
Sample records for terbium 161

  1. Preparation of extractive resins for producing terbium-161; Preparacion de resinas extractivas para produccion de terbio-161

    Energy Technology Data Exchange (ETDEWEB)

    De la Cruz B, C. C.; Monroy G, F. [ININ, Carretera Mexico-Toluca s/n, 52750 Ocoyoacac, Estado de Mexico (Mexico)], e-mail:


    This paper presents the development of a methodology for extractive resins preparation to base of HDEHP, which allows to separation of Tb from Gd generating an own technology of preparation of these resins. The study included the extractive resins preparation from 6 different supports: kieselguhr Dg, alumina, red volcanic rock, chiluca, quarry and fluorite; two treatment types of of supports and varied concentrations of HDEHP extractant (di(2-etil hexyl) orthophosphoric acid), in order to determine which resin has improved efficiency of Gd and Tb separation, and radionuclide purity of {sup 161}Tb. Resins were prepared to base of kieselguhr to determine the most appropriate silicon deposition process. Two silicon deposition treatments were realized: treatment I , by contact with silicon deposition solution (dimethyldichlorosilane / heptane 1:30) and treatment II by contact with vapors of dimethyldichlorosilane in vacuum. The extractant retention was carried out to different concentrations of HDEHP / acetone: 1:4, 1:8, 1:15, 1:20, 1:30 and 1:40. According to the results, there is not direct relation of HDEHP concentration used in extractive resins preparation to base of kieselguhr over the efficiency of Gd and Tb separation and of radionuclide purity of {sup 161}Tb. The effect of support in the efficiency of Gd and Tb separation was studied to prepare resins with the supports kieselguhr, alumina, quarry, chiluca, volcanic rock and fluorite, using the silicon deposition treatment II for the supports and a concentration of HDEHP / acetone 1:20, for extractant retention. Only resins based on kieselguhr could separate to Gd from Tb quantitatively, the resin at a concentration of HDEHP / Acetone 1:20 was the best results obtained in Gd and Tb separation, achieving a separation efficiency greater than 90% and a radionuclide purity higher than 99%. (Author)

  2. Anti-L1CAM radioimmunotherapy is more effective with the radiolanthanide terbium-161 compared to lutetium-177 in an ovarian cancer model

    Energy Technology Data Exchange (ETDEWEB)

    Gruenberg, Juergen; Lindenblatt, Dennis; Cohrs, Susan; Fischer, Eliane [Paul Scherrer Institute, Center for Radiopharmaceutical Sciences ETH-PSI-USZ, Villigen (Switzerland); Dorrer, Holger [Paul Scherrer Institute, Laboratory of Radiochemistry and Environmental Chemistry, Villigen (Switzerland); Zhernosekov, Konstantin [ITG Isotope Technologies Garching GmbH, Garching (Germany); Koester, Ulli [Institut Laue-Langevin, Grenoble (France); Tuerler, Andreas [Paul Scherrer Institute, Laboratory of Radiochemistry and Environmental Chemistry, Villigen (Switzerland); University of Bern, Department of Chemistry and Biochemistry, Berne (Switzerland); Schibli, Roger [Paul Scherrer Institute, Center for Radiopharmaceutical Sciences ETH-PSI-USZ, Villigen (Switzerland); ETH Zurich, Department of Chemistry and Applied Biosciences, Zurich (Switzerland)


    The L1 cell adhesion molecule (L1CAM) is considered a valuable target for therapeutic intervention in different types of cancer. Recent studies have shown that anti-L1CAM radioimmunotherapy (RIT) with {sup 67}Cu- and {sup 177}Lu-labelled internalising monoclonal antibody (mAb) chCE7 was effective in the treatment of human ovarian cancer xenografts. In this study, we directly compared the therapeutic efficacy of anti-L1CAM RIT against human ovarian cancer under equitoxic conditions with the radiolanthanide {sup 177}Lu and the potential alternative {sup 161}Tb in an ovarian cancer therapy model. Tb was produced by neutron bombardment of enriched {sup 160}Gd targets. {sup 161}Tb and {sup 177}Lu were used for radiolabelling of DOTA-conjugated antibodies. The in vivo behaviour of the radioimmunoconjugates (RICs) was assessed in IGROV1 tumour-bearing nude mice using biodistribution experiments and SPECT/CT imaging. After ascertaining the maximal tolerated doses (MTD) the therapeutic impact of 50 % MTD of {sup 177}Lu- and {sup 161}Tb-DOTA-chCE7 was evaluated in groups of ten mice by monitoring the tumour size of subcutaneous IGROV1 tumours. The average number of DOTA ligands per antibody was 2.5 and maximum specific activities of 600 MBq/mg were achieved under identical radiolabelling conditions. RICs were stable in human plasma for at least 48 h. {sup 177}Lu- and {sup 161}Tb-DOTA-chCE7 showed high tumour uptake (37.8-39.0 %IA/g, 144 h p.i.) with low levels in off-target organs. SPECT/CT images confirmed the biodistribution data. {sup 161}Tb-labelled chCE7 revealed a higher radiotoxicity in nude mice (MTD: 10 MBq) than the {sup 177}Lu-labelled counterpart (MTD: 12 MBq). In a comparative therapy study with equitoxic doses, tumour growth inhibition was better by 82.6 % for the {sup 161}Tb-DOTA-chCE7 than the {sup 177}Lu-DOTA-chCE7 RIT. Our study is the first to show that anti-L1CAM {sup 161}Tb RIT is more effective compared to {sup 177}Lu RIT in ovarian cancer xenografts

  3. Elastic properties of terbium

    DEFF Research Database (Denmark)

    Spichkin, Y.I.; Bohr, Jakob; Tishin, A.M.


    The temperature dependence of the Young modulus along the crystallographic axes b and c (E(b) and E(c)), and the internal friction of a terbium single crystal have been measured. At 4.2 K, E(b) and E(c) are equal to 38 and 84.5 GPa, respectively. The lattice part of the Young modulus and the Debye...... temperature has been calculated. The origin of the Young modulus anomalies arising at the transition to the magnetically ordered state is discussed....

  4. Critical scattering of neutrons from terbium

    DEFF Research Database (Denmark)

    Als-Nielsen, Jens Aage; Dietrich, O.W.; Marshall, W.


    The inelasticity of the critical scattering of neutrons in terbium has been measured above the Neél temperature at the (0, 0, 2−Q) satellite position. The results show that dynamic slowing down of the fluctuations does occur in a second‐order phase transition in agreement with the general theory...

  5. Semiconductor composition containing iron, dysprosium, and terbium

    Energy Technology Data Exchange (ETDEWEB)

    Pooser, Raphael C.; Lawrie, Benjamin J.; Baddorf, Arthur P.; Malasi, Abhinav; Taz, Humaira; Farah, Annettee E.; Kalyanaraman, Ramakrishnan; Duscher, Gerd Josef Mansfred; Patel, Maulik K.


    An amorphous semiconductor composition includes 1 to 70 atomic percent iron, 15 to 65 atomic percent dysprosium, 15 to 35 atomic percent terbium, balance X, wherein X is at least one of an oxidizing element and a reducing element. The composition has an essentially amorphous microstructure, an optical transmittance of at least 50% in at least the visible spectrum and semiconductor electrical properties.

  6. Raman spectroscopy study of the doping effect of the encapsulated terbium halogenides on single-walled carbon nanotubes

    Energy Technology Data Exchange (ETDEWEB)

    Kharlamova, M.V.; Kramberger, C.; Mittelberger, A. [University of Vienna, Faculty of Physics, Vienna (Austria)


    In the present work, the doping effect of terbium chloride, terbium bromide, and terbium iodide on single-walled carbon nanotubes (SWCNTs) was compared by Raman spectroscopy. A precise investigation of the doping-induced alterations of the Raman modes of the filled SWCNTs was conducted. The shifts of the components of the Raman modes and modification of their profiles allowed concluding that the inserted terbium halogenides have acceptor doping effect on the SWCNTs, and the doping efficiency increases in the line with terbium iodide, terbium bromide, and terbium chloride. (orig.)

  7. Magnetocaloric effect of thin Terbium films (United States)

    Mello, V. D.; Anselmo, D. H. A. L.; Vasconcelos, M. S.; Almeida, N. S.


    We report a theoretical study of the magnetocaloric effect of Terbium (Tb) thin films due to finite size and surface effects in the helimagnetic phase, corresponding to a temperature range from TC=219 K to TN=231 K, for external fields of the order of kOe. For a Tb thin film of 6 monolayers submitted to an applied field (ΔH =30 kOe, ΔH =50 kOe and ΔH = 70 kOe) we report a significative change in adiabatic temperature, ΔT / ΔH , near the Néel temperature, of the order ten times higher than that observed for Tb bulk. On the other hand, for small values of the magnetic field, large thickness effects are found. For external field strength around few kOe, we have found that the thermal caloric efficiency increases remarkably for ultrathin films. For an ultrathin film with 6 monolayers, we have found ΔT / ΔH = 43 K/T while for thicker films, with 20 monolayers, ΔT / ΔH = 22 K/T. Our results suggest that thin films of Tb are a promising material for magnetocaloric effect devices for applications at intermediate temperatures.

  8. Femtosecond XUV spectroscopy of gadolinium and terbium

    Energy Technology Data Exchange (ETDEWEB)

    Carley, Robert; Frietsch, Bjoern; Doebrich, Kristian; Teichmann, Martin; Gahl, Cornelius; Noack, Frank [Max-Born-Institute, Berlin (Germany); Schwarzkopf, Olaf; Wernet, Philippe [Helmholtz-Zentrum fuer Materialien und Energie (BESSY II), Berlin (Germany); Weinelt, Martin [Max-Born-Institute, Berlin (Germany); Fachbereich Physik, Freie Universitaet, Berlin (Germany)


    We present recent results of time-resolved IR-pump-XUV-probe experiments on the ultrafast demagnetization of thin films of Gadolinium(0001) and Terbium(0001) on Tungsten(110). The experiments are the first to be done using a newly developed high-order harmonics (HHG) XUV beamline at the MBI. The beamline delivers monochromated XUV pulses of approximately 150 fs duration with a photon energy resolution of up to 150 meV. Following excitation by intense femtosecond infrared (IR) pulses, photoemission with 35 eV photons allows us to directly probe the 4f electrons and their interaction with the valence band, both in the bulk and at the surface, to follow the ultrafast magnetization dynamics in the Lanthanide metals. As signatures of ultrafast demagnetization of the metal by the IR pulse, we see for the first time, rapid strong reduction of the exchange splitting in the valence band. This is followed by a slower demagnetization due to the spin-lattice interaction.

  9. Green fluorescence of terbium ions in lithium fluoroborate glasses ...

    Indian Academy of Sciences (India)

    Glasses; terbium ion; oscillator strengths; fluorescence; lifetimes; fibre lasers. 1. Introduction. Today glasses are most favourable engineering materials for abundant applications due to the wide ability of property altering by compositional modifications. The considerable examination of glass science to achieve required ...

  10. Green fluorescence of terbium ions in lithium fluoroborate glasses ...

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science; Volume 39; Issue 3. Green fluorescence of terbium ions in lithium fluoroborate glasses for fibre lasers and display devices. G R DILLIP C MADHUKAR REDDY M RAJESH SHIVANAND CHAURASIA B DEVA PRASAD RAJU S W JOO. Volume 39 Issue 3 June 2016 pp 711-717 ...

  11. Terahertz Cherenkov radiation from ultrafast magnetization in terbium gallium garnet (United States)

    Gorelov, S. D.; Mashkovich, E. A.; Tsarev, M. V.; Bakunov, M. I.


    We report an experimental observation of terahertz Cherenkov radiation from a moving magnetic moment produced in terbium gallium garnet by a circularly polarized femtosecond laser pulse via the inverse Faraday effect. Contrary to some existing theoretical predictions, the polarity of the observed radiation unambiguously demonstrates the paramagnetic, rather than diamagnetic, nature of the ultrafast inverse Faraday effect. From measurements of the radiation field, the Verdet constant in the subpicosecond regime is ˜3-10 times smaller than its table quasistatic value.

  12. Terbium luminescence in alumina xerogel fabricated in porous anodic alumina matrix under various excitation conditions

    Energy Technology Data Exchange (ETDEWEB)

    Gaponenko, N. V., E-mail: [Belarusian State University of Informatics and Radioelectronics (Belarus); Kortov, V. S. [Yeltsin Ural Federal University (Russian Federation); Orekhovskaya, T. I.; Nikolaenko, I. A. [Belarusian State University of Informatics and Radioelectronics (Belarus); Pustovarov, V. A.; Zvonarev, S. V.; Slesarev, A. I. [Yeltsin Ural Federal University (Russian Federation); Prislopski, S. Ya. [National Academy of Sciences of Belarus, Stepanov Institute of Physics (Belarus)


    Terbium-doped alumina xerogel layers are synthesized by the sol-gel method in pores of a porous anodic alumina film 1 {mu}m thick with a pore diameter of 150-180 nm; the film is grown on a silicon substrate. The fabricated structures exhibit terbium photoluminescence with bands typical of trivalent terbium terms. Terbium X-ray luminescence with the most intense band at 542 nm is observed for the first time for such a structure. Morphological analysis of the structure by scanning electron microscopy shows the presence of xerogel clusters in pore channels, while the main pore volume remains unfilled and pore mouths remain open. The data obtained confirm the promising applications of fabricated structures for developing matrix converters of X-rays and other ionizing radiations into visible light. The possibilities of increasing luminescence intensity in the matrix converter are discussed.

  13. 40 CFR 35.161 - Definition. (United States)


    ... ASSISTANCE Environmental Program Grants Water Pollution Control (section 106) § 35.161 Definition. Recurrent expenditures are those expenditures associated with the activities of a continuing Water Pollution Control... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Definition. 35.161 Section 35.161...

  14. 46 CFR 161.012-9 - Performance. (United States)


    ... 46 Shipping 6 2010-10-01 2010-10-01 false Performance. 161.012-9 Section 161.012-9 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) EQUIPMENT, CONSTRUCTION, AND MATERIALS: SPECIFICATIONS AND APPROVAL ELECTRICAL EQUIPMENT Personal Flotation Device Lights § 161.012-9 Performance. (a) If...

  15. 7 CFR 1427.161 - Administration. (United States)


    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Administration. 1427.161 Section 1427.161 Agriculture Regulations of the Department of Agriculture (Continued) COMMODITY CREDIT CORPORATION, DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Recourse Seed Cotton Loans § 1427.161 Administration...

  16. 46 CFR 161.012-7 - Construction. (United States)


    ... 46 Shipping 6 2010-10-01 2010-10-01 false Construction. 161.012-7 Section 161.012-7 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) EQUIPMENT, CONSTRUCTION, AND MATERIALS: SPECIFICATIONS AND APPROVAL ELECTRICAL EQUIPMENT Personal Flotation Device Lights § 161.012-7 Construction. (a...

  17. 14 CFR 21.161 - Display. (United States)


    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Display. 21.161 Section 21.161 Aeronautics... PROCEDURES FOR PRODUCTS AND PARTS Production Certificates § 21.161 Display. The holder of a production certificate shall display it prominently in the main office of the factory in which the product concerned is...

  18. 14 CFR 161.5 - Definitions. (United States)


    ... NOTICE AND APPROVAL OF AIRPORT NOISE AND ACCESS RESTRICTIONS General Provisions § 161.5 Definitions. For... definition does not include peak-period pricing programs where the objective is to align the number of... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Definitions. 161.5 Section 161.5...

  19. Optical Properties of Lithium Terbium Fluoride and Implications for Performance in High Power Lasers (Postprint) (United States)



  20. Detection of biothiols in cells by a terbium chelate-Hg (II) system (United States)

    Tan, Hongliang; Chen, Yang


    Great efforts have been devoted to the development of sensitive and specific analysis methods for biothiols because of their important roles in biological systems. We present a new detection system for biothiols that is based on the reversible quenching and restoration of fluorescence of terbium chelate caused by Hg2+ and thiol species. In the presence of biothiols, a restoration of fluorescence of terbium chelate after quenching by Hg2+ was observed due to the interaction of Hg2+ with thiol groups, and the restored fluorescence increased with the concentration of biothiols. This method was sensitive and selective for biothiols. The detection limit was 80 nM for glutathione, 100 nM for Hcy, and 400 nM for Cysteine, respectively. The terbium chelate-Hg (II) system was successfully applied to determine the levels of biothiols in cancer cells and urine samples. Further, it was also shown to be comparable to Ellman's assay. Compared to other fluorescence methods, the terbium chelate probe is advantageous because interference from short-lived nonspecific fluorescence can be efficiently eliminated due to the long fluorescence lifetime of terbium chelate, which allows for detection by time-resolved fluorescence. The terbium chelate probe can serve as a diagnostic tool for the detection of abnormal levels of biothiols in disease.

  1. Cryogenic temperature characteristics of Verdet constant of terbium sesquioxide ceramics (United States)

    Snetkov, I. L.; Palashov, O. V.


    The dependence of the Verdet constant on temperature in the (80-300 K) range for a promising magneto-active material terbium sesquioxide Tb2O3 at the wavelengths of 405-1064 nm is considered. For each of the studied wavelengths, the Verdet constant of the material cooled down to the liquid nitrogen temperature increased by more than a factor of 3.2 as compared to the room temperature value. Similarly to the other paramagnetics, the increase follows the law ∼1/T. Approximations for the temperature dependence of the Verdet constant have been obtained and the value of 1/V·(dV/dT) has been estimated. This information is needed to determine the angle of rotation as well as the variation of the extinction ratio of a Faraday isolator with temperature and extremely important at creation a cryogenic Faraday devices.

  2. Biogenic terbium oxide nanoparticles as the vanguard against osteosarcoma (United States)

    Iram, Sana; Khan, Salman; Ansary, Abu Ayoobul; Arshad, Mohd; Siddiqui, Sahabjada; Ahmad, Ejaz; Khan, Rizwan H.; Khan, Mohd Sajid


    The synthesis of inner transition metal nanoparticles via an ecofriendly route is quite difficult. This study, for the first time, reports synthesis of terbium oxide nanoparticles using fungus, Fusarium oxysporum. The biocompatible terbium oxide nanoparticles (Tb2O3 NPs) were synthesized by incubating Tb4O7 with the biomass of fungus F. oxysporum. Multiple physical characterization techniques, such as UV-visible and photoluminescence spectroscopy, TEM, SAED, and zeta-potential were used to confirm the synthesis, purity, optical and surface characteristics, crystallinity, size, shape, distribution, and stability of the nanoemulsion of Tb2O3 NPs. The Tb2O3 NPs were found to inhibit the propagation of MG-63 and Saos-2 cell-lines (IC50 value of 0.102 μg/mL) and remained non-toxic up to a concentration of 0.373 μg/mL toward primary osteoblasts. Cell viability decreased in a concentration-dependent manner upon exposure to 10 nm Tb2O3 NPs in the concentration range 0.023-0.373 μg/mL. Cell toxicity was evaluated by observing changes in cell morphology, cell viability, oxidative stress parameters, and FACS analysis. Morphological examinations of cells revealed cell shrinkage, nuclear condensation, and formation of apoptotic bodies. The level of ROS within the cells-an indicator of oxidative stress was significantly increased. The induction of apoptosis at concentrations ≤ IC50 was corroborated by 4‧,6-diamidino-2-phenylindole dihydrochloride (DAPI) staining (DNA damage and nuclear fragmentation). Flow-cytometric studies indicated that the response was dose dependent with a threshold effect.

  3. 29 CFR 1952.161 - Developmental schedule. (United States)


    ... 29 Labor 9 2010-07-01 2010-07-01 false Developmental schedule. 1952.161 Section 1952.161 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR... provided by the plan: (a) Enabling legislation becomes effective (Chapter 88 of Iowa Code)—July 1972. (b...

  4. 50 CFR 14.161 - Primary enclosures. (United States)


    ... 50 Wildlife and Fisheries 1 2010-10-01 2010-10-01 false Primary enclosures. 14.161 Section 14.161... Primary enclosures. (a) Except as provided in § 14.106(j), ventilation openings must be located on at least two walls of a primary enclosure. When the required ventilation openings are located on two...

  5. 46 CFR 161.006-4 - Requirements. (United States)


    ... 46 Shipping 6 2010-10-01 2010-10-01 false Requirements. 161.006-4 Section 161.006-4 Shipping COAST... Requirements. (a) Corrosion-resisting materials. Silver, corrosion-resisting steel, copper, brass, bronze and... intensity. (k) Bolts, nuts, and screws. Bolts and nuts shall conform to the requirements of Navy Department...

  6. 40 CFR 417.161 - Specialized definitions. (United States)


    ... 40 Protection of Environment 28 2010-07-01 2010-07-01 true Specialized definitions. 417.161 Section 417.161 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS SOAP AND DETERGENT MANUFACTURING POINT SOURCE CATEGORY Manufacture of Liquid Detergents...

  7. Autofluorescence-free Live-cell Imaging Using Terbium Nanoparticles. (United States)

    Cardoso Dos Santos, Marcelina; Goetz, Joan; Bartenlian, Hortense; Wong, Ka-Leung; Charbonniere, Loïc Joanny; Hildebrandt, Niko


    Fluorescent nanoparticles (NPs) have become irreplaceable tools for advanced cellular and sub-cellular imaging. While very bright NPs require excitation with UV or visible light, which can create strong autofluorescence of biological components, NIR-excitable NPs without autofluorescence issues exhibit much lower brightness. Here, we show the application of a new type of surface-photosensitized terbium NPs (Tb-NPs) for autofluorescence-free intracellular imaging in live HeLa cells. Combination of exceptionally high brightness, high photostability, and long photoluminecence (PL) lifetimes for highly efficient suppression of the short-lived autofluorescence, allowed for time-gated PL imaging of intracellular vesicles over 72 h without toxicity and at extremely low Tb-NP concentrations down to 12 pM. Detection of highly resolved long-lifetime (ms) PL decay curves from small (~10 µm2) areas within single cells within a few seconds emphasized the unprecedented photophysical properties of Tb-NPs for live-cell imaging that extend well beyond currently available nanometric imaging agents.

  8. Solar Thermochemical Hydrogen Production via Terbium Oxide Based Redox Reactions

    Directory of Open Access Journals (Sweden)

    Rahul Bhosale


    Full Text Available The computational thermodynamic modeling of the terbium oxide based two-step solar thermochemical water splitting (Tb-WS cycle is reported. The 1st step of the Tb-WS cycle involves thermal reduction of TbO2 into Tb and O2, whereas the 2nd step corresponds to the production of H2 through Tb oxidation by water splitting reaction. Equilibrium compositions associated with the thermal reduction and water splitting steps were determined via HSC simulations. Influence of oxygen partial pressure in the inert gas on thermal reduction of TbO2 and effect of water splitting temperature (TL on Gibbs free energy related to the H2 production step were examined in detail. The cycle (ηcycle and solar-to-fuel energy conversion (ηsolar-to-fuel efficiency of the Tb-WS cycle were determined by performing the second-law thermodynamic analysis. Results obtained indicate that ηcycle and ηsolar-to-fuel increase with the decrease in oxygen partial pressure in the inert flushing gas and thermal reduction temperature (TH. It was also realized that the recuperation of the heat released by the water splitting reactor and quench unit further enhances the solar reactor efficiency. At TH=2280 K, by applying 60% heat recuperation, maximum ηcycle of 39.0% and ηsolar-to-fuel of 47.1% for the Tb-WS cycle can be attained.

  9. Folate Receptor Targeted Alpha-Therapy Using Terbium-149

    CERN Document Server

    Müller, Cristina; Haller, Stephanie; Dorrer, Holger; Köster, Ulli; Johnston, Karl; Zhernosekov, Konstantin; Türler, Andreas; Schibli, Roger


    Terbium-149 is among the most interesting therapeutic nuclides for medical applications. It decays by emission of short-range α-particles (Eα = 3.967 MeV) with a half-life of 4.12 h. The goal of this study was to investigate the anticancer efficacy of a 149Tb-labeled DOTA-folate conjugate (cm09) using folate receptor (FR)-positive cancer cells in vitro and in tumor-bearing mice. 149Tb was produced at the ISOLDE facility at CERN. Radiolabeling of cm09 with purified 149Tb resulted in a specific activity of ~1.2 MBq/nmol. In vitro assays performed with 149Tb-cm09 revealed a reduced KB cell viability in a FR-specific and activity concentration-dependent manner. Tumor-bearing mice were injected with saline only (group A) or with 149Tb-cm09 (group B: 2.2 MBq; group C: 3.0 MBq). A significant tumor growth delay was found in treated animals resulting in an increased average survival time of mice which received 149Tb-cm09 (B: 30.5 d; C: 43 d) compared to untreated controls (A: 21 d). Analysis of blood parameters rev...

  10. Hardness and dielectric characteristics of flux grown terbium aluminate crystals

    Energy Technology Data Exchange (ETDEWEB)

    Sharma, K.K.; Kotru, P.N. [Jammu Univ. (India). Dept. of Physics; Tandon, R.P. [National Physical Laboratory, New Delhi (India); Wanklyn, B.M. [Clarendon Laboratory, University of Oxford, Oxford (United Kingdom)


    Results of indentation induced Vickers hardness testing and dielectric studies conducted on flux-grown terbium aluminate crystals are presented. It is shown that the Vickers hardness value (H{sub v}) is independent of indentation time, but depends on the applied load. Applying the concept of Hays and Kendall, the load independent values are estimated for (110) and (001) planes. Differential behaviour in the crack formation of two different planes (110) and (001) is observed, while (001) plane develops Palmqvist cracks in the whole load range of 10-100 g, (110) plane shows a transition from Palmqvist to median cracks at 70 g. The fracture toughness, brittleness index and yield strength are determined for both the planes. The hardness anisotropy is reported. The dielectric constant, dielectric loss and conductivity are shown to be dependent on temperature and frequency of the applied a.c. field. The dielectric constant versus temperature shows a transition peak at 230 C, which remains independent of the frequency of the applied a.c. field in the range 1 kHz-13 MHz. (orig.) 36 refs.

  11. Thermoluminescence of cerium and terbium -doped calcium pyrophosphate

    Energy Technology Data Exchange (ETDEWEB)

    Roman L, J.; Cruz Z, E. [UNAM, Instituto de Ciencias Nucleares, Circuito Exterior, Ciudad Universitaria, 04510 Mexico D. F. (Mexico); Lozano R, I. B.; Diaz G, J. A. I., E-mail: [IPN, Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada, Av. Legaria No. 694, 11500 Mexico D. F. (Mexico)


    The aim of this work is to report the thermoluminescence (Tl) response of Calcium Pyrophosphate phosphor doped with Cerium and Terbium impurities (Ca{sub 2}P{sub 2}O{sub 7}:Ce{sup 3+},Tb{sup 3+}). The phosphors were synthesized using the co-precipitation method and annealed at 900 degrees C by two hours for obtain the β phase. The intentional doping with Ce and Tb ions was 1 at.% and 0.1 at.%, whereas in the EDS results the concentration of impurities was 0.39 at.% and 0.05 at.%, respectively. The superficial morphology of phosphor is mainly composed by thin wafers of different size. All samples were exposed to gamma rays from {sup 60}Co in the Gammacell-200 irradiator. The Tl response of the phosphor was measured from Rt up to 350 degrees C and under nitrogen atmosphere in a Harshaw TLD 3500 reader. The glow curves of the Ca{sub 2}P{sub 2}O{sub 7}:Ce{sup 3+},Tb{sup 3+} powders showed a broad intense Tl peak centered at 165 degrees C and a shoulder at approximate 260 degrees C was observed. A linear Tl response in the range of absorbed dose of 0.2 to 10 Gy was obtained. Tl glow curves were analyzed using the initial rise (IR)and computerized glow curve deconvolution methods to evaluate the kinetics parameters such as activation energy (E), frequency factor (s) and kinetic order (b). (Author)

  12. 46 CFR 161.012-3 - Definitions. (United States)


    ... used in this subpart, PFD means Coast Guard approved personal flotation device. (b) For the purpose of § 161.012-7, storage life means the amount of time after the date of manufacture of the power source of...

  13. 161 Teachers' Continuing Professional Development as Correlates ...

    African Journals Online (AJOL)


    Pp. 161-177). Iyunade .... The statistics for 2008 is 1724. Teachers' Continuing Professional Development as Correlates of Sustainable UBE. .... implementation while instilling in them virtues of dedication, loyalty, commitment, discipline and ...

  14. Solvent polarity and oxygen sensitivity, rather than viscosity, determine lifetimes of biaryl-sensitised terbium luminescence. (United States)

    Walter, Edward R H; Williams, J A Gareth; Parker, David


    In a macrocyclic terbium complex incorporating a biaryl sensitiser, the observed variation of emission lifetime is shown to be determined by the solubility of oxygen in the solvent system and the relative energy of the chromophore excited state, rather than any dependence on solvent viscosity.

  15. Dicty_cDB: CHF161 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CH (Link to library) CHF161 (Link to dictyBase) - - - Contig-U16411-1 | Contig-U16470-1 CHF...161P (Link to Original site) CHF161F 559 CHF161Z 759 CHF161P 1298 - - Show CHF161 Library CH (Link to library) Clone ID CHF...411-1 | Contig-U16470-1 Original site URL Representative seq. ID CHF161P (Link to Original site) Representative DNA sequence >CHF161 (CHF...161Q) /CSM/CH/CHF1-C/CHF161Q.Seq.d/ ATTAATAAATAATAATTAAAATTTGCATATATAAAAGAAATAAAAATTTTTTATTTTTTG

  16. Arginine-responsive terbium luminescent hybrid sensors triggered by two crown ether carboxylic acids

    Energy Technology Data Exchange (ETDEWEB)

    Jiang, Lasheng [Key Laboratory of Theoretical Chemistry of Environment, Ministry of Education, School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); Tang, Ke; Ding, Xiaoping [School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); Wang, Qianming, E-mail: [Key Laboratory of Theoretical Chemistry of Environment, Ministry of Education, School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); Zhou, Zhan; Xiao, Rui [School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China)


    Crown ether carboxylic acids constitute main building blocks for the synthesis of terbium containing covalent cross-linked luminescent materials. Both the complexes and the hybrid nanomaterials could exhibit remarkable green emissions in pure water. More importantly, they were found to have a profound effect on the luminescence responses to arginine compared with glutamic acid, histidine, tryptophan, threonine, tyrosine and phenylalanine in aqueous environment. The present study provided the possibility of using a host–guest mechanism as a way of signal transduction based on lanthanide supramolecular hybrid materials. - Highlights: • Crown ether carboxylic acids were found to sensitize terbium ions among a group of ethers. • The complexes and silica hybrid materials were both prepared and characterized. • They could exhibit remarkable green emissions in pure water.

  17. Comparative analysis of conjugated alkynyl chromophore-triazacyclononane ligands for sensitized emission of europium and terbium. (United States)

    Soulié, Marine; Latzko, Frédéric; Bourrier, Emmanuel; Placide, Virginie; Butler, Stephen J; Pal, Robert; Walton, James W; Baldeck, Patrice L; Le Guennic, Boris; Andraud, Chantal; Zwier, Jurriaan M; Lamarque, Laurent; Parker, David; Maury, Olivier


    A series of europium and terbium complexes based on a functionalized triazacyclononane carboxylate or phosphinate macrocyclic ligand is described. The influence of the anionic group, that is, carboxylate, methylphosphinate, or phenylphosphinate, on the photophysical properties was studied and rationalized on the basis of DFT calculated structures. The nature, number, and position of electron-donating or electron-withdrawing aryl substituents were varied systematically within the same phenylethynyl scaffold in order to optimize the brightness of the corresponding europium complexes and investigate their two-photon absorption properties. Finally, the europium complexes were examined in cell-imaging applications, and selected terbium complexes were studied as potential oxygen sensors. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. 40 CFR 161.45 - Waivers. (United States)


    ... Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS DATA REQUIREMENTS FOR REGISTRATION OF ANTIMICROBIAL PESTICIDES General Provisions § 161.45 Waivers. (a) Rationale and... not be useful in the Agency's evaluation of the risks or benefits of the product. The Agency will...

  19. 40 CFR 161.20 - Overview. (United States)


    ... Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS DATA REQUIREMENTS FOR REGISTRATION OF ANTIMICROBIAL PESTICIDES General Provisions § 161.20 Overview. (a) Legal authority... information the Agency requires in order to make regulatory judgments about the risks and benefits of various...

  20. 25 CFR 16.1 - Definitions. (United States)


    ... individual who is either an enrolled member of the Cherokee, Chickasaw, Choctaw, Creek, or Seminole Tribes of... AFFAIRS, DEPARTMENT OF THE INTERIOR PROBATE ESTATES OF INDIANS OF THE FIVE CIVILIZED TRIBES § 16.1... affecting properties in which a restricted interest is owned by an Indian of the Five Civilized Tribes. (c...

  1. 33 CFR 161.21 - Automated reporting. (United States)


    ...) PORTS AND WATERWAYS SAFETY VESSEL TRAFFIC MANAGEMENT Vessel Movement Reporting System § 161.21 Automated... required to make continuous, all stations, AIS broadcasts, in lieu of voice Position Reports, to those..., until restored a vessel must: (1) Notify the Center; (2) Make voice radio Position Reports at designated...

  2. 40 CFR 161.155 - Product composition. (United States)


    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Product composition. 161.155 Section... composition. Information on the composition of the pesticide product must be furnished. The information... or chemical composition of an ingredient is not known to the applicant because it is proprietary or...

  3. Spectrofluorimetric Determination of Human Serum Albumin Using Terbium-Danofloxacin Probe


    Ramezani, Amir M.; Manzoori, Jamshid L.; Amjadi, Mohammad; Jouyban, Abolghasem


    A spectrofluorimetric method is proposed for the determination of human serum albumin (HSA) and bovine serum albumin (BSA) using terbium-danofloxacin (Tb3+-Dano) as a fluorescent probe. These proteins remarkably enhance the fluorescence intensity of the Tb3+-Dano complex at 545 nm, and the enhanced fluorescence intensity of Tb3+-Dano is proportional to the concentration of proteins (HSA and BSA). Optimum conditions for the determination of HSA were investigated and found that the maximum resp...

  4. Genetically Encoded FRET-Sensor Based on Terbium Chelate and Red Fluorescent Protein for Detection of Caspase-3 Activity

    Directory of Open Access Journals (Sweden)

    Alexander S. Goryashchenko


    Full Text Available This article describes the genetically encoded caspase-3 FRET-sensor based on the terbium-binding peptide, cleavable linker with caspase-3 recognition site, and red fluorescent protein TagRFP. The engineered construction performs two induction-resonance energy transfer processes: from tryptophan of the terbium-binding peptide to Tb3+ and from sensitized Tb3+ to acceptor—the chromophore of TagRFP. Long-lived terbium-sensitized emission (microseconds, pulse excitation source, and time-resolved detection were utilized to eliminate directly excited TagRFP fluorescence and background cellular autofluorescence, which lasts a fraction of nanosecond, and thus to improve sensitivity of analyses. Furthermore the technique facilitates selective detection of fluorescence, induced by uncleaved acceptor emission. For the first time it was shown that fluorescence resonance energy transfer between sensitized terbium and TagRFP in the engineered construction can be studied via detection of microsecond TagRFP fluorescence intensities. The lifetime and distance distribution between donor and acceptor were calculated using molecular dynamics simulation. Using this data, quantum yield of terbium ions with binding peptide was estimated.

  5. 40 CFR 161.590 - Nontarget insect data requirements. (United States)


    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Nontarget insect data requirements... § 161.590 Nontarget insect data requirements. (a) Table. Sections 161.100 through 161.102 describe how to use this table to determine the nontarget insect data requirements and the substance to be tested...

  6. 25 CFR 161.702 - Who will enforce this subpart? (United States)


    ... 25 Indians 1 2010-04-01 2010-04-01 false Who will enforce this subpart? 161.702 Section 161.702... GRAZING PERMITS Trespass § 161.702 Who will enforce this subpart? (a) BIA enforces the provisions of this subpart. If the Navajo Nation adopts the provisions of this subpart, the Navajo Nation will have...

  7. 27 CFR 44.161 - Discontinuance of operations. (United States)


    ... Operations § 44.161 Discontinuance of operations. Every export warehouse proprietor who desires to discontinue operations and close out his warehouse shall dispose of all cigars, cigarettes, and cigarette... operations. 44.161 Section 44.161 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE...

  8. 40 CFR 161.340 - Toxicology data requirements. (United States)


    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Toxicology data requirements. 161.340 Section 161.340 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS DATA REQUIREMENTS FOR REGISTRATION OF ANTIMICROBIAL PESTICIDES Data Requirement Tables § 161.340...

  9. 46 CFR 161.013-11 - Prototype test. (United States)


    ... 46 Shipping 6 2010-10-01 2010-10-01 false Prototype test. 161.013-11 Section 161.013-11 Shipping...: SPECIFICATIONS AND APPROVAL ELECTRICAL EQUIPMENT Electric Distress Light for Boats § 161.013-11 Prototype test. (a) Each manufacturer must test a prototype light identical to the lights to be certified prior to...

  10. 25 CFR 161.203 - Are range management plans required? (United States)


    ... 25 Indians 1 2010-04-01 2010-04-01 false Are range management plans required? 161.203 Section 161... LANDS GRAZING PERMITS General Provisions § 161.203 Are range management plans required? Yes. BIA will... range restoration activities for the Navajo Partitioned Lands. (b) Develop range management plans with...

  11. 49 CFR 38.161 - Moveable aisle armrests. (United States)


    ... 49 Transportation 1 2010-10-01 2010-10-01 false Moveable aisle armrests. 38.161 Section 38.161 Transportation Office of the Secretary of Transportation AMERICANS WITH DISABILITIES ACT (ADA) ACCESSIBILITY SPECIFICATIONS FOR TRANSPORTATION VEHICLES Over-the-Road Buses and Systems § 38.161 Moveable aisle armrests. A...

  12. Green light emission in aluminum oxide powders doped with different terbium concentrations

    Energy Technology Data Exchange (ETDEWEB)

    Mariscal B, L; Falcony, C. [IPN, Centro de Investigacion y de Estudios Avanzados, 07360 Ciudad de Mexico (Mexico); Carmona T, S.; Murrieta, H.; Sanchez A, M. A. [UNAM, Instituto de Fisica, 04510 Ciudad de Mexico (Mexico); Vazquez A, R. [IPN, Escuela Superior de Computo, 07738 Ciudad de Mexico (Mexico); Garcia R, C. M., E-mail: [UNAM, Facultad de Ciencias, 04510 Ciudad de Mexico (Mexico)


    Different emission intensities presented in aluminum oxide phosphors corresponding to different concentrations of doping performed with terbium are analyzed. The phosphors were synthesized by the evaporation technique and were characterized by photo and cathodoluminescence, X-ray diffraction and EDS techniques for different incorporation percentages of terbium as dopant; they show characteristic transitions in 494, 543, 587 and 622 nm, corresponding to {sup 5}D{sub 4} → {sup 7}F{sub 6}, {sup 5}D{sub 4} → {sup 7}F{sub 5}, {sup 5}D{sub 4} → {sup 7}F{sub 4} and {sup 5}D{sub 4} → {sup 7}F{sub 3}, respectively when they are excited with λ{sub exc} = 380 nm wavelength at room temperature. The results of X-ray diffraction show the presence of α-Al{sub 2}O{sub 3} phases with peaks located at 2θ = 25.78, 35.34, 37.96, 43.56, 45.8, 52.74, 57.7, 61.5, 66.74, 68.44, 77.12 and 80.94, and the δ-Al{sub 2}O-3 phase 2θ = 32.82, 45.8, 61.36 and 66.74. These compounds were heat treated for two hours at 1100 degrees Celsius. EDS analyzes indicate that these compounds have close to 60% oxygen around of 40% aluminum in the presence of terbium as dopant which indicates a stoichiometry close to the expected one for alumina. (Author)

  13. Graphene quantum dots-terbium ions as novel sensitive and selective time-resolved luminescent probes. (United States)

    Llorent-Martínez, Eulogio J; Durán, Gema M; Ríos, Ángel; Ruiz-Medina, Antonio


    We propose an alternative approach for the development of analytical methods based on terbium-sensitized luminescence (TSL). TSL is based on the complexation between Tb(III) ions and fluorescent organic compounds that have appropriate functional groups to complex with Tb(III). We report the use of graphene quantum dot (GQDs) nanoparticles to improve the sensitivity and selectivity of TSL detection. GQDs can react with terbium ions through the carboxylic groups present in their structure. These Tb(III)-GQD complexes, formed in situ in aqueous solution, can be used as time-resolved luminescent probes. Ascorbic acid was selected as a target analyte to demonstrate the suitability of the proposed method. The selectivity of the TSL method was highly improved for most of the interferences tested. Under the optimum conditions [Tb(III) concentration 5 × 10-4 mol L-1, GQD concentration 4 mg L-1], a minimum 100% increase in selectivity was observed for several vitamins and common cations that may be present in the samples to be analyzed. In addition, the analytical signal showed a 30% enhancement with the use of GQDs compared with the use of merely Tb(III) ions, with a detection limit of 0.12 μg mL-1. The repeatability and intermediate precision were lower than 3% and 5%, respectively. From the results obtained, the implementation of GQDs in TSL can lead to the development of novel time-resolved luminescent probes with high analytical potential. Graphical abstract Quenching of Tb(III)-graphene quantum dot (GQD) luminescence by ascorbic acid (AA). TBL terbium-sensitized luminescence.

  14. Fluorescence study of some terbium-oligopeptide complexes in methanolic solution. (United States)

    Rabouan, S; Delage, J; Durand, W; Prognon, P; Barthes, D


    This study concerned the use of lanthanide chelates to detect glycyl-leucyl-phenylalanine (GLF) and its homologues. Spectroscopic analysis of peptides without or with terbium complexation revealed the formation of (LF)(3)(Tb)(2), (GF)(3)(Tb)(2), (GLF)(3)(Tb)(2) and (FL)(4)Tb, (FG)(4)Tb complexes with high stability constants in methanolic solutions (pK(d)>13). Lanthanide chelate emission displayed a large Stokes shift (>270 nm), which allowed Tb chelates of GLF and its derivatives to be used for detection purposes. However, this preliminary study indicated some important limitations associated with lanthanide chelation, such as high methanolic content.

  15. Electromagnetic properties of terbium gallium garnet at millikelvin temperatures and low photon energy (United States)

    Kostylev, Nikita; Goryachev, Maxim; Bushev, Pavel; Tobar, Michael E.


    Electromagnetic properties of single crystal terbium gallium garnet are characterised from room down to millikelvin temperatures using the whispering gallery mode method. Microwave spectroscopy is performed at low powers equivalent to a few photons in energy and conducted as functions of the magnetic field and temperature. A phase transition is detected close to the temperature of 3.5 K. This is observed for multiple whispering gallery modes causing an abrupt negative frequency shift and a change in transmission due to extra losses in the new phase caused by a change in complex magnetic susceptibility.

  16. Nuclear excitation functions from 40 to 200 MeV proton irradiation of terbium

    Energy Technology Data Exchange (ETDEWEB)

    Engle, Jonathan W., E-mail:; Mashnik, Stepan G.; Parker, Lauren A.; Jackman, Kevin R.; Bitteker, Leo J.; Ullmann, John L.; Gulley, Mark S.; Pillai, Chandra; John, Kevin D.; Birnbaum, Eva R.; Nortier, Francois M.


    Nuclear formation cross sections are reported for 26 radionuclides, measured with 40–200 MeV proton irradiations of terbium foils. These data provide the basis for the production of medically relevant radionuclides (e.g., {sup 152}Tb, {sup 155}Tb, {sup 155}Eu, and {sup 156}Eu) and {sup 153}Gd, a potential source used in ongoing efforts to characterize stellar nucleosynthesis routes. Computational predictions from the ALICE2011, CEM03.03, Bertini, and INCL + ABLA codes are compared with newly measured data to contribute to the ongoing process of code development, and yields are calculated for selected radionuclides using measured data.

  17. Micelle-enhanced and terbium-sensitized spectrofluorimetric determination of gatifloxacin and its interaction mechanism (United States)

    Guo, Changchuan; Wang, Lei; Hou, Zhun; Jiang, Wei; Sang, Lihong


    A terbium-sensitized spectrofluorimetric method using an anionic surfactant, sodium dodecyl benzene sulfonate (SDBS), was developed for the determination of gatifloxacin (GFLX). A coordination complex system of GFLX-Tb 3+-SDBS was studied. It was found that SDBS significantly enhanced the fluorescence intensity of the complex (about 11-fold). Optimal experimental conditions were determined as follows: excitation and emission wavelengths of 331 and 547 nm, pH 7.0, 2.0 × 10 -4 mol l -1 terbium (III), and 2.0 × 10 -4 mol l -1 SDBS. The enhanced fluorescence intensity of the system (Δ If) showed a good linear relationship with the concentration of GFLX over the range of 5.0 × 10 -10 to 5.0 × 10 -8 mol l -1 with a correlation coefficient of 0.9996. The detection limit (3 σ) was determined as 6.0 × 10 -11 mol l -1. This method has been successfully applied to the determination of GFLX in pharmaceuticals and human urine/serum samples. Compared with most of other methods reported, the rapid and simple procedure proposed in the text offers higher sensitivity, wider linear range, and better stability. The interaction mechanism of the system is also studied by the research of ultraviolet absorption spectra, surface tension, solution polarity and fluorescence polarization.

  18. Circularly Polarized Luminescence in Enantiopure Europium and Terbium Complexes with Modular, All-Oxygen Donor Ligands (United States)

    Seitz, Michael; Do, King; Ingram, Andrew J.; Moore, Evan G.; Muller, Gilles; Raymond, Kenneth N.


    Abstract: Circulaly polarized luminescence from terbium(III) complexed and excited by chiral antenna ligands gives strong emission The modular synthesis of three new octadentate, enantiopure ligands are reported - one with the bidentate chelating unit 2-hydroxyisophthalamide (IAM) and two with 1-hydroxy-2-pyridinone (1,2-HOPO) units. A new design principle is introduced for the chiral, non-racemic hexamines which constitute the central backbones for the presented class of ligands. The terbium(III) complex of the IAM ligand, as well as the europium(III) complexes of the 1,2-HOPO ligands are synthesized and characterized by various techniques (NMR, UV, CD, luminescence spectroscopy). All species exhibit excellent stability and moderate to high luminescence efficiency (quantum yields ΦEu = 0.05–0.08 and ΦTb = 0.30–0.57) in aqueous solution at physiological pH. Special focus is put onto the properties of the complexes in regard to circularly polarized luminescence (CPL). The maximum luminescence dissymmetry factors (glum) in aqueous solution are high with |glum|max = 0.08 – 0.40. Together with the very favorable general properties (good stability, high quantum yields, long lifetimes), the presented lanthanide complexes can be considered as good candidates for analytical probes based on CPL in biologically relevant environments. PMID:19639983

  19. Dicty_cDB: VSK161 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VS (Link to library) VSK161 (Link to dictyBase) - - - Contig-U15185-1 VSK161P (Link to Original site)...VSK161Z 343 VSK161P 692 - - Show VSK161 Library VS (Link to library) Clone ID VSK161 (Link to dictyBase)...AL116011 |AL116011.1 Botrytis cinerea strain T4 cDNA library under conditions of nitrogen deprivation. 84 2e-14...AL116009 |AL116009.1 Botrytis cinerea strain T4 cDNA library under conditions of nitrogen deprivation. 84 2e-14...AL115603 |AL115603.1 Botrytis cinerea strain T4 cDNA library under conditions of nitrogen deprivation. 84 2e-14

  20. 26 CFR 31.3401(a)(16)-1 - Tips. (United States)


    ... 26 Internal Revenue 15 2010-04-01 2010-04-01 false Tips. 31.3401(a)(16)-1 Section 31.3401(a)(16)-1... Income Tax at Source § 31.3401(a)(16)-1 Tips. Tips paid to an employee are excepted from wages and hence not subject to withholding if— (a) The tips are paid in any medium other than cash, or (b) The cash...

  1. Luminescent method of determination of composition of europium and terbium complexes in solution by change of intensity ratio of luminescence bands

    Energy Technology Data Exchange (ETDEWEB)

    Bel' tyukova, S.V.; Nazarenko, N.A.; Poluehktov, N.S.


    The complexes of europium and terbium with phenanthroline, ethylenediaminetetraacetate, nitrilotriacetate, some acids-phenol derivatives and ..beta..-diketones series have been used as an example to demonstrate that the value of the ratio of intensities on the two bands of europium(terbium) luminescence spectra - the one corresponding to the hypersensitive'' transition and the other, to the magnetic dipole one - can be used for determination of the complexes composition in solutions.

  2. 29 CFR 1910.161 - Fixed extinguishing systems, dry chemical. (United States)


    ... 29 Labor 5 2010-07-01 2010-07-01 false Fixed extinguishing systems, dry chemical. 1910.161 Section... § 1910.161 Fixed extinguishing systems, dry chemical. (a) Scope and application. This section applies to all fixed extinguishing systems, using dry chemical as the extinguishing agent, installed to meet a...

  3. 12 CFR 563.161 - Management and financial policies. (United States)


    ... 12 Banks and Banking 5 2010-01-01 2010-01-01 false Management and financial policies. 563.161... ASSOCIATIONS-OPERATIONS Financial Management Policies § 563.161 Management and financial policies. (a)(1) For... corporation must be well managed and operate safely and soundly. Each also must pursue financial policies that...

  4. 22 CFR 161.6 - Responsibilities of departmental officials. (United States)


    ... Secretary for Congressional Relations in the preparation of environmental documents relating to legislation....6 Section 161.6 Foreign Relations DEPARTMENT OF STATE ENVIRONMENTAL PROTECTION REGULATIONS FOR IMPLEMENTATION OF THE NATIONAL ENVIRONMENTAL POLICY ACT (NEPA) NEPA and Departmental Decisionmaking § 161.6...

  5. 21 CFR 516.161 - Modifications to indexed drugs. (United States)


    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Modifications to indexed drugs. 516.161 Section 516.161 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS NEW ANIMAL DRUGS FOR MINOR USE AND MINOR SPECIES Index...

  6. 40 CFR 161.35 - Flexibility of the data requirements. (United States)


    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Flexibility of the data requirements. 161.35 Section 161.35 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE... Flexibility of the data requirements. Several provisions of this part provide EPA flexibility in requiring (or...

  7. 27 CFR 20.161 - Withdrawals under permit. (United States)


    ... permittee may obtain domestic specially denatured spirits only. The alcohol in domestic denatured spirits... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Withdrawals under permit. 20.161 Section 20.161 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU...

  8. 7 CFR 1150.161 - Promotion, research and nutrition education. (United States)


    ... 7 Agriculture 9 2010-01-01 2009-01-01 true Promotion, research and nutrition education. 1150.161... Dairy Promotion and Research Order Promotion, Research and Nutrition Education § 1150.161 Promotion, research and nutrition education. (a) The Board shall receive and evaluate, or on its own initiative...

  9. 27 CFR 1.61 - Use of wine. (United States)


    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Use of wine. 1.61 Section..., NONINDUSTRIAL USE OF DISTILLED SPIRITS AND WINE, BULK SALES AND BOTTLING OF DISTILLED SPIRITS Nonindustrial Use of Distilled Spirits and Wine Uses Regarded As Industrial § 1.61 Use of wine. The following uses of...

  10. 24 CFR 982.161 - Conflict of interest. (United States)


    ... 24 Housing and Urban Development 4 2010-04-01 2010-04-01 false Conflict of interest. 982.161... and PHA Administration of Program § 982.161 Conflict of interest. (a) Neither the PHA nor any of its... responsibilities with respect to the programs; or (4) Any member of the Congress of the United States. (b) Any...

  11. Thermo-transferred thermoluminescence (TTTl) in potassium-yttrium double fluoride doped with terbium

    Energy Technology Data Exchange (ETDEWEB)

    Gallegos, A.; Rivera, T.; Diaz G, J. A. [IPN, Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada, Legaria 694, Col. Irrigacion, 11500 Mexico D. F. (Mexico); Azorin, J. [Universidad Autonoma Metropolitana, Unidad Iztapalapa, San Rafael Atlixco No. 186, Col. Vicentina, 09340 Mexico D. F. (Mexico); Azorin, J. C. [Universidad de Guanajuato, Division de Ciencias e Ingenierias-Campus Leon, Lomas del Bosque No. 103, Col. Lomas del Campestre, 37000 Leon, Guanajuato (Mexico); Licona, R.; Rivas, F.; Hernandez C, G. [Benemerita Universidad Autonoma de Puebla, Facultad de Ciencias Quimicas, 14 Sur y San Claudio, Ciudad Universitaria, Puebla de Zaragoza, Puebla (Mexico); Khaidukov, N. [Institute of General and Inorganic Chemistry, Lenin SK 11 Prospect 31, Moscow 117907 (Russian Federation)


    This paper presents results of studying the thermo-transferred thermoluminescence (TTTl) phenomenon in potassium-yttrium double fluoride doped with terbium (K{sub 2}YF{sub 5:}Tb) at different impurity concentrations (0.8%, 0.95% and 0.99%). Previously to study the TTTl phenomenon, structural characterization and chemical composition of the materials were determined. The structural studies were conducted using a scanning electron microscope; meanwhile, chemical composition was analyzed using energy dispersive X-ray spectroscopy. Thermoluminescence kinetics was studied irradiating the samples with {sup 137}Cs gamma rays as well as with {sup 90}Sr/{sup 90}Y beta rays, analyzing the glow curves by the deconvolution method for obtaining the kinetic parameters. (Author)

  12. The influence of pressure on the photoluminescence properties of a terbium-adipate framework (United States)

    Spencer, Elinor C.; Zhao, Jing; Ross, Nancy L.; Andrews, Michael B.; Surbella, Robert G.; Cahill, Christopher L.


    The influence of pressure (over the 0-4.7 GPa range) on the photoluminescence emissions and crystal structure of the known 3D terbium-adipate metal-organic framework material Tb-GWMOF6 has been evaluated by high-pressure single-crystal X-ray diffraction and spectroscopic techniques. The results from this study show that this complex lanthanide framework structure undergoes three phase transitions within the 0-4 GPa pressure range that involve alterations in the number of symmetry independent Tb3+ ion sites within the crystal lattice. These pressure induced modifications to the structure of Tb-GWMOF6 lead to pronounced changes in the profiles of the 5D4→7F5 emission spectra of this complex.

  13. Terbium Radionuclides for Theranostics Applications: A Focus On MEDICIS-PROMED (United States)

    Cavaier, R. Formento; Haddad, F.; Sounalet, T.; Stora, T.; Zahi, I.

    A new facility, named CERN-MEDICIS, is under construction at CERN to produce radionuclides for medical applications. In parallel, the MEDICIS-PROMED, a Marie Sklodowska-Curie innovative training network of the Horizon 2020 European Commission's program, is being coordinated by CERN to train young scientists on the production and use of innovative radionuclides and develop a network of experts within Europe. One program within MEDICIS-PROMED is to determine the feasibility of producing innovative radioisotopes for theranostics using a commercial middle-sized high-current cyclotron and the mass separation technology developed at CERN-MEDICIS. This will allow the production of high specific activity radioisotopes not achievable with the common post-processing by chemical separation. Radioisotopes of scandium, copper, arsenic and terbium have been identified. Preliminary studies of activation yield and irradiation parameters optimization for the production of Tb-149 will be described.

  14. Dielectric and conducting behavior of gadolinium-terbium fumarate heptahydrate crystals (United States)

    Shah, M. D.; Want, B.


    Gadolinium-terbium fumarate heptahydrate crystals were grown in silica gel by using single gel diffusion technique. The crystals were characterized by different physico-chemical techniques of characterization. Powder X-ray diffraction results showed that the grown material is purely crystalline in nature. Elemental analyses suggested the chemical formula of the compound to be Gd Tb (C4H2O4)3ṡ7H2O. Energy dispersive X-ray analysis confirmed the presence of Gd and Tb in the title compound. The dielectric and conductivity studies of the grown compound were carried as function of frequency of applied field and the temperature. The grown material showed a dielectric anomaly which was correlated with its thermal behavior. The ac conductivity of the material showed Jonscher's power law behavior: σ(ω)=σo+Aωs, with a temperature-dependent power exponent s(<1). The conductivity was found to be a function of temperature and frequency.

  15. Highly sensitive detection of dipicolinic acid with a water-dispersible terbium-metal organic framework. (United States)

    Bhardwaj, Neha; Bhardwaj, Sanjeev; Mehta, Jyotsana; Kim, Ki-Hyun; Deep, Akash


    The sensitive detection of dipicolinic acid (DPA) is strongly associated with the sensing of bacterial organisms in food and many types of environmental samples. To date, the demand for a sensitive detection method for bacterial toxicity has increased remarkably. Herein, we investigated the DPA detection potential of a water-dispersible terbium-metal organic framework (Tb-MOF) based on the fluorescence quenching mechanism. The Tb-MOF showed a highly sensitive ability to detect DPA at a limit of detection of 0.04nM (linear range of detection: 1nM to 5µM) and also offered enhanced selectivity from other commonly associated organic molecules. The present study provides a basis for the application of Tb-MOF for direct, convenient, highly sensitive, and specific detection of DPA in the actual samples. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. A New Bis(phthalocyaninato) Terbium Single-Ion Magnet with an Overall Excellent Magnetic Performance. (United States)

    Chen, Yuxiang; Ma, Fang; Chen, Xiaoxiang; Dong, Bowei; Wang, Kang; Jiang, Shangda; Wang, Chiming; Chen, Xin; Qi, Dongdong; Sun, Haoling; Wang, Bingwu; Gao, Song; Jiang, Jianzhuang


    Bulky and strong electron-donating dibutylamino groups were incorporated onto the peripheral positions of one of the two phthalocyanine ligands in the bis(phthalocyaninato) terbium complex, resulting in the isolation of heteroleptic double-decker (Pc)Tb{Pc[N(C4H9)2]8} {Pc = phthalocyaninate; Pc[N(C4H9)2]8 = 2,3,9,10,16,17,23,24-octakis(dibutylamino)phthalocyaninate} with the nature of an unsymmetrical molecular structure, a square-antiprismatic coordination geometry, an intensified coordination field strength, and the presence of organic radical-f interaction. As a total result of all these factors, this sandwich-type tetrapyrrole lanthanide single-ion magnet (SIM) exhibits an overall enhanced magnetic performance including a high blocking temperature (TB) of 30 K and large effective spin-reversal energy barrier of Ueff = 939 K, rendering it the best sandwich-type tetrapyrrole lanthanide SIM reported thus far.

  17. Ultralarge magneto-optic rotations and rotary dispersion in terbium gallium garnet single crystal. (United States)

    Shaheen, Amrozia; Majeed, Hassaan; Anwar, Muhammad Sabieh


    We report systematically acquired data on the Verdet constant of terbium gallium garnet for wavelengths ranging from visible to near-infrared (405-830 nm) regime. Our experimental method of Stokes polarimetry is based on the Fourier decomposition of the received light intensity and allows unambiguous determination of both the Faraday rotation and the ellipticity of the emergent light. Temperature-dependent investigations in the range of 8-300 K extend earlier reports and verify the Verdet's constant direct dependence on the magnetization, whose first-order approximation is simply a manifestation of the Curie's law. Further, a least-squares fitting of the experimental data correlates well with theoretical predictions. At a wavelength of 405 nm and temperature of 8 K, the rotation is approximately 500°.

  18. Terbium fluorescence as a sensitive, inexpensive probe for UV-induced damage in nucleic acids

    Energy Technology Data Exchange (ETDEWEB)

    El-Yazbi, Amira F.; Loppnow, Glen R., E-mail:


    Graphical abstract: -- Highlights: •Simple, inexpensive, mix-and-read assay for positive detection of DNA damage. •Recognition of undamaged DNA via hybridization to a hairpin probe. •Terbium(III) fluorescence reports the amount of damage by binding to ssDNA. •Tb/hairpin is a highly selective and sensitive fluorescent probe for DNA damage. -- Abstract: Much effort has been focused on developing methods for detecting damaged nucleic acids. However, almost all of the proposed methods consist of multi-step procedures, are limited, require expensive instruments, or suffer from a high level of interferences. In this paper, we present a novel simple, inexpensive, mix-and-read assay that is generally applicable to nucleic acid damage and uses the enhanced luminescence due to energy transfer from nucleic acids to terbium(III) (Tb{sup 3+}). Single-stranded oligonucleotides greatly enhance the Tb{sup 3+} emission, but duplex DNA does not. With the use of a DNA hairpin probe complementary to the oligonucleotide of interest, the Tb{sup 3+}/hairpin probe is applied to detect ultraviolet (UV)-induced DNA damage. The hairpin probe hybridizes only with the undamaged DNA. However, the damaged DNA remains single-stranded and enhances the intrinsic fluorescence of Tb{sup 3+}, producing a detectable signal directly proportional to the amount of DNA damage. This allows the Tb{sup 3+}/hairpin probe to be used for sensitive quantification of UV-induced DNA damage. The Tb{sup 3+}/hairpin probe showed superior selectivity to DNA damage compared to conventional molecular beacons probes (MBs) and its sensitivity is more than 2.5 times higher than MBs with a limit of detection of 4.36 ± 1.2 nM. In addition, this probe is easier to synthesize and more than eight times cheaper than MBs, which makes its use recommended for high-throughput, quantitative analysis of DNA damage.

  19. Fine- and hyperfine structure investigations of even configuration system of atomic terbium (United States)

    Stefanska, D.; Elantkowska, M.; Ruczkowski, J.; Furmann, B.


    In this work a parametric study of the fine structure (fs) and the hyperfine structure (hfs) for the even-parity configurations of atomic terbium (Tb I) is presented, based in considerable part on the new experimental results. Measurements on 134 spectral lines were performed by laser induced fluorescence (LIF) in a hollow cathode discharge lamp; on this basis, the hyperfine structure constants A and B were determined for 52 even-parity levels belonging to the configurations 4f85d6s2, 4f85d26s or 4f96s6p; in all the cases those levels were involved in the transitions investigated as the lower levels. For 40 levels the hfs was examined for the first time, and for the remaining 12 levels the new measurements supplement our earlier results. As a by-product, also preliminary values of the hfs constants for 84 odd-parity levels were determined (the investigations of the odd-parity levels system in the terbium atom are still in progress). This huge amount of new experimental data, supplemented by our earlier published results, were considered for the fine and hyperfine structure analysis. A multi-configuration fit of 7 configurations was performed, taking into account second-order of perturbation theory, including the effects of closed shell-open shell excitations. Predicted values of the level energies, as well as of magnetic dipole and electric quadrupole hyperfine structure constants A and B, are quoted in cases when no experimental values are available. By combining our experimental data with our own semi-empirical procedure it was possible to identify correctly the lower and upper level of the line 544.1440 nm measured by Childs with the use of the atomic-beam laser-rf double-resonance technique (Childs, J Opt Soc Am B 9;1992:191-6).

  20. Structural and optical characterization of terbium doped ZnGa2O4 thin films deposited by RF magnetron sputtering (United States)

    Somasundaram, K.; Girija, K. G.; Sudarsan, V.; Selvin, P. Christopher; Vatsa, R. K.


    Tb3+ doped ZnGa2O4 nanophosphor (21 nm) has been synthesized via low temperature polyol route and subsequently thin films of the same were deposited on glass and ITO substrates by RF magnetron sputtering. The films were characterized by X-ray Diffraction and luminescence measurements. The XRD pattern showed that Tb3+ doped ZnGa2O4 nanophosphor has a cubic spinel phase. Luminescence behavior of the nanophosphor and as deposited sputtered film was investigated. The PL emission spectra of nanophosphor gave a broad ZnGa2O4 host emission band along with a strong terbium emission and the thin films showed only broad host emission band and there was no terbium ion emission.

  1. Determination of fluoxetine in pharmaceutical and biological samples based on the silver nanoparticle enhanced fluorescence of fluoxetine-terbium complex. (United States)

    Lotfi, Ali; Manzoori, Jamshid L


    In this study, a simple and sensitive spectrofluorimetric method is presented for the determination of fluoxetine based on the enhancing effect of silver nanoparticles (AgNPs) on the terbium-fluoxetine fluorescence emission. The AgNPs were prepared by a simple reduction method and characterized by UV-Vis spectroscopy and transmission electron microscopy. It was indicated that these AgNPs have a remarkable amplifying effect on the terbium-sensitized fluorescence of fluoxetine. The effects of various parameters such as AgNP and Tb(3+) concentration and the pH of the media were investigated. Under obtained optimal conditions, the fluorescence intensity of the terbium-fluoxetine-AgNP system was enhanced linearly by increasing the concentration of fluoxetine in the range of 0.008 to 19 mg/L. The limit of detection (b + 3s) was 8.3 × 10(-4) mg/L. The interference effects of common species found in real samples were also studied. The method had good linearity, recovery, reproducibility and sensitivity, and was satisfactorily applied for the determination of fluoxetine in tablet formulations, human urine and plasma samples. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  2. Neutron Diffraction and Electrical Transport Studies on Magnetic Transition in Terbium at High Pressures and Low Temperatures (United States)

    Thomas, Sarah; Montgomery, Jeffrey; Tsoi, Georgiy; Vohra, Yogesh; Weir, Samuel; Tulk, Christopher; Moreira Dos Santos, Antonio


    Neutron diffraction and electrical transport measurements have been carried out on the heavy rare earth metal terbium at high pressures and low temperatures in order to elucidate its transition from a helical antiferromagnetic to a ferromagnetic ordered phase as a function of pressure. The electrical resistance measurements using designer diamonds show a change in slope as the temperature is lowered through the ferromagnetic Curie temperature. The temperature of the ferromagnetic transition decreases at a rate of -16.7 K/GPa till 3.6 GPa, where terbium undergoes a structural transition from hexagonal close packed (hcp) to an α-Sm phase. Above this pressure, the electrical resistance measurements no longer exhibit a change in slope. In order to confirm the change in magnetic phase suggested by the electrical resistance measurements, neutron diffraction measurements were conducted at the SNAP beamline at the Oak Ridge National Laboratory. Measurements were made at pressures to 5.3 GPa and temperatures as low as 90 K. An abrupt increase in peak intensity in the neutron diffraction spectra signaled the onset of magnetic order below the Curie temperature. A magnetic phase diagram of rare earth metal terbium will be presented to 5.3 GPa and 90 K based on these studies.

  3. Phenotype abnormality: 161 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 161 decreased efficiency... in organ named stem during process named growth ... stem ... decreased efficiency ... growth ...

  4. Eestist osaleb rahvusvahelisel reklaamifestivalil 161 reklaami / Sergo Selder

    Index Scriptorium Estoniae

    Selder, Sergo


    Riias toimuvast kuuendast Baltimaade reklaamifestivalist "Kuldne haamer" ("Golden Hammer"). Eestist on esitatud 161 reklaami. Žüriisse kuulub eestlastest Jaanus Vahtra reklaamifirmast Saatchi & Saatchi, kelle Diseli õllereklaam võitis möödunud aastal telereklaamide Kuldhaamri

  5. 22 CFR 161.7 - Categories of actions. (United States)


    ... documents and delivering retirement checks, social security payments and veterans benefits; (3) Conduct of... in § 161.11 of these regulations); and (3) Ocean dumping, control of toxic substances, disposal and...

  6. 46 CFR 161.012-11 - Approval tests. (United States)


    ...: SPECIFICATIONS AND APPROVAL ELECTRICAL EQUIPMENT Personal Flotation Device Lights § 161.012-11 Approval tests. (a... procedures necessary to conduct the approval tests required by this subpart, and that is free of influence...

