WorldWideScience

Sample records for terbium 154

  1. Elastic properties of terbium

    DEFF Research Database (Denmark)

    Spichkin, Y.I.; Bohr, Jakob; Tishin, A.M.

    1996-01-01

    The temperature dependence of the Young modulus along the crystallographic axes b and c (E(b) and E(c)), and the internal friction of a terbium single crystal have been measured. At 4.2 K, E(b) and E(c) are equal to 38 and 84.5 GPa, respectively. The lattice part of the Young modulus and the Debye...... temperature has been calculated. The origin of the Young modulus anomalies arising at the transition to the magnetically ordered state is discussed....

  2. Critical scattering of neutrons from terbium

    DEFF Research Database (Denmark)

    Als-Nielsen, Jens Aage; Dietrich, O.W.; Marshall, W.

    1968-01-01

    The inelasticity of the critical scattering of neutrons in terbium has been measured above the Neél temperature at the (0, 0, 2−Q) satellite position. The results show that dynamic slowing down of the fluctuations does occur in a second‐order phase transition in agreement with the general theory...

  3. Semiconductor composition containing iron, dysprosium, and terbium

    Energy Technology Data Exchange (ETDEWEB)

    Pooser, Raphael C.; Lawrie, Benjamin J.; Baddorf, Arthur P.; Malasi, Abhinav; Taz, Humaira; Farah, Annettee E.; Kalyanaraman, Ramakrishnan; Duscher, Gerd Josef Mansfred; Patel, Maulik K.

    2017-09-26

    An amorphous semiconductor composition includes 1 to 70 atomic percent iron, 15 to 65 atomic percent dysprosium, 15 to 35 atomic percent terbium, balance X, wherein X is at least one of an oxidizing element and a reducing element. The composition has an essentially amorphous microstructure, an optical transmittance of at least 50% in at least the visible spectrum and semiconductor electrical properties.

  4. Raman spectroscopy study of the doping effect of the encapsulated terbium halogenides on single-walled carbon nanotubes

    Energy Technology Data Exchange (ETDEWEB)

    Kharlamova, M.V.; Kramberger, C.; Mittelberger, A. [University of Vienna, Faculty of Physics, Vienna (Austria)

    2017-04-15

    In the present work, the doping effect of terbium chloride, terbium bromide, and terbium iodide on single-walled carbon nanotubes (SWCNTs) was compared by Raman spectroscopy. A precise investigation of the doping-induced alterations of the Raman modes of the filled SWCNTs was conducted. The shifts of the components of the Raman modes and modification of their profiles allowed concluding that the inserted terbium halogenides have acceptor doping effect on the SWCNTs, and the doping efficiency increases in the line with terbium iodide, terbium bromide, and terbium chloride. (orig.)

  5. Magnetocaloric effect of thin Terbium films

    Science.gov (United States)

    Mello, V. D.; Anselmo, D. H. A. L.; Vasconcelos, M. S.; Almeida, N. S.

    2017-12-01

    We report a theoretical study of the magnetocaloric effect of Terbium (Tb) thin films due to finite size and surface effects in the helimagnetic phase, corresponding to a temperature range from TC=219 K to TN=231 K, for external fields of the order of kOe. For a Tb thin film of 6 monolayers submitted to an applied field (ΔH =30 kOe, ΔH =50 kOe and ΔH = 70 kOe) we report a significative change in adiabatic temperature, ΔT / ΔH , near the Néel temperature, of the order ten times higher than that observed for Tb bulk. On the other hand, for small values of the magnetic field, large thickness effects are found. For external field strength around few kOe, we have found that the thermal caloric efficiency increases remarkably for ultrathin films. For an ultrathin film with 6 monolayers, we have found ΔT / ΔH = 43 K/T while for thicker films, with 20 monolayers, ΔT / ΔH = 22 K/T. Our results suggest that thin films of Tb are a promising material for magnetocaloric effect devices for applications at intermediate temperatures.

  6. Femtosecond XUV spectroscopy of gadolinium and terbium

    Energy Technology Data Exchange (ETDEWEB)

    Carley, Robert; Frietsch, Bjoern; Doebrich, Kristian; Teichmann, Martin; Gahl, Cornelius; Noack, Frank [Max-Born-Institute, Berlin (Germany); Schwarzkopf, Olaf; Wernet, Philippe [Helmholtz-Zentrum fuer Materialien und Energie (BESSY II), Berlin (Germany); Weinelt, Martin [Max-Born-Institute, Berlin (Germany); Fachbereich Physik, Freie Universitaet, Berlin (Germany)

    2011-07-01

    We present recent results of time-resolved IR-pump-XUV-probe experiments on the ultrafast demagnetization of thin films of Gadolinium(0001) and Terbium(0001) on Tungsten(110). The experiments are the first to be done using a newly developed high-order harmonics (HHG) XUV beamline at the MBI. The beamline delivers monochromated XUV pulses of approximately 150 fs duration with a photon energy resolution of up to 150 meV. Following excitation by intense femtosecond infrared (IR) pulses, photoemission with 35 eV photons allows us to directly probe the 4f electrons and their interaction with the valence band, both in the bulk and at the surface, to follow the ultrafast magnetization dynamics in the Lanthanide metals. As signatures of ultrafast demagnetization of the metal by the IR pulse, we see for the first time, rapid strong reduction of the exchange splitting in the valence band. This is followed by a slower demagnetization due to the spin-lattice interaction.

  7. Green fluorescence of terbium ions in lithium fluoroborate glasses ...

    Indian Academy of Sciences (India)

    Glasses; terbium ion; oscillator strengths; fluorescence; lifetimes; fibre lasers. 1. Introduction. Today glasses are most favourable engineering materials for abundant applications due to the wide ability of property altering by compositional modifications. The considerable examination of glass science to achieve required ...

  8. Green fluorescence of terbium ions in lithium fluoroborate glasses ...

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science; Volume 39; Issue 3. Green fluorescence of terbium ions in lithium fluoroborate glasses for fibre lasers and display devices. G R DILLIP C MADHUKAR REDDY M RAJESH SHIVANAND CHAURASIA B DEVA PRASAD RAJU S W JOO. Volume 39 Issue 3 June 2016 pp 711-717 ...

  9. Terahertz Cherenkov radiation from ultrafast magnetization in terbium gallium garnet

    Science.gov (United States)

    Gorelov, S. D.; Mashkovich, E. A.; Tsarev, M. V.; Bakunov, M. I.

    2013-12-01

    We report an experimental observation of terahertz Cherenkov radiation from a moving magnetic moment produced in terbium gallium garnet by a circularly polarized femtosecond laser pulse via the inverse Faraday effect. Contrary to some existing theoretical predictions, the polarity of the observed radiation unambiguously demonstrates the paramagnetic, rather than diamagnetic, nature of the ultrafast inverse Faraday effect. From measurements of the radiation field, the Verdet constant in the subpicosecond regime is ˜3-10 times smaller than its table quasistatic value.

  10. Terbium luminescence in alumina xerogel fabricated in porous anodic alumina matrix under various excitation conditions

    Energy Technology Data Exchange (ETDEWEB)

    Gaponenko, N. V., E-mail: nik@nano.bsuir.edu.by [Belarusian State University of Informatics and Radioelectronics (Belarus); Kortov, V. S. [Yeltsin Ural Federal University (Russian Federation); Orekhovskaya, T. I.; Nikolaenko, I. A. [Belarusian State University of Informatics and Radioelectronics (Belarus); Pustovarov, V. A.; Zvonarev, S. V.; Slesarev, A. I. [Yeltsin Ural Federal University (Russian Federation); Prislopski, S. Ya. [National Academy of Sciences of Belarus, Stepanov Institute of Physics (Belarus)

    2011-07-15

    Terbium-doped alumina xerogel layers are synthesized by the sol-gel method in pores of a porous anodic alumina film 1 {mu}m thick with a pore diameter of 150-180 nm; the film is grown on a silicon substrate. The fabricated structures exhibit terbium photoluminescence with bands typical of trivalent terbium terms. Terbium X-ray luminescence with the most intense band at 542 nm is observed for the first time for such a structure. Morphological analysis of the structure by scanning electron microscopy shows the presence of xerogel clusters in pore channels, while the main pore volume remains unfilled and pore mouths remain open. The data obtained confirm the promising applications of fabricated structures for developing matrix converters of X-rays and other ionizing radiations into visible light. The possibilities of increasing luminescence intensity in the matrix converter are discussed.

  11. Optical Properties of Lithium Terbium Fluoride and Implications for Performance in High Power Lasers (Postprint)

    Science.gov (United States)

    2016-02-01

    AFRL-RX-WP-JA-2016-0323 OPTICAL PROPERTIES OF LITHIUM TERBIUM FLUORIDE AND IMPLICATIONS FOR PERFORMANCE IN HIGH POWER LASERS... AMERICA (STINFO COPY) AIR FORCE RESEARCH LABORATORY MATERIALS AND MANUFACTURING DIRECTORATE WRIGHT-PATTERSON AIR FORCE BASE, OH 45433-7750 AIR...OPTICAL PROPERTIES OF LITHIUM TERBIUM FLUORIDE AND IMPLICATIONS FOR PERFORMANCE IN HIGH POWER LASERS (POSTPRINT) 5a. CONTRACT NUMBER IN-HOUSE 5b

  12. Detection of biothiols in cells by a terbium chelate-Hg (II) system

    Science.gov (United States)

    Tan, Hongliang; Chen, Yang

    2012-01-01

    Great efforts have been devoted to the development of sensitive and specific analysis methods for biothiols because of their important roles in biological systems. We present a new detection system for biothiols that is based on the reversible quenching and restoration of fluorescence of terbium chelate caused by Hg2+ and thiol species. In the presence of biothiols, a restoration of fluorescence of terbium chelate after quenching by Hg2+ was observed due to the interaction of Hg2+ with thiol groups, and the restored fluorescence increased with the concentration of biothiols. This method was sensitive and selective for biothiols. The detection limit was 80 nM for glutathione, 100 nM for Hcy, and 400 nM for Cysteine, respectively. The terbium chelate-Hg (II) system was successfully applied to determine the levels of biothiols in cancer cells and urine samples. Further, it was also shown to be comparable to Ellman's assay. Compared to other fluorescence methods, the terbium chelate probe is advantageous because interference from short-lived nonspecific fluorescence can be efficiently eliminated due to the long fluorescence lifetime of terbium chelate, which allows for detection by time-resolved fluorescence. The terbium chelate probe can serve as a diagnostic tool for the detection of abnormal levels of biothiols in disease.

  13. 46 CFR 154.1430 - Equipment locker.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Equipment locker. 154.1430 Section 154.1430 Shipping... FOR SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES Design, Construction and Equipment Safety Equipment § 154.1430 Equipment locker. One of each item of equipment under §§ 154.1400 and 154.1420 must be...

  14. Cryogenic temperature characteristics of Verdet constant of terbium sesquioxide ceramics

    Science.gov (United States)

    Snetkov, I. L.; Palashov, O. V.

    2016-12-01

    The dependence of the Verdet constant on temperature in the (80-300 K) range for a promising magneto-active material terbium sesquioxide Tb2O3 at the wavelengths of 405-1064 nm is considered. For each of the studied wavelengths, the Verdet constant of the material cooled down to the liquid nitrogen temperature increased by more than a factor of 3.2 as compared to the room temperature value. Similarly to the other paramagnetics, the increase follows the law ∼1/T. Approximations for the temperature dependence of the Verdet constant have been obtained and the value of 1/V·(dV/dT) has been estimated. This information is needed to determine the angle of rotation as well as the variation of the extinction ratio of a Faraday isolator with temperature and extremely important at creation a cryogenic Faraday devices.

  15. Biogenic terbium oxide nanoparticles as the vanguard against osteosarcoma

    Science.gov (United States)

    Iram, Sana; Khan, Salman; Ansary, Abu Ayoobul; Arshad, Mohd; Siddiqui, Sahabjada; Ahmad, Ejaz; Khan, Rizwan H.; Khan, Mohd Sajid

    2016-11-01

    The synthesis of inner transition metal nanoparticles via an ecofriendly route is quite difficult. This study, for the first time, reports synthesis of terbium oxide nanoparticles using fungus, Fusarium oxysporum. The biocompatible terbium oxide nanoparticles (Tb2O3 NPs) were synthesized by incubating Tb4O7 with the biomass of fungus F. oxysporum. Multiple physical characterization techniques, such as UV-visible and photoluminescence spectroscopy, TEM, SAED, and zeta-potential were used to confirm the synthesis, purity, optical and surface characteristics, crystallinity, size, shape, distribution, and stability of the nanoemulsion of Tb2O3 NPs. The Tb2O3 NPs were found to inhibit the propagation of MG-63 and Saos-2 cell-lines (IC50 value of 0.102 μg/mL) and remained non-toxic up to a concentration of 0.373 μg/mL toward primary osteoblasts. Cell viability decreased in a concentration-dependent manner upon exposure to 10 nm Tb2O3 NPs in the concentration range 0.023-0.373 μg/mL. Cell toxicity was evaluated by observing changes in cell morphology, cell viability, oxidative stress parameters, and FACS analysis. Morphological examinations of cells revealed cell shrinkage, nuclear condensation, and formation of apoptotic bodies. The level of ROS within the cells-an indicator of oxidative stress was significantly increased. The induction of apoptosis at concentrations ≤ IC50 was corroborated by 4‧,6-diamidino-2-phenylindole dihydrochloride (DAPI) staining (DNA damage and nuclear fragmentation). Flow-cytometric studies indicated that the response was dose dependent with a threshold effect.

  16. 46 CFR 154.446 - Tank design.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Tank design. 154.446 Section 154.446 Shipping COAST... SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES Design, Construction and Equipment Independent Tank Type B § 154.446 Tank design. An independent tank type B must meet the calculations under § 154...

  17. Autofluorescence-free Live-cell Imaging Using Terbium Nanoparticles.

    Science.gov (United States)

    Cardoso Dos Santos, Marcelina; Goetz, Joan; Bartenlian, Hortense; Wong, Ka-Leung; Charbonniere, Loïc Joanny; Hildebrandt, Niko

    2018-02-20

    Fluorescent nanoparticles (NPs) have become irreplaceable tools for advanced cellular and sub-cellular imaging. While very bright NPs require excitation with UV or visible light, which can create strong autofluorescence of biological components, NIR-excitable NPs without autofluorescence issues exhibit much lower brightness. Here, we show the application of a new type of surface-photosensitized terbium NPs (Tb-NPs) for autofluorescence-free intracellular imaging in live HeLa cells. Combination of exceptionally high brightness, high photostability, and long photoluminecence (PL) lifetimes for highly efficient suppression of the short-lived autofluorescence, allowed for time-gated PL imaging of intracellular vesicles over 72 h without toxicity and at extremely low Tb-NP concentrations down to 12 pM. Detection of highly resolved long-lifetime (ms) PL decay curves from small (~10 µm2) areas within single cells within a few seconds emphasized the unprecedented photophysical properties of Tb-NPs for live-cell imaging that extend well beyond currently available nanometric imaging agents.

  18. Solar Thermochemical Hydrogen Production via Terbium Oxide Based Redox Reactions

    Directory of Open Access Journals (Sweden)

    Rahul Bhosale

    2016-01-01

    Full Text Available The computational thermodynamic modeling of the terbium oxide based two-step solar thermochemical water splitting (Tb-WS cycle is reported. The 1st step of the Tb-WS cycle involves thermal reduction of TbO2 into Tb and O2, whereas the 2nd step corresponds to the production of H2 through Tb oxidation by water splitting reaction. Equilibrium compositions associated with the thermal reduction and water splitting steps were determined via HSC simulations. Influence of oxygen partial pressure in the inert gas on thermal reduction of TbO2 and effect of water splitting temperature (TL on Gibbs free energy related to the H2 production step were examined in detail. The cycle (ηcycle and solar-to-fuel energy conversion (ηsolar-to-fuel efficiency of the Tb-WS cycle were determined by performing the second-law thermodynamic analysis. Results obtained indicate that ηcycle and ηsolar-to-fuel increase with the decrease in oxygen partial pressure in the inert flushing gas and thermal reduction temperature (TH. It was also realized that the recuperation of the heat released by the water splitting reactor and quench unit further enhances the solar reactor efficiency. At TH=2280 K, by applying 60% heat recuperation, maximum ηcycle of 39.0% and ηsolar-to-fuel of 47.1% for the Tb-WS cycle can be attained.

  19. Folate Receptor Targeted Alpha-Therapy Using Terbium-149

    CERN Document Server

    Müller, Cristina; Haller, Stephanie; Dorrer, Holger; Köster, Ulli; Johnston, Karl; Zhernosekov, Konstantin; Türler, Andreas; Schibli, Roger

    2014-01-01

    Terbium-149 is among the most interesting therapeutic nuclides for medical applications. It decays by emission of short-range α-particles (Eα = 3.967 MeV) with a half-life of 4.12 h. The goal of this study was to investigate the anticancer efficacy of a 149Tb-labeled DOTA-folate conjugate (cm09) using folate receptor (FR)-positive cancer cells in vitro and in tumor-bearing mice. 149Tb was produced at the ISOLDE facility at CERN. Radiolabeling of cm09 with purified 149Tb resulted in a specific activity of ~1.2 MBq/nmol. In vitro assays performed with 149Tb-cm09 revealed a reduced KB cell viability in a FR-specific and activity concentration-dependent manner. Tumor-bearing mice were injected with saline only (group A) or with 149Tb-cm09 (group B: 2.2 MBq; group C: 3.0 MBq). A significant tumor growth delay was found in treated animals resulting in an increased average survival time of mice which received 149Tb-cm09 (B: 30.5 d; C: 43 d) compared to untreated controls (A: 21 d). Analysis of blood parameters rev...

  20. Hardness and dielectric characteristics of flux grown terbium aluminate crystals

    Energy Technology Data Exchange (ETDEWEB)

    Sharma, K.K.; Kotru, P.N. [Jammu Univ. (India). Dept. of Physics; Tandon, R.P. [National Physical Laboratory, New Delhi (India); Wanklyn, B.M. [Clarendon Laboratory, University of Oxford, Oxford (United Kingdom)

    1999-01-29

    Results of indentation induced Vickers hardness testing and dielectric studies conducted on flux-grown terbium aluminate crystals are presented. It is shown that the Vickers hardness value (H{sub v}) is independent of indentation time, but depends on the applied load. Applying the concept of Hays and Kendall, the load independent values are estimated for (110) and (001) planes. Differential behaviour in the crack formation of two different planes (110) and (001) is observed, while (001) plane develops Palmqvist cracks in the whole load range of 10-100 g, (110) plane shows a transition from Palmqvist to median cracks at 70 g. The fracture toughness, brittleness index and yield strength are determined for both the planes. The hardness anisotropy is reported. The dielectric constant, dielectric loss and conductivity are shown to be dependent on temperature and frequency of the applied a.c. field. The dielectric constant versus temperature shows a transition peak at 230 C, which remains independent of the frequency of the applied a.c. field in the range 1 kHz-13 MHz. (orig.) 36 refs.

  1. Thermoluminescence of cerium and terbium -doped calcium pyrophosphate

    Energy Technology Data Exchange (ETDEWEB)

    Roman L, J.; Cruz Z, E. [UNAM, Instituto de Ciencias Nucleares, Circuito Exterior, Ciudad Universitaria, 04510 Mexico D. F. (Mexico); Lozano R, I. B.; Diaz G, J. A. I., E-mail: jesus.roman@nucleares.unam.mx [IPN, Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada, Av. Legaria No. 694, 11500 Mexico D. F. (Mexico)

    2015-10-15

    The aim of this work is to report the thermoluminescence (Tl) response of Calcium Pyrophosphate phosphor doped with Cerium and Terbium impurities (Ca{sub 2}P{sub 2}O{sub 7}:Ce{sup 3+},Tb{sup 3+}). The phosphors were synthesized using the co-precipitation method and annealed at 900 degrees C by two hours for obtain the β phase. The intentional doping with Ce and Tb ions was 1 at.% and 0.1 at.%, whereas in the EDS results the concentration of impurities was 0.39 at.% and 0.05 at.%, respectively. The superficial morphology of phosphor is mainly composed by thin wafers of different size. All samples were exposed to gamma rays from {sup 60}Co in the Gammacell-200 irradiator. The Tl response of the phosphor was measured from Rt up to 350 degrees C and under nitrogen atmosphere in a Harshaw TLD 3500 reader. The glow curves of the Ca{sub 2}P{sub 2}O{sub 7}:Ce{sup 3+},Tb{sup 3+} powders showed a broad intense Tl peak centered at 165 degrees C and a shoulder at approximate 260 degrees C was observed. A linear Tl response in the range of absorbed dose of 0.2 to 10 Gy was obtained. Tl glow curves were analyzed using the initial rise (IR)and computerized glow curve deconvolution methods to evaluate the kinetics parameters such as activation energy (E), frequency factor (s) and kinetic order (b). (Author)

  2. Synthesis and crystal structure of terbium(III) meta-oxoborate Tb(BO{sub 2}){sub 3} ({identical_to} TbB{sub 3}O{sub 6}); Synthese und Kristallstruktur von Terbium(III)-meta-Oxoborat Tb(BO{sub 2}){sub 3} ({identical_to} TbB{sub 3}O{sub 6})

    Energy Technology Data Exchange (ETDEWEB)

    Nikelski, Tanja; Schleid, Thomas [Institut fuer Anorganische Chemie der Universitaet Stuttgart (Germany)

    2003-06-01

    The terbium meta-oxoborate Tb(BO{sub 2}){sub 3} ({identical_to} TbB{sub 3}O{sub 6}) is obtained as single crystals by the reaction of terbium, Tb{sub 4}O{sub 7} and TbCl{sub 3} with an excess of B{sub 2}O{sub 3} in gastight sealed platinum ampoules at 950 C after three weeks. The compound appears to be air- and water-resistant and crystallizes as long, thin, colourless needles which tend to growth-twinning due to their marked fibrous habit. The crystal structure of Tb(BO{sub 2}){sub 3} (orthorhombic, Pnma; a = 1598.97(9), b = 741.39(4), c = 1229.58(7) pm; Z = 16) contains strongly corrugated oxoborate layers {sub {infinity}}{sup 2}{l_brace}(BO{sub 2}){sup -}{r_brace} built of vertex-linked [BO{sub 4}]{sup 5-} tetrahedra (d(B-O) = 143 - 154 pm, and angsph;(O-B-O) = 102-115 ) which spread out parallel (100). The four crystallographically different Tb{sup 3+} cations all exhibit coordination numbers of eight towards the oxygen atoms (d(Tb-O) = 228-287 pm). The corresponding metal cation polyhedra [TbO{sub 8}]{sup 13+} too convene to layers (composition: {sub {infinity}}{sup 2}{l_brace}(Tb{sub 2}O{sub 11}){sup 16-}{r_brace}) which are likewise oriented parallel to the (100) plane. (Abstract Copyright [2003], Wiley Periodicals, Inc.) [German] Das Terbium-meta-Oxoborat Tb(BO{sub 2}){sub 3} ({identical_to} TbB{sub 3}O{sub 6}) entsteht einkristallin bei der Reaktion von Terbium, Tb{sub 4}O{sub 7} und TbCl{sub 3} mit einem Ueberschuss von B{sub 2}O{sub 3} in gasdicht verschlossenen Platinampullen nach drei Wochen bei 950 C. Die Verbindung ist luft- und wasserstabil und faellt in langen, duennen, farblosen Nadeln an, die aufgrund ihres ausgepraegt faserigen Habitus zur Wachstumsverzwillingung neigen. Die Kristallstruktur von Tb(BO{sub 2}){sub 3} (orthorhombisch, Pnma; a = 1598, 97(9), b = 741, 39(4), c = 1229, 58(7) pm; Z = 16) enthaelt parallel (100) verlaufende, stark gewellte Oxoborat-Schichten {sub {infinity}}{sup 2}{l_brace}(BO{sub 2}){sup -}{r_brace} aus

  3. Solvent polarity and oxygen sensitivity, rather than viscosity, determine lifetimes of biaryl-sensitised terbium luminescence.

    Science.gov (United States)

    Walter, Edward R H; Williams, J A Gareth; Parker, David

    2017-12-14

    In a macrocyclic terbium complex incorporating a biaryl sensitiser, the observed variation of emission lifetime is shown to be determined by the solubility of oxygen in the solvent system and the relative energy of the chromophore excited state, rather than any dependence on solvent viscosity.

  4. 46 CFR 154.660 - Pipe welding.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Pipe welding. 154.660 Section 154.660 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS FOR... § 154.660 Pipe welding. (a) Pipe welding must meet Part 57 of this chapter. (b) Longitudinal butt welds...

  5. 46 CFR 154.466 - Design criteria.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Design criteria. 154.466 Section 154.466 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS FOR... § 154.466 Design criteria. (a) The insulation for a cargo tank without a secondary barrier must be...

  6. 46 CFR 154.471 - Design criteria.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Design criteria. 154.471 Section 154.471 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS FOR... § 154.471 Design criteria. (a) The cargo tank support system must be designed: (1) For the loads in...

  7. 33 CFR 154.570 - Lighting.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Lighting. 154.570 Section 154.570... TRANSFERRING OIL OR HAZARDOUS MATERIAL IN BULK Equipment Requirements § 154.570 Lighting. (a) Except as... fixed lighting that adequately illuminates: (1) Each transfer connection point on the facility; (2) Each...

  8. 32 CFR 154.61 - Security education.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 1 2010-07-01 2010-07-01 false Security education. 154.61 Section 154.61... PERSONNEL SECURITY PROGRAM REGULATION Continuing Security Responsibilities § 154.61 Security education. (a.... Through security briefings and education, the Department of Defense continues to provide for the...

  9. 29 CFR 1915.154 - Respiratory protection.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 7 2010-07-01 2010-07-01 false Respiratory protection. 1915.154 Section 1915.154 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR... (PPE) § 1915.154 Respiratory protection. Respiratory protection for shipyard employment is covered by...

  10. 46 CFR 154.1405 - Respiratory protection.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Respiratory protection. 154.1405 Section 154.1405... Equipment § 154.1405 Respiratory protection. When Table 4 references this section, a vessel carrying the listed cargo must have: (a) Respiratory protection equipment for each person on board that protects the...

  11. 46 CFR 154.520 - Piping calculations.

    Science.gov (United States)

    2010-10-01

    ...: (a) Pipe weight loads; (b) Acceleration loads; (c) Internal pressure loads; (d) Thermal loads; and (e... 46 Shipping 5 2010-10-01 2010-10-01 false Piping calculations. 154.520 Section 154.520 Shipping... Process Piping Systems § 154.520 Piping calculations. A piping system must be designed to meet the...

  12. 46 CFR 154.429 - Calculations.

    Science.gov (United States)

    2010-10-01

    ... § 154.429 Calculations. The tank design load calculations for a membrane tank must include the following... submitted to meet this paragraph. (c) The combined strains from static, dynamic, and thermal loads. ... 46 Shipping 5 2010-10-01 2010-10-01 false Calculations. 154.429 Section 154.429 Shipping COAST...

  13. 46 CFR 154.1020 - Emergency power.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Emergency power. 154.1020 Section 154.1020 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS... § 154.1020 Emergency power. The emergency generator must be designed to allow operation at the final...

  14. 46 CFR 154.665 - Welding procedures.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Welding procedures. 154.665 Section 154.665 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS... Construction § 154.665 Welding procedures. Welding procedure tests for cargo tanks for a design temperature...

  15. 33 CFR 154.510 - Loading arms.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Loading arms. 154.510 Section 154... FACILITIES TRANSFERRING OIL OR HAZARDOUS MATERIAL IN BULK Equipment Requirements § 154.510 Loading arms. (a) Each mechanical loading arm used for transferring oil or hazardous material and placed into service...

  16. 46 CFR 154.439 - Tank design.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Tank design. 154.439 Section 154.439 Shipping COAST... SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES Design, Construction and Equipment Independent Tank Type A § 154.439 Tank design. An independent tank type A must meet the deep tank standard of the...

  17. 46 CFR 154.420 - Tank design.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Tank design. 154.420 Section 154.420 Shipping COAST... SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES Design, Construction and Equipment Integral Tanks § 154.420 Tank design. (a) The structure of an integral tank must meet the deep tank scantling standards...

  18. 11 CFR 100.154 - Candidate debates.

    Science.gov (United States)

    2010-01-01

    ... 11 Federal Elections 1 2010-01-01 2010-01-01 false Candidate debates. 100.154 Section 100.154 Federal Elections FEDERAL ELECTION COMMISSION GENERAL SCOPE AND DEFINITIONS (2 U.S.C. 431) Exceptions to Expenditures § 100.154 Candidate debates. Funds used to defray costs incurred in staging candidate debates in...

  19. 46 CFR 154.1410 - Decontamination shower.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Decontamination shower. 154.1410 Section 154.1410... Equipment § 154.1410 Decontamination shower. When Table 4 references this section, a vessel carrying the listed cargo must have a decontamination shower and an eye wash that: (a) Are on the weatherdeck; and (b...

  20. 46 CFR 154.428 - Allowable stress.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Allowable stress. 154.428 Section 154.428 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS FOR... § 154.428 Allowable stress. The membrane tank and the supporting insulation must have allowable stresses...

  1. 46 CFR 154.447 - Allowable stress.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Allowable stress. 154.447 Section 154.447 Shipping COAST... Tank Type B § 154.447 Allowable stress. (a) An independent tank type B designed from bodies of revolution must have allowable stresses 3 determined by the following formulae: 3 See Appendix B for stress...

  2. 46 CFR 154.440 - Allowable stress.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Allowable stress. 154.440 Section 154.440 Shipping COAST... Tank Type A § 154.440 Allowable stress. (a) The allowable stresses for an independent tank type A must... Commandant (CG-522). (b) A greater allowable stress than required in paragraph (a)(1) of this section may be...

  3. 46 CFR 154.421 - Allowable stress.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Allowable stress. 154.421 Section 154.421 Shipping COAST... § 154.421 Allowable stress. The allowable stress for the integral tank structure must meet the American Bureau of Shipping's allowable stress for the vessel's hull published in “Rules for Building and Classing...

  4. 46 CFR 154.1840 - Protective clothing.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Protective clothing. 154.1840 Section 154.1840 Shipping... FOR SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES Operations § 154.1840 Protective clothing... operation, except those assigned to gas-safe cargo control rooms, wears protective clothing. ...

  5. 46 CFR 154.702 - Refrigerated carriage.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Refrigerated carriage. 154.702 Section 154.702 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS... Pressure and Temperature Control § 154.702 Refrigerated carriage. (a) Each refrigeration system must: (1...

  6. 7 CFR 58.154 - Refrigerated storage.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 3 2010-01-01 2010-01-01 false Refrigerated storage. 58.154 Section 58.154 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Standards... § 58.154 Refrigerated storage. Finished product in containers subject to such conditions that will...

  7. 46 CFR 154.1715 - Moisture control.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Moisture control. 154.1715 Section 154.1715 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS... § 154.1715 Moisture control. When a vessel is carrying sulfur dioxide, the master shall ensure that: (a...

  8. 32 CFR 154.55 - Requirements.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 1 2010-07-01 2010-07-01 false Requirements. 154.55 Section 154.55 National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE SECURITY DEPARTMENT OF DEFENSE PERSONNEL SECURITY PROGRAM REGULATION Unfavorable Administrative Actions § 154.55 Requirements. (a) General. For...

