosidases through paired detection with fluorescent activity-based probes.

Directory of Open Access Journals (Sweden)

Wouter W Kallemeijn

Full Text Available Deficiency of glucocerebrosidase (GBA causes Gaucher disease (GD. In the common non-neuronopathic GD type I variant, glucosylceramide accumulates primarily in the lysosomes of visceral macrophages. Supplementing storage cells with lacking enzyme is accomplished via chronic intravenous administration of recombinant GBA containing mannose-terminated N-linked glycans, mediating the selective uptake by macrophages expressing mannose-binding lectin(s. Two recombinant GBA preparations with distinct N-linked glycans are registered in Europe for treatment of type I GD: imiglucerase (Genzyme, contains predominantly Man(3 glycans, and velaglucerase (Shire PLC Man(9 glycans. Activity-based probes (ABPs enable fluorescent labeling of recombinant GBA preparations through their covalent attachment to the catalytic nucleophile E340 of GBA. We comparatively studied binding and uptake of ABP-labeled imiglucerase and velaglucerase in isolated dendritic cells, cultured human macrophages and living mice, through simultaneous detection of different GBAs by paired measurements. Uptake of ABP-labeled rGBAs by dendritic cells was comparable, as well as the bio-distribution following equimolar intravenous administration to mice. ABP-labeled rGBAs were recovered largely in liver, white-blood cells, bone marrow and spleen. Lungs, brain and skin, affected tissues in severe GD types II and III, were only poorly supplemented. Small, but significant differences were noted in binding and uptake of rGBAs in cultured human macrophages, in the absence and presence of mannan. Mannan-competed binding and uptake were largest for velaglucerase, when determined with single enzymes or as equimolar mixtures of both enzymes. Vice versa, imiglucerase showed more prominent binding and uptake not competed by mannan. Uptake of recombinant GBAs by cultured macrophages seems to involve multiple receptors, including several mannose-binding lectins. Differences among cells from different donors

Investigations into nuclear pairing

International Nuclear Information System (INIS)

Clark, R.M.

2006-01-01

This paper is divided in two main sections focusing on different aspects of collective nuclear behavior. In the first section, solutions are considered for the collective pairing Hamiltonian. In particular, an approximate solution at the critical point of the pairing transition from harmonic vibration (normal nuclear behavior) to deformed rotation (superconducting behavior) in gauge space is found by analytic solution of the Hamiltonian. The eigenvalues are expressed in terms of the zeros of Bessel functions of integer order. The results are compared to the pairing bands based on the Pb isotopes. The second section focuses on the experimental search for the Giant Pairing Vibration (GPV) in nuclei. After briefly describing the origin of the GPV, and the reasons that the state has remained unidentified, a novel idea for populating this state is presented. A recent experiment has been performed using the LIBERACE+STARS detector system at the 88-Inch Cyclotron of LBNL to test the idea. (Author)

Matched molecular pair-based data sets for computer-aided medicinal chemistry

Science.gov (United States)

Bajorath, Jürgen

2014-01-01

Matched molecular pairs (MMPs) are widely used in medicinal chemistry to study changes in compound properties including biological activity, which are associated with well-defined structural modifications. Herein we describe up-to-date versions of three MMP-based data sets that have originated from in-house research projects. These data sets include activity cliffs, structure-activity relationship (SAR) transfer series, and second generation MMPs based upon retrosynthetic rules. The data sets have in common that they have been derived from compounds included in the ChEMBL database (release 17) for which high-confidence activity data are available. Thus, the activity data associated with MMP-based activity cliffs, SAR transfer series, and retrosynthetic MMPs cover the entire spectrum of current pharmaceutical targets. Our data sets are made freely available to the scientific community. PMID:24627802

Effect of an intervention based on basic Buddhist principles on the spiritual well-being of patients with terminal cancer.

Science.gov (United States)

Chimluang, Janya; Thanasilp, Sureeporn; Akkayagorn, Lanchasak; Upasen, Ratchaneekorn; Pudtong, Noppamat; Tantitrakul, Wilailuck

2017-12-01

To evaluate the effect of an intervention based on basic Buddhist principles on the spiritual well-being of patients with terminal cancer. This quasi-experimental research study had pre- and post-test control groups. The experimental group received conventional care and an intervention based on basic Buddhist principles for three consecutive days, including seven activities based on precept activities, concentration activities and wisdom activities. The control group received conventional care alone. Forty-eight patients participated in this study: 23 in the experimental group and 25 in the control group. Their mean age was 53 (standard deviation 10) years. The spiritual well-being of participants in the experimental group was significantly higher than that of participants in the control group at the second post-test (P principles improved the spiritual well-being of patients with terminal cancer. This result supports the beneficial effects of implementing this type of intervention for patients with terminal cancer. Copyright © 2017 Elsevier Ltd. All rights reserved.

Detection of protonated non-Watson-Crick base pairs using electrospray ionization mass spectrometry.

Science.gov (United States)

Ishida, Riyoko; Iwahashi, Hideo

2018-03-01

Many studies have shown that protonated nucleic acid base pairs are involved in a wide variety of nucleic acid structures. However, little information is available on relative stability of hemiprotonated self- and non-self-dimers at monomer level. We used electrospray ionization mass spectrometry (ESI-MS) to evaluate the relative stability under various concentrations of hydrogen ion. These enable conjecture of the formation of protonated non-Watson-Crick base pairs based on DNA and RNA base sequence. In the present study, we observed that ESI-MS peaks corresponded to respective self-dimers for all examined nucleosides except for adenosine. Peak heights depended on the concentration of hydrogen ion. The ESI-MS peak heights of the hemiprotonated cytidine dimers and the hemiprotonated thymidine dimer sharply increased with increased concentration of hydrogen ion, suggesting direct participation of hydrogen ion in dimer formations. In ESI-MS measurements of the solutions containing adenosine, cytidine, thymidine and guanosine, we observed protonated cytidine-guanosine dimer (CH+-G) and protonated cytidine-thymidine dimer (CH+-T) in addition to hemiprotonated cytidine-cytidine dimer (CH+-C) with following relative peak height, (CH+-C) > (CH+-G) ≈ (CH+-T) > (CH+-A). Additionally, in the ESI-MS measurements of solutions containing adenosine, thymidine and guanosine, we observed a considerable amount of protonated adenosine-guanosine (AH+-G) and protonated adenosine-thymidine (AH+-T).

2-Methoxypyridine as a Thymidine Mimic in Watson-Crick Base Pairs of DNA and PNA: Synthesis, Thermal Stability, and NMR Structural Studies.

Science.gov (United States)

Novosjolova, Irina; Kennedy, Scott D; Rozners, Eriks

2017-11-02

The development of nucleic acid base-pair analogues that use new modes of molecular recognition is important both for fundamental research and practical applications. The goal of this study was to evaluate 2-methoxypyridine as a cationic thymidine mimic in the A-T base pair. The hypothesis was that including protonation in the Watson-Crick base pairing scheme would enhance the thermal stability of the DNA double helix without compromising the sequence selectivity. DNA and peptide nucleic acid (PNA) sequences containing the new 2-methoxypyridine nucleobase (P) were synthesized and studied by using UV thermal melting and NMR spectroscopy. Introduction of P nucleobase caused a loss of thermal stability of ≈10 °C in DNA-DNA duplexes and ≈20 °C in PNA-DNA duplexes over a range of mildly acidic to neutral pH. Despite the decrease in thermal stability, the NMR structural studies showed that P-A formed the expected protonated base pair at pH 4.3. Our study demonstrates the feasibility of cationic unnatural base pairs; however, future optimization of such analogues will be required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

Science.gov (United States)

Sinurat, E. N.; Yudiarsah, E.

2017-07-01

The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

Contact ion pair formation between hard acids and soft bases in aqueous solutions observed with 2DIR spectroscopy.

Science.gov (United States)

Sun, Zheng; Zhang, Wenkai; Ji, Minbiao; Hartsock, Robert; Gaffney, Kelly J

2013-12-12

The interaction of charged species in aqueous solution has important implications for chemical, biological, and environmental processes. We have used 2DIR spectroscopy to study the equilibrium dynamics of thiocyanate chemical exchange between free ion (NCS(-)) and contact ion pair configurations (MNCS(+)), where M(2+) = Mg(2+) or Ca(2+). Detailed studies of the influence of anion concentration and anion speciation show that the chemical exchange observed with the 2DIR measurements results from NCS(-) exchanging with other anion species in the first solvation shell surrounding Mg(2+) or Ca(2+). The presence of chemical exchange in the 2DIR spectra provides an indirect, but robust, determinant of contact ion pair formation. We observe preferential contact ion pair formation between soft Lewis base anions and hard Lewis acid cations. This observation cannot be easily reconciled with Pearson's acid-base concept or Collins' Law of Matching Water Affinities. The anions that form contact ion pairs also correspond to the ions with an affinity for water and protein surfaces, so similar physical and chemical properties may control these distinct phenomena.

Recent advances in mechanism-based chemotherapy drug-siRNA pairs in co-delivery systems for cancer: A review.

Science.gov (United States)

Wang, Mingfang; Wang, Jinyu; Li, Bingcheng; Meng, Lingxin; Tian, Zhaoxing

2017-09-01

Co-delivery of chemotherapy drugs and siRNA for cancer therapy has achieved remarkable results according to synergistic/combined antitumor effects, and is recognized as a promising therapeutic modality. However, little attention has been paid to the extremely complex mechanisms of chemotherapy drug-siRNA pairs during co-delivery process. Proper selection of chemotherapy drug-siRNA pairs is beneficial for achieving desirable cancer therapeutic effects. Exploring the inherent principles during chemotherapy drug-siRNA pair selection for co-delivery would greatly enhanced therapeutic efficiency. To achieve ideal results, this article will systematically review current different mechanism-based chemotherapy drug-siRNA pairs for co-delivery in cancer treatment. Large-scale library screening of recent different chemotherapy drug-siRNA pairs for co-delivery would help to establish the chemotherapy drug-siRNA pair selection principle, which could pave the way for co-delivery of chemotherapy drugs and siRNA for cancer treatment in clinic. Following the inherent principle of chemotherapy drug-siRNA pair, more effective co-delivery vectors can be designed in the future. Copyright © 2017 Elsevier B.V. All rights reserved.

Four-terminal circuit element with photonic core

Science.gov (United States)

Sampayan, Stephen

2017-08-29

A four-terminal circuit element is described that includes a photonic core inside of the circuit element that uses a wide bandgap semiconductor material that exhibits photoconductivity and allows current flow through the material in response to the light that is incident on the wide bandgap material. The four-terminal circuit element can be configured based on various hardware structures using a single piece or multiple pieces or layers of a wide bandgap semiconductor material to achieve various designed electrical properties such as high switching voltages by using the photoconductive feature beyond the breakdown voltages of semiconductor devices or circuits operated based on electrical bias or control designs. The photonic core aspect of the four-terminal circuit element provides unique features that enable versatile circuit applications to either replace the semiconductor transistor-based circuit elements or semiconductor diode-based circuit elements.

Prediction of drug terminal half-life and terminal volume of distribution after intravenous dosing based on drug clearance, steady-state volume of distribution, and physiological parameters of the body.

Science.gov (United States)

Berezhkovskiy, Leonid M

2013-02-01

The steady state, V(ss), terminal volume of distribution, V(β), and the terminal half-life, t(1/2), are commonly obtained from the drug plasma concentration-time profile, C(p)(t), following intravenous dosing. Unlike V(ss) that can be calculated based on the physicochemical properties of drugs considering the equilibrium partitioning between plasma and organ tissues, t(1/2) and V(β) cannot be calculated that way because they depend on the rates of drug transfer between blood and tissues. Considering the physiological pharmacokinetic model pertinent to the terminal phase of drug elimination, a novel equation that calculates t(1/2) (and consequently V(β)) was derived. It turns out that V(ss), the total body clearance, Cl, equilibrium blood-plasma concentration ratio, r; and the physiological parameters of the body such as cardiac output, and blood and tissue volumes are sufficient for determination of terminal kinetics. Calculation of t(1/2) by the obtained equation appears to be in good agreement with the experimentally observed vales of this parameter in pharmacokinetic studies in rat, monkey, dog, and human. The equation for the determination of the pre-exponent of the terminal phase of C(p)(t) is also found. The obtained equation allows to predict t(1/2) in human assuming that V(ss) and Cl were either obtained by allometric scaling or, respectively, calculated in silico or based on in vitro drug stability measurements. For compounds that have high clearance, the derived equation may be applied to calculate r just using the routine data on Cl, V(ss), and t(1/2), rather than doing the in vitro assay to measure this parameter. Copyright © 2012 Wiley Periodicals, Inc.

Human terminal deoxyribonucleotidyltransferase: molecular cloning and structural analysis of the gene and 5' flanking region

International Nuclear Information System (INIS)

Riley, L.K.; Morrow, J.K.; Danton, M.J.; Coleman, M.S.

1988-01-01

Human terminal deoxyribonucleotidyltransferase cDNA contains an open reading frame of 1530 base pairs (bp) corresponding to a protein containing 510 amino acids. The encoded protein is a template-independent DNA polymerase found only in a restricted population of normal and malignant prelymphocytes. To begin to investigate the genetic elements responsible for the tissue-specific expression of terminal deoxyribonucleotidyltransferase, genomic clones, containing the entire human gene were isolated and characterized. Initially, cDNA clones were isolated from a library generated from the human lymphoblastoid cell line, MOLT-4R. A cDNA clone containing the entire coding region of the protein was used to isolate a series of overlapping clones from two human genomic libraries. The gene comprises 11 exons and 10 introns and spans 49.4 kilobases. The 5' flanking region (709 bp) including exon 1 was sequenced. Several putative transcription initiation sites were mapped. Within 500 nucleotides of the translation start site, a series of promoter elements was detected. TATA and CAAT sequences, respectively, were found to start at nucleotides -185 and -204, -328 and -370, and -465 and -505. Start sites were found for a cyclic AMP-dependent promoter analog at nucleotide -121, an eight-base sequence corresponding to the IgG promoter enhancer (cd) at nucleotide -455, and an analog of the IgG promoter (pd) at nucleotide -159. These findings suggest that transcripts coding for terminal deoxyribonucleotidyltransferase may be variable in length and that transcription may be influenced by a variety of genetic elements

Vinylimidazole-Based Asymmetric Ion Pair Comonomers: Synthesis, Polymerization Studies and Formation of Ionically Crosslinked PMMA

NARCIS (Netherlands)

Jana, S.; Vasantha, V.A.; Stubbs, L.P.; Parthiban, A.; Vancso, Gyula J.

2013-01-01

Vinylimidazole-based asymmetric ion pair comonomers (IPCs) which are free from nonpolymerizable counter ions have been synthesized, characterized and polymerized by free radical polymerization (FRP), atom transfer radical polymerization (ATRP), and reversible addition-fragmentation chain transfer

Making Wireless Terminals Simpler

DEFF Research Database (Denmark)

Christensen, Søren Skovgaard; Popovski, Petar; De Carvalho, Elisabeth

2005-01-01

equalization in the downlink, which these requirements lead to. We propose to solve the problem by applying pre-processing at the base station, thereby rendering the terminal simple. We establish a general MIMO block transmission model, and derive different transmit/receive filters, based on the Linear Minimum...

Determination of redox potentials for the Watson-Crick base pairs, DNA nucleosides, and relevant nucleoside analogues.

Science.gov (United States)

Crespo-Hernandez, Carlos E; Close, David M; Gorb, Leonid; Leszczynski, Jerzy

2007-05-17

Redox potentials for the DNA nucleobases and nucleosides, various relevant nucleoside analogues, Watson-Crick base pairs, and seven organic dyes are presented based on DFT/B3LYP/6-31++G(d,p) and B3YLP/6-311+G(2df,p)//B3LYP/6-31+G* levels of calculations. The values are determined from an experimentally calibrated set of equations that correlate the vertical ionization (electron affinity) energy of 20 organic molecules with their experimental reversible oxidation (reduction) potential. Our results are in good agreement with those estimated experimentally for the DNA nucleosides in acetonitrile solutions (Seidel et al. J. Phys. Chem. 1996, 100, 5541). We have found that nucleosides with anti conformation exhibit lower oxidation potentials than the corresponding syn conformers. The lowering in the oxidation potential is due to the formation of an intramolecular hydrogen bonding interaction between the 5'-OH group of the sugar and the N3 of the purine bases or C2=O of the pyrimidine bases in the syn conformation. Pairing of adenine or guanine with its complementary pyrimidine base decreases its oxidation potential by 0.15 or 0.28 V, respectively. The calculated energy difference between the oxidation potential for the G.C base pair and that of the guanine base is in good agreement with the experimental value estimated recently (0.34 V: Caruso, T.; et al. J. Am. Chem. Soc. 2005, 127, 15040). The complete and consistent set of reversible redox values determined in this work for the DNA constituents is expected to be of considerable value to those studying charge and electronic energy transfer in DNA.

Performance Evaluation and Modelling of Container Terminals

Science.gov (United States)

Venkatasubbaiah, K.; Rao, K. Narayana; Rao, M. Malleswara; Challa, Suresh

2018-02-01

The present paper evaluates and analyzes the performance of 28 container terminals of south East Asia through data envelopment analysis (DEA), principal component analysis (PCA) and hybrid method of DEA-PCA. DEA technique is utilized to identify efficient decision making unit (DMU)s and to rank DMUs in a peer appraisal mode. PCA is a multivariate statistical method to evaluate the performance of container terminals. In hybrid method, DEA is integrated with PCA to arrive the ranking of container terminals. Based on the composite ranking, performance modelling and optimization of container terminals is carried out through response surface methodology (RSM).

Non-equilibrium properties of Josephson critical current in Nb-based three terminal superconducting tunnel devices

International Nuclear Information System (INIS)

Ammendola, G.; Parlato, L.; Peluso, G.; Pepe, G.

1998-01-01

Tunnel quasi-particle injection into a superconducting film provides useful information on the non-equilibrium state inside the perturbed superconductor as well as on the potential application to electronic devices. Three terminal injector-detector superconducting devices have a long history in non-equilibrium superconductivity. In the recent past non-equilibrium phenomena have attracted again considerable attention because of many superconducting based detectors involve processes substantially non-equilibrium in nature. The possibility of using a stacked double tunnel junction to study the influence of non-equilibrium superconductivity on the Josephson critical current is now considered. An experimental study of the effect of quasi-particle injection on the Josephson current both in steady-state and pulsed experiments down to T=1.2 K is presented using 3 terminal Nb-based stacked double tunnel devices. The feasibility of a new class of particle detectors based on the direct measurement of the change in the Josephson current following the absorption of a X-ray quantum is also discussed in terms of non-equilibrium theories. (orig.)

Power Terminal Communication Access Network Monitoring System Scheme Based on Design Patterns

Science.gov (United States)

Yan, Shengchao; Wu, Desheng; Zhu, Jiang

2018-01-01

In order to realize patterns design for terminal communication monitoring system, this paper introduces manager-workers, tasks-workers design patterns, based on common design patterns such as factory method, chain of responsibility, facade. Using these patterns, the communication monitoring system which combines module-groups like networking communication, business data processing and the peripheral support has been designed successfully. Using these patterns makes this system have great flexibility and scalability and improves the degree of systematic pattern design structure.

Kaposi's sarcoma herpesvirus C-terminal LANA concentrates at pericentromeric and peri-telomeric regions of a subset of mitotic chromosomes

International Nuclear Information System (INIS)

Kelley-Clarke, Brenna; Ballestas, Mary E.; Komatsu, Takashi; Kaye, Kenneth M.

2007-01-01

The Kaposi's sarcoma-associated herpesvirus (KSHV) latency-associated nuclear antigen (LANA) tethers KSHV terminal repeat (TR) DNA to mitotic chromosomes to efficiently segregate episomes to progeny nuclei. LANA contains N- and C-terminal chromosome binding regions. We now show that C-terminal LANA preferentially concentrates to paired dots at pericentromeric and peri-telomeric regions of a subset of mitotic chromosomes through residues 996-1139. Deletions within C-terminal LANA abolished both self-association and chromosome binding, consistent with a requirement for self-association to bind chromosomes. A deletion abolishing TR DNA binding did not affect chromosome targeting, indicating LANA's localization is not due to binding its recognition sequence in chromosomal DNA. LANA distributed similarly on human and non-human mitotic chromosomes. These results are consistent with C-terminal LANA interacting with a cell factor that concentrates at pericentromeric and peri-telomeric regions of mitotic chromosomes

Uncertainty evaluation for three-dimensional scanning electron microscope reconstructions based on the stereo-pair technique

International Nuclear Information System (INIS)

Carli, L; Cantatore, A; De Chiffre, L; Genta, G; Barbato, G; Levi, R

2011-01-01

3D-SEM is a method, based on the stereophotogrammetry technique, which obtains three-dimensional topographic reconstructions starting typically from two SEM images, called the stereo-pair. In this work, a theoretical uncertainty evaluation of the stereo-pair technique, according to GUM (Guide to the Expression of Uncertainty in Measurement), was carried out, considering 3D-SEM reconstructions of a wire gauge with a reference diameter of 250 µm. Starting from the more commonly used tilting strategy, one based on the item rotation inside the SEM chamber was also adopted. The latter enables multiple-view reconstructions of the cylindrical item under consideration. Uncertainty evaluation was performed starting from a modified version of the Piazzesi equation, enabling the calculation of the z-coordinate from a given stereo-pair. The metrological characteristics of each input variable have been taken into account and a SEM stage calibration has been performed. Uncertainty tables for the cases of tilt and rotation were then produced, leading to the calculation of expanded uncertainty. For the case of rotation, the largest uncertainty contribution resulted to be the rotational angle; however, for the case of tilt it resulted to be the pixel size. A relative expanded uncertainty equal to 5% and 4% was obtained for the case of rotation and tilt, respectively

Retention of nucleic acids in ion-pair reversed-phase high-performance liquid chromatography depends not only on base composition but also on base sequence.

Science.gov (United States)

Qiao, Jun-Qin; Liang, Chao; Wei, Lan-Chun; Cao, Zhao-Ming; Lian, Hong-Zhen

2016-12-01

The study on nucleic acid retention in ion-pair reversed-phase high-performance liquid chromatography mainly focuses on size-dependence, however, other factors influencing retention behaviors have not been comprehensively clarified up to date. In this present work, the retention behaviors of oligonucleotides and double-stranded DNAs were investigated on silica-based C 18 stationary phase by ion-pair reversed-phase high-performance liquid chromatography. It is found that the retention of oligonucleotides was influenced by base composition and base sequence as well as size, and oligonucleotides prone to self-dimerization have weaker retention than those not prone to self-dimerization but with the same base composition. However, homo-oligonucleotides are suitable for the size-dependent separation as a special case of oligonucleotides. For double-stranded DNAs, the retention is also influenced by base composition and base sequence, as well as size. This may be attributed to the interaction of exposed bases in major or minor grooves with the hydrophobic alky chains of stationary phase. In addition, no specific influence of guanine and cytosine content was confirmed on retention of double-stranded DNAs. Notably, the space effect resulted from the stereostructure of nucleic acids also influences the retention behavior in ion-pair reversed-phase high-performance liquid chromatography. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Theoretical realization of cluster-assembled hydrogen storage materials based on terminated carbon atomic chains.

Science.gov (United States)

Liu, Chun-Sheng; An, Hui; Guo, Ling-Ju; Zeng, Zhi; Ju, Xin

2011-01-14

The capacity of carbon atomic chains with different terminations for hydrogen storage is studied using first-principles density functional theory calculations. Unlike the physisorption of H(2) on the H-terminated chain, we show that two Li (Na) atoms each capping one end of the odd- or even-numbered carbon chain can hold ten H(2) molecules with optimal binding energies for room temperature storage. The hybridization of the Li 2p states with the H(2)σ orbitals contributes to the H(2) adsorption. However, the binding mechanism of the H(2) molecules on Na arises only from the polarization interaction between the charged Na atom and the H(2). Interestingly, additional H(2) molecules can be bound to the carbon atoms at the chain ends due to the charge transfer between Li 2s2p (Na 3s) and C 2p states. More importantly, dimerization of these isolated metal-capped chains does not affect the hydrogen binding energy significantly. In addition, a single chain can be stabilized effectively by the C(60) fullerenes termination. With a hydrogen uptake of ∼10 wt.% on Li-coated C(60)-C(n)-C(60) (n = 5, 8), the Li(12)C(60)-C(n)-Li(12)C(60) complex, keeping the number of adsorbed H(2) molecules per Li and stabilizing the dispersion of individual Li atoms, can serve as better building blocks of polymers than the (Li(12)C(60))(2) dimer. These findings suggest a new route to design cluster-assembled hydrogen storage materials based on terminated sp carbon chains.

Conformational analysis of a covalently cross-linked Watson-Crick base pair model.

Science.gov (United States)

Jensen, Erik A; Allen, Benjamin D; Kishi, Yoshito; O'Leary, Daniel J

2008-11-15

Low-temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH(2)C(5') (psi) carbon-carbon bond, which is energetically preferred over the alternate CH(2)N(3) (phi) carbon-nitrogen bond rotation.

Influence of Hydration on Proton Transfer in the Guanine-Cytosine Radical Cation (G•+-C) Base Pair: A Density Functional Theory Study

Science.gov (United States)

Kumar, Anil; Sevilla, Michael D.

2009-01-01

On one-electron oxidation all molecules including DNA bases become more acidic in nature. For the GC base pair experiments suggest that a facile proton transfer takes place in the G•+-C base pair from N1 of G•+ to N3 of cytosine. This intra-base pair proton transfer reaction has been extensively considered using theoretical methods for the gas phase and it is predicted that the proton transfer is slightly unfavorable in disagreement with experiment. In the present study, we consider the effect of the first hydration layer on the proton transfer reaction in G•+-C by the use of density functional theory (DFT), B3LYP/6-31+G** calculations of the G•+-C base pair in the presence of 6 and 11 water molecules. Under the influence of hydration of 11 waters, a facile proton transfer from N1 of G•+ to N3 of C is predicted. The zero point energy (ZPE) corrected forward and backward energy barriers, for the proton transfer from N1 of G•+ to N3 of C, was found to be 1.4 and 2.6 kcal/mol, respectively. The proton transferred G•-(H+)C + 11H2O was found to be 1.2 kcal/mol more stable than G•+-C + 11H2O in agreement with experiment. The present calculation demonstrates that the inclusion of the first hydration shell around G•+-C base pair has an important effect on the internal proton transfer energetics. PMID:19485319

Chaotic sedimentation of particle pairs in a vertical channel at low Reynolds number: Multiple states and routes to chaos

Science.gov (United States)

Verjus, Romuald; Guillou, Sylvain; Ezersky, Alexander; Angilella, Jean-Régis

2016-12-01

The sedimentation of a pair of rigid circular particles in a two-dimensional vertical channel containing a Newtonian fluid is investigated numerically, for terminal particle Reynolds numbers (ReT) ranging from 1 to 10, and for a confinement ratio equal to 4. While it is widely admitted that sufficiently inertial pairs should sediment by performing a regular DKT oscillation (Drafting-Kissing-Tumbling), the present analysis shows in contrast that a chaotic regime can also exist for such particles, leading to a much slower sedimentation velocity. It consists of a nearly horizontal pair, corresponding to a maximum effective blockage ratio, and performing a quasiperiodic transition to chaos while increasing the particle weight. For less inertial regimes, the classical oblique doublet structure and its complex behavior (multiple stable states and hysteresis, period-doubling cascade and chaotic attractor) are recovered, in agreement with previous work [Aidun, C. K. and Ding, E.-J., "Dynamics of particle sedimentation in a vertical channel: Period-doubling bifurcation and chaotic state," Phys. Fluids 15, 1612 (2003)]. As a consequence of these various behaviors, the link between the terminal Reynolds number and the non-dimensional driving force is complex: it contains several branches displaying hysteresis as well as various bifurcations. For the range of Reynolds number considered here, a global bifurcation diagram is given.

Directed evolution of the TALE N-terminal domain for recognition of all 5′ bases

Science.gov (United States)

Lamb, Brian M.; Mercer, Andrew C.; Barbas, Carlos F.

2013-01-01

Transcription activator-like effector (TALE) proteins can be designed to bind virtually any DNA sequence. General guidelines for design of TALE DNA-binding domains suggest that the 5′-most base of the DNA sequence bound by the TALE (the N0 base) should be a thymine. We quantified the N0 requirement by analysis of the activities of TALE transcription factors (TALE-TF), TALE recombinases (TALE-R) and TALE nucleases (TALENs) with each DNA base at this position. In the absence of a 5′ T, we observed decreases in TALE activity up to >1000-fold in TALE-TF activity, up to 100-fold in TALE-R activity and up to 10-fold reduction in TALEN activity compared with target sequences containing a 5′ T. To develop TALE architectures that recognize all possible N0 bases, we used structure-guided library design coupled with TALE-R activity selections to evolve novel TALE N-terminal domains to accommodate any N0 base. A G-selective domain and broadly reactive domains were isolated and characterized. The engineered TALE domains selected in the TALE-R format demonstrated modularity and were active in TALE-TF and TALEN architectures. Evolved N-terminal domains provide effective and unconstrained TALE-based targeting of any DNA sequence as TALE binding proteins and designer enzymes. PMID:23980031

Differential BPFs with Multiple Transmission Zeros Based on Terminated Coupled Lines

Science.gov (United States)

Niu, Yiming; Yang, Guo; Wu, Wen

2018-04-01

Differential bandpass filters (BPFs) named Filter A and Filter B based on Terminated Coupled Lines (TCLs) are proposed in this letter. The TCLs contributes to not only three poles in differential-mode (DM) for wideband filtering response but also multiple zeros in both DM and common-mode (CM) offering wide DM out-of-band rejection and good CM suppression. Fabricated filters centred at 3.5 GHz with wide DM passband and wideband CM suppression have been designed and measured. The filters improved the noise suppression capability of the communication and radiometer systems. The simulated and measured results are in good agreement.