  7. Study of Silver Nanoparticles Sensitized Fluorescence and Second-Order Scattering of Terbium(III-Pefloxacin Mesylate Complex and Determination of Pefloxacin Mesylate

    Directory of Open Access Journals (Sweden)

    Aiyun Li


    Full Text Available α-Keto acid of pefloxacin mesylate (PFLX can form the complex with Terbium(III. The intramolecular energy from PFLX to Terbium(III ion takes place when excited, and thus Terbium(III excited state is formed and then emits the characteristic fluorescence of Terbium(III, locating at 490, 545, 580, and 620 nm. The second-order scattering (SOS peak at 545 nm also appears for the complex with the exciting wavelength of 273 nm. When the silver nanoparticles are added to the system, the luminescence intensity at 545 nm greatly increased. So, with the adding of nanoparticles to the Terbium(III-PFLX complex, not only is the intramolecular energy promoted but also the SOS intensity is enhanced. The experimental results show that it is the silver nanoparticles with certain size and certain concentration which can greatly enhance the fluorescence-SOS intensity, and the relative intensity at 545 nm is proportional to the amount of PFLX. Based on this phenomenon, a novel method for the determination of PFLX has been developed and applied to the determination of PFLX in capsule and serum samples.

  8. Influence of crystalline structure on the luminescence properties of terbium orthotantalates

    Energy Technology Data Exchange (ETDEWEB)

    Siqueira, Kisla P.F. [Departamento de Química, Universidade Federal de Ouro Preto, Campus Morro do Cruzeiro, ICEB II, Ouro Preto 35400-000, Minas Gerais (Brazil); Carmo, Alexandre P. [Instituto Federal Fluminense, Campus Cabo Frio, RJ 28909-971 (Brazil); Bell, Maria J.V. [Departamento de Física, Universidade Federal de Juiz de Fora, Juiz de Fora 36036-330, MG (Brazil); Dias, Anderson, E-mail: [Departamento de Química, Universidade Federal de Ouro Preto, Campus Morro do Cruzeiro, ICEB II, Ouro Preto 35400-000, Minas Gerais (Brazil)


    Terbium orthotantalate powders were produced with M-fergusonite type (I2/a) and M′-fergusonite type (P2/a) structures. The samples were studied by X-ray diffraction, Raman scattering, and photoluminescence measurements (emission and decay curves). The results showed that crystalline materials were obtained with all the 18 Raman-active modes predicted by group theory calculations. Also, it was observed through photoluminescence decay curves that the Tb{sup 3+} ions occupies only one-symmetry site in both crystallographic arrangements. Photoluminescence emission curves exhibited some variation in spectral shape, peak position, and relative intensity as a consequence of their different crystalline arrangements. The dominated emission of Tb{sup 3+} ({sup 5}D{sub 4}→{sup 7}F{sub 5}) is centered with a maximum intensity at 549.2 nm (M-type) and 543.0 nm (M′-type). Fluorescence lifetimes for M-TbTaO{sub 4} and M′-TbTaO{sub 4} were determined as 33.4 μs and 1.25 ms, respectively. M′-type materials seems to be the most suitable for luminescent devices and could be a potential green luminescent material due to the strongest emission if compared with the M-fergusonite type. -- Highlights: ► Terbium orthotantalates were prepared in two different crystalline structures: I2/a and P2/a. ► XRD and Raman scattering showed that the different space groups obtained were exhibited all the 18 Raman-active modes. ► PL decay curves that the Tb{sup 3+} ions occupies only one-symmetry site in both crystallographic arrangements. ► Dominated emission of Tb{sup 3+} ({sup 5}D{sub 4}→{sup 7}F{sub 5}) is centered with a maximum intensity at 549 nm (M-type) and 543 nm (M′-type). ► Fluorescence lifetimes for M-TbTaO{sub 4} and M′-TbTaO{sub 4} were determined as 33.4 μs and 1.25 ms, respectively.

  9. Laser control and temperature switching of luminescence intensity in photostable transparent film based on terbium(III) β-diketonate complex (United States)

    Lapaev, Dmitry V.; Nikiforov, Victor G.; Safiullin, Georgy M.; Lobkov, Vladimir S.; Salikhov, Kev M.; Knyazev, Andrey A.; Galyametdinov, Yury G.


    The study of the terbium(III) and gadolinium(III) β-diketonate complexes by photoluminescence spectroscopy reveals considerable changes of the photophysical properties of the complexes under the UV laser irradiation. The measurements show the enhancement of the luminescence intensities in the vitrified transparent film of the terbium(III) complex as well as the gadolinium(III) complex under the 337 nm laser irradiation at room temperature. The irradiated film of the terbium(III) complex restores the initial photophysical properties after heating close to the melting temperature (∼353 K) and cooling. We observe no change of the luminescent properties of the irradiated film for months. These features can be used for the design of new lanthanide-based photostable systems with laser control of the luminescence intensity.

  10. Development of functionalized terbium fluorescent nanoparticles for antibody labeling and time-resolved fluoroimmunoassay application. (United States)

    Ye, Zhiqiang; Tan, Mingqian; Wang, Guilan; Yuan, Jingli


    Silica-based functionalized terbium fluorescent nanoparticles were prepared, characterized and developed as a fluorescence probe for antibody labeling and time-resolved fluoroimmunoassay. The nanoparticles were prepared in a water-in-oil (W/O) microemulsion containing a strongly fluorescent Tb(3+) chelate, N,N,N(1),N(1)-[2,6-bis(3'-aminomethyl-1'-pyrazolyl)phenylpyridine] tetrakis(acetate)-Tb(3+) (BPTA-Tb(3+)), Triton X-100, octanol, and cyclohexane by controlling copolymerization of tetraethyl orthosilicate (TEOS) and 3-[2-(2-aminoethylamino)ethylamino]propyl-trimethoxysilane (AEPS) with ammonia water. The characterizations by transmission electron microscopy and fluorometric methods show that the nanoparticles are spherical and uniform in size, 45 +/- 3nm in diameter, strongly fluorescent with fluorescence quantum yield of 10% and a long fluorescence lifetime of 2.0ms. The amino groups directly introduced to the nanoparticle's surface by using AEPS in the preparation made the surface modification and bioconjugation of the nanoparticles easier. The nanoparticle-labeled anti-human alpha-fetoprotein antibody was prepared and used for time-resolved fluoroimmunoassay of alpha-fetoprotein (AFP) in human serum samples. The assay response is linear from 0.10ngml(-1) to about 100ngml(-1) with the detection limit of 0.10ngml(-1). The coefficient variations (CVs) of the method are less than 9.0%, and the recoveries are in the range of 84-98% for human serum sample measurements.

  11. Highly efficient precipitation of phosphoproteins using trivalent europium, terbium, and erbium ions

    Energy Technology Data Exchange (ETDEWEB)

    Guezel, Yueksel; Rainer, Matthias; Mirza, Munazza Raza; Bonn, Guenther K. [Leopold-Franzens University, Institute of Analytical Chemistry and Radiochemistry, Innsbruck (Austria)


    This study describes a highly efficient method for the selective precipitation of phosphoproteins by trivalent europium, terbium, and erbium metal ions. These metal cations belong to the group of lanthanides and are known to be hard acceptors with an overwhelming preference for oxygen-containing anions such as phosphates to which they form very tight ionic bonds. The method could be successfully applied to specifically precipitate phosphoproteins from complex samples including milk and egg white by forming solid metal-protein complexes. Owing to the low solubility product of the investigated lanthanide salts, the produced metal-protein complexes showed high stability. The protein pellets were extensively washed to remove nonphosphorylated proteins and contaminants. For the analysis of proteins the pellets were first dissolved in 30 % formic acid and subjected to matrix-assisted laser desorption/ionization-time of flight (MALDI-TOF) MS. For peptide mass-fingerprint analysis the precipitated phosphoproteins were enzymatically digested using microwave-assisted digestion. The method was found to be highly specific for the isolation and purification of phosphoproteins. Protein quantification was performed by colorimetric detection of total precipitated phosphoproteins and revealed more than 95 % protein recovery for each lanthanide salt. (orig.)

  12. A Terbium Sensitized Luminescence Method for the Assay of Flubiprofen in Pharmaceutical Formulations

    Directory of Open Access Journals (Sweden)

    Salma M.Z. Al-Kindy


    Full Text Available A sensitive time-resolved luminescence method for the determination of flubiprofen (FLP in methanol and in aqueous solution is described. The method is based on the luminescence sensitization of terbium (Tb3+ by the formation of a ternary complex with FLP in the presence of 4,7 diphenyl 1,10 phenanthroline (DPP as co-ligand, and Tween-20 as surfactant. The signal for Tb-FLP-DPP was monitored at λex  = 285 nm and λem  = 552 nm. Optimum conditions for the formation of the complex in an aqueous system were TRIS buffer, pH 8.0, DPP (2.5Å~10−7  M, Tween-20 (0.30% and 4Å~10-5  mol L-1  of Tb3+  which allowed the determination of 20–1000 ng mL-1  of FLP with a limit of detection (LOD of 10 ng mL-1 . The relative standard deviations of the method ranged between 0.6 and 1.4% indicating excellent reproducibility of the method. The proposed method was successfully applied for the assays of FLP in pharmaceutical formulations and spiked tap water samples with average recoveries of 87% – 95%.

  13. Sensitization effects of supramolecular assemblies on the luminescence of terbium-ion prulifloxacin complexes

    Energy Technology Data Exchange (ETDEWEB)

    Wang Hong; Yi Chongyue; Li Xue; Fang Fang [School of Chemistry and Chemical Engineering, Huazhong University of Science and Technology, Wuhan 430074 (China); Yang Yajiang, E-mail: [School of Chemistry and Chemical Engineering, Huazhong University of Science and Technology, Wuhan 430074 (China)


    Luminescence enhancement of terbium-ion prulifloxacin complexes (Tb(III)-PUFX) in supramolecular hydrogels formed by assembly of 1,3:2,4-di-O-benzylidene-D-sorbitol (DBS) was investigated by steady-state fluorescence, varying temperature fluorescence and time-resolved fluorescence. The luminescence images show that Tb(III)-PUFX were dispersed in the DBS gels. The luminescence intensity of Tb(III)-PUFX in the DBS gels was significantly increased in comparison with that in corresponding aqueous solutions. The varying temperature fluorescent spectra show that the luminescence intensity of Tb(III)-PUFX decreased with an increase in the temperature. This implies that the luminescence enhancement of Tb(III)-PUFX is related to the dissociation and the formation of the DBS assemblies. Time-resolved fluorescence measurements show slower rotational motion in DBS gels in comparison with that in the corresponding aqueous solutions. This may be ascribed to a unique microstructure of three-dimensional network formed by DBC aggregates, resulting in deactivation of the nonradiative relaxation. The images of field emission scanning electron microscopy and polarized optical microscopy indicate that the morphology of the DBS assemblies was not influenced upon addition of Tb(III)-PUFX to the DBS gels.

  14. A Nanoscale Multiresponsive Luminescent Sensor Based on a Terbium(III) Metal-Organic Framework. (United States)

    Dang, Song; Wang, Ting; Yi, Feiyan; Liu, Qinghui; Yang, Weiting; Sun, Zhong-Ming


    A nanoscale terbium-containing metal-organic framework (nTbL), with a layer-like structure and [H2 NMe2 ](+) cations located in the framework channels, was synthesized under hydrothermal conditions. The structure of the as-prepared sample was systematically confirmed by powder XRD and elemental analysis; the morphology was characterized by field-emission SEM and TEM. The photoluminescence studies revealed that rod-like nTbL exhibited bright-green emission, corresponding to (5)D4 →(7)FJ (J=6-3) transitions of the Tb(3+) ion under excitation. Further sensing measurements revealed that as-prepared nTbL could be utilized as a multiresponsive luminescent sensor, which showed significant and exclusive detection ability for Fe(3+) ions and phenylmethanol. These results highlight the practical applications of lanthanide-containing metal-organic frameworks as fluorescent probes. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Terbium-Doped VO2 Thin Films: Reduced Phase Transition Temperature and Largely Enhanced Luminous Transmittance. (United States)

    Wang, Ning; Duchamp, Martial; Dunin-Borkowski, Rafal E; Liu, Shiyu; Zeng, XianTing; Cao, Xun; Long, Yi


    Vanadium dioxide (VO2) is a well-known thermochromic material with large IR modulating ability, promising for energy-saving smart windows. The main drawbacks of VO2 are its high phase transition temperature (τ(c) = 68°C), low luminous transmission (T(lum)), and weak solar modulating ability (ΔT(sol)). In this paper, the terbium cation (Tb(3+)) doping was first reported to reduce τ(c) and increase T(lum) of VO2 thin films. Compared with pristine VO2, 2 at. % doping level gives both enhanced T(lum) and ΔT(sol) from 45.8% to 54.0% and 7.7% to 8.3%, respectively. The T(lum) increases with continuous Tb(3+) doping and reaches 79.4% at 6 at. % doping level, representing ∼73.4% relative increment compared with pure VO2. This has surpassed the best reported doped VO2 thin films. The enhanced thermochromic properties is meaningful for smart window applications of VO2 materials.

  16. Luminescent investigations of terbium(III) biosorption as a surrogate for heavy metals and radionuclides. (United States)

    Achyuthan, Komandoor E; Arango, Dulce C; Carles, Elizabeth L; Cutler, Christopher E; Meyer, Lauren A; Brozik, Susan M


    We describe a metal transport system for investigating the interfacial interactions between the anionic surface charge of a gram-negative bacterium (Escherichia coli) and a trivalent cationic metal, Tb3+. We believe this is the first description of the uptake kinetics, sub- and intracellular distribution, and temporal fate of Tb3+ ion in E. coli. We used the luminescence of the terbium-dipicolinic acid chelate to study metal ion transport. The bacteria had a high tolerance for the metal (IC(50) = 4 mM Tb3+). Metal ion transport was passive and metabolism independent. The uptake kinetics rapidly reached a maximum within 15 min, followed by a stasis for 60 min, and declining thereafter between 120 and 240 min, resulting in a biphasic curve. During this period, greater than one-third of the metal ion was sequestered within the cell. Our choice of a safe Biosafety Level I E. coli bacteria and the relatively non-toxic Tb3+ metal represents a model system for luminescent investigations of biosorption, for studying bacterial-water interfacial chemistry and for the bioremediation of heavy metals and radionuclides.

  17. Lifetimes in {sup 161}Lu measured with recoil distance method

    Energy Technology Data Exchange (ETDEWEB)

    Yu, C.H.; Lewis, J.M.; Riedinger, L.L. [and others


    High spin states of {sup 161}Lu are populated using the {sup 120}Sn({sup 45}Sc,4n){sup 161}Lu reaction with a 205 MeV {sup 45}Sc beam provided by the Oak Ridge National Lab. A plunger was used to stop the recoils at various distances and the {gamma}-rays were detected by the compact array of 20 Compton-suppressed Ge detectors of 17, 30, 60, 85, 140, 210, and 320 micrometers. These data are being analyzed in order to extract lifetimes. High spin lifetimes in the {pi}h{sub 11/12}, 9/2[514] band of {sup 161}Lu were previously measured with DSAM technique. Large energy signature splitting was observed in the low spin portion of this band, which has been interpreted as the evidence for triaxiality and small quadrupole deformation. The authors measured lifetimes at low spin will be helpful for the verification of this prediction.

  18. Construction of the energy matrix for complex atoms. Part VIII: Hyperfine structure HPC calculations for terbium atom (United States)

    Elantkowska, Magdalena; Ruczkowski, Jarosław; Sikorski, Andrzej; Dembczyński, Jerzy


    A parametric analysis of the hyperfine structure (hfs) for the even parity configurations of atomic terbium (Tb I) is presented in this work. We introduce the complete set of 4fN-core states in our high-performance computing (HPC) calculations. For calculations of the huge hyperfine structure matrix, requiring approximately 5000 hours when run on a single CPU, we propose the methods utilizing a personal computer cluster or, alternatively a cluster of Microsoft Azure virtual machines (VM). These methods give a factor 12 performance boost, enabling the calculations to complete in an acceptable time.

  19. 14 CFR 161.409 - Required analysis by reevaluation petitioner. (United States)


    ... procedures in § 161.407 and shall include the following: (1) A copy of the restriction or the language of the... noise environment using methodology specified in this part; (4) Evidence of the relationship between... exclusion under FAA orders implementing the National Environmental Policy Act of 1969 (42 U.S.C. 4321). (c...

  20. 50 CFR 300.161 - Alternatives and exceptions. (United States)


    ... container or package containing fish or wildlife if the shipper has a valid wildlife import/export license... FISHERIES REGULATIONS Transportation and Labeling of Fish or Wildlife § 300.161 Alternatives and exceptions... containing fish or wildlife with the word “fish” or “wildlife” as appropriate for its contents, or with the...

  1. 46 CFR 161.002-1 - Incorporation by reference. (United States)


    ... Section 4 Albert Embankment, London SE1 7SR, United Kingdom. International Convention for the Safety of Life at Sea, 1974 (SOLAS 74) Consolidated Edition (Including 1992 Amendments to SOLAS 74, and 1994 Amendments to SOLAS 74), 1992—161.002-4(b). National Fire Protection Association (NFPA) National Fire...

  2. 14 CFR 121.161 - Airplane limitations: Type of route. (United States)


    ... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Airplane limitations: Type of route. 121... OPERATING REQUIREMENTS: DOMESTIC, FLAG, AND SUPPLEMENTAL OPERATIONS Aircraft Requirements § 121.161 Airplane... specifications, no certificate holder may operate a turbine-engine-powered airplane over a route that contains a...

  3. 33 CFR 161.12 - Vessel operating requirements. (United States)


    ... VTS. (b) If, in a specific circumstance, a VTS User is unable to safely comply with a measure or... respond promptly when hailed and communicate in the English language. Note to § 161.12(c): As stated in 47... Monitoring Areas Center MMSI 1 Call Sign Designated frequency (Channel designation)—purpose 2 Monitoring area...

  4. 30 CFR 75.161 - Plans for training programs. (United States)


    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Plans for training programs. 75.161 Section 75... for training programs. Each operator must submit to the district manager, of the Coal Mine Safety and... qualified. The program must provide— (a) For certified persons, annual training courses in first aid...

  5. 14 CFR 171.161 - Maintenance and operations requirements. (United States)


    ... shall provide a stock of spare parts of such a quantity to make possible the prompt replacement of... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Maintenance and operations requirements... (DME) § 171.161 Maintenance and operations requirements. (a) The owner of the facility shall establish...

  6. Spectrofluorimetric determination of human serum albumin using terbium-danofloxacin probe. (United States)

    Ramezani, Amir M; Manzoori, Jamshid L; Amjadi, Mohammad; Jouyban, Abolghasem


    A spectrofluorimetric method is proposed for the determination of human serum albumin (HSA) and bovine serum albumin (BSA) using terbium-danofloxacin (Tb(3+)-Dano) as a fluorescent probe. These proteins remarkably enhance the fluorescence intensity of the Tb(3+)-Dano complex at 545 nm, and the enhanced fluorescence intensity of Tb(3+)-Dano is proportional to the concentration of proteins (HSA and BSA). Optimum conditions for the determination of HSA were investigated and found that the maximum response was observed at: pH = 7.8, [Tb(3+)] = 8.5 × 10(-5) mol L(-1), [Dano] = 1.5 × 10(-4) mol L(-1). The calibration graphs for standard solutions of BSA, HSA, and plasma samples of HSA were linear in the range of 0.2 × 10(-6) - 1.3 × 10(-6) mol L(-1), 0.2 × 10(-6) - 1.4 × 10(-6) mol L(-1), and 0.2 × 10(-6) - 1 × 10(-6) mol L(-1), respectively. The detection limits (S/N = 3) for BSA, HSA, and plasma sample of HSA were 8.7 × 10(-8) mol L(-1), 6.2 × 10(-8) mol L(-1), and 8.1 × 10(-8) mol L(-1), respectively. The applicability of the method was checked using a number of real biological plasma samples and was compared with the UV spectrometric reference method. The results was showed that the method could be regarded as a simple, practical, and sensitive alternative method for determination of albumin in biological samples.

  7. Spectrofluorimetric Determination of Human Serum Albumin Using Terbium-Danofloxacin Probe

    Directory of Open Access Journals (Sweden)

    Amir M. Ramezani


    Full Text Available A spectrofluorimetric method is proposed for the determination of human serum albumin (HSA and bovine serum albumin (BSA using terbium-danofloxacin (Tb3+-Dano as a fluorescent probe. These proteins remarkably enhance the fluorescence intensity of the Tb3+-Dano complex at 545 nm, and the enhanced fluorescence intensity of Tb3+-Dano is proportional to the concentration of proteins (HSA and BSA. Optimum conditions for the determination of HSA were investigated and found that the maximum response was observed at: pH=7.8, [Tb3+] =8.5×10−5 mol L−1, [Dano] =1.5×10−4 mol L−1. The calibration graphs for standard solutions of BSA, HSA, and plasma samples of HSA were linear in the range of 0.2×10−6−1.3×10−6 mol L−1, 0.2×10−6−1.4×10−6 mol L−1, and 0.2×10−6−1×10−6 mol L−1, respectively. The detection limits (S/N = 3 for BSA, HSA, and plasma sample of HSA were 8.7×10−8 mol L−1, 6.2×10−8 mol L−1, and 8.1×10−8 mol L−1, respectively. The applicability of the method was checked using a number of real biological plasma samples and was compared with the UV spectrometric reference method. The results was showed that the method could be regarded as a simple, practical, and sensitive alternative method for determination of albumin in biological samples.

  8. Determination of flavonoids in pharmaceutical preparations using Terbium sensitized fluorescence method

    Directory of Open Access Journals (Sweden)

    M Shaghaghi


    Full Text Available "nBackground and the Purpose of the Study: The aim of this study was development and validation of a simple, rapid and sensitive spectrofluorimetric method for determination of total flavonoids in two topical formulations of Calendula officinalis, Ziziphus Spina-christi and an oral drop of Hypiran perforatum L. The proposed method is based on the formation of terbium (Tb3+ "n-flavonoids (quercetin as a reference standard complex at pH 7.0, which has fluorescence intensely with maximum emission at 545 nm when excited at 310 nm. "nMethod "n: For ointments masses of topical formulations were weighed and added to ethanol-aqueous buffer (pH 10.0 and the resulting mixtures were shaken and then two phases were separated by centrifugation. Aqueous phases were filtered and then diluted with water. For Hypiran drops an appropriate portion was diluted with ethanol and then aliquots of sample or standard solutions were determined according to the experimental procedure. "nResults "n: Under the optimum conditions, total concentrations of flavonoids (as quercetin equivalent in three tested formulations were found to be 0.204 mg/g (for Dermatin cream, 0.476 mg/g (for Calendula ointment and 13.50 μg/ml (for Hypiran drops. Analytical recoveries from samples spiked with different amounts of quercetin were 96.1-104.0 % with RSD % of less than 3.5. Conclusion : The proposed method which requires a simple dissolution step without any matrix interferences provided high sensitivity and selectivity and was easily applied to determine total flavonoids in real samples of three investigated formulations with excellent reproducibility.

  9. TOF SIMS analysis and generation of white photoluminescence from strontium silicate codoped with europium and terbium

    Energy Technology Data Exchange (ETDEWEB)

    Tshabalala, Modiehi A.; Swart, Hendrik C.; Ntwaeaborwa, Odireleng M., E-mail: [Department of Physics, University of the Free State, P.O Box 339, Bloemfontein 9300 South Africa (South Africa)


    White light emitting terbium (Tb{sup 3+}) and europium (Eu{sup 3+}) codoped strontium silicate (Sr{sub 2}SiO{sub 4}) phosphors were prepared by a solid state reaction process. The structure, particle morphology, chemical composition, ion distribution, photoluminescence (PL), and decay characteristics of the phosphors were analyzed by x-ray diffraction (XRD), scanning electron microscopy (SEM), time-of-flight secondary ion mass spectrometry (TOF-SIMS), and PL spectroscopy, respectively. The XRD data showed that our Sr{sub 2}SiO{sub 4} composed of two phases, namely, β-Sr{sub 2}SiO{sub 4} and α′-Sr{sub 2}SiO{sub 4}, and the α′-Sr{sub 2}SiO{sub 4} phase was more prominent than the β-Sr{sub 2}SiO{sub 4} phase. The SEM micrographs showed that the particles were agglomerated together and they did not have definite shapes. All ions (i.e., negative and positive) present in our materials were identified by TOF-SIMS. In addition, the chemical imaging performed with the TOF-SIMS demonstrated how the individual ions including the dopants (Eu{sup 3+} and Tb{sup 3+}) were distributed in the host lattice. White photoluminescence was observed when the Sr{sub 2}SiO{sub 4}:Tb{sup 3+}, Eu{sup 3+} phosphor was excited at 239 nm using a monochromatized xenon lamp as the excitation source. The phosphor exhibited fast decay lifetimes implying that it is not a good candidate for long afterglow applications.

  10. Synthesis, crystal structure and photophysical properties of europium(III) and terbium(III) complexes with pyridine-2,6-dicarboxamide

    NARCIS (Netherlands)

    Tanase, S.; Gallego, P.M.; Gelder, R. de; Fu, W.T.


    The reactions of pyridine-2,6-dicarboxamide with europium(III) and terbium(III) triflates led to the formation of mononuclear complexes of formula [Ln(pcam)(3)](CF3SO3)(3) (Ln = Eu 1, Tb 2; pcam stands for pyridine-2,6-dicarboxamide). From single-crystal X-ray diffraction analysis, the complexes

  11. Zinc sulfide and terbium-doped zinc sulfide films grown by traveling wave reactor atomic layer epitaxy

    CERN Document Server

    Yun, S J; Nam, K S


    Zinc sulfide (ZnS) and terbium-doped ZnS (ZnS:Tb) thin films were grown by traveling wave reactor atomic layer epitaxy (ALE). In the present work, ZnCl sub 2 , H sub 2 S, and tris (2,2,6,6-tetramethyl-3,5-heptandionato) terbium (Tb(tmhd) sub 3) were used as the precursors. The dependence of crystallinity and Cl content of ZnS films was investigated on the growth temperature. ZnS and ZnS:Tb films grown at temperatures ranging from 400 to 500 .deg. C showed a hexagonal-2H crystalline structure. The crystallinity of ZnS film was greatly enhanced as the temperature increased. At growth temperatures higher than 450.deg.C, the films showed preferred orientation with mainly (002) diffraction peak. The Cl content decreased from approximately 9 to 1 at.% with the increase in growth temperature from 400 to 500 .deg. C. The segregation of Cl near the surface region and the incorporation of O from Tb(tmhd) sub 3 during ALE process were also observed using Auger electron spectroscopy. The ALE-grown ZnS and ZnS:Tb films re...

  12. Commercializing potassium terbium fluoride, KTF (KTb3F10) faraday crystals for high laser power optical isolator applications (United States)

    Schlichting, Wolfgang; Stevens, Kevin; Foundos, Greg; Payne, Alexis


    Many scientific lasers and increasingly industrial laser systems operate in power regime, require high-performance optical isolators to prevent disruptive light feedback into the laser cavity. The optically active Faraday material is the key optical element inside the isolator. SYNOPTICS has been supplying the laser market with Terbium Gallium Garnet (TGG - Tb3Ga5O12) for many years. It is the most commonly used material for the 650-1100nm range and the key advantages for TGG include its cubic crystal structure for alignment free processing, little to no intrinsic birefringence, and ease of manufacture. However, for high-power laser applications TGG is limited by its absorption at 1064nm and its thermo-optic coefficient, dn/dT. Specifically, thermal lensing and depolarization effects become a limiting factor at high laser powers. While TGG absorption has improved significantly over the past few years, there is an intrinsic limit. Now, SYNOPTICS is commercializing the enhanced new crystal Potassium Terbium Fluoride KTF (KTb3F10) that exhibits much smaller nonlinear refractive index and thermo-optic coefficients, and still exhibits a Verdet constant near that of TGG. This cubic crystal has relatively low absorption and thermo-optic coefficients. It is now fully characterized and available for select production orders. At OPTIFAB in October 2017 we present recent results comparing the performance of KTF to TGG in optical isolators and show SYNOPTICS advances in large volume crystal growth and the production ramp up.

  13. Preparation and photoluminescence enhancement in terbium(III ternary complexes with β-diketone and monodentate auxiliary ligands

    Directory of Open Access Journals (Sweden)

    Devender Singh


    Full Text Available A series of new solid ternary complexes of terbium(III ion based on β-diketone ligand acetylacetone (acac and monodentate auxiliary ligands (aqua/urea/triphenylphosphineoxide/pyridine-N-oxide had been prepared. The structural characterizations of synthesized ternary compounds were studied by means of elemental analysis, infrared (IR, and proton nuclear magnetic resonance (NMR spectral techniques. The optical characteristics were investigated with absorption as well as photoluminescence spectroscopy. Thermal behavior of compounds was examined by TGA/DTA analysis and all metal complexes were found to have good thermal stability. The luminescence decay time of complexes were also calculated by monitoring at emission wavelength corresponding to 5D4 → 7F5 transition. A comparative inspection of the luminescent behavior of prepared ternary compounds was performed in order to determine the function of auxiliary ligands in the enhancement of luminescence intensity produced by central terbium(III ion. The color coordinates values suggested that compounds showed bright green emission in visible region in electromagnetic spectrum. Complexes producing green light could play a significant role in the fabrication of efficient light conversion molecular devices for display purposes and lightning systems.

  14. Closure report for underground storage tank 161-R1U1 and its associated underground piping

    Energy Technology Data Exchange (ETDEWEB)

    Mallon, B.J.; Blake, R.G.


    Underground storage tank (UST) 161-31 R at the Lawrence Livermore National Laboratory (LLNL) was registered with the State Water Resources Control Board on June 27, 1984. UST 161-31R was subsequently renamed UST 161-R1U1 (Fig. A-1, Appendix A). UST 161-R1U1 was installed in 1976, and had a capacity of 383 gallons. This tank system consisted of a fiberglass reinforced plastic tank, approximately 320 feet of polyvinyl chloride (PVC) underground piping from Building 161, and approximately 40 feet of PVC underground piping from Building 160. The underground piping connected laboratory drains and sinks inside Buildings 160 and 161 to UST 161-R1U1. The wastewater collected in UST 161-R1U1, contained organic solvents, metals, inorganic acids, and radionuclides, most of which was produced within Building 161. On June 28, 1989, the UST 161-R1U1 piping system.around the perimeter of Building 161 failed a precision test performed by Gary Peters Enterprises (Appendix B). The 161-R1U1 tank system was removed from service after the precision test. In July 1989, additional hydrostatic tests and helium leak detection tests were performed (Appendix B) to determine the locations of the piping failures in the Building 161 piping system. The locations of the piping system failures are shown in Figure A-2 (Appendix A). On July 11, 1989, LLNL submitted an Unauthorized Release Report to Alameda County Department of Environmental Health (ACDEH), Appendix C.

  15. Synthesis and luminescent study of Ce{sup 3+}-doped terbium-yttrium aluminum garnet

    Energy Technology Data Exchange (ETDEWEB)

    Dotsenko, V.P., E-mail: [A.V. Bogatsky Physico-Chemical Institute, National Academy of Sciences of Ukraine, Lustdorfskaya doroga 86, 65080 Odessa (Ukraine); Berezovskaya, I.V.; Zubar, E.V.; Efryushina, N.P. [A.V. Bogatsky Physico-Chemical Institute, National Academy of Sciences of Ukraine, Lustdorfskaya doroga 86, 65080 Odessa (Ukraine); Poletaev, N.I.; Doroshenko, Yu.A. [Institute of Combustion and Advanced Technologies, Mechnikov Odessa National University, Dvoryanskaya 2, 65082 Odessa (Ukraine); Stryganyuk, G.B. [Ivan Franko National University of Lviv, Kirilo i Mefodii 8, 79005 Lviv (Ukraine); HASYLAB at DESY, Notkestrasse 85, 22607 Hamburg (Germany); Voloshinovskii, A.S. [Ivan Franko National University of Lviv, Kirilo i Mefodii 8, 79005 Lviv (Ukraine)


    Highlights: Black-Right-Pointing-Pointer Ce{sup 3+}-doped garnets (TYAG) were prepared using nanostructured reagents. Black-Right-Pointing-Pointer The Ce{sup 3+} ions cause a very efficient yellow emission of the samples. Black-Right-Pointing-Pointer The reasons for the long wavelength position of this emission are discussed. Black-Right-Pointing-Pointer Contribution from Al atoms to the conduction band of TYAG is quite essential. - Abstract: Terbium-yttrium aluminum garnets (TYAG) doped with Ce{sup 3+} ions have been prepared by solid state reactions between nanostructured oxides of aluminum and rare earths. The luminescent properties of Ce{sup 3+} ions in (Tb{sub 0.8}Y{sub 0.2}){sub 3(1-x)}Ce{sub 3x}Al{sub 5}O{sub 12} (x = 0.03) have been studied upon excitation in the 2-20 eV region. The substitution of Tb{sup 3+} for Y{sup 3+} in the garnet structure results in broadening the emission band and shifting its maximum towards the longer wavelengths. It was found that in addition to the 4f{sup n} {yields} 4f{sup n-1}5d excitation bands of Ce{sup 3+} and Tb{sup 3+} ions, the excitation spectra for the Ce{sup 3+} emission contain broad bands at 6.73 and {approx}9.5 eV. These bands are attributed to the Ce{sup 3+}-bound exciton formation and O 2p {yields} Al 3s, 3p transitions, respectively. In contrast to the predictions based on the results of electronic structure calculations on Y{sub 3}Al{sub 5}O{sub 12} and Tb{sub 4}Al{sub 2}O{sub 9}, the threshold of interband transitions in TYAG is at high energies ( Greater-Than-Or-Slanted-Equal-To 7.3 eV), and contributions from Al{sub tetr} and Al{sub oct} atoms to the conduction-band density of states are evaluated as quite essential.

  16. Structural variations in terbium(III) complexes with 1,3-adamantanedicarboxylate and diverse co-ligands

    Energy Technology Data Exchange (ETDEWEB)

    Thuéry, Pierre, E-mail:


    Terbium nitrate was reacted with 1,3-adamantanedicarboxylic acid (LH{sub 2}) under solvo-hydrothermal conditions with either N,N-dimethylformamide (DMF) or N,N-dimethylacetamide (DMA) as organic solvents. Hydrolysation of the latter co-solvents resulted in the formation of formate or acetate ions, which are present as co-ligands in the 1D coordination polymer [Tb(L)(HCOO)(H{sub 2}O){sub 2}] (1) and the 2D assembly [Tb(L)(CH{sub 3}COO)(H{sub 2}O)] (2). The increase in dimensionality in the latter arises from the higher connectivity provided by acetate versus formate, the L{sup 2−} ligand being bis-chelating in both cases. The complex [Tb{sub 2}(L){sub 3}(H{sub 2}O){sub 5}][Tb{sub 2}(L){sub 3}(H{sub 2}O){sub 4}]·3H{sub 2}O (3), another 1D species, crystallizes alongside crystals of 2. Further addition of cucurbit[6]uril (CB6), with DMF as co-solvent, gave the two complexes [Tb{sub 2}(L){sub 2}(CB6)(H{sub 2}O){sub 6}](NO{sub 3}){sub 2}·6H{sub 2}O (4) and [H{sub 2}NMe{sub 2}]{sub 2}[Tb(L)(HCOO){sub 2}]{sub 2}·CB6·3H{sub 2}O (5). Complex 4 crystallizes as a 3D framework in which Tb(L){sup +} chains are connected by tetradentate CB6 molecules, while 5 unites a carboxylate-bridged anionic 2D planar assembly and layers of CB6 molecules with counter-cations held at both portals. - Graphical abstract: One- to three-dimensional assemblies are formed in terbium(III) complexes with 1,3-adamantanedicarboxylate obtained under solvo-hydrothermal conditions, these species including formate or acetate co-ligands formed in situ, or additional cucurbit[6]uril molecules. - Highlights: • We report structures of terbium(III) complexes with 1,3-adamantanedicarboxylate. • Solvents able to generate co-ligands or counter-ions in situ have been used. • A 3D species including additional cucurbituril molecules is decribed. • One species displays an alternation of metal–organic and organic sheets.

  17. 26 CFR 31.3121(b)(16)-1 - Services performed under share-farming arrangement. (United States)


    ... 26 Internal Revenue 15 2010-04-01 2010-04-01 false Services performed under share-farming arrangement. 31.3121(b)(16)-1 Section 31.3121(b)(16)-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT... Revenue Code of 1954) General Provisions § 31.3121(b)(16)-1 Services performed under share-farming...

  18. 20 CFR 702.161 - Liens against assets of insurance carriers and employers. (United States)


    ... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Liens against assets of insurance carriers and employers. 702.161 Section 702.161 Employees' Benefits EMPLOYMENT STANDARDS ADMINISTRATION... AND PROCEDURE General Provisions Liens on Compensation § 702.161 Liens against assets of insurance...

  19. 43 CFR 16.1 - Agreements to dispose of helium in natural gas. (United States)


    ... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Agreements to dispose of helium in natural gas. 16.1 Section 16.1 Public Lands: Interior Office of the Secretary of the Interior CONSERVATION OF HELIUM § 16.1 Agreements to dispose of helium in natural gas. (a) Pursuant to his authority and...

  20. 50 CFR 216.161 - Specified activity and incidental take levels by species. (United States)


    ... levels by species. 216.161 Section 216.161 Wildlife and Fisheries NATIONAL MARINE FISHERIES SERVICE.... Atlantic Coast § 216.161 Specified activity and incidental take levels by species. (a) Regulations in this... species: Minke whale (Balaenoptera acutorostrata), dwarf sperm whale (Kogia simus); pygmy sperm whale (K...

  1. 22 CFR 161.9 - Specific steps in the Department's NEPA process. (United States)


    ... identify those persons, community organizations, environmental interest groups, international organizations.... 161.9 Section 161.9 Foreign Relations DEPARTMENT OF STATE ENVIRONMENTAL PROTECTION REGULATIONS FOR IMPLEMENTATION OF THE NATIONAL ENVIRONMENTAL POLICY ACT (NEPA) Environmental Review Procedures § 161.9 Specific...

  2. 33 CFR 161.60 - Vessel Traffic Service Prince William Sound. (United States)


    ... William Sound. 161.60 Section 161.60 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND... Movement Reporting System Areas and Reporting Points § 161.60 Vessel Traffic Service Prince William Sound... Cape Hinchinbrook Light to Schooner Rock Light, comprising that portion of Prince William Sound between...

  3. 40 CFR 161.55 - Agricultural vs. non-agricultural pesticides. (United States)


    ... pesticides. 161.55 Section 161.55 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS DATA REQUIREMENTS FOR REGISTRATION OF ANTIMICROBIAL PESTICIDES General Provisions § 161.55 Agricultural vs. non-agricultural pesticides. Section 25(a)(1) of FIFRA instructs the...

  4. Complete Stokes polarimetry of magneto-optical Faraday effect in a terbium gallium garnet crystal at cryogenic temperatures. (United States)

    Majeed, Hassaan; Shaheen, Amrozia; Anwar, Muhammad Sabieh


    We report the complete determination of the polarization changes caused in linearly polarized incident light due to propagation in a magneto-optically active terbium gallium garnet (TGG) single crystal, at temperatures ranging from 6.3 to 300 K. A 28-fold increase in the Verdet constant of the TGG crystal is seen as its temperature decreases to 6.3 K. In contrast with polarimetry of light emerging from a Faraday material at room temperature, polarimetry at cryogenic temperatures cannot be carried out using the conventional fixed polarizer-analyzer technique because the assumption that ellipticity is negligible becomes increasingly invalid as temperature is lowered. It is shown that complete determination of light polarization in such a case requires the determination of its Stokes parameters, otherwise inaccurate measurements will result with negative implications for practical devices.

  5. Development of Optical Isolators for Visible Light Using Terbium Aluminum Garnet (Tb3Al5O12) Single Crystals (United States)

    Geho, Mikio; Takagi, Takashi; Chiku, Shinichiro; Fujii, Takashi


    We have recently reported the successful growth of incongruently melting terbium aluminum garnet (Tb3Al5O12; TAG) single crystals by the hybrid laser FZ (floating zone) method. Optical property evaluations confirmed a high transmittance and a larger Verdet constant than conventional Tb3Ga5O12 (TGG) crystals and/or Faraday glasses. In this study, we attempted to design, fabricate, and evaluate optical isolators in visible light through near-infrared (NIR) regions using TAG crystals. A finite element method (FEM) simulation of possible models led us to the preferable one based on a radially magnetized magnet. To realize this, we employed a pseudo-radially magnetized magnet. The target wavelengths of the prototype device were 408, 808, and 1064 nm. The typical extinction ratio was more than 30 dB and the insertion loss was less than 0.3 dB for AR-coated devices.

  6. A hydrometallurgical process for the recovery of terbium from fluorescent lamps: Experimental design, optimization of acid leaching process and process analysis. (United States)

    Innocenzi, Valentina; Ippolito, Nicolò Maria; De Michelis, Ida; Medici, Franco; Vegliò, Francesco


    Terbium and rare earths recovery from fluorescent powders of exhausted lamps by acid leaching with hydrochloric acid was the objective of this study. In order to investigate the factors affecting leaching a series of experiments was performed in according to a full factorial plan with four variables and two levels (4 2 ). The factors studied were temperature, concentration of acid, pulp density and leaching time. Experimental conditions of terbium dissolution were optimized by statistical analysis. The results showed that temperature and pulp density were significant with a positive and negative effect, respectively. The empirical mathematical model deducted by experimental data demonstrated that terbium content was completely dissolved under the following conditions: 90 °C, 2 M hydrochloric acid and 5% of pulp density; while when the pulp density was 15% an extraction of 83% could be obtained at 90 °C and 5 M hydrochloric acid. Finally a flow sheet for the recovery of rare earth elements was proposed. The process was tested and simulated by commercial software for the chemical processes. The mass balance of the process was calculated: from 1 ton of initial powder it was possible to obtain around 160 kg of a concentrate of rare earths having a purity of 99%. The main rare earths elements in the final product was yttrium oxide (86.43%) following by cerium oxide (4.11%), lanthanum oxide (3.18%), europium oxide (3.08%) and terbium oxide (2.20%). The estimated total recovery of the rare earths elements was around 70% for yttrium and europium and 80% for the other rare earths. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Investigation of the luminescent properties of terbium-anthranilate complexes and application to the determination of anthranilic acid derivatives in aqueous solutions

    Energy Technology Data Exchange (ETDEWEB)

    Arnaud, N.; Georges, J


    The luminescent properties of terbium complexes with furosemide (FR), flufenamic (FF) acid, tolfenamic (TF) acid and mefenamic (MF) acid have been investigated in aqueous solutions. For all four compounds, complexation occurs when the carboxylic acid of the aminobenzoic group is dissociated and is greatly favoured in the presence of trioctylphosphine oxide as co-ligand and Triton X-100 as surfactant. Under optimum conditions, luminescence of the lanthanide ion is efficiently sensitised and the lifetime of the {sup 5}D{sub 4} resonance level of terbium in the complex is ranging between 1 and 1.9 ms, against 0.4 ms for the aqua ion. The sensitivity of the method for the determination of anthranilic acid derivatives is improved by one to two orders of magnitude with respect to that achieved using native fluorescence or terbium-sensitised luminescence in methanol. The limits of detection are 2x10{sup -10}, 5x10{sup -10} and 2x10{sup -9} mol l{sup -1} for flufenamic acid, furosemide and tolfenamic acid, and mefenamic acid, respectively, with within-run RSD values of less than 1%. The method has been applied to the determination of flufenamic acid in spiked calf sera with and without sample pretreatment. Depending on the method and the analyte concentration, the recovery was ranging between 83 and 113% and the lowest concentration attainable in serum samples was close to 1x10{sup -7} mol l{sup -1}.

  8. Dicty_cDB: SSE161 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 5' similar to SW:IPYR_CAEEL Q18680 PROBABLE INORGANIC PYROPHOSPHATASE ;, mRNA sequence. 36 2e-04 3 X14230...N-(5'-phosphoribosyl)anthranilate isomerase, histone H3 and inorganic pyrophosphatase (EC respectively. 38 5e-04...RecName: Full=Inorganic pyrophosphatase; EC=3.... 317 2e-85 (Q6C1T4) RecName: Full=Inorganic pyrophosphatase;...RecName: Full=Inorganic pyrophosphatase; EC=3.... 164 1e-39 ( P13998 ) RecName: Full=Inorganic pyrophosphatase;...RecName: Full=Inorganic pyrophosphatase; EC=3.... 161 1e-38 (Q6FRB7) RecName: Full=Inorganic pyrophosphatase;

  9. Spectroscopy of ^161Yb with ATLAS/Gammasphere (United States)

    Gaison, J.; Carroll, J.; Litz, M.; Wang, X.; Riley, M.; Baron, J.; Miller, S.; Simpson, J.; Paul, E.; Boston, A.; Boston, H.; Nolan, J.; Rees, M.; Revill, J.; Janssens, R.; Carpenter, M.; Kondev, F.; Lauritsen, T.; Zhu, S.; Riedinger, L.; Hartley, D.; Ayangeakaa, A.; Garg, U.; Chiara, C.


    An experiment was performed at Argonne National Laboratory's ATLAS accelerator using the Gammasphere array (˜100 HPGe detectors) whose primary aim was to investigate the collective bands beyond band termination in ^160Yb via the ^120Sn(^44Ca,4n) fusion-evaporation reaction. The high spin yield of the 4n channel was enhanced significantly by selecting a beam energy of 222 MeV and a considerable amount of data of 3n and 5n channels were also obtained. Here is presented the preliminary result of an initial spectroscopic analysis of ^161Yb, the product of the 3n channel. The RadWare (coincidence analysis) software package was utilized and the possibility of revised level placements has been suggested by the analysis, in comparison with previous level schemes.

  10. CD161 Defines a Transcriptional and Functional Phenotype across Distinct Human T Cell Lineages

    Directory of Open Access Journals (Sweden)

    Joannah R. Fergusson


    Full Text Available The C-type lectin CD161 is expressed by a large proportion of human T lymphocytes of all lineages, including a population known as mucosal-associated invariant T (MAIT cells. To understand whether different T cell subsets expressing CD161 have similar properties, we examined these populations in parallel using mass cytometry and mRNA microarray approaches. The analysis identified a conserved CD161++/MAIT cell transcriptional signature enriched in CD161+CD8+ T cells, which can be extended to CD161+ CD4+ and CD161+TCRγδ+ T cells. Furthermore, this led to the identification of a shared innate-like, TCR-independent response to interleukin (IL-12 plus IL-18 by different CD161-expressing T cell populations. This response was independent of regulation by CD161, which acted as a costimulatory molecule in the context of T cell receptor stimulation. Expression of CD161 hence identifies a transcriptional and functional phenotype, shared across human T lymphocytes and independent of both T cell receptor (TCR expression and cell lineage.

  11. Structural investigation and photoluminescent properties of gadolinium(III), europium(III) and terbium(III) 3-mercaptopropionate complexes. (United States)

    Souza, E R; Mazali, I O; Sigoli, F A


    This work reports on the synthesis, crystallographic determination and spectroscopic characterization of gadolinium(III), terbium(III) and europium(III) 3-mercaptopropionate complexes, aqua-tris(3-mercaptopropionate)lanthanide(III)--[Ln(mpa)3(H2O)]. The Judd-Ofelt intensity parameters were experimentally determined from emission spectrum of the [Eu(mpa)3(H2O)]complex and they were also calculated from crystallographic data. The complexes are coordination polymers, where the units of each complex are linked together by carboxylate groups leading to an unidimensional and parallel chains that by chemical interactions form a tridimensional framework. The emission spectrum profile of the [Eu(mpa)3(H2O)] complex is discussed based on point symmetry of the europium(III) ion, that explains the bands splitting observed in its emission spectrum. Photoluminescent analysis of the [Gd(mpa)3(H2O)] complex show no efficient ligand excitation but an intense charge transfer band. The excitation spectra of the [Eu(mpa)3(H2O)] and [Tb(mpa)3(H2O)] complexes do not show evidence of energy transfer from the ligand to the excited levels of these trivalent ions. Therefore the emission bands are originated only by direct f-f intraconfigurational excitation of the lantanide(III) ions.

  12. Fluorometric determination of proteins using the terbium (III)-2-thenoyltrifluoroacetone-sodium dodecyl benzene sulfonate-protein system

    Energy Technology Data Exchange (ETDEWEB)

    Jia Zhen [Key Laboratory of Colloid and Interface Chemistry of Education Ministry, School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Department of Chemistry, Dezhou University, Dezhou 253023 (China); Yang Jinghe [Key Laboratory of Colloid and Interface Chemistry of Education Ministry, School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China)]. E-mail:; Wu Xia [Key Laboratory of Colloid and Interface Chemistry of Education Ministry, School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Wang Fei [Key Laboratory of Colloid and Interface Chemistry of Education Ministry, School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Guo Changying [Key Laboratory of Colloid and Interface Chemistry of Education Ministry, School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Liu Shufang [Key Laboratory of Colloid and Interface Chemistry of Education Ministry, School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China)


    It is found that in hexamethylene tetramine (HMTA)-HCl buffer of pH=8.00, proteins can enhance the fluorescence of terbium (III) (Tb{sup 3+})-2-thenoyltrifluoroacetone (TTA)-sodium dodecyl benzene sulfonate (SDBS) system. Based on this, a sensitive method for the determination of proteins is proposed. The experiments indicate that under the optimum conditions, the enhanced fluorescence intensity is in proportion to the concentration of proteins in the range of 4.0x10{sup -9}-7.5x10{sup -6}g/mL for bovine serum albumin (BSA), 5.0x10{sup -9}-1.5x10{sup -5}g/mL for human serum albumin (HSA), 1.0x10{sup -8}-7.5x10{sup -6}g/mL for egg albumin (EA). Their detection limits (S/N=3) are 0.5, 0.8 and 2.0ng/mL, respectively. The interaction mechanism is also studied.

  13. Terbium to Quantum Dot FRET Bioconjugates for Clinical Diagnostics: Influence of Human Plasma on Optical and Assembly Properties

    Directory of Open Access Journals (Sweden)

    Niko Hildebrandt


    Full Text Available Förster resonance energy transfer (FRET from luminescent terbium complexes (LTC as donors to semiconductor quantum dots (QDs as acceptors allows extraordinary large FRET efficiencies due to the long Förster distances afforded. Moreover, time-gated detection permits an efficient suppression of autofluorescent background leading to sub-picomolar detection limits even within multiplexed detection formats. These characteristics make FRET-systems with LTC and QDs excellent candidates for clinical diagnostics. So far, such proofs of principle for highly sensitive multiplexed biosensing have only been performed under optimized buffer conditions and interactions between real-life clinical media such as human serum or plasma and LTC-QD-FRET-systems have not yet been taken into account. Here we present an extensive spectroscopic analysis of absorption, excitation and emission spectra along with the luminescence decay times of both the single components as well as the assembled FRET-systems in TRIS-buffer, TRIS-buffer with 2% bovine serum albumin, and fresh human plasma. Moreover, we evaluated homogeneous LTC-QD FRET assays in QD conjugates assembled with either the well-known, specific biotin-streptavidin biological interaction or, alternatively, the metal-affinity coordination of histidine to zinc. In the case of conjugates assembled with biotin-streptavidin no significant interference with the optical and binding properties occurs whereas the histidine-zinc system appears to be affected by human plasma.

  14. Evidence of mass exchange between inside and outside of sonoluminescing bubble in aqueous solution of terbium chloride

    Energy Technology Data Exchange (ETDEWEB)

    Liang, Jinfu, E-mail: [School of Physics and Electronic Science, Guizhou Normal University, Guiyang 550001 (China); Chen, Weizhong, E-mail: [The Key Laboratory of Modern Acoustics, Ministry of Education, Institution of Acoustics, Nanjing University, Nanjing 210093 (China); Wang, Xun; Yang, Jing; Chen, Zhan [The Key Laboratory of Modern Acoustics, Ministry of Education, Institution of Acoustics, Nanjing University, Nanjing 210093 (China)


    Highlights: • Time-resolved spectra of SBSL were obtained for Tb{sup 3+} ions emission lines. • Mass exchange between inside and outside of SL bubble was probed via Tb{sup 3+} ions lines. • The argon rectification hypothesis was tested by time-resolved spectra of SBSL. • The rate of mass exchange inside an SBSL bubble increases with increasing sound pressure. - Abstract: Spectra of single-bubble sonoluminescence (SBSL) were obtained for Tb{sup 3+} ions emission lines from bubbles in an aqueous solution of terbium chloride (TbCl{sub 3}). The spectra provide experimental evidence to prove that an air bubble driven by strong ultrasound will not eventually become a rectified pure argon bubble, which is not as predicted by the argon rectification hypothesis. The time-resolved spectra of SBSL show a mass exchange of material such as Tb{sup 3+} ions between the inside and outside of the bubble. With increasing sound pressure, the rate of mass exchange and the SBSL intensity increases.

  15. Optical properties and electrical transport of thin films of terbium(III bis(phthalocyanine on cobalt

    Directory of Open Access Journals (Sweden)

    Peter Robaschik


    Full Text Available The optical and electrical properties of terbium(III bis(phthalocyanine (TbPc2 films on cobalt substrates were studied using variable angle spectroscopic ellipsometry (VASE and current sensing atomic force microscopy (cs-AFM. Thin films of TbPc2 with a thickness between 18 nm and 87 nm were prepared by organic molecular beam deposition onto a cobalt layer grown by electron beam evaporation. The molecular orientation of the molecules on the metallic film was estimated from the analysis of the spectroscopic ellipsometry data. A detailed analysis of the AFM topography shows that the TbPc2 films consist of islands which increase in size with the thickness of the organic film. Furthermore, the cs-AFM technique allows local variations of the organic film topography to be correlated with electrical transport properties. Local current mapping as well as local I–V spectroscopy shows that despite the granular structure of the films, the electrical transport is uniform through the organic films on the microscale. The AFM-based electrical measurements allow the local charge carrier mobility of the TbPc2 thin films to be quantified with nanoscale resolution.

  16. Highly luminescent charge-neutral europium(iii) and terbium(iii) complexes with tridentate nitrogen ligands. (United States)

    Senthil Kumar, Kuppusamy; Schäfer, Bernhard; Lebedkin, Sergei; Karmazin, Lydia; Kappes, Manfred M; Ruben, Mario


    We report on the synthesis of tridentate-nitrogen pyrazole-pyridine-tetrazole (L(1)H) and pyrazole-pyridine-triazole (L(2)H) ligands and their complexation with lanthanides (Ln = Gd(iii), Eu(iii) and Tb(iii)) resulting in stable, charge-neutral complexes Ln(L(1))3 and Ln(L(2))3, respectively. X-ray crystallographic analysis of the complexes with L(1) ligands revealed tricapped trigonal coordination geometry around the lanthanide ions. All complexes show bright photoluminescence (PL) in the solid state, indicating efficient sensitization of the lanthanide emission via the triplet states of the ligands. In particular, the terbium complexes show high PL quantum yields of 65 and 59% for L(1) and L(2), respectively. Lower PL efficiencies of the europium complexes (7.5 and 9%, respectively) are attributed to large energy gaps between the triplet states of the ligands and accepting levels of Eu(iii). The triplet state energy can be reduced by introducing an electron withdrawing (EW) group at the 4 position of the pyridine ring. Such substitution of L(1)H with a carboxylic ester (COOMe) EW group leads to a europium complex with increased PL quantum yield of 31%. A comparatively efficient PL of the complexes dissolved in ethanol indicates that the lanthanide ions are shielded against nonradiative deactivation via solvent molecules.

  17. Micelle enhanced and terbium sensitized spectrofluorimetric determination of danofloxacin in milk using molecularly imprinted solid phase extraction (United States)

    Kaur, Kuldeep; Saini, Shivender Singh; Malik, Ashok Kumar; Singh, Baldev


    An efficient molecularly imprinted solid phase extraction (MISPE)-spectrofluorimetric method was developed to sensitively determine danofloxacin (DAN) in milk samples. Solid phase extraction procedure using MISPE cartridges was first performed on milk samples and then spectrofluorimetric determination was done at 546 nm using an excitation wavelength of 285 nm in presence of terbium and sodium dodecyl benzene sulfonate (SDBS). It was found that SDBS significantly enhanced the fluorescence intensity of the DAN-Tb3+ complex. Various factors affecting the fluorescence intensity of DAN-Tb3+-SDBS system were studied and conditions were optimized. The enhanced fluorescence intensity of the system (ΔF) showed a good linear relationship with the concentration of DAN over the range of 8.4 × 10-9-3.4 × 10-7 mol L-1 with a correlation coefficient of 0.9996. The detection limit was determined as 2.0 × 10-9 mol L-1 and the limit of quantification was determined as 6.5 × 10-9 mol L-1. The MISPE-spectrofluorimetric procedure was successfully applied to the determination of DAN in milk samples. The method is simple, rapid, sensitive and allows interference free determination of DAN in complex fluorescent matrices like milk. The method can be used to determine whether the DAN residues in milk exceed MRLs or not.

  18. Study of quantum dot based on tin/yttrium mixed oxide doped with terbium to be used as biomarker

    Energy Technology Data Exchange (ETDEWEB)

    Paganini, Paula P.; Felinto, Maria Claudia F.C.; Kodaira, Claudia A., E-mail: paulapaganini@usp.b, E-mail: mfelinto@ipen.b, E-mail: [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil); Brito, Hermi F., E-mail: hefbrito@iq.usp.b [Universidade de Sao Paulo (USP), SP (Brazil). Inst. de Quimica. Lab. de Elementos do Bloco f; Nunes, Luiz Antonio O., E-mail: luizant@ifsc.usp.b [Universidade de Sao Paulo (USP), Sao Carlos, SP (Brazil). Inst. de Fisica. Dept. de Fisica e Informatica


    Quantum dots (semiconductors nanocrystals) have brought a promising field to develop a new generation of luminescent biomarkers. The use of lanthanides ions as luminescent markers has many advantages, for example a security method, low cost, high specificity and also the luminescence can be promptly measured with high sensibility and accuracy. These luminescent dots are functionalized with biomolecules. For the luminophore particle to be connect with biologicals molecules (for example covalent antibody) is necessary a previous chemical treatment to modify luminophore particle surface and this process is called functionalization. A prior chemical treatment with changes on the surface luminophore particle is necessary to couple the luminophore to biological molecules. This process can be used as coating which can protect these particles from being dissolved by acid as well as provide functional groups for biological conjugation. This work presents a photoluminescence study of nanoparticles based on tin/yttrium mixed oxides doped with terbium (SnO{sub 2}/Y{sub 2}O{sub 3}:Tb{sup 3+}), synthesized by coprecipitation method. The nanoparticles were submitted to thermal treatment and characterized by X-Ray Powder Diffraction (XRD) that showed cassiterite phase formation and the influence of thermal treatment on nanoparticles structures. These nanoparticles going to be functionalized with a natural polysaccharide (chitosan) in order to form microspheres. These microspheres going to be irradiated with gamma radiation to sterilization and it can be evaluated if the nanoparticles are resistant to irradiation and they do not lose functionality with this process. (author)

  19. 49 CFR 173.161 - Chemical kits and first aid kits. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Chemical kits and first aid kits. 173.161 Section... Class 7 § 173.161 Chemical kits and first aid kits. (a) Chemical kits and First aid kits must conform to... 10 kg. (b) Chemical kits and First aid kits are excepted from the specification packaging...

  20. 25 CFR 1000.161 - What is a self-governance compact? (United States)


    ... 25 Indians 2 2010-04-01 2010-04-01 false What is a self-governance compact? 1000.161 Section 1000... EDUCATION ACT Negotiation Process for Annual Funding Agreements Negotiating A Self-Governance Compact § 1000.161 What is a self-governance compact? A self-governance compact is an executed document that affirms...

  1. 34 CFR 222.161 - How is State aid treated under section 8009 of the Act? (United States)


    ... the school year in an elementary (including pre-kindergarten) or secondary school program. “Current... 34 Education 1 2010-07-01 2010-07-01 false How is State aid treated under section 8009 of the Act? 222.161 Section 222.161 Education Regulations of the Offices of the Department of Education OFFICE OF...

  2. 9 CFR 161.2 - Requirements and application procedures for accreditation. (United States)


    ... vaccination tags, and determine the state of origin of eartags, to properly identify animals in interstate... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Requirements and application procedures for accreditation. 161.2 Section 161.2 Animals and Animal Products ANIMAL AND PLANT HEALTH...

  3. 26 CFR 1.501(c)(16)-1 - Corporations organized to finance crop operations. (United States)


    ... 26 Internal Revenue 7 2010-04-01 2010-04-01 true Corporations organized to finance crop operations. 1.501(c)(16)-1 Section 1.501(c)(16)-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE... Corporations organized to finance crop operations. A corporation organized by a farmers' cooperative marketing...

  4. 9 CFR 381.161 - “(Kind) A La Kiev.” (United States)


    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false â(Kind) A La Kiev.â 381.161 Section 381.161 Animals and Animal Products FOOD SAFETY AND INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE... INSPECTION AND CERTIFICATION POULTRY PRODUCTS INSPECTION REGULATIONS Definitions and Standards of Identity or...

  5. Circulating Glucagon 1-61 Regulates Blood Glucose by Increasing Insulin Secretion and Hepatic Glucose Production

    DEFF Research Database (Denmark)

    Wewer Albrechtsen, Nicolai J.; Kuhre, Rune E.; Hornburg, Daniel


    that PG 1-61 dose-dependently increases levels of cAMP, through the glucagon receptor, and increases insulin secretion and protein levels of enzymes regulating glycogenolysis and gluconeogenesis. In rats, PG 1-61 increases blood glucose and plasma insulin and decreases plasma levels of amino acids in...

  6. 75 FR 61655 - Airworthiness Directives; Piper Aircraft, Inc. Model PA-28-161 Airplanes (United States)


    ... Federal Aviation Administration 14 CFR Part 39 RIN 2120-AA64 Airworthiness Directives; Piper Aircraft, Inc... directive (AD) for all Piper Aircraft, Inc. (Piper) Model PA-28-161 airplanes equipped with Thielert.... Piper Model PA-28-161 airplanes modified by STC No. SA03303AT have a similar unsafe design feature that...

  7. 21 CFR 150.161 - Artificially sweetened fruit preserves and jams. (United States)


    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Artificially sweetened fruit preserves and jams. 150.161 Section 150.161 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN..., spice extract. (2) A vinegar, lemon juice, lime juice, citric acid, lactic acid, malic acid, tartaric...

  8. 22 CFR 161.12 - Environmental effects abroad of major departmental actions. (United States)


    ... analysis shall be prepared in accordance with separate Departmental procedures (Foreign Affairs Manual... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Environmental effects abroad of major departmental actions. 161.12 Section 161.12 Foreign Relations DEPARTMENT OF STATE ENVIRONMENTAL PROTECTION...

  9. 22 CFR 161.8 - General description of the Department's NEPA process. (United States)


    ... (Foreign Affairs Manual, Volume 2). (b) Environmental Assessment. An environmental assessment is a concise... 22 Foreign Relations 1 2010-04-01 2010-04-01 false General description of the Department's NEPA process. 161.8 Section 161.8 Foreign Relations DEPARTMENT OF STATE ENVIRONMENTAL PROTECTION REGULATIONS...

  10. Management of sinonasal chondrosarcoma: a systematic review of 161 patients. (United States)

    Khan, Mohemmed N; Husain, Qasim; Kanumuri, Vivek V; Boghani, Zain; Patel, Chirag R; Liu, James K; Eloy, Jean Anderson


    This study reviews the published literature related to management of sinonasal chondrosarcoma. Clinical presentation, demographics, radiographic diagnosis, treatment, and management outcomes of this uncommon disease are reported. A systematic review of studies for sinonasal chondrosarcoma from 1950 to 2012 was conducted. A PubMed search for articles related to this condition, along with bibliographies of the selected articles was performed. Articles were examined for patient data that reported survivability. Demographic data, disease site, treatment strategies, follow-up, outcome, and survival were analyzed. A total of 63 journal articles were included, comprising a total of 161 cases of sinonasal chondrosarcoma. The average follow-up was 77.4 months (range, 1 to 325.2 months). Surgical resection was the most common treatment modality, used in 72.0% of cases. A combination of surgery and radiation therapy was the second most commonly used treatment modality, used in 21.7% of cases. This review contains the largest pool of sinonasal chondrosarcoma patients to date and suggests aggressive surgical resection is the most common treatment modality for this condition. The use of adjuvant radiotherapy for prevention of local recurrence after subtotal or total resection has not been proven effective. However, the use of radiotherapy in addition to surgical resection has shown benefit in some studies in terms of survival. © 2013 ARS-AAOA, LLC.

  11. Terbium-doped gadolinium oxysulfide (Gd2O2S:Tb) scintillation-based polymer optical fibre sensor for real time monitoring of radiation dose in oncology (United States)

    Lewis, E.; O'Keeffe, S.; Grattan, M.; Hounsell, A.; McCarthy, D.; Woulfe, P.; Cronin, J.; Mihai, L.; Sporea, D.; Santhanam, A.; Agazaryan, N.


    A PMMA based plastic optical fibre sensor for use in real time radiotherapy dosimetry is presented. The optical fibre tip is coated with a scintillation material, terbium-doped gadolinium oxysulfide (Gd2O2S:Tb), which fluoresces when exposed to ionising radiation (X-Ray). The emitted visible light signal penetrates the sensor optical fibre and propagates along the transmitting fibre at the end of which it is remotely monitored using a fluorescence spectrometer. The results demonstrate good repeatability, with a maximum percentage error of 0.5% and the response is independent of dose rate.

  12. The influence of quasineutron configurations on {sup 161}Ta and nearby odd-A nuclei

    Energy Technology Data Exchange (ETDEWEB)

    Joss, D. T.; Thomson, J.; Bianco, L.; O' Donnell, D.; Page, R. D.; Paul, E. S.; Sapple, P. J.; Wiseman, D. R. [Oliver Lodge Laboratory, University of Liverpool, Liverpool, L69 7ZE (United Kingdom); Lagergren, K. [Joint Institute for Heavy Ion Research, Holifield Radioactive Ion Beam Facility, Oak Ridge, TN 37381 (United States); Appelbe, D. E.; Barton, C. J.; Gomez-Hornillos, M. B.; Labiche, M.; Simpson, J.; Warner, D. D. [STFC Daresbury Laboratory, Daresbury, Warrington, WA4 4AD (United Kingdom); Cederwall, B.; Hadinia, B.; Wyss, R. [Department of Physics, Royal Institute of Technology, S-10691 Stockholm (Sweden); Darby, I. G.; Grahn, T. [Department of Physics, University of Jyvaeskylae, P.O. Box 35, FI-40014 (Finland); and others


    Several strongly coupled bands in the neutron-deficient nucleus {sup 161}Ta have been identified and quasiparticle configuration assignments have been made on the basis of rotational alignments and cranked shell model calculations. The level scheme elucidated for {sup 161}Ta highlights the competition between the {nu}(h{sub 9/2}) and {nu}(i{sub 13/2}) orbitals to form the yrast spectrum. The band structures in {sup 161}Ta also provide new insights into the structural features of other heavy odd-A nuclei populated with much lower reaction cross sections in this region at the proton drip line.

  13. Compact all-fiber optical Faraday components using 65-wt%-terbium-doped fiber with a record Verdet constant of -32 rad/(Tm). (United States)

    Sun, L; Jiang, S; Marciante, J R


    A compact all-fiber Faraday isolator and a Faraday mirror are demonstrated. At the core of each of these components is an all-fiber Faraday rotator made of a 4-cm-long, 65-wt%-terbium-doped silicate fiber. The effective Verdet constant of the terbium-doped fiber is measured to be -32 rad/(Tm), which is 27 x larger than that of silica fiber. This effective Verdet constant is the largest value measured to date in any fiber and is 83% of the Verdet constant of commercially available crystal used in bulk optics-based isolators. Combining the all-fiber Faraday rotator with fiber polarizers results in a fully fusion spliced all-fiber isolator whose isolation is measured to be 19 dB. Combining the all-fiber Faraday rotator with a fiber Bragg grating results in an all-fiber Faraday mirror that rotates the polarization state of the reflected light by 88 +/- 4 degrees .