  9. 46 CFR 154.703 - Methane (LNG).

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Methane (LNG). 154.703 Section 154.703 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS FOR... and Temperature Control § 154.703 Methane (LNG). Unless a cargo tank carrying methane (LNG) can...

  10. 40 CFR 417.154 - [Reserved

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 28 2010-07-01 2010-07-01 true 417.154 Section 417.154 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS SOAP AND DETERGENT MANUFACTURING POINT SOURCE CATEGORY Manufacture of Spray Dried Detergents Subcategory § 417.154 ...

  11. Arginine-responsive terbium luminescent hybrid sensors triggered by two crown ether carboxylic acids

    Energy Technology Data Exchange (ETDEWEB)

    Jiang, Lasheng [Key Laboratory of Theoretical Chemistry of Environment, Ministry of Education, School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); Tang, Ke; Ding, Xiaoping [School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); Wang, Qianming, E-mail: qmwang@scnu.edu.cn [Key Laboratory of Theoretical Chemistry of Environment, Ministry of Education, School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); Zhou, Zhan; Xiao, Rui [School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China)

    2013-12-01

    Crown ether carboxylic acids constitute main building blocks for the synthesis of terbium containing covalent cross-linked luminescent materials. Both the complexes and the hybrid nanomaterials could exhibit remarkable green emissions in pure water. More importantly, they were found to have a profound effect on the luminescence responses to arginine compared with glutamic acid, histidine, tryptophan, threonine, tyrosine and phenylalanine in aqueous environment. The present study provided the possibility of using a host–guest mechanism as a way of signal transduction based on lanthanide supramolecular hybrid materials. - Highlights: • Crown ether carboxylic acids were found to sensitize terbium ions among a group of ethers. • The complexes and silica hybrid materials were both prepared and characterized. • They could exhibit remarkable green emissions in pure water.

  12. Comparative analysis of conjugated alkynyl chromophore-triazacyclononane ligands for sensitized emission of europium and terbium.

    Science.gov (United States)

    Soulié, Marine; Latzko, Frédéric; Bourrier, Emmanuel; Placide, Virginie; Butler, Stephen J; Pal, Robert; Walton, James W; Baldeck, Patrice L; Le Guennic, Boris; Andraud, Chantal; Zwier, Jurriaan M; Lamarque, Laurent; Parker, David; Maury, Olivier

    2014-07-07

    A series of europium and terbium complexes based on a functionalized triazacyclononane carboxylate or phosphinate macrocyclic ligand is described. The influence of the anionic group, that is, carboxylate, methylphosphinate, or phenylphosphinate, on the photophysical properties was studied and rationalized on the basis of DFT calculated structures. The nature, number, and position of electron-donating or electron-withdrawing aryl substituents were varied systematically within the same phenylethynyl scaffold in order to optimize the brightness of the corresponding europium complexes and investigate their two-photon absorption properties. Finally, the europium complexes were examined in cell-imaging applications, and selected terbium complexes were studied as potential oxygen sensors. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Spectrofluorimetric Determination of Human Serum Albumin Using Terbium-Danofloxacin Probe

    OpenAIRE

    Ramezani, Amir M.; Manzoori, Jamshid L.; Amjadi, Mohammad; Jouyban, Abolghasem

    2012-01-01

    A spectrofluorimetric method is proposed for the determination of human serum albumin (HSA) and bovine serum albumin (BSA) using terbium-danofloxacin (Tb3+-Dano) as a fluorescent probe. These proteins remarkably enhance the fluorescence intensity of the Tb3+-Dano complex at 545 nm, and the enhanced fluorescence intensity of Tb3+-Dano is proportional to the concentration of proteins (HSA and BSA). Optimum conditions for the determination of HSA were investigated and found that the maximum resp...

  14. Genetically Encoded FRET-Sensor Based on Terbium Chelate and Red Fluorescent Protein for Detection of Caspase-3 Activity

    Directory of Open Access Journals (Sweden)

    Alexander S. Goryashchenko

    2015-07-01

    Full Text Available This article describes the genetically encoded caspase-3 FRET-sensor based on the terbium-binding peptide, cleavable linker with caspase-3 recognition site, and red fluorescent protein TagRFP. The engineered construction performs two induction-resonance energy transfer processes: from tryptophan of the terbium-binding peptide to Tb3+ and from sensitized Tb3+ to acceptor—the chromophore of TagRFP. Long-lived terbium-sensitized emission (microseconds, pulse excitation source, and time-resolved detection were utilized to eliminate directly excited TagRFP fluorescence and background cellular autofluorescence, which lasts a fraction of nanosecond, and thus to improve sensitivity of analyses. Furthermore the technique facilitates selective detection of fluorescence, induced by uncleaved acceptor emission. For the first time it was shown that fluorescence resonance energy transfer between sensitized terbium and TagRFP in the engineered construction can be studied via detection of microsecond TagRFP fluorescence intensities. The lifetime and distance distribution between donor and acceptor were calculated using molecular dynamics simulation. Using this data, quantum yield of terbium ions with binding peptide was estimated.

  15. 33 CFR 154.1216 - Facility classification.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Facility classification. 154.1216... Vegetable Oils Facilities § 154.1216 Facility classification. (a) The Coast Guard classifies facilities that... classification of a facility that handles, stores, or transports animal fats or vegetable oils. The COTP may...

  16. 32 CFR 154.34 - Priority requests.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 1 2010-07-01 2010-07-01 false Priority requests. 154.34 Section 154.34... requests. To insure that personnel security investigations are conducted in an orderly and efficient manner, requests for priority for individual investigations or categories of investigations shall be kept to a...

  17. 42 CFR 441.154 - Active treatment.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 4 2010-10-01 2010-10-01 false Active treatment. 441.154 Section 441.154 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED... treatment. Inpatient psychiatric services must involve “active treatment”, which means implementation of a...

  18. 46 CFR 154.1725 - Ethylene oxide.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Ethylene oxide. 154.1725 Section 154.1725 Shipping COAST....1725 Ethylene oxide. (a) A vessel carrying ethylene oxide must: (1) Have cargo piping, vent piping, and... space of an ethylene oxide cargo tank for a period of 30 days under the condition of paragraph (e) of...

  19. 32 CFR 154.30 - General.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 1 2010-07-01 2010-07-01 false General. 154.30 Section 154.30 National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE SECURITY DEPARTMENT OF DEFENSE PERSONNEL SECURITY... security investigations shall be limited to those required to accomplish the Defense mission. Such requests...

  20. 32 CFR 154.1 - Purpose.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 1 2010-07-01 2010-07-01 false Purpose. 154.1 Section 154.1 National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE SECURITY DEPARTMENT OF DEFENSE PERSONNEL SECURITY... employees in the Department of Defense (DoD), and granting members of the Armed Forces, DoD civilian...

  1. 18 CFR 154.502 - Reports.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Reports. 154.502... OF ENERGY REGULATIONS UNDER NATURAL GAS ACT RATE SCHEDULES AND TARIFFS Refunds and Reports § 154.502 Reports. (a) When the natural gas company is required, either by a Commission order or as a part of a...

  2. 33 CFR 154.1075 - Appeal process.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Appeal process. 154.1075 Section 154.1075 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED....1075 Appeal process. (a) Any owner or operator of a facility who desires to appeal the classification...

  3. 46 CFR 154.1755 - Nitrogen.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Nitrogen. 154.1755 Section 154.1755 Shipping COAST GUARD... Nitrogen. Except for deck tanks and their piping systems, cargo containment systems and piping systems carrying nitrogen must be specially approved by the Commandant (CG-522). ...

  4. 46 CFR 154.605 - Toughness test.

    Science.gov (United States)

    2010-10-01

    ... of this chapter. (b) If subsize test specimens are used for the Charpy V-notch toughness test, the... 46 Shipping 5 2010-10-01 2010-10-01 false Toughness test. 154.605 Section 154.605 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS FOR...

  5. 46 CFR 154.460 - Design criteria.

    Science.gov (United States)

    2010-10-01

    ... dynamic loads in § 154.409(e); (c) If the primary barrier fails, prevent the temperature of the vessel's structure from falling below the minimum allowable service temperature of the steel; and (d) Be designed so... tank for at least 15 days under the dynamic loads in § 154.409(e); (b) If a partial secondary barrier...

  6. 34 CFR 668.154 - Institutional accountability.

    Science.gov (United States)

    2010-07-01

    ... 34 Education 3 2010-07-01 2010-07-01 false Institutional accountability. 668.154 Section 668.154 Education Regulations of the Offices of the Department of Education (Continued) OFFICE OF POSTSECONDARY... accountability. An institution shall be liable for the Title IV, HEA program funds disbursed to a student whose...

  7. 40 CFR 93.154 - Conformity analysis.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Conformity analysis. 93.154 Section 93...) DETERMINING CONFORMITY OF FEDERAL ACTIONS TO STATE OR FEDERAL IMPLEMENTATION PLANS Determining Conformity of General Federal Actions to State or Federal Implementation Plans § 93.154 Conformity analysis. Any Federal...

  8. 33 CFR 154.800 - Applicability.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Applicability. 154.800 Section 154.800 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED... receives cargo vapor from a vessel is connected to a facility vapor control system that serves tank storage...

  9. Dicty_cDB: VHP154 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VH (Link to library) VHP154 (Link to dictyBase) - G23560 DDB0231372 Contig-U12088-1 | Contig-U13789-1 VHP...154P (Link to Original site) VHP154F 617 VHP154Z 715 VHP154P 1312 - - Show VHP154 Libr...ary VH (Link to library) Clone ID VHP154 (Link to dictyBase) Atlas ID - NBRP ID G23560 dictyBase ID DDB02313...ycdb.biol.tsukuba.ac.jp/CSM/VH/VHP1-C/VHP154Q.Seq.d/ Representative seq. ID VHP154P (Link to Original site) ...Representative DNA sequence >VHP154 (VHP154Q) /CSM/VH/VHP1-C/VHP154Q.Seq.d/ TACAACTGCAGCTAATTTATTCAAGAAAACCG

  10. Green light emission in aluminum oxide powders doped with different terbium concentrations

    Energy Technology Data Exchange (ETDEWEB)

    Mariscal B, L; Falcony, C. [IPN, Centro de Investigacion y de Estudios Avanzados, 07360 Ciudad de Mexico (Mexico); Carmona T, S.; Murrieta, H.; Sanchez A, M. A. [UNAM, Instituto de Fisica, 04510 Ciudad de Mexico (Mexico); Vazquez A, R. [IPN, Escuela Superior de Computo, 07738 Ciudad de Mexico (Mexico); Garcia R, C. M., E-mail: mariscal2005@gmail.com [UNAM, Facultad de Ciencias, 04510 Ciudad de Mexico (Mexico)

    2016-11-01

    Different emission intensities presented in aluminum oxide phosphors corresponding to different concentrations of doping performed with terbium are analyzed. The phosphors were synthesized by the evaporation technique and were characterized by photo and cathodoluminescence, X-ray diffraction and EDS techniques for different incorporation percentages of terbium as dopant; they show characteristic transitions in 494, 543, 587 and 622 nm, corresponding to {sup 5}D{sub 4} → {sup 7}F{sub 6}, {sup 5}D{sub 4} → {sup 7}F{sub 5}, {sup 5}D{sub 4} → {sup 7}F{sub 4} and {sup 5}D{sub 4} → {sup 7}F{sub 3}, respectively when they are excited with λ{sub exc} = 380 nm wavelength at room temperature. The results of X-ray diffraction show the presence of α-Al{sub 2}O{sub 3} phases with peaks located at 2θ = 25.78, 35.34, 37.96, 43.56, 45.8, 52.74, 57.7, 61.5, 66.74, 68.44, 77.12 and 80.94, and the δ-Al{sub 2}O-3 phase 2θ = 32.82, 45.8, 61.36 and 66.74. These compounds were heat treated for two hours at 1100 degrees Celsius. EDS analyzes indicate that these compounds have close to 60% oxygen around of 40% aluminum in the presence of terbium as dopant which indicates a stoichiometry close to the expected one for alumina. (Author)

  11. Graphene quantum dots-terbium ions as novel sensitive and selective time-resolved luminescent probes.

    Science.gov (United States)

    Llorent-Martínez, Eulogio J; Durán, Gema M; Ríos, Ángel; Ruiz-Medina, Antonio

    2018-01-01

    We propose an alternative approach for the development of analytical methods based on terbium-sensitized luminescence (TSL). TSL is based on the complexation between Tb(III) ions and fluorescent organic compounds that have appropriate functional groups to complex with Tb(III). We report the use of graphene quantum dot (GQDs) nanoparticles to improve the sensitivity and selectivity of TSL detection. GQDs can react with terbium ions through the carboxylic groups present in their structure. These Tb(III)-GQD complexes, formed in situ in aqueous solution, can be used as time-resolved luminescent probes. Ascorbic acid was selected as a target analyte to demonstrate the suitability of the proposed method. The selectivity of the TSL method was highly improved for most of the interferences tested. Under the optimum conditions [Tb(III) concentration 5 × 10-4 mol L-1, GQD concentration 4 mg L-1], a minimum 100% increase in selectivity was observed for several vitamins and common cations that may be present in the samples to be analyzed. In addition, the analytical signal showed a 30% enhancement with the use of GQDs compared with the use of merely Tb(III) ions, with a detection limit of 0.12 μg mL-1. The repeatability and intermediate precision were lower than 3% and 5%, respectively. From the results obtained, the implementation of GQDs in TSL can lead to the development of novel time-resolved luminescent probes with high analytical potential. Graphical abstract Quenching of Tb(III)-graphene quantum dot (GQD) luminescence by ascorbic acid (AA). TBL terbium-sensitized luminescence.

  12. Fluorescence study of some terbium-oligopeptide complexes in methanolic solution.

    Science.gov (United States)

    Rabouan, S; Delage, J; Durand, W; Prognon, P; Barthes, D

    2000-04-03

    This study concerned the use of lanthanide chelates to detect glycyl-leucyl-phenylalanine (GLF) and its homologues. Spectroscopic analysis of peptides without or with terbium complexation revealed the formation of (LF)(3)(Tb)(2), (GF)(3)(Tb)(2), (GLF)(3)(Tb)(2) and (FL)(4)Tb, (FG)(4)Tb complexes with high stability constants in methanolic solutions (pK(d)>13). Lanthanide chelate emission displayed a large Stokes shift (>270 nm), which allowed Tb chelates of GLF and its derivatives to be used for detection purposes. However, this preliminary study indicated some important limitations associated with lanthanide chelation, such as high methanolic content.

  13. Electromagnetic properties of terbium gallium garnet at millikelvin temperatures and low photon energy

    Science.gov (United States)

    Kostylev, Nikita; Goryachev, Maxim; Bushev, Pavel; Tobar, Michael E.

    2017-07-01

    Electromagnetic properties of single crystal terbium gallium garnet are characterised from room down to millikelvin temperatures using the whispering gallery mode method. Microwave spectroscopy is performed at low powers equivalent to a few photons in energy and conducted as functions of the magnetic field and temperature. A phase transition is detected close to the temperature of 3.5 K. This is observed for multiple whispering gallery modes causing an abrupt negative frequency shift and a change in transmission due to extra losses in the new phase caused by a change in complex magnetic susceptibility.

  14. Nuclear excitation functions from 40 to 200 MeV proton irradiation of terbium

    Energy Technology Data Exchange (ETDEWEB)

    Engle, Jonathan W., E-mail: jwengle@lanl.gov; Mashnik, Stepan G.; Parker, Lauren A.; Jackman, Kevin R.; Bitteker, Leo J.; Ullmann, John L.; Gulley, Mark S.; Pillai, Chandra; John, Kevin D.; Birnbaum, Eva R.; Nortier, Francois M.

    2016-01-01

    Nuclear formation cross sections are reported for 26 radionuclides, measured with 40–200 MeV proton irradiations of terbium foils. These data provide the basis for the production of medically relevant radionuclides (e.g., {sup 152}Tb, {sup 155}Tb, {sup 155}Eu, and {sup 156}Eu) and {sup 153}Gd, a potential source used in ongoing efforts to characterize stellar nucleosynthesis routes. Computational predictions from the ALICE2011, CEM03.03, Bertini, and INCL + ABLA codes are compared with newly measured data to contribute to the ongoing process of code development, and yields are calculated for selected radionuclides using measured data.

  15. 154 GHz collective Thomson scattering in LHD

    Science.gov (United States)

    Tanaka, K.; Nishiura, M.; Kubo, S.; Shimozuma, T.; Saito, T.; Moseev, D.; Abramovic, I.

    2018-01-01

    Collective Thomson scattering (CTS) was developed by using a 154 GHz gyrotron, and the first data has been obtained. Already, 77 GHz CTS has worked successfully. However, in order to access higher density region, 154 GHz option enhances the usability that reduces the refraction effect, which deteriorates in the local measurements. The system in the down converted frequency was almost identical to the system for 77 GHz. Probing beam, a notch filter, a mixer, and a local oscillator in the receiver system for 77 GHz option were replaced to those for the 154 GHz option. 154 GHz gyrotron was originally prepared for the second harmonic electron cyclotron heating (ECRH) at 2.75 T. However, scattering signal was masked by the second harmonic electron cyclotron emission (ECE) at 2.75 T. Therefore, 154 GHz CTS was operated at 1.375 T with fourth harmonic ECE, and an acceptable signal to noise ratio was obtained. There is a signature of fast ion components with neutral beam (NB) injection. In addition, the CTS spectrum became broader in hydrogen discharge than in deuterium discharge, as the theoretical CTS spectrum expects. This observation indicates a possibility to identify ion species ratio by the 154 GHz CTS diagnostic.

  16. Micelle-enhanced and terbium-sensitized spectrofluorimetric determination of gatifloxacin and its interaction mechanism

    Science.gov (United States)

    Guo, Changchuan; Wang, Lei; Hou, Zhun; Jiang, Wei; Sang, Lihong

    2009-05-01

    A terbium-sensitized spectrofluorimetric method using an anionic surfactant, sodium dodecyl benzene sulfonate (SDBS), was developed for the determination of gatifloxacin (GFLX). A coordination complex system of GFLX-Tb 3+-SDBS was studied. It was found that SDBS significantly enhanced the fluorescence intensity of the complex (about 11-fold). Optimal experimental conditions were determined as follows: excitation and emission wavelengths of 331 and 547 nm, pH 7.0, 2.0 × 10 -4 mol l -1 terbium (III), and 2.0 × 10 -4 mol l -1 SDBS. The enhanced fluorescence intensity of the system (Δ If) showed a good linear relationship with the concentration of GFLX over the range of 5.0 × 10 -10 to 5.0 × 10 -8 mol l -1 with a correlation coefficient of 0.9996. The detection limit (3 σ) was determined as 6.0 × 10 -11 mol l -1. This method has been successfully applied to the determination of GFLX in pharmaceuticals and human urine/serum samples. Compared with most of other methods reported, the rapid and simple procedure proposed in the text offers higher sensitivity, wider linear range, and better stability. The interaction mechanism of the system is also studied by the research of ultraviolet absorption spectra, surface tension, solution polarity and fluorescence polarization.

  17. Circularly Polarized Luminescence in Enantiopure Europium and Terbium Complexes with Modular, All-Oxygen Donor Ligands

    Science.gov (United States)

    Seitz, Michael; Do, King; Ingram, Andrew J.; Moore, Evan G.; Muller, Gilles; Raymond, Kenneth N.

    2009-01-01

    Abstract: Circulaly polarized luminescence from terbium(III) complexed and excited by chiral antenna ligands gives strong emission The modular synthesis of three new octadentate, enantiopure ligands are reported - one with the bidentate chelating unit 2-hydroxyisophthalamide (IAM) and two with 1-hydroxy-2-pyridinone (1,2-HOPO) units. A new design principle is introduced for the chiral, non-racemic hexamines which constitute the central backbones for the presented class of ligands. The terbium(III) complex of the IAM ligand, as well as the europium(III) complexes of the 1,2-HOPO ligands are synthesized and characterized by various techniques (NMR, UV, CD, luminescence spectroscopy). All species exhibit excellent stability and moderate to high luminescence efficiency (quantum yields ΦEu = 0.05–0.08 and ΦTb = 0.30–0.57) in aqueous solution at physiological pH. Special focus is put onto the properties of the complexes in regard to circularly polarized luminescence (CPL). The maximum luminescence dissymmetry factors (glum) in aqueous solution are high with |glum|max = 0.08 – 0.40. Together with the very favorable general properties (good stability, high quantum yields, long lifetimes), the presented lanthanide complexes can be considered as good candidates for analytical probes based on CPL in biologically relevant environments. PMID:19639983

  18. 46 CFR 154.355 - Bow and stern loading piping.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Bow and stern loading piping. 154.355 Section 154.355... Arrangements § 154.355 Bow and stern loading piping. (a) Bow and stern loading piping must: (1) Meet § 154.310... other openings to accommodation, service, or control spaces that face the bow or stern loading area must...

  19. 46 CFR 154.408 - Cargo tank external pressure load.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Cargo tank external pressure load. 154.408 Section 154... Equipment Cargo Containment Systems § 154.408 Cargo tank external pressure load. For the calculation required under § 154.406 (a)(2) and (b), the external pressure load must be the difference between the...

  20. 46 CFR 154.178 - Contiguous hull structure: Heating system.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Contiguous hull structure: Heating system. 154.178... Equipment Hull Structure § 154.178 Contiguous hull structure: Heating system. The heating system for... the heating capacity to meet § 154.174(b)(2) or § 154.176(b)(2); (b) Have stand-by heating to provide...

  1. Luminescent method of determination of composition of europium and terbium complexes in solution by change of intensity ratio of luminescence bands

    Energy Technology Data Exchange (ETDEWEB)

    Bel' tyukova, S.V.; Nazarenko, N.A.; Poluehktov, N.S.

    1982-03-01

    The complexes of europium and terbium with phenanthroline, ethylenediaminetetraacetate, nitrilotriacetate, some acids-phenol derivatives and ..beta..-diketones series have been used as an example to demonstrate that the value of the ratio of intensities on the two bands of europium(terbium) luminescence spectra - the one corresponding to the hypersensitive'' transition and the other, to the magnetic dipole one - can be used for determination of the complexes composition in solutions.

  2. 18 CFR 154.309 - Incremental expansions.

    Science.gov (United States)

    2010-04-01

    ... Changes § 154.309 Incremental expansions. (a) For every expansion for which incremental rates are charged... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Incremental expansions... incremental facilities to be rolled-in to the pipeline's rates. For every expansion that has an at-risk...

  3. 46 CFR 154.448 - Calculations.

    Science.gov (United States)

    2010-10-01

    ... SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES Design, Construction and Equipment Independent... similar vessel. (d) A tank buckling analysis considering the maximum construction tolerance. (e) A finite element analysis using the loads determined under § 154.406. (f) A fracture mechanics analysis using the...

  4. 32 CFR 154.41 - Central adjudication.

    Science.gov (United States)

    2010-07-01

    ... administrative action is contemplated under § 154.56(b), the letter of intent (LOI) to deny or revoke must be...-5. A final notification of unfavorable administrative action, subsequent to the issuance of the LOI.... A final notification of unfavorable administrative action subsequent to the issuance of the LOI must...

  5. 18 CFR 154.106 - Map.

    Science.gov (United States)

    2010-04-01

    ....106 Map. (a) The map must show the general geographic location of the company's principal pipeline... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Map. 154.106 Section... on a single map. In addition, a separate map should be provided for each zone. (b) (c) The map must...

  6. 46 CFR 154.1345 - Gas detection.

    Science.gov (United States)

    2010-10-01

    ...” in Table 4 must have: (1) A fixed flammable gas detection system that meets § 154.1350; and (2) Two portable gas detectors that can each measure 0 to 100% of the lower flammable limit of the cargo carried... sulfur dioxide must have a fixed gas detection system that is not located in a gas-safe space. (d) A...

  7. 33 CFR 154.1010 - Purpose.

    Science.gov (United States)

    2010-07-01

    ... FACILITIES TRANSFERRING OIL OR HAZARDOUS MATERIAL IN BULK Response Plans for Oil Facilities § 154.1010 Purpose. This subpart establishes oil spill response plan requirements for all marine transportation... response plan prepares the facility owner or operator to respond to an oil spill. These requirements...

  8. 7 CFR 3560.154 - Tenant selection.

    Science.gov (United States)

    2010-01-01

    ... AGRICULTURE DIRECT MULTI-FAMILY HOUSING LOANS AND GRANTS Multi-Family Housing Occupancy § 3560.154 Tenant... documented in the housing project's management plan and Affirmative Fair Housing Marketing Plan. (d... regardless of income. Such applicants, however, will be ranked among themselves by income level, giving...

  9. Thermo-transferred thermoluminescence (TTTl) in potassium-yttrium double fluoride doped with terbium

    Energy Technology Data Exchange (ETDEWEB)

    Gallegos, A.; Rivera, T.; Diaz G, J. A. [IPN, Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada, Legaria 694, Col. Irrigacion, 11500 Mexico D. F. (Mexico); Azorin, J. [Universidad Autonoma Metropolitana, Unidad Iztapalapa, San Rafael Atlixco No. 186, Col. Vicentina, 09340 Mexico D. F. (Mexico); Azorin, J. C. [Universidad de Guanajuato, Division de Ciencias e Ingenierias-Campus Leon, Lomas del Bosque No. 103, Col. Lomas del Campestre, 37000 Leon, Guanajuato (Mexico); Licona, R.; Rivas, F.; Hernandez C, G. [Benemerita Universidad Autonoma de Puebla, Facultad de Ciencias Quimicas, 14 Sur y San Claudio, Ciudad Universitaria, Puebla de Zaragoza, Puebla (Mexico); Khaidukov, N. [Institute of General and Inorganic Chemistry, Lenin SK 11 Prospect 31, Moscow 117907 (Russian Federation)

    2011-02-15

    This paper presents results of studying the thermo-transferred thermoluminescence (TTTl) phenomenon in potassium-yttrium double fluoride doped with terbium (K{sub 2}YF{sub 5:}Tb) at different impurity concentrations (0.8%, 0.95% and 0.99%). Previously to study the TTTl phenomenon, structural characterization and chemical composition of the materials were determined. The structural studies were conducted using a scanning electron microscope; meanwhile, chemical composition was analyzed using energy dispersive X-ray spectroscopy. Thermoluminescence kinetics was studied irradiating the samples with {sup 137}Cs gamma rays as well as with {sup 90}Sr/{sup 90}Y beta rays, analyzing the glow curves by the deconvolution method for obtaining the kinetic parameters. (Author)

  10. The influence of pressure on the photoluminescence properties of a terbium-adipate framework

    Science.gov (United States)

    Spencer, Elinor C.; Zhao, Jing; Ross, Nancy L.; Andrews, Michael B.; Surbella, Robert G.; Cahill, Christopher L.

    2013-06-01

    The influence of pressure (over the 0-4.7 GPa range) on the photoluminescence emissions and crystal structure of the known 3D terbium-adipate metal-organic framework material Tb-GWMOF6 has been evaluated by high-pressure single-crystal X-ray diffraction and spectroscopic techniques. The results from this study show that this complex lanthanide framework structure undergoes three phase transitions within the 0-4 GPa pressure range that involve alterations in the number of symmetry independent Tb3+ ion sites within the crystal lattice. These pressure induced modifications to the structure of Tb-GWMOF6 lead to pronounced changes in the profiles of the 5D4→7F5 emission spectra of this complex.

  11. Terbium Radionuclides for Theranostics Applications: A Focus On MEDICIS-PROMED

    Science.gov (United States)

    Cavaier, R. Formento; Haddad, F.; Sounalet, T.; Stora, T.; Zahi, I.

    A new facility, named CERN-MEDICIS, is under construction at CERN to produce radionuclides for medical applications. In parallel, the MEDICIS-PROMED, a Marie Sklodowska-Curie innovative training network of the Horizon 2020 European Commission's program, is being coordinated by CERN to train young scientists on the production and use of innovative radionuclides and develop a network of experts within Europe. One program within MEDICIS-PROMED is to determine the feasibility of producing innovative radioisotopes for theranostics using a commercial middle-sized high-current cyclotron and the mass separation technology developed at CERN-MEDICIS. This will allow the production of high specific activity radioisotopes not achievable with the common post-processing by chemical separation. Radioisotopes of scandium, copper, arsenic and terbium have been identified. Preliminary studies of activation yield and irradiation parameters optimization for the production of Tb-149 will be described.

  12. Dielectric and conducting behavior of gadolinium-terbium fumarate heptahydrate crystals

    Science.gov (United States)

    Shah, M. D.; Want, B.

    2015-07-01

    Gadolinium-terbium fumarate heptahydrate crystals were grown in silica gel by using single gel diffusion technique. The crystals were characterized by different physico-chemical techniques of characterization. Powder X-ray diffraction results showed that the grown material is purely crystalline in nature. Elemental analyses suggested the chemical formula of the compound to be Gd Tb (C4H2O4)3ṡ7H2O. Energy dispersive X-ray analysis confirmed the presence of Gd and Tb in the title compound. The dielectric and conductivity studies of the grown compound were carried as function of frequency of applied field and the temperature. The grown material showed a dielectric anomaly which was correlated with its thermal behavior. The ac conductivity of the material showed Jonscher's power law behavior: σ(ω)=σo+Aωs, with a temperature-dependent power exponent s(<1). The conductivity was found to be a function of temperature and frequency.

  13. Highly sensitive detection of dipicolinic acid with a water-dispersible terbium-metal organic framework.

    Science.gov (United States)

    Bhardwaj, Neha; Bhardwaj, Sanjeev; Mehta, Jyotsana; Kim, Ki-Hyun; Deep, Akash

    2016-12-15

    The sensitive detection of dipicolinic acid (DPA) is strongly associated with the sensing of bacterial organisms in food and many types of environmental samples. To date, the demand for a sensitive detection method for bacterial toxicity has increased remarkably. Herein, we investigated the DPA detection potential of a water-dispersible terbium-metal organic framework (Tb-MOF) based on the fluorescence quenching mechanism. The Tb-MOF showed a highly sensitive ability to detect DPA at a limit of detection of 0.04nM (linear range of detection: 1nM to 5µM) and also offered enhanced selectivity from other commonly associated organic molecules. The present study provides a basis for the application of Tb-MOF for direct, convenient, highly sensitive, and specific detection of DPA in the actual samples. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. A New Bis(phthalocyaninato) Terbium Single-Ion Magnet with an Overall Excellent Magnetic Performance.

    Science.gov (United States)

    Chen, Yuxiang; Ma, Fang; Chen, Xiaoxiang; Dong, Bowei; Wang, Kang; Jiang, Shangda; Wang, Chiming; Chen, Xin; Qi, Dongdong; Sun, Haoling; Wang, Bingwu; Gao, Song; Jiang, Jianzhuang

    2017-11-20

    Bulky and strong electron-donating dibutylamino groups were incorporated onto the peripheral positions of one of the two phthalocyanine ligands in the bis(phthalocyaninato) terbium complex, resulting in the isolation of heteroleptic double-decker (Pc)Tb{Pc[N(C4H9)2]8} {Pc = phthalocyaninate; Pc[N(C4H9)2]8 = 2,3,9,10,16,17,23,24-octakis(dibutylamino)phthalocyaninate} with the nature of an unsymmetrical molecular structure, a square-antiprismatic coordination geometry, an intensified coordination field strength, and the presence of organic radical-f interaction. As a total result of all these factors, this sandwich-type tetrapyrrole lanthanide single-ion magnet (SIM) exhibits an overall enhanced magnetic performance including a high blocking temperature (TB) of 30 K and large effective spin-reversal energy barrier of Ueff = 939 K, rendering it the best sandwich-type tetrapyrrole lanthanide SIM reported thus far.

