
Sample records for terbium 167

  1. Elastic properties of terbium

    DEFF Research Database (Denmark)

    Spichkin, Y.I.; Bohr, Jakob; Tishin, A.M.


    The temperature dependence of the Young modulus along the crystallographic axes b and c (E(b) and E(c)), and the internal friction of a terbium single crystal have been measured. At 4.2 K, E(b) and E(c) are equal to 38 and 84.5 GPa, respectively. The lattice part of the Young modulus and the Debye...... temperature has been calculated. The origin of the Young modulus anomalies arising at the transition to the magnetically ordered state is discussed....

  2. Critical scattering of neutrons from terbium

    DEFF Research Database (Denmark)

    Als-Nielsen, Jens Aage; Dietrich, O.W.; Marshall, W.


    The inelasticity of the critical scattering of neutrons in terbium has been measured above the Neél temperature at the (0, 0, 2−Q) satellite position. The results show that dynamic slowing down of the fluctuations does occur in a second‐order phase transition in agreement with the general theory...

  3. Semiconductor composition containing iron, dysprosium, and terbium

    Energy Technology Data Exchange (ETDEWEB)

    Pooser, Raphael C.; Lawrie, Benjamin J.; Baddorf, Arthur P.; Malasi, Abhinav; Taz, Humaira; Farah, Annettee E.; Kalyanaraman, Ramakrishnan; Duscher, Gerd Josef Mansfred; Patel, Maulik K.


    An amorphous semiconductor composition includes 1 to 70 atomic percent iron, 15 to 65 atomic percent dysprosium, 15 to 35 atomic percent terbium, balance X, wherein X is at least one of an oxidizing element and a reducing element. The composition has an essentially amorphous microstructure, an optical transmittance of at least 50% in at least the visible spectrum and semiconductor electrical properties.

  4. Neutron Diffraction and Electrical Transport Studies on Magnetic Transition in Terbium at High Pressures and Low Temperatures (United States)

    Thomas, Sarah; Montgomery, Jeffrey; Tsoi, Georgiy; Vohra, Yogesh; Weir, Samuel; Tulk, Christopher; Moreira Dos Santos, Antonio


    Neutron diffraction and electrical transport measurements have been carried out on the heavy rare earth metal terbium at high pressures and low temperatures in order to elucidate its transition from a helical antiferromagnetic to a ferromagnetic ordered phase as a function of pressure. The electrical resistance measurements using designer diamonds show a change in slope as the temperature is lowered through the ferromagnetic Curie temperature. The temperature of the ferromagnetic transition decreases at a rate of -16.7 K/GPa till 3.6 GPa, where terbium undergoes a structural transition from hexagonal close packed (hcp) to an α-Sm phase. Above this pressure, the electrical resistance measurements no longer exhibit a change in slope. In order to confirm the change in magnetic phase suggested by the electrical resistance measurements, neutron diffraction measurements were conducted at the SNAP beamline at the Oak Ridge National Laboratory. Measurements were made at pressures to 5.3 GPa and temperatures as low as 90 K. An abrupt increase in peak intensity in the neutron diffraction spectra signaled the onset of magnetic order below the Curie temperature. A magnetic phase diagram of rare earth metal terbium will be presented to 5.3 GPa and 90 K based on these studies.

  5. Raman spectroscopy study of the doping effect of the encapsulated terbium halogenides on single-walled carbon nanotubes

    Energy Technology Data Exchange (ETDEWEB)

    Kharlamova, M.V.; Kramberger, C.; Mittelberger, A. [University of Vienna, Faculty of Physics, Vienna (Austria)


    In the present work, the doping effect of terbium chloride, terbium bromide, and terbium iodide on single-walled carbon nanotubes (SWCNTs) was compared by Raman spectroscopy. A precise investigation of the doping-induced alterations of the Raman modes of the filled SWCNTs was conducted. The shifts of the components of the Raman modes and modification of their profiles allowed concluding that the inserted terbium halogenides have acceptor doping effect on the SWCNTs, and the doping efficiency increases in the line with terbium iodide, terbium bromide, and terbium chloride. (orig.)

  6. Magnetocaloric effect of thin Terbium films (United States)

    Mello, V. D.; Anselmo, D. H. A. L.; Vasconcelos, M. S.; Almeida, N. S.


    We report a theoretical study of the magnetocaloric effect of Terbium (Tb) thin films due to finite size and surface effects in the helimagnetic phase, corresponding to a temperature range from TC=219 K to TN=231 K, for external fields of the order of kOe. For a Tb thin film of 6 monolayers submitted to an applied field (ΔH =30 kOe, ΔH =50 kOe and ΔH = 70 kOe) we report a significative change in adiabatic temperature, ΔT / ΔH , near the Néel temperature, of the order ten times higher than that observed for Tb bulk. On the other hand, for small values of the magnetic field, large thickness effects are found. For external field strength around few kOe, we have found that the thermal caloric efficiency increases remarkably for ultrathin films. For an ultrathin film with 6 monolayers, we have found ΔT / ΔH = 43 K/T while for thicker films, with 20 monolayers, ΔT / ΔH = 22 K/T. Our results suggest that thin films of Tb are a promising material for magnetocaloric effect devices for applications at intermediate temperatures.

  7. Femtosecond XUV spectroscopy of gadolinium and terbium

    Energy Technology Data Exchange (ETDEWEB)

    Carley, Robert; Frietsch, Bjoern; Doebrich, Kristian; Teichmann, Martin; Gahl, Cornelius; Noack, Frank [Max-Born-Institute, Berlin (Germany); Schwarzkopf, Olaf; Wernet, Philippe [Helmholtz-Zentrum fuer Materialien und Energie (BESSY II), Berlin (Germany); Weinelt, Martin [Max-Born-Institute, Berlin (Germany); Fachbereich Physik, Freie Universitaet, Berlin (Germany)


    We present recent results of time-resolved IR-pump-XUV-probe experiments on the ultrafast demagnetization of thin films of Gadolinium(0001) and Terbium(0001) on Tungsten(110). The experiments are the first to be done using a newly developed high-order harmonics (HHG) XUV beamline at the MBI. The beamline delivers monochromated XUV pulses of approximately 150 fs duration with a photon energy resolution of up to 150 meV. Following excitation by intense femtosecond infrared (IR) pulses, photoemission with 35 eV photons allows us to directly probe the 4f electrons and their interaction with the valence band, both in the bulk and at the surface, to follow the ultrafast magnetization dynamics in the Lanthanide metals. As signatures of ultrafast demagnetization of the metal by the IR pulse, we see for the first time, rapid strong reduction of the exchange splitting in the valence band. This is followed by a slower demagnetization due to the spin-lattice interaction.

  8. Green fluorescence of terbium ions in lithium fluoroborate glasses ...

    Indian Academy of Sciences (India)

    Glasses; terbium ion; oscillator strengths; fluorescence; lifetimes; fibre lasers. 1. Introduction. Today glasses are most favourable engineering materials for abundant applications due to the wide ability of property altering by compositional modifications. The considerable examination of glass science to achieve required ...

  9. Green fluorescence of terbium ions in lithium fluoroborate glasses ...

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science; Volume 39; Issue 3. Green fluorescence of terbium ions in lithium fluoroborate glasses for fibre lasers and display devices. G R DILLIP C MADHUKAR REDDY M RAJESH SHIVANAND CHAURASIA B DEVA PRASAD RAJU S W JOO. Volume 39 Issue 3 June 2016 pp 711-717 ...

  10. Terahertz Cherenkov radiation from ultrafast magnetization in terbium gallium garnet (United States)

    Gorelov, S. D.; Mashkovich, E. A.; Tsarev, M. V.; Bakunov, M. I.


    We report an experimental observation of terahertz Cherenkov radiation from a moving magnetic moment produced in terbium gallium garnet by a circularly polarized femtosecond laser pulse via the inverse Faraday effect. Contrary to some existing theoretical predictions, the polarity of the observed radiation unambiguously demonstrates the paramagnetic, rather than diamagnetic, nature of the ultrafast inverse Faraday effect. From measurements of the radiation field, the Verdet constant in the subpicosecond regime is ˜3-10 times smaller than its table quasistatic value.

  11. 46 CFR 167.43-10 - Use. (United States)


    ... 46 Shipping 7 2010-10-01 2010-10-01 false Use. 167.43-10 Section 167.43-10 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) NAUTICAL SCHOOLS PUBLIC NAUTICAL SCHOOL SHIPS Work Vests § 167.43-10 Use. (a) Approved buoyant work vests are considered to be items of safety apparel and may be...

  12. 32 CFR 552.167 - Activities. (United States)


    ... 32 National Defense 3 2010-07-01 2010-07-01 true Activities. 552.167 Section 552.167 National..., and Camp Bonneville § 552.167 Activities. (a) Authorized activities are listed in appendix C to this subpart. (b) Prohibited activities are listed in appendix D to this subpart. ...

  13. 46 CFR 167.20-1 - Construction. (United States)


    ... 46 Shipping 7 2010-10-01 2010-10-01 false Construction. 167.20-1 Section 167.20-1 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) NAUTICAL SCHOOLS PUBLIC NAUTICAL SCHOOL SHIPS Hull Requirements, Construction and Arrangement of Nautical School Ships § 167.20-1 Construction. Except as...

  14. 46 CFR 167.40-40 - Radar. (United States)


    ... 46 Shipping 7 2010-10-01 2010-10-01 false Radar. 167.40-40 Section 167.40-40 Shipping COAST GUARD... Requirements § 167.40-40 Radar. All mechanically propelled vessels of 1,600 gross tons and over in ocean or coastwise service must be fitted with a marine radar system for surface navigation. Facilities for plotting...

  15. 27 CFR 19.167 - Organizational documents. (United States)


    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Organizational documents. 19.167 Section 19.167 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU....167 Organizational documents. The supporting information required by paragraph (c) of § 19.152, and...

  16. 40 CFR 159.167 - Discontinued studies. (United States)


    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Discontinued studies. 159.167 Section 159.167 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS STATEMENTS OF POLICIES AND INTERPRETATIONS Reporting Requirements for Risk/Benefit Information § 159.167 Discontinued studies. The fact that a study has...

  17. 19 CFR 122.167 - Aviation smuggling. (United States)


    ... 19 Customs Duties 1 2010-04-01 2010-04-01 false Aviation smuggling. 122.167 Section 122.167... TREASURY AIR COMMERCE REGULATIONS Penalties § 122.167 Aviation smuggling. (a) Civil penalties. Any aircraft.... More severe penalties are provided in 19 U.S.C. 1590 if the smuggled merchandise is a controlled...

  18. Terbium luminescence in alumina xerogel fabricated in porous anodic alumina matrix under various excitation conditions

    Energy Technology Data Exchange (ETDEWEB)

    Gaponenko, N. V., E-mail: [Belarusian State University of Informatics and Radioelectronics (Belarus); Kortov, V. S. [Yeltsin Ural Federal University (Russian Federation); Orekhovskaya, T. I.; Nikolaenko, I. A. [Belarusian State University of Informatics and Radioelectronics (Belarus); Pustovarov, V. A.; Zvonarev, S. V.; Slesarev, A. I. [Yeltsin Ural Federal University (Russian Federation); Prislopski, S. Ya. [National Academy of Sciences of Belarus, Stepanov Institute of Physics (Belarus)


    Terbium-doped alumina xerogel layers are synthesized by the sol-gel method in pores of a porous anodic alumina film 1 {mu}m thick with a pore diameter of 150-180 nm; the film is grown on a silicon substrate. The fabricated structures exhibit terbium photoluminescence with bands typical of trivalent terbium terms. Terbium X-ray luminescence with the most intense band at 542 nm is observed for the first time for such a structure. Morphological analysis of the structure by scanning electron microscopy shows the presence of xerogel clusters in pore channels, while the main pore volume remains unfilled and pore mouths remain open. The data obtained confirm the promising applications of fabricated structures for developing matrix converters of X-rays and other ionizing radiations into visible light. The possibilities of increasing luminescence intensity in the matrix converter are discussed.

  19. Dicty_cDB: SLF167 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLF167 (Link to dictyBase) - - - Contig-U16176-1 SLF167Z (Link... to Original site) - - SLF167Z 480 - - - - Show SLF167 Library SL (Link to library) Clone ID SLF167 (Link Representative seq. ID SLF16...7Z (Link to Original site) Representative DNA sequence >SLF167 (SLF167Q) /CSM/SL/SLF1-C/SLF167Q.Seq.d/ XXXXX...hckft qknk*isyr*rrlgtiwywc*nlcindgtcf*lfrcpn*knlwc*csnaicfklgkccyg pnskhcqcc*ksyskk*inlkkkks*inffsrkkrnndkek

  20. Optical Properties of Lithium Terbium Fluoride and Implications for Performance in High Power Lasers (Postprint) (United States)



  1. Detection of biothiols in cells by a terbium chelate-Hg (II) system (United States)

    Tan, Hongliang; Chen, Yang


    Great efforts have been devoted to the development of sensitive and specific analysis methods for biothiols because of their important roles in biological systems. We present a new detection system for biothiols that is based on the reversible quenching and restoration of fluorescence of terbium chelate caused by Hg2+ and thiol species. In the presence of biothiols, a restoration of fluorescence of terbium chelate after quenching by Hg2+ was observed due to the interaction of Hg2+ with thiol groups, and the restored fluorescence increased with the concentration of biothiols. This method was sensitive and selective for biothiols. The detection limit was 80 nM for glutathione, 100 nM for Hcy, and 400 nM for Cysteine, respectively. The terbium chelate-Hg (II) system was successfully applied to determine the levels of biothiols in cancer cells and urine samples. Further, it was also shown to be comparable to Ellman's assay. Compared to other fluorescence methods, the terbium chelate probe is advantageous because interference from short-lived nonspecific fluorescence can be efficiently eliminated due to the long fluorescence lifetime of terbium chelate, which allows for detection by time-resolved fluorescence. The terbium chelate probe can serve as a diagnostic tool for the detection of abnormal levels of biothiols in disease.

  2. Cryogenic temperature characteristics of Verdet constant of terbium sesquioxide ceramics (United States)

    Snetkov, I. L.; Palashov, O. V.


    The dependence of the Verdet constant on temperature in the (80-300 K) range for a promising magneto-active material terbium sesquioxide Tb2O3 at the wavelengths of 405-1064 nm is considered. For each of the studied wavelengths, the Verdet constant of the material cooled down to the liquid nitrogen temperature increased by more than a factor of 3.2 as compared to the room temperature value. Similarly to the other paramagnetics, the increase follows the law ∼1/T. Approximations for the temperature dependence of the Verdet constant have been obtained and the value of 1/V·(dV/dT) has been estimated. This information is needed to determine the angle of rotation as well as the variation of the extinction ratio of a Faraday isolator with temperature and extremely important at creation a cryogenic Faraday devices.

  3. Biogenic terbium oxide nanoparticles as the vanguard against osteosarcoma (United States)

    Iram, Sana; Khan, Salman; Ansary, Abu Ayoobul; Arshad, Mohd; Siddiqui, Sahabjada; Ahmad, Ejaz; Khan, Rizwan H.; Khan, Mohd Sajid


    The synthesis of inner transition metal nanoparticles via an ecofriendly route is quite difficult. This study, for the first time, reports synthesis of terbium oxide nanoparticles using fungus, Fusarium oxysporum. The biocompatible terbium oxide nanoparticles (Tb2O3 NPs) were synthesized by incubating Tb4O7 with the biomass of fungus F. oxysporum. Multiple physical characterization techniques, such as UV-visible and photoluminescence spectroscopy, TEM, SAED, and zeta-potential were used to confirm the synthesis, purity, optical and surface characteristics, crystallinity, size, shape, distribution, and stability of the nanoemulsion of Tb2O3 NPs. The Tb2O3 NPs were found to inhibit the propagation of MG-63 and Saos-2 cell-lines (IC50 value of 0.102 μg/mL) and remained non-toxic up to a concentration of 0.373 μg/mL toward primary osteoblasts. Cell viability decreased in a concentration-dependent manner upon exposure to 10 nm Tb2O3 NPs in the concentration range 0.023-0.373 μg/mL. Cell toxicity was evaluated by observing changes in cell morphology, cell viability, oxidative stress parameters, and FACS analysis. Morphological examinations of cells revealed cell shrinkage, nuclear condensation, and formation of apoptotic bodies. The level of ROS within the cells-an indicator of oxidative stress was significantly increased. The induction of apoptosis at concentrations ≤ IC50 was corroborated by 4‧,6-diamidino-2-phenylindole dihydrochloride (DAPI) staining (DNA damage and nuclear fragmentation). Flow-cytometric studies indicated that the response was dose dependent with a threshold effect.

  4. Dicty_cDB: VHB167 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VH (Link to library) VHB167 (Link to dictyBase) - - - Contig-U10801-1 | Contig-U12701-1 VHB...167P (Link to Original site) VHB167F 663 VHB167Z 719 VHB167P 1362 - - Show VHB167 Library VH (Link to library) Clone ID VHB...801-1 | Contig-U12701-1 Original site URL Representative seq. ID VHB167P (Link to Original site) Representative DNA sequence >VHB167 (VHB...167Q) /CSM/VH/VHB1-C/VHB167Q.Seq.d/ GTNNTCCTTACAATAATAAAATAATAATAAATAATGGATAATACAGNATTAGTTATTAAT

  5. Autofluorescence-free Live-cell Imaging Using Terbium Nanoparticles. (United States)

    Cardoso Dos Santos, Marcelina; Goetz, Joan; Bartenlian, Hortense; Wong, Ka-Leung; Charbonniere, Loïc Joanny; Hildebrandt, Niko


    Fluorescent nanoparticles (NPs) have become irreplaceable tools for advanced cellular and sub-cellular imaging. While very bright NPs require excitation with UV or visible light, which can create strong autofluorescence of biological components, NIR-excitable NPs without autofluorescence issues exhibit much lower brightness. Here, we show the application of a new type of surface-photosensitized terbium NPs (Tb-NPs) for autofluorescence-free intracellular imaging in live HeLa cells. Combination of exceptionally high brightness, high photostability, and long photoluminecence (PL) lifetimes for highly efficient suppression of the short-lived autofluorescence, allowed for time-gated PL imaging of intracellular vesicles over 72 h without toxicity and at extremely low Tb-NP concentrations down to 12 pM. Detection of highly resolved long-lifetime (ms) PL decay curves from small (~10 µm2) areas within single cells within a few seconds emphasized the unprecedented photophysical properties of Tb-NPs for live-cell imaging that extend well beyond currently available nanometric imaging agents.

  6. Solar Thermochemical Hydrogen Production via Terbium Oxide Based Redox Reactions

    Directory of Open Access Journals (Sweden)

    Rahul Bhosale


    Full Text Available The computational thermodynamic modeling of the terbium oxide based two-step solar thermochemical water splitting (Tb-WS cycle is reported. The 1st step of the Tb-WS cycle involves thermal reduction of TbO2 into Tb and O2, whereas the 2nd step corresponds to the production of H2 through Tb oxidation by water splitting reaction. Equilibrium compositions associated with the thermal reduction and water splitting steps were determined via HSC simulations. Influence of oxygen partial pressure in the inert gas on thermal reduction of TbO2 and effect of water splitting temperature (TL on Gibbs free energy related to the H2 production step were examined in detail. The cycle (ηcycle and solar-to-fuel energy conversion (ηsolar-to-fuel efficiency of the Tb-WS cycle were determined by performing the second-law thermodynamic analysis. Results obtained indicate that ηcycle and ηsolar-to-fuel increase with the decrease in oxygen partial pressure in the inert flushing gas and thermal reduction temperature (TH. It was also realized that the recuperation of the heat released by the water splitting reactor and quench unit further enhances the solar reactor efficiency. At TH=2280 K, by applying 60% heat recuperation, maximum ηcycle of 39.0% and ηsolar-to-fuel of 47.1% for the Tb-WS cycle can be attained.

  7. Folate Receptor Targeted Alpha-Therapy Using Terbium-149

    CERN Document Server

    Müller, Cristina; Haller, Stephanie; Dorrer, Holger; Köster, Ulli; Johnston, Karl; Zhernosekov, Konstantin; Türler, Andreas; Schibli, Roger


    Terbium-149 is among the most interesting therapeutic nuclides for medical applications. It decays by emission of short-range α-particles (Eα = 3.967 MeV) with a half-life of 4.12 h. The goal of this study was to investigate the anticancer efficacy of a 149Tb-labeled DOTA-folate conjugate (cm09) using folate receptor (FR)-positive cancer cells in vitro and in tumor-bearing mice. 149Tb was produced at the ISOLDE facility at CERN. Radiolabeling of cm09 with purified 149Tb resulted in a specific activity of ~1.2 MBq/nmol. In vitro assays performed with 149Tb-cm09 revealed a reduced KB cell viability in a FR-specific and activity concentration-dependent manner. Tumor-bearing mice were injected with saline only (group A) or with 149Tb-cm09 (group B: 2.2 MBq; group C: 3.0 MBq). A significant tumor growth delay was found in treated animals resulting in an increased average survival time of mice which received 149Tb-cm09 (B: 30.5 d; C: 43 d) compared to untreated controls (A: 21 d). Analysis of blood parameters rev...

  8. Hardness and dielectric characteristics of flux grown terbium aluminate crystals

    Energy Technology Data Exchange (ETDEWEB)

    Sharma, K.K.; Kotru, P.N. [Jammu Univ. (India). Dept. of Physics; Tandon, R.P. [National Physical Laboratory, New Delhi (India); Wanklyn, B.M. [Clarendon Laboratory, University of Oxford, Oxford (United Kingdom)


    Results of indentation induced Vickers hardness testing and dielectric studies conducted on flux-grown terbium aluminate crystals are presented. It is shown that the Vickers hardness value (H{sub v}) is independent of indentation time, but depends on the applied load. Applying the concept of Hays and Kendall, the load independent values are estimated for (110) and (001) planes. Differential behaviour in the crack formation of two different planes (110) and (001) is observed, while (001) plane develops Palmqvist cracks in the whole load range of 10-100 g, (110) plane shows a transition from Palmqvist to median cracks at 70 g. The fracture toughness, brittleness index and yield strength are determined for both the planes. The hardness anisotropy is reported. The dielectric constant, dielectric loss and conductivity are shown to be dependent on temperature and frequency of the applied a.c. field. The dielectric constant versus temperature shows a transition peak at 230 C, which remains independent of the frequency of the applied a.c. field in the range 1 kHz-13 MHz. (orig.) 36 refs.

  9. 26 CFR 1.167(m)-1 - Class lives. (United States)


    ... 26 Internal Revenue 2 2010-04-01 2010-04-01 false Class lives. 1.167(m)-1 Section 1.167(m)-1...) INCOME TAXES (CONTINUED) Itemized Deductions for Individuals and Corporations § 1.167(m)-1 Class lives. (a) For rules regarding the election to use the class life system authorized by section 167(m), see...

  10. 14 CFR 61.167 - Privileges. (United States)


    ... debriefings, an airline transport pilot may not instruct in aircraft, flight simulators, and flight training... CERTIFICATION: PILOTS, FLIGHT INSTRUCTORS, AND GROUND INSTRUCTORS Airline Transport Pilots § 61.167 Privileges. (a) A person who holds an airline transport pilot certificate is entitled to the same privileges as a...

  11. 14 CFR 406.167 - Initial decision. (United States)


    ... Aeronautics and Space COMMERCIAL SPACE TRANSPORTATION, FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF... Transportation Adjudications § 406.167 Initial decision. (a) Contents. The administrative law judge must issue an... law judge must include findings of fact and conclusions of law, and the grounds supporting those...

  12. Thermoluminescence of cerium and terbium -doped calcium pyrophosphate

    Energy Technology Data Exchange (ETDEWEB)

    Roman L, J.; Cruz Z, E. [UNAM, Instituto de Ciencias Nucleares, Circuito Exterior, Ciudad Universitaria, 04510 Mexico D. F. (Mexico); Lozano R, I. B.; Diaz G, J. A. I., E-mail: [IPN, Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada, Av. Legaria No. 694, 11500 Mexico D. F. (Mexico)


    The aim of this work is to report the thermoluminescence (Tl) response of Calcium Pyrophosphate phosphor doped with Cerium and Terbium impurities (Ca{sub 2}P{sub 2}O{sub 7}:Ce{sup 3+},Tb{sup 3+}). The phosphors were synthesized using the co-precipitation method and annealed at 900 degrees C by two hours for obtain the β phase. The intentional doping with Ce and Tb ions was 1 at.% and 0.1 at.%, whereas in the EDS results the concentration of impurities was 0.39 at.% and 0.05 at.%, respectively. The superficial morphology of phosphor is mainly composed by thin wafers of different size. All samples were exposed to gamma rays from {sup 60}Co in the Gammacell-200 irradiator. The Tl response of the phosphor was measured from Rt up to 350 degrees C and under nitrogen atmosphere in a Harshaw TLD 3500 reader. The glow curves of the Ca{sub 2}P{sub 2}O{sub 7}:Ce{sup 3+},Tb{sup 3+} powders showed a broad intense Tl peak centered at 165 degrees C and a shoulder at approximate 260 degrees C was observed. A linear Tl response in the range of absorbed dose of 0.2 to 10 Gy was obtained. Tl glow curves were analyzed using the initial rise (IR)and computerized glow curve deconvolution methods to evaluate the kinetics parameters such as activation energy (E), frequency factor (s) and kinetic order (b). (Author)

  13. Dicty_cDB: VFL167 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VF (Link to library) VFL167 (Link to dictyBase) - - - Contig-U12091-1 VFL167E (Link to Original site) VFL167F...(Link to library) Clone ID VFL167 (Link to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig...Contig-U12091-1 Original site URL Representative...Representative seq. ID VFL167E (Link to Original site) Representative DNA sequence >VFL167 (VFL167Q) /CSM/VF/VFL1-C/VFL167Q...AAACAATTATAAAAACAACAAATACAAAAATGATTAAGAATAGAAAATTAGATATTACTT CAACTAATGTTGCTGGTATTGGAACAGATTTAGATAAAA

  14. Solvent polarity and oxygen sensitivity, rather than viscosity, determine lifetimes of biaryl-sensitised terbium luminescence. (United States)

    Walter, Edward R H; Williams, J A Gareth; Parker, David


    In a macrocyclic terbium complex incorporating a biaryl sensitiser, the observed variation of emission lifetime is shown to be determined by the solubility of oxygen in the solvent system and the relative energy of the chromophore excited state, rather than any dependence on solvent viscosity.

  15. 46 CFR 167.05-35 - Public nautical school. (United States)


    ... 46 Shipping 7 2010-10-01 2010-10-01 false Public nautical school. 167.05-35 Section 167.05-35 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) NAUTICAL SCHOOLS PUBLIC NAUTICAL SCHOOL SHIPS Definitions § 167.05-35 Public nautical school. The term public nautical school means any school...

  16. 14 CFR 125.167 - Extinguishing agent container compartment temperature. (United States)


    ... temperature. 125.167 Section 125.167 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF... Requirements § 125.167 Extinguishing agent container compartment temperature. Precautions must be taken to ensure that the extinguishing agent containers are installed in places where reasonable temperatures can...

  17. 46 CFR 167.65-35 - Use of auto pilot. (United States)


    ... 46 Shipping 7 2010-10-01 2010-10-01 false Use of auto pilot. 167.65-35 Section 167.65-35 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) NAUTICAL SCHOOLS PUBLIC NAUTICAL SCHOOL SHIPS Special Operating Requirements § 167.65-35 Use of auto pilot. Except as provided in 33 CFR 164.15, when...

  18. 10 CFR 52.167 - Issuance of manufacturing license. (United States)


    ... 10 Energy 2 2010-01-01 2010-01-01 false Issuance of manufacturing license. 52.167 Section 52.167... POWER PLANTS Manufacturing Licenses § 52.167 Issuance of manufacturing license. (a) After completing any... manufacturing license if the Commission finds that: (1) Applicable standards and requirements of the Act and the...

  19. 46 CFR 167.65-25 - Steering gear tests. (United States)


    ... 46 Shipping 7 2010-10-01 2010-10-01 false Steering gear tests. 167.65-25 Section 167.65-25... SHIPS Special Operating Requirements § 167.65-25 Steering gear tests. On all nautical school ships making voyages of more than 48 hours' duration, the entire steering gear, the whistle, the means of...

  20. Arginine-responsive terbium luminescent hybrid sensors triggered by two crown ether carboxylic acids

    Energy Technology Data Exchange (ETDEWEB)

    Jiang, Lasheng [Key Laboratory of Theoretical Chemistry of Environment, Ministry of Education, School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); Tang, Ke; Ding, Xiaoping [School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); Wang, Qianming, E-mail: [Key Laboratory of Theoretical Chemistry of Environment, Ministry of Education, School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); Zhou, Zhan; Xiao, Rui [School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China)


    Crown ether carboxylic acids constitute main building blocks for the synthesis of terbium containing covalent cross-linked luminescent materials. Both the complexes and the hybrid nanomaterials could exhibit remarkable green emissions in pure water. More importantly, they were found to have a profound effect on the luminescence responses to arginine compared with glutamic acid, histidine, tryptophan, threonine, tyrosine and phenylalanine in aqueous environment. The present study provided the possibility of using a host–guest mechanism as a way of signal transduction based on lanthanide supramolecular hybrid materials. - Highlights: • Crown ether carboxylic acids were found to sensitize terbium ions among a group of ethers. • The complexes and silica hybrid materials were both prepared and characterized. • They could exhibit remarkable green emissions in pure water.

  1. Comparative analysis of conjugated alkynyl chromophore-triazacyclononane ligands for sensitized emission of europium and terbium. (United States)

    Soulié, Marine; Latzko, Frédéric; Bourrier, Emmanuel; Placide, Virginie; Butler, Stephen J; Pal, Robert; Walton, James W; Baldeck, Patrice L; Le Guennic, Boris; Andraud, Chantal; Zwier, Jurriaan M; Lamarque, Laurent; Parker, David; Maury, Olivier


    A series of europium and terbium complexes based on a functionalized triazacyclononane carboxylate or phosphinate macrocyclic ligand is described. The influence of the anionic group, that is, carboxylate, methylphosphinate, or phenylphosphinate, on the photophysical properties was studied and rationalized on the basis of DFT calculated structures. The nature, number, and position of electron-donating or electron-withdrawing aryl substituents were varied systematically within the same phenylethynyl scaffold in order to optimize the brightness of the corresponding europium complexes and investigate their two-photon absorption properties. Finally, the europium complexes were examined in cell-imaging applications, and selected terbium complexes were studied as potential oxygen sensors. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Neutroneneinfangsgammaspektrum und Niveauschema von Erbium167

    DEFF Research Database (Denmark)

    Koch, H.


    The (n, gamma)-spectrum of Er 167 was investigated by means of the Risø bent crystal spectrometer. The energies and intensities of 47 transitions were measured. 22 of them were fitted into a level scheme. The rotational bands of theK=7/2+[633],K=1/2–[521], andK=5/2–[512] states were found up to t...... to the spin valuesI=11/2+, 9/2–, and 7/2–. Gammavibrational states of these Nilsson orbitals were determined or proposed. The energy of theK=5/2–[523] state was suggested. Branching ratios of gamma transitions were compared with theoretical predictions....

  3. Spectrofluorimetric Determination of Human Serum Albumin Using Terbium-Danofloxacin Probe


    Ramezani, Amir M.; Manzoori, Jamshid L.; Amjadi, Mohammad; Jouyban, Abolghasem


    A spectrofluorimetric method is proposed for the determination of human serum albumin (HSA) and bovine serum albumin (BSA) using terbium-danofloxacin (Tb3+-Dano) as a fluorescent probe. These proteins remarkably enhance the fluorescence intensity of the Tb3+-Dano complex at 545 nm, and the enhanced fluorescence intensity of Tb3+-Dano is proportional to the concentration of proteins (HSA and BSA). Optimum conditions for the determination of HSA were investigated and found that the maximum resp...

  4. Genetically Encoded FRET-Sensor Based on Terbium Chelate and Red Fluorescent Protein for Detection of Caspase-3 Activity

    Directory of Open Access Journals (Sweden)

    Alexander S. Goryashchenko


    Full Text Available This article describes the genetically encoded caspase-3 FRET-sensor based on the terbium-binding peptide, cleavable linker with caspase-3 recognition site, and red fluorescent protein TagRFP. The engineered construction performs two induction-resonance energy transfer processes: from tryptophan of the terbium-binding peptide to Tb3+ and from sensitized Tb3+ to acceptor—the chromophore of TagRFP. Long-lived terbium-sensitized emission (microseconds, pulse excitation source, and time-resolved detection were utilized to eliminate directly excited TagRFP fluorescence and background cellular autofluorescence, which lasts a fraction of nanosecond, and thus to improve sensitivity of analyses. Furthermore the technique facilitates selective detection of fluorescence, induced by uncleaved acceptor emission. For the first time it was shown that fluorescence resonance energy transfer between sensitized terbium and TagRFP in the engineered construction can be studied via detection of microsecond TagRFP fluorescence intensities. The lifetime and distance distribution between donor and acceptor were calculated using molecular dynamics simulation. Using this data, quantum yield of terbium ions with binding peptide was estimated.

  5. 29 CFR 1952.167 - Changes to approved plans. (United States)


    ... 29 Labor 9 2010-07-01 2010-07-01 false Changes to approved plans. 1952.167 Section 1952.167 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR.... (a) Legislation. (1) On March 29, 1994, the Assistant Secretary approved Iowa's revised statutory...

  6. 26 CFR 1.167(a)-2 - Tangible property. (United States)


    ... 26 Internal Revenue 2 2010-04-01 2010-04-01 false Tangible property. 1.167(a)-2 Section 1.167(a)-2... property. The depreciation allowance in the case of tangible property applies only to that part of the property which is subject to wear and tear, to decay or decline from natural causes, to exhaustion, and to...

  7. 26 CFR 1.167(a)-4 - Leased property. (United States)


    ... 26 Internal Revenue 2 2010-04-01 2010-04-01 false Leased property. 1.167(a)-4 Section 1.167(a)-4... property. Capital expenditures made by a lessee for the erection of buildings or the construction of other permanent improvements on leased property are recoverable through allowances for depreciation or...

  8. Dicty_cDB: VSD167 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value VSD167 (VSD167Q) /...25 Homology vs DNA Score E Sequences producing significant alignments: (bits) Value N CB890904 |CB890904...Homology vs Protein Score E Sequences producing significant alignments: (bits) Value (Q54ST0) RecName: Full=NHP2-like

  9. 21 CFR 133.167 - Pasteurized blended cheese. (United States)


    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Pasteurized blended cheese. 133.167 Section 133...) FOOD FOR HUMAN CONSUMPTION CHEESES AND RELATED CHEESE PRODUCTS Requirements for Specific Standardized Cheese and Related Products § 133.167 Pasteurized blended cheese. Pasteurized blended cheese conforms to...

  10. 46 CFR 167.40-1 - Electrical installations. (United States)


    ... 46 Shipping 7 2010-10-01 2010-10-01 false Electrical installations. 167.40-1 Section 167.40-1 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) NAUTICAL SCHOOLS PUBLIC NAUTICAL SCHOOL... danger of fire, giving particular attention to wiring which is carried through wooden bulkheads...

  11. 40 CFR 98.167 - Records that must be retained. (United States)


    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Records that must be retained. 98.167... (CONTINUED) MANDATORY GREENHOUSE GAS REPORTING Hydrogen Production § 98.167 Records that must be retained. In addition to the information required by § 98.3(g), you must retain the records specified in paragraphs (a...

  12. 26 CFR 1.167(a)-1 - Depreciation in general. (United States)


    ... 26 Internal Revenue 2 2010-04-01 2010-04-01 false Depreciation in general. 1.167(a)-1 Section 1... Depreciation in general. (a) Reasonable allowance. Section 167(a) provides that a reasonable allowance for the... the taxpayer for the production of income shall be allowed as a depreciation deduction. The allowance...

  13. 26 CFR 1.167(g)-1 - Basis for depreciation. (United States)


    ... 26 Internal Revenue 2 2010-04-01 2010-04-01 false Basis for depreciation. 1.167(g)-1 Section 1.167... for depreciation. The basis upon which the allowance for depreciation is to be computed with respect... property at that time, is the basis for computing depreciation. ...

  14. 49 CFR 572.167 - Test conditions and instrumentation. (United States)


    ... 49 Transportation 7 2010-10-01 2010-10-01 false Test conditions and instrumentation. 572.167... Hybrid III Six-Year-Old Weighted Child Test Dummy § 572.167 Test conditions and instrumentation. The test conditions and instrumentation are as specified in 49 CFR 572.127 (Subpart N). Pt. 572, Subpt. S, Figs...

  15. Green light emission in aluminum oxide powders doped with different terbium concentrations

    Energy Technology Data Exchange (ETDEWEB)

    Mariscal B, L; Falcony, C. [IPN, Centro de Investigacion y de Estudios Avanzados, 07360 Ciudad de Mexico (Mexico); Carmona T, S.; Murrieta, H.; Sanchez A, M. A. [UNAM, Instituto de Fisica, 04510 Ciudad de Mexico (Mexico); Vazquez A, R. [IPN, Escuela Superior de Computo, 07738 Ciudad de Mexico (Mexico); Garcia R, C. M., E-mail: [UNAM, Facultad de Ciencias, 04510 Ciudad de Mexico (Mexico)


    Different emission intensities presented in aluminum oxide phosphors corresponding to different concentrations of doping performed with terbium are analyzed. The phosphors were synthesized by the evaporation technique and were characterized by photo and cathodoluminescence, X-ray diffraction and EDS techniques for different incorporation percentages of terbium as dopant; they show characteristic transitions in 494, 543, 587 and 622 nm, corresponding to {sup 5}D{sub 4} → {sup 7}F{sub 6}, {sup 5}D{sub 4} → {sup 7}F{sub 5}, {sup 5}D{sub 4} → {sup 7}F{sub 4} and {sup 5}D{sub 4} → {sup 7}F{sub 3}, respectively when they are excited with λ{sub exc} = 380 nm wavelength at room temperature. The results of X-ray diffraction show the presence of α-Al{sub 2}O{sub 3} phases with peaks located at 2θ = 25.78, 35.34, 37.96, 43.56, 45.8, 52.74, 57.7, 61.5, 66.74, 68.44, 77.12 and 80.94, and the δ-Al{sub 2}O-3 phase 2θ = 32.82, 45.8, 61.36 and 66.74. These compounds were heat treated for two hours at 1100 degrees Celsius. EDS analyzes indicate that these compounds have close to 60% oxygen around of 40% aluminum in the presence of terbium as dopant which indicates a stoichiometry close to the expected one for alumina. (Author)

  16. Graphene quantum dots-terbium ions as novel sensitive and selective time-resolved luminescent probes. (United States)

    Llorent-Martínez, Eulogio J; Durán, Gema M; Ríos, Ángel; Ruiz-Medina, Antonio


    We propose an alternative approach for the development of analytical methods based on terbium-sensitized luminescence (TSL). TSL is based on the complexation between Tb(III) ions and fluorescent organic compounds that have appropriate functional groups to complex with Tb(III). We report the use of graphene quantum dot (GQDs) nanoparticles to improve the sensitivity and selectivity of TSL detection. GQDs can react with terbium ions through the carboxylic groups present in their structure. These Tb(III)-GQD complexes, formed in situ in aqueous solution, can be used as time-resolved luminescent probes. Ascorbic acid was selected as a target analyte to demonstrate the suitability of the proposed method. The selectivity of the TSL method was highly improved for most of the interferences tested. Under the optimum conditions [Tb(III) concentration 5 × 10-4 mol L-1, GQD concentration 4 mg L-1], a minimum 100% increase in selectivity was observed for several vitamins and common cations that may be present in the samples to be analyzed. In addition, the analytical signal showed a 30% enhancement with the use of GQDs compared with the use of merely Tb(III) ions, with a detection limit of 0.12 μg mL-1. The repeatability and intermediate precision were lower than 3% and 5%, respectively. From the results obtained, the implementation of GQDs in TSL can lead to the development of novel time-resolved luminescent probes with high analytical potential. Graphical abstract Quenching of Tb(III)-graphene quantum dot (GQD) luminescence by ascorbic acid (AA). TBL terbium-sensitized luminescence.

  17. Fluorescence study of some terbium-oligopeptide complexes in methanolic solution. (United States)

    Rabouan, S; Delage, J; Durand, W; Prognon, P; Barthes, D


    This study concerned the use of lanthanide chelates to detect glycyl-leucyl-phenylalanine (GLF) and its homologues. Spectroscopic analysis of peptides without or with terbium complexation revealed the formation of (LF)(3)(Tb)(2), (GF)(3)(Tb)(2), (GLF)(3)(Tb)(2) and (FL)(4)Tb, (FG)(4)Tb complexes with high stability constants in methanolic solutions (pK(d)>13). Lanthanide chelate emission displayed a large Stokes shift (>270 nm), which allowed Tb chelates of GLF and its derivatives to be used for detection purposes. However, this preliminary study indicated some important limitations associated with lanthanide chelation, such as high methanolic content.

  18. Electromagnetic properties of terbium gallium garnet at millikelvin temperatures and low photon energy (United States)

    Kostylev, Nikita; Goryachev, Maxim; Bushev, Pavel; Tobar, Michael E.


    Electromagnetic properties of single crystal terbium gallium garnet are characterised from room down to millikelvin temperatures using the whispering gallery mode method. Microwave spectroscopy is performed at low powers equivalent to a few photons in energy and conducted as functions of the magnetic field and temperature. A phase transition is detected close to the temperature of 3.5 K. This is observed for multiple whispering gallery modes causing an abrupt negative frequency shift and a change in transmission due to extra losses in the new phase caused by a change in complex magnetic susceptibility.

  19. Nuclear excitation functions from 40 to 200 MeV proton irradiation of terbium

    Energy Technology Data Exchange (ETDEWEB)

    Engle, Jonathan W., E-mail:; Mashnik, Stepan G.; Parker, Lauren A.; Jackman, Kevin R.; Bitteker, Leo J.; Ullmann, John L.; Gulley, Mark S.; Pillai, Chandra; John, Kevin D.; Birnbaum, Eva R.; Nortier, Francois M.


    Nuclear formation cross sections are reported for 26 radionuclides, measured with 40–200 MeV proton irradiations of terbium foils. These data provide the basis for the production of medically relevant radionuclides (e.g., {sup 152}Tb, {sup 155}Tb, {sup 155}Eu, and {sup 156}Eu) and {sup 153}Gd, a potential source used in ongoing efforts to characterize stellar nucleosynthesis routes. Computational predictions from the ALICE2011, CEM03.03, Bertini, and INCL + ABLA codes are compared with newly measured data to contribute to the ongoing process of code development, and yields are calculated for selected radionuclides using measured data.

  20. Micelle-enhanced and terbium-sensitized spectrofluorimetric determination of gatifloxacin and its interaction mechanism (United States)

    Guo, Changchuan; Wang, Lei; Hou, Zhun; Jiang, Wei; Sang, Lihong


    A terbium-sensitized spectrofluorimetric method using an anionic surfactant, sodium dodecyl benzene sulfonate (SDBS), was developed for the determination of gatifloxacin (GFLX). A coordination complex system of GFLX-Tb 3+-SDBS was studied. It was found that SDBS significantly enhanced the fluorescence intensity of the complex (about 11-fold). Optimal experimental conditions were determined as follows: excitation and emission wavelengths of 331 and 547 nm, pH 7.0, 2.0 × 10 -4 mol l -1 terbium (III), and 2.0 × 10 -4 mol l -1 SDBS. The enhanced fluorescence intensity of the system (Δ If) showed a good linear relationship with the concentration of GFLX over the range of 5.0 × 10 -10 to 5.0 × 10 -8 mol l -1 with a correlation coefficient of 0.9996. The detection limit (3 σ) was determined as 6.0 × 10 -11 mol l -1. This method has been successfully applied to the determination of GFLX in pharmaceuticals and human urine/serum samples. Compared with most of other methods reported, the rapid and simple procedure proposed in the text offers higher sensitivity, wider linear range, and better stability. The interaction mechanism of the system is also studied by the research of ultraviolet absorption spectra, surface tension, solution polarity and fluorescence polarization.

  1. Circularly Polarized Luminescence in Enantiopure Europium and Terbium Complexes with Modular, All-Oxygen Donor Ligands (United States)

    Seitz, Michael; Do, King; Ingram, Andrew J.; Moore, Evan G.; Muller, Gilles; Raymond, Kenneth N.


    Abstract: Circulaly polarized luminescence from terbium(III) complexed and excited by chiral antenna ligands gives strong emission The modular synthesis of three new octadentate, enantiopure ligands are reported - one with the bidentate chelating unit 2-hydroxyisophthalamide (IAM) and two with 1-hydroxy-2-pyridinone (1,2-HOPO) units. A new design principle is introduced for the chiral, non-racemic hexamines which constitute the central backbones for the presented class of ligands. The terbium(III) complex of the IAM ligand, as well as the europium(III) complexes of the 1,2-HOPO ligands are synthesized and characterized by various techniques (NMR, UV, CD, luminescence spectroscopy). All species exhibit excellent stability and moderate to high luminescence efficiency (quantum yields ΦEu = 0.05–0.08 and ΦTb = 0.30–0.57) in aqueous solution at physiological pH. Special focus is put onto the properties of the complexes in regard to circularly polarized luminescence (CPL). The maximum luminescence dissymmetry factors (glum) in aqueous solution are high with |glum|max = 0.08 – 0.40. Together with the very favorable general properties (good stability, high quantum yields, long lifetimes), the presented lanthanide complexes can be considered as good candidates for analytical probes based on CPL in biologically relevant environments. PMID:19639983

  2. Luminescent method of determination of composition of europium and terbium complexes in solution by change of intensity ratio of luminescence bands

    Energy Technology Data Exchange (ETDEWEB)

    Bel' tyukova, S.V.; Nazarenko, N.A.; Poluehktov, N.S.


    The complexes of europium and terbium with phenanthroline, ethylenediaminetetraacetate, nitrilotriacetate, some acids-phenol derivatives and ..beta..-diketones series have been used as an example to demonstrate that the value of the ratio of intensities on the two bands of europium(terbium) luminescence spectra - the one corresponding to the hypersensitive'' transition and the other, to the magnetic dipole one - can be used for determination of the complexes composition in solutions.

  3. Thermo-transferred thermoluminescence (TTTl) in potassium-yttrium double fluoride doped with terbium

    Energy Technology Data Exchange (ETDEWEB)

    Gallegos, A.; Rivera, T.; Diaz G, J. A. [IPN, Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada, Legaria 694, Col. Irrigacion, 11500 Mexico D. F. (Mexico); Azorin, J. [Universidad Autonoma Metropolitana, Unidad Iztapalapa, San Rafael Atlixco No. 186, Col. Vicentina, 09340 Mexico D. F. (Mexico); Azorin, J. C. [Universidad de Guanajuato, Division de Ciencias e Ingenierias-Campus Leon, Lomas del Bosque No. 103, Col. Lomas del Campestre, 37000 Leon, Guanajuato (Mexico); Licona, R.; Rivas, F.; Hernandez C, G. [Benemerita Universidad Autonoma de Puebla, Facultad de Ciencias Quimicas, 14 Sur y San Claudio, Ciudad Universitaria, Puebla de Zaragoza, Puebla (Mexico); Khaidukov, N. [Institute of General and Inorganic Chemistry, Lenin SK 11 Prospect 31, Moscow 117907 (Russian Federation)


    This paper presents results of studying the thermo-transferred thermoluminescence (TTTl) phenomenon in potassium-yttrium double fluoride doped with terbium (K{sub 2}YF{sub 5:}Tb) at different impurity concentrations (0.8%, 0.95% and 0.99%). Previously to study the TTTl phenomenon, structural characterization and chemical composition of the materials were determined. The structural studies were conducted using a scanning electron microscope; meanwhile, chemical composition was analyzed using energy dispersive X-ray spectroscopy. Thermoluminescence kinetics was studied irradiating the samples with {sup 137}Cs gamma rays as well as with {sup 90}Sr/{sup 90}Y beta rays, analyzing the glow curves by the deconvolution method for obtaining the kinetic parameters. (Author)

  4. The influence of pressure on the photoluminescence properties of a terbium-adipate framework (United States)

    Spencer, Elinor C.; Zhao, Jing; Ross, Nancy L.; Andrews, Michael B.; Surbella, Robert G.; Cahill, Christopher L.


    The influence of pressure (over the 0-4.7 GPa range) on the photoluminescence emissions and crystal structure of the known 3D terbium-adipate metal-organic framework material Tb-GWMOF6 has been evaluated by high-pressure single-crystal X-ray diffraction and spectroscopic techniques. The results from this study show that this complex lanthanide framework structure undergoes three phase transitions within the 0-4 GPa pressure range that involve alterations in the number of symmetry independent Tb3+ ion sites within the crystal lattice. These pressure induced modifications to the structure of Tb-GWMOF6 lead to pronounced changes in the profiles of the 5D4→7F5 emission spectra of this complex.

  5. Terbium Radionuclides for Theranostics Applications: A Focus On MEDICIS-PROMED (United States)

    Cavaier, R. Formento; Haddad, F.; Sounalet, T.; Stora, T.; Zahi, I.

    A new facility, named CERN-MEDICIS, is under construction at CERN to produce radionuclides for medical applications. In parallel, the MEDICIS-PROMED, a Marie Sklodowska-Curie innovative training network of the Horizon 2020 European Commission's program, is being coordinated by CERN to train young scientists on the production and use of innovative radionuclides and develop a network of experts within Europe. One program within MEDICIS-PROMED is to determine the feasibility of producing innovative radioisotopes for theranostics using a commercial middle-sized high-current cyclotron and the mass separation technology developed at CERN-MEDICIS. This will allow the production of high specific activity radioisotopes not achievable with the common post-processing by chemical separation. Radioisotopes of scandium, copper, arsenic and terbium have been identified. Preliminary studies of activation yield and irradiation parameters optimization for the production of Tb-149 will be described.

  6. Dielectric and conducting behavior of gadolinium-terbium fumarate heptahydrate crystals (United States)

    Shah, M. D.; Want, B.


    Gadolinium-terbium fumarate heptahydrate crystals were grown in silica gel by using single gel diffusion technique. The crystals were characterized by different physico-chemical techniques of characterization. Powder X-ray diffraction results showed that the grown material is purely crystalline in nature. Elemental analyses suggested the chemical formula of the compound to be Gd Tb (C4H2O4)3ṡ7H2O. Energy dispersive X-ray analysis confirmed the presence of Gd and Tb in the title compound. The dielectric and conductivity studies of the grown compound were carried as function of frequency of applied field and the temperature. The grown material showed a dielectric anomaly which was correlated with its thermal behavior. The ac conductivity of the material showed Jonscher's power law behavior: σ(ω)=σo+Aωs, with a temperature-dependent power exponent s(<1). The conductivity was found to be a function of temperature and frequency.

  7. Highly sensitive detection of dipicolinic acid with a water-dispersible terbium-metal organic framework. (United States)

    Bhardwaj, Neha; Bhardwaj, Sanjeev; Mehta, Jyotsana; Kim, Ki-Hyun; Deep, Akash


    The sensitive detection of dipicolinic acid (DPA) is strongly associated with the sensing of bacterial organisms in food and many types of environmental samples. To date, the demand for a sensitive detection method for bacterial toxicity has increased remarkably. Herein, we investigated the DPA detection potential of a water-dispersible terbium-metal organic framework (Tb-MOF) based on the fluorescence quenching mechanism. The Tb-MOF showed a highly sensitive ability to detect DPA at a limit of detection of 0.04nM (linear range of detection: 1nM to 5µM) and also offered enhanced selectivity from other commonly associated organic molecules. The present study provides a basis for the application of Tb-MOF for direct, convenient, highly sensitive, and specific detection of DPA in the actual samples. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. A New Bis(phthalocyaninato) Terbium Single-Ion Magnet with an Overall Excellent Magnetic Performance. (United States)

    Chen, Yuxiang; Ma, Fang; Chen, Xiaoxiang; Dong, Bowei; Wang, Kang; Jiang, Shangda; Wang, Chiming; Chen, Xin; Qi, Dongdong; Sun, Haoling; Wang, Bingwu; Gao, Song; Jiang, Jianzhuang


    Bulky and strong electron-donating dibutylamino groups were incorporated onto the peripheral positions of one of the two phthalocyanine ligands in the bis(phthalocyaninato) terbium complex, resulting in the isolation of heteroleptic double-decker (Pc)Tb{Pc[N(C4H9)2]8} {Pc = phthalocyaninate; Pc[N(C4H9)2]8 = 2,3,9,10,16,17,23,24-octakis(dibutylamino)phthalocyaninate} with the nature of an unsymmetrical molecular structure, a square-antiprismatic coordination geometry, an intensified coordination field strength, and the presence of organic radical-f interaction. As a total result of all these factors, this sandwich-type tetrapyrrole lanthanide single-ion magnet (SIM) exhibits an overall enhanced magnetic performance including a high blocking temperature (TB) of 30 K and large effective spin-reversal energy barrier of Ueff = 939 K, rendering it the best sandwich-type tetrapyrrole lanthanide SIM reported thus far.

  9. Ultralarge magneto-optic rotations and rotary dispersion in terbium gallium garnet single crystal. (United States)

    Shaheen, Amrozia; Majeed, Hassaan; Anwar, Muhammad Sabieh


    We report systematically acquired data on the Verdet constant of terbium gallium garnet for wavelengths ranging from visible to near-infrared (405-830 nm) regime. Our experimental method of Stokes polarimetry is based on the Fourier decomposition of the received light intensity and allows unambiguous determination of both the Faraday rotation and the ellipticity of the emergent light. Temperature-dependent investigations in the range of 8-300 K extend earlier reports and verify the Verdet's constant direct dependence on the magnetization, whose first-order approximation is simply a manifestation of the Curie's law. Further, a least-squares fitting of the experimental data correlates well with theoretical predictions. At a wavelength of 405 nm and temperature of 8 K, the rotation is approximately 500°.