  14. Picomolar Traces of Americium(III) Introduce Drastic Changes in the Structural Chemistry of Terbium(III): A Break in the "Gadolinium Break". (United States)

    Welch, Jan M; Müller, Danny; Knoll, Christian; Wilkovitsch, Martin; Giester, Gerald; Ofner, Johannes; Lendl, Bernhard; Weinberger, Peter; Steinhauser, Georg


    The crystallization of terbium 5,5'-azobis[1H-tetrazol-1-ide] (ZT) in the presence of trace amounts (ca. 50 Bq, ca. 1.6 pmol) of americium results in 1) the accumulation of the americium tracer in the crystalline solid and 2) a material that adopts a different crystal structure to that formed in the absence of americium. Americium-doped [Tb(Am)(H 2 O) 7 ZT] 2 ZT⋅10 H 2 O is isostructural to light lanthanide (Ce-Gd) 5,5'-azobis[1H-tetrazol-1-ide] compounds, rather than to the heavy lanthanide (Tb-Lu) 5,5'-azobis[1H-tetrazol-1-ide] (e.g., [Tb(H 2 O) 8 ] 2 ZT 3 ⋅6 H 2 O) derivatives. Traces of Am seem to force the Tb compound into a structure normally preferred by the lighter lanthanides, despite a 10 8 -fold Tb excess. The americium-doped material was studied by single-crystal X-ray diffraction, vibrational spectroscopy, radiochemical neutron activation analysis, and scanning electron microcopy. In addition, the inclusion properties of terbium 5,5'-azobis[1H-tetrazol-1-ide] towards americium were quantified, and a model for the crystallization process is proposed. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. 34 CFR 403.161 - How must funds be used under the Comprehensive Career Guidance and Counseling Programs? (United States)


    ... Guidance and Counseling Programs? 403.161 Section 403.161 Education Regulations of the Offices of the... the Special Programs? Comprehensive Career Guidance and Counseling Programs § 403.161 How must funds be used under the Comprehensive Career Guidance and Counseling Programs? (a) A State shall use not...

  16. 33 CFR 165.161 - Safety zones: Coast Guard Captain of the Port New York annual fireworks displays. (United States)


    ... of the Port New York annual fireworks displays. 165.161 Section 165.161 Navigation and Navigable... Coast Guard District § 165.161 Safety zones: Coast Guard Captain of the Port New York annual fireworks displays. (a) Safety zones. The following areas are designated safety zones: (1) Bar Beach fireworks...

  17. Yeast Interacting Proteins Database: YGL161C, YDR084C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available YGL161C YIP5 Protein that interacts with Rab GTPases, localized to late Golgi vesicles; computational...GTPases, localized to late Golgi vesicles; computational analysis of large-scale protein-protein interaction

  18. 22 CFR 161.10 - Non-Federal applicants for permits. (United States)


    ... IMPLEMENTATION OF THE NATIONAL ENVIRONMENTAL POLICY ACT (NEPA) Coordination of Other Requirements of NEPA § 161... permits for the construction of bridges and oil pipelines that cross the international boundaries with...

  19. Biologic and serologic characterization of the 161A strain of Naegleria fowleri. (United States)

    Visvesvara, G S; Healy, G R


    The 161A strain of Naegleria isolated from the nasal swab of a boy (9) was grown axenically in Nelson's medium. When 10,000 amoebae from the axenic medium were inoculated onto each monkey kidney cell (Vero) culture, characteristic cytopathic effects (CPE) were noticed in 4 to 5 days. The CPE consisted of granulation of the host cell cytoplasm, cell shrinkage, nuclear pycnosis, and discontinuity of cell sheet. When 10,000 amoebae were instilled intranasally into a group of ten 2- to 3-week-old mice, 8 of the 10 mice exhibited characteristic symptoms of primary amoebic meningoencephalitis and died within 10 to 12 days. Histopathology of the brain revealed necrotic tissue and an acute inflammatory reaction in the superficial regions of the brain. In the gel diffusion and immunoelectrophoresis tests the sonically disrupted antigens of 161A amoebae reacted extensively with the hyper-immune sera against 3 strains (CA, CJ, HB-1) of pathogenic N. fowleri and produced patterns very similar to those produced by the homologous systems. Further, anti-HB-1 serum absorbed with the 161A antigens failed to react with the antigens of HB-1, CA, CJ, and 161A strains thus indicating antigenic identity of 161A strain with N. fowleri. In view of these observations it was concluded that the strain 161A is pathogenic and should be reclassified as N. fowleri.

  20. Circulating Glucagon 1-61 Regulates Blood Glucose by Increasing Insulin Secretion and Hepatic Glucose Production

    Directory of Open Access Journals (Sweden)

    Nicolai J. Wewer Albrechtsen


    Full Text Available Glucagon is secreted from pancreatic α cells, and hypersecretion (hyperglucagonemia contributes to diabetic hyperglycemia. Molecular heterogeneity in hyperglucagonemia is poorly investigated. By screening human plasma using high-resolution-proteomics, we identified several glucagon variants, among which proglucagon 1-61 (PG 1-61 appears to be the most abundant form. PG 1-61 is secreted in subjects with obesity, both before and after gastric bypass surgery, with protein and fat as the main drivers for secretion before surgery, but glucose after. Studies in hepatocytes and in β cells demonstrated that PG 1-61 dose-dependently increases levels of cAMP, through the glucagon receptor, and increases insulin secretion and protein levels of enzymes regulating glycogenolysis and gluconeogenesis. In rats, PG 1-61 increases blood glucose and plasma insulin and decreases plasma levels of amino acids in vivo. We conclude that glucagon variants, such as PG 1-61, may contribute to glucose regulation by stimulating hepatic glucose production and insulin secretion.

  1. Crystal structures of two mononuclear complexes of terbium(III) nitrate with the tripodal alcohol 1,1,1-tris-(hy-droxy-meth-yl)propane. (United States)

    Gregório, Thaiane; Giese, Siddhartha O K; Nunes, Giovana G; Soares, Jaísa F; Hughes, David L


    Two new mononuclear cationic complexes in which the TbIII ion is bis-chelated by the tripodal alcohol 1,1,1-tris-(hy-droxy-meth-yl)propane (H3LEt, C6H14O3) were prepared from Tb(NO3)3·5H2O and had their crystal and mol-ecular structures solved by single-crystal X-ray diffraction analysis after data collection at 100 K. Both products were isolated in reasonable yields from the same reaction mixture by using different crystallization conditions. The higher-symmetry complex dinitratobis[1,1,1-tris-(hy-droxy-meth-yl)propane]-terbium(III) nitrate di-meth-oxy-ethane hemisolvate, [Tb(NO3)2(H3LEt)2]NO3·0.5C4H10O2, 1, in which the lanthanide ion is 10-coordinate and adopts an s-bicapped square-anti-prismatic coordination geometry, contains two bidentate nitrate ions bound to the metal atom; another nitrate ion functions as a counter-ion and a half-mol-ecule of di-meth-oxy-ethane (completed by a crystallographic twofold rotation axis) is also present. In product aqua-nitratobis[1,1,1-tris-(hy-droxy-meth-yl)propane]-terbium(III) dinitrate, [Tb(NO3)(H3LEt)2(H2O)](NO3)2, 2, one bidentate nitrate ion and one water mol-ecule are bound to the nine-coordinate terbium(III) centre, while two free nitrate ions contribute to charge balance outside the tricapped trigonal-prismatic coordination polyhedron. No free water mol-ecule was found in either of the crystal structures and, only in the case of 1, di-meth-oxy-ethane acts as a crystallizing solvent. In both mol-ecular structures, the two tripodal ligands are bent to one side of the coordination sphere, leaving room for the anionic and water ligands. In complex 2, the methyl group of one of the H3LEt ligands is disordered over two alternative orientations. Strong hydrogen bonds, both intra- and inter-molecular, are found in the crystal structures due to the number of different donor and acceptor groups present.

  2. The response behavior of PPy-DB18C6 electrode to terbium(III in acetonitrile and its thermodynamic application

    Directory of Open Access Journals (Sweden)

    Mohammad Hossein Arbab Zavar


    Full Text Available Polypyrrole modified electrode prepared by electropolymerization of pyrrole in the presence of a complexing ligand, dibenzo-18-crown-6(DB18C6, was prepared and investigated as a Tb3+-selective electrode in acetonitrile. The potentiometric response of the electrode was linear within the Tb3+ concentration range 1 × 10−5–1 × 10−2 M with a Nernstian slope of 20.9 mVdecade−1 in AN. The electrode was applied to study the complexation of the terbium(III ion in acetonitrile with such other basic aprotic solvent molecules (D as dimethyl sulfoxide, N,N-dimethyl formamide, propylene carbonate and pyridine. The successive complex formation constant (βi and Gibbs energies of transfer (ΔGtr of Tb3+ in AN in relation to such D were obtained.

  3. Luminescence and Magnetic Properties of Two Three-Dimensional Terbium and Dysprosium MOFs Based on Azobenzene-4,4′-Dicarboxylic Linker

    Directory of Open Access Journals (Sweden)

    Belén Fernández


    Full Text Available We report the in situ formation of two novel metal-organic frameworks based on terbium and dysprosium ions using azobenzene-4,4′-dicarboxylic acid (H2abd as ligand, synthesized by soft hydrothermal routes. Both materials show isostructural three-dimensional networks with channels along a axis and display intense photoluminescence properties in the solid state at room temperature. Textural properties of the metal-organic frameworks (MOFs have been fully characterized although no appreciable porosity was obtained. Magnetic properties of these materials were studied, highlighting the dysprosium material displays slightly frequency-dependent out of phase signals when measured under zero external field and under an applied field of 1000 Oe.

  4. Performance evaluation of heat pump system using R744/R161 mixture refrigerant

    Directory of Open Access Journals (Sweden)

    Zhang Xian-Ping


    Full Text Available As an efficient and energy conservation technology, heat pumps working with R22, which are scheduled to be phased out by Montreal Protocol, are widely used in China at present. The global deteriorating ecology environment would accelerate the phase-out time of R22 in developing countries. Therefore, as a matter of urgency, an eco-friendly substitute should be investigated in order to replace R22. Under this context, and with a consideration of the environmental protection, R744/R161 mixture refrigerant is proposed. R744/R161 mixture refrigerant’s condensation pressure is reduced and its flammability and explosivity are suppressed. A thermodynamic model is developed, and under the given working conditions, the performances of subcritical heat pump system using R744/R161 mixture of variable mass fraction are discussed and compared with those of the R22 system. The optimal mass fraction of R744/R161 is given, which corresponds to a maximal heating coefficient of performance. The simulation results show that R744/R161 mixture can work as a competitive alternative to R22 in heat pump system.

  5. Percentages of CD4+CD161+ and CD4−CD8−CD161+ T Cells in the Synovial Fluid Are Correlated with Disease Activity in Rheumatoid Arthritis

    Directory of Open Access Journals (Sweden)

    Jinlin Miao


    Full Text Available Objective. CD161 has been identified as a marker of human IL-17-producing T cells that are implicated in the pathogenesis of rheumatoid arthritis (RA. This study aimed to investigate the potential link between the percentage of CD161+ T cells and disease activity in RA patients. Methods. Peripheral blood (PB from 54 RA patients and 21 healthy controls was evaluated. Paired synovial fluid (SF (n = 17 was analyzed. CD161 expression levels on CD4+, CD8+, and CD4−CD8− T cells were assessed by flow cytometry. Results. The percentage of CD4+CD161+ T cells in RA SF was higher than RA PB, and it was positively correlated with DAS28, erythrocyte sedimentation rate (ESR, and C-reactive protein (CRP. CD4−CD8−CD161+ T cell percentage was decreased in RA PB and was further reduced in RA SF, and its level in SF was inversely correlated with DAS28, ESR, and CRP. However, CD8+CD161+ T cell percentage was neither changed in RA PB and SF nor correlated with disease activity indices. Conclusion. An increased CD4+CD161+ T cell percentage and a decreased CD4−CD8−CD161+ T cell percentage are present in RA SF and are associated with disease activity, and the accumulation of CD4+CD161+ T cells in SF may contribute to the local inflammation of RA.

  6. Luminescent europium and terbium complexes of dipyridoquinoxaline and dipyridophenazine ligands as photosensitizing antennae: structures and biological perspectives. (United States)

    Dasari, Srikanth; Patra, Ashis K


    The europium(III) and terbium(III) complexes, namely [Eu(dpq)(DMF)2(NO3)3] (1), [Eu(dppz)2(NO3)3] (2), [Tb(dpq)(DMF)2Cl3] (3), and [Tb(dppz)(DMF)2Cl3] (4), where dipyrido[3,2-d:2',3'-f]quinoxaline (dpq in 1 and 3), dipyrido[3,2-a:2',3'-c]phenazine (dppz in 2 and 4) and N,N'-dimethylformamide (DMF) have been isolated, characterized from their physicochemical data, luminescence studies and their interaction with DNA, serum albumin protein and photo-induced DNA cleavage activity are studied. The X-ray crystal structures of complexes 1-4 show discrete mononuclear Ln(3+)-based structures. The Eu(3+) in [Eu(dpq)(DMF)2(NO3)3] (1) and [Eu(dppz)2(NO3)3] (2) as [Eu(dppz)2(NO3)3]·dppz (2a) adopts a ten-coordinated bicapped dodecahedron structure with a bidentate N,N-donor dpq ligand, two DMF and three NO3(-) anions in 1 and two bidentate N,N-donor dppz ligands and three NO3(-) anions in 2. Complexes 3 and 4 show a seven-coordinated mono-capped octahedron structure where Tb(3+) contains bidentate dpq/dppz ligands, two DMF and three Cl(-) anions. The complexes are highly luminescent in nature indicating efficient photo-excited energy transfer from the dpq/dppz antenna to Ln(3+) to generate long-lived emissive excited states for characteristic f → f transitions. The time-resolved luminescence spectra of complexes 1-4 show typical narrow emission bands attributed to the (5)D0 → (7)F(J) and (5)D4 → (7)F(J) f-f transitions of Eu(3+) and Tb(3+) ions respectively. The number of inner-sphere water molecules (q) was determined from luminescence lifetime measurements in H2O and D2O confirming ligand-exchange reactions with water in solution. The complexes display significant binding propensity to the CT-DNA giving binding constant values in the range of 1.0 × 10(4)-6.1 × 10(4) M(-1) in the order 2, 4 (dppz) > 1, 3 (dpq). DNA binding data suggest DNA groove binding with the partial intercalation nature of the complexes. All the complexes also show binding propensity (K(BSA)

  7. CD3+CD8+CD161high Tc17 cells are depleted in HIV-infection

    DEFF Research Database (Denmark)

    Gaardbo, Julie Christine; Hartling, Hans Jakob; Thorsteinsson, Kristina


    CD8+ Tc17 cells with pro-inflammatory properties have only recently been acknowledged, and Tc17 cells in HIV-infection are undescribed. CD3+CD8+CD161 Tc17 cells and the production of Interleukin-17 were examined in untreated and treated HIV-infected patients, HIV-HCV co-infected patients...... and healthy controls. Depletion of CD3+CD8+CD161 Tc17 cells and diminished production of Interleukin-17 in HIV-infected patients was found. The level of Tc17 cells was associated with the level of the CD4+ count in treated patients....

  8. Spin Waves in Terbium

    DEFF Research Database (Denmark)

    Jensen, J.; Houmann, Jens Christian Gylden


    The selection rules for the linear couplings between magnons and phonons propagating in the c direction of a simple basal-plane hcp ferromagnet are determined by general symmetry considerations. The acoustic-optical magnon-phonon interactions observed in the heavy-rare-earth metals have been expl...... by Liu. The coupled magnon—transverse-phonon system for the c direction of Tb is analyzed in detail, and the strengths of the couplings are deduced as a function of wave vector by combining the experimental studies with the theory....

  9. Spin Waves in Terbium

    DEFF Research Database (Denmark)

    Jensen, J.; Houmann, Jens Christian Gylden; Bjerrum Møller, Hans


    The energies of spin waves propagating in the c direction of Tb have been studied by inelastic neutron scattering, as a function of a magnetic field applied along the easy and hard directions in the basal plane, and as a function of temperature. From a general spin Hamiltonian, consistent...... with the symmetry, we deduce the dispersion relation for the spin waves in a basal-plane ferromagnet. This phenomenological spin-wave theory accounts for the observed behavior of the magnon energies in Tb. The two q⃗-dependent Bogoliubov components of the magnon energies are derived from the experimental results...

  10. CD147-mediated chemotaxis of CD4+CD161+ T cells may contribute to local inflammation in rheumatoid arthritis. (United States)

    Lv, Minghua; Miao, Jinlin; Zhao, Peng; Luo, Xing; Han, Qing; Wu, Zhenbiao; Zhang, Kui; Zhu, Ping


    CD161 is used as a surrogate marker for Th17 cells, which are implicated in the pathogenesis of rheumatoid arthritis (RA). In this study, we evaluated the percentage, clinical significance, and CD98 and CD147 expression of CD4+CD161+ T cells. The potential role of CD147 and CD98 in cyclophilin A-induced chemotaxis of CD4+CD161+ T cells was analyzed. Thirty-seven RA patients, 15 paired synovial fluid (SF) of RA, and 22 healthy controls were recruited. The cell populations and surface expression of CD98 and CD147 were analyzed by flow cytometry. Spearman's rank correlation coefficient and multiple linear regression were applied to calculate the correlations. Chemotaxis assay was used to investigate CD4+CD161+ T cell migration. We found that the percentage of CD4+CD161+ T cells and their expression of CD147 and CD98 in SF were higher than in the peripheral blood of RA patients. Percentage of SF CD4+CD161+ T cells was positively correlated with 28-Joint Disease Activity Score (DAS28). CD147 monoclonal antibody (HAb18) attenuated the chemotactic ability of CD4+CD161+ T cells. An increased CD4+CD161+ T cell percentage and expression of CD147 and CD98 were shown in RA SF. Percentage of SF CD4+CD161+ T cells can be used as a predictive marker of disease activity in RA. CD147 block significantly decreased the chemotactic index of CD4+CD161+ cells induced by cyclophilin A (CypA). These results imply that the accumulation of CD4+CD161+ T cells in SF and their high expression of CD147 may be associated with CypA-mediated chemotaxis and contribute to local inflammation in RA.

  11. An Amphiphysin-Like Domain in Fus2p Is Required for Rvs161p Interaction and Cortical Localization

    Directory of Open Access Journals (Sweden)

    Richard A. Stein


    Full Text Available Cell–cell fusion fulfils essential roles in fertilization, development and tissue repair. In the budding yeast, Saccharomyces cerevisiae, fusion between two haploid cells of opposite mating type generates the diploid zygote. Fus2p is a pheromone-induced protein that regulates cell wall removal during mating. Fus2p shuttles from the nucleus to localize at the shmoo tip, bound to Rvs161p, an amphiphysin. However, Rvs161p independently binds a second amphiphysin, Rvs167p, playing an essential role in endocytosis. To understand the basis of the Fus2p–Rvs161p interaction, we analyzed Fus2p structural domains. A previously described N-terminal domain (NTD is necessary and sufficient to regulate nuclear/cytoplasmic trafficking of Fus2p. The Dbl homology domain (DBH binds GTP-bound Cdc42p; binding is required for cell fusion, but not localization. We identified an approximately 200 amino acid region of Fus2p that is both necessary and sufficient for Rvs161p binding. The Rvs161p binding domain (RBD contains three predicted alpha-helices; structural modeling suggests that the RBD adopts an amphiphysin-like structure. The RBD contains a 13-amino-acid region, conserved with Rvs161p and other amphiphysins, which is essential for binding. Mutations in the RBD, predicted to affect membrane binding, abolish cell fusion without affecting Rvs161p binding. We propose that Fus2p/Rvs161p form a novel heterodimeric amphiphysin required for cell fusion. Rvs161p binding is required but not sufficient for Fus2p localization. Mutations in the C-terminal domain (CTD of Fus2p block localization, but not Rvs161p binding, causing a significant defect in cell fusion. We conclude that the Fus2p CTD mediates an additional, Rvs161p-independent interaction at the shmoo tip.

  12. Page 1 Numerical simulation of the Indian monsoon 161 points out ...

    Indian Academy of Sciences (India)

    Numerical simulation of the Indian monsoon 161 points out “the dynamics of the whole terrestrial climate cannot be separated from the heat Storage effects of the upper ocean". For monsoon studies, the Indian. 9°ºan is the only ocean which experiences a bi-annual reversal of the wind circu- lation. The generation of the ...

  13. 28 CFR 35.161 - Telecommunication devices for the deaf (TDD's). (United States)


    ... 28 Judicial Administration 1 2010-07-01 2010-07-01 false Telecommunication devices for the deaf... BASIS OF DISABILITY IN STATE AND LOCAL GOVERNMENT SERVICES Communications § 35.161 Telecommunication... beneficiaries, TDD's or equally effective telecommunication systems shall be used to communicate with...

  14. 78 FR 20888 - Foreign-Trade Zone (FTZ) 161-Sedgwick County, Kansas; Notification of Proposed Production... (United States)


    ... Production Activity; Siemens Energy, Inc., (Wind Turbine Nacelles and Hubs), Hutchinson, Kansas Siemens Energy, Inc. (SEI), an operator of FTZ 161, submitted a notification of proposed production activity for.../hoses/seals/sheets/tape/bags/ containers; bushings; funnels; weather strips; hydraulic hoses; rubber...

  15. 27 CFR 31.161 - Conversion between metric and U.S. units. (United States)


    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Conversion between metric... Wholesale Dealers' Records and Reports § 31.161 Conversion between metric and U.S. units. When liters are... proof in metric bottles may be converted to U.S. units by multiplying the liters in one case by the...

  16. Yeast Interacting Proteins Database: YDR425W, YGL161C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available with this bait as prey (0) YGL161C YIP5 Protein that interacts with Rab GTPases, localized to late Golgi vesicles; computational...IP5 Prey description Protein that interacts with Rab GTPases, localized to late Golgi vesicles; computatio...nal analysis of large-scale protein-protein interaction data suggests a possible ro

  17. 40 CFR 161.100 - How to determine registration data requirements. (United States)


    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false How to determine registration data...) PESTICIDE PROGRAMS DATA REQUIREMENTS FOR REGISTRATION OF ANTIMICROBIAL PESTICIDES How To Use Data Tables § 161.100 How to determine registration data requirements. To determine the specific kinds of data...

  18. 25 CFR 700.161 - Substitute personal property-nonresidential moves. (United States)


    ... 25 Indians 2 2010-04-01 2010-04-01 false Substitute personal property-nonresidential moves. 700... RELOCATION PROCEDURES Moving and Related Expenses, Temporary Emergency Moves § 700.161 Substitute personal... substitute item at the replacement site, the displaced person is entitled to payment of the lesser of— (1...

  19. 21 CFR 133.161 - Muenster and munster cheese for manufacturing. (United States)


    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Muenster and munster cheese for manufacturing. 133... Specific Standardized Cheese and Related Products § 133.161 Muenster and munster cheese for manufacturing. Muenster cheese for manufacturing conforms to the definition and standard of identity for muenster cheese...

  20. 46 CFR 161.002-10 - Automatic fire detecting system control unit. (United States)


    ... 46 Shipping 6 2010-10-01 2010-10-01 false Automatic fire detecting system control unit. 161.002-10...-10 Automatic fire detecting system control unit. (a) General. The fire detecting system control unit... control unit to silence the audible fire alarms, but operation of the audible fire alarm device shall...

  1. 26 CFR 31.3306(c)(16)-1 - Services in employ of international organization. (United States)


    ... of 1954) § 31.3306(c)(16)-1 Services in employ of international organization. (a) Subject to the provisions of section 1 of the International Organizations Immunities Act (22 U.S.C. 228), services performed in the employ of an international organization as defined in section 7701(a)(18) are excepted from...

  2. Molecular genetics of FAM161A in North American patients with early-onset retinitis pigmentosa.

    Directory of Open Access Journals (Sweden)

    Giulia Venturini

    Full Text Available Retinitis pigmentosa (RP is a hereditary disease that leads to the progressive degeneration of retinal photoreceptor cells and to blindness. It is caused by mutations in several distinct genes, including the ciliary gene FAM161A, which is associated with a recessive form of this disorder. Recent investigations have revealed that defects in FAM161A represent a rather prevalent cause of hereditary blindness in Israel and the Palestinian territories, whereas they seem to be rarely present within patients from Germany. Genetic or clinical data are currently not available for other countries. In this work, we screened a cohort of patients with recessive RP from North America to determine the frequency of FAM161A mutations in this ethnically-mixed population and to assess the phenotype of positive cases. Out of 273 unrelated patients, only 3 subjects had defects in FAM161A. A fourth positive patient, the sister of one of these index cases, was also identified following pedigree analysis. They were all homozygous for the p.T452Sfx3 mutation, which was previously reported as a founder DNA variant in the Israeli and Palestinian populations. Analysis of cultured lymphoblasts from patients revealed that mutant FAM161A transcripts were actively degraded by nonsense-mediated mRNA decay. Electroretinographic testing showed 30 Hz cone flicker responses in the range of 0.10 to 0.60 microvolts in all cases at their first visit (age 12 to 23 (lower norm  =  50 μV and of 0.06 to 0.32 microvolts at their most recent examination (age 27 to 43, revealing an early-onset of this progressive disease. Our data indicate that mutations in FAM161A are responsible for 1% of recessive RP cases in North America, similar to the prevalence detected in Germany and unlike the data from Israel and the Palestinian territories. We also show that, at the molecular level, the disease is likely caused by FAM161A protein deficiency.

  3. Nicotine Mediates CD161a+ Renal Macrophage Infiltration and Premature Hypertension in the Spontaneously Hypertensive Rat (United States)

    Harwani, Sailesh C.; Ratcliff, Jason; Sutterwala, Fayyaz S.; Ballas, Zuhair K.; Meyerholz, David K.; Chapleau, Mark W.; Abboud, Francois M.


    Rationale Renal inflammation contributes to the pathophysiology of hypertension. CD161a+ immune cells are dominant in the Spontaneously Hypertensive Rat (SHR) and expand in response to nicotinic cholinergic activation. Objective We aimed to phenotype CD161a+ immune cells in pre-hypertensive SHR following cholinergic activation with nicotine, and determine if these cells are involved in renal inflammation and the development of hypertension. Methods and Results Studies utilized young SHR and Wistar Kyoto (WKY) rats. Splenocytes and bone marrow cells were exposed to nicotine ex-vivo and nicotine was infused in-vivo. Blood pressures, kidney, serum, and urine were obtained. Flow cytometry, Luminex/ELISA, immunohistochemistry, confocal microscopy, and Western blot were used. Nicotinic cholinergic activation induced proliferation of CD161a+/CD68+ macrophages in SHR-derived splenocytes, their renal infiltration, and premature hypertension in SHR. These changes were associated with increased renal expression of monocyte-chemoattractant-protein-1 (MCP-1) and very-late-antigen-4 (VLA-4). Lectin-Like-Transcript 1 (LLT1), the ligand for CD161a, was overexpressed in SHR kidney, while vascular cellular (VCAM-1) and intracellular adhesion molecules (ICAM-1) were similar to WKY. Inflammatory cytokines were elevated in SHR kidney and urine following nicotine infusion. Nicotine mediated renal macrophage infiltration/inflammation was enhanced in denervated kidneys, not explained by angiotensin-II levels or expression of angiotensin type-1/2 receptors. Moreover, expression of the anti-inflammatory α7-nicotinic-acetylcholine receptor was similar in young SHR and WKY. Conclusions A novel, inherited nicotinic cholinergic inflammatory effect exists in young SHR, measured by expansion of CD161a+/CD68+ macrophages. This leads to renal inflammation and premature hypertension, which may be partially explained by increased renal expression of LLT-1, MCP-1, and VLA-4. PMID:27660287

  4. 42 CFR 84.161 - Man test for gases and vapors; Type B and Type BE respirators; test requirements. (United States)


    ... 42 Public Health 1 2010-10-01 2010-10-01 false Man test for gases and vapors; Type B and Type BE respirators; test requirements. 84.161 Section 84.161 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES OCCUPATIONAL SAFETY AND HEALTH RESEARCH AND RELATED ACTIVITIES APPROVAL OF RESPIRATORY PROTECTIVE DEVICES Supplied-Air...

  5. Synthesis and crystal structure of terbium(III) meta-oxoborate Tb(BO{sub 2}){sub 3} ({identical_to} TbB{sub 3}O{sub 6}); Synthese und Kristallstruktur von Terbium(III)-meta-Oxoborat Tb(BO{sub 2}){sub 3} ({identical_to} TbB{sub 3}O{sub 6})

    Energy Technology Data Exchange (ETDEWEB)

    Nikelski, Tanja; Schleid, Thomas [Institut fuer Anorganische Chemie der Universitaet Stuttgart (Germany)


    The terbium meta-oxoborate Tb(BO{sub 2}){sub 3} ({identical_to} TbB{sub 3}O{sub 6}) is obtained as single crystals by the reaction of terbium, Tb{sub 4}O{sub 7} and TbCl{sub 3} with an excess of B{sub 2}O{sub 3} in gastight sealed platinum ampoules at 950 C after three weeks. The compound appears to be air- and water-resistant and crystallizes as long, thin, colourless needles which tend to growth-twinning due to their marked fibrous habit. The crystal structure of Tb(BO{sub 2}){sub 3} (orthorhombic, Pnma; a = 1598.97(9), b = 741.39(4), c = 1229.58(7) pm; Z = 16) contains strongly corrugated oxoborate layers {sub {infinity}}{sup 2}{l_brace}(BO{sub 2}){sup -}{r_brace} built of vertex-linked [BO{sub 4}]{sup 5-} tetrahedra (d(B-O) = 143 - 154 pm, and angsph;(O-B-O) = 102-115 ) which spread out parallel (100). The four crystallographically different Tb{sup 3+} cations all exhibit coordination numbers of eight towards the oxygen atoms (d(Tb-O) = 228-287 pm). The corresponding metal cation polyhedra [TbO{sub 8}]{sup 13+} too convene to layers (composition: {sub {infinity}}{sup 2}{l_brace}(Tb{sub 2}O{sub 11}){sup 16-}{r_brace}) which are likewise oriented parallel to the (100) plane. (Abstract Copyright [2003], Wiley Periodicals, Inc.) [German] Das Terbium-meta-Oxoborat Tb(BO{sub 2}){sub 3} ({identical_to} TbB{sub 3}O{sub 6}) entsteht einkristallin bei der Reaktion von Terbium, Tb{sub 4}O{sub 7} und TbCl{sub 3} mit einem Ueberschuss von B{sub 2}O{sub 3} in gasdicht verschlossenen Platinampullen nach drei Wochen bei 950 C. Die Verbindung ist luft- und wasserstabil und faellt in langen, duennen, farblosen Nadeln an, die aufgrund ihres ausgepraegt faserigen Habitus zur Wachstumsverzwillingung neigen. Die Kristallstruktur von Tb(BO{sub 2}){sub 3} (orthorhombisch, Pnma; a = 1598, 97(9), b = 741, 39(4), c = 1229, 58(7) pm; Z = 16) enthaelt parallel (100) verlaufende, stark gewellte Oxoborat-Schichten {sub {infinity}}{sup 2}{l_brace}(BO{sub 2}){sup -}{r_brace} aus

  6. 161 | Page

    African Journals Online (AJOL)

    Fr. Ikenga

    A treaty is basically an agreement between parties on the international scene. Although treaties may be concluded, or made between States and international organizations, they are primarily concerned with relations between States.13In this wise, the 1969 Vienna Convention on the Law of Treaties defines a. 'Treaty' as: ...

  7. 161 | Page

    African Journals Online (AJOL)

    Fr. Ikenga

    49 JA Cohen 'The Personal Security of Businessmen and Trade Representatives' in VH Li Law and Politics in .... was not immune from prosecution by Spanish courts for the crimes of torture ..... Unofficial translation by Human Rights Watch.

  8. Expression of Lectin-Like Transcript 1, the Ligand for CD161, in Rheumatoid Arthritis.

    Directory of Open Access Journals (Sweden)

    Paulina Chalan

    Full Text Available Precursor Th17 lineage cells expressing CD161 are implicated in Rheumatoid Arthritis (RA pathogenesis. CD4+CD161+ T-cells accumulate in RA joints and may acquire a non classical Th1 phenotype. The endogenous ligand for CD161 is lectin-like transcript 1 (LLT1. CD161/LLT1 ligation may co-stimulate T-cell IFN-γ production. We investigated the presence and identity of LLT1-expressing cells in RA synovial fluid (SF and synovial tissue (ST. We also assessed levels of soluble LLT1 (sLLT1 in different phases of RA development.Paired samples of peripheral blood mononuclear cells (MC and SFMC (n = 14, digested ST cells (n = 4 and ST paraffin sections (n = 6 from late-stage RA were analyzed for LLT1 expression by flow cytometry and immunohistochemistry. sLLT1 was measured using a sandwich ELISA. Sera and SF from late-stage RA (n = 26, recently diagnosed RA patients (n = 39, seropositive arthralgia patients (SAP, n = 31, spondyloarthropathy patients (SpA, n = 26 and healthy controls (HC, n = 31 were assayed.In RA SF, LLT1 was expressed by a small proportion of monocytes. In RA ST, LLT1-expressing cells were detected in the lining, sublining layer and in areas with infiltrates. The LLT1 staining pattern overlapped with the CD68 staining pattern. FACS analysis of digested ST confirmed LLT1 expression by CD68+ cells. Elevated systemic sLLT1 was found in all patient groups.In RA joints, LLT1 is expressed by cells of the monocyte/macrophage lineage. Serum levels of sLLT1 were increased in all patient groups (patients with early- and late-stage RA, seropositive arthralgia and spondyloarthropathy when compared to healthy subjects.

  9. Yeast Interacting Proteins Database: YGL161C, YGL198W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available YGL161C YIP5 Protein that interacts with Rab GTPases, localized to late Golgi vesicles; computational...that interacts with Rab GTPases, localized to late Golgi vesicles; computational ...eracts with Rab GTPases, localized to late Golgi vesicles; computational analysis of large-scale protein-pro...ized to late Golgi vesicles; computational analysis of large-scale protein-protein interaction data suggests

  10. Chemical stratification in the Orion Bar : JCMT spectral legacy survey observations (vol 498, pg 161, 2009)

    NARCIS (Netherlands)

    van der Wiel, M. H. D.; van der Tak, F. F. S.; Ossenkopf, V.; Spaans, M.; Roberts, H.; Fuller, G. A.; Plume, R.

    The integrated line intensities in Table 1 of Van der Wiel et al. (2009, A&A 498, 161) should be modified due to an error in the adopted channel widths: values are reduced by similar to 20% for C2H, H2CO and SO, reduced by a factor similar to 5 for (CO)-O-18 and HCN, and increased by similar to 40%

  11. Foot strike pattern and gait changes during a 161-km ultramarathon. (United States)

    Kasmer, Mark E; Wren, Jeremy J; Hoffman, Martin D


    Foot strike pattern has not been examined during ultramarathons where fatigue or avoidance of impact might have greater effect on foot strike and other gait parameters than in shorter events. In this study, video analysis from 3 level sites at a 161-km ultramarathon was used to: (a) examine changes in foot strike pattern, stride rate, and stride length; (b) determine if foot strike pattern is related to performance; and (c) ascertain if post-race blood creatine phosphokinase (CK) concentrations differ by foot strike pattern. Rear-foot strike (RFS) prevalence was 79.9, 89.0, and 83.9% at 16.5, 90.3, and 161.1 km, respectively. There was a significant distance effect observed between the 90.3 and 161.1-km site for stride rate (p foot strike pattern on performance. However, top 20 finishers had greater use (p = 0.02) of a non-RFS pattern at 161.1 km than the remaining finishers. There was a trend toward greater post-race blood CK values among non-RFS runners compared with RFS runners, reaching significance at the 90.3 km site (p race midpoint was likely because of greater muscular demands of non-RFS patterns as supported by the higher post-race blood CK concentrations among non-RFS runners. Faster runners maintained higher stride rates and lengths throughout the race and made greater use of a non-RFS pattern at the end of the race compared with the slower finishers.

  12. An integrated logic system for time-resolved fluorescent "turn-on" detection of cysteine and histidine base on terbium (III) coordination polymer-copper (II) ensemble. (United States)

    Xue, Shi-Fan; Lu, Ling-Fei; Wang, Qi-Xian; Zhang, Shengqiang; Zhang, Min; Shi, Guoyue


    Cysteine (Cys) and histidine (His) both play indispensable roles in many important biological activities. An enhanced Cys level can result in Alzheimer's and cardiovascular diseases. Likewise, His plays a significant role in the growth and repair of tissues as well as in controlling the transmission of metal elements in biological bases. Therefore, it is meaningful to detect Cys and His simultaneously. In this work, a novel terbium (III) coordination polymer-Cu (II) ensemble (Tb(3+)/GMP-Cu(2+)) was proposed. Guanosine monophosphate (GMP) can self-assemble with Tb(3+) to form a supramolecular Tb(3+) coordination polymer (Tb(3+)/GMP), which can be suited as a time-resolved probe. The fluorescence of Tb(3+)/GMP would be quenched upon the addition of Cu(2+), and then the fluorescence of the as-prepared Tb(3+)/GMP-Cu(2+) ensemble would be restored again in the presence of Cys or His. By incorporating N-Ethylmaleimide and Ni(2+) as masking agents, Tb(3+)/GMP-Cu(2+) was further exploited as an integrated logic system and a specific time-resolved fluorescent "turn-on" assay for simultaneously sensing His and Cys was designed. Meanwhile it can also be used in plasma samples, showing great potential to meet the need of practical application. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Synthesis and photoluminescence properties of cerium-doped terbium-yttrium aluminum garnet phosphor for white light-emitting diodes applications (United States)

    Wang, Jun; Han, Tao; Lang, Tianchun; Tu, Mingjing; Peng, Lingling


    Cerium-doped terbium-yttrium aluminum garnet phosphors were synthesized using the solid-state reaction method. The crystalline phase, morphology, and photoluminescence properties were characterized by x-ray diffraction (XRD), scanning electron microscope (SEM), and fluorescence spectrophotometer, respectively. The XRD results indicate that with an increase of the amount of x (Tb3+), all of the samples have a pure garnet crystal structure without secondary phases. The SEM images reveal that the samples are composed of sphere-like crystallites, which exhibit different degrees of agglomeration. The luminescent properties of Ce ions in )Al5O12∶Ce0.1 have been studied, and it was found that the emission band shifted toward a longer wavelength. The redshift is attributed to the lowering of the 5d energy level centroid of Ce, which can be explained by the nephelauxetic effect and compression effect. These phosphors were coated on blue light-emitting diode (LED) chips to fabricate white light-emitting diodes (WLEDs), and their color-rendering indices, color temperatures, and luminous efficiencies were measured. As a consequence of the addition of Tb, the blue LED pumped )Al5O12∶Ce0.1 phosphors WLEDs showed good optical properties.

  14. Study on the fluorescent enhancement effect in terbium-gadolinium-protein-sodium dodecyl benzene sulfonate system and its application on sensitive detection of protein at nanogram level. (United States)

    Sun, Changxia; Yang, Jinghe; Wu, Xia; Liu, Shufang; Su, Benyu


    The co-luminescence effect in a terbium-gadolinium-protein-sodium dodecyl benzene sulfonate (SDBS) system is reported here. Based on it, the sensitive quantitative analysis of protein at nanogram levels is established. The co-luminescence mechanism is studied using fluorescence, resonance light scattering (RLS), absorption spectroscopy and NMR measurement. It is considered that protein could be unfolded by SDBS, then a efficacious intramolecular fluorescent energy transfer occurs from unfolded protein to rare earth ions through SDBS acting as a "transfer bridge" to enhance the emission fluorescence of Tb3+ in this ternary complex of Tb-SDBS-BSA, where energy transfer from protein to SDBS by aromatic ring stacking is the most important step. Cooperating with the intramolecular energy transfer above is the intermolecular energy transfer between the simultaneous existing complexes of both Tb3+ and Gd3+. The fluorescence quantum yield is increased by an energy-insulating sheath, which is considered to be another reason for the resulting enhancement of the fluorescence. Förster theory is used to calculate the distribution of enhancing factors and has led to a greater understanding of the mechanisms of energy transfer.

  15. [Studies on luminescence properties of seven ternary complexes of terbium with 1,10-phenanthroline and benzoic acid and its derivatives]. (United States)

    Gao, Zhi-hua; Wang, Shu-ping; Liu, Cui-ge; Ma, Rui-xia; Wang, Rui-fen


    Seven ternary complexes of Tb(III) were synthesized with benzoic acid (BA), o-, m-, p-methylbenzoic acid (o-MBA, m-MBA, p-MBA), and o-, m-, p-methoxybenzoic acid (o-MOBA, m-MOBA, p-MOBA) as the first ligand, and 1,10-phenanthroline (phen) as the second ligand. The content of C, H and N were measured by using a Flash-EA model 1112 elemental analyzer. Excitation and luminescence spectra of the title solid complexes were recorded by using a Hitachi F-4500 fluorescence spectrophotometer at room temperature. The effects of different varieties and different positions of replacing benzoic acid as the first ligand on fluorescence properties of the ternary complexes of terbium were discussed. The results indicated that the intensity of 5D4-->7F6 (489 nm) and 5D4-->7F5 (545 nm) of substituting benzoic acid complexes was stronger than benzoic acid. Three ternary complexes of Tb(III) with o-, m-, p-methylbenzoic acid showed emission intensity in the consecution: Tb(o-MBA)3 phenMOBA)3phen x H2O>Tb(m-MOBA)3phen x H2O>Tb(p-MOBA)3 phen.

  16. Investigation of production routes for the 161Ho Auger-electron emitting radiolanthanide, a candidate for therapy


    Tárkányi, F.; Ditrói, F.; Hermanne, A.; Takács, S.; Ignatyuk, A. V.


    The radiolanthanide 161Ho (2.48 h) is a promising Auger-electron emitter for internal radiotherapy that can be produced with particle accelerators. The excitation functions of the natDy(p,xn)161Ho and natDy(d,x)161Ho reactions were measured up to 40 and 50 MeV respectively by using the stacked foil activation method and gamma-ray spectrometry. The experimental data were compared with results of the TALYS code available in the TENDL 2011 library [1]. The main parameters of different production...

  17. The low-energy {beta}{sup -} and electron emitter {sup 161}Tb as an alternative to {sup 177}Lu for targeted radionuclide therapy

    Energy Technology Data Exchange (ETDEWEB)

    Lehenberger, Silvia; Barkhausen, Christoph [Institute for Radiochemistry, Technical University of Munich, Walther-Meissner-Strasse 3, 85748 Garching (Germany); Cohrs, Susan; Fischer, Eliane; Gruenberg, Juergen; Hohn, Alexander [Center for Radiopharmaceutical Sciences, Paul Scherrer Institute, 5232 Villigen, PSI (Switzerland); Koester, Ulli [Institut Laue-Langevin, 6 rue Jules Horowitz, 38042 Grenoble (France); Schibli, Roger [Center for Radiopharmaceutical Sciences, Paul Scherrer Institute, 5232 Villigen, PSI (Switzerland); Tuerler, Andreas [Institute for Radiochemistry, Technical University of Munich, Walther-Meissner-Strasse 3, 85748 Garching (Germany); Laboratory of Radiochemistry and Environmental Chemistry, Paul Scherrer Institute, 5232 Villigen, PSI (Switzerland); Laboratory of Radiochemistry and Environmental Chemistry, Department of Chemistry and Biochemistry, University of Bern, Freiestr. 3, 3012 Bern (Switzerland); Zhernosekov, Konstantin, E-mail: [Institute for Radiochemistry, Technical University of Munich, Walther-Meissner-Strasse 3, 85748 Garching (Germany); Center for Radiopharmaceutical Sciences, Paul Scherrer Institute, 5232 Villigen, PSI (Switzerland); Laboratory of Radiochemistry and Environmental Chemistry, Paul Scherrer Institute, 5232 Villigen, PSI (Switzerland)


    Introduction: The low-energy {beta}{sup -} emitter {sup 161}Tb is very similar to {sup 177}Lu with respect to half-life, beta energy and chemical properties. However, {sup 161}Tb also emits a significant amount of conversion and Auger electrons. Greater therapeutic effect can therefore be expected in comparison to {sup 177}Lu. It also emits low-energy photons that are useful for gamma camera imaging. Methods: The {sup 160}Gd(n,{gamma}){sup 161}Gd{yields}{sup 161}Tb production route was used to produce {sup 161}Tb by neutron irradiation of massive {sup 160}Gd targets (up to 40 mg) in nuclear reactors. A semiautomated procedure based on cation exchange chromatography was developed and applied to isolate no carrier added (n.c.a.) {sup 161}Tb from the bulk of the {sup 160}Gd target and from its stable decay product {sup 161}Dy. {sup 161}Tb was used for radiolabeling DOTA-Tyr3-octreotate; the radiolabeling profile was compared to the commercially available n.c.a. {sup 177}Lu. A {sup 161}Tb Derenzo phantom was imaged using a small-animal single-photon emission computed tomography camera. Results: Up to 15 GBq of {sup 161}Tb was produced by long-term irradiation of Gd targets. Using a cation exchange resin, we obtained 80%-90% of the available {sup 161}Tb with high specific activity, radionuclide and chemical purity and in quantities sufficient for therapeutic applications. The {sup 161}Tb obtained was of the quality required to prepare {sup 161}Tb-DOTA-Tyr3-octreotate. Conclusions: We were able to produce {sup 161}Tb in n.c.a. form by irradiating highly enriched {sup 160}Gd targets; it can be obtained in the quantity and quality required for the preparation of {sup 161}Tb-labeled therapeutic agents.

  18. A 16:1 Serializer ASIC for Data Transmission at 5 Gbps

    CERN Document Server

    Gong, D; The ATLAS collaboration


    A high speed, low power 16:1 serializer is developed using a commercial 0.25 μm silicon-on-sapphire CMOS technology. It operates from 4.0 to 5.8 Gbps in the lab test. Its total jitter is measured to be 62 ps and the bathtub scan demonstrates a 122 ps opening at BER of less than 10-12 level at 5 Gbps. The measured power consumption is 507 mW at this data rate. A proton test of this chip is scheduled in June and test results will be discussed when available.

  19. A 16:1 Serializer ASIC for Data Transmission at 5 Gbps

    CERN Document Server

    Gong, D; The ATLAS collaboration


    A high speed, low power 16:1 serializer has been developed with a commercial 0.25 μm silicon-on-sapphire CMOS technology. The serializer operates from 4.0 to 5.7 Gbps. Total jitter is 62 ps and the eye openning of the bathtub curve is 122 ps at bit rate error of 10-12 at 5 Gbps. Power consumption is 463 mW at 5 Gbps. A proton beam test indicates the serializer is suitable for applications in high energy physics experiments.

  20. Development of A 16:1 serializer for data transmission at 5 Gbps

    CERN Document Server

    Gong, Datao; Liang, Zhihua; Liu, Chonghan; Liu, Tiankuan; Da-Shun Su,; Teng, Ping-Kun; Xiang, Annie C; Ye, Jingbo


    Radiation tolerant, high speed and low power serializer ASIC is critical for optical link systems in particle physics experiments. Based on a commercial 0.25 μm silicon-onsapphire CMOS technology, we design a 16:1 serializer with 5 Gbps serial data rate. This ASIC has been submitted for fabrication. The post-layout simulation indicates the deterministic jitter is 54 ps (pk-pk) and random jitter is 3 ps (rms). The power consumption of the serializer is 500 mW. The design details and post layout simulation results are presented in this paper.

  1. Corneal Opacity in a Participant of a 161-km Mountain Bike Race at High Altitude. (United States)

    Khodaee, Morteza; Torres, David R


    Visual dysfunction is a relatively uncommon complaint among athletes during ultraendurance races. The pathophysiology of most of these cases is unknown. Corneal opacity has been speculated as the etiology for most of reported cases. We are presenting a case of a 56-year-old man with a partial unilateral corneal opacity and edema at kilometer 150 of a 161-km mountain bike race in high altitude. He was not able to finish the race (12-hour cutoff) because of his visual symptoms. He completely recovered in 3 days with no sequelae. Copyright © 2016 Wilderness Medical Society. Published by Elsevier Inc. All rights reserved.

  2. Self-diffusion coefficients of the trivalent f-element ion series in dilute and moderately dilute aqueous solutions: A comparative study between europium, gadolinium, terbium and berkelium (United States)

    Rafik, Besbes; Noureddine, Ouerfelli; Abderabbou, Abdelmanef; Habib, Latrous


    We have continued the studies on the trivalent ions of the 4f and 5f elements. In this paper, we compare the transport properties (self-diffusion coefficient) of the trivalent aquo ions over two ranges of concentrations (0 — 2×10-3M) and (2×10-3 — 1.5M). Self-diffusion coefficients, D, of the trivalent f-element aquo ion series have been determined in aqueous background electrolytes of Gd(NO3)3 and Nd(ClO4)3, at pH=2.5 (HNO3, HClO4) and at 25°C using the open-end capillary method (O.E.C.M.). This method measures the transportation time of ions across a fixed distance. In this paper, we complete a measurement of self-diffusion coefficient for terbium. We optimized the pH to avoid hydrolysis, ion-pairing and complexation of the trivalent 4f and 5f ions. The variation of D versus √C is not linear for dilute solutions (0 — 2×10-3M) and quasi-linear in moderate concentrations (C<=1.5 M). Similar behavior was observed for Tb, as compared with those for Bk, Eu and Gd. We complete the comparison variation of D/D° versus √C for all studied 4f and 5f elements from concentration 0 to 1.5M and we obtained the same variation with √C for all studied elements. All 4f and 5f elements studied follow the Nernst-Hartley expression.

  3. Terbium-based time-gated Förster resonance energy transfer imaging for evaluating protein-protein interactions on cell membranes. (United States)

    Lindén, Stina; Singh, Manish Kumar; Wegner, K David; Regairaz, Marie; Dautry, François; Treussart, François; Hildebrandt, Niko


    Fluorescence imaging of cells and subcellular compartments is an essential tool to investigate biological processes and to evaluate the development and progression of diseases. In particular, protein-protein interactions can be monitored by Förster resonance energy transfer (FRET) between two proximal fluorophores that are attached to specific recognition biomolecules such as antibodies. We investigated the membrane expression of E- and N-cadherins in three different cell lines used as model systems to study epithelial to mesenchymal transition (EMT) and a possible detection of circulating tumour cells (CTCs). EMT is a key process in cancer metastasis, during which epithelial markers (such as E-cadherin) are down-regulated in the primary tumour whereas mesenchymal markers (such as N-cadherin) are up-regulated, leading to enhanced cell motility, intravasation, and appearance of CTCs. Various FRET donor-acceptor pairs and protein recognition strategies were utilized, in which Lumi4-Tb terbium complexes (Tb) and different organic dyes were conjugated to several distinct E- and N-cadherin-specific antibodies. Pulsed excitation of Tb at low repetition rates (100 Hz) and time-gated (TG) imaging of both the Tb-donor and the dye-acceptor photoluminescence (PL) allowed efficient detection of the EMT markers as well as FRET in the case of sufficient donor-acceptor proximity. Efficient FRET was observed only between two E-cadherin-specific antibodies and further experiments indicated that these antibodies recognized the same E-cadherin molecule, suggesting a limited accessibility of cadherins when they are clustered at adherens junctions. The investigated Tb-to-dye FRET systems provided reduced photobleaching compared to the AlexaFluor 488-568 donor-acceptor pair. Our results demonstrate the applicability and advantages of Tb-based TG FRET for efficient and stable imaging of antibody-antibody interactions on different cell lines. They also reveal the limitations of

  4. A broad G protein-coupled receptor internalization assay that combines SNAP-tag labeling, diffusion-enhanced resonance energy transfer, and a highly emissive terbium cryptate acceptor

    Directory of Open Access Journals (Sweden)

    Angélique eLEVOYE


    Full Text Available Although G protein-coupled receptor (GPCR internalization has long been considered a major aspect of the desensitization process that tunes ligand responsiveness, internalization is also involved in receptor resensitization and signaling, as well as the ligand scavenging function of some atypical receptors. Internalization thus contributes to the diversity of GPCR-dependent signaling, and its dynamics and quantification in living cells has generated considerable interest. We developed a robust and sensitive assay to follow and quantify ligand-induced and constitutive GPCR internalization but also receptor recycling in living cells. This assay is based on diffusion-enhanced resonance energy transfer (DERET between cell surface GPCRs labeled with a luminescent terbium cryptate donor and a fluorescein acceptor present in the culture medium. GPCR internalization results in a quantifiable reduction of energy transfer. This method yields a high signal-to-noise ratio due to time-resolved measurements. For various GPCRs belonging to different classes, we demonstrated that constitutive and ligand-induced internalization could be monitored as a function of time and ligand concentration, thus allowing accurate quantitative determination of kinetics of receptor internalization but also half-maximal effective or inhibitory concentrations of compounds. In addition to its selectivity and sensitivity, we provided evidence that DERET-based internalization assay is particularly suitable for characterizing biased ligands. Furthermore, the determination of a Z’-factor value of 0.45 indicates the quality and suitability of DERET-based internalization assay for high-throughput screening (HTS of compounds that may modulate GPCRs internalization.

  5. Enhanced Th1/Th17 Functions of CD161+ CD8+ T Cells in Mucosal Tissues of Rhesus Macaques.

    Directory of Open Access Journals (Sweden)

    Namita Rout

    Full Text Available Expression of the C-type lectin-like receptor CD161 by human T cells is associated with type-17 responses, which play critical regulatory roles in immunity and inflammation at mucosal sites. However, the functions of CD161-expressing T cells in macaques, the pre-clinical model of several human diseases, remain unknown. This study examined the phenotypic and functional characteristics of CD161+ T cells in peripheral blood, mucosal tissues and lymph nodes of rhesus macaques. Majority of CD161-expressing T cells in peripheral blood and lung/intestinal mucosal tissues of rhesus macaques were found to be CD8+CD4- in phenotype. There was a significant enrichment of CD161+CD8+ T cells in the lungs and colonic mucosa (16.1%±6.6 and 16.8%±5.7 in comparison to peripheral blood (4.2%±1.2 and mesenteric lymph nodes (1.3%±0.8. Regardless of the tissue compartment, CD161+CD8+ T cells mainly comprised of γδ T cells and TCR Vα7.2+ MAIT cells (up to 80%, and displayed Th1 and Th17 cytokine responses to mitogen stimulation. Mucosal CD161+CD8+ T cells were characterized by very high expression of CD69, a recent activation marker that is preferentially expressed on tissue resident cells. Furthermore, lung and colonic mucosal CD161+CD8+ T cells showed enhanced IFN-γ, IL-17, and Perforin production in comparison to those in blood. Thus, macaque CD161+CD8+ T cells represent mucosal tissue-homing innate-like CD8+ T-cell populations with Th1/Th17 type cytokine and cytotoxic effector functions that can potentially enhance the recruitment of adaptive immune cells and control initial pathogen burden/dissemination in tissues. Analysis of their role in early immune responses to mucosal pathogens will be valuable in the design of vaccines and therapeutics.

  6. Crystal structure of an eight-coordinate terbium(III ion chelated by N,N′-bis(2-hydroxybenzyl-N,N′-bis(pyridin-2-ylmethylethylenediamine (bbpen2− and nitrate

    Directory of Open Access Journals (Sweden)

    Thaiane Gregório


    Full Text Available The reaction of terbium(III nitrate pentahydrate in acetonitrile with N,N′-bis(2-hydroxybenzyl-N,N′-bis(pyridin-2-ylmethylethylenediamine (H2bbpen, previously deprotonated with triethylamine, produced the mononuclear compound [N,N′-bis(2-oxidobenzyl-κO-N,N′-bis(pyridin-2-ylmethyl-κNethylenediamine-κ2N,N′](nitrato-κ2O,O′terbium(III, [Tb(C28H28N4O2(NO3]. The molecule lies on a twofold rotation axis and the TbIII ion is eight-coordinate with a slightly distorted dodecahedral coordination geometry. In the symmetry-unique part of the molecule, the pyridine and benzene rings are both essentially planar and form a dihedral angle of 61.42 (7°. In the molecular structure, the N4O4 coordination environment is defined by the hexadentate bbpen ligand and the bidentate nitrate anion. In the crystal, a weak C—H...O hydrogen bond links molecules into a two-dimensional network parallel to (001.

  7. β-decay spectroscopy of neutron-rich 160,161,162Sm isotopes

    Directory of Open Access Journals (Sweden)

    Patel Z.


    Full Text Available Neutron-rich 160,161,162Sm isotopes have been populated at the RIBF, RIKEN via β first time. β-coincident γ rays were observed in all three isotopes including γ rays from the isomeric decay of 160Sm and 162Sm. The isomers in 160Sm and 162Sm have previously been observed but have been populated via β decay for the first time. The isomeric state in 162Sm is assigned a 4−v72+[ 633 ]⊗v12−[ 521 ]${4^ - }v{{7 \\over 2}^ + }\\left[ {633} \\right] \\otimes v{{1 \\over 2}^ - }\\left[ {521} \\right]$ configuration based on the decay pattern. The level schemes of 160Sm and 162Sm are presented. The ground states in the parent nuclei 160Pm and 162Pm are both assigned a 6−v72+[633]⊗π52−[532]${6^ - }v{{7 \\over 2}^ + }\\left[ {633} \\right] \\otimes \\pi {{5 \\over 2}^ - }\\left[ {532} \\right]$ configuration based on the population of states in the daughter nuclei. Blocked BCS calculations were performed to further investigate the spin-parities of the ground states in 160Pm, 161Pm, and 162Pm, and the isomeric state in 162Sm

  8. Innate signals overcome acquired TCR signaling pathway regulation and govern the fate of human CD161(hi) CD8α⁺ semi-invariant T cells. (United States)

    Turtle, Cameron J; Delrow, Jeff; Joslyn, Rochelle C; Swanson, Hillary M; Basom, Ryan; Tabellini, Laura; Delaney, Colleen; Heimfeld, Shelly; Hansen, John A; Riddell, Stanley R


    Type 17 programmed CD161(hi)CD8α(+) T cells contribute to mucosal immunity to bacteria and yeast. In early life, microbial colonization induces proliferation of CD161(hi) cells that is dependent on their expression of a semi-invariant Vα7.2(+) TCR. Although prevalent in adults, CD161(hi)CD8α(+) cells exhibit weak proliferative and cytokine responses to TCR ligation. The mechanisms responsible for the dichotomous response of neonatal and adult CD161(hi) cells, and the signals that enable their effector function, have not been established. We describe acquired regulation of TCR signaling in adult memory CD161(hi)CD8α(+) T cells that is absent in cord CD161(hi) cells and adult CD161(lo) cells. Regulated TCR signaling in CD161(hi) cells was due to profound alterations in TCR signaling pathway gene expression and could be overcome by costimulation through CD28 or innate cytokine receptors, which dictated the fate of their progeny. Costimulation with IL-1β during TCR ligation markedly increased proinflammatory IL-17 production, while IL-12-induced Tc1-like function and restored the response to TCR ligation without costimulation. CD161(hi) cells from umbilical cord blood and granulocyte colony stimulating factor-mobilized leukaphereses differed in frequency and function, suggesting future evaluation of the contribution of CD161(hi) cells in hematopoietic stem cell grafts to transplant outcomes is warranted.

  9. Entropy in hot $^{161,162}Dy$ and $^{171,172}Yb$ nuclei

    CERN Document Server

    Guttormsen, M; Hjorth-Jensen, M; Melby, E; Rekstad, J; Schiller, A; Siem, S; Belic, A


    The density of accessible levels at low spin in the (^3He,\\alpha \\gamma) reaction has been extracted for the ^{161,162}Dy and ^{171,172}Yb nuclei. The entropy of the even-odd and even-even nuclei has been deduced as a function of excitation energy, and found to reach a maximum of 15 k_B before neutron evaporation. The entropy of one quasi-particle outside an even-even core is found to be 1.70(15) k_B. This quasi-particle picture of hot nuclei is well accounted for within a simple pairing model. The onset of two, four and six quasi-particle excitations in the ^{162}Dy and ^{172}Yb nuclei is discussed and compared to theory. The number of quasi-particles excited per excitation energy is a measure for the ratio of the level energy spacing and the pairing strength.

  10. Cross-section measurement of some deuteron induced reactions on $^{160}$Gd for possible production of the therapeutic radionuclide $^{161}$Tb


    Tárkányi, F.; Hermanne, A.; Takács, S.; Ditrói, F.; Csikai, J.; Ignatyuk, A. V.


    The radionuclide 161Tb (T1/2=6.89 d) is potentially important for internal radiotherapy. It is generally produced through the 160Gd(n,{\\gamma})161Gd - 161Tb route at research reactors. In this work the possibility of its production at a cyclotron was investigated. Determination of the excitation function of the 160Gd(d,x)161Tb production route and that of the disturbing 160Gd(d,2n)160Tb side reaction was done over the deuteron energy range up to 50 MeV using the stacked-foil technique and hig...

  11. Differential Effect of Cytomegalovirus Infection with Age on the Expression of CD57, CD300a, and CD161 on T-Cell Subpopulations

    Directory of Open Access Journals (Sweden)

    Fakhri Hassouneh


    Full Text Available Immunosenescence is a progressive deterioration of the immune system with aging. It affects both innate and adaptive immunity limiting the response to pathogens and to vaccines. As chronic cytomegalovirus (CMV infection is probably one of the major driving forces of immunosenescence, and its persistent infection results in functional and phenotypic changes to the T-cell repertoire, the aim of this study was to analyze the effect of CMV-seropositivity and aging on the expression of CD300a and CD161 inhibitory receptors, along with the expression of CD57 marker on CD4+, CD8+, CD8+CD56+ (NKT-Like and CD4−CD8− (DN T-cell subsets. Our results showed that, regardless of the T-cell subset, CD57−CD161−CD300a+ T-cells expand with age in CMV-seropositive individuals, whereas CD57−CD161+CD300a+ T-cells decrease. Similarly, CD57+CD161−CD300a+ T-cells expand with age in CMV-seropositive individuals in all subsets except in DN cells and CD57−CD161+CD300a− T-cells decrease in all T-cell subsets except in CD4+ T-cells. Besides, in young individuals, CMV latent infection associates with the expansion of CD57+CD161−CD300a+CD4+, CD57−CD161−CD300a+CD4+, CD57+CD161−CD300a+CD8+, CD57−CD161−CD300a+CD8+, CD57+CD161−CD300a+NKT-like, and CD57+CD161−CD300a+DN T-cells. Moreover, in young individuals, CD161 expression on T-cells is not affected by CMV infection. Changes of CD161 expression were only associated with age in the context of CMV latent infection. Besides, CD300a+CD57+CD161+ and CD300a−CD57+CD161+ phenotypes were not found in any of the T-cell subsets studied except in the DN subpopulation, indicating that in the majority of T-cells, CD161 and CD57 do not co-express. Thus, our results show that CMV latent infection impact on the immune system depends on the age of the individual, highlighting the importance of including CMV serology in any study regarding immunosenescence.

  12. IAC 25 (Pedrinhas e IAC 161 (Taiamã: novos cultivares de trigo IAC 25 (Pedrinhas and IAC 161 (Taiamã: new wheat cultivars

    Directory of Open Access Journals (Sweden)

    João Carlos Felíco


    Full Text Available Avaliaram-se os cultivares de trigo IAC 25 (Pedrinhas e IAC 161 (Taiamã, provenientes de cruzamentos artificiais e obtidos por seleção pelo método genealógico, quanto à produtividade de grãos e às reações aos agentes causais da ferrugem-do-colmo e da-folha e da helmintosporiose no Vale do Paranapanema (SP, em condições de sequeiro, e na região Norte (SP, com irrigação por aspersão. Avaliaram-nos também em relação às qualidades industriais de panificação. Em condições de sequeiro, as produções médias de grãos dos novos cultivares não se apresentaram estatisticamente diferentes das da testemunha 'Anahuac', porém 'Pedrinhas' confirmou como grande vantagem o ciclo precoce (100-115 dias. Para as áreas com irrigação por aspersão, em solos com elevada acidez (porcentagem de saturação por bases inferior a 60% 'Pedrinhas' e Taiamã' exibiram melhor produção de grãos em relação ao 'Anahuac'. Para solos com baixa acidez, não houve diferença estatística entre os três cultivares. O 'Pedrinhas' e o 'Taiamã' apresentaram moderada tolerância ao Al3+, quando testados em soluções nutritivas contendo esse elemento; 'Taiamã' demonstrou alta suscetibilidade à toxicidade de ferro e, 'Pedrinhas', moderada tolerância, enquanto para o manganês ambos exibiram tolerância. O 'Taiamã' mostrou resistência à ferrugem-do-colmo e, o 'Pedrinhas', moderada resistência, em testes em casa de vegetação. O 'Pedrinhas' revelou-se mais suscetível à ferrugem-da-folha que o 'Taiamã' e o 'Anahuac' em condições de campo, enquanto, para a helmintosporiose, os três apresentaram-se suscetíveis. Nos ensaios de panificação, a farinha do 'Taiamã' foi superior à do 'Pedrinhas', proporcionando pães de excelente qualidade física, com volume específico bastante superior à farinha de trigo comercial.The wheat cultivars IAC 25 (Pedrinhas and IAC 161 (Taiamã originated from artificial crosses and selected by the pedigree method

  13. 77 FR 28406 - 161st Meeting of the Advisory Council on Employee Welfare and Pension Benefit Plans; Notice of... (United States)


    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF LABOR Employee Benefits Security Administration 161st Meeting of the Advisory Council on Employee Welfare and Pension... Council on Employee Welfare and Pension Benefit Plans (also known as the ERISA Advisory Council) will be...

  14. CNV-association meta-analysis in 191,161 European adults reveals new loci associated with anthropometric traits

    DEFF Research Database (Denmark)

    Macé, Aurélien; Tuke, Marcus A; Deelen, Patrick


    There are few examples of robust associations between rare copy number variants (CNVs) and complex continuous human traits. Here we present a large-scale CNV association meta-analysis on anthropometric traits in up to 191,161 adult samples from 26 cohorts. The study reveals five CNV associations ...