  15. Ultralarge magneto-optic rotations and rotary dispersion in terbium gallium garnet single crystal.

    Science.gov (United States)

    Shaheen, Amrozia; Majeed, Hassaan; Anwar, Muhammad Sabieh

    2015-06-10

    We report systematically acquired data on the Verdet constant of terbium gallium garnet for wavelengths ranging from visible to near-infrared (405-830 nm) regime. Our experimental method of Stokes polarimetry is based on the Fourier decomposition of the received light intensity and allows unambiguous determination of both the Faraday rotation and the ellipticity of the emergent light. Temperature-dependent investigations in the range of 8-300 K extend earlier reports and verify the Verdet's constant direct dependence on the magnetization, whose first-order approximation is simply a manifestation of the Curie's law. Further, a least-squares fitting of the experimental data correlates well with theoretical predictions. At a wavelength of 405 nm and temperature of 8 K, the rotation is approximately 500°.

  16. Terbium fluorescence as a sensitive, inexpensive probe for UV-induced damage in nucleic acids

    Energy Technology Data Exchange (ETDEWEB)

    El-Yazbi, Amira F.; Loppnow, Glen R., E-mail: glen.loppnow@ualberta.ca

    2013-07-05

    Graphical abstract: -- Highlights: •Simple, inexpensive, mix-and-read assay for positive detection of DNA damage. •Recognition of undamaged DNA via hybridization to a hairpin probe. •Terbium(III) fluorescence reports the amount of damage by binding to ssDNA. •Tb/hairpin is a highly selective and sensitive fluorescent probe for DNA damage. -- Abstract: Much effort has been focused on developing methods for detecting damaged nucleic acids. However, almost all of the proposed methods consist of multi-step procedures, are limited, require expensive instruments, or suffer from a high level of interferences. In this paper, we present a novel simple, inexpensive, mix-and-read assay that is generally applicable to nucleic acid damage and uses the enhanced luminescence due to energy transfer from nucleic acids to terbium(III) (Tb{sup 3+}). Single-stranded oligonucleotides greatly enhance the Tb{sup 3+} emission, but duplex DNA does not. With the use of a DNA hairpin probe complementary to the oligonucleotide of interest, the Tb{sup 3+}/hairpin probe is applied to detect ultraviolet (UV)-induced DNA damage. The hairpin probe hybridizes only with the undamaged DNA. However, the damaged DNA remains single-stranded and enhances the intrinsic fluorescence of Tb{sup 3+}, producing a detectable signal directly proportional to the amount of DNA damage. This allows the Tb{sup 3+}/hairpin probe to be used for sensitive quantification of UV-induced DNA damage. The Tb{sup 3+}/hairpin probe showed superior selectivity to DNA damage compared to conventional molecular beacons probes (MBs) and its sensitivity is more than 2.5 times higher than MBs with a limit of detection of 4.36 ± 1.2 nM. In addition, this probe is easier to synthesize and more than eight times cheaper than MBs, which makes its use recommended for high-throughput, quantitative analysis of DNA damage.

  17. Fine- and hyperfine structure investigations of even configuration system of atomic terbium

    Science.gov (United States)

    Stefanska, D.; Elantkowska, M.; Ruczkowski, J.; Furmann, B.

    2017-03-01

    In this work a parametric study of the fine structure (fs) and the hyperfine structure (hfs) for the even-parity configurations of atomic terbium (Tb I) is presented, based in considerable part on the new experimental results. Measurements on 134 spectral lines were performed by laser induced fluorescence (LIF) in a hollow cathode discharge lamp; on this basis, the hyperfine structure constants A and B were determined for 52 even-parity levels belonging to the configurations 4f85d6s2, 4f85d26s or 4f96s6p; in all the cases those levels were involved in the transitions investigated as the lower levels. For 40 levels the hfs was examined for the first time, and for the remaining 12 levels the new measurements supplement our earlier results. As a by-product, also preliminary values of the hfs constants for 84 odd-parity levels were determined (the investigations of the odd-parity levels system in the terbium atom are still in progress). This huge amount of new experimental data, supplemented by our earlier published results, were considered for the fine and hyperfine structure analysis. A multi-configuration fit of 7 configurations was performed, taking into account second-order of perturbation theory, including the effects of closed shell-open shell excitations. Predicted values of the level energies, as well as of magnetic dipole and electric quadrupole hyperfine structure constants A and B, are quoted in cases when no experimental values are available. By combining our experimental data with our own semi-empirical procedure it was possible to identify correctly the lower and upper level of the line 544.1440 nm measured by Childs with the use of the atomic-beam laser-rf double-resonance technique (Childs, J Opt Soc Am B 9;1992:191-6).

  18. Studies of the N=90 region: The decay of 154Eu to 154Gd

    Energy Technology Data Exchange (ETDEWEB)

    Kulp, W.D.; Wood, J.L.; Krane, K.S.; Loats, J.; Schmelzenbach, P.; Stapels, C.J.; Larimer, R.-M.; Norman, E.B.

    2003-12-05

    The decay of {sup 154}Eu {yields} {sup 154}Gd has been studied by {gamma}-ray singles and {gamma}-{gamma} coincidence spectroscopy using an array of 20 Compton-suppressed Ge detectors. The primary goal of the work was to confirm or refute a large number of questionable features in the decay scheme: the outcome is the removal of 8 levels from the previously adopted scheme, with the result that a new type of collective band is revealed. Many weak decay branches for the decay are clarified. These results are critical for understanding the structure of {sup 154}Gd and the N = 90 isotones; and the improved completeness of the decay scheme contributes to the use of {sup 154}Eu as a metrological standard.

  19. Structural and optical characterization of terbium doped ZnGa2O4 thin films deposited by RF magnetron sputtering

    Science.gov (United States)

    Somasundaram, K.; Girija, K. G.; Sudarsan, V.; Selvin, P. Christopher; Vatsa, R. K.

    2016-05-01

    Tb3+ doped ZnGa2O4 nanophosphor (21 nm) has been synthesized via low temperature polyol route and subsequently thin films of the same were deposited on glass and ITO substrates by RF magnetron sputtering. The films were characterized by X-ray Diffraction and luminescence measurements. The XRD pattern showed that Tb3+ doped ZnGa2O4 nanophosphor has a cubic spinel phase. Luminescence behavior of the nanophosphor and as deposited sputtered film was investigated. The PL emission spectra of nanophosphor gave a broad ZnGa2O4 host emission band along with a strong terbium emission and the thin films showed only broad host emission band and there was no terbium ion emission.

  20. 46 CFR 154.411 - Cargo tank thermal loads.

    Science.gov (United States)

    2010-10-01

    ... Containment Systems § 154.411 Cargo tank thermal loads. For the calculations required under § 154.406(a)(4... 46 Shipping 5 2010-10-01 2010-10-01 false Cargo tank thermal loads. 154.411 Section 154.411... thermal loads for the cooling down periods of cargo tanks for design temperatures lower than −55 °C (−67...

  1. Determination of fluoxetine in pharmaceutical and biological samples based on the silver nanoparticle enhanced fluorescence of fluoxetine-terbium complex.

    Science.gov (United States)

    Lotfi, Ali; Manzoori, Jamshid L

    2016-11-01

    In this study, a simple and sensitive spectrofluorimetric method is presented for the determination of fluoxetine based on the enhancing effect of silver nanoparticles (AgNPs) on the terbium-fluoxetine fluorescence emission. The AgNPs were prepared by a simple reduction method and characterized by UV-Vis spectroscopy and transmission electron microscopy. It was indicated that these AgNPs have a remarkable amplifying effect on the terbium-sensitized fluorescence of fluoxetine. The effects of various parameters such as AgNP and Tb(3+) concentration and the pH of the media were investigated. Under obtained optimal conditions, the fluorescence intensity of the terbium-fluoxetine-AgNP system was enhanced linearly by increasing the concentration of fluoxetine in the range of 0.008 to 19 mg/L. The limit of detection (b + 3s) was 8.3 × 10(-4) mg/L. The interference effects of common species found in real samples were also studied. The method had good linearity, recovery, reproducibility and sensitivity, and was satisfactorily applied for the determination of fluoxetine in tablet formulations, human urine and plasma samples. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  2. Neutron Diffraction and Electrical Transport Studies on Magnetic Transition in Terbium at High Pressures and Low Temperatures

    Science.gov (United States)

    Thomas, Sarah; Montgomery, Jeffrey; Tsoi, Georgiy; Vohra, Yogesh; Weir, Samuel; Tulk, Christopher; Moreira Dos Santos, Antonio

    2013-06-01

    Neutron diffraction and electrical transport measurements have been carried out on the heavy rare earth metal terbium at high pressures and low temperatures in order to elucidate its transition from a helical antiferromagnetic to a ferromagnetic ordered phase as a function of pressure. The electrical resistance measurements using designer diamonds show a change in slope as the temperature is lowered through the ferromagnetic Curie temperature. The temperature of the ferromagnetic transition decreases at a rate of -16.7 K/GPa till 3.6 GPa, where terbium undergoes a structural transition from hexagonal close packed (hcp) to an α-Sm phase. Above this pressure, the electrical resistance measurements no longer exhibit a change in slope. In order to confirm the change in magnetic phase suggested by the electrical resistance measurements, neutron diffraction measurements were conducted at the SNAP beamline at the Oak Ridge National Laboratory. Measurements were made at pressures to 5.3 GPa and temperatures as low as 90 K. An abrupt increase in peak intensity in the neutron diffraction spectra signaled the onset of magnetic order below the Curie temperature. A magnetic phase diagram of rare earth metal terbium will be presented to 5.3 GPa and 90 K based on these studies.

  3. 46 CFR 154.1435 - Medical first aid guide.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Medical first aid guide. 154.1435 Section 154.1435 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY... Equipment § 154.1435 Medical first aid guide. Each vessel must have a copy of the IMO Medical First Aid...

  4. 46 CFR 154.1150 - Distribution of dry chemical.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Distribution of dry chemical. 154.1150 Section 154.1150... Firefighting System: Dry Chemical § 154.1150 Distribution of dry chemical. (a) All locations on the above deck... chemical hand hose lines; or (2) At least one dry chemical hand hose line and one dry chemical monitor. (b...

  5. 46 CFR 154.560 - Cargo hose: Prototype test.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Cargo hose: Prototype test. 154.560 Section 154.560... Hose § 154.560 Cargo hose: Prototype test. (a) Each cargo hose must be of a type that passes a prototype test at a pressure of at least five times its maximum working pressure at or below the minimum...

  6. 46 CFR 154.802 - Alternate pressure relief settings.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Alternate pressure relief settings. 154.802 Section 154... Equipment Cargo Vent Systems § 154.802 Alternate pressure relief settings. Cargo tanks with more than one relief valve setting must have one of the following arrangements: (a) Relief valves that: (1) Are set and...

  7. 46 CFR Appendix A to Part 154 - Equivalent Stress

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Equivalent Stress A Appendix A to Part 154 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS FOR SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES Pt. 154, App. A Appendix A to Part 154...

  8. 46 CFR Appendix B to Part 154 - Stress Analyses Definitions

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Stress Analyses Definitions B Appendix B to Part 154 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS FOR SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES Pt. 154, App. B Appendix B to Part 154...

  9. 46 CFR 154.1870 - Bow and stern loading.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Bow and stern loading. 154.1870 Section 154.1870... STANDARDS FOR SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES Operations § 154.1870 Bow and stern loading. (a) When the bow or stern loading piping is not in use, the master shall lock closed the shut-off...

  10. 21 CFR 133.154 - High-moisture jack cheese.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false High-moisture jack cheese. 133.154 Section 133.154... FOR HUMAN CONSUMPTION CHEESES AND RELATED CHEESE PRODUCTS Requirements for Specific Standardized Cheese and Related Products § 133.154 High-moisture jack cheese. High-moisture jack cheese conforms to...

  11. 46 CFR 154.412 - Cargo tank corrosion allowance.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Cargo tank corrosion allowance. 154.412 Section 154.412... Containment Systems § 154.412 Cargo tank corrosion allowance. A cargo tank must be designed with a corrosion...) carries a cargo that corrodes the tank material. Note: Corrosion allowance for independent tank type C is...

  12. 46 CFR 154.180 - Contiguous hull structure: Welding procedure.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Contiguous hull structure: Welding procedure. 154.180 Section 154.180 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS... Equipment Hull Structure § 154.180 Contiguous hull structure: Welding procedure. Welding procedure tests for...

  13. 46 CFR 154.546 - Excess flow valve: Closing flow.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Excess flow valve: Closing flow. 154.546 Section 154.546... and Process Piping Systems § 154.546 Excess flow valve: Closing flow. (a) The rated closing flow of vapor or liquid cargo for an excess flow valve must be specially approved by the Commandant (CG-522). (b...

  14. 46 CFR 154.9 - Issuance of documents.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Issuance of documents. 154.9 Section 154.9 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS FOR SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES General § 154.9 Issuance of documents. The...

  15. 46 CFR 154.188 - Membrane tank: Inner hull steel.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Membrane tank: Inner hull steel. 154.188 Section 154.188... Structure § 154.188 Membrane tank: Inner hull steel. For a vessel with membrane tanks, the inner hull... “Rules for Building and Classing Steel Vessels”, 1981. ...

  16. 46 CFR 154.1340 - Temperature measuring devices.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Temperature measuring devices. 154.1340 Section 154.1340... STANDARDS FOR SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES Design, Construction and Equipment Instrumentation § 154.1340 Temperature measuring devices. (a) Each cargo tank must have devices that measure the...

  17. 46 CFR 154.172 - Contiguous steel hull structure.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Contiguous steel hull structure. 154.172 Section 154.172... Structure § 154.172 Contiguous steel hull structure. (a) Except as allowed in paragraphs (b) and (c) of this... construction of the contiguous steel hull structure must meet the thickness and steel grade in Table 1 for the...

  18. 33 CFR 154.820 - Fire, explosion, and detonation protection.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Fire, explosion, and detonation protection. 154.820 Section 154.820 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND... Systems § 154.820 Fire, explosion, and detonation protection. (a) A vapor control system with a single...

  19. 46 CFR 154.528 - Piping joints: Flange type.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Piping joints: Flange type. 154.528 Section 154.528 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY... and Process Piping Systems § 154.528 Piping joints: Flange type. (a) A flange must be one of the...

  20. 46 CFR 154.526 - Piping joints: Flange connection.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Piping joints: Flange connection. 154.526 Section 154... Equipment Cargo and Process Piping Systems § 154.526 Piping joints: Flange connection. Flange connections for pipe joints must meet § 56.30-10 and § 56.50-105 (a)(4) and (b)(4) of this chapter. ...

  1. 46 CFR 154.195 - Aluminum cargo tank: Steel enclosure.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Aluminum cargo tank: Steel enclosure. 154.195 Section 154.195 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS... Equipment Hull Structure § 154.195 Aluminum cargo tank: Steel enclosure. (a) An aluminum cargo tank and its...

  2. 46 CFR 154.514 - Piping: Electrical bonding.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Piping: Electrical bonding. 154.514 Section 154.514... and Process Piping Systems § 154.514 Piping: Electrical bonding. (a) Cargo tanks or piping that are... side. (c) An electrical bond must be made by at least one of the following methods: (1) A metal bonding...

  3. 46 CFR 154.1205 - Mechanical ventilation system: Standards.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Mechanical ventilation system: Standards. 154.1205... Equipment Cargo Area: Mechanical Ventilation System § 154.1205 Mechanical ventilation system: Standards. (a) Each exhaust type mechanical ventilation system required under § 154.1200 (a) must have ducts for...

  4. 46 CFR 154.1702 - Materials of construction.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Materials of construction. 154.1702 Section 154.1702... § 154.1702 Materials of construction. When Table 4 references one of the following paragraphs in this section, the materials in the referenced paragraph must not be in components that contact the cargo liquid...

  5. 46 CFR 154.1145 - Dry chemical supply.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Dry chemical supply. 154.1145 Section 154.1145 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS... Firefighting System: Dry Chemical § 154.1145 Dry chemical supply. (a) A vessel with a cargo carrying capacity...

  6. Study of Silver Nanoparticles Sensitized Fluorescence and Second-Order Scattering of Terbium(III-Pefloxacin Mesylate Complex and Determination of Pefloxacin Mesylate

    Directory of Open Access Journals (Sweden)

    Aiyun Li

    2014-01-01

    Full Text Available α-Keto acid of pefloxacin mesylate (PFLX can form the complex with Terbium(III. The intramolecular energy from PFLX to Terbium(III ion takes place when excited, and thus Terbium(III excited state is formed and then emits the characteristic fluorescence of Terbium(III, locating at 490, 545, 580, and 620 nm. The second-order scattering (SOS peak at 545 nm also appears for the complex with the exciting wavelength of 273 nm. When the silver nanoparticles are added to the system, the luminescence intensity at 545 nm greatly increased. So, with the adding of nanoparticles to the Terbium(III-PFLX complex, not only is the intramolecular energy promoted but also the SOS intensity is enhanced. The experimental results show that it is the silver nanoparticles with certain size and certain concentration which can greatly enhance the fluorescence-SOS intensity, and the relative intensity at 545 nm is proportional to the amount of PFLX. Based on this phenomenon, a novel method for the determination of PFLX has been developed and applied to the determination of PFLX in capsule and serum samples.

  7. Influence of crystalline structure on the luminescence properties of terbium orthotantalates

    Energy Technology Data Exchange (ETDEWEB)

    Siqueira, Kisla P.F. [Departamento de Química, Universidade Federal de Ouro Preto, Campus Morro do Cruzeiro, ICEB II, Ouro Preto 35400-000, Minas Gerais (Brazil); Carmo, Alexandre P. [Instituto Federal Fluminense, Campus Cabo Frio, RJ 28909-971 (Brazil); Bell, Maria J.V. [Departamento de Física, Universidade Federal de Juiz de Fora, Juiz de Fora 36036-330, MG (Brazil); Dias, Anderson, E-mail: anderson_dias@iceb.ufop.br [Departamento de Química, Universidade Federal de Ouro Preto, Campus Morro do Cruzeiro, ICEB II, Ouro Preto 35400-000, Minas Gerais (Brazil)

    2013-06-15

    Terbium orthotantalate powders were produced with M-fergusonite type (I2/a) and M′-fergusonite type (P2/a) structures. The samples were studied by X-ray diffraction, Raman scattering, and photoluminescence measurements (emission and decay curves). The results showed that crystalline materials were obtained with all the 18 Raman-active modes predicted by group theory calculations. Also, it was observed through photoluminescence decay curves that the Tb{sup 3+} ions occupies only one-symmetry site in both crystallographic arrangements. Photoluminescence emission curves exhibited some variation in spectral shape, peak position, and relative intensity as a consequence of their different crystalline arrangements. The dominated emission of Tb{sup 3+} ({sup 5}D{sub 4}→{sup 7}F{sub 5}) is centered with a maximum intensity at 549.2 nm (M-type) and 543.0 nm (M′-type). Fluorescence lifetimes for M-TbTaO{sub 4} and M′-TbTaO{sub 4} were determined as 33.4 μs and 1.25 ms, respectively. M′-type materials seems to be the most suitable for luminescent devices and could be a potential green luminescent material due to the strongest emission if compared with the M-fergusonite type. -- Highlights: ► Terbium orthotantalates were prepared in two different crystalline structures: I2/a and P2/a. ► XRD and Raman scattering showed that the different space groups obtained were exhibited all the 18 Raman-active modes. ► PL decay curves that the Tb{sup 3+} ions occupies only one-symmetry site in both crystallographic arrangements. ► Dominated emission of Tb{sup 3+} ({sup 5}D{sub 4}→{sup 7}F{sub 5}) is centered with a maximum intensity at 549 nm (M-type) and 543 nm (M′-type). ► Fluorescence lifetimes for M-TbTaO{sub 4} and M′-TbTaO{sub 4} were determined as 33.4 μs and 1.25 ms, respectively.

  8. Laser control and temperature switching of luminescence intensity in photostable transparent film based on terbium(III) β-diketonate complex

    Science.gov (United States)

    Lapaev, Dmitry V.; Nikiforov, Victor G.; Safiullin, Georgy M.; Lobkov, Vladimir S.; Salikhov, Kev M.; Knyazev, Andrey A.; Galyametdinov, Yury G.

    2014-11-01

    The study of the terbium(III) and gadolinium(III) β-diketonate complexes by photoluminescence spectroscopy reveals considerable changes of the photophysical properties of the complexes under the UV laser irradiation. The measurements show the enhancement of the luminescence intensities in the vitrified transparent film of the terbium(III) complex as well as the gadolinium(III) complex under the 337 nm laser irradiation at room temperature. The irradiated film of the terbium(III) complex restores the initial photophysical properties after heating close to the melting temperature (∼353 K) and cooling. We observe no change of the luminescent properties of the irradiated film for months. These features can be used for the design of new lanthanide-based photostable systems with laser control of the luminescence intensity.

  9. Development of functionalized terbium fluorescent nanoparticles for antibody labeling and time-resolved fluoroimmunoassay application.

    Science.gov (United States)

    Ye, Zhiqiang; Tan, Mingqian; Wang, Guilan; Yuan, Jingli

    2005-01-15

    Silica-based functionalized terbium fluorescent nanoparticles were prepared, characterized and developed as a fluorescence probe for antibody labeling and time-resolved fluoroimmunoassay. The nanoparticles were prepared in a water-in-oil (W/O) microemulsion containing a strongly fluorescent Tb(3+) chelate, N,N,N(1),N(1)-[2,6-bis(3'-aminomethyl-1'-pyrazolyl)phenylpyridine] tetrakis(acetate)-Tb(3+) (BPTA-Tb(3+)), Triton X-100, octanol, and cyclohexane by controlling copolymerization of tetraethyl orthosilicate (TEOS) and 3-[2-(2-aminoethylamino)ethylamino]propyl-trimethoxysilane (AEPS) with ammonia water. The characterizations by transmission electron microscopy and fluorometric methods show that the nanoparticles are spherical and uniform in size, 45 +/- 3nm in diameter, strongly fluorescent with fluorescence quantum yield of 10% and a long fluorescence lifetime of 2.0ms. The amino groups directly introduced to the nanoparticle's surface by using AEPS in the preparation made the surface modification and bioconjugation of the nanoparticles easier. The nanoparticle-labeled anti-human alpha-fetoprotein antibody was prepared and used for time-resolved fluoroimmunoassay of alpha-fetoprotein (AFP) in human serum samples. The assay response is linear from 0.10ngml(-1) to about 100ngml(-1) with the detection limit of 0.10ngml(-1). The coefficient variations (CVs) of the method are less than 9.0%, and the recoveries are in the range of 84-98% for human serum sample measurements.

  10. Highly efficient precipitation of phosphoproteins using trivalent europium, terbium, and erbium ions

    Energy Technology Data Exchange (ETDEWEB)

    Guezel, Yueksel; Rainer, Matthias; Mirza, Munazza Raza; Bonn, Guenther K. [Leopold-Franzens University, Institute of Analytical Chemistry and Radiochemistry, Innsbruck (Austria)

    2012-05-15

    This study describes a highly efficient method for the selective precipitation of phosphoproteins by trivalent europium, terbium, and erbium metal ions. These metal cations belong to the group of lanthanides and are known to be hard acceptors with an overwhelming preference for oxygen-containing anions such as phosphates to which they form very tight ionic bonds. The method could be successfully applied to specifically precipitate phosphoproteins from complex samples including milk and egg white by forming solid metal-protein complexes. Owing to the low solubility product of the investigated lanthanide salts, the produced metal-protein complexes showed high stability. The protein pellets were extensively washed to remove nonphosphorylated proteins and contaminants. For the analysis of proteins the pellets were first dissolved in 30 % formic acid and subjected to matrix-assisted laser desorption/ionization-time of flight (MALDI-TOF) MS. For peptide mass-fingerprint analysis the precipitated phosphoproteins were enzymatically digested using microwave-assisted digestion. The method was found to be highly specific for the isolation and purification of phosphoproteins. Protein quantification was performed by colorimetric detection of total precipitated phosphoproteins and revealed more than 95 % protein recovery for each lanthanide salt. (orig.)

  11. A Terbium Sensitized Luminescence Method for the Assay of Flubiprofen in Pharmaceutical Formulations

    Directory of Open Access Journals (Sweden)

    Salma M.Z. Al-Kindy

    2014-12-01

    Full Text Available A sensitive time-resolved luminescence method for the determination of flubiprofen (FLP in methanol and in aqueous solution is described. The method is based on the luminescence sensitization of terbium (Tb3+ by the formation of a ternary complex with FLP in the presence of 4,7 diphenyl 1,10 phenanthroline (DPP as co-ligand, and Tween-20 as surfactant. The signal for Tb-FLP-DPP was monitored at λex  = 285 nm and λem  = 552 nm. Optimum conditions for the formation of the complex in an aqueous system were TRIS buffer, pH 8.0, DPP (2.5Å~10−7  M, Tween-20 (0.30% and 4Å~10-5  mol L-1  of Tb3+  which allowed the determination of 20–1000 ng mL-1  of FLP with a limit of detection (LOD of 10 ng mL-1 . The relative standard deviations of the method ranged between 0.6 and 1.4% indicating excellent reproducibility of the method. The proposed method was successfully applied for the assays of FLP in pharmaceutical formulations and spiked tap water samples with average recoveries of 87% – 95%.

  12. Sensitization effects of supramolecular assemblies on the luminescence of terbium-ion prulifloxacin complexes

    Energy Technology Data Exchange (ETDEWEB)

    Wang Hong; Yi Chongyue; Li Xue; Fang Fang [School of Chemistry and Chemical Engineering, Huazhong University of Science and Technology, Wuhan 430074 (China); Yang Yajiang, E-mail: yjyang@mail.hust.edu.c [School of Chemistry and Chemical Engineering, Huazhong University of Science and Technology, Wuhan 430074 (China)

    2011-04-15

    Luminescence enhancement of terbium-ion prulifloxacin complexes (Tb(III)-PUFX) in supramolecular hydrogels formed by assembly of 1,3:2,4-di-O-benzylidene-D-sorbitol (DBS) was investigated by steady-state fluorescence, varying temperature fluorescence and time-resolved fluorescence. The luminescence images show that Tb(III)-PUFX were dispersed in the DBS gels. The luminescence intensity of Tb(III)-PUFX in the DBS gels was significantly increased in comparison with that in corresponding aqueous solutions. The varying temperature fluorescent spectra show that the luminescence intensity of Tb(III)-PUFX decreased with an increase in the temperature. This implies that the luminescence enhancement of Tb(III)-PUFX is related to the dissociation and the formation of the DBS assemblies. Time-resolved fluorescence measurements show slower rotational motion in DBS gels in comparison with that in the corresponding aqueous solutions. This may be ascribed to a unique microstructure of three-dimensional network formed by DBC aggregates, resulting in deactivation of the nonradiative relaxation. The images of field emission scanning electron microscopy and polarized optical microscopy indicate that the morphology of the DBS assemblies was not influenced upon addition of Tb(III)-PUFX to the DBS gels.

  13. A Nanoscale Multiresponsive Luminescent Sensor Based on a Terbium(III) Metal-Organic Framework.

    Science.gov (United States)

    Dang, Song; Wang, Ting; Yi, Feiyan; Liu, Qinghui; Yang, Weiting; Sun, Zhong-Ming

    2015-08-01

    A nanoscale terbium-containing metal-organic framework (nTbL), with a layer-like structure and [H2 NMe2 ](+) cations located in the framework channels, was synthesized under hydrothermal conditions. The structure of the as-prepared sample was systematically confirmed by powder XRD and elemental analysis; the morphology was characterized by field-emission SEM and TEM. The photoluminescence studies revealed that rod-like nTbL exhibited bright-green emission, corresponding to (5)D4 →(7)FJ (J=6-3) transitions of the Tb(3+) ion under excitation. Further sensing measurements revealed that as-prepared nTbL could be utilized as a multiresponsive luminescent sensor, which showed significant and exclusive detection ability for Fe(3+) ions and phenylmethanol. These results highlight the practical applications of lanthanide-containing metal-organic frameworks as fluorescent probes. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Terbium-Doped VO2 Thin Films: Reduced Phase Transition Temperature and Largely Enhanced Luminous Transmittance.

    Science.gov (United States)

    Wang, Ning; Duchamp, Martial; Dunin-Borkowski, Rafal E; Liu, Shiyu; Zeng, XianTing; Cao, Xun; Long, Yi

    2016-01-26

    Vanadium dioxide (VO2) is a well-known thermochromic material with large IR modulating ability, promising for energy-saving smart windows. The main drawbacks of VO2 are its high phase transition temperature (τ(c) = 68°C), low luminous transmission (T(lum)), and weak solar modulating ability (ΔT(sol)). In this paper, the terbium cation (Tb(3+)) doping was first reported to reduce τ(c) and increase T(lum) of VO2 thin films. Compared with pristine VO2, 2 at. % doping level gives both enhanced T(lum) and ΔT(sol) from 45.8% to 54.0% and 7.7% to 8.3%, respectively. The T(lum) increases with continuous Tb(3+) doping and reaches 79.4% at 6 at. % doping level, representing ∼73.4% relative increment compared with pure VO2. This has surpassed the best reported doped VO2 thin films. The enhanced thermochromic properties is meaningful for smart window applications of VO2 materials.

  15. Luminescent investigations of terbium(III) biosorption as a surrogate for heavy metals and radionuclides.

    Science.gov (United States)

    Achyuthan, Komandoor E; Arango, Dulce C; Carles, Elizabeth L; Cutler, Christopher E; Meyer, Lauren A; Brozik, Susan M

    2009-07-01

    We describe a metal transport system for investigating the interfacial interactions between the anionic surface charge of a gram-negative bacterium (Escherichia coli) and a trivalent cationic metal, Tb3+. We believe this is the first description of the uptake kinetics, sub- and intracellular distribution, and temporal fate of Tb3+ ion in E. coli. We used the luminescence of the terbium-dipicolinic acid chelate to study metal ion transport. The bacteria had a high tolerance for the metal (IC(50) = 4 mM Tb3+). Metal ion transport was passive and metabolism independent. The uptake kinetics rapidly reached a maximum within 15 min, followed by a stasis for 60 min, and declining thereafter between 120 and 240 min, resulting in a biphasic curve. During this period, greater than one-third of the metal ion was sequestered within the cell. Our choice of a safe Biosafety Level I E. coli bacteria and the relatively non-toxic Tb3+ metal represents a model system for luminescent investigations of biosorption, for studying bacterial-water interfacial chemistry and for the bioremediation of heavy metals and radionuclides.

  16. 46 CFR 154.1854 - Methane (LNG) as fuel.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Methane (LNG) as fuel. 154.1854 Section 154.1854... fuel. (a) If methane (LNG) vapors are used as fuel in the main propulsion system of a vessel, the master shall ensure that the fuel oil fired pilot under § 154.705(c) is used when the vessel is on the...