  10. Terbium fluorescence as a sensitive, inexpensive probe for UV-induced damage in nucleic acids

    Energy Technology Data Exchange (ETDEWEB)

    El-Yazbi, Amira F.; Loppnow, Glen R., E-mail:


    Graphical abstract: -- Highlights: •Simple, inexpensive, mix-and-read assay for positive detection of DNA damage. •Recognition of undamaged DNA via hybridization to a hairpin probe. •Terbium(III) fluorescence reports the amount of damage by binding to ssDNA. •Tb/hairpin is a highly selective and sensitive fluorescent probe for DNA damage. -- Abstract: Much effort has been focused on developing methods for detecting damaged nucleic acids. However, almost all of the proposed methods consist of multi-step procedures, are limited, require expensive instruments, or suffer from a high level of interferences. In this paper, we present a novel simple, inexpensive, mix-and-read assay that is generally applicable to nucleic acid damage and uses the enhanced luminescence due to energy transfer from nucleic acids to terbium(III) (Tb{sup 3+}). Single-stranded oligonucleotides greatly enhance the Tb{sup 3+} emission, but duplex DNA does not. With the use of a DNA hairpin probe complementary to the oligonucleotide of interest, the Tb{sup 3+}/hairpin probe is applied to detect ultraviolet (UV)-induced DNA damage. The hairpin probe hybridizes only with the undamaged DNA. However, the damaged DNA remains single-stranded and enhances the intrinsic fluorescence of Tb{sup 3+}, producing a detectable signal directly proportional to the amount of DNA damage. This allows the Tb{sup 3+}/hairpin probe to be used for sensitive quantification of UV-induced DNA damage. The Tb{sup 3+}/hairpin probe showed superior selectivity to DNA damage compared to conventional molecular beacons probes (MBs) and its sensitivity is more than 2.5 times higher than MBs with a limit of detection of 4.36 ± 1.2 nM. In addition, this probe is easier to synthesize and more than eight times cheaper than MBs, which makes its use recommended for high-throughput, quantitative analysis of DNA damage.

  11. Fine- and hyperfine structure investigations of even configuration system of atomic terbium (United States)

    Stefanska, D.; Elantkowska, M.; Ruczkowski, J.; Furmann, B.


    In this work a parametric study of the fine structure (fs) and the hyperfine structure (hfs) for the even-parity configurations of atomic terbium (Tb I) is presented, based in considerable part on the new experimental results. Measurements on 134 spectral lines were performed by laser induced fluorescence (LIF) in a hollow cathode discharge lamp; on this basis, the hyperfine structure constants A and B were determined for 52 even-parity levels belonging to the configurations 4f85d6s2, 4f85d26s or 4f96s6p; in all the cases those levels were involved in the transitions investigated as the lower levels. For 40 levels the hfs was examined for the first time, and for the remaining 12 levels the new measurements supplement our earlier results. As a by-product, also preliminary values of the hfs constants for 84 odd-parity levels were determined (the investigations of the odd-parity levels system in the terbium atom are still in progress). This huge amount of new experimental data, supplemented by our earlier published results, were considered for the fine and hyperfine structure analysis. A multi-configuration fit of 7 configurations was performed, taking into account second-order of perturbation theory, including the effects of closed shell-open shell excitations. Predicted values of the level energies, as well as of magnetic dipole and electric quadrupole hyperfine structure constants A and B, are quoted in cases when no experimental values are available. By combining our experimental data with our own semi-empirical procedure it was possible to identify correctly the lower and upper level of the line 544.1440 nm measured by Childs with the use of the atomic-beam laser-rf double-resonance technique (Childs, J Opt Soc Am B 9;1992:191-6).

  12. Structural and optical characterization of terbium doped ZnGa2O4 thin films deposited by RF magnetron sputtering (United States)

    Somasundaram, K.; Girija, K. G.; Sudarsan, V.; Selvin, P. Christopher; Vatsa, R. K.


    Tb3+ doped ZnGa2O4 nanophosphor (21 nm) has been synthesized via low temperature polyol route and subsequently thin films of the same were deposited on glass and ITO substrates by RF magnetron sputtering. The films were characterized by X-ray Diffraction and luminescence measurements. The XRD pattern showed that Tb3+ doped ZnGa2O4 nanophosphor has a cubic spinel phase. Luminescence behavior of the nanophosphor and as deposited sputtered film was investigated. The PL emission spectra of nanophosphor gave a broad ZnGa2O4 host emission band along with a strong terbium emission and the thin films showed only broad host emission band and there was no terbium ion emission.

  13. High yield production of the medical radioisotope {sup 167}Tm by the {sup 167}Er(d,2n) reaction

    Energy Technology Data Exchange (ETDEWEB)

    Hermanne, A., E-mail: [Vrije Universiteit Brussel (VUB), Brussels (Belgium); Adam Rebeles, R. [Vrije Universiteit Brussel (VUB), Brussels (Belgium); Tarkanyi, F.; Takacs, S. [Institute of Nuclear Research of the Hungarian Academy of Sciences (ATOMKI), Debrecen (Hungary); Spahn, I. [Institut fuer Nuklearchemie, Forschungszentrum Juelich (Germany); Ignatyuk, A.V. [Institute of Physics and Power Engineering (IPPE), Obninsk (Russian Federation)


    As part of our systematic comparison of (p,n) and (d,2n) reactions, the excitation functions of the {sup 167}Er(d,2n){sup 167}Tm production reaction and reactions leading to Tm radio-impurities were investigated up to 20 MeV. A stacked foil irradiation technique and {gamma}-ray spectroscopy is used. The measured excitation functions are compared with results of ALICE-D, EMPIRE-D and TALYS reaction model codes and with data from our earlier investigations on natural Er. Thick target yields and contamination levels are discussed. A comparison with other charged particle production routes for {sup 167}Tm shows that deuteron induced reactions are not competitive.

  14. Phenotype abnormality: 167 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 167 decreased efficiency... in organ named whole plant during process named cell growth ... whole plant ... decreased efficiency ... cell growth ...

  15. 26 CFR 1.167(b)-2 - Declining balance method. (United States)


    ... straight line rate (without adjustment for salvage) is 5 percent, and the declining balance rate at twice... 26 Internal Revenue 2 2010-04-01 2010-04-01 false Declining balance method. 1.167(b)-2 Section 1... Declining balance method. (a) Application of method. Under the declining balance method a uniform rate is...

  16. Determination of fluoxetine in pharmaceutical and biological samples based on the silver nanoparticle enhanced fluorescence of fluoxetine-terbium complex. (United States)

    Lotfi, Ali; Manzoori, Jamshid L


    In this study, a simple and sensitive spectrofluorimetric method is presented for the determination of fluoxetine based on the enhancing effect of silver nanoparticles (AgNPs) on the terbium-fluoxetine fluorescence emission. The AgNPs were prepared by a simple reduction method and characterized by UV-Vis spectroscopy and transmission electron microscopy. It was indicated that these AgNPs have a remarkable amplifying effect on the terbium-sensitized fluorescence of fluoxetine. The effects of various parameters such as AgNP and Tb(3+) concentration and the pH of the media were investigated. Under obtained optimal conditions, the fluorescence intensity of the terbium-fluoxetine-AgNP system was enhanced linearly by increasing the concentration of fluoxetine in the range of 0.008 to 19 mg/L. The limit of detection (b + 3s) was 8.3 × 10(-4) mg/L. The interference effects of common species found in real samples were also studied. The method had good linearity, recovery, reproducibility and sensitivity, and was satisfactorily applied for the determination of fluoxetine in tablet formulations, human urine and plasma samples. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  17. Study of Silver Nanoparticles Sensitized Fluorescence and Second-Order Scattering of Terbium(III-Pefloxacin Mesylate Complex and Determination of Pefloxacin Mesylate

    Directory of Open Access Journals (Sweden)

    Aiyun Li


    Full Text Available α-Keto acid of pefloxacin mesylate (PFLX can form the complex with Terbium(III. The intramolecular energy from PFLX to Terbium(III ion takes place when excited, and thus Terbium(III excited state is formed and then emits the characteristic fluorescence of Terbium(III, locating at 490, 545, 580, and 620 nm. The second-order scattering (SOS peak at 545 nm also appears for the complex with the exciting wavelength of 273 nm. When the silver nanoparticles are added to the system, the luminescence intensity at 545 nm greatly increased. So, with the adding of nanoparticles to the Terbium(III-PFLX complex, not only is the intramolecular energy promoted but also the SOS intensity is enhanced. The experimental results show that it is the silver nanoparticles with certain size and certain concentration which can greatly enhance the fluorescence-SOS intensity, and the relative intensity at 545 nm is proportional to the amount of PFLX. Based on this phenomenon, a novel method for the determination of PFLX has been developed and applied to the determination of PFLX in capsule and serum samples.

  18. Influence of crystalline structure on the luminescence properties of terbium orthotantalates

    Energy Technology Data Exchange (ETDEWEB)

    Siqueira, Kisla P.F. [Departamento de Química, Universidade Federal de Ouro Preto, Campus Morro do Cruzeiro, ICEB II, Ouro Preto 35400-000, Minas Gerais (Brazil); Carmo, Alexandre P. [Instituto Federal Fluminense, Campus Cabo Frio, RJ 28909-971 (Brazil); Bell, Maria J.V. [Departamento de Física, Universidade Federal de Juiz de Fora, Juiz de Fora 36036-330, MG (Brazil); Dias, Anderson, E-mail: [Departamento de Química, Universidade Federal de Ouro Preto, Campus Morro do Cruzeiro, ICEB II, Ouro Preto 35400-000, Minas Gerais (Brazil)


    Terbium orthotantalate powders were produced with M-fergusonite type (I2/a) and M′-fergusonite type (P2/a) structures. The samples were studied by X-ray diffraction, Raman scattering, and photoluminescence measurements (emission and decay curves). The results showed that crystalline materials were obtained with all the 18 Raman-active modes predicted by group theory calculations. Also, it was observed through photoluminescence decay curves that the Tb{sup 3+} ions occupies only one-symmetry site in both crystallographic arrangements. Photoluminescence emission curves exhibited some variation in spectral shape, peak position, and relative intensity as a consequence of their different crystalline arrangements. The dominated emission of Tb{sup 3+} ({sup 5}D{sub 4}→{sup 7}F{sub 5}) is centered with a maximum intensity at 549.2 nm (M-type) and 543.0 nm (M′-type). Fluorescence lifetimes for M-TbTaO{sub 4} and M′-TbTaO{sub 4} were determined as 33.4 μs and 1.25 ms, respectively. M′-type materials seems to be the most suitable for luminescent devices and could be a potential green luminescent material due to the strongest emission if compared with the M-fergusonite type. -- Highlights: ► Terbium orthotantalates were prepared in two different crystalline structures: I2/a and P2/a. ► XRD and Raman scattering showed that the different space groups obtained were exhibited all the 18 Raman-active modes. ► PL decay curves that the Tb{sup 3+} ions occupies only one-symmetry site in both crystallographic arrangements. ► Dominated emission of Tb{sup 3+} ({sup 5}D{sub 4}→{sup 7}F{sub 5}) is centered with a maximum intensity at 549 nm (M-type) and 543 nm (M′-type). ► Fluorescence lifetimes for M-TbTaO{sub 4} and M′-TbTaO{sub 4} were determined as 33.4 μs and 1.25 ms, respectively.

  19. Laser control and temperature switching of luminescence intensity in photostable transparent film based on terbium(III) β-diketonate complex (United States)

    Lapaev, Dmitry V.; Nikiforov, Victor G.; Safiullin, Georgy M.; Lobkov, Vladimir S.; Salikhov, Kev M.; Knyazev, Andrey A.; Galyametdinov, Yury G.


    The study of the terbium(III) and gadolinium(III) β-diketonate complexes by photoluminescence spectroscopy reveals considerable changes of the photophysical properties of the complexes under the UV laser irradiation. The measurements show the enhancement of the luminescence intensities in the vitrified transparent film of the terbium(III) complex as well as the gadolinium(III) complex under the 337 nm laser irradiation at room temperature. The irradiated film of the terbium(III) complex restores the initial photophysical properties after heating close to the melting temperature (∼353 K) and cooling. We observe no change of the luminescent properties of the irradiated film for months. These features can be used for the design of new lanthanide-based photostable systems with laser control of the luminescence intensity.

  20. Development of functionalized terbium fluorescent nanoparticles for antibody labeling and time-resolved fluoroimmunoassay application. (United States)

    Ye, Zhiqiang; Tan, Mingqian; Wang, Guilan; Yuan, Jingli


    Silica-based functionalized terbium fluorescent nanoparticles were prepared, characterized and developed as a fluorescence probe for antibody labeling and time-resolved fluoroimmunoassay. The nanoparticles were prepared in a water-in-oil (W/O) microemulsion containing a strongly fluorescent Tb(3+) chelate, N,N,N(1),N(1)-[2,6-bis(3'-aminomethyl-1'-pyrazolyl)phenylpyridine] tetrakis(acetate)-Tb(3+) (BPTA-Tb(3+)), Triton X-100, octanol, and cyclohexane by controlling copolymerization of tetraethyl orthosilicate (TEOS) and 3-[2-(2-aminoethylamino)ethylamino]propyl-trimethoxysilane (AEPS) with ammonia water. The characterizations by transmission electron microscopy and fluorometric methods show that the nanoparticles are spherical and uniform in size, 45 +/- 3nm in diameter, strongly fluorescent with fluorescence quantum yield of 10% and a long fluorescence lifetime of 2.0ms. The amino groups directly introduced to the nanoparticle's surface by using AEPS in the preparation made the surface modification and bioconjugation of the nanoparticles easier. The nanoparticle-labeled anti-human alpha-fetoprotein antibody was prepared and used for time-resolved fluoroimmunoassay of alpha-fetoprotein (AFP) in human serum samples. The assay response is linear from 0.10ngml(-1) to about 100ngml(-1) with the detection limit of 0.10ngml(-1). The coefficient variations (CVs) of the method are less than 9.0%, and the recoveries are in the range of 84-98% for human serum sample measurements.

  1. Highly efficient precipitation of phosphoproteins using trivalent europium, terbium, and erbium ions

    Energy Technology Data Exchange (ETDEWEB)

    Guezel, Yueksel; Rainer, Matthias; Mirza, Munazza Raza; Bonn, Guenther K. [Leopold-Franzens University, Institute of Analytical Chemistry and Radiochemistry, Innsbruck (Austria)


    This study describes a highly efficient method for the selective precipitation of phosphoproteins by trivalent europium, terbium, and erbium metal ions. These metal cations belong to the group of lanthanides and are known to be hard acceptors with an overwhelming preference for oxygen-containing anions such as phosphates to which they form very tight ionic bonds. The method could be successfully applied to specifically precipitate phosphoproteins from complex samples including milk and egg white by forming solid metal-protein complexes. Owing to the low solubility product of the investigated lanthanide salts, the produced metal-protein complexes showed high stability. The protein pellets were extensively washed to remove nonphosphorylated proteins and contaminants. For the analysis of proteins the pellets were first dissolved in 30 % formic acid and subjected to matrix-assisted laser desorption/ionization-time of flight (MALDI-TOF) MS. For peptide mass-fingerprint analysis the precipitated phosphoproteins were enzymatically digested using microwave-assisted digestion. The method was found to be highly specific for the isolation and purification of phosphoproteins. Protein quantification was performed by colorimetric detection of total precipitated phosphoproteins and revealed more than 95 % protein recovery for each lanthanide salt. (orig.)

  2. A Terbium Sensitized Luminescence Method for the Assay of Flubiprofen in Pharmaceutical Formulations

    Directory of Open Access Journals (Sweden)

    Salma M.Z. Al-Kindy


    Full Text Available A sensitive time-resolved luminescence method for the determination of flubiprofen (FLP in methanol and in aqueous solution is described. The method is based on the luminescence sensitization of terbium (Tb3+ by the formation of a ternary complex with FLP in the presence of 4,7 diphenyl 1,10 phenanthroline (DPP as co-ligand, and Tween-20 as surfactant. The signal for Tb-FLP-DPP was monitored at λex  = 285 nm and λem  = 552 nm. Optimum conditions for the formation of the complex in an aqueous system were TRIS buffer, pH 8.0, DPP (2.5Å~10−7  M, Tween-20 (0.30% and 4Å~10-5  mol L-1  of Tb3+  which allowed the determination of 20–1000 ng mL-1  of FLP with a limit of detection (LOD of 10 ng mL-1 . The relative standard deviations of the method ranged between 0.6 and 1.4% indicating excellent reproducibility of the method. The proposed method was successfully applied for the assays of FLP in pharmaceutical formulations and spiked tap water samples with average recoveries of 87% – 95%.

  3. Sensitization effects of supramolecular assemblies on the luminescence of terbium-ion prulifloxacin complexes

    Energy Technology Data Exchange (ETDEWEB)

    Wang Hong; Yi Chongyue; Li Xue; Fang Fang [School of Chemistry and Chemical Engineering, Huazhong University of Science and Technology, Wuhan 430074 (China); Yang Yajiang, E-mail: [School of Chemistry and Chemical Engineering, Huazhong University of Science and Technology, Wuhan 430074 (China)


    Luminescence enhancement of terbium-ion prulifloxacin complexes (Tb(III)-PUFX) in supramolecular hydrogels formed by assembly of 1,3:2,4-di-O-benzylidene-D-sorbitol (DBS) was investigated by steady-state fluorescence, varying temperature fluorescence and time-resolved fluorescence. The luminescence images show that Tb(III)-PUFX were dispersed in the DBS gels. The luminescence intensity of Tb(III)-PUFX in the DBS gels was significantly increased in comparison with that in corresponding aqueous solutions. The varying temperature fluorescent spectra show that the luminescence intensity of Tb(III)-PUFX decreased with an increase in the temperature. This implies that the luminescence enhancement of Tb(III)-PUFX is related to the dissociation and the formation of the DBS assemblies. Time-resolved fluorescence measurements show slower rotational motion in DBS gels in comparison with that in the corresponding aqueous solutions. This may be ascribed to a unique microstructure of three-dimensional network formed by DBC aggregates, resulting in deactivation of the nonradiative relaxation. The images of field emission scanning electron microscopy and polarized optical microscopy indicate that the morphology of the DBS assemblies was not influenced upon addition of Tb(III)-PUFX to the DBS gels.

  4. A Nanoscale Multiresponsive Luminescent Sensor Based on a Terbium(III) Metal-Organic Framework. (United States)

    Dang, Song; Wang, Ting; Yi, Feiyan; Liu, Qinghui; Yang, Weiting; Sun, Zhong-Ming


    A nanoscale terbium-containing metal-organic framework (nTbL), with a layer-like structure and [H2 NMe2 ](+) cations located in the framework channels, was synthesized under hydrothermal conditions. The structure of the as-prepared sample was systematically confirmed by powder XRD and elemental analysis; the morphology was characterized by field-emission SEM and TEM. The photoluminescence studies revealed that rod-like nTbL exhibited bright-green emission, corresponding to (5)D4 →(7)FJ (J=6-3) transitions of the Tb(3+) ion under excitation. Further sensing measurements revealed that as-prepared nTbL could be utilized as a multiresponsive luminescent sensor, which showed significant and exclusive detection ability for Fe(3+) ions and phenylmethanol. These results highlight the practical applications of lanthanide-containing metal-organic frameworks as fluorescent probes. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Terbium-Doped VO2 Thin Films: Reduced Phase Transition Temperature and Largely Enhanced Luminous Transmittance. (United States)

    Wang, Ning; Duchamp, Martial; Dunin-Borkowski, Rafal E; Liu, Shiyu; Zeng, XianTing; Cao, Xun; Long, Yi


    Vanadium dioxide (VO2) is a well-known thermochromic material with large IR modulating ability, promising for energy-saving smart windows. The main drawbacks of VO2 are its high phase transition temperature (τ(c) = 68°C), low luminous transmission (T(lum)), and weak solar modulating ability (ΔT(sol)). In this paper, the terbium cation (Tb(3+)) doping was first reported to reduce τ(c) and increase T(lum) of VO2 thin films. Compared with pristine VO2, 2 at. % doping level gives both enhanced T(lum) and ΔT(sol) from 45.8% to 54.0% and 7.7% to 8.3%, respectively. The T(lum) increases with continuous Tb(3+) doping and reaches 79.4% at 6 at. % doping level, representing ∼73.4% relative increment compared with pure VO2. This has surpassed the best reported doped VO2 thin films. The enhanced thermochromic properties is meaningful for smart window applications of VO2 materials.

  6. Luminescent investigations of terbium(III) biosorption as a surrogate for heavy metals and radionuclides. (United States)

    Achyuthan, Komandoor E; Arango, Dulce C; Carles, Elizabeth L; Cutler, Christopher E; Meyer, Lauren A; Brozik, Susan M


    We describe a metal transport system for investigating the interfacial interactions between the anionic surface charge of a gram-negative bacterium (Escherichia coli) and a trivalent cationic metal, Tb3+. We believe this is the first description of the uptake kinetics, sub- and intracellular distribution, and temporal fate of Tb3+ ion in E. coli. We used the luminescence of the terbium-dipicolinic acid chelate to study metal ion transport. The bacteria had a high tolerance for the metal (IC(50) = 4 mM Tb3+). Metal ion transport was passive and metabolism independent. The uptake kinetics rapidly reached a maximum within 15 min, followed by a stasis for 60 min, and declining thereafter between 120 and 240 min, resulting in a biphasic curve. During this period, greater than one-third of the metal ion was sequestered within the cell. Our choice of a safe Biosafety Level I E. coli bacteria and the relatively non-toxic Tb3+ metal represents a model system for luminescent investigations of biosorption, for studying bacterial-water interfacial chemistry and for the bioremediation of heavy metals and radionuclides.

  7. Construction of the energy matrix for complex atoms. Part VIII: Hyperfine structure HPC calculations for terbium atom (United States)

    Elantkowska, Magdalena; Ruczkowski, Jarosław; Sikorski, Andrzej; Dembczyński, Jerzy


    A parametric analysis of the hyperfine structure (hfs) for the even parity configurations of atomic terbium (Tb I) is presented in this work. We introduce the complete set of 4fN-core states in our high-performance computing (HPC) calculations. For calculations of the huge hyperfine structure matrix, requiring approximately 5000 hours when run on a single CPU, we propose the methods utilizing a personal computer cluster or, alternatively a cluster of Microsoft Azure virtual machines (VM). These methods give a factor 12 performance boost, enabling the calculations to complete in an acceptable time.

  8. 33 CFR 167.150 - Off New York Traffic Separation Scheme: General. (United States)


    ... Scheme: General. 167.150 Section 167.150 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) PORTS AND WATERWAYS SAFETY OFFSHORE TRAFFIC SEPARATION SCHEMES Description of Traffic Separation Schemes and Precautionary Areas Atlantic East Coast § 167.150 Off New York Traffic...

  9. 33 CFR 167.170 - Off Delaware Bay Approach Traffic Separation Scheme: General. (United States)


    ... Separation Scheme: General. 167.170 Section 167.170 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) PORTS AND WATERWAYS SAFETY OFFSHORE TRAFFIC SEPARATION SCHEMES Description of Traffic Separation Schemes and Precautionary Areas Atlantic East Coast § 167.170 Off Delaware...

  10. 33 CFR 167.200 - In the approaches to Chesapeake Bay Traffic Separation Scheme: General. (United States)


    ... Bay Traffic Separation Scheme: General. 167.200 Section 167.200 Navigation and Navigable Waters COAST... SEPARATION SCHEMES Description of Traffic Separation Schemes and Precautionary Areas Atlantic East Coast § 167.200 In the approaches to Chesapeake Bay Traffic Separation Scheme: General. (a) The traffic...

  11. 33 CFR 167.400 - Off San Francisco Traffic Separation Scheme: General. (United States)


    ... Separation Scheme: General. 167.400 Section 167.400 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) PORTS AND WATERWAYS SAFETY OFFSHORE TRAFFIC SEPARATION SCHEMES Description of Traffic Separation Schemes and Precautionary Areas Pacific West Coast § 167.400 Off San...

  12. 33 CFR 167.450 - In the Santa Barbara Channel Traffic Separation Scheme: General. (United States)


    ... Traffic Separation Scheme: General. 167.450 Section 167.450 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) PORTS AND WATERWAYS SAFETY OFFSHORE TRAFFIC SEPARATION SCHEMES Description of Traffic Separation Schemes and Precautionary Areas Pacific West Coast § 167.450 In the Santa...

  13. 33 CFR 167.1702 - In Prince William Sound: Prince William Sound Traffic Separation Scheme. (United States)


    ... William Sound Traffic Separation Scheme. 167.1702 Section 167.1702 Navigation and Navigable Waters COAST... SEPARATION SCHEMES Description of Traffic Separation Schemes and Precautionary Areas Pacific West Coast § 167.1702 In Prince William Sound: Prince William Sound Traffic Separation Scheme. The Prince William Sound...

  14. 9 CFR 167.1 - Scope and applicability of rules of practice. (United States)


    ... HEALTH PROTECTION ACT General § 167.1 Scope and applicability of rules of practice. The Uniform Rules of... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Scope and applicability of rules of practice. 167.1 Section 167.1 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE...

  15. 46 CFR 167.60-10 - Exhibition of certificate of inspection. (United States)


    ... 46 Shipping 7 2010-10-01 2010-10-01 false Exhibition of certificate of inspection. 167.60-10 Section 167.60-10 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) NAUTICAL SCHOOLS PUBLIC NAUTICAL SCHOOL SHIPS Certificates of Inspection § 167.60-10 Exhibition of certificate of...

  16. 46 CFR 167.40-20 - Deep-sea sounding apparatus. (United States)


    ... 46 Shipping 7 2010-10-01 2010-10-01 false Deep-sea sounding apparatus. 167.40-20 Section 167.40-20... SHIPS Certain Equipment Requirements § 167.40-20 Deep-sea sounding apparatus. Nautical school ships shall be equipped with an efficient or electronic deep-sea sounding apparatus. The electronic deep-sea...

  17. 26 CFR 1.167(b)-0 - Methods of computing depreciation. (United States)


    ... 26 Internal Revenue 2 2010-04-01 2010-04-01 false Methods of computing depreciation. 1.167(b)-0....167(b)-0 Methods of computing depreciation. (a) In general. Any reasonable and consistently applied method of computing depreciation may be used or continued in use under section 167. Regardless of the...

  18. 26 CFR 1.167(a)-6 - Depreciation in special cases. (United States)


    ... 26 Internal Revenue 2 2010-04-01 2010-04-01 false Depreciation in special cases. 1.167(a)-6....167(a)-6 Depreciation in special cases. (a) Depreciation of patents or copyrights. The cost or other... unrecovered cost or other basis may be deducted in that year. See § 1.167(a)-14(c)(4) for depreciation of a...

  19. 26 CFR 1.167(d)-1 - Agreement as to useful life and rates of depreciation. (United States)


    ... depreciation. 1.167(d)-1 Section 1.167(d)-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE... and Corporations § 1.167(d)-1 Agreement as to useful life and rates of depreciation. After August 16... respect to the estimated useful life, method and rate of depreciation and treatment of salvage of any...

  20. 9 CFR 381.167 - Other poultry dishes and specialty items. (United States)


    ... items. 381.167 Section 381.167 Animals and Animal Products FOOD SAFETY AND INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE AGENCY ORGANIZATION AND TERMINOLOGY; MANDATORY MEAT AND POULTRY PRODUCTS INSPECTION... Standards of Identity or Composition § 381.167 Other poultry dishes and specialty items. Poultry dishes and...

  1. 33 CFR 167.405 - Off San Francisco: Main ship channel. (United States)


    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Off San Francisco: Main ship channel. 167.405 Section 167.405 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND... Separation Schemes and Precautionary Areas Pacific West Coast § 167.405 Off San Francisco: Main ship channel...

  2. Spectrofluorimetric determination of human serum albumin using terbium-danofloxacin probe. (United States)

    Ramezani, Amir M; Manzoori, Jamshid L; Amjadi, Mohammad; Jouyban, Abolghasem


    A spectrofluorimetric method is proposed for the determination of human serum albumin (HSA) and bovine serum albumin (BSA) using terbium-danofloxacin (Tb(3+)-Dano) as a fluorescent probe. These proteins remarkably enhance the fluorescence intensity of the Tb(3+)-Dano complex at 545 nm, and the enhanced fluorescence intensity of Tb(3+)-Dano is proportional to the concentration of proteins (HSA and BSA). Optimum conditions for the determination of HSA were investigated and found that the maximum response was observed at: pH = 7.8, [Tb(3+)] = 8.5 × 10(-5) mol L(-1), [Dano] = 1.5 × 10(-4) mol L(-1). The calibration graphs for standard solutions of BSA, HSA, and plasma samples of HSA were linear in the range of 0.2 × 10(-6) - 1.3 × 10(-6) mol L(-1), 0.2 × 10(-6) - 1.4 × 10(-6) mol L(-1), and 0.2 × 10(-6) - 1 × 10(-6) mol L(-1), respectively. The detection limits (S/N = 3) for BSA, HSA, and plasma sample of HSA were 8.7 × 10(-8) mol L(-1), 6.2 × 10(-8) mol L(-1), and 8.1 × 10(-8) mol L(-1), respectively. The applicability of the method was checked using a number of real biological plasma samples and was compared with the UV spectrometric reference method. The results was showed that the method could be regarded as a simple, practical, and sensitive alternative method for determination of albumin in biological samples.

  3. Spectrofluorimetric Determination of Human Serum Albumin Using Terbium-Danofloxacin Probe

    Directory of Open Access Journals (Sweden)

    Amir M. Ramezani


    Full Text Available A spectrofluorimetric method is proposed for the determination of human serum albumin (HSA and bovine serum albumin (BSA using terbium-danofloxacin (Tb3+-Dano as a fluorescent probe. These proteins remarkably enhance the fluorescence intensity of the Tb3+-Dano complex at 545 nm, and the enhanced fluorescence intensity of Tb3+-Dano is proportional to the concentration of proteins (HSA and BSA. Optimum conditions for the determination of HSA were investigated and found that the maximum response was observed at: pH=7.8, [Tb3+] =8.5×10−5 mol L−1, [Dano] =1.5×10−4 mol L−1. The calibration graphs for standard solutions of BSA, HSA, and plasma samples of HSA were linear in the range of 0.2×10−6−1.3×10−6 mol L−1, 0.2×10−6−1.4×10−6 mol L−1, and 0.2×10−6−1×10−6 mol L−1, respectively. The detection limits (S/N = 3 for BSA, HSA, and plasma sample of HSA were 8.7×10−8 mol L−1, 6.2×10−8 mol L−1, and 8.1×10−8 mol L−1, respectively. The applicability of the method was checked using a number of real biological plasma samples and was compared with the UV spectrometric reference method. The results was showed that the method could be regarded as a simple, practical, and sensitive alternative method for determination of albumin in biological samples.

  4. Determination of flavonoids in pharmaceutical preparations using Terbium sensitized fluorescence method

    Directory of Open Access Journals (Sweden)

    M Shaghaghi


    Full Text Available "nBackground and the Purpose of the Study: The aim of this study was development and validation of a simple, rapid and sensitive spectrofluorimetric method for determination of total flavonoids in two topical formulations of Calendula officinalis, Ziziphus Spina-christi and an oral drop of Hypiran perforatum L. The proposed method is based on the formation of terbium (Tb3+ "n-flavonoids (quercetin as a reference standard complex at pH 7.0, which has fluorescence intensely with maximum emission at 545 nm when excited at 310 nm. "nMethod "n: For ointments masses of topical formulations were weighed and added to ethanol-aqueous buffer (pH 10.0 and the resulting mixtures were shaken and then two phases were separated by centrifugation. Aqueous phases were filtered and then diluted with water. For Hypiran drops an appropriate portion was diluted with ethanol and then aliquots of sample or standard solutions were determined according to the experimental procedure. "nResults "n: Under the optimum conditions, total concentrations of flavonoids (as quercetin equivalent in three tested formulations were found to be 0.204 mg/g (for Dermatin cream, 0.476 mg/g (for Calendula ointment and 13.50 μg/ml (for Hypiran drops. Analytical recoveries from samples spiked with different amounts of quercetin were 96.1-104.0 % with RSD % of less than 3.5. Conclusion : The proposed method which requires a simple dissolution step without any matrix interferences provided high sensitivity and selectivity and was easily applied to determine total flavonoids in real samples of three investigated formulations with excellent reproducibility.

  5. TOF SIMS analysis and generation of white photoluminescence from strontium silicate codoped with europium and terbium

    Energy Technology Data Exchange (ETDEWEB)

    Tshabalala, Modiehi A.; Swart, Hendrik C.; Ntwaeaborwa, Odireleng M., E-mail: [Department of Physics, University of the Free State, P.O Box 339, Bloemfontein 9300 South Africa (South Africa)


    White light emitting terbium (Tb{sup 3+}) and europium (Eu{sup 3+}) codoped strontium silicate (Sr{sub 2}SiO{sub 4}) phosphors were prepared by a solid state reaction process. The structure, particle morphology, chemical composition, ion distribution, photoluminescence (PL), and decay characteristics of the phosphors were analyzed by x-ray diffraction (XRD), scanning electron microscopy (SEM), time-of-flight secondary ion mass spectrometry (TOF-SIMS), and PL spectroscopy, respectively. The XRD data showed that our Sr{sub 2}SiO{sub 4} composed of two phases, namely, β-Sr{sub 2}SiO{sub 4} and α′-Sr{sub 2}SiO{sub 4}, and the α′-Sr{sub 2}SiO{sub 4} phase was more prominent than the β-Sr{sub 2}SiO{sub 4} phase. The SEM micrographs showed that the particles were agglomerated together and they did not have definite shapes. All ions (i.e., negative and positive) present in our materials were identified by TOF-SIMS. In addition, the chemical imaging performed with the TOF-SIMS demonstrated how the individual ions including the dopants (Eu{sup 3+} and Tb{sup 3+}) were distributed in the host lattice. White photoluminescence was observed when the Sr{sub 2}SiO{sub 4}:Tb{sup 3+}, Eu{sup 3+} phosphor was excited at 239 nm using a monochromatized xenon lamp as the excitation source. The phosphor exhibited fast decay lifetimes implying that it is not a good candidate for long afterglow applications.

  6. Synthesis, crystal structure and photophysical properties of europium(III) and terbium(III) complexes with pyridine-2,6-dicarboxamide

    NARCIS (Netherlands)

    Tanase, S.; Gallego, P.M.; Gelder, R. de; Fu, W.T.


    The reactions of pyridine-2,6-dicarboxamide with europium(III) and terbium(III) triflates led to the formation of mononuclear complexes of formula [Ln(pcam)(3)](CF3SO3)(3) (Ln = Eu 1, Tb 2; pcam stands for pyridine-2,6-dicarboxamide). From single-crystal X-ray diffraction analysis, the complexes

  7. Zinc sulfide and terbium-doped zinc sulfide films grown by traveling wave reactor atomic layer epitaxy

    CERN Document Server

    Yun, S J; Nam, K S


    Zinc sulfide (ZnS) and terbium-doped ZnS (ZnS:Tb) thin films were grown by traveling wave reactor atomic layer epitaxy (ALE). In the present work, ZnCl sub 2 , H sub 2 S, and tris (2,2,6,6-tetramethyl-3,5-heptandionato) terbium (Tb(tmhd) sub 3) were used as the precursors. The dependence of crystallinity and Cl content of ZnS films was investigated on the growth temperature. ZnS and ZnS:Tb films grown at temperatures ranging from 400 to 500 .deg. C showed a hexagonal-2H crystalline structure. The crystallinity of ZnS film was greatly enhanced as the temperature increased. At growth temperatures higher than 450.deg.C, the films showed preferred orientation with mainly (002) diffraction peak. The Cl content decreased from approximately 9 to 1 at.% with the increase in growth temperature from 400 to 500 .deg. C. The segregation of Cl near the surface region and the incorporation of O from Tb(tmhd) sub 3 during ALE process were also observed using Auger electron spectroscopy. The ALE-grown ZnS and ZnS:Tb films re...

  8. Commercializing potassium terbium fluoride, KTF (KTb3F10) faraday crystals for high laser power optical isolator applications (United States)

    Schlichting, Wolfgang; Stevens, Kevin; Foundos, Greg; Payne, Alexis


    Many scientific lasers and increasingly industrial laser systems operate in power regime, require high-performance optical isolators to prevent disruptive light feedback into the laser cavity. The optically active Faraday material is the key optical element inside the isolator. SYNOPTICS has been supplying the laser market with Terbium Gallium Garnet (TGG - Tb3Ga5O12) for many years. It is the most commonly used material for the 650-1100nm range and the key advantages for TGG include its cubic crystal structure for alignment free processing, little to no intrinsic birefringence, and ease of manufacture. However, for high-power laser applications TGG is limited by its absorption at 1064nm and its thermo-optic coefficient, dn/dT. Specifically, thermal lensing and depolarization effects become a limiting factor at high laser powers. While TGG absorption has improved significantly over the past few years, there is an intrinsic limit. Now, SYNOPTICS is commercializing the enhanced new crystal Potassium Terbium Fluoride KTF (KTb3F10) that exhibits much smaller nonlinear refractive index and thermo-optic coefficients, and still exhibits a Verdet constant near that of TGG. This cubic crystal has relatively low absorption and thermo-optic coefficients. It is now fully characterized and available for select production orders. At OPTIFAB in October 2017 we present recent results comparing the performance of KTF to TGG in optical isolators and show SYNOPTICS advances in large volume crystal growth and the production ramp up.

  9. Preparation and photoluminescence enhancement in terbium(III ternary complexes with β-diketone and monodentate auxiliary ligands

    Directory of Open Access Journals (Sweden)

    Devender Singh


    Full Text Available A series of new solid ternary complexes of terbium(III ion based on β-diketone ligand acetylacetone (acac and monodentate auxiliary ligands (aqua/urea/triphenylphosphineoxide/pyridine-N-oxide had been prepared. The structural characterizations of synthesized ternary compounds were studied by means of elemental analysis, infrared (IR, and proton nuclear magnetic resonance (NMR spectral techniques. The optical characteristics were investigated with absorption as well as photoluminescence spectroscopy. Thermal behavior of compounds was examined by TGA/DTA analysis and all metal complexes were found to have good thermal stability. The luminescence decay time of complexes were also calculated by monitoring at emission wavelength corresponding to 5D4 → 7F5 transition. A comparative inspection of the luminescent behavior of prepared ternary compounds was performed in order to determine the function of auxiliary ligands in the enhancement of luminescence intensity produced by central terbium(III ion. The color coordinates values suggested that compounds showed bright green emission in visible region in electromagnetic spectrum. Complexes producing green light could play a significant role in the fabrication of efficient light conversion molecular devices for display purposes and lightning systems.

  10. Synthesis and luminescent study of Ce{sup 3+}-doped terbium-yttrium aluminum garnet

    Energy Technology Data Exchange (ETDEWEB)

    Dotsenko, V.P., E-mail: [A.V. Bogatsky Physico-Chemical Institute, National Academy of Sciences of Ukraine, Lustdorfskaya doroga 86, 65080 Odessa (Ukraine); Berezovskaya, I.V.; Zubar, E.V.; Efryushina, N.P. [A.V. Bogatsky Physico-Chemical Institute, National Academy of Sciences of Ukraine, Lustdorfskaya doroga 86, 65080 Odessa (Ukraine); Poletaev, N.I.; Doroshenko, Yu.A. [Institute of Combustion and Advanced Technologies, Mechnikov Odessa National University, Dvoryanskaya 2, 65082 Odessa (Ukraine); Stryganyuk, G.B. [Ivan Franko National University of Lviv, Kirilo i Mefodii 8, 79005 Lviv (Ukraine); HASYLAB at DESY, Notkestrasse 85, 22607 Hamburg (Germany); Voloshinovskii, A.S. [Ivan Franko National University of Lviv, Kirilo i Mefodii 8, 79005 Lviv (Ukraine)


    Highlights: Black-Right-Pointing-Pointer Ce{sup 3+}-doped garnets (TYAG) were prepared using nanostructured reagents. Black-Right-Pointing-Pointer The Ce{sup 3+} ions cause a very efficient yellow emission of the samples. Black-Right-Pointing-Pointer The reasons for the long wavelength position of this emission are discussed. Black-Right-Pointing-Pointer Contribution from Al atoms to the conduction band of TYAG is quite essential. - Abstract: Terbium-yttrium aluminum garnets (TYAG) doped with Ce{sup 3+} ions have been prepared by solid state reactions between nanostructured oxides of aluminum and rare earths. The luminescent properties of Ce{sup 3+} ions in (Tb{sub 0.8}Y{sub 0.2}){sub 3(1-x)}Ce{sub 3x}Al{sub 5}O{sub 12} (x = 0.03) have been studied upon excitation in the 2-20 eV region. The substitution of Tb{sup 3+} for Y{sup 3+} in the garnet structure results in broadening the emission band and shifting its maximum towards the longer wavelengths. It was found that in addition to the 4f{sup n} {yields} 4f{sup n-1}5d excitation bands of Ce{sup 3+} and Tb{sup 3+} ions, the excitation spectra for the Ce{sup 3+} emission contain broad bands at 6.73 and {approx}9.5 eV. These bands are attributed to the Ce{sup 3+}-bound exciton formation and O 2p {yields} Al 3s, 3p transitions, respectively. In contrast to the predictions based on the results of electronic structure calculations on Y{sub 3}Al{sub 5}O{sub 12} and Tb{sub 4}Al{sub 2}O{sub 9}, the threshold of interband transitions in TYAG is at high energies ( Greater-Than-Or-Slanted-Equal-To 7.3 eV), and contributions from Al{sub tetr} and Al{sub oct} atoms to the conduction-band density of states are evaluated as quite essential.

  11. Structural variations in terbium(III) complexes with 1,3-adamantanedicarboxylate and diverse co-ligands

    Energy Technology Data Exchange (ETDEWEB)

    Thuéry, Pierre, E-mail:


    Terbium nitrate was reacted with 1,3-adamantanedicarboxylic acid (LH{sub 2}) under solvo-hydrothermal conditions with either N,N-dimethylformamide (DMF) or N,N-dimethylacetamide (DMA) as organic solvents. Hydrolysation of the latter co-solvents resulted in the formation of formate or acetate ions, which are present as co-ligands in the 1D coordination polymer [Tb(L)(HCOO)(H{sub 2}O){sub 2}] (1) and the 2D assembly [Tb(L)(CH{sub 3}COO)(H{sub 2}O)] (2). The increase in dimensionality in the latter arises from the higher connectivity provided by acetate versus formate, the L{sup 2−} ligand being bis-chelating in both cases. The complex [Tb{sub 2}(L){sub 3}(H{sub 2}O){sub 5}][Tb{sub 2}(L){sub 3}(H{sub 2}O){sub 4}]·3H{sub 2}O (3), another 1D species, crystallizes alongside crystals of 2. Further addition of cucurbit[6]uril (CB6), with DMF as co-solvent, gave the two complexes [Tb{sub 2}(L){sub 2}(CB6)(H{sub 2}O){sub 6}](NO{sub 3}){sub 2}·6H{sub 2}O (4) and [H{sub 2}NMe{sub 2}]{sub 2}[Tb(L)(HCOO){sub 2}]{sub 2}·CB6·3H{sub 2}O (5). Complex 4 crystallizes as a 3D framework in which Tb(L){sup +} chains are connected by tetradentate CB6 molecules, while 5 unites a carboxylate-bridged anionic 2D planar assembly and layers of CB6 molecules with counter-cations held at both portals. - Graphical abstract: One- to three-dimensional assemblies are formed in terbium(III) complexes with 1,3-adamantanedicarboxylate obtained under solvo-hydrothermal conditions, these species including formate or acetate co-ligands formed in situ, or additional cucurbit[6]uril molecules. - Highlights: • We report structures of terbium(III) complexes with 1,3-adamantanedicarboxylate. • Solvents able to generate co-ligands or counter-ions in situ have been used. • A 3D species including additional cucurbituril molecules is decribed. • One species displays an alternation of metal–organic and organic sheets.

  12. 26 CFR 1.167(l)-4 - Public utility property; election to use asset depreciation range system. (United States)


    ... depreciation range system. 1.167(l)-4 Section 1.167(l)-4 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT... Individuals and Corporations § 1.167(l)-4 Public utility property; election to use asset depreciation range system. (a) Application of section 167(l) to certain property subject to asset depreciation range system...

  13. 26 CFR 1.167(l)-2 - Public utility property; election as to post-1969 property representing growth in capacity. (United States)


    ...-1969 property representing growth in capacity. 1.167(l)-2 Section 1.167(l)-2 Internal Revenue INTERNAL...) Itemized Deductions for Individuals and Corporations § 1.167(l)-2 Public utility property; election as to post-1969 property representing growth in capacity. (a) In general. Section 167(l)(2) prescribes the...

  14. 26 CFR 1.167(l)-1 - Limitations on reasonable allowance in case of property of certain public utilities. (United States)


    ... property of certain public utilities. 1.167(l)-1 Section 1.167(l)-1 Internal Revenue INTERNAL REVENUE... Deductions for Individuals and Corporations § 1.167(l)-1 Limitations on reasonable allowance in case of property of certain public utilities. (a) In general—(1) Scope. Section 167(l) in general provides...

  15. Distinct transcriptional and processing regulations control miR167a level in tomato during stress. (United States)

    Jodder, Jayanti; Das, Rohit; Sarkar, Deepti; Bhattacharjee, Payel; Kundu, Pallob


    Besides their definite role in plant developmental processes miR167 also serve as mediator of stress response. Although differential expression of miR167 occurs during stresses, the regulatory-mechanism of biogenesis remained elusive. Therefore, using tomato as the model plant we have explored the mechanism of regulation of miR167a expression during stresses. Fungus or virus infections and exposure to cold stress raised the level of miR167a expression. Whereas, salt, drought and heat treatments resulted in the downregulation, indicating different stresses activated alternative mechanisms for miR167a regulation. Interestingly, the relative expression level of precursors in control versus temperature stressed plants differed from the pattern observed in the mature miR167a expression, suggesting that both transcriptional and processing regulation were important for biogenesis. The promoter-regulatory sequence of the major isoform MIR167a harbours several development and stress-related regulatory sites. Accordingly, promoter assays using transient transformation and transgenic tobacco plants proved stress-dependent regulation of the promoter. Further analyses corroborated the role of tomato DREB2A protein in the transcriptional regulation during temperature stress. Finally, in vitro assays established the importance of processing factors in cold-stress dependent efficient processing of MIR167a precursors. These data confirm distinct role of transcriptional and processing machinery in stress-influenced regulation of tomato miR167a biogenesis.

  16. Health survey of 167 pet rabbits (Oryctolagus cuniculus) in Finland. (United States)

    Mäkitaipale, J; Harcourt-Brown, F M; Laitinen-Vapaavuori, O


    Only a limited amount of information is available about health status of pet rabbits. The aim of this study was to obtain data about the health status of pet rabbits considered healthy by the owners in Finland. Physical examination and lateral abdominal and lateral skull radiography were performed on 167 pet rabbits of which 118 (70.7 per cent) had abnormal findings in at least one examination. The most common findings were acquired dental disease (n=67, 40.1 per cent), vertebral column deformities and degenerative lesions (n=52, 31.1 per cent), skin disorders (n=28, 16.8 per cent) and eye disorders (n=12, 7.2 per cent). Vertebral column angulating deformities were significantly more common in dwarf lop rabbits (P≤0.001). The prevalence of health disorders was significantly higher in rabbits over three years of age of which 51 (82.3 per cent) had findings in at least one examination (PRabbits as prey animals hide their illness, which cause difficulties to owners to recognise health problems. Because of the high prevalence of clinical and radiological findings in apparently healthy pet rabbits, regular physical examinations are advised, especially for animals over three years old. British Veterinary Association.

  17. Burnable Absorbers with Enriched Er-167 in PWR Fuel Assembly

    Energy Technology Data Exchange (ETDEWEB)

    Choe, Jiwon; Kong, Chidong; Lee, Deokjung [Ulsan National Institute of Science and Technology, Ulsan (Korea, Republic of); Shin, Ho Cheol [KHNP-CRI, Daejeon (Korea, Republic of)


    Many advanced PWRs are required to have a 24-month operating cycle to improve plant economy, and to keep the boron concentration low to allow an adequately negative moderator feedback during any ATWS event through 100% core life. Unfortunately, longer cycles require higher uranium-235 enrichment and initial boron concentration in the reactor coolant. The amount of soluble boron is limited due to the requirement that the MTC must remain negative over the fuel cycle. Too much boron, typically greater than 1,300 ppm at full power, will make the MTC positive. The optimal design of burnable absorbers is key to the feasibility of this extended cycle and low boron core below the design limit of peak pin power. New concepts for burnable absorbers include changing the materials and geometry in the burnable absorber. k{sub inf}, peaking factor, MTC, and control rod worth of new BAs were compared with those of the conventional BA. A new enriched Er-167 based BA has been proposed and, from three test cases, it was shown that the Erbium burnable absorber is favorable to counterbalance the power peak and Gadolinium burnable absorber is favorable to flattening k{sub inf} trends over burnup.

  18. Complete Stokes polarimetry of magneto-optical Faraday effect in a terbium gallium garnet crystal at cryogenic temperatures. (United States)

    Majeed, Hassaan; Shaheen, Amrozia; Anwar, Muhammad Sabieh


    We report the complete determination of the polarization changes caused in linearly polarized incident light due to propagation in a magneto-optically active terbium gallium garnet (TGG) single crystal, at temperatures ranging from 6.3 to 300 K. A 28-fold increase in the Verdet constant of the TGG crystal is seen as its temperature decreases to 6.3 K. In contrast with polarimetry of light emerging from a Faraday material at room temperature, polarimetry at cryogenic temperatures cannot be carried out using the conventional fixed polarizer-analyzer technique because the assumption that ellipticity is negligible becomes increasingly invalid as temperature is lowered. It is shown that complete determination of light polarization in such a case requires the determination of its Stokes parameters, otherwise inaccurate measurements will result with negative implications for practical devices.

  19. Development of Optical Isolators for Visible Light Using Terbium Aluminum Garnet (Tb3Al5O12) Single Crystals (United States)

    Geho, Mikio; Takagi, Takashi; Chiku, Shinichiro; Fujii, Takashi


    We have recently reported the successful growth of incongruently melting terbium aluminum garnet (Tb3Al5O12; TAG) single crystals by the hybrid laser FZ (floating zone) method. Optical property evaluations confirmed a high transmittance and a larger Verdet constant than conventional Tb3Ga5O12 (TGG) crystals and/or Faraday glasses. In this study, we attempted to design, fabricate, and evaluate optical isolators in visible light through near-infrared (NIR) regions using TAG crystals. A finite element method (FEM) simulation of possible models led us to the preferable one based on a radially magnetized magnet. To realize this, we employed a pseudo-radially magnetized magnet. The target wavelengths of the prototype device were 408, 808, and 1064 nm. The typical extinction ratio was more than 30 dB and the insertion loss was less than 0.3 dB for AR-coated devices.

  20. 46 CFR 167.65-15 - Routing instructions; strict compliance with. (United States)


    ... 46 Shipping 7 2010-10-01 2010-10-01 false Routing instructions; strict compliance with. 167.65-15... PUBLIC NAUTICAL SCHOOL SHIPS Special Operating Requirements § 167.65-15 Routing instructions; strict... strictly comply with routing instructions issued by competent naval authority. ...

  1. 15 CFR 922.167 - Permits for access to the Tortugas Ecological Reserve. (United States)


    ... 15 Commerce and Foreign Trade 3 2010-01-01 2010-01-01 false Permits for access to the Tortugas Ecological Reserve. 922.167 Section 922.167 Commerce and Foreign Trade Regulations Relating to Commerce and Foreign Trade (Continued) NATIONAL OCEANIC AND ATMOSPHERIC ADMINISTRATION, DEPARTMENT OF COMMERCE OCEAN AND COASTAL RESOURCE MANAGEMENT NATIONAL...


    African Journals Online (AJOL)

    Preferred Customer

    ABSTRACT. The allenic ketone 8-methylnonane-1,6,7-trien-4-one and related allenes have been synthesized from simple commercially available materials. Since allenes analogous to 8-methylnonane-1,6,7-trien-4-one have previously been transformed to substituted bicyclo[3.3.0]octanones via corresponding ...

  3. 46 CFR 167.65-60 - Examination of boilers and machinery by engineer. (United States)


    ... 46 Shipping 7 2010-10-01 2010-10-01 false Examination of boilers and machinery by engineer. 167.65-60 Section 167.65-60 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) NAUTICAL... machinery by engineer. It shall be the duty of an engineer when he assumes charge of the boilers and...

  4. 33 CFR 167.1703 - In Prince William Sound: Valdez Arm Traffic Separation Scheme. (United States)


    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false In Prince William Sound: Valdez Arm Traffic Separation Scheme. 167.1703 Section 167.1703 Navigation and Navigable Waters COAST GUARD... William Sound: Valdez Arm Traffic Separation Scheme. The Valdez Arm Traffic Separation Scheme consists of...

  5. 7 CFR 1789.167 - Terms and conditions of escrow agreement. (United States)


    ... 7 Agriculture 12 2010-01-01 2010-01-01 false Terms and conditions of escrow agreement. 1789.167 Section 1789.167 Agriculture Regulations of the Department of Agriculture (Continued) RURAL UTILITIES SERVICE, DEPARTMENT OF AGRICULTURE (CONTINUED) USE OF CONSULTANTS FUNDED BY BORROWERS Escrow Account...

  6. 75 FR 51757 - Foreign-Trade Zone 167-Green Bay, WI; Site Renumbering Notice (United States)


    ... No: 2010-20899] DEPARTMENT OF COMMERCE Foreign-Trade Zones Board Foreign-Trade Zone 167--Green Bay, WI; Site Renumbering Notice Foreign-Trade Zone 167 was approved by the FTZ Board on August 23, 1990... Elizabeth Whiteman at [email protected] or (202) 482-0473. Dated: August 17, 2010. Andrew Mc...

  7. 46 CFR 167.15-33 - Underwater Survey in Lieu of Drydocking (UWILD). (United States)


    ... remotely operated vehicle's (ROV) location relative to the hull; (4) The means for examining all through... 46 Shipping 7 2010-10-01 2010-10-01 false Underwater Survey in Lieu of Drydocking (UWILD). 167.15... SCHOOLS PUBLIC NAUTICAL SCHOOL SHIPS Inspections § 167.15-33 Underwater Survey in Lieu of Drydocking...

  8. 20 CFR 669.650 - How are MSFW youth funds allocated to section 167 youth grantees? (United States)


    ... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false How are MSFW youth funds allocated to section 167 youth grantees? 669.650 Section 669.650 Employees' Benefits EMPLOYMENT AND TRAINING ADMINISTRATION... Youth Program § 669.650 How are MSFW youth funds allocated to section 167 youth grantees? The allocation...