  15. CNV-association meta-analysis in 191,161 European adults reveals new loci associated with anthropometric traits

    NARCIS (Netherlands)

    Macé, Aurélien; Tuke, Marcus A; Deelen, Patrick; Kristiansson, Kati; Mattsson, Hannele; Nõukas, Margit; Sapkota, Yadav; Schick, Ursula; Porcu, Eleonora; Rüeger, Sina; McDaid, Aaron F; Porteous, David; Winkler, Thomas W; Salvi, Erika; Shrine, Nick; Liu, Xueping; Ang, Wei Q; Zhang, Weihua; Feitosa, Mary F; Venturini, Cristina; van der Most, Peter J; Rosengren, Anders; Wood, Andrew R; Beaumont, Robin N; Jones, Samuel E; Ruth, Katherine S; Yaghootkar, Hanieh; Tyrrell, Jessica; Havulinna, Aki S; Boers, Harmen; Mägi, Reedik; Kriebel, Jennifer; Müller-Nurasyid, Martina; Perola, Markus; Nieminen, Markku; Lokki, Marja-Liisa; Kähönen, Mika; Viikari, Jorma S; Geller, Frank; Lahti, Jari; Palotie, Aarno; Koponen, Päivikki; Lundqvist, Annamari; Rissanen, Harri; Bottinger, Erwin P; Afaq, Saima; Wojczynski, Mary K; Lenzini, Petra; Nolte, Ilja M; Sparsø, Thomas; Schupf, Nicole; Christensen, Kaare; Perls, Thomas T; Newman, Anne B; Werge, Thomas; Snieder, Harold; Spector, Timothy D; Chambers, John C; Koskinen, Seppo; Melbye, Mads; Raitakari, Olli T; Lehtimäki, Terho; Tobin, Martin D; Wain, Louise V; Sinisalo, Juha; Peters, Annette; Meitinger, Thomas; Martin, Nicholas G; Wray, Naomi R; Montgomery, Grant W; Medland, Sarah E; Swertz, Morris A; Vartiainen, Erkki; Borodulin, Katja; Männistö, Satu; Murray, Anna; Bochud, Murielle; Jacquemont, Sébastien; Rivadeneira, Fernando; Hansen, Thomas F; Oldehinkel, Albertine J; Mangino, Massimo; Province, Michael A; Deloukas, Panos; Kooner, Jaspal S; Freathy, Rachel M; Pennell, Craig; Feenstra, Bjarke; Strachan, David P; Lettre, Guillaume; Hirschhorn, Joel; Cusi, Daniele; Heid, Iris M; Hayward, Caroline; Männik, Katrin; Beckmann, Jacques S; Loos, Ruth J F; Nyholt, Dale R; Metspalu, Andres; Eriksson, Johan G; Weedon, Michael N; Salomaa, Veikko; Franke, Lude; Reymond, Alexandre; Frayling, Timothy M; Kutalik, Zoltán


    There are few examples of robust associations between rare copy number variants (CNVs) and complex continuous human traits. Here we present a large-scale CNV association meta-analysis on anthropometric traits in up to 191,161 adult samples from 26 cohorts. The study reveals five CNV associations at

  16. Role of cysteine at positions 67, 161 and 241 of a Bacillus sphaericus binary toxin BinB. (United States)

    Boonyos, Patcharaporn; Soonsanga, Sumarin; Boonserm, Panadda; Promdonkoy, Boonhiang


    Binary toxin consisting of BinA and BinB from Bacillus sphaericus is toxic to mosquito larvae. BinB is responsible for specific binding to the larval gut cell membrane while BinA is crucial for toxicity. To investigate functional role of cysteine in BinB, three cysteine residues at positions 67, 161, and 241 were replaced by alanine or serine. Mutations at these positions did not affect protein production and overall structure of BinB. These cysteine residues are not involved in disulfide bond formation between BinB molecules. Mosquito-larvicidal assays revealed that C67 and C161 are essential for toxicity, whereas C241 is not. Mutations at C67 and C161 resulted in weaker BinA-BinB interaction. The loss of toxicity may be due to the reduction of interactions between BinA and BinB or BinB and its receptor. C67 and C161 could also play a part during conformational changes or internalization of the binary toxin into the target cell. [BMB reports 2010; 43(1): 23-28].

  17. Kui naine tahab olla kangelane : kestvus-perfomance "Äng - 161 km palja rindkerega" / Fideelia-Signe Roots

    Index Scriptorium Estoniae

    Roots, Fideelia-Signe, 1976-


    Fideelia-Signe Roots oma aktsioonist tegevuskunstiürituse "Äng" raames, mille käigus kunstnik kõndis jalgsi alasti ülakehaga 161 kilomeetrit Tartust Karepale eesmärgiga testida naise kehakuvandi piire. Kangelase ja superkangelase mõistest

  18. Selective Sensing of Fe(3+) and Al(3+) Ions and Detection of 2,4,6-Trinitrophenol by a Water-Stable Terbium-Based Metal-Organic Framework. (United States)

    Cao, Li-Hui; Shi, Fang; Zhang, Wen-Min; Zang, Shuang-Quan; Mak, Thomas C W


    A water-stable luminescent terbium-based metal-organic framework (MOF), {[Tb(L1 )1.5 (H2 O)]⋅3 H2 O}n (Tb-MOF), with rod-shaped secondary building units (SBUs) and honeycomb-type tubular channels has been synthesized and structurally characterized by single-crystal X-ray diffraction. The high green emission intensity and the microporous nature of the Tb-MOF indicate that it can potentially be used as a luminescent sensor. In this work, we show that Tb-MOF can selectively sense Fe(3+) and Al(3+) ions from mixed metal ions in water through different detection mechanisms. In addition, it also exhibits high sensitivity for 2,4,6-trinitrophenol (TNP) in the presence of other nitro aromatic compounds in aqueous solution by luminescence quenching experiments. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Picomolar traces of americium(III) introduce drastic changes in the structural chemistry of terbium(III). A break in the ''gadolinium break''

    Energy Technology Data Exchange (ETDEWEB)

    Welch, Jan M. [TU Wien, Atominstitut, Vienna (Austria); Mueller, Danny; Knoll, Christian; Wilkovitsch, Martin; Weinberger, Peter [TU Wien, Institute of Applied Synthetic Chemistry, Vienna (Austria); Giester, Gerald [University of Vienna, Institute of Mineralogy and Crystallography, Vienna (Austria); Ofner, Johannes; Lendl, Bernhard [TU Wien, Institute of Chemical Technologies and Analytics, Vienna (Austria); Steinhauser, Georg [Leibniz Universitaet Hannover, Institute of Radioecology and Radiation Protection (Germany)


    The crystallization of terbium 5,5{sup '}-azobis[1H-tetrazol-1-ide] (ZT) in the presence of trace amounts (ca. 50 Bq, ca. 1.6 pmol) of americium results in 1) the accumulation of the americium tracer in the crystalline solid and 2) a material that adopts a different crystal structure to that formed in the absence of americium. Americium-doped [Tb(Am)(H{sub 2}O){sub 7}ZT]{sub 2} ZT.10 H{sub 2}O is isostructural to light lanthanide (Ce-Gd) 5,5{sup '}-azobis[1H-tetrazol-1-ide] compounds, rather than to the heavy lanthanide (Tb-Lu) 5,5{sup '}-azobis[1H-tetrazol-1-ide] (e.g., [Tb(H{sub 2}O){sub 8}]{sub 2}ZT{sub 3}.6 H{sub 2}O) derivatives. Traces of Am seem to force the Tb compound into a structure normally preferred by the lighter lanthanides, despite a 10{sup 8}-fold Tb excess. The americium-doped material was studied by single-crystal X-ray diffraction, vibrational spectroscopy, radiochemical neutron activation analysis, and scanning electron microscopy. In addition, the inclusion properties of terbium 5,5{sup '}-azobis[1H-tetrazol-1-ide] towards americium were quantified, and a model for the crystallization process is proposed. (copyright 2017 Wiley-VCH Verlag GmbH and Co. KGaA, Weinheim)

  20. An investigation of genetic heterogeneity and linkage disequilibrium in 161 families with spinal muscular atrophy

    Energy Technology Data Exchange (ETDEWEB)

    Merette, C.; Gilliam, T.C.; Brzustowicz, L.M. (Columbia Univ., New York, NY (United States)); Daniels, R.J.; Davies, K.E. (Institute of Molecular Medicine, Oxford (United Kingdom)); Melki, J.; Munnich, A. (Hopital des Enfants-Malades, Paris (France)); Pericak-Vance, M.A. (Duke Univ Medical Center, Durham, NC (United States)); Siddique, T. (Northwestern Univ., Chicago, IL (United States)); Voosen, B. (Institute fuer Humangenetik der Universitaet, Bonn (Germany)) (and others)


    The authors performed linkage analysis of 161 families with spinal muscular atrophy (SMA) in which affected individuals suffer from the intermediate or mild form of the disease (Types II or III). Markers for six loci encompassing the chromosome 5q11.2-q13.3 region were typed. The best map location for the disease locus was found to be between D5S6 and MAP1B. The corresponding 1 lod unit support interval is confined to this interval and spans 0.5 cM. The data strongly support the hypothesis of linkage heterogeneity (likelihood ratio, 1.14 [times] 10[sup 4]), with 5% of the families unlinked. Four families have a probability of less than 50% of segregating the SMA gene linked to the region 5q11.2-q13.3. A likelihood approach to test for linkage disequilibrium revealed no significant departure from Hardy-Weinberg equilibrium with any marker under study. 28 refs., 4 figs., 3 tabs.

  1. Development and initial performance results of a Solo 161 Stirling refrigerator for temperatures between -30 C and -90 C; Entwicklung und erste Betriebserfahrungen einer Solo 161 Stirling-Kaeltemaschine fuer die Kaeltebereitstellung bei Temperaturen zwischen -30 C und -90 C

    Energy Technology Data Exchange (ETDEWEB)

    Schikora, H.; Siegel, A. [Essen Univ. (Gesamthochschule) (Germany). Inst. fuer Angewandte Thermodynamik und Klimatechnik


    Several theoretical investigations have shown that Stirling refrigerators could be a promising alternative for refrigeration at 'near-ambient' temperatures (above -40 C). These theoretical statements shall be validated in an actual research project by measurements taken from a Stirling refrigerator that is optimised for this range of temperature. In this paper first measurement results of this new developed Solo 161 Stirling refrigerator will be presented. Problems are investigated by detailed measurements. Possible improvements are described. (orig.) [German] Verschiedene theoretische Untersuchungen haben gezeigt, dass Stirling-Kaeltemaschinen eine interessante Alternative fuer die Kaelteerzeugung im sog. 'umgebungsnahen' Temperaturbereich (oberhalb von -40 C) darstellen koennten. In einem derzeit laufenden Forschungsvorhaben sollen diese theoretischen Untersuchungen durch Messungen an einer fuer diesen Temperaturbereich optimierten Stirling-Kaeltemaschine ueberprueft werden. In diesem Aufsatz werden erste Messergebnisse dieser neu entwickelten Solo 161 Stirling-Kaeltemaschine praesentiert. Anhand detaillierter Messergebnisse werden Schwachstellen lokalisiert und moegliche Verbesserungsmassnahmen beschrieben. (orig.)

  2. Sodium terbium(III polyphosphate

    Directory of Open Access Journals (Sweden)

    Abdelghani Oudahmane


    Full Text Available Single crystals of the title compound, NaTb(PO34, were obtained by solid-state reaction. This compound belongs to type II of long-chain polyphosphates with the general formula AIBIII(PO34. It is isotypic with the NaNd(PO34 and NaEr(PO34 homologues. The crystal structure is built up of infinite crenelated chains of corner-sharing PO4 tetrahedra with a repeating unit of four tetrahedra. These chains, extending parallel to [100], are linked by isolated TbO8 square antiprisms, forming a three-dimensional framework. The Na+ ions are located in channels running along [010] and are surrounded by six oxygen atoms in a distorted octahedral environment within a cut-off distance <2.9 Å.

  3. Measurement of Trilinear Gauge Couplings in $e^+ e^-$ Collisions at 161 GeV and 172 GeV

    CERN Document Server

    Abreu, P; Adye, T; Adzic, P; Alekseev, G D; Alemany, R; Allport, P P; Almehed, S; Amaldi, Ugo; Amato, S; Andersson, P; Andreazza, A; Antilogus, P; Apel, W D; Arnoud, Y; Åsman, B; Augustin, J E; Augustinus, A; Baillon, Paul; Bambade, P; Barão, F; Barbier, R; Bardin, Dimitri Yuri; Barker, G; Baroncelli, A; Bärring, O; Bates, M J; Battaglia, Marco; Baubillier, M; Becks, K H; Begalli, M; Beillière, P; Belokopytov, Yu A; Benvenuti, Alberto C; Bérat, C; Berggren, M; Bertini, D; Bertrand, D; Besançon, M; Bianchi, F; Bigi, M; Bilenky, S M; Billoir, P; Bizouard, M A; Bloch, D; Bonesini, M; Bonivento, W; Boonekamp, M; Booth, P S L; Borgland, A W; Borisov, G; Bosio, C; Botner, O; Boudinov, E; Bouquet, B; Bourdarios, C; Bowcock, T J V; Bozovic, I; Bozzo, M; Branchini, P; Brand, K D; Brenke, T; Brenner, R A; Brown, R; Brückman, P; Brunet, J M; Bugge, L; Buran, T; Burgsmüller, T; Buschmann, P; Cabrera, S; Caccia, M; Calvi, M; Camacho-Rozas, A J; Camporesi, T; Canale, V; Canepa, M; Carena, F; Carroll, L; Caso, Carlo; Castillo-Gimenez, M V; Cattai, A; Cavallo, F R; Cerruti, C; Chabaud, V; Chapkin, M M; Charpentier, P; Chaussard, L; Checchia, P; Chelkov, G A; Chen, M; Chierici, R; Chliapnikov, P V; Chochula, P; Chorowicz, V; Chudoba, J; Collins, P; Colomer, M; Contri, R; Cortina, E; Cosme, G; Cossutti, F; Cowell, J H; Crawley, H B; Crennell, D J; Crosetti, G; Cuevas-Maestro, J; Czellar, S; D'Almagne, B; Damgaard, G; Dauncey, P D; Davenport, Martyn; Da Silva, W; Deghorain, A; Della Ricca, G; Delpierre, P A; Demaria, N; De Angelis, A; de Boer, Wim; De Brabandere, S; De Clercq, C; La Vaissière, C de; De Lotto, B; De Min, A; De Paula, L S; Dijkstra, H; Di Ciaccio, Lucia; Di Diodato, A; Djannati, A; Dolbeau, J; Doroba, K; Dracos, M; Drees, J; Drees, K A; Dris, M; Duperrin, A; Durand, J D; Edsall, D M; Ehret, R; Eigen, G; Ekelöf, T J C; Ekspong, Gösta; Ellert, M; Elsing, M; Engel, J P; Erzen, B; Espirito-Santo, M C; Falk, E; Fanourakis, G K; Fassouliotis, D; Fayot, J; Feindt, Michael; Ferrari, P; Ferrer, A; Fichet, S; Firestone, A; Fischer, P A; Flagmeyer, U; Föth, H; Fokitis, E; Fontanelli, F; Formenti, F; Franek, B J; Frodesen, A G; Frühwirth, R; Fulda-Quenzer, F; Fuster, J A; Galloni, A; Gamba, D; Gandelman, M; García, C; García, J; Gaspar, C; Gaspar, M; Gasparini, U; Gavillet, P; Gazis, E N; Gelé, D; Gerber, J P; Gerdyukov, L N; Ghodbane, N; Glege, F; Gokieli, R; Golob, B; Gonçalves, P; González-Caballero, I; Gopal, Gian P; Gorn, L; Górski, M; Guz, Yu; Gracco, Valerio; Grahl, J; Graziani, E; Green, C; Grefrath, A; Gris, P; Grosdidier, G; Grzelak, K; Günther, M; Guy, J; Hahn, F; Hahn, S; Haider, S; Hajduk, Z; Hallgren, A; Hamacher, K; Harris, F J; Hedberg, V; Heising, S; Henriques, R P; Hernández, J J; Herquet, P; Herr, H; Hessing, T L; Heuser, J M; Higón, E; Holmgren, S O; Holt, P J; Holthuizen, D J; Hoorelbeke, S; Houlden, M A; Hrubec, Josef; Huet, K; Hultqvist, K; Jackson, J N; Jacobsson, R; Jalocha, P; Janik, R; Jarlskog, C; Jarlskog, G; Jarry, P; Jean-Marie, B; Johansson, E K; Jönsson, L B; Jönsson, P E; Joram, Christian; Juillot, P; Kapusta, F; Karafasoulis, K; Katsanevas, S; Katsoufis, E C; Keränen, R; Khomenko, B A; Khovanskii, N N; King, B J; Kjaer, N J; Klapp, O; Klein, H; Kluit, P M; Knoblauch, D; Kokkinias, P; Koratzinos, M; Korcyl, K; Kostyukhin, V; Kourkoumelis, C; Kuznetsov, O; Krammer, Manfred; Kreuter, C; Kronkvist, I J; Krumshtein, Z; Kubinec, P; Kucewicz, W; Kurvinen, K L; Lacasta, C; Lamsa, J; Lanceri, L; Lane, D W; Langefeld, P; Lapin, V; Laugier, J P; Lauhakangas, R; Leder, Gerhard; Ledroit, F; Lefébure, V; Legan, C K; Leisos, A; Leitner, R; Lemonne, J; Lenzen, Georg; Lepeltier, V; Lesiak, T; Lethuillier, M; Libby, J; Liko, D; Lipniacka, A; Lippi, I; Lörstad, B; Loken, J G; Lopes, J H; López, J M; Loukas, D; Lutz, P; Lyons, L; MacNaughton, J N; Mahon, J R; Maio, A; Malek, A; Malmgren, T G M; Malychev, V; Mandl, F; Marco, J; Marco, R P; Maréchal, B; Margoni, M; Marin, J C; Mariotti, C; Markou, A; Martínez-Rivero, C; Martínez-Vidal, F; Martí i García, S; Matorras, F; Matteuzzi, C; Matthiae, Giorgio; Mazzucato, F; Mazzucato, M; McCubbin, M L; McKay, R; McNulty, R; McPherson, G; Medbo, J; Meroni, C; Meyer, W T; Michelotto, M; Migliore, E; Mirabito, L; Mitaroff, Winfried A; Mjörnmark, U; Moa, T; Møller, R; Mönig, K; Monge, M R; Moreau, X; Morettini, P; Münich, K; Mulders, M; Mundim, L M; Murray, W J; Muryn, B; Myatt, Gerald; Myklebust, T; Naraghi, F; Navarria, Francesco Luigi; Navas, S; Nawrocki, K; Negri, P; Némécek, S; Neufeld, N; Neumann, W; Neumeister, N; Nicolaidou, R; Nielsen, B S; Nieuwenhuizen, M; Nikolaenko, V; Nikolenko, M; Niss, P; Nomerotski, A; Normand, Ainsley; Nygren, A; Oberschulte-Beckmann, W; Obraztsov, V F; Olshevskii, A G; Onofre, A; Orava, Risto; Orazi, G; Österberg, K; Ouraou, A; Paganini, P; Paganoni, M; Paiano, S; Pain, R; Paiva, R; Palka, H; Papadopoulou, T D; Papageorgiou, K; Pape, L; Parkes, C; Parodi, F; Parzefall, U; Passeri, A; Pegoraro, M; Pernegger, H; Pernicka, Manfred; Perrotta, A; Petridou, C; Petrolini, A; Phillips, H T; Piana, G; Pierre, F; Pimenta, M; Piotto, E; Podobnik, T; Podobrin, O; Pol, M E; Polok, G; Poropat, P; Pozdnyakov, V; Privitera, P; Pukhaeva, N; Pullia, Antonio; Radojicic, D; Ragazzi, S; Rahmani, H; Rames, J; Ratoff, P N; Read, A L; Rebecchi, P; Redaelli, N G; Regler, Meinhard; Reid, D; Reinhardt, R; Renton, P B; Resvanis, L K; Richard, F; Rídky, J; Rinaudo, G; Røhne, O M; Romero, A; Ronchese, P; Rosenberg, E I; Rosinsky, P; Roudeau, Patrick; Rovelli, T; Ruhlmann-Kleider, V; Ruiz, A; Saarikko, H; Sacquin, Yu; Sadovskii, A; Sajot, G; Salt, J; Sampsonidis, D; Sannino, M; Schneider, H; Schwickerath, U; Schyns, M A E; Scuri, F; Seager, P; Sedykh, Yu; Segar, A M; Sekulin, R L; Senko, V A; Shellard, R C; Sheridan, A; Silvestre, R; Simonetto, F; Sissakian, A N; Skaali, T B; Smadja, G; Smirnov, N; Smirnova, O G; Smith, G R; Solovyanov, O; Sopczak, André; Sosnowski, R; Souza-Santos, D; Spassoff, Tz; Spiriti, E; Sponholz, P; Squarcia, S; Stampfer, D; Stanescu, C; Stanic, S; Stapnes, Steinar; Stavitski, I; Stevenson, K; Stocchi, A; Strauss, J; Strub, R; Stugu, B; Szczekowski, M; Szeptycka, M; Tabarelli de Fatis, T; Chikilev, O G; Tegenfeldt, F; Terranova, F; Thomas, J; Tilquin, A; Timmermans, J; Tkatchev, L G; Todorov, T; Todorova, S; Toet, D Z; Tomaradze, A G; Tomé, B; Tonazzo, A; Tortora, L; Tranströmer, G; Treille, D; Tristram, G; Trombini, A; Troncon, C; Tsirou, A L; Turluer, M L; Tyapkin, I A; Tyndel, M; Tzamarias, S; Überschär, B; Ullaland, O; Uvarov, V; Valenti, G; Vallazza, E; van Apeldoorn, G W; van Dam, P; Van Doninck, W K; Van Eldik, J; Van Lysebetten, A; Van Vulpen, I B; Vassilopoulos, N; Vegni, G; Ventura, L; Venus, W A; Verbeure, F; Verlato, M; Vertogradov, L S; Verzi, V; Vilanova, D; Vincent, P; Vishnevski, N K; Vitale, L; Vlasov, E; Vodopyanov, A S; Vrba, V; Wahlen, H; Walck, C; Weiser, C; Wetherell, Alan M; Wicke, D; Wickens, J H; Wilkinson, G R; Williams, W S C; Winter, M; Witek, M; Wlodek, T; Wolf, G; Yi, J; Yushchenko, O P; Zalewska-Bak, A; Zalewski, Piotr; Zavrtanik, D; Zevgolatakos, E; Zimin, N I; Zucchelli, G C; Zumerle, G


    Trilinear gauge boson couplings are measured using data taken by DELPHI at 161~GeV and 172~GeV. Values for $WWV$ couplings ($V=Z, \\gamma$) are determined from a study of the reactions \\eeWW\\ and \\eeWev, using differential distributions from the $WW$ final state in which one $W$ decays hadronically and the other leptonically, and total cross-section4AU LWit

  4. Circulating CD3+CD4+CD161+ Cells Are Associated with Early Complications after Autologous Stem Cell Transplantation in Multiple Myeloma

    Directory of Open Access Journals (Sweden)

    Sung-Eun Lee


    Full Text Available The aim of this study was to explore if measurement of pretransplant circulating CD161-expressing cells, in addition to clinical risk factors, could predict mucositis and infections in patients with multiple myeloma (MM undergoing autologous stem cell transplantation (ASCT. To determine if CD161-expressing cells are likely to predict early complications, namely, mucositis (≥grade 3, infections, and cytomegalovirus (CMV reactivation, we prospectively examined CD161-expressing cells (CD3+CD4+CD161+ and CD3+CD8+CD161+ in peripheral blood samples from 108 patients with MM undergoing ASCT. After adjusting for factors identified by univariate analysis that predicted mucositis (≥grade 3, infection before engraftment, and CMV reactivation, multivariate analyses revealed that the low proportion of CD3+CD4+CD161+ cells in peripheral blood was an independent predictor of mucositis (≥grade 3 (P=0.020, infections before engraftment (P=0.014, and CMV reactivation (P=0.010. In addition, we found that female sex and decreased glomerular filtration rate were independent factors for predicting mucositis. Female sex and severe pulmonary comorbidity were independent factors for predicting infection before engraftment. We found that the proportion of circulating CD3+CD4+CD161+ cells is useful for predicting the occurrence of early complications, including mucositis and infections, after ASCT in patients with MM.

  5. Disruption of δ-opioid receptor phosphorylation at threonine 161 attenuates morphine tolerance in rats with CFA-induced inflammatory hypersensitivity. (United States)

    Chen, Hai-Jing; Xie, Wei-Yan; Hu, Fang; Zhang, Ying; Wang, Jun; Wang, Yun


    Our previous study identified Threonine 161 (Thr-161), located in the second intracellular loop of the δ-opioid receptor (DOR), as the only consensus phosphorylation site for cyclin-dependent kinase 5 (Cdk5). The aim of this study was to assess the function of DOR phosphorylation by Cdk5 in complete Freund's adjuvant (CFA)-induced inflammatory pain and morphine tolerance. Dorsal root ganglion (DRG) neurons of rats with CFA-induced inflammatory pain were acutely dissociated and the biotinylation method was used to explore the membrane localization of phosphorylated DOR at Thr-161 (pThr-161-DOR), and paw withdrawal latency was measured after intrathecal delivery of drugs or Tat-peptide, using a radiant heat stimulator in rats with CFA-induced inflammatory pain. Both the total amount and the surface localization of pThr-161-DOR were significantly enhanced in the ipsilateral DRG following CFA injection. Intrathecal delivery of the engineered Tat fusion-interefering peptide corresponding to the second intracellular loop of DOR (Tat-DOR-2L) increased inflammatory hypersensitivity, and inhibited DOR- but not µ-opioid receptor-mediated spinal analgesia in CFA-treated rats. However, intrathecal delivery of Tat-DOR-2L postponed morphine antinociceptive tolerance in rats with CFA-induced inflammatory pain. Phosphorylation of DOR at Thr-161 by Cdk5 attenuates hypersensitivity and potentiates morphine tolerance in rats with CFA-induced inflammatory pain, while disruption of the phosphorylation of DOR at Thr-161 attenuates morphine tolerance.

  6. Completion Report for Well ER-16-1 Corrective Action Unit 99: Rainier Mesa - Shoshone Mountain

    Energy Technology Data Exchange (ETDEWEB)

    NSTec Environmental Management


    Well ER-16-1 was drilled for the U.S. Department of Energy, National Nuclear Security Administration Nevada Site Office, in support of the Nevada Environmental Restoration Project at the Nevada Test Site, Nye County, Nevada. The well was drilled in June and July 2005 as part of a hydrogeologic investigation program for the Rainier Mesa-Shoshone Mountain Corrective Action Unit, Number 99. The overall purpose of the well was to gather subsurface data to better characterize the hydrogeology of the Shoshone Mountain area, especially in the older Tertiary and pre-Tertiary strata. The main 46.99-centimeter hole was drilled to a depth of 702.9 meters and cased with 33.97-centimeter casing to 663.7 meters. The hole diameter was then decreased to 31.1 centimeters, and the well was drilled to total depth of 1,220.7 meters. A completion string set at the depth of 1,162.4 meters consisted of 13.97-centimeter stainless-steel casing, with one continuous slotted interval open to the lower carbonate aquifer. The fluid level in the borehole soon dropped, so the borehole was deepened in July 2006. To deepen the borehole, the slotted section was cemented and a 12.1-centimeter hole was drilled through the bottom of the completion string to the new total depth of 1,391.7 meters, which is 171.0 meters deeper than the original borehole. A string of 6.03-centimeter carbon-steel tubing with one continuous slotted interval at 1,361.8 to 1,381.4 meters, and open to the lower carbonate aquifer, was installed in the well with no gravel packing or cement, to serve as a monitoring string. Data gathered during and shortly after hole construction include composite drill cuttings samples collected every 3 meters (extra cuttings samples were collected from the Paleozoic rocks for paleontological analyses), sidewall core samples from 37 depths, various geophysical logs, and water level measurements. These data indicate that the well penetrated 646.8 meters of Tertiary volcanic rocks and 744.9 meters

  7. Activation cross sections of proton and deuteron induced nuclear reactions on holmium and erbium, related to the production of (161)Er and (160)Er medical isotopes. (United States)

    Tárkányi, F; Ditrói, F; Takács, S; Hermanne, A; Baba, M


    Experimental excitation functions for long-lived products in proton induced reactions were measured with the activation method in the 37-65MeV energy range on natural holmium. Stacked foil irradiation technique and high resolution gamma spectrometry were used in order to measure cross-section data for the production of (161)Er, (160)Er and (1)(59,157)Dy. For comparison of the production routes of medically related (161)Er and (160)Er radioisotopes new experimental cross section data were deduced for the (162)Er(p,x)(161,160)Er and (162)Er(d,x)(161,160)Er reactions by re-evaluating gamma-ray spectra from earlier measurements. No earlier data were found in the literature for these reactions. The experimental data are compared with results of TALYS theoretical code reported in TENDL-2015. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. Clinical and Molecular Characterization of a Cohort of 161 Unrelated Women with Nonclassical Congenital Adrenal Hyperplasia Due to 21-Hydroxylase Deficiency and 330 Family Members

    National Research Council Canada - National Science Library

    Bidet, Maud; Bellanné-Chantelot, Christine; Galand-Portier, Marie-Béatrice; Tardy, Véronique; Billaud, Line; Laborde, Kathleen; Coussieu, Christiane; Morel, Yves; Vaury, Christelle; Golmard, Jean-Louis; Claustre, Aurélie; Mornet, Etienne; Chakhtoura, Zeina; Mowszowicz, Irene; Bachelot, Anne; Touraine, Philippe; Kuttenn, Frédérique


    .... Patients and Methods: A total of 161 NC-CAH unrelated women diagnosed on late-onset symptoms, mainly hirsutism, and post-ACTH 17-hydroxyprogesterone more than 10 ng/ml, and 330 of their relatives was explored...

  9. Cross-section measurement of some deuteron induced reactions on $^{160}$Gd for possible production of the therapeutic radionuclide $^{161}$Tb

    CERN Document Server

    Tárkányi, F; Takács, S; Ditrói, F; Csikai, J; Ignatyuk, A V


    The radionuclide 161Tb (T1/2=6.89 d) is potentially important for internal radiotherapy. It is generally produced through the 160Gd(n,{\\gamma})161Gd - 161Tb route at research reactors. In this work the possibility of its production at a cyclotron was investigated. Determination of the excitation function of the 160Gd(d,x)161Tb production route and that of the disturbing 160Gd(d,2n)160Tb side reaction was done over the deuteron energy range up to 50 MeV using the stacked-foil technique and high-resolution gamma-ray spectrometry. A comparison of this production route with the established (n,\\gamma) reaction at a nuclear reactor is made.

  10. Contribution of Auger/conversion electrons to renal side effects after radionuclide therapy: preclinical comparison of (161)Tb-folate and (177)Lu-folate. (United States)

    Haller, Stephanie; Pellegrini, Giovanni; Vermeulen, Christiaan; van der Meulen, Nicholas P; Köster, Ulli; Bernhardt, Peter; Schibli, Roger; Müller, Cristina


    The radiolanthanide (161)Tb has, in recent years, attracted increasing interest due to its favorable characteristics for medical application. (161)Tb exhibits similar properties to the widely-used therapeutic radionuclide (177)Lu. In contrast to (177)Lu, (161)Tb yields a significant number of short-ranging Auger/conversion electrons (≤50 keV) during its decay process. (161)Tb has been shown to be more effective for tumor therapy than (177)Lu if applied using the same activity. The purpose of this study was to investigate long-term damage to the kidneys after application of (161)Tb-folate and compare it to the renal effects caused by (177)Lu-folate. Renal side effects were investigated in nude mice after the application of different activities of (161)Tb-folate (10, 20, and 30 MBq per mouse) over a period of 8 months. Renal function was monitored by the determination of (99m)Tc-DMSA uptake in the kidneys and by measuring blood urea nitrogen and creatinine levels in the plasma. Histopathological analysis was performed by scoring of the tissue damage observed in HE-stained kidney sections from euthanized mice. Due to the co-emitted Auger/conversion electrons, the mean absorbed renal dose of (161)Tb-folate (3.0 Gy/MBq) was about 24 % higher than that of (177)Lu-folate (2.3 Gy/MBq). After application of (161)Tb-folate, kidney function was reduced in a dose- and time-dependent manner, as indicated by the decreased renal uptake of (99m)Tc-DMSA and the increased levels of blood urea nitrogen and creatinine. Similar results were obtained when (177)Lu-folate was applied at the same activity. Histopathological investigations confirmed comparable renal cortical damage after application of the same activities of (161)Tb-folate and (177)Lu-folate. This was characterized by collapsed tubules and enlarged glomeruli with fibrin deposition in moderately injured kidneys and glomerulosclerosis in severely damaged kidneys. Tb-folate induced dose-dependent radionephropathy over

  11. Alterations in the mir-15a/16-1 Loci Impairs Its Processing and Augments B-1 Expansion in De Novo Mouse Model of Chronic Lymphocytic Leukemia (CLL.

    Directory of Open Access Journals (Sweden)

    Siddha Kasar

    Full Text Available New Zealand Black (NZB mice, a de novo model of CLL, share multiple characteristics with CLL patients, including decreased expression of miR-15a/16-1. We previously discovered a point mutation and deletion in the 3' flanking region of mir-16-1 of NZB and a similar mutation has been found in a small number of CLL patients. However, it was unknown whether the mutation is the cause for the reduced miR-15a/16-1 expression and CLL development. Using PCR and in vitro microRNA processing assays, we found that the NZB sequence alterations in the mir-15a/16-1 loci result in deficient processing of the precursor forms of miR-15a/16-1, in particular, we observe impaired conversion of pri-miR-15a/16-1 to pre-miR-15a/16-1. The in vitro data was further supported by derivation of congenic strains with replaced mir-15a/16-1 loci at one or both alleles: NZB congenic mice (NmiR+/- and DBA congenic mice (DmiR-/-. The level of miR-15a/16-1 reflected the configuration of the mir-15a/16-1 loci with DBA congenic mice (DmiR-/- showing reduced miR-15a levels compared to homozygous wild-type allele, while the NZB congenic mice (NmiR+/- showed an increase in miR-15a levels relative to homozygous mutant allele. Similar to Monoclonal B-cell Lymphocytosis (MBL, the precursor stage of the human disease, an overall expansion of the B-1 population was observed in DBA congenic mice (DmiR-/- relative to wild-type (DmiR+/+. These studies support our hypothesis that the mutations in the mir-15a/16-1 loci are responsible for decreased expression of this regulatory microRNA leading to B-1 expansion and CLL development.

  12. Use of the Signature Fatty Acid 16:1ω5 as a Tool to Determine the Distribution of Arbuscular Mycorrhizal Fungi in Soil

    Directory of Open Access Journals (Sweden)

    Christopher Ngosong


    Full Text Available Biomass estimation of arbuscular mycorrhiza (AM fungi, widespread plant root symbionts, commonly employs lipid biomarkers, predominantly the fatty acid 16:1ω5. We briefly reviewed the application of this signature fatty acid, followed by a case study comparing biochemical markers with microscopic techniques in an arable soil following a change to AM non-host plants after 27 years of continuous host crops, that is, two successive cropping seasons with wheat followed by amaranth. After switching to the non-host amaranth, spore biomass estimated by the neutral lipid fatty acid (NLFA 16:1ω5 decreased to almost nil, whereas microscopic spore counts decreased by about 50% only. In contrast, AM hyphal biomass assessed by the phospholipid (PLFA 16:1ω5 was greater under amaranth than wheat. The application of PLFA 16:1ω5 as biomarker was hampered by background level derived from bacteria, and further enhanced by its incorporation from degrading spores used as microbial resource. Meanwhile, biochemical and morphological assessments showed negative correlation for spores and none for hyphal biomass. In conclusion, the NLFA 16:1ω5 appears to be a feasible indicator for AM fungi of the Glomales group in the complex field soils, whereas the use of PLFA 16:1ω5 for hyphae is unsuitable and should be restricted to controlled laboratory studies.

  13. Cytoplasmic Localization of WT1 and Decrease of miRNA-16-1 in Nephrotic Syndrome

    Directory of Open Access Journals (Sweden)

    Pablo Zapata-Benavides


    Full Text Available Nephrotic syndrome (NS is a glomerular disease that is defined by the leakage of protein into the urine and is associated with hypoalbuminemia, hyperlipidemia, and edema. Steroid-resistant NS (SRNS patients do not respond to treatment with corticosteroids and show decreased Wilms tumor 1 (WT1 expression in podocytes. Downregulation of WT1 has been shown to be affected by certain microRNAs (miRNAs. Twenty-one patients with idiopathic NS (68.75% were SSNS and 31.25% SRNS and 10 healthy controls were enrolled in the study. Podocyte number and WT1 location were determined by immunofluorescence, and the serum levels of miR-15a, miR-16-1, and miR-193a were quantified by RT-qPCR. Low expression and delocalization of WT1 protein from the nucleus to the cytoplasm were found in kidney biopsies of patients with SRNS and both nuclear and cytoplasmic localization were found in steroid-sensitive NS (SSNS patients. In sera from NS patients, low expression levels of miR-15a and miR-16-1 were found compared with healthy controls, but only the miR-16-1 expression levels showed statistically significant decrease (p=0.019. The miR-193a expression levels only slightly increased in NS patients. We concluded that low expression and delocalization from the WT1 protein in NS patients contribute to loss of podocytes while modulation from WT1 protein is not associated with the miRNAs analyzed in sera from the patients.

  14. Cytoplasmic Localization of WT1 and Decrease of miRNA-16-1 in Nephrotic Syndrome (United States)

    Rangel-Ochoa, Gloria Azucena; Rodríguez-Padilla, Cristina


    Nephrotic syndrome (NS) is a glomerular disease that is defined by the leakage of protein into the urine and is associated with hypoalbuminemia, hyperlipidemia, and edema. Steroid-resistant NS (SRNS) patients do not respond to treatment with corticosteroids and show decreased Wilms tumor 1 (WT1) expression in podocytes. Downregulation of WT1 has been shown to be affected by certain microRNAs (miRNAs). Twenty-one patients with idiopathic NS (68.75% were SSNS and 31.25% SRNS) and 10 healthy controls were enrolled in the study. Podocyte number and WT1 location were determined by immunofluorescence, and the serum levels of miR-15a, miR-16-1, and miR-193a were quantified by RT-qPCR. Low expression and delocalization of WT1 protein from the nucleus to the cytoplasm were found in kidney biopsies of patients with SRNS and both nuclear and cytoplasmic localization were found in steroid-sensitive NS (SSNS) patients. In sera from NS patients, low expression levels of miR-15a and miR-16-1 were found compared with healthy controls, but only the miR-16-1 expression levels showed statistically significant decrease (p = 0.019). The miR-193a expression levels only slightly increased in NS patients. We concluded that low expression and delocalization from the WT1 protein in NS patients contribute to loss of podocytes while modulation from WT1 protein is not associated with the miRNAs analyzed in sera from the patients. PMID:28299339

  15. The possible role of CD8+/Vα7.2+/CD161++ T (MAIT) and CD8+/Vα7.2+/CD161loT (MAIT-like) cells in the pathogenesis of early-onset pre-eclampsia. (United States)

    Meggyes, Matyas; Szanto, Julia; Lajko, Adrienn; Farkas, Balint; Varnagy, Akos; Tamas, Peter; Hantosi, Eszter; Miko, Eva; Szereday, Laszlo


    The objective of this study was to compare the expressions of different immune-checkpoint molecules by MAIT and MAIT-like cells in healthy pregnancy and in early-onset pre-eclampsia. Peripheral blood mononuclear cells (PBMC) were stained with monoclonal antibodies to characterize MAIT and MAIT-like cells. Flow cytometric analyses were used to measure PD-1, TIM-3, activation markers, and intracellular perforin expression. We identified CD3+/CD8+/Vα7.2+/CD161++ MAIT cells and a minor cell population characterized by CD3+/CD8+/Vα7.2+/CD161 lo surface markers. In measuring the expression of PD-1 receptor, we found a significantly lower expression by MAIT cells in women with early-onset pre-eclampsia. CD69 expression by MAIT cells was significantly elevated in early-onset pre-eclamptic patients. Intracellular perforin content by MAIT and PD-1+ MAIT cells was significantly increased in pre-eclamptic patients compared with healthy individuals. Altered frequency and reduced PD-1 expression combined together with the elevated perforin content of MAIT cells insinuate their potential roles in the pathogenesis of early-onset pre-eclampsia. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  16. Investigation of the miR16-1 (C>T + 7 Substitution in Seven Different Types of Cancer from Three Ethnic Groups

    Directory of Open Access Journals (Sweden)

    Hulya Yazici


    Full Text Available Background. MicroRNAs are a type of small noncoding RNA molecules that have been shown to control gene expression in eukaryotes. Aberrant expression and alteration of miRNAs may be responsible for human diseases including cancer. An miR16-1 (C>T  + 7 gene mutation has been previously found in familial chronic lymphocytic leukemia patients, one of which reported a family history of breast cancer. miR16-1 regulates the expression of bcl-2, which is important in retinoblastoma, and is located in a genomic region that is frequently lost in nasopharyngeal and hepatocellular carcinomas (HCCs. Therefore, miR16-1 may be potentially important in the etiology of several solid tumors. To understand the power of the miR16-1 (C>T  + 7 mutation as a prognostic and diagnostic risk factor, we investigated the mutation in patients with seven different types of cancer including 188 with breast, 102 with ovarian, and 22 nasopharyngeal carcinomas, 96 HCC, 872 chronic myeloid leukemia (CML, 39 chronic lymphocytic leukemia (CLL, and 46 retinoblastoma cases from three different ethnic groups and of hereditary and sporadic etiology. Methods. 5′Nuclease TaqMan SNP genotyping assay was used to detect the miR16-1 gene C>T substitution. Results. The miR16-1 (C>T  + 7 substitution was not detected in any of the groups studied. Conclusions. Considering the large scale of our study, the representation of different ethnicities and levels of hereditary risk, we conclude that the miR-16-1 (C>T  + 7 mutation is not a good diagnostic or prognostic indicator of risk for the cancers tested.

  17. Preliminary measurements on a Solo 161 Stirling refrigerator at temperatures below -30 C; Erste Messergebnisse einer Solo 161 Stirling-Kaeltemaschine bei Temperaturen der Kaeltebereitstellung unterhalb von -30 C

    Energy Technology Data Exchange (ETDEWEB)

    Schikora, H.; Siegel, A.; Steimle, F. [Essen Univ. (Gesamthochschule) (Germany). Inst. fuer Angewandte Thermodynamik und Klimatechnik


    Theoretical investigations have shown that Stirling refrigerators may be an interesting alternative in this temperature range; they are now being verified by measurements. The authors present preliminary results. [German] Verschiedene theoretische Untersuchungen haben gezeigt, dass Stirling-Kaeltemaschinen eine interessante Alternative fuer die Kaelteerzeugung bei umgebungsnahen Temperaturen (oberhalb von -40 C) darstellen koennten. In einem derzeit laufenden Forschungsvorhaben sollen diese theoretischen Untersuchungen durch Messungen an einer fuer diesen Temperaturbereich optimierten Stirling-Kaeltemaschine ueberprueft werden. In diesem Aufsatz werden erste Messergebnisse dieser neu entwickelten Solo 161 Stirling-Kaeltemaschine praesentiert. Neben den herkoemmlichen Leistungsdaten wie Kaelteleistung und Leistungsaufnahme werden weitere Groessen im Inneren der Maschine gemessen. Dazu gehoeren die mittleren Gastemperaturen an einigen Stellen in der Maschine. Die Druckverlaeufe in den Arbeitsraeumen werden ueber eine Kurbelumdrehung aufgeloest. Aus den damit erstellten p,V-Diagrammen koennen wichtige Groessen wie die Reibleistung im Kurbeltrieb und den Zylindern ermittelt werden. Anhand so detaillierter Messtechnik werden Schwachstellen lokalisiert und moegliche Verbesserungsmassnahmen beschrieben. (orig.)

  18. A Study of Single W Production in $e^{+}e^{-}$ Collisions at $\\sqrt{s}$ = 161 - 183 GeV

    CERN Document Server

    Barate, R; Ghez, P; Goy, C; Jézéquel, S; Lees, J P; Martin, F; Merle, E; Minard, M N; Pietrzyk, B; Przysiezniak, H; Alemany, R; Casado, M P; Chmeissani, M; Crespo, J M; Fernández, E; Fernández-Bosman, M; Garrido, L; Graugès-Pous, E; Juste, A; Martínez, M; Merino, G; Miquel, R; Mir, L M; Morawitz, P; Pacheco, A; Park, I C; Riu, I; Colaleo, A; Creanza, D; De Palma, M; Iaselli, Giuseppe; Maggi, G; Maggi, M; Nuzzo, S; Ranieri, A; Raso, G; Ruggieri, F; Selvaggi, G; Silvestris, L; Tempesta, P; Tricomi, A; Zito, G; Huang, X; Lin, J; Ouyang, Q; Wang, T; Xie, Y; Xu, R; Xue, S; Zhang, J; Zhang, L; Zhao, W; Abbaneo, D; Becker, U; Boix, G; Cattaneo, M; Cerutti, F; Ciulli, V; Dissertori, G; Drevermann, H; Forty, Roger W; Frank, M; Gianotti, F; Greening, T C; Halley, A W; Hansen, J B; Harvey, J; Janot, P; Jost, B; Lehraus, Ivan; Leroy, O; Loomis, C; Maley, P; Mato, P; Minten, Adolf G; Moutoussi, A; Ranjard, F; Rolandi, Luigi; Schlatter, W D; Schmitt, M; Schneider, O; Spagnolo, P; Tejessy, W; Teubert, F; Tomalin, I R; Tournefier, E; Ajaltouni, Ziad J; Badaud, F; Chazelle, G; Deschamps, O; Dessagne, S; Falvard, A; Ferdi, C; Gay, P; Guicheney, C; Henrard, P; Jousset, J; Michel, B; Monteil, S; Montret, J C; Pallin, D; Perret, P; Podlyski, F; Hansen, J D; Hansen, J R; Hansen, P H; Nilsson, B S; Rensch, B; Wäänänen, A; Daskalakis, G; Kyriakis, A; Markou, C; Simopoulou, Errietta; Vayaki, Anna; Blondel, A; Brient, J C; Machefert, F P; Rougé, A; Swynghedauw, M; Tanaka, R; Valassi, Andrea; Videau, H L; Focardi, E; Parrini, G; Zachariadou, K; Cavanaugh, R J; Corden, M; Georgiopoulos, C H; Antonelli, A; Bencivenni, G; Bologna, G; Bossi, F; Campana, P; Capon, G; Chiarella, V; Laurelli, P; Mannocchi, G; Murtas, F; Murtas, G P; Passalacqua, L; Pepé-Altarelli, M; Chalmers, M; Curtis, L; Lynch, J G; Negus, P; O'Shea, V; Räven, B; Raine, C; Smith, D; Teixeira-Dias, P; Thompson, A S; Ward, J J; Buchmüller, O L; Dhamotharan, S; Geweniger, C; Hanke, P; Hansper, G; Hepp, V; Kluge, E E; Putzer, A; Sommer, J; Tittel, K; Werner, S; Wunsch, M; Beuselinck, R; Binnie, David M; Cameron, W; Dornan, Peter J; Girone, M; Goodsir, S M; Marinelli, N; Martin, E B; Nash, J; Nowell, J; Sedgbeer, J K; Thomson, E; Williams, M D; Ghete, V M; Girtler, P; Kneringer, E; Kuhn, D; Rudolph, G; Bowdery, C K; Buck, P G; Ellis, G; Finch, A J; Foster, F; Hughes, G; Jones, R W L; Robertson, N A; Smizanska, M; Williams, M; Giehl, I; Hölldorfer, F; Jakobs, K; Kleinknecht, K; Kröcker, M; Müller, A S; Nürnberger, H A; Quast, G; Renk, B; Rohne, E; Sander, H G; Schmeling, S; Wachsmuth, H W; Zeitnitz, C; Ziegler, T; Aubert, Jean-Jacques; Benchouk, C; Bonissent, A; Carr, J; Coyle, P; Ealet, A; Fouchez, D; Motsch, F; Payre, P; Rousseau, D; Talby, M; Thulasidas, M; Tilquin, A; Aleppo, M; Antonelli, M; Ragusa, F; Büscher, V; Dietl, H; Ganis, G; Hüttmann, K; Lütjens, G; Mannert, C; Männer, W; Moser, H G; Schael, S; Settles, Ronald; Seywerd, H C J; Stenzel, H; Wiedenmann, W; Wolf, G; Boucrot, J; Callot, O; Chen, S; Davier, M; Duflot, L; Grivaz, J F; Heusse, P; Jacholkowska, A; Kado, M; Kim, D W; Lefrançois, J; Serin, L; Veillet, J J; Videau, I; De Vivie de Régie, J B; Zerwas, D; Azzurri, P; Bagliesi, G; Bettarini, S; Boccali, T; Bozzi, C; Calderini, G; Dell'Orso, R; Fantechi, R; Ferrante, I; Giassi, A; Gregorio, A; Ligabue, F; Lusiani, A; Marrocchesi, P S; Messineo, A; Palla, Fabrizio; Rizzo, G; Sanguinetti, G; Sciabà, A; Sguazzoni, G; Tenchini, Roberto; Vannini, C; Venturi, A; Verdini, P G; Blair, G A; Chambers, J T; Coles, J; Cowan, G D; Green, M G; Hutchcroft, D E; Jones, L T; Medcalf, T; Strong, J A; Von Wimmersperg-Töller, J H; Botterill, David R; Clifft, R W; Edgecock, T R; Norton, P R; Thompson, J C; Wright, A E; Bloch-Devaux, B; Colas, P; Fabbro, B; Faïf, G; Lançon, E; Lemaire, M C; Locci, E; Pérez, P; Rander, J; Renardy, J F; Rosowsky, A; Trabelsi, A; Tuchming, B; Vallage, B; Black, S N; Dann, J H; Kim, H Y; Konstantinidis, N P; Litke, A M; McNeil, M A; Taylor, G; Booth, C N; Cartwright, S L; Combley, F; Hodgson, P N; Kelly, M S; Lehto, M H; Thompson, L F; Affholderbach, K; Böhrer, A; Brandt, S; Foss, J; Grupen, Claus; Hess, J; Misiejuk, A; Prange, G; Sieler, U; Smolik, L; Stephan, F; Giannini, G; Gobbo, B; Pütz, J; Rothberg, J E; Wasserbaech, S R; Williams, R W; Armstrong, S R; Elmer, P; Ferguson, D P S; Gao, Y; González, S; Hayes, O J; Hu, H; Jin, S; McNamara, P A; Nielsen, J; Orejudos, W; Pan, Y B; Saadi, Y; Scott, I J; Vogt, M; Walsh, J; Wu Sau Lan; Wu, X; Zobernig, G


    Single W production is studied in the data recorded with the ALEPH detector at LEP at centre-of-mass energies between 161 and 183 GeV. The cross section is measured to be sigma_W=0.41+-0.17 (stat) +-0.04 (syst) pb at 183 GeV, consistent with the Standard Model expectation. Limits on non-standard WWgamma couplings are deduced as -1.6 < kg < 1.5 (lg=0) and -1.6 < lg < 1.6 (kg=1) at 95% C.L. A search for effectively invisible decays of the W boson in W pair production is performed, leading to an upper limit on the branching ratio of 1.3% (\\Gamma_inv= 27 MeV) at 95% C.L.

  19. Evaluation of the topoisomerase II-inactive bisdioxopiperazine ICRF-161 as a protectant against doxorubicin-induced cardiomyopathy

    DEFF Research Database (Denmark)

    Martin, E.; Thougaard, A.V.; Grauslund, M.


    Anthracycline-induced cardiomyopathy is a major problem in anti-cancer therapy. The only approved agent for alleviating this serious dose limiting side effect is ICRF-187 (dexrazoxane). The current thinking is that the ring-opened hydrolysis product of this agent, ADR-925, which is formed inside...... or in cells, it is well tolerated and shows similar exposure to ICRF-187 in rodents, and it does not induce myelosuppression when given at high doses to mice as opposed to ICRF-187. However, when tested in a model of chronic anthracycline-induced cardiomyopathy in spontaneously hypertensive rats, ICRF-161...... chelation alone does not appear to be sufficient for protection against anthracycline-induced cardiomyopathy Udgivelsesdato: 2009/1/8...

  20. Age and CD161 expression contribute to inter-individual variation in interleukin-23 response in CD8+ memory human T cells.

    Directory of Open Access Journals (Sweden)

    Hui Shen

    Full Text Available The interleukin-23 (IL-23 pathway plays a critical role in the pathogenesis of multiple chronic inflammatory disorders, however, inter-individual variability in IL-23-induced signal transduction in circulating human lymphocytes has not been well-defined. In this study, we observed marked, reproducible inter-individual differences in IL-23 responsiveness (measured by STAT3 phosphorylation in peripheral blood CD8+CD45RO+ memory T and CD3+CD56+ NKT cells. Age, but not gender, was a significant (Pearson's correlation coefficient, r = -0.37, p = 0.001 source of variability observed in CD8+CD45RO+ memory T cells, with IL-23 responsiveness gradually decreasing with increasing age. Relative to cells from individuals demonstrating low responsiveness to IL-23 stimulation, CD8+CD45RO+ memory T cells from individuals demonstrating high responsiveness to IL-23 stimulation showed increased gene expression for IL-23 receptor (IL-23R, RORC (RORγt and CD161 (KLRB1, whereas RORA (RORα and STAT3 expression were equivalent. Similar to CD4+ memory T cells, IL-23 responsiveness is confined to the CD161+ subset in CD8+CD45RO+ memory T cells, suggesting a similar CD161+ precursor as has been reported for CD4+ Th17 cells. We observed a very strong positive correlation between IL-23 responsiveness and the fraction of CD161+, CD8+CD45RO+ memory T cells (r = 0.80, p<0.001. Moreover, the fraction of CD161+, CD8+CD45RO+ memory T cells gradually decreases with aging (r = -0.34, p = 0.05. Our data define the inter-individual differences in IL-23 responsiveness in peripheral blood lymphocytes from the general population. Variable expression of CD161, IL-23R and RORC affects IL-23 responsiveness and contributes to the inter-individual susceptibility to IL-23-mediated defenses and inflammatory processes.

  1. A europium- and terbium-coated magnetic nanocomposite as sorbent in dispersive solid phase extraction coupled with ultra-high performance liquid chromatography for antibiotic determination in meat samples. (United States)

    Castillo-García, M L; Aguilar-Caballos, M P; Gómez-Hens, A


    A new magnetic dispersive solid-phase extraction approach based on Eu- and Tb-coated magnetic nanocomposites, combined with ultra-high performance liquid chromatography with fluorometric detection, is reported for the extraction and simultaneous determination of veterinary antibiotics. The method is aimed at monitoring of potential residues of three tetracyclines, namely oxytetracycline, tetracycline, chlortetracycline and three acidic quinolones, such as oxolinic acid, nalidixic acid and flumequine, chosen as model analytes, in animal muscle samples. The nanocomposites were obtained by synthesizing magnetic nanoparticles by a co-precipitation method and their coating with terbium and europium ions. The limits of detection obtained using standard solutions were: 1.0, 1.5, 3.8, 0.25, 0.7 and 1.2ngmL(-1), which corresponds to 3.3, 5.0, 12.7, 0.8, 2.3 and 4.0μgkg(-1) for oxytetracycline, tetracycline, chlortetracycline, oxolinic acid, nalidixic acid and flumequine, respectively, in meat samples. The precision values, obtained in the presence of the sample matrix, were in the ranges 0.12-2.0% and 2.6-15.4% for retention times and areas, respectively. The selectivity of the method was checked by assaying different veterinary drugs, finding that most of them did not interfere at the same concentration levels as that of analytes. A recovery study was performed in the presence of chicken and pork muscle samples, which provided values in the range of 61.5-102.6%. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. CD161+CD4+ T cells are enriched in the liver during chronic hepatitis and associated with co-secretion of IL-22 and Interferon-gamma

    Directory of Open Access Journals (Sweden)

    Yu-Hoi eKang


    Full Text Available Hepatitis C virus infection is a major cause of chronic liver disease. CD4+ T cells play a key role in disease outcome. However, the critical functions and associated phenotypes of intrahepatic CD4+ T cells are not well defined. We have previously shown that CD8+ T cells expressing the C type lectin CD161 are highly enriched in the human liver, especially during chronic hepatitis. These cells are associated with a type 17 differentiation pattern and express cytokines including IL-17A, IL-22 and IFNγ. We therefore analysed expression of CD161 on CD4+ T cells in blood and liver and addressed the relevant phenotype and functional capacity of these populations. We observed marked enrichment of CD161+CD4+ T cells in the liver during chronic hepatitis such that they are the dominant subtype (mean 55% of CD4+ T cells. IL-22 and IL-17 secreting CD4+ cells were readily found in the livers of HCV+ and NASH donors, although not enriched compared to blood. There was, however, specific enrichment of a novel subset of IL-22/IFN-γ dual secretors (p=0.02 compared to blood, a result reconfirmed with direct ex vivo analyses. These data indicate the dominance of CD161+ expressing lymphocyte populations within the hepatic infiltrate, associated with a distinct cytokine profile. Given their documented roles as antiviral and hepatoprotective cytokines respectively, the impact of co-secretion of IFNγ and IL-22 in the liver may be particularly significant.

  3. Complement activation in Mycoplasma fermentans-induced mycoplasma clearance from infected cells: probing of the organism with monoclonal antibodies against M161Ag. (United States)

    Kikkawa, S; Matsumoto, M; Sasaki, T; Nishiguchi, M; Tanaka, K; Toyoshima, K; Seya, T


    Mycoplasma fermentans, a cell wall-less prokaryote, is capable of infecting humans and has been suggested to serve as a cofactor in AIDS development. Recently, we discovered a novel lipoprotein with a molecular mass of 43 kDa originating from M. fermentans. This protein, named M161Ag, activated human complement via the alternative pathway and efficiently induced the proinflammatory cytokines interleukin 1beta (IL-1beta), tumor necrosis factor alpha, IL-6, IL-10, and IL-12 in human peripheral blood monocytes. It is likely that M161Ag of M. fermentans affects the host immune system upon mycoplasma infection. In this study, we developed monoclonal antibodies (MAbs) against M161Ag and examined the direct role of complement in M. fermentans infection using these MAbs as probes. M. fermentans was rapidly cleared from the surfaces of infected cells by human complement, but a low-grade infection persisted in human tumor cell lines. Mycoplasma particles remaining alive in host cells may cause recurrent infection, and liberated M161Ag may serve as a biological response modifier affecting both innate and acquired immunity.

  4. How Are Substrate Binding and Catalysis Affected by Mutating Glu127 and Arg161 in Prolyl-4-hydroxylase? A QM/MM and MD Study

    Directory of Open Access Journals (Sweden)

    Amy Timmins


    Full Text Available Prolyl-4-hydroxylase is a vital enzyme for human physiology involved in the biosynthesis of 4-hydroxyproline, an essential component for collagen formation. The enzyme performs a unique stereo- and regioselective hydroxylation at the C4 position of proline despite the fact that the C5 hydrogen atoms should be thermodynamically easier to abstract. To gain insight into the mechanism and find the origin of this regioselectivity, we have done a quantum mechanics/molecular mechanics (QM/MM study on wildtype and mutant structures. In a previous study (Timmins et al., 2017 we identified several active site residues critical for substrate binding and positioning. In particular, the Glu127 and Arg161 were shown to form multiple hydrogen bonding and ion-dipole interactions with substrate and could thereby affect the regio- and stereoselectivity of the reaction. In this work, we decided to test that hypothesis and report a QM/MM and molecular dynamics (MD study on prolyl-4-hydroxylase and several active site mutants where Glu127 or Arg161 are mutated for Asp, Gln, or Lys. Thus, the R161D and R161Q mutants give very high barriers for hydrogen atom abstraction from any proline C–H bond and therefore will be inactive. The R161K mutant, by contrast, sees the regio- and stereoselectivity of the reaction change but still is expected to hydroxylate proline at room temperature. By contrast, the Glu127 mutants E127D and E127Q show possible changes in regioselectivity with the former being more probable to react compared to the latter.

  5. Search for R-Parity violating effects at $\\sqrt{s}$ 161 and 172 GeV

    CERN Document Server

    Arnoud, Y; Berat, C; Witek, M; Vassilopoulos, N; Sajot, G; Richard, F; Nicolaidou, R; Pimenta M; Papadopoulou, Th D; Palka, H; Onofre, A; Lola, S; Kluit, P; Katsanevas, S; Gris, P; Fichet, S; Cieslik, K; Boonekamp, M


    Searches for charginos, neutralinos and sleptons in e+ e collisions at center-of-mass energies of 161 and 172 GeV have been performed on DELPHI data, under the assumptions that R-Parity is not conserved and that the dominant R-Parity violating couplings involve only leptonic or only quark elds. Particular emphasis is given in decays involving, the minimally constrained by low-energy studies, third generation couplings including 's and b quarks in the decay products. Squark decays are also studied for the same energies assuming that the dominant R-Parity violating couplings involve a mixture of leptonic and quark elds. In the above studies, it is assumed that the strength of the couplings is such that the lifetimes can be neglected. These searches are used to constraint domains of the parameter space, previously explored under the assumption of R-Parity conservation. Further, the single sparticle production, possible when R-parity is not conserved, is studied. In particular the single squark production and the...

  6. Sleep Behavior and EEG Oscillations in Aged Dp(16)1Yey/+ Mice: A Down Syndrome Model. (United States)

    Levenga, J; Peterson, D J; Cain, P; Hoeffer, C A


    Down syndrome (DS) results from the triplication of genes located on human chromosome 21 (Hsa21). Though many cognitive and behavioral impairments are associated with DS, sleep disturbances remain poorly understood despite being a reported phenotype in approximately 60% of individuals diagnosed with DS. In this study, sleep and electroencephalography (EEG) oscillations were recorded from aged (12-14 mos.) Dp(16)1Yey/+ mice (Dp16), a mouse model of DS. We observed disrupted sleep demonstrated by increased activity during the dark phase and increased time awake at the expense of NREM sleep compared to wild-type mice. In addition, we found that Dp16 mice display significant differences in relative EEG power distribution among oscillation frequencies in both sleep and awake states. These results in Dp16 mice are consistent with sleep disturbances found in individuals with DS, and the abnormal EEG oscillations in aged Dp16 mice suggest a potential role for GABAergic activity in these sleep and EEG abnormalities. These sleep and EEG data reflect underlying differences in neuronal activity at the network level and thus are causative agents rather than merely symptoms of DS. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  7. Central and Eastern European countries between the 16+1 platform and Chinese OBOR - One Belt, One Road - Initiative

    Directory of Open Access Journals (Sweden)

    George Cornel Dumitrescu


    Full Text Available This paper aims at analysing the projects and the initiatives of the Central and Eastern European countries that have been finalised, are in progress or will be developed in the near future with the help of the existing or future financial instruments specific to the 16+1 platform and the One Belt, One Road complex program. For our research we selected four countries, namely: Poland, Romania, Serbia and Hungary, the group being relevant from the perspective of the transportation corridors connected to the ”One Belt, One Road” initiative: (1 - Piraeus, Skopje, Belgrade, Budapest, Western Europe; (2 - Suez Canal, Constanta and then Danube, Western Europe, or through Moldova towards Ukraine and Poland; (3 – Constanta, through the Black Sea and Caspian Sea and then the corridors mentioned at the previous point. We based our analysis on the data provided by the National Bureau of Statistics of China, China-CEEC think-tank network and the literature in the field.

  8. Searches for charginos and neutralinos in $e^+ e^-$ collisions at $\\sqrt{s}$ = 161 and 172 GeV

    CERN Document Server

    Barate, R; Décamp, D; Ghez, P; Goy, C; Lees, J P; Lucotte, A; Minard, M N; Nief, J Y; Pietrzyk, B; Casado, M P; Chmeissani, M; Comas, P; Crespo, J M; Delfino, M C; Fernández, E; Fernández-Bosman, M; Garrido, L; Juste, A; Martínez, M; Merino, G; Miquel, R; Mir, L M; Padilla, C; Park, I C; Pascual, A; Perlas, J A; Riu, I; Sánchez, F; Colaleo, A; Creanza, D; De Palma, M; Gelao, G; Iaselli, Giuseppe; Maggi, G; Maggi, M; Marinelli, N; Nuzzo, S; Ranieri, A; Raso, G; Ruggieri, F; Selvaggi, G; Silvestris, L; Tempesta, P; Tricomi, A; Zito, G; Huang, X; Lin, J; Ouyang, Q; Wang, T; Xie, Y; Xu, R; Xue, S; Zhang, J; Zhang, L; Zhao, W; Abbaneo, D; Alemany, R; Bazarko, A O; Becker, U; Bright-Thomas, P G; Cattaneo, M; Cerutti, F; Dissertori, G; Drevermann, H; Forty, Roger W; Frank, M; Gianotti, F; Hagelberg, R; Hansen, J B; Harvey, J; Janot, P; Jost, B; Kneringer, E; Lehraus, Ivan; Mato, P; Minten, Adolf G; Moneta, L; Pacheco, A; Pusztaszeri, J F; Ranjard, F; Rizzo, G; Rolandi, Luigi; Rousseau, D; Schlatter, W D; Schmitt, M; Schneider, O; Tejessy, W; Teubert, F; Tomalin, I R; Wachsmuth, H W; Wagner, A; Ajaltouni, Ziad J; Barrès, A; Boyer, C; Falvard, A; Ferdi, C; Gay, P; Guicheney, C; Henrard, P; Jousset, J; Michel, B; Monteil, S; Montret, J C; Pallin, D; Perret, P; Podlyski, F; Proriol, J; Rosnet, P; Rossignol, J M; Fearnley, Tom; Hansen, J D; Hansen, J R; Hansen, P H; Nilsson, B S; Rensch, B; Wäänänen, A; Daskalakis, G; Kyriakis, A; Markou, C; Simopoulou, Errietta; Vayaki, Anna; Blondel, A; Brient, J C; Machefert, F P; Rougé, A; Rumpf, M; Valassi, Andrea; Videau, H L; Boccali, T; Focardi, E; Parrini, G; Zachariadou, K; Cavanaugh, R J; Corden, M; Georgiopoulos, C H; Hühn, T; Jaffe, D E; Antonelli, A; Bencivenni, G; Bologna, G; Bossi, F; Campana, P; Capon, G; Casper, David William; Chiarella, V; Felici, G; Laurelli, P; Mannocchi, G; Murtas, F; Murtas, G P; Passalacqua, L; Pepé-Altarelli, M; Curtis, L; Dorris, S J; Halley, A W; Knowles, I G; Lynch, J G; O'Shea, V; Raine, C; Scarr, J M; Smith, K; Teixeira-Dias, P; Thompson, A S; Thomson, E; Thomson, F; Turnbull, R M; Buchmüller, O L; Dhamotharan, S; Geweniger, C; Graefe, G; Hanke, P; Hansper, G; Hepp, V; Kluge, E E; Putzer, A; Sommer, J; Tittel, K; Werner, S; Wunsch, M; Beuselinck, R; Binnie, David M; Cameron, W; Dornan, Peter J; Girone, M; Goodsir, S M; Martin, E B; Morawitz, P; Moutoussi, A; Nash, J; Sedgbeer, J K; Spagnolo, P; Stacey, A M; Williams, M D; Ghete, V M; Girtler, P; Kuhn, D; Rudolph, G; Betteridge, A P; Bowdery, C K; Buck, P G; Colrain, P; Crawford, G; Finch, A J; Foster, F; Hughes, G; Jones, R W L; Sloan, Terence; Whelan, E P; Williams, M I; Giehl, I; Hoffmann, C; Jakobs, K; Kleinknecht, K; Quast, G; Renk, B; Rohne, E; Sander, H G; Van Gemmeren, P; Zeitnitz, C; Aubert, Jean-Jacques; Benchouk, C; Bonissent, A; Bujosa, G; Carr, J; Coyle, P; Diaconu, C A; Ealet, A; Fouchez, D; Konstantinidis, N P; Leroy, O; Motsch, F; Payre, P; Talby, M; Sadouki, A; Thulasidas, M; Tilquin, A; Trabelsi, K; Aleppo, M; Antonelli, M; Ragusa, F; Berlich, R; Blum, Walter; Büscher, V; Dietl, H; Ganis, G; Gotzhein, C; Kroha, H; Lütjens, G; Lutz, Gerhard; Männer, W; Moser, H G; Richter, R H; Rosado-Schlosser, A; Schael, S; Settles, Ronald; Seywerd, H C J; Saint-Denis, R; Stenzel, H; Wiedenmann, W; Wolf, G; Boucrot, J; Callot, O; Chen, S; Davier, M; Duflot, L; Grivaz, J F; Heusse, P; Höcker, A; Jacholkowska, A; Kim, D W; Le Diberder, F R; Lefrançois, J; Lutz, A M; Marumi, M; Schune, M H; Serin, L; Tournefier, E; Veillet, J J; Videau, I; Zerwas, D; Azzurri, P; Bagliesi, G; Bettarini, S; Bozzi, C; Calderini, G; Ciulli, V; Dell'Orso, R; Fantechi, R; Ferrante, I; Giassi, A; Gregorio, A; Ligabue, F; Lusiani, A; Marrocchesi, P S; Messineo, A; Palla, Fabrizio; Sanguinetti, G; Sciabà, A; Sguazzoni, G; Steinberger, Jack; Tenchini, Roberto; Vannini, C; Venturi, A; Verdini, P G; Blair, G A; Bryant, L M; Chambers, J T; Green, M G; Medcalf, T; Perrodo, P; Strong, J A; Von Wimmersperg-Töller, J H; Botterill, David R; Clifft, R W; Edgecock, T R; Haywood, S; Maley, P; Norton, P R; Thompson, J C; Wright, A E; Bloch-Devaux, B; Colas, P; Fabbro, B; Lançon, E; Lemaire, M C; Locci, E; Pérez, P; Rander, J; Renardy, J F; Rosowsky, A; Roussarie, A; Schwindling, J; Trabelsi, A; Vallage, B; Black, S N; Dann, J H; Kim, H Y; Litke, A M; McNeil, M A; Taylor, G; Booth, C N; Brew, C A J; Cartwright, S L; Combley, F; Kelly, M S; Lehto, M H; Reeve, J; Thompson, L F; Affholderbach, K; Böhrer, A; Brandt, S; Cowan, G D; Foss, J; Grupen, Claus; Smolik, L; Stephan, F; Apollonio, M; Bosisio, L; Della Marina, R; Giannini, G; Gobbo, B; Musolino, G; Pütz, J; Rothberg, J E; Wasserbaech, S R; Williams, R W; Armstrong, S R; Charles, E; Elmer, P; Ferguson, D P S; Gao, Y; González, S; Greening, T C; Hayes, O J; Hu, H; Jin, S; McNamara, P A; Nachtman, J M; Nielsen, J; Orejudos, W; Pan, Y B; Saadi, Y; Scott, I J; Walsh, J; Wu Sau Lan; Wu, X; Yamartino, J M; Zobernig, G


    The data recorded by the ALEPH detector at centre-of-mass energies of 161, 170, and 172 GeV are analysed for signals of chargino and neutralino production. No evidence of a signal is found, although candidate events consistent with the expectations from Standard Model processes are observed. Limits at 95% C.L. on the production cross sections are derived and bounds on the parameters of the Minimal Supersymmetric Standard Model are set. The lower limit on the mass of the lightest chargino is 85.5 GeV/c^2 for gaugino-like charginos (mu = -500 GeV/c^2), and 85.0 GeV/c^2 for Higgsino-like charginos (M_2 = 500 GeV/c^2), for heavy sneutrinos (M(snu) > 200 GeV/c^2) and tanb = sqrt(2). The effect of light sleptons on chargino and neutralino limits is investigated. The assumptions of a universal slepton mass and a universal gaugino mass are relaxed, allowing less model-dependent limits to be obtained.