  17. Construction of the energy matrix for complex atoms. Part VIII: Hyperfine structure HPC calculations for terbium atom

    Science.gov (United States)

    Elantkowska, Magdalena; Ruczkowski, Jarosław; Sikorski, Andrzej; Dembczyński, Jerzy

    2017-11-01

    A parametric analysis of the hyperfine structure (hfs) for the even parity configurations of atomic terbium (Tb I) is presented in this work. We introduce the complete set of 4fN-core states in our high-performance computing (HPC) calculations. For calculations of the huge hyperfine structure matrix, requiring approximately 5000 hours when run on a single CPU, we propose the methods utilizing a personal computer cluster or, alternatively a cluster of Microsoft Azure virtual machines (VM). These methods give a factor 12 performance boost, enabling the calculations to complete in an acceptable time.

  18. Platelet-derived or soluble CD154 induces vascularized allograft rejection independent of cell-bound CD154

    OpenAIRE

    Xu, He; Zhang, Xiaojie; Mannon, Roslyn B.; Kirk, Allan D.

    2006-01-01

    CD154 is a cell surface molecule expressed on activated T cells that binds to CD40, an activating molecule on APCs. Its blockade has been shown to prevent allograft rejection, presumably by interrupting interactions between T cells and APCs. It is known that activated human platelets express and shed CD154 and can induce APC activation and other immune processes in vitro. Here we show that platelet-derived CD154 is sufficient to initiate cardiac allograft rejection independent of any cellular...

  19. Spectrofluorimetric determination of human serum albumin using terbium-danofloxacin probe.

    Science.gov (United States)

    Ramezani, Amir M; Manzoori, Jamshid L; Amjadi, Mohammad; Jouyban, Abolghasem

    2012-01-01

    A spectrofluorimetric method is proposed for the determination of human serum albumin (HSA) and bovine serum albumin (BSA) using terbium-danofloxacin (Tb(3+)-Dano) as a fluorescent probe. These proteins remarkably enhance the fluorescence intensity of the Tb(3+)-Dano complex at 545 nm, and the enhanced fluorescence intensity of Tb(3+)-Dano is proportional to the concentration of proteins (HSA and BSA). Optimum conditions for the determination of HSA were investigated and found that the maximum response was observed at: pH = 7.8, [Tb(3+)] = 8.5 × 10(-5) mol L(-1), [Dano] = 1.5 × 10(-4) mol L(-1). The calibration graphs for standard solutions of BSA, HSA, and plasma samples of HSA were linear in the range of 0.2 × 10(-6) - 1.3 × 10(-6) mol L(-1), 0.2 × 10(-6) - 1.4 × 10(-6) mol L(-1), and 0.2 × 10(-6) - 1 × 10(-6) mol L(-1), respectively. The detection limits (S/N = 3) for BSA, HSA, and plasma sample of HSA were 8.7 × 10(-8) mol L(-1), 6.2 × 10(-8) mol L(-1), and 8.1 × 10(-8) mol L(-1), respectively. The applicability of the method was checked using a number of real biological plasma samples and was compared with the UV spectrometric reference method. The results was showed that the method could be regarded as a simple, practical, and sensitive alternative method for determination of albumin in biological samples.

  20. Spectrofluorimetric Determination of Human Serum Albumin Using Terbium-Danofloxacin Probe

    Directory of Open Access Journals (Sweden)

    Amir M. Ramezani

    2012-01-01

    Full Text Available A spectrofluorimetric method is proposed for the determination of human serum albumin (HSA and bovine serum albumin (BSA using terbium-danofloxacin (Tb3+-Dano as a fluorescent probe. These proteins remarkably enhance the fluorescence intensity of the Tb3+-Dano complex at 545 nm, and the enhanced fluorescence intensity of Tb3+-Dano is proportional to the concentration of proteins (HSA and BSA. Optimum conditions for the determination of HSA were investigated and found that the maximum response was observed at: pH=7.8, [Tb3+] =8.5×10−5 mol L−1, [Dano] =1.5×10−4 mol L−1. The calibration graphs for standard solutions of BSA, HSA, and plasma samples of HSA were linear in the range of 0.2×10−6−1.3×10−6 mol L−1, 0.2×10−6−1.4×10−6 mol L−1, and 0.2×10−6−1×10−6 mol L−1, respectively. The detection limits (S/N = 3 for BSA, HSA, and plasma sample of HSA were 8.7×10−8 mol L−1, 6.2×10−8 mol L−1, and 8.1×10−8 mol L−1, respectively. The applicability of the method was checked using a number of real biological plasma samples and was compared with the UV spectrometric reference method. The results was showed that the method could be regarded as a simple, practical, and sensitive alternative method for determination of albumin in biological samples.

  1. Determination of flavonoids in pharmaceutical preparations using Terbium sensitized fluorescence method

    Directory of Open Access Journals (Sweden)

    M Shaghaghi

    2009-12-01

    Full Text Available "nBackground and the Purpose of the Study: The aim of this study was development and validation of a simple, rapid and sensitive spectrofluorimetric method for determination of total flavonoids in two topical formulations of Calendula officinalis, Ziziphus Spina-christi and an oral drop of Hypiran perforatum L. The proposed method is based on the formation of terbium (Tb3+ "n-flavonoids (quercetin as a reference standard complex at pH 7.0, which has fluorescence intensely with maximum emission at 545 nm when excited at 310 nm. "nMethod "n: For ointments masses of topical formulations were weighed and added to ethanol-aqueous buffer (pH 10.0 and the resulting mixtures were shaken and then two phases were separated by centrifugation. Aqueous phases were filtered and then diluted with water. For Hypiran drops an appropriate portion was diluted with ethanol and then aliquots of sample or standard solutions were determined according to the experimental procedure. "nResults "n: Under the optimum conditions, total concentrations of flavonoids (as quercetin equivalent in three tested formulations were found to be 0.204 mg/g (for Dermatin cream, 0.476 mg/g (for Calendula ointment and 13.50 μg/ml (for Hypiran drops. Analytical recoveries from samples spiked with different amounts of quercetin were 96.1-104.0 % with RSD % of less than 3.5. Conclusion : The proposed method which requires a simple dissolution step without any matrix interferences provided high sensitivity and selectivity and was easily applied to determine total flavonoids in real samples of three investigated formulations with excellent reproducibility.

  2. TOF SIMS analysis and generation of white photoluminescence from strontium silicate codoped with europium and terbium

    Energy Technology Data Exchange (ETDEWEB)

    Tshabalala, Modiehi A.; Swart, Hendrik C.; Ntwaeaborwa, Odireleng M., E-mail: ntwaeab@ufs.ac.za [Department of Physics, University of the Free State, P.O Box 339, Bloemfontein 9300 South Africa (South Africa)

    2014-03-15

    White light emitting terbium (Tb{sup 3+}) and europium (Eu{sup 3+}) codoped strontium silicate (Sr{sub 2}SiO{sub 4}) phosphors were prepared by a solid state reaction process. The structure, particle morphology, chemical composition, ion distribution, photoluminescence (PL), and decay characteristics of the phosphors were analyzed by x-ray diffraction (XRD), scanning electron microscopy (SEM), time-of-flight secondary ion mass spectrometry (TOF-SIMS), and PL spectroscopy, respectively. The XRD data showed that our Sr{sub 2}SiO{sub 4} composed of two phases, namely, β-Sr{sub 2}SiO{sub 4} and α′-Sr{sub 2}SiO{sub 4}, and the α′-Sr{sub 2}SiO{sub 4} phase was more prominent than the β-Sr{sub 2}SiO{sub 4} phase. The SEM micrographs showed that the particles were agglomerated together and they did not have definite shapes. All ions (i.e., negative and positive) present in our materials were identified by TOF-SIMS. In addition, the chemical imaging performed with the TOF-SIMS demonstrated how the individual ions including the dopants (Eu{sup 3+} and Tb{sup 3+}) were distributed in the host lattice. White photoluminescence was observed when the Sr{sub 2}SiO{sub 4}:Tb{sup 3+}, Eu{sup 3+} phosphor was excited at 239 nm using a monochromatized xenon lamp as the excitation source. The phosphor exhibited fast decay lifetimes implying that it is not a good candidate for long afterglow applications.

  3. Synthesis, crystal structure and photophysical properties of europium(III) and terbium(III) complexes with pyridine-2,6-dicarboxamide

    NARCIS (Netherlands)

    Tanase, S.; Gallego, P.M.; Gelder, R. de; Fu, W.T.

    2007-01-01

    The reactions of pyridine-2,6-dicarboxamide with europium(III) and terbium(III) triflates led to the formation of mononuclear complexes of formula [Ln(pcam)(3)](CF3SO3)(3) (Ln = Eu 1, Tb 2; pcam stands for pyridine-2,6-dicarboxamide). From single-crystal X-ray diffraction analysis, the complexes

  4. The role of CD154 in haematopoietic development

    NARCIS (Netherlands)

    Seijkens, Tom; Engel, David; Tjwa, Marc; Lutgens, Esther

    2010-01-01

    CD154 (CD40 ligand, CD40L, gp139) is a co-stimulatory molecule of the tumour necrosis factor (TNF) family. CD154 was originally discovered on T-cells, and was found to be involved in many immune responses including B-cell activation, isotype switching, and germinal centre formation. The expression

  5. 42 CFR 483.154 - Nurse aide competency evaluation.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 5 2010-10-01 2010-10-01 false Nurse aide competency evaluation. 483.154 Section... Requirements That Must Be Met by States and State Agencies: Nurse Aide Training and Competency Evaluation, and Paid Feeding Assistants § 483.154 Nurse aide competency evaluation. (a) Notification to Individual. The...

  6. 76 FR 2726 - Withdrawal of Regulatory Guide 1.154

    Science.gov (United States)

    2011-01-14

    ... Regulatory Guide 1.154, ``Format and Content of Plant-Specific Pressurized Thermal Shock Safety Analysis... Regulatory Guide (RG) 1.154, ``Format and Content of Plant-Specific Pressurized Thermal Shock Safety Analysis... format and content acceptable to the NRC staff for plant-specific pressurized thermal shock (PTS) safety...

  7. 21 CFR 520.154 - Bacitracin oral dosage forms.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Bacitracin oral dosage forms. 520.154 Section 520...) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS ORAL DOSAGE FORM NEW ANIMAL DRUGS § 520.154 Bacitracin oral dosage forms. ...

  8. 46 CFR 154.1808 - Limitations in the endorsement.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Limitations in the endorsement. 154.1808 Section 154... Limitations in the endorsement. No person may operate a vessel unless that person complies with all limitations in the endorsement on the vessel's Certificate of Inspection or Certificate of Compliance. ...

  9. 32 CFR Appendix G to Part 154 - [Reserved

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 1 2010-07-01 2010-07-01 false G Appendix G to Part 154 National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE SECURITY DEPARTMENT OF DEFENSE PERSONNEL SECURITY PROGRAM REGULATION Appendix G to Part 154 ...

  10. 46 CFR 154.1735 - Methyl acetylene-propadiene mixture.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Methyl acetylene-propadiene mixture. 154.1735 Section... CARGOES SAFETY STANDARDS FOR SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES Special Design and Operating Requirements § 154.1735 Methyl acetylene-propadiene mixture. (a) The composition of the methyl...

  11. 43 CFR 15.4 - Refuse and polluting substances.

    Science.gov (United States)

    2010-10-01

    ... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Refuse and polluting substances. 15.4... § 15.4 Refuse and polluting substances. No person shall dump or deposit in or on the waters of this..., boxes, cans, dirt, rubbish, waste garbage, refuse or other debris or polluting substance. ...

  12. 49 CFR 572.154 - Thorax assembly and test procedure.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 7 2010-10-01 2010-10-01 false Thorax assembly and test procedure. 572.154... 12-Month-Old Infant, Alpha Version § 572.154 Thorax assembly and test procedure. (a) Thorax Assembly (refer to § 572.150(a)(1)(iv)) . The thorax consists of the part of the torso assembly shown in drawing...

  13. 33 CFR 154.810 - Vapor line connections.

    Science.gov (United States)

    2010-07-01

    ...) POLLUTION FACILITIES TRANSFERRING OIL OR HAZARDOUS MATERIAL IN BULK Vapor Control Systems § 154.810 Vapor... the OCIMF International Safety Guide for Oil Tankers and Terminals (incorporated by reference; see § 154.106). (h) A vapor collection system fitted with an enriching system that operates at a positive...

  14. 46 CFR 154.174 - Transverse contiguous hull structure.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Transverse contiguous hull structure. 154.174 Section... Equipment Hull Structure § 154.174 Transverse contiguous hull structure. (a) The transverse contiguous hull structure of a vessel having cargo containment systems without secondary barriers must meet the standards of...

  15. 46 CFR 154.176 - Longitudinal contiguous hull structure.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Longitudinal contiguous hull structure. 154.176 Section... Equipment Hull Structure § 154.176 Longitudinal contiguous hull structure. (a) The longitudinal contiguous hull structure of a vessel having cargo containment systems without secondary barriers must meet the...

  16. 46 CFR 154.1200 - Mechanical ventilation system: General.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Mechanical ventilation system: General. 154.1200 Section... Equipment Cargo Area: Mechanical Ventilation System § 154.1200 Mechanical ventilation system: General. (a... cargo handling equipment must have a fixed, exhaust-type mechanical ventilation system. (b) The...

  17. 33 CFR 154.530 - Small discharge containment.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Small discharge containment. 154.530 Section 154.530 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY... serves one or more hoses of 6-inch inside diameter or smaller, or loading arms of 6-inch nominal pipe...

  18. 21 CFR 520.154a - Soluble bacitracin methylene disalicylate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Soluble bacitracin methylene disalicylate. 520.154a Section 520.154a Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN... Soluble bacitracin methylene disalicylate. (a) Specifications. Each pound of soluble powder contains the...

  19. 18 CFR 154.312 - Composition of Statements.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Composition of Statements. 154.312 Section 154.312 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY... this chapter) with subtotals by functional classifications, e.g., Intangible Plant, Manufactured Gas...

  20. 24 CFR 982.154 - ACC reserve account.

    Science.gov (United States)

    2010-04-01

    ... 24 Housing and Urban Development 4 2010-04-01 2010-04-01 false ACC reserve account. 982.154... and PHA Administration of Program § 982.154 ACC reserve account. (a) HUD may establish and maintain an unfunded reserve account for the PHA program from available budget authority under the consolidated ACC...

  1. 29 CFR 1926.154 - Temporary heating devices.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 8 2010-07-01 2010-07-01 false Temporary heating devices. 1926.154 Section 1926.154 Labor... Temporary heating devices. (a) Ventilation. (1) Fresh air shall be supplied in sufficient quantities to... heating devices shall be installed to provide clearance to combustible material not less than the amount...

  2. Zinc sulfide and terbium-doped zinc sulfide films grown by traveling wave reactor atomic layer epitaxy

    CERN Document Server

    Yun, S J; Nam, K S

    1998-01-01

    Zinc sulfide (ZnS) and terbium-doped ZnS (ZnS:Tb) thin films were grown by traveling wave reactor atomic layer epitaxy (ALE). In the present work, ZnCl sub 2 , H sub 2 S, and tris (2,2,6,6-tetramethyl-3,5-heptandionato) terbium (Tb(tmhd) sub 3) were used as the precursors. The dependence of crystallinity and Cl content of ZnS films was investigated on the growth temperature. ZnS and ZnS:Tb films grown at temperatures ranging from 400 to 500 .deg. C showed a hexagonal-2H crystalline structure. The crystallinity of ZnS film was greatly enhanced as the temperature increased. At growth temperatures higher than 450.deg.C, the films showed preferred orientation with mainly (002) diffraction peak. The Cl content decreased from approximately 9 to 1 at.% with the increase in growth temperature from 400 to 500 .deg. C. The segregation of Cl near the surface region and the incorporation of O from Tb(tmhd) sub 3 during ALE process were also observed using Auger electron spectroscopy. The ALE-grown ZnS and ZnS:Tb films re...

  3. Commercializing potassium terbium fluoride, KTF (KTb3F10) faraday crystals for high laser power optical isolator applications

    Science.gov (United States)

    Schlichting, Wolfgang; Stevens, Kevin; Foundos, Greg; Payne, Alexis

    2017-10-01

    Many scientific lasers and increasingly industrial laser systems operate in power regime, require high-performance optical isolators to prevent disruptive light feedback into the laser cavity. The optically active Faraday material is the key optical element inside the isolator. SYNOPTICS has been supplying the laser market with Terbium Gallium Garnet (TGG - Tb3Ga5O12) for many years. It is the most commonly used material for the 650-1100nm range and the key advantages for TGG include its cubic crystal structure for alignment free processing, little to no intrinsic birefringence, and ease of manufacture. However, for high-power laser applications TGG is limited by its absorption at 1064nm and its thermo-optic coefficient, dn/dT. Specifically, thermal lensing and depolarization effects become a limiting factor at high laser powers. While TGG absorption has improved significantly over the past few years, there is an intrinsic limit. Now, SYNOPTICS is commercializing the enhanced new crystal Potassium Terbium Fluoride KTF (KTb3F10) that exhibits much smaller nonlinear refractive index and thermo-optic coefficients, and still exhibits a Verdet constant near that of TGG. This cubic crystal has relatively low absorption and thermo-optic coefficients. It is now fully characterized and available for select production orders. At OPTIFAB in October 2017 we present recent results comparing the performance of KTF to TGG in optical isolators and show SYNOPTICS advances in large volume crystal growth and the production ramp up.

  4. Preparation and photoluminescence enhancement in terbium(III ternary complexes with β-diketone and monodentate auxiliary ligands

    Directory of Open Access Journals (Sweden)

    Devender Singh

    2016-12-01

    Full Text Available A series of new solid ternary complexes of terbium(III ion based on β-diketone ligand acetylacetone (acac and monodentate auxiliary ligands (aqua/urea/triphenylphosphineoxide/pyridine-N-oxide had been prepared. The structural characterizations of synthesized ternary compounds were studied by means of elemental analysis, infrared (IR, and proton nuclear magnetic resonance (NMR spectral techniques. The optical characteristics were investigated with absorption as well as photoluminescence spectroscopy. Thermal behavior of compounds was examined by TGA/DTA analysis and all metal complexes were found to have good thermal stability. The luminescence decay time of complexes were also calculated by monitoring at emission wavelength corresponding to 5D4 → 7F5 transition. A comparative inspection of the luminescent behavior of prepared ternary compounds was performed in order to determine the function of auxiliary ligands in the enhancement of luminescence intensity produced by central terbium(III ion. The color coordinates values suggested that compounds showed bright green emission in visible region in electromagnetic spectrum. Complexes producing green light could play a significant role in the fabrication of efficient light conversion molecular devices for display purposes and lightning systems.

  5. CD154 Induces Matrix Metalloproteinase-9 Secretion in Human Podocytes.

    Science.gov (United States)

    Rigothier, Claire; Daculsi, Richard; Lepreux, Sébastien; Auguste, Patrick; Villeneuve, Julien; Dewitte, Antoine; Doudnikoff, Evelyne; Saleem, Moin; Bourget, Chantal; Combe, Christian; Ripoche, Jean

    2016-12-01

    Matrix remodeling is a key feature of glomerulosclerosis secondary to diabetes or hypertension. Podocytes contribute to glomerular basement membrane (GBM) turnover by producing matrix components and matrix remodelling enzymes, including matrix metalloproteinases (MMPs). The CD40/CD154 signaling pathway modulates matrix remodeling through the synthesis of MMPs and tissue inhibitors of MMPs. Platelets are a primary blood reservoir of CD154. Here we studied, the impact of the CD154/CD40 pathway on MMP-9 expression by cultured human podocytes. The role of CD40/CD154 was evaluated upon exposure of podocytes to recombinant human CD154 (rhCD154) or activated platelet supernatants from healthy human subjects. We first showed by protein and mRNA expression that CD40 was synthesized by podocytes and detectable on kidney tissue sections. CD40 expression was acquired during podocyte differentiation and enhanced upon exposure to rhCD154. In podocytes, rhCD154 induced an increase of MMP-9 production as shown by RT-PCR, Western blot and and gelatin zymography. Activated platelet supernatants induced MMP-9 mRNA synthesis in podocytes, an effect reduced by anti-CD40 antibody. Our results underscore a potential role for platelets through the CD40/CD154 signaling pathway in the control of GBM synthesis and degradation, via its regulatory role on MMP-9 production. CD154 secretion by activated platelets may contribute to GBM alterations in proteinuric nephropathies. J. Cell. Biochem. 117: 2737-2747, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  6. Synthesis and luminescent study of Ce{sup 3+}-doped terbium-yttrium aluminum garnet

    Energy Technology Data Exchange (ETDEWEB)

    Dotsenko, V.P., E-mail: ssclab@ukr.net [A.V. Bogatsky Physico-Chemical Institute, National Academy of Sciences of Ukraine, Lustdorfskaya doroga 86, 65080 Odessa (Ukraine); Berezovskaya, I.V.; Zubar, E.V.; Efryushina, N.P. [A.V. Bogatsky Physico-Chemical Institute, National Academy of Sciences of Ukraine, Lustdorfskaya doroga 86, 65080 Odessa (Ukraine); Poletaev, N.I.; Doroshenko, Yu.A. [Institute of Combustion and Advanced Technologies, Mechnikov Odessa National University, Dvoryanskaya 2, 65082 Odessa (Ukraine); Stryganyuk, G.B. [Ivan Franko National University of Lviv, Kirilo i Mefodii 8, 79005 Lviv (Ukraine); HASYLAB at DESY, Notkestrasse 85, 22607 Hamburg (Germany); Voloshinovskii, A.S. [Ivan Franko National University of Lviv, Kirilo i Mefodii 8, 79005 Lviv (Ukraine)

    2013-02-15

    Highlights: Black-Right-Pointing-Pointer Ce{sup 3+}-doped garnets (TYAG) were prepared using nanostructured reagents. Black-Right-Pointing-Pointer The Ce{sup 3+} ions cause a very efficient yellow emission of the samples. Black-Right-Pointing-Pointer The reasons for the long wavelength position of this emission are discussed. Black-Right-Pointing-Pointer Contribution from Al atoms to the conduction band of TYAG is quite essential. - Abstract: Terbium-yttrium aluminum garnets (TYAG) doped with Ce{sup 3+} ions have been prepared by solid state reactions between nanostructured oxides of aluminum and rare earths. The luminescent properties of Ce{sup 3+} ions in (Tb{sub 0.8}Y{sub 0.2}){sub 3(1-x)}Ce{sub 3x}Al{sub 5}O{sub 12} (x = 0.03) have been studied upon excitation in the 2-20 eV region. The substitution of Tb{sup 3+} for Y{sup 3+} in the garnet structure results in broadening the emission band and shifting its maximum towards the longer wavelengths. It was found that in addition to the 4f{sup n} {yields} 4f{sup n-1}5d excitation bands of Ce{sup 3+} and Tb{sup 3+} ions, the excitation spectra for the Ce{sup 3+} emission contain broad bands at 6.73 and {approx}9.5 eV. These bands are attributed to the Ce{sup 3+}-bound exciton formation and O 2p {yields} Al 3s, 3p transitions, respectively. In contrast to the predictions based on the results of electronic structure calculations on Y{sub 3}Al{sub 5}O{sub 12} and Tb{sub 4}Al{sub 2}O{sub 9}, the threshold of interband transitions in TYAG is at high energies ( Greater-Than-Or-Slanted-Equal-To 7.3 eV), and contributions from Al{sub tetr} and Al{sub oct} atoms to the conduction-band density of states are evaluated as quite essential.

  7. Structural variations in terbium(III) complexes with 1,3-adamantanedicarboxylate and diverse co-ligands

    Energy Technology Data Exchange (ETDEWEB)

    Thuéry, Pierre, E-mail: pierre.thuery@cea.fr

    2015-07-15

    Terbium nitrate was reacted with 1,3-adamantanedicarboxylic acid (LH{sub 2}) under solvo-hydrothermal conditions with either N,N-dimethylformamide (DMF) or N,N-dimethylacetamide (DMA) as organic solvents. Hydrolysation of the latter co-solvents resulted in the formation of formate or acetate ions, which are present as co-ligands in the 1D coordination polymer [Tb(L)(HCOO)(H{sub 2}O){sub 2}] (1) and the 2D assembly [Tb(L)(CH{sub 3}COO)(H{sub 2}O)] (2). The increase in dimensionality in the latter arises from the higher connectivity provided by acetate versus formate, the L{sup 2−} ligand being bis-chelating in both cases. The complex [Tb{sub 2}(L){sub 3}(H{sub 2}O){sub 5}][Tb{sub 2}(L){sub 3}(H{sub 2}O){sub 4}]·3H{sub 2}O (3), another 1D species, crystallizes alongside crystals of 2. Further addition of cucurbit[6]uril (CB6), with DMF as co-solvent, gave the two complexes [Tb{sub 2}(L){sub 2}(CB6)(H{sub 2}O){sub 6}](NO{sub 3}){sub 2}·6H{sub 2}O (4) and [H{sub 2}NMe{sub 2}]{sub 2}[Tb(L)(HCOO){sub 2}]{sub 2}·CB6·3H{sub 2}O (5). Complex 4 crystallizes as a 3D framework in which Tb(L){sup +} chains are connected by tetradentate CB6 molecules, while 5 unites a carboxylate-bridged anionic 2D planar assembly and layers of CB6 molecules with counter-cations held at both portals. - Graphical abstract: One- to three-dimensional assemblies are formed in terbium(III) complexes with 1,3-adamantanedicarboxylate obtained under solvo-hydrothermal conditions, these species including formate or acetate co-ligands formed in situ, or additional cucurbit[6]uril molecules. - Highlights: • We report structures of terbium(III) complexes with 1,3-adamantanedicarboxylate. • Solvents able to generate co-ligands or counter-ions in situ have been used. • A 3D species including additional cucurbituril molecules is decribed. • One species displays an alternation of metal–organic and organic sheets.

  8. 46 CFR 154.1872 - Cargo emergency jettisoning.

    Science.gov (United States)

    2010-10-01

    ... jettisoning. (a) The master shall ensure that emergency jettisoning piping under § 154.356, except bow and stern loading and discharging piping, is only used when an emergency exists. (b) Emergency jettisoning...

  9. Complete Stokes polarimetry of magneto-optical Faraday effect in a terbium gallium garnet crystal at cryogenic temperatures.

    Science.gov (United States)

    Majeed, Hassaan; Shaheen, Amrozia; Anwar, Muhammad Sabieh

    2013-10-21

    We report the complete determination of the polarization changes caused in linearly polarized incident light due to propagation in a magneto-optically active terbium gallium garnet (TGG) single crystal, at temperatures ranging from 6.3 to 300 K. A 28-fold increase in the Verdet constant of the TGG crystal is seen as its temperature decreases to 6.3 K. In contrast with polarimetry of light emerging from a Faraday material at room temperature, polarimetry at cryogenic temperatures cannot be carried out using the conventional fixed polarizer-analyzer technique because the assumption that ellipticity is negligible becomes increasingly invalid as temperature is lowered. It is shown that complete determination of light polarization in such a case requires the determination of its Stokes parameters, otherwise inaccurate measurements will result with negative implications for practical devices.

  10. Development of Optical Isolators for Visible Light Using Terbium Aluminum Garnet (Tb3Al5O12) Single Crystals

    Science.gov (United States)

    Geho, Mikio; Takagi, Takashi; Chiku, Shinichiro; Fujii, Takashi

    2005-07-01

    We have recently reported the successful growth of incongruently melting terbium aluminum garnet (Tb3Al5O12; TAG) single crystals by the hybrid laser FZ (floating zone) method. Optical property evaluations confirmed a high transmittance and a larger Verdet constant than conventional Tb3Ga5O12 (TGG) crystals and/or Faraday glasses. In this study, we attempted to design, fabricate, and evaluate optical isolators in visible light through near-infrared (NIR) regions using TAG crystals. A finite element method (FEM) simulation of possible models led us to the preferable one based on a radially magnetized magnet. To realize this, we employed a pseudo-radially magnetized magnet. The target wavelengths of the prototype device were 408, 808, and 1064 nm. The typical extinction ratio was more than 30 dB and the insertion loss was less than 0.3 dB for AR-coated devices.

  11. A hydrometallurgical process for the recovery of terbium from fluorescent lamps: Experimental design, optimization of acid leaching process and process analysis.

    Science.gov (United States)

    Innocenzi, Valentina; Ippolito, Nicolò Maria; De Michelis, Ida; Medici, Franco; Vegliò, Francesco

    2016-12-15

    Terbium and rare earths recovery from fluorescent powders of exhausted lamps by acid leaching with hydrochloric acid was the objective of this study. In order to investigate the factors affecting leaching a series of experiments was performed in according to a full factorial plan with four variables and two levels (4 2 ). The factors studied were temperature, concentration of acid, pulp density and leaching time. Experimental conditions of terbium dissolution were optimized by statistical analysis. The results showed that temperature and pulp density were significant with a positive and negative effect, respectively. The empirical mathematical model deducted by experimental data demonstrated that terbium content was completely dissolved under the following conditions: 90 °C, 2 M hydrochloric acid and 5% of pulp density; while when the pulp density was 15% an extraction of 83% could be obtained at 90 °C and 5 M hydrochloric acid. Finally a flow sheet for the recovery of rare earth elements was proposed. The process was tested and simulated by commercial software for the chemical processes. The mass balance of the process was calculated: from 1 ton of initial powder it was possible to obtain around 160 kg of a concentrate of rare earths having a purity of 99%. The main rare earths elements in the final product was yttrium oxide (86.43%) following by cerium oxide (4.11%), lanthanum oxide (3.18%), europium oxide (3.08%) and terbium oxide (2.20%). The estimated total recovery of the rare earths elements was around 70% for yttrium and europium and 80% for the other rare earths. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. Reduced Lentivirus Susceptibility in Sheep with TMEM154 Mutations

    Science.gov (United States)

    Heaton, Michael P.; Clawson, Michael L.; Chitko-Mckown, Carol G.; Leymaster, Kreg A.; Smith, Timothy P. L.; Harhay, Gregory P.; White, Stephen N.; Herrmann-Hoesing, Lynn M.; Mousel, Michelle R.; Lewis, Gregory S.; Kalbfleisch, Theodore S.; Keen, James E.; Laegreid, William W.