  9. 26 CFR 1.167(a)-10 - When depreciation deduction is allowable. (United States)


    ... 26 Internal Revenue 2 2010-04-01 2010-04-01 false When depreciation deduction is allowable. 1.167... Corporations § 1.167(a)-10 When depreciation deduction is allowable. (a) A taxpayer should deduct the proper depreciation allowance each year and may not increase his depreciation allowances in later years by reason of...

  10. A hydrometallurgical process for the recovery of terbium from fluorescent lamps: Experimental design, optimization of acid leaching process and process analysis. (United States)

    Innocenzi, Valentina; Ippolito, Nicolò Maria; De Michelis, Ida; Medici, Franco; Vegliò, Francesco


    Terbium and rare earths recovery from fluorescent powders of exhausted lamps by acid leaching with hydrochloric acid was the objective of this study. In order to investigate the factors affecting leaching a series of experiments was performed in according to a full factorial plan with four variables and two levels (4 2 ). The factors studied were temperature, concentration of acid, pulp density and leaching time. Experimental conditions of terbium dissolution were optimized by statistical analysis. The results showed that temperature and pulp density were significant with a positive and negative effect, respectively. The empirical mathematical model deducted by experimental data demonstrated that terbium content was completely dissolved under the following conditions: 90 °C, 2 M hydrochloric acid and 5% of pulp density; while when the pulp density was 15% an extraction of 83% could be obtained at 90 °C and 5 M hydrochloric acid. Finally a flow sheet for the recovery of rare earth elements was proposed. The process was tested and simulated by commercial software for the chemical processes. The mass balance of the process was calculated: from 1 ton of initial powder it was possible to obtain around 160 kg of a concentrate of rare earths having a purity of 99%. The main rare earths elements in the final product was yttrium oxide (86.43%) following by cerium oxide (4.11%), lanthanum oxide (3.18%), europium oxide (3.08%) and terbium oxide (2.20%). The estimated total recovery of the rare earths elements was around 70% for yttrium and europium and 80% for the other rare earths. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Investigation of the luminescent properties of terbium-anthranilate complexes and application to the determination of anthranilic acid derivatives in aqueous solutions

    Energy Technology Data Exchange (ETDEWEB)

    Arnaud, N.; Georges, J


    The luminescent properties of terbium complexes with furosemide (FR), flufenamic (FF) acid, tolfenamic (TF) acid and mefenamic (MF) acid have been investigated in aqueous solutions. For all four compounds, complexation occurs when the carboxylic acid of the aminobenzoic group is dissociated and is greatly favoured in the presence of trioctylphosphine oxide as co-ligand and Triton X-100 as surfactant. Under optimum conditions, luminescence of the lanthanide ion is efficiently sensitised and the lifetime of the {sup 5}D{sub 4} resonance level of terbium in the complex is ranging between 1 and 1.9 ms, against 0.4 ms for the aqua ion. The sensitivity of the method for the determination of anthranilic acid derivatives is improved by one to two orders of magnitude with respect to that achieved using native fluorescence or terbium-sensitised luminescence in methanol. The limits of detection are 2x10{sup -10}, 5x10{sup -10} and 2x10{sup -9} mol l{sup -1} for flufenamic acid, furosemide and tolfenamic acid, and mefenamic acid, respectively, with within-run RSD values of less than 1%. The method has been applied to the determination of flufenamic acid in spiked calf sera with and without sample pretreatment. Depending on the method and the analyte concentration, the recovery was ranging between 83 and 113% and the lowest concentration attainable in serum samples was close to 1x10{sup -7} mol l{sup -1}.

  12. Lanthanides in Nuclear Medicine. The Production of Terbium-149 by Heavy Ion Beams

    CERN Document Server

    Dmitriev, S N; Zaitseva, N G; Maslov, O D; Molokanova, L G; Starodub, G Ya; Shishkin, S V; Shishkina, T V


    Among radioactive isotopes of lanthanide series elements, finding the increasing using in nuclear medicine, alpha-emitter {149}Tb (T_{1/2} = 4.118 h; EC 76.2 %; beta^+ 7.1 %; alpha 16.7 %) is considered as a perspective radionuclide for radioimmunotherapy. The aim of the present work is to study experimental conditions of the {149}Tb production in reactions Nd({12}C, xn){149}Dy (4.23 min; beta^+, EC)\\to {149}Tb when the Nd targets have been irradiated by heavy ions of carbon. On the basis of results of formation and decay of {149}Dy\\to{149}Tb evaluation of the {149}Tb activity, is made which can be received under optimum conditions (enriched {142}Nd target, {12}C ions with the energy 120 MeV and up to current 100 mu A, time of irradiating 8-10 hours). Under these conditions {149}Tb can be obtained up to 30 GBq (up to 0.8 Ci).

  13. 26 CFR 1.167(c)-1 - Limitations on methods of computing depreciation under section 167(b) (2), (3), and (4). (United States)


    ... 26 Internal Revenue 2 2010-04-01 2010-04-01 false Limitations on methods of computing depreciation... Deductions for Individuals and Corporations § 1.167(c)-1 Limitations on methods of computing depreciation... other basis of such construction or erection qualifies for these methods of depreciation. In the case of...

  14. Transactivation of proto-oncogene c-Myc by hepatitis B virus transactivator MHBst167. (United States)

    Lun, Yong-Zhi; Cheng, Jun; Chi, Qing; Wang, Xue-Lei; Gao, Meng; Sun, Li-DA


    C-terminally truncated hepatitis B virus (HBV) middle size surface proteins (MHBst) has been shown to be a transcriptional activator and may be relevant to hepatocarcinogenesis by transactivating gene expression. In the present study, a pcDNA3.1(-)-MHBst167 vector coding for MHBst truncated at amino acid 167 (MHBst167) was constructed and transfected into the HepG2 hepatoma cell line. mRNA and protein expression of MHBst167 in the cells was detected by reverse transcription-polymerase chain reaction (RT-PCR) and western blot analysis. A cDNA library of genes transactivated by the truncated protein in HepG2 cells was made in pGEM-T Easy using suppression subtractive hybridization. The cDNAs were sequenced and analyzed with BLAST searching against the sequences in GenBank. The results showed that certain sequences, such as that of human proto-oncogene c-Myc, may be involved in tumor development. An expression vector pCAT3/c-Myc containing the chloramphenicol acetyltransferase (CAT) gene under the control of a c-Myc promoter was generated, and the transcriptional transactivating effect of MHBst167 on the c-Myc promoter was investigated by RT-PCR and western blotting. MHBst167 was found to upregulate the transcriptional activity of the promoter, as well as transcription and translation of c-Myc. MHBst167 was also shown to transactivate SV40 immediate early promoter, and transcriptionally transactivate the expression of human c-Myc. These findings provide new directions for studying the biological functions of MHBst167, and for a better understanding of the tumor development mechanisms of HBV infection.

  15. 33 CFR 167.500 - In the approaches to Los Angeles-Long Beach Traffic Separation Scheme: General. (United States)


    ...-Long Beach Traffic Separation Scheme: General. 167.500 Section 167.500 Navigation and Navigable Waters... SEPARATION SCHEMES Description of Traffic Separation Schemes and Precautionary Areas Pacific West Coast § 167.500 In the approaches to Los Angeles-Long Beach Traffic Separation Scheme: General. The Traffic...

  16. File list: NoD.CeL.10.AllAg.Kc167 [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available NoD.CeL.10.AllAg.Kc167 dm3 No description Cell line Kc167 ERX402111,ERX402119,ERX40...RX402127,ERX402115,ERX402103,ERX402109 ...

  17. File list: NoD.CeL.50.AllAg.Kc167 [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available NoD.CeL.50.AllAg.Kc167 dm3 No description Cell line Kc167 ERX402141,ERX402101,ERX40...RX402123,ERX402115,ERX402104,ERX402109 ...

  18. Structural investigation and photoluminescent properties of gadolinium(III), europium(III) and terbium(III) 3-mercaptopropionate complexes. (United States)

    Souza, E R; Mazali, I O; Sigoli, F A


    This work reports on the synthesis, crystallographic determination and spectroscopic characterization of gadolinium(III), terbium(III) and europium(III) 3-mercaptopropionate complexes, aqua-tris(3-mercaptopropionate)lanthanide(III)--[Ln(mpa)3(H2O)]. The Judd-Ofelt intensity parameters were experimentally determined from emission spectrum of the [Eu(mpa)3(H2O)]complex and they were also calculated from crystallographic data. The complexes are coordination polymers, where the units of each complex are linked together by carboxylate groups leading to an unidimensional and parallel chains that by chemical interactions form a tridimensional framework. The emission spectrum profile of the [Eu(mpa)3(H2O)] complex is discussed based on point symmetry of the europium(III) ion, that explains the bands splitting observed in its emission spectrum. Photoluminescent analysis of the [Gd(mpa)3(H2O)] complex show no efficient ligand excitation but an intense charge transfer band. The excitation spectra of the [Eu(mpa)3(H2O)] and [Tb(mpa)3(H2O)] complexes do not show evidence of energy transfer from the ligand to the excited levels of these trivalent ions. Therefore the emission bands are originated only by direct f-f intraconfigurational excitation of the lantanide(III) ions.

  19. Fluorometric determination of proteins using the terbium (III)-2-thenoyltrifluoroacetone-sodium dodecyl benzene sulfonate-protein system

    Energy Technology Data Exchange (ETDEWEB)

    Jia Zhen [Key Laboratory of Colloid and Interface Chemistry of Education Ministry, School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Department of Chemistry, Dezhou University, Dezhou 253023 (China); Yang Jinghe [Key Laboratory of Colloid and Interface Chemistry of Education Ministry, School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China)]. E-mail:; Wu Xia [Key Laboratory of Colloid and Interface Chemistry of Education Ministry, School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Wang Fei [Key Laboratory of Colloid and Interface Chemistry of Education Ministry, School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Guo Changying [Key Laboratory of Colloid and Interface Chemistry of Education Ministry, School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Liu Shufang [Key Laboratory of Colloid and Interface Chemistry of Education Ministry, School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China)


    It is found that in hexamethylene tetramine (HMTA)-HCl buffer of pH=8.00, proteins can enhance the fluorescence of terbium (III) (Tb{sup 3+})-2-thenoyltrifluoroacetone (TTA)-sodium dodecyl benzene sulfonate (SDBS) system. Based on this, a sensitive method for the determination of proteins is proposed. The experiments indicate that under the optimum conditions, the enhanced fluorescence intensity is in proportion to the concentration of proteins in the range of 4.0x10{sup -9}-7.5x10{sup -6}g/mL for bovine serum albumin (BSA), 5.0x10{sup -9}-1.5x10{sup -5}g/mL for human serum albumin (HSA), 1.0x10{sup -8}-7.5x10{sup -6}g/mL for egg albumin (EA). Their detection limits (S/N=3) are 0.5, 0.8 and 2.0ng/mL, respectively. The interaction mechanism is also studied.

  20. Terbium to Quantum Dot FRET Bioconjugates for Clinical Diagnostics: Influence of Human Plasma on Optical and Assembly Properties

    Directory of Open Access Journals (Sweden)

    Niko Hildebrandt


    Full Text Available Förster resonance energy transfer (FRET from luminescent terbium complexes (LTC as donors to semiconductor quantum dots (QDs as acceptors allows extraordinary large FRET efficiencies due to the long Förster distances afforded. Moreover, time-gated detection permits an efficient suppression of autofluorescent background leading to sub-picomolar detection limits even within multiplexed detection formats. These characteristics make FRET-systems with LTC and QDs excellent candidates for clinical diagnostics. So far, such proofs of principle for highly sensitive multiplexed biosensing have only been performed under optimized buffer conditions and interactions between real-life clinical media such as human serum or plasma and LTC-QD-FRET-systems have not yet been taken into account. Here we present an extensive spectroscopic analysis of absorption, excitation and emission spectra along with the luminescence decay times of both the single components as well as the assembled FRET-systems in TRIS-buffer, TRIS-buffer with 2% bovine serum albumin, and fresh human plasma. Moreover, we evaluated homogeneous LTC-QD FRET assays in QD conjugates assembled with either the well-known, specific biotin-streptavidin biological interaction or, alternatively, the metal-affinity coordination of histidine to zinc. In the case of conjugates assembled with biotin-streptavidin no significant interference with the optical and binding properties occurs whereas the histidine-zinc system appears to be affected by human plasma.

  1. Evidence of mass exchange between inside and outside of sonoluminescing bubble in aqueous solution of terbium chloride

    Energy Technology Data Exchange (ETDEWEB)

    Liang, Jinfu, E-mail: [School of Physics and Electronic Science, Guizhou Normal University, Guiyang 550001 (China); Chen, Weizhong, E-mail: [The Key Laboratory of Modern Acoustics, Ministry of Education, Institution of Acoustics, Nanjing University, Nanjing 210093 (China); Wang, Xun; Yang, Jing; Chen, Zhan [The Key Laboratory of Modern Acoustics, Ministry of Education, Institution of Acoustics, Nanjing University, Nanjing 210093 (China)


    Highlights: • Time-resolved spectra of SBSL were obtained for Tb{sup 3+} ions emission lines. • Mass exchange between inside and outside of SL bubble was probed via Tb{sup 3+} ions lines. • The argon rectification hypothesis was tested by time-resolved spectra of SBSL. • The rate of mass exchange inside an SBSL bubble increases with increasing sound pressure. - Abstract: Spectra of single-bubble sonoluminescence (SBSL) were obtained for Tb{sup 3+} ions emission lines from bubbles in an aqueous solution of terbium chloride (TbCl{sub 3}). The spectra provide experimental evidence to prove that an air bubble driven by strong ultrasound will not eventually become a rectified pure argon bubble, which is not as predicted by the argon rectification hypothesis. The time-resolved spectra of SBSL show a mass exchange of material such as Tb{sup 3+} ions between the inside and outside of the bubble. With increasing sound pressure, the rate of mass exchange and the SBSL intensity increases.

  2. Optical properties and electrical transport of thin films of terbium(III bis(phthalocyanine on cobalt

    Directory of Open Access Journals (Sweden)

    Peter Robaschik


    Full Text Available The optical and electrical properties of terbium(III bis(phthalocyanine (TbPc2 films on cobalt substrates were studied using variable angle spectroscopic ellipsometry (VASE and current sensing atomic force microscopy (cs-AFM. Thin films of TbPc2 with a thickness between 18 nm and 87 nm were prepared by organic molecular beam deposition onto a cobalt layer grown by electron beam evaporation. The molecular orientation of the molecules on the metallic film was estimated from the analysis of the spectroscopic ellipsometry data. A detailed analysis of the AFM topography shows that the TbPc2 films consist of islands which increase in size with the thickness of the organic film. Furthermore, the cs-AFM technique allows local variations of the organic film topography to be correlated with electrical transport properties. Local current mapping as well as local I–V spectroscopy shows that despite the granular structure of the films, the electrical transport is uniform through the organic films on the microscale. The AFM-based electrical measurements allow the local charge carrier mobility of the TbPc2 thin films to be quantified with nanoscale resolution.

  3. Highly luminescent charge-neutral europium(iii) and terbium(iii) complexes with tridentate nitrogen ligands. (United States)

    Senthil Kumar, Kuppusamy; Schäfer, Bernhard; Lebedkin, Sergei; Karmazin, Lydia; Kappes, Manfred M; Ruben, Mario


    We report on the synthesis of tridentate-nitrogen pyrazole-pyridine-tetrazole (L(1)H) and pyrazole-pyridine-triazole (L(2)H) ligands and their complexation with lanthanides (Ln = Gd(iii), Eu(iii) and Tb(iii)) resulting in stable, charge-neutral complexes Ln(L(1))3 and Ln(L(2))3, respectively. X-ray crystallographic analysis of the complexes with L(1) ligands revealed tricapped trigonal coordination geometry around the lanthanide ions. All complexes show bright photoluminescence (PL) in the solid state, indicating efficient sensitization of the lanthanide emission via the triplet states of the ligands. In particular, the terbium complexes show high PL quantum yields of 65 and 59% for L(1) and L(2), respectively. Lower PL efficiencies of the europium complexes (7.5 and 9%, respectively) are attributed to large energy gaps between the triplet states of the ligands and accepting levels of Eu(iii). The triplet state energy can be reduced by introducing an electron withdrawing (EW) group at the 4 position of the pyridine ring. Such substitution of L(1)H with a carboxylic ester (COOMe) EW group leads to a europium complex with increased PL quantum yield of 31%. A comparatively efficient PL of the complexes dissolved in ethanol indicates that the lanthanide ions are shielded against nonradiative deactivation via solvent molecules.

  4. Micelle enhanced and terbium sensitized spectrofluorimetric determination of danofloxacin in milk using molecularly imprinted solid phase extraction (United States)

    Kaur, Kuldeep; Saini, Shivender Singh; Malik, Ashok Kumar; Singh, Baldev


    An efficient molecularly imprinted solid phase extraction (MISPE)-spectrofluorimetric method was developed to sensitively determine danofloxacin (DAN) in milk samples. Solid phase extraction procedure using MISPE cartridges was first performed on milk samples and then spectrofluorimetric determination was done at 546 nm using an excitation wavelength of 285 nm in presence of terbium and sodium dodecyl benzene sulfonate (SDBS). It was found that SDBS significantly enhanced the fluorescence intensity of the DAN-Tb3+ complex. Various factors affecting the fluorescence intensity of DAN-Tb3+-SDBS system were studied and conditions were optimized. The enhanced fluorescence intensity of the system (ΔF) showed a good linear relationship with the concentration of DAN over the range of 8.4 × 10-9-3.4 × 10-7 mol L-1 with a correlation coefficient of 0.9996. The detection limit was determined as 2.0 × 10-9 mol L-1 and the limit of quantification was determined as 6.5 × 10-9 mol L-1. The MISPE-spectrofluorimetric procedure was successfully applied to the determination of DAN in milk samples. The method is simple, rapid, sensitive and allows interference free determination of DAN in complex fluorescent matrices like milk. The method can be used to determine whether the DAN residues in milk exceed MRLs or not.

  5. Study of quantum dot based on tin/yttrium mixed oxide doped with terbium to be used as biomarker

    Energy Technology Data Exchange (ETDEWEB)

    Paganini, Paula P.; Felinto, Maria Claudia F.C.; Kodaira, Claudia A., E-mail: paulapaganini@usp.b, E-mail: mfelinto@ipen.b, E-mail: [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil); Brito, Hermi F., E-mail: hefbrito@iq.usp.b [Universidade de Sao Paulo (USP), SP (Brazil). Inst. de Quimica. Lab. de Elementos do Bloco f; Nunes, Luiz Antonio O., E-mail: luizant@ifsc.usp.b [Universidade de Sao Paulo (USP), Sao Carlos, SP (Brazil). Inst. de Fisica. Dept. de Fisica e Informatica


    Quantum dots (semiconductors nanocrystals) have brought a promising field to develop a new generation of luminescent biomarkers. The use of lanthanides ions as luminescent markers has many advantages, for example a security method, low cost, high specificity and also the luminescence can be promptly measured with high sensibility and accuracy. These luminescent dots are functionalized with biomolecules. For the luminophore particle to be connect with biologicals molecules (for example covalent antibody) is necessary a previous chemical treatment to modify luminophore particle surface and this process is called functionalization. A prior chemical treatment with changes on the surface luminophore particle is necessary to couple the luminophore to biological molecules. This process can be used as coating which can protect these particles from being dissolved by acid as well as provide functional groups for biological conjugation. This work presents a photoluminescence study of nanoparticles based on tin/yttrium mixed oxides doped with terbium (SnO{sub 2}/Y{sub 2}O{sub 3}:Tb{sup 3+}), synthesized by coprecipitation method. The nanoparticles were submitted to thermal treatment and characterized by X-Ray Powder Diffraction (XRD) that showed cassiterite phase formation and the influence of thermal treatment on nanoparticles structures. These nanoparticles going to be functionalized with a natural polysaccharide (chitosan) in order to form microspheres. These microspheres going to be irradiated with gamma radiation to sterilization and it can be evaluated if the nanoparticles are resistant to irradiation and they do not lose functionality with this process. (author)

  6. Endothelin-1 stimulates catalase activity through the PKCδ mediated phosphorylation of Serine 167 (United States)

    Rafikov, Ruslan; Kumar, Sanjiv; Aggarwal, Saurabh; Hou, Yali; Kangath, Archana; Pardo, Daniel; Fineman, Jeffrey R.; Black, Stephen M.


    Our previous studies have shown that endothelin-1 (ET-1) stimulates catalase activity in endothelial cells and lambs with acute increases in pulmonary blood flow (PBF), without altering gene expression. The purpose of this study was to investigate the molecular mechanism by which this occurs. Exposing pulmonary arterial endothelial cells (PAEC) to ET-1 increased catalase activity and decreased cellular hydrogen peroxide (H2O2) levels. These changes correlated with an increase in serine phosphorylated catalase. Using the inhibitory peptide δV1.1, this phosphorylation was shown to be PKCδ dependent. Mass spectrometry identified serine167 as the phosphorylation site. Site-directed mutagenesis was used to generate a phospho-mimic (S167D) catalase. Activity assays using recombinant protein purified from E.coli or transiently transfected COS-7 cells, demonstrated that S167D-catalase had an increased ability to degrade H2O2 compared to the wildtype enzyme. Using a phospho-specific antibody, we were able to verify that pS167 catalase levels are modulated in lambs with acute increases in PBF in the presence and absence of the ET receptor antagonist, tezosentan. S167 is being located on the dimeric interface suggesting it could be involved in regulating the formation of catalase tetramers. To evaluate this possibility we utilized analytical gel-filtration to examine the multimeric structure of recombinant wildtype- and S167D-catalase. We found that recombinant wildtype catalase was present as a mixture of monomers and dimers while S167D catalase was primarily tetrameric. Further, the incubation of wildtype catalase with PKCδ was sufficient to convert wildtype catalase into a tetrameric structure. In conclusion, this is the first report indicating that the phosphorylation of catalase regulates its multimeric structure and activity. PMID:24211614

  7. Terbium-doped gadolinium oxysulfide (Gd2O2S:Tb) scintillation-based polymer optical fibre sensor for real time monitoring of radiation dose in oncology (United States)

    Lewis, E.; O'Keeffe, S.; Grattan, M.; Hounsell, A.; McCarthy, D.; Woulfe, P.; Cronin, J.; Mihai, L.; Sporea, D.; Santhanam, A.; Agazaryan, N.


    A PMMA based plastic optical fibre sensor for use in real time radiotherapy dosimetry is presented. The optical fibre tip is coated with a scintillation material, terbium-doped gadolinium oxysulfide (Gd2O2S:Tb), which fluoresces when exposed to ionising radiation (X-Ray). The emitted visible light signal penetrates the sensor optical fibre and propagates along the transmitting fibre at the end of which it is remotely monitored using a fluorescence spectrometer. The results demonstrate good repeatability, with a maximum percentage error of 0.5% and the response is independent of dose rate.

  8. Compact all-fiber optical Faraday components using 65-wt%-terbium-doped fiber with a record Verdet constant of -32 rad/(Tm). (United States)

    Sun, L; Jiang, S; Marciante, J R


    A compact all-fiber Faraday isolator and a Faraday mirror are demonstrated. At the core of each of these components is an all-fiber Faraday rotator made of a 4-cm-long, 65-wt%-terbium-doped silicate fiber. The effective Verdet constant of the terbium-doped fiber is measured to be -32 rad/(Tm), which is 27 x larger than that of silica fiber. This effective Verdet constant is the largest value measured to date in any fiber and is 83% of the Verdet constant of commercially available crystal used in bulk optics-based isolators. Combining the all-fiber Faraday rotator with fiber polarizers results in a fully fusion spliced all-fiber isolator whose isolation is measured to be 19 dB. Combining the all-fiber Faraday rotator with a fiber Bragg grating results in an all-fiber Faraday mirror that rotates the polarization state of the reflected light by 88 +/- 4 degrees .

  9. Picomolar Traces of Americium(III) Introduce Drastic Changes in the Structural Chemistry of Terbium(III): A Break in the "Gadolinium Break". (United States)

    Welch, Jan M; Müller, Danny; Knoll, Christian; Wilkovitsch, Martin; Giester, Gerald; Ofner, Johannes; Lendl, Bernhard; Weinberger, Peter; Steinhauser, Georg


    The crystallization of terbium 5,5'-azobis[1H-tetrazol-1-ide] (ZT) in the presence of trace amounts (ca. 50 Bq, ca. 1.6 pmol) of americium results in 1) the accumulation of the americium tracer in the crystalline solid and 2) a material that adopts a different crystal structure to that formed in the absence of americium. Americium-doped [Tb(Am)(H 2 O) 7 ZT] 2 ZT⋅10 H 2 O is isostructural to light lanthanide (Ce-Gd) 5,5'-azobis[1H-tetrazol-1-ide] compounds, rather than to the heavy lanthanide (Tb-Lu) 5,5'-azobis[1H-tetrazol-1-ide] (e.g., [Tb(H 2 O) 8 ] 2 ZT 3 ⋅6 H 2 O) derivatives. Traces of Am seem to force the Tb compound into a structure normally preferred by the lighter lanthanides, despite a 10 8 -fold Tb excess. The americium-doped material was studied by single-crystal X-ray diffraction, vibrational spectroscopy, radiochemical neutron activation analysis, and scanning electron microcopy. In addition, the inclusion properties of terbium 5,5'-azobis[1H-tetrazol-1-ide] towards americium were quantified, and a model for the crystallization process is proposed. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. 26 CFR 1.167(a)-14 - Treatment of certain intangible property excluded from section 197. (United States)


    ... include certain computer software and certain other separately acquired rights, such as rights to receive tangible property or services, patents and copyrights, certain mortgage servicing rights, and rights of... subject to the allowance for depreciation under section 167(a). (b) Computer software—(1) In general. The...

  11. Intrinsic gK factors of odd-mass 167− 179Lu isotopes

    Indian Academy of Sciences (India)

    In this paper, g K -factors of the intrinsic magnetic moments and effective spin gyromagnetic factors ( g s eff ) of the 167−179Lu isotopes have been studied within the Tamm–Dancoff approximation (TDA) (Kuliev et al, Sov. J. Nucl. Phys. 9, 185 (1969)) by using a realistic potential such as Woods–Saxon potential for the first ...

  12. Synthesis of (--Indolizidine 167B based on domino hydroformylation/cyclization reactions

    Directory of Open Access Journals (Sweden)

    Settambolo Roberta


    Full Text Available Abstract The synthesis of (--Indolizidine 167B has been achieved from optically active (R-3-(pyrrol-1-ylhex-1-ene. The key step is a highly regioselective hydroformylation reaction and a one-pot intramolecular cyclization providing a general approach to the indolizine nucleus.

  13. 26 CFR 1.167(i)-1 - Depreciation of improvements in the case of mines, etc. (United States)


    ... 26 Internal Revenue 2 2010-04-01 2010-04-01 false Depreciation of improvements in the case of... and Corporations § 1.167(i)-1 Depreciation of improvements in the case of mines, etc. Property used in... depreciation provided in section 611 shall be treated for all purposes of the Code as if it were property...

  14. 46 CFR 167.45-45 - Carbon dioxide fire-extinguishing system requirements. (United States)


    ... SCHOOLS PUBLIC NAUTICAL SCHOOL SHIPS Special Firefighting and Fire Prevention Requirements § 167.45-45... school ship propelled by internal combustion engines, the quantity of carbon dioxide required may be... arrangement of the piping shall be such as to give a general and fairly uniform distribution over the entire...

  15. 46 CFR 167.45-75 - Fire extinguishers for emergency powerplants. (United States)


    ... 46 Shipping 7 2010-10-01 2010-10-01 false Fire extinguishers for emergency powerplants. 167.45-75... extinguishers for emergency powerplants. In compartments where emergency lighting and wireless units are located, two fire extinguishers approved by the Coast Guard or the Navy, of either carbon dioxide or dry...

  16. 46 CFR 167.45-65 - Portable fire extinguishers in accommodation spaces. (United States)


    ... 46 Shipping 7 2010-10-01 2010-10-01 false Portable fire extinguishers in accommodation spaces. 167... Portable fire extinguishers in accommodation spaces. (a) All nautical school ships shall be provided with such number of good and efficient portable fire extinguishers approved by the Navy or Coast Guard as...

  17. 46 CFR 167.45-70 - Portable fire extinguishers, general requirements. (United States)


    ... 46 Shipping 7 2010-10-01 2010-10-01 false Portable fire extinguishers, general requirements. 167... Portable fire extinguishers, general requirements. (a) Extra charges shall be carried on board for 50 percent of each size and variety of fire extinguishers provided. If 50 percent of each size and variety of...

  18. 21 CFR 172.167 - Silver nitrate and hydrogen peroxide solution. (United States)


    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Silver nitrate and hydrogen peroxide solution. 172... FOOD FOR HUMAN CONSUMPTION Food Preservatives § 172.167 Silver nitrate and hydrogen peroxide solution. An aqueous solution containing a mixture of silver nitrate and hydrogen peroxide may be safely used...

  19. Crystal structures of two mononuclear complexes of terbium(III) nitrate with the tripodal alcohol 1,1,1-tris-(hy-droxy-meth-yl)propane. (United States)

    Gregório, Thaiane; Giese, Siddhartha O K; Nunes, Giovana G; Soares, Jaísa F; Hughes, David L


    Two new mononuclear cationic complexes in which the TbIII ion is bis-chelated by the tripodal alcohol 1,1,1-tris-(hy-droxy-meth-yl)propane (H3LEt, C6H14O3) were prepared from Tb(NO3)3·5H2O and had their crystal and mol-ecular structures solved by single-crystal X-ray diffraction analysis after data collection at 100 K. Both products were isolated in reasonable yields from the same reaction mixture by using different crystallization conditions. The higher-symmetry complex dinitratobis[1,1,1-tris-(hy-droxy-meth-yl)propane]-terbium(III) nitrate di-meth-oxy-ethane hemisolvate, [Tb(NO3)2(H3LEt)2]NO3·0.5C4H10O2, 1, in which the lanthanide ion is 10-coordinate and adopts an s-bicapped square-anti-prismatic coordination geometry, contains two bidentate nitrate ions bound to the metal atom; another nitrate ion functions as a counter-ion and a half-mol-ecule of di-meth-oxy-ethane (completed by a crystallographic twofold rotation axis) is also present. In product aqua-nitratobis[1,1,1-tris-(hy-droxy-meth-yl)propane]-terbium(III) dinitrate, [Tb(NO3)(H3LEt)2(H2O)](NO3)2, 2, one bidentate nitrate ion and one water mol-ecule are bound to the nine-coordinate terbium(III) centre, while two free nitrate ions contribute to charge balance outside the tricapped trigonal-prismatic coordination polyhedron. No free water mol-ecule was found in either of the crystal structures and, only in the case of 1, di-meth-oxy-ethane acts as a crystallizing solvent. In both mol-ecular structures, the two tripodal ligands are bent to one side of the coordination sphere, leaving room for the anionic and water ligands. In complex 2, the methyl group of one of the H3LEt ligands is disordered over two alternative orientations. Strong hydrogen bonds, both intra- and inter-molecular, are found in the crystal structures due to the number of different donor and acceptor groups present.

  20. The response behavior of PPy-DB18C6 electrode to terbium(III in acetonitrile and its thermodynamic application

    Directory of Open Access Journals (Sweden)

    Mohammad Hossein Arbab Zavar


    Full Text Available Polypyrrole modified electrode prepared by electropolymerization of pyrrole in the presence of a complexing ligand, dibenzo-18-crown-6(DB18C6, was prepared and investigated as a Tb3+-selective electrode in acetonitrile. The potentiometric response of the electrode was linear within the Tb3+ concentration range 1 × 10−5–1 × 10−2 M with a Nernstian slope of 20.9 mVdecade−1 in AN. The electrode was applied to study the complexation of the terbium(III ion in acetonitrile with such other basic aprotic solvent molecules (D as dimethyl sulfoxide, N,N-dimethyl formamide, propylene carbonate and pyridine. The successive complex formation constant (βi and Gibbs energies of transfer (ΔGtr of Tb3+ in AN in relation to such D were obtained.

  1. Luminescence and Magnetic Properties of Two Three-Dimensional Terbium and Dysprosium MOFs Based on Azobenzene-4,4′-Dicarboxylic Linker

    Directory of Open Access Journals (Sweden)

    Belén Fernández


    Full Text Available We report the in situ formation of two novel metal-organic frameworks based on terbium and dysprosium ions using azobenzene-4,4′-dicarboxylic acid (H2abd as ligand, synthesized by soft hydrothermal routes. Both materials show isostructural three-dimensional networks with channels along a axis and display intense photoluminescence properties in the solid state at room temperature. Textural properties of the metal-organic frameworks (MOFs have been fully characterized although no appreciable porosity was obtained. Magnetic properties of these materials were studied, highlighting the dysprosium material displays slightly frequency-dependent out of phase signals when measured under zero external field and under an applied field of 1000 Oe.

  2. Measurement of conversion coefficients in normal and triaxial strongly deformed bands in {sup 167}Lu.

    Energy Technology Data Exchange (ETDEWEB)

    Gurdal, G.; Beausang, C. W.; Brenner, D. S.; Ai, H.; Casten, R. F.; Crider, B.; Heinz, A.; Williams, E.; Hartley, D. J.; Carpenter, M. P.; Hecht, A. A.; Janssens, R. V. F.; Lauritsen, T.; Lister, C. J.; Raabe, R.; Seweryniak, D.; Zhu, S.; Saladin, J. X.; Physics; Yale Univ.; Clark Univ.; Univ. of Richmond; United States Naval Academy; Univ. of Maryland; Univ. of Pittsburgh


    Internal conversion coefficients have been measured for transitions in both normal deformed and triaxial strongly deformed bands in {sup 167}Lu using the Gammasphere and ICE Ball spectrometers. The results for all in-band transitions are consistent with E2 multipolarity. Upper limits are determined for the internal conversion coefficients for linking transitions between TSD Band 2 and TSD Band 1, the n{sub w} = 1 and n{sub w} = 0 wobbling bands, respectively.

  3. Luminescent europium and terbium complexes of dipyridoquinoxaline and dipyridophenazine ligands as photosensitizing antennae: structures and biological perspectives. (United States)

    Dasari, Srikanth; Patra, Ashis K


    The europium(III) and terbium(III) complexes, namely [Eu(dpq)(DMF)2(NO3)3] (1), [Eu(dppz)2(NO3)3] (2), [Tb(dpq)(DMF)2Cl3] (3), and [Tb(dppz)(DMF)2Cl3] (4), where dipyrido[3,2-d:2',3'-f]quinoxaline (dpq in 1 and 3), dipyrido[3,2-a:2',3'-c]phenazine (dppz in 2 and 4) and N,N'-dimethylformamide (DMF) have been isolated, characterized from their physicochemical data, luminescence studies and their interaction with DNA, serum albumin protein and photo-induced DNA cleavage activity are studied. The X-ray crystal structures of complexes 1-4 show discrete mononuclear Ln(3+)-based structures. The Eu(3+) in [Eu(dpq)(DMF)2(NO3)3] (1) and [Eu(dppz)2(NO3)3] (2) as [Eu(dppz)2(NO3)3]·dppz (2a) adopts a ten-coordinated bicapped dodecahedron structure with a bidentate N,N-donor dpq ligand, two DMF and three NO3(-) anions in 1 and two bidentate N,N-donor dppz ligands and three NO3(-) anions in 2. Complexes 3 and 4 show a seven-coordinated mono-capped octahedron structure where Tb(3+) contains bidentate dpq/dppz ligands, two DMF and three Cl(-) anions. The complexes are highly luminescent in nature indicating efficient photo-excited energy transfer from the dpq/dppz antenna to Ln(3+) to generate long-lived emissive excited states for characteristic f → f transitions. The time-resolved luminescence spectra of complexes 1-4 show typical narrow emission bands attributed to the (5)D0 → (7)F(J) and (5)D4 → (7)F(J) f-f transitions of Eu(3+) and Tb(3+) ions respectively. The number of inner-sphere water molecules (q) was determined from luminescence lifetime measurements in H2O and D2O confirming ligand-exchange reactions with water in solution. The complexes display significant binding propensity to the CT-DNA giving binding constant values in the range of 1.0 × 10(4)-6.1 × 10(4) M(-1) in the order 2, 4 (dppz) > 1, 3 (dpq). DNA binding data suggest DNA groove binding with the partial intercalation nature of the complexes. All the complexes also show binding propensity (K(BSA)

  4. SjE16.7 activates macrophages and promotes Schistosoma japonicum egg-induced granuloma development. (United States)

    Fang, Yan; Wu, Chenyun; Chen, Qing; Wu, Jianhua; Yang, Yang; Guo, Xiaokui; Chen, Guangjie; Wang, Zhaojun


    SjE16.7 is an egg-specific protein from Schistosoma japonicum that recruits neutrophils and initiates an inflammatory granuloma response in host tissue. However, since macrophages are known to be important regulators of egg granuloma formation we investigated the effect of SjE16.7 on this cell type. Here we report that SjE16.7 is a potent macrophage activator, inducing macrophage chemotaxis and stimulating cytokine production. Treatment of murine primary macrophages with SjE16.7 resulted in upregulation of both pro- and anti-inflammatory cytokines (IL-10, IL-12, IL-6 and TNF-α), as well as phosphorylation of mitogen-activated protein kinases (MAPKs). Moreover, SjE16.7 treatment increased MHC Class II expression on the surface of macrophages. Importantly, in vivo blockade of SjE16.7 significantly reduced egg-induced pathology, as a result of decreased leucocyte infiltration and reduced granuloma size. Our results suggest that SjE16.7 is an important pathogenic factor and a potential treatment target for this disease. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Relation between outcomes and expression of estrogen receptor-α phosphorylated at Ser(167) in endometrioid endometrial cancer. (United States)

    Kato, Eiichi; Orisaka, Makoto; Kurokawa, Tetsuji; Chino, Yoko; Fujita, Yuko; Shinagawa, Akiko; Yoshida, Yoshio


    Both ligand-dependent and ligand-independent activation of estrogen receptor (ER)α is modulated by receptor phosphorylation and results in activation of the ERα-dependent pathways that are involved in endometrioid endometrial cancer (EEC) pathogenesis. It is also known that the mammalian target of rapamycin (mTOR)/p70 S6 kinase 1 (S6K1) and MAPK/p90 ribosomal S6 kinase (RSK) signaling pathways coordinately regulate phosphorylated-ERα at Ser(167) (p-Ser(167) -ERα). However, the expression of p-Ser(167) -ERα in EEC and its prognostic role in ECC is largely unexplored. The purpose of the present study was to investigate the expression of p-Ser(167) -ERα in ECC and its relationship with prognosis. Immunohistochemical staining of primary EEC surgical specimens (n = 103) was carried out using antibodies specific for p-Ser(167) -ERα and for p-mTOR/p-S6K1 and p-MAPK/p-RSK. The correlation of p-Ser(167) -ERα expression with clinicopathological features and survival of ECC was studied. Patients that were positive for nuclear p-Ser(167) -ERα had significantly shorter relapse-free survival, and although the result was not significant, levels of nuclear p-Ser(167) -ERα tended to be higher in advanced-stage ECC patients. Nuclear p-Ser(167) -ERα was significantly positively correlated with p-MAPK and p-S6K1, and with significantly shorter relapse-free survival in EEC. © 2014 The Authors. Cancer Science published by Wiley Publishing Asia Pty Ltd on behalf of Japanese Cancer Association.

  6. Spin Waves in Terbium

    DEFF Research Database (Denmark)

    Jensen, J.; Houmann, Jens Christian Gylden


    The selection rules for the linear couplings between magnons and phonons propagating in the c direction of a simple basal-plane hcp ferromagnet are determined by general symmetry considerations. The acoustic-optical magnon-phonon interactions observed in the heavy-rare-earth metals have been expl...... by Liu. The coupled magnon—transverse-phonon system for the c direction of Tb is analyzed in detail, and the strengths of the couplings are deduced as a function of wave vector by combining the experimental studies with the theory....

  7. Spin Waves in Terbium

    DEFF Research Database (Denmark)

    Jensen, J.; Houmann, Jens Christian Gylden; Bjerrum Møller, Hans


    The energies of spin waves propagating in the c direction of Tb have been studied by inelastic neutron scattering, as a function of a magnetic field applied along the easy and hard directions in the basal plane, and as a function of temperature. From a general spin Hamiltonian, consistent...... with the symmetry, we deduce the dispersion relation for the spin waves in a basal-plane ferromagnet. This phenomenological spin-wave theory accounts for the observed behavior of the magnon energies in Tb. The two q⃗-dependent Bogoliubov components of the magnon energies are derived from the experimental results...

  8. 167 W, power scalable ytterbium-doped photonic bandgap fiber amplifier at 1178nm

    DEFF Research Database (Denmark)

    Olausson, Christina Bjarnal Thulin; Shirakawa, A.; Chen, M.


    An ytterbium-doped photonic bandgap fiber amplifier operating at the long wavelength edge of the ytterbium gain band is investigated for high power amplification. The spectral filtering effect of the photonic bandgap efficiently suppresses amplified spontaneous emission at the conventional...... ytterbium gain wavelengths and thus enables high power amplification at 1178 nm. A record output power of 167 W, a slope efficiency of 61% and 15 dB saturated gain at 1178 nm have been demonstrated using the ytterbium-doped photonic bandgap fiber....

  9. 42 CFR 137.167 - What cost principles must a Self-Governance Tribe follow when participating in self-governance... (United States)


    ... 42 Public Health 1 2010-10-01 2010-10-01 false What cost principles must a Self-Governance Tribe follow when participating in self-governance under Title V? 137.167 Section 137.167 Public Health PUBLIC... HUMAN SERVICES TRIBAL SELF-GOVERNANCE Operational Provisions Audits and Cost Principles § 137.167 What...

  10. 26 CFR 1.167(a)-11 - Depreciation based on class lives and asset depreciation ranges for property placed in service... (United States)


    ... 26 Internal Revenue 2 2010-04-01 2010-04-01 false Depreciation based on class lives and asset depreciation ranges for property placed in service after December 31, 1970. 1.167(a)-11 Section 1.167(a)-11...) INCOME TAXES (CONTINUED) Itemized Deductions for Individuals and Corporations § 1.167(a)-11 Depreciation...

  11. Synthesis and crystal structure of terbium(III) meta-oxoborate Tb(BO{sub 2}){sub 3} ({identical_to} TbB{sub 3}O{sub 6}); Synthese und Kristallstruktur von Terbium(III)-meta-Oxoborat Tb(BO{sub 2}){sub 3} ({identical_to} TbB{sub 3}O{sub 6})

    Energy Technology Data Exchange (ETDEWEB)

    Nikelski, Tanja; Schleid, Thomas [Institut fuer Anorganische Chemie der Universitaet Stuttgart (Germany)


    The terbium meta-oxoborate Tb(BO{sub 2}){sub 3} ({identical_to} TbB{sub 3}O{sub 6}) is obtained as single crystals by the reaction of terbium, Tb{sub 4}O{sub 7} and TbCl{sub 3} with an excess of B{sub 2}O{sub 3} in gastight sealed platinum ampoules at 950 C after three weeks. The compound appears to be air- and water-resistant and crystallizes as long, thin, colourless needles which tend to growth-twinning due to their marked fibrous habit. The crystal structure of Tb(BO{sub 2}){sub 3} (orthorhombic, Pnma; a = 1598.97(9), b = 741.39(4), c = 1229.58(7) pm; Z = 16) contains strongly corrugated oxoborate layers {sub {infinity}}{sup 2}{l_brace}(BO{sub 2}){sup -}{r_brace} built of vertex-linked [BO{sub 4}]{sup 5-} tetrahedra (d(B-O) = 143 - 154 pm, and angsph;(O-B-O) = 102-115 ) which spread out parallel (100). The four crystallographically different Tb{sup 3+} cations all exhibit coordination numbers of eight towards the oxygen atoms (d(Tb-O) = 228-287 pm). The corresponding metal cation polyhedra [TbO{sub 8}]{sup 13+} too convene to layers (composition: {sub {infinity}}{sup 2}{l_brace}(Tb{sub 2}O{sub 11}){sup 16-}{r_brace}) which are likewise oriented parallel to the (100) plane. (Abstract Copyright [2003], Wiley Periodicals, Inc.) [German] Das Terbium-meta-Oxoborat Tb(BO{sub 2}){sub 3} ({identical_to} TbB{sub 3}O{sub 6}) entsteht einkristallin bei der Reaktion von Terbium, Tb{sub 4}O{sub 7} und TbCl{sub 3} mit einem Ueberschuss von B{sub 2}O{sub 3} in gasdicht verschlossenen Platinampullen nach drei Wochen bei 950 C. Die Verbindung ist luft- und wasserstabil und faellt in langen, duennen, farblosen Nadeln an, die aufgrund ihres ausgepraegt faserigen Habitus zur Wachstumsverzwillingung neigen. Die Kristallstruktur von Tb(BO{sub 2}){sub 3} (orthorhombisch, Pnma; a = 1598, 97(9), b = 741, 39(4), c = 1229, 58(7) pm; Z = 16) enthaelt parallel (100) verlaufende, stark gewellte Oxoborat-Schichten {sub {infinity}}{sup 2}{l_brace}(BO{sub 2}){sup -}{r_brace} aus

  12. An integrated logic system for time-resolved fluorescent "turn-on" detection of cysteine and histidine base on terbium (III) coordination polymer-copper (II) ensemble. (United States)

    Xue, Shi-Fan; Lu, Ling-Fei; Wang, Qi-Xian; Zhang, Shengqiang; Zhang, Min; Shi, Guoyue


    Cysteine (Cys) and histidine (His) both play indispensable roles in many important biological activities. An enhanced Cys level can result in Alzheimer's and cardiovascular diseases. Likewise, His plays a significant role in the growth and repair of tissues as well as in controlling the transmission of metal elements in biological bases. Therefore, it is meaningful to detect Cys and His simultaneously. In this work, a novel terbium (III) coordination polymer-Cu (II) ensemble (Tb(3+)/GMP-Cu(2+)) was proposed. Guanosine monophosphate (GMP) can self-assemble with Tb(3+) to form a supramolecular Tb(3+) coordination polymer (Tb(3+)/GMP), which can be suited as a time-resolved probe. The fluorescence of Tb(3+)/GMP would be quenched upon the addition of Cu(2+), and then the fluorescence of the as-prepared Tb(3+)/GMP-Cu(2+) ensemble would be restored again in the presence of Cys or His. By incorporating N-Ethylmaleimide and Ni(2+) as masking agents, Tb(3+)/GMP-Cu(2+) was further exploited as an integrated logic system and a specific time-resolved fluorescent "turn-on" assay for simultaneously sensing His and Cys was designed. Meanwhile it can also be used in plasma samples, showing great potential to meet the need of practical application. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Synthesis and photoluminescence properties of cerium-doped terbium-yttrium aluminum garnet phosphor for white light-emitting diodes applications (United States)

    Wang, Jun; Han, Tao; Lang, Tianchun; Tu, Mingjing; Peng, Lingling


    Cerium-doped terbium-yttrium aluminum garnet phosphors were synthesized using the solid-state reaction method. The crystalline phase, morphology, and photoluminescence properties were characterized by x-ray diffraction (XRD), scanning electron microscope (SEM), and fluorescence spectrophotometer, respectively. The XRD results indicate that with an increase of the amount of x (Tb3+), all of the samples have a pure garnet crystal structure without secondary phases. The SEM images reveal that the samples are composed of sphere-like crystallites, which exhibit different degrees of agglomeration. The luminescent properties of Ce ions in )Al5O12∶Ce0.1 have been studied, and it was found that the emission band shifted toward a longer wavelength. The redshift is attributed to the lowering of the 5d energy level centroid of Ce, which can be explained by the nephelauxetic effect and compression effect. These phosphors were coated on blue light-emitting diode (LED) chips to fabricate white light-emitting diodes (WLEDs), and their color-rendering indices, color temperatures, and luminous efficiencies were measured. As a consequence of the addition of Tb, the blue LED pumped )Al5O12∶Ce0.1 phosphors WLEDs showed good optical properties.

  14. Study on the fluorescent enhancement effect in terbium-gadolinium-protein-sodium dodecyl benzene sulfonate system and its application on sensitive detection of protein at nanogram level. (United States)

    Sun, Changxia; Yang, Jinghe; Wu, Xia; Liu, Shufang; Su, Benyu


    The co-luminescence effect in a terbium-gadolinium-protein-sodium dodecyl benzene sulfonate (SDBS) system is reported here. Based on it, the sensitive quantitative analysis of protein at nanogram levels is established. The co-luminescence mechanism is studied using fluorescence, resonance light scattering (RLS), absorption spectroscopy and NMR measurement. It is considered that protein could be unfolded by SDBS, then a efficacious intramolecular fluorescent energy transfer occurs from unfolded protein to rare earth ions through SDBS acting as a "transfer bridge" to enhance the emission fluorescence of Tb3+ in this ternary complex of Tb-SDBS-BSA, where energy transfer from protein to SDBS by aromatic ring stacking is the most important step. Cooperating with the intramolecular energy transfer above is the intermolecular energy transfer between the simultaneous existing complexes of both Tb3+ and Gd3+. The fluorescence quantum yield is increased by an energy-insulating sheath, which is considered to be another reason for the resulting enhancement of the fluorescence. Förster theory is used to calculate the distribution of enhancing factors and has led to a greater understanding of the mechanisms of energy transfer.

  15. [Studies on luminescence properties of seven ternary complexes of terbium with 1,10-phenanthroline and benzoic acid and its derivatives]. (United States)

    Gao, Zhi-hua; Wang, Shu-ping; Liu, Cui-ge; Ma, Rui-xia; Wang, Rui-fen


    Seven ternary complexes of Tb(III) were synthesized with benzoic acid (BA), o-, m-, p-methylbenzoic acid (o-MBA, m-MBA, p-MBA), and o-, m-, p-methoxybenzoic acid (o-MOBA, m-MOBA, p-MOBA) as the first ligand, and 1,10-phenanthroline (phen) as the second ligand. The content of C, H and N were measured by using a Flash-EA model 1112 elemental analyzer. Excitation and luminescence spectra of the title solid complexes were recorded by using a Hitachi F-4500 fluorescence spectrophotometer at room temperature. The effects of different varieties and different positions of replacing benzoic acid as the first ligand on fluorescence properties of the ternary complexes of terbium were discussed. The results indicated that the intensity of 5D4-->7F6 (489 nm) and 5D4-->7F5 (545 nm) of substituting benzoic acid complexes was stronger than benzoic acid. Three ternary complexes of Tb(III) with o-, m-, p-methylbenzoic acid showed emission intensity in the consecution: Tb(o-MBA)3 phenMOBA)3phen x H2O>Tb(m-MOBA)3phen x H2O>Tb(p-MOBA)3 phen.

  16. Identification and characterization of Rvs162/Rvs167-3, a novel N-BAR heterodimer in the human fungal pathogen Candida albicans. (United States)

    Gkourtsa, Areti; van den Burg, Janny; Strijbis, Karin; Avula, Teja; Bijvoets, Sietske; Timm, Dave; Hochstenbach, Frans; Distel, Ben


    Membrane reshaping resides at the core of many important cellular processes, and among its mediators are the BAR (Bin, Amphiphysin, Rvs) domain-containing proteins. We have explored the diversity and function of the Rvs BAR proteins in Candida albicans and identified a novel family member, Rvs167-3 (orf19.1861). We show that Rvs167-3 specifically interacts with Rvs162 to form a stable BAR heterodimer able to bind liposomes in vitro. A second, distinct heterodimer is formed by the canonical BAR proteins Rvs161 and Rvs167. Purified Rvs161/Rvs167 complex also binds liposomes, indicating that C. albicans expresses two functional BAR heterodimers. We used live-cell imaging to localize green fluorescent protein (GFP)-tagged Rvs167-3 and Rvs167 and show that both proteins concentrate in small cortical spots. However, while Rvs167 strictly colocalizes with the endocytic marker protein Abp1, we do not observe any colocalization of Rvs167-3 with sites of endocytosis marked by Abp1. Furthermore, the rvs167-3Δ/Δ mutant is not defective in endocytosis and strains lacking Rvs167-3 or its partner Rvs162 do not display increased sensitivity to high salt concentrations or decreased cell wall integrity, phenotypes which have been observed for rvs167Δ/Δ and rvs161Δ/Δ strains and which are linked to endocytosis defects. Taken together, our results indicate different roles for the two BAR heterodimers in C. albicans: the canonical Rvs161/Rvs167 heterodimer functions in endocytosis, whereas the novel Rvs162/Rvs167-3 heterodimer seems not to be involved in this process. Nevertheless, despite their different roles, our phenotypic analysis revealed a genetic interaction between the two BAR heterodimers, suggesting that they may have related but distinct membrane-associated functions. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  17. 46 CFR 167.15-15 - Application for inspection of a new nautical school ship or a conversion of a vessel to a... (United States)


    ... 46 Shipping 7 2010-10-01 2010-10-01 false Application for inspection of a new nautical school ship or a conversion of a vessel to a nautical school ship. 167.15-15 Section 167.15-15 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) NAUTICAL SCHOOLS PUBLIC NAUTICAL SCHOOL SHIPS Inspections § 167.15-15 Application for inspection of...

  18. 78 FR 44600 - 167th Meeting of the Advisory Council on Employee Welfare and Pension Benefit Plans; Notice of... (United States)


    ... Benefits Security Administration 167th Meeting of the Advisory Council on Employee Welfare and Pension... Council on Employee Welfare and Pension Benefit Plans (also known as the ERISA Advisory Council) will be... Segments, (2), Locating Missing and Lost Participants, and (3) Private Sector Pension De-risking and...

  19. 20 CFR 669.560 - Are there regulatory and/or statutory waiver provisions that apply to WIA section 167? (United States)


    ... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Are there regulatory and/or statutory waiver provisions that apply to WIA section 167? 669.560 Section 669.560 Employees' Benefits EMPLOYMENT AND TRAINING..., allocation of funds, procedures for review and approval of plans; and (3) Not related to the key reform...