  9. Is there a gender equity for women farmers? Reflections on public policy and social CONPES 161/2013.

    Directory of Open Access Journals (Sweden)

    Ximena Marin Hermann


    Full Text Available Domestic roles ( reproductive and productive Colombian rural women are different and are marked by the dynamics of their own territories , but also developed in the areas of public and private unevenly and unfairly compared to men rural sector. Considering the above, raises feminist economics "care economy" as an effort to validate and make visible the contribution of women to the economy. But this trend can go further, can contribute to the transformation of reproductive and productive roles, encouraging participation and democracy for women. Considering this, the equitable use of the time in the private ( family enters debate. Women no longer want and seek only equality in public but do not want to share your time at home on an unequal footing . Public policies are needed to contribute to these disparities disappear. To this extent it is possible to ask yourself the current Public Policy Of Gender Equity for Women ( SOCIAL CONPES 161/2013 , can guarantee the full enjoyment of the rights of Colombian women applying the principles of equality and non-discrimination? This reflection tries to do, from a gender perspective, an analytical reading of the impact of public policy on the transformation of the reality of the Colombian rural women.

  10. 16.1% Efficient Hysteresis-Free Mesostructured Perovskite Solar Cells Based on Synergistically Improved ZnO Nanorod Arrays

    KAUST Repository

    Mahmood, Khalid


    Significant efficiency improvements are reported in mesoscopic perovskite solar cells based on the development of a low-temperature solution-processed ZnO nanorod (NR) array exhibiting higher NR aspect ratio, enhanced electron density, and substantially reduced work function than conventional ZnO NRs. These features synergistically result in hysteresis-free, scan-independent, and stabilized devices with an efficiency of 16.1%. Electron-rich, nitrogen-doped ZnO (N:ZnO) NR-based electron transporting materials (ETMs) with enhanced electron mobility produced using ammonium acetate show consistently higher efficiencies by one to three power points than undoped ZnO NRs. Additionally, the preferential electrostatic interaction between the -nonpolar facets of N:ZnO and the conjugated polyelectrolyte polyethylenimine (PEI) has been relied on to promote the hydrothermal growth of high aspect ratio NR arrays and substantially improve the infiltration of the perovskite light absorber into the ETM. Using the same interactions, a conformal PEI coating on the electron-rich high aspect ratio N:ZnO NR arrays is -successfully applied, resulting in a favorable work function shift and altogether leading to the significant boost in efficiency from <10% up to >16%. These results largely surpass the state-of-the-art PCE of ZnO-based perovskite solar cells and highlight the benefits of synergistically combining mesoscale control with doping and surface modification. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Absence of Prenatal Forebrain Defects in the Dp(16)1Yey/+ Mouse Model of Down Syndrome. (United States)

    Goodliffe, Joseph W; Olmos-Serrano, Jose Luis; Aziz, Nadine M; Pennings, Jeroen L A; Guedj, Faycal; Bianchi, Diana W; Haydar, Tarik F


    Studies in humans with Down syndrome (DS) show that alterations in fetal brain development are followed by postnatal deficits in neuronal numbers, synaptic plasticity, and cognitive and motor function. This same progression is replicated in several mouse models of DS. Dp(16)1Yey/+ (hereafter called Dp16) is a recently developed mouse model of DS in which the entire region of mouse chromosome 16 that is homologous to human chromosome 21 has been triplicated. As such, Dp16 mice may more closely reproduce neurodevelopmental changes occurring in humans with DS. Here, we present the first comprehensive cellular and behavioral study of the Dp16 forebrain from embryonic to adult stages. Unexpectedly, our results demonstrate that Dp16 mice do not have prenatal brain defects previously reported in human fetal neocortex and in the developing forebrains of other mouse models, including microcephaly, reduced neurogenesis, and abnormal cell proliferation. Nevertheless, we found impairments in postnatal developmental milestones, fewer inhibitory forebrain neurons, and deficits in motor and cognitive performance in Dp16 mice. Therefore, although this new model does not express prenatal morphological phenotypes associated with DS, abnormalities in the postnatal period appear sufficient to produce significant cognitive deficits in Dp16. Copyright © 2016 the authors 0270-6474/16/362926-19$15.00/0.

  12. Di-Jet Production in Photon-Photon Collisions at $\\sqrt{s}_{ee}$ = 161 and 172 GeV

    CERN Document Server

    Abbiendi, G.; Alexander, G.; Allison, John; Altekamp, N.; Anderson, K.J.; Anderson, S.; Arcelli, S.; Asai, S.; Ashby, S.F.; Axen, D.; Azuelos, G.; Ball, A.H.; Barberio, E.; Barillari, T.; Barlow, Roger J.; Bartoldus, R.; Batley, J.R.; Baumann, S.; Bechtluft, J.; Behnke, T.; Bell, Kenneth Watson; Bella, G.; Bellerive, A.; Bentvelsen, S.; Bethke, S.; Betts, S.; Biebel, O.; Biguzzi, A.; Bird, S.D.; Blobel, V.; Bloodworth, I.J.; Bobinski, M.; Bock, P.; Bohme, J.; Bonacorsi, D.; Boutemeur, M.; Braibant, S.; Bright-Thomas, P.; Brigliadori, L.; Brown, Robert M.; Burckhart, H.J.; Burgard, C.; Burgin, R.; Capiluppi, P.; Carnegie, R.K.; Carter, A.A.; Carter, J.R.; Chang, C.Y.; Charlton, David G.; Chrisman, D.; Ciocca, C.; Clarke, P.E.L.; Clay, E.; Cohen, I.; Conboy, J.E.; Cooke, O.C.; Couyoumtzelis, C.; Coxe, R.L.; Cuffiani, M.; Dado, S.; Dallavalle, G.Marco; Davis, R.; De Jong, S.; del Pozo, L.A.; De Roeck, A.; Desch, K.; Dienes, B.; Dixit, M.S.; Dubbert, J.; Duchovni, E.; Duckeck, G.; Duerdoth, I.P.; Eatough, D.; Estabrooks, P.G.; Etzion, E.; Evans, H.G.; Fabbri, F.; Fanti, M.; Faust, A.A.; Fiedler, F.; Fierro, M.; Fleck, I.; Folman, R.; Furtjes, A.; Futyan, D.I.; Gagnon, P.; Gary, J.W.; Gascon, J.; Gascon-Shotkin, S.M.; Gaycken, G.; Geich-Gimbel, C.; Giacomelli, G.; Giacomelli, P.; Gibson, V.; Gibson, W.R.; Gingrich, D.M.; Glenzinski, D.; Goldberg, J.; Gorn, W.; Grandi, C.; Gross, E.; Grunhaus, J.; Gruwe, M.; Hanson, G.G.; Hansroul, M.; Hapke, M.; Harder, K.; Hargrove, C.K.; Hartmann, C.; Hauschild, M.; Hawkes, C.M.; Hawkings, R.; Hemingway, R.J.; Herndon, M.; Herten, G.; Heuer, R.D.; Hildreth, M.D.; Hill, J.C.; Hillier, S.J.; Hobson, P.R.; Hocker, James Andrew; Homer, R.J.; Honma, A.K.; Horvath, D.; Hossain, K.R.; Howard, R.; Huntemeyer, P.; Igo-Kemenes, P.; Imrie, D.C.; Ishii, K.; Jacob, F.R.; Jawahery, A.; Jeremie, H.; Jimack, M.; Jones, C.R.; Jovanovic, P.; Junk, T.R.; Karlen, D.; Kartvelishvili, V.; Kawagoe, K.; Kawamoto, T.; Kayal, P.I.; Keeler, R.K.; Kellogg, R.G.; Kennedy, B.W.; Klier, A.; Kluth, S.; Kobayashi, T.; Kobel, M.; Koetke, D.S.; Kokott, T.P.; Kolrep, M.; Komamiya, S.; Kowalewski, Robert V.; Kress, T.; Krieger, P.; von Krogh, J.; Kuhl, T.; Kyberd, P.; Lafferty, G.D.; Lanske, D.; Lauber, J.; Lautenschlager, S.R.; Lawson, I.; Layter, J.G.; Lazic, D.; Lee, A.M.; Lellouch, D.; Letts, J.; Levinson, L.; Liebisch, R.; List, B.; Littlewood, C.; Lloyd, A.W.; Lloyd, S.L.; Loebinger, F.K.; Long, G.D.; Losty, M.J.; Ludwig, J.; Lui, D.; Macchiolo, A.; Macpherson, A.; Mader, W.; Mannelli, M.; Marcellini, S.; Markopoulos, C.; Martin, A.J.; Martin, J.P.; Martinez, G.; Mashimo, T.; Mattig, Peter; McDonald, W.John; McKenna, J.; Mckigney, E.A.; McMahon, T.J.; McPherson, R.A.; Meijers, F.; Menke, S.; Merritt, F.S.; Mes, H.; Meyer, J.; Michelini, A.; Mihara, S.; Mikenberg, G.; Miller, D.J.; Mir, R.; Mohr, W.; Montanari, A.; Mori, T.; Nagai, K.; Nakamura, I.; Neal, H.A.; Nellen, B.; Nisius, R.; O'Neale, S.W.; Oakham, F.G.; Odorici, F.; Ogren, H.O.; Oreglia, M.J.; Orito, S.; Palinkas, J.; Pasztor, G.; Pater, J.R.; Patrick, G.N.; Patt, J.; Perez-Ochoa, R.; Petzold, S.; Pfeifenschneider, P.; Pilcher, J.E.; Pinfold, J.; Plane, David E.; Poffenberger, P.; Polok, J.; Przybycien, M.; Rembser, C.; Rick, H.; Robertson, S.; Robins, S.A.; Rodning, N.; Roney, J.M.; Roscoe, K.; Rossi, A.M.; Rozen, Y.; Runge, K.; Runolfsson, O.; Rust, D.R.; Sachs, K.; Saeki, T.; Sahr, O.; Sang, W.M.; Sarkisian, E.K.G.; Sbarra, C.; Schaile, A.D.; Schaile, O.; Scharf, F.; Scharff-Hansen, P.; Schieck, J.; Schmitt, B.; Schmitt, S.; Schoning, A.; Schroder, Matthias; Schumacher, M.; Schwick, C.; Scott, W.G.; Seuster, R.; Shears, T.G.; Shen, B.C.; Shepherd-Themistocleous, C.H.; Sherwood, P.; Siroli, G.P.; Sittler, A.; Skuja, A.; Smith, A.M.; Snow, G.A.; Sobie, R.; Soldner-Rembold, S.; Sproston, M.; Stahl, A.; Stephens, K.; Steuerer, J.; Stoll, K.; Strom, David M.; Strohmer, R.; Surrow, B.; Talbot, S.D.; Tanaka, S.; Taras, P.; Tarem, S.; Teuscher, R.; Thiergen, M.; Thomson, M.A.; von Torne, E.; Torrence, E.; Towers, S.; Trigger, I.; Trocsanyi, Z.; Tsur, E.; Turcot, A.S.; Turner-Watson, M.F.; Van Kooten, Rick J.; Vannerem, P.; Verzocchi, M.; Voss, H.; Wackerle, F.; Wagner, A.; Ward, C.P.; Ward, D.R.; Watkins, P.M.; Watson, A.T.; Watson, N.K.; Wells, P.S.; Wermes, N.; White, J.S.; Wilson, G.W.; Wilson, J.A.; Wyatt, T.R.; Yamashita, S.; Yekutieli, G.; Zacek, V.; Zer-Zion, D.


    Di-jet production is studied in collisions of quasi-real photons radiated by the LEP beams at e+e- centre-of-mass energies 161 and 172 GeV. The jets are reconstructed using a cone jet finding algorithm. The angular distributions of direct and double-resolved processes are measured and compared to the predictions of leading order and next-to-leading order perturbative QCD. The jet energy profiles are also studied. The inclusive two-jet cross-section is measured as a function of transverse energy and rapidity and compared to next-to-leading order perturbative QCD calculations. The inclusive two-jet cross-section as a function of rapidity is compared to the prediction of the leading order Monte Carlo generators PYTHIA and PHOJET. The Monte Carlo predictions are calculated with different parametrisations of the parton distributions of the photon. The influence of the `underlying event' has been studied to reduce the model dependence of the predicted jet cross-sections from the Monte Carlo generators.

  13. Mental Status Test Scores are Inversely Correlated with Tremor Severity: A Study of 161 Elderly Essential Tremor Cases

    Directory of Open Access Journals (Sweden)

    Elan D. Louis


    Full Text Available Background: There is an increasing awareness that patients with essential tremor (ET may exhibit non-motor features, including cognitive dysfunction. Yet there are surprisingly few data in ET on the association, if any, between cognitive dysfunction and motor dysfunction (i.e., tremor severity. Establishing links between the cognitive and motor features of ET would imply that the two share a common underlying pathogenic process. Recent neuroimaging data support this notion.Methods: ET cases were enrolled in a clinical–pathological study at Columbia University Medical Center, New York. The Folstein Mini-Mental State Examination (FMMSE and Modified Mini Mental Status Examination (mMMSE were administered. Action tremor was rated with a total tremor score (TTS.Results: There were 161 ET cases (mean age 83.9±5.7 years, median FMMSE 28, median mMMSE 50. The FMMSE and mMMSE were inversely correlated with the TTS (r = −0.22, p = 0.005; and r = −0.17, p = 0.029. The association, while statistically significant, was modest in magnitude. In linear regression models that adjusted for age, gender, and education, the association between cognitive test scores and TTS remained robust (p<0.001. After excluding 68 (42.2% cases taking ET medications with potential cognitive side effects, results remained unchanged.Conclusions: Each of the two cognitive test scores was associated with tremor severity such that greater cognitive dysfunction occurred in cases with more marked tremor. These data support recent imaging data, which suggest that the cerebellar neurodegeneration underlying ET may be involved in the expression of cognitive symptoms in ET.

  14. Rates of intraoperative complications and conversion to laparotomy during laparoscopic ovariectomy performed by veterinary students: 161 cases (2010-2014). (United States)

    Nylund, Adam M; Drury, Adam; Weir, Heather; Monnet, Eric


    OBJECTIVE To assess rates of intraoperative complications and conversion to laparotomy associated with supervised veterinary students performing laparoscopic ovariectomy in dogs. DESIGN Retrospective case series. ANIMALS 161 female shelter dogs for which elective laparoscopic ovariectomy had been performed by supervised senior (fourth-year) veterinary students from 2010 through 2014. PROCEDURES Medical records of all dogs were reviewed and data collected regarding duration of surgery, surgical complications and other characteristics, and whether conversion to laparotomy was required. RESULTS Laparoscopic ovariectomy was performed with a 2-cannula technique and a 10-mm vessel-sealing device for hemostasis in all dogs. A Veress needle was used for initial insufflation in 144 (89.4%) dogs; method of insufflation was not reported for the remaining 17 (10.6%) dogs. Mean ± SD duration of surgery was 114.90 ± 33.40 minutes. Surgical complications, all classified as minor blood loss, occurred in 24 (14.9%) dogs. These included splenic puncture during insertion of the Veress needle (n = 20 [12.4%]) and minor bleeding from the ovarian pedicle (4 [2.5%]). Splenic puncture required no intervention, and ovarian pedicle bleeding required application of the vessel-sealing device an additional time to control the bleeding. Two ovaries were dropped in the abdominal cavity at the time of removal. Both were retrieved without complication. Conversion to laparotomy was not required for any dog. All dogs were discharged from the hospital within 24 hours after surgery. CONCLUSIONS AND CLINICAL RELEVANCE Laparoscopic ovariectomy in dogs was performed safely by closely supervised novice surgeons, with only minor intraoperative complications encountered and no need for conversion to laparotomy.

  15. Palmitoleic acid isomer (C16:1delta6) in human skin sebum is effective against gram-positive bacteria. (United States)

    Wille, J J; Kydonieus, A


    The percent lipid composition of pooled human sebum analyzed by thin-layer chromatography was: ceramides (13%), fatty acid (47%), cholesterol (7%), cholesterol esters (2%), squalene (11%), triglycerides (3%), and wax esters (17%). Total sebum lipids (2- 4 mg/ml), sonicated into bacterial culture medium, caused 4- to 5-fold log reduction in growth of gram-positive bacteria, Staphylococcus aureus, Streptococcus salivarius and the anaerobe Fusobacterium nucleatum, but was ineffective against most gram-negative bacteria. Fractionation of the sebum lipids showed that both saturated and unsaturated fatty acids contained the bulk of the antimicrobial activity. Lauric acid (C12:0) was the most active saturated fatty acid. The unsaturated fatty acid, palmitoleic acid (C16:1delta6, cPA) was both the most predominant monoene and the most active antimicrobial fatty acid. Purified cPA (>99%) yielded typical minimal inhibitory concentration (MIC) values of 10-20 microg/ml against gram-positive bacteria. Organically synthesized cPA isomer gave MIC values comparable to the natural material. Both natural and synthetic cPA were found to be the most active sebum lipid fraction in blocking the adherence of a pathogenic strain of Candida albicans to porcine stratum corneum. Ethanol in combination with cPA exerts a synergistic bactericidal activity against gram-negative pathogenic bacteria, including Pseudomonas aeruginosa, Propionibacterium acnes, Escherichia coli, and several methacillin-resistant strains of S. aureus. Palmitoleic acid may be useful in topical formulations for treatment of secondary gram-positive bacterial infections, as a gram-positive bacteria antimicrobial in wound dressings, and as a natural gram-positive antimicrobial preservative in skin and hair care products. Copyright 2003 S. Karger AG, Basel

  16. Epidemiologia e distribuição de lesões extrarrenais de uremia em 161 cães

    Directory of Open Access Journals (Sweden)

    Isadora P. Silveira


    Full Text Available Resumo: Com o objetivo de determinar a epidemiologia e as características morfológicas, incluindo a localização anatômica, das lesões extrarrenais de uremia, bem como determinar as principais lesões do sistema urinário associadas à ocorrência de uremia, foram revisados os protocolos de necropsias de cães realizadas no Laboratório de Patologia Veterinária da Universidade Federal de Santa Maria de janeiro de 1996 a dezembro de 2012 (17 anos. Nesse período foram necropsiados 4.201 cães, sendo que 161 (3,8% apresentaram lesões extrarrenais de uremia. Em 134 cães (83,2% foram descritos sinais clínicos associados à uremia. As lesões extrarrenais mais frequentes, em ordem decrescente, foram: gastrite ulcerativa e hemorrágica (56,5%, mineralização de tecidos moles (55,9%, edema pulmonar (47,2%, estomatite e/ou glossite ulcerativa (30,4%, endocardite/trombose atrial e aórtica (28,6%, hiperplasia das paratireoides (9,3%, osteodistrofia fibrosa (8,1%, anemia (6,2%, laringite ulcerativa (5%, enterite ulcerativa/hemorrágica (3,7%, esofagite fibrinonecrótica (1,9% e pericardite fibrinosa (1.9%. Na maioria dos casos as lesões extrarrenais de uremia foram decorrentes de azotemia prolongada por lesões renais graves, sendo as mais prevalentes a nefrite intersticial e a glomerulonefrite.

  17. Search for anomalous production of dilepton events with missing transverse momentum in $e^{+} e^{-}$ collisions at $\\sqrt{s}$ = 161 and 172 GeV

    CERN Document Server

    Ackerstaff, K.; Allison, John; Altekamp, N.; Anderson, K.J.; Anderson, S.; Arcelli, S.; Asai, S.; Axen, D.; Azuelos, G.; Ball, A.H.; Barberio, E.; Barlow, Roger J.; Bartoldus, R.; Batley, J.R.; Baumann, S.; Bechtluft, J.; Beeston, C.; Behnke, T.; Bell, A.N.; Bell, Kenneth Watson; Bella, G.; Bentvelsen, S.; Bethke, S.; Biebel, O.; Biguzzi, A.; Bird, S.D.; Blobel, V.; Bloodworth, I.J.; Bloomer, J.E.; Bobinski, M.; Bock, P.; Bonacorsi, D.; Boutemeur, M.; Bouwens, B.T.; Braibant, S.; Brigliadori, L.; Brown, Robert M.; Burckhart, H.J.; Burgard, C.; Burgin, R.; Capiluppi, P.; Carnegie, R.K.; Carter, A.A.; Carter, J.R.; Chang, C.Y.; Charlton, David G.; Chrisman, D.; Clarke, P.E.L.; Cohen, I.; Conboy, J.E.; Cooke, O.C.; Cuffiani, M.; Dado, S.; Dallapiccola, C.; Dallavalle, G.Marco; Davis, R.; De Jong, S.; del Pozo, L.A.; Desch, K.; Dienes, B.; Dixit, M.S.; do Couto e Silva, E.; Doucet, M.; Duchovni, E.; Duckeck, G.; Duerdoth, I.P.; Eatough, D.; Edwards, J.E.G.; Estabrooks, P.G.; Evans, H.G.; Evans, M.; Fabbri, F.; Fanti, M.; Faust, A.A.; Fiedler, F.; Fierro, M.; Fischer, H.M.; Fleck, I.; Folman, R.; Fong, D.G.; Foucher, M.; Furtjes, A.; Futyan, D.I.; Gagnon, P.; Gary, J.W.; Gascon, J.; Gascon-Shotkin, S.M.; Geddes, N.I.; Geich-Gimbel, C.; Geralis, T.; Giacomelli, G.; Giacomelli, P.; Giacomelli, R.; Gibson, V.; Gibson, W.R.; Gingrich, D.M.; Glenzinski, D.; Goldberg, J.; Goodrick, M.J.; Gorn, W.; Grandi, C.; Gross, E.; Grunhaus, J.; Gruwe, M.; Hajdu, C.; Hanson, G.G.; Hansroul, M.; Hapke, M.; Hargrove, C.K.; Hart, P.A.; Hartmann, C.; Hauschild, M.; Hawkes, C.M.; Hawkings, R.; Hemingway, R.J.; Herndon, M.; Herten, G.; Heuer, R.D.; Hildreth, M.D.; Hill, J.C.; Hillier, S.J.; Hobson, P.R.; Homer, R.J.; Honma, A.K.; Horvath, D.; Hossain, K.R.; Howard, R.; Huntemeyer, P.; Hutchcroft, D.E.; Igo-Kemenes, P.; Imrie, D.C.; Ingram, M.R.; Ishii, K.; Jawahery, A.; Jeffreys, P.W.; Jeremie, H.; Jimack, M.; Joly, A.; Jones, C.R.; Jones, G.; Jones, M.; Jost, U.; Jovanovic, P.; Junk, T.R.; Karlen, D.; Kartvelishvili, V.; Kawagoe, K.; Kawamoto, T.; Kayal, P.I.; Keeler, R.K.; Kellogg, R.G.; Kennedy, B.W.; Kirk, J.; Klier, A.; Kluth, S.; Kobayashi, T.; Kobel, M.; Koetke, D.S.; Kokott, T.P.; Kolrep, M.; Komamiya, S.; Kress, T.; Krieger, P.; von Krogh, J.; Kyberd, P.; Lafferty, G.D.; Lahmann, R.; Lai, W.P.; Lanske, D.; Lauber, J.; Lautenschlager, S.R.; Layter, J.G.; Lazic, D.; Lee, A.M.; Lefebvre, E.; Lellouch, D.; Letts, J.; Levinson, L.; Lloyd, S.L.; Loebinger, F.K.; Long, G.D.; Losty, M.J.; Ludwig, J.; Macchiolo, A.; Macpherson, A.; Mannelli, M.; Marcellini, S.; Markus, C.; Martin, A.J.; Martin, J.P.; Martinez, G.; Mashimo, T.; Mattig, Peter; McDonald, W.John; McKenna, J.; Mckigney, E.A.; McMahon, T.J.; McPherson, R.A.; Meijers, F.; Menke, S.; Merritt, F.S.; Mes, H.; Meyer, J.; Michelini, A.; Mikenberg, G.; Miller, D.J.; Mincer, A.; Mir, R.; Mohr, W.; Montanari, A.; Mori, T.; Morii, M.; Muller, U.; Mihara, S.; Nagai, K.; Nakamura, I.; Neal, H.A.; Nellen, B.; Nisius, R.; O'Neale, S.W.; Oakham, F.G.; Odorici, F.; Ogren, H.O.; Oh, A.; Oldershaw, N.J.; Oreglia, M.J.; Orito, S.; Palinkas, J.; Pasztor, G.; Pater, J.R.; Patrick, G.N.; Patt, J.; Pearce, M.J.; Perez-Ochoa, R.; Petzold, S.; Pfeifenschneider, P.; Pilcher, J.E.; Pinfold, J.; Plane, David E.; Poffenberger, P.; Poli, B.; Posthaus, A.; Rees, D.L.; Rigby, D.; Robertson, S.; Robins, S.A.; Rodning, N.; Roney, J.M.; Rooke, A.; Ros, E.; Rossi, A.M.; Routenburg, P.; Rozen, Y.; Runge, K.; Runolfsson, O.; Ruppel, U.; Rust, D.R.; Rylko, R.; Sachs, K.; Saeki, T.; Sarkisian, E.K.G.; Sbarra, C.; Schaile, A.D.; Schaile, O.; Scharf, F.; Scharff-Hansen, P.; Schenk, P.; Schieck, J.; Schleper, P.; Schmitt, B.; Schmitt, S.; Schoning, A.; Schroder, Matthias; Schultz-Coulon, H.C.; Schumacher, M.; Schwick, C.; Scott, W.G.; Shears, T.G.; Shen, B.C.; Shepherd-Themistocleous, C.H.; Sherwood, P.; Siroli, G.P.; Sittler, A.; Skillman, A.; Skuja, A.; Smith, A.M.; Snow, G.A.; Sobie, R.; Soldner-Rembold, S.; Springer, Robert Wayne; Sproston, M.; Stephens, K.; Steuerer, J.; Stockhausen, B.; Stoll, K.; Strom, David M.; Szymanski, P.; Tafirout, R.; Talbot, S.D.; Tanaka, S.; Taras, P.; Tarem, S.; Teuscher, R.; Thiergen, M.; Thomson, M.A.; von Torne, E.; Towers, S.; Trigger, I.; Trocsanyi, Z.; Tsur, E.; Turcot, A.S.; Turner-Watson, M.F.; Utzat, P.; Van Kooten, Rick J.; Verzocchi, M.; Vikas, P.; Vokurka, E.H.; Voss, H.; Wackerle, F.; Wagner, A.; Ward, C.P.; Ward, D.R.; Watkins, P.M.; Watson, A.T.; Watson, N.K.; Wells, P.S.; Wermes, N.; White, J.S.; Wilkens, B.; Wilson, G.W.; Wilson, J.A.; Wolf, G.; Wyatt, T.R.; Yamashita, S.; Yekutieli, G.; Zacek, V.; Zer-Zion, D.


    Events containing a pair of charged leptons and significant missing transverse momentum are selected from a data sample corresponding to a total integrated luminosity of 20.6 pb^-1 at centre-of-mass energies of 161 GeV and 172 GeV. The observed number of events, four at 161 GeV and nine at 172 GeV, is consistent with the number expected from Standard Model processes, predominantly arising from W+W- production with each W decaying leptonically. This topology is also an experimental signature for the pair production of new particles that decay to a charged lepton accompanied by one or more invisible particles. Further event selection criteria are described that optimise the sensitivity to particular new physics channels. No evidence for new phenomena is observed and limits on the production of scalar charged lepton pairs and other new particles are presented.

  18. Clinical significance of pre-transplant circulating CD3(+) CD4(+) CD161(+) cell frequency on the occurrence of neutropenic infections after allogeneic stem cell transplantation. (United States)

    Kim, Tae Woo; Lee, Sung-Eun; Lim, Ji-Young; Ryu, Da-Bin; Jeon, Young-Woo; Yoon, Jae-Ho; Cho, Byung-Sik; Eom, Ki-Seong; Kim, Yoo-Jin; Kim, Hee-Je; Lee, Seok; Cho, Seok-Goo; Kim, Dong-Wook; Lee, Jong Wook; Min, Woo-Sung; Min, Chang-Ki


    Few studies have been performed to identify factors that are associated with an increased risk of infections during the neutropenic period in patients undergoing allogeneic stem cell transplantation (allo-SCT). The aim of this study was to identify the host immune cells responsible for infections before engraftment. A total of 282 patients who underwent allo-SCT were enrolled. Peripheral blood samples were collected before conditioning therapy. Expression of CD161-expressing T cells, natural killer cells, and immature myeloid cells was analyzed by flow cytometry. Microbially and clinically defined infections and fevers of unknown origin as proposed by the Immunocompromised Host Society were included in this study. The median age was 45 years (range, 16-68 years). Patients had various hematologic disorders and were transplanted from human leukocyte antigen (HLA)-matched siblings, unrelated donors, and familial HLA-mismatched donors. In univariate analysis, younger age and a familial HLA-mismatched donor were risk factors for the occurrence of infections. After adjusting for potential variables in univariate analysis, multivariate analyses revealed that a lower frequency of CD3(+) CD4(+) CD161(+) cells was significantly associated with the occurrence of neutropenic infections. An age of 35 years or younger and allografting from familial HLA-mismatched donors showed a trend toward higher infection rates. Our data indicated that a lower frequency of CD3(+) CD4(+) CD161(+) T cells in peripheral blood before conditioning therapy was associated with a higher incidence of infection during the neutropenic period. These results suggest that recipient innate T cells with expression of C-type lectin CD161 can guard against infections before engraftment. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  19. May TLR4 Asp299Gly and IL17 His161Arg polymorphism be associated with progression of primary measles infection to subacute sclerosing panencephalitis? (United States)

    Karakas-Celik, Sevim; Piskin, Ibrahim Etem; Keni, Mehmet Fatih; Calık, Mustafa; Iscan, Akın; Dursun, Ahmet


    SSPE is a progressive neurological disorder of children. Only some of the children who are infected with measles virus develop SSPE, which supports individual variation. TLR-2 and TLR-4 play an important role in innate immunity by recognizing envelope proteins of MV. Another important cytokine that plays an important role in orchestrating innate immune function is IL-17. The purpose of our study is to elucidate whether the TLR2, TLR4, IL17F and IL17A gene polymorphisms are susceptibility genes for the development of SSPE. Using the PCR-RFLP methods, the single nucleotide polymorphisms of TLR2 (Arg753Gln, Arg677Trp, -194 to -174 del), TLR4 (Asp299Gly and Thr399Ile) IL17F (His161Arg, Glu126Gly) and IL17A were studied in 54 patients with SSPE and 81 healthy controls. For Asp299Gly polymorphism of the TLR4 gene we found that there were no control individuals who were homozygous carriers of the Gly/Gly genotype, and the risk for SSPE increased at approximately 4.7 fold for the heterozygous carriers of the Asp/Gly genotype (OR 4.727, 95%-CI 1.192-18.742; P=0.01), when compared to healthy controls. Also our findings demonstrate that homozygosity for the Arg161 variant of the IL17F His161Arg polymorphism is inversely associated with development of SSPE (OR 0.114 95%-CI 0.026-0.494; P<0.001). In conclusion, it is suggested that variation in susceptibility to SSPE disease may be in part due to variations in TLR4 and IL17 function resulting from polymorphisms of TLR4 Asp299Gly and IL17F His161Arg. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. Solution NMR Structure and Backbone Dynamics of the Partially Disordered Arabidopsis thaliana Phloem Protein 16-1, A Putative mRNA Transporter. (United States)

    Sashi, Pulikallu; Singarapu, Kiran Kumar; Bhuyan, Abani K


    Although RNA-binding proteins in plant phloem are believed to carry out long-distance systemic transport of RNA in the phloem conduit, the structure of none of them is known. The Arabidopsis thaliana phloem protein 16-1 (AtPP16-1) is such a putative mRNA transporter whose structure and backbone dynamics have been studied at pH 4.1, 25oC, by high-resolution NMR spectroscopy. Results obtained using basic optical spectroscopic tools show that the protein is unstable with little secondary structure near the physiological pH of the phloem sap. Fluorescence-monitored titrations reveal that AtPP16-1 binds not only A. thaliana RNA (Kdiss ~ 67 nM) but also sheared DNA and model dodecamer DNA, albeit the affinity for DNA is ~15-fold less. In the solution structure of the protein secondary structural elements are formed of residues 3-9 (β1), 56-62 (β2), 133-135 (β3), and 96-110 (αα-helix). Most of the rest of the chain segments is disordered. The N-terminal disordered regions (residues 10-55) form a small lobe, which conjoins the rest of the molecule via a deep and large irregular cleft that could have functional implications. The average order parameter extracted by model-free analysis of 15N relaxation and {1H}-15N heteronuclear NOE data is 0.66, suggesting less restricted backbone motion. The average conformational entropy of the backbone NH vectors is -0.31 cal mol-1 K-1. These results also suggest structural disorder in AtPP16-1.

  1. The Effect of Problem Based Learning Strategic and Divergent Thinking Style on the Ability to Solve Environmental the Problems (An Experimental Study at SMP Negeri 161 Jakarta, 2015)


    Gultom, Saurmaida


    The aim of the research is to identify the influence of learning strategic and divergent thinking style on the ability to solve the problems in environmental topic biology subject matter. This research was conducted in SMP Negeri 161 Jakarta. Experimental method with factorial 2 x 2 was applied on this research. The sampling objects were 60-second grade students. The two ways Varian analysis (ANAVA) was used in hypothesis test and continued by t-Dunnet test. The research conclusion were: 1) G...

  2. Spectroscopic analysis of lithium terbium tetrafluoride

    DEFF Research Database (Denmark)

    Christensen, H.P.


    . The rare-earth site in LiTbF4 possesses S4 symmetry, which allows six crystal-field parameters. ζ and the six Bim were varied to obtain the best agreement with the experimentally observed levels. Keeping F2=434 cm-1 fixed, a fit with a standard deviation of 12 cm-1 was obtained at 10 K with the following...... were calculated by diagonalizing an effective spin-orbit and crystal-field Hamiltonian in an LS basis. H=Σλi(L→·S→)i+ΣαiΣBimOim, where the parameters λi are functions of the spin-orbit parameter ζ and the Slater parameter F2. The Oim and αi are Racah operators and reduced matrix elements, respectively...

  3. Inelastic critical scattering of neutrons from terbium

    DEFF Research Database (Denmark)

    Als-Nielsen, Jens Aage; Dietrich, O.W.; Marshall, W.


    We have measured the inelasticity of the critical neutron scattering in Tb above the Néel temperature. The results show that dynamical slowing down of fluctuations does occur at a second order phase transition.......We have measured the inelasticity of the critical neutron scattering in Tb above the Néel temperature. The results show that dynamical slowing down of fluctuations does occur at a second order phase transition....

  4. Abnormal CD161+ immune cells and retinoic acid receptor-related orphan receptor γt-mediate enhanced IL-17F expression in the setting of genetic hypertension. (United States)

    Singh, Madhu V; Cicha, Michael Z; Kumar, Santosh; Meyerholz, David K; Irani, Kaikobad; Chapleau, Mark W; Abboud, François M


    Hypertension is considered an immunologic disorder. However, the role of the IL-17 family in genetic hypertension in the spontaneously hypertensive rat (SHR) has not been investigated. We tested the hypothesis that enhanced TH17 programming and IL-17 expression in abundant CD161+ immune cells in SHRs represent an abnormal proinflammatory adaptive immune response. Furthermore, we propose that this response is driven by the master regulator retinoic acid receptor-related orphan receptor γt (RORγt) and a nicotinic proinflammatory innate immune response. We measured expression of the CD161 surface marker on splenocytes in SHRs and normotensive control Wistar-Kyoto (WKY) rats from birth to adulthood. We compared expression of IL-17A and IL-17F in splenic cells under different conditions. We then determined the functional effect of these cytokines on vascular reactivity. Finally, we tested whether pharmacologic inhibition of RORγt can attenuate hypertension in SHRs. SHRs exhibited an abnormally large population of CD161+ cells at birth that increased with age, reaching more than 30% of the splenocyte population at 38 weeks. The SHR splenocytes constitutively expressed more RORγt than those of WKY rats and produced more IL-17F on induction. Exposure of WKY rat aortas to IL-17F impaired endothelium-dependent vascular relaxation, whereas IL-17A did not. Moreover, in vivo inhibition of RORγt by digoxin decreased systolic blood pressure in SHRs. SHRs have a markedly enhanced potential for RORγt-driven expression of proinflammatory and prohypertensive IL-17F in response to innate immune activation. Increased RORγt and IL-17F levels contribute to SHR hypertension and might be therapeutic targets. Copyright © 2017 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  5. Space shuttle: Heat transfer rate measurements on Convair booster (B-15B-2) and North American Rockwell orbiter (161B) at nominal Mach number of 8 (United States)

    Warmbrod, J. D.; Martindale, W. R.; Matthews, R. K.


    Plotted and tabulated data from the thin-skin thermocouple phase of an experimental test program are presented. These data are representative of three events of simulated flight and are described as booster-orbiter ascent heating data, booster reentry heating data, and orbiter reentry heating data. The test was conducted in a 50-inch hypersonic tunnel b at a nominal Mach number of 8 and free-stream Reynolds number range of 700,000 to 3,700,000 per foot. The model employed was a 0.009 scale replica of the Convair B-15B-2 booster and North American Rockwell 161B orbiter.

  6. Search for the Standard Model Higgs Boson in $e^+ e^-$ Collisions at $\\sqrt{s}$ = 161-172 GeV

    CERN Document Server

    Ackerstaff, K; Allison, J; Altekamp, N; Anderson, K J; Anderson, S; Arcelli, S; Asai, S; Axen, D A; Azuelos, Georges; Ball, A H; Barberio, E; Barlow, R J; Bartoldus, R; Batley, J Richard; Baumann, S; Bechtluft, J; Beeston, C; Behnke, T; Bell, A N; Bell, K W; Bella, G; Bentvelsen, Stanislaus Cornelius Maria; Bethke, Siegfried; Biebel, O; Biguzzi, A; Bird, S D; Blobel, Volker; Bloodworth, Ian J; Bloomer, J E; Bobinski, M; Bock, P; Bonacorsi, D; Boutemeur, M; Bouwens, B T; Braibant, S; Brigliadori, L; Brown, R M; Burckhart, Helfried J; Burgard, C; Bürgin, R; Capiluppi, P; Carnegie, R K; Carter, A A; Carter, J R; Chang, C Y; Charlton, D G; Chrisman, D; Clarke, P E L; Cohen, I; Conboy, J E; Cooke, O C; Cuffiani, M; Dado, S; Dallapiccola, C; Dallavalle, G M; Davis, R; De Jong, S; del Pozo, L A; Desch, Klaus; Dienes, B; Dixit, M S; do Couto e Silva, E; Doucet, M; Duchovni, E; Duckeck, G; Duerdoth, I P; Eatough, D; Edwards, J E G; Estabrooks, P G; Evans, H G; Evans, M; Fabbri, Franco Luigi; Fanti, M; Faust, A A; Fiedler, F; Fierro, M; Fischer, H M; Fleck, I; Folman, R; Fong, D G; Foucher, M; Fürtjes, A; Futyan, D I; Gagnon, P; Gary, J W; Gascon, J; Gascon-Shotkin, S M; Geddes, N I; Geich-Gimbel, C; Geralis, T; Giacomelli, G; Giacomelli, P; Giacomelli, R; Gibson, V; Gibson, W R; Gingrich, D M; Glenzinski, D A; Goldberg, J; Goodrick, M J; Gorn, W; Grandi, C; Gross, E; Grunhaus, Jacob; Gruwé, M; Hajdu, C; Hanson, G G; Hansroul, M; Hapke, M; Hargrove, C K; Hart, P A; Hartmann, C; Hauschild, M; Hawkes, C M; Hawkings, R; Hemingway, Richard J; Herndon, M; Herten, G; Heuer, R D; Hildreth, M D; Hill, J C; Hillier, S J; Hobson, P R; Homer, R James; Honma, A K; Horváth, D; Hossain, K R; Howard, R; Hüntemeyer, P; Hutchcroft, D E; Igo-Kemenes, P; Imrie, D C; Ingram, M R; Ishii, K; Jawahery, A; Jeffreys, P W; Jeremie, H; Jimack, Martin Paul; Joly, A; Jones, C R; Jones, G; Jones, M; Jost, U; Jovanovic, P; Junk, T R; Karlen, D A; Kartvelishvili, V G; Kawagoe, K; Kawamoto, T; Kayal, P I; Keeler, Richard K; Kellogg, R G; Kennedy, B W; Kirk, J; Klier, A; Kluth, S; Kobayashi, T; Kobel, M; Koetke, D S; Kokott, T P; Kolrep, M; Komamiya, S; Kress, T; Krieger, P; Von Krogh, J; Kyberd, P; Lafferty, G D; Lahmann, R; Lai, W P; Lanske, D; Lauber, J; Lautenschlager, S R; Layter, J G; Lazic, D; Lee, A M; Lefebvre, E; Lellouch, Daniel; Letts, J; Levinson, L; Lloyd, S L; Loebinger, F K; Long, G D; Losty, Michael J; Ludwig, J; Macchiolo, A; MacPherson, A L; Mannelli, M; Marcellini, S; Markus, C; Martin, A J; Martin, J P; Martínez, G; Mashimo, T; Mättig, P; McDonald, W J; McKenna, J A; McKigney, E A; McMahon, T J; McPherson, R A; Meijers, F; Menke, S; Merritt, F S; Mes, H; Meyer, J; Michelini, Aldo; Mikenberg, G; Miller, D J; Mincer, A; Mir, R; Mohr, W; Montanari, A; Mori, T; Morii, M; Müller, U; Mihara, S; Nagai, K; Nakamura, I; Neal, H A; Nellen, B; Nisius, R; O'Neale, S W; Oakham, F G; Odorici, F; Ögren, H O; Oh, A; Oldershaw, N J; Oreglia, M J; Orito, S; Pálinkás, J; Pásztor, G; Pater, J R; Patrick, G N; Patt, J; Pearce, M J; Pérez-Ochoa, R; Petzold, S; Pfeifenschneider, P; Pilcher, J E; Pinfold, J L; Plane, D E; Poffenberger, P R; Poli, B; Posthaus, A; Rees, D L; Rigby, D; Robertson, S; Robins, S A; Rodning, N L; Roney, J M; Rooke, A M; Ros, E; Rossi, A M; Routenburg, P; Rozen, Y; Runge, K; Runólfsson, O; Ruppel, U; Rust, D R; Rylko, R; Sachs, K; Saeki, T; Sarkisyan-Grinbaum, E; Sbarra, C; Schaile, A D; Schaile, O; Scharf, F; Scharff-Hansen, P; Schenk, P; Schieck, J; Schleper, P; Schmitt, B; Schmitt, S; Schöning, A; Schröder, M; Schultz-Coulon, H C; Schumacher, M; Schwick, C; Scott, W G; Shears, T G; Shen, B C; Shepherd-Themistocleous, C H; Sherwood, P; Siroli, G P; Sittler, A; Skillman, A; Skuja, A; Smith, A M; Snow, G A; Sobie, Randall J; Söldner-Rembold, S; Springer, R W; Sproston, M; Stephens, K; Steuerer, J; Stockhausen, B; Stoll, K; Strom, D; Szymanski, P; Tafirout, R; Talbot, S D; Tanaka, S; Taras, P; Tarem, S; Teuscher, R; Thiergen, M; Thomson, M A; Von Törne, E; Towers, S; Trigger, I; Trócsányi, Z L; Tsur, E; Turcot, A S; Turner-Watson, M F; Utzat, P; Van Kooten, R; Verzocchi, M; Vikas, P; Vokurka, E H; Voss, H; Wäckerle, F; Wagner, A; Ward, C P; Ward, D R; Watkins, P M; Watson, A T; Watson, N K; Wells, P S; Wermes, N; White, J S; Wilkens, B; Wilson, G W; Wilson, J A; Wolf, G; Wyatt, T R; Yamashita, S; Yekutieli, G; Zacek, V; Zer-Zion, D


    This paper describes a search for the Standard Model Higgs boson using data from e^+e^- collisions collected at center-of-mass energies of 161, 170 and 172 GeV by the OPAL detector at LEP. The data collected at these energies correspond to integrated luminosities of 10.0, 1.0 and 9.4 pb^-1, respectively. The search is sensitive to the main final states from the process in which the Higgs boson is produced in association with a fermion anti-fermion pair, namely four jets, two jets with missing energy, and two jets produced together with a pair of electron, muon or tau leptons. One candidate event is observed, in agreement with the Standard Model background expectation. In combination with previous OPAL searches at center-of-mass energies close to the Z^0 resonance and the revised previous OPAL searches at 161 GeV, we derive a lower limit of 69.4 GeV for the mass of the Standard Model Higgs boson at the 95% confidence level.

  7. MicroRNA-15a and -16-1 act via MYB to elevate fetal hemoglobin expression in human trisomy 13. (United States)

    Sankaran, Vijay G; Menne, Tobias F; Šćepanović, Danilo; Vergilio, Jo-Anne; Ji, Peng; Kim, Jinkuk; Thiru, Prathapan; Orkin, Stuart H; Lander, Eric S; Lodish, Harvey F


    Many human aneuploidy syndromes have unique phenotypic consequences, but in most instances it is unclear whether these phenotypes are attributable to alterations in the dosage of specific genes. In human trisomy 13, there is delayed switching and persistence of fetal hemoglobin (HbF) and elevation of embryonic hemoglobin in newborns. Using partial trisomy cases, we mapped this trait to chromosomal band 13q14; by examining the genes in this region, two microRNAs, miR-15a and -16-1, appear as top candidates for the elevated HbF levels. Indeed, increased expression of these microRNAs in primary human erythroid progenitor cells results in elevated fetal and embryonic hemoglobin gene expression. Moreover, we show that a direct target of these microRNAs, MYB, plays an important role in silencing the fetal and embryonic hemoglobin genes. Thus we demonstrate how the developmental regulation of a clinically important human trait can be better understood through the genetic and functional study of aneuploidy syndromes and suggest that miR-15a, -16-1, and MYB may be important therapeutic targets to increase HbF levels in patients with sickle cell disease and β-thalassemia.

  8. Identification of a recombinant inulin fructotransferase (difructose dianhydride III forming) from Arthrobacter sp. 161MFSha2.1 with high specific activity and remarkable thermostability. (United States)

    Wang, Xiao; Yu, Shuhuai; Zhang, Tao; Jiang, Bo; Mu, Wanmeng


    Difructose dianhydride III (DFA III) is a functional carbohydrate produced from inulin by inulin fructotransferase (IFTase, EC In this work, an IFTase gene from Arthrobacter sp. 161MFSha2.1 was cloned and expressed in Escherachia coli. The recombinant enzyme was purified by metal affinity chromatography. It showed significant inulin hydrolysis activity, and the produced main product from inulin was determined as DFA III by nuclear magnetic resonance analysis. The molecular mass of the purified protein was calculated to be 43 and 125 kDa by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and gel filtration, respectively, suggesting the native enzyme might be a homotrimer. The recombinant enzyme showed maximal activity as 2391 units/mg at pH 6.5 and 55 °C. It displayed the highest thermostability among previously reported IFTases (DFA III forming) and was stable up to 80 °C for 4 h of incubation. The smallest substrate was determined as nystose. The conversion ratio of inulin to DFA III reached 81% when 100 g/L inulin was catalyzed by 80 nM recombinant enzyme for 20 min at pH 6.5 and 55 °C. All of these data indicated that the IFTase (DFA III forming) from Arthrobacter sp. 161MFSha2.1 had great potential for industrial DFA III production.

  9. Search for Acoplanar Lepton Pair Events in $e^{+}e^{-}$ Collisions at $\\sqrt{s}$ = 161, 172 and 183 GeV

    CERN Document Server

    Abbiendi, G.; Alexander, G.; Allison, John; Altekamp, N.; Anderson, K.J.; Anderson, S.; Arcelli, S.; Asai, S.; Ashby, S.F.; Axen, D.; Azuelos, G.; Ball, A.H.; Barberio, E.; Barlow, Roger J.; Bartoldus, R.; Batley, J.R.; Baumann, S.; Bechtluft, J.; Behnke, T.; Bell, Kenneth Watson; Bella, G.; Bellerive, A.; Bentvelsen, S.; Bethke, S.; Betts, S.; Biebel, O.; Biguzzi, A.; Bird, S.D.; Blobel, V.; Bloodworth, I.J.; Bobinski, M.; Bock, P.; Bohme, J.; Bonacorsi, D.; Boutemeur, M.; Braibant, S.; Bright-Thomas, P.; Brigliadori, L.; Brown, Robert M.; Burckhart, H.J.; Burgard, C.; Burgin, R.; Capiluppi, P.; Carnegie, R.K.; Carter, A.A.; Carter, J.R.; Chang, C.Y.; Charlton, David G.; Chrisman, D.; Ciocca, C.; Clarke, P.E.L.; Clay, E.; Cohen, I.; Conboy, J.E.; Cooke, O.C.; Couyoumtzelis, C.; Coxe, R.L.; Cuffiani, M.; Dado, S.; Dallavalle, G.Marco; Davis, R.; De Jong, S.; del Pozo, L.A.; De Roeck, A.; Desch, K.; Dienes, B.; Dixit, M.S.; Dubbert, J.; Duchovni, E.; Duckeck, G.; Duerdoth, I.P.; Eatough, D.; Estabrooks, P.G.; Etzion, E.; Evans, H.G.; Fabbri, F.; Fanti, M.; Faust, A.A.; Fiedler, F.; Fierro, M.; Fleck, I.; Folman, R.; Furtjes, A.; Futyan, D.I.; Gagnon, P.; Gary, J.W.; Gascon, J.; Gascon-Shotkin, S.M.; Gaycken, G.; Geich-Gimbel, C.; Giacomelli, G.; Giacomelli, P.; Gibson, V.; Gibson, W.R.; Gingrich, D.M.; Glenzinski, D.; Goldberg, J.; Gorn, W.; Grandi, C.; Gross, E.; Grunhaus, J.; Gruwe, M.; Hanson, G.G.; Hansroul, M.; Hapke, M.; Harder, K.; Hargrove, C.K.; Hartmann, C.; Hauschild, M.; Hawkes, C.M.; Hawkings, R.; Hemingway, R.J.; Herndon, M.; Herten, G.; Heuer, R.D.; Hildreth, M.D.; Hill, J.C.; Hillier, S.J.; Hobson, P.R.; Hocker, James Andrew; Homer, R.J.; Honma, A.K.; Horvath, D.; Hossain, K.R.; Howard, R.; Huntemeyer, P.; Igo-Kemenes, P.; Imrie, D.C.; Ishii, K.; Jacob, F.R.; Jawahery, A.; Jeremie, H.; Jimack, M.; Jones, C.R.; Jovanovic, P.; Junk, T.R.; Karlen, D.; Kartvelishvili, V.; Kawagoe, K.; Kawamoto, T.; Kayal, P.I.; Keeler, R.K.; Kellogg, R.G.; Kennedy, B.W.; Klier, A.; Kluth, S.; Kobayashi, T.; Kobel, M.; Koetke, D.S.; Kokott, T.P.; Kolrep, M.; Komamiya, S.; Kowalewski, Robert V.; Kress, T.; Krieger, P.; von Krogh, J.; Kuhl, T.; Kyberd, P.; Lafferty, G.D.; Lanske, D.; Lauber, J.; Lautenschlager, S.R.; Lawson, I.; Layter, J.G.; Lazic, D.; Lee, A.M.; Lellouch, D.; Letts, J.; Levinson, L.; Liebisch, R.; List, B.; Littlewood, C.; Lloyd, A.W.; Lloyd, S.L.; Loebinger, F.K.; Long, G.D.; Losty, M.J.; Ludwig, J.; Lui, D.; Macchiolo, A.; Macpherson, A.; Mader, W.; Mannelli, M.; Marcellini, S.; Markopoulos, C.; Martin, A.J.; Martin, J.P.; Martinez, G.; Mashimo, T.; Mattig, Peter; McDonald, W.John; McKenna, J.; Mckigney, E.A.; McMahon, T.J.; McPherson, R.A.; Meijers, F.; Menke, S.; Merritt, F.S.; Mes, H.; Meyer, J.; Michelini, A.; Mihara, S.; Mikenberg, G.; Miller, D.J.; Mir, R.; Mohr, W.; Montanari, A.; Mori, T.; Nagai, K.; Nakamura, I.; Neal, H.A.; Nellen, B.; Nisius, R.; O'Neale, S.W.; Oakham, F.G.; Odorici, F.; Ogren, H.O.; Oreglia, M.J.; Orito, S.; Palinkas, J.; Pasztor, G.; Pater, J.R.; Patrick, G.N.; Patt, J.; Perez-Ochoa, R.; Petzold, S.; Pfeifenschneider, P.; Pilcher, J.E.; Pinfold, J.; Plane, David E.; Poffenberger, P.; Polok, J.; Przybycien, M.; Rembser, C.; Rick, H.; Robertson, S.; Robins, S.A.; Rodning, N.; Roney, J.M.; Roscoe, K.; Rossi, A.M.; Rozen, Y.; Runge, K.; Runolfsson, O.; Rust, D.R.; Sachs, K.; Saeki, T.; Sahr, O.; Sang, W.M.; Sarkisian, E.K.G.; Sbarra, C.; Schaile, A.D.; Schaile, O.; Scharf, F.; Scharff-Hansen, P.; Schieck, J.; Schmitt, B.; Schmitt, S.; Schoning, A.; Schroder, Matthias; Schumacher, M.; Schwick, C.; Scott, W.G.; Seuster, R.; Shears, T.G.; Shen, B.C.; Shepherd-Themistocleous, C.H.; Sherwood, P.; Siroli, G.P.; Sittler, A.; Skuja, A.; Smith, A.M.; Snow, G.A.; Sobie, R.; Soldner-Rembold, S.; Sproston, M.; Stahl, A.; Stephens, K.; Steuerer, J.; Stoll, K.; Strom, David M.; Strohmer, R.; Surrow, B.; Talbot, S.D.; Tanaka, S.; Taras, P.; Tarem, S.; Teuscher, R.; Thiergen, M.; Thomson, M.A.; von Torne, E.; Torrence, E.; Towers, S.; Trigger, I.; Trocsanyi, Z.; Tsur, E.; Turcot, A.S.; Turner-Watson, M.F.; Van Kooten, Rick J.; Vannerem, P.; Verzocchi, M.; Voss, H.; Wackerle, F.; Wagner, A.; Ward, C.P.; Ward, D.R.; Watkins, P.M.; Watson, A.T.; Watson, N.K.; Wells, P.S.; Wermes, N.; White, J.S.; Wilson, G.W.; Wilson, J.A.; Wyatt, T.R.; Yamashita, S.; Yekutieli, G.; Zacek, V.; Zer-Zion, D.


    A selection of di-lepton events with significant missing transverse momentum has been performed using a total data sample of 77.0 pb-1 at e+e- centre-of-mass energies of 161 GeV, 172 GeV and 183 GeV. The observed numbers of events: four at 161 GeV, nine at 172 GeV, and 78 at 183 GeV, are consistent with the numbers expected from Standard Model processes, which arise predominantly from W+W- production with each W decaying leptonically. This topology is an experimental signature also for the pair production of new particles that decay to a charged lepton accompanied by one or more invisible particles. Further event selection criteria are described that optimise the sensitivity to particular new physics channels. No evidence for new phenomena is apparent and model independent limits on the production cross-section times branching ratio squared for various new physics processes are presented. Assuming a 100% branching ratio for the decay of a right-handed charged slepton to a charged lepton and the lightest neutr...