    2012-01-01

    Visna/Maedi, or ovine progressive pneumonia (OPP) as it is known in the United States, is an incurable slow-acting disease of sheep caused by persistent lentivirus infection. This disease affects multiple tissues, including those of the respiratory and central nervous systems. Our aim was to identify ovine genetic risk factors for lentivirus infection. Sixty-nine matched pairs of infected cases and uninfected controls were identified among 736 naturally exposed sheep older than five years of age. These pairs were used in a genome-wide association study with 50,614 markers. A single SNP was identified in the ovine transmembrane protein (TMEM154) that exceeded genome-wide significance (unadjusted p-value 3×10−9). Sanger sequencing of the ovine TMEM154 coding region identified six missense and two frameshift deletion mutations in the predicted signal peptide and extracellular domain. Two TMEM154 haplotypes encoding glutamate (E) at position 35 were associated with infection while a third haplotype with lysine (K) at position 35 was not. Haplotypes encoding full-length E35 isoforms were analyzed together as genetic risk factors in a multi-breed, matched case-control design, with 61 pairs of 4-year-old ewes. The odds of infection for ewes with one copy of a full-length TMEM154 E35 allele were 28 times greater than the odds for those without (p-valuesheep from Nebraska, Idaho, and Iowa, the relative risk of infection was 2.85 times greater for sheep with a full-length TMEM154 E35 allele (p-valuesheep were homozygous for TMEM154 deletion mutations and remained uninfected despite a lifetime of significant exposure. Together, these findings indicate that TMEM154 may play a central role in ovine lentivirus infection and removing sheep with the most susceptible genotypes may help eradicate OPP and protect flocks from reinfection. PMID:22291605

  13. Investigation of the luminescent properties of terbium-anthranilate complexes and application to the determination of anthranilic acid derivatives in aqueous solutions

    Energy Technology Data Exchange (ETDEWEB)

    Arnaud, N.; Georges, J

    2003-01-10

    The luminescent properties of terbium complexes with furosemide (FR), flufenamic (FF) acid, tolfenamic (TF) acid and mefenamic (MF) acid have been investigated in aqueous solutions. For all four compounds, complexation occurs when the carboxylic acid of the aminobenzoic group is dissociated and is greatly favoured in the presence of trioctylphosphine oxide as co-ligand and Triton X-100 as surfactant. Under optimum conditions, luminescence of the lanthanide ion is efficiently sensitised and the lifetime of the {sup 5}D{sub 4} resonance level of terbium in the complex is ranging between 1 and 1.9 ms, against 0.4 ms for the aqua ion. The sensitivity of the method for the determination of anthranilic acid derivatives is improved by one to two orders of magnitude with respect to that achieved using native fluorescence or terbium-sensitised luminescence in methanol. The limits of detection are 2x10{sup -10}, 5x10{sup -10} and 2x10{sup -9} mol l{sup -1} for flufenamic acid, furosemide and tolfenamic acid, and mefenamic acid, respectively, with within-run RSD values of less than 1%. The method has been applied to the determination of flufenamic acid in spiked calf sera with and without sample pretreatment. Depending on the method and the analyte concentration, the recovery was ranging between 83 and 113% and the lowest concentration attainable in serum samples was close to 1x10{sup -7} mol l{sup -1}.

  14. Posttranscriptional Regulation in Lymphocytes: The case of CD154

    Science.gov (United States)

    Vavassori, Stefano; Covey, Lori R.

    2010-01-01

    The control of mRNA decay is emerging as an important control point and a major contributor to gene expression in both immune and non-immune cells. The identification of protein factors and cis-acting elements responsible for transcript degradation has illuminated a comprehensive picture of precisely orchestrated events required to both regulate and establish the decay process. One gene that is highly regulated at the posttranscriptional level is CD40 ligand (CD154 or CD40L). CD154 on CD4+ T cells is tightly controlled by an interacting network of transcriptional and posttranscriptional processes that result in precise surface levels of protein throughout an extended time course of antigen stimulation. The activation-induced stabilization of the CD154 transcript by a polypyrimidine tract-binding protein (PTB)-complex is a key event that corresponds to the temporal expression of CD154. In this review, we discuss known and potential roles of major mRNA decay pathways in lymphocytes and focus on the unique posttranscriptional mechanisms leading to CD154 expression by activated CD4+ T cells. PMID:19395873

  15. CD154: the atherosclerotic risk factor in rheumatoid arthritis?

    Science.gov (United States)

    2013-01-01

    Atherosclerosis, now regarded as a chronic inflammatory disease of the arterial wall, and its clinical manifestations have increasingly been associated with rheumatoid arthritis (RA), supporting the notion that autoimmune diseases and vascular disorders share common etiological features. Indeed, evidence pertaining to this matter indicates that inflammation and its multiple components are the driving force behind the pathogenesis of these disorders. Interestingly, CD154 and its receptors have emerged as major players in the development of RA and atherosclerosis, which raises the possibility that this axis may represent an important biological link between both complications. Indeed, CD154 signaling elicits critical inflammatory responses that are common to the pathogenesis of both diseases. Here, we provide an overview of the traditional and disease-related interrelations between RA and vascular abnormalities, while focusing on CD154 as a potential mediator in the development of atherosclerotic events in RA patients. PMID:23433179

  16. Requirement of Transmembrane Domain for CD154 Association to Lipid Rafts and Subsequent Biological Events

    Science.gov (United States)

    Benslimane, Nadir; Hassan, Ghada S.; Yacoub, Daniel; Mourad, Walid

    2012-01-01

    Interaction of CD40 with CD154 leads to recruitment of both molecules into lipid rafts, resulting in bi-directional cell activation. The precise mechanism by which CD154 is translocated into lipid rafts and its impact on CD154 signaling remain largely unknown. Our aim is to identify the domain of CD154 facilitating its association to lipid rafts and the impact of such association on signaling events and cytokine production. Thus, we generated Jurkat cell lines expressing truncated CD154 lacking the cytoplasmic domain or chimeric CD154 in which the transmembrane domain was replaced by that of transferrin receptor I, known to be excluded from lipid rafts. Our results show that cell stimulation with soluble CD40 leads to the association of CD154 wild-type and CD154-truncated, but not CD154-chimera, with lipid rafts. This is correlated with failure of CD154-chimera to activate Akt and p38 MAP kinases, known effectors of CD154 signaling. We also found that CD154-chimera lost the ability to promote IL-2 production upon T cell stimulation with anti-CD3/CD28 and soluble CD40. These results demonstrate the implication of the transmembrane domain of CD154 in lipid raft association, and that this association is necessary for CD154-mediated Akt and p38 activation with consequent enhancement of IL-2 production. PMID:22905203

  17. Requirement of transmembrane domain for CD154 association to lipid rafts and subsequent biological events.

    Directory of Open Access Journals (Sweden)

    Nadir Benslimane

    Full Text Available Interaction of CD40 with CD154 leads to recruitment of both molecules into lipid rafts, resulting in bi-directional cell activation. The precise mechanism by which CD154 is translocated into lipid rafts and its impact on CD154 signaling remain largely unknown. Our aim is to identify the domain of CD154 facilitating its association to lipid rafts and the impact of such association on signaling events and cytokine production. Thus, we generated Jurkat cell lines expressing truncated CD154 lacking the cytoplasmic domain or chimeric CD154 in which the transmembrane domain was replaced by that of transferrin receptor I, known to be excluded from lipid rafts. Our results show that cell stimulation with soluble CD40 leads to the association of CD154 wild-type and CD154-truncated, but not CD154-chimera, with lipid rafts. This is correlated with failure of CD154-chimera to activate Akt and p38 MAP kinases, known effectors of CD154 signaling. We also found that CD154-chimera lost the ability to promote IL-2 production upon T cell stimulation with anti-CD3/CD28 and soluble CD40. These results demonstrate the implication of the transmembrane domain of CD154 in lipid raft association, and that this association is necessary for CD154-mediated Akt and p38 activation with consequent enhancement of IL-2 production.

  18. Enfoque terapéutico en 154 pacientes con acromegalia Therapeutic management in 154 acromegalic patients

    Directory of Open Access Journals (Sweden)

    Marcos P. Manavela

    2010-08-01

    Full Text Available La acromegalia es una enfermedad poco frecuente producida en más del 95% de los casos por un tumor hipofisario secretor de hormona de crecimiento (GH. Las manifestaciones clínicas están asociadas a síntomas locales por crecimiento del tumor o a las consecuencias orgánicas y metabólicas secundarias a la hipersecreción de GH. Debido a la alta morbilidad y mortalidad asociadas a la acromegalia, un tratamiento individualizado y optimizado para cada paciente es fundamental. Informamos el enfoque terapéutico de nuestro servicio de endocrinología en la atención de 154 pacientes con acromegalia. Utilizando criterios bioquímicos estrictos, con la cirugía logramos un 32% de remisión global, tasa relativamente baja debido fundamentalmente a que la mayor parte de los pacientes presentaban macroadenomas con un alto porcentaje de invasividad local. Con radioterapia complementaria o como tratamiento inicial se logró la remisión en el 65.4% de los pacientes irradiados. El 14.0% de los pacientes controlaron la enfermedad utilizando agonistas dopaminérgicos solos o combinados con otra droga, mientras que aquellos que utilizaron análogos de la somatostatina normalizaron los parámetros bioquímicos en un 45.7% de los casos. En conclusión, con los diferentes tratamientos utilizados obtuvimos el control de la acromegalia en el 55.2% de los casos, esperando optimizar el tratamiento de estos pacientes en la medida en que contemos con y tengamos acceso a nuevas herramientas terapéuticas.Acromegaly is a chronic, invalidating disease due in over 95% of cases to a growth hormone (GH secreting pituitary adenoma. Its clinical manifestations are associated to local complications related to the tumor growth and/or to the metabolic consequences of GH excess. We report here our experience on 154 acromegalic patients. Surgical remission rate using stringent biochemical criteria was 32%, a figure relatively low due to the great number of patients bearing

  19. Phenotype abnormality: 154 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 154 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u1ria224u660i decreased efficiency...ent of blue light regimen http://metadb.riken.jp/db/SciNetS_ria224i/cria224u2ria224u29i root ... decreased efficiency ...

  20. Requirement for CD154 in the progression of atherosclerosis

    NARCIS (Netherlands)

    Lutgens, E.; Gorelik, L.; Daemen, M. J.; de Muinck, E. D.; Grewal, I. S.; Koteliansky, V. E.; Flavell, R. A.

    1999-01-01

    Atherosclerosis is a systemic disease of the large arteries, and activation of inflammatory pathways is important in its pathogenesis. Increasing evidence supports the importance of CD40-CD154 interactions in atherosclerosis, interactions originally known to be essential in major immune reactions

  1. 46 CFR 154.438 - Design vapor pressure.

    Science.gov (United States)

    2010-10-01

    ... Independent Tank Type A § 154.438 Design vapor pressure. (a) If the surface of an independent tank type A are mostly flat surfaces,the Po must not exceed 69 kPa gauge (10 psig). (b) If the surfaces of an independent tank type A are formed by bodies of revolution, the design calculation of the Po must be specially...

  2. 32 CFR 154.42 - Evaluation of personnel security information.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 1 2010-07-01 2010-07-01 false Evaluation of personnel security information... SECURITY DEPARTMENT OF DEFENSE PERSONNEL SECURITY PROGRAM REGULATION Adjudication § 154.42 Evaluation of personnel security information. (a) The criteria and adjudicative policy to be used in applying the...

  3. 32 CFR 154.15 - Military appointment, enlistment, and induction.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 1 2010-07-01 2010-07-01 false Military appointment, enlistment, and induction... Requirements § 154.15 Military appointment, enlistment, and induction. (a) General. The appointment, enlistment, and induction of each member of the Armed Forces or their Reserve Components shall be subject to the...

  4. 29__154 -158_ _Galadanci_ANALYSIS OF AURORAL

    African Journals Online (AJOL)

    User

    Bayero Journal of Pure and Applied Sciences, 9(2): 154 - 158. Received: April, 2016. Accepted: August, 2016 ... 1Department of Physics, Bayero University, Kano. NIGERIA. 2Department of Mathematical Sciences, Bayero ... first described by a Japanese geophysicist named. Syun-IchiAkasofu in 1964 (Sarris and Li, 2005).

  5. 27 CFR 44.154 - Claim for refund of tax.

    Science.gov (United States)

    2010-04-01

    ..., WITHOUT PAYMENT OF TAX, OR WITH DRAWBACK OF TAX Operations by Export Warehouse Proprietors Claims § 44.154... refunded (without interest) to an export warehouse proprietor on proof satisfactory to the appropriate TTB... ownership of such export warehouse proprietor, or withdrawn by him from the market. Any claim for refund...

  6. 21 CFR 146.154 - Concentrated orange juice with preservative.

    Science.gov (United States)

    2010-04-01

    ... Canned Fruit Juices and Beverages § 146.154 Concentrated orange juice with preservative. (a) Concentrated... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Concentrated orange juice with preservative. 146... ingredients prescribed for concentrated orange juice for manufacturing by § 146.153, except that a...

  7. 154.pdf | 25jan2011 | currsci | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; currsci; 25jan2011; 154.pdf. 404! error. The page your are looking for can not be found! Please check the link or use the navigation bar at the top. YouTube · Twitter · Facebook · Blog. Academy News. IAS Logo. Ethical Guidelines and Procedures document. Posted on 17 January 2017. A revised version of the ...

  8. 46 CFR 154.1350 - Flammable gas detection system.

    Science.gov (United States)

    2010-10-01

    ... compressor room; (3) Each motor room for cargo handling machinery; (4) Each cargo control station that is not... the space where the gas detection system's readout is located and must meet § 154.1365. (h) Remote... away from all ignition sources. (o) Each flammable gas detection system must not have common sampling...

  9. 33 CFR 154.1125 - Additional response plan requirements.

    Science.gov (United States)

    2010-07-01

    ...) for exercises that test either the entire appendix or individual components(s). (3) Testing... Prince William Sound, Alaska § 154.1125 Additional response plan requirements. (a) The owner or operator of a TAPAA facility shall include the following information in the Prince William Sound appendix to...

  10. 18 CFR 154.401 - RD&D expenditures.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false RD&D expenditures. 154....401 RD&D expenditures. (a) Requirements. Upon approval by the Commission, a natural gas company may file to recover research, development, and demonstration (RD&D) expenditures in its rates under this...

  11. 20 CFR 655.154 - Additional positive recruitment.

    Science.gov (United States)

    2010-04-01

    ... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Additional positive recruitment. 655.154... recruitment. (a) Where to conduct additional positive recruitment. The employer must conduct positive recruitment within a multistate region of traditional or expected labor supply where the CO finds that there...

  12. 33 CFR 154.545 - Discharge containment equipment.

    Science.gov (United States)

    2010-07-01

    ... (CONTINUED) POLLUTION FACILITIES TRANSFERRING OIL OR HAZARDOUS MATERIAL IN BULK Equipment Requirements § 154... chapter may be utilized in the planning requirements of subpart F and subpart H of this part. ... material and equipment to contain any oil or hazardous material discharged on the water from operations at...

  13. 33 CFR 154.1210 - Purpose and applicability.

    Science.gov (United States)

    2010-07-01

    ... planning requirements for an owner or operator of a facility that handles, stores, or transports animal... (CONTINUED) POLLUTION FACILITIES TRANSFERRING OIL OR HAZARDOUS MATERIAL IN BULK Response Plans for Animal Fats and Vegetable Oils Facilities § 154.1210 Purpose and applicability. (a) The requirements of this...

  14. 33 CFR 154.1110 - Purpose and applicability.

    Science.gov (United States)

    2010-07-01

    ... (CONTINUED) POLLUTION FACILITIES TRANSFERRING OIL OR HAZARDOUS MATERIAL IN BULK Additional Response Plan Requirements for a Trans-Alaska Pipeline Authorization Act (TAPAA) Facility Operating in Prince William Sound, Alaska § 154.1110 Purpose and applicability. (a) This subpart establishes oil spill response planning...

  15. Immunotargeting with CD154 (CD40 Ligand) Enhances DNA Vaccine Responses in Ducks

    OpenAIRE

    Sheryl L. Gares; Karl P Fischer; Congly, Stephen E.; Lacoste, Stacey; Addison, William R.; Tyrrell, D Lorne; Gutfreund, Klaus S.

    2006-01-01

    Engagement of CD154 on activated T cells with CD40 on antigen-presenting cells (APCs) potentiates adaptive immune responses in mammals. Soluble multimeric forms of CD154 have been used as an adjuvant or in immunotargeting strategies to enhance vaccine responses. The objective of our study was to examine the ability of duck CD154 (DuCD154) to enhance DNA vaccine responses in the duck hepatitis B model. Constructs were generated to express the functional domain of DuCD154 (tCD154), truncated du...

  16. Counteractive functions are encrypted in the residues of CD154.

    Science.gov (United States)

    Bandyopadhyay, Syamdas; Chandel, Himanshu Singh; Singh, Shailza; Roy, Somenath; Krishnasastry, M V; Saha, Bhaskar

    2015-09-01

    CD40, as a single receptor that binds CD154 (CD40-ligand or CD40L), regulates counteractive effector functions such as production of pro- and anti-inflammatory cytokines. Therefore, we examined whether such dual messages are encrypted in CD40L. As such message encryption was never investigated, we hypothesized that mutation of certain amino acid residues should in principle enhance pro-inflammatory cytokine production whereas mutation of some others would enhance anti-inflammatory cytokine secretion. We mutated six such residues, which were previously showed to participate in CD40L function. Here, we report that the mutant CD154 129E→V was superior to the wild-type CD154 in killing of Leishmania donovani, induction of inducible nitric oxide synthase (iNOS) and production of IL-12 and relative phosphorylation of p38MAPK and ERK-1/2 in PBMC-derived macrophages. By contrast, 128S→V promoted L. donovani survival, reducing iNOS, but increasing IL-10 expression and predominant ERK-1/2 phosphorylation. The mutant 144G→V did not have significant effects. Other mutants (142E→V, 143K→A, 145Y→F) mimicked the wild-type CD154. Molecular dynamics simulation suggested that these mutations induced differential conformational changes in the CD40-CD154 complex. Therefore, assortment of the contrasting messages encrypted in a given ligand performing counteractive functions presents a novel fundamental biological principle that can be used for devising various therapies. Copyright © 2015. Published by Elsevier Inc.

  17. Structural investigation and photoluminescent properties of gadolinium(III), europium(III) and terbium(III) 3-mercaptopropionate complexes.

    Science.gov (United States)

    Souza, E R; Mazali, I O; Sigoli, F A

    2014-01-01

    This work reports on the synthesis, crystallographic determination and spectroscopic characterization of gadolinium(III), terbium(III) and europium(III) 3-mercaptopropionate complexes, aqua-tris(3-mercaptopropionate)lanthanide(III)--[Ln(mpa)3(H2O)]. The Judd-Ofelt intensity parameters were experimentally determined from emission spectrum of the [Eu(mpa)3(H2O)]complex and they were also calculated from crystallographic data. The complexes are coordination polymers, where the units of each complex are linked together by carboxylate groups leading to an unidimensional and parallel chains that by chemical interactions form a tridimensional framework. The emission spectrum profile of the [Eu(mpa)3(H2O)] complex is discussed based on point symmetry of the europium(III) ion, that explains the bands splitting observed in its emission spectrum. Photoluminescent analysis of the [Gd(mpa)3(H2O)] complex show no efficient ligand excitation but an intense charge transfer band. The excitation spectra of the [Eu(mpa)3(H2O)] and [Tb(mpa)3(H2O)] complexes do not show evidence of energy transfer from the ligand to the excited levels of these trivalent ions. Therefore the emission bands are originated only by direct f-f intraconfigurational excitation of the lantanide(III) ions.

  18. Fluorometric determination of proteins using the terbium (III)-2-thenoyltrifluoroacetone-sodium dodecyl benzene sulfonate-protein system

    Energy Technology Data Exchange (ETDEWEB)

    Jia Zhen [Key Laboratory of Colloid and Interface Chemistry of Education Ministry, School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Department of Chemistry, Dezhou University, Dezhou 253023 (China); Yang Jinghe [Key Laboratory of Colloid and Interface Chemistry of Education Ministry, School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China)]. E-mail: yjh@sdu.edu.cn; Wu Xia [Key Laboratory of Colloid and Interface Chemistry of Education Ministry, School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Wang Fei [Key Laboratory of Colloid and Interface Chemistry of Education Ministry, School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Guo Changying [Key Laboratory of Colloid and Interface Chemistry of Education Ministry, School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Liu Shufang [Key Laboratory of Colloid and Interface Chemistry of Education Ministry, School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China)

    2006-12-15

    It is found that in hexamethylene tetramine (HMTA)-HCl buffer of pH=8.00, proteins can enhance the fluorescence of terbium (III) (Tb{sup 3+})-2-thenoyltrifluoroacetone (TTA)-sodium dodecyl benzene sulfonate (SDBS) system. Based on this, a sensitive method for the determination of proteins is proposed. The experiments indicate that under the optimum conditions, the enhanced fluorescence intensity is in proportion to the concentration of proteins in the range of 4.0x10{sup -9}-7.5x10{sup -6}g/mL for bovine serum albumin (BSA), 5.0x10{sup -9}-1.5x10{sup -5}g/mL for human serum albumin (HSA), 1.0x10{sup -8}-7.5x10{sup -6}g/mL for egg albumin (EA). Their detection limits (S/N=3) are 0.5, 0.8 and 2.0ng/mL, respectively. The interaction mechanism is also studied.

  19. Terbium to Quantum Dot FRET Bioconjugates for Clinical Diagnostics: Influence of Human Plasma on Optical and Assembly Properties

    Directory of Open Access Journals (Sweden)

    Niko Hildebrandt

    2011-10-01

    Full Text Available Förster resonance energy transfer (FRET from luminescent terbium complexes (LTC as donors to semiconductor quantum dots (QDs as acceptors allows extraordinary large FRET efficiencies due to the long Förster distances afforded. Moreover, time-gated detection permits an efficient suppression of autofluorescent background leading to sub-picomolar detection limits even within multiplexed detection formats. These characteristics make FRET-systems with LTC and QDs excellent candidates for clinical diagnostics. So far, such proofs of principle for highly sensitive multiplexed biosensing have only been performed under optimized buffer conditions and interactions between real-life clinical media such as human serum or plasma and LTC-QD-FRET-systems have not yet been taken into account. Here we present an extensive spectroscopic analysis of absorption, excitation and emission spectra along with the luminescence decay times of both the single components as well as the assembled FRET-systems in TRIS-buffer, TRIS-buffer with 2% bovine serum albumin, and fresh human plasma. Moreover, we evaluated homogeneous LTC-QD FRET assays in QD conjugates assembled with either the well-known, specific biotin-streptavidin biological interaction or, alternatively, the metal-affinity coordination of histidine to zinc. In the case of conjugates assembled with biotin-streptavidin no significant interference with the optical and binding properties occurs whereas the histidine-zinc system appears to be affected by human plasma.

  20. Evidence of mass exchange between inside and outside of sonoluminescing bubble in aqueous solution of terbium chloride

    Energy Technology Data Exchange (ETDEWEB)

    Liang, Jinfu, E-mail: liang.shi2007@163.com [School of Physics and Electronic Science, Guizhou Normal University, Guiyang 550001 (China); Chen, Weizhong, E-mail: wzchen@nju.edu.cn [The Key Laboratory of Modern Acoustics, Ministry of Education, Institution of Acoustics, Nanjing University, Nanjing 210093 (China); Wang, Xun; Yang, Jing; Chen, Zhan [The Key Laboratory of Modern Acoustics, Ministry of Education, Institution of Acoustics, Nanjing University, Nanjing 210093 (China)

    2016-12-16

    Highlights: • Time-resolved spectra of SBSL were obtained for Tb{sup 3+} ions emission lines. • Mass exchange between inside and outside of SL bubble was probed via Tb{sup 3+} ions lines. • The argon rectification hypothesis was tested by time-resolved spectra of SBSL. • The rate of mass exchange inside an SBSL bubble increases with increasing sound pressure. - Abstract: Spectra of single-bubble sonoluminescence (SBSL) were obtained for Tb{sup 3+} ions emission lines from bubbles in an aqueous solution of terbium chloride (TbCl{sub 3}). The spectra provide experimental evidence to prove that an air bubble driven by strong ultrasound will not eventually become a rectified pure argon bubble, which is not as predicted by the argon rectification hypothesis. The time-resolved spectra of SBSL show a mass exchange of material such as Tb{sup 3+} ions between the inside and outside of the bubble. With increasing sound pressure, the rate of mass exchange and the SBSL intensity increases.

  1. Optical properties and electrical transport of thin films of terbium(III bis(phthalocyanine on cobalt

    Directory of Open Access Journals (Sweden)

    Peter Robaschik

    2014-11-01

    Full Text Available The optical and electrical properties of terbium(III bis(phthalocyanine (TbPc2 films on cobalt substrates were studied using variable angle spectroscopic ellipsometry (VASE and current sensing atomic force microscopy (cs-AFM. Thin films of TbPc2 with a thickness between 18 nm and 87 nm were prepared by organic molecular beam deposition onto a cobalt layer grown by electron beam evaporation. The molecular orientation of the molecules on the metallic film was estimated from the analysis of the spectroscopic ellipsometry data. A detailed analysis of the AFM topography shows that the TbPc2 films consist of islands which increase in size with the thickness of the organic film. Furthermore, the cs-AFM technique allows local variations of the organic film topography to be correlated with electrical transport properties. Local current mapping as well as local I–V spectroscopy shows that despite the granular structure of the films, the electrical transport is uniform through the organic films on the microscale. The AFM-based electrical measurements allow the local charge carrier mobility of the TbPc2 thin films to be quantified with nanoscale resolution.

  2. Highly luminescent charge-neutral europium(iii) and terbium(iii) complexes with tridentate nitrogen ligands.

    Science.gov (United States)

    Senthil Kumar, Kuppusamy; Schäfer, Bernhard; Lebedkin, Sergei; Karmazin, Lydia; Kappes, Manfred M; Ruben, Mario

    2015-09-21

    We report on the synthesis of tridentate-nitrogen pyrazole-pyridine-tetrazole (L(1)H) and pyrazole-pyridine-triazole (L(2)H) ligands and their complexation with lanthanides (Ln = Gd(iii), Eu(iii) and Tb(iii)) resulting in stable, charge-neutral complexes Ln(L(1))3 and Ln(L(2))3, respectively. X-ray crystallographic analysis of the complexes with L(1) ligands revealed tricapped trigonal coordination geometry around the lanthanide ions. All complexes show bright photoluminescence (PL) in the solid state, indicating efficient sensitization of the lanthanide emission via the triplet states of the ligands. In particular, the terbium complexes show high PL quantum yields of 65 and 59% for L(1) and L(2), respectively. Lower PL efficiencies of the europium complexes (7.5 and 9%, respectively) are attributed to large energy gaps between the triplet states of the ligands and accepting levels of Eu(iii). The triplet state energy can be reduced by introducing an electron withdrawing (EW) group at the 4 position of the pyridine ring. Such substitution of L(1)H with a carboxylic ester (COOMe) EW group leads to a europium complex with increased PL quantum yield of 31%. A comparatively efficient PL of the complexes dissolved in ethanol indicates that the lanthanide ions are shielded against nonradiative deactivation via solvent molecules.

  3. Micelle enhanced and terbium sensitized spectrofluorimetric determination of danofloxacin in milk using molecularly imprinted solid phase extraction

    Science.gov (United States)

    Kaur, Kuldeep; Saini, Shivender Singh; Malik, Ashok Kumar; Singh, Baldev

    2012-10-01

    An efficient molecularly imprinted solid phase extraction (MISPE)-spectrofluorimetric method was developed to sensitively determine danofloxacin (DAN) in milk samples. Solid phase extraction procedure using MISPE cartridges was first performed on milk samples and then spectrofluorimetric determination was done at 546 nm using an excitation wavelength of 285 nm in presence of terbium and sodium dodecyl benzene sulfonate (SDBS). It was found that SDBS significantly enhanced the fluorescence intensity of the DAN-Tb3+ complex. Various factors affecting the fluorescence intensity of DAN-Tb3+-SDBS system were studied and conditions were optimized. The enhanced fluorescence intensity of the system (ΔF) showed a good linear relationship with the concentration of DAN over the range of 8.4 × 10-9-3.4 × 10-7 mol L-1 with a correlation coefficient of 0.9996. The detection limit was determined as 2.0 × 10-9 mol L-1 and the limit of quantification was determined as 6.5 × 10-9 mol L-1. The MISPE-spectrofluorimetric procedure was successfully applied to the determination of DAN in milk samples. The method is simple, rapid, sensitive and allows interference free determination of DAN in complex fluorescent matrices like milk. The method can be used to determine whether the DAN residues in milk exceed MRLs or not.

  4. Study of quantum dot based on tin/yttrium mixed oxide doped with terbium to be used as biomarker

    Energy Technology Data Exchange (ETDEWEB)

    Paganini, Paula P.; Felinto, Maria Claudia F.C.; Kodaira, Claudia A., E-mail: paulapaganini@usp.b, E-mail: mfelinto@ipen.b, E-mail: claudiakodaira@yahoo.co [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil); Brito, Hermi F., E-mail: hefbrito@iq.usp.b [Universidade de Sao Paulo (USP), SP (Brazil). Inst. de Quimica. Lab. de Elementos do Bloco f; Nunes, Luiz Antonio O., E-mail: luizant@ifsc.usp.b [Universidade de Sao Paulo (USP), Sao Carlos, SP (Brazil). Inst. de Fisica. Dept. de Fisica e Informatica

    2009-07-01

    Quantum dots (semiconductors nanocrystals) have brought a promising field to develop a new generation of luminescent biomarkers. The use of lanthanides ions as luminescent markers has many advantages, for example a security method, low cost, high specificity and also the luminescence can be promptly measured with high sensibility and accuracy. These luminescent dots are functionalized with biomolecules. For the luminophore particle to be connect with biologicals molecules (for example covalent antibody) is necessary a previous chemical treatment to modify luminophore particle surface and this process is called functionalization. A prior chemical treatment with changes on the surface luminophore particle is necessary to couple the luminophore to biological molecules. This process can be used as coating which can protect these particles from being dissolved by acid as well as provide functional groups for biological conjugation. This work presents a photoluminescence study of nanoparticles based on tin/yttrium mixed oxides doped with terbium (SnO{sub 2}/Y{sub 2}O{sub 3}:Tb{sup 3+}), synthesized by coprecipitation method. The nanoparticles were submitted to thermal treatment and characterized by X-Ray Powder Diffraction (XRD) that showed cassiterite phase formation and the influence of thermal treatment on nanoparticles structures. These nanoparticles going to be functionalized with a natural polysaccharide (chitosan) in order to form microspheres. These microspheres going to be irradiated with gamma radiation to sterilization and it can be evaluated if the nanoparticles are resistant to irradiation and they do not lose functionality with this process. (author)

  5. 46 CFR 154.1836 - Vapor venting as a means of cargo tank pressure and temperature control.

    Science.gov (United States)

    2010-10-01

    ... LIQUEFIED GASES Operations § 154.1836 Vapor venting as a means of cargo tank pressure and temperature... temperature control. 154.1836 Section 154.1836 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY... cargo pressure and temperature control system under §§ 154.701 through 154.709 is operating and that...

  6. Immunotargeting with CD154 (CD40 ligand) enhances DNA vaccine responses in ducks.

    Science.gov (United States)

    Gares, Sheryl L; Fischer, Karl P; Congly, Stephen E; Lacoste, Stacey; Addison, William R; Tyrrell, D Lorne; Gutfreund, Klaus S

    2006-08-01

    Engagement of CD154 on activated T cells with CD40 on antigen-presenting cells (APCs) potentiates adaptive immune responses in mammals. Soluble multimeric forms of CD154 have been used as an adjuvant or in immunotargeting strategies to enhance vaccine responses. The objective of our study was to examine the ability of duck CD154 (DuCD154) to enhance DNA vaccine responses in the duck hepatitis B model. Constructs were generated to express the functional domain of DuCD154 (tCD154), truncated duck hepatitis B virus (DHBV) core antigen (tcore) and chimera of tcore fused to tCD154 (tcore-tCD154). Expression in LMH cells demonstrated that all proteins were secreted and that tCD154 and tcore-tCD154 formed multimers. Ducks immunized with the plasmid ptcore-tCD154 developed accelerated and enhanced core-specific antibody responses compared to ducks immunized with ptcore or ptcore plus ptCD154. Antibody responses were better sustained in both ptcore-tCD154- and ptcore plus ptCD154-immunized ducks. Core-specific proliferative responses of duck peripheral blood mononuclear cells were enhanced in ducks immunized with ptcore-tCD154 or ptcore alone. This study suggests that the role of CD154 in the regulation of adaptive immune responses had already evolved before the divergence of birds and mammals. Thus, targeting of antigens to APCs with CD154 is an effective strategy to enhance DNA vaccine responses not only in mammalian species but also in avian species.