  20. Self-diffusion coefficients of the trivalent f-element ion series in dilute and moderately dilute aqueous solutions: A comparative study between europium, gadolinium, terbium and berkelium (United States)

    Rafik, Besbes; Noureddine, Ouerfelli; Abderabbou, Abdelmanef; Habib, Latrous


    We have continued the studies on the trivalent ions of the 4f and 5f elements. In this paper, we compare the transport properties (self-diffusion coefficient) of the trivalent aquo ions over two ranges of concentrations (0 — 2×10-3M) and (2×10-3 — 1.5M). Self-diffusion coefficients, D, of the trivalent f-element aquo ion series have been determined in aqueous background electrolytes of Gd(NO3)3 and Nd(ClO4)3, at pH=2.5 (HNO3, HClO4) and at 25°C using the open-end capillary method (O.E.C.M.). This method measures the transportation time of ions across a fixed distance. In this paper, we complete a measurement of self-diffusion coefficient for terbium. We optimized the pH to avoid hydrolysis, ion-pairing and complexation of the trivalent 4f and 5f ions. The variation of D versus √C is not linear for dilute solutions (0 — 2×10-3M) and quasi-linear in moderate concentrations (C<=1.5 M). Similar behavior was observed for Tb, as compared with those for Bk, Eu and Gd. We complete the comparison variation of D/D° versus √C for all studied 4f and 5f elements from concentration 0 to 1.5M and we obtained the same variation with √C for all studied elements. All 4f and 5f elements studied follow the Nernst-Hartley expression.

  1. Terbium-based time-gated Förster resonance energy transfer imaging for evaluating protein-protein interactions on cell membranes. (United States)

    Lindén, Stina; Singh, Manish Kumar; Wegner, K David; Regairaz, Marie; Dautry, François; Treussart, François; Hildebrandt, Niko


    Fluorescence imaging of cells and subcellular compartments is an essential tool to investigate biological processes and to evaluate the development and progression of diseases. In particular, protein-protein interactions can be monitored by Förster resonance energy transfer (FRET) between two proximal fluorophores that are attached to specific recognition biomolecules such as antibodies. We investigated the membrane expression of E- and N-cadherins in three different cell lines used as model systems to study epithelial to mesenchymal transition (EMT) and a possible detection of circulating tumour cells (CTCs). EMT is a key process in cancer metastasis, during which epithelial markers (such as E-cadherin) are down-regulated in the primary tumour whereas mesenchymal markers (such as N-cadherin) are up-regulated, leading to enhanced cell motility, intravasation, and appearance of CTCs. Various FRET donor-acceptor pairs and protein recognition strategies were utilized, in which Lumi4-Tb terbium complexes (Tb) and different organic dyes were conjugated to several distinct E- and N-cadherin-specific antibodies. Pulsed excitation of Tb at low repetition rates (100 Hz) and time-gated (TG) imaging of both the Tb-donor and the dye-acceptor photoluminescence (PL) allowed efficient detection of the EMT markers as well as FRET in the case of sufficient donor-acceptor proximity. Efficient FRET was observed only between two E-cadherin-specific antibodies and further experiments indicated that these antibodies recognized the same E-cadherin molecule, suggesting a limited accessibility of cadherins when they are clustered at adherens junctions. The investigated Tb-to-dye FRET systems provided reduced photobleaching compared to the AlexaFluor 488-568 donor-acceptor pair. Our results demonstrate the applicability and advantages of Tb-based TG FRET for efficient and stable imaging of antibody-antibody interactions on different cell lines. They also reveal the limitations of

  2. A broad G protein-coupled receptor internalization assay that combines SNAP-tag labeling, diffusion-enhanced resonance energy transfer, and a highly emissive terbium cryptate acceptor

    Directory of Open Access Journals (Sweden)

    Angélique eLEVOYE


    Full Text Available Although G protein-coupled receptor (GPCR internalization has long been considered a major aspect of the desensitization process that tunes ligand responsiveness, internalization is also involved in receptor resensitization and signaling, as well as the ligand scavenging function of some atypical receptors. Internalization thus contributes to the diversity of GPCR-dependent signaling, and its dynamics and quantification in living cells has generated considerable interest. We developed a robust and sensitive assay to follow and quantify ligand-induced and constitutive GPCR internalization but also receptor recycling in living cells. This assay is based on diffusion-enhanced resonance energy transfer (DERET between cell surface GPCRs labeled with a luminescent terbium cryptate donor and a fluorescein acceptor present in the culture medium. GPCR internalization results in a quantifiable reduction of energy transfer. This method yields a high signal-to-noise ratio due to time-resolved measurements. For various GPCRs belonging to different classes, we demonstrated that constitutive and ligand-induced internalization could be monitored as a function of time and ligand concentration, thus allowing accurate quantitative determination of kinetics of receptor internalization but also half-maximal effective or inhibitory concentrations of compounds. In addition to its selectivity and sensitivity, we provided evidence that DERET-based internalization assay is particularly suitable for characterizing biased ligands. Furthermore, the determination of a Z’-factor value of 0.45 indicates the quality and suitability of DERET-based internalization assay for high-throughput screening (HTS of compounds that may modulate GPCRs internalization.

  3. Crystal structure of an eight-coordinate terbium(III ion chelated by N,N′-bis(2-hydroxybenzyl-N,N′-bis(pyridin-2-ylmethylethylenediamine (bbpen2− and nitrate

    Directory of Open Access Journals (Sweden)

    Thaiane Gregório


    Full Text Available The reaction of terbium(III nitrate pentahydrate in acetonitrile with N,N′-bis(2-hydroxybenzyl-N,N′-bis(pyridin-2-ylmethylethylenediamine (H2bbpen, previously deprotonated with triethylamine, produced the mononuclear compound [N,N′-bis(2-oxidobenzyl-κO-N,N′-bis(pyridin-2-ylmethyl-κNethylenediamine-κ2N,N′](nitrato-κ2O,O′terbium(III, [Tb(C28H28N4O2(NO3]. The molecule lies on a twofold rotation axis and the TbIII ion is eight-coordinate with a slightly distorted dodecahedral coordination geometry. In the symmetry-unique part of the molecule, the pyridine and benzene rings are both essentially planar and form a dihedral angle of 61.42 (7°. In the molecular structure, the N4O4 coordination environment is defined by the hexadentate bbpen ligand and the bidentate nitrate anion. In the crystal, a weak C—H...O hydrogen bond links molecules into a two-dimensional network parallel to (001.

  4. Adenomas da hipófise: estudo imuno-histoquímico de 167 casos

    Directory of Open Access Journals (Sweden)

    Lígia M. Barbosa-Coutinho


    Full Text Available Foram analisados 167 casos de adenomas da hipófise pelo método imuno-histo-químico utilizando o Complexo da Avidina Biotina (ABC descrito por Hsu e col. (1981. Foram usados 6 anti-hormônios hipofisários: anti-prolactina (aPRL, na diluição de 1:1.500, anti-hormônio do crescimento (aHGH, na diluição de 1:4.000, anti-hormônio adrenocortico-trófico (aACTH, na diluição de 1:3.000, anti-hormônio tireotrófico (aTSH, na diluição de 1:3.000, anti-hormônio luteinizante (aLH, na diluição de 1:1.000, anti-hormônio folículo estimulante (aFSH, na diluição de 1:300. O período de incubação foi de 14 a 16 horas a 4ºC. Foi realizada também a coloração pelo Orange G-PAS. O levantamento dos dados clínicos, laboratoriais, e radiológicos dos casos de adenomas da hipófise foi realizado após a leitura das lâminas pelo método imuno-histoquímico. Dos 167 casos de adenomas da hipófise, 136 (81,4% mostraram imuno-reação positiva a um ou mais anti-hormônios, variando o índice de positividade entre 1 e 90% das células neoplásicas. A imuno-reação foi positiva exclusivamente a um anti-hormônio em 80 casos (58,8% e para dois ou mais anti-hormônios nos 56 casos restantes (41,2%, sendo a associação mais freqüentemente encontrada aquela em aue a positividade ocorreu para o aPRL e o aHGH. A positividade à reação imuno-his-toquímica distribuiu-se da seguinte forma: 100 casos foram positivos para o aPRL, em 49 pacientes de forma isolada; 65 casos foram positivos para o aHGH, em 22 pacientes de forma isolada; 31 casos foram positivos para o aACTH, em 8 pacientes de forma isolada; 5 casos foram positivos ao aTSH, em um paciente de forma isolada; um paciente apresentou adenoma positivo ao aLH; um caso foi positivo ao aFSH.

  5. Three-phase 16.7 Hz system for the transmission of offshore wind power. Pt. 1. System and components; Dreiphasiges 16,7-Hz-System fuer die Uebertragung von Offshore-Windenergie. T. 1. System und Komponenten

    Energy Technology Data Exchange (ETDEWEB)

    Braun, Rainer [DB Energie GmbH, Frankfurt am Main (Germany). Anlagen- und Projektmanagement; Erlich, Istvan [Duisburg-Essen Univ., Duisburg (Germany). Fachgebiet Elektrische Anlagen und Netze; Brakelmann, Heinrich [CCB Cable Consulting, Rheinberg (Germany); Meng, Xing [Duisburg-Essen Univ., Duisburg (Germany); Fischer, Wilfried


    The current transmission in a three-phase power cable is limited to a frequency of 50 Hz due to the length of the charging current. If the frequency is reduced, then the cable may be longer. In the first part of this contribution the system and components are presented for the use of 16.7 Hz technology in offshore wind farms. In the second part, to be published in the next issue, the authors examine the technical opportunities of a 16.7 Hz system on the basis of load flow calculations for a hypothetical wind grid system in the North Sea. The results demonstrate the technical feasibility. It is shown that a three-phase 245 kV submarine cable may transfer nearly 600 MW - with cable lengths of more than 500 km.

  6. Stationary and coherent spectroscopy of 167Er3+ in waveguides in 7LiYF4 crystal

    Directory of Open Access Journals (Sweden)

    Minnegaliev Mansur


    Full Text Available We have conducted a spectroscopic investigation of 167Er3+ ions in optical waveguides on an optical transition between the hyperfine sublevels of 4I15/2 and 4I9/2 multiplets. Waveguides with diameters ranging from 20 to 100 µm were produced in the crystal by a femtosecond laser using the depressed-cladding approach. The spectroscopy results of 167Er3+ ions inside the waveguides show additional broadening and an overall shifts of the spectra compared to the bulk spectrum of ions. The sign of the observed frequency shift depends on the diameter of the specific waveguide. We have also observed a two-pulse photon echo in several waveguides. The acquired results show the possibility for integrated quantum schemes in rare-earth ions doped crystals.

  7. A refined Panax ginseng karyotype based on an ultra-high copy 167-bp tandem repeat and ribosomal DNAs

    Directory of Open Access Journals (Sweden)

    Nomar Espinosa Waminal


    Conclusion: Identification of individual P. ginseng chromosomes was achieved using Pg167TR-FISH. Chromosome identification is important in understanding the P. ginseng genome structure, and our method will be useful for future integration of genetic linkage maps and genome scaffold anchoring. Additionally, it is a good tool for comparative studies with related species in efforts to understand the evolution of P. ginseng.

  8. Superconductivity and valence state in layered single-crystal HfAs1.67Te0.12 (United States)

    Peng, Jian; Yu, Jia; Zhang, Shuai; Chen, Genfu


    We report a detailed study on single crystals of HfAs1.67Te0.12 within a PbFCl-type layered structure. The single crystals of the title compound were successfully grown using a chemical transport reaction. The temperature dependence of electrical resistivity ρ (T), AC magnetic susceptibility {χ }{AC}(T) and specific heat C(T) show a bulk superconductivity with transition temperature T c = 1.67 K. The jump of C/T at T c is comparable to the traditional BCS weak-coupling model. A full H–T phase diagram is established using the results of ρ (T,H) and C(T) under fields, suggesting a rather weak anisotropy [({H}c2\\parallel {ab}(0)/{H}c2\\parallel c(0)] of 1.8 in orbital limit dominated three-dimension-like superconducting system. The mixed-valence states of Hf and As observed in the binding energy from x-ray photoelectron spectroscopy are consistent with the single-crystal x-ray diffraction analysis, indicating that the As–Te disorder prefers to occur in the [HfAs] layer and a large amount of vacancies are present in tetragonal As layer. As compared to HfAs1.7Se0.2 (T c = 0.52 K), a positive-like vacancy effect on T c has been confirmed in HfAs1.67Te0.12. The analysis of the Hall coefficient implies that the hole-type carriers dominate the transport properties, which is in good agreement with the hole pockets at Fermi surface obtained in a band structure calculation. The detailed study of single-crystal HfAs1.67Te0.12 provides a possible candidate to discuss the non-magnetic Kondo effect.

  9. Association between cotinine-verified smoking status and hypertension in 167,868 Korean adults. (United States)

    Kim, Byung Jin; Han, Ji Min; Kang, Jung Gyu; Kim, Bum Soo; Kang, Jin Ho


    Previous studies showed inconsistent results concerning the relationship between chronic smoking and blood pressure. Most of the studies involved self-reported smoking status. This study was performed to evaluate the association of urinary cotinine or self-reported smoking status with hypertension and blood pressure in Korean adults. Among individuals enrolled in the Kangbuk Samsung Health Study and Kangbuk Samsung Cohort Study, 167,868 participants (men, 55.7%; age, 37.5 ± 6.9 years) between 2011 and 2013 who had urinary cotinine measurements were included. Individuals with urinary cotinine levels ≥50 ng/mL were defined as cotinine-verified current smokers. The prevalence of hypertension and cotinine-verified current smokers in the overall population was 6.8% and 22.7%, respectively (10.0% in men and 2.8% in women for hypertension: 37.7% in men and 3.9% in women for cotinine-verified current smokers). In a multivariate regression analysis adjusted for age, sex, body mass index, waist circumference, alcohol drinking, vigorous exercise, and diabetes, cotinine-verified current smoking was associated with lower prevalence of hypertension compared with cotinine-verified never smoking (OR[95% CI], 0.79 [0.75, 0.84]). Log-transformed cotinine levels and unobserved smoking were negatively associated with hypertension, respectively (0.96 [0.96, 0.97] and 0.55 [0.39, 0.79]). In a multivariate linear regression analysis, the cotinine-verified current smoking was inversely associated with systolic and diastolic blood pressure (BP) (regression coefficient[95% CI], -1.23[-1.39, -1.07] for systolic BP and -0.71 [-0.84, -0.58] for diastolic BP). In subgroup analyses according to sex, the inverse associations between cotinine-verified current smoking and hypertension were observed only in men. This large observational study showed that cotinine-verified current smoking and unobserved smoking were inversely associated with hypertension in Korean adults, especially only in

  10. Tank 241-AN-103, cores 166 and 167 analytical results for the final report

    Energy Technology Data Exchange (ETDEWEB)

    Steen, F.H.


    This document is the analytical laboratory report for tank 241-AN-103 [Hydrogen Watch Listed] push mode core segments collected between September 13, 1996 and September 23, 1996. The segments were subsampled and analyzed in accordance with the Tank 241-AN-103 Push Mode Core Sampling and Analysis Plan (TSAP), the Safety Screening Data Quality Objective (DQO) and the Flammable Gas Data Quality Objective (DQO). The analytical results are included in the data summary table. The raw data are included in this document. None of the samples submitted for Total Alpha Activity (AT), Total Organic Carbon (TOC) and Plutonium analyses exceeded notification limits as stated in the TSAP. One sample submitted for Differential Scanning Calorimetry (DSC) analysis exceeded the notification limit of 480 Joules/g (dry weight basis) as stated in the Safety Screening DQO. Appropriate notifications were made. Statistical evaluation of results by calculating the 95% upper confidence limit is not performed by the 222-S Laboratory and is not considered in this report. Appearance and Sample Handling Attachment 1 is a cross reference to relate the tank farm identification numbers to the 222-S Laboratory LabCore/LIMS sample numbers. The subsamples generated in the laboratory for analyses are identified in these diagrams with their sources shown. The diagrams identifying the core composites are also included. Core 166 Nineteen push mode core segments were removed from tank 241-AN-103 riser 12A between September 13, 1996 and September 17, 1996. Segments were received by the 222-S Laboratory between September 20, 1996 and September 30, 1996. Table 2 summarizes the extrusion information. Selected segments (2, 5 and 14) were sampled using the Retained Gas Sampler (RGS) and extruded by the Process Chemistry and Statistical Analysis Group. Core 167 Eighteen push mode core segments were removed from tank 241-AN-103 riser 21A between September 18, 1996 and September 23, 1996. Tank Farm Operations were

  11. Selective Sensing of Fe(3+) and Al(3+) Ions and Detection of 2,4,6-Trinitrophenol by a Water-Stable Terbium-Based Metal-Organic Framework. (United States)

    Cao, Li-Hui; Shi, Fang; Zhang, Wen-Min; Zang, Shuang-Quan; Mak, Thomas C W


    A water-stable luminescent terbium-based metal-organic framework (MOF), {[Tb(L1 )1.5 (H2 O)]⋅3 H2 O}n (Tb-MOF), with rod-shaped secondary building units (SBUs) and honeycomb-type tubular channels has been synthesized and structurally characterized by single-crystal X-ray diffraction. The high green emission intensity and the microporous nature of the Tb-MOF indicate that it can potentially be used as a luminescent sensor. In this work, we show that Tb-MOF can selectively sense Fe(3+) and Al(3+) ions from mixed metal ions in water through different detection mechanisms. In addition, it also exhibits high sensitivity for 2,4,6-trinitrophenol (TNP) in the presence of other nitro aromatic compounds in aqueous solution by luminescence quenching experiments. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Picomolar traces of americium(III) introduce drastic changes in the structural chemistry of terbium(III). A break in the ''gadolinium break''

    Energy Technology Data Exchange (ETDEWEB)

    Welch, Jan M. [TU Wien, Atominstitut, Vienna (Austria); Mueller, Danny; Knoll, Christian; Wilkovitsch, Martin; Weinberger, Peter [TU Wien, Institute of Applied Synthetic Chemistry, Vienna (Austria); Giester, Gerald [University of Vienna, Institute of Mineralogy and Crystallography, Vienna (Austria); Ofner, Johannes; Lendl, Bernhard [TU Wien, Institute of Chemical Technologies and Analytics, Vienna (Austria); Steinhauser, Georg [Leibniz Universitaet Hannover, Institute of Radioecology and Radiation Protection (Germany)


    The crystallization of terbium 5,5{sup '}-azobis[1H-tetrazol-1-ide] (ZT) in the presence of trace amounts (ca. 50 Bq, ca. 1.6 pmol) of americium results in 1) the accumulation of the americium tracer in the crystalline solid and 2) a material that adopts a different crystal structure to that formed in the absence of americium. Americium-doped [Tb(Am)(H{sub 2}O){sub 7}ZT]{sub 2} ZT.10 H{sub 2}O is isostructural to light lanthanide (Ce-Gd) 5,5{sup '}-azobis[1H-tetrazol-1-ide] compounds, rather than to the heavy lanthanide (Tb-Lu) 5,5{sup '}-azobis[1H-tetrazol-1-ide] (e.g., [Tb(H{sub 2}O){sub 8}]{sub 2}ZT{sub 3}.6 H{sub 2}O) derivatives. Traces of Am seem to force the Tb compound into a structure normally preferred by the lighter lanthanides, despite a 10{sup 8}-fold Tb excess. The americium-doped material was studied by single-crystal X-ray diffraction, vibrational spectroscopy, radiochemical neutron activation analysis, and scanning electron microscopy. In addition, the inclusion properties of terbium 5,5{sup '}-azobis[1H-tetrazol-1-ide] towards americium were quantified, and a model for the crystallization process is proposed. (copyright 2017 Wiley-VCH Verlag GmbH and Co. KGaA, Weinheim)

  13. Public access defibrillation: Suppression of 16.7 Hz interference generated by the power supply of the railway systems

    Directory of Open Access Journals (Sweden)

    Iliev Georgi L


    Full Text Available Abstract Background A specific problem using the public access defibrillators (PADs arises at the railway stations. Some countries as Germany, Austria, Switzerland, Norway and Sweden are using AC railroad net power-supply system with rated 16.7 Hz frequency modulated from 15.69 Hz to 17.36 Hz. The power supply frequency contaminates the electrocardiogram (ECG. It is difficult to be suppressed or eliminated due to the fact that it considerably overlaps the frequency spectra of the ECG. The interference impedes the automated decision of the PADs whether a patient should be (or should not be shocked. The aim of this study is the suppression of the 16.7 Hz interference generated by the power supply of the railway systems. Methods Software solution using adaptive filtering method was proposed for 16.7 Hz interference suppression. The optimal performance of the filter is achieved, embedding a reference channel in the PADs to record the interference. The method was tested with ECGs from AHA database. Results The method was tested with patients of normal sinus rhythms, symptoms of tachycardia and ventricular fibrillation. Simulated interference with frequency modulation from 15.69 Hz to 17.36 Hz changing at a rate of 2% per second was added to the ECGs, and then processed by the suggested adaptive filtering. The method totally suppresses the noise with no visible distortions of the original signals. Conclusion The proposed adaptive filter for noise suppression generated by the power supply of the railway systems has a simple structure requiring a low level of computational resources, but a good reference signal as well.

  14. Genetic risk of TNFSF4 and FAM167A-BLK polymorphisms in children with asthma and allergic rhinitis in a Han Chinese population. (United States)

    Liu, Yun; Ke, Xia; Kang, Hou-Yong; Wang, Xiao-Qiang; Shen, Yang; Hong, Su-Ling


    Asthma and allergic rhinitis (AR) frequently occur as comorbid diseases of the upper airways. Single-nucleotide polymorphisms (SNPs) in the TNFSF4 and FAM167A-BLK genes have recently been shown to be associated with various immune-related disorders. Our aim was to determine whether TNFSF4 or FAM167A-BLK polymorphisms confer genetic susceptibility to asthma and AR in a Han Chinese population. We performed a case-control study of 290 asthmatic children and 252 healthy controls. Nine SNPs in the TNFSF4 region (rs1234313, rs1234314, rs1234315, rsl 2039904, rs844648 and rsl 0912580) and the FAM167A-BLK region (rs2254546, rs13277113 and rs1600249) were detected using the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay. This study revealed that three SNPs in TNFSF4 (rsl 234313, rsl 234314 and rsl 234315) and two SNPs in FAM167A-BLK (rs2254546 and rsl 600249) were significantly correlated with asthma and AR, while SNP rsl600249 was associated with asthma without allergic rhinitis as a risk factor. Further, we demonstrated synergistic effects between the TNFSF4 and FAM167A-BLK SNPs. This study supports that the SNPs in TNFSF4 and FAM167A-BLK may be involved in asthma and AR gene risk in the Han Chinese cohort.

  15. The K167I variant of DNA polymerase β that is found in Esophageal Carcinoma patients impairs polymerase activity and BER. (United States)

    Wang, Yuanyuan; Zang, Wenqiao; Du, Yuwen; Chen, Xiaonan; Zhao, Guoqiang


    DNA polymerase β (pol β) is a key enzyme in DNA base excision repair, and an important factor for maintaining genomic integrity and stability. Esophageal carcinoma (EC) patients who have been identified as carrying the K167I variant of pol β have been shown to have decreased life expectancy. However, it is unknown if the variant affects pol β's functions and/or how it contributes to the initiation and progression of cancer. In this study, we expressed and purified the K167I variant. Moreover, we found that K167I significantly reduced polymerase activity. As a result, the K167I substitution reduced base excision repair (BER) efficiency when assayed in a reconstitution assay or when using cellular extracts. Finally, we observed EC cells expressing the K167I variant to be sensitive to DNA damaging agents. These results suggest the K167I variant affected pol β biochemical activity resulting in impaired BER function, which might subsequently contribute to genomic instability and cancer development.

  16. Benzimidazole -Resistance in Haemonchus Contortus: New PCR-RFLP Method for the Detection of Point Mutation at Codon 167 of Isotype 1 Β-Tubulin Gene

    Directory of Open Access Journals (Sweden)

    A Eslami


    Full Text Available Background: Due to the lack of a suitable and economic test for the analysis of the polymorphism at codon 167, we developed a new PCR-RFLP technique, based on a modified forward primer (UT-HC167 MF-primer, to identify simultaneously the SNPs at codons 167 and 200 of isotype 1 β-tubu­lin gene of Haemonchus contortus.Methods: There already are several safe and easy methods for identification of point mutations at codons 198 and 200. Due to the lack of a reliable and easy method for the detection of the single nucleo­tide polymorphism (SNP at codon 167, we developed an innovative PCR-RFLP technique based on a modified forward primer (UT-HC167 MF-primer, in which the nucleotide T at the posi­tion 443 was substituted through a nucleotide A creating a restriction site for restriction endonuc­lease SnaB I in the nucleotide sequences including codon 167. A total of 138 adult male H. contortus were collected from three different geo-climatic areas of Iran. The isolated genomic DNA of each single worm was amplified by PCR using primers flanking codon 167. The PCR product (527 bp was then amplified by semi-nested PCR using the UT-HC167 MF-primer and the reverse primer achiev­ing a PCR product of 451 bp in length. This PCR product was subsequently digested with the restriction endonucleases SnaB I and TaaI for analysis of the mutations at codons 167 and 200, respec­tively.Results: All worms had two alleles encoding for phenylalanine (BZss homozygote for both codons.Conclusion: Using the UT-HC167 MF-primer and a suitable reverse primer designed upstream from codon 200, it is possible to amplify a PCR product which can be used for analysis of the SNPs at all three mentioned codons using RFLP.

  17. Sodium terbium(III polyphosphate

    Directory of Open Access Journals (Sweden)

    Abdelghani Oudahmane


    Full Text Available Single crystals of the title compound, NaTb(PO34, were obtained by solid-state reaction. This compound belongs to type II of long-chain polyphosphates with the general formula AIBIII(PO34. It is isotypic with the NaNd(PO34 and NaEr(PO34 homologues. The crystal structure is built up of infinite crenelated chains of corner-sharing PO4 tetrahedra with a repeating unit of four tetrahedra. These chains, extending parallel to [100], are linked by isolated TbO8 square antiprisms, forming a three-dimensional framework. The Na+ ions are located in channels running along [010] and are surrounded by six oxygen atoms in a distorted octahedral environment within a cut-off distance <2.9 Å.

  18. Crystal structure of a sodium, zinc and iron(III-based non-stoichiometric phosphate with an alluaudite-like structure: Na1.67Zn1.67Fe1.33(PO43

    Directory of Open Access Journals (Sweden)

    Jamal Khmiyas


    Full Text Available The new title compound, disodium dizinc iron(III tris(phosphate, Na1.67Zn1.67Fe1.33(PO43, which belongs to the alluaudite family, has been synthesized by solid-state reactions. In this structure, all atoms are in general positions except for four, which are located on special positions of the C2/c space group. This structure is characterized by cation substitutional disorder at two sites, one situated on the special position 4e (2 and the other on the general position 8f. The 4e site is partially occupied by Na+ [0.332 (3], whereas the 8f site is entirely filled by a mixture of Fe and Zn. The full-occupancy sodium and zinc atoms are located at the Wyckoff positions on the inversion center 4a (-1 and on the twofold rotation axis 4e, respectively. Refinement of the occupancy ratios, bond-valence analysis and the electrical neutrality requirement of the structure lead to the given composition for the title compound. The three-dimensional framework of this structure consists of kinked chains of edge-sharing octahedra stacked parallel to [10-1]. The chains are formed by a succession of trimers based on [ZnO6] octahedra and the mixed-cation FeIII/ZnII [(Fe/ZnO6] octahedra [FeIII:ZnIII ratio 0.668 (3/0.332 (3]. Continuous chains are held together by PO4 phosphate groups, forming polyhedral sheets perpendicular to [010]. The stacked sheets delimit two types of tunnels parallel to the c axis in which the sodium cations are located. Each Na+ cation is coordinated by eight O atoms. The disorder of Na in the tunnel might presage ionic mobility for this material.

  19. 26 CFR 1.167(a)-12 - Depreciation based on class lives for property first placed in service before January 1, 1971. (United States)


    ... 26 Internal Revenue 2 2010-04-01 2010-04-01 false Depreciation based on class lives for property... (CONTINUED) Itemized Deductions for Individuals and Corporations § 1.167(a)-12 Depreciation based on class... section provides an elective class life system for determining the reasonable allowance for depreciation...

  20. 20 CFR 1002.167 - What actions may a plan administrator take if the employee does not elect or pay for continuing... (United States)


    ... the employee does not elect or pay for continuing coverage in a timely manner? 1002.167 Section 1002... employee does not elect or pay for continuing coverage in a timely manner? The actions a plan administrator... have developed reasonable rules regarding the period within which an employee may elect continuing...

  1. Identification and characterization of Rvs162/Rvs167-3, a novel N-BAR heterodimer in the human fungal pathogen Candida albicans

    NARCIS (Netherlands)

    Gkourtsa, Areti; van den Burg, Janny; Strijbis, Karin; Avula, Teja; Bijvoets, Sietske; Timm, Dave; Hochstenbach, Frans; Distel, Ben

    Membrane reshaping resides at the core of many important cellular processes and amongst its mediators are the BAR (Bin, Amphiphysin, Rvs) domain-containing proteins. We have explored the diversity and function of the Rvs BAR proteins in Candida albicans and identified a novel family member, Rvs167-3

  2. Identification and characterization of Rvs162/Rvs167-3, a novel N-BAR heterodimer in the human fungal pathogen Candida albicans

    NARCIS (Netherlands)

    Gkourtsa, Areti; van den Burg, Janny; Strijbis, Karin; Avula, Teja; Bijvoets, Sietske; Timm, Dave; Hochstenbach, Frans; Distel, Ben


    Membrane reshaping resides at the core of many important cellular processes, and among its mediators are the BAR (Bin, Amphiphysin, Rvs) domain-containing proteins. We have explored the diversity and function of the Rvs BAR proteins in Candida albicans and identified a novel family member, Rvs167-3

  3. Different collectivity in the two signatures of the i13/2 stemming band in 167Yb (United States)

    Petkov, P.; Gladnishki, K. A.; Dewald, A.; Möller, O.; Deloncle, I.; Reese, M.; Fransen, C.; Hackstein, M.; Jolie, J.; Pissulla, Th; Rother, W.; Zell, K. O.


    Six lifetimes have been determined in the 5/2+ [642] band from vi13/2 parentage in 167Yb by means of Recoil distance Doppler-shift (RDDS) measurements carried out at the Cologne FN tandem. The deduced transition strengths and the level scheme are reasonably described by Particle plus triaxial rotor model (PTRM) calculations except for the behavior of the quadrupole collectivity in the two signatures of the 5/2+[642] band. In that band, the quadrupole collectivity of the favored signature is appreciably larger than this of the unfavored signature. The effect increases with increasing the spin. Naturally, the rigid PTRM cannot explain these features, but the structure of its wave functions suggests a possible solution. It is associated with the enhanced contribution of low-Ω orbitals from vi13/2 parentage in the favored signature compared to the unfavored one. This could selectively increase the deformation of the favored signature band members and give rise to a dynamic shape coexistence taking place between the two signatures which needs quantitative explanation by future theoretical work.

  4. Atomistic modeling of crystal structure of Ca{sub 1.67}SiH{sub x}

    Energy Technology Data Exchange (ETDEWEB)

    Kovačević, Goran; Persson, Björn [Theoretical Chemistry, P.O.B. 124, Lund University, Lund 22100 (Sweden); Nicoleau, Luc [BASF Construction Solutions GmbH, Advanced Materials and Systems Research, Albert Frank Straße 32, 83304 Trostberg (Germany); Nonat, André [Laboratoire Interdisciplinaire Carnot de Bourgogne, UMR 6303 CNRS-Université de Bourgogne, BP 47870, F-21078 Dijon Cedex (France); Veryazov, Valera, E-mail: [Theoretical Chemistry, P.O.B. 124, Lund University, Lund 22100 (Sweden)


    The atomic structure of calcium-silicate-hydrate (C{sub 1.67}-S-H{sub x}) has been investigated by theoretical methods in order to establish a better insight into its structure. Three models for C-S-H all derived from tobermorite are proposed and a large number of structures were created within each model by making a random distribution of silica oligomers of different size within each structure. These structures were subjected to structural relaxation by geometry optimization and molecular dynamics steps. That resulted in a set of energies within each model. Despite an energy distribution between individual structures within each model, significant energy differences are observed between the three models. The C-S-H model related to the lowest energy is considered as the most probable. It turns out to be characterized by the distribution of dimeric and pentameric silicates and the absence of monomers. This model has mass density which is closest to the experimental one.

  5. IAA-Ala Resistant3, an evolutionarily conserved target of miR167, mediates Arabidopsis root architecture changes during high osmotic stress

    KAUST Repository

    Kinoshita, Natsuko


    The functions of microRNAs and their target mRNAs in Arabidopsis thaliana development have been widely documented; however, roles of stress-responsive microRNAs and their targets are not as well understood. Using small RNA deep sequencing and ATH1 microarrays to profile mRNAs, we identified IAA-Ala Resistant3 (IAR3) as a new target of miR167a. As expected, IAR3 mRNA was cleaved at the miR167a complementary site and under high osmotic stress miR167a levels decreased, whereas IAR3 mRNA levels increased. IAR3 hydrolyzes an inactive form of auxin (indole-3-acetic acid [IAA]-alanine) and releases bioactive auxin (IAA), a central phytohormone for root development. In contrast with the wild type, iar3 mutants accumulated reduced IAA levels and did not display high osmotic stress-induced root architecture changes. Transgenic plants expressing a cleavage-resistant form of IAR3 mRNA accumulated high levels of IAR3 mRNAs and showed increased lateral root development compared with transgenic plants expressing wild-type IAR3. Expression of an inducible noncoding RNA to sequester miR167a by target mimicry led to an increase in IAR3 mRNA levels, further confirming the inverse relationship between the two partners. Sequence comparison revealed the miR167 target site on IAR3 mRNA is conserved in evolutionarily distant plant species. Finally, we showed that IAR3 is required for drought tolerance. © 2012 American Society of Plant Biologists. All rights reserved.

  6. A europium- and terbium-coated magnetic nanocomposite as sorbent in dispersive solid phase extraction coupled with ultra-high performance liquid chromatography for antibiotic determination in meat samples. (United States)

    Castillo-García, M L; Aguilar-Caballos, M P; Gómez-Hens, A


    A new magnetic dispersive solid-phase extraction approach based on Eu- and Tb-coated magnetic nanocomposites, combined with ultra-high performance liquid chromatography with fluorometric detection, is reported for the extraction and simultaneous determination of veterinary antibiotics. The method is aimed at monitoring of potential residues of three tetracyclines, namely oxytetracycline, tetracycline, chlortetracycline and three acidic quinolones, such as oxolinic acid, nalidixic acid and flumequine, chosen as model analytes, in animal muscle samples. The nanocomposites were obtained by synthesizing magnetic nanoparticles by a co-precipitation method and their coating with terbium and europium ions. The limits of detection obtained using standard solutions were: 1.0, 1.5, 3.8, 0.25, 0.7 and 1.2ngmL(-1), which corresponds to 3.3, 5.0, 12.7, 0.8, 2.3 and 4.0μgkg(-1) for oxytetracycline, tetracycline, chlortetracycline, oxolinic acid, nalidixic acid and flumequine, respectively, in meat samples. The precision values, obtained in the presence of the sample matrix, were in the ranges 0.12-2.0% and 2.6-15.4% for retention times and areas, respectively. The selectivity of the method was checked by assaying different veterinary drugs, finding that most of them did not interfere at the same concentration levels as that of analytes. A recovery study was performed in the presence of chicken and pork muscle samples, which provided values in the range of 61.5-102.6%. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. Genetic variation in codons 167, 198 and 200 of the beta-tubulin gene in whipworms (Trichuris spp.) from a range of domestic animals and wildlife

    DEFF Research Database (Denmark)

    Hansen, Tina Vicky Alstrup; Nejsum, Peter; Olsen, Annette


    and used to amplify a ~476 bp fragment of the beta-tubulin gene. The PCR products were sequenced, analysed and evaluated. We did not identify SNPs in codons 167, 198 or 200 that led to amino acid substitutions in any of the studied Trichuris spp., but genetic variation expected to be related to species......A recurrent problem in the control of whipworm (Trichuris spp.) infections in many animal species and man is the relatively low efficacy of treatment with a single application of benzimidazoles (BZs). The presence of single nucleotide polymorphisms (SNPs) in codons 167, 198 and 200 in the beta...... to investigate the presence of these SNPs in the beta-tubulin gene of Trichuris spp. obtained from a range of animals. DNA was extracted from a total of 121 Trichuris spp. adult whipworm specimens obtained from 6 different host species. The number of worms from each host was pig: 31, deer: 21, sheep: 18, mouse...

  8. 1060nm FDML laser with centimeter coherence length and 1.67 MHz sweep rate for full eye length and retinal ultra-widefield OCT (United States)

    Kolb, Jan Philip; Klee, Julian; Pfeiffer, Tom; Huber, Robert


    We present a new design of a 1060nm Fourier Domain Mode Locked-Laser (FDML-Laser) that combines 1.67 MHz A-scan rate with a centimeter scale coherence length. The extended coherence length is achieved by synchronizing the cavity roundtrip time over the 75 nm sweep with a relative accuracy of 10-7. We will show that this requires careful combination of multiple fiber types in the cavity with a gradient heated chirped Fiber Bragg grating.

  9. WASP-167b/KELT-13b : joint discovery of a hot Jupiter transiting a rapidly rotating F1V star


    Temple, L. Y.; Hellier, C.; Albrow, M. D.; Anderson, D. R.; Bayliss, D.; Beatty, T. G.; Bieryla, A.; Brown, D. J. A.; Cargile, P. A.; Collier Cameron, A.; Collins, K. A.; Colón, K. D.; Curtis, I. A.; D'Ago, G.; Delrez, L.


    We report the joint WASP/KELT discovery of WASP-167b/KELT-13b, a transiting hot Jupiter with a 2.02-d orbit around a $V$ = 10.5, F1V star with [Fe/H] = 0.1 $\\pm$ 0.1. The 1.5 R$_{\\rm Jup}$ planet was confirmed by Doppler tomography of the stellar line profiles during transit. We place a limit of $

  10. C-Terminal Substitution of HBV Core Proteins with Those from DHBV Reveals That Arginine-Rich 167RRRSQSPRR175 Domain Is Critical for HBV Replication (United States)

    Kim, Taeyeung; Shin, Bo-Hye; Park, Gil-Soon; Park, Sun; Chwae, Yong-Joon; Shin, Ho-Joon; Kim, Kyongmin


    To investigate the contributions of carboxyl-terminal nucleic acid binding domain of HBV core (C) protein for hepatitis B virus (HBV) replication, chimeric HBV C proteins were generated by substituting varying lengths of the carboxyl-terminus of duck hepatitis B virus (DHBV) C protein for the corresponding regions of HBV C protein. All chimeric C proteins formed core particles. A chimeric C protein with 221–262 amino acids of DHBV C protein, in place of 146–185 amino acids of the HBV C protein, supported HBV pregenomic RNA (pgRNA) encapsidation and DNA synthesis: 40% amino acid sequence identity or 45% homology in the nucleic-acid binding domain of HBV C protein was sufficient for pgRNA encapsidation and DNA synthesis, although we predominantly detected spliced DNA. A chimeric C protein with 221–241 and 251–262 amino acids of DHBV C, in place of HBV C 146–166 and 176–185 amino acids, respectively, could rescue full-length DNA synthesis. However, a reciprocal C chimera with 242–250 of DHBV C (242RAGSPLPRS250) introduced in place of 167–175 of HBV C (167RRRSQSPRR175) significantly decreased pgRNA encapsidation and DNA synthesis, and full-length DNA was not detected, demonstrating that the arginine-rich 167RRRSQSPRR175 domain may be critical for efficient viral replication. Five amino acids differing between viral species (underlined above) were tested for replication rescue; R169 and R175 were found to be important. PMID:22911745

  11. First identification of coexistence of blaNDM-1 and blaCMY-42 among Escherichia coli ST167 clinical isolates. (United States)

    Zhang, Xueqing; Lou, Danping; Xu, Yuanyuan; Shang, Yongpeng; Li, Dan; Huang, Xiaoying; Li, Yuping; Hu, Longhua; Wang, Liangxing; Yu, Fangyou


    Emergence of multidrug resistance in Enterobacteriaceae limits the selection of antimicrobials for treatment of infectious diseases. Identification of NDM-1 makes more difficulty in treating multidrug-resistant Enterobacteriaceae infections. Carbapenem-resistant Escherichia coli clinical isolates from a tertiary hospital in Wenzhou, east China, were investigated for NDM-1 production. The two tested isolates were negative for modified Hodge test, but positive for a double-disc synergy test used for detecting metallo-β-lactamase production. E. coli WZ33 and WZ51 exhibited discrepant-level resistance to most clinically frequent used antimicrobials, but still susceptible to trimethoprim/sulfamethoxazole, amikacin, fosfomycin, tigecycline and polymyxin B. E. coli WZ33 and WZ51 were positive for bla(NDM-1) determined by PCR and DNA sequencing. Other than bla(NDM-1), E. coli WZ33 also harbored bla(CTX-M-14) and bla(CMY-42), while E. coli WZ51 simultaneously harbored blaSHV-12,bla(CTX-M-14) and bla(CMY-42). Carbapenem resistance for E. coli WZ51 and WZ33 could not be transferred to E. coli recipients through conjugation, but could be transferred to E. coli recipients by chemical transformation. The EcoR1-digested DNA pattern of plasmids from the transformant of E. coli WZ51 was different from that of E. coli WZ51. MLST showed that E. coli WZ33 and WZ51 belonged to an animal-associated clone (ST167). The present study is the first report of bla(NDM-1) carriage in E. coli ST167 isolates and coexistence of bla(NDM-1) and bla(CMY-42) in same isolate. Systemic surveillance should focus on the dissemination of bla(NDM-1) among Enterobacteriaceae, especially E. coli ST167 clone associated with animal infection.

  12. Left ventricular remodeling leads to heart failure in mice with cardiac-specific overexpression of VEGF-B167: echocardiography and magnetic resonance imaging study. (United States)

    Lottonen-Raikaslehto, Line; Rissanen, Riina; Gurzeler, Erika; Merentie, Mari; Huusko, Jenni; Schneider, Jurgen E; Liimatainen, Timo; Ylä-Herttuala, Seppo


    Cardiac-specific overexpression of vascular endothelial growth factor (VEGF)-B 167 is known to induce left ventricular hypertrophy due to altered lipid metabolism, in which ceramides accumulate to the heart and cause mitochondrial damage. The aim of this study was to evaluate and compare different imaging methods to find the most sensitive way to diagnose at early stage the progressive left ventricular remodeling leading to heart failure. Echocardiography and cardiovascular magnetic resonance imaging were compared for imaging the hearts of transgenic mice with cardiac-specific overexpression of VEGF-B 167 and wild-type mice from 5 to 14 months of age at several time points. Disease progression was verified by molecular biology methods and histology. We showed that left ventricular remodeling is already ongoing at the age of 5 months in transgenic mice leading to heart failure by the age of 14 months. Measurements from echocardiography and cardiovascular magnetic resonance imaging revealed similar changes in cardiac structure and function in the transgenic mice. Changes in histology, gene expressions, and electrocardiography supported the progression of left ventricular hypertrophy. Longitudinal relaxation time in rotating frame (T 1 ρ ) in cardiovascular magnetic resonance imaging could be suitable for detecting severe fibrosis in the heart. We conclude that cardiac-specific overexpression of VEGF-B 167 leads to left ventricular remodeling at early age and is a suitable model to study heart failure development with different imaging methods. © 2017 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of The Physiological Society and the American Physiological Society.

  13. Hb Matera (HBB: c.167 T > A): A Second Case Detected in a Pregnant Chinese Woman by the Capillary Electrophoresis Method. (United States)

    Li, You-qiong; Ye, Li-Hua; Mo, Yun


    Hb Matera (HBB: c.167 T > A) is an unstable β-globin gene variant with an ATG > AAG substitution at codon 55. Its coelution with Hb A2 on high performance liquid chromatography (HPLC) makes it difficult to discriminate between Hb Matera and Hb E (HBB: c.79 G > A) that also coelutes with Hb A2 in this method. However, we found that capillary electrophoresis (CE) was able to detect Hb Matera and discriminate it from Hb E, based on the quantification of the peaks and on hematological parameters.

  14. WASP-167b/KELT-13b: joint discovery of a hot Jupiter transiting a rapidly rotating F1V star (United States)

    Temple, L. Y.; Hellier, C.; Albrow, M. D.; Anderson, D. R.; Bayliss, D.; Beatty, T. G.; Bieryla, A.; Brown, D. J. A.; Cargile, P. A.; Collier Cameron, A.; Collins, K. A.; Colón, K. D.; Curtis, I. A.; D'Ago, G.; Delrez, L.; Eastman, J.; Gaudi, B. S.; Gillon, M.; Gregorio, J.; James, D.; Jehin, E.; Joner, M. D.; Kielkopf, J. F.; Kuhn, R. B.; Labadie-Bartz, J.; Latham, D. W.; Lendl, M.; Lund, M. B.; Malpas, A. L.; Maxted, P. F. L.; Myers, G.; Oberst, T. E.; Pepe, F.; Pepper, J.; Pollacco, D.; Queloz, D.; Rodriguez, J. E.; Ségransan, D.; Siverd, R. J.; Smalley, B.; Stassun, K. G.; Stevens, D. J.; Stockdale, C.; Tan, T. G.; Triaud, A. H. M. J.; Udry, S.; Villanueva, S.; West, R. G.; Zhou, G.


    We report the joint WASP/KELT discovery of WASP-167b/KELT-13b, a transiting hot Jupiter with a 2.02-d orbit around a V = 10.5, F1V star with [Fe/H] = 0.1 ± 0.1. The 1.5 RJup planet was confirmed by Doppler tomography of the stellar line profiles during transit. We place a limit of <8 MJup on its mass. The planet is in a retrograde orbit with a sky-projected spin-orbit angle of λ = -165° ± 5°. This is in agreement with the known tendency for orbits around hotter stars to be more likely to be misaligned. WASP-167/KELT-13 is one of the few systems where the stellar rotation period is less than the planetary orbital period. We find evidence of non-radial stellar pulsations in the host star, making it a δ-Scuti or γ-Dor variable. The similarity to WASP-33, a previously known hot-Jupiter host with pulsations, adds to the suggestion that close-in planets might be able to excite stellar pulsations.

  15. 16.7 W 885 nm diode-side-pumped actively Q-switched Nd:YAG/YVO4 intracavity Raman laser at 1176 nm (United States)

    Jiang, Pengbo; Zhang, Guizhong; Liu, Jian; Ding, Xin; Sheng, Quan; Yu, Xuanyi; Sun, Bing; Shi, Rui; Wu, Liang; Wang, Rui; Yao, Jianquan


    We proposed and experimentally demonstrated the generation of high-power 1176 nm Stokes wave by frequency shifting of a 885 nm diode-side-pumped Nd:YAG laser using a YVO4 crystal in a Z-shaped cavity configuration. Employing the 885 nm diode-side-pumped scheme and the Z-shaped cavity, for the first time to our knowledge, we realized the thermal management effectively, achieving excellent 1176 nm Stokes wave consequently. With an incident pump power of ~190.0 W, a maximum average output power of 16.7 W was obtained at the pulse repetition frequency of 10 kHz. The pulse duration and spectrum linewidth of the Stokes wave at the maximum output power were 20.3 ns and ~0.08 nm, respectively.

  16. Spectroscopic analysis of lithium terbium tetrafluoride

    DEFF Research Database (Denmark)

    Christensen, H.P.


    . The rare-earth site in LiTbF4 possesses S4 symmetry, which allows six crystal-field parameters. ζ and the six Bim were varied to obtain the best agreement with the experimentally observed levels. Keeping F2=434 cm-1 fixed, a fit with a standard deviation of 12 cm-1 was obtained at 10 K with the following...... were calculated by diagonalizing an effective spin-orbit and crystal-field Hamiltonian in an LS basis. H=Σλi(L→·S→)i+ΣαiΣBimOim, where the parameters λi are functions of the spin-orbit parameter ζ and the Slater parameter F2. The Oim and αi are Racah operators and reduced matrix elements, respectively...

  17. Inelastic critical scattering of neutrons from terbium

    DEFF Research Database (Denmark)

    Als-Nielsen, Jens Aage; Dietrich, O.W.; Marshall, W.


    We have measured the inelasticity of the critical neutron scattering in Tb above the Néel temperature. The results show that dynamical slowing down of fluctuations does occur at a second order phase transition.......We have measured the inelasticity of the critical neutron scattering in Tb above the Néel temperature. The results show that dynamical slowing down of fluctuations does occur at a second order phase transition....

  18. Association study of 167 candidate genes for schizophrenia selected by a multi-domain evidence-based prioritization algorithm and neurodevelopmental hypothesis.

    Directory of Open Access Journals (Sweden)

    Zhongming Zhao

    Full Text Available Integrating evidence from multiple domains is useful in prioritizing disease candidate genes for subsequent testing. We ranked all known human genes (n=3819 under linkage peaks in the Irish Study of High-Density Schizophrenia Families using three different evidence domains: 1 a meta-analysis of microarray gene expression results using the Stanley Brain collection, 2 a schizophrenia protein-protein interaction network, and 3 a systematic literature search. Each gene was assigned a domain-specific p-value and ranked after evaluating the evidence within each domain. For comparison to this ranking process, a large-scale candidate gene hypothesis was also tested by including genes with Gene Ontology terms related to neurodevelopment. Subsequently, genotypes of 3725 SNPs in 167 genes from a custom Illumina iSelect array were used to evaluate the top ranked vs. hypothesis selected genes. Seventy-three genes were both highly ranked and involved in neurodevelopment (category 1 while 42 and 52 genes were exclusive to neurodevelopment (category 2 or highly ranked (category 3, respectively. The most significant associations were observed in genes PRKG1, PRKCE, and CNTN4 but no individual SNPs were significant after correction for multiple testing. Comparison of the approaches showed an excess of significant tests using the hypothesis-driven neurodevelopment category. Random selection of similar sized genes from two independent genome-wide association studies (GWAS of schizophrenia showed the excess was unlikely by chance. In a further meta-analysis of three GWAS datasets, four candidate SNPs reached nominal significance. Although gene ranking using integrated sources of prior information did not enrich for significant results in the current experiment, gene selection using an a priori hypothesis (neurodevelopment was superior to random selection. As such, further development of gene ranking strategies using more carefully selected sources of information is

  19. The English Language Amendment. Hearing before the Subcommittee on the Constitution of the Committee on the Judiciary. Senate, Ninety-Eighth Congress, Second Session on S.J. Res. 167, a Joint Resolution Proposing an Amendment to the Constitution of the United States with Respect to the English Language. (United States)

    Congress of the U.S., Washington, DC. Senate Committee on the Judiciary.

    The transcripts of the hearings on Senate Joint Resolution 167, proposing an amendment to the United States Constitution with regard to establishment of English as the country's official language includes: the statements of three committee members (Senators Orrin G. Hatch, Jeremiah Denton, and Dennis DeConcini); the text of the proposed…

  20. Ultra-low thermal conductivity of TlIn5Se8 and structure of the new complex chalcogenide Tl0.98In13.12Se16.7Te2.3 (United States)

    Lefèvre, Robin; Berthebaud, David; Pérez, Olivier; Pelloquin, Denis; Boudin, Sophie; Gascoin, Franck


    TlIn5Se8 has been synthesized by means of solid-state reaction and densified by Spark Plasma Sintering. The compound is a semiconductor with a band gap of 1.62 eV estimated from reflectance measurements. Its thermal conductivity is about 0.45 W m-1. K-1 in the temperature range 300-673 K, an extremely low value attributed to its complex pseudo-1D structure reminiscent of the pseudo-hollandite. While attempting to dope TlIn5Se8 with Te, a new complex chalcogenide was discovered and characterized by the combination of TEM and XRD diffraction. It belongs to the A2In12X19 family, crystallizing in the R 3 ̅:H space group. Single crystal X-ray diffraction study led to a refined composition of Tl0.98In13.12Se16.7Te2.3 with cell parameters: a=13.839(5) Å and c=35.18(3) Å. A static disorder is found on one indium site situated in an octahedral environment. The single crystal XRD study is in agreement with TEM analyses in STEM-HAADF image mode that do not show any extended defects or disorder at atomic scale.

  1. Publications | Page 167 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Woody and non-woody biomass utilisation for fuel and implications on plant nutrients availability in the Mukehantuta watershed in Ethiopia (open access). Scarcity of fuel wood has huge implications for agricultural productivity and food security. Due to the increasing scarcity of traditional fuel wood resources, rural ...


    African Journals Online (AJOL)

    satellite television stations operating in the country, real sex programmes beamed uncontrolled and unedited from satellite televisions into many Nigerian homes. Foreign and local pornographic ..... new materialism, inequity and social injustice, dropout from educational institutions, looseness and carelessness of parent ...

  3. Environmental Radiation Data (ERD) Journal Report 167 (United States)

    RadNet Environmental Radiation Data (ERD) journal report for the period of July – September 2016. The report includes results for air, drinking water and precipitation samples collected as part of EPA's RadNet monitoring program.

  4. Publications | Page 167 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Water-related disaster management and adaptation to climate change : bridges and challenges? (restricted access) ... Openness and quality in Asian distance education : sub-project 3; distance learning mode for youth of Angkaol village, Damnark Chang Eur district, Kep province, Cambodia (restricted access). The project ...

  5. Reference: 167 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 3% plastoquinone. Photooxidation of P700 of PSI in the abc4 mutant was not observed, and reduced-versus-oxidized difference spectros...copy indicated that the abc4 mutant had no P700. The maximum quantum yield of photo

  6. Inelastic scattering of neutrons by spin waves in terbium

    DEFF Research Database (Denmark)

    Bjerrum Møller, Hans; Houmann, Jens Christian Gylden


    Measurements of spin-wave dispersion relations for magnons propagating in symmetry directions in ferromagnetic Tb; it is first experiment to give detailed information on magnetic excitations in heavy rare earths; Tb was chosen for these measurements because it is one of few rare-earth metals whic...... does not have very high thermal-neutron capture cross section, so that inelastic neutron scattering experiments can give satisfactory information on magnon dispersion relations....

  7. Coherent magnetic structures in terbium/holmium superlattices

    DEFF Research Database (Denmark)

    Bryn-Jacobsen, C.; Cowley, R.A.; McMorrow, D.F.