  10. Search for neutral and charged Higgs bosons in $e^+ e^-$ collisions at $\\sqrt{s}= 161 GeV$ and $172 GeV$

    CERN Document Server

    Abreu, P; Adye, T; Adzic, P; Ajinenko, I; Alekseev, G D; Alemany, R; Allport, P P; Almehed, S; Amaldi, Ugo; Amato, S; Andersson, P; Andreazza, A; Antilogus, P; Apel, W D; Arnoud, Y; Åsman, B; Augustin, J E; Augustinus, A; Baillon, Paul; Bambade, P; Barbi, M S; Bardin, Dimitri Yuri; Barker, G; Baroncelli, A; Bärring, O; Bates, M J; Battaglia, Marco; Baubillier, M; Baudot, J; Becks, K H; Begalli, M; Beillière, P; Belokopytov, Yu A; Benvenuti, Alberto C; Bérat, C; Berggren, M; Bertini, D; Bertrand, D; Besançon, M; Bianchi, F; Bigi, M; Bilenky, S M; Billoir, P; Bizouard, M A; Bloch, D; Blume, M; Bonesini, M; Bonivento, W; Boonekamp, M; Booth, P S L; Borgland, A W; Borisov, G; Bosio, C; Botner, O; Boudinov, E; Bouquet, B; Bourdarios, C; Bowcock, T J V; Bozzo, M; Branchini, P; Brand, K D; Brenke, T; Brenner, R A; Brown, R C A; Brückman, P; Brunet, J M; Bugge, L; Buran, T; Burgsmüller, T; Buschmann, P; Cabrera, S; Caccia, M; Calvi, M; Camacho-Rozas, A J; Camporesi, T; Canale, V; Canepa, M; Carena, F; Carroll, L; Caso, Carlo; Castillo-Gimenez, M V; Cattai, A; Cavallo, F R; Chabaud, V; Charpentier, P; Chaussard, L; Checchia, P; Chelkov, G A; Chen, M; Chierici, R; Chliapnikov, P V; Chochula, P; Chorowicz, V; Chudoba, J; Cindro, V; Collins, P; Colomer, M; Contri, R; Cortina, E; Cosme, G; Cossutti, F; Cowell, J H; Crawley, H B; Crennell, D J; Crosetti, G; Cuevas-Maestro, J; Czellar, S; Dahm, J; D'Almagne, B; Damgaard, G; Dauncey, P D; Davenport, Martyn; Da Silva, W; Deghorain, A; Della Ricca, G; Delpierre, P A; Demaria, N; De Angelis, A; de Boer, Wim; De Brabandere, S; De Clercq, C; La Vaissière, C de; De Lotto, B; De Min, A; De Paula, L S; Dijkstra, H; Di Ciaccio, Lucia; Di Diodato, A; Djannati, A; Dolbeau, J; Doroba, K; Dracos, M; Drees, J; Drees, K A; Dris, M; Durand, J D; Edsall, D M; Ehret, R; Eigen, G; Ekelöf, T J C; Ekspong, Gösta; Elsing, M; Engel, J P; Erzen, B; Espirito-Santo, M C; Falk, E; Fanourakis, G K; Fassouliotis, D; Feindt, Michael; Fenyuk, A; Ferrari, P; Ferrer, A; Fichet, S; Filippas-Tassos, A; Firestone, A; Fischer, P A; Föth, H; Fokitis, E; Fontanelli, F; Formenti, F; Franek, B J; Frodesen, A G; Frühwirth, R; Fulda-Quenzer, F; Fuster, J A; Galloni, A; Gamba, D; Gandelman, M; García, C; García, J; Gaspar, C; Gasparini, U; Gavillet, P; Gazis, E N; Gelé, D; Gerber, J P; Gerdyukov, L N; Gokieli, R; Golob, B; Gonçalves, P; Gopal, Gian P; Gorn, L; Górski, M; Guz, Yu; Gracco, Valerio; Graziani, E; Green, C; Grefrath, A; Gris, P; Grosdidier, G; Grzelak, K; Günther, M; Guy, J; Hahn, F; Hahn, S; Hajduk, Z; Hallgren, A; Hamacher, K; Harris, F J; Hedberg, V; Henriques, R P; Hernández, J J; Herquet, P; Herr, H; Hessing, T L; Heuser, J M; Higón, E; Holmgren, S O; Holt, P J; Holthuizen, D J; Hoorelbeke, S; Houlden, M A; Hrubec, Josef; Huet, K; Hultqvist, K; Jackson, J N; Jacobsson, R; Jalocha, P; Janik, R; Jarlskog, C; Jarlskog, G; Jarry, P; Jean-Marie, B; Johansson, E K; Jönsson, L B; Jönsson, P E; Joram, Christian; Juillot, P; Kaiser, M; Kapusta, F; Karafasoulis, K; Karvelas, E; Katsanevas, S; Katsoufis, E C; Keränen, R; Khokhlov, Yu A; Khomenko, B A; Khovanskii, N N; King, B J; Kjaer, N J; Klapp, O; Klein, H; Kluit, P M; Knoblauch, D; Kokkinias, P; Koratzinos, M; Korcyl, K; Kostyukhin, V; Kourkoumelis, C; Kuznetsov, O; Krammer, Manfred; Kreuter, C; Kronkvist, I J; Krumshtein, Z; Krupinski, W; Kubinec, P; Kucewicz, W; Kurvinen, K L; Lacasta, C; Laktineh, I; Lamsa, J; Lanceri, L; Lane, D W; Langefeld, P; Laugier, J P; Lauhakangas, R; Leder, Gerhard; Ledroit, F; Lefébure, V; Legan, C K; Leisos, A; Leitner, R; Lemonne, J; Lenzen, Georg; Lepeltier, V; Lesiak, T; Lethuillier, M; Libby, J; Liko, D; Lipniacka, A; Lippi, I; Lörstad, B; Loken, J G; López, J M; Loukas, D; Lutz, P; Lyons, L; Naughton, J M; Maehlum, G; Mahon, J R; Maio, A; Malmgren, T G M; Malychev, V; Mandl, F; Marco, J; Marco, R P; Maréchal, B; Margoni, M; Marin, J C; Mariotti, C; Markou, A; Martínez-Rivero, C; Martínez-Vidal, F; Martí i García, S; Masik, J; Matorras, F; Matteuzzi, C; Matthiae, Giorgio; Mazzucato, M; McCubbin, M L; McKay, R; McNulty, R; McPherson, G; Medbo, J; Meroni, C; Meyer, S; Meyer, W T; Michelotto, M; Migliore, E; Mirabito, L; Mitaroff, Winfried A; Mjörnmark, U; Moa, T; Møller, R; Mönig, K; Monge, M R; Morettini, P; Müller, H; Münich, K; Mulders, M; Mundim, L M; Murray, W J; Muryn, B; Myatt, Gerald; Myklebust, T; Naraghi, F; Navarria, Francesco Luigi; Navas, S; Nawrocki, K; Negri, P; Némécek, S; Neumann, W; Neumeister, N; Nicolaidou, R; Nielsen, B S; Nieuwenhuizen, M; Nikolaenko, V; Nikolenko, M; Niss, P; Nomerotski, A; Normand, Ainsley; Nygren, A; Oberschulte-Beckmann, W; Obraztsov, V F; Olshevskii, A G; Onofre, A; Orava, Risto; Orazi, G; Ortuno, S; Österberg, K; Ouraou, A; Paganini, P; Paganoni, M; Paiano, S; Pain, R; Palka, H; Papadopoulou, T D; Papageorgiou, K; Pape, L; Parkes, C; Parodi, F; Parzefall, U; Passeri, A; Pegoraro, M; Peralta, L; Pernegger, H; Pernicka, Manfred; Perrotta, A; Petridou, C; Petrolini, A; Phillips, H T; Piana, G; Pierre, F; Pimenta, M; Piotto, E; Podobnik, T; Podobrin, O; Pol, M E; Polok, G; Poropat, P; Pozdnyakov, V; Privitera, P; Pukhaeva, N; Pullia, Antonio; Radojicic, D; Ragazzi, S; Rahmani, H; Ratoff, P N; Read, A L; Reale, M; Rebecchi, P; Redaelli, N G; Regler, Meinhard; Reid, D; Reinhardt, R; Renton, P B; Resvanis, L K; Richard, F; Rídky, J; Rinaudo, G; Røhne, O M; Romero, A; Ronchese, P; Roos, L; Rosenberg, E I; Rosinsky, P; Roudeau, Patrick; Rovelli, T; Ruhlmann-Kleider, V; Ruiz, A; Rybicki, K; Saarikko, H; Sacquin, Yu; Sadovskii, A; Sajot, G; Salt, J; Sannino, M; Schneider, H; Schwickerath, U; Schyns, M A E; Sciolla, G; Scuri, F; Seager, P; Sedykh, Yu; Segar, A M; Seitz, A; Sekulin, R L; Serbelloni, L; Shellard, R C; Sheridan, A; Siegrist, P; Silvestre, R; Simonetto, F; Sissakian, A N; Skaali, T B; Smadja, G; Smirnova, O G; Smith, G R; Sokolov, A; Solovyanov, O; Sosnowski, R; Souza-Santos, D; Spassoff, Tz; Spiriti, E; Sponholz, P; Squarcia, S; Stampfer, D; Stanescu, C; Stanic, S; Stapnes, Steinar; Stavitski, I; Stevenson, K; Stocchi, A; Strauss, J; Strub, R; Stugu, B; Szczekowski, M; Szeptycka, M; Tabarelli de Fatis, T; Tavernet, J P; Chernyaev, E; Chikilev, O G; Tegenfeldt, F; Terranova, F; Thomas, J; Tilquin, A; Timmermans, J; Tkatchev, L G; Todorov, T; Todorova, S; Toet, D Z; Tomaradze, A G; Tomé, B; Tonazzo, A; Tortora, L; Tranströmer, G; Treille, D; Tristram, G; Trombini, A; Troncon, C; Tsirou, A L; Turluer, M L; Tyapkin, I A; Tyndel, M; Tzamarias, S; Überschär, B; Ullaland, O; Uvarov, V; Valenti, G; Vallazza, E; Van der Velde, C; van Apeldoorn, G W; van Dam, P; Van Doninck, W K; Van Eldik, J; Van Lysebetten, A; Vassilopoulos, N; Vegni, G; Ventura, L; Venus, W A; Verbeure, F; Verlato, M; Vertogradov, L S; Vilanova, D; Vincent, P; Vitale, L; Vlasov, E; Vodopyanov, A S; Vrba, V; Wahlen, H; Walck, C; Waldner, F; Weiser, C; Wetherell, Alan M; Wicke, D; Wickens, J H; Wielers, M; Wilkinson, G R; Williams, W S C; Winter, M; Witek, M; Wlodek, T; Yi, J; Yip, K; Yushchenko, O P; Zach, F; Zaitsev, A; Zalewska-Bak, A; Zalewski, Piotr; Zavrtanik, D; Zevgolatakos, E; Zimin, N I; Zucchelli, G C; Zumerle, G


    A search for neutral and charged Higgs bosons has been performed in the data collected by the {\\sc DELPHI} detector at centre-of-mass energies of 161~GeV and 172~GeV. The analysis assumes either the pair-production of charged Higgs bosons, ${\\mathrm H}^{\\pm}$, or the production of the lightest neutral Higgs boson, h, with either a Z or a neutral pseudoscalar Higgs boson, A. All final state topologies expected from the decay of h and A %neutral Higgs particles into hadrons or a pair of $\\tau$ leptons, and from the decay of ${\\mathrm H}^{\\pm}$ %charged Higgs bosons into a pair of quarks or a $\\tau \

  11. Searches for supersymmetry in the photon(s) plus missing energy channels at $\\sqrt{s}$ = 161 GeV and 172 GeV

    CERN Document Server

    Barate, R.; Decamp, D.; Ghez, Philippe; Goy, C.; Lees, J.P.; Lucotte, A.; Minard, M.N.; Nief, J.Y.; Pietrzyk, B.; Casado, M.P.; Chmeissani, M.; Comas, P.; Crespo, J.M.; Delfino, M.; Fernandez, E.; Fernandez-Bosman, M.; Garrido, L.; Juste, A.; Martinez, M.; Merino, G.; Miquel, R.; Mir, L.M.; Padilla, C.; Park, I.C.; Pascual, A.; Perlas, J.A.; Riu, I.; Sanchez, F.; Colaleo, A.; Creanza, D.; de Palma, M.; Gelao, G.; Iaselli, G.; Maggi, G.; Maggi, M.; Marinelli, N.; Nuzzo, S.; Ranieri, A.; Raso, G.; Ruggieri, F.; Selvaggi, G.; Silvestris, L.; Tempesta, P.; Tricomi, A.; Zito, G.; Huang, X.; Lin, J.; Ouyang, Q.; Wang, T.; Xie, Y.; Xu, R.; Xue, S.; Zhang, J.; Zhang, L.; Zhao, W.; Abbaneo, D.; Alemany, R.; Bazarko, A.O.; Becker, U.; Bright-Thomas, P.; Cattaneo, M.; Cerutti, F.; Dissertori, G.; Drevermann, H.; Forty, R.W.; Frank, M.; Hagelberg, R.; Hansen, J.B.; Harvey, John; Janot, P.; Jost, B.; Kneringer, E.; Lehraus, I.; Mato, P.; Minten, A.; Moneta, L.; Pacheco, A.; Pusztaszeri, J.F.; Ranjard, F.; Rizzo, G.; Rolandi, Gigi; Rousseau, D.; Schlatter, D.; Schmitt, M.; Schneider, O.; Tejessy, W.; Teubert, F.; Tomalin, I.R.; Wachsmuth, H.; Wagner, A.; Ajaltouni, Z.; Barres, A.; Boyer, C.; Falvard, A.; Ferdi, C.; Gay, P.; Guicheney, C.; Henrard, P.; Jousset, J.; Michel, B.; Monteil, S.; Montret, J.C.; Pallin, D.; Perret, P.; Podlyski, F.; Proriol, J.; Rosnet, P.; Rossignol, J.M.; Fearnley, T.; Hansen, J.D.; Hansen, J.R.; Hansen, P.H.; Nilsson, B.S.; Rensch, B.; Waananen, A.; Daskalakis, G.; Kyriakis, A.; Markou, C.; Simopoulou, E.; Vayaki, A.; Blondel, A.; Brient, J.C.; Machefert, F.; Rouge, A.; Rumpf, M.; Valassi, A.; Videau, H.; Boccali, T.; Focardi, E.; Parrini, G.; Zachariadou, K.; Cavanaugh, R.; Corden, M.; Georgiopoulos, C.; Huehn, T.; Jaffe, D.E.; Antonelli, A.; Bencivenni, G.; Bologna, G.; Bossi, F.; Campana, P.; Capon, G.; Casper, D.; Chiarella, V.; Felici, G.; Laurelli, P.; Mannocchi, G.; Murtas, F.; Murtas, G.P.; Passalacqua, L.; Pepe-Altarelli, M.; Curtis, L.; Dorris, S.J.; Halley, A.W.; Knowles, I.G.; Lynch, J.G.; O'Shea, V.; Raine, C.; Scarr, J.M.; Smith, K.; Teixeira-Dias, P.; Thompson, A.S.; Thomson, Evelyn J.; Thomson, F.; Turnbull, R.M.; Buchmuller, O.; Dhamotharan, S.; Geweniger, C.; Graefe, G.; Hanke, P.; Hansper, G.; Hepp, V.; Kluge, E.E.; Putzer, A.; Sommer, J.; Tittel, K.; Werner, S.; Wunsch, M.; Beuselinck, R.; Binnie, D.M.; Cameron, W.; Dornan, P.J.; Girone, M.; Goodsir, S.; Martin, E.B.; Morawitz, P.; Moutoussi, A.; Nash, J.; Sedgbeer, J.K.; Spagnolo, P.; Stacey, A.M.; Williams, M.D.; Ghete, V.M.; Girtler, P.; Kuhn, D.; Rudolph, G.; Betteridge, A.P.; Bowdery, C.K.; Buck, P.G.; Colrain, P.; Crawford, G.; Finch, A.J.; Foster, F.; Hughes, G.; Jones, R.W.L.; Sloan, T.; Whelan, E.P.; Williams, M.I.; Giehl, I.; Hoffmann, C.; Jakobs, K.; Kleinknecht, K.; Quast, G.; Renk, B.; Rohne, E.; Sander, H.G.; van Gemmeren, P.; Zeitnitz, C.; Aubert, J.J.; Benchouk, C.; Bonissent, A.; Bujosa, G.; Carr, J.; Coyle, P.; Diaconu, C.; Ealet, A.; Fouchez, D.; Konstantinidis, N.; Leroy, O.; Motsch, F.; Payre, P.; Talby, M.; Sadouki, A.; Thulasidas, M.; Tilquin, A.; Trabelsi, K.; Aleppo, M.; Antonelli, M.; Ragusa, F.; Berlich, R.; Blum, W.; Buescher, Volker; Dietl, H.; Ganis, G.; Gotzhein, C.; Kroha, H.; Lutjens, G.; Lutz, G.; Manner, W.; Moser, H.G.; Richter, Robert, 1; Rosado-Schlosser, A.; Schael, S.; Settles, R.; Seywerd, H.; St. Denis, Richard Dante; Stenzel, H.; Wiedenmann, W.; Wolf, G.; Boucrot, J.; Callot, O.; Chen, S.; Cordier, A.; Davier, M.; Duflot, L.; Grivaz, J.F.; Heusse, Ph.; Hocker, Andreas; Jacholkowska, A.; Jacquet, M.; Kim, D.W.; Le Diberder, F.; Lefrancois, J.; Lutz, A.M.; Nikolic, Irina; Schune, M.H.; Serin, L.; Simion, S.; Tournefier, E.; Veillet, J.J.; Videau, I.; Zerwas, D.; Azzurri, P.; Bagliesi, Giuseppe; Bettarini, S.; Bozzi, C.; Calderini, G.; Ciulli, V.; Dell'Orso, R.; Fantechi, R.; Ferrante, I.; Giassi, A.; Gregorio, A.; Ligabue, F.; Lusiani, A.; Marrocchesi, P.S.; Messineo, A.; Palla, F.; Sanguinetti, G.; Sciaba, A.; Sguazzoni, G.; Steinberger, J.; Tenchini, R.; Vannini, C.; Venturi, A.; Verdini, P.G.; Blair, G.A.; Bryant, L.M.; Chambers, J.T.; Gao, Y.; Green, M.G.; Medcalf, T.; Perrodo, P.; Strong, J.A.; von Wimmersperg-Toeller, J.H.; Botterill, D.R.; Clifft, R.W.; Edgecock, T.R.; Haywood, S.; Maley, P.; Norton, P.R.; Thompson, J.C.; Wright, A.E.; Bloch-Devaux, Brigitte; Colas, P.; Fabbro, B.; Kozanecki, W.; Lancon, E.; Lemaire, M.C.; Locci, E.; Perez, P.; Rander, J.; Renardy, J.F.; Rosowsky, A.; Roussarie, A.; Schuller, J.P.; Schwindling, J.; Trabelsi, A.; Vallage, B.; Black, S.N.; Dann, J.H.; Kim, H.Y.; Litke, A.M.; McNeil, M.A.; Taylor, G.; Booth, C.N.; Boswell, R.; Brew, C.A.J.; Cartwright, S.; Combley, F.; Kelly, M.S.; Lehto, M.; Newton, W.M.; Reeve, J.; Thompson, L.F.; Affholderbach, K.; Boehrer, Armin; Brandt, S.; Cowan, G.; Foss, J.; Grupen, C.; Lutters, G.; Saraiva, P.; Smolik, L.; Stephan, F.; Apollonio, M.; Bosisio, L.; Della Marina, R.; Giannini, G.; Gobbo, B.; Musolino, G.; Putz, J.; Rothberg, J.; Wasserbaech, S.; Williams, R.W.; Armstrong, S.R.; Charles, E.; Elmer, P.; Ferguson, D.P.S.; Gonzalez, S.; Greening, T.C.; Hayes, O.J.; Hu, H.; Jin, S.; McNamara, P.A., III; Nachtman, J.M.; Nielsen, J.; Orejudos, W.; Pan, Y.B.; Saadi, Y.; Scott, I.J.; Walsh, J.; Wu, Sau Lan; Wu, X.; Yamartino, J.M.; Zobernig, G.


    Searches for supersymmetric particles in channels with one or more photons and missing energy have been performed with data collected by the ALEPH detector at LEP. The data consist of 11.1 \\pb\\ at $\\sqrt{s} = 161 ~\\, \\rm GeV$, 1.1 \\pb\\ at 170 \\gev\\ and 9.5 \\pb\\ at 172 GeV. The \\eenunu\\ cross se ction is measured. The data are in good agreement with predictions based on the Standard Model, and are used to set upper limits on the cross sections for anomalous photon production. These limits are compared to two different SUSY models and used to set limits on the neutralino mass. A limit of 71 \\gevsq\\ at 95\\% C.L. is set on the mass of the lightest neutralin o ($\\tau_{\\chi_{1}^{0}} \\leq $ 3 ns) for the gauge-mediated supersymmetry breaking and LNZ models.

  12. Ricerca di chargini a 130 GeV < $\\sqrt{s}$ < 161 GeV, con l'esperimento L3 al LEP

    CERN Document Server

    Giagu, S


    The subject of this work is the search for charginos with the L3 detector at LEP, using the data collected by L3 during the years 1995-1996 at center of mass energies $130 GeV < \\sqrt{s} < 161 GeV$. In the thesis are described the design and realization of a new Monte Carlo generator (DFGT) for chargiNO1production and decay at $e^+e^-$ colliders, which is based on the evaluation of the full matrix elements of the process, and the realization and the results of two analysis, one cuts based conventional analysis, and a new and more advanced one based on the EPDE multivariate method. The results of this search are also compared with the predictions of the CMSSM model to obtain esclusion limits on the model parameters space and mass limits on charginos.

  13. Measurement of the Mass and Width of the W Boson in $e^{+}e^{-}$ Collisions at $\\sqrt{s}$ = 161 - 209 GeV

    CERN Document Server

    Abdallah, J.; Adam, W.; Adzic, P.; Albrecht, T.; Alemany-Fernandez, R.; Allmendinger, T.; Allport, P.P.; Amaldi, U.; Amapane, N.; Amato, Sandra F.; Anashkin, E.; Andreazza, A.; Andringa, Sofia; Anjos, N.; Antilogus, Pierre; Apel, W-D.; Arnoud, Y.; Ask, S.; Asman, B.; Augustin, Jean-Eudes; Augustinus, A.; Baillon, P.; Ballestrero, A.; Bambade, P.; Barbier, R.; Bardin, D.; Barker, G.J.; Baroncelli, Antonio; Battaglia, Marco; Baubillier, M.; Becks, K-H.; Begalli, M.; Behrmann, A.; Ben-Haim, Eli; Benekos, N.; Benvenuti, A.; Berat, C.; Berggren, Mikael; Bertrand, D.; Besancon, Marc; Besson, N.; Bloch, Daniel; Blom, M.; Bluj, Michal; Bonesini, Maurizio; Boonekamp, M.; Booth, PSL; Borisov, G.; Botner, Olga; Bouquet, B.; Bowcock, T.J.V.; Boyko, I.; Bracko, Marko; Brenner, R.; Brodet, E.; Bruckman, P.; Brunet, J.M.; Buschbeck, B.; Buschmann, P.; Calvi, M.; Camporesi, Tiziano; Canale, V.; Carena, F.; Castro, Nuno Filipe; Cavallo, F.; Chapkin, M.; Charpentier, Ph.; Checchia, Paolo; Chierici, R.; Chliapnikov, P.; Chudoba, J.; Chung, Suh-Urk; Cieslik, K.; Collins, P.; Contri, Roberto; Cosme, G.; Cossutti, Fabio; Costa, M.J.; Crennell, D.; Cuevas, Javier; D'Hondt, J.; da Silva, T.; Da Silva, W.; Della Ricca, Giuseppe; De Angelis, Alessandro; De Boer, W.; De Clercq, C.; De Lotto, Barbara; De Maria, N.; De Min, A.; de Paula, L.; Di Ciaccio, L.; Di Simone, A.; Doroba, K.; Duperrin, A.; Eigen, G.; Ekelof, Tord; Ellert, Mattias; Elsing, M.; Espirito Santo, Maria Catarina; Fanourakis, George K.; Feindt, Michael; Fernandez, J.; Ferrer, Antonio; Ferro, F.; Flagmeyer, U.; Foeth, H.; Fokitis, E.; Fulda-Quenzer, F.; Fuster, J.; Gandelman, Miriam; Garcia, C.; Gavillet, Philippe; Gazis, Evangelos; Gomez-Ceballos, G.; Goncalves, P.; Graziani, E.; Grosdidier, G.; Grzelak, K.; Guy, J.; Haag, C.; Hallgren, A.; Hamacher, Klaus; Hamilton, K.; Haug, S.; Hauler, F.; Hedberg, Vincent; Hennecke, M.; Herr, H.; Hoffman, J.; Holmgren, S-O.; Holt, P.J.; Houlden, M.A.; Jackson, John Neil; Jarlskog, Goran; Jarry, P.; Jeans, D.; Johansson, Erik Karl; Jonsson, P.; Joram, C.; Jungermann, L.; Kapusta, Frederic; Katsanevas, S.; Katsoufis, E.; Kernel, Gabrijel; Kerzel, U.; King, B.T.; Kjaer, N.J.; Kluit, Peter; Kokkinias, P.; Kourkoumelis, C.; Kouznetsov, O.; Krumstein, Z.; Kucharczyk, M.; Lamsa, J.; Leder, G.; Ledroit, F.; Leinonen, L.; Leitner, R.; Lemonne, Jacques; Lepeltier, V.; Lesiak, T.; Liebig, W.; Liko, D.; Lipniacka, A.; Lopes, J.H.; Lopez, J.M.; Loukas, D.; Lutz, Pierre; Lyons, Louis; MacNaughton, J.; Malek, A.; Maltezos, S.; Mandl, F.; Marco, J.; Marco, R.; Marechal, B.; Margoni, M.; Marin, J-C.; Mariotti, C.; Markou, A.; Martinez-Rivero, C.; Masik, J.; Mastroyiannopoulos, N.; Matorras, F.; Matteuzzi, C.; Mazzucato, F.; Mazzucato, M.; Nulty, R.Mc; Meroni, C.; Migliore, E.; Mitaroff, W.; Mjoernmark, U.; Moa, T.; Moch, M.; Monge, R.; Montenegro, J.; Moraes, D.; Moreno, S.; Morettini, P.; Muller, Ulrich; Muenich, K.; Mulders, M.; Mundim Filho, Luiz Martins; Murray, W.; Muryn, B.; Myatt, G.; Myklebust, T.; Nassiakou, M.; Navarria, F.; Nawrocki, K.; Nicolaidou, R.; Oblakowska-Mucha, A.; Obraztsov, V.; Olshevski, A.; Onofre, A.; Orava, R.; Osterberg, K.; Ouraou, A.; Oyanguren, A.; Paganoni, M.; Paiano, S.; Palacios, J.P.; Palka, Henryk; Papadopoulou, Th.D.; Pape, L.; Parkes, C.; Parodi, F.; Parzefall, U.; Passeri, A.; Passon, O.; Peralta, L.; Perepelitsa, V.; Perrotta, Andrea; Petrolini, Alessandro; Piedra, Jonatan; Pieri, L.; Pierre, Francois; Pimenta, M.; Piotto, E.; Poireau, V.; Pol, M.E.; Polok, G.; Pozdniakov, V.; Pukhaeva, N.; Pullia, A.; Radojicic, D.; Rames, J.; Read, A.; Rebecchi, P.; Rehn, J.; Reid, D.; Reinhardt, R.; Renton, Peter; Richard, F.; Ridky, Jan; Rivero, M.; Rodriguez, D.; Romero, A.; Ronchese, Paolo; Roudeau, P.; Rovelli, T.; Ruhlmann, Vanina; Ryabtchikov, D.; Sadovsky, A.; Salmi, L.; Salt, J.; Sander, C.; Savoy-Navarro, A.; Schwickerath, U.; Segar, A.; Sekulin, R.; Siebel, Martin; Simard, L.; Sisakian, A.; Smadja, G.; Smirnova, O.; Sokolov, Andrei Valerevich; Sopczak, A.; Sosnowski, R.; Spassov, T.; Stanitzki, M.; Stocchi, A.; Strauss, J.; Stugu, B.; Szczekowski, M.; Szeptycka, M.; Szumlak, T.; Tabarelli de Fatis, T.; Taffard, A.C.; Tegenfeldt, F.; Thomas, J.; Timmermans, Jan; Tkatchev, L.; Tobin, M.; Todorovova, S.; Tome, B.; Tonazzo, A.; Tortosa, P.; Travnicek, Petr; Treille, D.; Tristram, G.; Trochimczuk, M.; Troncon, Clara; Turluer, M-L.; Tyapkin, I.A.; Tyapkin, P.; Tzamarias, S.; Uvarov, V.; Valenti, Giovanni; Van Dam, P.; Van Eldik, J.; van Remortel, N.; Van Vulpen, I.; Vegni, G.; Veloso, Filipe; Venus, W.; Verdier, Patrice; Verzi, V.; Vilanova, D.; Vitale, Lorenzo; Vrba, V.; Wahlen, H.; Washbrook, A.J.; Weiser, C.; Wicke, D.; Wickens, J.; Wilkinson, G.; Winter, M.; Witek, M.; Yushchenko, O.; Zalewska, A.; Zalewski, P.; Zavrtanik, Danilo; Zhuravlov, V.; Zimine, N.I.; Zintchenko, Alexandre


    A measurement of the W boson mass and width has been performed by the DELPHI collaboration using the data collected during the full LEP2 programme (1996-2000). The data sample has an integrated luminosity of 660 pb^-1 and was collected over a range of centre-of-mass energies from 161 to 209 GeV. Results are obtained by applying the method of direct reconstruction of the mass of the W from its decay products in both the W+W- -> lvqq and W+W- -> qqqq channels. The W mass result for the combined data set is M_W = 80.336 +/- 0.055 (Stat.) +/- 0.028 (Syst.) +/- 0.025 (FSI) +/- 0.009 (LEP) GeV/c^2, where FSI represents the uncertainty due to final state interaction effects in the qqqq channel, and LEP represents that arising from the knowledge of the collision energy of the accelerator. The combined value for the W width is Gamma_W = 2.404 +/- 0.140 (Stat.) +/- 0.077 (Syst.) +/- 0.065 (FSI) GeV/c^2. These results supersede all values previously published by the DELPHI collaboration. This paper is dedicated to the m...

  14. Prognostic value of CT findings to predict survival outcomes in patients with pancreatic neuroendocrine neoplasms: a single institutional study of 161 patients

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Dong Wook; Kim, Hyoung Jung; Kim, Kyung Won; Byun, Jae Ho; Kim, So Yeon [University of Ulsan College of Medicine, Department of Radiology and Research Institute of Radiology, Asan Medical Center, Seoul (Korea, Republic of); Song, Ki Byung [University of Ulsan College of Medicine, Department of Surgery, Asan Medical Center, Seoul (Korea, Republic of); Ramaiya, Nikhil H.; Tirumani, Sree Harsha [Harvard Medical School, Department of Imaging, Dana-Farber Cancer Institute, Brigham and Women' s Hospital, Boston, MA (United States); Hong, Seung-Mo [University of Ulsan College of Medicine, Department of Pathology, Asan Medical Center, Seoul (Korea, Republic of)


    To evaluate the prognostic value of CT to predict recurrence-free and overall survival in patients with pancreatic neuroendocrine neoplasms (PanNENs). Between January 2004 and December 2012, 161 consecutive patients who underwent preoperative triphasic CT and surgical resection with curative intent for PanNENs were identified. The tumour consistency, margin, presence of calcification, pancreatic duct dilatation, bile duct dilatation, vascular invasion, and hepatic metastases were evaluated. The tumour size, arterial enhancement ratio, and portal enhancement ratio were measured. The Cox proportional hazard model was used to determine the association between CT features and recurrence-free survival and overall survival. By multivariate analysis, tumour size (>3 cm) (hazard ratio, 3.314; p = 0.006), portal enhancement ratio (≤1.1) (hazard ratio, 2.718; p = 0.006), and hepatic metastases (hazard ratio, 4.374; p = 0.003) were independent significant variables for worse recurrence-free survival. Portal enhancement ratio (≤1.1) (hazard ratio, 5.951; p = 0.001) and hepatic metastases (hazard ratio, 4.122; p = 0.021) were independent significant variables for worse overall survival. Portal enhancement ratio (≤1.1) and hepatic metastases assessed on CT were common independent prognostic factors for worse recurrence-free survival and overall survival in patients with PanNENs. (orig.)

  15. An Intronic SINE insertion in FAM161A that causes exon-skipping is associated with progressive retinal atrophy in Tibetan Spaniels and Tibetan Terriers.

    Directory of Open Access Journals (Sweden)

    Louise M Downs

    Full Text Available Progressive retinal atrophy (PRA in dogs is characterised by the degeneration of the photoreceptor cells of the retina, resulting in vision loss and eventually complete blindness. The condition affects more than 100 dog breeds and is known to be genetically heterogeneous between breeds. Around 19 mutations have now been identified that are associated with PRA in around 49 breeds, but for the majority of breeds the mutation(s responsible have yet to be identified. Using genome-wide association with 22 Tibetan Spaniel PRA cases and 10 controls, we identified a novel PRA locus, PRA3, on CFA10 (p(raw = 2.01 × 10(-5, p(genome = 0.014, where a 3.8 Mb region was homozygous within 12 cases. Using targeted next generation sequencing, a short interspersed nuclear element insertion was identified near a splice acceptor site in an intron of a provocative gene, FAM161A. Analysis of mRNA from an affected dog revealed that the SINE causes exon skipping, resulting in a frame shift, leading to a downstream premature termination codon and possibly a truncated protein product. This mutation segregates with the disease in 22 out of 35 cases tested (63%. Of the PRA controls, none are homozygous for the mutation, 15% carry the mutation and 85% are homozygous wildtype. This mutation was also identified in Tibetan Terriers, although our results indicate that PRA is genetically heterogeneous in both Tibetan Spaniels and Tibetan Terriers.

  16. Antimicrobial activity in the egg wax of the tick Amblyomma hebraeum (Acari: Ixodidae) is associated with free fatty acids C16:1 and C18:2. (United States)

    Yu, Zhijun; Thomson, Euan L S; Liu, Jingze; Dennis, Jonathan J; Jacobs, René L; Kaufman, W Reuben


    Untreated eggs of the tick Amblyomma hebraeum Koch (Acari: Ixodidae) exhibited antimicrobial activity (AMA) against Gram-negative but not Gram-positive bacteria; eggs denuded of wax by solvent extraction showed no AMA. The unfractionated egg wax extract, however, showed AMA against Gram-positive but not Gram-negative bacteria, as also shown by Arrieta et al. (Exp Appl Acarol 39: 297-313, 2006). In this study we partitioned the egg wax into various fractions, using a variety of techniques, analyzed their compositions, and tested them for AMA. The crude aqueous extract exhibited AMA. However, although more than 30 metabolites were identified in this extract by nuclear magnetic resonance analysis, none of them seemed likely to be responsible for the observed AMA. In the crude organic extract, cholesterol esters were the most abundant lipids, but were devoid of AMA. Fatty acids (FAs), with chain lengths between C13 and C26 were the next most abundant lipids. After lipid fractionation and gas chromatography/mass spectroscopy, free FAs, especially C16:1 and C18:2, accounted for most of the AMA in the organic extract. The material responsible for AMA in the crude aqueous extract remains unidentified. No AMA was detected in the intracellular contents of untreated eggs.

  17. The parable of the shrewd manager (Lk 16:1–8: A biography of Jesus and a lesson on mercy

    Directory of Open Access Journals (Sweden)

    Dieter H. Reinstorf


    Full Text Available Many scholars have regarded the parable of the shrewd manager (Lk 16:1–8 as the most puzzling of all parables as Jesus seems to use the unrighteous actions of a dishonest (worldly manager as a model for emulation by others. The unease associated with this understanding was managed in part by focusing almost exclusively on the ‘shrewdness’ of the dishonest manager. In this interpretation, it is not his unjust behaviour that is to be imitated but his wise and intelligent actions. This interpretation has led to a divergence of applications regarding the ‘property’ that was entrusted to him. The author, however, argues that, in the context of the historical Jesus, the entrusted property in the parable references first and foremost the Torah entrusted to God’s people and that the manager mirrors the life of Jesus, who was ‘accused’ by the religious leaders of being unjust. Despite being threatened, he continued unabatedly to scatter God’s mercy, epitomised by the reduction of debt and symbolising the dawning of God’s Kingdom. The manager is therefore not a negative figure but a positive (diaphorical example of what it means to be a faithful manager of God in the light of adversary and opposition.

  18. Hematoma subdural crônico: estudo de 161 pacientes operados e a relação com alterações no coagulograma

    Directory of Open Access Journals (Sweden)

    Yasuda Clarissa Lin


    Full Text Available O objetivo deste estudo é analisar a evolução de pacientes com hematoma subdural crônico em relação aos achados do coagulograma. Foram analisados 161 pacientes operados no Hospital das Clínicas-UNICAMP entre abril de 1994 e 2000. Foi detectado um predomínio do sexo masculino (86,3%, da cor branca (85,1% e da faixa etária na quinta década (mediana 57 anos. O estudo mostrou mortalidade maior no período pós-operatório entre os pacientes com valores de RNI (international normalized ratio superiores a 1,25 e/ou trombocitopenia (p<0,001 e p=0,004, respectivamente e mortalidade menor para os pacientes com antecedente de traumatismo cranioencefálico (76% (p=0,044. Os resultados ressaltam a importância da avaliação pré-operatória com o coagulograma a fim de se corrigir possíveis alterações.

  19. Cell growth and resistance of Lactococcus lactis subsp. lactis TOMSC161 following freezing, drying and freeze-dried storage are differentially affected by fermentation conditions. (United States)

    Velly, H; Fonseca, F; Passot, S; Delacroix-Buchet, A; Bouix, M


    To investigate the effects of fermentation parameters on the cell growth and on the resistance to each step of the freeze-drying process of Lactococcus lactis subsp. lactis TOMSC161, a natural cheese isolate, using a response surface methodology. Cells were cultivated at different temperatures (22, 30 and 38°C) and pH (5·6, 6·2 and 6·8) and were harvested at different growth phases (0, 3 and 6 h of stationary phase). Cultivability and acidification activity losses of Lc. lactis were quantified after freezing, drying, 1 and 3 months of storage at 4 and 25°C. Lactococcus lactis was not damaged by freezing but was sensitive to drying and to ambient temperature storage. Moreover, the fermentation temperature and the harvesting time influenced the drying resistance of Lc. lactis. Lactococcus lactis cells grown in a whey-based medium at 32°C, pH 6·2 and harvested at late stationary phase exhibited both an optimal growth and the highest resistance to freeze-drying and storage. A better insight on the individual and interaction effects of fermentation parameters made it possible the freeze-drying and storage preservation of a sensitive strain of technological interest. Evidence on the particularly damaging effect of the drying step and the high-temperature storage is presented. © 2014 The Society for Applied Microbiology.

  20. Charged-particle multiplicity in $e^+ e^- \\rightarrow q \\overline{q}$ events at 161 and 172 GeV and from the decay of the W boson

    CERN Document Server

    Abreu, P; Adye, T; Ajinenko, I; Alekseev, G D; Alemany, R; Allport, P P; Almehed, S; Amaldi, Ugo; Amato, S; Andersson, P; Andreazza, A; Antilogus, P; Apel, W D; Arnoud, Y; Åsman, B; Augustin, J E; Augustinus, A; Baillon, Paul; Bambade, P; Barão, F; Barbi, M S; Bardin, Dimitri Yuri; Barker, G; Baroncelli, A; Bärring, O; Bates, M J; Battaglia, Marco; Baubillier, M; Baudot, J; Becks, K H; Begalli, M; Beillière, P; Belokopytov, Yu A; Belous, K S; Benvenuti, Alberto C; Bérat, C; Berggren, M; Bertini, D; Bertrand, D; Besançon, M; Bianchi, F; Bigi, M; Bilenky, S M; Billoir, P; Bizouard, M A; Bloch, D; Blume, M; Bonesini, M; Bonivento, W; Boonekamp, M; Booth, P S L; Borgland, A W; Borisov, G; Bosio, C; Botner, O; Boudinov, E; Bouquet, B; Bourdarios, C; Bowcock, T J V; Bozzo, M; Branchini, P; Brand, K D; Brenke, T; Brenner, R A; Brown, R C A; Brückman, P; Brunet, J M; Bugge, L; Buran, T; Burgsmüller, T; Buschmann, P; Cabrera, S; Caccia, M; Calvi, M; Camacho-Rozas, A J; Camporesi, T; Canale, V; Canepa, M; Carena, F; Carroll, L; Caso, Carlo; Castillo-Gimenez, M V; Cattai, A; Cavallo, F R; Chabaud, V; Charpentier, P; Chaussard, L; Checchia, P; Chelkov, G A; Chen, M; Chierici, R; Chliapnikov, P V; Chochula, P; Chorowicz, V; Chudoba, J; Cindro, V; Collins, P; Colomer, M; Contri, R; Cortina, E; Cosme, G; Cossutti, F; Cowell, J H; Crawley, H B; Crennell, D J; Crosetti, G; Cuevas-Maestro, J; Czellar, S; Dahm, J; D'Almagne, B; Damgaard, G; Dauncey, P D; Davenport, Martyn; Da Silva, W; Deghorain, A; Della Ricca, G; Delpierre, P A; Demaria, N; De Angelis, A; de Boer, Wim; De Brabandere, S; De Clercq, C; La Vaissière, C de; De Lotto, B; De Min, A; De Paula, L S; Dijkstra, H; Di Ciaccio, Lucia; Di Diodato, A; Djannati, A; Dolbeau, J; Doroba, K; Dracos, M; Drees, J; Drees, K A; Dris, M; Durand, J D; Edsall, D M; Ehret, R; Eigen, G; Ekelöf, T J C; Ekspong, Gösta; Elsing, M; Engel, J P; Erzen, B; Espirito-Santo, M C; Falk, E; Fanourakis, G K; Fassouliotis, D; Feindt, Michael; Fenyuk, A; Ferrari, P; Ferrer, A; Fichet, S; Filippas-Tassos, A; Firestone, A; Fischer, P A; Föth, H; Fokitis, E; Fontanelli, F; Formenti, F; Franek, B J; Frodesen, A G; Frühwirth, R; Fulda-Quenzer, F; Fuster, J A; Galloni, A; Gamba, D; Gandelman, M; García, C; García, J; Gaspar, C; Gasparini, U; Gavillet, P; Gazis, E N; Gelé, D; Gerber, J P; Gerdyukov, L N; Gokieli, R; Golob, B; Gonçalves, P; Gopal, Gian P; Gorn, L; Górski, M; Guz, Yu; Gracco, Valerio; Graziani, E; Green, C; Grefrath, A; Gris, P; Grosdidier, G; Grzelak, K; Günther, M; Guy, J; Hahn, F; Hahn, S; Hajduk, Z; Hallgren, A; Hamacher, K; Harris, F J; Hedberg, V; Henriques, R P; Hernández, J J; Herquet, P; Herr, H; Hessing, T L; Heuser, J M; Higón, E; Holmgren, S O; Holt, P J; Holthuizen, D J; Hoorelbeke, S; Houlden, M A; Hrubec, Josef; Huet, K; Hultqvist, K; Jackson, J N; Jacobsson, R; Jalocha, P; Janik, R; Jarlskog, C; Jarlskog, G; Jarry, P; Jean-Marie, B; Johansson, E K; Jönsson, L B; Jönsson, P E; Joram, Christian; Juillot, P; Kaiser, M; Kapusta, F; Karafasoulis, K; Karvelas, E; Katsanevas, S; Katsoufis, E C; Keränen, R; Khokhlov, Yu A; Khomenko, B A; Khovanskii, N N; King, B J; Kjaer, N J; Klapp, O; Klein, H; Kluit, P M; Knoblauch, D; Kokkinias, P; Koratzinos, M; Korcyl, K; Kostyukhin, V; Kourkoumelis, C; Kuznetsov, O; Krammer, Manfred; Kreuter, C; Kronkvist, I J; Krstic, J; Krumshtein, Z; Krupinski, W; Kubinec, P; Kucewicz, W; Kurvinen, K L; Lacasta, C; Laktineh, I; Lamsa, J; Lanceri, L; Lane, D W; Langefeld, P; Laugier, J P; Lauhakangas, R; Leder, Gerhard; Ledroit, F; Lefébure, V; Legan, C K; Leisos, A; Leitner, R; Lemonne, J; Lenzen, Georg; Lepeltier, V; Lesiak, T; Lethuillier, M; Libby, J; Liko, D; Lipniacka, A; Lippi, I; Lörstad, B; Loken, J G; López, J M; Loukas, D; Lutz, P; Lyons, L; MacNaughton, J N; Maehlum, G; Mahon, J R; Maio, A; Malmgren, T G M; Malychev, V; Mandl, F; Marco, J; Marco, R P; Maréchal, B; Margoni, M; Marin, J C; Mariotti, C; Markou, A; Martínez-Rivero, C; Martínez-Vidal, F; Martí i García, S; Masik, J; Matorras, F; Matteuzzi, C; Matthiae, Giorgio; Mazzucato, M; McCubbin, M L; McKay, R; McNulty, R; McPherson, G; Medbo, J; Meroni, C; Meyer, S; Meyer, W T; Michelotto, M; Migliore, E; Mirabito, L; Mitaroff, Winfried A; Mjörnmark, U; Moa, T; Møller, R; Mönig, K; Monge, M R; Morettini, P; Müller, H; Münich, K; Mulders, M; Mundim, L M; Murray, W J; Muryn, B; Myatt, Gerald; Myklebust, T; Naraghi, F; Navarria, Francesco Luigi; Navas, S; Nawrocki, K; Negri, P; Némécek, S; Neumann, W; Neumeister, N; Nicolaidou, R; Nielsen, B S; Nieuwenhuizen, M; Nikolaenko, V; Nikolenko, M; Niss, P; Nomerotski, A; Normand, Ainsley; Nygren, A; Oberschulte-Beckmann, W; Obraztsov, V F; Olshevskii, A G; Onofre, A; Orava, Risto; Orazi, G; Ortuno, S; Österberg, K; Ouraou, A; Paganini, P; Paganoni, M; Paiano, S; Pain, R; Palka, H; Papadopoulou, T D; Papageorgiou, K; Pape, L; Parkes, C; Parodi, F; Parzefall, U; Passeri, A; Pegoraro, M; Peralta, L; Pernegger, H; Pernicka, Manfred; Perrotta, A; Petridou, C; Petrolini, A; Phillips, H T; Piana, G; Pierre, F; Pimenta, M; Piotto, E; Podobnik, T; Podobrin, O; Pol, M E; Polok, G; Poropat, P; Pozdnyakov, V; Privitera, P; Pukhaeva, N; Pullia, Antonio; Radojicic, D; Ragazzi, S; Rahmani, H; Ratoff, P N; Read, A L; Reale, M; Rebecchi, P; Redaelli, N G; Regler, Meinhard; Reid, D; Reinhardt, R; Renton, P B; Resvanis, L K; Richard, F; Rídky, J; Rinaudo, G; Røhne, O M; Romero, A; Ronchese, P; Roos, L; Rosenberg, E I; Rosinsky, P; Roudeau, Patrick; Rovelli, T; Ruhlmann-Kleider, V; Ruiz, A; Rybicki, K; Saarikko, H; Sacquin, Yu; Sadovskii, A; Sajot, G; Salt, J; Sannino, M; Schneider, H; Schwickerath, U; Schyns, M A E; Sciolla, G; Scuri, F; Seager, P; Sedykh, Yu; Segar, A M; Seitz, A; Sekulin, R L; Serbelloni, L; Shellard, R C; Sheridan, A; Siegrist, P; Silvestre, R; Simonetto, F; Sissakian, A N; Skaali, T B; Smadja, G; Smirnov, N; Smirnova, O G; Smith, G R; Solovyanov, O; Sosnowski, R; Souza-Santos, D; Spassoff, Tz; Spiriti, E; Sponholz, P; Squarcia, S; Stampfer, D; Stanescu, C; Stanic, S; Stapnes, Steinar; Stavitski, I; Stevenson, K; Stocchi, A; Strauss, J; Strub, R; Stugu, B; Szczekowski, M; Szeptycka, M; Tabarelli de Fatis, T; Tavernet, J P; Chikilev, O G; Tegenfeldt, F; Terranova, F; Thomas, J; Tilquin, A; Timmermans, J; Tkatchev, L G; Todorov, T; Todorova, S; Toet, D Z; Tomaradze, A G; Tomé, B; Tonazzo, A; Tortora, L; Tranströmer, G; Treille, D; Tristram, G; Trombini, A; Troncon, C; Tsirou, A L; Turluer, M L; Tyapkin, I A; Tyndel, M; Tzamarias, S; Überschär, B; Ullaland, O; Uvarov, V; Valenti, G; Vallazza, E; van Apeldoorn, G W; van Dam, P; Van Eldik, J; Van Lysebetten, A; Vassilopoulos, N; Vegni, G; Ventura, L; Venus, W A; Verbeure, F; Verlato, M; Vertogradov, L S; Vilanova, D; Vincent, P; Vitale, L; Vlasov, E; Vodopyanov, A S; Vrba, V; Wahlen, H; Walck, C; Waldner, F; Weiser, C; Wetherell, Alan M; Wicke, D; Wickens, J H; Wielers, M; Wilkinson, G R; Williams, W S C; Winter, M; Witek, M; Wlodek, T; Yi, J; Yip, K; Yushchenko, O P; Zach, F; Zaitsev, A; Zalewska-Bak, A; Zalewski, Piotr; Zavrtanik, D; Zevgolatakos, E; Zimin, N I; Zucchelli, G C; Zumerle, G


    The data collected by DELPHI in 1996 have been used to measure the average charged particle multiplicities and dispersions in $q\\bar{q}$ events at centre-of-mass energies of $\\sqrt{s}=161$~GeV and $\\sqrt{s}=172$~GeV, and the average charge multiplicity in WW events at $\\sqrt{s}=172$~GeV. The multiplicities in $q\\bar{q}$ events are consistent with the evolution predicted by QCD. The dispersions in the multiplicity distributions are consistent with Koba-Nielsen-Olesen (KNO) scaling. The average multiplicity of charged particles in hadronic W decays has been measured for the first time; its value, $19.23 \\pm 0.74 (stat+syst)$, is consistent with that expected for an $e^+e^-$ interaction at a centre-of-mass energy equal to the W mass. The charged particle multiplicity in W decays shows no evidence of effects of colour reconnection between partons from different W's at the present level of statistics.

  1. Probing the Role of Two Critical Residues in Inulin Fructotransferase (DFA III-Producing) Thermostability from Arthrobacter sp. 161MFSha2.1. (United States)

    Yu, Shuhuai; Wang, Xiao; Zhang, Tao; Jiang, Bo; Mu, Wanmeng


    Inulin fructotransferase (IFTase) is an important enzyme that produces di-d-fructofuranose 1,2':2,3' dianhydride (DAF III), which is beneficial for human health. Present investigations mainly focus on screening and characterizing IFTase, including catalytic efficiency and thermostability, which are two important factors for enzymatic industrial applications. However, few reports aimed to improve these two characteristics based on the structure of IFTase. In this work, a structural model of IFTase (DFA III-producing) from Arthrobacter sp. 161MFSha2.1 was constructed through homology modeling. Analysis of this model reveals that two residues, Ser-309 and Ser-333, may play key roles in the structural stability. Therefore, the functions of the two residues were probed by site-directed mutagenesis combined with the Nano-DSC method and assays for residual activity. In contrast to other mutations, single mutation of serine 309 (or serine 333) to threonine did not decrease the enzymatic stability, whereas double mutation (serine 309 and serine 333 to threonine) can enhance thermostability (by approximately 5 °C). The probable mechanisms for this enhancement were investigated.

  2. Efficacy and safety of surgical lung biopsy for interstitial disease. Experience of 161 consecutive patients from a single institution in Italy. (United States)

    Rotolo, Nicola; Imperatori, Andrea; Dominioni, Lorenzo; Facchini, Annalaura; Conti, Valentina; Castiglioni, Massimo; Spanevello, Antonio


    The role of surgical biopsy for interstitial lung disease (ILD) is controversial, because of possible postoperative morbidity and mortality. We aimed to assess the efficacy and safety of surgical biopsy for ILD. We retrospectively analysed the diagnostic performance and the postoperative complications of 161 consecutive surgical lung biopsy procedures carried out in suspected ILD cases that were undefined after multidisciplinary clinico-radiological evaluation. In 151 cases (93.8%) the biopsy was performed by video-assisted thoracoscopic surgery (VATS), in 6.2% by limited thoracotomy. A specific histological diagnosis was obtained in 154 (95.7%) of the surgically biopsied patients, while 4.3% remained histologically unclassified. The predominant histological patterns were sarcoidosis (29.8 %), usual interstitial pneumonia/idiopathic pulmonary fibrosis (UIP/IPF) (24.2%), cryptogenic organizing pneumonia (18.6%) and nonspecific interstitial pneumonia (8.1%). The postoperative course was uneventful in 142 cases. In 19 patients (11.8%) we observed postoperative complications, predominantly prolonged air leakage (5.0% of all cases). Thirty-day postoperative mortality was 3.1%, mostly due to acute exacerbation of respiratory insufficiency. Postoperative mortality independently correlated with preoperative need of oxygen therapy (OR, 5.21; 95% CI, 1.19-22.95) and with UIP/IPF histology (OR, 5.67; 95% CI, 1.27-25.25). Lung biopsy was performed mostly by VATS, with limited morbidity, and was effective in yielding a specific histologic diagnosis in the vast majority of undefined ILD cases. To optimize the outcome of surgical biopsy for specific diagnosis of ILD, this procedure should be performed only exceptionally in patients with critical respiratory illness as postoperative mortality risk in these subjects is exceedingly high.

  3. Effect of a high-altitude expedition to a Himalayan peak (Pumori, 7,161 m) on plasma and erythrocyte antioxidant profile. (United States)

    Magalhães, José; Ascensão, António; Marques, Franklim; Soares, José M C; Ferreira, Rita; Neuparth, Maria J; Duarte, José A


    The effects of a high-altitude exposure were studied in six mountaineers who spent 3 weeks at an altitude range between 5,250 and 7,161 m after 1 week in an acclimatization trek (2,800-5,250 m). Blood drawn from the antecubital vein was collected at sea level 1 day before and 1 day after the expedition to analyse some haematological variables [haemoglobin (Hb), haematocrit (Htc) and red blood cell (RBC) count], erythrocyte antioxidant enzyme activity [superoxide dismutase (SOD), glutathione peroxidase (GPx) and glutathione reductase (Gr)] and membrane fatty acid profile [mono-unsaturated fatty acids (MUFA), polyunsaturated fatty acids (PUFA), saturated fatty acids (SFA), trans fatty acids (TRANS)]. Moreover, total antioxidant status (TAS), thiobarbituric acid reactive substances (TBARS), thiol protein groups (SH), SOD, GPx and Gr were measured in plasma. High-altitude exposure induced polycythaemia, with significant increases in RBC count (5.26%), Hb concentration (4.83%) and Htc (6.26%). Furthermore, a significant increase in plasma TBARS, SOD and Gr was observed after the expedition, whereas SH, TAS and GPx decreased. Erythrocyte glutathione-cycle-related antioxidant enzyme activity was upregulated, whereas SOD activity was maintained after the expedition. In addition, despite the unchanged (MUFA+PUFA)/SFA ratio, the membrane erythrocyte fatty acid content showed a significant increase in PUFAs and a decrease in TRANS, suggesting enhanced membrane fluidity. In conclusion, it seems that high-altitude exposure, besides quantitative variations in RBC expression, induced plasma oxidative stress and damage, and significant changes in erythrocyte components, namely in antioxidant enzyme activity and membrane fatty acid profile that might modify RBC functionality.

  4. Sausage-like toe and heel pain: value for diagnosing and evaluating the severity of spondyloarthropathies defined by Amor's criteria. A retrospective study in 161 patients. (United States)

    Eulry, François; Diamano, Joël; Launay, David; Tabache, Fatima; Lechevalier, Dominique; Magnin, Jacques


    To evaluate the frequency of sausage-like toe and talalgia in spondyloarthropathies diagnosed by the 12 items of Amor's criteria; to study the frequency of a diagnosis which would be impossible without these two symptoms; and to study the correlations between Amor's criteria score and the clinical and biological symptoms in the presence of both of these. Retrospective study of 161 cases (age, 38.8 +/- 13.1 years; duration, 7.12 +/- 7.3 years; HLA B27, 112). Peripheral involvement is observed in 89 cases (52 cases of pure peripheral form). Eighty cases (group N1) experience talalgia and/or sausage-like toe and 80 do not (group N2). Talalgia concerns 68 patients (42.2%) and sausage-like toe 37 (23.3%); both signs are present in 18. Age, duration, morning stiffness, SR, CRP are similar in both groups. Ankle involvement and oligoarthritis are significantly more frequent in group N1. In 17 cases the presence of talalgia or sausage-like toe are indispensable to the diagnosis (10.6%): 11 undetermined spondyloarthropathies, six psoriatic arthritis. In the N1 group, a positive correlation is present between the score of the 12 items and, respectively, morning stiffness (+ 0.69; P = 0.0001), SR (+ 0.6; P = 0.001 8), CRP (+ 0.59; P = 0.001 8) in patients with sausage-like toe, probably because of the associated oligoarthritis, but neither in patients with talalgia (N1) nor in patients of the group N2. Talalgia and sausage-like toe are present respectively in 42.2 and 23.6% of spondyloarthropathies and are indispensable to the diagnosis using Amor's criteria in 10.6% of cases. The sausage-like toe would indicate a more severe spondyloarthopathy because of the synovitis, even though talalgia (pure enthesopathy) does not reflect the inflammatory process.

  5. Common variants on 2p16.1, 6p22.1 and 10q24.32 are associated with schizophrenia in Han Chinese population. (United States)

    Yu, H; Yan, H; Li, J; Li, Z; Zhang, X; Ma, Y; Mei, L; Liu, C; Cai, L; Wang, Q; Zhang, F; Iwata, N; Ikeda, M; Wang, L; Lu, T; Li, M; Xu, H; Wu, X; Liu, B; Yang, J; Li, K; Lv, L; Ma, X; Wang, C; Li, L; Yang, F; Jiang, T; Shi, Y; Li, T; Zhang, D; Yue, W


    Many schizophrenia susceptibility loci have been identified through genome-wide association studies (GWASs) in European populations. However, until recently, schizophrenia GWASs in non-European populations were limited to small sample sizes and have yielded few loci associated with schizophrenia. To identify genetic risk variations for schizophrenia in the Han Chinese population, we performed a two-stage GWAS of schizophrenia comprising 4384 cases and 5770 controls, followed by independent replications of 13 single-nucleotide polymorphisms in an additional 4339 schizophrenia cases and 7043 controls of Han Chinese ancestry. Furthermore, we conducted additional analyses based on the results in the discovery stage. The combined analysis confirmed evidence of genome-wide significant associations in the Han Chinese population for three loci, at 2p16.1 (rs1051061, in an exon of VRK2, P=1.14 × 10 -12 , odds ratio (OR)=1.17), 6p22.1 (rs115070292 in an intron of GABBR1, P=4.96 × 10 -10 , OR=0.77) and 10q24.32 (rs10883795 in an intron of AS3MT, P=7.94 × 10 -10 , OR=0.87; rs10883765 at an intron of ARL3, P=3.06 × 10 -9 , OR=0.87). The polygenic risk score based on Psychiatric Genomics Consortium schizophrenia GWAS data modestly predicted case-control status in the Chinese population (Nagelkerke R 2 : 1.7% ~5.7%). Our pathway analysis suggested that neurological biological pathways such as GABAergic signaling, dopaminergic signaling, cell adhesion molecules and myelination pathways are involved in schizophrenia. These findings provide new insights into the pathogenesis of schizophrenia in the Han Chinese population. Further studies are needed to establish the biological context and potential clinical utility of these findings.

  6. China’s foreign policy towards Central and Eastern Europe: The “16+1” format in the South–South cooperation perspective. Cases of the Czech Republic and Hungary

    Directory of Open Access Journals (Sweden)

    Bartosz Kowalski


    Full Text Available This article discusses the “16+1” format initiated in 2012 as a platform for economic, trade, and cultural cooperation between Central and Eastern Europe (CEE and China. As Chinese authorities claim, the “16+1” initiative is complementary to the “New Silk Road” strategy, being a pragmatic formula without political goals, whose main rationale is to bring mutual benefits to all of its participants (win–win. However, despite the Chinese narratives concerning cooperation with the CEE countries as an economic bridgehead of the “One Road, One Belt” (OBOR initiative, some signs of the political dimension of the project can be noticed. Since at least the 1950s, active participation and promotion of the South–South cooperation has become an important component of China’s foreign relations. Although for Chinese policy makers Sino–South relations have been traditionally defined within the frame of, mostly postcolonial, developing countries of Southeast Asia, Central Asia, Africa, and Latin America, this article tries to examine the “South–South” pattern of China’s diplomacy towards Central and Eastern European states with a focus on the Czech Republic and Hungary.

  7. Inelastic scattering of neutrons by spin waves in terbium

    DEFF Research Database (Denmark)

    Bjerrum Møller, Hans; Houmann, Jens Christian Gylden


    Measurements of spin-wave dispersion relations for magnons propagating in symmetry directions in ferromagnetic Tb; it is first experiment to give detailed information on magnetic excitations in heavy rare earths; Tb was chosen for these measurements because it is one of few rare-earth metals whic...... does not have very high thermal-neutron capture cross section, so that inelastic neutron scattering experiments can give satisfactory information on magnon dispersion relations....

  8. Coherent magnetic structures in terbium/holmium superlattices

    DEFF Research Database (Denmark)

    Bryn-Jacobsen, C.; Cowley, R.A.; McMorrow, D.F.


    Neutron-scattering techniques have been used to investigate the magnetic properties of three Tb/Ho superlattices grown by molecular-beam epitaxy. It is revealed that for temperatures in the range T = 10 to T-N(Ho)approximate to 130 K, there is a basal-plane ferromagnetic alignment of Tb moments w...

  9. Delitos que Vulneran la Intimidad de las Personas: Análisis crítico del artículo 161-A del Código Penal Chileno

    Directory of Open Access Journals (Sweden)

    Regina Ingrid Díaz Tolosa


    Full Text Available El artículo 161-A del Código Penal chileno es una muestra de los resultados que se obtienen al legislar materias tan importantes, como lo es la protección penal de la intimidad de las personas, de forma acelerada. La norma en análisis resiste innumerables críticas; su redacción es confusa e imprecisa, lo que conlleva arduas tareas de interpretación. Este trabajo pretende contribuir en esta labor, reflexionando acerca de puntuales problemas asociados a la tipificación de los delitos recogidos en la citada disposición, así respecto al inciso primero se analiza, especialmente, si se penaliza la indiscreción o deslealtad en las comunicaciones y actuaciones privadas, mientras que en cuanto al inciso segundo se medita acerca de si se exige el conocimiento de la obtención subrepticia del material por parte de quien lo difunde. Además, se destaca la necesaria interpretación restrictiva de estos tipos, se analiza el interés público como fundamento de la autorización legal o judicial para ejecutar las conductas tipificadas, y de ¡egeferendae, se indican las ventajas que tendría introducir un elemento subjetivo del tipo distinto del dolo como la finalidad de vulnerar ¡a intimidad de otro, a fin de salvar las incertidumbres que existen en la actual legislaciónThe article 161-A of the Chilean Penal Code is a sample of the results that are obtained when so important matters, like the penal protection of the privacy, are legislated precipitately. The norm in analysis resists innumerable critiques; its draft is confused and vague, giving us an arduous interpretation work. This paper tries to contribute in this analysis, thinking over punctual problems, for example, regarding to the first clause we studied, specially, if the indiscretion or disloyalty is penalized in the communications and private performances, while as for the second clause it is pondered if who diffuse the information must to know about that it was obtained illegally

  10. Increased Tryptophan Catabolism is Associated with Increased Frequency of CD161+Tc17/MAIT Cells, and Lower CD4+ T cell Count in HIV-1 infected Patients on cART after Two Years of Follow-up

    DEFF Research Database (Denmark)

    Gaardbo, Julie Christine; Trøseid, Marius; Stiksrud, Birgitte


    of KTR on CD4+ T cell recovery in HIV-infected patients on cART after two years of follow-up was investigated. METHODS: Forty-one HIV-infected individuals treated with cART for a minimum of two years were included. Tregs, CD161+Tc17/MAIT cells, naïve cells, immune activation, senescence and apoptosis......BACKGROUND: HIV infection is associated with increased ratio between kynurenine and tryptophan (KTR) in plasma, increased microbial translocation, expansion of Tregs and depletion of Tc17/mucosa associated invariant T cells (MAIT) cells. The association between these parameters and the impact...... divided in two groups defined by high vs. low KTR. The CD4+ T cell count was determined at inclusion and after two years of follow-up. RESULTS: The KTR decreased following cART initiation. Patients on cART with high KTR displayed an immunological profile with high sCD14, high percentage Tregs, low...

  11. 32_155 - 161_BIO 083 Magashi

    African Journals Online (AJOL)


    pesticide and lubricant activities. Phytol-. Diterpene is an antimicrobial, anticancer, anti- inflammatory and diuretic agent (Praveen et al.,. 2010). Similarly Maria et .... Capitalizing on the Bio-Economic Value of Multi-purpuse Medicinal Plants for the. Rehabilitation of Drylands in Sub-Saharan. Africa.The International Bank for.

  12. 40 CFR 161.150 - General. (United States)


    .... Physicians, hospitals, and poison control centers also request this information to aid in their..., explodability, storage stability, corrosion, and dielectric breakdown voltage. For example, a study of the... container sides will not be damaged and cause the contents to leak during storage, transport, handling, or...

  13. 12 CFR 303.161 - Filing procedures. (United States)


    ... filed in letter form with the appropriate FDIC office at the same time as required conversion... letter form with the appropriate FDIC office as soon as practicable after adoption of its plan of...; (2) Certified board resolutions relating to the conversion; (3) A business plan, including a detailed...

  14. 21 CFR 161.130 - Oysters. (United States)


    ... oysters are drained on a strainer or skimmer which has an area of not less than 300 square inches per... evenly over the draining surface of the skimmer and drained for not less than 5 minutes; or (ii) The... packing by draining a representative gallon of oysters on a skimmer of the dimensions and in the manner...

  15. Publications | Page 161 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Openness and quality in Asian distance education : sub-project 5; development and evaluation of use of distance education technologies for enriching clinical practicum in nursing in the Philippines (restricted access). The Virtual Clinical Experience Courseware was distributed to all Master of Arts in Nursing (MAN) students ...

  16. 161 Teachers' Continuing Professional Development as Correlates ...

    African Journals Online (AJOL)


    Abstract. The study examined the correlates of teachers' continuing professional development on universal basic education in Bayelsa State, Nigeria. Using descriptive survey, a sample of 500 teachers was randomly selected from twenty (20) Basic Junior Secondary Schools and Primary Schools used for the study.

  17. Publications | Page 161 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    We share the results of our funded research, and offer free training materials to guide researchers and institutions. Want more? Explore outputs from ... The Coastal Cities at Risk project takes an interdisciplinary approach involving natural, social, and health scientists, engineers, and economists. The initiative focuses on ...

  18. 27 CFR 22.161 - Records. (United States)


    ... shall be kept current at all times. (b) Records of receipt and shipment. Records of receipt and shipment shall consist of the consignor's or consignee's (as the case may be) invoice, bill or bill of lading, or...) General. All persons qualified under this part shall keep accurate records of all receipts, shipments...

  19. Clean Cities Now Vol. 16.1

    Energy Technology Data Exchange (ETDEWEB)



    Biannual newsletter for the U.S. Department of Energy's Clean Cities initiative. The newsletter includes feature stories on advanced vehicle deployment, idle reduction, and articles on Clean Cities coalition successes across the country.

  20. 40 CFR 63.161 - Definitions. (United States)


    ... dripping means any visible leakage from the seal including dripping, spraying, misting, clouding, and ice...). Sensor means a device that measures a physical quantity or the change in a physical quantity, such as...

  1. 22 CFR 16.1 - Definitions. (United States)


    ... surviving spouse or dependent family member of the officer or employee. (c) Grievance means any act or..., misinterpretation, or misapplication of applicable law, regulation, or published policy affecting the terms and conditions of the grievant's employment or career status; (3) Allegedly wrongful disciplinary action against...

  2. 161-IJBCS-Article-Dr Ekanayake

    African Journals Online (AJOL)

    RHUMSIKI ABSTRACT. Cost effective primary and secondary wound care is needed and have significant importance in current medicine. The steroidal saponin Flabelliferin B with a UV active binder attached (FB), isolated from palmyrah.

  3. Environmental Radiation Data (ERD) Journal Report 161 (United States)

    RadNet environmental radiation monitoring data report for the period of January - March 2015. The report includes results for air, drinking water and precipitation samples collected as part of EPA's RadNet monitoring program.

  4. Reference: 161 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available ids, based on thin layer chromatography. The identity of the Ala, Asp, Phe, and T...rp conjugates was verified by gas chromatography-mass spectrometry. Insertional mutations in GH3.1, GH3.2, G

  5. The Art of Graffiti and Room 161 (United States)

    Forseth, Sonia


    Covering the walls of the art room with white paper and sealing off all the open edges with masking tape, students proceeded to do their thing'' by using tempera, oil crayons and India ink to create an environment that was completely their own. (Author/CB)

  6. 21 CFR 161.190 - Canned tuna. (United States)


    ... Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN... peppers, spinach, and tomatoes. (vi) Garlic. (vii) Lemon flavoring to be prepared from lemon oil and citric acid together with safe and suitable carriers for the lemon oil which are present at nonfunctional...

  7. 40 CFR 82.161 - Technician certification. (United States)


    .... Programs are encouraged to make provisions for non-English speaking technicians by providing tests in other languages or allowing the use of a translator when taking the test. If a translator is used, the certificate... test offered by a training and certification program approved under § 82.40. (6) Apprentices are exempt...

  8. 7 CFR 905.161 - Repacking shipper. (United States)


    ... and Orders; Fruits, Vegetables, Nuts), DEPARTMENT OF AGRICULTURE ORANGES, GRAPEFRUIT, TANGERINES, AND... repacking shipper is a person who repacks and ships citrus fruit grown in the production area in Florida... market (fruit shipped from the production area to any point outside thereof in the 48 contiguous States...

  9. 33 CFR 161.18 - Reporting requirements. (United States)


    ... call. H HOTEL Date, time and point of entry system Entry time expressed as in (B) and into the entry... Radiotelephone Act and participating in a Vessel Traffic Service (VTS) system when the watch is maintained on...

  10. 21 CFR 161.145 - Canned oysters. (United States)


    ... specifications for such cloth set forth under “2.38 mm (No. 8)” in “Official Methods of Analysis of the Association of Official Analytical Chemists,” 13th Ed. (1980), Table 1, “Nominal Dimensions of Standard Test... container. (2) Water capacity of containers is determined by the general method provided in § 130.12(a) of...

  11. Comparison of histopathology, acid fast bacillus smear and real-time polymerase chain reaction for detection of Mycobacterium tuberculosis in anal fistula in 161 patients: A prospective controlled trial. (United States)

    Garg, Pankaj; Garg, Mohinder K; Agarwal, Narinder


    Mycobacterium tuberculosis (MTB) is a known cause of refractory and recurrent fistula-in-ano. Histopathology of fistula tract and acid fast bacillus (AFB) smear of the pus are the standard procedures employed to diagnose MTB. However, they have some drawbacks. Nontubercular mycobacteria (NTM) has also been detected to cause fistula-in-ano and these methods cannot differentiate between MTB and NTM. Secondly, as these methods have low sensitivity, they could possibly be missing out MTB patients. Real-time polymerase chain reaction (RT-PCR) has high sensitivity in detecting mycobacteria. The aim of the study was to compare the sensitivity of RT-PCR, histopathology, and AFB smear in detecting MTB in fistula-in-ano. The histopathology and RT-PCR of tissue (fistula tract) was done along with AFB smear and RT-PCR of the pus was done in all the cases as per the availability of the specimen. The histopathology, AFB smear and RT-PCR was done by same pathologists in all the cases and all the patients were operated by a single surgeon. A total of 286 samples were tested in 161 patients of fistula-in-ano who were operated over a period of 1year. The mean age was 38.6±10.5 and male/female ratio was 153/8. Histopathology and RT-PCR of tissue (fistula tract) was done in 131 patients and 141 patients respectively. AFB smear and RT-PCR of pus (fistula) was done in 14 patients. Overall, MTB was detected in total of 17/161 (10.63%) patients. Out of these, MTB was detected in tissue (fistula tract) in 1/131 (0.76%) by histopathology and 14/141 (10%) by RT-PCR tissue. In pus samples, AFB smear was negative in all cases (0/14), whereas RT-PCR detected MTB in four of 14 (28.6%) patients. In 17 patients detected to have MTB, four-drug antitubercular therapy (ATT) was recommended. ATT was started in 15 patients. Nine of 17 patients completed 6months ATT and were cured. Six of 17 patients are currently taking ATT. Two patients did not take ATT; both of these have persistent symptoms of pus

  12. Quantitative imaging by pixel-based contrast-enhanced ultrasound reveals a linear relationship between synovial vascular perfusion and the recruitment of pathogenic IL-17A-F+IL-23+ CD161+ CD4+ T helper cells in psoriatic arthritis joints. (United States)

    Fiocco, Ugo; Stramare, Roberto; Martini, Veronica; Coran, Alessandro; Caso, Francesco; Costa, Luisa; Felicetti, Mara; Rizzo, Gaia; Tonietto, Matteo; Scanu, Anna; Oliviero, Francesca; Raffeiner, Bernd; Vezzù, Maristella; Lunardi, Francesca; Scarpa, Raffaele; Sacerdoti, David; Rubaltelli, Leopoldo; Punzi, Leonardo; Doria, Andrea; Grisan, Enrico


    To develop quantitative imaging biomarkers of synovial tissue perfusion by pixel-based contrast-enhanced ultrasound (CEUS), we studied the relationship between CEUS synovial vascular perfusion and the frequencies of pathogenic T helper (Th)-17 cells in psoriatic arthritis (PsA) joints. Eight consecutive patients with PsA were enrolled in this study. Gray scale CEUS evaluation was performed on the same joint immediately after joint aspiration, by automatic assessment perfusion data, using a new quantification approach of pixel-based analysis and the gamma-variate model. The set of perfusional parameters considered by the time intensity curve includes the maximum value (peak) of the signal intensity curve, the blood volume index or area under the curve, (BVI, AUC) and the contrast mean transit time (MTT). The direct ex vivo analysis of the frequencies of SF IL17A-F+CD161+IL23+ CD4+ T cells subsets were quantified by fluorescence-activated cell sorter (FACS). In cross-sectional analyses, when tested for multiple comparison setting, a false discovery rate at 10%, a common pattern of correlations between CEUS Peak, AUC (BVI) and MTT parameters with the IL17A-F+IL23+ - IL17A-F+CD161+ - and IL17A-F+CD161+IL23+ CD4+ T cells subsets, as well as lack of correlation between both peak and AUC values and both CD4+T and CD4+IL23+ T cells, was observed. The pixel-based CEUS assessment is a truly measure synovial inflammation, as a useful tool to develop quantitative imaging biomarker for monitoring target therapeutics in PsA.

  13. Results of an investigation to determine local flow characteristics at the air data probe locations using an 0.030-scale model (45-0) of the space shuttle vehicle orbiter configuration 140A/B (modified) in the NASA Ames Research Center unitary plan wind tunnel (OA161, A, B, C), volume 1 (United States)

    Nichols, M. E.


    Results are presented of wind tunnel test 0A161 of a 0.030-scale model 45-0 of the configuration 140A/B (modified) space shuttle vehicle orbiter in the NASA Ames Research Center Unitary Plan Wind Tunnel facilities. The purpose of this test was to determine local total and static pressure environments for the air data probe locations and relative effectiveness of alternate flight-test probe configurations. Testing was done in the Mach number range from 0.30 to 3.5. Angle of attack was varied from -8 to 25 degrees while sideslip varied between -8 and 8 degrees.

  14. Hb Midnapore [β53(D4)Ala→Val; HBB: c.161C>T]: A Novel Hemoglobin Variant with a Structural Abnormality Associated with IVS-I-5 (G>C) (HBB: c.92+5G>C) Found in a Bengali Indian Family. (United States)

    Panja, Amrita; Chowdhury, Prosanto; Basu, Anupam


    We describe a novel C>T substitution at codon 53 of the HBB gene (HBB: c.161C>T). The proband was a transfusion-dependent β-thalassemia major (β-TM) patient. DNA was extracted and subsequently, DNA sequencing was done to detect the mutations on the HBB gene. Capillary zone electrophoresis (CZE) revealed the presence of an unknown peak. She inherited this mutation from her grandmother through her mother. This mutation exists in cis with the common β0 mutation IVS-I-5 (G>C) (HBB: c.92+5G>C). The proband is homozygous for HBB: c.92+5G>C and needs monthly transfusions. On the other hand, her grandmother, mother and sister all possess this novel mutation cis with the heterozygous HBB: c.92+5G>C. They are carriers not thalassemic. This mutation produces the substitution β53(D4)Ala→Val; HBB: c.161C>T, a new structural hemoglobin (Hb) variant. As this variant was identified in a Bengali family from Paschim Midnapore district of West Bengal, India, it has been designated as Hb Midnapore. This variant has now been reported to the HbVar database.