Biomimetic PDMS-hydroxyurethane terminated with catecholic moieties for chemical grafting on transition metal oxide-based surfaces

Science.gov (United States)

de Aguiar, Kelen R.; Rischka, Klaus; Gätjen, Linda; Noeske, Paul-Ludwig Michael; Cavalcanti, Welchy Leite; Rodrigues-Filho, Ubirajara P.

2018-01-01

The aim of this work was to synthesize a non-isocyanate poly(dimethylsiloxane) hydroxyurethane with biomimetic terminal catechol moieties, as a candidate for inorganic and metallic surface modification. Such surface modifier is capable to strongly attach onto metallic and inorganic substrates forming layers and, in addition, providing water-repellent surfaces. The non-isocyanate route is based on carbon dioxide cycloaddition into bis-epoxide, resulting in a precursor bis(cyclic carbonate)-polydimethylsiloxane (CCPDMS), thus fully replacing isocyanate in the manufacture process. A biomimetic approach was chosen with the molecular composition being inspired by terminal peptides present in adhesive proteins of mussels, like Mefp (Mytilus edulis foot protein), which bear catechol moieties and are strong adhesives even under natural and saline water. The catechol terminal groups were grafted by aminolysis reaction into a polydimethylsiloxane backbone. The product, PDMSUr-Dopamine, presented high affinity towards inhomogeneous alloy surfaces terminated by native oxide layers as demonstrated by quartz crystal microbalance (QCM-D), as well as stability against desorption by rinsing with ethanol. As revealed by QCM-D, X-ray photoelectron spectroscopy (XPS) and computational studies, the thickness and composition of the resulting nanolayers indicated an attachment of PDMSUr-Dopamine molecules to the substrate through both terminal catechol groups, with the adsorbate exposing the hydrophobic PDMS backbone. This hypothesis was investigated by classical molecular dynamic simulation (MD) of pure PDMSUr-Dopamine molecules on SiO2 surfaces. The computationally obtained PDMSUr-Dopamine assembly is in agreement with the conclusions from the experiments regarding the conformation of PDMSUr-Dopamine towards the surface. The tendency of the terminal catechol groups to approach the surface is in agreement with proposed model for the attachment PDMSUr-Dopamine. Remarkably, the versatile

Ab initio characterization of coupling strength for all types of dangling-bond pairs on the hydrogen-terminated Si(100)-2 × 1 surface

Science.gov (United States)

Shaterzadeh-Yazdi, Zahra; Sanders, Barry C.; DiLabio, Gino A.

2018-04-01

Recent work has suggested that coupled silicon dangling bonds sharing an excess electron may serve as building blocks for quantum-cellular-automata cells and quantum computing schemes when constructed on hydrogen-terminated silicon surfaces. In this work, we employ ab initio density-functional theory to examine the details associated with the coupling between two dangling bonds sharing one excess electron and arranged in various configurations on models of phosphorous-doped hydrogen-terminated silicon (100) surfaces. Our results show that the coupling strength depends strongly on the relative orientation of the dangling bonds on the surface and on the separation between them. The orientation of dangling bonds is determined by the anisotropy of the silicon (100) surface, so this feature of the surface is a significant contributing factor to variations in the strength of coupling between dangling bonds. The results demonstrate that simple models for approximating tunneling, such as the Wentzel-Kramer-Brillouin method, which do not incorporate the details of surface structure, are incapable of providing reasonable estimates of tunneling rates between dangling bonds. The results provide guidance to efforts related to the development of dangling-bond based computing elements.

A QM/MM refinement of an experimental DNA structure with metal-mediated base pairs.

Science.gov (United States)

Kumbhar, Sadhana; Johannsen, Silke; Sigel, Roland K O; Waller, Mark P; Müller, Jens

2013-10-01

A series of hybrid quantum mechanical/molecular mechanical (QM/MM) calculations was performed on models of a DNA duplex with artificial silver(I)-mediated imidazole base pairs. The optimized structures were compared to the original experimental NMR structure (Nat. Chem. 2 (2010) 229-234). The metal⋯metal distances are significantly shorter (~0.5Å) in the QM/MM model than in the original NMR structure. As a result, argentophilic interactions are feasible between the silver(I) ions of neighboring metal-mediated base pairs. Using the computationally determined metal⋯metal distances, a re-refined NMR solution structure of the DNA duplex was obtained. In this new NMR structure, all experimental constraints remain fulfilled. The new NMR structure shows less deviation from the regular B-type conformation than the original one. This investigation shows that the application of QM/MM models to generate additional constraints to be used during NMR structural refinements represents an elegant approach to obtaining high-resolution NMR structures. Copyright © 2013 Elsevier Inc. All rights reserved.

Conformational Analysis of a Covalently Cross-Linked Watson-Crick Base Pair Model

OpenAIRE

Jensen, Erik A.; Allen, Benjamin D.; Kishi, Yoshito; O'Leary, Daniel J.

2008-01-01

Low temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH2–C(5′) (ψ) carbon-carbon bond, which is energetically preferred over the alternate CH2–N(3) (ϕ) carbon-nitrogen ...

Paired fuzzy sets

DEFF Research Database (Denmark)

Rodríguez, J. Tinguaro; Franco de los Ríos, Camilo; Gómez, Daniel

2015-01-01

In this paper we want to stress the relevance of paired fuzzy sets, as already proposed in previous works of the authors, as a family of fuzzy sets that offers a unifying view for different models based upon the opposition of two fuzzy sets, simply allowing the existence of different types...

Structural variability and the nature of intermolecular interactions in Watson-Crick B-DNA base pairs.

Science.gov (United States)

Czyznikowska, Z; Góra, R W; Zaleśny, R; Lipkowski, P; Jarzembska, K N; Dominiak, P M; Leszczynski, J

2010-07-29

A set of nearly 100 crystallographic structures was analyzed using ab initio methods in order to verify the effect of the conformational variability of Watson-Crick guanine-cytosine and adenine-thymine base pairs on the intermolecular interaction energy and its components. Furthermore, for the representative structures, a potential energy scan of the structural parameters describing mutual orientation of the base pairs was carried out. The results were obtained using the hybrid variational-perturbational interaction energy decomposition scheme. The electron correlation effects were estimated by means of the second-order Møller-Plesset perturbation theory and coupled clusters with singles and doubles method adopting AUG-cc-pVDZ basis set. Moreover, the characteristics of hydrogen bonds in complexes, mimicking those appearing in B-DNA, were evaluated using topological analysis of the electron density. Although the first-order electrostatic energy is usually the largest stabilizing component, it is canceled out by the associated exchange repulsion in majority of the studied crystallographic structures. Therefore, the analyzed complexes of the nucleic acid bases appeared to be stabilized mainly by the delocalization component of the intermolecular interaction energy which, in terms of symmetry adapted perturbation theory, encompasses the second- and higher-order induction and exchange-induction terms. Furthermore, it was found that the dispersion contribution, albeit much smaller in terms of magnitude, is also a vital stabilizing factor. It was also revealed that the intermolecular interaction energy and its components are strongly influenced by four (out of six) structural parameters describing mutual orientation of bases in Watson-Crick pairs, namely shear, stagger, stretch, and opening. Finally, as a part of a model study, much of the effort was devoted to an extensive testing of the UBDB databank. It was shown that the databank quite successfully reproduces the

An Intelligent Model for Pairs Trading Using Genetic Algorithms.

Science.gov (United States)

Huang, Chien-Feng; Hsu, Chi-Jen; Chen, Chi-Chung; Chang, Bao Rong; Li, Chen-An

2015-01-01

Pairs trading is an important and challenging research area in computational finance, in which pairs of stocks are bought and sold in pair combinations for arbitrage opportunities. Traditional methods that solve this set of problems mostly rely on statistical methods such as regression. In contrast to the statistical approaches, recent advances in computational intelligence (CI) are leading to promising opportunities for solving problems in the financial applications more effectively. In this paper, we present a novel methodology for pairs trading using genetic algorithms (GA). Our results showed that the GA-based models are able to significantly outperform the benchmark and our proposed method is capable of generating robust models to tackle the dynamic characteristics in the financial application studied. Based upon the promising results obtained, we expect this GA-based method to advance the research in computational intelligence for finance and provide an effective solution to pairs trading for investment in practice.

Substituent effif ects on hydrogen bonding in Watson-Crick base pairs. A theoretical study

NARCIS (Netherlands)

Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.

2005-01-01

We have theoretically analyzed Watson-Crick AT and GC base pairs in which purine C8 and/or pyrimidine C6 positions carry a substituent X = H, F, Cl or Br, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P. The purpose is to study the effects on structure

Contract Award Decisions Resulting in Contract Termination for Default

National Research Council Canada - National Science Library

1996-01-01

.... Specifically, the audit focused on contracts terminated either for default or convenience and determined whether the contract terminations could have been averted based on information available before contract award...

Deuterium isotope effects and fractionation factors of hydrogen-bonded A:T base pairs of DNA

International Nuclear Information System (INIS)

Vakonakis, Ioannis; Salazar, Miguel; Kang, Mijeong; Dunbar, Kim R.; Li Wang, Andy C.

2003-01-01

Deuterium isotope effects and fractionation factors of N1...H3-N3 hydrogen bonded Watson-Crick A:T base pairs of two DNA dodecamers are presented here. Specifically, two-bond deuterium isotope effects on the chemical shifts of 13 C2 and 13 C4, 2 Δ 13 C2 and 2 Δ 13 C4, and equilibrium deuterium/protium fractionation factors of H3, Φ, were measured and seen to correlate with the chemical shift of the corresponding imino proton, δ H3 . Downfield-shifted imino protons associated with larger values of 2 Δ 13 C2 and 2 Δ 13 C4 and smaller Φ values, which together suggested that the effective H3-N3 vibrational potentials were more anharmonic in the stronger hydrogen bonds of these DNA molecules. We anticipate that 2 Δ 13 C2, 2 Δ 13 C4 and Φ values can be useful gauges of hydrogen bond strength of A:T base pairs

Energy Landscape and Pathways for Transitions between Watson-Crick and Hoogsteen Base Pairing in DNA.

Science.gov (United States)

Chakraborty, Debayan; Wales, David J

2018-01-04

The recent discovery that Hoogsteen (HG) base pairs are widespread in DNA across diverse sequences and positional contexts could have important implications for understanding DNA replication and DNA-protein recognition. While evidence is emerging that the Hoogsteen conformation could be a thermodynamically accessible conformation of the DNA duplex and provide a means to expand its functionality, relatively little is known about the molecular mechanism underlying the Watson-Crick (WC) to HG transition. In this Perspective, we describe pathways and kinetics for this transition at an atomic level of detail, using the energy landscape perspective. We show that competition between the duplex conformations results in a double funnel landscape, which explains some recent experimental observations. The interconversion pathways feature a number of intermediates, with a variable number of WC and HG base pairs. The relatively slow kinetics, with possible deviations from two-state behavior, suggest that this conformational switch is likely to be a challenging target for both simulation and experiment.

Analytical methods and simulation models to assess innovative operational measures and technologies for rail port terminals: the case of Valencia Principe Felipe terminal

Energy Technology Data Exchange (ETDEWEB)

Ricci, S.

2016-07-01

The topic of freight transport by rail is a complex theme and, in recent years, a main issue of European policy. The legislation evolution and the White Paper 2011 have demonstrated the European intention to re-launch this sector. The challenge is to promote the intermodal transport system to the detriment of road freight transport. In this context intermodal freight terminals, play a primary role for the supply chain, they are the connection point between the various transport nodes and the nodal points where the freight are handled, stored and transferred between different modes to final customer. To achieve the purpose, it is strengthen the improvement of existing intermodal freight terminals and the development of innovative intermodal freight terminals towards higher performance (ERRAC, 2012). Many terminal performances improvements have been proposed and sometime experimented. They are normally basing on combinations of operational measures and innovative technologies (e.g. automatic horizontal and parallel storage and handling, automated gate and sensors for tracking systems data exchange) tested in various terminals, with often-contradictory results. The research work described in this paper (developed within the Capacity4Rail EU project) focusses on the assessment of effects that these innovations can have in the intermodal freight terminals combined in various alternative consistent effective scenarios. The methodological framework setup to assess these innovations is basing on a combination of analytical methods based on sequential algorithms and discrete events simulation models. The output of this assessment method are key performance indicators (KPIs) selected according to terminals typologies and related to different aspects (e.g. management, operation and organization). The present paper illustrates the application of the methodological framework, tuned on the operation of various intermodal terminals, for the validation on today operation and the

Weighted profile likelihood-based confidence interval for the difference between two proportions with paired binomial data.

Science.gov (United States)

Pradhan, Vivek; Saha, Krishna K; Banerjee, Tathagata; Evans, John C

2014-07-30

Inference on the difference between two binomial proportions in the paired binomial setting is often an important problem in many biomedical investigations. Tang et al. (2010, Statistics in Medicine) discussed six methods to construct confidence intervals (henceforth, we abbreviate it as CI) for the difference between two proportions in paired binomial setting using method of variance estimates recovery. In this article, we propose weighted profile likelihood-based CIs for the difference between proportions of a paired binomial distribution. However, instead of the usual likelihood, we use weighted likelihood that is essentially making adjustments to the cell frequencies of a 2 × 2 table in the spirit of Agresti and Min (2005, Statistics in Medicine). We then conduct numerical studies to compare the performances of the proposed CIs with that of Tang et al. and Agresti and Min in terms of coverage probabilities and expected lengths. Our numerical study clearly indicates that the weighted profile likelihood-based intervals and Jeffreys interval (cf. Tang et al.) are superior in terms of achieving the nominal level, and in terms of expected lengths, they are competitive. Finally, we illustrate the use of the proposed CIs with real-life examples. Copyright © 2014 John Wiley & Sons, Ltd.

Imidazopyridine/Pyrrole and hydroxybenzimidazole/pyrrole pairs for DNA minor groove recognition.

Science.gov (United States)

Renneberg, Dorte; Dervan, Peter B

2003-05-14

The DNA binding properties of fused heterocycles imidazo[4,5-b]pyridine (Ip) and hydroxybenzimidazole (Hz) paired with pyrrole (Py) in eight-ring hairpin polyamides are reported. The recognition profile of Ip/Py and Hz/Py pairs were compared to the five-membered ring pairs Im/Py and Hp/Py on a DNA restriction fragment at four 6-base pair recognition sites which vary at a single position 5'-TGTNTA-3', where N = G, C, T, A. The Ip/Py pair distinguishes G.C from C.G, T.A, and A.T, and the Hz/Py pair distinguishes T.A from A.T, G.C, and C.G, affording a new set of heterocycle pairs to target the four Watson-Crick base pairs in the minor groove of DNA.

Roles of the active site residues and metal cofactors in noncanonical base-pairing during catalysis by human DNA polymerase iota.

Science.gov (United States)

Makarova, Alena V; Ignatov, Artem; Miropolskaya, Nataliya; Kulbachinskiy, Andrey

2014-10-01

Human DNA polymerase iota (Pol ι) is a Y-family polymerase that can bypass various DNA lesions but possesses very low fidelity of DNA synthesis in vitro. Structural analysis of Pol ι revealed a narrow active site that promotes noncanonical base-pairing during catalysis. To better understand the structure-function relationships in the active site of Pol ι we investigated substitutions of individual amino acid residues in its fingers domain that contact either the templating or the incoming nucleotide. Two of the substitutions, Y39A and Q59A, significantly decreased the catalytic activity but improved the fidelity of Pol ι. Surprisingly, in the presence of Mn(2+) ions, the wild-type and mutant Pol ι variants efficiently incorporated nucleotides opposite template purines containing modifications that disrupted either Hoogsteen or Watson-Crick base-pairing, suggesting that Pol ι may use various types of interactions during nucleotide addition. In contrast, in Mg(2+) reactions, wild-type Pol ι was dependent on Hoogsteen base-pairing, the Y39A mutant was essentially inactive, and the Q59A mutant promoted Watson-Crick interactions with template purines. The results suggest that Pol ι utilizes distinct mechanisms of nucleotide incorporation depending on the metal cofactor and reveal important roles of specific residues from the fingers domain in base-pairing and catalysis. Copyright © 2014 Elsevier B.V. All rights reserved.

Parametric Design and Rapid Prototyping of Installation Box for Vehicle Terminal PCB

Directory of Open Access Journals (Sweden)

Wang Xingxing

2016-01-01

Full Text Available Installation box for vehicle terminal PCB (Printed Circuit Board was took as research object, which is encountered in the process of project developing. Vehicle terminal PCB in actual development process was set as an example, point cloud data were acquired by three coordinate measuring method; Imageware software was used to reconstruct the vehicle terminal PCB model, basic size parameters of vehicle terminal PCB can be got and then design parameters of installation box for vehicle terminal PCB can be determined. Design of the installation box for vehicle terminal PCB was completed based on Solidworks software, then 3D modeling and 2D drawing of installation box for vehicle terminal PCB was gained. Up Plus 2 rapid prototype machine was used to manufacture installation box for vehicle terminal PCB rapidly based on 3D printing technology, then prototype of installation box for vehicle terminal PCB was obtained. It is of certain engineering significant for single (small amount manufacturing of installation box for general PCB.

Proof of concept of a "greener" protein purification/enrichment method based on carboxylate-terminated carbosilane dendrimer-protein interactions.

Science.gov (United States)

González-García, Estefanía; Maly, Marek; de la Mata, Francisco Javier; Gómez, Rafael; Marina, María Luisa; García, María Concepción

2016-11-01

Protein sample preparation is a critical and an unsustainable step since it involves the use of tedious methods that usually require high amount of solvents. The development of new materials offers additional opportunities in protein sample preparation. This work explores, for the first time, the potential application of carboxylate-terminated carbosilane dendrimers to the purification/enrichment of proteins. Studies on dendrimer binding to proteins, based on protein fluorescence intensity and emission wavelengths measurements, demonstrated the interaction between carboxylate-terminated carbosilane dendrimers and proteins at all tested pH levels. Interactions were greatly affected by the protein itself, pH, and dendrimer concentration and generation. Especially interesting was the interaction at acidic pH since it resulted in a significant protein precipitation. Dendrimer-protein interactions were modeled observing stable complexes for all proteins. Carboxylate-terminated carbosilane dendrimers at acidic pH were successfully used in the purification/enrichment of proteins extracted from a complex sample. Graphical Abstract Images showing the growing turbidity of solutions containing a mixture of proteins (lysozyme, myoglobin, and BSA) at different protein:dendrimer ratios (1:0, 1:1, 1:8, and 1:20) at acidic pH and SDS-PAGE profiles of the corresponsing supernatants. Comparison of SDS-PAGE profiles for the pellets obtained during the purification of proteins present in a complex sample using a conventional "no-clean" method based on acetone precipitation and the proposed "greener" method using carboxylate-terminated carbosilane dendrimer at a 1:20 protein:dendrimer ratio.

Mispairs with Watson-Crick base-pair geometry observed in ternary complexes of an RB69 DNA polymerase variant.

Science.gov (United States)

Xia, Shuangluo; Konigsberg, William H

2014-04-01

Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.

Investigation of the surface terminations of icosahedral AlPdMn quasicrystal based on a modified non-spherical model

International Nuclear Information System (INIS)

Yu Fengmei; Zou Huamin; Wang Jianbo; Wang Renhui

2004-01-01

The atomic positions are obtained from a modified non-spherical model of icosahedral AlPdMn quasicrystal (Fang et al 2003 J. Phys.: Condens. Matter 15 4947) by the cut method. The four-shell pseudo-Mackay clusters (PMCs) were searched for in a box of 400 A x 400 A x 400 A. The results show that the number of atoms in the fourth shell, an icosidodecahedron, of the pseudo-Mackay cluster can vary from 15 to 30 because of the cluster overlap, and about 99.96% of the total atoms are included in such incomplete pseudo-Mackay clusters. The characteristics of the atom distribution in the planes perpendicular to a fivefold axis indicate that the planes, which are 1.56 A apart from their neighbouring planes, are expected to be the terminal surfaces. If one such a plane and its closest neighbouring plane, between which the spacing is 0.48 A, are considered as a thin layer or a corrugated surface, these layers are also the layers with the maximum density. The pair of corrugated surfaces that are 1.56 A apart have almost identical chemical composition. These planes form terraces that follow the rule of the Fibonacci sequence with two step heights, 6.60 and 4.08 A. On the corrugated surfaces perpendicular to a fivefold axis the pentagonal holes arise from the interspaces of adjacent incomplete PMCs. For the atomic planes normal to a twofold axis, the planes with spacing of 1.48 A from their adjacent planes might be expected to be the terminal surfaces, which form terraces with step heights of 6.28 and 3.88 A following the rule of the Fibonacci sequence. For the atomic planes normal to a threefold axis, the planes with spacing of 0.86 A from their adjacent planes might be expected to be the terminal surfaces. No similar results were found for the atomic layers perpendicular to a pseudo-twofold axis

Study on New Smart Transformer Terminal Unit Based on ARM and GPRS Network

Directory of Open Access Journals (Sweden)

Na Wu

2013-12-01

Full Text Available Distribution transformer is one of the most important power equipments in distribution network, whose running state exercises a great influence on the stability of the network. Transformer Terminal Unit (TTU is an effective device to monitor the running state of transformers in the distribution automation system. In this paper, we study a new smart TTU which uses ARM7 series chip as processor, equipped with ATT7022B based electric meter module and GPRS module for remote data transmission control. We focus on the corresponding hardware, software design and the measurement principle of harmonics of TTU. The new TTU can measure the electric parameters of the distribution transformer precisely. Taking advantage of the powerful ARM processor, it can analyze harmonic of the power line effectively. Due to the always-on-line feature of GPRS, TTU can achieve reliable communication with the remote terminal and the master station. Compared with other similar units, the new unit outperforms in terms of real-time, precision and reliability, which can fully meet with the high-speed development of distribution automation system.

PAIR'14 / PAIR'15 STUDENT CONFERENCES ON PLANNING IN ARTIFICIAL INTELLIGENCE AND ROBOTICS

Directory of Open Access Journals (Sweden)

Editorial Foreword

2015-12-01

Full Text Available Dear Readerthe original idea of the student conference on “Planning in Artificial Intelligence and Robotics” (PAIR is to join young researchers from particular laboratories in Czech Republic, where planning problems are investigated from artificial intelligence (AI or robotics points of view. The first year of PAIR has been organized at the Dept. of Computer Science, Faculty Electrical Engineering, Czech Technical University in 2014.At PAIR 2014, laboratories from Prague and Brno were presented. In particular, students and researchers from Charles University, Czech Technical University in Prague, Brno University of Technology, and Central European Institute of Technology participated at the event. Beside an introduction of the particular research groups and their topics, students presented contributions on their current research results. Ten papers were presented on topics ranging from domain–independent planning, trajectory planning to applications for unmanned aerial and legged robots. This first event provides us an initial experience with the community of young researchers in Czech Republic that are working planning in robotic or AI. Based on the success of PAIR 2014, we decided to continue with our effort to establish a suitable fora for students that are geographically very close, but usually do not meet, because of participation on different Robotics and AI events.The second student conference on Planning in Artificial Intelligence and Robotics (PAIR 2015 successfully continues the tradition of the first year of the conference organized in Prague. This year, the conference was collocated with 10th anniversary of RoboTour contest in Písek. This format enable us to extend the impact of the PAIR conference and improve the visibility of the growing student community. The conference reached a good amount of interesting papers focused on image processing for mobile robots, swarm control, driving simulation, robot control, or domain�

Ni2+-binding RNA motifs with an asymmetric purine-rich internal loop and a G-A base pair.

Science.gov (United States)

Hofmann, H P; Limmer, S; Hornung, V; Sprinzl, M

1997-01-01

RNA molecules with high affinity for immobilized Ni2+ were isolated from an RNA pool with 50 randomized positions by in vitro selection-amplification. The selected RNAs preferentially bind Ni2+ and Co2+ over other cations from first series transition metals. Conserved structure motifs, comprising about 15 nt, were identified that are likely to represent the Ni2+ binding sites. Two conserved motifs contain an asymmetric purine-rich internal loop and probably a mismatch G-A base pair. The structure of one of these motifs was studied with proton NMR spectroscopy and formation of the G-A pair at the junction of helix and internal loop was demonstrated. Using Ni2+ as a paramagnetic probe, a divalent metal ion binding site near this G-A base pair was identified. Ni2+ ions bound to this motif exert a specific stabilization effect. We propose that small asymmetric purine-rich loops that contain a G-A interaction may represent a divalent metal ion binding site in RNA. PMID:9409620

Paired-Associate and Feedback-Based Weather Prediction Tasks Support Multiple Category Learning Systems

OpenAIRE

Li, Kaiyun; Fu, Qiufang; Sun, Xunwei; Zhou, Xiaoyan; Fu, Xiaolan

2016-01-01

It remains unclear whether probabilistic category learning in the feedback-based weather prediction task (FB-WPT) can be mediated by a non-declarative or procedural learning system. To address this issue, we compared the effects of training time and verbal working memory, which influence the declarative learning system but not the non-declarative learning system, in the FB and paired-associate (PA) WPTs, as the PA task recruits a declarative learning system. The results of Experiment 1 showed...

The effect of chemical modification of DNA base on binding of Hg-II and Ag-I in metal-mediated base pairs

Czech Academy of Sciences Publication Activity Database

Šebera, Jakub; Tanaka, Y.; Ono, A.; Sychrovský, Vladimír

2016-01-01

Roč. 452, Oct 1 (2016), s. 199-204 ISSN 0020-1693 R&D Projects: GA ČR GA13-27676S Institutional support: RVO:61388963 Keywords : DFT * metal-mediated base pairs * Hg * Ag Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.002, year: 2016

Generalized pairing strategies-a bridge from pairing strategies to colorings

Directory of Open Access Journals (Sweden)

Győrffy Lajos

2016-12-01

Full Text Available In this paper we define a bridge between pairings and colorings of the hypergraphs by introducing a generalization of pairs called t-cakes for t ∈ ℕ, t ≥ 2. For t = 2 the 2-cakes are the same as the well-known pairs of system of distinct representatives, that can be turned to pairing strategies in Maker-Breaker hypergraph games, see Hales and Jewett [12]. The two-colorings are the other extremity of t-cakes, in which the whole ground set of the hypergraph is one big cake that we divide into two parts (color classes. Starting from the pairings (2-cake placement and two-colorings we define the generalized t-cake placements where we pair p elements by q elements (p, q ∈ ℕ, 1 ≤ p, q < t, p + q = t.

Multi-user distribution of polarization entangled photon pairs

Energy Technology Data Exchange (ETDEWEB)

Trapateau, J.; Orieux, A.; Diamanti, E.; Zaquine, I., E-mail: isabelle.zaquine@telecom-paristech.fr [LTCI, CNRS, Télécom ParisTech, Université Paris-Saclay, 75013 Paris (France); Ghalbouni, J. [Applied Physics Laboratory, Faculty of Sciences 2, Lebanese University, Campus Fanar, BP 90656 Jdeidet (Lebanon)

2015-10-14

We experimentally demonstrate multi-user distribution of polarization entanglement using commercial telecom wavelength division demultiplexers. The entangled photon pairs are generated from a broadband source based on spontaneous parametric down conversion in a periodically poled lithium niobate crystal using a double path setup employing a Michelson interferometer and active phase stabilisation. We test and compare demultiplexers based on various technologies and analyze the effect of their characteristics, such as losses and polarization dependence, on the quality of the distributed entanglement for three channel pairs of each demultiplexer. In all cases, we obtain a Bell inequality violation, whose value depends on the demultiplexer features. This demonstrates that entanglement can be distributed to at least three user pairs of a network from a single source. Additionally, we verify for the best demultiplexer that the violation is maintained when the pairs are distributed over a total channel attenuation corresponding to 20 km of optical fiber. These techniques are therefore suitable for resource-efficient practical implementations of entanglement-based quantum key distribution and other quantum communication network applications.

Research Trends of Inland Terminals: A Literature Review

Directory of Open Access Journals (Sweden)

Tomislav Rožić

2016-10-01

and revised. The review will summarize the literature related to development, classification, technological processes and location of inland terminals. In the end, the paper identifies a new proposition for further research based on the current trends and developments in inland terminals as an important factor of intermodal transport.

Proving termination of logic programs with delay declarations

NARCIS (Netherlands)

E. Marchiori; F. Teusink (Frank)

1996-01-01

textabstractIn this paper we propose a method for proving termination of logic programs with delay declarations. The method is based on the notion of recurrent logic program, which is used to prove programs terminating wrt an arbitrary selection rule. Most importantly, we use the notion of bound

Atomic-Level Organization of Vicinal Acid-Base Pairs through the Chemisorption of Aniline and Derivatives onto Mesoporous SBA15

KAUST Repository

Basset, Jean-Marie

2016-06-09

The design of novel heterogeneous catalysts with multiple adjacent functionalities is of high interest for heterogeneous catalysis. Herein, we report a method to obtain a majority bifunctional acid-base pairs on SBA15. Aniline reacts with SBA15 by opening siloxane bridges leading to N-phenylsilanamine-silanol pairs. In contrast with ammonia treated surfaces, the material is stable under air/moisture. Advanced solid state MAS NMR: 2D ¹H-¹H double-quantum, ¹H-¹³C HETCOR experiments and dynamic nuclear polarization enhanced ²⁹Si and ¹⁵N spectra demonstrate both the close proximity between the two moieties and the formation of a covalent Si-N surface bond and confirm the design of vicinal acid-base pairs. This approach was successfully applied to the design of a series of aniline derivatives bifunctional SBA15. A correlation of the substituents effects on the aromatic ring (Hammet parameters) on the kinetics of the model reaction of Knoevenagel is observed.