    Neutron-scattering techniques have been used to investigate the magnetic properties of three Tb/Ho superlattices grown by molecular-beam epitaxy. It is revealed that for temperatures in the range T = 10 to T-N(Ho)approximate to 130 K, there is a basal-plane ferromagnetic alignment of Tb moments w...

  8. Metal ion displacements in noncentrosymmetric chalcogenides La3Ga1.67S7, La3Ag0.6GaCh7 (Ch=S, Se), and La3MGaSe7 (M=Zn, Cd) (United States)

    Iyer, Abishek K.; Yin, Wenlong; Rudyk, Brent W.; Lin, Xinsong; Nilges, Tom; Mar, Arthur


    The quaternary Ga-containing chalcogenides La3Ag0.6GaS7, La3Ag0.6GaSe7, La3ZnGaSe7, and La3CdGaSe7, as well as the related ternary chalcogenide La3Ga1.67S7, were prepared by reactions of the elements at 950 °C. They adopt noncentrosymmetric hexagonal structures (space group P63, Z=2) with cell parameters (a=10.2 Å, c=6.1 Å for the sulfides; a=10.6 Å, c=6.4 Å for the selenides) that are largely controlled by the geometrical requirements of one-dimensional stacks of Ga-centered tetrahedra separated by the La atoms. Among these compounds, which share the common formulation La3M1-xGaCh7 (M=Ga, Ag, Zn, Cd; Ch=S, Se), the M atoms occupy sites within a stacking of trigonal antiprisms formed by Ch atoms. The location of the M site varies between extremes with trigonal antiprismatic (CN6) and trigonal planar (CN3) geometry. Partial occupation of these sites and intermediate ones accounts for the considerable versatility of these structures and the occurrence of large metal displacement parameters. The site occupations can be understood in a simple way as being driven by the need to satisfy appropriate bond valence sums for both the M and Ch atoms. Band structure calculations rationalize the substoichiometry observed in the Ag-containing compounds (La3Ag0.6GaS7, La3Ag0.6GaSe7) as a response to overbonding. X-ray photoelectron spectroscopy supports the presence of monovalent Ag atoms in these compounds, which are not charge-balanced.

  9. Study of the chelating capacity of nucleobase analogs with biological interest: XRD structural study and ab initio molecular orbital calculations on 1-methyl and 1,6,7-trimethyllumazine (United States)

    Acuña-Cueva, Esther R.; Faure, René; Jiménez-Pulido, Sonia B.; Moreno-Carretero, Miguel N.; Peña-Ruiz, Tomás


    The molecular and crystal structures of 1-methyllumazine (MLM) and 1,6,7-trimethyllumazine (MLMD) (lumazine=pteridine-2,4( 1H,3H)-dione) have been XRD determined. The compound MLM crystallizes in the monoclinic system (space group P2 1/c ) with cell dimensions: a=4.8200(2), b=9.7820(5), c=15.3230(9) Å, β=93.407(2)°. The structure was solved from 1947 reflections with I>2 σ( I). The final R[ I>2 σ( I)] was 0.0756 for 136 parameters. The compound MLMD crystallizes in the monoclinic system (space group C2) with cell dimensions: a=16.1360(4), b=6.5850(2), c=10.5380(4) Å, β=125.150(1)°. The structure was solved from 1800 reflections with I>4 σ( I). The final R[ I>4 σ( I)] was 0.0547 for 165 parameters. In both structures, the pteridine derivatives are H-bond dimerized (N-H⋯O), but whereas MLM shows a N3-H3⋯O2 H-bond, MLMD displays a N3-H3⋯O4 one, which is in accordance with the different sequence found for the carbonyl lengths. Ab initio molecular orbital calculations at the RHF/6-31G ∗ and B3LYP/6-31G ∗ levels using the GAUSSIAN94 program package have allowed us to simulate the molecular structures. The geometrical data are in good agreement with those calculated. The contribution of the atomic orbitals of the potential donor atoms to the higher occupied molecular orbitals allows us to propose theoretical arguments to justify the well-known N5-O4-bidentate coordinative behaviour found for these compounds in several metal complexes.

  10. Differences in Arctic and Antarctic PSC occurrence as observed by lidar in Ny-Ålesund (79° N, 12° E and McMurdo (78° S, 167° E

    Directory of Open Access Journals (Sweden)

    M. Maturilli


    Full Text Available The extent of springtime Arctic ozone loss does not reach Antarctic ``ozone hole'' dimensions because of the generally higher temperatures in the northern hemisphere vortex and consequent less polar stratospheric cloud (PSC particle surface for heterogeneous chlorine activation. Yet, with increasing greenhouse gases stratospheric temperatures are expected to further decrease. To infer if present Antarctic PSC occurrence can be applied to predict future Arctic PSC occurrence, lidar observations from McMurdo station (78° S, 167° E and NyÅlesund (79° N, 12° E have been analysed for the 9 winters between 1995 (1995/1996 and 2003 (2003/2004. Although the statistics may not completely cover the overall hemispheric PSC occurrence, the observations are considered to represent the main synoptic cloud features as both stations are mostly situated in the centre or at the inner edge of the vortex. Since the focus is set on the occurrence frequency of solid and liquid particles, the analysis has been restricted to volcanic aerosol free conditions. In McMurdo, by far the largest part of PSC observations is associated with NAT PSCs. The observed persistent background of NAT particles and their potential ability to cause denoxification and irreversible denitrification is presumably more important to Antarctic ozone chemistry than the scarcely observed ice PSCs. Meanwhile in Ny-Ålesund, ice PSCs have never been observed, while solid NAT and liquid STS clouds both occur in large fraction. Although they are also found solely, the majority of observations reveals solid and liquid particle layers in the same profile. For the Ny-Ålesund measurements, the frequent occurrence of liquid PSC particles yields major significance in terms of ozone chemistry, as their chlorine activation rates are more efficient. The relationship between temperature, PSC formation, and denitrification is nonlinear and the McMurdo and Ny-Ålesund PSC observations imply that for

  11. Saúde autorreferida e qualidade de vida em praticantes de caminhada do programa academia das cidades, Petrolina – PE, Brasil - doi: 10.5020/18061230.2012.p167

    Directory of Open Access Journals (Sweden)

    Jéssica Thayani Santos Brandão


    Full Text Available Avaliar a saúde autorreferida (SAR e qualidade de vida (QV em praticantes de caminhada no Programa Academia das Cidades (PAC. Métodos: Estudo transversal descritivo, conduzido com 300 praticantes de caminhada no PAC, em Petrolina-PE, Brasil. Realizou-se entrevista com questões distribuídas em quatro partes: sociodemográficas/ hábitos de vida (idade, sexo, situação conjugal, renda, ocupação e hábitos de vida; saúde autorreferida (escala de 5 pontos sobre a percepção de saúde; qualidade de vida (WHOQOLOMS e informações sobre o PAC e benefícios da caminhada. Resultados: Observou-se idade média de 40,75 (±14,72 e 99 (33,0% sujeitos tinham idade entre 41-60 anos, 208 (69,3% eram mulheres, 166 (55,3% eram casados, 167 (55,7% tinham mais de 12 anos de escolaridade, 106 (35,3% recebiam entre 2-3 salários mínimos, 234 (78,0% trabalhavam e 153 (51,0% praticavam caminhada 3 vezes por semana. A televisão (37,3% foi a principal fonte de informação sobre os benefícios da caminhada e as redes sociais (55,0% forneceram as principais informações sobre a existência do programa que influenciou a maioria (63,7% a iniciar a atividade. Não houve diferença estatisticamente significante nos escores de QV e na SAR, de acordo com a idade, entretanto observou-se que, à medida que aumenta a frequência da caminhada semanal, aumentam os escores de QV e SAR. Conclusão: A caminhada foi importante determinante da promoção da saúde e qualidade de vida, à medida que aumentava a frequência semanal da atividade, cujos benefícios e existência de locais para sua prática foram disseminados pela televisão e pelas redes sociais, respectivamente.

  12. A inconstitucionalidade da (DRU sob a luz do inciso XI do artigo 167 da Constituição Social e a falsa idéia do déficit previdenciário

    Directory of Open Access Journals (Sweden)

    Karen Costa Braga


    Full Text Available O presente estudo científico tem o nítido propósito de realizar um estudo científico sobre a desvinculação das receitas públicas, no ordenamento jurídico brasileiro, que extirpa do orçamento da Seguridade Social uma parcela de toda a sua arrecadação. Longe de querer esgotar o tema, esta pesquisa faz uma abordagem do constitucionalismo moderno e a figura dos princípios como fonte de interpretação das normas jurídicas além de realizar uma análise dos critérios jurídicos e temporais da instituição da DRU e a sua inconstitucionalidade sob o enfoque do artigo 167 inciso XI do texto constitucional que veda a utilização dos recursos provenientes das contribuições sociais previstas no artigo 195 para pagamento de outras despesas que não os benefícios previdenciários. A tendência seguida no presente artigo científico é a de que, apesar de já decidido pelo Supremo Tribunal Federal a constitucionalidade da DRU, esta questão foi analisada sob o enfoque tributário e não sob o enfoque constitucional-social. É vezo da cultura legislativa-tributária brasileira ignorar a supremacia da Constituição Federal e há, atualmente, recordes de receitas desvinculadas dos cofres do Regime Geral da Previdência Social. Por derradeiro, faz-se uma análise integrativa dos mecanismos utilizados, indevidamente para operacionalizar a atividade estatal e ainda o debate entre o possível engessamento da prática orçamentária rígida e a defasagem dos direitos prestacionais que garantiriam, sob o enfoque dos direitos sociais, o mínimo existencial e a completude da dignidade da pessoa humana.

  13. Dicty_cDB: CFI167 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available ideum chromoso... 294 1e-78 AY533208_1( AY533208 |pid:none) Sus scrofa type III iodo...thyronine ... 79 9e-14 AY656759_1( AY656759 |pid:none) Ovis aries type 3 iodothyronine de... 79 1e-13 AY8...58552_1( AY858552 |pid:none) Bos taurus type III iodothyronine ... 79 1e-13 (Q6DN07) RecName: Full=Type III iodo...thyronine deiodinase; ... 79 1e-13 (Q2QEI3) RecName: Full=Type I iodothyronin...e deiodinase; ... 78 2e-13 ( P55073 ) RecName: Full=Type III iodothyronine deiodinase; ... 78 2e-13 DQ098656

  14. What we do | Page 167 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Building Capacity for Feminist Research in Africa : Gender, Sexuality and Politics. Over the past decade, there has been increasing interest in African scholarship on the importance of understanding sexualities and on connecting this understanding to more relevant policy prescriptions so that African women can enjoy their ...

  15. 167 ORIGINAL ARTICLE Auteur correspondant : adesola.ajayi ...

    African Journals Online (AJOL)


    R. G. and Peralta, R.M. 2008. Production of tanna by Aspergillus tamarii in submerged cultures. Archives of Bio. and Tech. 51(2): 399-404. 3. Natarajan, K. and A. Rajendran, 2009. Effect. Fermentation Parameters on Extracellular Tanna. Production by Lactobacillus plantarum MTCC 1407. of Chem. 6(4): 979-984. 4. Yaoa J.

  16. People’s Republic of China Scientific Abstracts, Number 167. (United States)


    are analyzed. The bacteriostatic action of one of the three herbs, Thymus serpyl- lum L. var. vulgaris , Benth. was also tested in vitro. Injectio...100$ Thymus (made of whole plants) was judged to be definitely effective for bacterial pneumonia. Vitro experiment of a compound containing


    African Journals Online (AJOL)

    Fr. Ikenga

    as a non-monetary award. The scope of this paper is non-monetary awards. There are three enforcement systems for domestic awards under the Nigerian legal system. A domestic award is enforceable by action upon the award, by application under section 31(1) of the Arbitration and Conciliation Act and by the summary ...

  18. 40 CFR 161.167 - Discussion of formation of impurities. (United States)


    ... produce other products or substances. (viii) The process control, purification and quality control...) Technical grade active ingredients and products produced by an integrated system. (1) Each impurity associated with the active ingredient which was found to be present in any analysis of the product conducted...

  19. Publications | Page 167 | CRDI - Centre de recherches pour le ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Water Hyacinth in Africa and the Middle East : A Survey of Problems and Solutions. L'infestation des eaux douces par la jacinthe d'eau a atteint des proportions critiques dans beaucoup de régions de l'Afrique et du Moyen-Orient. On estime que les dommages environnementaux, économiques et sociaux cumulatifs ...

  20. 167 History, Land and Conflict in Nigeria: The Aguleri- Umuleri ...

    African Journals Online (AJOL)


    over Otuocha land as the sole cause of the conflict, neglecting the aspect on ... religious and inter-personal, among other forms of conflicts. ... relationship. This led to the distortion in the reconstruction of their history, as Umuleri community changed their name to. Umueri, to substantiate their claim of being the direct descent.

  1. All projects related to | Page 167 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Region: Bangladesh, Japan. Program: Employment and Growth. Total Funding: CA$ 584,200.00. Changing Labour Markets in Bangladesh: The Dynamics Between Growth and Inclusion in a Low-Income Economy. Project. With its growing economy and population, Bangladesh's job creation success has primarily taken ...

  2. Dicty_cDB: CHF167 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available ted gapping in prelim test: 0 Number of HSP's gapped (non-prelim): 0 length of query: 180 length of database: 80,480,566 effective... HSP length: 17 effective length of query: 163 effective le...ngth of database: 78,821,179 effective search space: 12847852177 effective search space used: 12847852177 T:...0 length of query: 180 length of database: Z,951,760,654 effective HSP length: 22 effective length of query: 158 effective... length of database: Z,096,903,420 effective search space: 6651310740360 effective

  3. Publications | Page 167 | CRDI - Centre de recherches pour le ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    ... and State Sovereignty. L'enjeu le plus critique auquel fait face actuellement la collectivité internationale porte sur la façon de protéger les personnes captives de nouvelles crises humanitaires d'envergure — l'intervention humanitaire a suscité des controverses à la fois lorsqu'elle s'est produite, comme au Kosovo,.

  4. What we do | Page 167 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Telecentres across French-speaking West Africa are struggling to attain financial sustainability while remaining relevant to their communities. ... The Centro de Tecnologia e Sociedade (CTS - Center for Technology and Society) is part of the Fundação Getulio Vargas Law School in Rio de Janeiro and is the only institution in ...

  5. Dicty_cDB: SFG167 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available cppkhecrinhfgeeccv ksrndcltcedlncerkglhcamktvpmikkivxksss Translated Amino Acid sequence (All Frames) Frame ...hgkeccvvahrpppkcslrcppkhecrinhfgeeccv ksrndcltcedlncerkglhcamktvpmikkivxksss Frame C: fiiqfyf*siqikkkxixn*vk

  6. 27 CFR 40.167 - Prepayment tax return. (United States)


    ..., DEPARTMENT OF THE TREASURY (CONTINUED) TOBACCO MANUFACTURE OF TOBACCO PRODUCTS, CIGARETTE PAPERS AND TUBES... consumption or sale by completing the return and filing it with TTB, in accordance with the instructions on...

  7. Dicty_cDB: SSK167 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 8e-08 2 AY022565 |AY022565.1 Oryza sativa microsatellite MRG4890 containing (ATT)X12, genomic sequence...3e-07 2 AY023400 |AY023400.1 Oryza sativa microsatellite MRG5725 containing (TAT)X13, closest to marker...3e-07 2 AY022503 |AY022503.1 Oryza sativa microsatellite MRG4828 containing (ATA)X13, genomic sequence...3e-07 2 AY022351 |AY022351.1 Oryza sativa microsatellite MRG4676 containing (AAT)X13, genomic sequence...3e-07 2 AY022570 |AY022570.1 Oryza sativa microsatellite MRG4895 containing (ATT)X14, genomic sequence

  8. Dicty_cDB: CFG167 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available |BU495005.1 PfESToab82g05.y1 Plasmodium falciparum 3D7 asexual cDNA Plasmodium falciparum cDNA 5' similar to...|BU496632.1 PfESToab52g07.y1 Plasmodium falciparum 3D7 asexual cDNA Plasmodium falciparum cDNA 5' similar to...|BI670607.1 PfESToaa02a07.y1 Plasmodium falciparum 3D7 asexual cDNA Plasmodium falciparum cDNA 5' similar to...|BI816321.1 PfESToaa39a10.y1 Plasmodium falciparum 3D7 asexual cDNA Plasmodium falciparum cDNA 5' similar to...|BI815601.1 PfESToaa30e06.y1 Plasmodium falciparum 3D7 asexual cDNA Plasmodium falciparum cDNA 5' similar to

  9. Dicty_cDB: VFJ167 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available sequence (All Frames) Frame A: *kv*y*klknvc*ck*skillw*klhw*ii*iqqr*nckiqqw**me**ihvmfgwfkc* m*hlga**...*lcckwkc ll*ilpnnw--- ---enkfqk*kv*y*klknvc*ck*skillw*klhw*ii*iqqr*nckiqqw**me**ih vmfgwfkc*m*hlga**

  10. Dicty_cDB: SLE167 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available qlkekqvnlmqmkn*ikrelknllerd*pimvsv*vple*knlklvemmfvhavvernik nvvqnk*LNNIYIY--- ---NIIII*iittsiinnnnnnnnnn...qlkekqvnlmqmkn*ikrelknllerd*pimvsv*vple*knlklvemmfvhavvernik nvvqnk*LNNIYIY--- ---*ynnninnnnihhkqqqqqqqqq

  11. Dicty_cDB: AFO167 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available ces characterized by their enhanced expression in good prognostic human neuroblas...toma upon comparison between good prognostic human neuroblastoma and poor prognostic human neuroblastoma. 36... 0.23 3 BD083746 |BD083746.1 Nucleic acid sequence characterized in that expression is potentiated in human neuroblastoma with good... prognosis, in comparion between human neuroblastoma with good prognosis and human ne

  12. MO-A-BRC-02: TG167 Report - Detailed Description

    Energy Technology Data Exchange (ETDEWEB)

    Rivard, M.


    Although a multicenter, Phase III, prospective, randomized trial is the gold standard for evidence-based medicine, it is rarely used to evaluate innovative radiotherapy devices because of many practical and ethical reasons. It is usually sufficient to compare the dose distributions and dose rates for determining equivalence of the innovative device to an existing one. Thus, quantitative evaluation of the dosimetric characteristics of an innovative brachytherapy device or application is a critical part in which physicists are actively involved. The physicist’s role, along with physician colleagues, in this process is highlighted for innovative products or applications and includes evaluation of 1) dosimetric considerations for clinical implementation (including calibrations, dose calculations, and radiobiological aspects) to comply with existing societal dosimetric prerequisites for sources in routine clinical use, 2) risks and benefits from regulatory and safety perspectives, and 3) resource assessment and preparedness. Further, calibration methods should be traceable to a primary standards dosimetry laboratory such as NIST in the U.S. or to other primary standards dosimetry laboratory located elsewhere. Clinical users should follow standards as approved by their country’s regulatory agencies that approved such a brachytherapy device. Integration of this system into the medical source calibration infrastructure of secondary standard dosimetry laboratories such as the ADCLs is encouraged before a source is introduced into widespread routine clinical use. The AAPM and GEC-ESTRO have developed guidelines for the safe and consistent application of brachytherapy using innovative brachytherapy devices and applications. The current report covers regulatory approvals, calibration, dose calculations, radiobiological issues, and overall safety concerns that should be addressed during the commissioning stage preceding clinical use. These guidelines are based on review of requirements of the U.S. NRC, FDA, Department of Transportation, International Electrotechnical Commission Medical Electrical Equipment Standard 60601, European Commission for CE Marking, and institutional review boards and radiation safety committees. Learning Objectives: Understand the necessary dosimetric considerations for clinical implementation (including calibrations, dose calculations, and radiobiological aspects) to comply with existing societal dosimetric prerequisites for sources in routine clinical use. Evaluate risks and benefits from regulatory and safety perspectives. Identify necessary resources and create a plan for clinical introduction of innovative brachytherapy device or applications. Consultant for Theragenics Corp.; R. Nath, Consultant to Theragenics Corp.

  13. MO-A-BRC-01: TG167 Report - Introduction

    Energy Technology Data Exchange (ETDEWEB)

    Nath, R. [Yale University School of Medicine (United States)


    Although a multicenter, Phase III, prospective, randomized trial is the gold standard for evidence-based medicine, it is rarely used to evaluate innovative radiotherapy devices because of many practical and ethical reasons. It is usually sufficient to compare the dose distributions and dose rates for determining equivalence of the innovative device to an existing one. Thus, quantitative evaluation of the dosimetric characteristics of an innovative brachytherapy device or application is a critical part in which physicists are actively involved. The physicist’s role, along with physician colleagues, in this process is highlighted for innovative products or applications and includes evaluation of 1) dosimetric considerations for clinical implementation (including calibrations, dose calculations, and radiobiological aspects) to comply with existing societal dosimetric prerequisites for sources in routine clinical use, 2) risks and benefits from regulatory and safety perspectives, and 3) resource assessment and preparedness. Further, calibration methods should be traceable to a primary standards dosimetry laboratory such as NIST in the U.S. or to other primary standards dosimetry laboratory located elsewhere. Clinical users should follow standards as approved by their country’s regulatory agencies that approved such a brachytherapy device. Integration of this system into the medical source calibration infrastructure of secondary standard dosimetry laboratories such as the ADCLs is encouraged before a source is introduced into widespread routine clinical use. The AAPM and GEC-ESTRO have developed guidelines for the safe and consistent application of brachytherapy using innovative brachytherapy devices and applications. The current report covers regulatory approvals, calibration, dose calculations, radiobiological issues, and overall safety concerns that should be addressed during the commissioning stage preceding clinical use. These guidelines are based on review of requirements of the U.S. NRC, FDA, Department of Transportation, International Electrotechnical Commission Medical Electrical Equipment Standard 60601, European Commission for CE Marking, and institutional review boards and radiation safety committees. Learning Objectives: Understand the necessary dosimetric considerations for clinical implementation (including calibrations, dose calculations, and radiobiological aspects) to comply with existing societal dosimetric prerequisites for sources in routine clinical use. Evaluate risks and benefits from regulatory and safety perspectives. Identify necessary resources and create a plan for clinical introduction of innovative brachytherapy device or applications. Consultant for Theragenics Corp.; R. Nath, Consultant to Theragenics Corp.

  14. Page 1 New Strategies for separations through reactions 167 Table ...

    Indian Academy of Sciences (India)

    1981b); Jagirdar & Sharma (1981b); d Gaikar. & Sharma (1985). 2.5 Dissociation leaching. New strategies have been also developed for solid-liquid systems through dissociation leaching; it involves equilibrating the solid mixture with aqueous.

  15. 167 Biologie de reproduction du cerf de Barbarie (Cervus elaphus ...

    African Journals Online (AJOL)


    Résumé. La biologie de reproduction des cerfs de Barbarie (Cervus elaphus barabrus) a été étudiée dans le parc d'El Feidja et la réserve de Mhebès sur des populations qui vivent respectivement en état de captivité et semi captivité. Il ressort de cette étude que la période de rut débute en fin août-début septembre.

  16. 15 CFR 16.7 - Participation in program. (United States)


    ... participant in the event that he does not appeal such notification by the end of the thirty (30) day period...) Participants may reproduce the Department of Commerce Label and Mark in advertising: Provided, That the entire...

  17. Dicty_cDB: VFO167 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available mRNA for AL... 74 3e-12 (Q9WU78) RecName: Full=Programmed cell death 6-interacting prote... 71 1e-11 BC051123_1(...BC051123_1( BC051123 |pid:none) Mus musculus programmed cell death... 71 2e-11 AF119955_1( AF119955 |pid:none)...2e-11 BC026823_1( BC026823 |pid:none) Mus musculus programmed cell death... 71 2e-11 AC007591_7( AC007591

  18. What we do | Page 167 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    The Centro de Tecnologia e Sociedade (CTS - Center for Technology and Society) is part of the Fundação Getulio Vargas Law School in Rio de Janeiro and is the only institution in Brazil that specifically deals with the interplay of law, technology and society. Brazil, South America, Nigeria, North Of Sahara, South Of Sahara, ...

  19. 26 CFR 1.167(a)-9 - Obsolescence. (United States)


    .... The depreciation allowance includes an allowance for normal obsolescence which should be taken into.... Obsolescence may render an asset economically useless to the taxpayer regardless of its physical condition... governing the allowance of a loss when the usefulness of depreciable property is suddenly terminated, see...

  20. Dicty_cDB: VHQ167 [Dicty_cDB

    Lifescience Database Archive (English)


  1. Photoluminescence studies of a Terbium(III) complex as a fluorescent probe for DNA detection

    Energy Technology Data Exchange (ETDEWEB)

    Khorasani-Motlagh, Mozhgan, E-mail:; Noroozifar, Meissam; Niroomand, Sona; Moodi, Asieh


    The photoluminescence properties of a Tb(III) complex of the form [Tb(phen){sub 2}Cl{sub 3}·OH{sub 2}] (phen=1,10-phenanthroline) in different solvents are presented. It shows the characteristic luminescence of the corresponding Ln{sup 3+} ion in the visible region. The emission intensity of this complex in coordinating solvent is higher than non-coordinating one. The suggested mechanism for the energy transfer between the ligand and Tb{sup 3+} ion is the intramolecular energy transfer mechanism. The interactions of the Tb(III) complex with fish salmon DNA are studied by fluorescence spectroscopy, circular dichroism study and viscosity measurements. The results of fluorescence titration reveal that DNA strongly quenches the intrinsic fluorescence of the complex through a static quenching procedure. The binding constant (K{sub b}) of the above metal complex at 25 °C is determined by the fluorescence titration method and it is found to be (8.06±0.01)×10{sup 3} M{sup −1}. The thermodynamic parameters (ΔH{sup 0}>0, ΔS{sup 0}>0 and ΔG{sup 0}<0) indicate that the hydrophobic interactions play a major role in DNA–Tb complex association. The results support the claim that the title complex bonds to FS-DNA by a groove mode. -- Highlights: • Photoluminescence of [Tb(phen){sub 2}Cl{sub 3}·OH{sub 2}] in different solvents are studied. • Tb(III) complex shows good binding affinity to FS DNA with K{sub b}=(8.06±0.01)×10{sup 3} M{sup −1}. • Viscosity of DNA almost unchanged by increasing amount of Tb complex. • CD spectrum of DNA has a little change with increasing amount of Tb complex. • Thermodynamic parameters indicate that the binding reaction is entropically driven.

  2. Poly[[aqua-?3-picolinato-?2-picolinato-dipicolinatopotassium(I)terbium(III)] 2.5-hydrate


    Filipe A. Almeida Paz; João Rocha; Jacek Klinowski; Tito Trindade; Nogueira,Helena I. S.; Soares-Santos, Paula C. R.; Cunha-Silva, Lu?s


    In the title compound, [KTb(C6H4NO2)4(H2O)]·2.5H2O, each Tb3+ centre is coordinated by four N and five O atoms from five distinct picolinate ligands in a geometry resembling a highly distorted tricapped trigonal prism. One of the ligands establishes a skew bridge between neighbouring Tb3+ centres, leading to the formation of one-dimensional anionic polymeric chains, {[(C6H4NO2)4Tb]−}n, running along the direction [010]. Each K+ cation is seven-coordinated by six O atoms from one an...

  3. Spin waves in terbium. III. Magnetic anisotropy at zero wave vector

    DEFF Research Database (Denmark)

    Houmann, Jens Christian Gylden; Jensen, J.; Touborg, P.


    The energy gap at zero wave vector in the spin-wave dispersion relation of ferromagnetic. Tb has been studied by inelastic neutron scattering. The energy was measured as a function of temperature and applied magnetic field, and the dynamic anisotropy parameters were deduced from the results....... The axial anisotropy is found to depend sensitively on the orientation of the magnetic moments in the basal plane. This behavior is shown to be a convincing indication of considerable two-ion contributions to the magnetic anisotropy at zero wave vector. With the exception of the sixfold basal...... the effects of zero-point deviations from the fully aligned ground state, and we tentatively propose polarization-dependent two-ion couplings as their origin....

  4. Structural and Magnetic Anisotropy in Amorphous Terbium-Iron Thin Films (United States)

    Hufnagel, Todd Clayton


    High density, removable media magnetooptic disk drives have recently begun to make significant gains in the information mass storage market. The media in these disks are amorphous rare-earth/transition-metal (RE-TM) alloys. One vital property of these materials is a large perpendicular magnetic anisotropy; that is, an easy axis of magnetization which is perpendicular to the plane of the film. A variety of theories, sometimes contradictory, have been proposed to account for this surprising presence of an anisotropic property in an amorphous material. Recent research indicates that there is an underlying atomic-scale structural anisotropy which is responsible for the observed magnetic anisotropy. Several different types of structural anisotropy have been proposed to account for the observed magnetic anisotropy, including pair-ordering anisotropy (anisotropic chemical short-range order) and bond orientation anisotropy (an anisotropy in coordination number or distances independent of chemical ordering). We have studied the structural origins of perpendicular magnetic anisotropy in amorphous Tb-Fe thin films by employing high-energy and anomalous dispersion x-ray scattering. The as-deposited films show a clear structural anisotropy, with a preference for Tb-Fe near neighbors to align in the out-of-plane direction. These films also have a large perpendicular magnetic anisotropy. Upon annealing, the magnetic anisotropy energy drops significantly, and we see a corresponding reduction in the structural anisotropy. The radial distribution functions indicate that the number of Tb-Fe near-neighbors increases in the in-plane direction, but does not change in the out-of-plane direction. Therefore, the distribution of Tb-Fe near-neighbors becomes more uniform upon annealing. We propose that the observed reduction in perpendicular magnetic anisotropy energy is a result of this change in structure. Our results support the pair -ordering anisotropy model of the structural anisotropy in amorphous Tb-Fe thin films. We see no evidence to support the bond orientation anisotropy model.

  5. Luminescence properties of terbium-doped Li3PO4 phosphor for ...

    Indian Academy of Sciences (India)

    Antonov-Romanovskii et al [2] firstly suggested applications of OSL for personal dosime- try. This technique got momentum for personnel dosime- try after the development of α-Al2O3:C. OSL properties of α-Al2O3:C have been investigated for personnel dosimetry, environmental dosimetry, medical dosimetry and space.

  6. Luminescence properties of terbium-doped Li3PO4 phosphor for ...

    Indian Academy of Sciences (India)

    The powder X-ray diffraction (PXRD), photoluminescence (PL) emission and excitation spectra, thermoluminescence (TL) and optically stimulated luminescence (OSL) were measured. The particle size was calculated using the Debye Scherrer formula and found to be 79.42 nm. PL emission spectra of Li 3 PO 4 :Tb 3 + ...

  7. Charge-transfer-based terbium MOF nanoparticles as fluorescent pH sensor for extreme acidity. (United States)

    Qi, Zewan; Chen, Yang


    Newly emerged metal organic frameworks (MOFs) have aroused the great interest in designing functional materials by means of its flexible structure and component. In this study, we used lanthanide Tb 3+ ions and small molecular ligands to design and assemble a kind of pH-sensitive MOF nanoparticle based on intramolecular-charge-transfer effect. This kind of made-to-order MOF nanoparticle for H + is highly specific and sensitive and could be used to fluorescently indicate pH value of strong acidic solution via preset mechanism through luminescence of Tb 3+ . The long luminescence lifetime of Tb 3+ allows eliminating concomitant non-specific fluorescence by time-revised fluorescence techniques, processing an advantage in sensing H + in biological media with strong autofluorescence. Our method showed a great potential of MOF structures in designing and constructing sensitive sensing materials for specific analytes directly via the assembly of functional ions/ligands. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Assessment of terbium (III) as a luminescent probe for the detection of tuberculosis biomarkers

    Energy Technology Data Exchange (ETDEWEB)

    Bamogo, W. [CNRS, IRAMIS, UMR 3685 NIMBE/LEDNA, F-91191 Gif-sur-Yvette (France); Mugherli, L. [CEA, IRAMIS, UMR 3685 NIMBE/LEDNA, F-91191 Gif-sur-Yvette (France); Banyasz, A. [CNRS, IRAMIS, LIDyL/Laboratoire Francis Perrin, URA 2453, F-91191 Gif-sur-Yvette (France); Novelli-Rousseau, A.; Mallard, F. [BioMérieux SA, F-38000 Grenoble (France); Tran-Thi, T.-H., E-mail: [CNRS, IRAMIS, UMR 3685 NIMBE/LEDNA, F-91191 Gif-sur-Yvette (France)


    A detection method for nicotinic acid, a specific metabolite marker of Mycobacterium tuberculosis present in cultures and patients' breath, is studied in complex solutions containing other metabolites and in biological media such as urine, saliva and breath condensate. The method is based on the analysis of the luminescence increase of Tb{sup 3+} complexes in the presence of nicotinic acid due to the energy transfer from the excited ligand to the lanthanide ion. It is shown that other potential markers found in M. tuberculosis culture supernatant, such as methyl phenylacetate, p-methyl anisate, methyl nicotinate and 2-methoxy biphenyl, can interfere with nicotinic acid via a competitive absorption of the excitation photons. A new strategy to circumvent these interferences is proposed with an upstream trapping of volatile markers preceding the detection of nicotinic acid in the liquid phase via the luminescence of Tb{sup 3+} complexes. The cost of the method is evaluated and compared with the Xpert MTB/RIF test endorsed by the World Health Organization. - Highlights: • Nicotinic acid, a specific marker of M. tuberculosis, can be detected via luminescence. • The detection limit with a commercial phosphorimeter is 0.4 µmol·L{sup -1}. • Other metabolites of M. tuberculosis can interfere via absorbed excitation light. • The interference can be removed via trapping of the most volatile metabolites. • A breath analysis procedure's cost is compared with the Xpert TBM/RIF test.

  9. A highly porous luminescent terbium-organic framework for reversible anion sensing

    Energy Technology Data Exchange (ETDEWEB)

    Wong, K.L.; Law, G.L.; Wong, W.T. [Department of Chemistry, The University of Hong Kong, Pokfulam Road, Hong Kong (China); Yang, Y.Y. [School of Chemistry and Chemical Engineering, Sun Yat-Sen University, Guangzhou 510275 (China)


    Unique tailored porous frameworks incorporating a lanthanide metal center have been designed to function as chemical detectors. A flexible multidentate ligand, mucic acid, is used to differentiate between several anions, thus creating an organic framework that is ideally suited for applications in gas separation, sensors, and chemical switches. (Abstract Copyright [2006], Wiley Periodicals, Inc.)

  10. Synthesis and characterization of wide bandgap semiconductors doped with terbium for electroluminescent devices


    Montañez Huamán, Liz Margarita


    En el presente trabajo de investigación se ha estudiado propiedades estequiometrias, estructurales y de emisión de luz de semiconductor de amplio ancho de banda dopados con terbio. La difracción de rayos-X en ángulo rasante confirma el estado amorfo de las películas. Los espectros de absorción infrarroja muestran la formación de óxidos en las películas y la espectroscopia de foto-electrones de rayos-X revela la formación de oxinitruro de aluminio y oxicarburo de silicio. Las pe...

  11. Synthesis and characterization of terbium-doped SrSnO3 pigments

    Czech Academy of Sciences Publication Activity Database

    Dohnalová, Ž.; Gorodylova, N.; Šulcová, P.; Vlček, Milan


    Roč. 40, č. 8 (2014), s. 12637-12645 ISSN 0272-8842 Institutional support: RVO:61389013 Keywords : pigments * solid state reaction * perovskites Subject RIV: CA - Inorganic Chemistry Impact factor: 2.605, year: 2014

  12. An optical material for the detection of β-hydroxybutyrate based on a terbium complex (United States)

    Wang, Xiaomiao; Chen, Huili; Li, Hua


    A novel Tb3+ complex (Tb(C14H10O4)ṡCl, TbL2) based on benzoic acid (L+H) was successfully synthesized, and gave a weak green emission in methanol-water (V:V, 4:1, pH 4.49). With the addition of β-hydroxybutyrate (β-HB) to a semi-aqueous solution of TbL2, an increment of the luminescent intensity at 545 nm assigned to 5D4 → 7F5 transition of Tb3+ was measured, which was evident to the naked eye. The response showed high selectivity for β-HB compared with other common anions including Cl-, NO3-, CO32-, PO43-, HPO42-, HPO4-, CO42-, PO74-, SO42-, lactate, AcO-, citrate, malate therefore it has the potential to be applied as a luminescent sensor for β-HB.

  13. KN167L01: WHOI cruise 167 leg 01 aboard the R/V Knorr from 2002-09-24 - 2002-09-28 (NODC Accession 0054766) (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Post-cruise download of raw data from shipboard computer(s) as furnished by the Woods Hole Oceanographic Institution Shipboard Scientific Support Group and archived...

  14. pH dependent photophysical studies of new europium and terbium complexes of tripodal ligand: Experimental and semiempirical approach

    Energy Technology Data Exchange (ETDEWEB)

    Akbar, Rifat [Department of Chemistry, Sant Longowal Institute of Engineering & Technology, Longowal, Punjab 148106 (India); Baral, Minati [Department of Chemistry, National Institute of Technology Kurukshetra, Haryana 136119 (India); Kanungo, B K, E-mail: [Department of Chemistry, Sant Longowal Institute of Engineering & Technology, Longowal, Punjab 148106 (India)


    The photophysical properties of adduct of a novel nonadentate tripodal ligand, 5,5′-(2-(((8-hydroxyquinolin-5-yl)methylamino)methyl)-2-methylpropane-1, 3-diyl)bis(azanediyl)bis(methylene diquinolin-8-ol, (TAME5OX), with Eu{sup 3+} and Tb{sup 3+} metal ions have been probed for photonics applications. The absorption spectroscopy of these complexes show remarkable spectral changes due to characteristic lanthanide transitions, which support the use of TAME5OX as a sensitive optical pH based sensor to detect Ln{sup 3+} metal ions in biological systems. In addition, these complexes have also been shown to exhibit strong green fluorescence allowing simultaneous sensing within the visible region under physiological pH in competitive medium for both Eu{sup 3+} and Tb{sup 3+} ions. The intense fluorescence from these compounds were revealed to intermittently get quenched under acidic as well as basic conditions due to the photoinduced intramolecular electron transfer from excited 8-hydroxyquinoline (8-HQ) moiety to metal ion, just an opposite process. This renders these compounds the OFF–ON–OFF type of pH-dependent fluorescent sensor. The thermodynamic stability and aqueous coordination chemistry of the chelator with the said lanthanide ions have also been probed by potentiometric, UV–visible and fluorescence spectrophotometric method. TAME5OX has been found to form two protonated complexes [Ln(H{sub 5}L)]{sup 5+} and [Ln(H{sub 4}L)]{sup 4+} below pH 2.5 with both metal ions, which consecutively deprotonates through one proton process with rise of pH. The formation constants (log β{sub 11n}) of neutral complexes have been determined to be 33.51 and 32.16 with pLn (pLn=−log[Ln{sup 3+}]) values of 16.14 and 19.48 for Eu{sup 3+} and Tb{sup 3+} ions, respectively, calculated at pH 7.4, indicating TAME5OX is a good lanthanide synthetic chelator. The emission lifetimes of the Eu{sup 3+} and Tb{sup 3+} complexes recorded in D{sub 2}O and H{sub 2}O suggest the presence of water molecules in the first coordination sphere of the metal ions. NMR titrations were carried out to determine the stoichiometry of chelates. The complexe's coordination geometries were optimized by using PM7 as sparkle/PM7 model. The theoretical electronic behavior was evaluated to support the experimental findings, based on ZINDO/S methodology at configuration interaction with single excitations (CIS) level. These results emphasize the capability of the use of the theoretical models in prediction of geometries and all other calculations of compounds containing lanthanide ions and create new interesting possibilities for the design in-silico of novel and highly efficient lanthanide–organic edifice. - Highlights: • Photophysical behavior of Eu{sup 3+} and Tb{sup 3+} complexes of TAME5OX has been investigated. • This tripodal ligand forms thermodynamically stable Ln{sup 3+} complexes. • These compounds exhibit strong green fluorescence under physiological pH. • Green fluorescence gets quenched under acidic and basic conditions, due to PET process. • This renders these compounds the OFF–ON–OFF type of pH-dependent fluorescent sensors.

  15. Visible photoluminescence in polycrystalline terbium doped aluminum nitride (Tb:AlN) ceramics with high thermal conductivity (United States)

    Wieg, A. T.; Kodera, Y.; Wang, Z.; Imai, T.; Dames, C.; Garay, J. E.


    Thermal management continues to be one of the major challenges in the development of high powered light sources such as solid state lasers. In particular, the relatively low thermal conductivity of standard photoluminescent (PL) materials limits the overall power output and/or duty cycle. We present a method based on current activated pressure assisted densification for the fabrication of high thermal conductivity PL materials: rare earth doped polycrystalline bulk aluminum nitride. Specifically, the ceramics are translucent and are doped with Tb3+, allowing for emission in the visible. Remarkably, the ceramics have a room temperature thermal conductivity of 94 W/(m K) which is almost seven times higher than that of the state of the art host material, Nd-doped yttrium aluminum garnet. These light emitting properties coupled with very high thermal conductivity should enable the development of a wide variety of more powerful light sources.

  16. Preparation of extractive resins for producing terbium-161; Preparacion de resinas extractivas para produccion de terbio-161

    Energy Technology Data Exchange (ETDEWEB)

    De la Cruz B, C. C.; Monroy G, F. [ININ, Carretera Mexico-Toluca s/n, 52750 Ocoyoacac, Estado de Mexico (Mexico)], e-mail:


    This paper presents the development of a methodology for extractive resins preparation to base of HDEHP, which allows to separation of Tb from Gd generating an own technology of preparation of these resins. The study included the extractive resins preparation from 6 different supports: kieselguhr Dg, alumina, red volcanic rock, chiluca, quarry and fluorite; two treatment types of of supports and varied concentrations of HDEHP extractant (di(2-etil hexyl) orthophosphoric acid), in order to determine which resin has improved efficiency of Gd and Tb separation, and radionuclide purity of {sup 161}Tb. Resins were prepared to base of kieselguhr to determine the most appropriate silicon deposition process. Two silicon deposition treatments were realized: treatment I , by contact with silicon deposition solution (dimethyldichlorosilane / heptane 1:30) and treatment II by contact with vapors of dimethyldichlorosilane in vacuum. The extractant retention was carried out to different concentrations of HDEHP / acetone: 1:4, 1:8, 1:15, 1:20, 1:30 and 1:40. According to the results, there is not direct relation of HDEHP concentration used in extractive resins preparation to base of kieselguhr over the efficiency of Gd and Tb separation and of radionuclide purity of {sup 161}Tb. The effect of support in the efficiency of Gd and Tb separation was studied to prepare resins with the supports kieselguhr, alumina, quarry, chiluca, volcanic rock and fluorite, using the silicon deposition treatment II for the supports and a concentration of HDEHP / acetone 1:20, for extractant retention. Only resins based on kieselguhr could separate to Gd from Tb quantitatively, the resin at a concentration of HDEHP / Acetone 1:20 was the best results obtained in Gd and Tb separation, achieving a separation efficiency greater than 90% and a radionuclide purity higher than 99%. (Author)

  17. Synthesis and Characterization of Europium(III) and Terbium(III) Complexes: An Advanced Undergraduate Inorganic Chemistry Experiment (United States)

    Swavey, Shawn


    Undergraduate laboratories rarely involve lanthanide coordination chemistry. This is unfortunate in light of the ease with which many of these complexes are made and the interesting and instructive photophysical properties they entail. The forbidden nature of the 4f transitions associated with the lanthanides is overcome by incorporation of…

  18. Sensitized green emission of terbium with dibenzoylmethane and 1, 10 phenanthroline in polyvinyl alcohol and polyvinyl pyrrolidone blends (United States)

    Kumar, Brijesh; Kaur, Gagandeep; Rai, S. B.


    Tb doped polyvinyl alcohol: polyvinyl pyrrolidone blends with dibenzoylmethane (DBM) and 1, 10 Phenanthroline (Phen) have been prepared by solution cast technique. Bond formation amongst the ligands and Tb3 + ions in the doped polymer has been confirmed employing Fourier Transform Infrared (FTIR) techniques. Optical properties of the Tb3 + ions have been investigated using UV-Vis absorption, excitation and fluorescence studies excited by different radiations. Addition of dimethylbenzoate and 1, 10 Phenanthroline to the polymer blend increases the luminescence from Tb3 + ions along with energy transfer from the polymer blend itself. Luminescence decay curve analysis affirms the non-radiative energy transfer from DBM and Phen to Tb3 + ions, which is identified as the reason behind this enhancement. The fluorescence decay time of PVA-PVP host decreases from 6.02 ns to 2.31 ns showing an evidence of energy transfer from the host blend to the complexed Tb ions. Similarly the lifetime of DBM and Phen and both in the blend reduces in the complexed system showing the feasibility of energy transfer from these excited DBM and Phen to Tb3 + and is proposed as the cause of the above observations. These entire phenomena have been explained by the energy level diagram.

  19. A Terbium Metal-Organic Framework for Highly Selective and Sensitive Luminescence Sensing of Hg2+Ions in Aqueous Solution. (United States)

    Xia, Tifeng; Song, Tao; Zhang, Gege; Cui, Yuanjing; Yang, Yu; Wang, Zhiyu; Qian, Guodong


    A series of isomorphic lanthanide metal-organic frameworks (MOFs) Ln(TATAB)⋅(DMF) 4 (H 2 O)(MeOH) 0.5 (LnTATAB, Ln=Eu, Tb, Sm, Dy, Gd; H 3 TATAB=4,4',4''-s-triazine-1,3,5-triyltri-p-aminobenzoic acid) have been solvothermally synthesized and structurally characterized. Among these MOFs, TbTATAB exhibits good water stability and a high fluorescence quantum yield. Because mercury ions (Hg 2+ ) have a high affinity to nitrogen atoms, and the space between multiple nitrogen atoms from triazine and imino groups is suitable for interacting with Hg 2+ ions, TbTATAB shows highly selective and sensitive detection of Hg 2+ in aqueous solution with a detection limit of 4.4 nm. Furthermore, it was successfully applied to detect Hg 2+ ions in natural water samples. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Yeast Interacting Proteins Database: YOR167C, YEL015W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available plays a role in mRNA decapping by specifically affecting the function of the decapping enzyme Dcp1p;...plays a role in mRNA decapping by specifically affecting the function of the decapping enzyme Dcp1p;...Co-induced by (YPD) - Co-repressed by (YPD) - Not affected by(YPD) - Interologs - Expression similarity

  1. SU-F-J-167: Use of MR for Permanent Prostate Implant Preplanning

    Energy Technology Data Exchange (ETDEWEB)

    Narayana, V; McLaughlin, P [Assarian Cancer Center, Novi, MI (United States); University of Michigan, Ann Arbor, MI (United States); Yao, B [Assarian Cancer Center, Novi, MI (United States)


    Purpose: To study the feasibility using MR imaging to improve target definition on ultrasound during permanent prostate implants and aid in source strength determination for treatment planning in the OR. Methods: Patients who receive permanent prostate implants undergo MR and CT imaging prior to the implant procedure to determine the volume of the prostate, bony restriction to the procedure, bladder extension, external sphincter length and neurovascular bundle. The volume of the prostate is generally used to order seeds for the procedure. In 10 patients, the MR was used as the preplanning study with the PTV defined as a 2 mm expansion of the MR prostate in all directions except the posterior. Various dose volume parameters for the MR prostate and the PTV were compared to the actual preplan developed and executed in the OR. In addition, there parameters were compared to the post implant dosimetry performed 3 weeks after the implant procedure. Results: The results show that the number of seeds used using MR and US (ultrasound) planning was generally with 2 seeds and the maximum difference was 7 seeds. There is no significant difference between any of the dose index parameters of V100, V150, V200, D99 and D90 parameters between MR planning, US planning and postimplant evaluation There was a significant difference between planned D99 (avg of 105%) and achieved D99 (avg 91%). Conclusion: MR imaging is an invaluable tool to improve target definition for permanent prostate implants. Use of MR images for preplanning improves the confidence with which source can be ordered for the procedure that is OR planned. Ordering a maximum of 10 seeds more than planned would be sufficient to deliver a plan in the OR using US. Moving ahead to non-rigid registration between MR ad US images could further increase the confidence level of MR planning.

  2. Page 1 Bull, Mater. Sci., Vol. 3, Number 2, July 1981, pp. 163-167. C ...

    Indian Academy of Sciences (India)

    The importance of 3d core-level photoemission studies in the understanding of valence fluctuation phenomenon has been emphasized. Keywords. Photoemission spectra; ESCA; XPS; rare earth intermetallics; valence fluctuation. 1. Introduction. Rare-earths include a group of lanthanides (La to Lu) with atomic numbers, Z= ...

  3. 46 CFR 167.45-1 - Steam, carbon dioxide, and halon fire extinguishing systems. (United States)


    ... 46 Shipping 7 2010-10-01 2010-10-01 false Steam, carbon dioxide, and halon fire extinguishing....45-1 Steam, carbon dioxide, and halon fire extinguishing systems. (a) General requirements. (1...-extinguishing system. On such vessels contracted for prior to January 1, 1962, a steam smothering system may be...

  4. Intrinsic gK factors of odd-mass 167−179Lu isotopes

    Indian Academy of Sciences (India)

    Phys. J. A3, 225 (1998)) using the spin matrix elements. The theoretical predictions for the gK factors exhibit good agreement with the experimental gK factors with increasing mass number A of the lutetium isotopes. The strongest influence of the neutron–proton spin interaction occurs at q = −1. Sufficient agreement between.

  5. Yeast Interacting Proteins Database: YOR167C, YOL149W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available is bait as prey (0) YOL149W DCP1 Subunit of the Dcp1p-Dcp2p decapping enzyme complex, which removes the 5' c... DCP1 Prey description Subunit of the Dcp1p-Dcp2p decapping enzyme complex, which removes

  6. Practice Bulletin No. 167 Summary: Gynecologic Care for Women and Adolescents With Human Immunodeficiency Virus. (United States)


    In the United States in 2013, there were an estimated 226,000 women and adolescents living with human immunodeficiency virus (HIV) infection (1). Women with HIV are living longer, healthier lives, so the need for routine and problem-focused gynecologic care has increased. The purpose of this document is to educate clinicians about basic health screening and care, family planning, prepregnancy care, and managing common gynecologic problems for women and adolescents who are infected with HIV. For information on screening guidelines, refer to the American College of Obstetricians and Gynecologists' Committee Opinion No. 596, Routine Human Immunodeficiency Virus Screening (2).

  7. Ce que nous faisons | Page 167 | CRDI - Centre de recherches pour ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Modèles commerciaux libres (Amérique latine). Le Centro de Tecnologia e Sociedade (CTS - centre pour la technologie et la société) fait partie de la Faculté de droit de la Fundação Getulio Vargas à Rio de Janeiro. Brésil, Amérique Du Sud, Nigéria, Nord Du Sahara, Sud Du Sahara, Amérique Nord Et Centrale. PROJECT ...

  8. smzh-Ethiop. 1. Sci" 24(2):167-184, 2001

    African Journals Online (AJOL)

    have strong bearing on the occurrence and movement of the groundwater. The major flow systems and groundwater flux into the lakes are controlled strongly by rift faults. Key words/phrases; Groundwater flow, groundwater modeling, hydrogeology, Rift lakes, water balance. INTRODUCTION. The studied area is a closed ...

  9. 46 CFR 167.20-15 - Scupper, sanitary and similar discharges. (United States)


    ... PUBLIC NAUTICAL SCHOOL SHIPS Hull Requirements, Construction and Arrangement of Nautical School Ships... discharges which lead through the ship's hull shall be fitted with efficient means for preventing the ingress...

  10. Detail of the star WR124 and the surrounding nebula M1-67. (United States)


    The massive, hot central star is known as a Wolf-Rayet star. This extremely rare and short-lived class of super-hot star is going through a violent, transitional phase characterized by the fierce ejection of mass. The blobs may result from the furious stellar wind that does not flow smoothly into space but has instabilities which make it clumpy. This black and white image was made in the light of atomic hydrogen. The contrast has been increased to emphasize the fine detail in the nebula near the central star. Credit: Yves Grosdidier (University of Montreal and Observatoire de Strasbourg), Anthony Moffat (Universitie de Montreal), Gilles Joncas (Universite Laval), Agnes Acker (Observatoire de Strasbourg), and NASA

  11. 46 CFR 167.55-5 - Marking of fire and emergency equipment. (United States)


    ...) General alarm bell switch. The general alarm bell switch in the pilot-house or fire control station shall... background: “General Alarm.” (b) General alarm bells. General alarm bells shall be marked in not less than 1/2-inch red letters: “General Alarm—When Bell Rings Go to Your Station.” (c) Steam, foam or CO 2 fire...

  12. Roman General’s Attitude against the enemy (200-167 BC: Three Case Studies

    Directory of Open Access Journals (Sweden)



    Full Text Available This paper aims to analyze jointly the campaigns led by three magistrates (l. Emilio Paulo, Q. Fulvius Flaccus and ti. Gracchus who took part in Hispania as praetores and subsequently developed their consulates in different territories, focusing specifically on the terms imposed on surrendered enemies. the objective is to determine the existence of an evolution of the modus operandi of the imperatores throughout their military career, taking into account the attitude towards the surrendered enemies, and linking this evolution to the general framework of aristocratic rivalry.

  13. 26 CFR 1.167(a)-7 - Accounting for depreciable property. (United States)


    ..., unadjusted for depreciation or salvage, shall be removed from the asset account and shall be charged to the depreciation reserve. Amounts representing salvage ordinarily are credited to the depreciation reserve. Where... asset shall be removed from the asset account, and the depreciation reserve shall be charged with the...