  15. Photoluminescence studies of a Terbium(III) complex as a fluorescent probe for DNA detection

    Energy Technology Data Exchange (ETDEWEB)

    Khorasani-Motlagh, Mozhgan, E-mail:; Noroozifar, Meissam; Niroomand, Sona; Moodi, Asieh


    The photoluminescence properties of a Tb(III) complex of the form [Tb(phen){sub 2}Cl{sub 3}·OH{sub 2}] (phen=1,10-phenanthroline) in different solvents are presented. It shows the characteristic luminescence of the corresponding Ln{sup 3+} ion in the visible region. The emission intensity of this complex in coordinating solvent is higher than non-coordinating one. The suggested mechanism for the energy transfer between the ligand and Tb{sup 3+} ion is the intramolecular energy transfer mechanism. The interactions of the Tb(III) complex with fish salmon DNA are studied by fluorescence spectroscopy, circular dichroism study and viscosity measurements. The results of fluorescence titration reveal that DNA strongly quenches the intrinsic fluorescence of the complex through a static quenching procedure. The binding constant (K{sub b}) of the above metal complex at 25 °C is determined by the fluorescence titration method and it is found to be (8.06±0.01)×10{sup 3} M{sup −1}. The thermodynamic parameters (ΔH{sup 0}>0, ΔS{sup 0}>0 and ΔG{sup 0}<0) indicate that the hydrophobic interactions play a major role in DNA–Tb complex association. The results support the claim that the title complex bonds to FS-DNA by a groove mode. -- Highlights: • Photoluminescence of [Tb(phen){sub 2}Cl{sub 3}·OH{sub 2}] in different solvents are studied. • Tb(III) complex shows good binding affinity to FS DNA with K{sub b}=(8.06±0.01)×10{sup 3} M{sup −1}. • Viscosity of DNA almost unchanged by increasing amount of Tb complex. • CD spectrum of DNA has a little change with increasing amount of Tb complex. • Thermodynamic parameters indicate that the binding reaction is entropically driven.

  16. Lanthanides in Nuclear Medicine. The Production of Terbium-149 by Heavy Ion Beams

    CERN Document Server

    Dmitriev, S N; Zaitseva, N G; Maslov, O D; Molokanova, L G; Starodub, G Ya; Shishkin, S V; Shishkina, T V


    Among radioactive isotopes of lanthanide series elements, finding the increasing using in nuclear medicine, alpha-emitter {149}Tb (T_{1/2} = 4.118 h; EC 76.2 %; beta^+ 7.1 %; alpha 16.7 %) is considered as a perspective radionuclide for radioimmunotherapy. The aim of the present work is to study experimental conditions of the {149}Tb production in reactions Nd({12}C, xn){149}Dy (4.23 min; beta^+, EC)\\to {149}Tb when the Nd targets have been irradiated by heavy ions of carbon. On the basis of results of formation and decay of {149}Dy\\to{149}Tb evaluation of the {149}Tb activity, is made which can be received under optimum conditions (enriched {142}Nd target, {12}C ions with the energy 120 MeV and up to current 100 mu A, time of irradiating 8-10 hours). Under these conditions {149}Tb can be obtained up to 30 GBq (up to 0.8 Ci).

  17. Poly[[aqua-?3-picolinato-?2-picolinato-dipicolinatopotassium(I)terbium(III)] 2.5-hydrate


    Filipe A. Almeida Paz; João Rocha; Jacek Klinowski; Tito Trindade; Nogueira,Helena I. S.; Soares-Santos, Paula C. R.; Cunha-Silva, Lu?s


    In the title compound, [KTb(C6H4NO2)4(H2O)]·2.5H2O, each Tb3+ centre is coordinated by four N and five O atoms from five distinct picolinate ligands in a geometry resembling a highly distorted tricapped trigonal prism. One of the ligands establishes a skew bridge between neighbouring Tb3+ centres, leading to the formation of one-dimensional anionic polymeric chains, {[(C6H4NO2)4Tb]−}n, running along the direction [010]. Each K+ cation is seven-coordinated by six O atoms from one an...

  18. Spin waves in terbium. III. Magnetic anisotropy at zero wave vector

    DEFF Research Database (Denmark)

    Houmann, Jens Christian Gylden; Jensen, J.; Touborg, P.


    The energy gap at zero wave vector in the spin-wave dispersion relation of ferromagnetic. Tb has been studied by inelastic neutron scattering. The energy was measured as a function of temperature and applied magnetic field, and the dynamic anisotropy parameters were deduced from the results....... The axial anisotropy is found to depend sensitively on the orientation of the magnetic moments in the basal plane. This behavior is shown to be a convincing indication of considerable two-ion contributions to the magnetic anisotropy at zero wave vector. With the exception of the sixfold basal...... the effects of zero-point deviations from the fully aligned ground state, and we tentatively propose polarization-dependent two-ion couplings as their origin....

  19. Structural and Magnetic Anisotropy in Amorphous Terbium-Iron Thin Films (United States)

    Hufnagel, Todd Clayton


    High density, removable media magnetooptic disk drives have recently begun to make significant gains in the information mass storage market. The media in these disks are amorphous rare-earth/transition-metal (RE-TM) alloys. One vital property of these materials is a large perpendicular magnetic anisotropy; that is, an easy axis of magnetization which is perpendicular to the plane of the film. A variety of theories, sometimes contradictory, have been proposed to account for this surprising presence of an anisotropic property in an amorphous material. Recent research indicates that there is an underlying atomic-scale structural anisotropy which is responsible for the observed magnetic anisotropy. Several different types of structural anisotropy have been proposed to account for the observed magnetic anisotropy, including pair-ordering anisotropy (anisotropic chemical short-range order) and bond orientation anisotropy (an anisotropy in coordination number or distances independent of chemical ordering). We have studied the structural origins of perpendicular magnetic anisotropy in amorphous Tb-Fe thin films by employing high-energy and anomalous dispersion x-ray scattering. The as-deposited films show a clear structural anisotropy, with a preference for Tb-Fe near neighbors to align in the out-of-plane direction. These films also have a large perpendicular magnetic anisotropy. Upon annealing, the magnetic anisotropy energy drops significantly, and we see a corresponding reduction in the structural anisotropy. The radial distribution functions indicate that the number of Tb-Fe near-neighbors increases in the in-plane direction, but does not change in the out-of-plane direction. Therefore, the distribution of Tb-Fe near-neighbors becomes more uniform upon annealing. We propose that the observed reduction in perpendicular magnetic anisotropy energy is a result of this change in structure. Our results support the pair -ordering anisotropy model of the structural anisotropy in amorphous Tb-Fe thin films. We see no evidence to support the bond orientation anisotropy model.

  20. Luminescence properties of terbium-doped Li3PO4 phosphor for ...

    Indian Academy of Sciences (India)

    Antonov-Romanovskii et al [2] firstly suggested applications of OSL for personal dosime- try. This technique got momentum for personnel dosime- try after the development of α-Al2O3:C. OSL properties of α-Al2O3:C have been investigated for personnel dosimetry, environmental dosimetry, medical dosimetry and space.

  1. Luminescence properties of terbium-doped Li3PO4 phosphor for ...

    Indian Academy of Sciences (India)

    The powder X-ray diffraction (PXRD), photoluminescence (PL) emission and excitation spectra, thermoluminescence (TL) and optically stimulated luminescence (OSL) were measured. The particle size was calculated using the Debye Scherrer formula and found to be 79.42 nm. PL emission spectra of Li 3 PO 4 :Tb 3 + ...

  2. Charge-transfer-based terbium MOF nanoparticles as fluorescent pH sensor for extreme acidity. (United States)

    Qi, Zewan; Chen, Yang


    Newly emerged metal organic frameworks (MOFs) have aroused the great interest in designing functional materials by means of its flexible structure and component. In this study, we used lanthanide Tb 3+ ions and small molecular ligands to design and assemble a kind of pH-sensitive MOF nanoparticle based on intramolecular-charge-transfer effect. This kind of made-to-order MOF nanoparticle for H + is highly specific and sensitive and could be used to fluorescently indicate pH value of strong acidic solution via preset mechanism through luminescence of Tb 3+ . The long luminescence lifetime of Tb 3+ allows eliminating concomitant non-specific fluorescence by time-revised fluorescence techniques, processing an advantage in sensing H + in biological media with strong autofluorescence. Our method showed a great potential of MOF structures in designing and constructing sensitive sensing materials for specific analytes directly via the assembly of functional ions/ligands. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Assessment of terbium (III) as a luminescent probe for the detection of tuberculosis biomarkers

    Energy Technology Data Exchange (ETDEWEB)

    Bamogo, W. [CNRS, IRAMIS, UMR 3685 NIMBE/LEDNA, F-91191 Gif-sur-Yvette (France); Mugherli, L. [CEA, IRAMIS, UMR 3685 NIMBE/LEDNA, F-91191 Gif-sur-Yvette (France); Banyasz, A. [CNRS, IRAMIS, LIDyL/Laboratoire Francis Perrin, URA 2453, F-91191 Gif-sur-Yvette (France); Novelli-Rousseau, A.; Mallard, F. [BioMérieux SA, F-38000 Grenoble (France); Tran-Thi, T.-H., E-mail: [CNRS, IRAMIS, UMR 3685 NIMBE/LEDNA, F-91191 Gif-sur-Yvette (France)


    A detection method for nicotinic acid, a specific metabolite marker of Mycobacterium tuberculosis present in cultures and patients' breath, is studied in complex solutions containing other metabolites and in biological media such as urine, saliva and breath condensate. The method is based on the analysis of the luminescence increase of Tb{sup 3+} complexes in the presence of nicotinic acid due to the energy transfer from the excited ligand to the lanthanide ion. It is shown that other potential markers found in M. tuberculosis culture supernatant, such as methyl phenylacetate, p-methyl anisate, methyl nicotinate and 2-methoxy biphenyl, can interfere with nicotinic acid via a competitive absorption of the excitation photons. A new strategy to circumvent these interferences is proposed with an upstream trapping of volatile markers preceding the detection of nicotinic acid in the liquid phase via the luminescence of Tb{sup 3+} complexes. The cost of the method is evaluated and compared with the Xpert MTB/RIF test endorsed by the World Health Organization. - Highlights: • Nicotinic acid, a specific marker of M. tuberculosis, can be detected via luminescence. • The detection limit with a commercial phosphorimeter is 0.4 µmol·L{sup -1}. • Other metabolites of M. tuberculosis can interfere via absorbed excitation light. • The interference can be removed via trapping of the most volatile metabolites. • A breath analysis procedure's cost is compared with the Xpert TBM/RIF test.

  4. A highly porous luminescent terbium-organic framework for reversible anion sensing

    Energy Technology Data Exchange (ETDEWEB)

    Wong, K.L.; Law, G.L.; Wong, W.T. [Department of Chemistry, The University of Hong Kong, Pokfulam Road, Hong Kong (China); Yang, Y.Y. [School of Chemistry and Chemical Engineering, Sun Yat-Sen University, Guangzhou 510275 (China)


    Unique tailored porous frameworks incorporating a lanthanide metal center have been designed to function as chemical detectors. A flexible multidentate ligand, mucic acid, is used to differentiate between several anions, thus creating an organic framework that is ideally suited for applications in gas separation, sensors, and chemical switches. (Abstract Copyright [2006], Wiley Periodicals, Inc.)

  5. Synthesis and characterization of wide bandgap semiconductors doped with terbium for electroluminescent devices


    Montañez Huamán, Liz Margarita


    En el presente trabajo de investigación se ha estudiado propiedades estequiometrias, estructurales y de emisión de luz de semiconductor de amplio ancho de banda dopados con terbio. La difracción de rayos-X en ángulo rasante confirma el estado amorfo de las películas. Los espectros de absorción infrarroja muestran la formación de óxidos en las películas y la espectroscopia de foto-electrones de rayos-X revela la formación de oxinitruro de aluminio y oxicarburo de silicio. Las pe...

  6. Synthesis and characterization of terbium-doped SrSnO3 pigments

    Czech Academy of Sciences Publication Activity Database

    Dohnalová, Ž.; Gorodylova, N.; Šulcová, P.; Vlček, Milan


    Roč. 40, č. 8 (2014), s. 12637-12645 ISSN 0272-8842 Institutional support: RVO:61389013 Keywords : pigments * solid state reaction * perovskites Subject RIV: CA - Inorganic Chemistry Impact factor: 2.605, year: 2014

  7. An optical material for the detection of β-hydroxybutyrate based on a terbium complex (United States)

    Wang, Xiaomiao; Chen, Huili; Li, Hua


    A novel Tb3+ complex (Tb(C14H10O4)ṡCl, TbL2) based on benzoic acid (L+H) was successfully synthesized, and gave a weak green emission in methanol-water (V:V, 4:1, pH 4.49). With the addition of β-hydroxybutyrate (β-HB) to a semi-aqueous solution of TbL2, an increment of the luminescent intensity at 545 nm assigned to 5D4 → 7F5 transition of Tb3+ was measured, which was evident to the naked eye. The response showed high selectivity for β-HB compared with other common anions including Cl-, NO3-, CO32-, PO43-, HPO42-, HPO4-, CO42-, PO74-, SO42-, lactate, AcO-, citrate, malate therefore it has the potential to be applied as a luminescent sensor for β-HB.

  8. 40 CFR 51.161 - Public availability of information. (United States)


    ... advertisement in the area affected of the location of the source information and analysis specified in paragraph... submitted by owners and operators. The public information must include the agency's analysis of the effect... the information submitted by the owner or operator and of the State or local agency's analysis of the...

  9. Dicty_cDB: CFJ161 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available sae68c10.y1 Gm-c1064 Glycine max cDNA clone GENOME SYSTEMS CLONE ID: Gm-c1064-3212 5' similar to TR:O65744...sq98c12.y1 Gm-c1049 Glycine max cDNA clone GENOME SYSTEMS CLONE ID: Gm-c1049-1199 5' similar to TR:O65744...sg79d05.y1 Gm-c1007 Glycine max cDNA clone GENOME SYSTEMS CLONE ID: Gm-c1007-2626 5' similar to TR:O65744...saf75f12.y1 Gm-c1078 Glycine max cDNA clone GENOME SYSTEMS CLONE ID: Gm-c1078-2184 5' similar to TR:O65744...sa37e09.y1 Gm-c1004 Glycine max cDNA clone GENOME SYSTEMS CLONE ID: Gm-c1004-1505 5' similar to TR:O24653

  10. 40 CFR 161.101 - Required vs. conditionally required data. (United States)


    ...) PESTICIDE PROGRAMS DATA REQUIREMENTS FOR REGISTRATION OF ANTIMICROBIAL PESTICIDES How To Use Data Tables... with a given general use pattern are needed by EPA to evaluate the risks or benefits of a product... pattern are needed by EPA to evaluate the risks or benefits of a product having that use pattern if the...

  11. 40 CFR 161.390 - Reentry protection data requirements. (United States)


    ...) PESTICIDE PROGRAMS DATA REQUIREMENTS FOR REGISTRATION OF ANTIMICROBIAL PESTICIDES Data Requirement Tables... oncogenic effects or other adverse effects as evidenced by subchronic, chronic, and reproduction studies... scientifically validated toxicological or epidemiological evidence that a pesticide or residue of a pesticide...

  12. 161---8 Dec 2009.indd [final version].indd

    African Journals Online (AJOL)


    Dec 8, 2009 ... Vol. 65 No. 1 Page 5 of 7. Table 1. Type Distribution for preachers, compared with the United Kingdom population norms. N = 389 + = 1% of N I = Selection Ratio Index *<.05 **p<.01 ***p<.001. The sixteen Complete Types. Dichotomous Preference. ISTJ. ISFJ. INFJ. INTJ. E. 147. (37.8%). ***I = 0.72 n = 44.

  13. What we do | Page 161 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Topic(s): Sri Lanka, Remittances, Peace, Terrorism, Conflict Resolution, Community Development. Region(s): Americas, Canada, North And Central America, Asia, South And Central Asia, Sri Lanka. This project will examine the role of diaspora funding and networking in ethno-political conflict in Sri Lanka by examining ...

  14. Dicty_cDB: CFG161 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available ktmrtltisfhdf fiwfncfwffiglfgsngaihl*rfckssrtyifvl*lspvycidlhknviyf*hlhily gfnlwsiil*fikenl*fng****kiicns*ly...vnynaisffinvfnnwlhcyndygnns igkprlvictignvfihpl*t Frame C: ---KFMFLVFNLYWTHYVITYTCYSVVSGLVASWYFFADEDFNGMPPKP

  15. Dicty_cDB: SFD161 [Dicty_cDB

    Lifescience Database Archive (English)


  16. Dicty_cDB: SLJ161 [Dicty_cDB

    Lifescience Database Archive (English)


  17. 40 CFR 161.290 - Environmental fate data requirements. (United States)


    ... adsorption/desorption R R R R R TGAI or PAIRA TGAI or PAIRA 163-1 Volatility: (Lab) (2) CR CR CR TEP TEP 163-2 (Field) (2) CR CR CR TEP TEP 163-3 Dissipation studies-field Soil R R R TEP TEP 164-1 Aquatic (sediment) R R TEP TEP 164-2 Forestry R TEP TEP 164-3 Combination and tank mixes (2) 164-4 Soil, long-term...

  18. 33 CFR 161.5 - Deviations from the rules. (United States)


    ... appropriate District Commander. Upon receipt of the written request, the District Commander may authorize a... appropriate VTS Director. Requests to deviate shall be made as far in advance as practicable. Upon receipt of... handling characteristics, traffic density, radar contacts, environmental conditions and other relevant...

  19. 40 CFR 161.640 - Product performance data requirements. (United States)


    ... microbial pests associated with human and animal wastes (1) CR EP* 91-7 Products for treating water systems... data unless the pesticide product bears a claim to control pest microorganisms that pose a threat to..., microorganisms infectious to man in any area of the inanimate environment or a claim to control vertebrates (such...

  20. 40 CFR 161.167 - Discussion of formation of impurities. (United States)


    ... produce other products or substances. (viii) The process control, purification and quality control...) Technical grade active ingredients and products produced by an integrated system. (1) Each impurity associated with the active ingredient which was found to be present in any analysis of the product conducted...

  1. Dicty_cDB: CHP161 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available |CD169096.1 MM1-0024G-M078-E11-U.B MM1-0024 Schistosoma mansoni cDNA cloneMM1-0024G-M078-E11.B, mRNA...|CD169707.1 MM1-0024T-M086-B01-U.B MM1-0024 Schistosoma mansoni cDNA clone MM1-0024T-M086-B01.B, mRNA...|CD169077.1 MM1-0024G-M078-D02-U.B MM1-0024 Schistosoma mansoni cDNA clone MM1-0024G-M078-D02.B, mRNA...|CD169818.1 MM1-0024T-M087-D03-U.B MM1-0024 Schistosoma mansoni cDNA clone MM1-0024T-M087-D03.B, mRNA...|CD168683.1 MM1-0023U-M091-D09-U.B MM1-0023 Schistosoma mansoni cDNA clone MM1-0023U-M091-D09.B, mRNA

  2. A Formal Theory of Perception. Technical Report No. 161. (United States)

    Rottmayer, William Arthur

    An attempt to build a mathematical model of a device that could learn geometry is discussed. The report discusses the background and motivation of the study, the coding problem, the derivation of Suppes "Stimulus-Response Theory of Finite Automata" used in the work in learning theory, and a summary of the technical work. (DB)

  3. March 2001 EAST AFRICAN MEDICAL JOURNAL 161 East African ...

    African Journals Online (AJOL)


    Mar 1, 2001 ... Accident by bicycle 186 5.6 48 1,4 234 70. Dog bite 104 3.1 36 1.1 140 4.2. Accident falling .... useful guide as to whether particular injuries are a problem(5). Lack of complete morbidity data for ... 25 (l%) cases, snake and dog bites 26 (l%) cases each, human bites 13 cases and firearms 21 (1 %) cases.

  4. 9 CFR 161.3 - Standards for accredited veterinarian duties. (United States)


    ..., vaccination or treatment performed by him or her with respect to any animal in that program, unless he or she..., vaccination or treatment performed by him or her with respect to any animal in that program, unless he or she... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Standards for accredited veterinarian...

  5. 161---8 Dec 2009.indd [final version].indd

    African Journals Online (AJOL)


    Dec 8, 2009 ... ABSTRACT. A sample of 389 experienced preachers completed a measure of psychological type. They then read Mark 1:29–39 and recorded their evaluations of the four reflections on this passage proposed by Francis (1997) and which were derived from the SIFT method of biblical hermeneutics and.

  6. Dicty_cDB: SFJ161 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available Translated Amino Acid sequence ifkhyn*ytfcffssflffyfhfifhckyi**kik*nkie**ik*KRMSSPPTTTTTTTT STGGNQETPKAI...sequence (All Frames) Frame A: ifkhyn*ytfcffssflffyfhfifhckyi**kik*nkie**ik*KRMSSPPTTTTTTTT STGGNQETPKAI

  7. What we do | Page 161 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    This knowledge can be used as a tool for addressing pressing global challenges. ... and future generations from the devastating health, social, environmental and economic consequences of tobacco consumption and exposure to tobacco smoke. ... Argentina, Bangladesh, Brazil, India, Kenya, Lebanon, Malawi, Viet Nam.

  8. 14 CFR 16.1 - Applicability and description of part. (United States)


    ..., regulation, or other authority that provides an administrative process for the investigation or adjudication of complaints by a Federal agency other than the FAA, persons shall use the administrative process... section 308 of the Federal Aviation Act of 1958, as amended). (2) Requirements of the Anti-Head Tax Act...

  9. What we do | Page 161 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Livelihood Diversification for Smallholder Tobacco Farmers in South Nyanza, Kenya - Phase I. Most of Kenya's tobacco production takes place in the South Nyanza region, where the land under tobacco cultivation has increased rapidly and often at the expense of traditional food crops and livestock activities. Kenya, North ...

  10. All projects related to | Page 161 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)


    This research will investigate how inclusive urban planning and governance can help reduce urban tensions, conflicts, inequalities, and violence in five Indian cities (Ahmedabad, Gurgaon, Patna, Guwahati, and Bidar). Start Date: December 21, 2012. End Date: September 12, 2016. Topic: VIOLENCE, Poverty, URBAN ...


    African Journals Online (AJOL)

    effectiveness of on-shore oil spillage remediation in Port-Harcourt in particular and the Niger. Delta region in ... The yearly mean. Eni D. D. & Okpiliya F. E. - Evaluation of On-Shore Oil Spill Remediation Operations in Port Harcourt, Nigeia .... contaminated environment for the purpose of detoxification of toxic pollutants.

  12. 40 CFR 80.161 - Detergent additive certification program. (United States)


    ... new certification information which demonstrates that the modification is consistent with the... fuel specifications must include: (A) The sulfur content in weight percent. (B) The T-90 distillation... the detergent may lose its eligibility to be used to comply with the detergency requirements of this...

  13. Dicty_cDB: SSG161 [Dicty_cDB

    Lifescience Database Archive (English)


  14. Publications | Page 161 | CRDI - Centre de recherches pour le ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Cette publication explore le sens que revêt l'agriculture et guide le lecteur à travers un nouveau territoire à la jonction de l'alimentation, de l'écologie et de la culture. Dans les systèmes alimentaires d'Asie du Sud, la démarcation entre biodiversité cultivée et biodiversité naturelle s'... The Future Control of Food : A Guide to ...

  15. 21 CFR 161.170 - Canned Pacific salmon. (United States)


    ... 1.814 kg (64 oz). 301×411 454 g (16 oz). 301×408 439 g (151/2 oz). 401×211 439 g (151/2 oz). 607×406×108 439 g (151/2 oz). 301×308 340 g (12 oz). 307×200.25 220 g (73/4 oz). 513×307×103 220 g (73/4 oz... substandard fill specified in § 130.14(b) of this chapter, in the manner and form therein specified. [42 FR...

  16. 40 CFR 161.190 - Physical and chemical characteristics. (United States)


    .... (3) Required if technical chemical is organic and non-polar. (4) Required if test substance is dispersible with water. (5) Required if product contains an oxidizing or reducing agent. (6) Required if... pressure TGAI or PAI TGAI or PAI 63-9 Dissociation constant TGAI or PAI TGAI or PAI 63-10 Octanol/water...

  17. Dicty_cDB: SFF161 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CP000529_2493( CP000529 |pid:none) Polaromonas naphthalenivorans C... 45 0.002 AL132969_20( AL132969 |pid:none)...003 CP000530_47( CP000530 |pid:none) Polaromonas naphthalenivorans CJ2... 44 0.003 protein update 2009.

  18. Publications | Page 161 | CRDI - Centre de recherches pour le ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Culture, Environment, and Food to Prevent Vitamin A Deficiency. Dans cet ouvrage qui s'adresse aux planificateurs du développement et aux étudiants en nutrition, santé publique et anthropologie culturelle humaine, on aborde des enjeux de l'utilisation des sources naturelles d'aliments pour prévenir la carence en ...

  19. 19 CFR 161.2 - Enforcement for other agencies. (United States)


    ... exportations of arms, ammunition, implements of war, helium gas, and other munitions of war are governed by...) Importations and exportations of controlled substances are governed by laws administered by the Drug...

  20. 21 CFR 161.175 - Frozen raw breaded shrimp. (United States)


    ... the sieves under a faucet, preferably with spray attached, and rinse shrimp with no rubbing of flesh... careful to avoid undue pressure or rubbing, and return each shrimp to the sieve. Remove the top sieve and...

  1. Modular forms and special cycles on Shimura curves (AM-161)

    CERN Document Server

    Kudla, Stephen S; Yang, Tonghai


    Modular Forms and Special Cycles on Shimura Curves is a thorough study of the generating functions constructed from special cycles, both divisors and zero-cycles, on the arithmetic surface ""M"" attached to a Shimura curve ""M"" over the field of rational numbers. These generating functions are shown to be the q-expansions of modular forms and Siegel modular forms of genus two respectively, valued in the Gillet-Soulé arithmetic Chow groups of ""M"". The two types of generating functions are related via an arithmetic inner product formula. In addition, an analogue of the classical Siegel-Weil


    African Journals Online (AJOL)

    the child after collecting same willingly give in for it with the adult, it is said to be rape as well. ... in their teens, while others are matured adults (Obasi, 2007). ... Christian teen girls are no less likely to become victims of the rape". Rape cases are not limited to Nigeria alone. Other countries of the globe have their own side of ...

  3. 7 CFR 4279.161 - Filing preapplications and applications. (United States)


    ... list of assumptions showing the basis for the projections. (8) Lender's complete written analysis... including a cash-flow analysis, history of debt repayment, necessity of any debt refinancing, and the credit... borrower's history, projections and equity, and the collateral to be obtained. (17) Any additional...

  4. What we do | Page 161 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Mariam Nakawa, photographed near her mine shaft at a gold mining site in central Uganda ... Golden girls: The hidden role of women in Africa's artisanal mines ... (graduate students, professors, researchers) from Canada and Latin America and the Caribbean (LAC) opportunities for face-to-face dialogue on development ...

  5. 40 CFR 161.32 - Format of data submission. (United States)


    ... of a published document, all relevant facts of publication, such as the journal title, volume, issue... include the following elements in addition to the study itself: (i) A title page, as described in... oversize pages and glued bindings are not acceptable. (c) Contents of title page. Each individual study...

  6. Dicty_cDB: AFM161 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available eus Uni-Zap XR EST Library Sp... 46 0.003 2 ( GO147943 ) CAGA3319.fwd CAGA Alvinella pompejana Normalized ...... 40 0.005 3 ( GO097927 ) CAFZ1859.fwd CAFZ Alvinella pompejana Incyte regu... 40

  7. 33 CFR 161.1 - Purpose and Intent. (United States)


    ..., enhances the safe routing of vessels through congested waterways or waterways of particular hazard. Under... promote safe vessel movement by reducing the potential for collisions, rammings, and groundings, and the...) Vessel Traffic Services provide the mariner with information related to the safe navigation of a waterway...

  8. pH dependent photophysical studies of new europium and terbium complexes of tripodal ligand: Experimental and semiempirical approach

    Energy Technology Data Exchange (ETDEWEB)

    Akbar, Rifat [Department of Chemistry, Sant Longowal Institute of Engineering & Technology, Longowal, Punjab 148106 (India); Baral, Minati [Department of Chemistry, National Institute of Technology Kurukshetra, Haryana 136119 (India); Kanungo, B K, E-mail: [Department of Chemistry, Sant Longowal Institute of Engineering & Technology, Longowal, Punjab 148106 (India)


    The photophysical properties of adduct of a novel nonadentate tripodal ligand, 5,5′-(2-(((8-hydroxyquinolin-5-yl)methylamino)methyl)-2-methylpropane-1, 3-diyl)bis(azanediyl)bis(methylene diquinolin-8-ol, (TAME5OX), with Eu{sup 3+} and Tb{sup 3+} metal ions have been probed for photonics applications. The absorption spectroscopy of these complexes show remarkable spectral changes due to characteristic lanthanide transitions, which support the use of TAME5OX as a sensitive optical pH based sensor to detect Ln{sup 3+} metal ions in biological systems. In addition, these complexes have also been shown to exhibit strong green fluorescence allowing simultaneous sensing within the visible region under physiological pH in competitive medium for both Eu{sup 3+} and Tb{sup 3+} ions. The intense fluorescence from these compounds were revealed to intermittently get quenched under acidic as well as basic conditions due to the photoinduced intramolecular electron transfer from excited 8-hydroxyquinoline (8-HQ) moiety to metal ion, just an opposite process. This renders these compounds the OFF–ON–OFF type of pH-dependent fluorescent sensor. The thermodynamic stability and aqueous coordination chemistry of the chelator with the said lanthanide ions have also been probed by potentiometric, UV–visible and fluorescence spectrophotometric method. TAME5OX has been found to form two protonated complexes [Ln(H{sub 5}L)]{sup 5+} and [Ln(H{sub 4}L)]{sup 4+} below pH 2.5 with both metal ions, which consecutively deprotonates through one proton process with rise of pH. The formation constants (log β{sub 11n}) of neutral complexes have been determined to be 33.51 and 32.16 with pLn (pLn=−log[Ln{sup 3+}]) values of 16.14 and 19.48 for Eu{sup 3+} and Tb{sup 3+} ions, respectively, calculated at pH 7.4, indicating TAME5OX is a good lanthanide synthetic chelator. The emission lifetimes of the Eu{sup 3+} and Tb{sup 3+} complexes recorded in D{sub 2}O and H{sub 2}O suggest the presence of water molecules in the first coordination sphere of the metal ions. NMR titrations were carried out to determine the stoichiometry of chelates. The complexe's coordination geometries were optimized by using PM7 as sparkle/PM7 model. The theoretical electronic behavior was evaluated to support the experimental findings, based on ZINDO/S methodology at configuration interaction with single excitations (CIS) level. These results emphasize the capability of the use of the theoretical models in prediction of geometries and all other calculations of compounds containing lanthanide ions and create new interesting possibilities for the design in-silico of novel and highly efficient lanthanide–organic edifice. - Highlights: • Photophysical behavior of Eu{sup 3+} and Tb{sup 3+} complexes of TAME5OX has been investigated. • This tripodal ligand forms thermodynamically stable Ln{sup 3+} complexes. • These compounds exhibit strong green fluorescence under physiological pH. • Green fluorescence gets quenched under acidic and basic conditions, due to PET process. • This renders these compounds the OFF–ON–OFF type of pH-dependent fluorescent sensors.

  9. Visible photoluminescence in polycrystalline terbium doped aluminum nitride (Tb:AlN) ceramics with high thermal conductivity (United States)

    Wieg, A. T.; Kodera, Y.; Wang, Z.; Imai, T.; Dames, C.; Garay, J. E.


    Thermal management continues to be one of the major challenges in the development of high powered light sources such as solid state lasers. In particular, the relatively low thermal conductivity of standard photoluminescent (PL) materials limits the overall power output and/or duty cycle. We present a method based on current activated pressure assisted densification for the fabrication of high thermal conductivity PL materials: rare earth doped polycrystalline bulk aluminum nitride. Specifically, the ceramics are translucent and are doped with Tb3+, allowing for emission in the visible. Remarkably, the ceramics have a room temperature thermal conductivity of 94 W/(m K) which is almost seven times higher than that of the state of the art host material, Nd-doped yttrium aluminum garnet. These light emitting properties coupled with very high thermal conductivity should enable the development of a wide variety of more powerful light sources.

  10. Synthesis and Characterization of Europium(III) and Terbium(III) Complexes: An Advanced Undergraduate Inorganic Chemistry Experiment (United States)

    Swavey, Shawn


    Undergraduate laboratories rarely involve lanthanide coordination chemistry. This is unfortunate in light of the ease with which many of these complexes are made and the interesting and instructive photophysical properties they entail. The forbidden nature of the 4f transitions associated with the lanthanides is overcome by incorporation of…

  11. Sensitized green emission of terbium with dibenzoylmethane and 1, 10 phenanthroline in polyvinyl alcohol and polyvinyl pyrrolidone blends (United States)

    Kumar, Brijesh; Kaur, Gagandeep; Rai, S. B.


    Tb doped polyvinyl alcohol: polyvinyl pyrrolidone blends with dibenzoylmethane (DBM) and 1, 10 Phenanthroline (Phen) have been prepared by solution cast technique. Bond formation amongst the ligands and Tb3 + ions in the doped polymer has been confirmed employing Fourier Transform Infrared (FTIR) techniques. Optical properties of the Tb3 + ions have been investigated using UV-Vis absorption, excitation and fluorescence studies excited by different radiations. Addition of dimethylbenzoate and 1, 10 Phenanthroline to the polymer blend increases the luminescence from Tb3 + ions along with energy transfer from the polymer blend itself. Luminescence decay curve analysis affirms the non-radiative energy transfer from DBM and Phen to Tb3 + ions, which is identified as the reason behind this enhancement. The fluorescence decay time of PVA-PVP host decreases from 6.02 ns to 2.31 ns showing an evidence of energy transfer from the host blend to the complexed Tb ions. Similarly the lifetime of DBM and Phen and both in the blend reduces in the complexed system showing the feasibility of energy transfer from these excited DBM and Phen to Tb3 + and is proposed as the cause of the above observations. These entire phenomena have been explained by the energy level diagram.

  12. A Terbium Metal-Organic Framework for Highly Selective and Sensitive Luminescence Sensing of Hg2+Ions in Aqueous Solution. (United States)

    Xia, Tifeng; Song, Tao; Zhang, Gege; Cui, Yuanjing; Yang, Yu; Wang, Zhiyu; Qian, Guodong


    A series of isomorphic lanthanide metal-organic frameworks (MOFs) Ln(TATAB)⋅(DMF) 4 (H 2 O)(MeOH) 0.5 (LnTATAB, Ln=Eu, Tb, Sm, Dy, Gd; H 3 TATAB=4,4',4''-s-triazine-1,3,5-triyltri-p-aminobenzoic acid) have been solvothermally synthesized and structurally characterized. Among these MOFs, TbTATAB exhibits good water stability and a high fluorescence quantum yield. Because mercury ions (Hg 2+ ) have a high affinity to nitrogen atoms, and the space between multiple nitrogen atoms from triazine and imino groups is suitable for interacting with Hg 2+ ions, TbTATAB shows highly selective and sensitive detection of Hg 2+ in aqueous solution with a detection limit of 4.4 nm. Furthermore, it was successfully applied to detect Hg 2+ ions in natural water samples. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Separation device of radio lanthanides (DISER); Dispositivo de separacion de radiolantanidos (DISER)

    Energy Technology Data Exchange (ETDEWEB)

    Vera T, A.L. [FES-Zaragoza, UNAM, 09000 Mexico D.F. (Mexico); Monroy G, F.; Vazquez M, J.C.; Jimenez B, F. [ININ, 52750 La Marquesa, Estado de Mexico (Mexico)]. e-mail:


    At the present time the cancer is one of the main causes of mortality in our country, therefore, its prevention, diagnostic and treatment is of vital importance for those health systems. The treatment of the cancer and other illnesses, starting from monoclonal antibodies, peptides, macro aggregates or marked aminoacids with beta particles emitting radioisotopes, it is an extremely promising field. The radioactive lanthanides: Promethium 149, Terbium 161, Holmium 166 and Lutetium 177 are beta emitting ({beta}), which possess nuclear and chemical properties that have shown their feasibility like radioisotopes of radiotherapeutic use. However, these radioisotopes are not commercially available; to this respect, the Radioactive Materials Research Laboratory (LIMR) of the National Institute of Nuclear Research (ININ), it has developed the methodology of production of these radioisotopes and based on these works, there is designed, built and mounted the Radio lanthanides Separation Device (DISER) able to carry out the radioisotopes production in a routine way. This device is content in a cell that has an auxiliary air service, an extraction system and it is protected with a lead armor-plating of 10 cm. The DISER it is manual and easy of managing. The main function of this equipment is the radio lanthanides separation starting from the extractive chromatography by means of packed columns with a commercial resin (LnSPS) and recovered in the superior and inferior part by fiber glass. The DISER is composed by a main carrousel where the separation columns and the elution recipients are mounted. Also counts with an opening system of irradiation vials, port samples for columns and glass material. The present work presents a detailed description of the DISER, as well as its handling that allows to produce the radioisotopes Promethium-149, Terbium-161, Holmium-166 and Lutetium-177 starting from the separation of its parent elements Neodymium-149, Gadolinium-161, Dysprosium-166

  14. KN161L01: WHOI cruise 161 leg 01 aboard the R/V Knorr from 2000-01-12 - 2000-01-20 (NODC Accession 0064332) (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Post-cruise download of raw data from shipboard computer(s) as furnished by the Woods Hole Oceanographic Institution Shipboard Scientific Support Group and archived...

  15. KN161L07: WHOI cruise 161 leg 07 aboard the R/V Knorr from 2000-05-18 - 2000-06-05 (NODC Accession 0064323) (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Post-cruise download of raw data from shipboard computer(s) as furnished by the Woods Hole Oceanographic Institution Shipboard Scientific Support Group and archived...

  16. KN161L05: WHOI cruise 161 leg 05 aboard the R/V Knorr from 2000-03-19 - 2000-04-05 (NODC Accession 0064325) (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Post-cruise download of raw data from shipboard computer(s) as furnished by the Woods Hole Oceanographic Institution Shipboard Scientific Support Group and archived...

  17. KN161L06: WHOI cruise 161 leg 06 aboard the R/V Knorr from 2000-04-05 - 2000-05-16 (NODC Accession 0064324) (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Post-cruise download of raw data from shipboard computer(s) as furnished by the Woods Hole Oceanographic Institution Shipboard Scientific Support Group and archived...

  18. KN161L09: WHOI cruise 161 leg 09 aboard the R/V Knorr from 2000-07-03 - 2000-09-08 (NODC Accession 0057655) (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Post-cruise download of raw data from shipboard computer(s) as furnished by the Woods Hole Oceanographic Institution Shipboard Scientific Support Group and archived...

  19. Ce que nous faisons | Page 161 | CRDI - Centre de recherches pour ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Ce projet examinera le rôle du financement et des réseaux de la diaspora dans le conflit ethnopolitique au Sri Lanka, en étudiant les réseaux des collectivités transnationales tamoule et cinghalaise au Canada et leurs liens avec le Sri Lanka. Canada, Amérique Nord Et Centrale, Sri Lanka, Amérique Du Sud, Asie Centrale, ...

  20. 33 CFR 161.35 - Vessel Traffic Service Houston/Galveston. (United States)


    ... Areas Precautionary area name Radius (yds.) Center point Latitude Longitude Bolivar Roads 4000 29°20.9... Bayou 1000 29°45.0′ N 95°17.3′ W Note: Each Precautionary Area encompasses a circular area of the radius... Channel Lt. 12 29° 22.4′ N; 94° 50.9′ W X Houston Ship Channel ICW Intersection Houston Ship Channel (HSC...

  1. Adesina et al., Afr J Tradit Complement Altern Med. (2013) 10(3):161 ...

    African Journals Online (AJOL)


    C. Illoh, ³Imoh I. Johnny and ³Imo E. Jacobs. ¹Drug Research ... Wiens, 1998) and most genera of African mistletoes belong to the family Loranthaceae (Polhill and Wiens, 1998). Seven genera .... The most distinctive constituents of most European and Asian mistletoes are proteins, the viscotoxins, lectins and carbohydrates.

  2. 25 CFR 161.1 - What definitions do I need to know? (United States)


    ... traditionally confined his or her traditional grazing use and occupancy and/or an area traditionally inhabited... management plan is a statement of management objectives for grazing, farming, or other agriculture management...

  3. 40 CFR Appendix A to Part 161 - Data Requirements for Registration: Use Pattern Index (United States)


    .... Identify the Pesticide Use Site Group listed below (e.g., agricultural crops, forests, ornamental plants.... Ornamental Plants and Forest Trees. 3. General Soil Treatment and Composting. 4. Processed or Manufactured....g., grape, kiwi fruit) Strawberry Cranberry Pome fruits (e.g., apple, quince) Stone fruits (e.g...

  4. 40 CFR 161.490 - Wildlife and aquatic organisms data requirements. (United States)


    ...-3 Avian reproduction (preferably mallard and bobwhite) (3) CR CR CR CR CR CR TGAI TGAI 71-4... information, such as that derived from mammalian reproduction studies that indicates the reproduction in... organisms indicate the reproductive physiology of fish and/or invertebrates may be affected. (B...

  5. Page 1 Ife.Journal of Sciencevol. 9, no.2(2007) 161 KARYOTYPE ...

    African Journals Online (AJOL)

    were collected from the wet forest, dry forest and derived savanna areas of Nigeria to determine their karyotype. Each of the species has a chromosome number of n = 7 (2n = 14). A pair of satellited chromosomes was observed in the genome of Greenwayodendron suaveolens and Cleistopholis patens. The centromeric ...

  6. Pyrroloquinoline Quinone Is a Plant Growth Promotion Factor Produced by Pseudomonas fluorescens B161 (United States)

    Choi, Okhee; Kim, Jinwoo; Kim, Jung-Gun; Jeong, Yeonhwa; Moon, Jae Sun; Park, Chang Seuk; Hwang, Ingyu


    Pseudomonas fluorescens B16 is a plant growth-promoting rhizobacterium. To determine the factors involved in plant growth promotion by this organism, we mutagenized wild-type strain B16 using ΩKm elements and isolated one mutant, K818, which is defective in plant growth promotion, in a rockwool culture system. A cosmid clone, pOK40, which complements the mutant K818, was isolated from a genomic library of the parent strain. Tn3-gusA mutagenesis of pOK40 revealed that the genes responsible for plant growth promotion reside in a 13.3-kb BamHI fragment. Analysis of the DNA sequence of the fragment identified 11 putative open reading frames, consisting of seven known and four previously unidentified pyrroloquinoline quinone (PQQ) biosynthetic genes. All of the pqq genes showed expression only in nutrient-limiting conditions in a PqqH-dependent manner. Electrospray ionization-mass spectrometry analysis of culture filtrates confirmed that wild-type B16 produces PQQ, whereas mutants defective in plant growth promotion do not. Application of wild-type B16 on tomato (Solanum lycopersicum) plants cultivated in a hydroponic culture system significantly increased the height, flower number, fruit number, and total fruit weight, whereas none of the strains that did not produce PQQ promoted tomato growth. Furthermore, 5 to 1,000 nm of synthetic PQQ conferred a significant increase in the fresh weight of cucumber (Cucumis sativus) seedlings, confirming that PQQ is a plant growth promotion factor. Treatment of cucumber leaf discs with PQQ and wild-type B16 resulted in the scavenging of reactive oxygen species and hydrogen peroxide, suggesting that PQQ acts as an antioxidant in plants. PMID:18055583

  7. 161 Hydrologie et morphologie de l'estuaire du fleuve Sassandra ...

    African Journals Online (AJOL)

    HP 2000

    Résumé. Les études physico-chimiques des eaux de surface et de sub-surface et les levés bathymétriques effectués dans l'estuaire du fleuve Sassandra, ont permis de caractériser l'hydrologie et la morphologie du fond de cet embouchure. Sur toute la surface d'eau le pH est proche de la neutralité, la conductivité est ...

  8. 14 CFR 161.305 - Required analysis and conditions for approval of proposed restrictions. (United States)


    ... description of the relationship of the effect of the proposed restriction on airport users (by aviation user... Stage 3 operations shall prepare and make available for public comment an analysis that supports, by... effect at the airport; and measures taken to achieve land-use compatibility, such as controls or...

  9. 24 CFR 248.161 - Mandatory sale of housing in excess of the Federal cost limit. (United States)


    ... to purchase the project for a sale price less than the transfer preservation value of the project... fide offer in § 248.101, except for the requirement that the sale price equal the transfer preservation... any eligible low income housing for which the transfer preservation rent determined under § 248.121...

  10. 78 FR 56692 - Colorado River Storage Project-Rate Order No. WAPA-161 (United States)


    ... Bailey, Power Marketing Manager, CRSP Management Center, Western Area Power Administration, 150 East... Jeka, CRSP Manager, CRSP Management Center, Western Area Power Administration, 150 East Social Hall...) Organization Act (42 U.S.C. 7152) transferred to and vested in the Secretary of Energy the power marketing...

  11. : tous les projets | Page 161 | CRDI - Centre de recherches pour le ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Pour davantage d'emplois décents au Pérou - renforcement des capacités de recherche et d'élaboration des politiques .... l'émergence des institutions de la société civile, ces dernières n'ont jamais atteint le degré d'inclusion, de participation et de pluralisme requis afin de donner lieu à une société ouverte et démocratique.

  12. 25 CFR 161.301 - What will a grazing permit contain? (United States)


    ... permits will contain the following provisions: (1) Name of permit holder; (2) Range management plan...) Animal identification requirements (i.e., brand, microchip, freeze brand, earmark, tattoo, etc.); (6...

  13. Yeast Interacting Proteins Database: YGL198W, YGL161C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available YGL198W YIP4 Protein that interacts with Rab GTPases, localized to late Golgi vesicles; computational...that interacts with Rab GTPases, localized to late Golgi vesicles; computational ...eracts with Rab GTPases, localized to late Golgi vesicles; computational analysis of large-scale protein-pro...ized to late Golgi vesicles; computational analysis of large-scale protein-protein interaction data suggests

  14. SU-E-T-161: Evaluation of Dose Calculation Based On Cone-Beam CT

    Energy Technology Data Exchange (ETDEWEB)

    Abe, T; Nakazawa, T; Saitou, Y; Nakata, A; Yano, M [Graduate School of Medicine, Sapporo Medical University, Sapporo, Hokkaido (Japan); Tateoka, K [Graduate School of Medicine, Sapporo Medical University, Sapporo, Hokkaido (Japan); Radiation Therapy Research Institute, Social Medical Corporation Teishinkai, Sapporo, Hokkaido (Japan); Fujimoto, K [Radiation Therapy Research Institute, Social Medical Corporation Teishinkai, Sapporo, Hokkaido (Japan); Sakata, K [Graduate School of Medicine, Sapporo Medical University, Sapporo, Hokkaido (Japan); Sapporo Medical University, Sapporo, Hokkaido (Japan)


    Purpose: The purpose of this study is to convert pixel values in cone-beam CT (CBCT) using histograms of pixel values in the simulation CT (sim-CT) and the CBCT images and to evaluate the accuracy of dose calculation based on the CBCT. Methods: The sim-CT and CBCT images immediately before the treatment of 10 prostate cancer patients were acquired. Because of insufficient calibration of the pixel values in the CBCT, it is difficult to be directly used for dose calculation. The pixel values in the CBCT images were converted using an in-house program. A 7 fields treatment plans (original plan) created on the sim-CT images were applied to the CBCT images and the dose distributions were re-calculated with same monitor units (MUs). These prescription doses were compared with those of original plans. Results: In the results of the pixel values conversion in the CBCT images,the mean differences of pixel values for the prostate,subcutaneous adipose, muscle and right-femur were −10.78±34.60, 11.78±41.06, 29.49±36.99 and 0.14±31.15 respectively. In the results of the calculated doses, the mean differences of prescription doses for 7 fields were 4.13±0.95%, 0.34±0.86%, −0.05±0.55%, 1.35±0.98%, 1.77±0.56%, 0.89±0.69% and 1.69±0.71% respectively and as a whole, the difference of prescription dose was 1.54±0.4%. Conclusion: The dose calculation on the CBCT images achieve an accuracy of <2% by using this pixel values conversion program. This may enable implementation of efficient adaptive radiotherapy.

  15. 27 CFR 555.161 - Engaging in business without a license. (United States)


    ... the business of importing, manufacturing, or dealing in explosive materials without a license issued..., TOBACCO, FIREARMS, AND EXPLOSIVES, DEPARTMENT OF JUSTICE EXPLOSIVES COMMERCE IN EXPLOSIVES Unlawful Acts...

  16. Retention, Attrition, and Mobility among Teachers and Administrators in West Virginia. REL 2016-161 (United States)

    Lochmiller, Chad R.; Adachi, Eishi; Chesnut, Colleen E.; Johnson, Jerry


    Members of the West Virginia School Leadership Research Alliance partnered with Regional Educational Laboratory Appalachia to study the average retention, attrition, and mobility rates among teachers and administrators in the West Virginia public school system. There is increasing evidence nationwide that low teacher and administrator retention…

  17. 40 CFR 161.34 - Flagging of studies for potential adverse effects. (United States)


    ... a type listed in paragraph (b) of this section to support an application for new or amended... maternal toxicity at the same dose levels 5 Neurotoxicity 81-7 When compared with controls, treated animals...

  18. Page 1 The Specific Heats of Crystals—II 161 different techniques. It ...

    Indian Academy of Sciences (India)

    different techniques. It is a simple matter with the aid of the table to cal- culate the contributions to the specific heat arising from the nine modes of internal vibration of the diamond structure. The lowest frequency appearing in the table expressed in wave-numbers, viz., 621 cm." may also be properly assumed to be the upper ...

  19. SU-E-J-161: Inverse Problems for Optical Parameters in Laser Induced Thermal Therapy

    Energy Technology Data Exchange (ETDEWEB)

    Fahrenholtz, SJ; Stafford, RJ; Fuentes, DT [UT MD Anderson Cancer Center, Houston, TX (United States); UT Graduate School of Biomedical Sciences, Houston, TX (United States)


    Purpose: Magnetic resonance-guided laser-induced thermal therapy (MRgLITT) is investigated as a neurosurgical intervention for oncological applications throughout the body by active post market studies. Real-time MR temperature imaging is used to monitor ablative thermal delivery in the clinic. Additionally, brain MRgLITT could improve through effective planning for laser fiber's placement. Mathematical bioheat models have been extensively investigated but require reliable patient specific physical parameter data, e.g. optical parameters. This abstract applies an inverse problem algorithm to characterize optical parameter data obtained from previous MRgLITT interventions. Methods: The implemented inverse problem has three primary components: a parameter-space search algorithm, a physics model, and training data. First, the parameter-space search algorithm uses a gradient-based quasi-Newton method to optimize the effective optical attenuation coefficient, μ-eff. A parameter reduction reduces the amount of optical parameter-space the algorithm must search. Second, the physics model is a simplified bioheat model for homogeneous tissue where closed-form Green's functions represent the exact solution. Third, the training data was temperature imaging data from 23 MRgLITT oncological brain ablations (980 nm wavelength) from seven different patients. Results: To three significant figures, the descriptive statistics for μ-eff were 1470 m{sup −1} mean, 1360 m{sup −1} median, 369 m{sup −1} standard deviation, 933 m{sup −1} minimum and 2260 m{sup −1} maximum. The standard deviation normalized by the mean was 25.0%. The inverse problem took <30 minutes to optimize all 23 datasets. Conclusion: As expected, the inferred average is biased by underlying physics model. However, the standard deviation normalized by the mean is smaller than literature values and indicates an increased precision in the characterization of the optical parameters needed to plan MRgLITT procedures. This investigation demonstrates the potential for the optimization and validation of more sophisticated bioheat models that incorporate the uncertainty of the data into the predictions, e.g. stochastic finite element methods.

  20. Participatory Design in Academic Libraries: New Reports and Findings. CLIR Publication No. 161 (United States)

    Foster, Nancy Fried, Ed.


    This report is based on a series of presentations at the second CLIR Seminar on "Participatory Design of Academic Libraries," held at the University of Rochester's River Campus June 5-7, 2013. Participatory design is a relatively recent approach to understanding library user behavior. It is based on techniques used in anthropological and…

  1. 7 CFR 28.161 - Disputes involving contracts for shipment of cotton from United States. (United States)


    ... States to a contract made under the rules of the association or exchange. (b) The submission of samples... with the rules of the association or exchange shall be deemed to be a submission to the Department. (c... articles, rules, or bylaws of the association or exchange, such determinations may be evidenced by awards...

  2. Yeast Interacting Proteins Database: YKL057C, YGR161C-C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available required for even distribution of NPCs around the nuclear envelope, involved in establishment of a normal nu..., required for even distribution of NPCs around the nuclear envelope, involved in establishment of a normal

  3. 25 CFR 161.204 - How are carrying capacities and stocking rates established? (United States)


    ... be based on forage production, range utilization, the application of land management practices, and range improvements in place to achieve uniformity of grazing under sustained yield management principles... agricultural resource management plan and range unit management plan. (b) BIA, with the concurrence of the...

  4. 75 FR 81417 - Airworthiness Directives; Piper Aircraft, Inc. Model PA-28-161 Airplanes (United States)


    ...-057-AD; Amendment 39-16543; AD 2010-26-04] RIN 2120-AA64 Airworthiness Directives; Piper Aircraft, Inc...): 2010-26-04 Piper Aircraft, Inc: Amendment 39-16543; Docket No. FAA- 2010-1006; Directorate Identifier... alternative GmbH Supplement replacement times may be Airplane approved for this part. Maintenance Manual Piper...

  5. 29 CFR 4.161 - Minimum monetary wages under contracts exceeding $2,500. (United States)


    ... service contracts in excess of $2,500 to service employees engaged in performance of the contract or... wages to be paid the various classes of service employees engaged in the performance of the contract or... rates for such employees provided for in such agreement, including prospective wage increases as...

  6. 7 CFR 457.161 - Canola and rapeseed crop insurance provisions. (United States)


    ...: Canola and Rapeseed Crop Provisions If a conflict exists among the policy provisions, the order of... that contains at least 30 percent of an industrial type of oil as shown on the Special Provisions and... Official United States Standards for Grain including, but not limited to protein and oil, will not be...

  7. Horticultural Related Occupations. VEH Horticulture Related. Curriculum Guide for Agribusiness 161. (United States)

    Texas A and M Univ., College Station. Dept. of Agricultural Education.

    This curriculum guide provides materials for teachers to use in developing a 1- or 2-year course in horticulture-related occupations for at-risk and special education students. It is one of 28 semester courses in agricultural science and technology for Texas high schools. The program prepares low-achieving students with employability skills that…

  8. 21 CFR 161.173 - Canned wet pack shrimp in transparent or nontransparent containers. (United States)


    ... HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION FISH AND SHELLFISH Requirements for... ingredients. The following safe and suitable optional ingredients may be used: (i) Salt. (ii) Lemon juice...

  9. 25 CFR 161.3 - What is the purpose of this part? (United States)


    ... wildlife, fisheries, cultural resources, recreation and to regulate water runoff and minimize soil erosion... and economics of agribusiness, sources and use of credit and marketing of agricultural products, and...

  10. 40 CFR 93.161 - Conformity evaluation for Federal installations with facility-wide emission budgets. (United States)


    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Conformity evaluation for Federal... PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) DETERMINING CONFORMITY OF FEDERAL ACTIONS TO STATE OR FEDERAL IMPLEMENTATION PLANS Determining Conformity of General Federal Actions to State or Federal...

  11. Adesina et al., Afr J Tradit Complement Altern Med. (2013) 10(3):161 ...

    African Journals Online (AJOL)


    claimed a general use to counter sorcery and magical powers, to treat mental conditions, sterility, and health problems associated with urino-genital system, rheumatism and pain. These hemi-parasitic plants, mistletoes of the Loranthaceae and Viscaceae, are widely used in various cultures in almost every continent to treat ...

  12. Ce que nous faisons | Page 161 | CRDI - Centre de recherches pour ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Le CRDI finance des études de recherche dans les pays en voie de développement en vue de produire un changement durable à grande échelle. Pour que le savoir devienne un outil permettant de résoudre des problèmes urgents :

  13. The influence of hydration state on thermoregulation during a 161-km ultramarathon. (United States)

    Valentino, Taylor R; Stuempfle, Kristin J; Kern, Marialice; Hoffman, Martin D


    It is advised that individuals should avoid losing >2% of their body mass during exercise in order to prevent hyperthermia. This study sought to assess whether a loss of >2% body mass leads to elevations in core temperature during an ultramarathon. Thirty runners agreed to take part in the study. Body mass and core temperature were measured at the start, at three locations during the race and the finish. Core temperature was not correlated with percent body mass change (p = 0.19) or finish time (p = 0.11). Percent body mass change was directly associated with finish time (r = 0.58, p 3% body mass does not contribute to rises in core temperature. An emphasis on fluid replacement for body mass losses of this magnitude during prolonged exercise is not justified as a preventative measure for heat-related illnesses.

  14. Yeast Interacting Proteins Database: YIR016W, YNL161W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available olved in cell wall biosynthesis, apical growth, proper mating projection morphology, bipolar bud site select...sis, apical growth, proper mating projection morphology, bipolar bud site selection in diploid cells, and ce

  15. Yeast Interacting Proteins Database: YIL106W, YNL161W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available l morphogenesis pathways; involved in cell wall biosynthesis, apical growth, proper mating projection morphology, bipolar...ll morphogenesis pathways; involved in cell wall biosynthesis, apical growth, proper mating projection morphology, bipolar

  16. 76 FR 161 - Current List of Laboratories and Instrumented Initial Testing Facilities Which Meet Minimum... (United States)


    .... Advanced Toxicology Network, 3560 Air Center Cove, Suite 101, Memphis, TN 38118. 901-794-5770/888-290-1150....) Maxxam Analytics,\\*\\ 6740 Campobello Road, Mississauga, ON, Canada L5N 2L8.905-817-5700. (Formerly: Maxxam Analytics Inc., NOVAMANN (Ontario), Inc.) * The Standards Council of Canada (SCC) voted to end its...

  17. 40 CFR 86.161-00 - Air conditioning environmental test facility ambient requirements. (United States)


    ... 40 Protection of Environment 18 2010-07-01 2010-07-01 false Air conditioning environmental test... conditioning environmental test facility ambient requirements. The goal of an air conditioning test facility is... elements that are discussed are ambient air temperature and humidity, minimum test cell size, solar heating...

  18. 40 CFR 161.202 - Purposes of the registration data requirements. (United States)


    ... chemistry. (1) Residue Chemistry Data are used by the Agency to estimate the exposure of the general...) Residue chemistry data are also needed to support the adequacy of one or more methods for the enforcement... water resources. (6) Accumulation studies. Accumulation studies indicate pesticide residue levels in...

  19. 25 CFR 161.200 - Is an Indian agricultural resource management plan required? (United States)


    ... 25 Indians 1 2010-04-01 2010-04-01 false Is an Indian agricultural resource management plan... resource management plan required? (a) Yes, Navajo Partitioned Lands must be managed in accordance with the goals and objectives in the agricultural resource management plan developed by the Navajo Nation, or by...

  20. 9 CFR 161.1 - Statement of purpose; performance of accredited duties in different States. (United States)


    ... documents. (iii) Recognize all USDA animal identification systems. (iv) Estimate the age of livestock using a dental formula. (v) Apply USDA-recognized identification (e.g., eartag, microchip, tattoo) for the... record breed information on official documents. (iii) Apply common animal identification for Category I...

  1. 9 CFR 161.4 - Suspension or revocation of veterinary accreditation; criminal and civil penalties. (United States)


    ... signs a false, incorrect, or mislabeled animal health or inspection certificate, blood sample, official brucellosis vaccination certificate, or official tuberculin test certificate in accordance with this chapter... was not endorsed; but if the State Animal Health Official fails to take one of these actions within 14...

  2. Preparation of extraction resin for radio lanthanides separation; Preparacion de resina de extraccion para separacion de radiolantanidos

    Energy Technology Data Exchange (ETDEWEB)

    Cruz B, C.C. de la; Monroy G, F. [ININ, 52750 La Marquesa, Estado de Mexico (Mexico)]. e-mail:


    The present work presents the methodology that was developed for the preparation of one extractant resin with the aim of HDEHP, to separate radio lanthanides with serial atomic numbers. In this case it is exemplified with the separation of the following elements: Gadolinium-161 and the Terbium-161; this last radioisotope it is a beta emitting ({beta}{sup -}) that has a great potential to be used in therapy, also in nuclear medicine and in oncology, this is due to the high penetration power of their {beta}{sup -} particles that can kill to the cancerous cells and to inhibit the growth of the same ones. To be able to separate them it is necessary to appeal to extremely selective separation techniques, since the chemical properties of these elements are very similar. The chromatography is one of the more used analytical tools, this is due to its great sensibility and the selectivity in the compounds separation, in particular the use of the extractive chromatography has shown the feasibility of carrying out this type of separations for this type of elements. The resin with base of HDEHP was absorbed in an inert support under diverse preparation conditions. The extractant properties of the resin, in relation to the elements Gd and Tb (distribution coefficients), its were determined by means of the dynamic method, using as eluent solutions of nitric acid. The Gd-159 was prepared by irradiation of Gd-168 with thermal neutrons and the Tb-161 it is the result of the radioactive decay of the Gd-161 that is produced in turn with the irradiation with neutrons of Gd-160. The coefficients of distribution of Gd and Tb, using the prepared resin under diverse conditions are presented. (Author)

  3. CCDC 954774: Experimental Crystal Structure Determination : Dimethylammonium tri-terbium tris(4'-(tetrazol-2-id-5-yl)biphenyl-4-carboxylate) tetrahydroxide trihydrate unknown solvate

    KAUST Repository

    Xue, Dongxu


    An entry from the Cambridge Structural Database, the world’s repository for small molecule crystal structures. The entry contains experimental data from a crystal diffraction study. The deposited dataset for this entry is freely available from the CCDC and typically includes 3D coordinates, cell parameters, space group, experimental conditions and quality measures.

  4. CCDC 959634: Experimental Crystal Structure Determination : octakis(mu~3~-Hydroxo)-undecakis(mu~2~-2-fluorobenzoato)-(N,N-dimethylformamide)-nitrato-hexa-aqua-hexa-terbium

    KAUST Repository

    Guillerm, Vincent


    An entry from the Cambridge Structural Database, the world’s repository for small molecule crystal structures. The entry contains experimental data from a crystal diffraction study. The deposited dataset for this entry is freely available from the CCDC and typically includes 3D coordinates, cell parameters, space group, experimental conditions and quality measures.

  5. CCDC 954773: Experimental Crystal Structure Determination : Dimethylammonium tri-terbium tris(4-(tetrazol-2-id-5-yl)benzoate) tetrahydroxide trihydrate unknown solvate

    KAUST Repository

    Xue, Dongxu


    An entry from the Cambridge Structural Database, the world’s repository for small molecule crystal structures. The entry contains experimental data from a crystal diffraction study. The deposited dataset for this entry is freely available from the CCDC and typically includes 3D coordinates, cell parameters, space group, experimental conditions and quality measures.

  6. CCDC 954775: Experimental Crystal Structure Determination : Dimethylammonium tri-terbium tris(2-fluoro-4-(1H-tetrazol-5-yl)benzoate) tetrahydroxide tetradecahydrate

    KAUST Repository

    Xue, Dongxu


    An entry from the Cambridge Structural Database, the world’s repository for small molecule crystal structures. The entry contains experimental data from a crystal diffraction study. The deposited dataset for this entry is freely available from the CCDC and typically includes 3D coordinates, cell parameters, space group, experimental conditions and quality measures.

  7. CCDC 1411423: Experimental Crystal Structure Determination : catena-[dimethylammonium hexakis(mu-fumarato)-octakis(mu-hydroxo)-hexa-terbium N,N-dimethylformamide solvate hexahydrate

    KAUST Repository

    Assen, Ayalew H.


    An entry from the Cambridge Structural Database, the world’s repository for small molecule crystal structures. The entry contains experimental data from a crystal diffraction study. The deposited dataset for this entry is freely available from the CCDC and typically includes 3D coordinates, cell parameters, space group, experimental conditions and quality measures.

  8. CCDC 1410946: Experimental Crystal Structure Determination : catena-[dimethylammonium tris(mu-naphthalene-1,4-dicarboxylato)-tetrakis(mu-hydroxo)-triaqua-tri-terbium(iii) unknown solvate

    KAUST Repository

    Xue, Dongxu


    An entry from the Cambridge Structural Database, the world’s repository for small molecule crystal structures. The entry contains experimental data from a crystal diffraction study. The deposited dataset for this entry is freely available from the CCDC and typically includes 3D coordinates, cell parameters, space group, experimental conditions and quality measures.

  9. Phthalimides: Supramolecular Interactions in Crystals, Hypersensitive Solution 1H-NMR Dynamics and Energy Transfer to Europium(III and Terbium(III States

    Directory of Open Access Journals (Sweden)

    David J. Williams


    Full Text Available Detailed crystal structures and 1H-NMR characteristics of some alkylaminephthalimides, including dendritic polyphthalimides, are reported. These investigations were undertaken in order to obtain a better understanding of the relationship between solid-state supramolecular interactions, their persistence in solution and associated dynamics of magnetically hypersensitive phthalimide aromatic AA'BB'-AA'XX' proton NMR resonances. Some alkylamine phthalimides feature folded molecular geometries, which we attribute to n-π interactions among proximal amine-phthalimide sites; those alkylamine-phthalimides that have no possibility for such interactions feature fully extended phthalimide functionalities. Accordingly, alkylamine phthalimide compounds with folded solid-state geometries feature solvent and temperature dependent hypersensitive AA'BB'-AA'XX' 1H-NMR line profiles, which we attribute to the n-π interactions. Luminescence of Eu3+(5D0 and Tb3+(5D4 states show well defined metal ion environments in their complexes with dendritic phthalimides, as well as relatively weak phthalimide-lanthanide(III interactions.

  10. Analysis of tryptophan at nmoll(-1) level based on the fluorescence enhancement of terbium-gadolinium-tryptophan-sodium dodecyl benzene sulfonate system. (United States)

    Liu, Shufang; Yang, Jinghe; Wu, Xia; Su, Benyu; Sun, Changxia; Wang, Feng


    It is found that Tb(3+) can react with tryptophan (Trp) and sodium dodecyl benzene sulfonate (SDBS), and emits the intrinsic fluoresence of Tb(3+). The fluorescence intensity can be enhanced by La(3+), Gd(3+), Lu(3+), Sc(3+) and Y(3+), among which Gd(3+) has the greatest enhancement. This is a new co-luminescence system. The studies indicate that in the Tb-Gd-Trp-SDBS system, there is both Tb-Trp-SDBS and Gd-Trp-SDBS complexes, and they aggregate together and form a large congeries. The fluorescence enhancement of the Tb-Gd-Trp-SDBS system is considered to originate from intramolecular and intermolecular energy transfers, and the energy-insulating sheath effect of Gd-Trp-SDBS complex. Under the optimum conditions, the enhanced intensity of fluorescence is in proportion to the concentration of Trp in the range from 4x10(-8) to 4x10(-5)moll(-1). The detection limit is 10(-9)moll(-1). The proposed method is one of the most sensitive fluoremetries of Trp.