Rough Set Theory based prognostication of life expectancy for terminally ill patients.

Science.gov (United States)

Gil-Herrera, Eleazar; Yalcin, Ali; Tsalatsanis, Athanasios; Barnes, Laura E; Djulbegovic, Benjamin

2011-01-01

We present a novel knowledge discovery methodology that relies on Rough Set Theory to predict the life expectancy of terminally ill patients in an effort to improve the hospice referral process. Life expectancy prognostication is particularly valuable for terminally ill patients since it enables them and their families to initiate end-of-life discussions and choose the most desired management strategy for the remainder of their lives. We utilize retrospective data from 9105 patients to demonstrate the design and implementation details of a series of classifiers developed to identify potential hospice candidates. Preliminary results confirm the efficacy of the proposed methodology. We envision our work as a part of a comprehensive decision support system designed to assist terminally ill patients in making end-of-life care decisions.

Osteogenic cell differentiation on H-terminated and O-terminated nanocrystalline diamond films

Directory of Open Access Journals (Sweden)

Liskova J

2015-01-01

Full Text Available Jana Liskova,1 Oleg Babchenko,2 Marian Varga,2 Alexander Kromka,2 Daniel Hadraba,1 Zdenek Svindrych,1 Zuzana Burdikova,1 Lucie Bacakova1 1Institute of Physiology, Academy of Sciences of the Czech Republic, Prague, Czech Republic; 2Institute of Physics, Academy of Sciences of the Czech Republic, Prague, Czech Republic Abstract: Nanocrystalline diamond (NCD films are promising materials for bone implant coatings because of their biocompatibility, chemical resistance, and mechanical hardness. Moreover, NCD wettability can be tailored by grafting specific atoms. The NCD films used in this study were grown on silicon substrates by microwave plasma-enhanced chemical vapor deposition and grafted by hydrogen atoms (H-termination or oxygen atoms (O-termination. Human osteoblast-like Saos-2 cells were used for biological studies on H-terminated and O-terminated NCD films. The adhesion, growth, and subsequent differentiation of the osteoblasts on NCD films were examined, and the extracellular matrix production and composition were quantified. The osteoblasts that had been cultivated on the O-terminated NCD films exhibited a higher growth rate than those grown on the H-terminated NCD films. The mature collagen fibers were detected in Saos-2 cells on both the H-terminated and O-terminated NCD films; however, the quantity of total collagen in the extracellular matrix was higher on the O-terminated NCD films, as were the amounts of calcium deposition and alkaline phosphatase activity. Nevertheless, the expression of genes for osteogenic markers – type I collagen, alkaline phosphatase, and osteocalcin – was either comparable on the H-terminated and O-terminated films or even lower on the O-terminated films. In conclusion, the higher wettability of the O-terminated NCD films is promising for adhesion and growth of osteoblasts. In addition, the O-terminated surface also seems to support the deposition of extracellular matrix proteins and extracellular matrix

Human adenovirus serotype 12 virion precursors pMu and pVI are cleaved at amino-terminal and carboxy-terminal sites that conform to the adenovirus 2 endoproteinase cleavage consensus sequence.

Science.gov (United States)

Freimuth, P; Anderson, C W

1993-03-01

The sequence of a 1158-base pair fragment of the human adenovirus serotype 12 (Ad12) genome was determined. This segment encodes the precursors for virion components Mu and VI. Both Ad12 precursors contain two sequences that conform to a consensus sequence motif for cleavage by the endoproteinase of adenovirus 2 (Ad2). Analysis of the amino terminus of VI and of the peptide fragments found in Ad12 virions demonstrated that these sites are cleaved during Ad12 maturation. This observation suggests that the recognition motif for adenovirus endoproteinases is highly conserved among human serotypes. The adenovirus 2 endoproteinase polypeptide requires additional co-factors for activity (C. W. Anderson, Protein Expression Purif., 1993, 4, 8-15). Synthetic Ad12 or Ad2 pVI carboxy-terminal peptides each permitted efficient cleavage of an artificial endoproteinase substrate by recombinant Ad2 endoproteinase polypeptide.

Node-pair reliability of network systems with small distances between adjacent nodes

International Nuclear Information System (INIS)

Malinowski, Jacek

2007-01-01

A new method for computing the node-pair reliability of network systems modeled by random graphs with nodes arranged in sequence is presented. It is based on a recursive algorithm using the 'sliding window' technique, the window being composed of several consecutive nodes. In a single step, the connectivity probabilities for all nodes included in the window are found. Subsequently, the window is moved one node forward. This process is repeated until, in the last step, the window reaches the terminal node. The connectivity probabilities found at that point are used to compute the node-pair reliability of the network system considered. The algorithm is designed especially for graphs with small distances between adjacent nodes, where the distance between two nodes is defined as the absolute value of the difference between the nodes' numbers. The maximal distance between any two adjacent nodes is denoted by Γ(G), where G symbolizes a random graph. If Γ(G)=2 then the method can be applied for directed as well as undirected graphs whose nodes and edges are subject to failure. This is important in view of the fact that many algorithms computing network reliability are designed for graphs with failure-prone edges and reliable nodes. If Γ(G)=3 then the method's applicability is limited to undirected graphs with reliable nodes. The main asset of the presented algorithms is their low numerical complexity-O(n), where n denotes the number of nodes

[Biological and neural bases of partner preferences in rodents: models to understand human pair bonds].

Science.gov (United States)

Coria-Avila, G A; Hernández-Aguilar, M E; Toledo-Cárdenas, R; García-Hernández, L I; Manzo, J; Pacheco, P; Miquel, M; Pfaus, J G

To analyse the biological and neural bases of partner preference formation in rodents as models to understand human pair bonding. Rodents are social individuals, capable of forming short- or long-lasting partner preferences that develop slowly by stimuli like cohabitation, or rapidly by stimuli like sex and stress. Dopamine, corticosteroids, oxytocin, vasopressin, and opioids form the neurochemical substrate for pair bonding in areas like the nucleus accumbens, the prefrontal cortex, the piriform cortex, the medial preoptic area, the ventral tegmental area and the medial amygdala, among others. Additional areas may participate depending on the nature of the conditioned stimuli by which and individual recognizes a preferred partner. Animal models help us understand that the capacity of an individual to display long-lasting and selective preferences depends on neural bases, selected throughout evolution. The challenge in neuroscience is to use this knowledge to create new solutions for mental problems associated with the incapacity of an individual to display a social bond, keep one, or cope with the disruption of a consolidated one.

Organizational Relationship Termination Competence

DEFF Research Database (Denmark)

Ritter, Thomas; Geersbro, Jens

2011-01-01

termination are found to significantly affect a firm's relationship termination competence. The findings suggest that managers should regard termination as a legitimate option in customer relationship management. In order to decrease the number of unwanted customers, managers must accept termination......Most firms are involved in a number of customer relationships that drain the firm's resources. However, many firms are hesitant to address this problem. This paper investigates customer relationship termination at the organizational level. We develop and analyze the organizational dimensions...... of organizational termination in order to improve our understanding of the management of termination. The impact of these termination dimensions on the percentage of unwanted customers is developed and tested using PLS on data gathered from a cross-sectional survey of more than 800 sales representatives. We find...

Bio-activity of aminosulfonyl ureas in the light of nucleic acid bases and DNA base pair interaction.

Science.gov (United States)

Mondal Roy, Sutapa

2018-08-01

The quantum chemical descriptors based on density functional theory (DFT) are applied to predict the biological activity (log IC 50 ) of one class of acyl-CoA: cholesterol O-acyltransferase (ACAT) inhibitors, viz. aminosulfonyl ureas. ACAT are very effective agents for reduction of triglyceride and cholesterol levels in human body. Successful two parameter quantitative structure-activity relationship (QSAR) models are developed with a combination of relevant global and local DFT based descriptors for prediction of biological activity of aminosulfonyl ureas. The global descriptors, electron affinity of the ACAT inhibitors (EA) and/or charge transfer (ΔN) between inhibitors and model biosystems (NA bases and DNA base pairs) along with the local group atomic charge on sulfonyl moiety (∑Q Sul ) of the inhibitors reveals more than 90% efficacy of the selected descriptors for predicting the experimental log (IC 50 ) values. Copyright © 2018 Elsevier Ltd. All rights reserved.

Supercritical fluid chromatographic resolution of water soluble isomeric carboxyl/amine terminated peptides facilitated via mobile phase water and ion pair formation.

Science.gov (United States)

Patel, M A; Riley, F; Ashraf-Khorassani, M; Taylor, L T

2012-04-13

Both analytical scale and preparative scale packed column supercritical fluid chromatography (SFC) have found widespread applicability for chiral separations of multiple polar pharmaceutical candidates. However, SFC is rapidly becoming an achiral technique. More specifically, ion pair SFC is finding greater utility for separation of ionic analytes such as amine salts and organic sulfonates. The key to this success is, in part, the incorporation of additives such as trifluoroacetic acid and ammonium acetate into the mobile phase in association with a wide variety of both bonded silica stationary phases and high purity bare silica. Ion pairing SFC coupled with evaporative light scattering detection and mass spectrometric detection is presented here for the separation of water soluble, uncapped, isomeric peptide pairs that differ in amino acid arrangement. The separation is best achieved on either diol-bonded silica or bare silica with 1-5% (w/w) water as a significant ingredient in the mobile phase. Nitrogenous stationary phases such as 2-ethylpyridine, which had been very successful for the separation of capped peptides failed to yield the desired separation regardless of the mobile phase composition. A HILIC type retention mechanism is postulated for the separation of both isomeric uncapped peptide pairs. Copyright © 2012 Elsevier B.V. All rights reserved.

Detecting nonlocal Cooper pair entanglement by optical Bell inequality violation

Energy Technology Data Exchange (ETDEWEB)

Nigg, Simon E.; Tiwari, Rakesh P.; Walter, Stefan; Schmidt, Thomas L. [Department of Physics, University of Basel, Klingelbergstrasse 82, 4056 Basel (Switzerland)

2015-07-01

Based on the Bardeen Cooper Schrieffer (BCS) theory of superconductivity, the coherent splitting of Cooper pairs from a superconductor to two spatially separated quantum dots has been predicted to generate nonlocal pairs of entangled electrons. In order to test this hypothesis, we propose a scheme to transfer the spin state of a split Cooper pair onto the polarization state of a pair of optical photons. We show that the produced photon pairs can be used to violate a Bell inequality, unambiguously demonstrating the entanglement of the split Cooper pairs.

Detecting nonlocal Cooper pair entanglement by optical Bell inequality violation

Science.gov (United States)

Nigg, Simon E.; Tiwari, Rakesh P.; Walter, Stefan; Schmidt, Thomas L.

2015-03-01

Based on the Bardeen-Cooper-Schrieffer theory of superconductivity, the coherent splitting of Cooper pairs from a superconductor to two spatially separated quantum dots has been predicted to generate nonlocal pairs of entangled electrons. In order to test this hypothesis, we propose a scheme to transfer the spin state of a split Cooper pair onto the polarization state of a pair of optical photons. We show that the photon pairs produced can be used to violate a Bell inequality, unambiguously demonstrating the entanglement of the split Cooper pairs.

Error-correcting pairs for a public-key cryptosystem

International Nuclear Information System (INIS)

Pellikaan, Ruud; Márquez-Corbella, Irene

2017-01-01

Code-based Cryptography (CBC) is a powerful and promising alternative for quantum resistant cryptography. Indeed, together with lattice-based cryptography, multivariate cryptography and hash-based cryptography are the principal available techniques for post-quantum cryptography. CBC was first introduced by McEliece where he designed one of the most efficient Public-Key encryption schemes with exceptionally strong security guarantees and other desirable properties that still resist to attacks based on Quantum Fourier Transform and Amplitude Amplification. The original proposal, which remains unbroken, was based on binary Goppa codes. Later, several families of codes have been proposed in order to reduce the key size. Some of these alternatives have already been broken. One of the main requirements of a code-based cryptosystem is having high performance t -bounded decoding algorithms which is achieved in the case the code has a t -error-correcting pair (ECP). Indeed, those McEliece schemes that use GRS codes, BCH, Goppa and algebraic geometry codes are in fact using an error-correcting pair as a secret key. That is, the security of these Public-Key Cryptosystems is not only based on the inherent intractability of bounded distance decoding but also on the assumption that it is difficult to retrieve efficiently an error-correcting pair. In this paper, the class of codes with a t -ECP is proposed for the McEliece cryptosystem. Moreover, we study the hardness of distinguishing arbitrary codes from those having a t -error correcting pair. (paper)

Kitimat LNG terminal

International Nuclear Information System (INIS)

Schmaltz, I.; Boulton, R.

2007-01-01

Kitimat Liquefied Natural Gas (LNG) terminal is a terminal development company owned by Galveston LNG, a privately owned Canadian energy development company. This presentation provided information on Kitimat LNG with particular reference to its terminal located in Bish Cove on the Douglas Channel in British Columbia. This LNG terminal is reported to be the only fully permitted regasification terminal on the west coast of Canada and the United States. The presentation addressed market fundamentals including several graphs, such as world natural gas proved reserves in 2006; LNG supplements to Canadian gas supplies; global LNG demand for 2005-2020; average annual United States LNG imports; and global LNG liquefaction projects. Other market fundamentals were described, including that Kitimat is the only other approved terminal aside from the Costa Azul terminal in Mexico; Kitimat is the only west coast LNG import terminal that connects to midwest and eastern North American markets through existing gas pipelines; LNG producers are looking for destination diversification; and markets and marketers are looking for supply diversification. The authors noted that by 2010, western Canadian gas demand will exceed Californian demand. Other topics that were discussed in the presentation included Canadian natural gas field receipts; unadjusted bitumen production outlook; oil sands gas demand; forward basis fundamentals; and the commercial drivers of the Kitimat LNG terminal. The presentation also discussed the pacific trail pipelines, a partnership between Galveston LNG and Pacific Northern Gas to develop the natural gas transmission line from Kitimat to Summit. The presentation concluded with a discussion of the benefits of Kitimat LNG terminal such as providing access to the largest natural gas markets in the world via major gas transmission lines with spare capacity. figs

INTERACTION OF IRON(II MIXED-LIGAND COMPLEXES WITH DNA: BASE-PAIR SPECIFICITY AND THERMAL DENATURATION STUDIES

Directory of Open Access Journals (Sweden)

Mudasir Mudasir

2010-06-01

Full Text Available A research about base-pair specificity of the DNA binding of [Fe(phen3]2+, [Fe(phen2(dip]2+ and [Fe(phen(dip2]2+ complexes and the effect of calf-thymus DNA (ct-DNA binding of these metal complexes on thermal denaturation of ct-DNA has been carried out. This research is intended to evaluate the preferential binding of the complexes to the sequence of DNA (A-T or G-C sequence and to investigate the binding strength and mode upon their interaction with DNA. Base-pair specificity of the DNA binding of the complexes was determined by comparing the equilibrium binding constant (Kb of each complex to polysynthetic DNA that contain only A-T or G-C sequence. The Kb value of the interaction was determined by spectrophotometric titration and thermal denaturation temperature (Tm was determined by monitoring the absorbance of the mixture solution of each complex and ct-DNA at λ =260 nm as temperature was elevated in the range of 25 - 100 oC. Results of the study show that in general all iron(II complexes studied exhibit a base-pair specificity in their DNA binding to prefer the relatively facile A-T sequence as compared to the G-C one. The thermal denaturation experiments have demonstrated that Fe(phen3]2+ and [Fe(phen2(dip]2+ interact weakly with double helical DNA via electrostatic interaction as indicated by insignificant changes in melting temperature, whereas [Fe(phen2(dip]2+  most probably binds to DNA in mixed modes of interaction, i.e.: intercalation and electrostatic interaction. This conclusion is based on the fact that the binding of [Fe(phen2(dip]2+ to ct-DNA moderately increase the Tm value of ct- DNA   Keywords: DNA Binding, mixed-ligand complexes

Anomeric 2'-Deoxycytidines and Silver Ions: Hybrid Base Pairs with Greatly Enhanced Stability and Efficient DNA Mismatch Detection with α-dC.

Science.gov (United States)

Guo, Xiurong; Seela, Frank

2017-09-04

α-d-Nucleosides are rare in nature but can develop fascinating properties when incorporated into DNA. This work reports on the first silver-mediated base pair constructed from two anomeric nucleosides: α-dC and β-dC. The hybrid base pair was integrated into the DNA and DNA/RNA double helix. A 12-mer duplex with α-dC and β-dC pair exhibits a higher thermal stability (T m =43 °C) than that incorporating the β-dC-Ag + -β-dC homo pair (T m =34 °C). Furthermore, α-dC shows excellent mismatch discrimination for DNA single nucleotide polymorphism (SNP). All four SNPs were identified on the basis of large T m value differences measured in the presence of silver ions. High resolution melting was not required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

The Influence of the Thymine C5 Methyl Group on Spontaneous Base Pair Breathing in DNA

Czech Academy of Sciences Publication Activity Database

Wärmländer, S.; Šponer, Jiří; Leijon, M.; Šponer, Judit E.

2002-01-01

Roč. 277, č. 32 (2002), s. 28491-28497 ISSN 0021-9258 R&D Projects: GA MŠk LN00A016 Institutional research plan: CEZ:AV0Z4040901 Keywords : thymine * DNA * base pairs Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 6.696, year: 2002

Higher order structural effects stabilizing the reverse watson-crick guanine-cytosine base pair in functional RNAs

KAUST Repository

Chawla, Mohit; Abdel-Azeim, Safwat; Oliva, Romina; Cavallo, Luigi

2013-01-01

of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G

Watson-Crick base pairs with thiocarbonyl groups: How sulfur changes the hydrogen bonds in DNA

NARCIS (Netherlands)

Fonseca Guerra, C.; Baerends, E.J.; Bickelhaupt, F.M.

2008-01-01

We have theoretically analyzed mimics of Watson-Crick AT and GC base pairs in which N-H•••O hydrogen bonds are replaced by N-H•••S, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P level. The general effect of the above substitutions is an elongation and a

English for au pairs the au pair's guide to learning English

CERN Document Server

Curtis, Lucy

2014-01-01

English for Au Pairs has interlinked stories about a group of au pairs new to England. Marta, an 18-year-old from Poland arrives in the UK to work as an au pair. Throughout her year-long stay she has many different experiences - some bad, some good - but with the support of her host family she finds new friends and improves her English. English for Au Pairs offers insight into the joys and difficulties of being an au pair while at the same time reinforcing English language learning through grammar explanations and exercises.

Theoretical studies on the intermolecular interactions of potentially primordial base-pair analogues

Czech Academy of Sciences Publication Activity Database

Šponer, Judit E.; Vázquez-Mayagoitia, Á.; Sumpter, B.G.; Leszczynski, J.; Šponer, Jiří; Otyepka, M.; Banáš, P.; Fuentes-Cabrera, M.

2010-01-01

Roč. 16, č. 10 (2010), s. 3057-3065 ISSN 0947-6539 R&D Projects: GA MŠk(CZ) LC06030; GA AV ČR(CZ) 1QS500040581; GA AV ČR(CZ) IAA400040802; GA ČR(CZ) GA203/09/1476 Grant - others:GA MŠk(CZ) LC512; GA AV ČR(CZ) IAA400550701; GA ČR(CZ) GD203/09/H046 Program:LC; IA; GD Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : quantum chemistry * base pairing * origin of life Subject RIV: BO - Biophysics Impact factor: 5.476, year: 2010

Current Hormonal Contraceptive Use Predicts Female Extra-Pair and Dyadic Sexual Behavior: Evidence Based on Czech National Survey Data

Directory of Open Access Journals (Sweden)

Kateřina Klapilová

2014-01-01

Full Text Available Data from 1155 Czech women (493 using oral contraception, 662 non-users, obtained from the Czech National Survey of Sexual Behavior, were used to investigate evolutionary-based hypotheses concerning the predictive value of current oral contraceptive (OC use on extra-pair and dyadic (in-pair sexual behavior of coupled women. Specifically, the aim was to determine whether current OC use was associated with lower extra-pair and higher in-pair sexual interest and behavior, because OC use suppresses cyclical shifts in mating psychology that occur in normally cycling women. Zero-inflated Poisson (ZIP regression and negative binomial models were used to test associations between OC use and these sexual measures, controlling for other relevant predictors (e.g., age, parity, in-pair sexual satisfaction, relationship length. The overall incidence of having had an extra-pair partner or one-night stand in the previous year was not related to current OC use (the majority of the sample had not. However, among the women who had engaged in extra-pair sexual behavior, OC users had fewer one-night stands than non-users, and tended to have fewer partners, than non-users. OC users also had more frequent dyadic intercourse than non-users, potentially indicating higher commitment to their current relationship. These results suggest that suppression of fertility through OC use may alter important aspects of female sexual behavior, with potential implications for relationship functioning and stability.

Detecting nonlocal Cooper pair entanglement by optical Bell inequality violation

OpenAIRE

Nigg, Simon E.; Tiwari, Rakesh P.; Walter, Stefan; Schmidt, Thomas L.

2014-01-01

Based on the Bardeen Cooper Schrieffer (BCS) theory of superconductivity, the coherent splitting of Cooper pairs from a superconductor to two spatially separated quantum dots has been predicted to generate nonlocal pairs of entangled electrons. In order to test this hypothesis, we propose a scheme to transfer the spin state of a split Cooper pair onto the polarization state of a pair of optical photons. We show that the produced photon pairs can be used to violate a Bell inequality, unambiguo...

Evaluation of the Terminal Sequencing and Spacing System for Performance Based Navigation Arrivals

Science.gov (United States)

Thipphavong, Jane; Jung, Jaewoo; Swenson, Harry N.; Martin, Lynne; Lin, Melody; Nguyen, Jimmy

2013-01-01

NASA has developed the Terminal Sequencing and Spacing (TSS) system, a suite of advanced arrival management technologies combining timebased scheduling and controller precision spacing tools. TSS is a ground-based controller automation tool that facilitates sequencing and merging arrivals that have both current standard ATC routes and terminal Performance-Based Navigation (PBN) routes, especially during highly congested demand periods. In collaboration with the FAA and MITRE's Center for Advanced Aviation System Development (CAASD), TSS system performance was evaluated in human-in-the-loop (HITL) simulations with currently active controllers as participants. Traffic scenarios had mixed Area Navigation (RNAV) and Required Navigation Performance (RNP) equipage, where the more advanced RNP-equipped aircraft had preferential treatment with a shorter approach option. Simulation results indicate the TSS system achieved benefits by enabling PBN, while maintaining high throughput rates-10% above baseline demand levels. Flight path predictability improved, where path deviation was reduced by 2 NM on average and variance in the downwind leg length was 75% less. Arrivals flew more fuel-efficient descents for longer, spending an average of 39 seconds less in step-down level altitude segments. Self-reported controller workload was reduced, with statistically significant differences at the p less than 0.01 level. The RNP-equipped arrivals were also able to more frequently capitalize on the benefits of being "Best-Equipped, Best- Served" (BEBS), where less vectoring was needed and nearly all RNP approaches were conducted without interruption.

Observation of H-bond mediated 3hJH2H3coupling constants across Watson-Crick AU base pairs in RNA

International Nuclear Information System (INIS)

Luy, Burkhard; Richter, Uwe; DeJong, Eric S.; Sorensen, Ole W.; Marino, John P.

2002-01-01

3h J H2H3 trans-hydrogen bond scalar coupling constants have been observed for the first time in Watson-Crick AU base pairs in uniformly 15 N-labeled RNA oligonucleotides using a new 2h J NN -HNN-E. COSY experiment. The experiment utilizes adenosine H2 (AH2) for original polarization and detection, while employing 2h J NN couplings for coherence transfer across the hydrogen bonds (H-bonds). The H3 protons of uracil bases are unperturbed throughout the experiment so that these protons appear as passive spins in E. COSY patterns. 3h J H2H3 coupling constants can therefore be accurately measured in the acquisition dimension from the displacement of the E. COSY multiplet components, which are separated by the relatively large 1 J H3N3 coupling constants in the indirect dimension of the two-dimensional experiment. The 3h J H2H3 scalar coupling constants determined for AU base pairs in the two RNA hairpins examined here have been found to be positive and range in magnitude up to 1.8 Hz. Using a molecular fragment representation of an AU base pair, density functional theory/finite field perturbation theory (DFT/FPT) methods have been applied to attempt to predict the relative contributions of H-bond length and angular geometry to the magnitude of 3h J H2H3 coupling constants. Although the DFT/FPT calculations did not reproduce the full range of magnitude observed experimentally for the 3h J H2H3 coupling constants, the calculations do predict the correct sign and general trends in variation in size of these coupling constants. The calculations suggest that the magnitude of the coupling constants depends largely on H-bond length, but can also vary with differences in base pair geometry. The dependency of the 3h J H2H3 coupling constant on H-bond strength and geometry makes it a new probe for defining base pairs in NMR studies of nucleic acids

Normally-off AlGaN/GaN-based MOS-HEMT with self-terminating TMAH wet recess etching

Science.gov (United States)

Son, Dong-Hyeok; Jo, Young-Woo; Won, Chul-Ho; Lee, Jun-Hyeok; Seo, Jae Hwa; Lee, Sang-Heung; Lim, Jong-Won; Kim, Ji Heon; Kang, In Man; Cristoloveanu, Sorin; Lee, Jung-Hee

2018-03-01

Normally-off AlGaN/GaN-based MOS-HEMT has been fabricated by utilizing damage-free self-terminating tetramethyl ammonium hydroxide (TMAH) recess etching. The device exhibited a threshold voltage of +2.0 V with good uniformity, extremely small hysteresis of ∼20 mV, and maximum drain current of 210 mA/mm. The device also exhibited excellent off-state performances, such as breakdown voltage of ∼800 V with off-state leakage current as low as ∼10-12 A and high on/off current ratio (Ion/Ioff) of 1010. These excellent device performances are believed to be due to the high quality recessed surface, provided by the simple self-terminating TMAH etching.

Generation of arbitrary vector fields based on a pair of orthogonal elliptically polarized base vectors.

Science.gov (United States)

Xu, Danfeng; Gu, Bing; Rui, Guanghao; Zhan, Qiwen; Cui, Yiping

2016-02-22

We present an arbitrary vector field with hybrid polarization based on the combination of a pair of orthogonal elliptically polarized base vectors on the Poincaré sphere. It is shown that the created vector field is only dependent on the latitude angle 2χ but is independent on the longitude angle 2ψ on the Poincaré sphere. By adjusting the latitude angle 2χ, which is related to two identical waveplates in a common path interferometric arrangement, one could obtain arbitrary type of vector fields. Experimentally, we demonstrate the generation of such kind of vector fields and confirm the distribution of state of polarization by the measurement of Stokes parameters. Besides, we investigate the tight focusing properties of these vector fields. It is found that the additional degree of freedom 2χ provided by arbitrary vector field with hybrid polarization allows one to control the spatial structure of polarization and to engineer the focusing field.

Development of a clinician reputation metric to identify appropriate problem-medication pairs in a crowdsourced knowledge base.

Science.gov (United States)

McCoy, Allison B; Wright, Adam; Rogith, Deevakar; Fathiamini, Safa; Ottenbacher, Allison J; Sittig, Dean F

2014-04-01

Correlation of data within electronic health records is necessary for implementation of various clinical decision support functions, including patient summarization. A key type of correlation is linking medications to clinical problems; while some databases of problem-medication links are available, they are not robust and depend on problems and medications being encoded in particular terminologies. Crowdsourcing represents one approach to generating robust knowledge bases across a variety of terminologies, but more sophisticated approaches are necessary to improve accuracy and reduce manual data review requirements. We sought to develop and evaluate a clinician reputation metric to facilitate the identification of appropriate problem-medication pairs through crowdsourcing without requiring extensive manual review. We retrieved medications from our clinical data warehouse that had been prescribed and manually linked to one or more problems by clinicians during e-prescribing between June 1, 2010 and May 31, 2011. We identified measures likely to be associated with the percentage of accurate problem-medication links made by clinicians. Using logistic regression, we created a metric for identifying clinicians who had made greater than or equal to 95% appropriate links. We evaluated the accuracy of the approach by comparing links made by those physicians identified as having appropriate links to a previously manually validated subset of problem-medication pairs. Of 867 clinicians who asserted a total of 237,748 problem-medication links during the study period, 125 had a reputation metric that predicted the percentage of appropriate links greater than or equal to 95%. These clinicians asserted a total of 2464 linked problem-medication pairs (983 distinct pairs). Compared to a previously validated set of problem-medication pairs, the reputation metric achieved a specificity of 99.5% and marginally improved the sensitivity of previously described knowledge bases. A

Effect of Watson-Crick and Hoogsteen base pairing on the conformational stability of C8-phenoxyl-2'-deoxyguanosine adducts.