  7. Terbium-doped gadolinium oxysulfide (Gd2O2S:Tb) scintillation-based polymer optical fibre sensor for real time monitoring of radiation dose in oncology

    Science.gov (United States)

    Lewis, E.; O'Keeffe, S.; Grattan, M.; Hounsell, A.; McCarthy, D.; Woulfe, P.; Cronin, J.; Mihai, L.; Sporea, D.; Santhanam, A.; Agazaryan, N.

    2014-05-01

    A PMMA based plastic optical fibre sensor for use in real time radiotherapy dosimetry is presented. The optical fibre tip is coated with a scintillation material, terbium-doped gadolinium oxysulfide (Gd2O2S:Tb), which fluoresces when exposed to ionising radiation (X-Ray). The emitted visible light signal penetrates the sensor optical fibre and propagates along the transmitting fibre at the end of which it is remotely monitored using a fluorescence spectrometer. The results demonstrate good repeatability, with a maximum percentage error of 0.5% and the response is independent of dose rate.

  8. Platelet-derived CD154: ultrastructural localization and clinical correlation in organ transplantation

    OpenAIRE

    Ali H. Charafeddine; Kim, Eugenia J.; Maynard, Dawn M.; Yi, Hong; Weaver, Timothy A; Gunay-Aygun, Meral; Russell, Maria; Gahl, William A.; Kirk, Allan D.

    2012-01-01

    CD154 is an immunostimulatory ligand for CD40 that markedly influences alloimmunity. Its presence in platelets suggests that its release and subsequent immune effects are driven by trauma and thus could be relevant following organ transplantation. However, the release of platelet derived CD154 and its consequences have not been investigated in a clinical transplant setting. To better characterize the relationship between platelet activation and CD154 release, we investigated CD154 release by ...

  9. Requirement of Transmembrane Domain for CD154 Association to Lipid Rafts and Subsequent Biological Events

    OpenAIRE

    Benslimane, Nadir,; Hassan, Ghada,; Yacoub, Daniel; Mourad, Walid,

    2012-01-01

    International audience; Interaction of CD40 with CD154 leads to recruitment of both molecules into lipid rafts, resulting in bi-directional cell activation. The precise mechanism by which CD154 is translocated into lipid rafts and its impact on CD154 signaling remain largely unknown. Our aim is to identify the domain of CD154 facilitating its association to lipid rafts and the impact of such association on signaling events and cytokine production. Thus, we generated Jurkat cell lines expressi...

  10. 46 CFR 154.1015 - Lighting in gas-dangerous space.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Lighting in gas-dangerous space. 154.1015 Section 154... Equipment Electrical § 154.1015 Lighting in gas-dangerous space. (a) Each gas-dangerous space that has... protective device for any lighting circuit that is in a gas-dangerous space must open each conductor of the...

  11. 46 CFR 154.706 - Cargo boil-off as fuel: Fuel lines.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Cargo boil-off as fuel: Fuel lines. 154.706 Section 154... Equipment Cargo Pressure and Temperature Control § 154.706 Cargo boil-off as fuel: Fuel lines. (a) Gas fuel lines must not pass through accommodation, service, or control spaces. Each gas fuel line passing...

  12. 29 CFR 780.154 - Delivery “to market.”

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 3 2010-07-01 2010-07-01 false Delivery âto market.â 780.154 Section 780.154 Labor... of Agriculture Specified Delivery Operations § 780.154 Delivery “to market.” The term “delivery * * * to market” includes taking agricultural or horticultural commodities, dairy products, livestock, bees...

  13. 46 CFR 154.300 - Segregation of hold spaces from other spaces.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Segregation of hold spaces from other spaces. 154.300 Section 154.300 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS... Equipment Ship Arrangements § 154.300 Segregation of hold spaces from other spaces. Hold spaces must be...

  14. 46 CFR 154.305 - Segregation of hold spaces from the sea.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Segregation of hold spaces from the sea. 154.305 Section 154.305 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS... Equipment Ship Arrangements § 154.305 Segregation of hold spaces from the sea. In vessels having cargo...

  15. 37 CFR 1.54 - Parts of application to be filed together; filing receipt.

    Science.gov (United States)

    2010-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Parts of application to be filed together; filing receipt. 1.54 Section 1.54 Patents, Trademarks, and Copyrights UNITED STATES... Processing Provisions The Application § 1.54 Parts of application to be filed together; filing receipt. (a...

  16. M1 spin strength distribution in [sup 154]Sm

    Energy Technology Data Exchange (ETDEWEB)

    Sarriguren, P.; Guerra, E.M. de (Consejo Superior de Investigaciones Cientificas, Madrid (Spain). Inst. Estructura de la Materia); Nojarov, R.; Faessler, Amand (Tuebingen Univ. (Germany). Inst. fuer Theoretische Physik)

    1993-02-01

    The effect of the residual spin-spin interaction on the M1 spin-flip strength distribution in [sup 154]Sm is studied within the quasi-particle random phase approximation. The double-peaked structure found experimentally is reproduced. A new interpretation for the origin of the two peaks emerges from an analysis of our results. We identify these peaks as isoscalar and isovector and discuss previous theoretical interpretations. (Author).

  17. IL-15 prolongs CD154 expression on human CD4 T cells via STAT5 binding to the CD154 transcriptional promoter

    OpenAIRE

    Lowe, RM; Genin, A; Orgun, N; Cron, RQ

    2014-01-01

    Activation induced CD154 expression on CD4 T cells is prolonged in systemic lupus erythematosus but the mechanism(s) for its dysregulation are unknown. The studies reported herein demonstrate that IL-15 is capable of prolonging CD154 expression on PHA activated CD4 T cells. Since IL-15 signals through STAT5, predicted STAT5 binding sites in the human CD154 transcriptional promoter were identified, and STAT5 binding to the proximal CD154 promoter in vitro and in vivo following primary CD4 T ce...

  18. Compact all-fiber optical Faraday components using 65-wt%-terbium-doped fiber with a record Verdet constant of -32 rad/(Tm).

    Science.gov (United States)

    Sun, L; Jiang, S; Marciante, J R

    2010-06-07

    A compact all-fiber Faraday isolator and a Faraday mirror are demonstrated. At the core of each of these components is an all-fiber Faraday rotator made of a 4-cm-long, 65-wt%-terbium-doped silicate fiber. The effective Verdet constant of the terbium-doped fiber is measured to be -32 rad/(Tm), which is 27 x larger than that of silica fiber. This effective Verdet constant is the largest value measured to date in any fiber and is 83% of the Verdet constant of commercially available crystal used in bulk optics-based isolators. Combining the all-fiber Faraday rotator with fiber polarizers results in a fully fusion spliced all-fiber isolator whose isolation is measured to be 19 dB. Combining the all-fiber Faraday rotator with a fiber Bragg grating results in an all-fiber Faraday mirror that rotates the polarization state of the reflected light by 88 +/- 4 degrees .

  19. Picomolar Traces of Americium(III) Introduce Drastic Changes in the Structural Chemistry of Terbium(III): A Break in the "Gadolinium Break".

    Science.gov (United States)

    Welch, Jan M; Müller, Danny; Knoll, Christian; Wilkovitsch, Martin; Giester, Gerald; Ofner, Johannes; Lendl, Bernhard; Weinberger, Peter; Steinhauser, Georg

    2017-10-16

    The crystallization of terbium 5,5'-azobis[1H-tetrazol-1-ide] (ZT) in the presence of trace amounts (ca. 50 Bq, ca. 1.6 pmol) of americium results in 1) the accumulation of the americium tracer in the crystalline solid and 2) a material that adopts a different crystal structure to that formed in the absence of americium. Americium-doped [Tb(Am)(H 2 O) 7 ZT] 2 ZT⋅10 H 2 O is isostructural to light lanthanide (Ce-Gd) 5,5'-azobis[1H-tetrazol-1-ide] compounds, rather than to the heavy lanthanide (Tb-Lu) 5,5'-azobis[1H-tetrazol-1-ide] (e.g., [Tb(H 2 O) 8 ] 2 ZT 3 ⋅6 H 2 O) derivatives. Traces of Am seem to force the Tb compound into a structure normally preferred by the lighter lanthanides, despite a 10 8 -fold Tb excess. The americium-doped material was studied by single-crystal X-ray diffraction, vibrational spectroscopy, radiochemical neutron activation analysis, and scanning electron microcopy. In addition, the inclusion properties of terbium 5,5'-azobis[1H-tetrazol-1-ide] towards americium were quantified, and a model for the crystallization process is proposed. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Identification and characterization of functional CD154 (CD40 ligand) in the Pekin duck.

    Science.gov (United States)

    Fischer, Karl P; Gares, Sheryl L; Wang, Dakun; Lorne Tyrrell, D; Gutfreund, Klaus S

    2007-01-01

    Binding of CD154, a member of the TNF ligand superfamily, to its receptor CD40 is essential for the development and regulation of adaptive immune responses in mammals. The duck CD154 (DuCD154) encoding gene was isolated from activated splenocytes using RT-PCR. Sequence analysis of the cloned DuCD154 gene revealed an open reading frame of 819 base pairs encoding a 272 amino acid protein. The extracellular domain of DuCD154 was identified and expressed for characterization and generation of antibodies. DuCD154 mRNA was predominantly expressed in spleen, thymus and duodenum. DuCD154 protein generated in cell culture was secreted and formed dimers. DuCD154 markedly enhanced proliferative responses in duck splenocytes when used alone or in conjunction with LPS or PHA. These observations suggest that DuCD154 has functional equivalence with mammalian CD154 and that the central role of CD154 as an immunoregulatory protein had already evolved before the divergence of birds and mammals.

  1. Interaction of CD154 with different receptors and its role in bidirectional signals.

    Science.gov (United States)

    Alturaihi, Haydar; Hassan, Ghada S; Al-Zoobi, Loubna; Salti, Suzanne; Darif, Youssef; Yacoub, Daniel; El Akoum, Souhad; Oudghiri, Mounia; Merhi, Yahye; Mourad, Walid

    2015-02-01

    In addition to its classical receptor, CD40, it is now well established that CD154 also binds αIIbβ3, α5β1, and αMβ2 integrins. Although these integrins are all members of the same family, they bind CD154 differently. The current investigation aims to analyze the interaction of CD154 with α5β1 and αMβ2 and investigate its role in bidirectional signals in various human cell lines. Results obtained herein indicate that the CD154 residues involved in the interaction with α5β1 are N151 and Q166, whereas those involved in αMβ2 binding are common to residues required for CD40, namely Y145 and R203. Soluble CD40/CD154 or αMβ2/CD154 complexes do not interfere with the binding of CD154 to α5β1-positive cells, but inhibit the binding of CD154 to CD40- or αMβ2-positive cells, respectively. Ligation of CD154 on CD154-positive cells with soluble CD40, αIIbβ3, α5β1, or αMβ2 stimulates intracellular signaling, including MAPK phosphorylation. Given that CD154 exists as a trimer, our data strongly suggest that CD154 may bind concomitantly to two receptors of the same or different family, and biologically activate cells expressing both receptors. The characterization of CD154/receptor interactions helps the identification of new therapeutic targets for the prevention and/or treatment of CD154-associated autoimmune and inflammatory diseases. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Phase Transitions above the Yrast Line in {sup 154}Dy

    Energy Technology Data Exchange (ETDEWEB)

    Ma, W. C. [Mississippi State University, Mississippi State, Mississippi 39762 (United States); Martin, V. [Analisis Numerico, Facultad de Informatica, Universidad Politecnica de Madrid, E-28660 Madrid, (Spain); Khoo, T. L. [Argonne National Laboratory, Argonne, Illinois 60439 (United States); Lauritsen, T. [Argonne National Laboratory, Argonne, Illinois 60439 (United States); Egido, J. L. [Departamento de Fisica Teorica C-XI, Universidad Autonoma de Madrid, E-28049 Madrid, (Spain); Ahmad, I. [Argonne National Laboratory, Argonne, Illinois 60439 (United States); Bhattacharyya, P. [Purdue University, West Lafayette, Indiana 47907 (United States); Carpenter, M. P. [Argonne National Laboratory, Argonne, Illinois 60439 (United States); Daly, P. J. [Purdue University, West Lafayette, Indiana 47907 (United States); Grabowski, Z. W. [Purdue University, West Lafayette, Indiana 47907 (United States)] (and others)

    2000-06-26

    Spectra of the E2 quasicontinuum {gamma} rays feeding different spin regions of the {sup 154}Dy yrast line have been extracted. These are compared with corresponding theoretical spectra obtained by numerical simulations based on temperature-dependent Hartree-Fock theory, with thermal shape fluctuations. In this manner, different regions of the spin-energy plane can be examined. The results support the predictions of a smeared-out phase transition at high spin above the yrast line. (c) 2000 The American Physical Society.

  3. Platelet-derived CD154: ultrastructural localization and clinical correlation in organ transplantation

    Science.gov (United States)

    Charafeddine, Ali H.; Kim, Eugenia J.; Maynard, Dawn M.; Yi, Hong; Weaver, Timothy A.; Gunay-Aygun, Meral; Russell, Maria; Gahl, William A.; Kirk, Allan D.

    2012-01-01

    CD154 is an immunostimulatory ligand for CD40 that markedly influences alloimmunity. Its presence in platelets suggests that its release and subsequent immune effects are driven by trauma and thus could be relevant following organ transplantation. However, the release of platelet derived CD154 and its consequences have not been investigated in a clinical transplant setting. To better characterize the relationship between platelet activation and CD154 release, we investigated CD154 release by platelets obtained from normal individuals, and patients with two genetic defects that influence platelet granule development. Using these unique patient populations and immune-electron microscopy, we confirmed that CD154 was an alpha granule and not a cell surface protein, and thereafter optimized the methods for its in vivo measurement in humans. We then investigated plasma CD154 levels in kidney and liver transplant recipients and found no evidence that CD154 levels fluctuated systemically as a result of kidney or liver transplant procedures. Paradoxically, we found that kidney transplant patients had significantly lower systemic CD154 levels during episodes of rejection. These data suggest that the immune effects of CD154 are likely mediated through local and not systemic mechanisms, and discourage the use of CD154 as a peripheral biomarker in organ transplantation. PMID:22947105

  4. Crystal structures of two mononuclear complexes of terbium(III) nitrate with the tripodal alcohol 1,1,1-tris-(hy-droxy-meth-yl)propane.

    Science.gov (United States)

    Gregório, Thaiane; Giese, Siddhartha O K; Nunes, Giovana G; Soares, Jaísa F; Hughes, David L

    2017-02-01

    Two new mononuclear cationic complexes in which the TbIII ion is bis-chelated by the tripodal alcohol 1,1,1-tris-(hy-droxy-meth-yl)propane (H3LEt, C6H14O3) were prepared from Tb(NO3)3·5H2O and had their crystal and mol-ecular structures solved by single-crystal X-ray diffraction analysis after data collection at 100 K. Both products were isolated in reasonable yields from the same reaction mixture by using different crystallization conditions. The higher-symmetry complex dinitratobis[1,1,1-tris-(hy-droxy-meth-yl)propane]-terbium(III) nitrate di-meth-oxy-ethane hemisolvate, [Tb(NO3)2(H3LEt)2]NO3·0.5C4H10O2, 1, in which the lanthanide ion is 10-coordinate and adopts an s-bicapped square-anti-prismatic coordination geometry, contains two bidentate nitrate ions bound to the metal atom; another nitrate ion functions as a counter-ion and a half-mol-ecule of di-meth-oxy-ethane (completed by a crystallographic twofold rotation axis) is also present. In product aqua-nitratobis[1,1,1-tris-(hy-droxy-meth-yl)propane]-terbium(III) dinitrate, [Tb(NO3)(H3LEt)2(H2O)](NO3)2, 2, one bidentate nitrate ion and one water mol-ecule are bound to the nine-coordinate terbium(III) centre, while two free nitrate ions contribute to charge balance outside the tricapped trigonal-prismatic coordination polyhedron. No free water mol-ecule was found in either of the crystal structures and, only in the case of 1, di-meth-oxy-ethane acts as a crystallizing solvent. In both mol-ecular structures, the two tripodal ligands are bent to one side of the coordination sphere, leaving room for the anionic and water ligands. In complex 2, the methyl group of one of the H3LEt ligands is disordered over two alternative orientations. Strong hydrogen bonds, both intra- and inter-molecular, are found in the crystal structures due to the number of different donor and acceptor groups present.

  5. The role of CD154 in organ transplant rejection and acceptance.

    OpenAIRE

    Kirk, A. D.; Blair, P.J.; Tadaki, D K; Xu, H; Harlan, D. M.

    2001-01-01

    CD154 plays a critical role in determining the outcome of a transplanted organ. This simple statement is amply supported by experimental evidence demonstrating that anti-CD154 antibodies are potent inhibitors of allograft rejection in many rigorous transplant models. Unfortunately, despite intensive investigation over the past ten years, the precise mechanisms by which antibodies against CD154 exert their anti-rejection effects have remained less obvious. Though originally classified with ref...

  6. Cloning, sequence analysis and expression of ovine CD154 (CD40 ligand).

    Science.gov (United States)

    Oledzka, Gabriela; Li, Bo; William Kay, Graham; Chomicz, Lidia; Stankiewicz, Miroslaw

    2007-02-01

    The CD154 (CD40 ligand) molecule is a member of the tumor necrosis factor (TNF) family and plays an important role in the interaction between antigen-specific lymphocytes and antigen-presenting cells. In this study, reverse transcription-PCR cloning was used to derive the sequence encoding ovine CD154. Sequence analysis of the cloned CD154 gene showed a similarity of 97%, 89%, and 88% with the bovine, porcine and human sequences, respectively, at the nucleic acid level. The deduced amino acid sequence for the ovine CD154 shared 97%, 91%, and 87% similarity with the CD154 protein of bovine, porcine and human. The cysteine residues characteristic of the TNF family and N-linked glycosylation sites are conserved although one of the cysteine residues (Cys9) appeared only in ovine CD154. The isolated CD154 sequence was expressed as a mature protein in Chinese hamster ovary (CHO) cells. The analysis of expression of ovine CD154 in mammalian cells by Western blot confirmed the cross reactivity with anti-CD154 antibody.

  7. Polymorphisms at Amino Acid Residues 141 and 154 Influence Conformational Variation in Ovine PrP

    Directory of Open Access Journals (Sweden)

    Sujeong Yang

    2014-01-01

    Full Text Available Polymorphisms in ovine PrP at amino acid residues 141 and 154 are associated with susceptibility to ovine prion disease: Leu141Arg154 with classical scrapie and Phe141Arg154 and Leu141His154 with atypical scrapie. Classical scrapie is naturally transmissible between sheep, whereas this may not be the case with atypical scrapie. Critical amino acid residues will determine the range or stability of structural changes within the ovine prion protein or its functional interaction with potential cofactors, during conversion of PrPC to PrPSc in these different forms of scrapie disease. Here we computationally identified that regions of ovine PrP, including those near amino acid residues 141 and 154, displayed more conservation than expected based on local structural environment. Molecular dynamics simulations showed these conserved regions of ovine PrP displayed genotypic differences in conformational repertoire and amino acid side-chain interactions. Significantly, Leu141Arg154 PrP adopted an extended beta sheet arrangement in the N-terminal palindromic region more frequently than the Phe141Arg154 and Leu141His154 variants. We supported these computational observations experimentally using circular dichroism spectroscopy and immunobiochemical studies on ovine recombinant PrP. Collectively, our observations show amino acid residues 141 and 154 influence secondary structure and conformational change in ovine PrP that may correlate with different forms of scrapie.

  8. Increased T cell expression of CD154 (CD40-ligand) in multiple sclerosis

    DEFF Research Database (Denmark)

    Jensen, J; Krakauer, M; Sellebjerg, F

    2001-01-01

    CD154 (CD40-ligand, gp39), expressed on activated T cells, is crucial in T cell-dependent immune responses and may be involved in the pathogenesis of multiple sclerosis (MS). We studied cerebro-spinal fluid and peripheral blood T cell expression of CD154 in MS by flow cytometry. Patients with sec......CD154 (CD40-ligand, gp39), expressed on activated T cells, is crucial in T cell-dependent immune responses and may be involved in the pathogenesis of multiple sclerosis (MS). We studied cerebro-spinal fluid and peripheral blood T cell expression of CD154 in MS by flow cytometry. Patients...

  9. The response behavior of PPy-DB18C6 electrode to terbium(III in acetonitrile and its thermodynamic application

    Directory of Open Access Journals (Sweden)

    Mohammad Hossein Arbab Zavar

    2016-11-01

    Full Text Available Polypyrrole modified electrode prepared by electropolymerization of pyrrole in the presence of a complexing ligand, dibenzo-18-crown-6(DB18C6, was prepared and investigated as a Tb3+-selective electrode in acetonitrile. The potentiometric response of the electrode was linear within the Tb3+ concentration range 1 × 10−5–1 × 10−2 M with a Nernstian slope of 20.9 mVdecade−1 in AN. The electrode was applied to study the complexation of the terbium(III ion in acetonitrile with such other basic aprotic solvent molecules (D as dimethyl sulfoxide, N,N-dimethyl formamide, propylene carbonate and pyridine. The successive complex formation constant (βi and Gibbs energies of transfer (ΔGtr of Tb3+ in AN in relation to such D were obtained.

  10. Luminescence and Magnetic Properties of Two Three-Dimensional Terbium and Dysprosium MOFs Based on Azobenzene-4,4′-Dicarboxylic Linker

    Directory of Open Access Journals (Sweden)

    Belén Fernández

    2016-02-01

    Full Text Available We report the in situ formation of two novel metal-organic frameworks based on terbium and dysprosium ions using azobenzene-4,4′-dicarboxylic acid (H2abd as ligand, synthesized by soft hydrothermal routes. Both materials show isostructural three-dimensional networks with channels along a axis and display intense photoluminescence properties in the solid state at room temperature. Textural properties of the metal-organic frameworks (MOFs have been fully characterized although no appreciable porosity was obtained. Magnetic properties of these materials were studied, highlighting the dysprosium material displays slightly frequency-dependent out of phase signals when measured under zero external field and under an applied field of 1000 Oe.

  11. Regiospecific synthesis of 15-(4-[{sup 123}I]iodophenyl)pentadecanoic acid-IPPA via methyl 15-(4-trimethylstannylphenyl)pentadecanoate

    Energy Technology Data Exchange (ETDEWEB)

    Culbert, P.A. [Glaxo Wellcome Inc., Mississauga, ON (Canada); Jianming Lu; Adam, M.J. [TRIUMF, Vancouver, BC (Canada)

    1997-06-01

    The synthesis of methyl 15-(4-trimethylstannylphenyl)pentadecanoate (p-SnPPA), a precursor for the regiospecific production of 15-(4-[{sup 123}I]-iodophenyl)pentadecanoic acid, is described. The stannylated precursor is synthesized in six steps from 4-bromophenylacetylene in an overall yield of 16%. p-SnPPA reacts with N.C.A. [{sup 123}I]NaI in the presence of peracetic acid to yield IPPA in 62% radiochemical yield following hydrolysis. (author).

  12. Luminescent europium and terbium complexes of dipyridoquinoxaline and dipyridophenazine ligands as photosensitizing antennae: structures and biological perspectives.

    Science.gov (United States)

    Dasari, Srikanth; Patra, Ashis K

    2015-12-14

    The europium(III) and terbium(III) complexes, namely [Eu(dpq)(DMF)2(NO3)3] (1), [Eu(dppz)2(NO3)3] (2), [Tb(dpq)(DMF)2Cl3] (3), and [Tb(dppz)(DMF)2Cl3] (4), where dipyrido[3,2-d:2',3'-f]quinoxaline (dpq in 1 and 3), dipyrido[3,2-a:2',3'-c]phenazine (dppz in 2 and 4) and N,N'-dimethylformamide (DMF) have been isolated, characterized from their physicochemical data, luminescence studies and their interaction with DNA, serum albumin protein and photo-induced DNA cleavage activity are studied. The X-ray crystal structures of complexes 1-4 show discrete mononuclear Ln(3+)-based structures. The Eu(3+) in [Eu(dpq)(DMF)2(NO3)3] (1) and [Eu(dppz)2(NO3)3] (2) as [Eu(dppz)2(NO3)3]·dppz (2a) adopts a ten-coordinated bicapped dodecahedron structure with a bidentate N,N-donor dpq ligand, two DMF and three NO3(-) anions in 1 and two bidentate N,N-donor dppz ligands and three NO3(-) anions in 2. Complexes 3 and 4 show a seven-coordinated mono-capped octahedron structure where Tb(3+) contains bidentate dpq/dppz ligands, two DMF and three Cl(-) anions. The complexes are highly luminescent in nature indicating efficient photo-excited energy transfer from the dpq/dppz antenna to Ln(3+) to generate long-lived emissive excited states for characteristic f → f transitions. The time-resolved luminescence spectra of complexes 1-4 show typical narrow emission bands attributed to the (5)D0 → (7)F(J) and (5)D4 → (7)F(J) f-f transitions of Eu(3+) and Tb(3+) ions respectively. The number of inner-sphere water molecules (q) was determined from luminescence lifetime measurements in H2O and D2O confirming ligand-exchange reactions with water in solution. The complexes display significant binding propensity to the CT-DNA giving binding constant values in the range of 1.0 × 10(4)-6.1 × 10(4) M(-1) in the order 2, 4 (dppz) > 1, 3 (dpq). DNA binding data suggest DNA groove binding with the partial intercalation nature of the complexes. All the complexes also show binding propensity (K(BSA)

  13. 46 CFR 154.650 - Cargo tank and process pressure vessel welding.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Cargo tank and process pressure vessel welding. 154.650... Equipment Construction § 154.650 Cargo tank and process pressure vessel welding. (a) Cargo tank and process pressure vessel welding must meet Subpart 54.05 and Part 57 of this chapter. (b) Welding consumables used...

  14. 32 CFR 536.154 - Claims involving tortfeasors other than nonappropriated fund employees: NAFI risk management...

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 3 2010-07-01 2010-07-01 true Claims involving tortfeasors other than nonappropriated fund employees: NAFI risk management program (RIMP) claims. 536.154 Section 536.154 National... nonappropriated fund employees: NAFI risk management program (RIMP) claims. The risk management program (RIMP) is...

  15. Elevated serum levels of soluble CD154 in children with juvenile idiopathic arthritis

    Directory of Open Access Journals (Sweden)

    Zeft Andrew S

    2008-05-01

    Full Text Available Abstract Objective Cytokines play important roles in mediating inflammation in autoimmunity. Several cytokines are elevated in serum and synovial fluid samples from children with Juvenile Idiopathic Arthritis (JIA. Soluble CD154 (sCD154 is elevated in other autoimmune disorders, but has not been characterized in JIA. Our objectives were to determine if sCD154 is elevated in JIA, and to examine correlations between sCD154 and other inflammatory cytokines. Methods Serum from 77 children with JIA and 81 pediatric controls was analyzed for interleukin (IL1β, IL2, IL4, IL5, IL6, IL8, IL10, IL12, IL13, sCD154, interferon-γ (IFNγ, soluble IL2 receptor (sIL2R, and tumor necrosis factor-α (TNFα, using the Luminex Multi-Analyte Profiling system. Differences in levels of cytokines between cases and controls were analyzed. Logistic regression was also performed. Results sCD154 was significantly elevated in cases compared to controls (p Conclusion Serum levels of sCD154, IL1β, IL6, IL8, sIL2R and TNFα are elevated in most JIA subtypes, suggesting a major role for sCD154, and these cytokines and cytokine receptors in the pathogenesis of JIA.

  16. 46 CFR 154.1730 - Ethylene oxide: Loading and off loading.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Ethylene oxide: Loading and off loading. 154.1730... Operating Requirements § 154.1730 Ethylene oxide: Loading and off loading. (a) The master shall ensure that before ethylene oxide is loaded into a cargo tank: (1) The tank is thoroughly clean, dry, and free of...

  17. 21 CFR 520.154b - Bacitracin methylene disalicylate and streptomycin sulfate powder.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Bacitracin methylene disalicylate and streptomycin sulfate powder. 520.154b Section 520.154b Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF... bacterial enteritis caused by pathogens susceptible to bacitracin and streptomycin such as Escherichia coli...

  18. 7 CFR 1900.154 - Determining the need for special handling.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 12 2010-01-01 2010-01-01 false Determining the need for special handling. 1900.154 Section 1900.154 Agriculture Regulations of the Department of Agriculture (Continued) RURAL HOUSING... OF AGRICULTURE PROGRAM REGULATIONS GENERAL Processing and Servicing FmHA or Its Successor Agency...

  19. 46 CFR 154.701 - Cargo pressure and temperature control: General.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Cargo pressure and temperature control: General. 154.701... CARGOES SAFETY STANDARDS FOR SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES Design, Construction and Equipment Cargo Pressure and Temperature Control § 154.701 Cargo pressure and temperature control: General...

  20. 46 CFR 154.1375 - Readout for temperature measuring device: Marking.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Readout for temperature measuring device: Marking. 154... DANGEROUS CARGOES SAFETY STANDARDS FOR SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES Design, Construction and Equipment Instrumentation § 154.1375 Readout for temperature measuring device: Marking. Each...

  1. 17 CFR 230.154 - Delivery of prospectuses to investors at the same address.

    Science.gov (United States)

    2010-04-01

    ... investors at the same address. 230.154 Section 230.154 Commodity and Securities Exchanges SECURITIES AND... prospectuses to investors at the same address. (a) Delivery of a single prospectus. If you must deliver a... all of the following conditions are met: (1) The investor has the same last name as the other...

  2. The relationship between hepatic immunoglobulin production and CD154 expression in chronic liver diseases.

    Science.gov (United States)

    Mayo, Marlyn J; Mosby, James M; Jeyarajah, Rohan; Combes, Burton; Khilnani, Smina; Al-halimi, Maha; Handem, Iorna; Grammer, Amrie C; Lipsky, Peter E

    2006-03-01

    CD40-CD154 is a receptor-ligand pair that provides key communication signals between cells of the adaptive immune system in states of inflammation and autoimmunity. The CD40 receptor is expressed constitutively on B lymphocytes, for which it provides important signals regulating clonal expansion and antibody production. CD154 is a member of the tumor necrosis factor superfamily, which is primarily expressed by activated T cells. Because many chronic liver diseases are characterized by lymphocytic infiltration of the liver and several have increased immunoglobulin (Ig) production, the role of CD40-CD154 in hepatic Ig production was investigated in patients with primary biliary cirrhosis (PBC), primary sclerosing cholangitis, autoimmune hepatitis (AIH), hepatitis C, hepatitis B, alcoholic and non-alcoholic steatohepatitis, as well as normal controls. Soluble CD154 levels in the serum were found to be no different in chronic liver diseases vs normal controls. Likewise, CD154 mRNA levels in peripheral blood mononuclear cells did not differ. However, mRNA for CD154 was significantly increased in the liver of individuals with PBC and AIH as compared with the other groups. The quantity of CD154 mRNA in the liver correlated positively with the quantity of mRNA for secretory Ig. These findings suggest that CD40-CD154 signals may be involved in Ig production within the liver of autoimmune liver diseases.