  14. SU-E-J-167: Dosimetric Consequences From Minimal Displacements in APBI with SAVI Applicators

    Energy Technology Data Exchange (ETDEWEB)

    Chandrasekara, S; Dumitru, N [Bucharest (Romania); Hyvarinen, M [Florida Atlantic University, Boca Raton, FL (United States); Pella, S [South Florida Radiation Oncology, Boca Raton, FL (United States)


    Purpose: To determine the importance of providing proper solid immobilization in every fraction of treatment in APBI with brachytherapy. Methods: 125 patients treated with APBI brachytherapy with SAVI applicators at SFRO Boca Raton, from 2013–2015 were considered for this retrospective study. The CT scans of each patient, which were taken before each treatment, were imported in to the Oncentra treatment planning system. Then they were compared with the initial CT scan which was used for the initial plan. Deviation in displacements in reference to ribs and skin surface was measured and dosimetric evaluations respective to the initial image were performed. Results: Small deviations in displacements were observed from the SAVI applicator to the ribs and the skin surface. Dosimetric evaluations revealed, very small changes in the inter-fractionation position make significant differences in the maximum dose to critical organs. Additionally, the volume of the cavity also changed between fractions. As a Result, the maximum dose manifested variance between 10% and 32% in ribs and skin surface respectively. Conclusion: It appears that taking a CT scan before each treatment is necessary to minimize the risk of delivering undesired high doses to the critical organs. This study indicates, in 30% of the cases re-planning was necessary between treatments. We conclude that, treatment planning teams should evaluate the placement of the device by analyzing the CT images before each treatment and they must be prepared for re-planning if needed. This study also reveals the urgent need of improving the immobilization methods with APBI when treating with the SAVI applicator.

  15. MO-A-BRC-00: TG167: Clinical Recommendations for Innovative Brachytherapy Devices and Applicators

    Energy Technology Data Exchange (ETDEWEB)



    Although a multicenter, Phase III, prospective, randomized trial is the gold standard for evidence-based medicine, it is rarely used to evaluate innovative radiotherapy devices because of many practical and ethical reasons. It is usually sufficient to compare the dose distributions and dose rates for determining equivalence of the innovative device to an existing one. Thus, quantitative evaluation of the dosimetric characteristics of an innovative brachytherapy device or application is a critical part in which physicists are actively involved. The physicist’s role, along with physician colleagues, in this process is highlighted for innovative products or applications and includes evaluation of 1) dosimetric considerations for clinical implementation (including calibrations, dose calculations, and radiobiological aspects) to comply with existing societal dosimetric prerequisites for sources in routine clinical use, 2) risks and benefits from regulatory and safety perspectives, and 3) resource assessment and preparedness. Further, calibration methods should be traceable to a primary standards dosimetry laboratory such as NIST in the U.S. or to other primary standards dosimetry laboratory located elsewhere. Clinical users should follow standards as approved by their country’s regulatory agencies that approved such a brachytherapy device. Integration of this system into the medical source calibration infrastructure of secondary standard dosimetry laboratories such as the ADCLs is encouraged before a source is introduced into widespread routine clinical use. The AAPM and GEC-ESTRO have developed guidelines for the safe and consistent application of brachytherapy using innovative brachytherapy devices and applications. The current report covers regulatory approvals, calibration, dose calculations, radiobiological issues, and overall safety concerns that should be addressed during the commissioning stage preceding clinical use. These guidelines are based on review of requirements of the U.S. NRC, FDA, Department of Transportation, International Electrotechnical Commission Medical Electrical Equipment Standard 60601, European Commission for CE Marking, and institutional review boards and radiation safety committees. Learning Objectives: Understand the necessary dosimetric considerations for clinical implementation (including calibrations, dose calculations, and radiobiological aspects) to comply with existing societal dosimetric prerequisites for sources in routine clinical use. Evaluate risks and benefits from regulatory and safety perspectives. Identify necessary resources and create a plan for clinical introduction of innovative brachytherapy device or applications. Consultant for Theragenics Corp.; R. Nath, Consultant to Theragenics Corp.

  16. 46 CFR 167.01-1 - Basis and purpose of part. (United States)


    ... uniform application. This part is not applicable to civilian nautical school ships. ... Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) NAUTICAL SCHOOLS PUBLIC NAUTICAL SCHOOL... are prescribed and apply to public nautical school ships, except vessels of the Navy or Coast Guard...

  17. Yeast Interacting Proteins Database: YDL167C, YBL081W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available this prey as bait (0) Literature on bait (YPD) 5 Literature on prey (YPD) 5 Literature shared by bait and...and prey 2 Literature sharing score 2 CuraGen (0 or 1) 0 S. Fields (0 or 1) 0 Association (0 or 1,YPD)

  18. Controlling Shareholder and Tax Avoidance: Family Ownership and Corporate Governance (P. 167-180

    Directory of Open Access Journals (Sweden)

    Masripah Masripah


    Full Text Available The objective of this study is to analyze the entrenchment effect of controlling shareholder on tax avoidance, as well as looking at the role of family ownership, commissioner effectiveness, audit committee effectiveness and external audit quality. This research is a quantitative research using fixed effects model. Sample of this research is 70 firms with an observation period of 2010 until 2013. This study finds that the entrenchment effect of controlling shareholder has negative effect on tax avoidance. Other test results show that when a family is the controlling shareholder, entrenchment effect of controlling shareholder do not affect on tax avoidance. Board of commissioner and committee effectiveness proved to weaken the relationship between entrenchment effect of controlling shareholder and tax avoidance. However, the role of external quality audit does not prove to weaken the relationship between the entrenchment effect of controlling shareholder and tax avoidance. Keywords: controlling shareholder;commissioner; audit committee; external audit; tax avoidance

  19. December, 2013 ISSN 1119-944X 167 Rice Production under the ...

    African Journals Online (AJOL)


    Primary data were collected through the use of structured questionnaires and personal interview. ... Keywords: Rice Production, Youth Empowerment Scheme, Agricultural Transformation. Introduction. Nigeria is ... production in line with the rice implementation action plan (Transforming the Nigerian. Agricultural Landscape ...

  20. December, 2013 ISSN 1119-944X 167 Rice Production under the ...

    African Journals Online (AJOL)


    responsible and self-reliant, via agriculture, business and skill acquisitions through technical and managerial training. .... Female. 10.0. 12.5. Total. 100.0. 100.0. Marital status. Single. 37.5. 17.5. Married. 62.5. 82.5. Total. 100.0. 100.0. Occupation. Farming. 62.5. 70.0. Trading. 5.0. 2.5. Artisan. 2.5. 7.5. Civil servant. 25.0.

  1. Yeast Interacting Proteins Database: YDL167C, YBR212W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available ances its degradation; overexpression impairs mitochondrial function; expressed in stationary phase Rows wit...ial porin (POR1) mRNA and enhances its degradation; overexpression impairs mitochondrial function; expressed

  2. Anti-L1CAM radioimmunotherapy is more effective with the radiolanthanide terbium-161 compared to lutetium-177 in an ovarian cancer model

    Energy Technology Data Exchange (ETDEWEB)

    Gruenberg, Juergen; Lindenblatt, Dennis; Cohrs, Susan; Fischer, Eliane [Paul Scherrer Institute, Center for Radiopharmaceutical Sciences ETH-PSI-USZ, Villigen (Switzerland); Dorrer, Holger [Paul Scherrer Institute, Laboratory of Radiochemistry and Environmental Chemistry, Villigen (Switzerland); Zhernosekov, Konstantin [ITG Isotope Technologies Garching GmbH, Garching (Germany); Koester, Ulli [Institut Laue-Langevin, Grenoble (France); Tuerler, Andreas [Paul Scherrer Institute, Laboratory of Radiochemistry and Environmental Chemistry, Villigen (Switzerland); University of Bern, Department of Chemistry and Biochemistry, Berne (Switzerland); Schibli, Roger [Paul Scherrer Institute, Center for Radiopharmaceutical Sciences ETH-PSI-USZ, Villigen (Switzerland); ETH Zurich, Department of Chemistry and Applied Biosciences, Zurich (Switzerland)


    The L1 cell adhesion molecule (L1CAM) is considered a valuable target for therapeutic intervention in different types of cancer. Recent studies have shown that anti-L1CAM radioimmunotherapy (RIT) with {sup 67}Cu- and {sup 177}Lu-labelled internalising monoclonal antibody (mAb) chCE7 was effective in the treatment of human ovarian cancer xenografts. In this study, we directly compared the therapeutic efficacy of anti-L1CAM RIT against human ovarian cancer under equitoxic conditions with the radiolanthanide {sup 177}Lu and the potential alternative {sup 161}Tb in an ovarian cancer therapy model. Tb was produced by neutron bombardment of enriched {sup 160}Gd targets. {sup 161}Tb and {sup 177}Lu were used for radiolabelling of DOTA-conjugated antibodies. The in vivo behaviour of the radioimmunoconjugates (RICs) was assessed in IGROV1 tumour-bearing nude mice using biodistribution experiments and SPECT/CT imaging. After ascertaining the maximal tolerated doses (MTD) the therapeutic impact of 50 % MTD of {sup 177}Lu- and {sup 161}Tb-DOTA-chCE7 was evaluated in groups of ten mice by monitoring the tumour size of subcutaneous IGROV1 tumours. The average number of DOTA ligands per antibody was 2.5 and maximum specific activities of 600 MBq/mg were achieved under identical radiolabelling conditions. RICs were stable in human plasma for at least 48 h. {sup 177}Lu- and {sup 161}Tb-DOTA-chCE7 showed high tumour uptake (37.8-39.0 %IA/g, 144 h p.i.) with low levels in off-target organs. SPECT/CT images confirmed the biodistribution data. {sup 161}Tb-labelled chCE7 revealed a higher radiotoxicity in nude mice (MTD: 10 MBq) than the {sup 177}Lu-labelled counterpart (MTD: 12 MBq). In a comparative therapy study with equitoxic doses, tumour growth inhibition was better by 82.6 % for the {sup 161}Tb-DOTA-chCE7 than the {sup 177}Lu-DOTA-chCE7 RIT. Our study is the first to show that anti-L1CAM {sup 161}Tb RIT is more effective compared to {sup 177}Lu RIT in ovarian cancer xenografts. These results suggest that {sup 161}Tb is a promising candidate for future clinical applications in combination with internalising antibodies. (orig.)

  3. CCDC 954774: Experimental Crystal Structure Determination : Dimethylammonium tri-terbium tris(4'-(tetrazol-2-id-5-yl)biphenyl-4-carboxylate) tetrahydroxide trihydrate unknown solvate

    KAUST Repository

    Xue, Dongxu


    An entry from the Cambridge Structural Database, the world’s repository for small molecule crystal structures. The entry contains experimental data from a crystal diffraction study. The deposited dataset for this entry is freely available from the CCDC and typically includes 3D coordinates, cell parameters, space group, experimental conditions and quality measures.

  4. CCDC 959634: Experimental Crystal Structure Determination : octakis(mu~3~-Hydroxo)-undecakis(mu~2~-2-fluorobenzoato)-(N,N-dimethylformamide)-nitrato-hexa-aqua-hexa-terbium

    KAUST Repository

    Guillerm, Vincent


    An entry from the Cambridge Structural Database, the world’s repository for small molecule crystal structures. The entry contains experimental data from a crystal diffraction study. The deposited dataset for this entry is freely available from the CCDC and typically includes 3D coordinates, cell parameters, space group, experimental conditions and quality measures.

  5. CCDC 954773: Experimental Crystal Structure Determination : Dimethylammonium tri-terbium tris(4-(tetrazol-2-id-5-yl)benzoate) tetrahydroxide trihydrate unknown solvate

    KAUST Repository

    Xue, Dongxu


    An entry from the Cambridge Structural Database, the world’s repository for small molecule crystal structures. The entry contains experimental data from a crystal diffraction study. The deposited dataset for this entry is freely available from the CCDC and typically includes 3D coordinates, cell parameters, space group, experimental conditions and quality measures.

  6. CCDC 954775: Experimental Crystal Structure Determination : Dimethylammonium tri-terbium tris(2-fluoro-4-(1H-tetrazol-5-yl)benzoate) tetrahydroxide tetradecahydrate

    KAUST Repository

    Xue, Dongxu


    An entry from the Cambridge Structural Database, the world’s repository for small molecule crystal structures. The entry contains experimental data from a crystal diffraction study. The deposited dataset for this entry is freely available from the CCDC and typically includes 3D coordinates, cell parameters, space group, experimental conditions and quality measures.

  7. CCDC 1411423: Experimental Crystal Structure Determination : catena-[dimethylammonium hexakis(mu-fumarato)-octakis(mu-hydroxo)-hexa-terbium N,N-dimethylformamide solvate hexahydrate

    KAUST Repository

    Assen, Ayalew H.


    An entry from the Cambridge Structural Database, the world’s repository for small molecule crystal structures. The entry contains experimental data from a crystal diffraction study. The deposited dataset for this entry is freely available from the CCDC and typically includes 3D coordinates, cell parameters, space group, experimental conditions and quality measures.

  8. CCDC 1410946: Experimental Crystal Structure Determination : catena-[dimethylammonium tris(mu-naphthalene-1,4-dicarboxylato)-tetrakis(mu-hydroxo)-triaqua-tri-terbium(iii) unknown solvate

    KAUST Repository

    Xue, Dongxu


    An entry from the Cambridge Structural Database, the world’s repository for small molecule crystal structures. The entry contains experimental data from a crystal diffraction study. The deposited dataset for this entry is freely available from the CCDC and typically includes 3D coordinates, cell parameters, space group, experimental conditions and quality measures.

  9. Phthalimides: Supramolecular Interactions in Crystals, Hypersensitive Solution 1H-NMR Dynamics and Energy Transfer to Europium(III and Terbium(III States

    Directory of Open Access Journals (Sweden)

    David J. Williams


    Full Text Available Detailed crystal structures and 1H-NMR characteristics of some alkylaminephthalimides, including dendritic polyphthalimides, are reported. These investigations were undertaken in order to obtain a better understanding of the relationship between solid-state supramolecular interactions, their persistence in solution and associated dynamics of magnetically hypersensitive phthalimide aromatic AA'BB'-AA'XX' proton NMR resonances. Some alkylamine phthalimides feature folded molecular geometries, which we attribute to n-π interactions among proximal amine-phthalimide sites; those alkylamine-phthalimides that have no possibility for such interactions feature fully extended phthalimide functionalities. Accordingly, alkylamine phthalimide compounds with folded solid-state geometries feature solvent and temperature dependent hypersensitive AA'BB'-AA'XX' 1H-NMR line profiles, which we attribute to the n-π interactions. Luminescence of Eu3+(5D0 and Tb3+(5D4 states show well defined metal ion environments in their complexes with dendritic phthalimides, as well as relatively weak phthalimide-lanthanide(III interactions.

  10. Analysis of tryptophan at nmoll(-1) level based on the fluorescence enhancement of terbium-gadolinium-tryptophan-sodium dodecyl benzene sulfonate system. (United States)

    Liu, Shufang; Yang, Jinghe; Wu, Xia; Su, Benyu; Sun, Changxia; Wang, Feng


    It is found that Tb(3+) can react with tryptophan (Trp) and sodium dodecyl benzene sulfonate (SDBS), and emits the intrinsic fluoresence of Tb(3+). The fluorescence intensity can be enhanced by La(3+), Gd(3+), Lu(3+), Sc(3+) and Y(3+), among which Gd(3+) has the greatest enhancement. This is a new co-luminescence system. The studies indicate that in the Tb-Gd-Trp-SDBS system, there is both Tb-Trp-SDBS and Gd-Trp-SDBS complexes, and they aggregate together and form a large congeries. The fluorescence enhancement of the Tb-Gd-Trp-SDBS system is considered to originate from intramolecular and intermolecular energy transfers, and the energy-insulating sheath effect of Gd-Trp-SDBS complex. Under the optimum conditions, the enhanced intensity of fluorescence is in proportion to the concentration of Trp in the range from 4x10(-8) to 4x10(-5)moll(-1). The detection limit is 10(-9)moll(-1). The proposed method is one of the most sensitive fluoremetries of Trp.

  11. Preparation, characterization, and properties of PMMA-doped polymer film materials: a study on the effect of terbium ions on luminescence and lifetime enhancement. (United States)

    Zhang, Hui-Jie; Fan, Rui-Qing; Wang, Xin-Ming; Wang, Ping; Wang, Yu-Lei; Yang, Yu-Lin


    Poly(methylmethacrylate) (PMMA) doped with Tb-based imidazole derivative coordination polymer {[Tb(3)(L)(μ(3)-OH)(7)]·H(2)O}(n) (1) (L = N,N'-bis(acetoxy)biimidazole) was synthesized and its photophysical properties were studied. The L'(L' = N,N'-bis(ethylacetate)biimidazole) ligand was synthesized by an N-alkylation reaction process followed by ester hydrolysis to produce ligand L. Polymer 1 and ligand L' have been characterized by (1)H NMR and IR spectroscopy, elemental analysis, PXRD and X-ray single-crystal diffraction. Coordination polymer 1 is the first observation of a CdCl(2) structure constructed with hydroxy groups and decorated by ligand L in lanthanide N-heterocyclic coordination polymers. In the 2D layered structure of 1, each Tb3 metal center is connected with three Tb1 and three Tb2 metal centers by seven hydroxyl groups in different directions, resulting in a six-membered ring. After doping, not only the luminescence intensity and lifetime enhanced, but also their thermal stability was increased in comparison with 1. When 1 was doped into poly(methylmethacrylate) (1@PMMA), polymer film materials were formed with the PMMA polymer matrix (w/w = 2.5%-12.5%) acting as a co-sensitizer for Tb(3+) ions. The luminescence intensity of the Tb(3+) emission at 544 nm increases when the content of Tb(3+) was 10%. The lifetime of 1@PMMA (914.88 μs) is more than four times longer than that of 1 (196.24 μs). All τ values for the doped polymer systems are higher than coordination polymer 1, indicating that radiative processes are operative in all the doped polymer films. This is because PMMA coupling with the O-H oscillators from {[Tb(3)(L)(μ(3)-OH)(7)]·H(2)O}(n) can suppress multiphonon relaxation. According to the variable-temperature luminescence (VT-luminescence) investigation, 1@PMMA was confirmed to be a stable green luminescent polymer film material.

  12. Changing Single-Molecule Magnet Properties of a Windmill-Like Distorted Terbium(III) α-Butoxy-Substituted Phthalocyaninato Double-Decker Complex by Protonation/Deprotonation. (United States)

    Horii, Yoji; Horie, Yusuke; Katoh, Keiichi; Breedlove, Brian K; Yamashita, Masahiro


    Synthesis, structures, and magnetic properties of α-butoxy-substituted phthalocyaninato double-decker complexes Tb(α-obPc)2 (1-) (α-obPc: dianion of 1,4,8,11,15,18,22,25-octa(n-butoxy)phthalocyaninato) with protonated (1H), deprotonated (1[HDBU]), and diprotonated forms (1H2+) are discussed. X-ray analysis was used to confirm the position of the proton in 1H, and it was revealed that the protonation induced asymmetric distortion in 1H. In contrast, 1[HDBU] was distorted in a highly symmetric windmill-like fashion. 1H is arranged in a slipped column array in the crystal packing, whereas 1[HDBU] is arranged in a one-dimensional fashion, in which the magnetic easy axes of 1[HDBU] lie along the same line. From direct-current (dc) magnetic measurements, ferromagnetic Tb-Tb interactions occur in both 1H and 1[HDBU], and magnetic hysteresis was observed. However, the area of the magnetic hysteresis in 1[HDBU] is larger than that in 1H, meaning that magnetic relaxation time (τ) is longer in 1[HDBU]. In addition, the results of alternating-current magnetic measurements in a zero dc magnetic field indicate that τ of 1[HDBU] is longer as compared to 1H. In other words, protonation/deprotonation affects not only the molecular structures and crystal packing but also the single-molecule magnet properties.

  13. A Water-Stable Dual-Channel Luminescence Sensor for UO22+Ions Based on an Anionic Terbium(III) Metal-Organic Framework. (United States)

    Ye, Junwei; Bogale, Raji F; Shi, Yangwei; Chen, Yanzhen; Liu, Xigang; Zhang, Siqi; Yang, Yaoyao; Zhao, Jianzhang; Ning, Guiling


    A stable 3D Tb III -based metal-organic framework [Tb(BPDC) 2 ]⋅(CH 3 ) 2 NH 2 (DUT-101) was synthesized, and it is the first efficient dual-channel luminescence sensor for aqueous UO 2 2+ ions. DUT-101 contains an anionic three-dimensional framework and protonated dimethylamine molecules embedded within the channels. The intense green emission of DUT-101 could be highly selectively and sensitively quenched by UO 2 2+ ions even in the presence of other competing metal ions. A possible sensing mechanism was proposed based on both suppression of luminescence resonance energy transfer and enhancement of intermolecular electron transfer. Furthermore, visual green fluorescent test papers based on DUT-101 were fabricated and could be used to discriminate UO 2 2+ ions among various metal ions. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. [?-N,N?-Bis(3-meth?oxy-2-oxidobenzyl?idene)propane-1,3-diamine]trinitratocopper(II)terbium(III) acetone solvate


    Zhang Fang; Liu Fei


    In the title complex, [CuTb(C19H20N2O4)(NO3)3]·CH3COCH3, the CuII atom is four-coordinated by two O atoms and two N atoms from the deprotonated Schiff base in a square-planar geometry, while the TbIII atom is ten-coordinated by four O atoms from the deprotonated Schiff base and six O atoms from three bidentate nitrate anions. The compound is isostructural with the previously reported GdIII analogue [Elmali & Elerman (2004). Z. Naturforsch. Teil B, 59, 535–540], which was described ...

  15. Crystal structure of a mixed-ligand terbium(III coordination polymer containing oxalate and formate ligands, having a three-dimensional fcu topology

    Directory of Open Access Journals (Sweden)

    Chainok Kittipong


    Full Text Available The title compound, poly[(μ3-formato(μ4-oxalatoterbium(III], [Tb(CHO2(C2O4]n, is a three-dimensional coordination polymer, and is isotypic with the LaIII, CeIII and SmIII analogues. The asymmetric unit contains one TbIII ion, one formate anion (CHO2− and half of an oxalate anion (C2O42−, the latter being completed by application of inversion symmetry. The TbIII ion is nine-coordinated in a distorted tricapped trigonal–prismatic manner by two chelating carboxylate groups from two C2O42− ligands, two carboxylate oxygen atoms from another two C2O42− ligands and three oxygen atoms from three CHO2− ligands, with the Tb—O bond lengths and the O—Tb—O bond angles ranging from 2.4165 (19 to 2.478 (3 Å and 64.53 (6 to 144.49 (4°, respectively. The CHO2− and C2O42− anions adopt μ3-bridging and μ4-chelating-bridging coordination modes, respectively, linking adjacent TbIII ions into a three-dimensional 12-connected fcu topology with point symbol (324.436.56. The title compound exhibits thermal stability up to 623 K, and also displays strong green photoluminescence in the solid state at room temperature.

  16. Measurement of the Bi209(n,4n)Bi206 and Tm169(n,3n)Tm167 cross sections between 23.5 and 30.5 MeV relevant to reaction-in-flight neutron studies at the National Ignition Facility

    Energy Technology Data Exchange (ETDEWEB)

    Gooden, M. E.; Bredeweg, T. A.; Champine, B.; Combs, D. C.; Finch, S.; Hayes-Sterbenz, A.; Henry, E.; Krishichayan,; Rundberg, R.; Tornow, W.; Wilhelmy, J.; Yeamans, C.


    At the National Ignition Facility, experiments are being performed to measure charged-particle stopping powers in the previously unexplored warm dense plasma regime. These measurements are done using reaction-in-flight (RIF) neutrons from an inertial confinement fusion system. RIF neutrons are produced with a continuum of energies up to 30 MeV. By making activation measurements utilizing threshold reactions for neutrons in the energy range of 15 < E n < 30 MeV , the number of RIF neutrons can be determined and from this the stopping power of the deuterium and tritium ions that produced the RIF neutrons can be inferred. Currently, the 169 Tm ( n , 3 n ) 167 Tm reaction has been used. However, in an effort to provide a secondary complimentary measurement, efforts are underway to make use of the 209 Bi ( n , 4 n ) 206 Bi reaction, with a threshold of 22.5 MeV. The cross sections were measured at the 10 MV tandem Van De Graaff accelerator at the Triangle Universities Nuclear Laboratory with quasimonoenergetic neutrons between 23.5 and 30.5 MeV, where few previous measurements have been made. Cross-section data are compared to calculations and other available measurements.

  17. How Husbands Cope When Pregnancy Fails: A Longitudinal Study of Infertility and Psychosocial Generativity. Working Paper No. 167. (United States)

    Snarey, John; And Others

    The experience of marital infertility is a major biosocial life crisis that also represents a serious threat to the development of psychosocial generativity. Psychological studies of the consequences of involuntary infertility, however, are rare. A study was undertaken to identify variations in the coping patterns used by men who have experienced…

  18. FCJ-167 Spraying, fishing, looking for trouble: The Chinese Internet and a critical perspective on the concept of trolling

    Directory of Open Access Journals (Sweden)

    Gabriele de Seta


    Full Text Available Internet research has dealt with trolls from many different perspectives, framing them as agents of disruption, nomadic hate breeders and lowbrow cynics spawned by the excessive freedoms of online interaction, or as legitimate and necessary actors in the ecology of online communities. Yet, the question remains: what is a troll, where it come from and where does it belong? Presenting the results of a brief troll-hunt on the Chinese Internet and discussing the features of troll-like figures in Chinese digital folklore, I argue in favour of a localised understanding of Internet cultures, presenting trolling as a culture-specific construct that has come to embody disparate kinds of online behaviour and to function as an umbrella term for different kinds of discourse about the Internet itself.

  19. 46 CFR 167.01-7 - Ocean or unlimited coastwise vessels on inland and Great Lakes routes. (United States)


    ... vessels on inland and Great Lakes routes. (a) Vessels inspected and certificated for ocean or unlimited... are concerned on any inland route, including the Great Lakes. ... 46 Shipping 7 2010-10-01 2010-10-01 false Ocean or unlimited coastwise vessels on inland and Great...

  20. Jewish Literature and History Between the War of the Maccabees (167 BC and the Bar Kochba Rebellion (135 AC

    Directory of Open Access Journals (Sweden)

    Ricardo Martínez Lacy


    Full Text Available Droysen postuló la existencia de una época helenística en la que se dio la fusión de la cultura europea clásica y la asiática oriental. Le dio ese nombre, que se encuentra atestado por primera vez en el segundo libro de los Macabeos (4.13, donde designa la adopción de la cultura, la manera de pensar y el idioma griegos (Bichler: 5-22. El resultado de esa síntesis, según el mismo autor, fue el cristianismo. En este proceso, es importante la literatura porque desde su origen el judaísmo se ha regido e, incluso, se define por medio de una ley escrita a la cual se le fueron agregando libros, algunos aceptados como canónicos, que fueron formando la Biblia, y otros no, los Apócrifos del Antiguo Testamento. En esta época se empieza a escribir una literatura judía más profana, con Filón de Alejandría, que escribió libros de religión, historia y filosofía, y Flavio Josefo, historiador. Este corpus literario conforma el testimonio más directo de la helenización judía, de ahí su importancia histórica.

  1. CCDC 1410822: Experimental Crystal Structure Determination : heptakis(dimethylammonium) dodecakis(mu-hydroxo)-bis(mu-oxo)-nonaaqua-nona-terbium tris(octakis(mu-hydroxo)-triaqua-bis(2-fluorobenzoato)-bis(formato)-hexa-terbium) dodecakis(5-[(4-carboxylatophenyl)methoxy]benzene-1,3-dicarboxylate) unknown solvate

    KAUST Repository

    Alezi, Dalal


    An entry from the Cambridge Structural Database, the world’s repository for small molecule crystal structures. The entry contains experimental data from a crystal diffraction study. The deposited dataset for this entry is freely available from the CCDC and typically includes 3D coordinates, cell parameters, space group, experimental conditions and quality measures.



  3. Radosław Kaleta, Białorusko-polska homonimia międzyjęzykowa, Warszawa: Slawistyczny Ośrodek Wydawniczy, 2014, 167 ss.

    Directory of Open Access Journals (Sweden)

    Maksim Duszkin


    Full Text Available Review The text is a presentation of R. Kaleta's book Białorusko-polska homonimia międzyjęzykowa published in 2014 by the Slavic Publishing Centre of the Institute of Slavic Studies PAS. The monograph includes an analysis of source literature and some theoretical reflections on a phenomenon of the so-called interlanguage homonymy. The book also includes a brief vocabulary of selected Belarusian-Polish interlanguage homonyms.   Recenzja W recenzji przedstawiono wydaną w 2014 r. w Slawistycznym Ośrodku Wydawniczym Instytutu Slawistyki PAN książkę R. Kalety Białorusko-polska homonimia międzyjęzykowa. Monografia zawiera między innymi opis literatury przedmiotu oraz rozważania teoretyczne, dotyczące zjawiska tzw. hominimii międzyjęzykowej. Znaleźć w niej można również słowniczek wybranych białorusko-polskich hominimów międzyjęzykowych.

  4. Nikitin et al, ;Methane high-temperature partition function from contact transformations and variational calculations;, Journal of Quantitative Spectroscopy & Radiative Transfer Vol 167 (2015) pp. 53-63 (United States)

    Nikitin, A. V.; Krishna, B. M.; Rey, M.; Tashkun, S. A.; Tyuterev, Vl. G.


    Table 4 of Ref [1] did not contain enough digits to reproduce the fitted Q(T) values for practical applications. The corrected table is given below. This does not affect other Tables and Figures or the conclusions of [1].

  5. Denise Orange-Ravachol (2012).Didactique des sciences de la vie et de la Terre. Rennes : Presses Universitaires de Rennes, 167 p.


    Santini, Jérôme


    Le livre de Denise Orange-Ravachol, récemment paru (2012) aux Presses Universitaires de Rennes, intéressera plus d'un lecteur, ceux préoccupés de didactique des sciences de la vie et de la Terre (le titre de l'ouvrage), mais pas seulement. En effet, son auteur y travaille des problèmes épistémologiques et didactiques de première importance, dans une approche que l'on pourrait qualifier de « rationalisme pragmatiste », chaque problème étant abordé systématiquement en croisant les analyses de l...

  6. Dakwah STAIN Purwokerto KOMUNIKA ISSN: 1978-1261 Vol.3 No.2 Juli-Desember 2009 pp.167-183 GENDER DALAM KONSTRUKSI MEDIA

    Directory of Open Access Journals (Sweden)

    Hariyanto Hariyanto


    Full Text Available Gender issues, the image of the relation of men and women in the media product, located at the position concurrence. While the media products that represent a certain meaning and reality to be submitted by his creator (media workers. Not infrequently, sense of product made through the media has put the position of media products as part of social reality itself.On the other hand, the position of the meaning of media products into the medium for the legitimacy of a change in governance norms and values in society. In other words, the image of the relation of men and women in the media products that contain sexual harassment can be carried still values the old conservative and applicable to the community that Indonesia is very patriarchy

  7. Reconstruction of geomagnetic activity and near-Earth interplanetary conditions over the past 167 yr – Part 3: Improved representation of solar cycle 11

    Directory of Open Access Journals (Sweden)

    M. Lockwood


    Full Text Available Svalgaard (2014 has recently pointed out that the calibration of the Helsinki magnetic observatory's H component variometer was probably in error in published data for the years 1866–1874.5 and that this makes the interdiurnal variation index based on daily means, IDV(1d, (Lockwood et al., 2013a, and the interplanetary magnetic field strength derived from it (Lockwood et al., 2013b, too low around the peak of solar cycle 11. We use data from the modern Nurmijarvi station, relatively close to the site of the original Helsinki Observatory, to confirm a 30% underestimation in this interval and hence our results are fully consistent with the correction derived by Svalgaard. We show that the best method for recalibration uses the Helsinki Ak (H and aa indices and is accurate to ±10%. This makes it preferable to recalibration using either the sunspot number or the diurnal range of geomagnetic activity which we find to be accurate to ±20%. In the case of Helsinki data during cycle 11, the two recalibration methods produce very similar corrections which are here confirmed using newly digitised data from the nearby St Petersburg observatory and also using declination data from Helsinki. However, we show that the IDV index is, compared to later years, too similar to sunspot number before 1872, revealing independence of the two data series has been lost; either because the geomagnetic data used to compile IDV has been corrected using sunspot numbers, or vice versa, or both. We present corrected data sequences for both the IDV(1d index and the reconstructed IMF (interplanetary magnetic field. We also analyse the relationship between the derived near-Earth IMF and the sunspot number and point out the relevance of the prior history of solar activity, in addition to the contemporaneous value, to estimating any "floor" value of the near-Earth interplanetary field.

  8. Reconstruction of geomagnetic activity and near-Earth interplanetary conditions over the past 167 yr – Part 1: A new geomagnetic data composite

    Directory of Open Access Journals (Sweden)

    M. Lockwood


    Full Text Available We present a new composite of geomagnetic activity which is designed to be as homogeneous in its construction as possible. This is done by only combining data that, by virtue of the locations of the source observatories used, have similar responses to solar wind and IMF (interplanetary magnetic field variations. This will enable us (in Part 2, Lockwood et al., 2013a to use the new index to reconstruct the interplanetary magnetic field, B, back to 1846 with a full analysis of errors. Allowance is made for the effects of secular change in the geomagnetic field. The composite uses interdiurnal variation data from Helsinki for 1845–1890 (inclusive and 1893–1896 and from Eskdalemuir from 1911 to the present. The gaps are filled using data from the Potsdam (1891–1892 and 1897–1907 and the nearby Seddin observatories (1908–1910 and intercalibration achieved using the Potsdam–Seddin sequence. The new index is termed IDV(1d because it employs many of the principles of the IDV index derived by Svalgaard and Cliver (2010, inspired by the u index of Bartels (1932; however, we revert to using one-day (1d means, as employed by Bartels, because the use of near-midnight values in IDV introduces contamination by the substorm current wedge auroral electrojet, giving noise and a dependence on solar wind speed that varies with latitude. The composite is compared with independent, early data from European-sector stations, Greenwich, St Petersburg, Parc St Maur, and Ekaterinburg, as well as the composite u index, compiled from 2–6 stations by Bartels, and the IDV index of Svalgaard and Cliver. Agreement is found to be extremely good in all cases, except two. Firstly, the Greenwich data are shown to have gradually degraded in quality until new instrumentation was installed in 1915. Secondly, we infer that the Bartels u index is increasingly unreliable before about 1886 and overestimates the solar cycle amplitude between 1872 and 1883 and this is amplified in the proxy data used before 1872. This is therefore also true of the IDV index which makes direct use of the u index values.

  9. PP167. A process evaluation of an innovative implementation strategy of the Dutch guidelines on hypertensive disorders in pregnancy using a computerized decision support system. (United States)

    Luitjes, S; Mesri, K; Wouters, M; van Tulder, M; Hermens, R


    Hypertensive disorders in pregnancy remain the leading cause of maternal mortality in the Netherlands. The Dutch Society of Obstetrics and Gynecology (NVOG) has developed evidence-based guidelines on the management of hypertension in pregnancy. Previous studies showed a low adherence rate to other NVOG guidelines and a large variation in usual care in different hospitals. In the BIG CHANGE trial an innovative implementation strategy of the NVOG guidelines on hypertension using a web-based application (BOS, by Giant Soft, Leeuwarden, The Netherlands) was compared to a common strategy of professional audit and feedback. In this study a process evaluation of BOS has been done, analyzing its efficiency, barriers and formulate improvement points. Gynecologists, residents and clinical midwives from seven hospitals using BOS were asked to fill in the questionnaire. A questionnaire was developed on the following items: efficiency, barriers and improvement. Thirty four completed questionnaires useful for analysis. 63.6% of the respondent also consulted the NVOG guideline or local protocol, mainly for confirmation of information, background information, medication. Technical problems were found in 44.1%. Positive opinions on user friendliness varied from 73.5% to 100%. No significant difference was found between the user frequency of BOS compared to the NVOG guidelines or local protocol, or between the time needed to consult them. Improvements mentioned by the respondents were mainly regarding the lay-out. Most respondents (85.3%) found it useful to make a computer based support system for other guidelines and 79.4% would also use this. BOS is regarded suitable as an instrument for implementing guidelines and respondents find it useful to develop it for other guidelines as well. Technical problems and poor implementation are important areas of improvement. Copyright © 2012. Published by Elsevier B.V.

  10. Reconstruction of geomagnetic activity and near-Earth interplanetary conditions over the past 167 yr – Part 2: A new reconstruction of the interplanetary magnetic field

    Directory of Open Access Journals (Sweden)

    M. Lockwood


    Full Text Available We present a new reconstruction of the interplanetary magnetic field (IMF, B for 1846–2012 with a full analysis of errors, based on the homogeneously constructed IDV(1d composite of geomagnetic activity presented in Part 1 (Lockwood et al., 2013a. Analysis of the dependence of the commonly used geomagnetic indices on solar wind parameters is presented which helps explain why annual means of interdiurnal range data, such as the new composite, depend only on the IMF with only a very weak influence of the solar wind flow speed. The best results are obtained using a polynomial (rather than a linear fit of the form B = χ · (IDV(1d − βα with best-fit coefficients χ = 3.469, β = 1.393 nT, and α = 0.420. The results are contrasted with the reconstruction of the IMF since 1835 by Svalgaard and Cliver (2010.

  11. Expediciones Botánicas Siglo XXI Aprendiendo Ciencias con José Celestino Mutis. (pág. 167-178

    Directory of Open Access Journals (Sweden)

    Diego Campos


    Full Text Available Las experiencias con docentes de ciencias nos han permitido conocer como los maestros de diferentes secretarías de Educación enfrentan el reto y compromiso de dar a conocer la diversidad biológica en diferentes contextos, además de contribuir a su uso y conservación.  En la gran mayoría de experiencias se evidenció como los valores culturales incluyen saberes que contribuyen a la sensibilización y el reconocimiento de los recursos biológicos en los estudiantes.  Por este motivo los profesores del Departamento de Biología, seguimos acompañando experiencias de proyectos de aula con los que se busca estimular el reconocimiento de la diversidad biológica y su uso y conservación a nivel local, regional y nacional así como su aprovechamiento en procesos de enseñanza aprendizaje de la biología y de las ciencias en general  en niveles de formación básica y secundaria.

  12. Corrigendum to ;Dynamics of epidemic spreading with vaccination: Impact of social pressure and engagement; [Physica A 467 (2017) 167-179 (United States)

    Pires, Marcelo A.; Crokidakis, Nuno


    The authors regret to inform that there are two misprints in the axis of Fig. 3 of the paper. In Fig. 3(c), the correct identification of the x-axis is γ (gamma) instead of λ (lambda), and in Fig. 3(d), the correct identification of the y-axis is γ (gamma) instead of λ (lambda). These modifications do not affect the results of the paper, as well as the discussion made in the text.

  13. Pressure data from a 64A010 airfoil at transonic speeds in heavy gas media of ratio of specific heats from 1.67 to 1.12 (United States)

    Gross, A. R.; Steinle, F. W., Jr.


    A NACA 64A010 pressure-instrumented airfoil was tested at transonic speeds over a range of angle of attack from -1 to 12 degrees at various Reynolds numbers ranging from 2 to 6 million in air, argon, Freon 12, and a mixture of argon and Freon 12 having a ratio of specific heats corresponding to air. Good agreement of results is obtained for conditions where compressibility is not significant and for the air and comparable argon-Freon 12 mixture. Comparison of heavy gas results with air, when adjusted for transonic similarity, show improved, but less than desired agreement.

  14. Geology of the Beckbury and Worfield area, 1:10000 sheets SJ70SE & SO79NE : part of 1:50000 sheet 153 (Wolverhampton) and 167 (Dudley)


    Hough, E.; Barnett, A.J.


    This report describes the geology of 1:lO 000 sheets SJ 70 SE (Beckbury) and SO 79 NE (Worfield) (Figure 1). This area was first surveyed geologically at the 1:lO 560 scale by R W Pocock and T Robertson in 1922 and 1923, and published on County Sheets Staffordshire 44SW, 44SE and 61SW, and Shropshire 52NW, 52NE, 52SW, 52SE, 59NW and 59NE. The one-inch Geological Sheet 153 (Wolverhampton) was published in 1929, and the accompanying sheet memoir (Whitehead et al.) dates fiom 1928...

  15. 167. Estenosis mitral funcional y recurrencia de insuficiencia tras anuloplastia en la insuficiencia mitral isquémica crónica

    Directory of Open Access Journals (Sweden)

    C.E. Martín López


    Conclusiones: La anuloplastia mitral aporta una corrección efectiva y durable de la insuficiencia mitral isquémica crónica. Esta técnica puede inducir estenosis mitral funcional durante el ejercicio, debiéndose valorar, a largo plazo, un posible impacto adverso en la clase funcional y supervivencia.

  16. 18 CFR 16.7 - Information to be made available to the public at the time of notification of intent under... (United States)


    ... project area. (iv) The following recreation and land use resources information: (A) Any report on past and...) Any public correspondence relating to recreation and land use resources within the project area. (v... costs of reproduction; or (ii) Through the mail, after obtaining reimbursement for postage fees and...

  17. A validated spectrofluorimetric method for the determination of citalopram in bulk and pharmaceutical preparations based on the measurement of the silver nanoparticles-enhanced fluorescence of citalopram/terbium complexes. (United States)

    Khan, Muhammad Naeem; Shah, Jasmin; Jan, Muhammad Rasul; Lee, Sang Hak


    A simple, sensitive, and accurate spectrofluorimetric method was developed for the determination of citalopram in bulk and pharmaceutical preparations. The method is based on the enhancement of the weak fluorescence signal (FL) of the Tb (III)-citalopram system in the presence of silver nanoparticles. Fluorescence intensities were measured at 555 nm after excitation at 281 nm. Prepared silver nanoparticles (AgNPs) were characterized by UV-Visible spectra and transmission electron microscopy (TEM). Various factors affecting the formation of citalopram-Tb (III)-AgNPs complexes were studied and optimized. The fluorescence intensity versus concentration plot was linear over the range 0.02-14 μg mL(-1), with an excellent correlation coefficient of 0.9978. The limit of detection (LOD) and limit of quantification (LOQ) were found to be 7.15 × 10(-6) μg mL(-1) and 2.38 × 10(-5) μg mL(-1) respectively. The proposed method was found to have good reproducibility with a relative standard deviation of 3.66% (n = 6). The interference effects of common excipients found in pharmaceutical preparations were studied. The developed method was validated statistically by performing recoveries studies and successfully applied for the assay of citalopram in bulk powder and pharmaceutical preparations. Percent recoveries were found to range from 98.98% to 100.97% for bulk powder and from 96.57% to 101.77% for pharmaceutical preparations.

  18. A "plug-and-play" approach to the preparation of transparent luminescent hybrid materials based on poly(methyl methacrylate), a calix[4]arene cross-linking agent, and terbium ions. (United States)

    Driscoll, Christopher R; Reid, Brodie L; McIldowie, Matthew J; Muzzioli, Sara; Nealon, Gareth L; Skelton, Brian W; Stagni, Stefano; Brown, David H; Massi, Massimiliano; Ogden, Mark I


    A novel methodology to prepare transparent luminescent hybrid materials is reported. Using a calixarene ionophore as a PMMA cross-linker avoids problems, such as phase segregation, and produces a polymer monolith that can be loaded with the metal ion required for luminescence post-synthesis. This approach is versatile and will simplify the production of such materials.

  19. CCDC 954772: Experimental Crystal Structure Determination : catena-(Dimethylammonium tris(mu~4~-3-fluorobiphenyl-4,4'-dicarboxylato)-tetrakis(mu~3~-hydroxo)-triaqua-tri-terbium unknown solvate)

    KAUST Repository

    Xue, Dongxu


    An entry from the Cambridge Structural Database, the world’s repository for small molecule crystal structures. The entry contains experimental data from a crystal diffraction study. The deposited dataset for this entry is freely available from the CCDC and typically includes 3D coordinates, cell parameters, space group, experimental conditions and quality measures.

  20. CCDC 1410820: Experimental Crystal Structure Determination : heptakis(dimethylammonium) heptacosa-terbium dodecakis((1,1'-biphenyl)-3,4',5-tricarboxylate) hexakis(2-fluorobenzoate) hexakis(formate) hexatriacontakis(hydroxide) bis(oxide) unknown solvate hydrate

    KAUST Repository

    Alezi, Dalal


    An entry from the Cambridge Structural Database, the world’s repository for small molecule crystal structures. The entry contains experimental data from a crystal diffraction study. The deposited dataset for this entry is freely available from the CCDC and typically includes 3D coordinates, cell parameters, space group, experimental conditions and quality measures.

  1. Terbium doped SnO2 nanoparticles as white emitters and SnO2:5Tb/Fe3O4 magnetic luminescent nanohybrids for hyperthermia application and biocompatibility with HeLa cancer cells. (United States)

    Singh, Laishram Priyobarta; Singh, Ningthoujam Premananda; Srivastava, Sri Krishna


    SnO2:5Tb (SnO2 doped with 5 at% Tb(3+)) nanoparticles were synthesised by a polyol method and their luminescence properties at different annealing temperatures were studied. Characterization of nanomaterials was done by X-ray diffraction (XRD), Fourier transformation infrared spectroscopy (FTIR), transmission electron microscopy (TEM) and vibrating sample magnetometry (VSM). XRD studies indicate that the prepared nanoparticles were of tetragonal structures. Upon Tb(3+) ion incorporation into SnO2, Sn(4+) changes to Sn(2+) and, on annealing again at higher temperature, Sn(2+) changes to Sn(4+). The prepared nanoparticles were spherical in shape. Sn-O vibrations were found from the FTIR studies. In photoluminescence studies, the intensity of the emission peaks of Tb(3+) ions increases with the increase of annealing temperature, and emission spectra lie in the region of white emission in the CIE diagram. CCT calculations show that the SnO2:5Tb emission lies in cold white emission. Quantum yields up to 38% can be obtained for 900 °C annealed samples. SnO2:5Tb nanoparticles were well incorporated into the PVA polymer and such a material incorporated into the polymer can be used for display devices. The SnO2:5Tb/Fe3O4 nanohybrid was prepared and investigated for hyperthermia applications at different concentrations of the nanohybrid. This achieves a hyperthermia temperature (42 °C) under an AC magnetic field. The hybrid nanomaterial SnO2:5Tb/Fe3O4 was found to exhibit biocompatibility with HeLa cells (human cervical cancer cells) at concentrations up to 74% for 100 μg L(-1). Also, this nanohybrid shows green emission and thus it will be helpful in tracing magnetic nanoparticles through optical imaging in vivo and in vitro application.

  2. Filmes delgados luminescentes obtidos a partir de hidroxicarbonatos de ítrio ativados por európio ou térbio Luminescent thin films obtained from ytrium hydroxycarbonates activated by terbium or europium

    Directory of Open Access Journals (Sweden)

    Emy Niyama


    Full Text Available These films were obtained by dip coating. Parameters like dislocation velocity; number of deposits, suspension concentration, and number of deposits followed or not by heat treatment between each deposit and calcination temperature were evaluated for establishing the best homogeneity. The obtained films were characterized in terms of their morphology, optical quality and photoluminescence by scanning electron microscopy (SEM, UV-vis absorption spectrophotometry and luminescence spectroscopy, respectively. The morphologic and luminescent characteristics showed dip coating as good laboratory technique for development of thin films for optical applications.

  3. ORF Alignment: NC_004459 [GENIUS II[Archive

    Lifescience Database Archive (English)


  4. Synthesis and characterization of spherical Tb-MCM-41

    Energy Technology Data Exchange (ETDEWEB)

    Pires, Luiza H.O., E-mail: [Universidade Federal do Para, Instituto de Ciencias Exatas e Naturais, Laboratorio de Catalise e Oleoquimica, CP 479, CEP 66075-110, Belem, PA (Brazil); Queiroz, Renan M.; Souza, Ruth P.; Costa, Carlos E.F. da; Zamian, Jose R. [Universidade Federal do Para, Instituto de Ciencias Exatas e Naturais, Laboratorio de Catalise e Oleoquimica, CP 479, CEP 66075-110, Belem, PA (Brazil); Weber, Ingrid T. [Universidade Federal de Pernambuco, Centro de Ciencias Exatas e da Natureza, Av. Prof. Luis Barros Freire, s/n, Cidade Universitaria, 50670-901 Recife, PE (Brazil); Filho, Geraldo N. da Rocha [Universidade Federal do Para, Instituto de Ciencias Exatas e Naturais, Laboratorio de Catalise e Oleoquimica, CP 479, CEP 66075-110, Belem, PA (Brazil)


    Spherical MCM-41 was synthesized at room temperature and functionalized by means of direct synthesis method. Evidence for the terbium presence in the silica matrix was obtained by means of EDX. Scanning electron microscopy (SEM) micrographs showed that terbium incorporation did not change significantly MCM-41 morphology. The maintenance of the hexagonal structure was confirmed by X-ray diffraction (XRD) pattern analysis. The cell parameter increase and the surface area decrease, observed by N{sub 2} adsorption-desorption technique, were taken as evidence of terbium introduction inside the MCM-41 framework. By FT-IR spectra it was found that the main features of the silica framework were maintained. The presence of a strong absorption band centered at ca. 220 nm in the diffuse reflectance UV-vis spectra could indicate the presence of tetra-coordinated terbium in the silica network of Tb-MCM-41 samples.

  5. Therapeutic use of radioactive isotopes

    CERN Multimedia

    Caroline Duc


    In December, researchers from ISOLDE-CERN, the Paul Scherrer Institute (PSI) and the Institut Laue-Langevin (ILL) published the results of an in vivo study which successfully proved the effectiveness of four terbium isotopes for diagnosing and treating cancerous tumours.   Four terbium isotopes suitable for clinical purposes. “ISOLDE is the only installation capable of supplying terbium isotopes of such purity and intensity in the case of three out of the four types used in this study,” explains Karl Johnson, a physicist at ISOLDE.  “Producing over a thousand different isotopes, our equipment offers the widest choice of isotopes in the world!” Initially intended for fundamental physics research, ISOLDE has diversified its activities over time to invest in various projects in the materials science, biochemistry and nuclear medicine fields. The proof-of-concept study has confirmed that the four terbium isotopes 149Tb, 152Tb, 155Tb produ...

  6. Thermal History Using Microparticle Trap Luminescence (United States)


    and thermoluminescence of terbium-activated silicates and aluminates " . Radiat. Meas. 43, 323-326 (2008). HDTRA1-07-1-0016 University of...of terbium-activated silicates and aluminates " . 15th Solid State Dosimetry Conference, Delft, The Netherlands, July 8-13 (2007). 2 INTRODUCTION...increased to 500°C until combustion occurred (- 7 min). The remaining powder was collected, crushed in a agate mortar, and annealed (typically at 900

  7. ORF Alignment: NC_002663 [GENIUS II[Archive

    Lifescience Database Archive (English)


  8. Geochemistry and Sm-Nd systematics of the 1.67 Ga Buanji Group of southwestern Tanzania: Paleo-weathering, provenance and paleo-tectonic setting implications

    Directory of Open Access Journals (Sweden)

    Charles H. Kasanzu


    The lower Buanji Formation yielded a depleted mantle Nd model age (TDM of ∼2100 Ma which indicates an Eburnean parentage. TDM ages of 2486–2155 Ma and 2535–2379 Ma obtained from middle and upper Buanji formations, respectively, suggest a progressive increase of sedimentary input from the Tanzania Craton up-stratigraphy. The Eburnean TDM ages of the lower Buanji rocks are attributed to their derivation through denudation of a decaying topographic high composed predominantly of rocks that were generated during the Palaeoproterozoic Ubendian orogenesis, possibly in the realm of Columbian Supercontinent assembly. Overlapping TDM ages between the middle and upper Buanji formations suggest multiple sources involving mixing of detritus from Archaean cratonic rocks and the Palaeoproterozoic Ubendian belt. However, the Archaean signal is relatively more pronounced in the upper Buanji Formation, suggesting sediments derivation from the craton, to the north of the basin. The middle Buanji Formation suggests more diverse protolith, given the relatively larger spread in the TDM ages. The Nb/Ta, Zr/Sm and Ce/Pb ratios coupled with the negative Nb and Ta anomalies, relative to primitive mantle, suggest that the tectonic setting of the source rocks for the Buanji sediments was a subduction zone akin to that generating modern Island Arc Basalts. Thus, we suggest that the Buanji's palaeogeography is consistent with an extensional continental backarc basin during the late Paleoproterozoic.

  9. Práctica de Campo del Eje Curricular Organización – Un Encuentro con la Paleobiología. (pág. 153-167

    Directory of Open Access Journals (Sweden)

    Diego Campos


    Full Text Available El Proyecto Curricular de la Licenciatura en Biología de la Universidad Pedagógica se estructura en dos ciclos: el de fundamentación de primero a sexto semestre y el de profundización de séptimo a décimo. En el primero cada semestre conforma un Eje Curricular en el que los estudiantes adelantan un proyecto que permite integrar los espacios académicos respondiendo una pregunta fundamental y proyectándose a una comunidad educativa de manera que los licenciados en formación adquieren experiencias en procesos de enseñanza articulando los contenidos abordados en cada semestre en la ejecución de proyectos pedagógicos.El Proyecto Curricular de la Licenciatura en Biología de la Universidad Pedagógica se estructura en dos ciclos: el de fundamentación de primero a sexto semestre y el de profundización de séptimo a décimo. En el primero cada semestre conforma un Eje Curricular en el que los estudiantes adelantan un proyecto que permite integrar los espacios académicos respondiendo una pregunta fundamental y proyectándose a una comunidad educativa de manera que los licenciados en formación adquieren experiencias en procesos de enseñanza articulando los contenidos abordados en cada semestre en la ejecución de proyectos pedagógicos.

  10. A Response to Ages Past. Commentary on Harris, R. M., Michell, B.G. & Cooley. C. (1985) The Gender Gap in Library Education. (Journal of Education for Library and Information Science, 25(3), 167-176) (United States)

    Wellstead, Peta


    Much has changed in the information environment since the years of Harris' review. It is important to mention the significance of the impact of technology that has rendered the work of librarians and information workers almost unknowable to those teaching in the period 1965-1983. As a result of these reviews and technological changes, many…

  11. Reeleição para a Câmara dos Deputados brasileira em 2006 e as incertezas do sistema eleitoral DOI:10.5007/2175-7984.2011v10n19p167

    Directory of Open Access Journals (Sweden)

    Alvaro Augusto de Borba Barreto


    Full Text Available A pesquisa relaciona o sucesso ou o fracasso na tentativa de reeleição dos deputados federais no pleito de 2006 com a votação individual e o posicionamento de cada um na lista, comparados a 2002, na tentativa de verificar se a performance em alguns desses indicadores pode ser a garantia para a manutenção do mandato parlamentar. São encontradas situações correspondentes a cada uma das oito combinações possíveis, as quais, ao serem analisadas, demonstram que não há fórmula de sucesso na atual configuração do sistema eleitoral: fazer mais votos e/ou melhorar o posicionamento na lista não são suficientes para a manutenção do mandato, bem como desempenho negativo em comparação ao pleito anterior não elimina esta possibilidade.