Science.gov (United States)

Millen, Andrea L; Churchill, Cassandra D M; Manderville, Richard A; Wetmore, Stacey D

2010-10-14

Bulky DNA addition products (adducts) formed through attack at the C8 site of guanine can adopt the syn orientation about the glycosidic bond due to changes in conformational stability or hydrogen-bonding preferences directly arising from the bulky group. Indeed, the bulky substituent may improve the stability of (non-native) Hoogsteen pairs. Therefore, such adducts often result in mutations upon DNA replication. This work examines the hydrogen-bonded pairs between the Watson-Crick and Hoogsteen faces of the ortho or para C8-phenoxyl-2'-deoxyguanosine adduct and each natural (undamaged) nucleobase with the goal to clarify the conformational preference of this type of damage, as well as provide insight into the likelihood of subsequent mutation events. B3LYP/6-311+G(2df,p)//B3LYP/6-31G(d) hydrogen-bond strengths were determined using both nucleobase and nucleoside models for adduct pairs, as well as the corresponding complexes involving natural 2'-deoxyguanosine. In addition to the magnitude of the binding strengths, the R(C1'···C1') distances and ∠(N9C1'C1') angles, as well as the degree of propeller-twist and buckle distortions, were carefully compared to the values observed in natural DNA strands. Due to structural changes in the adduct monomer upon inclusion of the sugar moiety, the monomer deformation energy significantly affects the relative hydrogen-bond strengths calculated with the nucleobase and nucleoside models. Therefore, we recommend the use of at least a nucleoside model to accurately evaluate hydrogen-bond strengths of base pairs involving flexible, bulky nucleobase adducts. Our results also emphasize the importance of considering both the magnitude of the hydrogen-bond strength and the structure of the base pair when predicting the preferential binding patterns of nucleobases. Using our best models, we conclude that the Watson-Crick face of the ortho phenoxyl adduct forms significantly more stable complexes than the Hoogsteen face, which

Photoinduced electron transfer in a Watson-Crick base-paired, 2-aminopurine:uracil-C60 hydrogen bonding conjugate.

Science.gov (United States)

D'Souza, Francis; Gadde, Suresh; Islam, D-M Shafiqul; Pang, Siew-Cheng; Schumacher, Amy Lea; Zandler, Melvin E; Horie, Rumiko; Araki, Yasuyaki; Ito, Osamu

2007-02-07

A fluorescent reporter molecule, 2-aminopurine was self-assembled via Watson-Crick base-pairing to a uracil appended fullerene to form a donor-acceptor conjugate; efficient photoinduced charge separation was confirmed by time-resolved emission and transient absorption spectral studies.

Termination in cognitive-behavioral therapy with children, adolescents, and parents.

Science.gov (United States)

Vidair, Hilary B; Feyijinmi, Grace O; Feindler, Eva L

2017-03-01

The process of terminating cognitive-behavioral therapy (CBT) with families has been largely neglected in the literature, with the limited research focused on premature termination. This article describes the natural termination process in CBT with children, adolescents, and their parents. Based on existing theories, we describe a cognitive-behavioral model for: (a) initiating and engaging in discussion of termination, (b) processing the termination of treatment and the therapeutic relationship, (c) key aspects of the termination process in the final session, and (d) the very end of the final session (saying goodbye). For each of the 4 components, we review relevant theories, provide clinical exchanges to demonstrate techniques, and provide related research support. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

Thermodynamics of pairing phase transition in nuclei

International Nuclear Information System (INIS)

Karim, Afaque; Ahmad, Shakeb

2014-01-01

The pairing gaps, pairing energy, heat capacity and entropy are calculated within BCS (Bardeen- Cooper-Schrieffer) based quasi particle approach, including thermal fluctuations on pairing field within pairing model for all nuclei (light, medium, heavy and super heavy nuclei). Quasi particles approach in BCS theory was introduced and reformulated to study various properties. For thermodynamic behavior of nuclei at finite temperatures, the anomalous averages of creation and annihilation operators are introduced. It is solved self consistently at finite temperatures to obtain BCS Hamiltonian. After doing unitary transformation, we obtained the Hamiltonian in the diagonal form. Thus, one gets temperature dependence gap parameter and pairing energy for nuclei. Moreover, the energy at finite temperatures is the sum of the condensation energy and the thermal energy of fermionic quasi particles. With the help of BCS Hamiltonian, specific heat, entropy and free energy are calculated for different nuclei. In this paper the gap parameter occupation number and pairing energy as a function of temperature which is important for all the light, medium, heavy and super heavy nuclei is calculated. Moreover, the various thermo dynamical quantities like specific heat, entropy and free energy is also obtained for different nuclei. Thus, the thermodynamics of pairing phase transition in nuclei is studied

Termination Criteria for Computerized Classification Testing

Directory of Open Access Journals (Sweden)

Nathan A. Thompson

2011-02-01

Full Text Available Computerized classification testing (CCT is an approach to designing tests with intelligent algorithms, similar to adaptive testing, but specifically designed for the purpose of classifying examinees into categories such as - pass- and - fail.- Like adaptive testing for point estimation of ability, the key component is the termination criterion, namely the algorithm that decides whether to classify the examinee and end the test or to continue and administer another item. This paper applies a newly suggested termination criterion, the generalized likelihood ratio (GLR, to CCT. It also explores the role of the indifference region in the specification of likelihood-ratio based termination criteria, comparing the GLR to the sequential probability ratio test. Results from simulation studies suggest that the GLR is always at least as efficient as existing methods.

Ion-pair chromatography of nucleic acid derivatives

International Nuclear Information System (INIS)

Perrone, P.A.; Brown, P.R.

1985-01-01

Little work has been done on the ion-pair chromatography of nucleic acid constituents, although there is a great potential for the use of this technique in the field. Since the classic work in 1949, nucleotides, as well as nucleosides and bases, have been separated by ion-exchange chromatography. However, ion exchange is a difficult mode and most researchers prefer the use of reversed-phase whenever possible. Although reversed-phase is now the method of choice, ionic compounds like nucleotides and some of the more polar bases are not adequately retained by many systems of this type. In addition, it is difficult to analyze simultaneously members of all three classes of nucleic acid compounds (bases, nucleosides, and nucleotides) using a reversed-phase system, even with gradient elution. Ion pairing can be a useful technique because, theoretically, the separation of nonionic bases and nucleosides along with the ionic nucleotides can be achieved. Additionally, each group of compounds may be separated isocratically. In this chapter, they will discuss ion-pair chromatography as applied to nucleic acid constituents. The current theories, advantages and disadvantages, a limited number of applications, and potential for future work are presented

Terminal Disease: A Biolaw Management

Directory of Open Access Journals (Sweden)

Francisco Rivas García

2017-10-01

Full Text Available There are numerous and varied pathologies that can lead to a state of terminal illness, provoking numerous bioethical dilemmas that are inherent and specific to each circumstance. The objective of the present work has been to provide a current and useful analysis that can help to understand the main bioethical problems, from the perspective of biolaw that must be solved in the inevitable path towards the end of life that any terminal illness implies. The methodology used included a study of bibliographic documentation in the main databases of interest in bioethics. It can be concluded that the biolaw is a very useful tool that helps health care professionals and relatives when it comes to the analysis and decision making regarding a terminal illness. Independently of medical practice based on protocols and scientific knowledge, it is necessary to ensure that not everything that can legally be carried out is accepted in the field of biolaw.

Chitin based polyurethanes using hydroxyl terminated polybutadiene, part III: surface characteristics.

Science.gov (United States)

Zia, Khalid Mahmood; Zuber, Mohammad; Saif, Muhammad Jawwad; Jawaid, Mohammad; Mahmood, Kashif; Shahid, Muhammad; Anjum, Muhammad Naveed; Ahmad, Mirza Nadeem

2013-11-01

Hydroxy terminated polybutadiene (HTPB)-chitin based polyurethanes (PUs) with controlled hydrophobicity were synthesized using HTPB and toluene diisocyanate (TDI). The prepolymer was extended with different mass ratios of chitin and 1,4-butane diol (BDO). The effect of chitin contents in chain extender (CE) proportions on surface properties was studied and investigated. Incorporation of chitin contents into the final PU showed decrease in contact angle value of water drop, water absorption (%) and swelling behavior. The antibacterial activity of the prepared samples was affected by varying the chitin contents in the chemical composition of the final PU. The results demonstrated that the use of prepared material can be suggested as non-absorbable suture. Copyright © 2013 Elsevier B.V. All rights reserved.

A configuration space of homologous proteins conserving mutual information and allowing a phylogeny inference based on pair-wise Z-score probabilities.

Science.gov (United States)

Bastien, Olivier; Ortet, Philippe; Roy, Sylvaine; Maréchal, Eric

2005-03-10

Popular methods to reconstruct molecular phylogenies are based on multiple sequence alignments, in which addition or removal of data may change the resulting tree topology. We have sought a representation of homologous proteins that would conserve the information of pair-wise sequence alignments, respect probabilistic properties of Z-scores (Monte Carlo methods applied to pair-wise comparisons) and be the basis for a novel method of consistent and stable phylogenetic reconstruction. We have built up a spatial representation of protein sequences using concepts from particle physics (configuration space) and respecting a frame of constraints deduced from pair-wise alignment score properties in information theory. The obtained configuration space of homologous proteins (CSHP) allows the representation of real and shuffled sequences, and thereupon an expression of the TULIP theorem for Z-score probabilities. Based on the CSHP, we propose a phylogeny reconstruction using Z-scores. Deduced trees, called TULIP trees, are consistent with multiple-alignment based trees. Furthermore, the TULIP tree reconstruction method provides a solution for some previously reported incongruent results, such as the apicomplexan enolase phylogeny. The CSHP is a unified model that conserves mutual information between proteins in the way physical models conserve energy. Applications include the reconstruction of evolutionary consistent and robust trees, the topology of which is based on a spatial representation that is not reordered after addition or removal of sequences. The CSHP and its assigned phylogenetic topology, provide a powerful and easily updated representation for massive pair-wise genome comparisons based on Z-score computations.

A configuration space of homologous proteins conserving mutual information and allowing a phylogeny inference based on pair-wise Z-score probabilities

Directory of Open Access Journals (Sweden)

Maréchal Eric

2005-03-01

Full Text Available Abstract Background Popular methods to reconstruct molecular phylogenies are based on multiple sequence alignments, in which addition or removal of data may change the resulting tree topology. We have sought a representation of homologous proteins that would conserve the information of pair-wise sequence alignments, respect probabilistic properties of Z-scores (Monte Carlo methods applied to pair-wise comparisons and be the basis for a novel method of consistent and stable phylogenetic reconstruction. Results We have built up a spatial representation of protein sequences using concepts from particle physics (configuration space and respecting a frame of constraints deduced from pair-wise alignment score properties in information theory. The obtained configuration space of homologous proteins (CSHP allows the representation of real and shuffled sequences, and thereupon an expression of the TULIP theorem for Z-score probabilities. Based on the CSHP, we propose a phylogeny reconstruction using Z-scores. Deduced trees, called TULIP trees, are consistent with multiple-alignment based trees. Furthermore, the TULIP tree reconstruction method provides a solution for some previously reported incongruent results, such as the apicomplexan enolase phylogeny. Conclusion The CSHP is a unified model that conserves mutual information between proteins in the way physical models conserve energy. Applications include the reconstruction of evolutionary consistent and robust trees, the topology of which is based on a spatial representation that is not reordered after addition or removal of sequences. The CSHP and its assigned phylogenetic topology, provide a powerful and easily updated representation for massive pair-wise genome comparisons based on Z-score computations.

Fragment-Based Drug Discovery in the Bromodomain and Extra-Terminal Domain Family.

Science.gov (United States)

Radwan, Mostafa; Serya, Rabah

2017-08-01

Bromodomain and extra-terminal domain (BET) inhibition has emerged recently as a potential therapeutic target for the treatment of many human disorders such as atherosclerosis, inflammatory disorders, chronic obstructive pulmonary disease (COPD), some viral infections, and cancer. Since the discovery of the two potent inhibitors, I-BET762 and JQ1, different research groups have used different techniques to develop novel potent and selective inhibitors. In this review, we will be concerned with the trials that used fragment-based drug discovery (FBDD) approaches to discover or optimize BET inhibitors, also showing fragments that can be further optimized in future projects to reach novel potent BET inhibitors. © 2017 Deutsche Pharmazeutische Gesellschaft.

RNA-PAIRS: RNA probabilistic assignment of imino resonance shifts

International Nuclear Information System (INIS)

Bahrami, Arash; Clos, Lawrence J.; Markley, John L.; Butcher, Samuel E.; Eghbalnia, Hamid R.

2012-01-01

The significant biological role of RNA has further highlighted the need for improving the accuracy, efficiency and the reach of methods for investigating RNA structure and function. Nuclear magnetic resonance (NMR) spectroscopy is vital to furthering the goals of RNA structural biology because of its distinctive capabilities. However, the dispersion pattern in the NMR spectra of RNA makes automated resonance assignment, a key step in NMR investigation of biomolecules, remarkably challenging. Herein we present RNA Probabilistic Assignment of Imino Resonance Shifts (RNA-PAIRS), a method for the automated assignment of RNA imino resonances with synchronized verification and correction of predicted secondary structure. RNA-PAIRS represents an advance in modeling the assignment paradigm because it seeds the probabilistic network for assignment with experimental NMR data, and predicted RNA secondary structure, simultaneously and from the start. Subsequently, RNA-PAIRS sets in motion a dynamic network that reverberates between predictions and experimental evidence in order to reconcile and rectify resonance assignments and secondary structure information. The procedure is halted when assignments and base-parings are deemed to be most consistent with observed crosspeaks. The current implementation of RNA-PAIRS uses an initial peak list derived from proton-nitrogen heteronuclear multiple quantum correlation ( 1 H– 15 N 2D HMQC) and proton–proton nuclear Overhauser enhancement spectroscopy ( 1 H– 1 H 2D NOESY) experiments. We have evaluated the performance of RNA-PAIRS by using it to analyze NMR datasets from 26 previously studied RNAs, including a 111-nucleotide complex. For moderately sized RNA molecules, and over a range of comparatively complex structural motifs, the average assignment accuracy exceeds 90%, while the average base pair prediction accuracy exceeded 93%. RNA-PAIRS yielded accurate assignments and base pairings consistent with imino resonances for a

RNA-PAIRS: RNA probabilistic assignment of imino resonance shifts

Energy Technology Data Exchange (ETDEWEB)

Bahrami, Arash; Clos, Lawrence J.; Markley, John L.; Butcher, Samuel E. [National Magnetic Resonance Facility at Madison (United States); Eghbalnia, Hamid R., E-mail: eghbalhd@uc.edu [University of Cincinnati, Department of Molecular and Cellular Physiology (United States)

2012-04-15

The significant biological role of RNA has further highlighted the need for improving the accuracy, efficiency and the reach of methods for investigating RNA structure and function. Nuclear magnetic resonance (NMR) spectroscopy is vital to furthering the goals of RNA structural biology because of its distinctive capabilities. However, the dispersion pattern in the NMR spectra of RNA makes automated resonance assignment, a key step in NMR investigation of biomolecules, remarkably challenging. Herein we present RNA Probabilistic Assignment of Imino Resonance Shifts (RNA-PAIRS), a method for the automated assignment of RNA imino resonances with synchronized verification and correction of predicted secondary structure. RNA-PAIRS represents an advance in modeling the assignment paradigm because it seeds the probabilistic network for assignment with experimental NMR data, and predicted RNA secondary structure, simultaneously and from the start. Subsequently, RNA-PAIRS sets in motion a dynamic network that reverberates between predictions and experimental evidence in order to reconcile and rectify resonance assignments and secondary structure information. The procedure is halted when assignments and base-parings are deemed to be most consistent with observed crosspeaks. The current implementation of RNA-PAIRS uses an initial peak list derived from proton-nitrogen heteronuclear multiple quantum correlation ({sup 1}H-{sup 15}N 2D HMQC) and proton-proton nuclear Overhauser enhancement spectroscopy ({sup 1}H-{sup 1}H 2D NOESY) experiments. We have evaluated the performance of RNA-PAIRS by using it to analyze NMR datasets from 26 previously studied RNAs, including a 111-nucleotide complex. For moderately sized RNA molecules, and over a range of comparatively complex structural motifs, the average assignment accuracy exceeds 90%, while the average base pair prediction accuracy exceeded 93%. RNA-PAIRS yielded accurate assignments and base pairings consistent with imino

Attenuation-based kV pair selection in dual source dual energy computed tomography angiography of the chest: impact on radiation dose and image quality

Energy Technology Data Exchange (ETDEWEB)

Renapurkar, Rahul D.; Azok, Joseph; Lempel, Jason; Karim, Wadih; Graham, Ruffin [Thoracic Imaging, L10, Imaging Institute, Cleveland Clinic, Cleveland, OH (United States); Primak, Andrew [Siemens Medical Solutions, Malvern, PA (United States); Tandon, Yasmeen [Case Western Reserve University-Metro Health Medical Center, Department of Radiology, Cleveland, OH (United States); Bullen, Jennifer [Quantitative Health Sciences, Cleveland Clinic, Cleveland, OH (United States); Dong, Frank [Section of Medical Physics, Cleveland Clinic, Cleveland, OH (United States)

2017-08-15

The purpose of this study was to evaluate the impact of attenuation-based kilovoltage (kV) pair selection in dual source dual energy (DSDE)-pulmonary embolism (PE) protocol examinations on radiation dose savings and image quality. A prospective study was carried out on 118 patients with suspected PE. In patients in whom attenuation-based kV pair selection selected the 80/140Sn kV pair, the pre-scan 100/140Sn CTDIvol (computed tomography dose index volume) values were compared with the pre-scan 80/140Sn CTDIvol values. Subjective and objective image quality parameters were assessed. Attenuation-based kV pair selection switched to the 80/140Sn kV pair (''switched'' cohort) in 63 out of 118 patients (53%). The mean 100/140Sn pre-scan CTDIvol was 8.8 mGy, while the mean 80/140Sn pre-scan CTDIvol was 7.5 mGy. The average estimated dose reduction for the ''switched'' cohort was 1.3 mGy (95% CI 1.2, 1.4; p < 0.001), representing a 15% reduction in dose. After adjusting for patient weight, mean attenuation was significantly higher in the ''switched'' vs. ''non-switched'' cohorts in all five pulmonary arteries and in all lobes on iodine maps. This study demonstrates that attenuation-based kV pair selection in DSDE examination is feasible and can offer radiation dose reduction without compromising image quality. (orig.)

DNA sequence of 15 base pairs is sufficient to mediate both glucocorticoid and progesterone induction of gene expression

International Nuclear Information System (INIS)

Straehle, U.; Klock, G.; Schuetz, G.

1987-01-01

To define the recognition sequence of the glucocorticoid receptor and its relationship with that of the progesterone receptor, oligonucleotides derived from the glucocorticoid response element of the tyrosine aminotransferase gene were tested upstream of a heterologous promoter for their capacity to mediate effects of these two steroids. The authors show that a 15-base-pair sequence with partial symmetry is sufficient to confer glucocorticoid inducibility on the promoter of the herpes simplex virus thymidine kinase gene. The same 15-base-pair sequence mediates induction by progesterone. Point mutations in the recognition sequence affect inducibility by glucocorticoids and progesterone similarly. Together with the strong conservation of the sequence of the DNA-binding domain of the two receptors, these data suggest that both proteins recognize a sequence that is similar, if not the same

Can tautomerization of the A·T Watson-Crick base pair via double proton transfer provoke point mutations during DNA replication? A comprehensive QM and QTAIM analysis.

Science.gov (United States)

Brovarets, Ol'ha O; Hovorun, Dmytro M

2014-01-01

Trying to answer the question posed in the title, we have carried out a detailed theoretical investigation of the biologically important mechanism of the tautomerization of the A·T Watson-Crick DNA base pair, information that is hard to establish experimentally. By combining theoretical investigations at the MP2 and density functional theory levels of QM theory with quantum theory of atoms in molecules analysis, the tautomerization of the A·T Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4) corresponding to a hydrophobic interfaces of protein-nucleic acid interactions. Based on the sweeps of the electron-topological, geometric, and energetic parameters, which describe the course of the tautomerization along its intrinsic reaction coordinate (IRC), it was proved that the A·T → A(∗)·T(∗) tautomerization through the DPT is a concerted (i.e. the pathway without an intermediate) and asynchronous (i.e. protons move with a time gap) process. The limiting stage of this phenomenon is the final PT along the N6H⋯O4 hydrogen bond (H-bond). The continuum with ϵ = 4 does not affect qualitatively the course of the tautomerization reaction: similar to that observed in vacuo, it proceeds via a concerted asynchronous process with the same structure of the transition state (TS). For the first time, the nine key points along the IRC of the A·T base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These nine key points have been used to define the reactant, TS, and product regions of the DPT in the A·T base pair. Considering the energy dependence of each of the three H-bonds, which stabilize the Watson-Crick and Löwdin's base pairs, along the IRC of the tautomerization, it was found that all these H

Affine pairings on ARM

NARCIS (Netherlands)

Acar, T.; Lauter, K.; Naehrig, M.; Shumow, D.; Abdalla, M.; Lange, T.

2013-01-01

We report on relative performance numbers for affine and projective pairings on a dual-core Cortex A9 ARM processor. Using a fast inversion in the base field and doing inversion in extension fields by using the norm map to reduce to inversions in smaller fields, we find a very low ratio of

Adiabatic pair creation in heavy-ion and laser fields

International Nuclear Information System (INIS)

Pickl, P.; Durr, D.

2008-01-01

The planned generation of lasers and heavy-ion colliders renews the hope to see electron-positron pair creation in strong classical fields. This old prediction is usually referred to as spontaneous pair creation. We observe that both heavy-ion collisions and pair creation in strong laser fields, are instances of the theory of adiabatic pair creation. We shall present the theory, thereby correcting earlier results. We give the momentum distribution of created pairs in overcritical fields. We discuss carefully the proposed experimental verifications and conclude that pure laser-based experiments are highly questionable. We propose a new experiment, joining laser fields and heavy ions, which may be feasible with present-day technology and which may indeed verify the theoretical prediction of adiabatic pair creation. Our presentation relies on recent rigorous works in mathematical physics. (authors)

Mahonian pairs

OpenAIRE

Sagan, Bruce E.; Savage, Carla D.

2012-01-01

We introduce the notion of a Mahonian pair. Consider the set, P^*, of all words having the positive integers as alphabet. Given finite subsets S,T of P^*, we say that (S,T) is a Mahonian pair if the distribution of the major index, maj, over S is the same as the distribution of the inversion number, inv, over T. So the well-known fact that maj and inv are equidistributed over the symmetric group, S_n, can be expressed by saying that (S_n,S_n) is a Mahonian pair. We investigate various Mahonia...

Lax pairs: a novel type of separability

International Nuclear Information System (INIS)

Fokas, A S

2009-01-01

An attempt is made to place into historical context the fundamental concept of Lax pairs. For economy of presentation, emphasis is placed on the effectiveness of Lax pairs for the analysis of integrable nonlinear evolution PDEs. It is argued that Lax pairs provide a deeper type of separability than the classical separation of variables. Indeed, it is shown that: (a) the solution of the Cauchy problem of evolution equations is based on the derivation of a nonlinear Fourier transform pair, and this is achieved by employing the spectral analysis of one of the two eigenvalue equations forming a Lax pair; thus, although this methodology still follows the reverent philosophy of the classical separation of variables and transform methods, it can be applied to a class of nonlinear PDEs. (b) The solution of initial-boundary-value problems of evolution equations is based on the simultaneous spectral analysis of both equations forming a Lax pair and hence, in a sense, it employs the synthesis instead of the separation of variables; this methodology does not have a direct classical analogue, however, it can be considered as the nonlinearization of a method which combines Green's function classical integral representations with an analogue of the method of images, but which are now formulated in the spectral (Fourier) instead of the physical space. In addition to presenting a general methodology for analysing initial- and initial-boundary-value problems for nonlinear integrable evolution equations in one and two spatial variables, recent progress is reviewed for the derivation and the solution of integrable nonlinear evolution PDEs formulated in higher than two spatial dimensions. (topical review)

Liability for wrongful terminations: are hospitals at risk?

Science.gov (United States)

Hames, D S

1991-01-01

This article examines the extent to which the three principal exceptions to the common-law doctrine of employment-at-will--namely the public policy, implied contract, and good faith and fair dealing exceptions--have been recognized in hospital termination cases. State supreme court and appellate court cases are analyzed to illustrate the type of conduct that precipitated wrongful termination claims against hospitals during the 1980s, how the courts disposed of these claims, and the rationale underlying their decisions. Suggestions, based on these and related cases, for avoiding or at least minimizing liability for wrongfully terminating hospital employees, are presented.

Research and design of smart grid monitoring control via terminal based on iOS system

Science.gov (United States)

Fu, Wei; Gong, Li; Chen, Heli; Pan, Guangji

2017-06-01

Aiming at a series of problems existing in current smart grid monitoring Control Terminal, such as high costs, poor portability, simple monitoring system, poor software extensions, low system reliability when transmitting information, single man-machine interface, poor security, etc., smart grid remote monitoring system based on the iOS system has been designed. The system interacts with smart grid server so that it can acquire grid data through WiFi/3G/4G networks, and monitor each grid line running status, as well as power plant equipment operating conditions. When it occurs an exception in the power plant, incident information can be sent to the user iOS terminal equipment timely, which will provide troubleshooting information to help the grid staff to make the right decisions in a timely manner, to avoid further accidents. Field tests have shown the system realizes the integrated grid monitoring functions, low maintenance cost, friendly interface, high security and reliability, and it possesses certain applicable value.

Noninteractive Verifiable Outsourcing Algorithm for Bilinear Pairing with Improved Checkability

Directory of Open Access Journals (Sweden)

Yanli Ren

2017-01-01

Full Text Available It is well known that the computation of bilinear pairing is the most expensive operation in pairing-based cryptography. In this paper, we propose a noninteractive verifiable outsourcing algorithm of bilinear pairing based on two servers in the one-malicious model. The outsourcer need not execute any expensive operation, such as scalar multiplication and modular exponentiation. Moreover, the outsourcer could detect any failure with a probability close to 1 if one of the servers misbehaves. Therefore, the proposed algorithm improves checkability and decreases communication cost compared with the previous ones. Finally, we utilize the proposed algorithm as a subroutine to achieve an anonymous identity-based encryption (AIBE scheme with outsourced decryption and an identity-based signature (IBS scheme with outsourced verification.

Pair-correlations in swimmer suspensions

Science.gov (United States)

Nambiar, Sankalp; Subramanian, Ganesh

2017-11-01

Suspensions of rear-actuated swimming microorganisms, such as E.coli, exhibit several interesting phenomena including spontaneous pattern formation above a critical concentration, novel rheological properties, shear-induced concentration banding etc. Explanations based on mean-field theory are only qualitative, since interactions between swimmers are important for typical experimental concentrations. We analytically characterize the hydrodynamic pair-interactions in a quiescent suspension of slender straight swimmers. The pair-correlation, calculated at leading order by integrating the swimmer velocity disturbances along straight trajectories, decays as 1/r2 for r >> L (L being the swimmer size). This allows us to characterize both polar and nematic correlations in an interacting swimmer suspension. In the absence of correlations, the velocity covariance asymptotes from a constant for r > L, the latter being characteristic of a suspension of non-interacting point force-dipoles. On including correlations, the slow decay of the pair-orientation correlation leads to an additional contribution to the velocity covariance that diverges logarithmically with system size.

NetAcet: prediction of N-terminal acetylation sites

DEFF Research Database (Denmark)

Kiemer, Lars; Bendtsen, Jannick Dyrløv; Blom, Nikolaj

2005-01-01

Summary: We present here a neural network based method for prediction of N-terminal acetylation-by far the most abundant post-translational modification in eukaryotes. The method was developed on a yeast dataset for N-acetyltransferase A (NatA) acetylation, which is the type of N-acetylation for ......Summary: We present here a neural network based method for prediction of N-terminal acetylation-by far the most abundant post-translational modification in eukaryotes. The method was developed on a yeast dataset for N-acetyltransferase A (NatA) acetylation, which is the type of N...

Light-emitting self-assembled peptide nucleic acids exhibit both stacking interactions and Watson-Crick base pairing.

Science.gov (United States)

Berger, Or; Adler-Abramovich, Lihi; Levy-Sakin, Michal; Grunwald, Assaf; Liebes-Peer, Yael; Bachar, Mor; Buzhansky, Ludmila; Mossou, Estelle; Forsyth, V Trevor; Schwartz, Tal; Ebenstein, Yuval; Frolow, Felix; Shimon, Linda J W; Patolsky, Fernando; Gazit, Ehud

2015-04-01

The two main branches of bionanotechnology involve the self-assembly of either peptides or DNA. Peptide scaffolds offer chemical versatility, architectural flexibility and structural complexity, but they lack the precise base pairing and molecular recognition available with nucleic acid assemblies. Here, inspired by the ability of aromatic dipeptides to form ordered nanostructures with unique physical properties, we explore the assembly of peptide nucleic acids (PNAs), which are short DNA mimics that have an amide backbone. All 16 combinations of the very short di-PNA building blocks were synthesized and assayed for their ability to self-associate. Only three guanine-containing di-PNAs-CG, GC and GG-could form ordered assemblies, as observed by electron microscopy, and these di-PNAs efficiently assembled into discrete architectures within a few minutes. The X-ray crystal structure of the GC di-PNA showed the occurrence of both stacking interactions and Watson-Crick base pairing. The assemblies were also found to exhibit optical properties including voltage-dependent electroluminescence and wide-range excitation-dependent fluorescence in the visible region.