  3. Allospecific CD154+ T-cells associate with rejection risk after pediatric liver transplantation

    Science.gov (United States)

    AshokKumar, Chethan; Talukdar, Anjan; Sun, Qing; Higgs, Brandon W; Janosky, Janine; Wilson, Patrick; Mazariegos, George; Jaffe, Ronald; Demetris, Anthony; Dobberstein, Jennifer; Soltys, Kyle; Bond, Geoffrey; Thomson, Angus; Zeevi, Adriana; Sindhi, Rakesh

    2010-01-01

    Antigen-specific T-cells, which express CD154 rapidly, but remain untested in alloimmunity, were measured with flow cytometry in 16-hour MLR of 58 identically-immunosuppressed children with liver transplantation (LTx), to identify Rejectors (who had experienced biopsy-proven rejection within 60 days post-transplantation). Thirty one children were sampled once, cross-sectionally. Twenty seven children were sampled longitudinally, pre-LTx, and at 1–60 and 61–200 days after LTx. Results were correlated with proliferative alloresponses measured by CFSE-dye dilution (n=23), and CTLA4, a negative T-cell costimulator, which antagonizes CD154-mediated effects (n=31). In cross-sectional observations, logistic regression and leave-one-out cross-validation identified donor-specific, CD154+T-cytotoxic (Tc)-memory cells as best associated with rejection outcomes. In the longitudinal cohort, 1) the association between CD154+Tc-memory cells and rejection outcomes was replicated with sensitivity/specificity 92.3%/84.6% for observations at 1–60 days, and 2) elevated pre-LTx CD154+Tc-memory cell responses were associated with significantly increased incidence (p=0.02) and hazard (HR=7.355) of rejection in survival/proportional hazard analysis. CD154 expression correlated with proliferative alloresponses (r=0.835, p=7.1e-07), and inversely with CTLA4 expression of allospecific CD154+Tc-memory cells (r=−0.706, p=3.0e-05). Allospecific CD154+T-helper-memory cells, not CD154+Tc-memory, were inhibited by increasing Tacrolimus concentrations (p=0.026). Collectively, allospecific CD154+T-cells provide an estimate of rejection risk in children with LTx. PMID:18976293

  4. Spin Waves in Terbium

    DEFF Research Database (Denmark)

    Jensen, J.; Houmann, Jens Christian Gylden

    1975-01-01

    The selection rules for the linear couplings between magnons and phonons propagating in the c direction of a simple basal-plane hcp ferromagnet are determined by general symmetry considerations. The acoustic-optical magnon-phonon interactions observed in the heavy-rare-earth metals have been expl...... by Liu. The coupled magnon—transverse-phonon system for the c direction of Tb is analyzed in detail, and the strengths of the couplings are deduced as a function of wave vector by combining the experimental studies with the theory....

  5. Spin Waves in Terbium

    DEFF Research Database (Denmark)

    Jensen, J.; Houmann, Jens Christian Gylden; Bjerrum Møller, Hans

    1975-01-01

    The energies of spin waves propagating in the c direction of Tb have been studied by inelastic neutron scattering, as a function of a magnetic field applied along the easy and hard directions in the basal plane, and as a function of temperature. From a general spin Hamiltonian, consistent...... with the symmetry, we deduce the dispersion relation for the spin waves in a basal-plane ferromagnet. This phenomenological spin-wave theory accounts for the observed behavior of the magnon energies in Tb. The two q⃗-dependent Bogoliubov components of the magnon energies are derived from the experimental results...

  6. BRCA2 Mutations in 154 Finnish Male Breast Cancer Patients

    Directory of Open Access Journals (Sweden)

    Kirsi Syrjäkoski

    2004-09-01

    Full Text Available The etiology and pathogenesis of male breast cancer (MBC are poorly known. This is due to the fact that the disease is rare, and large-scale genetic epidemiologic studies have been difficult to carry out. Here, we studied the frequency of eight recurrent Finnish BRCA2 founder mutations in a large cohort of 154 MBC patients (65% diagnosed in Finland from 1967 to 1996. Founder mutations were detected in 10 patients (6.5%, eight of whom carried the 9346(-2 A>G mutation. Two novel mutations (4075 delGT and 5808 del5 were discovered in a screening of the entire BRCA2 coding region in 34 samples. However, these mutations were not found in the rest of the 120 patients studied. Patients with positive family history of breast and/or ovarian cancer were often BRCA2 mutation carriers (44%, whereas those with no family history showed a low frequency of involvement (3.6%; P < .0001. Finally, we found only one Finnish MBC patient with 999 dell, the most common founder mutation in Finnish female breast cancer (FBC patients, and one that explains most of the hereditary FBC and MBC cases in Iceland. The variation in BRCA2 mutation spectrum between Finnish MBC patients and FBC patients in Finland and breast cancer patients in Iceland suggests that modifying genetic and environmental factors may significantly influence the penetrance of MBC and FBC in individuals carrying germline BRCA2 mutations in some populations.

  7. AGR-2 Data Qualification Report for ATR Cycle 154B

    Energy Technology Data Exchange (ETDEWEB)

    Binh Pham; Jeff Einerson

    2014-01-01

    This report provides the data qualification status of Advanced Gas Reactor-2 (AGR-2) fuel irradiation experimental data from Advanced Test Reactor (ATR) Cycle 154B as recorded in the Nuclear Data Management and Analysis System (NDMAS). This is the last cycle of AGR-2 irradiation, as the test train was pulled from the ATR core during the outage portion of ATR Cycle 155A. The AGR-2 data streams addressed in this report include thermocouple (TC) temperatures, sweep gas data (flow rates including new Fission Product Monitoring (FPM) downstream flows from Fission Product Monitoring System (FPMS) detectors, pressure, and moisture content), and FPMS data (release rates and release-to-birth rate ratios [R/Bs]) for each of the six capsules in the AGR-2 experiment. The final data qualification status for these data streams is determined by a Data Review Committee (DRC) comprised of AGR technical leads, Sitewide Quality Assurance (QA), and NDMAS analysts. The Data Review Committee reviewed the data acquisition process, considered whether the data met the requirements for data collection as specified in QA-approved Very High Temperature Reactor (VHTR) data collection plans, examined the results of NDMAS data testing and statistical analyses, and confirmed the qualification status of the data as given in this report.

  8. CD154-CD40 interactions in the control of murine B cell hematopoiesis

    Science.gov (United States)

    Carlring, Jennifer; Altaher, Hala M.; Clark, Susan; Chen, Xi; Latimer, Sarah L.; Jenner, Tracey; Buckle, Anne-Marie; Heath, Andrew W.

    2011-01-01

    Interactions between CD40 and CD154 play a very important role in control of immune responses, including the delivery of T cell help to B cells and other APCs. Thus far, there has been no role postulated for CD40-CD154 interactions in hematopoiesis. We show here that CD40 is expressed on murine pro-B cells and that its ligation enhances pro-B cell proliferation in vitro and in vivo. In addition, CD154 mRNA is present in the BM. Moreover, we show that a deficiency in CD154 expression has effects on B cell hematopoiesis. Aged, CD154-deficient mice have significantly lower levels of B hematopoietic subsets downstream of pro-B cells in the BM. In addition, B lineage cells reconstitute more slowly following BMT into CD154-deficient recipients. We hypothesize that CD154 is expressed by radio-resistant cells in the BM and plays a role in fine-tuning B cell hematopoiesis. PMID:21330346

  9. A Role for CD154, the CD40 Ligand, in Granulomatous Inflammation.

    Science.gov (United States)

    Villeneuve, Julien; Desmoulière, Alexis; Dewitte, Antoine; Bordeau, Nelly; Costet, Pierre; Bassaganyas, Laia; Fricain, Jean-Christophe; Ripoche, Jean; Lepreux, Sébastien

    2017-01-01

    Granulomatous inflammation is a distinctive form of chronic inflammation in which predominant cells include macrophages, epithelioid cells, and multinucleated giant cells. Mechanisms regulating granulomatous inflammation remain ill-understood. CD154, the ligand of CD40, is a key mediator of inflammation. CD154 confers a proinflammatory phenotype to macrophages and controls several macrophagic functions. Here, we studied the contribution of CD154 in a mouse model of toxic liver injury with carbon tetrachloride and a model of absorbable suture graft. In both models, granulomas are triggered in response to endogenous persistent liver calcified necrotic lesions or by grafted sutures. CD154-deficient mice showed delayed clearance of carbon tetrachloride-induced liver calcified necrotic lesions and impaired progression of suture-induced granuloma. In vitro, CD154 stimulated phagocytosis of opsonized erythrocytes by macrophages, suggesting a potential mechanism for the altered granulomatous inflammation in CD154KO mice. These results suggest that CD154 may contribute to the natural history of granulomatous inflammation.

  10. The role of platelets CD40 ligand (CD154) in acute coronary syndromes.

    Science.gov (United States)

    Abu el-Makrem, Mona A; Mahmoud, Yehia Z; Sayed, Douaa; Nassef, Noussa M; Abd el-Kader, Samir S; Zakhary, Madiha; Ghazaly, Taghreed; Matta, Ragaa

    2009-12-01

    Despite of the proof of the biological function of CD154 on platelets, there has been little information about its role either in patients with stable angina or in those with acute coronary syndrome (ACS). This study aimed to investigate the expression of CD154 on platelets and its role in ACS. The study included 50 patients with ACS (24 patients with acute myocardial infarction (AMI) and 26 patients with unstable angina (UA)), 20 patients with stable angina (SA) and 18 healthy volunteers. CD154 and CD62 expression on platelets were analyzed by flow cytometry. Their relations to the clinical and laboratory data were assessed in the studied group. Patients with AMI and UA had higher levels of platelets CD154 and CD62 as compared to those with SA and among patients with AMI, UA and SA versus healthy volunteers. Platelets CD154 showed significant positive correlations with the studied pro-inflammatory markers (Ox-LDL, CRP and fibrinogen), segmental wall motion score and the studied risk factors. There were significant negative correlations between platelet CD154 and serum nitric oxide among patients. CD154 may be used as a marker of thrombo-embolic events. Nitric oxide may have an anti-atherogenic effect. There is an association between platelet activation and severity of coronary artery disease among patients with ACS.

  11. CD40/CD154 blockade inhibits dendritic cell expression of inflammatory cytokines but not costimulatory molecules.

    Science.gov (United States)

    Ferrer, Ivana R; Liu, Danya; Pinelli, David F; Koehn, Brent H; Stempora, Linda L; Ford, Mandy L

    2012-11-01

    Blockade of the CD40/CD154 pathway remains one of the most effective means of promoting graft survival following transplantation. However, the effects of CD40/CD154 antagonism on dendritic cell (DC) phenotype and functionality following transplantation remain incompletely understood. To dissect the effects of CD154/CD40 blockade on DC activation in vivo, we generated hematopoietic chimeras in mice that expressed a surrogate minor Ag (OVA). Adoptive transfer of OVA-specific CD4(+) and CD8(+) T cells led to chimerism rejection, which was inhibited by treatment with CD154 blockade. Surprisingly, CD154 antagonism did not alter the expression of MHC and costimulatory molecules on CD11c(+) DCs compared with untreated controls. However, DCs isolated from anti-CD154-treated animals exhibited a significant reduction in inflammatory cytokine secretion. Combined blockade of inflammatory cytokines IL-6 and IL-12p40 attenuated the expansion of Ag-specific CD4(+) and CD8(+) T cells and transiently inhibited the rejection of OVA-expressing cells. These results suggest that a major effect of CD154 antagonism in vivo is an impairment in the provision of signal three during donor-reactive T cell programming, as opposed to an impact on the provision of signal two. We conclude that therapies designed to target inflammatory cytokines during donor-reactive T cell activation may be beneficial in attenuating these responses and prolonging graft survival.

  12. A Role for CD154, the CD40 Ligand, in Granulomatous Inflammation

    Directory of Open Access Journals (Sweden)

    Julien Villeneuve

    2017-01-01

    Full Text Available Granulomatous inflammation is a distinctive form of chronic inflammation in which predominant cells include macrophages, epithelioid cells, and multinucleated giant cells. Mechanisms regulating granulomatous inflammation remain ill-understood. CD154, the ligand of CD40, is a key mediator of inflammation. CD154 confers a proinflammatory phenotype to macrophages and controls several macrophagic functions. Here, we studied the contribution of CD154 in a mouse model of toxic liver injury with carbon tetrachloride and a model of absorbable suture graft. In both models, granulomas are triggered in response to endogenous persistent liver calcified necrotic lesions or by grafted sutures. CD154-deficient mice showed delayed clearance of carbon tetrachloride-induced liver calcified necrotic lesions and impaired progression of suture-induced granuloma. In vitro, CD154 stimulated phagocytosis of opsonized erythrocytes by macrophages, suggesting a potential mechanism for the altered granulomatous inflammation in CD154KO mice. These results suggest that CD154 may contribute to the natural history of granulomatous inflammation.

  13. Patients with acute coronary syndromes express enhanced CD40 ligand/CD154 on platelets.

    Science.gov (United States)

    Garlichs, C D; Eskafi, S; Raaz, D; Schmidt, A; Ludwig, J; Herrmann, M; Klinghammer, L; Daniel, W G; Schmeisser, A

    2001-12-01

    To investigate whether CD40L/CD154 on platelets and soluble CD40L/CD154 may play a role in the inflammatory process of acute coronary syndromes. Observational study in a university hospital. 15 patients with acute myocardial infarction, 25 patients with unstable angina, 15 patients with stable angina, and 12 controls. CD40L/CD154 on platelets, P-selectin/CD62P on platelets, soluble CD40L/CD154 serum concentrations. Mean (SD) CD40L/CD154 expression on platelets was 6.2 (2.8) MFI (mean fluorescence intensity) in the infarct group, 11 (3.3) MFI in the unstable angina group (p angina group (p angina), and 3.2 (1.0) MFI in the controls (p angina; NS v stable angina). Soluble CD40L/CD154 concentration was 5.2 (1.1) ng/ml in the infarct group, 4.2 (0.7) ng/ml in the unstable angina group (p angina group (p angina), and 3.0 (0.5) ng/ml in the controls (p angina; NS v stable angina). At a six months follow up, there was lower expression of CD40L/CD154 on platelets in patients with unstable angina (12.3 (3.6) v 3.8 (1.2) MFI, p angina who needed redo coronary angioplasty (PTCA) or who had recurrence of angina were characterised by increased CD40L/CD154 expression on platelets compared with the remainder of the study group (recurrence of angina: 12.7 (3.2) v 9.7 (1.6) MFI, p angina and myocardial infarction. These findings suggest that CD40-CD40L/CD154 interactions may play a pathogenic role in triggering and propagation of acute coronary syndromes.

  14. 33 CFR 154.106 - Incorporation by reference: Where can I get a copy of the publications incorporated by reference...

    Science.gov (United States)

    2010-07-01

    ... approved for § 154.735. (2) NFPA 70, National Electrical Code, 2008, IBR approved for § 154.812. (h) Oil..., IBR approved for § 154.812. (f) National Electrical Manufacturers Association (NEMA), 1300 North 17th... the public. All approved material is available for inspection at the National Archives and Records...

  15. CD154 is a negative regulator of autoaggressive CD8+ T cells in type 1 diabetes

    OpenAIRE

    McGregor, Catrin M.; Schoenberger, Stephen P.; Green, E. Allison

    2004-01-01

    TNF/CD80 mice, a CD8+ T cell-mediated model for type 1 diabetes, transgenically express tumor necrosis factor α (TNF-α) and the costimulatory molecule CD80 in their pancreatic islets. Here we show that these molecules bypass the need for CD40–CD154 costimulatory interactions in activation of CD8+ T cells, allowing us to determine the role of CD40–CD154 signals in regulation of autoaggressive CD8+ T cells after their in vivo priming. TNF/CD80 CD154-deficient mice rapidly develop diabetes, wher...

  16. CD40 ligand (CD154) involvement in platelet transfusion reactions.

    Science.gov (United States)

    Sahler, J; Spinelli, S; Phipps, R; Blumberg, N

    2012-06-01

    Platelet transfusions are commonly used treatments that occasionally lead to adverse reactions. Clinical trials, in vitro and animal studies have been performed to try to understand the causes of such reactions. Multiple studies have shown that the supernatant fraction of platelet concentrates contain prothrombotic and pro-inflammatory mediators. The origin of these mediators was first ascribed to white blood cells contaminating the platelet preparation. However, the accumulation of bioactive mediators after leukoreduction focused attention on platelets themselves during storage. Numerous cytokines, chemokines and prostaglandins are released in stored platelet concentrates. We have focused on a powerful mediator called soluble CD40 ligand (sCD40L, formally known as CD154) as a seminal contributor to adverse reactions. sCD40L can bind and signal the surface receptor, CD40, which is present on various types of human cells including white blood cells, vascular cells and fibroblasts. Downstream results of sCD40L/CD40 signaling include pro-inflammatory cytokine and chemokine production, prothrombotic mediator release, adherence and transmigration of leukocytes to endothelium and other undesirable vascular inflammatory events. Increased plasma levels of sCD40L can be detected in conditions such as myocardial infarction, stroke, unstable angina, high cholesterol, or other cardiovascular conditions. In retrospective studies, correlations were made between increased sCD40L levels of platelet concentrates and adverse transfusion reactions. We hypothesize that transfusion of partially activated, CD40L-expressing platelets along with sCD40L into a recipient with damaged or dysfunctional vascular tissue results in a "double-hit", thus inciting inflammation and vascular damage in the recipient. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

  17. Enfoque terapéutico en 154 pacientes con acromegalia

    Directory of Open Access Journals (Sweden)

    Marcos P. Manavela

    2010-08-01

    Full Text Available La acromegalia es una enfermedad poco frecuente producida en más del 95% de los casos por un tumor hipofisario secretor de hormona de crecimiento (GH. Las manifestaciones clínicas están asociadas a síntomas locales por crecimiento del tumor o a las consecuencias orgánicas y metabólicas secundarias a la hipersecreción de GH. Debido a la alta morbilidad y mortalidad asociadas a la acromegalia, un tratamiento individualizado y optimizado para cada paciente es fundamental. Informamos el enfoque terapéutico de nuestro servicio de endocrinología en la atención de 154 pacientes con acromegalia. Utilizando criterios bioquímicos estrictos, con la cirugía logramos un 32% de remisión global, tasa relativamente baja debido fundamentalmente a que la mayor parte de los pacientes presentaban macroadenomas con un alto porcentaje de invasividad local. Con radioterapia complementaria o como tratamiento inicial se logró la remisión en el 65.4% de los pacientes irradiados. El 14.0% de los pacientes controlaron la enfermedad utilizando agonistas dopaminérgicos solos o combinados con otra droga, mientras que aquellos que utilizaron análogos de la somatostatina normalizaron los parámetros bioquímicos en un 45.7% de los casos. En conclusión, con los diferentes tratamientos utilizados obtuvimos el control de la acromegalia en el 55.2% de los casos, esperando optimizar el tratamiento de estos pacientes en la medida en que contemos con y tengamos acceso a nuevas herramientas terapéuticas.

  18. CD154: An Immunoinflammatory Mediator in Systemic Lupus Erythematosus and Rheumatoid Arthritis

    Science.gov (United States)

    Alaaeddine, Nada; Hassan, Ghada S.; Yacoub, Daniel; Mourad, Walid

    2012-01-01

    Systemic lupus erythematosus and rheumatoid arthritis are two major chronic inflammatory autoimmune diseases with significant prevalence rates among the population. Although the etiology of these diseases remains unresolved, several evidences support the key role of CD154/CD40 interactions in initiating and/or propagating these diseases. The discovery of new receptors (αIIbβ3, α5β1, and αMβ2) for CD154 has expanded our understanding about the precise role of this critical immune mediator in the physiopathology of chronic inflammatory autoimmune diseases in general, and in systemic lupus erythematosus and rheumatoid arthritis in particular. This paper presents an overview of the interaction of CD154 with its various receptors and outlines its role in the pathogenesis of systemic lupus erythematosus and rheumatoid arthritis. Moreover, the potential usefulness of various CD154-interfering agents in the treatment and prevention of these diseases is also discussed. PMID:22110533

  19. CD154: An Immunoinflammatory Mediator in Systemic Lupus Erythematosus and Rheumatoid Arthritis

    Directory of Open Access Journals (Sweden)

    Nada Alaaeddine

    2012-01-01

    Full Text Available Systemic lupus erythematosus and rheumatoid arthritis are two major chronic inflammatory autoimmune diseases with significant prevalence rates among the population. Although the etiology of these diseases remains unresolved, several evidences support the key role of CD154/CD40 interactions in initiating and/or propagating these diseases. The discovery of new receptors (αIIbβ3, α5β1, and αMβ2 for CD154 has expanded our understanding about the precise role of this critical immune mediator in the physiopathology of chronic inflammatory autoimmune diseases in general, and in systemic lupus erythematosus and rheumatoid arthritis in particular. This paper presents an overview of the interaction of CD154 with its various receptors and outlines its role in the pathogenesis of systemic lupus erythematosus and rheumatoid arthritis. Moreover, the potential usefulness of various CD154-interfering agents in the treatment and prevention of these diseases is also discussed.

  20. Abnormal CD40 Ligand (CD154) Expression in Human Immunodeficiency Virus-Infected Children

    Science.gov (United States)

    O'Gorman, Maurice R. G.; DuChateau, Brian; Paniagua, Mary; Hunt, Janelle; Bensen, Nicolas; Yogev, Ram

    2001-01-01

    The CD40 ligand (CD154), expressed primarily on activated CD4-positive T cells, is a costimulatory molecule involved in B-cell proliferation, germinal center formation, and immunoglobulin class switching. Since B-cell abnormalities including hypergammaglobulinemia and abnormal antibody-specific immune responses are prominent and occur early during the course of pediatric human immunodeficiency virus (HIV) infection, we measured the baseline levels and the induced levels of expression of CD154 on CD3+ CD8− (T helper cells) in HIV-infected children and uninfected children born to HIV-positive mothers. The percentage of CD154+ T helper cells activated in vitro and the level of CD154 expressed per T helper cell (mean fluorescent channel [MFC]) were significantly lower in the HIV-infected children than in the uninfected control group (77% ± 3% versus 89% ± 1%, respectively [P CD154 expressed on resting T helper cells in the HIV-infected group were not significantly different from the levels observed in the control group. In the HIV-infected children, the level of CD154 on activated T helper cells correlated with the level of immunodeficiency, as assessed by the CD4 T-cell levels (correlation coefficient [r] = 0.707, P = 0.003), but did not correlate with the viral load or with any of the serum immunoglobulin concentrations measured in this group of HIV-infected children. The baseline level of CD154 expressed on T helper cells did, however, correlate with the concentration of immunoglobulin A in serum. We conclude that HIV-infected children have impaired regulation of CD154 expression which may contribute to the immune dysregulation commonly observed. PMID:11687447

  1. The CD40-CD154 co-stimulation pathway mediates innate immune injury in adriamycin nephrosis.

    Science.gov (United States)

    Lee, Vincent W S; Qin, Xiaohong; Wang, Yiping; Zheng, Guoping; Wang, Ya; Wang, Ying; Ince, Jon; Tan, Thian K; Kairaitis, Lukas K; Alexander, Stephen I; Harris, David C H

    2010-03-01

    Blockade of CD40-CD40 ligand (CD154) interactions protects against renal injury in adriamycin nephropathy (AN) in immunocompetent mice. To investigate whether this protection relied on adaptive or cognate immunity, we tested the effect of CD40-CD154 blockade in severe combined immunodeficient (SCID) mice. SCID mice were divided into three groups: normal, AN + hamster IgG (ADR+IgG group) and AN + anti-CD154 antibody (MR1) (ADR+MR1 group). AN was induced by tail vein injection of 5.2 mg/kg of adriamycin (ADR). Hamster IgG (control Ab) or MR1 was administered intraperitoneally on days 5, 7, 9 and 11 after ADR injection. Histological and functional data were collected 4 weeks after ADR injection. In vitro experiments tested the effect of soluble and cell-bound CD154 co-cultured with CD40-expressing cells [macrophages, mesangial cells and renal tubular epithelial cells (RTEC)]. All experimental animals developed nephropathy. Compared to the ADR+IgG group, ADR+MR1 animals had significantly less histological injury (glomerulosclerosis and tubular atrophy) and functional injury (creatinine clearance). Kidneys of ADR+MR1 animals had significantly less macrophage infiltration than those of ADR+IgG animals. Interestingly, expression of CD40 and CD41 (a platelet-specific marker) was significantly less in ADR+MR1 animals compared to ADR+IgG animals. In vitro, CD154 blockade significantly attenuated upregulation of CCL2 gene expression by RTEC stimulated by activated macrophage-conditioned medium. In contrast, platelet-induced upregulation of macrophage and mesangial cell proinflammatory cytokine gene expression were not CD154-dependent. CD40-CD154 blockade has a significant innate renoprotective effect in ADR nephrosis. This is potentially due to inhibition of macrophage-derived soluble CD154.

  2. Deficiencies in the CD40 and CD154 receptor-ligand system reduce experimental lung metastasis.

    Science.gov (United States)

    Ingersoll, Susan Blaydes; Langer, Florian; Walker, Jamie M; Meyer, Todd; Robson, Theresa; Amaya, Mildred; Desai, Hina; Francis, John L; Amirkhosravi, Ali

    2009-01-01

    It is established that experimental metastasis requires platelet activity. CD154 expressed on and released from activated platelets induces an inflammatory response in endothelial cells and monocytes, including tissue factor production. CD154 has also been shown to activate platelets in vitro and promote thrombus stability in vivo. These CD154 effects may be mediated, at least in part, by CD40 signaling on platelets and vascular endothelial cells. We have previously demonstrated prolonged bleeding and PFA-100 closure times in mice deficient for Cd154 or its receptor Cd40. In the present study, we hypothesized that Cd40 and Cd154 promote lung tumor formation in experimental metastasis in mice. We created mice doubly deficient in Cd40 and Cd154 (Dbl KO) and found them to be both fertile and viable. Injected tumor cells seeded poorly in mice deficient in Cd40 or Cd154, as well as Dbl KO, compared to wild-type mice. We sought to determine whether blood-borne Cd40 versus endothelial Cd40 contribute differentially to reduced experimental lung metastasis, as observed in Cd40 deficient mice. By bone marrow transplantation, we created mice deficient for Cd40 either in the blood compartment but not in the endothelium, or vice versa. We found that mice deficient in blood compartment Cd40 had fewer lung nodules compared to wild-type mice and mice deficient in endothelial Cd40. Our findings suggest an important contribution of the Cd40-Cd154 pathway to experimental lung metastasis. Furthermore, the data points to a selective role for peripheral blood cell Cd40 in this process.

  3. An integrated logic system for time-resolved fluorescent "turn-on" detection of cysteine and histidine base on terbium (III) coordination polymer-copper (II) ensemble.

    Science.gov (United States)

    Xue, Shi-Fan; Lu, Ling-Fei; Wang, Qi-Xian; Zhang, Shengqiang; Zhang, Min; Shi, Guoyue

    2016-09-01

    Cysteine (Cys) and histidine (His) both play indispensable roles in many important biological activities. An enhanced Cys level can result in Alzheimer's and cardiovascular diseases. Likewise, His plays a significant role in the growth and repair of tissues as well as in controlling the transmission of metal elements in biological bases. Therefore, it is meaningful to detect Cys and His simultaneously. In this work, a novel terbium (III) coordination polymer-Cu (II) ensemble (Tb(3+)/GMP-Cu(2+)) was proposed. Guanosine monophosphate (GMP) can self-assemble with Tb(3+) to form a supramolecular Tb(3+) coordination polymer (Tb(3+)/GMP), which can be suited as a time-resolved probe. The fluorescence of Tb(3+)/GMP would be quenched upon the addition of Cu(2+), and then the fluorescence of the as-prepared Tb(3+)/GMP-Cu(2+) ensemble would be restored again in the presence of Cys or His. By incorporating N-Ethylmaleimide and Ni(2+) as masking agents, Tb(3+)/GMP-Cu(2+) was further exploited as an integrated logic system and a specific time-resolved fluorescent "turn-on" assay for simultaneously sensing His and Cys was designed. Meanwhile it can also be used in plasma samples, showing great potential to meet the need of practical application. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Synthesis and photoluminescence properties of cerium-doped terbium-yttrium aluminum garnet phosphor for white light-emitting diodes applications

    Science.gov (United States)

    Wang, Jun; Han, Tao; Lang, Tianchun; Tu, Mingjing; Peng, Lingling

    2015-11-01

    Cerium-doped terbium-yttrium aluminum garnet phosphors were synthesized using the solid-state reaction method. The crystalline phase, morphology, and photoluminescence properties were characterized by x-ray diffraction (XRD), scanning electron microscope (SEM), and fluorescence spectrophotometer, respectively. The XRD results indicate that with an increase of the amount of x (Tb3+), all of the samples have a pure garnet crystal structure without secondary phases. The SEM images reveal that the samples are composed of sphere-like crystallites, which exhibit different degrees of agglomeration. The luminescent properties of Ce ions in )Al5O12∶Ce0.1 have been studied, and it was found that the emission band shifted toward a longer wavelength. The redshift is attributed to the lowering of the 5d energy level centroid of Ce, which can be explained by the nephelauxetic effect and compression effect. These phosphors were coated on blue light-emitting diode (LED) chips to fabricate white light-emitting diodes (WLEDs), and their color-rendering indices, color temperatures, and luminous efficiencies were measured. As a consequence of the addition of Tb, the blue LED pumped )Al5O12∶Ce0.1 phosphors WLEDs showed good optical properties.

  5. Study on the fluorescent enhancement effect in terbium-gadolinium-protein-sodium dodecyl benzene sulfonate system and its application on sensitive detection of protein at nanogram level.

    Science.gov (United States)

    Sun, Changxia; Yang, Jinghe; Wu, Xia; Liu, Shufang; Su, Benyu

    2004-08-01

    The co-luminescence effect in a terbium-gadolinium-protein-sodium dodecyl benzene sulfonate (SDBS) system is reported here. Based on it, the sensitive quantitative analysis of protein at nanogram levels is established. The co-luminescence mechanism is studied using fluorescence, resonance light scattering (RLS), absorption spectroscopy and NMR measurement. It is considered that protein could be unfolded by SDBS, then a efficacious intramolecular fluorescent energy transfer occurs from unfolded protein to rare earth ions through SDBS acting as a "transfer bridge" to enhance the emission fluorescence of Tb3+ in this ternary complex of Tb-SDBS-BSA, where energy transfer from protein to SDBS by aromatic ring stacking is the most important step. Cooperating with the intramolecular energy transfer above is the intermolecular energy transfer between the simultaneous existing complexes of both Tb3+ and Gd3+. The fluorescence quantum yield is increased by an energy-insulating sheath, which is considered to be another reason for the resulting enhancement of the fluorescence. Förster theory is used to calculate the distribution of enhancing factors and has led to a greater understanding of the mechanisms of energy transfer.