  12. Police recording of road accident in-patients : investigation into the completeness, representativity, and reliability of police records of hospitalized traffic victims. Article published in Accident Analysis and Prevention, 1984/06. 16(3) pp167-184.

    NARCIS (Netherlands)

    Maas, M.W. & Harris, S.


    Many road safety research projects make use of the official police road accident data. Their use is often restricted to the data of fatal accidents and fatalities because it is the only complete registration, and the extent of underreporting of injury accidents is unknown. The need to extend the use

  13. Reconstruction of geomagnetic activity and near-Earth interplanetary conditions over the past 167 yr – Part 4: Near-Earth solar wind speed, IMF, and open solar flux

    Directory of Open Access Journals (Sweden)

    M. Lockwood


    Full Text Available In the concluding paper of this tetralogy, we here use the different geomagnetic activity indices to reconstruct the near-Earth interplanetary magnetic field (IMF and solar wind flow speed, as well as the open solar flux (OSF from 1845 to the present day. The differences in how the various indices vary with near-Earth interplanetary parameters, which are here exploited to separate the effects of the IMF and solar wind speed, are shown to be statistically significant at the 93% level or above. Reconstructions are made using four combinations of different indices, compiled using different data and different algorithms, and the results are almost identical for all parameters. The correction to the aa index required is discussed by comparison with the Ap index from a more extensive network of mid-latitude stations. Data from the Helsinki magnetometer station is used to extend the aa index back to 1845 and the results confirmed by comparison with the nearby St Petersburg observatory. The optimum variations, using all available long-term geomagnetic indices, of the near-Earth IMF and solar wind speed, and of the open solar flux, are presented; all with ±2σ uncertainties computed using the Monte Carlo technique outlined in the earlier papers. The open solar flux variation derived is shown to be very similar indeed to that obtained using the method of Lockwood et al. (1999.

  14. Multibeam collection for TN167: Multibeam data collected aboard Thomas G. Thompson from 2004-03-27 to 2004-04-17, departing from Guam and returning to Yokohama, Japan (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This data set is part of a larger set of data called the Multibeam Bathymetry Database (MBBDB) where other similar data can be found at...

  15. Estudo comparativo da dieta, hábitos alimentares e morfologia trófica de duas espécies simpátricas, de peixes de pequeno porte, associados à macrófitas aquáticas - DOI: 10.4025/actascibiolsci.167 Comparative study about diet, feeding habits and trophic morphology of two sympatric species of small fishes in association with aquatic macrophytes- DOI: 10.4025/actascibiolsci.167

    Directory of Open Access Journals (Sweden)

    Valdirene Esgarbossa Loureiro-Crippa


    Full Text Available Nesse estudo foram avaliados aspectos da dieta e morfologia trófica de duas espécies simpátricas, uma de Cheirodontinae e uma de Aphyocharacinae, associadas a macrofitas aquáticas, em nove lagoas isoladas da planície de inundação do alto rio Paraná, Brasil, no ano de 2001. A análise da dieta mostrou que Aphyocharax anisitsi consumiu predominantemente microcrustáceos e Serrapinnus notomelas predominantemente algas. A morfologia do trato alimentar, incluindo boca, dentes, rastros branquiais e estômago, apresentou, aparentemente, o mesmo padrão para as duas espécies. Entretanto, os dentes são mais robustos em S. notomelas. Houve interação significativa entre o comprimento padrão (F2,215 = 74,89; p1,215 = 4,72; pS. notomelas e a menor para A. anisitsi, sendo essa diferença significativa. Os dados de dieta e morfologia, analisados conjuntamente, permitem inferir que há segregação trófica entre as duas espécies examinadas. E, ainda, que a co-existência dessas espécies é favorecida pelo amplo suprimento alimentar fornecido pelas macrófitas aquáticas.In this study we analyzed the diet and trophic morphology of two species, one of Cheirodontinae and one of Aphyocharacinae, associated with aquatic macrophytes in nine isolated lagoons of the Paraná river floodplain, Brazil, during 2001. Diet showed that Aphyocharax anisitsi feed mainly on microcrustaceans and Serrapinnus notomelas feed mainly on algae. Trophic morphology, including mouth, tooth, gill rakers and stomach showed apparently the same pattern for the two species. However, teeth are the biggest and the hardest in S. notomelas. Regarding intestine length there was significant interaction between standard length (F2.215 = 74.89; p1.215 = 4.72; pS. notomelas and a smaller mean in A. anisitsi. Based on dates of diet and morphology, it is possible to conclude that there are trophic segregation between the two species. Thus, the co-existence of these species is possible in function of the wide food supply given by aquatic macrophytes.

  16. On the quenching of trivalent terbium luminescence by ligand low lying triplet state energy and the role of the {sup 7}F{sub 5} level: The [Tb(tta){sub 3} (H{sub 2}O){sub 2}] case

    Energy Technology Data Exchange (ETDEWEB)

    Souza, A.S., E-mail: [Departamento de Química Fundamental, Universidade Federal de Pernambuco, 50670-901 Recife, PE (Brazil); Nunes, L.A. [Instituto de Física de São Carlos, Universidade de São Paulo, 13560-970 São Carlos, SP (Brazil); Felinto, M.C.F.C. [Instituto de Pesquisas Energéticas e Nucleares-IPEN, 05505-800 São Paulo, SP (Brazil); Brito, H.F. [Instituto de Química, Universidade de São Paulo, 05508-900 São Paulo, SP (Brazil); Malta, O.L. [Departamento de Química Fundamental, Universidade Federal de Pernambuco, 50670-901 Recife, PE (Brazil)


    In this work we discuss the observed Tb{sup 3+} ion luminescence quenching, due to the relative ligand low lying triplet state energy, in the [Tb(tta){sub 3} (H{sub 2}O){sub 2}] compound at low and room temperature (tta=thenoyltrifluoroacetonate). Theoretical energy transfer rates, for both multipolar and exchange mechanisms, were calculated and discussed on the basis of selection rules and energy mismatch conditions from the [Tb(tta){sub 3} (H{sub 2}O){sub 2}] emission spectra. We have concluded that the exchange mechanism by far dominates, in the present case, and that the long first excited state {sup 7}F{sub 5} lifetime (in the millisecond scale) plays a crucial role in the Tb{sup 3+} luminescence quenching. - Highlights: • The energy exchange between the ligand T{sub 1} and Tb{sup 3+5}D{sub 4} levels occur by the exchange interaction. • The Tb{sup 3+} first excited {sup 7}F{sub 5} level plays a crucial role in this process due to its long lifetime. • At room temperature the energy exchanged between the {sup 5}D{sub 4} level of the Tb{sup 3+} ion and the T{sub 1} of the ligand is lost via the intersystem crossing T{sub 1} → S{sub 0} channel.

  17. Synthesis, structure, and magnetic properties of a new family of tetra-nuclear {Mn2(III)Ln2}(Ln = Dy, Gd, Tb, Ho) clusters with an arch-type topology: single-molecule magnetism behavior in the dysprosium and terbium analogues. (United States)

    Chandrasekhar, Vadapalli; Bag, Prasenjit; Speldrich, Manfred; van Leusen, Jan; Kögerler, Paul


    Sequential reaction of Mn(II) and lanthanide(III) salts with a new multidentate ligand, 2,2'-(2-hydroxy-3-methoxy-5-methylbenzylazanediyl)diethanol (LH3), containing two flexible ethanolic arms, one phenolic oxygen, and a methoxy group afforded heterometallic tetranuclear complexes [Mn2Dy2(LH)4(μ-OAc)2](NO3)2·2CH3OH·3H2O (1), [Mn2Gd2(LH)4(μ-OAc)2](NO3)2·2CH3OH·3H2O (2), [Mn2Tb2(LH)4(μ-OAc)2](NO3)2·2H2O·2CH3OH·Et2O (3), and [Mn2Ho2(LH)4(μ-OAc)2]Cl2·5CH3OH (4). All of these dicationic complexes possess an arch-like structural topology containing a central Mn(III)-Ln-Ln-Mn(III) core. The two central lanthanide ions are connected via two phenolate oxygen atoms. The remaining ligand manifold assists in linking the central lanthanide ions with the peripheral Mn(III) ions. Four doubly deprotonated LH(2-) chelating ligands are involved in stabilizing the tetranuclear assembly. A magnetochemical analysis reveals that single-ion effects dominate the observed susceptibility data for all compounds, with comparably weak Ln···Ln and very weak Ln···Mn(III) couplings. The axial, approximately square-antiprismatic coordination environment of the Ln(3+) ions in 1-4 causes pronounced zero-field splitting for Tb(3+), Dy(3+), and Ho(3+). For 1 and 3, the onset of a slowing down of the magnetic relaxation was observed at temperatures below approximately 5 K (1) and 13 K (3) in frequency-dependent alternating current (AC) susceptibility measurements, yielding effective relaxation energy barriers of ΔE = 16.8 cm(-1) (1) and 33.8 cm(-1) (3).

  18. Reactive Chemical Vapor Deposition Method as New Approach for Obtaining Electroluminescent Thin Film Materials

    Directory of Open Access Journals (Sweden)

    Valentina V. Utochnikova


    Full Text Available The new reactive chemical vapor deposition (RCVD method has been proposed for thin film deposition of luminescent nonvolatile lanthanide aromatic carboxylates. This method is based on metathesis reaction between the vapors of volatile lanthanide dipivaloylmethanate (Ln(dpm3 and carboxylic acid (HCarb orH2Carb′ and was successfully used in case of HCarb. Advantages of the method were demonstrated on example of terbium benzoate (Tb(bz3 and o-phenoxybenzoate thin films, and Tb(bz3 thin films were successfully examined in the OLED with the following structure glass/ITO/PEDOT:PSS/TPD/Tb(bz3/Ca/Al. Electroluminescence spectra of Tb(bz3 showed only typical luminescent bands, originated from transitions of the terbium ion. Method peculiarities for deposition of compounds of dibasic acids H2Carb′ are established on example of terbium and europium terephtalates and europium 2,6-naphtalenedicarboxylate.

  19. Spatial resolution in X-ray imaging with scintillating glass optical fiber plates (United States)

    Pavan, P.; Zanella, G.; Zannoni, R.; Marigo, A.


    Some scintillating optical fiber plates, fabricated with terbium glasses are tested for their intrinsic spatial resolution under X-ray irradiation and the result is compared with a typical phosphor screen. The spatial resolution (CTF and MTF) is measured as a function of spatial frequency and the standard deviation of the corresponding Gaussian PSF is derived.


    DEFF Research Database (Denmark)


    The present invention concerns a chemical process for preparing nanoparticles of an alloy comprising both a noble metal, such as platinum, and a non-noble transition or lanthanide metal, such as yttrium, gadolinium or terbium. The process is carried out by reduction with hydrogen and removal...

  1. Multiplet effects in the electronic structure of heavy rare-earth metals

    NARCIS (Netherlands)

    Lebegue, S.; Svane, A.; Katsnelson, M.I.; Lichtenstein, A.I.; Eriksson, O.


    The spectroscopic properties of elemental terbium, dysprosium, holmium, and erbium are investigated using first-principles calculations taking into account intra-atomic correlation effects. In order to describe the strongly localized f electrons together with the conduction bands, we have used the

  2. Performance of 20 Ci 137Cs γ-ray Compton spectrometer for the ...

    Indian Academy of Sciences (India)

    The in-house 137Cs spectrometer is very useful for the measurement of momentum densities of heavy materials. The performance of the machine is assessed using aluminum, terbium and mercury samples and the exper- imental data from comparable apparatus. Keywords. Compton scattering; electron momentum density; ...

  3. Author Details

    African Journals Online (AJOL)

    Pengkiliya, P. Vol 67 (2014) - Articles Interaction of 3-Hydroxypicolinamide with TbIII and its Sensitizing Effect on Terbium Luminescence as a Function of pH and Medium Abstract PDF. ISSN: 0379-4350. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about ...

  4. Author Details

    African Journals Online (AJOL)

    Devi, TP. Vol 67 (2014) - Articles Interaction of 3-Hydroxypicolinamide with TbIII and its Sensitizing Effect on Terbium Luminescence as a Function of pH and Medium Abstract PDF. ISSN: 0379-4350. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about AJOL ...

  5. THz near-field Faraday imaging in hybrid metamaterials

    NARCIS (Netherlands)

    Kumar, N.; Strikwerda, A.C.; Fan, K.; Zhang, X.; Averitt, R.D.; Planken, P.C.M.; Adam, A.J.L.


    We report on direct measurements of the magnetic near-field of metamaterial split ring resonators at terahertz frequencies using a magnetic field sensitive material. Specifically, planar split ring resonators are fabricated on a single magneto-optically active terbium gallium garnet crystal.

  6. Synthesis and photoluminescence properties of CaSixOy:Tb3+ phosphors prepared using solution-combustion method

    CSIR Research Space (South Africa)

    Dejene, FB


    Full Text Available to Ca3Si2O7 as the terbium concentration increase. Broad band excitations peaking between 280 - 360 nm derived from excited states of Tb3+ ions were observed for all powders grown from various Tb compositions. The green emission peak at 545 nm due...

  7. Scanning Electron Microscope-Cathodoluminescence Analysis of Rare-Earth Elements in Magnets. (United States)

    Imashuku, Susumu; Wagatsuma, Kazuaki; Kawai, Jun


    Scanning electron microscope-cathodoluminescence (SEM-CL) analysis was performed for neodymium-iron-boron (NdFeB) and samarium-cobalt (Sm-Co) magnets to analyze the rare-earth elements present in the magnets. We examined the advantages of SEM-CL analysis over conventional analytical methods such as SEM-energy-dispersive X-ray (EDX) spectroscopy and SEM-wavelength-dispersive X-ray (WDX) spectroscopy for elemental analysis of rare-earth elements in NdFeB magnets. Luminescence spectra of chloride compounds of elements in the magnets were measured by the SEM-CL method. Chloride compounds were obtained by the dropwise addition of hydrochloric acid on the magnets followed by drying in vacuum. Neodymium, praseodymium, terbium, and dysprosium were separately detected in the NdFeB magnets, and samarium was detected in the Sm-Co magnet by the SEM-CL method. In contrast, it was difficult to distinguish terbium and dysprosium in the NdFeB magnet with a dysprosium concentration of 1.05 wt% by conventional SEM-EDX analysis. Terbium with a concentration of 0.02 wt% in an NdFeB magnet was detected by SEM-CL analysis, but not by conventional SEM-WDX analysis. SEM-CL analysis is advantageous over conventional SEM-EDX and SEM-WDX analyses for detecting trace rare-earth elements in NdFeB magnets, particularly dysprosium and terbium.

  8. Performance of 20 Ci 137Cs γ-ray Compton spectrometer for the ...

    Indian Academy of Sciences (India)

    ... than the conventional 241Am Compton spectrometers. The in-house 137Cs spectrometer is very useful for the measurement of momentum densities of heavy materials. The performance of the machine is assessed using aluminum, terbium and mercury samples and the experimental data from comparable apparatus.

  9. Faraday isolator based on TSAG crystal for high power lasers. (United States)

    Mironov, E A; Palashov, O V


    A Faraday isolator based on a new magneto-optical medium, TSAG (terbium scandium aluminum garnet) crystal, has been constructed and investigated experimentally. The device provides an isolation ratio of more than 30 dB at 500 W laser power. It is shown that this medium can be used in Faraday isolators for kilowatt-level laser powers.

  10. 1. Novel Dopants in Silica Based Fibers. 2. Applications of Embedded Optical Fiber Sensors in Reinforced Concrete Buildings and Structures (United States)


    effects in fibers, and nonlinear phenomena in fibers. We also use NMR, ESR and Raman techniques to study incorporation of novel as well as...neodymium, erbium, holmium or terbium. These products can be vacuum dried at elevated temperature. The acac-compound is less expensive since the hfa

  11. Time-gated FRET nanoassemblies for rapid and sensitive intra- and extracellular fluorescence imaging

    NARCIS (Netherlands)

    Afsari, Hamid Samareh; Cardoso Dos Santos, Marcelina; Lindén, Stina; Chen, Ting; Qiu, Xue; van Bergen En Henegouwen, Paul M P|info:eu-repo/dai/nl/071919481; Jennings, Travis L; Susumu, Kimihiro; Medintz, Igor L; Hildebrandt, Niko; Miller, Lawrence W

    Time-gated Förster resonance energy transfer (FRET) using the unique material combination of long-lifetime terbium complexes (Tb) and semiconductor quantum dots (QDs) provides many advantages for highly sensitive and multiplexed biosensing. Although time-gated detection can efficiently suppress

  12. Bulletin of Materials Science | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science; Volume 39; Issue 7. Issue front cover thumbnail. Volume 39, Issue 7. December 2016, pages 1619-1889. pp 1619-1623. Luminescence properties of terbium-doped Li 3 PO 4 phosphor for radiation dosimetry · C B PALAN N S BAJAJ S K OMANWAR · More Details Abstract ...

  13. Interaction of 3-Hydroxypicolinamide with Tb III and its Sensitizing ...

    African Journals Online (AJOL)

    Interaction of 3-Hydroxypicolinamide with Tb III and its Sensitizing Effect on Terbium Luminescence as a Function of pH and Medium. ... The complex formed exists asML2 species in which HPA behaves as anO,O,N,N-chelating ligand. The solid complex is isolated from aqueous medium and characterized employing ...

  14. Lanthanide Enhanced Luminescence (LEL) with One and Two Photon Excitation of Quantum Dyes(copyright) Lanthanide(III)-Macrocycles

    National Research Council Canada - National Science Library

    Leif, Robert C; Becker, Margie C; Bromm Jr., Al; Chen, Nanguang; Cowan, Ann E; Vallarino, Lidia M; Yang, Sean; Zucker, Robert M


    .... Preliminary studies indicate that cells stained with the europium Quantum Dye can be observed both by conventional UV laser excitation and by infrared two-photon confocal microscopy. An enhancer has been found that enables the observation of simultaneous emissions from both the europium and terbium Quantum Dyes.

  15. Kinetically inert lanthanide complexes as reporter groups for binding of potassium by 18-crown-6

    DEFF Research Database (Denmark)

    Junker, Anne Kathrine Ravnsborg; Tropiano, Manuel; Faulkner, Stephen


    in a copper(I)-catalyzed alkyne-azide cycloaddition (CuAAC) “click” reaction with azide-functionalized crown ethers. The resulting complexes were investigated using NMR and optical methods. Titrations with potassium chloride in methanol observing the sensititzed europium- and terbium-centered emissions were...

  16. Protein (Cyanobacteria): 428221531 [PGDBj - Ortholog DB

    Lifescience Database Archive (English)


  17. ORF Alignment: NC_005139 [GENIUS II[Archive

    Lifescience Database Archive (English)


  18. ORF Alignment: NC_006512 [GENIUS II[Archive

    Lifescience Database Archive (English)


  19. Dicty_cDB: CHA831 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available californicus haplotype S... 167 2e-40 DQ901654_1( DQ901654 |pid:none) Tigriopus californicus haplotype A... 167...californicus haplotype A... 167 2e-40 DQ901691_1( DQ901691 |pid:none) Tigriopus californicus haplotype S... 167...californicus haplotype S... 167 2e-40 DQ901657_1( DQ901657 |pid:none) Tigriopus californicus haplotype A... 167...DQ901666_1( DQ901666 |pid:none) Tigriopus californicus haplotype S... 167 2e-40 (Q6LHK5) RecName: Full=NAD-dependent

  20. Luminescent properties of Al{sub 2}O{sub 3}: Tb powders; Propiedades luminiscentes de polvos de Al{sub 2}O{sub 3}: Tb

    Energy Technology Data Exchange (ETDEWEB)

    Esparza G, A.E.; Garcia, M.; Falcony, C.; Azorin N, J. [CICATA-IPN, Legaria 694, Col. Irrigacion, 11500 Mexico D.F. (Mexico)


    In this work the photo luminescent and cathode luminescent characteristics of aluminium oxide (Al{sub 2}O{sub 3}) powders impurified with terbium (Tb) were studied for their use in dosimetry. The optical, structural, morphological characteristics of the powders as function of variation in the impurity concentration and the annealing temperature will be presented. As regards the optical properties of powders (photoluminescence and cathode luminescence) it was observed a characteristic emission associated with radiative transitions between electron energy levels of terbium, the spectra associated with this emission consists of several peaks associated with such transitions. In the structural and morphological characterization (X-ray diffraction and scanning electron microscopy) it was appreciated that in accordance the annealing temperature of powders is augmented it is evident the apparition of certain crystalline phases. The results show that this is a promissory material for radiation dosimetry. (Author)

  1. Plastic optical fibre sensor for in-vivo radiation monitoring during brachytherapy (United States)

    Woulfe, P.; Sullivan, F. J.; Lewis, E.; O'Keeffe, S.


    An optical fibre sensor is presented for applications in real-time in-vivo monitoring of the radiation dose a cancer patient receives during seed implantation in Brachytherapy. The sensor is based on radioluminescence whereby radiation sensitive scintillation material is embedded in the core of a 1mm plastic optical fibre. Three scintillation materials are investigated: thallium-doped caesium iodide (CsI:Tl), terbium-doped gadolinium oxysulphide (Gd2O2S:Tb) and europium-doped lanthanum oxysulphide (La2O2S:Eu). Terbium-doped gadolinium oxysulphide was identified as being the most suitable scintillator and further testing demonstrates its measureable response to different activities of Iodine-125, the radio-active source commonly used in Brachytherapy for treating prostate cancer.

  2. [Luminescent cytochemical methods of detecting microorganisms]. (United States)

    Ivanovskaia, N P; Osin, N S; Khramov, E N; Zlobin, V N


    The paper shows that the luminescence cytochemical technique can be used for identification of microorganisms and microbiological synthesis products. The method is based on the interaction of specific fluorescence probes (ANS, terbium ions, and beta-diketonate complexes of europium, as well as metal-containing porphyrines) with major microbial intracellular components and toxins. Unlike classical microbiological, immunochemical or biochemical methods of detection, the proposed method has a reasonable versatility, specificity, sensitivity, rapid action, and possible automation.

  3. Radiotherapy dosimetry based on plastic optical fibre sensors (United States)

    O'Keeffe, S.; Grattan, M.; Hounsell, A.; McCarthy, D.; Woulfe, P.; Cronin, J.; Lewis, E.


    The use of a PMMA based plastic optical fibre in radiotherapy dosimetry is presented. The optical fibre tip is coated with a scintillation material, terbium-doped gadolinium oxysulfide (Gd2O2S:Tb), which fluoresces under ionising radiation. The emitted signal penetrates the fibre and propagates along the fibre where it is remotely monitored using a fluorescence spectrometer. The results demonstrate good repeatability, with a maximum percentage error of 0.59% and the response is independent of dose rate.

  4. Luminescent Lanthanide Metal Organic Frameworks for cis-Selective Isoprene Polymerization Catalysis


    Samantha Russell; Thierry Loiseau; Christophe Volkringer; Marc Visseaux


    In this study, we are combining two areas of chemistry; solid-state coordination polymers (or Metal-Organic Framework—MOF) and polymerization catalysis. MOF compounds combining two sets of different lanthanide elements (Nd3+, Eu3+/Tb3+) were used for that purpose: the use of neodymium was required due to its well-known catalytic properties in dienes polymerization. A second lanthanide, europium or terbium, was included in the MOF structure with the aim to provide luminescent properties. Sev...

  5. Modeled Neutron Induced Nuclear Reaction Cross Sections for Radiochemsitry in the region of Thulium, Lutetium, and Tantalum I. Results of Built in Spherical Symmetry in a Deformed Region

    Energy Technology Data Exchange (ETDEWEB)

    Hoffman, R. D. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)


    We have developed a set of modeled nuclear reaction cross sections for use in radiochemical diagnostics. Systematics for the input parameters required by the Hauser-Feshbach statistical model were developed and used to calculate neutron induced nuclear reaction cross sections for targets ranging from Terbium (Z = 65) to Rhenium (Z = 75). Of particular interest are the cross sections on Tm, Lu, and Ta including reactions on isomeric targets.

  6. Factors Affecting the Efficiency of Excited-States Interactions of Complexes between Some Visible Light-Emitting Lanthanide Ions and Cyclophanes Containing Spirobiindanol Phosphonates

    Directory of Open Access Journals (Sweden)

    M. S. Attia


    Full Text Available The efficiency of excited-states interactions between lanthanide ions Tb3+ and Eu3+ and some new cyclophanes (I, II, and III has been studied in different media. High luminescence quantum yield values for terbium and europium complexes in DMSO and PMMA were obtained. The photophysical properties of the green and red emissive Tb3+ and Eu3+ complexes have been elucidated, respectively.

  7. The effect of core and lanthanide ion dopants in sodium fluoride-based nanocrystals on phagocytic activity of human blood leukocytes (United States)

    Sojka, Bartlomiej; Liskova, Aurelia; Kuricova, Miroslava; Banski, Mateusz; Misiewicz, Jan; Dusinska, Maria; Horvathova, Mira; Ilavska, Silvia; Szabova, Michaela; Rollerova, Eva; Podhorodecki, Artur; Tulinska, Jana


    Sodium fluoride-based β-NaLnF4 nanoparticles (NPs) doped with lanthanide ions are promising materials for application as luminescent markers in bio-imaging. In this work, the effect of NPs doped with yttrium (Y), gadolinium (Gd), europium (Eu), thulium (Tm), ytterbium (Yb) and terbium (Tb) ions on phagocytic activity of monocytes and granulocytes and the respiratory burst was examined. The surface functionalization of leukocytes and respiratory burst of cells was observed for limited number of samples.

  8. The effect of metal distribution on the luminescence properties of mixed-lanthanide metal-organic frameworks. (United States)

    Cadman, Laura K; Mahon, Mary F; Burrows, Andrew D


    A series of lanthanide metal-organic frameworks (MOFs) of the general formula [Ln(Hodip)(H 2 O)]·nH 2 O (Sm, 1; Eu, 2; Gd, 3; Tb, 4; Dy, 5; Er, 6; H 4 odip = 5,5'-oxydiisophthalic acid) have been prepared and shown crystallographically to have isostructural three-dimensional frameworks. The fluorescence emission spectra of the europium compound 2, which is red, and the terbium compound 4, which is green, show characteristic peaks for transitions involving the metal centres, whereas that for the gadolinium compound 3 is dominated by transitions involving Hodip. Using a 1 : 1 : 1 mixture of europium, gadolinium and terbium nitrates in the synthesis resulted in the mixed-metal MOF [Gd 0.17 Tb 0.19 Eu 0.64 (Hodip)(H 2 O)]·nH 2 O 7, for which the ratio of the metal ions was determined using EDX spectroscopy. The fluorescence emission spectrum of 7 is dominated by europium emission bands reflecting the higher proportion of Eu 3+ centres and quenching of the terbium fluorescence by metal-to-metal energy transfer. A series of core-shell MOF materials based on the Ln(Hodip)(H 2 O) framework have been prepared in order to isolate the lanthanides in different domains within the crystals. The emission spectra for materials with Gd@Tb@Eu (8) and Tb@Eu@Gd (9) are dominated by terbium emissions, suggesting that physical separation from europium suppresses quenching. In contrast, the material with Eu@Gd@Tb (10) shows only broad ligand bands and europium emissions. This confirms that core-shell MOFs have different fluorescence properties to simple mixed-metal MOFs, demonstrating that the spatial distribution of the metals within a mixed-lanthanide MOF affects the fluorescence behaviour.

  9. Synthesis and stimulated luminescence property of Zn(BO2)2:Tb(3). (United States)

    Del Rosario, G Cedillo; Cruz-Zaragoza, E; Hipólito, M García; Marcazzó, J; Hernández A, J M; Murrieta S, H


    Zinc borate, Zn(BO2)2, doped with different concentrations of terbium (0.5-8mol%) was synthesized and polycrystalline samples were characterized by Scanning Electron Microscopy and X-Ray Diffraction. The Zn(BO2)2 was formed in the pure samples sintered at 750 and 800°C which has the body centered cubic structure, and a ZnB4O7 primitive orthorhombic phase was present. The thermoluminescent intensity was dependents on the thermal treatment (250-500°C) and also on the impurity concentration. The linear dose-response was obtained between 0.022-27.7Gy and 0.5-50Gy when the samples were exposed to beta and gamma radiation, respectively. The complex structure of the glow curves was analyzed by the Computerized Glow Curve Deconvolution method. The kinetics parameters were calculated assuming the general order kinetics model describing accurately the TL process. The glow curves of Tb(3+)-doped zinc borate phosphor were well deconvolved by six glow peaks. Zinc borate with 8mol% of impurity concentration exhibited an intense radioluminescent emission. The radioluminescent spectra show their maximum bands at 370, 490, 545 and 700nm related to the terbium ion in the zinc borate. These obtained results suggest that the terbium doped zinc borate is a promising phosphor for use in radiation dosimetry because of its high TL sensitivity to the ionizing radiation. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Effect of Ising-type Tb3+ ions on the low-temperature magnetism of La, Ca cobaltite. (United States)

    Knížek, K; Jirák, Z; Hejtmánek, J; Veverka, M; Kaman, O; Maryško, M; Santavá, E; André, G


    Crystal and magnetic structures of the x = 0.2 member of the La0.8-xTbxCa0.2CoO3 perovskite series have been determined from powder neutron diffraction. Enhancement of the diffraction peaks due to ferromagnetic or cluster glass ordering is observed below TC = 55 K. The moments first evolve on Co sites, and ordering of Ising-type Tb(3+) moments is induced at lower temperatures by a molecular field due to Co ions. The final magnetic configuration is collinear Fx for the cobalt subsystem, while it is canted FxCy for terbium ions. The rare-earth moments align along local Ising axes within the ab-plane of the orthorhombic Pbnm structure. The behavior in external fields up to 70-90 kOe has been probed by magnetization and heat capacity measurements. The dilute terbium ions contribute to significant coercivity and remanence that both steeply increase with decreasing temperature. A remarkable manifestation of the Tb(3+) Ising character is the observation of a low-temperature region with an anomalously large linear term of heat capacity and its field dependence. Similar behaviors are detected also for other terbium dopings x = 0.1 and 0.3.

  11. Luminescence enhancement by energy transfer in melamine-Y{sub 2}O{sub 3}:Tb{sup 3+} nanohybrids

    Energy Technology Data Exchange (ETDEWEB)

    Stagi, Luigi, E-mail:; Chiriu, Daniele; Carbonaro, Carlo M.; Ricci, Pier Carlo [Dipartimento di Fisica, Università degli Studi di Cagliari, S.P. Monserrato-Sestu Km 0,700, 09042 Monserrato (Italy); Ardu, Andrea; Cannas, Carla [Departimento di Scienze Chimiche e Geologiche and INSTM, Università d Cagliari, SS 554 bivio Sestu, I-09042 Monserrato (Italy)


    The phenomenon of luminescence enhancement was studied in melamine-Y{sub 2}O{sub 3}:Tb hybrids. Terbium doped Y{sub 2}O{sub 3} mesoporous nanowires were synthesized by hydrothermal method. X-ray diffraction patterns and Raman scattering spectra testified the realization of a cubic crystal phase. Organic-inorganic melamine-Y{sub 2}O{sub 3}:Tb{sup 3+} hybrid system was successfully obtained by vapour deposition method. Vibration Raman active modes of the organic counterpart were investigated in order to verify the achievement of hybrid system. Photoluminescence excitation and photoluminescence spectra, preformed in the region between 250 and 350 nm, suggest a strong interaction among melamine and Terbium ions. In particular, a remarkable improvement of {sup 5}D{sub 4}→ F{sub J} Rare Earth emission (at about 542 nm) of about 10{sup 2} fold was observed and attributed to an efficient organic-Tb energy transfer. The energy transfer mechanism was studied by the use of time resolved photoluminescence measurements. The melamine lifetime undergoes to a significant decrease when adsorbed to oxide surfaces and it was connected to a sensitization mechanism. The detailed analysis of time decay profile of Terbium radiative recombination shows a variation of double exponential law toward a single exponential one. Its correlation with surface defects and non-radiative recombination was thus discussed.

  12. ORF Alignment: Ca19AnnotatedDec2004aaSeq [GENIUS II[Archive

    Lifescience Database Archive (English)

    Full Text Available potential regulator of cytoskeleton and endocytosis Rvs167 [Candida ... albicans SC5314] gb|EAK91317....1| potential regulator of ... cytoskeleton and endocytosis Rvs167 [Candida albicans ... SC5314

  13. Experiment list: ERX402139 [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available ila Kc167 and S2R+ cell lines organism=Drosophila melanogaster || cell line=Kc167 || genotype=gro RNA || genetic modification=transfe...ction || ENA-CHECKLIST=ERC000011 http://dbarchive.biosci

  14. Experiment list: ERX402107 [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available sfection || ENA-CHECKLIST=ERC000011 Kc167 and S2R+ cell lines organism=Drosophila melanogaster || cell line=Kc167 || genotype=gro RNA || genetic modification=tran

  15. Experiment list: ERX402124 [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available sfection || ENA-CHECKLIST=ERC000011 Kc167 and S2R+ cell lines organism=Drosophila melanogaster || cell line=Kc167 || genotype=gro RNA || genetic modification=tran

  16. Experiment list: ERX402106 [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available fection || ENA-CHECKLIST=ERC000011 http://dbarchive.bios...phila Kc167 and S2R+ cell lines organism=Drosophila melanogaster || cell line=Kc167 || genotype=gro RNA || genetic modification=trans

  17. Gclust Server: 194692 [Gclust Server

    Lifescience Database Archive (English)

    Full Text Available 194692 Rde_RD1_1346 Cluster Sequences - 167 probable aggregation factor core 1 Cluster Sequences Link to related sequences - Sequence length 167 Representative annotation probable aggregation

  18. A systematic review of the Indo-Australian Zosteropidae (Part III)

    NARCIS (Netherlands)

    Mees, G.F.


    CONTENTS Introduction .................. 4 Acknowledgements................. 5 Systematic part.................. 7 Zosterops (concluded)................ 7 Tephrozosterops................. 167 Madanga................... 169 Lophozosterops................. 171 Oculocincta.................. 204

  19. ORF Alignment: NC_003279 [GENIUS II[Archive

    Lifescience Database Archive (English)


  20. ORF Alignment: NC_003279 [GENIUS II[Archive

    Lifescience Database Archive (English)


  1. ORF Alignment: NC_005027 [GENIUS II[Archive

    Lifescience Database Archive (English)


  2. Experiment list: SRX017473 [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Stage=dorsal closure stage 15540073,96.9,11.8,0 GSM522361: ORC2 KC167 Input 1 extraction3 seq1 aliquote 1 s...ource_name=ORC2_KC167_Input_1 extraction3_seq1 channel_1 || cell line=Kc167 || tissue=embryo-derived cell-li

  3. Experiment list: SRX017470 [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Stage=dorsal closure stage 15060643,96.4,19.7,1982 GSM522364: MCM KC167 Input 1 extraction3 seq1 aliquote 1... source_name=MCM_KC167_Input_1 extraction3_seq1 channel_1 || cell line=Kc167 || tissue=embryo-derived cell-l

  4. Differences in Sleep Quality and Health-Related Quality of Life in Young Adults with Allergies and Asthma and Their Healthy Peers (United States)

    Molzon, Elizabeth S.; Bonner, Margaret S.; Hullmann, Stephanie E.; Ramsey, Rachelle R.; Suorsa, Kristina I.; Chaney, John M.; Mullins, Larry L.


    Objective: The current study examined the relationship between sleep quality and health-related quality of life (HRQOL). Participants: Participants were 501 undergraduate students with allergies (167), asthma + allergies (167), or with no history of a chronic illness (167) completed study measures from August 2011 to April 2012. Methods: The…

  5. LLE Review 120 (July-September 2009)

    Energy Technology Data Exchange (ETDEWEB)

    Edgell, D.H., editor


    This issue has the following articles: (1) The Omega Laser Facility Users Group Workshop; (2) The Effect of Condensates and Inner Coatings on the Performance of Vacuum Hohlraum Targets; (3) Zirconia-Coated-Carbonyl-Iron-Particle-Based Magnetorheological Fluid for Polishing Optical Glasses and Ceramics; (4) All-Fiber Optical Magnetic Field Sensor Based on Faraday Rotation in Highly Terbium Doped Fiber; (5) Femtosecond Optical Pump-Probe Characterization of High-Pressure-Grown Al{sub 0.86}Ga{sub 0.14}N Single Crystals; (6) LLE's Summer High School Research Program; (7) Laser Facility Report; and (8) National Laser Users Facility and External Users Programs.

  6. Luminescent trimethoprim-polyaminocarboxylate lanthanide complex conjugates for selective protein labeling and time-resolved bioassays (United States)

    Reddy, D. Rajasekhar; Pedró Rosa, Laura E.; Miller, Lawrence W.


    Labeling proteins with long-lifetime emitting lanthanide (III) chelate reporters enables sensitive, time-resolved luminescence bioaffinity assays. Heterodimers of trimethoprim (TMP) covalently linked to various cs124-sensitized, polyaminocarboxylate chelates stably retain lanthanide ions and exhibit quantum yields of europium emission up to 20% in water. A time-resolved, luminescence resonance energy transfer (LRET) assay showed that TMP-polyaminocarboxylates bind to Escherichia coli dihydrofolate reductase (eDHFR) fusion proteins with nanomolar affinity in purified solutions and in bacterial lysates. The ability to selectively impart terbium or europium luminescence to fusion proteins in complex physiological mixtures bypasses the need for specific antibodies and simplifies sample preparation. PMID:21619068

  7. Micro-meter size organogelator with tri-color luminescence (blue, green and red) activated by Dy3+, Tb3+ and Eu3+ ions. (United States)

    Wang, QianMing


    The preparation of a novel type of low-molecular-weight amphiphilic organogelator bearing three long 14-alkyl chains and hydrophilic oligo(oxyethylene) groups was described. Ultra-violet absorption and fluorescence spectra give evidence of the energy transfer between organic ligands to lanthanide ions. Characteristic green, blue and red luminescence of the organogels were obtained and interesting emission properties of terbium, dysprosium and europium ions were unexpectedly observed at the first time during the order-disorder phase transition point (29 degrees C).

  8. Giant onsite electronic entropy enhances the performance of ceria for water splitting

    DEFF Research Database (Denmark)

    Naghavi, S. Shahab; Emery, Antoine A.; Hansen, Heine Anton


    lanthanides, and reaches a maximum value of ≈4.7 kB per oxygen vacancy for Ce4+/Ce3+ reduction. This unique and large positive entropy source in ceria explains its excellent performance for high-temperature catalytic redox reactions such as water splitting. Our calculations also show that terbium dioxide has......Previous studies have shown that a large solid-state entropy of reduction increases the thermodynamic efficiency of metal oxides, such as ceria, for two-step thermochemical water splitting cycles. In this context, the configurational entropy arising from oxygen off-stoichiometry in the oxide, has...

  9. Surface-Modified Gold Nanoparticles Possessing Two-Channel Responsive Eu(III) /Tb(III) Cyclen Complexes as Luminescent Logic Gate Mimics. (United States)

    Truman, Laura K; Bradberry, Samuel J; Comby, Steve; Kotova, Oxana; Gunnlaugsson, Thorfinnur


    The development of material-supported molecular logic gate mimics (MGLMs) for contained application and device fabrication has become of increasing interest. Herein, we present the formation of ≈5 nm gold nanoparticles (AuNPs) that have been surface-modified (via a thiol linkage) with heptadentate cyclen-based complexes of europium and terbium for sensing applications using delayed lanthanide luminescence and as integrated logic gate mimics within competitive media. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Synthesis and characterization of multifunctional silica core-shell nanocomposites with magnetic and fluorescent functionalities

    Energy Technology Data Exchange (ETDEWEB)

    Ma Zhiya; Dosev, Dosi [Department of Mechanical and Aeronautical Engineering, University of California-Davis, One Shields Avenue, Davis CA 95616 (United States); Nichkova, Mikaela [Department of Entomology, University of California-Davis, One Shields Avenue, Davis CA 95616 (United States); Dumas, Randy K. [Department of Physics, University of California-Davis, One Shields Avenue, Davis CA 95616 (United States); Gee, Shirley J.; Hammock, Bruce D. [Department of Entomology, University of California-Davis, One Shields Avenue, Davis CA 95616 (United States); Liu Kai [Department of Physics, University of California-Davis, One Shields Avenue, Davis CA 95616 (United States); Kennedy, Ian M. [Department of Mechanical and Aeronautical Engineering, University of California-Davis, One Shields Avenue, Davis CA 95616 (United States)], E-mail:


    Multifunctional core-shell nanocomposites with a magnetic core and a silica shell doped with lanthanide chelate have been prepared by a simple method. First, citric acid-modified magnetite nanoparticles were synthesized by a chemical coprecipitation method. Then the magnetite nanoparticles were coated with silica shells doped with terbium (Tb{sup 3+}) complex by a modified Stoeber method based on hydrolyzing and condensation of tetraethyl orthosilicate (TEOS) and a silane precursor. These multifunctional nanocomposites are potentially useful in a variety of biological areas such as bio-imaging, bio-labeling and bioassays because they can be simultaneously manipulated with an external magnetic field and exhibit unique phosphorescence properties.

  11. Luminescent probing of the simplest chiral α-amino acid-alanine in an enantiopure and racemic state. (United States)

    Tarasevych, Arkadii V; Kostyukov, Anton I; Baronskiy, Mark G; Rastorguev, Alexander A; Guillemin, Jean-Claude; Snytnikov, Valeriy N


    Luminescent spectroscopy combined with the technique of luminescent probing with rare earth ions (europium, gadolinium, terbium) and an actinide ion (uranyl) was used to differentiate enantiopure and racemic alanine, the simplest chiral proteinogenic amino acid. Using the achiral luminescent probes, small differences between pure L and DL alanine in the solid state were strongly amplified. Based on the observed electronic transitions of the probes, the position of the triplet level of the coordinated alanine was estimated. Formation of homo- and heterochiral complexes between enantiomers of alanine and the metal ions is discussed as a possible mechanism of chiral self-discrimination. © 2017 Wiley Periodicals, Inc.

  12. Investigation of magnon dispersion relations and neutron scattering cross sections with special attention to anisotropy effects

    DEFF Research Database (Denmark)

    Lindgård, Per-Anker; Kowalska, A.; Laut, Peter


    -helical structure. A numerical calculation is performed for terbium on the basis of the Kaplan-Lyons Hamiltonian with added crystalline anisotropy. The non-istropic exchange part is shown to have a small effect on the dispersion curves, and it turns out that radical changes of the Ruderman-Kittel-type functions...... for the exchange interaction seem to be necessary for agreement with experimental dispersion curves be obtained. The effect of the anisotropy in the cross section is estimated and shown to be important for small magnon energies....

  13. Rare (Earth Elements [score

    Directory of Open Access Journals (Sweden)

    Camilo Méndez


    Full Text Available Rare (Earth Elements is a cycle of works for solo piano. The cycle was inspired by James Dillon’s Book of Elements (Vol. I-V. The complete cycle will consist of 14 pieces; one for each selected rare (earth element. The chosen elements are Neodymium, Erbium, Tellurium, Hafnium, Tantalum, Technetium, Indium, Dysprosium, Lanthanium, Cerium, Europium, Terbium, Yttrium and Darmstadtium. These elements were selected due to their special atomic properties that in many cases make them extremely valuable for the development of new technologies, and also because of their scarcity. To date, only 4 works have been completed Yttrium, Technetium, Indium and Tellurium.

  14. Alaska's rare earth deposits and resource potential (United States)

    Barker, James C.; Van Gosen, Bradley S.


    Alaska’s known mineral endowment includes some of the largest and highest grade deposits of various metals, including gold, copper and zinc. Recently, Alaska has also been active in the worldwide search for sources of rare earth elements (REE) to replace exports now being limitedby China. Driven by limited supply of the rare earths, combined with their increasing use in new ‘green’ energy, lighting, transportation, and many other technological applications, the rare earth metals neodymium, europium and, in particular, the heavy rare earth elements terbium, dysprosium and yttrium are forecast to soon be in critical short supply (U.S. Department of Energy, 2010).

  15. Sol-Gel Electrolytes Incorporated by Lanthanide Luminescent Materials and Their Photophysical Properties (United States)

    Yu, Chufang; Zhang, Zhengyang; Fu, Meizhen; Gao, Jinwei; Zheng, Yuhui


    A group of silica gel electrolytes with lanthanide luminescent hybrid materials were assembled and investigated. Photophysical studies showed that terbium and europium hybrids displayed characteristic green and red emissions within the electrolytes. The influence of different concentration of the lanthanide hybrids on the electrochemical behavior of a gelled electrolyte valve-regulated lead-acid battery were studied through cyclic voltammograms, electrochemical impedance spectroscopy, water holding experiments and mobility tests. The morphology and particle size were analyzed by scanning electron microscopy. The results proved that lanthanide (Tb3+/Eu3+) luminescent materials are effective additives which will significantly improve the electrochemical properties of lead-acid batteries.


    Directory of Open Access Journals (Sweden)

    Sergiy Smola


    Full Text Available Four new heteronuclear lanthanide complexes with general formula [Ge(OH(μ-HDTPALnGe(OH (μ-DTPA] (Ln = Sm – Dy were synthesized and subsequently characterized by different physico- chemical methods. The structures of new compounds have been proposed. In considered complexes the 4f-luminescence of three-charged ions of samarium, europium, terbium and dysprosium is realized at UV-excitation. It is noteworthy that it is the first observation of 4f-luminescence in water solutions of heteronuclear f-p-complexes. The comparison of luminescent characteristics of hetero- and homonuclear landthanide complexes is described and discussed as well.

  17. Tetrakis(μ-2-phenoxypropionato-κ3O,O′:O′;κ3O:O,O′,κ4O:O′-bis[(1,10-phenanthroline-κ2N,N′(2-phenoxypropionato-κ2O,O′praseodymium(III

    Directory of Open Access Journals (Sweden)

    Jin-Bei Shen


    Full Text Available In the centrosymmetric binuclear title complex, [Pr2(C9H9O36(C12H8N22], the two PrIII ions are linked by four 2-phenoxypropionate (L groups through their bi- and tridentate bridging modes. Each PrIII ion is nine-coordinated by one 1,10-phenanthroline molecule, one bidentate carboxylate group and four bridging carboxylate groups in a distorted PrN2O7 monocapped square-antiprismatic geometry. The title compound is isotypic with its terbium- and dysprosium-containing analogues.

  18. Detection of rare earth elements in Powder River Basin sub-bituminous coal ash using laser-induced breakdown spectroscopy (LIBS)

    Energy Technology Data Exchange (ETDEWEB)

    Tran, Phuoc [National Energy Technology Lab. (NETL), Pittsburgh, PA, (United State; Mcintyre, Dustin [National Energy Technology Lab. (NETL), Pittsburgh, PA, (United State


    We reported our preliminary results on the use of laser-induced breakdown spectroscopy to analyze the rare earth elements contained in ash samples from Powder River Basin sub-bituminous coal (PRB-coal). We have identified many elements in the lanthanide series (cerium, europium, holmium, lanthanum, lutetium, praseodymium, promethium, samarium, terbium, ytterbium) and some elements in the actinide series (actinium, thorium, uranium, plutonium, berkelium, californium) in the ash samples. In addition, various metals were also seen to present in the ash samples

  19. Faraday rotator based on TSAG crystal with orientation. (United States)

    Yasuhara, Ryo; Snetkov, Ilya; Starobor, Aleksey; Mironov, Evgeniy; Palashov, Oleg


    A Faraday isolator (FI) for high-power lasers with kilowatt-level average power and 1-µm wavelength was demonstrated using a terbium scandium aluminum garnet (TSAG) with its crystal axis aligned in the direction. Furthermore, no compensation scheme for thermally induced depolarization in a magnetic field was used. An isolation ratio of 35.4 dB (depolarization ratio γ of 2.9 × 10-4) was experimentally observed at a maximum laser power of 1470 W. This result for room-temperature FIs is the best reported, and provides a simple, practical solution for achieving optical isolation in high-power laser systems.

  20. Lattice sites and damage annealing of implanted Tm and Er in Si

    CERN Document Server

    Wahl, U; De Wachter, J H; Langouche, G; Marques, J G; Moons, R; Vantomme, A


    We have studied the lattice sites of Er in CZ Si single crystals by using conversion electron emission channeling from the isotope $^{167m}$Er (2.28 s) which is the decay product of radioactive $^{167}$Tm (9.25 d). Following 60 keV implantation of $^{167}$Tm at a dose of 4 $\\times 10^{13}$ cm$^{-2}$ and annealing at 600°C, more than 90% of $^{167m}$Er is found close to tetrahedral insterstitial (T) sites. The tetrahedral fraction of $^{167m}$Er decreases considerably after 10 min annealing at 800°C and above. We attribute this to the onset of diffusion of the parent $^{167}$Tm and its trapping at other defects, presumably oxygen atoms or clusters of Tm/Er.

  1. Experiment list: SRX365704 [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available orsal closure stage 17312277,95.9,11.4,6813 GSM1246076: shep-rb-a; Drosophila melanogaster; ChIP-Seq source_name=Kc167_She...SRX365704 dm3 TFs and others shep Cell line Kc167 Source=e/se|Developmental Stage=d...p_ChIP-seq || cell line=Kc167 || chip antibody=Shep rabbit || chip antibody reference=PMID:232

  2. Experiment list: SRX365703 [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available orsal closure stage 16720900,97.2,10.2,4841 GSM1246075: shep-gp-a; Drosophila melanogaster; ChIP-Seq source_name=Kc167_She...SRX365703 dm3 TFs and others shep Cell line Kc167 Source=e/se|Developmental Stage=d...p_ChIP-seq || cell line=Kc167 || chip antibody=Shep guinea pig || chip antibody reference=PMID

  3. ORF Alignment: NC_004567 [GENIUS II[Archive

    Lifescience Database Archive (English)


  4. ORF Alignment: NC_003280 [GENIUS II[Archive

    Lifescience Database Archive (English)


  5. ORF Alignment: NC_003280 [GENIUS II[Archive

    Lifescience Database Archive (English)


  6. ORF Alignment: NC_006361 [GENIUS II[Archive

    Lifescience Database Archive (English)


  7. Dicty_cDB: Contig-U14000-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AHI168F ,56,167 Translated Amino Acid sequence klhveinqlf**KKNYSDSELKFGLFYFFFIFLIFFFFFPRXKKXFKXKXFXXKKXF...iwfilfffyffnfffffsqgkkxf*xkkxxxkkkx Frame B: klhveinqlf**KKNYSDSELKFGLFYFFFIFLIFFFFFPRXKKXFKXKXFXXKKXF

  8. Detection of bacterial spores with lanthanide-macrocycle binary complexes. (United States)

    Cable, Morgan L; Kirby, James P; Levine, Dana J; Manary, Micah J; Gray, Harry B; Ponce, Adrian


    The detection of bacterial spores via dipicolinate-triggered lanthanide luminescence has been improved in terms of detection limit, stability, and susceptibility to interferents by use of lanthanide-macrocycle binary complexes. Specifically, we compared the effectiveness of Sm, Eu, Tb, and Dy complexes with the macrocycle 1,4,7,10-tetraazacyclododecane-1,7-diacetate (DO2A) to the corresponding lanthanide aquo ions. The Ln(DO2A)(+) binary complexes bind dipicolinic acid (DPA), a major constituent of bacterial spores, with greater affinity and demonstrate significant improvement in bacterial spore detection. Of the four luminescent lanthanides studied, the terbium complex exhibits the greatest dipicolinate binding affinity (100-fold greater than Tb(3+) alone, and 10-fold greater than other Ln(DO2A)(+) complexes) and highest quantum yield. Moreover, the inclusion of DO2A extends the pH range over which Tb-DPA coordination is stable, reduces the interference of calcium ions nearly 5-fold, and mitigates phosphate interference 1000-fold compared to free terbium alone. In addition, detection of Bacillus atrophaeus bacterial spores was improved by the use of Tb(DO2A)(+), yielding a 3-fold increase in the signal-to-noise ratio over Tb(3+). Out of the eight cases investigated, the Tb(DO2A)(+) binary complex is best for the detection of bacterial spores.

  9. Structural Characterization and Absolute Luminescence Efficiency Evaluation of Gd2O2S High Packing Density Ceramic Screens Doped with Tb3+ and Eu3+ for further Applications in Radiology (United States)

    Dezi, Anna; Monachesi, Elenasophie; D’Ignazio, Michela; Scalise, Lorenzo; Montalto, Luigi; Paone, Nicola; Rinaldi, Daniele; Mengucci, Paolo; Loudos, George; Bakas, Athanasios; Michail, Christos; Valais, Ioannis; Fountzoula, Christine; Fountos, George; David, Stratos


    Rare earth activators are impurities added in the phosphor material to enhance probability of visible photon emission during the luminescence process. The main activators employed are rare earth trivalent ions such as Ce+3, Tb+3, Pr3+ and Eu+3. In this work, four terbium-activated Gd2O2S (GOS) powder screens with different thicknesses (1049 mg/cm2, 425.41 mg/cm2, 313 mg/cm2 and 187.36 mg/cm2) and one europium-activated GOS powder screen (232.18 mg/cm2) were studied to investigate possible applications for general radiology detectors. Results presented relevant differences in crystallinity between the GOS:Tb doped screens and GOS:Eu screens in respect to the dopant agent present. The AE (Absolute efficiency) was found to rise (i) with the increase of the X-ray tube voltage with the highest peaking at 110kVp and (ii) with the decrease of the thickness among the four GOS:Tb. Comparing similar thickness values, the europium-activated powder screen showed lower AE than the corresponding terbium-activated.