Ponderomotive effects in multiphoton pair production

Science.gov (United States)

Kohlfürst, Christian; Alkofer, Reinhard

2018-02-01

The Dirac-Heisenberg-Wigner formalism is employed to investigate electron-positron pair production in cylindrically symmetric but otherwise spatially inhomogeneous, oscillating electric fields. The oscillation frequencies are hereby tuned to obtain multiphoton pair production in the nonperturbative threshold regime. An effective mass, as well as a trajectory-based semiclassical analysis, is introduced in order to interpret the numerical results for the distribution functions as well as for the particle yields and spectra. The results, including the asymptotic particle spectra, display clear signatures of ponderomotive forces.

NMR structure of the N-terminal domain of the replication initiator protein DnaA

Energy Technology Data Exchange (ETDEWEB)

Wemmer, David E.; Lowery, Thomas J.; Pelton, Jeffrey G.; Chandonia, John-Marc; Kim, Rosalind; Yokota, Hisao; Wemmer, David E.

2007-08-07

DnaA is an essential component in the initiation of bacterial chromosomal replication. DnaA binds to a series of 9 base pair repeats leading to oligomerization, recruitment of the DnaBC helicase, and the assembly of the replication fork machinery. The structure of the N-terminal domain (residues 1-100) of DnaA from Mycoplasma genitalium was determined by NMR spectroscopy. The backbone r.m.s.d. for the first 86 residues was 0.6 +/- 0.2 Angstrom based on 742 NOE, 50 hydrogen bond, 46 backbone angle, and 88 residual dipolar coupling restraints. Ultracentrifugation studies revealed that the domain is monomeric in solution. Features on the protein surface include a hydrophobic cleft flanked by several negative residues on one side, and positive residues on the other. A negatively charged ridge is present on the opposite face of the protein. These surfaces may be important sites of interaction with other proteins involved in the replication process. Together, the structure and NMR assignments should facilitate the design of new experiments to probe the protein-protein interactions essential for the initiation of DNA replication.

Emergency Medical Technicians Are Often Consulted on Termination of Resuscitation, and Will Terminate Resuscitation Based on Controversial Single Factors

DEFF Research Database (Denmark)

Mygind-Klausen, Troels; Glerup Lauridsen, Kasper; Bødtker, Henrik

2016-01-01

Introduction: Many out-of-hospital cardiopulmonary resuscitation (CPR) attempts have to be terminated. Previous studies have investigated knowledge on abandoning resuscitation among physicians. In the prehospital setting emergency medical technicians (EMTs) may be involved in the decision......: 100%) participated. Median clinical experience was 12 (IQR: 6-22) years. All EMTs had performed resuscitation (median time since last resuscitation attempt: 1 (IQR: 0.5-2.8) month). Overall, 68% of EMTs had been consulted on termination of CPR, 74% felt it was important to be consulted, and 74% felt...... arrest (12%), witnessed cardiac arrest without bystander CPR within 10 minutes (30%), age above 80 years (20%), age above 90 years (62%), living at a nursing home (62%), known cancer (24%) and absence of pupillary light reflex (54%) during resuscitation. Conclusion: The majority of EMTs have been...

CONTAINER TERMINALS IN EUROPE

Directory of Open Access Journals (Sweden)

Bart W. WIEGMANS

2001-01-01

Full Text Available This paper aims to address the linkage between logistics (in particular, the management of marketing channel flows and transport markets, while also the interaction between these two markets and intermodal container terminals is analysed. The marketing channel theory is used to describe all relevant actors and flows that run through marketing channels, starting with customer needs and ending with customer satisfaction. Porter's theory of competitive advantages is used to review competitive forces in both markets. Finally, a competitor analysis is performed for the logistics and transport market. These theories are applied so as to be able to determine the competitive position of intermodal container terminals with a view to the management of marketing channel flows and the physical transport of freight flows. Hence, the central question of this paper is: Which markets are served by intermodal container terminals and with whom are they competing? At present, neither the maritime container terminals nor the continental container terminals appear to have a significant influence in the logistics service market; they concentrate mainly on the physical movement of containers (transshipment. Furthermore, maritime container terminals and continental container terminals are not dominant players in the transport service market. Our conclusion is that continental terminals are predominantly competing with unimodal road transport, with neighbouring continental terminals and with barge transport companies.

Pairing States of Spin-3/2 Fermions: Symmetry-Enforced Topological Gap Functions

Science.gov (United States)

Venderbos, Jörn W. F.; Savary, Lucile; Ruhman, Jonathan; Lee, Patrick A.; Fu, Liang

2018-01-01

We study the topological properties of superconductors with paired j =3/2 quasiparticles. Higher spin Fermi surfaces can arise, for instance, in strongly spin-orbit coupled band-inverted semimetals. Examples include the Bi-based half-Heusler materials, which have recently been established as low-temperature and low-carrier density superconductors. Motivated by this experimental observation, we obtain a comprehensive symmetry-based classification of topological pairing states in systems with higher angular momentum Cooper pairing. Our study consists of two main parts. First, we develop the phenomenological theory of multicomponent (i.e., higher angular momentum) pairing by classifying the stationary points of the free energy within a Ginzburg-Landau framework. Based on the symmetry classification of stationary pairing states, we then derive the symmetry-imposed constraints on their gap structures. We find that, depending on the symmetry quantum numbers of the Cooper pairs, different types of topological pairing states can occur: fully gapped topological superconductors in class DIII, Dirac superconductors, and superconductors hosting Majorana fermions. Notably, we find a series of nematic fully gapped topological superconductors, as well as double- and triple-Dirac superconductors, with quadratic and cubic dispersion, respectively. Our approach, applied here to the case of j =3/2 Cooper pairing, is rooted in the symmetry properties of pairing states, and can therefore also be applied to other systems with higher angular momentum and high-spin pairing. We conclude by relating our results to experimentally accessible signatures in thermodynamic and dynamic probes.

Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase iota: Hoogsteen or Watson-Crick base pairing?

Science.gov (United States)

Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

2009-01-13

Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase iota (poliota) is a bypass polymerase of the Y family. Crystal structures of poliota suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that poliota is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in poliota for bypass of dG-AAF. In poliota with Hoogsteen-paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick-paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that poliota would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for poliota in lesion bypass.

Radio Sensor for Monitoring of UMTS Mobile Terminals

Directory of Open Access Journals (Sweden)

F. Kozak

2014-06-01

Full Text Available Relatively simple and low-cost radio sensor for monitoring of 3rd generation (3G UMTS mobile terminals (i.e., phones has been designed and practically tested. The main purpose of this sensor is to serve as an extending module that can be installed into systems used for monitoring of standard 2nd generation (2G GSM and DCS mobile phones in highly guarded buildings and areas. Since the transmitted powers of UMTS mobile terminals can be very low in relation to GSM and DCS specifications, the new UMTS sensor is based on a highly sensitive receiver and additional signal processing. The radio sensor was practically tested in several scenarios representing worst-case mobile terminal - base station relations. The measured detection ranges attain values from approx. 11 m inside of rooms to more than 30 m in corridors, which seems to be sufficient for the expected application. Results of all performed tests correspond fairly well with the presented theoretical descriptions. An extended version of the radio sensor can be used for monitoring of mobile terminals of all existing voice or data formats.

The analysis of photon pair source at telecom wavelength based on the BBO crystal (Conference Presentation)

Science.gov (United States)

Gajewski, Andrzej; Kolenderski, Piotr L.

2016-10-01

There are several problems that must be solved in order to increase the distance of quantum communication protocols based on photons as an information carriers. One of them is the dispersion, whose effects can be minimized by engineering spectral properties of transmitted photons. In particular, it is expected that positively correlated photon pairs can be very useful. We present the full characterization of a source of single photon pairs at a telecom wavelength based on type II spontaneous parametric down conversion (SPDC) process in a beta-barium borate (BBO) crystal. In the type II process, a pump photon, which is polarized extraordinarily, splits in a nonlinear medium into signal and idler photons, which are polarized perpendicularly to each other. In order for the process to be efficient a phase matching condition must be fulfilled. These conditions originate from momentum and energy conservation rules and put severe restrictions on source parameters. Seemingly, these conditions force the photon pair to be negatively correlated in their spectral domain. However, it is possible to achieve positive correlation for pulsed pumping. The experimentally available degrees of freedom of a source are the width of the pumping beam, the collected modes' widths, the length of the nonlinear crystal and the duration of the pumping pulse. In our numerical model we use the following figures of merit: the pair production rate, the efficiency of photon coupling into a single mode fiber, the spectral correlation of the coupled photon pair. The last one is defined as the Pearson correlation parameter for a joint spectral distribution. The aim here is to find the largest positive spectral correlation and the highest coupling efficiency. By resorting to the numerical model Ref. [1] we showed in Ref. [2], that by careful adjustment of the pump's and the collected modes' characteristics, one can optimize any of the source's parameters. Our numerical outcomes conform to the

Pair correlations in nuclei

International Nuclear Information System (INIS)

Shimizu, Yoshifumi

2009-01-01

Except for the closed shell nuclei, almost all nuclei are in the superconducting state at their ground states. This well-known pair correlation in nuclei causes various interesting phenomena. It is especially to be noted that the pair correlation becomes weak in the excited states of nuclei with high angular momentum, which leads to the pair phase transition to the normal state in the high spin limit. On the other hand, the pair correlation becomes stronger in the nuclei with lower nucleon density than in those with normal density. In the region of neutron halo or skin state of unstable nuclei, this phenomenon is expected to be further enhanced to be observed compared to the ground state of stable nuclei. An overview of those interesting aspects caused via the pair correlation is presented here in the sections titled 'pair correlations in ground states', pair correlations in high spin states' and 'pair correlations in unstable nuclei' focusing on the high spin state. (S. Funahashi)

The replacement of touch-terminal consoles of the CERN antiproton accumulator complex (AAC) by office PC's as well as X-windows based workstations

International Nuclear Information System (INIS)

Chohan, V.; Deloose, I.; Shering, G.

1992-01-01

With aging hardware and expensive maintenance and replacement possibilities, it was decided to upgrade the AAC touch terminal consoles with modern hardware. With significant amount of operational application software developed with touch terminals over 10 years, the philosophy adopted was to attempt a total emulation of these console functions of touch actions, graphics display as well as simple keyboard terminal entry onto the front-end computer controlling the AAC. The PC based emulation by mouse and multiple windows under MS-DOS and later, under the Windows 3 environment was realized relatively quickly; the next stage was therefore to do the same on the Unix platform using software based on X-windows. The communications channel was established using the TCP/IP socket library. This paper reviews this work up to the operational implementation for routine control room usage for both these solutions. (author)

Experimental many-pairs nonlocality

Science.gov (United States)

Poh, Hou Shun; Cerè, Alessandro; Bancal, Jean-Daniel; Cai, Yu; Sangouard, Nicolas; Scarani, Valerio; Kurtsiefer, Christian

2017-08-01

Collective measurements on large quantum systems together with a majority voting strategy can lead to a violation of the Clauser-Horne-Shimony-Holt Bell inequality. In the presence of many entangled pairs, this violation decreases quickly with the number of pairs and vanishes for some critical pair number that is a function of the noise present in the system. Here we show that a different binning strategy can lead to a more substantial Bell violation when the noise is sufficiently small. Given the relation between the critical pair number and the source noise, we then present an experiment where the critical pair number is used to quantify the quality of a high visibility photon pair source. Our results demonstrate nonlocal correlations using collective measurements operating on clusters of more than 40 photon pairs.

Visual communication and terminal equipment

International Nuclear Information System (INIS)

Kang, Cheol Hui

1988-06-01

This book is divided two parts about visual communication and terminal equipment. The first part introduces visual communication, which deals with foundation of visual communication, technique of visual communication, equipment of visual communication, a facsimile and pictorial image system. The second part contains terminal equipment such as telephone, terminal equipment for data transmission on constitution and constituent of terminal equipment for data transmission, input device and output device, terminal device and up-to-date terminal device.

Visual communication and terminal equipment

Energy Technology Data Exchange (ETDEWEB)

Kang, Cheol Hui

1988-06-15

This book is divided two parts about visual communication and terminal equipment. The first part introduces visual communication, which deals with foundation of visual communication, technique of visual communication, equipment of visual communication, a facsimile and pictorial image system. The second part contains terminal equipment such as telephone, terminal equipment for data transmission on constitution and constituent of terminal equipment for data transmission, input device and output device, terminal device and up-to-date terminal device.

Au pair trajectories

DEFF Research Database (Denmark)

Dalgas, Karina Märcher

2015-01-01

pair-sending families in the Philippines, this dissertation examines the long-term trajectories of these young Filipinas. It shows how the au pairs’ local and transnational family relations develop over time and greatly influence their life trajectories. A focal point of the study is how au pairs...... that Filipina au pairs see their stay abroad as an avenue of personal development and social recognition, I examine how the au pairs re-position themselves within their families at home through migration, and how they navigate between the often conflicting expectations of participation in the sociality......Since 2000, thousands of young Filipino migrants have come to Denmark as au pairs. Officially, they are there to “broaden their cultural horizons” by living temporarily with a Danish host family, but they also conduct domestic labor in exchange for food and money, which allows them to send...

Dislocation processes in quasicrystals-Kink-pair formation control or jog-pair formation control

International Nuclear Information System (INIS)

Takeuchi, Shin

2005-01-01

A computer simulation of dislocation in a model quasiperiodic lattice indicates that the dislocation feels a large Peierls potential when oriented in particular directions. For a dislocation with a high Peierls potential, the glide velocity and the climb velocity of the dislocation can be described almost in parallel in terms of the kink-pair formation followed by kink motion and the jog-pair formation followed by jog motion, respectively. The activation enthalpy of the kink-pair formation is the sum of the kink-pair formation enthalpy and the atomic jump activation enthalpy, while the activation enthalpy of the jog-pair formation involves the jog-pair enthalpy and the self-diffusion enthalpy. Since the kink-pair energy can be considerably larger than the jog-pair energy, the climb velocity can be faster than the glide velocity, so that the plastic deformation of quasicrystals can be brought not by dislocation glide but by dislocation climb at high temperatures

High Octane Fuel: Terminal Backgrounder

Energy Technology Data Exchange (ETDEWEB)

Moriarty, Kristi [National Renewable Energy Lab. (NREL), Golden, CO (United States)

2016-02-11

The Bioenergy Technologies Office of the U.S. Department of Energy Office of Energy Efficiency and Renewable Energy sponsored a scoping study to assess the potential of ethanol-based high octane fuel (HOF) to reduce energy consumption and greenhouse gas emissions. When the HOF blend is made with 25%-40% ethanol by volume, this energy efficiency improvement is potentially sufficient to offset the reduced vehicle range often associated with the decreased volumetric energy density of ethanol. The purpose of this study is to assess the ability of the fuel supply chain to accommodate more ethanol at fuel terminals. Fuel terminals are midstream in the transportation fuel supply chain and serve to store and distribute fuels to end users. While there are no technical issues to storing more ethanol at fuel terminals, there are several factors that could impact the ability to deploy more ethanol. The most significant of these issues include the availability of land to add more infrastructure and accommodate more truck traffic for ethanol deliveries as well as a lengthy permitting process to erect more tanks.

Interaction and dynamics of homologous pairing protein 2 (HOP2) and DNA studied by MD simulation

Science.gov (United States)

Moktan, Hem; Pezza, Roberto; Zhou, Donghua

2015-03-01

The homologous pairing protein 2 (Hop2) plays an important role in meiosis and DNA repair. Together with protein Mnd1, Hop2 enhances the strand invasion activity of recombinase Dmc1 by over 30 times, facilitating proper synapsis of homologous chromosomes. We recently determined the NMR structure of the N-terminal domain of Hop2 and proposed a model of Protein-DNA complex based on NMR chemical shift perturbations and mutagenesis studies (Moktan, J Biol Chem 2014 10.1074/jbc.M114.548180). However structure and dynamics of the complex have not been studied at the atomic level yet. Here, we used classical MD simulations to study the interactions between the N-terminal HOP2 and DNA. The simulated results indicate that helix3 (H3) interacts with DNA in major groove and wing1 (W1) interacts mostly in minor groove mainly via direct hydrogen bonds. Also it is found that binding leads to reduced fluctuations in both protein and DNA. Several water bridge interactions have been identified. The residue-wise contributions to the interaction energy were evaluated. Also the functional motion of the protein is analyzed using principal component analysis. The results confirmed the importance of H3 and W1 for the stability of the complex, which is consistent with our previous experimental studies.

Transverse Momentum Distributions for Heavy Quark Pairs

OpenAIRE

Berger, Edmond L.; Meng, Ruibin

1993-01-01

We study the transverse momentum distribution for a $pair$ of heavy quarks produced in hadron-hadron interactions. Predictions for the large transverse momentum region are based on exact order $\\alpha_s^3$ QCD perturbation theory. For the small transverse momentum region, we use techniques for all orders resummation of leading logarithmic contributions associated with initial state soft gluon radiation. The combination provides the transverse momentum distribution of heavy quark pairs for all...

Isominkowskian theory of Cooper Pairs in superconductors

International Nuclear Information System (INIS)

Animalu, A.O.E.

1993-01-01

Via the use of Santilli's isominkowskian space, the author presents a relativistic extension of the author's recent treatment of the Cooper Pair in superconductivity based on the Lie-isotopic lifting of quantum mechanics known as Hadronic Mechanics. The isominkowskian treatment reduces the solution of the eiganvalue problem for the quasiparticle energy spectrum to a geometric problem of specifying the metric of the isominkowskian space inside the pair in various models of ordinary high T c superconductors. The use of an intriguing realization of the metric due to Dirac reduces the dimensionality of the interior space to two yielding a spin mutation from 1/2 to zero inside a Cooper pair in two-band BCS and Hubbard models. 12 refs

Direct NMR Evidence that Transient Tautomeric and Anionic States in dG·dT Form Watson-Crick-like Base Pairs.

Science.gov (United States)

Szymanski, Eric S; Kimsey, Isaac J; Al-Hashimi, Hashim M

2017-03-29

The replicative and translational machinery utilizes the unique geometry of canonical G·C and A·T/U Watson-Crick base pairs to discriminate against DNA and RNA mismatches in order to ensure high fidelity replication, transcription, and translation. There is growing evidence that spontaneous errors occur when mismatches adopt a Watson-Crick-like geometry through tautomerization and/or ionization of the bases. Studies employing NMR relaxation dispersion recently showed that wobble dG·dT and rG·rU mismatches in DNA and RNA duplexes transiently form tautomeric and anionic species with probabilities (≈0.01-0.40%) that are in concordance with replicative and translational errors. Although computational studies indicate that these exceptionally short-lived and low-abundance species form Watson-Crick-like base pairs, their conformation could not be directly deduced from the experimental data, and alternative pairing geometries could not be ruled out. Here, we report direct NMR evidence that the transient tautomeric and anionic species form hydrogen-bonded Watson-Crick-like base pairs. A guanine-to-inosine substitution, which selectively knocks out a Watson-Crick-type (G)N2H 2 ···O2(T) hydrogen bond, significantly destabilized the transient tautomeric and anionic species, as assessed by lack of any detectable chemical exchange by imino nitrogen rotating frame spin relaxation (R 1ρ ) experiments. An 15 N R 1ρ NMR experiment targeting the amino nitrogen of guanine (dG-N2) provides direct evidence for Watson-Crick (G)N2H 2 ···O2(T) hydrogen bonding in the transient tautomeric state. The strategy presented in this work can be generally applied to examine hydrogen-bonding patterns in nucleic acid transient states including in other tautomeric and anionic species that are postulated to play roles in replication and translational errors.

The Effects of Reinforcer Pairing and Fading on Preschoolers' Snack Selections

Science.gov (United States)

Solberg, Katherine M.; Hanley, Gregory P.; Layer, Stacy A.; Ingvarsson, Einar T.

2007-01-01

The effects of reinforcement pairing and fading on preschoolers' snack selections were evaluated in a multiple baseline design. Baseline preferences for snack options were assessed via repeated paired-item preference assessments. Edible, social, and activity-based reinforcers were then exclusively paired with a less preferred snack option. Once…

Nucleic Acid Base Analog FRET-Pair Facilitating Detailed Structural Measurements in Nucleic Acid Containing Systems

DEFF Research Database (Denmark)

Börjesson, Karl; Preus, Søren; El-Sagheer, Afaf

2009-01-01

We present the first nucleobase analog fluorescence resonance energy transfer (FRET)-pair. The pair consists of tCO, 1,3-diaza-2-oxophenoxazine, as an energy donor and the newly developed tC(nitro), 7-nitro-1,3-diaza-2-oxophenothiazine, as an energy acceptor. The FRET-pair successfully monitors d...

Superior coexistence: systematicALLY regulatING land subsidence BASED on set pair theory

Directory of Open Access Journals (Sweden)

Y. Chen

2015-11-01

Full Text Available Anthropogenic land subsidence is an environmental side effect of exploring and using natural resources in the process of economic development. The key points of the system for controlling land subsidence include cooperation and superior coexistence while the economy develops, exploring and using natural resources, and geological environmental safety. Using the theory and method of set pair analysis (SPA, this article anatomises the factors, effects, and transformation of land subsidence. Based on the principle of superior coexistence, this paper promotes a technical approach to the system for controlling land subsidence, in order to improve the prevention and control of geological hazards.

Graph-based surface reconstruction from stereo pairs using image segmentation

Science.gov (United States)

Bleyer, Michael; Gelautz, Margrit

2005-01-01

This paper describes a novel stereo matching algorithm for epipolar rectified images. The method applies colour segmentation on the reference image. The use of segmentation makes the algorithm capable of handling large untextured regions, estimating precise depth boundaries and propagating disparity information to occluded regions, which are challenging tasks for conventional stereo methods. We model disparity inside a segment by a planar equation. Initial disparity segments are clustered to form a set of disparity layers, which are planar surfaces that are likely to occur in the scene. Assignments of segments to disparity layers are then derived by minimization of a global cost function via a robust optimization technique that employs graph cuts. The cost function is defined on the pixel level, as well as on the segment level. While the pixel level measures the data similarity based on the current disparity map and detects occlusions symmetrically in both views, the segment level propagates the segmentation information and incorporates a smoothness term. New planar models are then generated based on the disparity layers' spatial extents. Results obtained for benchmark and self-recorded image pairs indicate that the proposed method is able to compete with the best-performing state-of-the-art algorithms.

Single-flavour and two-flavour pairing in three-flavour quark matter

International Nuclear Information System (INIS)

Alford, Mark G; Cowan, Greig A

2006-01-01

We study single-flavour quark pairing ('self-pairing') in colour-superconducting phases of quark matter, paying particular attention to the difference between scenarios where all three flavours undergo single-flavour pairing, and scenarios where two flavours pair with each other ('2SC' pairing) and the remaining flavour self-pairs. We perform our calculations in the mean-field approximation using a pointlike four-fermion interaction based on single gluon exchange. We confirm the result from previous weakly-coupled-QCD calculations that when all three flavours self-pair the favoured channel for each is colour-spin-locked (CSL) pseudoisotropic pairing. However, we find that when the up and down quarks undergo 2SC pairing, they induce a colour chemical potential that disfavours the CSL phase. The strange quarks then self-pair in a 'polar' channel that breaks rotational invariance, although the CSL phase may survive in a narrow range of densities

Simulation-based investigation of the paired-gear method in cod-end selectivity studies

DEFF Research Database (Denmark)

Herrmann, Bent; Frandsen, Rikke; Holst, René

2007-01-01

In this paper, the paired-gear and covered cod-end methods for estimating the selectivity of trawl cod-ends are compared. A modified version of the cod-end selectivity simulator PRESEMO is used to simulate the data that would be collected from a paired-gear experiment where the test cod-end also ...

Electrochemical DNA biosensor based on grafting-to mode of terminal deoxynucleoside transferase-mediated extension.

Science.gov (United States)

Chen, Jinyuan; Liu, Zhoujie; Peng, Huaping; Zheng, Yanjie; Lin, Zhen; Liu, Ailin; Chen, Wei; Lin, Xinhua

2017-12-15

Previously reported electrochemical DNA biosensors based on in-situ polymerization approach reveal that terminal deoxynucleoside transferase (TdTase) has good amplifying performance and promising application in the design of electrochemical DNA biosensor. However, this method, in which the background is significantly affected by the amount of TdTase, suffers from being easy to produce false positive result and poor stability. Herein, we firstly present a novel electrochemical DNA biosensor based on grafting-to mode of TdTase-mediated extension, in which DNA targets are polymerized in homogeneous solution and then hybridized with DNA probes on BSA-based DNA carrier platform. It is surprising to find that the background in the grafting-to mode of TdTase-based electrochemical DNA biosensor have little interference from the employed TdTase. Most importantly, the proposed electrochemical DNA biosensor shows greatly improved detection performance over the in-situ polymerization approach-based electrochemical DNA biosensor. Copyright © 2017 Elsevier B.V. All rights reserved.

A simple and highly selective 2,2-diferrocenylpropane-based multi-channel ion pair receptor for Pb(2+) and HSO4(-).

Science.gov (United States)

Wan, Qian; Zhuo, Ji-Bin; Wang, Xiao-Xue; Lin, Cai-Xia; Yuan, Yao-Feng

2015-03-28

A structurally simple, 2,2-diferrocenylpropane-based ion pair receptor 1 was synthesized and characterized by (1)H NMR, (13)C NMR, HRMS, elemental analyses, and single-crystal X-ray diffraction. The ion pair receptor 1 showed excellent selectivity and sensitivity towards Pb(2+) with multi-channel responses: a fluorescence enhancement (more than 42-fold), a notable color change from yellow to red, redox anodic shift (ΔE1/2 = 151 mV), while HSO4(-) promoted fluorescence enhancement when Pb(2+) or Zn(2+) was bonded to the cation binding-site. (1)H NMR titration and density functional theory were performed to reveal the sensing mechanism based on photo-induced electron transfer (PET).

rSNPBase 3.0: an updated database of SNP-related regulatory elements, element-gene pairs and SNP-based gene regulatory networks.

Science.gov (United States)

Guo, Liyuan; Wang, Jing

2018-01-04

Here, we present the updated rSNPBase 3.0 database (http://rsnp3.psych.ac.cn), which provides human SNP-related regulatory elements, element-gene pairs and SNP-based regulatory networks. This database is the updated version of the SNP regulatory annotation database rSNPBase and rVarBase. In comparison to the last two versions, there are both structural and data adjustments in rSNPBase 3.0: (i) The most significant new feature is the expansion of analysis scope from SNP-related regulatory elements to include regulatory element-target gene pairs (E-G pairs), therefore it can provide SNP-based gene regulatory networks. (ii) Web function was modified according to data content and a new network search module is provided in the rSNPBase 3.0 in addition to the previous regulatory SNP (rSNP) search module. The two search modules support data query for detailed information (related-elements, element-gene pairs, and other extended annotations) on specific SNPs and SNP-related graphic networks constructed by interacting transcription factors (TFs), miRNAs and genes. (3) The type of regulatory elements was modified and enriched. To our best knowledge, the updated rSNPBase 3.0 is the first data tool supports SNP functional analysis from a regulatory network prospective, it will provide both a comprehensive understanding and concrete guidance for SNP-related regulatory studies. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Cost Analysis by Applying Time-Driven Activity Based Costing Method in Container Terminals

OpenAIRE

Yaşar, R. Şebnem

2017-01-01

Container transportation, which can also be called as “industrialization of maritime transportation”, gained significant ground in the world trade by offering numerous technical and economic advantages, and accordingly the container terminals have grown up in importance. Increased competition between container terminals puts pressure on the ports to reduce costs and increase operational productivity. To have the right cost information constitutes a prerequisite for cost reduction. Time-Driven...

Compact battery-less information terminal (CoBIT) for location-based support systems

Science.gov (United States)

Nishimura, Takuichi; Itoh, Hideo; Yamamoto, Yoshinobu; Nakashima, Hideyuki

2002-06-01

The target of ubiquitous computing environment is to support users to get necessary information and services in a situation-dependent form. Therefore, we propose a location-based information support system by using Compact Battery-less Information Terminal (CoBIT). A CoBIT can communicate with the environmental system and with the user by only the energy supply from the environment. It has a solar cell and get a modulated light from an environmental optical beam transmitter. The current from the solar cell is directly (or through passive circuit) introduced into an earphone, which generates sound for the user. The current is also used to make vibration, LED signal or electrical stimulus on the skin. The sizes of CoBITs are about 2cm in diameter, 3cm in length, which can be hanged on ears conveniently. The cost of it would be only about 1 dollar if produced massively. The CoBIT also has sheet type corner reflector, which reflect optical beam back in the direction of the light source. Therefore the environmental system can easily detect the terminal position and direction as well as some simple signs from the user by multiple cameras with infra-red LEDs. The system identifies the sign by the modulated patterns of the reflected light, which the user makes by occluding the reflector by hand. The environmental system also recognizes other objects using other sensors and displays video information on a nearby monitor in order to realize situated support.

QED peripheral mechanism of pair production at colliders

International Nuclear Information System (INIS)

Ahmadov, A. I.; Galynskii, M. V.; Bystritskiy, Yu. M.; Kuraev, E. A.; Shatnev, M. G.