  11. Preparation, characterization, and properties of PMMA-doped polymer film materials: a study on the effect of terbium ions on luminescence and lifetime enhancement. (United States)

    Zhang, Hui-Jie; Fan, Rui-Qing; Wang, Xin-Ming; Wang, Ping; Wang, Yu-Lei; Yang, Yu-Lin


    Poly(methylmethacrylate) (PMMA) doped with Tb-based imidazole derivative coordination polymer {[Tb(3)(L)(μ(3)-OH)(7)]·H(2)O}(n) (1) (L = N,N'-bis(acetoxy)biimidazole) was synthesized and its photophysical properties were studied. The L'(L' = N,N'-bis(ethylacetate)biimidazole) ligand was synthesized by an N-alkylation reaction process followed by ester hydrolysis to produce ligand L. Polymer 1 and ligand L' have been characterized by (1)H NMR and IR spectroscopy, elemental analysis, PXRD and X-ray single-crystal diffraction. Coordination polymer 1 is the first observation of a CdCl(2) structure constructed with hydroxy groups and decorated by ligand L in lanthanide N-heterocyclic coordination polymers. In the 2D layered structure of 1, each Tb3 metal center is connected with three Tb1 and three Tb2 metal centers by seven hydroxyl groups in different directions, resulting in a six-membered ring. After doping, not only the luminescence intensity and lifetime enhanced, but also their thermal stability was increased in comparison with 1. When 1 was doped into poly(methylmethacrylate) (1@PMMA), polymer film materials were formed with the PMMA polymer matrix (w/w = 2.5%-12.5%) acting as a co-sensitizer for Tb(3+) ions. The luminescence intensity of the Tb(3+) emission at 544 nm increases when the content of Tb(3+) was 10%. The lifetime of 1@PMMA (914.88 μs) is more than four times longer than that of 1 (196.24 μs). All τ values for the doped polymer systems are higher than coordination polymer 1, indicating that radiative processes are operative in all the doped polymer films. This is because PMMA coupling with the O-H oscillators from {[Tb(3)(L)(μ(3)-OH)(7)]·H(2)O}(n) can suppress multiphonon relaxation. According to the variable-temperature luminescence (VT-luminescence) investigation, 1@PMMA was confirmed to be a stable green luminescent polymer film material.

  12. Changing Single-Molecule Magnet Properties of a Windmill-Like Distorted Terbium(III) α-Butoxy-Substituted Phthalocyaninato Double-Decker Complex by Protonation/Deprotonation. (United States)

    Horii, Yoji; Horie, Yusuke; Katoh, Keiichi; Breedlove, Brian K; Yamashita, Masahiro


    Synthesis, structures, and magnetic properties of α-butoxy-substituted phthalocyaninato double-decker complexes Tb(α-obPc)2 (1-) (α-obPc: dianion of 1,4,8,11,15,18,22,25-octa(n-butoxy)phthalocyaninato) with protonated (1H), deprotonated (1[HDBU]), and diprotonated forms (1H2+) are discussed. X-ray analysis was used to confirm the position of the proton in 1H, and it was revealed that the protonation induced asymmetric distortion in 1H. In contrast, 1[HDBU] was distorted in a highly symmetric windmill-like fashion. 1H is arranged in a slipped column array in the crystal packing, whereas 1[HDBU] is arranged in a one-dimensional fashion, in which the magnetic easy axes of 1[HDBU] lie along the same line. From direct-current (dc) magnetic measurements, ferromagnetic Tb-Tb interactions occur in both 1H and 1[HDBU], and magnetic hysteresis was observed. However, the area of the magnetic hysteresis in 1[HDBU] is larger than that in 1H, meaning that magnetic relaxation time (τ) is longer in 1[HDBU]. In addition, the results of alternating-current magnetic measurements in a zero dc magnetic field indicate that τ of 1[HDBU] is longer as compared to 1H. In other words, protonation/deprotonation affects not only the molecular structures and crystal packing but also the single-molecule magnet properties.

  13. A Water-Stable Dual-Channel Luminescence Sensor for UO22+Ions Based on an Anionic Terbium(III) Metal-Organic Framework. (United States)

    Ye, Junwei; Bogale, Raji F; Shi, Yangwei; Chen, Yanzhen; Liu, Xigang; Zhang, Siqi; Yang, Yaoyao; Zhao, Jianzhang; Ning, Guiling


    A stable 3D Tb III -based metal-organic framework [Tb(BPDC) 2 ]⋅(CH 3 ) 2 NH 2 (DUT-101) was synthesized, and it is the first efficient dual-channel luminescence sensor for aqueous UO 2 2+ ions. DUT-101 contains an anionic three-dimensional framework and protonated dimethylamine molecules embedded within the channels. The intense green emission of DUT-101 could be highly selectively and sensitively quenched by UO 2 2+ ions even in the presence of other competing metal ions. A possible sensing mechanism was proposed based on both suppression of luminescence resonance energy transfer and enhancement of intermolecular electron transfer. Furthermore, visual green fluorescent test papers based on DUT-101 were fabricated and could be used to discriminate UO 2 2+ ions among various metal ions. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. [?-N,N?-Bis(3-meth?oxy-2-oxidobenzyl?idene)propane-1,3-diamine]trinitratocopper(II)terbium(III) acetone solvate


    Zhang Fang; Liu Fei


    In the title complex, [CuTb(C19H20N2O4)(NO3)3]·CH3COCH3, the CuII atom is four-coordinated by two O atoms and two N atoms from the deprotonated Schiff base in a square-planar geometry, while the TbIII atom is ten-coordinated by four O atoms from the deprotonated Schiff base and six O atoms from three bidentate nitrate anions. The compound is isostructural with the previously reported GdIII analogue [Elmali & Elerman (2004). Z. Naturforsch. Teil B, 59, 535–540], which was described ...

  15. Crystal structure of a mixed-ligand terbium(III coordination polymer containing oxalate and formate ligands, having a three-dimensional fcu topology

    Directory of Open Access Journals (Sweden)

    Chainok Kittipong


    Full Text Available The title compound, poly[(μ3-formato(μ4-oxalatoterbium(III], [Tb(CHO2(C2O4]n, is a three-dimensional coordination polymer, and is isotypic with the LaIII, CeIII and SmIII analogues. The asymmetric unit contains one TbIII ion, one formate anion (CHO2− and half of an oxalate anion (C2O42−, the latter being completed by application of inversion symmetry. The TbIII ion is nine-coordinated in a distorted tricapped trigonal–prismatic manner by two chelating carboxylate groups from two C2O42− ligands, two carboxylate oxygen atoms from another two C2O42− ligands and three oxygen atoms from three CHO2− ligands, with the Tb—O bond lengths and the O—Tb—O bond angles ranging from 2.4165 (19 to 2.478 (3 Å and 64.53 (6 to 144.49 (4°, respectively. The CHO2− and C2O42− anions adopt μ3-bridging and μ4-chelating-bridging coordination modes, respectively, linking adjacent TbIII ions into a three-dimensional 12-connected fcu topology with point symbol (324.436.56. The title compound exhibits thermal stability up to 623 K, and also displays strong green photoluminescence in the solid state at room temperature.

  16. CCDC 1410822: Experimental Crystal Structure Determination : heptakis(dimethylammonium) dodecakis(mu-hydroxo)-bis(mu-oxo)-nonaaqua-nona-terbium tris(octakis(mu-hydroxo)-triaqua-bis(2-fluorobenzoato)-bis(formato)-hexa-terbium) dodecakis(5-[(4-carboxylatophenyl)methoxy]benzene-1,3-dicarboxylate) unknown solvate

    KAUST Repository

    Alezi, Dalal


    An entry from the Cambridge Structural Database, the world’s repository for small molecule crystal structures. The entry contains experimental data from a crystal diffraction study. The deposited dataset for this entry is freely available from the CCDC and typically includes 3D coordinates, cell parameters, space group, experimental conditions and quality measures.

  17. FCJ-161 Productive Provocations: Vitriolic Media, Spaces of Protest and Agonistic Outrage in the 2011 England Riots

    Directory of Open Access Journals (Sweden)

    Anthony McCosker


    Full Text Available The intense social upheaval that spread through a number of UK cities in the riots and protests of August, 2011 signalled the terrifying speed with which passionate disaffection can turn to uncontained violence. At stake in the dense and volatile debate that ensued, and in the acts of violence themselves, were contests over spaces as well as competing models of democracy, publics and citizenship, including the appropriate use of social media. Within these debates, almost universally, rational deliberative discourse and action is assumed to be the only route to legitimate “civil” society. So what is to be made of the violent physical contest over city squares, streets and property, as well as contests over acts of participation and demonstration played out online through the hundreds of eyewitness videos posted to sites like YouTube and the endless flow of often vitriolic words in blogs, comments spaces and social network sites? This paper uses a video posted to YouTube titled ‘Clapham Junction Speaker (London Riots 2011’ to examine the passion and provocation that flowed beyond the city streets to enliven, intensify and sustain forms of protest and civic engagement. We argue that the aggressive and antagonistic tenor of the Speaker’s twenty minute monologue, the bitter vitriol that flowed through the comments space, and even the act of posting it constitute significant elements of a generative, ‘agonistic’ public, to use Chantal Mouffe’s term, that operates in multiple spaces and outside of the rationalising discourse demanded by mainstream media and government. This paper develops a richer understanding of these spaces of protest, and the concept of provocation central to these events.

  18. National Indian Education Study 2015: American Indian and Alaska Native Students at Grades 4 and 8. NCES 2017-161 (United States)

    Ninneman, A. M.; Deaton, J.; Francis-Begay, K.


    The National Indian Education Study (NIES) is administered as part of the National Assessment of Educational Progress (NAEP) to allow more in-depth reporting on the achievement and experiences of American Indian/Alaska Native (AI/AN)1 students in grades 4 and 8. This report focuses primarily on two themes identified during the development of the…

  19. 37 CFR 2.161 - Requirements for a complete affidavit or declaration of continued use or excusable nonuse. (United States)


    ..., the Office will presume that the fee(s) cover the classes in ascending order, beginning with the... affidavit or declaration covers less than all the goods or services, or less than all the classes in the... audio or video cassette tape recording, CD-ROM, or a specimen in another appropriate medium. (3) Be a...

  20. Employment and Training Policy in the United States during the Economic Crisis. Upjohn Institute Working Paper No. 10-161 (United States)

    O'Leary, Christopher J.; Eberts, Randall W.


    This paper examines labor market conditions and public employment policies in the United States during what some are calling the Great Recession. We document the dramatic labor market changes that rapidly unfolded when the rate of gross domestic product growth turned negative, from the end of 2007 through early 2009. The paper reviews the…

  1. Space shuttle: Heat transfer rate measurements of North American Rockwell orbiter (161B) at nominal Mach number of 8 (United States)

    Warmbrod, J. D.; Martindale, W. R.; Matthews, R. K.


    Plots and tables which determine detailed heat transfer distributions on phase B space shuttle configurations are presented. A thin-skinned thermocouple was used to measure the reentry events of the delta wing orbiter. Data was obtained at a nominal Mach number of 8 and free stream Reynolds numbers ranging from 0.83 x 10 to the 6th power to 3.76 x 10 to the 6th power per foot. Angle of attack was varied from -5 to 50 degrees.

  2. CNV-association meta-analysis in 191,161 European adults reveals new loci associated with anthropometric traits

    DEFF Research Database (Denmark)

    Macé, Aurélien; Tuke, Marcus A; Deelen, Patrick


    )). Burden analysis shows a 0.41 cm decrease in height, a 0.003 increase in waist-to-hip ratio and increase in BMI by 0.14 kg/m(2) for each Mb of total deletion burden (P = 2.5 × 10(-10), 6.0 × 10(-5), and 2.9 × 10(-3)). Our study provides evidence that the same genes (e.g., MC4R, FIBIN, and FMO5) harbor...

  3. Central and Eastern European countries between the 16+1 platform and Chinese OBOR - One Belt, One Road - Initiative

    National Research Council Canada - National Science Library

    George Cornel Dumitrescu; Ion Alexandru Tănase


    .... For our research we selected four countries, namely: Poland, Romania, Serbia and Hungary, the group being relevant from the perspective of the transportation corridors connected to the ”One Belt, One Road” initiative: (1...

  4. 161. Necrosis por presión del septo de salida ventricular causado por dos implantes adyacentes

    Directory of Open Access Journals (Sweden)

    A. González Calle


    Conclusiones: Esta complicación ilustra que los tejidos entre dos dispositivos duros y con movimiento uno conrespecto al otro pueden desarrollar necrosis por presión y fricción y, consecuentemente, perforación. Probablemente, hubiera sido preferible sustituir el homoinjerto pulmonar con stent en el momento de la sustitución valvular aórtica.

  5. 77 FR 34935 - Foreign-Trade Zone 161; Temporary/Interim Manufacturing Authority; Siemens Energy, Inc., (Wind... (United States)


    ... Energy, Inc., (Wind Turbine Nacelles and Hubs); Notice of Approval On April 2, 2012, the Executive...) authority, on behalf of Siemens Energy, Inc., to manufacture wind turbine nacelles and hubs under FTZ...

  6. 75 FR 32357 - Gallatin National Forest; Montana; Jack Rabbit to Big Sky Meadow Village 161 kV Transmission Line... (United States)


    ... power outages from construction Fire risk Reclamation practices Alternative energy generation... Consideration of reroutes near Cascade Creek homes/Lava Lake Trailhead area, Greek Creek homes and the Deer...

  7. Hana Cervinkova, Playing Soldiers in Bohemia: An Ethnography of NATO Membership. Prague Studies in Sociocultural Anthropology 4, 2006, 161 pages.

    Directory of Open Access Journals (Sweden)

    Marybeth Peterson Ulrich


    Full Text Available Hana Cervinkova’s ethnographic portrait of the Czech military in its “post-socialist” moment is a fascinating contribution to the literature on post-communist transitions. Not merely concerned with the provision of several anthropological descriptions of disappearing cultures, such as the obsolescent enlisted ranks and Air Force technicians expert in the mechanics of moth-balled Soviet aircraft, Cervinkova is determined to link the military’s post-socialist story to the Czech state’s own fort...

  8. Borrowing at the Maximum: Undergraduate Stafford Loan Borrowers in 2007-08. Stats in Brief. NCES 2012-161 (United States)

    Wei, Christina Chang; Skomsvold, Paul


    Using data from the 2007-08 National Postsecondary Student Aid Study (NPSAS:08), this Statistics in Brief examines the extent to which undergraduate students borrow the maximum possible within the limits of the Stafford loan program (the program maximum) and their own financial need and student budgets (the individual maximum). Students who…

  9. 77 FR 20782 - Foreign-Trade Zone 161-Sedgwick County, KS; Application for Temporary/Interim Manufacturing... (United States)


    ... Manufacturing Authority; Siemens Energy, Inc.; (Wind Turbine Nacelles and Hubs); Hutchinson, KS An application... authority to produce wind turbine nacelles and hubs (HTSUS 8412.80, 8412.90, 8502.31; duty rates: free, 2.5... to wind turbine nacelles and hubs (duty rate: free, 2.5%) for the foreign inputs noted above. In...

  10. 1-[6-(1H-Indol-1-ylpyridin-2-yl]-1H-indole-3-carbaldehyde

    Directory of Open Access Journals (Sweden)

    C. Ramathilagam


    Full Text Available In the title compound, C22H15N3O, the dihedral angle between the two indole units is 33.72 (3°. The molecular structure features a weak intramolecular C—H...N interaction. In the crystal, weak C—H...O and C—H...π interactions, forming a two-dimensional network parallel to the bc plane.

  11. 161 Etude du pouvoir germinatif de quatre variétés de riz que sont ...

    African Journals Online (AJOL)


    animaux ; assurer le bien-être par l'amélioration des revenus ; créer un capital semencier de qualité des variétés ... La germination est le premier stade du cycle de vie des plantes pour produire une nouvelle ... Le but du travail est l'étude du pouvoir germinatif des semences de riz en notre possession, l'isolement et.



  13. A validated spectrofluorimetric method for the determination of citalopram in bulk and pharmaceutical preparations based on the measurement of the silver nanoparticles-enhanced fluorescence of citalopram/terbium complexes. (United States)

    Khan, Muhammad Naeem; Shah, Jasmin; Jan, Muhammad Rasul; Lee, Sang Hak


    A simple, sensitive, and accurate spectrofluorimetric method was developed for the determination of citalopram in bulk and pharmaceutical preparations. The method is based on the enhancement of the weak fluorescence signal (FL) of the Tb (III)-citalopram system in the presence of silver nanoparticles. Fluorescence intensities were measured at 555 nm after excitation at 281 nm. Prepared silver nanoparticles (AgNPs) were characterized by UV-Visible spectra and transmission electron microscopy (TEM). Various factors affecting the formation of citalopram-Tb (III)-AgNPs complexes were studied and optimized. The fluorescence intensity versus concentration plot was linear over the range 0.02-14 μg mL(-1), with an excellent correlation coefficient of 0.9978. The limit of detection (LOD) and limit of quantification (LOQ) were found to be 7.15 × 10(-6) μg mL(-1) and 2.38 × 10(-5) μg mL(-1) respectively. The proposed method was found to have good reproducibility with a relative standard deviation of 3.66% (n = 6). The interference effects of common excipients found in pharmaceutical preparations were studied. The developed method was validated statistically by performing recoveries studies and successfully applied for the assay of citalopram in bulk powder and pharmaceutical preparations. Percent recoveries were found to range from 98.98% to 100.97% for bulk powder and from 96.57% to 101.77% for pharmaceutical preparations.

  14. A "plug-and-play" approach to the preparation of transparent luminescent hybrid materials based on poly(methyl methacrylate), a calix[4]arene cross-linking agent, and terbium ions. (United States)

    Driscoll, Christopher R; Reid, Brodie L; McIldowie, Matthew J; Muzzioli, Sara; Nealon, Gareth L; Skelton, Brian W; Stagni, Stefano; Brown, David H; Massi, Massimiliano; Ogden, Mark I


    A novel methodology to prepare transparent luminescent hybrid materials is reported. Using a calixarene ionophore as a PMMA cross-linker avoids problems, such as phase segregation, and produces a polymer monolith that can be loaded with the metal ion required for luminescence post-synthesis. This approach is versatile and will simplify the production of such materials.

  15. CCDC 954772: Experimental Crystal Structure Determination : catena-(Dimethylammonium tris(mu~4~-3-fluorobiphenyl-4,4'-dicarboxylato)-tetrakis(mu~3~-hydroxo)-triaqua-tri-terbium unknown solvate)

    KAUST Repository

    Xue, Dongxu


    An entry from the Cambridge Structural Database, the world’s repository for small molecule crystal structures. The entry contains experimental data from a crystal diffraction study. The deposited dataset for this entry is freely available from the CCDC and typically includes 3D coordinates, cell parameters, space group, experimental conditions and quality measures.

  16. CCDC 1410820: Experimental Crystal Structure Determination : heptakis(dimethylammonium) heptacosa-terbium dodecakis((1,1'-biphenyl)-3,4',5-tricarboxylate) hexakis(2-fluorobenzoate) hexakis(formate) hexatriacontakis(hydroxide) bis(oxide) unknown solvate hydrate

    KAUST Repository

    Alezi, Dalal


    An entry from the Cambridge Structural Database, the world’s repository for small molecule crystal structures. The entry contains experimental data from a crystal diffraction study. The deposited dataset for this entry is freely available from the CCDC and typically includes 3D coordinates, cell parameters, space group, experimental conditions and quality measures.

  17. Terbium doped SnO2 nanoparticles as white emitters and SnO2:5Tb/Fe3O4 magnetic luminescent nanohybrids for hyperthermia application and biocompatibility with HeLa cancer cells. (United States)

    Singh, Laishram Priyobarta; Singh, Ningthoujam Premananda; Srivastava, Sri Krishna


    SnO2:5Tb (SnO2 doped with 5 at% Tb(3+)) nanoparticles were synthesised by a polyol method and their luminescence properties at different annealing temperatures were studied. Characterization of nanomaterials was done by X-ray diffraction (XRD), Fourier transformation infrared spectroscopy (FTIR), transmission electron microscopy (TEM) and vibrating sample magnetometry (VSM). XRD studies indicate that the prepared nanoparticles were of tetragonal structures. Upon Tb(3+) ion incorporation into SnO2, Sn(4+) changes to Sn(2+) and, on annealing again at higher temperature, Sn(2+) changes to Sn(4+). The prepared nanoparticles were spherical in shape. Sn-O vibrations were found from the FTIR studies. In photoluminescence studies, the intensity of the emission peaks of Tb(3+) ions increases with the increase of annealing temperature, and emission spectra lie in the region of white emission in the CIE diagram. CCT calculations show that the SnO2:5Tb emission lies in cold white emission. Quantum yields up to 38% can be obtained for 900 °C annealed samples. SnO2:5Tb nanoparticles were well incorporated into the PVA polymer and such a material incorporated into the polymer can be used for display devices. The SnO2:5Tb/Fe3O4 nanohybrid was prepared and investigated for hyperthermia applications at different concentrations of the nanohybrid. This achieves a hyperthermia temperature (42 °C) under an AC magnetic field. The hybrid nanomaterial SnO2:5Tb/Fe3O4 was found to exhibit biocompatibility with HeLa cells (human cervical cancer cells) at concentrations up to 74% for 100 μg L(-1). Also, this nanohybrid shows green emission and thus it will be helpful in tracing magnetic nanoparticles through optical imaging in vivo and in vitro application.

  18. Filmes delgados luminescentes obtidos a partir de hidroxicarbonatos de ítrio ativados por európio ou térbio Luminescent thin films obtained from ytrium hydroxycarbonates activated by terbium or europium

    Directory of Open Access Journals (Sweden)

    Emy Niyama


    Full Text Available These films were obtained by dip coating. Parameters like dislocation velocity; number of deposits, suspension concentration, and number of deposits followed or not by heat treatment between each deposit and calcination temperature were evaluated for establishing the best homogeneity. The obtained films were characterized in terms of their morphology, optical quality and photoluminescence by scanning electron microscopy (SEM, UV-vis absorption spectrophotometry and luminescence spectroscopy, respectively. The morphologic and luminescent characteristics showed dip coating as good laboratory technique for development of thin films for optical applications.

  19. Measurement of the W-pair Production Cross-section and W Branching Ratios in $e^+ e^-$ Collisions at $\\sqrt{s}$ = 161-209 GeV

    CERN Document Server

    Abdallah, J.; Adam, W.; Adzic, P.; Albrecht, T.; Alderweireld, T.; Alemany-Fernandez, R.; Allmendinger, T.; Allport, P.P.; Amaldi, U.; Amapane, N.; Amato, S.; Anashkin, E.; Andreazza, A.; Andringa, S.; Anjos, N.; Antilogus, P.; Apel, W.D.; Arnoud, Y.; Ask, S.; Asman, B.; Augustin, J.E.; Augustinus, A.; Baillon, P.; Ballestrero, A.; Bambade, P.; Barbier, R.; Bardin, D.; Barker, G.; Baroncelli, A.; Battaglia, M.; Baubillier, M.; Becks, K.H.; Begalli, M.; Behrmann, A.; Ben-Haim, E.; Benekos, N.; Benvenuti, A.; Berat, C.; Berggren, M.; Berntzon, L.; Bertrand, D.; Besancon, M.; Besson, N.; Bloch, D.; Blom, M.; Bluj, M.; Bonesini, M.; Boonekamp, M.; Booth, P.S.L.; Borisov, G.; Botner, O.; Bouquet, B.; Bowcock, T.J.V.; Boyko, I.; Bracko, M.; Brenner, R.; Brodet, E.; Bruckman, P.; Brunet, J.M.; Bugge, L.; Buschmann, P.; Calvi, M.; Camporesi, T.; Canale, V.; Carena, F.; Castro, Nuno Filipe; Cavallo, F.; Chapkin, M.; Charpentier, Ph.; Checchia, P.; Chierici, R.; Chliapnikov, P.; Chudoba, J.; Chung, S.U.; Cieslik, K.; Collins, P.; Contri, R.; Cosme, G.; Cossutti, F.; Costa, M.J.; Crennell, D.; Cuevas, J.; D'Hondt, J.; Dalmau, J.; da Silva, T.; Da Silva, W.; Della Ricca, G.; De Angelis, A.; De Boer, W.; De Clercq, C.; De Lotto, B.; De Maria, N.; De Min, A.; de Paula, L.; Di Ciaccio, L.; Di Simone, A.; Doroba, K.; Drees, J.; Dris, M.; Eigen, G.; Ekelof, T.; Ellert, M.; Elsing, M.; Espirito Santo, M.C.; Fanourakis, G.; Fassouliotis, D.; Feindt, M.; Fernandez, J.; Ferrer, A.; Ferro, F.; Flagmeyer, U.; Foeth, H.; Fokitis, E.; Fulda-Quenzer, F.; Fuster, J.; Gandelman, M.; Garcia, C.; Gavillet, Ph.; Gazis, Evangelos; Gokieli, R.; Golob, B.; Gomez-Ceballos, G.; Goncalves, P.; Graziani, E.; Grosdidier, G.; Grzelak, K.; Guy, J.; Haag, C.; Hallgren, A.; Hamacher, K.; Hamilton, K.; Haug, S.; Hauler, F.; Hedberg, V.; Hennecke, M.; Herr, H.; Hoffman, J.; Holmgren, S.O.; Holt, P.J.; Houlden, M.A.; Hultqvist, K.; Jackson, John Neil; Jarlskog, G.; Jarry, P.; Jeans, D.; Johansson, Erik Karl; Johansson, P.D.; Jonsson, P.; Joram, C.; Jungermann, L.; Kapusta, Frederic; Katsanevas, S.; Katsoufis, E.; Kernel, G.; Kersevan, B.P.; Kerzel, U.; Kiiskinen, A.; King, B.T.; Kjaer, N.J.; Kluit, P.; Kokkinias, P.; Kourkoumelis, C.; Kouznetsov, O.; Krumstein, Z.; Kucharczyk, M.; Lamsa, J.; Leder, G.; Ledroit, Fabienne; Leinonen, L.; Leitner, R.; Lemonne, J.; Lepeltier, V.; Lesiak, T.; Liebig, W.; Liko, D.; Lipniacka, A.; Lopes, J.H.; Lopez, J.M.; Loukas, D.; Lutz, P.; Lyons, L.; MacNaughton, J.; Malek, A.; Maltezos, S.; Mandl, F.; Marco, J.; Marco, R.; Marechal, B.; Margoni, M.; Marin, J.C.; Mariotti, C.; Markou, A.; Martinez-Rivero, C.; Masik, J.; Mastroyiannopoulos, N.; Matorras, F.; Matteuzzi, C.; Mazzucato, F.; Mazzucato, M.; McNulty, R.; Meroni, C.; Migliore, E.; Mitaroff, W.; Mjoernmark, U.; Moa, T.; Moch, M.; Monig, Klaus; Monge, R.; Montenegro, J.; Moraes, D.; Moreno, S.; Morettini, P.; Mueller, U.; Muenich, K.; Mulders, M.; Mundim, L.; Murray, W.; Muryn, B.; Myatt, G.; Myklebust, T.; Nassiakou, M.; Navarria, F.; Nawrocki, K.; Nicolaidou, R.; Nikolenko, M.; Oblakowska-Mucha, A.; Obraztsov, V.; Olshevski, A.; Onofre, A.; Orava, R.; Osterberg, K.; Ouraou, A.; Oyanguren, A.; Paganoni, M.; Paiano, S.; Palacios, J.P.; Palka, H.; Papadopoulou, Th.D.; Pape, L.; Parkes, C.; Parodi, F.; Parzefall, U.; Passeri, A.; Passon, O.; Peralta, L.; Perepelitsa, V.; Perrotta, A.; Petrolini, A.; Piedra, J.; Pieri, L.; Pierre, F.; Pimenta, M.; Piotto, E.; Podobnik, T.; Poireau, V.; Pol, M.E.; Polok, G.; Poropat, P.; Pozdniakov, V.; Pukhaeva, N.; Pullia, A.; Rames, J.; Ramler, L.; Read, Alexander L.; Rebecchi, P.; Rehn, J.; Reid, D.; Reinhardt, R.; Renton, P.; Richard, F.; Ridky, J.; Rivero, M.; Rodriguez, D.; Romero, A.; Ronchese, P.; Roudeau, P.; Rovelli, T.; Ruhlmann-Kleider, V.; Ryabtchikov, D.; Sadovsky, A.; Salmi, L.; Salt, J.; Savoy-Navarro, A.; Schwickerath, U.; Segar, A.; Sekulin, R.; Siebel, M.; Sisakian, A.; Smadja, G.; Smirnova, O.; Sokolov, A.; Sopczak, A.; Sosnowski, R.; Spassov, T.; Stanitzki, M.; Stocchi, A.; Strauss, J.; Stugu, B.; Szczekowski, M.; Szeptycka, M.; Szumlak, T.; Tabarelli, T.; Taffard, A.C.; Tegenfeldt, F.; Timmermans, Jan; Tkatchev, L.; Tobin, M.; Todorovova, S.; Tome, B.; Tonazzo, A.; Tortosa, P.; Travnicek, P.; Treille, D.; Tristram, G.; Trochimczuk, M.; Troncon, C.; Turluer, M.L.; Tyapkin, I.A.; Tyapkin, P.; Tzamarias, S.; Uvarov, V.; Valenti, G.; Van Dam, Piet; Van Eldik, J.; Van Lysebetten, A.; van Remortel, N.; Van Vulpen, I.; Vegni, G.; Veloso, F.; Venus, W.; Verdier, P.; Verzi, V.; Vilanova, D.; Vitale, L.; Vrba, V.; Wahlen, H.; Washbrook, A.J.; Weiser, C.; Wicke, D.; Wickens, J.; Wilkinson, G.; Winter, M.; Witek, M.; Yushchenko, O.; Zalewska, A.; Zalewski, P.; Zavrtanik, D.; Zhuravlov, V.; Zimine, N.I.; Zintchenko, A.; Zupan, M.; Zinchenko, A.


    These final results on e+e- -> W+W- production cross-section measurements at LEP2 use data collected by the DELPHI detector at centre-of-mass energies up to 209 GeV. Measurements of total cross-sections, W angular differential distributions and decay branching fractions, and the value of the CKM element |V_{cs}| are compared to the expectations of the Standard Model. These results supersede all values previously published by DELPHI.

  20. Increase of CD69, CD161 and CD94 on NK Cells in Women with Recurrent Spontaneous Abortion and in Vitro Fertilization Failure

    National Research Council Canada - National Science Library

    Mehri Ghafourian; Najmeh Karami; Ali Khodadadi; Roshan Nikbakhat


    .... This paper aims to compare circulating NK cells expressing activation and inhibition surface markers between patients with RSA and IVF failure with those of healthy multiparous and successful IVF...

  1. Site Investigation Report. 161st Air Refueling Group, Arizona National Guard, Sky Harbor International Airport and Papago Military Reservation, Phoenix, Arizona. Volume 1. Report, Tables and Figures (United States)


    channel, floodplain, and alluvial fan environments derived from drainage areas of the Salt, Gila, Agua Fria, and Verde Rivers. Thickness of upper unit...groundwater media under consideration should be demonstrated to be potable and utilized as drinldng water, either currently or at some planncA future

  2. Prevalence of Bovine Viral Diarrhoea Virus (BVDV), Bovine Herpes Virus 1 (BHV 1), Leptospirosis and Neosporosis, and associated risk factors in 161 Irish beef herds. (United States)

    Barrett, Damien; Parr, Mervyn; Fagan, John; Johnson, Alan; Tratalos, Jamie; Lively, Francis; Diskin, Michael; Kenny, David


    There are limited data available, in Ireland or elsewhere, to determine the extent of exposure to various endemic diseases among beef cows and factors associated with exposure to causative pathogens. The objectives of this study were to determine the herd and within herd prevalence of Bovine Viral Diarrhoea Virus (BVDV), Bovine Herpes Virus 1 (BHV-1), Leptospirosis and Neosporosis in a large scale study of commercial beef herds on the island of Ireland, and to examine herd level factors associated with exposure to these pathogens in these herds. The average number of cows tested per herd was 35.5 (median 30). Herd level seroprevalence to Bovine Herpesvirus-1(BHV-1), Bovine Viral-Diarrhoea Virus (BVDV), Leptospirosis and Neosporosis was 90%, 100%, 91% and 67%, respectively, while the mean within herd prevalence for the these pathogens was 40%, 77.7%, 65.7% and 5.7%, respectively. The study confirms that the level of seroconversion for the four pathogens of interest increases with herd size. There was also evidence that exposure to one pathogen may increase the risk of exposure to another pathogen. Herd level seroprevalences were in excess of 90% for BVDV, BHV-1 and Leptosporosis. Larger herds were subject to increased exposure to disease pathogens. This study suggests that exposure to several pathogens may be associated with the further exposure to other pathogens.

  3. Endocrine phenotype of 6q16.1-q21 deletion involving SIM1 and Prader-Willi syndrome-like features. (United States)

    Izumi, Kosuke; Housam, Ryan; Kapadia, Chirag; Stallings, Virginia A; Medne, Livija; Shaikh, Tamim H; Kublaoui, Bassil M; Zackai, Elaine H; Grimberg, Adda


    Proximal interstitial 6q deletion involving Single-minded 1 (SIM1) gene causes a syndromic form of obesity mimicking Prader-Willi syndrome. In addition to obesity, Prader-Willi syndrome includes several other endocrinopathies, such as hypothyroidism, growth hormone deficiency, and hypogonadotropic hypogonadism. The endocrine phenotype of interstitial 6q deletion remains largely unknown, although clinical similarities between Prader-Willi syndrome and interstitial 6q deletion suggest endocrine abnormalities also may contribute to the interstitial 6q deletion phenotype. This report describes the endocrine phenotype in a propositus with the Prader-Willi-like syndrome associated with an interstitial 6q deletion including the SIM1 gene. Detailed endocrine evaluation of the propositus during childhood and adolescence revealed hypopituitarism, though initial endocrine evaluations during infancy were unremarkable. Our patient raises the possibility that hypopituitarism may be part of the phenotype, especially short stature, caused by interstitial 6q deletion. SIM1 plays an important role in the development of neuroendocrine lineage cells, implicating SIM1 haploinsufficiency in the pathophysiology of hypopituitarism seen in our propositus. Early identification of endocrine abnormalities can improve clinical outcome by allowing timely introduction of hormone replacement therapy. Hence, we suggest that detailed endocrine evaluation and longitudinal endocrine follow up be performed in individuals with proximal interstitial 6q deletion involving SIM1. © 2013 Wiley Periodicals, Inc.

  4. Site Investigation Report. 161st Air Refueling Group, Arizona National Guard, Sky Harbor International Airport and Papago Military Reservation, Phoenix, Arizona. Volume 2. Appendices A Through G (United States)


    Monitorina Revie, pD. 9l 1988, Lindorf, D., Fold , J., and Connelly , Groundwater Samolina Prpc @dure Gi elinui,% Wisconsin Department of Natural...a SRI model 8610 GC equipped with an PID and FID detector in series, purge and trap, and Peaksimple data system. The onboard integrator of the IOS50...representative of the formation water (Llndorf, Fold , Connelly, 1987). o According to the EPA Guidance, as soon as the well recovers, the order of sampling

  5. Properties of II-VI Semiconductors: Bulk Crystals, Epitaxial Films, Quantum Well Structures, and Dilute Magnetic Systems. Materials Research Society Symposium Proceedings. Volume 161 (United States)


    REPORT NJMEU Material Reserach Society 9800 McKnight Road, Suite 327 AFOSR TR- 1 () Pittsburgh, PA 15237-6005 C SWONSG MONIT0 hG A"IG Y NAME(S) £N0...OF ZnSe-ZnS STRAINED-LAYER SUPERLATTICES AND A FIBONACCI SEQUENCE 199 Tsunemasa Taguchi and Yoichi Yamada OPTICAL PROPERTIES OF CdZnS-ZnS STRAINED...the widespread alloy Hg0.8Cd0.2Te measured and calculated in a wide temperature range [5] : on the Te-saturated side as well as on the Hg- saturated

  6. SU-F-J-161: Prostate Contouring in Patients with Bilateral Hip Prostheses: Impact of Using Artifact-Reduced CT Images and MRI

    Energy Technology Data Exchange (ETDEWEB)

    Elzibak, A; Loblaw, A; Morton, G; Vesprini, D; Liu, S; Chung, H; Davidson, M [Odette Cancer Centre, Sunnybrook Health Sciences Centre, Toronto, Ontario (Canada)


    Purpose: To investigate the usefulness of metal artifact reduction in CT images of patients with bilateral hip prostheses (BHP) for contouring the prostate and determine if the inclusion of MR images provides additional benefits. Methods: Five patients with BHP were CT scanned using our clinical protocol (140kV, 300mAs, 3mm slices, 1.5mm increment, Philips Medical Systems, OH). Images were reconstructed with the orthopaedic metal artifact reduction (O-MAR) algorithm. MRI scanning was then performed (1.5T, GE Healthcare, WI) with a flat table-top (T{sub 2}-weighted, inherent body coil, FRFSE, 3mm slices with 0mm gap). All images were transferred to Pinnacle (Version 9.2, Philips Medical Systems). For each patient, two data sets were produced: one containing the O-MAR-corrected CT images and another containing fused MRI and O-MAR-corrected CT images. Four genito-urinary radiation oncologists contoured the prostate of each patient on the O-MAR-corrected CT data. Two weeks later, they contoured the prostate on the fused data set, blinded to all other contours. During each contouring session, the oncologists reported their confidence in the contours (1=very confident, 3=not confident) and the contouring difficulty that they experienced (1=really easy, 4=very challenging). Prostate volumes were computed from the contours and the conformity index was used to evaluate inter-observer variability. Results: Larger prostate volumes were found on the O-MAR-corrected CT set than on the fused set (p< 0.05, median=36.9cm{sup 3} vs. 26.63 cm{sup 3}). No significant differences were noted in the inter-observer variability between the two data sets (p=0.3). Contouring difficulty decreased with the addition of MRI (p<0.05) while the radiation oncologists reported more confidence in their contours when MRI was fused with the O-MAR-corrected CT data (p<0.05). Conclusion: This preliminary work demonstrated that, while O-MAR correction to CT images improves visualization of anatomy, the addition of MRI enhanced the oncologists’ confidence in contouring the prostate in patients with BHP.

  7. Synthesis and characterization of spherical Tb-MCM-41

    Energy Technology Data Exchange (ETDEWEB)

    Pires, Luiza H.O., E-mail: [Universidade Federal do Para, Instituto de Ciencias Exatas e Naturais, Laboratorio de Catalise e Oleoquimica, CP 479, CEP 66075-110, Belem, PA (Brazil); Queiroz, Renan M.; Souza, Ruth P.; Costa, Carlos E.F. da; Zamian, Jose R. [Universidade Federal do Para, Instituto de Ciencias Exatas e Naturais, Laboratorio de Catalise e Oleoquimica, CP 479, CEP 66075-110, Belem, PA (Brazil); Weber, Ingrid T. [Universidade Federal de Pernambuco, Centro de Ciencias Exatas e da Natureza, Av. Prof. Luis Barros Freire, s/n, Cidade Universitaria, 50670-901 Recife, PE (Brazil); Filho, Geraldo N. da Rocha [Universidade Federal do Para, Instituto de Ciencias Exatas e Naturais, Laboratorio de Catalise e Oleoquimica, CP 479, CEP 66075-110, Belem, PA (Brazil)


    Spherical MCM-41 was synthesized at room temperature and functionalized by means of direct synthesis method. Evidence for the terbium presence in the silica matrix was obtained by means of EDX. Scanning electron microscopy (SEM) micrographs showed that terbium incorporation did not change significantly MCM-41 morphology. The maintenance of the hexagonal structure was confirmed by X-ray diffraction (XRD) pattern analysis. The cell parameter increase and the surface area decrease, observed by N{sub 2} adsorption-desorption technique, were taken as evidence of terbium introduction inside the MCM-41 framework. By FT-IR spectra it was found that the main features of the silica framework were maintained. The presence of a strong absorption band centered at ca. 220 nm in the diffuse reflectance UV-vis spectra could indicate the presence of tetra-coordinated terbium in the silica network of Tb-MCM-41 samples.

  8. Therapeutic use of radioactive isotopes

    CERN Multimedia

    Caroline Duc


    In December, researchers from ISOLDE-CERN, the Paul Scherrer Institute (PSI) and the Institut Laue-Langevin (ILL) published the results of an in vivo study which successfully proved the effectiveness of four terbium isotopes for diagnosing and treating cancerous tumours.   Four terbium isotopes suitable for clinical purposes. “ISOLDE is the only installation capable of supplying terbium isotopes of such purity and intensity in the case of three out of the four types used in this study,” explains Karl Johnson, a physicist at ISOLDE.  “Producing over a thousand different isotopes, our equipment offers the widest choice of isotopes in the world!” Initially intended for fundamental physics research, ISOLDE has diversified its activities over time to invest in various projects in the materials science, biochemistry and nuclear medicine fields. The proof-of-concept study has confirmed that the four terbium isotopes 149Tb, 152Tb, 155Tb produ...

  9. Thermal History Using Microparticle Trap Luminescence (United States)


    and thermoluminescence of terbium-activated silicates and aluminates " . Radiat. Meas. 43, 323-326 (2008). HDTRA1-07-1-0016 University of...of terbium-activated silicates and aluminates " . 15th Solid State Dosimetry Conference, Delft, The Netherlands, July 8-13 (2007). 2 INTRODUCTION...increased to 500°C until combustion occurred (- 7 min). The remaining powder was collected, crushed in a agate mortar, and annealed (typically at 900

  10. On the quenching of trivalent terbium luminescence by ligand low lying triplet state energy and the role of the {sup 7}F{sub 5} level: The [Tb(tta){sub 3} (H{sub 2}O){sub 2}] case

    Energy Technology Data Exchange (ETDEWEB)

    Souza, A.S., E-mail: [Departamento de Química Fundamental, Universidade Federal de Pernambuco, 50670-901 Recife, PE (Brazil); Nunes, L.A. [Instituto de Física de São Carlos, Universidade de São Paulo, 13560-970 São Carlos, SP (Brazil); Felinto, M.C.F.C. [Instituto de Pesquisas Energéticas e Nucleares-IPEN, 05505-800 São Paulo, SP (Brazil); Brito, H.F. [Instituto de Química, Universidade de São Paulo, 05508-900 São Paulo, SP (Brazil); Malta, O.L. [Departamento de Química Fundamental, Universidade Federal de Pernambuco, 50670-901 Recife, PE (Brazil)


    In this work we discuss the observed Tb{sup 3+} ion luminescence quenching, due to the relative ligand low lying triplet state energy, in the [Tb(tta){sub 3} (H{sub 2}O){sub 2}] compound at low and room temperature (tta=thenoyltrifluoroacetonate). Theoretical energy transfer rates, for both multipolar and exchange mechanisms, were calculated and discussed on the basis of selection rules and energy mismatch conditions from the [Tb(tta){sub 3} (H{sub 2}O){sub 2}] emission spectra. We have concluded that the exchange mechanism by far dominates, in the present case, and that the long first excited state {sup 7}F{sub 5} lifetime (in the millisecond scale) plays a crucial role in the Tb{sup 3+} luminescence quenching. - Highlights: • The energy exchange between the ligand T{sub 1} and Tb{sup 3+5}D{sub 4} levels occur by the exchange interaction. • The Tb{sup 3+} first excited {sup 7}F{sub 5} level plays a crucial role in this process due to its long lifetime. • At room temperature the energy exchanged between the {sup 5}D{sub 4} level of the Tb{sup 3+} ion and the T{sub 1} of the ligand is lost via the intersystem crossing T{sub 1} → S{sub 0} channel.

  11. Synthesis, structure, and magnetic properties of a new family of tetra-nuclear {Mn2(III)Ln2}(Ln = Dy, Gd, Tb, Ho) clusters with an arch-type topology: single-molecule magnetism behavior in the dysprosium and terbium analogues. (United States)

    Chandrasekhar, Vadapalli; Bag, Prasenjit; Speldrich, Manfred; van Leusen, Jan; Kögerler, Paul


    Sequential reaction of Mn(II) and lanthanide(III) salts with a new multidentate ligand, 2,2'-(2-hydroxy-3-methoxy-5-methylbenzylazanediyl)diethanol (LH3), containing two flexible ethanolic arms, one phenolic oxygen, and a methoxy group afforded heterometallic tetranuclear complexes [Mn2Dy2(LH)4(μ-OAc)2](NO3)2·2CH3OH·3H2O (1), [Mn2Gd2(LH)4(μ-OAc)2](NO3)2·2CH3OH·3H2O (2), [Mn2Tb2(LH)4(μ-OAc)2](NO3)2·2H2O·2CH3OH·Et2O (3), and [Mn2Ho2(LH)4(μ-OAc)2]Cl2·5CH3OH (4). All of these dicationic complexes possess an arch-like structural topology containing a central Mn(III)-Ln-Ln-Mn(III) core. The two central lanthanide ions are connected via two phenolate oxygen atoms. The remaining ligand manifold assists in linking the central lanthanide ions with the peripheral Mn(III) ions. Four doubly deprotonated LH(2-) chelating ligands are involved in stabilizing the tetranuclear assembly. A magnetochemical analysis reveals that single-ion effects dominate the observed susceptibility data for all compounds, with comparably weak Ln···Ln and very weak Ln···Mn(III) couplings. The axial, approximately square-antiprismatic coordination environment of the Ln(3+) ions in 1-4 causes pronounced zero-field splitting for Tb(3+), Dy(3+), and Ho(3+). For 1 and 3, the onset of a slowing down of the magnetic relaxation was observed at temperatures below approximately 5 K (1) and 13 K (3) in frequency-dependent alternating current (AC) susceptibility measurements, yielding effective relaxation energy barriers of ΔE = 16.8 cm(-1) (1) and 33.8 cm(-1) (3).

  12. CCDC 849283: Experimental Crystal Structure Determination : bis(N-(1-(6-(1H-pyrazol-1-yl)pyridin-2-yl)ethylidene)aniline)-cobalt tetrachloro-cobalt

    KAUST Repository

    Gong, Dirong


    An entry from the Cambridge Structural Database, the world’s repository for small molecule crystal structures. The entry contains experimental data from a crystal diffraction study. The deposited dataset for this entry is freely available from the CCDC and typically includes 3D coordinates, cell parameters, space group, experimental conditions and quality measures.

  13. Comment on "Atomic structure calculations and identification of EUV and SXR spectral lines in Sr XXX" by A. Goyal, I. Khatri, S. Aggarwal, A.K. Singh, M. Mohan [J Quant Spectrosc Radiat Transf 2015;161:157 (United States)

    Aggarwal, Kanti M.


    Recently, Goyal et al. [1] reported energies and lifetimes (τ) for the lowest 113 levels of the 2s22p5, 2s2p6, 2s22p43ℓ, 2s2p53ℓ and 2p63ℓ configurations of F-like Sr XXX. For the calculations they adopted the multi-configuration Dirac-Fock (MCDF) and the flexible atomic code (FAC). Additionally, they also listed radiative rates (A- values), oscillator strengths (f- values) and line strengths (S- values) for four types of transitions, namely electric dipole (E1), electric quadrupole (E2), magnetic dipole (M1) and magnetic quadrupole (M2), but only from the ground to the higher excited levels. However, there are two clear anomalies in their reported data. Firstly, the f-values listed from FAC in their Tables 3-6 are larger than from MCDF by a factor of two, for all transitions. This is because they have blindly listed the output from FAC without realising that, unlike MCDF, FAC lists ωf where ω is the statistical weight, and happens to be exactly 2 in the present case. Secondly, their lifetime for level 2 (2s22p51/2 o 2P) is incorrect. This is because the dominant contributing transition for this level is 1-2 M1 for which A=3.25×106 s-1, listed (correctly) in their Table 5, and this leads to τ=3.08×10-7 s, and not 1.54×10-7 s, as listed in their Table 1.

  14. A genome-wide association study of Hodgkin's lymphoma identifies new susceptibility loci at 2p16.1 (REL), 8q24.21 and 10p14 (GATA3)

    DEFF Research Database (Denmark)

    Enciso-Mora, Victor; Broderick, Peter; Ma, Yussanne


    To identify susceptibility loci for classical Hodgkin's lymphoma (cHL), we conducted a genome-wide association study of 589 individuals with cHL (cases) and 5,199 controls with validation in four independent samples totaling 2,057 cases and 3,416 controls. We identified three new susceptibility l...

  15. Sabbatical Options for Academic Librarians in the U.S. Vary Widely. A Review of: Flaspohler, M. R. (2009. Librarian sabbatical leaves: Do we need to get out more? Journal of Academic Librarianship, 35(2, 152‐161.

    Directory of Open Access Journals (Sweden)

    Heather Ganshorn


    Full Text Available Objectives – To gather data on what proportion of U.S. academic libraries provide sabbatical opportunities to librarians, and to explore library directors’ perceptions of the effectiveness of sabbaticals and barriers to sabbatical‐taking among librarians at their institutions.Design – Online questionnaire.Setting – Academic libraries in the U.S..Subjects – Directors of 403 academic libraries.Methods – The author reviewed the literature on sabbatical leaves in the library profession. She then developed an online survey using the University of Washington’s Catalyst system (a tool similar to SurveyMonkey. The survey contained both closed and open‐ended questions, in order to generate quantitative data as well as to gather more in‐depth information on respondents’ views.A sample of American academic library directors was generated by choosing every eighth entry on a list of 3037 academic libraries generated by lib‐web‐cats, an online directory of libraries ( The survey was sent to 403 academic library directors based on this selection method. The author received 101 successfully completed surveys for a response rate of 25%.Main Results – The author found that just over half of respondents (53 libraries, or 52% indicated their institutions offered sabbatical leaves to librarians. Thirty‐six per cent indicated they did not, while 12% indicated “other” (many of these respondents commented with clarifications about what other leave programs were available to librarians. Of the 53 institutions that reported offering leave programs, only half (27 respondents indicated that library staff members had taken a sabbatical leave.Open‐ended questions generated some insight into the barriers to sabbatical leaves at academic libraries. Differences between institutions in terms of availability of sabbatical leaves appear to be due to a combination of librarian status (whether or not librarians have full faculty status; funding issues (in some institutions, the library, and not the college administration, has to cover the costs of a sabbatical; and availability of other staff to cover the duties of the individual taking the leave.Respondents also noted a discrepancy between the length and timing of librarian sabbaticals compared to other faculty (i.e., the professoriate, with librarians more often required to begin their leaves in the summer. Librarian sabbaticals were also sometimes shorter than those of other faculty; in some institutions a summer‐length sabbatical was available, but not a six‐month or year‐long sabbatical, even though these options were available to other faculty.In terms of impacts of sabbaticals, most respondents who had experienced a staff member taking sabbatical felt that the sabbatical benefited the staff member and the institution; positive results include improved morale, publications that raised the profile of the library, and learning that was applied in the workplace. Some respondents, however, had negative experiences to report, the most common being that the sabbatical had had no effect. Some respondents noted staff who had taken sabbaticals had failed to meet the goals that had been set for the sabbatical. When asked what could be done to enhance sabbatical programs, respondents at institutions with these programs had some interesting suggestions, such as aligning sabbatical programs more closely with institutional goals, or promoting the pursuit of more collaborative research while on sabbatical.Conclusion – The author notes that while it’s dangerous to over‐generalize from such a brief survey, many of the issues raised in the responses, such as faculty status, funding shortfalls, and staff shortages echo themes raised elsewhere in the library literature. These issues probably need to be addressed if we are to see any increase in the number of librarians taking sabbatical leaves.The author’s other conclusion is that librarians must be more accountable for demonstrating how a sabbatical could add institutional value, and for meeting the goals set in their sabbatical plans. The author conducted this study while on sabbatical herself, and concludes it “provides one example of how a librarian might create a manageable, research‐based project that more closely marries academic rigor to personal experience” (p. 160.

  16. Multibeam collection for KN161L06: Multibeam data collected aboard Knorr from 2000-04-07 to 2000-05-16, departing from Recife, Brazil and returning to Recife, Brazil (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This data set is part of a larger set of data called the Multibeam Bathymetry Database (MBBDB) where other similar data can be found at...

  17. CCDC 849284: Experimental Crystal Structure Determination : Dichloro-(2,6-diisopropyl-N-(1-(6-(1H-pyrazol-1-yl)pyridin-2-yl)ethylidene)aniline)-cobalt(ii)

    KAUST Repository

    Gong, Dirong


    An entry from the Cambridge Structural Database, the world’s repository for small molecule crystal structures. The entry contains experimental data from a crystal diffraction study. The deposited dataset for this entry is freely available from the CCDC and typically includes 3D coordinates, cell parameters, space group, experimental conditions and quality measures.

  18. Genome-wide association analysis of genetic generalized epilepsies implicates susceptibility loci at 1q43, 2p16.1, 2q22.3 and 17q21.32

    DEFF Research Database (Denmark)

    Steffens, M.; Leu, C.; Ruppert, A. K.


    Genetic generalized epilepsies (GGEs) have a lifetime prevalence of 0.3 and account for 2030 of all epilepsies. Despite their high heritability of 80, the genetic factors predisposing to GGEs remain elusive. To identify susceptibility variants shared across common GGE syndromes, we carried out a ...

  19. Experimental and Theoretical Study on the OH-Reaction Kinetics and Photochemistry of Acetyl Fluoride (CH3C(O)F), an Atmospheric Degradation Intermediate of HFC-161 (C2H5F). (United States)

    Song, Xinli; Zügner, Gábor L; Farkas, Mária; Illés, Ádám; Sarzyński, Dariusz; Rozgonyi, Tamás; Wang, Baoshan; Dóbé, Sándor


    The direct reaction kinetic method of low pressure fast discharge flow (DF) with resonance fluorescence monitoring of OH (RF) has been applied to determine rate coefficients for the overall reactions OH + C2H5F (EtF) (1) and OH + CH3C(O)F (AcF) (2). Acetyl fluoride reacts slowly with the hydroxyl radical, the rate coefficient at laboratory temperature is k2(300 K) = (0.74 ± 0.05) × 10(-14) cm(3) molecule(-1) s(-1) (given with 2σ statistical uncertainty). The temperature dependence of the reaction does not obey the Arrhenius law and it is described well by the two-exponential rate expression of k2(300-410 K) = 3.60 × 10(-3) exp(-10500/T) + 1.56 × 10(-13) exp(-910/T) cm(3) molecule(-1) s(-1). The rate coefficient of k1 = (1.90 ± 0.19) × 10(-13) cm(3) molecule(-1) s(-1) has been determined for the EtF-reaction at room temperature (T = 298 K). Microscopic mechanisms for the OH + CH3C(O)F reaction have also been studied theoretically using the ab initio CBS-QB3 and G4 methods. Variational transition state theory was employed to obtain rate coefficients for the OH + CH3C(O)F reaction as a function of temperature on the basis of the ab initio data. The calculated rate coefficients are in good agreement with the experimental data. It is revealed that the reaction takes place predominantly via the indirect H-abstraction mechanism involving H-bonded prereactive complexes and forming the nascent products of H2O and the CH2CFO radical. The non-Arrhenius behavior of the rate coefficient at temperatures below 500 K is ascribed to the significant tunneling effect of the in-the-plane H-abstraction dynamic bottleneck. The production of FC(O)OH + CH3 via the addition/elimination mechanism is hardly competitive due to the significant barriers along the reaction routes. Photochemical experiments of AcF were performed at 248 nm by using exciplex lasers. The total photodissociation quantum yield for CH3C(O)F has been found significantly less than unity; among the primary photochemical processes, C-C bond cleavage is by far dominating compared with CO-elimination. The absorption spectrum of AcF has also been determined by displaying a strong blue shift compared with the spectra of aliphatic carbonyls. Consequences of the results on atmospheric chemistry have been discussed.

  20. Reactive Chemical Vapor Deposition Method as New Approach for Obtaining Electroluminescent Thin Film Materials

    Directory of Open Access Journals (Sweden)

    Valentina V. Utochnikova


    Full Text Available The new reactive chemical vapor deposition (RCVD method has been proposed for thin film deposition of luminescent nonvolatile lanthanide aromatic carboxylates. This method is based on metathesis reaction between the vapors of volatile lanthanide dipivaloylmethanate (Ln(dpm3 and carboxylic acid (HCarb orH2Carb′ and was successfully used in case of HCarb. Advantages of the method were demonstrated on example of terbium benzoate (Tb(bz3 and o-phenoxybenzoate thin films, and Tb(bz3 thin films were successfully examined in the OLED with the following structure glass/ITO/PEDOT:PSS/TPD/Tb(bz3/Ca/Al. Electroluminescence spectra of Tb(bz3 showed only typical luminescent bands, originated from transitions of the terbium ion. Method peculiarities for deposition of compounds of dibasic acids H2Carb′ are established on example of terbium and europium terephtalates and europium 2,6-naphtalenedicarboxylate.

  1. Spatial resolution in X-ray imaging with scintillating glass optical fiber plates (United States)

    Pavan, P.; Zanella, G.; Zannoni, R.; Marigo, A.


    Some scintillating optical fiber plates, fabricated with terbium glasses are tested for their intrinsic spatial resolution under X-ray irradiation and the result is compared with a typical phosphor screen. The spatial resolution (CTF and MTF) is measured as a function of spatial frequency and the standard deviation of the corresponding Gaussian PSF is derived.


    DEFF Research Database (Denmark)


    The present invention concerns a chemical process for preparing nanoparticles of an alloy comprising both a noble metal, such as platinum, and a non-noble transition or lanthanide metal, such as yttrium, gadolinium or terbium. The process is carried out by reduction with hydrogen and removal...

  3. Multiplet effects in the electronic structure of heavy rare-earth metals

    NARCIS (Netherlands)

    Lebegue, S.; Svane, A.; Katsnelson, M.I.; Lichtenstein, A.I.; Eriksson, O.


    The spectroscopic properties of elemental terbium, dysprosium, holmium, and erbium are investigated using first-principles calculations taking into account intra-atomic correlation effects. In order to describe the strongly localized f electrons together with the conduction bands, we have used the

  4. Performance of 20 Ci 137Cs γ-ray Compton spectrometer for the ...

    Indian Academy of Sciences (India)

    The in-house 137Cs spectrometer is very useful for the measurement of momentum densities of heavy materials. The performance of the machine is assessed using aluminum, terbium and mercury samples and the exper- imental data from comparable apparatus. Keywords. Compton scattering; electron momentum density; ...

  5. Author Details

    African Journals Online (AJOL)

    Pengkiliya, P. Vol 67 (2014) - Articles Interaction of 3-Hydroxypicolinamide with TbIII and its Sensitizing Effect on Terbium Luminescence as a Function of pH and Medium Abstract PDF. ISSN: 0379-4350. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about ...

  6. Author Details

    African Journals Online (AJOL)

    Devi, TP. Vol 67 (2014) - Articles Interaction of 3-Hydroxypicolinamide with TbIII and its Sensitizing Effect on Terbium Luminescence as a Function of pH and Medium Abstract PDF. ISSN: 0379-4350. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about AJOL ...

  7. THz near-field Faraday imaging in hybrid metamaterials

    NARCIS (Netherlands)

    Kumar, N.; Strikwerda, A.C.; Fan, K.; Zhang, X.; Averitt, R.D.; Planken, P.C.M.; Adam, A.J.L.


    We report on direct measurements of the magnetic near-field of metamaterial split ring resonators at terahertz frequencies using a magnetic field sensitive material. Specifically, planar split ring resonators are fabricated on a single magneto-optically active terbium gallium garnet crystal.

  8. Synthesis and photoluminescence properties of CaSixOy:Tb3+ phosphors prepared using solution-combustion method

    CSIR Research Space (South Africa)

    Dejene, FB


    Full Text Available to Ca3Si2O7 as the terbium concentration increase. Broad band excitations peaking between 280 - 360 nm derived from excited states of Tb3+ ions were observed for all powders grown from various Tb compositions. The green emission peak at 545 nm due...

  9. Scanning Electron Microscope-Cathodoluminescence Analysis of Rare-Earth Elements in Magnets. (United States)

    Imashuku, Susumu; Wagatsuma, Kazuaki; Kawai, Jun


    Scanning electron microscope-cathodoluminescence (SEM-CL) analysis was performed for neodymium-iron-boron (NdFeB) and samarium-cobalt (Sm-Co) magnets to analyze the rare-earth elements present in the magnets. We examined the advantages of SEM-CL analysis over conventional analytical methods such as SEM-energy-dispersive X-ray (EDX) spectroscopy and SEM-wavelength-dispersive X-ray (WDX) spectroscopy for elemental analysis of rare-earth elements in NdFeB magnets. Luminescence spectra of chloride compounds of elements in the magnets were measured by the SEM-CL method. Chloride compounds were obtained by the dropwise addition of hydrochloric acid on the magnets followed by drying in vacuum. Neodymium, praseodymium, terbium, and dysprosium were separately detected in the NdFeB magnets, and samarium was detected in the Sm-Co magnet by the SEM-CL method. In contrast, it was difficult to distinguish terbium and dysprosium in the NdFeB magnet with a dysprosium concentration of 1.05 wt% by conventional SEM-EDX analysis. Terbium with a concentration of 0.02 wt% in an NdFeB magnet was detected by SEM-CL analysis, but not by conventional SEM-WDX analysis. SEM-CL analysis is advantageous over conventional SEM-EDX and SEM-WDX analyses for detecting trace rare-earth elements in NdFeB magnets, particularly dysprosium and terbium.

  10. Performance of 20 Ci 137Cs γ-ray Compton spectrometer for the ...

    Indian Academy of Sciences (India)

    ... than the conventional 241Am Compton spectrometers. The in-house 137Cs spectrometer is very useful for the measurement of momentum densities of heavy materials. The performance of the machine is assessed using aluminum, terbium and mercury samples and the experimental data from comparable apparatus.

  11. Faraday isolator based on TSAG crystal for high power lasers. (United States)

    Mironov, E A; Palashov, O V


    A Faraday isolator based on a new magneto-optical medium, TSAG (terbium scandium aluminum garnet) crystal, has been constructed and investigated experimentally. The device provides an isolation ratio of more than 30 dB at 500 W laser power. It is shown that this medium can be used in Faraday isolators for kilowatt-level laser powers.

  12. 1. Novel Dopants in Silica Based Fibers. 2. Applications of Embedded Optical Fiber Sensors in Reinforced Concrete Buildings and Structures (United States)


    effects in fibers, and nonlinear phenomena in fibers. We also use NMR, ESR and Raman techniques to study incorporation of novel as well as...neodymium, erbium, holmium or terbium. These products can be vacuum dried at elevated temperature. The acac-compound is less expensive since the hfa

  13. Time-gated FRET nanoassemblies for rapid and sensitive intra- and extracellular fluorescence imaging

    NARCIS (Netherlands)

    Afsari, Hamid Samareh; Cardoso Dos Santos, Marcelina; Lindén, Stina; Chen, Ting; Qiu, Xue; van Bergen En Henegouwen, Paul M P|info:eu-repo/dai/nl/071919481; Jennings, Travis L; Susumu, Kimihiro; Medintz, Igor L; Hildebrandt, Niko; Miller, Lawrence W

    Time-gated Förster resonance energy transfer (FRET) using the unique material combination of long-lifetime terbium complexes (Tb) and semiconductor quantum dots (QDs) provides many advantages for highly sensitive and multiplexed biosensing. Although time-gated detection can efficiently suppress

  14. Bulletin of Materials Science | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science; Volume 39; Issue 7. Issue front cover thumbnail. Volume 39, Issue 7. December 2016, pages 1619-1889. pp 1619-1623. Luminescence properties of terbium-doped Li 3 PO 4 phosphor for radiation dosimetry · C B PALAN N S BAJAJ S K OMANWAR · More Details Abstract ...

  15. Interaction of 3-Hydroxypicolinamide with Tb III and its Sensitizing ...

    African Journals Online (AJOL)

    Interaction of 3-Hydroxypicolinamide with Tb III and its Sensitizing Effect on Terbium Luminescence as a Function of pH and Medium. ... The complex formed exists asML2 species in which HPA behaves as anO,O,N,N-chelating ligand. The solid complex is isolated from aqueous medium and characterized employing ...

  16. Lanthanide Enhanced Luminescence (LEL) with One and Two Photon Excitation of Quantum Dyes(copyright) Lanthanide(III)-Macrocycles

    National Research Council Canada - National Science Library

    Leif, Robert C; Becker, Margie C; Bromm Jr., Al; Chen, Nanguang; Cowan, Ann E; Vallarino, Lidia M; Yang, Sean; Zucker, Robert M


    .... Preliminary studies indicate that cells stained with the europium Quantum Dye can be observed both by conventional UV laser excitation and by infrared two-photon confocal microscopy. An enhancer has been found that enables the observation of simultaneous emissions from both the europium and terbium Quantum Dyes.

  17. Kinetically inert lanthanide complexes as reporter groups for binding of potassium by 18-crown-6

    DEFF Research Database (Denmark)

    Junker, Anne Kathrine Ravnsborg; Tropiano, Manuel; Faulkner, Stephen


    in a copper(I)-catalyzed alkyne-azide cycloaddition (CuAAC) “click” reaction with azide-functionalized crown ethers. The resulting complexes were investigated using NMR and optical methods. Titrations with potassium chloride in methanol observing the sensititzed europium- and terbium-centered emissions were...

  18. ORF Alignment: NC_000961 [GENIUS II[Archive

    Lifescience Database Archive (English)


  19. Dicty_cDB: [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VF (Link to library) VFC161 (Link to dictyBase) - - - Contig-U15456-1 VFC161P (Link... to Original site) VFC161F 564 VFC161Z 562 VFC161P 1126 - - Show VFC161 Library VF (Link to library) Clone ID VFC161 (Link to dict...yBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig Contig-U15456-1 Original site URL http://dict...Value N Y16962 |Y16962.1 Dictyostelium discoideum mRNA for cathepsin D. 1025 0.0 5 AJ243946 |AJ243946.1 Dict...plasma membrane 4.0 %: vesicles of secretory system >> prediction for VFC161 is nuc 5' end seq. ID VFC161F 5

  20. Structure-Based Discovery of 4-(6-Methoxy-2-methyl-4-(quinolin-4-yl)-9 H -pyrimido[4,5- b ]indol-7-yl)-3,5-dimethylisoxazole (CD161) as a Potent and Orally Bioavailable BET Bromodomain Inhibitor

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Yujun; Bai, Longchuan; Liu, Liu; McEachern, Donna; Stuckey, Jeanne A.; Meagher, Jennifer L.; Yang, Chao-Yie; Ran, Xu; Zhou, Bing; Hu, Yang; Li, Xiaoqin; Wen, Bo; Zhao, Ting; Li, Siwei; Sun, Duxin; Wang, Shaomeng (Michigan)


    We have designed and synthesized 9H-pyrimido[4,5-b]indole-containing compounds to obtain potent and orally bioavailable BET inhibitors. By incorporation of an indole or a quinoline moiety to the 9H-pyrimido[4,5-b]indole core, we identified a series of small molecules showing high binding affinities to BET proteins and low nanomolar potencies in inhibition of cell growth in acute leukemia cell lines. One such compound, 4-(6-methoxy-2-methyl-4-(quinolin-4-yl)-9H-pyrimido[4,5-b]indol-7-yl)-3,5-dimethylisoxazole (31) has excellent microsomal stability and good oral pharmacokinetics in rats and mice. Orally administered, 31 achieves significant antitumor activity in the MV4;11 leukemia and MDA-MB-231 triple-negative breast cancer xenograft models in mice. Determination of the cocrystal structure of 31 with BRD4 BD2 provides a structural basis for its high binding affinity to BET proteins. Testing its binding affinities against other bromodomain-containing proteins shows that 31 is a highly selective inhibitor of BET proteins. Our data show that 31 is a potent, selective, and orally active BET inhibitor.