  10. Synthesis and characterization of magnetic nanoparticles of oxides for dual MnFe{sub 2}O{sub 4} bioseparation, stabilized in fatty acid and the system chitosan - Eu(TTA){sub 3}(TPPO){sub 2}. Studies on the influence of doping with Gd{sup 3+}, Tb{sup 3+}, Ho{sup 3+} e Eu{sup 3+} in structural and magnetic properties; Sintese e caracterizacao de nanoparticulas magneticas de oxidos duplos de MnFe{sub 2}O{sub 4} para biosseparacao, estabilizadas em acido graxo e recobertas pelo sistema quitosana - Eu(TTA){sub 3}(TPPO){sub 2}. Estudo da influencia da dopagem com Gd{sup 3+}, Tb{sup 3+}, Ho{sup 3+} e Eu{sup 3+} nas propriedades estruturais e magneticas

    Energy Technology Data Exchange (ETDEWEB)

    Kovacs, Thelma Antunes Rodrigues


    This work was synthesized and characterized ferrite magnetic nanoparticles manganese, using the chemical coprecipitation method. By varying the heating time under 98°C (0, 10,20,40,60 3 80 minutes), the molar percentage of doping (1, 3, 5, 7, and 10%), gadolinium, europium, terbium and holmium. Magnetic ferrite nanoparticles and manganese ferrite doped with manganese were synthesized by coprecipitation method starting with chloride solutions of metals (iron (III), manganese (II), europium (III), gadolinium (III), terbium (III) and holmium (III)) and NaOH 5mol.L{sup -1} as precipitating agent. The magnetic nanoparticles were characterized by scanning electron microscopy, infrared spectroscopy, X-ray diffraction, magnetization curves, and thermal analysis. Most of manganese ferrite particles showed superparamagnetic behavior. After the characterization it was found that the samples synthesized manganese ferrite with more than 40 minutes heating time, crystal structure showed the characteristic pattern of the inverted manganese ferrite spinel type. The stabilization of the samples in oleic acid nanoparticles produced with a hydrophobic outer layer and facilitated by coating chitosan biopolymer, since this has a positive charge. Among the doped samples there was no significant change in the magnetic behavior. Several techniques for characterizing these materials have been used such as X-ray diffraction spectrum in the infrared region, magnetization curves and thermal analysis. The resins were tested as magnetic material for the separation of biological materials. In this paper, are used as biological targets separation of bovine serum albumin. (author)

  11. Cerium fluoride nanoparticles protect cells against oxidative stress

    Energy Technology Data Exchange (ETDEWEB)

    Shcherbakov, Alexander B.; Zholobak, Nadezhda M. [Zabolotny Institute of Microbiology and Virology, National Academy of Sciences of Ukraine, Kyiv D0368 (Ukraine); Baranchikov, Alexander E. [Kurnakov Institute of General and Inorganic Chemistry of the Russian Academy of Sciences, Moscow 119991 (Russian Federation); Ryabova, Anastasia V. [Prokhorov General Physics Institute of the Russian Academy of Sciences, Moscow 119991 (Russian Federation); National Research Nuclear University MEPhI (Moscow Engineering Physics Institute), Moscow 115409 (Russian Federation); Ivanov, Vladimir K., E-mail: [Kurnakov Institute of General and Inorganic Chemistry of the Russian Academy of Sciences, Moscow 119991 (Russian Federation); National Research Tomsk State University, Tomsk 634050 (Russian Federation)


    A novel facile method of non-doped and fluorescent terbium-doped cerium fluoride stable aqueous sols synthesis is proposed. Intense green luminescence of CeF{sub 3}:Tb nanoparticles can be used to visualize these nanoparticles' accumulation in cells using confocal laser scanning microscopy. Cerium fluoride nanoparticles are shown for the first time to protect both organic molecules and living cells from the oxidative action of hydrogen peroxide. Both non-doped and terbium-doped CeF{sub 3} nanoparticles are shown to provide noteworthy protection to cells against the vesicular stomatitis virus. - Highlights: • Facile method of CeF{sub 3} and CeF{sub 3}:Tb stable aqueous sols synthesis is proposed. • Naked CeF{sub 3} nanoparticles are shown to be non-toxic and to protect cells from the action of H{sub 2}O{sub 2}. • CeF{sub 3} and CeF{sub 3}:Tb nanoparticles are shown to protect living cells against the vesicular stomatitis virus.

  12. Synthesis and characterization of Tin / Titanium mixed oxide nanoparticles doped with lanthanide for biomarking; Sintese e caracterizacao de nanoparticulas de oxido misto de estanho/titanio dopadas com lantanideos para marcacao biologica

    Energy Technology Data Exchange (ETDEWEB)

    Paganini, Paula Pinheiro


    This work presents the synthesis, characterization and photo luminescent study of tin and titanium mixed oxide nanoparticles doped with europium, terbium and neodymium to be used with luminescent markers on biological systems. The syntheses were done by co-precipitation, protein sol-gel and Pechini methods and the nanoparticles were characterized by infrared spectroscopy, thermogravimetric analysis, scanning electron microscopy, X-ray diffraction and X-ray absorption spectroscopy. The photo luminescent properties studies were conducted for luminophores doped with europium, terbium and neodymium synthesized by coprecipitation method. For luminophore doped with europium it was possible to calculate the intensity parameters and quantum yield and it showed satisfactory results. In the case of biological system marking it was necessary the functionalization of these particles to allow them to bind to the biological part to be studied. So the nanoparticles were functionalized by microwave and Stoeber methods and characterized by infrared spectroscopy, scanning electron microscopy, energy dispersive X-ray spectroscopy and X-ray diffraction obtaining qualitative response of functionalization efficacy. The ninhydrin spectroscopic method was used for quantification of luminophores functionalization. The photo luminescent studies of functionalized particles demonstrate the potential applying of these luminophores as luminescent markers. (author)

  13. Fabrication of Tb3Al5O12 transparent ceramics using co-precipitated nanopowders (United States)

    Dai, Jiawei; Pan, Yubai; Wang, Wei; Luo, Wei; Xie, Tengfei; Kou, Huamin; Li, Jiang


    Terbium aluminum garnet (TAG) precursor was synthesized by a co-precipitation method from a mixed solution of terbium and aluminum nitrates using ammonium hydrogen carbonate (AHC) as the precipitant. The powders calcined at different temperatures were investigated by XRD, FTIR and FESEM in order to choose the optimal calcination temperature. Fine and low-agglomerated TAG powders with average particle size of 88 nm were obtained by calcining the precursor at 1100 °C for 4 h. Using this powder as starting material, TAG transparent ceramics were fabricated by vacuum sintering combined with hot isostatic pressing (HIP) sintering. For the sample pre-sintered at 1700 °C for 20 h with HIP post-treated at 1700 °C for 3 h, the average grain size is about 3.9 μm and the in-line transmittance is beyond 55% in the region of 500-1600 nm, reaching a maximum transmittance of 64.2% at the wavelength of 1450 nm. The Verdet constant at 633 nm is measured to be -178.9 rad T-1 m-1, which is 33% larger than that of the commercial TGG single crystal (-134 rad T-1 m-1).

  14. Incorporation of Ln-Doped LaPO4 Nanocrystals as Luminescent Markers in Silica Nanoparticles. (United States)

    van Hest, Jacobine J H A; Blab, Gerhard A; Gerritsen, Hans C; Donega, Celso de Mello; Meijerink, Andries


    Lanthanide ions are promising for the labeling of silica nanoparticles with a specific luminescent fingerprint due to their sharp line emission at characteristic wavelengths. With the increasing use of silica nanoparticles in consumer products, it is important to label silica nanoparticles in order to trace the biodistribution, both in the environment and living organisms.In this work, we synthesized LaPO4 nanocrystals (NCs) with sizes ranging from 4 to 8 nm doped with europium or cerium and terbium. After silica growth using an inverse micelle method, monodisperse silica spheres were obtained with a single LaPO4 NC in the center. We demonstrate that the size of the silica spheres can be tuned in the 25-55 nm range by addition of small volumes of methanol during the silica growth reaction. Both the LaPO4 core and silica nanocrystal showed sharp line emission characteristic for europium and terbium providing unique optical labels in silica nanoparticles of variable sizes.

  15. Magnetic phase transitions in TbFe sub 2 Al sub 1 sub 0 , HoFe sub 2 Al sub 1 sub 0 and ErFe sub 2 Al sub 1 sub 0

    CERN Document Server

    Reehuis, M; Krimmel, A; Scheidt, E W; Stüsser, N; Loidl, A; Jeitschko, W


    The magnetic order of the orthorhombic aluminides TbFe sub 2 Al sub 1 sub 0 , HoFe sub 2 Al sub 1 sub 0 and ErFe sub 2 Al sub 1 sub 0 (space group Cmcm) has been studied by specific heat and magnetic measurements, as well as by neutron powder diffraction down to 100 mK and in external fields up to 5 T. Only the rare-earth ions carry a magnetic moment. At T = 1.5 K the terbium moments in TbFe sub 2 Al sub 1 sub 0 show a square-wave modulated magnetic order with wavevector k = (0, 0.7977, 0) and a moment direction parallel to the a-axis. At a critical field of H sub c sub 1 = 0.9 T one of ten spins is forced to flip, going into an intermediate ferrimagnetic phase that is stable up to the critical field H sub c sub 2 = 1.8 T. Above this field finally all the rest of the spins flip, resulting in a ferromagnetic order of the terbium moments. ErFe sub 2 Al sub 1 sub 0 orders antiferromagnetically below T sub N 1.77(7) K with a similar magnetic structure characterized by a wavevector k (0, approx 0.8, 0). In contras...

  16. Deuteron induced Tb-155 production, a theranostic isotope for SPECT imaging and auger therapy. (United States)

    Duchemin, C; Guertin, A; Haddad, F; Michel, N; Métivier, V


    Several terbium isotopes are suited for diagnosis or therapy in nuclear medicine. Tb-155 is of interest for SPECT imaging and/or Auger therapy. High radionuclide purity is mandatory for many applications in medicine. The quantification of the activity of the produced contaminants is therefore as important as that of the radionuclide of interest. The experiments performed at the ARRONAX cyclotron (Nantes, France), using the deuteron beam delivered up to 34MeV, provide an additional measurement of the excitation function of the Gd-nat(d,x)Tb-155 reaction and of the produced terbium and gadolinium contaminants. In this study, we investigate the achievable yield for each radionuclide produced in natural gadolinium as a function of the deuteron energy. Other reactions are discussed in order to define the production route that could provide Tb-155 with a high yield and a high radionuclide purity. This article aims to improve data for the Gd-nat(d,x) reaction and to optimize the irradiation conditions required to produce Tb-155. Copyright © 2016 Elsevier Ltd. All rights reserved.


    African Journals Online (AJOL)

    ... determine the number of developing and degenerating follicles as well as the size of follicles. • This work was completed while the author was employed by the National Parks Board and forms part of a thesis for the D.Sc. (Agric.) Degree, presented to the University of Pretoria. Zo%gica A/ricana 7 (/): 167-174 (1972). 167.

  18. Experiment list: SRX1056719 [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available r; ChIP-Seq source_name=Combined input DNA from Kc167 cells expressing Ubx-GFP, AbdA-GFP and AbdB-GFP (Exper...l Stage=dorsal closure stage 4674983,92.6,2.6,1569 GSM1708986: Input Kc167 Exp1 rep2; Drosophila melanogaste

  19. Experiment list: SRX1056718 [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available r; ChIP-Seq source_name=Combined input DNA from Kc167 cells expressing Ubx-GFP, AbdA-GFP and AbdB-GFP (Exper...l Stage=dorsal closure stage 9362306,93.3,4.1,2076 GSM1708985: Input Kc167 Exp1 rep1; Drosophila melanogaste

  20. Archaeological Investigations at Site 45-DO-285, Chief Joseph Dam Project, Washington. (United States)


    carapace or plastron. ea ’W’ 82 AMPHIBIA (NlSP=167) Ranidae/ Bufonidae (frogs, toads) -- 167 elements. Both frogs and toads inhabit the project area...Ranidae/ Bufonidae Zone 1: 1 skull fragment, 2 lnncoinate fragments, 1 femur fragment. Zone 2: 1 radloulna, 1 tiblofibula Zone 3: 29 humerus fragments, 18

  1. Safe Resection and Primary Anastomosis of Gangrenous Sigmoid ...

    African Journals Online (AJOL)

    Results. The causes of mechanical obstruction: sigmoid volvulus. 30%, hernia 17.8%, adhesions 16.7%, faecal impaction. 16.7%. Seventy five (75%) of the sigmoid volvulus ... fluids, 'nil per oral' and a nasogastric tube for gastric decompression. The patients were scheduled for emergency laparotomy within six hours of ...

  2. African Journals Online: Health

    African Journals Online (AJOL)

    Items 151 - 167 of 167 ... South Sudan Medical Journal. The SSMJ is the a multi-professional journal in the South Sudan which caters for the needs of Doctors, Nurses, Midwives, Clinical Officers, Pharmacists and all other cadres in the health profession. Its vision is to see a well-trained, skilled professionals delivering high ...

  3. EST Table: BP123589 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available BP123589 epV31251 10/09/28 99 %/167 aa ref|NP_001040476.1| muscular protein 20 [Bom...byx mori] gb|ABF51467.1| muscular protein 20 [Bombyx mori] 10/08/29 76 %/167 aa FBpp0235584|DvirGJ21167-PA 1

  4. Eesti Raamatukoguhoidjate Ühingu tegevusest 2002. aastal / Krista Talvi

    Index Scriptorium Estoniae

    Talvi, Krista, 1948-


    Ka EARis 2002. a. toimunust; mainitud ka EARi töötajaid : lk. 155, 157, 167 K. Kaugver; lk. 155 J. Kaps; lk. 160, 165 T. Reimo, lk. 164 A.-M. Kirsel; lk. 164, 167 M. Aasmets; lk. 165 A. Valmas; lk. 165 A. Kruus

  5. Gclust Server: 98292 [Gclust Server

    Lifescience Database Archive (English)

    Full Text Available Sequences Related Sequences(194) 167 nhr-31: Nuclear Hormone Receptor family member (nhr-31) 1 1.00e-90 0.0...167 Representative annotation nhr-31: Nuclear Hormone Receptor family member (nhr-31) Number of Sequences

  6. Experiment list: SRX365696 [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available e_name=Kc167_CP190_ChIP-seq || cell line=Kc167 || chip antibody=CP190 rabbit || chip antibody reference=PMID:21852534 || input... used=input-b

  7. 8 CFR 1245.7 - Adjustment of status of certain Soviet and Indochinese parolees under the Foreign Operations... (United States)


    ... Indochinese parolees under the Foreign Operations Appropriations Act for Fiscal Year 1990 (Pub. L. 101-167... Appropriations Act for Fiscal Year 1990 (Pub. L. 101-167). (a) Application. Each person applying for benefits...)(2) of this section. (f) No offset in number of visas available. When an alien is granted the status...

  8. Experiment list: SRX365698 [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Stage=dorsal closure stage 22204822,92.1,81.7,9388 GSM1246070: input-b; Drosophila melanogaster; ChIP-Seq source_name=Kc167_input... || cell line=Kc167 || sample type=input

  9. Experiment list: SRX365697 [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Stage=dorsal closure stage 12038239,93.0,20.1,1840 GSM1246069: input-a; Drosophila melanogaster; ChIP-Seq source_name=Kc167_input... || cell line=Kc167 || sample type=input

  10. Prediction and analysis of the secreteomic in Corynebacterium ...

    African Journals Online (AJOL)

    167 proteins were predicted to be secreted and contain signal peptides, whose amino residues were relatively conserved. Among them, 10 have RR-motif signal peptide and 46 have SignalPaseII signal peptide. Total of 167 secreted proteins have functional descriptions, many of which were enzymes that are involved in ...

  11. Dicty_cDB: SSM115 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 0 BC059257_1( BC059257 |pid:none) Mus musculus MYC binding protein 2... 167 3e-40 AY325887_1( AY325887 |pid:...none) Mus musculus highwire (Phr1) mRNA,... 167 4e-40 AB172733_1( AB172733 |pid:none) Macaca fascicularis br

  12. Gclust Server: 63864 [Gclust Server

    Lifescience Database Archive (English)

    Full Text Available Eba_ebA594 Cluster Sequences Related Sequences(1) 167 inorganic pyrophosphatase 2 1.00e-22 14.29 0.0 0.0 0.0 3...Sequence length 167 Representative annotation inorganic pyrophosphatase Number of Sequences 2 Homologs

  13. Holographic Grating Study. Volume 1 (United States)


    EFFICIENCY GRATING ANALYSIS AND MEASUREMENT 167 4. 1 High-Efficiency Holographic Grating Desl ^ri Isaues .... 167 4.2 Computer Modeling of or more higher orders is maximized . This distinguishes them from low-efficiency gratings which utilize the zero order at hi^h efficiency

  14. Browse Title Index

    African Journals Online (AJOL)

    Items 151 - 167 of 167 ... Emeka Ikechi. Vol 4, No 2 (2015), The Role of the Mass Media in the Fight against Terrorism and the Instrumental Use of Women in Boko Haram Insurgence in Nigeria, Abstract PDF. CU Omego. Vol 4, No 1 (2015), The Views of Women of Press Coverage of Rape Cases in Nigeria: A Misrepresentation ...

  15. EST Table: DC537528 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available milar to AGAP010429-PA [Acyrthosiphon pisum] 10/09/02 65 %/167 aa FBpp0085738|SdhA-PC 10/08/28 66 %/167 aa C...03G5.1#CE03917#WBGene00015391#locus:sdha-1#succinate dehydrogenase flavoprotein subunit#status:Confirmed#Uni

  16. Browse Title Index

    African Journals Online (AJOL)

    Items 151 - 167 of 167 ... Vol 12, No 1 (2016), Towards the sense disambiguation of Afan Oromo words using hybrid approach (unsupervised machine learning and rule based) ... Vol 5, No 1 (2009), Trend And Causes Of Female Students Dropout From Teacher Education Institutions Of Ethiopia: The Case Of Jimma University ...

  17. Youth clubs' contributions towards promotion of Sexual and ...

    African Journals Online (AJOL)

    Youth clubs' contributions towards promotion of Sexual and Reproductive Health Services in Machinga District, Malawi. ... Frequently offered services in youth clubs were HIV and AIDS education reported by 48.4% of the study participants, STI education (16.7%), family planning(16.7%) and life skills education (9.7%).

  18. EST Table: FS743516 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available FS743516 E_FL_bmmt_25O09_R_0 10/09/28 98 %/167 aa ref|NP_001040402.1| preimplantati...on protein [Bombyx mori] gb|ABF51322.1| preimplantation protein [Bombyx mori] 10/09/07 80 %/167 aa FBpp02771

  19. EST Table: FS786649 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available FS786649 E_FL_fcaL_18O17_R_0 10/09/28 98 %/167 aa ref|NP_001040402.1| preimplantation... protein [Bombyx mori] gb|ABF51322.1| preimplantation protein [Bombyx mori] 10/09/09 80 %/167 aa FBpp02771


    African Journals Online (AJOL)

    *RTA = road traffic accident. Table 2: Sex Distribution Related to the Causes of Paediatric Trauma. Males Females. Causes. No. % No. %. Amputation of glans penis 3 16.7% - -. Avulsion of the ventral wall of the urethra 3 16.7% - -. Iatrogenic fistula 2 11.1% - -. Bladder injury from road traffic accident 1 5.6% 1 5.6%. Bladder ...

  1. Research Review: Do motor deficits during development represent an endophenotype for schizophrenia?

    DEFF Research Database (Denmark)

    Burton, Birgitte Klee; Hjorthøj, Carsten; Jepsen, Jens Richardt M.


    correlated domains, with available N varying by domain. RESULTS: Inclusion criteria were met by k = 23 independent studies with a total N = 18,582, and N across domains varying from 167 to 8619. The youth from affected families had delays in gross and fine motor development in infancy (k = 3, n = 167, Hedges...

  2. Browse Title Index

    African Journals Online (AJOL)

    Items 151 - 167 of 167 ... Vol 5, No 1 (2014), Things fall Apart Across Cultures: The Universal Significance of Chinua Achebe's 1958 Reconstruction of the African heritage, Abstract. FI Mogu ... Vol 1, No 1 (2010), Use of the Internet by Nigerian Female Undergraduates: Implications for Inclusive Higher Education, Abstract.

  3. Experiment list: SRX017472 [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available orsal closure stage 11864949,84.4,15.9,3885 GSM522360: ORC2 KC167 2 extraction2 seq1 aliquote 1 source_name=ORC2_KC167_2 stage=late embryonic stage || genotype=se/e || sex=Female

  4. Experiment list: SRX017469 [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available orsal closure stage 16963039,94.1,13.5,7338 GSM522363: MCM KC167 2 extraction2 seq1 aliquote 1 source_name=MCM_KC167_2 ex... stage=late embryonic stage || genotype=se/e || sex=Female http://dbarchive.biosc

  5. Experiment list: SRX017471 [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available orsal closure stage 11385640,87.0,20.1,6280 GSM522359: ORC2 KC167 1 extraction1 seq1 aliquote 1 source_name=ORC2_KC167_1 stage=late embryonic stage || genotype=se/e || sex=Female

  6. Dermis-fat grafts and enucleation in Ghanaian children: 5 years ...

    African Journals Online (AJOL)

    were intraocular retinoblastoma (n=10, 66.7%), unexplained retinal detachment mimicking retinoblastoma (n=3,20.0%), anterior staphyloma (n=1,6.7%) and medulloepithelioma (n=1,6.7%). Fourteen (93.3%) patients showed increase in volume of DFG. Time for Conjunctival reepithelialisation of the dermal surface was four ...

  7. Gclust Server: 113283 [Gclust Server

    Lifescience Database Archive (English)

    Full Text Available of a complex (Rvs161p-Rvs167p) involved in regulation of actin cytoskeleton, endocytosis, and viability following... (Rvs161p-Rvs167p) involved in regulation of actin cytoskeleton, endocytosis, and viability following starva

  8. NCBI nr-aa BLAST: CBRC-DNOV-01-1268 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-DNOV-01-1268 ref|ZP_01710900.1| permease for cytosine/purines, uracil, thiamine, allan...toin [Caldivirga maquilingensis IC-167] gb|ABW02215.1| permease for cytosine/purines uracil thiamine allantoin [Caldivirga maquilingensis IC-167] ZP_01710900.1 5.2 28% ...

  9. Yeast Interacting Proteins Database: YBR108W, YGR136W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available YBR108W AIM3 Protein interacting with Rvs167p; null mutant is viable and displays e...w YBR108W Bait ORF YBR108W Bait gene name AIM3 Bait description Protein interacting with Rvs167p; null mutant is viable and display


    African Journals Online (AJOL)


    Jul 7, 2001 ... Minocycline 66.7 100 100. Ampicillin 50.0 40 50.0. Perfloxacin 33.3 40 16.7. Cotrimoxazole 16.7 20 0. The total number ofbacterial isolates were 27 with the commonest isolates being Streptococcus pneumonia. (22.7%) followed by Staphylococcus alhus (18.5%) and. Staphylococcus aureus (11.1%).

  11. Pramana – Journal of Physics | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Pramana – Journal of Physics; Volume 84; Issue 2. Issue front cover thumbnail. Volume 84, Issue 2. February 2015, pages 167-325. Proceedings of the Conference on Perspectives in Nonlinear Dynamics - Part I. pp 167-171. PNLD 2013: Conference summary and a perspective · Sudeshna Sinha Somdatta ...

  12. Volume 9 No. 4 2009 June 2009 1019 BACTERIOLOGICAL ...

    African Journals Online (AJOL)

    drinking water. Five (16.7 %) of the samples were Excellent, 5 (16.7%) were. Satisfactory, 9 (30%) were Suspicious and 11 (36.7%) were Unsatisfactory using the. MPN values recorded. Six samples were ..... water supplies or well water [5] which is then supposedly further treated to make it safe for direct consumption hence ...

  13. Direct evidence for stability of tetrahedral interstitial Er in Si up to 900$^{\\circ}$C

    CERN Document Server

    Wahl, U; Langouche, G; Marques, J G; Vantomme, A


    Conversion electron emission channeling from the isotope $^{167m}$Er (2.28 s), which is the decay product of radioactive $^{167}$Tm (9.25 d), offers a means of monitoring the lattice sites of Er in single crystals. We have used this method to determine the lattice location of $^{167m}$Er in Si directly following room temperature implantation of $^{167}$Tm, after subsequent annealing steps, and also in situ during annealing up to 900°C. Following the recovery of implantation damage around 600°C, about 90% of Er occupies near-tetrahedral interstitial sites in both FZ and CZ Si. While in FZ Si $^{167m}$Er was found to be stable on these sites even at 900°C, the tetrahedral Er fraction in CZ Si decreased considerably after annealing for 10 min at 800°C and above.

  14. Responsive hybrid inorganic-organic system derived from lanthanide luminescence

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Zhan [School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); Zheng, Yuhui, E-mail: [School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); Jiang, Lasheng; Yang, Jinglian [School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); Wang, Qianming, E-mail: [Key Laboratory of Theoretical Chemistry of Environment, Ministry of Education, School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); Guangzhou Key Laboratory of Materials for Energy Conversion and Storage, Guangzhou 510006 (China)


    Highlights: • A novel covalent hybrid material was used to detect hemoglobin. • All the recognition experiments were performed in buffer solution. • Porous nano-structures was extensively studied for the recognition. - Abstract: Terbium ions were incorporated into new organic-inorganic matrices to achieve intense green emissions. Hemoglobin (HB) interactions lead to dramatic changes in the luminescence emission intensities. Infrared spectra, morphological studies and photoluminescence give information for the speciation and process of hemoglobin additions. The porous material has a large specific surface area of 351 cm{sup 2}/g and the detection limit for HB (0.7 μM) was much lower than its physical doped material (8 μM). This promising hybrid material will lead to the design of versatile optical probes that are efficiently responding to the external targets.

  15. Optical fiber sensor for low dose gamma irradiation monitoring (United States)

    de Andrés, Ana I.; Esteban, Ã.`scar; Embid, Miguel


    An optical fiber gamma ray detector is presented in this work. It is based on a Terbium doped Gadolinium Oxysulfide (Gd2O2S:Tb) scintillating powder which cover a chemically etched polymer fiber tip. This etching improves the fluorescence gathering by the optical fiber. The final diameter has been selected to fulfill the trade-off between light gathering and mechanical strength. Powder has been encapsulated inside a microtube where the fiber tip is immersed. The sensor has been irradiated with different air Kerma doses up to 2 Gy/h with a 137Cs source, and the spectral distribution of the fluorescence intensity has been recorded in a commercial grade CCD spectrometer. The obtained signal-to-noise ratio is good enough even for low doses, which has allowed to reduce the integration time in the spectrometer. The presented results show the feasibility for using low cost equipment to detect/measure ionizing radiation as gamma rays are.

  16. See Also:physica status solidi (b)physica status solidi (c)Copyright © 2004 WILEY-VCH Verlag GmbH & Co. KGaA, WeinheimGet Sample CopyFree Online Trial -->Recommend to Your LibrarianSave Title to My ProfileSet E-Mail Alert Journal subnav -->var homepagelinks = new Array(new Array("Journal Home","/cgi-bin/jhome/40000761",""),new Array("Issues","/cgi-bin/jtoc/40000761/",""),new Array("Early View","/cgi-bin/jeview/40000761/",""),new Array("News","/cgi-bin/jabout/40000761/news/index.html",""),new Array("Reviews","/cgi-bin/jabout/40000761/reviews.html",""),new Array("Read Cover Story","/cgi-bin/jabout/40000761/cover/2231/current.html","e"),new Array("","","s"),new Array("Product Information","/cgi-bin/jabout/40000761/2231_info.html",""),new Array("Editorial Board","/cgi-bin/jabout/40000761/edbd.html",""),new Array("For Authors","/cgi-bin/jabout/40000761/authors.html",""),new Array("For Referees","/cgi-bin/jabout/40000761/refserv.html",""),new Array("Subscribe","",""),new Array("Contact","/cgi-bin/jabout/40000761/contact.html",""),new Array("Online Submission","",""),new Array("","","x"));writeJournalLinks("", "40000761");Journal subnav -->journal info area -->journal info area --> Previous Issue | Next Issue >Volume 201, Issue12 (September 2004)Articles in the Current Issue:article list -->Rapid Research NoteEffects of high dose proton irradiation on the electrical performance of ZnO Schottky diodes (United States)

    Khanna, Rohit; Ip, K.; Allums, K. K.; Baik, K.; Abernathy, C. R.; Pearton, S. J.; Heo, Y. W.; Norton, D. P.; Ren, F.; Dwivedi, R.; Fogarty, T. N.; Wilkins, R.


    The preparation and characterization of terbium doped zinc aluminate photoluminescent films obtained by ultrasonic spray pyrolysis deposition process are described. Variations on doping concentrations in the start spraying solution and substrate temperatures were studied. XRD measurements on these films showed that the crystalline structure depends on the substrate temperature. For an excitation wavelength of 242 nm, all the photoluminescence spectra show peaks located at 488 nm, 546 nm, 589 nm and 621 nm. The photoluminescence intensity reaches values practically constant for the samples deposited at substrate temperatures higher than 400 °C. In this case, concentration quenching of the photoluminescence appears at doping concentrations greater than 0.93 atomic percent into the films. The surface morphology characteristics of the films deposited on glass and silicon substrates, as a function of the deposition temperature, are presented.

  17. Luminescent lanthanide chelates and methods of use (United States)

    Selvin, Paul R.; Hearst, John


    The invention provides lanthanide chelates capable of intense luminescence. The celates comprise a lanthanide chelator covalently joined to a coumarin-like or quinolone-like sensitizer. Exemplary sensitzers include 2- or 4-quinolones, 2- or 4-coumarins, or derivatives thereof e.g. carbostyril 124 (7-amino-4-methyl-2-quinolone), coumarin 120 (7-amino-4-methyl-2-coumarin), coumarin 124 (7-amino-4-(trifluoromethyl)-2-coumarin), aminomethyltrimethylpsoralen, etc. The chelates form high affinity complexes with lanthanides, such as terbium or europium, through chelator groups, such as DTPA. The chelates may be coupled to a wide variety of compounds to create specific labels, probes, diagnostic and/or therapeutic reagents, etc. The chelates find particular use in resonance energy transfer between chelate-lanthanide complexes and another luminescent agent, often a fluorescent non-metal based resonance energy acceptor. The methods provide useful information about the structure, conformation, relative location and/or interactions of macromolecules.

  18. Creating infinite contrast in fluorescence microscopy by using lanthanide centered emission

    DEFF Research Database (Denmark)

    R. Carro-Temboury, Miguel; Arppe, Riikka Matleena; Hempel, Casper


    for completely removing the background signal in spectrally resolved fluorescence microscopy. The methodology is applicable for all probes with narrow and well-defined emission bands (Full width half-maximum lanthanide based probes exploiting the narrow emission lines of europium......(III) and terbium(III) ions. We used a model system with zeolites doped with lanthanides immobilized in a polymer stained with several fluorescent dyes regularly used in bioimaging. After smoothing the spectral data recorded in each pixel, they are differentiated. Method I is based on the direct sum of the gradient......, while method II resolves the fluorescent signal by subtracting a background calculated via the gradient. Both methods improve signal-to-background ratio significantly and we suggest that spectral imaging of lanthanide-centered emission can be used as a tool to obtain absolute contrast in bioimaging....

  19. Luminescent Lanthanide Metal Organic Frameworks for cis-Selective Isoprene Polymerization Catalysis

    Directory of Open Access Journals (Sweden)

    Samantha Russell


    Full Text Available In this study, we are combining two areas of chemistry; solid-state coordination polymers (or Metal-Organic Framework—MOF and polymerization catalysis. MOF compounds combining two sets of different lanthanide elements (Nd3+, Eu3+/Tb3+ were used for that purpose: the use of neodymium was required due to its well-known catalytic properties in dienes polymerization. A second lanthanide, europium or terbium, was included in the MOF structure with the aim to provide luminescent properties. Several lanthanides-based MOF meeting these criteria were prepared according to different approaches, and they were further used as catalysts for the polymerization of isoprene. Stereoregular cis-polyisoprene was received, which in some cases exhibited luminescent properties in the UV-visible range.

  20. Method for compensation of thermally induced modal distortions in the input optical components of gravitational wave interferometers

    CERN Document Server

    Müller, G; Guagliardo, D; McFeron, D; Lundock, R; Reitze, D H; Tanner, D B


    The next generation of interferometric gravitational wave detectors will employ laser powers approaching 200 W to increase shot-noise limited sensitivity. Optical components that transmit the laser light will exhibit increased thermal lensing induced by bulk absorption and concomitant changes in the material refractive index, resulting in significant changes in the modal characteristics of the beam. Key interferometer components such as electro-optic modulators and Faraday isolators are particularly at risk, since they possess relatively large absorption coefficients. We present a method for passive correction of thermally induced optical path length (DELTA LAMBDA) changes induced by absorption in transmissive optical components. Our method relies on introducing material in the optical path that possesses a negative index temperature derivative, thereby inducing a compensating opposite DELTA LAMBDA. We experimentally demonstrate a factor of 10 reduction in higher order spatial mode generation for terbium gall...

  1. High-density scintillating glasses for a proton imaging detector (United States)

    Tillman, I. J.; Dettmann, M. A.; Herrig, V.; Thune, Z. L.; Zieser, A. J.; Michalek, S. F.; Been, M. O.; Martinez-Szewczyk, M. M.; Koster, H. J.; Wilkinson, C. J.; Kielty, M. W.; Jacobsohn, L. G.; Akgun, U.


    High-density scintillating glasses are proposed for a novel proton-imaging device that can improve the accuracy of the hadron therapy. High-density scintillating glasses are needed to build a cost effective, compact calorimeter that can be attached to a gantry. This report summarizes the study on Europium, Terbium, and Cerium-doped scintillating glasses that were developed containing heavy elements such as Lanthanum, Gadolinium, and Tungsten. The density of the samples reach up to 5.9 g/cm3, and their 300-600 nm emission overlaps perfectly with the peak cathode sensitivity of the commercial photo detectors. The developed glasses do not require any special quenching and can be poured easily, which makes them a good candidate for production in various geometries. Here, the glass making conditions, preliminary tests on optical and physical properties of these scintillating, high-density, oxide glasses developed for a novel medical imaging application are reported.

  2. Heat-Flux Gage thermophosphor system

    Energy Technology Data Exchange (ETDEWEB)

    Tobin, K.W.


    This document describes the installation, hardware requirements, and application of the Heat-Flux Gage (Version 1.0) software package developed by the Oak Ridge National Laboratory, Applied Technology Division. The developed software is a single component of a thermographic phosphor-based temperature and heat-flux measurement system. The heat-flux transducer was developed by EG G Energy Measurements Systems and consists of a 1- by 1-in. polymethylpentene sheet coated on the front and back with a repeating thermographic phosphor pattern. The phosphor chosen for this application is gadolinium oxysulphide doped with terbium. This compound has a sensitive temperature response from 10 to 65.6{degree}C (50--150{degree}F) for the 415- and 490-nm spectral emission lines. 3 refs., 17 figs.

  3. Radioluminescence of rare-earth doped aluminum oxide

    Energy Technology Data Exchange (ETDEWEB)

    Santiago, M.; Molina, P. [Universidad Nacional del Centro de la Provincia de Buenos Aires, Instituto de Fisica Arroyo Seco, Pinto 399, 7000 Tandil (Argentina); Barros, V. S.; Khoury, H. J.; Elihimas, D. R., E-mail: [Universidade Federal de Pernambuco, Departamento de Energia Nuclear, Av. Prof. Luiz Freire 1000, Recife, PE 50740-540 (Brazil)


    Carbon-doped aluminum oxide (Al{sub 2}O{sub 3}:C) is one of the most used radioluminescence (Rl) materials for fiberoptic dosimetry due to its high efficiency and commercial availability. However, this compound presents the drawback of emitting in the spectral region, where the spurious radioluminescence of fibers is also important. In this work, the radioluminescence response of rare-earth doped Al{sub 2}O{sub 3} samples has been evaluated. The samples were prepared by mixing stoichiometric amounts of aluminum nitrate, urea and dopants with different amounts of terbium, samarium, cerium and thulium nitrates varying from 0 to 0.15 mo 1%. The influence of the different activators on the Rl spectra has been investigated in order to determine the feasibility of using these compounds for Rl fiberoptic dosimetry. (Author)

  4. Messenger RNA Detection in Leukemia Cell lines by Novel Metal-Tagged in situ Hybridization using Inductively Coupled Plasma Mass Spectrometry. (United States)

    Ornatsky, Olga I; Baranov, Vladimir I; Bandura, Dmitry R; Tanner, Scott D; Dick, John


    Conventional gene expression profiling relies on using fluorescent detection of hybridized probes. Physical characteristics of fluorophores impose limitations on achieving a highly multiplex gene analysis of single cells. Our work demonstrates the feasibility of using metal-tagged in situ hybridization for mRNA detection by inductively coupled plasma mass spectrometry (ICP-MS). ICP-MS as an analytical detector has a number of unique and relevant properties: 1) metals and their stable isotopes generate non-overlapping distinct signals that can be detected simultaneously; 2) these signals can be measured over a wide dynamic range; 3) ICP-MS is quantitative and very sensitive. We used commercial antibodies conjugated to europium (Eu) and gold together with biotinylated oligonucleotide probes reacted with terbium-labeled streptavidin to demonstrate simultaneous mRNA and protein detection by ICP-MS in leukemia cells.

  5. Magnetic behaviour of TbPc2 single-molecule magnets chemically grafted on silicon surface. (United States)

    Mannini, Matteo; Bertani, Federico; Tudisco, Cristina; Malavolti, Luigi; Poggini, Lorenzo; Misztal, Kasjan; Menozzi, Daniela; Motta, Alessandro; Otero, Edwige; Ohresser, Philippe; Sainctavit, Philippe; Condorelli, Guglielmo G; Dalcanale, Enrico; Sessoli, Roberta


    Single-molecule magnets (SMMs) are among the most promising molecular systems for the development of novel molecular electronics based on spin transport. Going beyond investigations focused on physisorbed SMMs, in this work the robust grafting of terbium(III) bis(phthalocyaninato) complexes to a silicon surface from a diluted solution is achieved by rational chemical design yielding the formation of a partially oriented monolayer on the conducting substrate. Here by exploiting the surface sensitivity of X-ray circular magnetic dichroism, we evidence an enhancement of the magnetic bistability of this SMM, in contrast to the dramatic reduction of the magnetic hysteresis that characterizes monolayer deposits evaporated on noble and ferromagnetic metals. Photoelectron spectroscopy investigations and density functional theory analysis suggest a non-innocent role played by the silicon substrate, evidencing the potentiality of this approach for robust integration of bistable magnetic molecules in electronic devices.

  6. Penicillium expansum Link strain for a biometallurgical method to recover REEs from WEEE. (United States)

    Di Piazza, Simone; Cecchi, Grazia; Cardinale, Anna Maria; Carbone, Cristina; Mariotti, Mauro Giorgio; Giovine, Marco; Zotti, Mirca


    Due to the wide range of applications in high-tech solutions, Rare Earth Elements (REEs) have become object of great interest. In the last years several studies regarding technologies for REE extraction from secondary resources have been carried out. In particular biotechnologies, which use tolerant and accumulator microorganisms to recover and recycle precious metals, are replacing traditional methods. This paper describes an original biometallurgical method to recover REEs from waste electrical and electronic equipment (WEEE) by using a strain of Penicillium expansum Link isolated from an ecotoxic metal contaminated site. The resulting product is a high concentrated solution of Lanthanum (up to 390ppm) and Terbium (up to 1520ppm) obtained from WEEE. Under this perspective, the proposed protocol can be considered a method of recycling exploiting biometallurgy. Finally, the process is the subject of the Italian patent application n. 102015000041404 submitted by the University of Genoa. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Infrared Spectroscopic Characterization of Photoluminescent Polymer Nanocomposites

    Directory of Open Access Journals (Sweden)

    Kyle Gipson


    Full Text Available Organicallycoated inorganic nanoparticles were synthesized to produce photoluminescent nanocomposites based on a polymethyl methacrylate (PMMA matrix. The nanoparticles comprised organic ligands (acetylsalicylic acid, ASA, and 2-picolinic acid, PA attached to the lanthanum trifluoride (LaF3 host crystals that were doped with optically active terbium III (Tb3+ and synthesized using solution-based methods. The ligands were employed to functionalize the surface of Tb3+:LaF3 nanocrystals to aid in dispersing the nanoparticles. In order to confirm the presence of the constituents within the inorganic-organic system, the nanoparticles were characterized by infrared spectroscopy and energy-dispersive X-ray spectroscopy. Absorption peaks observed from infrared spectroscopy for all the polymer nanocomposites loaded with organic surface treated nanocrystals exhibited peaks that were not present in undoped PMMA but were characteristic of the dopant and the ligand.

  8. Complex logic functions implemented with quantum dot bionanophotonic circuits. (United States)

    Claussen, Jonathan C; Hildebrandt, Niko; Susumu, Kimihiro; Ancona, Mario G; Medintz, Igor L


    We combine quantum dots (QDs) with long-lifetime terbium complexes (Tb), a near-IR Alexa Fluor dye (A647), and self-assembling peptides to demonstrate combinatorial and sequential bionanophotonic logic devices that function by time-gated Förster resonance energy transfer (FRET). Upon excitation, the Tb-QD-A647 FRET-complex produces time-dependent photoluminescent signatures from multi-FRET pathways enabled by the capacitor-like behavior of the Tb. The unique photoluminescent signatures are manipulated by ratiometrically varying dye/Tb inputs and collection time. Fluorescent output is converted into Boolean logic states to create complex arithmetic circuits including the half-adder/half-subtractor, 2:1 multiplexer/1:2 demultiplexer, and a 3-digit, 16-combination keypad lock.

  9. Creating infinite contrast in fluorescence microscopy by using lanthanide centered emission

    DEFF Research Database (Denmark)

    R. Carro-Temboury, Miguel; Arppe, Riikka Matleena; Hempel, Casper


    The popularity of fluorescence microscopy arises from the inherent mode of action, where the fluorescence emission from probes is used to visualize selected features on a presumed dark background. However, the background is rarely truly dark, and image processing and analysis is needed to enhance...... for completely removing the background signal in spectrally resolved fluorescence microscopy. The methodology is applicable for all probes with narrow and well-defined emission bands (Full width half-maximum emission lines of europium......(III) and terbium(III) ions. We used a model system with zeolites doped with lanthanides immobilized in a polymer stained with several fluorescent dyes regularly used in bioimaging. After smoothing the spectral data recorded in each pixel, they are differentiated. Method I is based on the direct sum of the gradient...

  10. TbNb6Sn6: the first ternary compound from the rare earth–niobium–tin system

    Directory of Open Access Journals (Sweden)

    Viktor Hlukhyy


    Full Text Available The title compound, terbium hexaniobium hexastannide, TbNb6Sn6, is the first ternary compound from the rare earth–niobium–tin system. It has the HfFe6Ge6 structure type, which can be analysed as an intergrowth of the Zr4Al3 and CaCu5 structures. All the atoms lie on special positions; their coordination geometries and site symmetries are: Tb (dodecahedron 6/mmm; Nb (distorted icosahedron 2mm; Sn (Frank–Caspar polyhedron, CN = 14–15 6mm and overline{6}m2; Sn (distorted icosahedron overline{6}m2. The structure contains a graphite-type Sn network, Kagome nets of Nb atoms, and Tb atoms alternating with Sn2 dumbbells in the channels.

  11. Robust lanthanide emitters in polyelectrolyte thin films for photonic applications (United States)

    Greenspon, Andrew S.; Marceaux, Brandt L.; Hu, Evelyn L.


    Trivalent lanthanides provide stable emission sources at wavelengths spanning the ultraviolet through the near infrared with uses in telecommunications, lighting, and biological sensing and imaging. We describe a method for incorporating an organometallic lanthanide complex within polyelectrolyte multilayers, producing uniform, optically active thin films on a variety of substrates. These films demonstrate excellent emission with narrow linewidths, stable over a period of months, even when bound to metal substrates. Utilizing different lanthanides such as europium and terbium, we are able to easily tune the resulting wavelength of emission of the thin film. These results demonstrate the suitability of this platform as a thin film emitter source for a variety of photonic applications such as waveguides, optical cavities, and sensors.

  12. Design and Development of a Magneto-Optic Sensor for Magnetic Field Measurements

    Directory of Open Access Journals (Sweden)



    Full Text Available A magneto-optic sensor is developed using a Terbium Doped Glass (TDG element as a Faraday rotation sensor and optical fiber as light transmitting and receiving medium. Online LabView based application software is developed to process the sensor output. The system is used to sense the magnetic field of a DC motor field winding in industrial environment. The sensor output is compared with the magnetic flux density variation obtained with a calibrated Hall Magnetic sensor (Gauss Meter. A linear variation of sensor output over wide range of current passing through the field winding is obtained. Further the results show an improved sensitivity of magneto-optic sensor over the Hall sensor.

  13. Photon Self-Induced Spin to Orbital Conversion in TGG crystal at high laser power

    CERN Document Server

    Mosca, S; Karimi, E; Piccirillo, B; Marrucci, L; De Rosa, R; Genin, E; Milano, L; Santamato, E


    In this paper, we present experimental evidence of a newly discovered third-order nonlinear optical process Self-Induced Spin-to-Orbital Conversion (SISTOC) of the photon angular momentum. This effect is the physical mechanism at the origin of the depolarization of very intense laser beams propagating in isotropic materials. The SISTOC process, like self-focusing, is triggered by laser heating leading to a radial temperature gradient in the medium. In this work we tested the occurrence of SISTOC in a terbium gallium garnet (TGG) rod for an impinging laser power of about 100~W. To study the SISTOC process we used different techniques: polarization analysis, interferometry and tomography of the photon orbital angular momentum. Our results confirm, in particular, that the apparent depolarization of the beam is due to the occurrence of maximal entanglement between the spin and orbital angular momentum of the photons undergoing the SISTOC process. This explanation of the true nature of the depolarization mechanism...

  14. Síntese, caracterização e propriedades espectroscópicas de criptatos de lantanídeo do tipo [LnÌ(bipy2py(CO2Et 23+

    Directory of Open Access Journals (Sweden)

    Nova Suzana P. Vila


    Full Text Available This work reports on the synthesis, characterization (infrared and hidrogen nmr spectra and photophysical properties (luminescence spectra and emission quantum yield of the lanthanide cryptates [LnÌ(bipy2py(CO2Et 2]3+ with Ln = Eu3+, Tb3+ or Gd3+, which can be applied as efficient Light-Conversion-Molecular-Devices. From emission spectra of [EuÌ(bipy2py(CO2Et 2]3+ it was possible to assign C3 symmetry to the metal ion. The spectroscopic studies show a higher emission quantum yield (q=25% for [TbÌ(bipy2py(CO2Et 2]3+ in aqueous solution, whereas the europium cryptate presents q=14%. This is justified by a more efficient energy transfer between triplet and emission levels of terbium (T->5D4.

  15. Inorganic phosphate nanorods are a novel fluorescent label in cell biology

    Directory of Open Access Journals (Sweden)

    Mukherjee Priyabrata


    Full Text Available Abstract We report the first use of inorganic fluorescent lanthanide (europium and terbium ortho phosphate [LnPO4·H2O, Ln = Eu and Tb] nanorods as a novel fluorescent label in cell biology. These nanorods, synthesized by the microwave technique, retain their fluorescent properties after internalization into human umbilical vein endothelial cells (HUVEC, 786-O cells, or renal carcinoma cells (RCC. The cellular internalization of these nanorods and their fluorescence properties were characterized by fluorescence spectroscopy (FS, differential interference contrast (DIC microscopy, confocal microscopy, and transmission electron microscopy (TEM. At concentrations up to 50 μg/ml, the use of [3H]-thymidine incorporation assays, apoptosis assays (TUNEL, and trypan blue exclusion illustrated the non-toxic nature of these nanorods, a major advantage over traditional organic dyes

  16. Processes and Technologies for the Recycling of Spent Fluorescent Lamps

    Directory of Open Access Journals (Sweden)

    Kujawski Wojciech


    Full Text Available The growing industrial application of rare earth metals led to great interest in the new technologies for the recycling and recovery of REEs from diverse sources. This work reviews the various methods for the recycling of spent fluorescent lamps. The spent fluorescent lamps are potential source of important rare earth elements (REEs such as: yttrium, terbium, europium, lanthanum and cerium. The characteristics of REEs properties and construction of typical fl uorescent lamps is described. The work compares also current technologies which can be utilized for an efficient recovery of REEs from phosphors powders coming from spent fluorescent lamps. The work is especially focused on the hydrometallurgical and pyrometallurgical processes. It was concluded that hydrometallurgical processes are especially useful for the recovery of REEs from spent fluorescent lamps. Moreover, the methods used for recycling of REEs are identical or very similar to those utilized for the raw ores processing.

  17. Electroluminescence characteristics of a new kind of rare-earth complex: TbY(o-MOBA){sub 6}(phen){sub 2} {center_dot}2H{sub 2}O

    Energy Technology Data Exchange (ETDEWEB)

    Shi, Yumeng [Key Laboratory of Luminescence and Optical Information, Ministry of Education, Institute of Optoelectronic Technology, Beijing Jiaotong University, Beijing 100044 (China); Deng, Zhenbo [Key Laboratory of Luminescence and Optical Information, Ministry of Education, Institute of Optoelectronic Technology, Beijing Jiaotong University, Beijing 100044 (China)]. E-mail:; Xiao, Jing [Key Laboratory of Luminescence and Optical Information, Ministry of Education, Institute of Optoelectronic Technology, Beijing Jiaotong University, Beijing 100044 (China); Xu, Denghui [Key Laboratory of Luminescence and Optical Information, Ministry of Education, Institute of Optoelectronic Technology, Beijing Jiaotong University, Beijing 100044 (China); Chen, Zheng [Key Laboratory of Luminescence and Optical Information, Ministry of Education, Institute of Optoelectronic Technology, Beijing Jiaotong University, Beijing 100044 (China); Wang, Ruifen [Department of Chemistry, Heibei Normal University, Shijiazhuang 050091 (China)


    A new rare-earth complex TbY(o-MOBA){sub 6}(phen){sub 2} {center_dot}2H{sub 2}O was synthesized, which was used as an emitting material in electroluminescence device. This was doped into poly(N-vinylcarbazole) and two devices were fabricated having structures of (1) Glass/ITO/PVK:RE complex/LiF/Al, and (2) Glass/ITO/PVK:RE complex/BCP/AlQ/LiF/Al. As compared with a different Terbium complex Tb(o-MOBA){sub 3}phen{center_dot}H{sub 2}O, the photoluminescence and electroluminescence mechanisms were discussed. Bright green emission was obtained from the optimized multi-layer device and the highest brightness reached 124.5 cd/m{sup 2} at the voltage of 23 V.

  18. Thermoluminescence on ZrO{sub 2} films with different dopants; Termoluminiscencia en peliculas de ZrO{sub 2} con distintos impurificantes

    Energy Technology Data Exchange (ETDEWEB)

    Ceron R, P. V.; Rivera M, T.; Ramos G, A. I.; Guzman M, J.; Montes R, E., E-mail: [IPN, Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada, Av. Legaria No. 694, Col. Irrigacion, 11500 Mexico D. F. (Mexico)


    Full text: The metal oxides doped with rare earths have presented good thermoluminescent properties for certain wavelengths in the UV. With respect to zirconium oxide exist several studies in which were incorporated impurities and their properties as dosimeter in several regions of the electromagnetic spectrum were analyzed. Because of this background, in this material thermoluminescent glow curves induced by UV in films of ZrO{sub 2}:Eu and ZrO{sub 2}:Tb were studied for comparison with the response of the material doped with two rare earths (ZrO{sub 2}:Eu + Tb). Samples were deposited on glass by ultrasonic spray pyrolysis technique with different synthesis parameters. It was found that the strongest Tl response was to ZrO{sub 2} film doped with terbium (14 times more intense than the film of ZrO{sub 2}:Eu and 6 times the response of ZrO{sub 2}:Eu + Tb). (Author)

  19. Growth and Faraday rotation characteristics of Tb2Sn2O7 crystal (United States)

    Guo, F. Y.; Wan, Q. P.; Hou, Y.; Zhang, L. Z.; Fu, H.; Chen, J. Z.


    Tb2Sn2O7 (TSO) single crystals have been grown by the top-seeded solution growth (TSSG) method using a Na2B4O7-NaF mixture as the flux. In this paper, the morphology of as-grown TSO crystals is briefly described and the valences of terbium and tin in crystal were analyzed by X-ray photoelectron spectroscopy. The transmission spectrum was measured in the wavelength range of 400-1600 nm at room temperature and the Faraday rotation of a TSO crystal was investigated at 532, 633 and 1064 nm wavelengths by the extinction method. Results show that TSO crystals exhibit typical paramagnetism when the temperature is above 2 K and have a larger Verdet constant than that reported for TGG.

  20. Lanthanide complexes of a picolinate ligand derived from 1,4,7-triazacyclononane with potential application in magnetic resonance imaging and time-resolved luminescence imaging. (United States)

    Nonat, Aline; Gateau, Christelle; Fries, Pascal H; Mazzanti, Marinella


    The new potentially octadentate ligand, 1-(carboxymethyl)-4,7-bis[(6-carboxypyridin-2-yl)methyl]-1,4,7-triazacyclononane (H(3)bpatcn), in which two picolinate arms and one acetate arm are connected to the 1,4,7-triazacyclonane core, has been prepared. Potentiometric studies show an increased stability of the Gd(III) complex of H(3)bpatcn (logK(GdL)=15.8(2)) with respect to the Gd(III) complex of the analogous ligand 1,4,7-triazacyclononane-N,N',N''-triacetic acid (H(3)nota) (logK(GdL)=13.7), associated with an increased selectivity of H(3)bpatcn for gadolinium over calcium. The H(3)bpatcn ligand sensitises the terbium ion very efficiently, leading to a long-lived and highly luminescent terbium complex (quantum yield=43 %), in spite of the presence of a coordinated water molecule. (1)H proton NMR studies indicate that the metal ion is rigidly encapsulated by the three arms of the octadentate ligand H(3)bpatcn and that the macrocycle framework remains bound (through the five nitrogen and the three oxygen atoms) even at high temperature. A new theoretical method for interpreting the water proton relaxivity is presented. It is based on recent progresses in the description of the electronic spin relaxation and on an auxiliary probe solute. It replaces the Solomon, Bloembergen and Morgan (SBM) framework, which is questionable at low field, while avoiding resorting to simulations and/or sophisticated theories with additional unknown zero-field splitting (ZFS) parameters. The inclusion of two picolinate groups on a triazacyclononane framework affords the mono-aquo gadolinium complex [Gd(bpatcn)(H(2)O)] with favourable electron-relaxation properties (tau(eff)(S0)=125 ps). The optimisation of the electronic relaxation by ligand design is especially important to achieve high relaxivity in the new generation macromolecular complexes with long rotational correlation times.