2008-01-01

Cross sections of the processes of production of neutral pions and pairs of charged fermions and bosons in peripheral interaction of leptons and photons are calculated in the main logarithmic approximation. We investigate the phase volumes and differential cross sections. The differential cross sections of production of a few neutral pions and a few pairs are written down explicitly. Considering the academic problem of summation over a number of pairs for massless particles we reproduce the known results obtained in the 1970s. The possibility of constructing the generator for Monte Carlo modeling of these processes based on these results is discussed.

Space-Efficient Re-Pair Compression

DEFF Research Database (Denmark)

Bille, Philip; Gørtz, Inge Li; Prezza, Nicola

2017-01-01

Re-Pair [5] is an effective grammar-based compression scheme achieving strong compression rates in practice. Let n, σ, and d be the text length, alphabet size, and dictionary size of the final grammar, respectively. In their original paper, the authors show how to compute the Re-Pair grammar...... in expected linear time and 5n + 4σ2 + 4d + √n words of working space on top of the text. In this work, we propose two algorithms improving on the space of their original solution. Our model assumes a memory word of [log2 n] bits and a re-writable input text composed by n such words. Our first algorithm runs...

The paired-domination and the upper paired-domination numbers of graphs

Directory of Open Access Journals (Sweden)

Włodzimierz Ulatowski

2015-01-01

Full Text Available In this paper we continue the study of paired-domination in graphs. A paired-dominating set, abbreviated PDS, of a graph \\(G\\ with no isolated vertex is a dominating set of vertices whose induced subgraph has a perfect matching. The paired-domination number of \\(G\\, denoted by \\(\\gamma_{p}(G\\, is the minimum cardinality of a PDS of \\(G\\. The upper paired-domination number of \\(G\\, denoted by \\(\\Gamma_{p}(G\\, is the maximum cardinality of a minimal PDS of \\(G\\. Let \\(G\\ be a connected graph of order \\(n\\geq 3\\. Haynes and Slater in [Paired-domination in graphs, Networks 32 (1998, 199-206], showed that \\(\\gamma_{p}(G\\leq n-1\\ and they determine the extremal graphs \\(G\\ achieving this bound. In this paper we obtain analogous results for \\(\\Gamma_{p}(G\\. Dorbec, Henning and McCoy in [Upper total domination versus upper paired-domination, Questiones Mathematicae 30 (2007, 1-12] determine \\(\\Gamma_{p}(P_n\\, instead in this paper we determine \\(\\Gamma_{p}(C_n\\. Moreover, we describe some families of graphs \\(G\\ for which the equality \\(\\gamma_{p}(G=\\Gamma_{p}(G\\ holds.

Location of terminals in a communications network

DEFF Research Database (Denmark)

2015-01-01

A method (400, 500) of identifying nodes in a communications network is disclosed, the nodes being for use in locating wireless terminals within the network based upon reports from the wireless terminals of transmissions received from the nodes. The method (400, 500) comprises prioritising...... combinations of nodes in which at least three nodes are located around a reference node in a configuration satisfying similarity criteria to an idealised star configuration, wherein an idealised star configuration comprises three nodes evenly angularly distributed around, and at the same distance from......, a reference node. Also disclosed is a method (100, 200) for locating a plurality of wireless terminals in a communications network, the network comprising a plurality of network nodes at known locations, wherein the nodes emit wireless transmissions in an unsynchronised manner, such that a time difference...

Antecedents of Customer Relationship Termination

DEFF Research Database (Denmark)

Geersbro, Jens; Ritter, Thomas

To end business relationships, or to more actively terminate relationships, has long been acknowledged as part of customer relationship management. However, compared to other elements such as initiation and maintenance of relationships, little is known about the termination of business...... relationships as a managerial task. This paper contributes by (1) developing a conceptualization of relationship termination competence and (2) analyzing its antecedents. The empirical results identify termination acceptance, definition non-customers, organizational relationship termination routines......, and motivation as significant antecedents. Because of this, managers need to develop their organizations in order to use relationship termination as a vital strategy....

Supramolecular Switches Based on the Guanine–Cytosine (GC) Watson–Crick Pair: Effect of Neutral and Ionic Substituents

NARCIS (Netherlands)

Guerra, C.F.; van der Wijst, T.; Bickelhaupt, F.M.

2006-01-01

We have theoretically analyzed Watson–Crick guanine–cytosine (GC) base pairs in which purine-C8 and/or pyrimidine-C6 positions carry a substituent X = NH−, NH2, NH3+ (N series), O−, OH, or OH2+ (O series), using the generalized gradient approximation (GGA) of density functional theory at the

Hydroxylamine and methoxyamine mutagenesis: displacement of the tautomeric equilibrium of the promutagen N6-methoxyadenosine by complementary base pairing.

Science.gov (United States)

Stolarski, R; Kierdaszuk, B; Hagberg, C E; Shugar, D

1984-06-19

The imino-amino tautomeric equilibrium of the promutagenic adenosine analogue N6-methoxy-2',3',5'-tri-O-methyladenosine [OMe6A(Me)3], in solvents of various polarities, has been studied with the aid of 1H and 13C NMR spectroscopy. The high energy barrier (free enthalpy delta G = 80 +/- 5 kJ X mol-1) between the two tautomeric species renders possible direct observation of the independent sets of all 1H and 13C signals from each of them. The equilibrium ranges from 10% imino in CCl4 to 90% in aqueous medium. Thermodynamic parameters, including energy barriers and lifetimes, were calculated from the temperature dependence of the equilibrium. Essentially similar results prevail for the promutagenic N6-hydroxy analogue. The conformations of the sugar moieties, and of the base about the glycosidic bond, for both tautomers are similar to those for adenosine. The conformation of the exocyclic N6-OCH3 group, which determines the ability of each species to form planar associates (hydrogen-bonded base pairs), has also been evaluated. Formation of autoassociates of OMe6A(Me)3 and of heteroassociates with the potentially complementary 2',3',5'-tri-O-methyluridine and -cytidine, in chloroform solution, was also investigated. The amino form base pairs with uridine and the imino form with cytidine. Formation of a complementary base pair by a given tautomeric species was accompanied by an increase of up to 10% in the population of this species and a concomitant decrease in population of the other species.(ABSTRACT TRUNCATED AT 250 WORDS)

A process-based approach to characterizing the effect of acute alprazolam challenge on visual paired associate learning and memory in healthy older adults.

Science.gov (United States)

Pietrzak, Robert H; Scott, James Cobb; Harel, Brian T; Lim, Yen Ying; Snyder, Peter J; Maruff, Paul

2012-11-01

Alprazolam is a benzodiazepine that, when administered acutely, results in impairments in several aspects of cognition, including attention, learning, and memory. However, the profile (i.e., component processes) that underlie alprazolam-related decrements in visual paired associate learning has not been fully explored. In this double-blind, placebo-controlled, randomized cross-over study of healthy older adults, we used a novel, "process-based" computerized measure of visual paired associate learning to examine the effect of a single, acute 1-mg dose of alprazolam on component processes of visual paired associate learning and memory. Acute alprazolam challenge was associated with a large magnitude reduction in visual paired associate learning and memory performance (d = 1.05). Process-based analyses revealed significant increases in distractor, exploratory, between-search, and within-search error types. Analyses of percentages of each error type suggested that, relative to placebo, alprazolam challenge resulted in a decrease in the percentage of exploratory errors and an increase in the percentage of distractor errors, both of which reflect memory processes. Results of this study suggest that acute alprazolam challenge decreases visual paired associate learning and memory performance by reducing the strength of the association between pattern and location, which may reflect a general breakdown in memory consolidation, with less evidence of reductions in executive processes (e.g., working memory) that facilitate visual paired associate learning and memory. Copyright © 2012 John Wiley & Sons, Ltd.

Seniority zero pair coupled cluster doubles theory

International Nuclear Information System (INIS)

Stein, Tamar; Henderson, Thomas M.; Scuseria, Gustavo E.

2014-01-01

Coupled cluster theory with single and double excitations accurately describes weak electron correlation but is known to fail in cases of strong static correlation. Fascinatingly, however, pair coupled cluster doubles (p-CCD), a simplified version of the theory limited to pair excitations that preserve the seniority of the reference determinant (i.e., the number of unpaired electrons), has mean field computational cost and is an excellent approximation to the full configuration interaction (FCI) of the paired space provided that the orbital basis defining the pairing scheme is adequately optimized. In previous work, we have shown that optimization of the pairing scheme in the seniority zero FCI leads to a very accurate description of static correlation. The same conclusion extends to p-CCD if the orbitals are optimized to make the p-CCD energy stationary. We here demonstrate these results with numerous examples. We also explore the contributions of different seniority sectors to the coupled cluster doubles (CCD) correlation energy using different orbital bases. We consider both Hartree-Fock and Brueckner orbitals, and the role of orbital localization. We show how one can pair the orbitals so that the role of the Brueckner orbitals at the CCD level is retained at the p-CCD level. Moreover, we explore ways of extending CCD to accurately describe strongly correlated systems

A configuration space of homologous proteins conserving mutual information and allowing a phylogeny inference based on pair-wise Z-score probabilities

OpenAIRE

Maréchal Eric; Ortet Philippe; Roy Sylvaine; Bastien Olivier

2005-01-01

Abstract Background Popular methods to reconstruct molecular phylogenies are based on multiple sequence alignments, in which addition or removal of data may change the resulting tree topology. We have sought a representation of homologous proteins that would conserve the information of pair-wise sequence alignments, respect probabilistic properties of Z-scores (Monte Carlo methods applied to pair-wise comparisons) and be the basis for a novel method of consistent and stable phylogenetic recon...

Involvement of a bifunctional, paired-like DNA-binding domain and a transpositional enhancer in Sleeping Beauty transposition.

Science.gov (United States)

Izsvák, Zsuzsanna; Khare, Dheeraj; Behlke, Joachim; Heinemann, Udo; Plasterk, Ronald H; Ivics, Zoltán

2002-09-13

Sleeping Beauty (SB) is the most active Tc1/mariner-like transposon in vertebrate species. Each of the terminal inverted repeats (IRs) of SB contains two transposase-binding sites (DRs). This feature, termed the IR/DR structure, is conserved in a group of Tc1-like transposons. The DNA-binding region of SB transposase, similar to the paired domain of Pax proteins, consists of two helix-turn-helix subdomains (PAI + RED = PAIRED). The N-terminal PAI subdomain was found to play a dominant role in contacting the DRs. Transposase was able to bind to mutant sites retaining the 3' part of the DRs; thus, primary DNA binding is not sufficient to determine the specificity of the transposition reaction. The PAI subdomain was also found to bind to a transpositional enhancer-like sequence within the left IR of SB, and to mediate protein-protein interactions between transposase subunits. A tetrameric form of the transposase was detected in solution, consistent with an interaction between the IR/DR structure and a transposase tetramer. We propose a model in which the transpositional enhancer and the PAI subdomain stabilize complexes formed by a transposase tetramer bound at the IR/DR. These interactions may result in enhanced stability of synaptic complexes, which might explain the efficient transposition of Sleeping Beauty in vertebrate cells.

Terminating pregnancy after prenatal diagnosis--with a little help of professional ethics?

Science.gov (United States)

Schmitz, Dagmar

2012-07-01

Termination of pregnancy after a certain gestational age and following prenatal diagnosis, in many nations seem to be granted with a special status to the extent that they by law have to be discussed within a predominantly medical context and have physicians as third parties involved in the decision-making process ('indication-based' approach). The existing legal frameworks for indication-based approaches, however, do frequently fail to provide clear guidance for the involved physicians. Critics, therefore, asked for professional ethics and professional institutions in order to provide normative guidance for the physicians in termination of pregnancy on medical grounds. After outlining the clinical pathway in an indication-based approach and the involved types of (clinical) judgements, this paper draws upon different understandings of professional ethics in order to explore their potential to provide normative guidance in termination of pregnancy on medical grounds. The analysis reveals that professional ethics will not suffice-neither as a set of established norms nor as internal morality-in order to determine the normative framework of indication-based approaches on termination of pregnancy. In addition, there seem to be considerable inconsistencies regarding the target and outcome between prenatal testing on the one hand and following termination of pregnancy on the other hand. A source of morality external to medicine has to be the basis of evaluation if a consistent and workable normative framework for termination of pregnancy and prenatal testing should be established.

The Risk of Termination Shock From Solar Geoengineering

Science.gov (United States)

Parker, Andy; Irvine, Peter J.

2018-03-01

If solar geoengineering were to be deployed so as to mask a high level of global warming, and then stopped suddenly, there would be a rapid and damaging rise in temperatures. This effect is often referred to as termination shock, and it is an influential concept. Based on studies of its potential impacts, commentators often cite termination shock as one of the greatest risks of solar geoengineering. However, there has been little consideration of the likelihood of termination shock, so that conclusions about its risk are premature. This paper explores the physical characteristics of termination shock, then uses simple scenario analysis to plot out the pathways by which different driver events (such as terrorist attacks, natural disasters, or political action) could lead to termination. It then considers where timely policies could intervene to avert termination shock. We conclude that some relatively simple policies could protect a solar geoengineering system against most of the plausible drivers. If backup deployment hardware were maintained and if solar geoengineering were implemented by agreement among just a few powerful countries, then the system should be resilient against all but the most extreme catastrophes. If this analysis is correct, then termination shock should be much less likely, and therefore much less of a risk, than has previously been assumed. Much more sophisticated scenario analysis—going beyond simulations purely of worst-case scenarios—will be needed to allow for more insightful policy conclusions.

Complexes of DNA bases and Watson-Crick base pairs with small neutral gold clusters.

Science.gov (United States)

Kryachko, E S; Remacle, F

2005-12-08

The nature of the DNA-gold interaction determines and differentiates the affinity of the nucleobases (adenine, thymine, guanine, and cytosine) to gold. Our preliminary computational study [Kryachko, E. S.; Remacle, F. Nano Lett. 2005, 5, 735] demonstrates that two major bonding factors govern this interaction: the anchoring, either of the Au-N or Au-O type, and the nonconventional N-H...Au hydrogen bonding. In this paper, we offer insight into the nature of nucleobase-gold interactions and provide a detailed characterization of their different facets, i.e., geometrical, energetic, and spectroscopic aspects; the gold cluster size and gold coordination effects; proton affinity; and deprotonation energy. We then investigate how the Watson-Crick DNA pairing patterns are modulated by the nucleobase-gold interaction. We do so in terms of the proton affinities and deprotonation energies of those proton acceptors and proton donors which are involved in the interbase hydrogen bondings. A variety of properties of the most stable Watson-Crick [A x T]-Au3 and [G x C]-Au3 hybridized complexes are described and compared with the isolated Watson-Crick A x T and G x C ones. It is shown that enlarging the gold cluster size to Au6 results in a rather short gold-gold bond in the Watson-Crick interbase region of the [G x C]-Au6 complex that bridges the G x C pair and thus leads to a significant strengthening of G x C pairing.

Service Quality Evaluation and Ranking of Container Terminal Operators

Directory of Open Access Journals (Sweden)

Jafar Sayareh

2016-12-01

Full Text Available In the service industry, the regular assessment of service quality is considered as a means of promoting the quality of services. Container market is no exception, and the quality of providing service in a container terminal is of prime importance in attracting new customers and maintaining the existing ones. The main aim of present research is to evaluate the quality of service being offered at Shahid Rajaee Container Terminal (SRCT in Bandar Abbas port. The evaluation process uses SERVQUAL model which is an appropriate tool for measuring the service quality, identifying and analyzing available gaps between service expectations and perceptions. Target population in this research includes customers of SRCT. The standard and customized questionnaires were distributed among 165 samples, out of which 127 (77% were returned. For the purpose of data analyses, initially the reliability of SERVQUAL model was checked, and then paired sample t-test was performed to reveal any possible gap between expectations and perceptions of respondents. Finally, TOPSIS was used to rank the 9 main container service companies in the SRCT. The results indicated that there are significant gaps between customers’ expectations and perceptions in SRCT, in all five dimensions of services quality. Additionally, from weighing point of view, ‘Tangibles’ was the most important dimension, followed by ‘Reliability’, ‘Assurance’, ‘Responsiveness’ and ‘Empathy’. In addition, ‘Tangibles’ dimension had maximum gap and ‘Empathy’ dimension had minimum gap between customers’ expectations and perceptions. Finally, after ranking companies, BandarAbbas Aria Container Terminal (BACT Company was ranked first among nine companies in satisfying customers’ expectations.

Distriubted terminal support in a data acquisition system for nuclear research reactors

International Nuclear Information System (INIS)

Shah, R.R.; Capel, A.C.; Pensom, C.F.

1980-01-01

A comprehensive and flexible terminal support facility is being designed to provide the necessary interactive man-machine interface for REDNET, a distriubted data aquisition system for nuclear research reactors. Host processors and a large number of terminals are linked via three physically independent but interconnected terminal support subsystems, which use in-house developed equipment based on cable TV technology. The CCITT X-25 protocol is supported, and virtual circuits are used for communications between terminals and software functions in host processors. This paper presents the requirements and conceptual design of the major terminal support components. (auth)

Effect of single interstitial impurity in iron-based superconductors with sign-changed s-wave pairing symmetry

Energy Technology Data Exchange (ETDEWEB)

Yu, Xiang-Long, E-mail: xlyu@theory.issp.ac.cn [Key Laboratory of Materials Physics, Institute of Solid State Physics, Chinese Academy of Sciences, P. O. Box 1129, Hefei 230031 (China); Liu, Da-Yong; Quan, Ya-Min; Zheng, Xiao-Jun [Key Laboratory of Materials Physics, Institute of Solid State Physics, Chinese Academy of Sciences, P. O. Box 1129, Hefei 230031 (China); Zou, Liang-Jian, E-mail: zou@theory.issp.ac.cn [Key Laboratory of Materials Physics, Institute of Solid State Physics, Chinese Academy of Sciences, P. O. Box 1129, Hefei 230031 (China); Department of Physics, University of Science and Technology of China, Hefei 230026 (China)

2015-12-15

Highlights: • Effects of single interstitial impurity are studied in iron-based superconductors. • Bound states within the superconducting gap can be induced. • The interstitial impurity can induce a π phase shift of pairing order parameter. • For strong magnetic scattering the bound-state peak can appear at the Fermi level. - Abstract: We employ the self-consistent Bogoliubov-de Gennes (BdG) formulation to investigate the effect of single interstitial nonmagnetic/magnetic impurity in iron-based superconductors with s ± -wave pairing symmetry. We find that both the nonmagnetic and magnetic impurities can induce bound states within the superconducting (SC) gap and a π phase shift of SC order parameter at the impurity site. However, different from the interstitial-nonmagnetic-impurity case characterized by two symmetric peaks with respect to zero energy, the interstitial magnetic one only induces single bound-state peak. In the strong scattering regime this peak can appear at the Fermi level, which has been observed in the recent scanning tunneling microscope (STM) experiment of Fe(Te,Se) superconductor with interstitial Fe impurities (Yin et al. 2015 [44]). This novel single in-gap peak feature also distinguishes the interstitial case from the substitutional one with two peaks. These results provide important information for comparing the different impurity effects in the iron-based superconductors.

Identification of cross-linked amino acids in the protein pair HmaL23-HmaL29 from the 50S ribosomal subunit of the archaebacterium Haloarcula marismortui.

Science.gov (United States)

Bergmann, U; Wittmann-Liebold, B

1993-03-23

50S ribosomal subunits from the extreme halophilic archaebacterium Haloarcula marismortui were treated with the homobifunctional protein-protein cross-linking reagents diepoxybutane (4 A) and dithiobis(succinimidyl propionate) (12 A). The dominant product with both cross-linking reagents was identified on the protein level as HmaL23-HmaL29, which is homologous to the protein pair L23-L29 from Escherichia coli [Walleczek, J., Martin, T., Redl, B., Stöffler-Meilicke, M., & Stöffler, G. (1989) Biochemistry 28, 4099-4105] and from Bacillus stearothermophilus [Brockmöller, J., & Kamp, R. M. (1986) Biol. Chem. Hoppe-Seyler 367, 925-935]. To reveal the exact cross-linking site in HmaL23-HmaL29, the cross-linked complex was purified on a preparative scale by conventional and high-performance liquid chromatography. After endoproteolytic fragmentation of the protein pair, the amino acids engaged in cross-link formation were unambiguously identified by N-terminal sequence analysis and mass spectrometry of the cross-linked peptides. The cross-link is formed between lysine-57 in the C-terminal region of HmaL29 and the alpha-amino group of the N-terminal serine in protein HmaL23, irrespective of the cross-linking reagent. This result demonstrates that the N-terminal region of protein HmaL23 and the C-terminal domain of HmaL29 are highly flexible so that the distance between the two polypeptide chains can vary by at least 8 A. Comparison of our cross-linking results with those obtained with B. stearothermophilus revealed that the fine structure within this ribosomal domain is at least partially conserved.

Pair- ${v}$ -SVR: A Novel and Efficient Pairing nu-Support Vector Regression Algorithm.

Science.gov (United States)

Hao, Pei-Yi

This paper proposes a novel and efficient pairing nu-support vector regression (pair--SVR) algorithm that combines successfully the superior advantages of twin support vector regression (TSVR) and classical -SVR algorithms. In spirit of TSVR, the proposed pair--SVR solves two quadratic programming problems (QPPs) of smaller size rather than a single larger QPP, and thus has faster learning speed than classical -SVR. The significant advantage of our pair--SVR over TSVR is the improvement in the prediction speed and generalization ability by introducing the concepts of the insensitive zone and the regularization term that embodies the essence of statistical learning theory. Moreover, pair--SVR has additional advantage of using parameter for controlling the bounds on fractions of SVs and errors. Furthermore, the upper bound and lower bound functions of the regression model estimated by pair--SVR capture well the characteristics of data distributions, thus facilitating automatic estimation of the conditional mean and predictive variance simultaneously. This may be useful in many cases, especially when the noise is heteroscedastic and depends strongly on the input values. The experimental results validate the superiority of our pair--SVR in both training/prediction speed and generalization ability.This paper proposes a novel and efficient pairing nu-support vector regression (pair--SVR) algorithm that combines successfully the superior advantages of twin support vector regression (TSVR) and classical -SVR algorithms. In spirit of TSVR, the proposed pair--SVR solves two quadratic programming problems (QPPs) of smaller size rather than a single larger QPP, and thus has faster learning speed than classical -SVR. The significant advantage of our pair--SVR over TSVR is the improvement in the prediction speed and generalization ability by introducing the concepts of the insensitive zone and the regularization term that embodies the essence of statistical learning theory

Predicting transmission of structure-borne sound power from machines by including terminal cross-coupling

DEFF Research Database (Denmark)

Ohlrich, Mogens

2011-01-01

of translational terminals in a global plane. This paired or bi-coupled power transmission represents the simplest case of cross-coupling. The procedure and quality of the predicted transmission using this improved technique is demonstrated experimentally for an electrical motor unit with an integrated radial fan......Structure-borne sound generated by audible vibration of machines in vehicles, equipment and house-hold appliances is often a major cause of noise. Such vibration of complex machines is mostly determined and quantified by measurements. It has been found that characterization of the vibratory source...

Fingerprint Identification Using SIFT-Based Minutia Descriptors and Improved All Descriptor-Pair Matching

Directory of Open Access Journals (Sweden)

Jiuqiang Han

2013-03-01

Full Text Available The performance of conventional minutiae-based fingerprint authentication algorithms degrades significantly when dealing with low quality fingerprints with lots of cuts or scratches. A similar degradation of the minutiae-based algorithms is observed when small overlapping areas appear because of the quite narrow width of the sensors. Based on the detection of minutiae, Scale Invariant Feature Transformation (SIFT descriptors are employed to fulfill verification tasks in the above difficult scenarios. However, the original SIFT algorithm is not suitable for fingerprint because of: (1 the similar patterns of parallel ridges; and (2 high computational resource consumption. To enhance the efficiency and effectiveness of the algorithm for fingerprint verification, we propose a SIFT-based Minutia Descriptor (SMD to improve the SIFT algorithm through image processing, descriptor extraction and matcher. A two-step fast matcher, named improved All Descriptor-Pair Matching (iADM, is also proposed to implement the 1:N verifications in real-time. Fingerprint Identification using SMD and iADM (FISiA achieved a significant improvement with respect to accuracy in representative databases compared with the conventional minutiae-based method. The speed of FISiA also can meet real-time requirements.

Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine †

OpenAIRE

Bhamra, Inder; Compagnone-Post, Patricia; O’Neil, Ian A.; Iwanejko, Lesley A.; Bates, Andrew D.; Cosstick, Richard

2012-01-01

8-Nitro-2′-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2′-O-methylguanosine, a ribonucleoside analogue of this lesi...

Observing Pair-Work Task in an English Speaking Class

Directory of Open Access Journals (Sweden)

Diana Achmad

2014-01-01

Full Text Available This paper reports on students’ pair-work interactions to develop their speaking skills in an ELT classroom which consisted of international learners. A number of 16 learners of intermediate proficiency with IELTS score band 5.5 were observed. The teacher had paired those he considered among them to be the more competent ones (hereafter, stronger with the less competent ones (hereafter, weaker; therefore, eight pairs were observed during the lesson. The task given to the students was to express ‘Agree and Disagree’ in the context of giving opinions related to social life. Based on the observations, the task was successfully implemented by six pairs; thus, the two others faced some problems. From the first pair, it was seen that the stronger student had intimated the weaker one into speaking during the task. The other pair, who was both of the same native, did not converse in English as expected and mostly used their native language to speak with one another presumably due to respect from the stronger student towards the weaker one. In situations like this, when pair-work becomes unproductive, rotating pairs is recommended to strengthen information sharing and assigning roles to avoid a student from taking over the activity from his or her pair. In conclusion, pairing international learners with mixed speaking proficiency by teachers must be conducted as effectively as possible by initially identifying their ability and learning culture to profoundly expand the students’ language resources.

An Intelligent Terminal for Access to a Medical Database

Science.gov (United States)

Womble, M. E.; Wilson, S. D.; Keiser, H. N.; Tworek, M. L.

1978-01-01

Very powerful data base management systems (DBMS) now exist which allow medical personnel access to patient record data bases. DBMS's make it easy to retrieve either complete or abbreviated records of patients with similar characteristics. In addition, statistics on data base records are immediately accessible. However, the price of this power is a large computer with the inherent problems of access, response time, and reliability. If a general purpose, time-shared computer is used to get this power, the response time to a request can be either rapid or slow, depending upon loading by other users. Furthermore, if the computer is accessed via dial-up telephone lines, there is competition with other users for telephone ports. If either the DBMS or the host machine is replaced, the medical users, who are typically not sophisticated in computer usage, are forced to learn the new system. Microcomputers, because of their low cost and adaptability, lend themselves to a solution of these problems. A microprocessor-based intelligent terminal has been designed and implemented at the USAF School of Aerospace Medicine to provide a transparent interface between the user and his data base. The intelligent terminal system includes multiple microprocessors, floppy disks, a CRT terminal, and a printer. Users interact with the system at the CRT terminal using menu selection (framing). The system translates the menu selection into the query language of the DBMS and handles all actual communication with the DBMS and its host computer, including telephone dialing and sign on procedures, as well as the actual data base query and response. Retrieved information is stored locally for CRT display, hard copy production, and/or permanent retention. Microprocessor-based communication units provide security for sensitive medical data through encryption/decryption algorithms and high reliability error detection transmission schemes. Highly modular software design permits adapation to a

Towards a Theory for Testing Non-terminating Programs

DEFF Research Database (Denmark)

Gotlieb, Arnaud; Petit, Matthieu

2009-01-01

Non-terminating programs are programs that legally perform unbounded computations. Though they are ubiquitous in real-world applications, testing these programs requires new theoretic developments as usual definitions of test data adequacy criteria ignore infinite paths. This paper develops...... a theory of program-based structural testing based on operational semantics. Reasoning at the program semantics level permits to cope with infinite paths (and non-feasible paths) when defining test data adequacy criteria. As a result, our criteria respect the first Weyuker’s property on finite...... applicability, even for non-terminating programs. We discuss the consequences of this re-interpretation of test data adequacy criteria w.r.t. existing test coverage criteria....

NMR scalar couplings across Watson–Crick base pair hydrogen bonds in DNA observed by transverse relaxation-optimized spectroscopy

Science.gov (United States)

Pervushin, Konstantin; Ono, Akira; Fernández, César; Szyperski, Thomas; Kainosho, Masatsune; Wüthrich, Kurt

1998-01-01

This paper describes the NMR observation of 15N—15N and 1H—15N scalar couplings across the hydrogen bonds in Watson–Crick base pairs in a DNA duplex, hJNN and hJHN. These couplings represent new parameters of interest for both structural studies of DNA and theoretical investigations into the nature of the hydrogen bonds. Two dimensional [15N,1H]-transverse relaxation-optimized spectroscopy (TROSY) with a 15N-labeled 14-mer DNA duplex was used to measure hJNN, which is in the range 6–7 Hz, and the two-dimensional hJNN-correlation-[15N,1H]-TROSY experiment was used to correlate the chemical shifts of pairs of hydrogen bond-related 15N spins and to observe, for the first time, hJHN scalar couplings, with values in the range 2–3.6 Hz. TROSY-based studies of scalar couplings across hydrogen bonds should be applicable for large molecular sizes, including protein-bound nucleic acids. PMID:9826668

Storage Space Allocation of Inbound Container in Railway Container Terminal

Directory of Open Access Journals (Sweden)

Li Wang

2014-01-01

Full Text Available Efficient storage strategy of railway container terminals is important in balancing resource utilization, reducing waiting time, and improving handling efficiency. In this paper, we consider the formulation and solution algorithm for storage space allocation problem of inbound containers in railway container terminal. The problem is formulated as two-stage optimization models, whose objectives are balancing the workload of inbound containers and reducing the overlapping amounts. An algorithm implement process based on rolling horizon approach is designed to solve the proposed models. Computational experiments on an actual railway container terminal show that the proposed approach is effective to solve space allocation problem of inbound container and is significant for the operation and organization of railway container terminals.

Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase ι: Hoogsteen or Watson-Crick base pairing?†

Science.gov (United States)

Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

2009-01-01

Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase ι (polι) is a bypass polymerase of the Y family. Crystal structures of polι suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that polι is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetyl-aminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in polι for bypass of dG-AAF. In polι with Hoogsteen paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that polι would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for polι in lesion bypass. PMID:19072536

Interior point algorithm-based power flow optimisation of a combined AC and DC multi-terminal grid

Directory of Open Access Journals (Sweden)

Farhan Beg

2015-01-01

Full Text Available The high cost of power electronic equipment, lower reliability and poor power handling capacity of the semiconductor devices had stalled the deployment of systems based on DC (multi-terminal direct current system (MTDC networks. The introduction of voltage source converters (VSCs for transmission has renewed the interest in the development of large interconnected grids based on both alternate current (AC and DC transmission networks. Such a grid platform also realises the added advantage of integrating the renewable energy sources into the grid. Thus a grid based on DC MTDC network is a possible solution to improve energy security and check the increasing supply demand gap. An optimal power solution for combined AC and DC grids obtained by the solution of the interior point algorithm is proposed in this study. Multi-terminal HVDC grids lie at the heart of various suggested transmission capacity increases. A significant difference is observed when MTDC grids are solved for power flows in place of conventional AC grids. This study deals with the power flow problem of a combined MTDC and an AC grid. The AC side is modelled with the full power flow equations and the VSCs are modelled using a connecting line, two generators and an AC node. The VSC and the DC losses are also considered. The optimisation focuses on several different goals. Three different scenarios are presented in an arbitrary grid network with ten AC nodes and five converter stations.

Formation of a silicon terminated (100) diamond surface

International Nuclear Information System (INIS)

Schenk, Alex; Sear, Michael; Pakes, Chris; Tadich, Anton; O'Donnell, Kane M.; Ley, Lothar; Stacey, Alastair

2015-01-01

We report the preparation of an ordered silicon terminated diamond (100) surface with a two domain 3 × 1 reconstruction as determined by low energy electron diffraction. Based on the dimensions of the surface unit cell and on chemical information provided by core level photoemission spectra, a model for the structure is proposed. The termination should provide a homogeneous, nuclear, and electron spin-free surface for the development of future near-surface diamond quantum device architectures

Josephson junction analog and quasiparticle-pair current

DEFF Research Database (Denmark)

Bak, Christen Kjeldahl; Pedersen, Niels Falsig

1973-01-01

A close analogy exists between a Josephson junction and a phase-locked loop. A new type of electrical analog based on this principle is presented. It is shown that the inclusion in this analog of a low-pass filter gives rise to a current of the same form as the Josephson quasiparticle-pair current....... A simple picture of the quasiparticle-pair current, which gives the right dependences, is obtained by assuming a junction cutoff frequency to be at the energy gap. ©1973 American Institute of Physics...

Perpendicular relativistic shocks in magnetized pair plasma

Science.gov (United States)

Plotnikov, Illya; Grassi, Anna; Grech, Mickael

2018-04-01

Perpendicular relativistic (γ0 = 10) shocks in magnetized pair plasmas are investigated using two dimensional Particle-in-Cell simulations. A systematic survey, from unmagnetized to strongly magnetized shocks, is presented accurately capturing the transition from Weibel-mediated to magnetic-reflection-shaped shocks. This transition is found to occur for upstream flow magnetizations 10-3 10-2, it leaves place to a purely electromagnetic precursor following from the strong emission of electromagnetic waves at the shock front. Particle acceleration is found to be efficient in weakly magnetized perpendicular shocks in agreement with previous works, and is fully suppressed for σ > 10-2. Diffusive Shock Acceleration is observed only in weakly magnetized shocks, while a dominant contribution of Shock Drift Acceleration is evidenced at intermediate magnetizations. The spatial diffusion coefficients are extracted from the simulations allowing for a deeper insight into the self-consistent particle kinematics and scale with the square of the particle energy in weakly magnetized shocks. These results have implications for particle acceleration in the internal shocks of AGN jets and in the termination shocks of Pulsar Wind Nebulae.

Terminal weather information management

Science.gov (United States)

Lee, Alfred T.

1990-01-01

Since the mid-1960's, microburst/windshear events have caused at least 30 aircraft accidents and incidents and have killed more than 600 people in the United States alone. This study evaluated alternative means of alerting an airline crew to the presence of microburst/windshear events in the terminal area. Of particular interest was the relative effectiveness of conventional and data link ground-to-air transmissions of ground-based radar and low-level windshear sensing information on microburst/windshear avoidance. The Advanced Concepts Flight Simulator located at Ames Research Center was employed in a line oriented simulation of a scheduled round-trip airline flight from Salt Lake City to Denver Stapleton Airport. Actual weather en route and in the terminal area was simulated using recorded data. The microburst/windshear incident of July 11, 1988 was re-created for the Denver area operations. Six experienced airline crews currently flying scheduled routes were employed as test subjects for each of three groups: (1) A baseline group which received alerts via conventional air traffic control (ATC) tower transmissions; (2) An experimental group which received alerts/events displayed visually and aurally in the cockpit six miles (approx. 2 min.) from the microburst event; and (3) An additional experimental group received displayed alerts/events 23 linear miles (approx. 7 min.) from the microburst event. Analyses of crew communications and decision times showed a marked improvement in both situation awareness and decision-making with visually displayed ground-based radar information. Substantial reductions in the variability of decision times among crews in the visual display groups were also found. These findings suggest that crew performance will be enhanced and individual differences among crews due to differences in training and prior experience are significantly reduced by providing real-time, graphic display of terminal weather hazards.

LNG TERMINAL SAFE OPERATION MANAGEMENT

Directory of Open Access Journals (Sweden)

Andrzej ADAMKIEWICZ

2012-07-01

Full Text Available This article presents the significance of LNG terminal safety issues in natural gas sea transport. It shows particular requirements for LNG transmission installations resulting from the specific properties of LNG. Out of the multi‐layer critical safety areas comprising structural elements of the terminal safety system, possibilities to decrease the risk of emergency occurrence on LNG terminals have been selected. Tasks performed by the LNG terminal, together with its own personnel and the outside one, have been defined. General theses for LNG terminal safety have been formulated.

Magnetism of triangular nanoflakes with different compositions and edge terminations

International Nuclear Information System (INIS)

Zhang Shunhong; Zhou Jian; Li Xiaowei; Wang Qian

2012-01-01

Since the discovery of the giant magnetoresistance effect, extensive research has been devoted to finding new materials for spintronic devices. The hotly pursued nanostructure-based magnetic materials are potential candidates for such applications. Among them, graphene triangular nanoflakes (G-TNFs), due to their special magnetic configurations, can serve as building blocks for design of new C-based magnetic materials. This motivates the present study to systematically investigate how magnetism of the TNFs changes with their edge termination, composition, and atomic distribution. Using density functional theory, we show that the F-terminated G-TNFs have similar magnetic behavior to the H-terminated G-TNFs. Besides the edge terminations, partially hydrogenation of interior C atoms in the G-TNFs breaks the conjugate π orbitals and thus leads to extra net magnetic moment. The IV-group binary SiC-TNFs resemble the G-TNFs in magnetic properties, while the III–V group binary BN- and AlN-TNFs are different although they also have honeycomb structures. The different magnetic behaviors originate from the different occupations of p z atomic orbitals and the resulting change of conjugate π molecular orbitals. This study provides physical insight on tuning the magnetic behavior of TNFs through controlling their composition, size, and edge termination.

Designing an ASIP for cryptographic pairings over Barreto-Naehrig curves

NARCIS (Netherlands)

Kammler, D.; Zhang, D.; Schwabe, P.; Scharwaechter, H.; Langenberg, M.; Auras, D.; Ascheid, G.; Mathar, R.; Clavier, C.; Gaj, K.

2009-01-01

This paper presents a design-space exploration of an application-specific instruction-set processor (ASIP) for the computation of various cryptographic pairings over Barreto-Naehrig curves (BN curves). Cryptographic pairings are based on elliptic curves over finite fields—in the case of BN curves a

Surprising conformers of the biologically important A·T DNA base pairs: QM/QTAIM proofs

Science.gov (United States)

Brovarets', Ol'ha O.; Tsiupa, Kostiantyn S.; Hovorun, Dmytro M.

2018-02-01

For the first time novel high-energy conformers – A·T(wWC) (5.36), A·T(wrWC) (5.97), A·T(wH) (5.78) and A·T(wrH) (ΔG=5.82 kcal•mol-1) were revealed for each of the four biologically important A·T(WC) DNA base pairs – Watson-Crick A·T(WC), reverse Watson-Crick A·T(rWC), Hoogsteen A·T(H) and reverse Hoogsteen A·T(rH) at the MP2/aug-cc-pVDZ//B3LYP/6-311++G(d,p) level of quantum-mechanical theory in the continuum with ɛ=4 under normal conditions. Each of these conformers possesses substantially non-planar wobble (w) structure and is stabilized by the participation of the two anti-parallel N6H/N6H'…O4/O2 and N3H…N6 H-bonds, involving the pyramidalized amino group of the A DNA base as an acceptor and a donor of the H-bonding. The transition states – TSA·T(WC)↔A·T(wWC), TSA·T(rWC)↔A·T(wrWC), TSA·T(H)↔A·T(wH) and TSA·T(rH)↔A·T(wrH), controlling the dipole-active transformations of the conformers from the main plane-symmetric state into the high-energy, significantly non-planar state and vice versa, were localized. They also possess wobble structures similarly to the high-energy conformers and are stabilized by the participation of the N6H/N6H'…O4/O2 and N3H…N6 H-bonds. Discovered conformers of the A·T DNA base pairs are dynamically stable short-lived structures (lifetime τ = (1.4-3.9) ps). Their possible biological significance and future perspectives have been briefly discussed.

Surprising Conformers of the Biologically Important A·T DNA Base Pairs: QM/QTAIM Proofs

Directory of Open Access Journals (Sweden)

Ol'ha O. Brovarets'

2018-02-01

Full Text Available For the first time novel high-energy conformers–A·T(wWC (5.36, A·T(wrWC (5.97, A·T(wH (5.78, and A·T(wrH (ΔG = 5.82 kcal·mol−1 (See Graphical Abstract were revealed for each of the four biologically important A·T DNA base pairs – Watson-Crick A·T(WC, reverse Watson-Crick A·T(rWC, Hoogsteen A·T(H and reverse Hoogsteen A·T(rH at the MP2/aug-cc-pVDZ//B3LYP/6-311++G(d,p level of quantum-mechanical theory in the continuum with ε = 4 under normal conditions. Each of these conformers possesses substantially non-planar wobble (w structure and is stabilized by the participation of the two anti-parallel N6H/N6H′…O4/O2 and N3H…N6 H-bonds, involving the pyramidalized amino group of the A DNA base as an acceptor and a donor of the H-bonding. The transition states – TSA·T(WC↔A·T(wWC, TSA·T(rWC↔A·T(wrWC, TSA·T(H↔A·T(wH, and TSA·T(rH↔A·T(wrH, controlling the dipole-active transformations of the conformers from the main plane-symmetric state into the high-energy, significantly non-planar state and vice versa, were localized. They also possess wobble structures similarly to the high-energy conformers and are stabilized by the participation of the N6H/N6H′…O4/O2 and N3H…N6 H-bonds. Discovered conformers of the A·T DNA base pairs are dynamically stable short-lived structures [lifetime τ = (1.4–3.9 ps]. Their possible biological significance and future perspectives have been briefly discussed.

Pair formation models for sexually transmitted infections: A primer

Directory of Open Access Journals (Sweden)

Mirjam Kretzschmar

2017-08-01

Full Text Available For modelling sexually transmitted infections, duration of partnerships can strongly influence the transmission dynamics of the infection. If partnerships are monogamous, pairs of susceptible individuals are protected from becoming infected, while pairs of infected individuals delay onward transmission of the infection as long as they persist. In addition, for curable infections re-infection from an infected partner may occur. Furthermore, interventions based on contact tracing rely on the possibility of identifying and treating partners of infected individuals. To reflect these features in a mathematical model, pair formation models were introduced to mathematical epidemiology in the 1980's. They have since been developed into a widely used tool in modelling sexually transmitted infections and the impact of interventions. Here we give a basic introduction to the concepts of pair formation models for a susceptible-infected-susceptible (SIS epidemic. We review some results and applications of pair formation models mainly in the context of chlamydia infection. Keywords: Pair formation, Mathematical model, Partnership duration, Sexually transmitted infections, Basic reproduction number

Two mechanisms coordinate replication termination by the Escherichia coli Tus–Ter complex

KAUST Repository

Pandey, Manjula

2015-07-13

The Escherichia coli replication terminator protein (Tus) binds to Ter sequences to block replication forks approaching from one direction. Here, we used single molecule and transient state kinetics to study responses of the heterologous phage T7 replisome to the Tus–Ter complex. The T7 replisome was arrested at the non-permissive end of Tus–Ter in a manner that is explained by a composite mousetrap and dynamic clamp model. An unpaired C(6) that forms a lock by binding into the cytosine binding pocket of Tus was most effective in arresting the replisome and mutation of C(6) removed the barrier. Isolated helicase was also blocked at the non-permissive end, but unexpectedly the isolated polymerase was not, unless C(6) was unpaired. Instead, the polymerase was blocked at the permissive end. This indicates that the Tus–Ter mechanism is sensitive to the translocation polarity of the DNA motor. The polymerase tracking along the template strand traps the C(6) to prevent lock formation; the helicase tracking along the other strand traps the complementary G(6) to aid lock formation. Our results are consistent with the model where strand separation by the helicase unpairs the GC(6) base pair and triggers lock formation immediately before the polymerase can sequester the C(6) base.

Awakened Oscillations in Coupled Consumer-Resource Pairs

Directory of Open Access Journals (Sweden)

Almaz Mustafin

2014-01-01

Full Text Available The paper concerns two interacting consumer-resource pairs based on chemostat-like equations under the assumption that the dynamics of the resource is considerably slower than that of the consumer. The presence of two different time scales enables to carry out a fairly complete analysis of the problem. This is done by treating consumers and resources in the coupled system as fast-scale and slow-scale variables, respectively, and subsequently considering developments in phase planes of these variables, fast and slow, as if they are independent. When uncoupled, each pair has unique asymptotically stable steady state and no self-sustained oscillatory behavior (although damped oscillations about the equilibrium are admitted. When the consumer-resource pairs are weakly coupled through direct reciprocal inhibition of consumers, the whole system exhibits self-sustained relaxation oscillations with a period that can be significantly longer than intrinsic relaxation time of either pair. It is shown that the model equations adequately describe locally linked consumer-resource systems of quite different nature: living populations under interspecific interference competition and lasers coupled via their cavity losses.

Rheokinetic Analysis of Hydroxy Terminated Polybutadiene Based Solid Propellant Slurry

Directory of Open Access Journals (Sweden)

Abhay K Mahanta

2010-01-01

Full Text Available The cure kinetics of propellant slurry based on hydroxy-terminated polybutadiene (HTPB and toluene diisocyanate (TDI polyurethane reaction has been studied by viscosity build up method. The viscosity (ɳ–time (t plots conform to the exponential function ɳ = aebt, where a & b are empirical constants. The rate constants (k for viscosity build up at various shear rate (rpm, evaluated from the slope of dɳ/dt versus ɳ plots at different temperatures, were found to vary from 0.0032 to 0.0052 min-1. It was observed that the increasing shear rate did not have significant effect on the reaction rate constants for viscosity build up of the propellant slurry. The activation energy (Eɳ, calculated from the Arrhenius plots, was found to be 13.17±1.78 kJ mole-1, whereas the activation enthalpy (∆Hɳ* and entropy (∆Sɳ* of the propellant slurry, calculated from Eyring relationship, were found to be 10.48±1.78 kJ mole-1 and –258.51± 5.38 J mole-1K-1, respectively. The reaction quenching temperature of the propellant slurry was found to be -9 ° C, based upon the experimental data. This opens up an avenue for a “freeze-and-store”, then “warm-up and cast”, mode of manufacturing of very large solid rocket propellant grains.

Nanoscale protein diffusion by STED-based pair correlation analysis.

Directory of Open Access Journals (Sweden)

Paolo Bianchini

Full Text Available We describe for the first time the combination between cross-pair correlation function analysis (pair correlation analysis or pCF and stimulated emission depletion (STED to obtain diffusion maps at spatial resolution below the optical diffraction limit (super-resolution. Our approach was tested in systems characterized by high and low signal to noise ratio, i.e. Capsid Like Particles (CLPs bearing several (>100 active fluorescent proteins and monomeric fluorescent proteins transiently expressed in living Chinese Hamster Ovary cells, respectively. The latter system represents the usual condition encountered in living cell studies on fluorescent protein chimeras. Spatial resolution of STED-pCF was found to be about 110 nm, with a more than twofold improvement over conventional confocal acquisition. We successfully applied our method to highlight how the proximity to nuclear envelope affects the mobility features of proteins actively imported into the nucleus in living cells. Remarkably, STED-pCF unveiled the existence of local barriers to diffusion as well as the presence of a slow component at distances up to 500-700 nm from either sides of nuclear envelope. The mobility of this component is similar to that previously described for transport complexes. Remarkably, all these features were invisible in conventional confocal mode.

Nonleaking battery terminals.

Science.gov (United States)

Snider, W. E.; Nagle, W. J.

1972-01-01

Three different terminals were designed for usage in a 40 ampere/hour silver zinc battery which has a 45% KOH by weight electrolyte in a plastic battery case. Life tests, including thermal cycling, electrical charge and discharge for up to three years duration, were conducted on these three different terminal designs. Tests for creep rate and tensile strength were conducted on the polyphenylene oxide plastic battery cases. Some cases were unused and others containing KOH electrolyte were placed on life tests. The design and testing of nonleaking battery terminals for use with a KOH electrolyte in a plastic case are considered.

A generic inertia emulation controller for multi-terminal VSC-HVDC systems

DEFF Research Database (Denmark)

Zhu, Jiebei; Guerrero, Josep M.; Booth, Campbell

2013-01-01

A generic Inertia Emulation Controller (INEC) for Multi-Terminal Voltage-source-converter based HVDC (VSC-MTDC) is proposed in this paper. The proposed INEC can be incorporated in any grid-side-voltage-source-converter (GVSC) station, allowing the MTDC terminal to contribute an inertial response...

Synthesis and characterization of phenylethynylcarbonyl terminated novel thermosetting imide compound

Directory of Open Access Journals (Sweden)

H. Kimura

2013-02-01

Full Text Available Phenylethynyl terminated novel imide compound based on 1,3-bis(3-aminophenoxybenzene (APB and phenylethynyl trimellitic anhydride (PETA were prepared. The curing behavior of phenylethynyl terminated imide compound was investigated by differential scanning calorimetry and Fourier transform infrared spectrometry. The curing reaction of phenylethynylcarbonyl end group completed at 220°C, and proceeded much faster than that of phenylethynyl end group. Glass transition temperature of the thermosetting resin from phenylethynylcarbonyl terminated novel imide compound determined by dynamic mechanical analysis was almost the same as that of o-cresolnovolac type epoxy resin. In addition, the thermosetting resin from phenylethynylcarbonyl terminated novel imide compound exhibited excellent thermal and dimensional stabilities. These excellent properties of these phenylethynyl terminated imide compound might be due to the incorporation of alkene group or aromatic ring substitutes in the backbones, which might enhance the chain interaction (molecular packing and reduce the molecular chain mobility.

Cooper Pairs in Insulators?

International Nuclear Information System (INIS)

Valles, James

2008-01-01

Nearly 50 years elapsed between the discovery of superconductivity and the emergence of the microscopic theory describing this zero resistance state. The explanation required a novel phase of matter in which conduction electrons joined in weakly bound pairs and condensed with other pairs into a single quantum state. Surprisingly, this Cooper pair formation has also been invoked to account for recently uncovered high-resistance or insulating phases of matter. To address this possibility, we have used nanotechnology to create an insulating system that we can probe directly for Cooper pairs. I will present the evidence that Cooper pairs exist and dominate the electrical transport in these insulators and I will discuss how these findings provide new insight into superconductor to insulator quantum phase transitions.

Evidence for Watson-Crick and not Hoogsteen or wobble base pairing in the selection of nucleotides for insertion opposite pyrimidines and a thymine dimer by yeast DNA pol eta.

Science.gov (United States)

Hwang, Hanshin; Taylor, John-Stephen

2005-03-29

We have recently reported that pyrene nucleotide is preferentially inserted opposite an abasic site, the 3'-T of a thymine dimer, and most undamaged bases by yeast DNA polymerase eta (pol eta). Because pyrene is a nonpolar molecule with no H-bonding ability, the unusually high efficiencies of dPMP insertion are ascribed to its superior base stacking ability, and underscore the importance of base stacking in the selection of nucleotides by pol eta. To investigate the role of H-bonding and base pair geometry in the selection of nucleotides by pol eta, we determined the insertion efficiencies of the base-modified nucleotides 2,6-diaminopurine, 2-aminopurine, 6-chloropurine, and inosine which would make a different number of H-bonds with the template base depending on base pair geometry. Watson-Crick base pairing appears to play an important role in the selection of nucleotide analogues for insertion opposite C and T as evidenced by the decrease in the relative insertion efficiencies with a decrease in the number of Watson-Crick H-bonds and an increase in the number of donor-donor and acceptor-acceptor interactions. The selectivity of nucleotide insertion is greater opposite the 5'-T than the 3'-T of the thymine dimer, in accord with previous work suggesting that the 5'-T is held more rigidly than the 3'-T. Furthermore, insertion of A opposite both Ts of the dimer appears to be mediated by Watson-Crick base pairing and not by Hoogsteen base pairing based on the almost identical insertion efficiencies of A and 7-deaza-A, the latter of which lacks H-bonding capability at N7. The relative efficiencies for insertion of nucleotides that can form Watson-Crick base pairs parallel those for the Klenow fragment, whereas the Klenow fragment more strongly discriminates against mismatches, in accord with its greater shape selectivity. These results underscore the importance of H-bonding and Watson-Crick base pair geometry in the selection of nucleotides by both pol eta and the

Optimal Decisions for Organ Exchanges in a Kidney Paired Donation Program.

Science.gov (United States)

Li, Yijiang; Song, Peter X-K; Zhou, Yan; Leichtman, Alan B; Rees, Michael A; Kalbfleisch, John D

2014-05-01

The traditional concept of barter exchange in economics has been extended in the modern era to the area of living-donor kidney transplantation, where one incompatible donor-candidate pair is matched to another pair with a complementary incompatibility, such that the donor from one pair gives an organ to a compatible candidate in the other pair and vice versa. Kidney paired donation (KPD) programs provide a unique and important platform for living incompatible donor-candidate pairs to exchange organs in order to achieve mutual benefit. In this paper, we propose novel organ allocation strategies to arrange kidney exchanges under uncertainties with advantages, including (i) allowance for a general utility-based evaluation of potential kidney transplants and an explicit consideration of stochastic features inherent in a KPD program; and (ii) exploitation of possible alternative exchanges when the originally planned allocation cannot be fully executed. This allocation strategy is implemented using an integer programming (IP) formulation, and its implication is assessed via a data-based simulation system by tracking an evolving KPD program over a series of match runs. Extensive simulation studies are provided to illustrate our proposed approach.

Three-terminal superconducting devices

International Nuclear Information System (INIS)

Gallagher, W.J.

1985-01-01

The transistor has a number of properties that make it so useful. The authors discuss these and the additional properties a transistor would need to have for high performance applications at temperatures where superconductivity could contribute advantages to system-level performance. These properties then serve as criteria by which to evaluate three-terminal devices that have been proposed for applications at superconducting temperatures. FETs can retain their transistor properties at low temperatures, but their power consumption is too large for high-speed, high-density cryogenic applications. They discuss in detail why demonstrated superconducting devices with three terminals -Josephson effect based devices, injection controlled weak links, and stacked tunnel junction devices such as the superconducting transistor proposed by K. Gray and the quiteron -- each fail to have true transistor-like properties. They conclude that the potentially very rewarding search for a transistor compatible with superconductivity in high performance applications must be in new directions

Charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion

Energy Technology Data Exchange (ETDEWEB)

Rahmi, Kinanti Aldilla, E-mail: kinanti.aldilla@ui.ac.id; Yudiarsah, Efta [Physics Department, FMIPA, Universitas Indonesia, Kampus UI Depok (Indonesia)

2016-04-19

By using tight binding Hamiltonian model, charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion is studied. The DNA chain used is 32 base pairs long poly(dA)-poly(dT) molecule. The molecule is contacted to electrode at both ends. The influence of environment on charge transport in DNA is modeled as variation of backbone disorder. The twisting motion amplitude is taking into account by assuming that the twisting angle distributes following Gaussian distribution function with zero average and standard deviation proportional to square root of temperature and inversely proportional to the twisting motion frequency. The base-pair twisting motion influences both the onsite energy of the bases and electron hopping constant between bases. The charge transport properties are studied by calculating current using Landauer-Buttiker formula from transmission probabilities which is calculated by transfer matrix methods. The result shows that as the backbone disorder increases, the maximum current decreases. By decreasing the twisting motion frequency, the current increases rapidly at low voltage, but the current increases slower at higher voltage. The threshold voltage can increase or decrease with increasing backbone disorder and increasing twisting frequency.

Understanding Fomalhaut as a Cooper pair

Science.gov (United States)

Feng, F.; Jones, H. R. A.

2018-03-01

Fomalhaut is a nearby stellar system and has been found to be a triple based on astrometric observations. With new radial velocity and astrometric data, we study the association between Fomalhaut A, B, and C in a Bayesian framework, finding that the system is gravitationally bound or at least associated. Based on simulations of the system, we find that Fomalhaut C can be easily destabilized through combined perturbations from the Galactic tide and stellar encounters. Considering that observing the disruption of a triple is probably rare in the solar neighbourhood, we conclude that Fomalhaut C is a so-called `gravitational pair' of Fomalhaut A and B. Like the Cooper pair mechanism in superconductors, this phenomenon only appears once the orbital energy of a component becomes comparable with the energy fluctuations caused by the environment. Based on our simulations, we find (1) an upper limit of 8 km s-1 velocity difference is appropriate when selecting binary candidates, and (2) an empirical formula for the escape radius, which is more appropriate than tidal radius when measuring the stability of wide binaries.

[Involvement of cranial pairs as manifestation of prostatic cancer].

Science.gov (United States)

Ripa Saldias, L M; Ayuso Blanco, T; Delpon Pérez, E; Sarria Octavio de Toledo, L

1994-10-01

Two cases of prostate cancer (PC) which presented clinically with affectation of the cranial pairs due to skull base metastasis. In both cases, existence of intraparenchimatous brain metastasis was excluded. Initial improvement with hormonal therapy was followed by clinical, analytical and radiological relapse due to spread of process until death, at 11 and 36 months from diagnosis. Although PC's bone metastasis are frequent, their location at the skull base is uncommon. Even more rare are the cases which present with changes in the cranial pairs in the absence of signs and symptoms of prostatism.

Hybrid organic-inorganic coatings based on alkoxy-terminated macromonomers

Energy Technology Data Exchange (ETDEWEB)

Kaddami, H. [Laboratoire des Materiaux Macromoleculaires---URA CNRS 507, Institut National des Sciences Appliquees de Lyon---Bat 403, 69621 Villeurbanne (France); Cuney, S. [Laboratoire des Materiaux Macromoleculaires---URA CNRS 507, Institut National des Sciences Appliquees de Lyon---Bat 403, 69621 Villeurbanne (France)]|[BSN Emballage-Centre de Recherche de Saint-Romain-en-Gier, 69700 Givors Cedex (France); Pascault, J.P. [Laboratoire des Materiaux Macromoleculaires---URA CNRS 507, Institut National des Sciences Appliquees de Lyon-Bat 403, 69621 Villeurbanne (France); Gerard, J.F. [Laboratoire des Materiaux Macromoleculaires---URA CNRS 507, Institut National des Sciences Appliquees de Lyon-Bat 403, 69621 Villeurbanne (France)

1996-01-01

From the use of alkoxysilane-terminated macromonomers based on hydrogenated polybutadiene and polycaprolactone oligomers and by using the polyurethane chemistry, hybrid organic{emdash}inorganic materials are prepared. These ones are two-phases systems in which the continuous phase is organic reinforced by silicon rich dispersed particles. These nanosized dispersed particles are formed {ital in} {ital situ} during the hydrolysis and condensation of the sol-gel process according to the phase separation process occurring between the organic and inorganic phases. The gelation process and the final morphologies were found to be very dependent on the acid(catalyst)-to-silicon ratio, on the molar mass of the oligomers, and on the solubility parameter of the soft segment. In fact, during the synthesis, there is a competition between the gelation and the phase separation process which could be perturbated by the vitrification of the silicon-rich clusters. The final morphologies observed by TEM and SAXS are discussed on the basis of the microstructural model proposed by Wilkes and Huang. Such hybrid organic-inorganic materials are applied as coatings on glass float plates tested in a bi-axial mode. The reinforcement is discussed as a function of the morphology of the coatings. {copyright} {ital 1996 American Institute of Physics.}

Charge Aspects of Composite Pair Superconductivity

Science.gov (United States)

Flint, Rebecca

2014-03-01

Conventional Cooper pairs form from well-defined electronic quasiparticles, making the internal structure of the pair irrelevant. However, in the 115 family of superconductors, the heavy electrons are forming as they pair and the internal pair structure becomes as important as the pairing mechanism. Conventional spin fluctuation mediated pairing cannot capture the direct transition from incoherent local moments to heavy fermion superconductivity, but the formation of composite pairs favored by the two channel Kondo effect can. These composite pairs are local d-wave pairs formed by two conduction electrons in orthogonal Kondo channels screening the same local moment. Composite pairing shares the same symmetries as magnetically mediated pairing, however, only composite pairing necessarily involves a redistribution of charge within the unit cell originating from the internal pair structure, both as a monopole (valence change) and a quadrupole effect. This redistribution will onset sharply at the superconducting transition temperature. A smoking gun test for composite pairing is therefore a sharp signature at Tc - for example, a cusp in the Mossbauer isomer shift in NpPd5Al2 or in the NQR shift in (Ce,Pu)CoIn5.

C-terminal peptides of tissue factor pathway inhibitor are novel host defense molecules.

Science.gov (United States)

Papareddy, Praveen; Kalle, Martina; Kasetty, Gopinath; Mörgelin, Matthias; Rydengård, Victoria; Albiger, Barbara; Lundqvist, Katarina; Malmsten, Martin; Schmidtchen, Artur

2010-09-03

Tissue factor pathway inhibitor (TFPI) inhibits tissue factor-induced coagulation, but may, via its C terminus, also modulate cell surface, heparin, and lipopolysaccharide interactions as well as participate in growth inhibition. Here we show that C-terminal TFPI peptide sequences are antimicrobial against the gram-negative bacteria Escherichia coli and Pseudomonas aeruginosa, gram-positive Bacillus subtilis and Staphylococcus aureus, as well as the fungi Candida albicans and Candida parapsilosis. Fluorescence studies of peptide-treated bacteria, paired with analysis of peptide effects on liposomes, showed that the peptides exerted membrane-breaking effects similar to those seen for the "classic" human antimicrobial peptide LL-37. The killing of E. coli, but not P. aeruginosa, by the C-terminal peptide GGLIKTKRKRKKQRVKIAYEEIFVKNM (GGL27), was enhanced in human plasma and largely abolished in heat-inactivated plasma, a phenomenon linked to generation of antimicrobial C3a and activation of the classic pathway of complement activation. Furthermore, GGL27 displayed anti-endotoxic effects in vitro and in vivo in a mouse model of LPS shock. Importantly, TFPI was found to be expressed in the basal layers of normal epidermis, and was markedly up-regulated in acute skin wounds as well as wound edges of chronic leg ulcers. Furthermore, C-terminal fragments of TFPI were associated with bacteria present in human chronic leg ulcers. These findings suggest a new role for TFPI in cutaneous defense against infections.

Congenital malformations among children of women working with video display terminals

DEFF Research Database (Denmark)

Brandt, L P; Nielsen, C V

1990-01-01

In a case-base study among 214,108 commercial and clerical employees in Denmark the potential effect of the use of video display terminals on the risk of congenital malformations in pregnancy was investigated. The study base was identified by means of register linkage of the Medical Birth Register...... and the National Register of In-Patients. In the source population 24,352 pregnancy outcomes were registered, 661 of which with congenital malformations entered the case group, and a base sample of 2252 pregnancies was drawn. Data concerning the use of video display terminals, job stress, ergonomic factors......, exposure to organic solvents, and life-style factors were obtained from postal questionnaires. The results of this study did not support the hypothesis that the use of video display terminals during pregnancy is associated with an increased risk of congenital malformations....

Intrinsic terminators in Mycoplasma hyopneumoniae transcription.

Science.gov (United States)

Fritsch, Tiago Ebert; Siqueira, Franciele Maboni; Schrank, Irene Silveira

2015-04-08

Mycoplasma hyopneumoniae, an important pathogen of swine, exhibits a low guanine and cytosine (GC) content genome. M. hyopneumoniae genome is organised in long transcriptional units and promoter sequences have been mapped upstream of all transcription units. These analysis provided insights into the gene organisation and transcription initiation at the genome scale. However, the presence of transcriptional terminator sequences in the M. hyopneumoniae genome is poorly understood. In silico analyses demonstrated the presence of putative terminators in 82% of the 33 monocistronic units (mCs) and in 74% of the 116 polycistronic units (pCs) considering different classes of terminators. The functional activity of 23 intrinsic terminators was confirmed by RT-PCR and qPCR. Analysis of all terminators found by three software algorithms, combined with experimental results, allowed us to propose a pattern of RNA hairpin formation during the termination process and to predict the location of terminators in the M. hyopneumoniae genome sequence. The stem-loop structures of intrinsic terminators of mycoplasma diverge from the pattern of terminators found in other bacteria due the low content of guanine and cytosine. In M. hyopneumoniae, transcription can end after a transcriptional unit and before its terminator sequence and can also continue past the terminator sequence with RNA polymerases gradually releasing the RNA.

Implementation method of multi-terminal DC control system

Science.gov (United States)

Yi, Liu; Hao-Ran, Huang; Jun-Wen, Zhou; Hong-Guang, Guo; Yu-Yong, Zhou

2018-04-01

Currently the multi-terminal DC system (MTDC) has more stations. Each station needs operators to monitor and control the device. It needs much more operation and maintenance, low efficiency and small reliability; for the most important reason, multi-terminal DC system has complex control mode. If one of the stations has some problem, the control of the whole system should have problems. According to research of the characteristics of multi-terminal DC (VSC-MTDC) systems, this paper presents a strong implementation of the multi-terminal DC Supervisory Control and Data Acquisition (SCADA) system. This system is intelligent, can be networking, integration and intelligent. A master control system is added in each station to communication with the other stations to send current and DC voltage value to pole control system for each station. Based on the practical application and information feedback in the China South Power Grid research center VSC-MTDC project, this system is higher efficiency and save the cost on the maintenance of convertor station to improve the intelligent level and comprehensive effect. And because of the master control system, a multi-terminal system hierarchy coordination control strategy is formed, this make the control and protection system more efficiency and reliability.

Terminal Sliding Mode Control with Unidirectional Auxiliary Surfaces for Hypersonic Vehicles Based on Adaptive Disturbance Observer

Directory of Open Access Journals (Sweden)

Naibao He

2015-01-01

Full Text Available A novel flight control scheme is proposed using the terminal sliding mode technique, unidirectional auxiliary surfaces and the disturbance observer model. These proposed dynamic attitude control systems can improve control performance of hypersonic vehicles despite uncertainties and external disturbances. The terminal attractor is employed to improve the convergence rate associated with the critical damping characteristics problem noted in short-period motions of hypersonic vehicles. The proposed robust attitude control scheme uses a dynamic terminal sliding mode with unidirectional auxiliary surfaces. The nonlinear disturbance observer is designed to estimate system uncertainties and external disturbances. The output of the disturbance observer aids the robust adaptive control scheme and improves robust attitude control performance. Finally, simulation results are presented to illustrate the effectiveness of the proposed terminal sliding mode with unidirectional auxiliary surfaces.

Personal Exposure Between People in a Room Ventilated by Textile Terminals

DEFF Research Database (Denmark)

Nielsen, Peter V.; Hyldgård, Carl-Erik; Melikov, Arsen

2007-01-01

This paper describes an investigation made in a room ventilated by an air distribution system based on a textile terminal. The air distribution in the room is mainly controlled by buoyancy forces from the heat sources, although the flow from the textile terminal can be characterized as a displace...

LNG TERMINAL SAFE OPERATION MANAGEMENT

OpenAIRE

Andrzej ADAMKIEWICZ; Włodzimierz KAMIŃSKI

2012-01-01

This article presents the significance of LNG terminal safety issues in natural gas sea transport. It shows particular requirements for LNG transmission installations resulting from the specific properties of LNG. Out of the multi‐layer critical safety areas comprising structural elements of the terminal safety system, possibilities to decrease the risk of emergency occurrence on LNG terminals have been selected. Tasks performed by the LNG terminal, together with its own personnel and the out...

Emission inventory estimation of an intercity bus terminal.

Science.gov (United States)

Qiu, Zhaowen; Li, Xiaoxia; Hao, Yanzhao; Deng, Shunxi; Gao, H Oliver

2016-06-01

Intercity bus terminals are hotspots of air pollution due to concentrated activities of diesel buses. In order to evaluate the bus terminals' impact on air quality, it is necessary to estimate the associated mobile emission inventories. Since the vehicles' operating condition at the bus terminal varies significantly, conventional calculation of the emissions based on average emission factors suffers the loss of accuracy. In this study, we examined a typical intercity bus terminal-the Southern City Bus Station of Xi'an, China-using a multi-scale emission model-(US EPA's MOVES model)-to quantity the vehicle emission inventory. A representative operating cycle for buses within the station is constructed. The emission inventory was then estimated using detailed inputs including vehicle ages, operating speeds, operating schedules, and operating mode distribution, as well as meteorological data (temperature and humidity). Five functional areas (bus yard, platforms, disembarking area, bus travel routes within the station, and bus entrance/exit routes) at the terminal were identified, and the bus operation cycle was established using the micro-trip cycle construction method. Results of our case study showed that switching to compressed natural gas (CNG) from diesel fuel could reduce PM2.5 and CO emissions by 85.64 and 6.21 %, respectively, in the microenvironment of the bus terminal. When CNG is used, tail pipe exhaust PM2.5 emission is significantly reduced, even less than brake wear PM2.5. The estimated bus operating cycles can also offer researchers and policy makers important information for emission evaluation in the planning and design of any typical intercity bus terminals of a similar scale.

Gantry Crane Scheduling with Interference Constraints in Railway Container Terminals

Directory of Open Access Journals (Sweden)

Peng Guo

2013-04-01

Full Text Available Railway container terminals, where gantry cranes are responsible for loading and unloading containers between freight trains and yards, are important hubs of hinterland logistics transportation. Terminal managers confront the challenge in improving the efficiency of their service. As the most expensive equipment in a terminal, the operational performance of gantry cranes is a crucial factor. In this paper, the gantry crane scheduling problem of railway container terminals is investigated. A mixed integer programming model which considers the effect of dwelling position dependent processing times is formulated. In addition, the safety distances, the travel times and the non-crossing requirement of cranes are incorporated in the mathematical model. A novel discrete artificial bee colony algorithm is presented to solve the intractable scheduling problem. Computational experiments are conducted to evaluate the proposed algorithm on some randomly constructed instances based on typical terminal operational data. Experimental results show that the proposed approach can obtain near optimal solutions for the investigated problem in a reasonable computational time.

Universal quantum gates for Single Cooper Pair Box based quantum computing

Science.gov (United States)

Echternach, P.; Williams, C. P.; Dultz, S. C.; Braunstein, S.; Dowling, J. P.

2000-01-01

We describe a method for achieving arbitrary 1-qubit gates and controlled-NOT gates within the context of the Single Cooper Pair Box (SCB) approach to quantum computing. Such gates are sufficient to support universal quantum computation.

A Portable Piezoelectric Tactile Terminal for Braille Readers

Directory of Open Access Journals (Sweden)

Ramiro Velázquez

2012-01-01

Full Text Available This paper introduces a novel concept on reading assistive technologies for the blind: the TactoBook, a system that is able to translate entire electronic books (eBooks to Braille code and to reproduce them in portable electronic Braille terminals. The TactoBook consists of a computer-based translator that converts fast and automatically any eBook into Braille. The Braille version of the eBook is then encrypted as a file and stored in a USB memory drive which is later inserted and reproduced in a compact, lightweight, and highly-portable tactile terminal. In particular, this paper presents a piezoelectric ultrasonic actuation approach to design and implement such portable Braille terminal. Actuating mechanism, design concept, first prototype, and performance results are presented and discussed.

Why the tautomerization of the G·C Watson-Crick base pair via the DPT does not cause point mutations during DNA replication? QM and QTAIM comprehensive analysis.

Science.gov (United States)

Brovarets', Ol'ha O; Hovorun, Dmytro M

2014-01-01

The ground-state tautomerization of the G·C Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4), corresponding to a hydrophobic interface of protein-nucleic acid interactions, using DFT and MP2 levels of quantum-mechanical (QM) theory and quantum theory "Atoms in molecules" (QTAIM). Based on the sweeps of the electron-topological, geometric, polar, and energetic parameters, which describe the course of the G·C ↔ G*·C* tautomerization (mutagenic tautomers of the G and C bases are marked with an asterisk) through the DPT along the intrinsic reaction coordinate (IRC), it was proved that it is, strictly speaking, a concerted asynchronous process both at the DFT and MP2 levels of theory, in which protons move with a small time gap in vacuum, while this time delay noticeably increases in the continuum with ϵ = 4. It was demonstrated using the conductor-like polarizable continuum model (CPCM) that the continuum with ϵ = 4 does not qualitatively affect the course of the tautomerization reaction. The DPT in the G·C Watson-Crick base pair occurs without any intermediates both in vacuum and in the continuum with ϵ = 4 at the DFT/MP2 levels of theory. The nine key points along the IRC of the G·C base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These key points have been used to define the reactant, transition state, and product regions of the DPT reaction in the G·C base pair. Analysis of the energetic characteristics of the H-bonds allows us to arrive at a definite conclusion that the middle N1H⋯N3/N3H⋯N1 and the lower N2H⋯O2/N2H⋯O2 parallel H-bonds in the G·C/G*·C* base pairs, respectively, are anticooperative, that is, the strengthening of the middle H-bond is accompanied

Development of a novel device to trap heavy metal cations: application of the specific interaction between heavy metal cation and mismatch DNA base pair.

Science.gov (United States)

Torigoe, Hidetaka; Miyakawa, Yukako; Fukushi, Miyako; Ono, Akira; Kozasa, Tetsuo

2009-01-01

We have already found that Hg(II) cation specifically binds to T:T mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving T:T mismatch base pair by about 4 degrees C. We have also found that Ag(I) cation specifically binds to C:C mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving C:C mismatch base pair by about 4 degrees C. Using the specific interaction, we developed a novel device to trap each of Hg(II) and Ag(I) cation. The device is composed of 5'-biotinylated T-rich or C-rich DNA oligonucleotides, BIO-T20: 5'-Bio-T(20)-3' or BIO-C20: 5'-Bio-C(20)-3' (Bio is a biotin), immobilized on streptavidin-coated polystylene beads. When the BIO-T20-immobilized beads were added to a solution containing Hg(II) cation, and the beads trapping Hg(II) cation were collected by centrifugation, almost all of Hg(II) cation were removed from the solution. Also, when the BIO-C20-immobilized beads were added to a solution containing Ag(I) cation, and the beads trapping Ag(I) cation were collected by centrifugation, almost all of Ag(I) cation were removed from the solution. We conclude that, using the novel device developed in this study, Hg(II) and Ag(I) cation can be effectively removed from the solution.

Kajian Kinerja Pelayanan General Cargo Terminal Jamrud Di Pelabuhan Tanjung Perak Surabaya

Directory of Open Access Journals (Sweden)

Ayu Fajar Ulfany

2018-02-01

Full Text Available Terminal Jamrud is a busy terminal among three others terminals run by PT. Pelabuhan Indonesia III branch of Tanjung Perak that serving general goods cargoes and dry bulk both dosmetically and internationally. The source of the problem to increase terminal performance are capacity building, efficiency, productivity and environment. The objectives of this study were to identify the existing performance of loading and unloading of general cargo and to arrange strategies for the development of Terminal Jamrud at Tanjung Perak Port using SWOT analysis. Based on secondary data: 1 the best operational performance of service is the productivity of loading and unloading of general cargo, 2 the best performance is the approach time (AT, 3 the waiting time (TW has not fulfilled the expected achievement as it is stil below the standard, 4 attributes of utility services, non-container terminal dock facilities, SOR and YOR still needs to be improved. The development strategies of Terminal Jamrud at kuadran I i.e grapid rowth strategy.

Statistical deprojection of galaxy pairs

Science.gov (United States)

Nottale, Laurent; Chamaraux, Pierre

2018-06-01

Aims: The purpose of the present paper is to provide methods of statistical analysis of the physical properties of galaxy pairs. We perform this study to apply it later to catalogs of isolated pairs of galaxies, especially two new catalogs we recently constructed that contain ≈1000 and ≈13 000 pairs, respectively. We are particularly interested by the dynamics of those pairs, including the determination of their masses. Methods: We could not compute the dynamical parameters directly since the necessary data are incomplete. Indeed, we only have at our disposal one component of the intervelocity between the members, namely along the line of sight, and two components of their interdistance, i.e., the projection on the sky-plane. Moreover, we know only one point of each galaxy orbit. Hence we need statistical methods to find the probability distribution of 3D interdistances and 3D intervelocities from their projections; we designed those methods under the term deprojection. Results: We proceed in two steps to determine and use the deprojection methods. First we derive the probability distributions expected for the various relevant projected quantities, namely intervelocity vz, interdistance rp, their ratio, and the product rp v_z^2, which is involved in mass determination. In a second step, we propose various methods of deprojection of those parameters based on the previous analysis. We start from a histogram of the projected data and we apply inversion formulae to obtain the deprojected distributions; lastly, we test the methods by numerical simulations, which also allow us to determine the uncertainties involved.

Classification between normal and tumor tissues based on the pair-wise gene expression ratio

International Nuclear Information System (INIS)

Yap, YeeLeng; Zhang, XueWu; Ling, MT; Wang, XiangHong; Wong, YC; Danchin, Antoine

2004-01-01

Precise classification of cancer types is critically important for early cancer diagnosis and treatment. Numerous efforts have been made to use gene expression profiles to improve precision of tumor classification. However, reliable cancer-related signals are generally lacking. Using recent datasets on colon and prostate cancer, a data transformation procedure from single gene expression to pair-wise gene expression ratio is proposed. Making use of the internal consistency of each expression profiling dataset this transformation improves the signal to noise ratio of the dataset and uncovers new relevant cancer-related signals (features). The efficiency in using the transformed dataset to perform normal/tumor classification was investigated using feature partitioning with informative features (gene annotation) as discriminating axes (single gene expression or pair-wise gene expression ratio). Classification results were compared to the original datasets for up to 10-feature model classifiers. 82 and 262 genes that have high correlation to tissue phenotype were selected from the colon and prostate datasets respectively. Remarkably, data transformation of the highly noisy expression data successfully led to lower the coefficient of variation (CV) for the within-class samples as well as improved the correlation with tissue phenotypes. The transformed dataset exhibited lower CV when compared to that of single gene expression. In the colon cancer set, the minimum CV decreased from 45.3% to 16.5%. In prostate cancer, comparable CV was achieved with and without transformation. This improvement in CV, coupled with the improved correlation between the pair-wise gene expression ratio and tissue phenotypes, yielded higher classification efficiency, especially with the colon dataset – from 87.1% to 93.5%. Over 90% of the top ten discriminating axes in both datasets showed significant improvement after data transformation. The high classification efficiency achieved suggested

Termination unit

Energy Technology Data Exchange (ETDEWEB)

Traeholt, Chresten; Willen, Dag; Roden, Mark; Tolbert, Jerry C.; Lindsay, David; Fisher, Paul W.; Nielsen, Carsten Thidemann

2016-05-03

Cable end section comprises end-parts of N electrical phases/neutral, and a thermally-insulation envelope comprising cooling fluid. The end-parts each comprises a conductor and are arranged with phase 1 innermost, N outermost surrounded by the neutral, electrical insulation being between phases and N and neutral. The end-parts comprise contacting surfaces located sequentially along the longitudinal extension of the end-section. A termination unit has an insulating envelope connected to a cryostat, special parts at both ends comprising an adapter piece at the cable interface and a closing end-piece terminating the envelope in the end-section. The special parts houses an inlet and/or outlet for cooling fluid. The space between an inner wall of the envelope and a central opening of the cable is filled with cooling fluid. The special part at the end connecting to the cryostat houses an inlet or outlet, splitting cooling flow into cable annular flow and termination annular flow.

A 3-base pair deletion, c.9711_9713del, in DMD results in intellectual disability without muscular dystrophy

NARCIS (Netherlands)

Brouwer, A.P.M. de; Nabuurs, S.B.; Verhaart, I.E.; Oudakker, A.R.; Hordijk, R.; Yntema, H.G.; Hordijk-Hos, J.M.; Voesenek, K.E.; Vries, B. de; Essen, T. van; Chen, W.; Hu, H; Chelly, J.; Dunnen, J.T. den; Kalscheuer, V.M.M.; Aartsma-Rus, A.M.; Hamel, B.C.J.; Bokhoven, H. van; Kleefstra, T.

2014-01-01

We have identified a deletion of 3 base pairs in the dystrophin gene (DMD), c.9711_9713del, in a family with nonspecific X-linked intellectual disability (ID) by sequencing of the exons of 86 known X-linked ID genes. This in-frame deletion results in the deletion of a single-amino-acid residue,

The structure of an E. coli tRNAfMet A1-U72 variant shows an unusual conformation of the A1-U72 base pair.

Science.gov (United States)

Monestier, Auriane; Aleksandrov, Alexey; Coureux, Pierre-Damien; Panvert, Michel; Mechulam, Yves; Schmitt, Emmanuelle

2017-05-01

Translation initiation in eukaryotes and archaea involves a methionylated initiator tRNA delivered to the ribosome in a ternary complex with e/aIF2 and GTP. Eukaryotic and archaeal initiator tRNAs contain a highly conserved A 1 -U 72 base pair at the top of the acceptor stem. The importance of this base pair to discriminate initiator tRNAs from elongator tRNAs has been established previously using genetics and biochemistry. However, no structural data illustrating how the A 1 -U 72 base pair participates in the accurate selection of the initiator tRNAs by the translation initiation systems are available. Here, we describe the crystal structure of a mutant E. coli initiator tRNA f Met A 1 -U 72 , aminoacylated with methionine, in which the C 1 :A 72 mismatch at the end of the tRNA acceptor stem has been changed to an A 1 -U 72 base pair. Sequence alignments show that the mutant E. coli tRNA is a good mimic of archaeal initiator tRNAs. The crystal structure, determined at 2.8 Å resolution, shows that the A 1 -U 72 pair adopts an unusual arrangement. A 1 is in a syn conformation and forms a single H-bond interaction with U 72 This interaction requires protonation of the N1 atom of A 1 Moreover, the 5' phosphoryl group folds back into the major groove of the acceptor stem and interacts with the N7 atom of G 2 A possible role of this unusual geometry of the A 1 -U 72 pair in the recognition of the initiator tRNA by its partners during eukaryotic and archaeal translation initiation is discussed. © 2017 Monestier et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Rapid change of chromomeric and pairing patterns of polytene chromosome tips in D. melanogaster: migration of polytene-nonpolytene transition zone?

Science.gov (United States)

Roberts, P A

1979-07-01

The high variability of chromomeric patterns in near-terminal regions of polytene chromosome arms has been explored in a number of races, strains and hybrids of Drosophila melanogaster. Traditional explanations for tip differences between strains (differential compaction of chromatin, somatic or germinal deletion) are examined and, in the light of the reported observations, rejected. The range of polytene tip variability and rates of change in wild races are greater than has been supposed: strains formerly considered to be terminally deleted appear to gain terminal bands; others, formerly considered normal, appear to have lost them. Strains with high cell-to-cell tip variability are also described. Cell-to-cell variations, as well as much of the observed rapid changes in tip appearance, are probably due to heritable differences in the location of an abrupt transition zone between polytene and nonpolytene chromatin. A quantitative relationship between the amount of certain subterminal bands present and the frequency of tip association of nonhomologous chromosomes is shown and its possible significance for chromosome is shown and its possible for chromosome pairing discussed.

A fully synthetic human Fab antibody library based on fixed VH/VL framework pairings with favorable biophysical properties

Science.gov (United States)

Tiller, Thomas; Schuster, Ingrid; Deppe, Dorothée; Siegers, Katja; Strohner, Ralf; Herrmann, Tanja; Berenguer, Marion; Poujol, Dominique; Stehle, Jennifer; Stark, Yvonne; Heßling, Martin; Daubert, Daniela; Felderer, Karin; Kaden, Stefan; Kölln, Johanna; Enzelberger, Markus; Urlinger, Stefanie

2013-01-01

This report describes the design, generation and testing of Ylanthia, a fully synthetic human Fab antibody library with 1.3E+11 clones. Ylanthia comprises 36 fixed immunoglobulin (Ig) variable heavy (VH)/variable light (VL) chain pairs, which cover a broad range of canonical complementarity-determining region (CDR) structures. The variable Ig heavy and Ig light (VH/VL) chain pairs were selected for biophysical characteristics favorable to manufacturing and development. The selection process included multiple parameters, e.g., assessment of protein expression yield, thermal stability and aggregation propensity in fragment antigen binding (Fab) and IgG1 formats, and relative Fab display rate on phage. The framework regions are fixed and the diversified CDRs were designed based on a systematic analysis of a large set of rearranged human antibody sequences. Care was taken to minimize the occurrence of potential posttranslational modification sites within the CDRs. Phage selection was performed against various antigens and unique antibodies with excellent biophysical properties were isolated. Our results confirm that quality can be built into an antibody library by prudent selection of unmodified, fully human VH/VL pairs as scaffolds. PMID:23571156

Container terminal spatial planning - A 2041 paradigm for the Western Cape Province in South Africa

Directory of Open Access Journals (Sweden)

Jan Havenga

2012-11-01

Full Text Available This paper investigates the suitable location for an intermodal inland container terminal (IICT in the city of Cape Town. A container market segmentation approach is used to project growth for container volumes over a 30-year period for all origin and destination pairings on a geographical district level in an identified catchment area. The segmentation guides the decision on what type of facility is necessary to fulfil capacity requirements in the catchment area and will be used to determine the maximum space requirements for a future IICT. Alternative sites are ranked from most suitable to least suitable using multi-criteria analysis, and preferred locations are identified. Currently, South Africa’s freight movement is dominated by the road sector. Heavy road congestion is thus prevalent at the Cape Town Container Terminal (CTCT. The paper proposes three possible alternative sites for an IICT that will focus on a hub-and-spoke system of transporting freight.

Identification of a two base pair deletion in five unrelated families with adrenoleukodystrophy: a possible hot spot for mutations

NARCIS (Netherlands)

Kemp, S.; Ligtenberg, M. J.; van Geel, B. M.; Barth, P. G.; Wolterman, R. A.; Schoute, F.; Sarde, C. O.; Mandel, J. L.; van Oost, B. A.; Bolhuis, P. A.

1994-01-01

The gene for X-linked adrenoleukodystrophy (ALD) was recently identified. Intragenic deletions of several kilobases were found in about 7% of patients. Point mutations, expected to be very heterogeneous, were identified so far in only two patients. We report the identification of a two base pair

Atomic-scale Visualization of Electronic Nematicity and Cooper Pairing in Iron-based Superconductors

Science.gov (United States)

Allan, Milan P.

2013-03-01

The mechanism of high-temperature superconductivity in the relatively novel iron-based high-Tc superconductors is unresolved, both in terms of how the phases evolve with doping, and in terms of the actual Cooper pairing process. To explore these issues, we used spectroscopic-imaging scanning tunneling microscopy to study the electronic structure of CaFe2As2 in the antiferromagnetic-orthorhombic `parent' state from which the superconductivity emerges. We discovered and visualized the now widely studied electronic `nematicity' of this phase, whose suppression is associated with the emergence of superconductivity (Science 327, 181, 2010). As subsequent transport experiments discovered a related anisotropic conductance which increases with dopant concentration, the interplay between the electronic structure surrounding each dopant atom, quasiparticle scattering therefrom, and the transport nematicity has become a pivotal focus of research. We find that substituting Co for Fe atoms in underdoped Ca(Fe1-xCox)2As2 generates a dense population of identical and strongly anisotropic impurity states that are distributed randomly but aligned with the antiferromagnetic a-axis. We also demonstrate, by imaging their surrounding interference patterns, that these impurity states scatter quasiparticles and thus influence transport in a highly anisotropic manner (M.P. Allan et al., 2013). Next, we studied the momentum dependence of the energy gaps of iron-based superconductivity, now focusing on LiFeAs. If strong electron-electron interactions mediate the Cooper pairing, then momentum-space anisotropic superconducting energy gaps Δi (k) were predicted by multiple techniques to appear on the different electronic bands i. We introduced intraband Bogoliubov quasiparticle scattering interference (QPI) techniques for the determination of anisotropic energy gaps to test these hypotheses and discovered the anisotropy, magnitude, and relative orientations of the energy gaps on multiple

AVE bond index in the H-bond of the Watson-Crick pairs

International Nuclear Information System (INIS)

Giambiagi, M.; Giambiagi, M.S. de; Barroso Filho, W.

1981-01-01

The normal Watson-Crick base pairs are treated as super-molecules. The properties of the electronic distribution along the N-H...Y bonds are studied in an all-valence-electrons calculation, through a bond index formula devised for non-orthogonal basis. Eletronic density diagrams of the adenine-uracil base pair are analysed. (Auhor) [pt