  6. [Studies on luminescence properties of seven ternary complexes of terbium with 1,10-phenanthroline and benzoic acid and its derivatives].

    Science.gov (United States)

    Gao, Zhi-hua; Wang, Shu-ping; Liu, Cui-ge; Ma, Rui-xia; Wang, Rui-fen

    2006-04-01

    Seven ternary complexes of Tb(III) were synthesized with benzoic acid (BA), o-, m-, p-methylbenzoic acid (o-MBA, m-MBA, p-MBA), and o-, m-, p-methoxybenzoic acid (o-MOBA, m-MOBA, p-MOBA) as the first ligand, and 1,10-phenanthroline (phen) as the second ligand. The content of C, H and N were measured by using a Flash-EA model 1112 elemental analyzer. Excitation and luminescence spectra of the title solid complexes were recorded by using a Hitachi F-4500 fluorescence spectrophotometer at room temperature. The effects of different varieties and different positions of replacing benzoic acid as the first ligand on fluorescence properties of the ternary complexes of terbium were discussed. The results indicated that the intensity of 5D4-->7F6 (489 nm) and 5D4-->7F5 (545 nm) of substituting benzoic acid complexes was stronger than benzoic acid. Three ternary complexes of Tb(III) with o-, m-, p-methylbenzoic acid showed emission intensity in the consecution: Tb(o-MBA)3 phenMOBA)3phen x H2O>Tb(m-MOBA)3phen x H2O>Tb(p-MOBA)3 phen.

  7. [Effect of ICOS signaling on CD154/CD40 expressions in mice infected with Schistosoma japonicum].

    Science.gov (United States)

    Wang, Yu; Cai, Ru; Xia, Chao-ming

    2015-08-01

    To explore the effect of ICOS signaling on the CD154/CD40 expressions and immunopathology in mice infected with Schistosoma japonicum. ICOS transgenic (ICOS-Tg) mice and wildtype FVB/NJ mice were used as experimental schistosomiasis models. The expressions of CD154 and CD40 on splenocytes and on inflammatory cells around granulomatous infiltration of the liver in the mice infected with S. japonicuin were detected by flow cytometry and im- munohistochemical staining. HE staining was applied to observe the changes on the granulomatous of the mice liver. Compared with the wildtype FVB/NJ mice, the expressions of CD154 on CD4 T splenocytes and of CD40 on CD19' B splenocytes in the ICOS-Tg mice significantly increased in 12 and 16 weeks post-infection (all P CD154 on inflammatory cells around granulomatous infiltration in the liver of the ICOS-Tg mice were significantly higher than those of the wildtype FVB/NJ mice in 7, 12, 16 and 20 weeks post-infection (all P CD154/CD40 expressions, and may play an important role in the hepatic egg granuloma formation of schistosomiasis.

  8. Self-diffusion coefficients of the trivalent f-element ion series in dilute and moderately dilute aqueous solutions: A comparative study between europium, gadolinium, terbium and berkelium

    Science.gov (United States)

    Rafik, Besbes; Noureddine, Ouerfelli; Abderabbou, Abdelmanef; Habib, Latrous

    2010-03-01

    We have continued the studies on the trivalent ions of the 4f and 5f elements. In this paper, we compare the transport properties (self-diffusion coefficient) of the trivalent aquo ions over two ranges of concentrations (0 — 2×10-3M) and (2×10-3 — 1.5M). Self-diffusion coefficients, D, of the trivalent f-element aquo ion series have been determined in aqueous background electrolytes of Gd(NO3)3 and Nd(ClO4)3, at pH=2.5 (HNO3, HClO4) and at 25°C using the open-end capillary method (O.E.C.M.). This method measures the transportation time of ions across a fixed distance. In this paper, we complete a measurement of self-diffusion coefficient for terbium. We optimized the pH to avoid hydrolysis, ion-pairing and complexation of the trivalent 4f and 5f ions. The variation of D versus √C is not linear for dilute solutions (0 — 2×10-3M) and quasi-linear in moderate concentrations (C<=1.5 M). Similar behavior was observed for Tb, as compared with those for Bk, Eu and Gd. We complete the comparison variation of D/D° versus √C for all studied 4f and 5f elements from concentration 0 to 1.5M and we obtained the same variation with √C for all studied elements. All 4f and 5f elements studied follow the Nernst-Hartley expression.

  9. Terbium-based time-gated Förster resonance energy transfer imaging for evaluating protein-protein interactions on cell membranes.

    Science.gov (United States)

    Lindén, Stina; Singh, Manish Kumar; Wegner, K David; Regairaz, Marie; Dautry, François; Treussart, François; Hildebrandt, Niko

    2015-03-21

    Fluorescence imaging of cells and subcellular compartments is an essential tool to investigate biological processes and to evaluate the development and progression of diseases. In particular, protein-protein interactions can be monitored by Förster resonance energy transfer (FRET) between two proximal fluorophores that are attached to specific recognition biomolecules such as antibodies. We investigated the membrane expression of E- and N-cadherins in three different cell lines used as model systems to study epithelial to mesenchymal transition (EMT) and a possible detection of circulating tumour cells (CTCs). EMT is a key process in cancer metastasis, during which epithelial markers (such as E-cadherin) are down-regulated in the primary tumour whereas mesenchymal markers (such as N-cadherin) are up-regulated, leading to enhanced cell motility, intravasation, and appearance of CTCs. Various FRET donor-acceptor pairs and protein recognition strategies were utilized, in which Lumi4-Tb terbium complexes (Tb) and different organic dyes were conjugated to several distinct E- and N-cadherin-specific antibodies. Pulsed excitation of Tb at low repetition rates (100 Hz) and time-gated (TG) imaging of both the Tb-donor and the dye-acceptor photoluminescence (PL) allowed efficient detection of the EMT markers as well as FRET in the case of sufficient donor-acceptor proximity. Efficient FRET was observed only between two E-cadherin-specific antibodies and further experiments indicated that these antibodies recognized the same E-cadherin molecule, suggesting a limited accessibility of cadherins when they are clustered at adherens junctions. The investigated Tb-to-dye FRET systems provided reduced photobleaching compared to the AlexaFluor 488-568 donor-acceptor pair. Our results demonstrate the applicability and advantages of Tb-based TG FRET for efficient and stable imaging of antibody-antibody interactions on different cell lines. They also reveal the limitations of

  10. A broad G protein-coupled receptor internalization assay that combines SNAP-tag labeling, diffusion-enhanced resonance energy transfer, and a highly emissive terbium cryptate acceptor

    Directory of Open Access Journals (Sweden)

    Angélique eLEVOYE

    2015-11-01

    Full Text Available Although G protein-coupled receptor (GPCR internalization has long been considered a major aspect of the desensitization process that tunes ligand responsiveness, internalization is also involved in receptor resensitization and signaling, as well as the ligand scavenging function of some atypical receptors. Internalization thus contributes to the diversity of GPCR-dependent signaling, and its dynamics and quantification in living cells has generated considerable interest. We developed a robust and sensitive assay to follow and quantify ligand-induced and constitutive GPCR internalization but also receptor recycling in living cells. This assay is based on diffusion-enhanced resonance energy transfer (DERET between cell surface GPCRs labeled with a luminescent terbium cryptate donor and a fluorescein acceptor present in the culture medium. GPCR internalization results in a quantifiable reduction of energy transfer. This method yields a high signal-to-noise ratio due to time-resolved measurements. For various GPCRs belonging to different classes, we demonstrated that constitutive and ligand-induced internalization could be monitored as a function of time and ligand concentration, thus allowing accurate quantitative determination of kinetics of receptor internalization but also half-maximal effective or inhibitory concentrations of compounds. In addition to its selectivity and sensitivity, we provided evidence that DERET-based internalization assay is particularly suitable for characterizing biased ligands. Furthermore, the determination of a Z’-factor value of 0.45 indicates the quality and suitability of DERET-based internalization assay for high-throughput screening (HTS of compounds that may modulate GPCRs internalization.

  11. 46 CFR 154.540 - Quick-closing shut-off valves: Emergency shut-down system.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Quick-closing shut-off valves: Emergency shut-down... shut-down system. The quick-closing shut-off valves under §§ 154.530, 154.532, and 154.538 must have an emergency shut-down system that: (a) Closes all the valves; (b) Is actuated by a single control in at least...

  12. Novel insights into anti-CD40/CD154 immunotherapy in transplant tolerance.

    Science.gov (United States)

    Pinelli, David F; Ford, Mandy L

    2015-01-01

    Since the discovery of the CD40-CD154 costimulatory pathway and its critical role in the adaptive immune response, there has been considerable interest in therapeutically targeting this interaction with monoclonal antibodies in transplantation. Unfortunately, initial promise in animal models gave way to disappointment in clinical trials following a number of thromboembolic complications. However, recent mechanistic studies have identified the mechanism of these adverse events, as well as detailed a myriad of interactions between CD40 and CD154 on a wide variety of immune cell types and the critical role of this pathway in generating both humoral and cell-mediated alloreactive responses. This has led to resurgence in interest and the potential resurrection of anti-CD154 and anti-CD40 antibodies as clinically viable therapeutic options.

  13. A hydrophobic patch surrounding Trp154 in human neuroserpin controls the helix F dynamics with implications in inhibition and aggregation

    Science.gov (United States)

    Ali, Mohammad Farhan; Kaushik, Abhinav; Kapil, Charu; Gupta, Dinesh; Jairajpuri, Mohamad Aman

    2017-02-01

    Neuroserpin (NS) mediated inhibition of tissue-type plasminogen activator (tPA) is important for brain development, synapse formation and memory. Aberrations in helix F and β-sheet A movement during inhibition can directly lead to epilepsy or dementia. Conserved W154 residue in a hydrophobic patch between helix F and β-sheet A is ideally placed to control their movement during inhibition. Molecular Dynamics (MD) simulation on wild type (WT) NS and its two variants (W154A and W154P) demonstrated partial deformation in helix F and conformational differences in strands 1A and 2A only in W154P. A fluorescence and Circular Dichroism (CD) analysis with purified W154 variants revealed a significant red-shift and an increase in α-helical content in W154P as compared to W154A and WT NS. Kinetics of tPA inhibition showed a decline in association rates (ka) for W154A as compared to WT NS with indication of complex formation. Appearance of cleaved without complex formation in W154P indicates that the variant acts as substrate due to conformational misfolding around helix F. Both the variants however showed increased rate of aggregation as compared to WT NS. The hydrophobic patch identified in this study may have importance in helix F dynamics of NS.

  14. Crystal structure of an eight-coordinate terbium(III ion chelated by N,N′-bis(2-hydroxybenzyl-N,N′-bis(pyridin-2-ylmethylethylenediamine (bbpen2− and nitrate

    Directory of Open Access Journals (Sweden)

    Thaiane Gregório

    2015-01-01

    Full Text Available The reaction of terbium(III nitrate pentahydrate in acetonitrile with N,N′-bis(2-hydroxybenzyl-N,N′-bis(pyridin-2-ylmethylethylenediamine (H2bbpen, previously deprotonated with triethylamine, produced the mononuclear compound [N,N′-bis(2-oxidobenzyl-κO-N,N′-bis(pyridin-2-ylmethyl-κNethylenediamine-κ2N,N′](nitrato-κ2O,O′terbium(III, [Tb(C28H28N4O2(NO3]. The molecule lies on a twofold rotation axis and the TbIII ion is eight-coordinate with a slightly distorted dodecahedral coordination geometry. In the symmetry-unique part of the molecule, the pyridine and benzene rings are both essentially planar and form a dihedral angle of 61.42 (7°. In the molecular structure, the N4O4 coordination environment is defined by the hexadentate bbpen ligand and the bidentate nitrate anion. In the crystal, a weak C—H...O hydrogen bond links molecules into a two-dimensional network parallel to (001.

  15. Barrier distribution from 28Si+154Sm quasielastic scattering: Coupling effects in the fusion process

    Directory of Open Access Journals (Sweden)

    Kaur Gurpreet

    2016-01-01

    Full Text Available Barrier distribution for the 28Si+154Sm system has been extracted from large angle quasielastic scattering measurement to investigate the role of various channel couplings on fusion dynamics. The coupled channel calculations, including the collective excitation of the target and projectile, are observed to reproduce the experimental BD rather well. It seems that the role of neutron transfer, relative to collective excitation, is in fact weak in the 28Si+154Sm system even though it has positive Q-value for neutron transfer channels.

  16. Tumor necrosis factor-α blockade treatment decreased CD154 (CD40-ligand expression in rheumatoid arthritis.

    Directory of Open Access Journals (Sweden)

    Chien-Hsueh Tung

    Full Text Available CD154 (commonly referred to as CD40-ligand is a critical T cell factor that participates in the pathogenesis of autoimmune and is over-expressed in rheumatoid arthritis (RA. TNF-α blockade treatment had dramatic efficacy in RA.To investigate whether TNF-α blockade treatment can inhibit CD154 expression in RA.Blood samples were collected from 33 patients with rheumatoid arthritis before and 3 months after TNF-α blockade treatment. Clinical serological data determined by standard assays and T cell CD154 expression levels determined by flow cytometry were statistically analyzed for these two time points.The percentage of CD154 expression on gated CD4+ T cells of PBMCs from RA patients after 3 months TNF-α blockade treatment was significantly lower than before treatment (2.94 ± 3.21% vs. 7.21 ± 5.64%; p = 0.0001. The disease activity and anti-CCP antibody levels were also significantly reduced after TNF-α blockade treatment. The CD154 expression levels were positively correlated with disease activity index DAS28, and CRP. The post-stimulated CD154 expression percentage of purified CD4+ T cells between baseline and after TNF-α blockade treatment was not significantly different (p = 0.221. Baseline CD154 levels were positively correlated with treatment-induced changes in DAS28 (p = 0.014; r2 = 0.187.TNF-α blockade treatment significantly decreased the CD154 expression on CD4+ T cells, disease activity and anti-CCP antibody simultaneously in RA patients. However TNF-α blockade did not impair T cell capacity to express CD154 after stimulation. These results suggest that decreased CD154 expression after TNF-α blockade may be due to decreased RA disease activity but not direct inhibition of CD154 responsiveness of T cells.

  17. Tumor necrosis factor-α blockade treatment decreased CD154 (CD40-ligand) expression in rheumatoid arthritis.

    Science.gov (United States)

    Tung, Chien-Hsueh; Lu, Ming-Chi; Lai, Ning-Sheng; Wu, Shu-Fen

    2017-01-01

    CD154 (commonly referred to as CD40-ligand) is a critical T cell factor that participates in the pathogenesis of autoimmune and is over-expressed in rheumatoid arthritis (RA). TNF-α blockade treatment had dramatic efficacy in RA. To investigate whether TNF-α blockade treatment can inhibit CD154 expression in RA. Blood samples were collected from 33 patients with rheumatoid arthritis before and 3 months after TNF-α blockade treatment. Clinical serological data determined by standard assays and T cell CD154 expression levels determined by flow cytometry were statistically analyzed for these two time points. The percentage of CD154 expression on gated CD4+ T cells of PBMCs from RA patients after 3 months TNF-α blockade treatment was significantly lower than before treatment (2.94 ± 3.21% vs. 7.21 ± 5.64%; p = 0.0001). The disease activity and anti-CCP antibody levels were also significantly reduced after TNF-α blockade treatment. The CD154 expression levels were positively correlated with disease activity index DAS28, and CRP. The post-stimulated CD154 expression percentage of purified CD4+ T cells between baseline and after TNF-α blockade treatment was not significantly different (p = 0.221). Baseline CD154 levels were positively correlated with treatment-induced changes in DAS28 (p = 0.014; r2 = 0.187). TNF-α blockade treatment significantly decreased the CD154 expression on CD4+ T cells, disease activity and anti-CCP antibody simultaneously in RA patients. However TNF-α blockade did not impair T cell capacity to express CD154 after stimulation. These results suggest that decreased CD154 expression after TNF-α blockade may be due to decreased RA disease activity but not direct inhibition of CD154 responsiveness of T cells.

  18. A microscopic study of deformation systematics in 154− 166Dy ...

    Indian Academy of Sciences (India)

    The Hartree–Bogoliubov (HB) framework of calculations has been applied for calculating various nuclear structure quantities for 154−166Dy mass chains. In this framework, the intrinsic quadrupole moments, the low-lying yrast states ( E 2 + and E 4 + ) and occupation numbers for various shell model orbits have been ...

  19. Dual function of the hemagglutinin H5 fused to chicken CD154 in a ...

    African Journals Online (AJOL)

    Dual function of the hemagglutinin H5 fused to chicken CD154 in a potential strategy of DIVA against avian influenza disease: preliminary study. AG Pose, ES Rodriguez, AC Mendez, JN Gomez, AV Redondo, ER Rodriguez, EMG Ramos, AA Gutierrez, MPR Molto, DG Roche, YS Ugalde, AM Lopez ...

  20. 40 CFR 154.5 - Burden of persuasion in determinations under this part.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Burden of persuasion in determinations... (CONTINUED) PESTICIDE PROGRAMS SPECIAL REVIEW PROCEDURES General Provisions § 154.5 Burden of persuasion in... principle that the burden of persuasion that a pesticide product is entitled to registration or continued...

  1. A microscopic study of deformation systematics in 154−166Dy ...

    Indian Academy of Sciences (India)

    A microscopic study of deformation systematics in 154−166Dy isotopes. AMITA DUA, ARUN BHARTI. ∗ and S K KHOSA. Department of Physics, University of Jammu, Jammu & Kashmir 180 006, India. ∗. Corresponding Author. E-mail: arunbharti 2003@yahoo.co.in. MS received 30 March 2006; revised 9 March 2007; ...

  2. 5 CFR 1201.154 - Time for filing appeal; closing record in cases involving grievance decisions.

    Science.gov (United States)

    2010-01-01

    ... 5 Administrative Personnel 3 2010-01-01 2010-01-01 false Time for filing appeal; closing record in... Allegations of Discrimination § 1201.154 Time for filing appeal; closing record in cases involving grievance... matter otherwise appealable to the Board must comply with the following time limits: (a) Where the...

  3. 32 CFR Appendix C to Part 154 - Tables for Requesting Investigations

    Science.gov (United States)

    2010-07-01

    ... the Award Forces Before appointment (after appointment for health professionals, chaplains, and attorneys, under conditions authorized by § 154.15(d) of this part). Naval Academy Midshipman, Military Academy Cadet, or Air Force Academy Cadet Enrollment To be initiated 90 days after entry. Reserve Officer...

  4. Characterization of human papillomavirus type 154 and tissue tropism of gammapapillomaviruses.

    Science.gov (United States)

    Ure, Agustín Enrique; Forslund, Ola

    2014-01-01

    The novel human papillomavirus type 154 (HPV154) was characterized from a wart on the crena ani of a three-year-old boy. It was previously designated as the putative HPV type FADI3 by sequencing of a subgenomic FAP amplicon. We obtained the complete genome by combined methods including rolling circle amplification (RCA), genome walking through an adapted method for detection of integrated papillomavirus sequences by ligation-mediated PCR (DIPS-PCR), long-range PCR, and finally by cloning of four overlapping amplicons. Phylogenetically, the HPV154 genome clustered together with members of the proposed species Gammapapillomavirus 11, and demonstrated the highest identity in L1 to HPV136 (68.6%). The HPV154 was detected in 3% (2/62) of forehead skin swabs from healthy children. In addition, the different detection sites of 62 gammapapillomaviruses were summarized in order to analyze their tissue tropism. Several of these HPV types have been detected from multiple sources such as skin, oral, nasal, and genital sites, suggesting that the gammapapillomaviruses are generalists with a broader tissue tropism than previously appreciated. The study expands current knowledge concerning genetic diversity and tropism among HPV types in the rapidly growing gammapapillomavirus genus.

  5. 33 CFR Appendix B to Part 154 - Standard Specification for Tank Vent Flame Arresters

    Science.gov (United States)

    2010-07-01

    ... be qualified in accordance with section IX of the ASME Code. 8.7The design of flame arresters shall... section VIII, Division 1, Pressure Vessels; section IX, Welding and Brazing Qualifications. 3.3... 1155 (incorporated by reference, see § 154.106), or section VIII, Division 1 of the ASME Boiler and...

  6. 32 CFR 154.8 - Types and scope of personnel security investigations.

    Science.gov (United States)

    2010-07-01

    ... in § 154.19(a) and other national directives, certain categories of duties, clearance, and access... Manager, S-2, Counterintelligence Specialist, Personnel Security Specialist, or Personnel Officer); or... “Personal Interview Conducted by (cite the duty assignment of the designated official (e.g., Commander...

  7. THE ANGULAR-MOMENTUM DEPENDENCE OF THE GIANT-DIPOLE RESONANCE IN DY-154

    NARCIS (Netherlands)

    NOORMAN, RF; BACELAR, JC; HARAKEH, MN; HESSELINK, WHA; HOFMANN, HJ; Kalantar-Nayestanaki, Nasser; VANSCHAGEN, JPS; STOLK, A; SUJKOWSKI, Z; DEVOIGT, MJA; VANDERWOUDE, A

    1994-01-01

    The statistical gamma-ray decay of the compound nucleus 154Dy* formed at an excitation energy of 69 MeV is studied in three angular-momentum windows [J] = 31,42 and 50h. The GDR strength function extracted from the data indicates a constant centroid energy for the resonance E(GDR) = 15.2 +/- 0.5

  8. CD154 Blockade Results in Transient Reduction in Theiler's Murine Encephalomyelitis Virus-Induced Demyelinating Disease

    OpenAIRE

    Howard, Laurence M.; Neville, Katherine L.; Haynes, Lia M.; Dal Canto, Mauro C.; Miller, Stephen D

    2003-01-01

    Transient CD154 blockade at the onset of Theiler's murine encephalomyelitis virus-induced demyelinating disease ameliorated disease progression for 80 days, reduced immune cell infiltration, and transiently increased viral loads in the central nervous system. Peripheral antiviral and autoimmune T-cell responses were normal, and disease severity returned to control levels by day 120.

  9. IL-2 and IL-15 regulate CD154 expression on activated CD4 T cells

    DEFF Research Database (Denmark)

    Skov, S; Bonyhadi, M; Odum, Niels

    2000-01-01

    activated CD4 T cells could respond to IL-2, or the related cytokine IL-15, by de novo CD154 production and expression without requiring an additional signal from CD3 and CD28. These results provide evidence that CD28 costimulation of CD4 T cells, through autocrine IL-2 production, maintains high levels...

  10. 38 CFR 17.154 - Dog-guides and equipment for blind.

    Science.gov (United States)

    2010-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 1 2010-07-01 2010-07-01 false Dog-guides and equipment... AFFAIRS MEDICAL Prosthetic, Sensory, and Rehabilitative Aids § 17.154 Dog-guides and equipment for blind... disability may be furnished a trained dog-guide. In addition, they may be furnished necessary travel expense...

  11. 32 CFR 154.35 - Personal data provided by the subject of the investigation.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 1 2010-07-01 2010-07-01 false Personal data provided by the subject of the... Investigations § 154.35 Personal data provided by the subject of the investigation. (a) To conduct the required investigation, it is necessary that the investigative agency be provided certain relevant data concerning the...

  12. 18 CFR 154.208 - Service of tariff filings on customers and other parties.

    Science.gov (United States)

    2010-04-01

    ... SCHEDULES AND TARIFFS Procedures for Changing Tariffs § 154.208 Service of tariff filings on customers and... customers and state regulatory commissions that have made a standing request for such service. (c) Within... section, service upon the designated recipient will be deemed service upon the customer or other party. (e...

  13. 30 CFR 250.154 - What identification signs must I display?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What identification signs must I display? 250... Facilities and Wells (does Not Include Modus) § 250.154 What identification signs must I display? (a) You... maintained in a legible condition. (1) You must display an identification sign that can be viewed from the...

  14. Selective steroid oxyfunctionalisation by CYP154C5, a bacterial cytochrome P450

    Science.gov (United States)

    2013-01-01

    Background Cytochrome P450 monooxygenases – able to regio- and stereoselectively hydroxylate non-activated carbon atoms – are important enzymes for the synthesis of valuable intermediates in the production of steroid hormones in the pharmaceutical industry. However, up to now only a few bacterial enzymes able to hydroxylate steroids have been reported. CYP154C5 from Nocardia farcinica IFM 10152, a bacterial P450 monooxygenase, was previously shown to convert testosterone to 16α-hydroxytestosterone. Since the hydroxylation at 16α-position is of special interest for the pharmaceutical industry, we have studied this enzyme in more detail to investigate its activity and selectivity in bioconversions of further steroids. Results CYP154C5 was coexpressed in Escherichia coli together with putidaredoxin and putidaredoxin reductase from Pseudomonas putida as redox partners for electron transfer and applied in bioconversions of various pregnanes and androstanes [pregnenolone (1), dehydroepiandrosterone (2), progesterone (3), androstenedione (4), testosterone (5) and nandrolone (6)]. Structure elucidation of the formed products revealed an exclusive regio- and stereoselectivity of CYP154C5, always yielding the corresponding 16α-hydroxylated steroids. Application of whole cells expressing the three components, P450, Pdx and PdR, in steroid biotransformations resulted in significantly higher conversions and total turnover numbers (TTN) compared to reactions using cell-free extracts. Additionally, considerably higher substrate loads (up to 15 mM) were tolerated by the whole-cell system. Furthermore, turnover numbers (TON) were determined for the six different steroids using whole cells. Thus, testosterone was found to be the worst substrate with a TON of only 0.8 μmol substrate consumed min-1 μmol-1 CYP154C5, while progesterone and pregnenolone were converted the fastest resulting in TON of 3.3 μmol substrate consumed min-1 μmol-1 CYP154C5. Conclusion CYP154C5

  15. CD154 induces p73 to overcome the resistance to apoptosis of chronic lymphocytic leukemia cells lacking functional p53

    NARCIS (Netherlands)

    Dicker, Frank; Kater, Arnon P.; Prada, Carlos E.; Fukuda, Tetsuya; Castro, Januario E.; Sun, Guizhen; Wang, Jean Y.; Kipps, Thomas J.

    2006-01-01

    Intravenous infusion of autologous chronic lymphocytic leukemia (CLL) cells transduced with an adenovirus encoding CD40-ligand (CD154) caused rapid reductions in leukemia-cell counts and lymphnode size. We hypothesized that CD40-ligation via CD154 sensitized CLL cells to death-receptor-mediated

  16. 27 CFR 31.154 - Records to be kept by alcohol beverage producers, processors, and bonded warehousemen.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Records to be kept by alcohol beverage producers, processors, and bonded warehousemen. 31.154 Section 31.154 Alcohol, Tobacco... alcohol beverage producers, processors, and bonded warehousemen. Wholesale liquor dealer operations...

  17. 33 CFR 154.T150 - Temporary suspension of requirements to permit support of deepwater horizon spill response.

    Science.gov (United States)

    2010-07-01

    ... requirements to permit support of deepwater horizon spill response. 154.T150 Section 154.T150 Navigation and... support of deepwater horizon spill response. (a) Applicability. This section applies to— (1) Any facility... support of the response to the Deepwater Horizon Spill of National Significance; and (2) Any facility...

  18. 17 CFR 1.54 - Contract market rules submitted to and approved or not disapproved by the Secretary of Agriculture.

    Science.gov (United States)

    2010-04-01

    ... submitted to and approved or not disapproved by the Secretary of Agriculture. 1.54 Section 1.54 Commodity... Secretary of Agriculture. Notwithstanding any provision of these rules, any bylaw, rule, regulation, or resolution of a contract market that was submitted to the Secretary of Agriculture pursuant or § 1.38(a) or...

  19. A polymorphic CD40 ligand (CD154) molecule mediates CD40‐dependent signalling but interferes with the ability of soluble CD40 to functionally block CD154 : CD40 interactions

    Science.gov (United States)

    Barnhart, B; Ford, G S; Bhushan, A; Song, C; Covey, L R

    2000-01-01

    We report the characterization of a naturally occurring polymorphism in CD40 ligand (CD40L, CD154) expressed by activated T cells from a young female patient. This polymorphism encodes a nonconservative Gly → Arg substitution in amino acid 219 in the extracellular, CD40 binding domain of the molecule. Studies carried out with 293 epithelial cells ectopically expressing the polymorphic protein (CD154/G219R) revealed reduced levels of binding to different anti‐CD154 monoclonal antibodies (mAb) and CD40‐immunoglobulin (CD40‐Ig). However, recognition of the polymorphic and wild‐type CD154 molecules by a polyclonal antiserum was comparable, suggesting that the polymorphism affects the ability of the protein to interact with CD40 but does not significantly alter its surface expression. To determine if reduced cross‐linking of CD40 mediated decreased functional effects, three CD40‐dependent properties were measured. We found that pathways leading to the induction of surface CD23, CD80, and Iγ transcription were activated in response to CD154/G219R signalling. However, the decrease in affinity for CD40 by the mutated CD154 affected the ability of CD40‐Ig to efficiently interfere with the binding and effectively block induced CD80 expression. In contrast, we found that the 5c8 mAb, which recognized the polymorphic molecule to a similar extent as wild‐type CD154, effectively blocked the interaction between CD154/G219R and CD40 as measured by CD80 expression. These findings suggest that naturally occurring polymorphisms in the CD154 molecule may affect the ability of CD40‐mediated functions to be blocked by soluble CD40 or anti‐CD154 mAb in the therapeutic treatment of disease and graft rejection. PMID:10651941

  20. Crystallographic and Mutational Analysis of the CD40-CD154 Complex and Its Implications for Receptor Activation*

    Science.gov (United States)

    An, Hyun-Jung; Kim, Young Jin; Song, Dong Hyun; Park, Beom Suk; Kim, Ho Min; Lee, Ju Dong; Paik, Sang-Gi; Lee, Jie-Oh; Lee, Hayyoung

    2011-01-01

    CD40 is a tumor necrosis factor receptor (TNFR) family protein that plays an important role in B cell development. CD154/CD40L is the physiological ligand of CD40. We have determined the crystal structure of the CD40-CD154 complex at 3.5 Å resolution. The binding site of CD40 is located in a crevice formed between two CD154 subunits. Charge complementarity plays a critical role in the CD40-CD154 interaction. Some of the missense mutations found in hereditary hyper-IgM syndrome can be mapped to the CD40-CD154 interface. The CD40 interaction area of one of the CD154 subunits is twice as large as that of the other subunit forming the binding crevice. This is because cysteine-rich domain 3 (CRD3) of CD40 has a disulfide bridge in an unusual position that alters the direction of the ladder-like structure of CD40. The Ser132 loop of CD154 is not involved in CD40 binding but its substitution significantly reduces p38- and ERK-dependent signaling by CD40, whereas JNK-dependent signaling is not affected. These findings suggest that ligand-induced di- or trimerization is necessary but not sufficient for complete activation of CD40. PMID:21285457

  1. CD40/CD154 Blockade Inhibits Dendritic Cell Expression of Inflammatory Cytokines but not Costimulatory Molecules1

    Science.gov (United States)

    Ferrer, Ivana R.; Liu, Danya; Pinelli, David F.; Koehn, Brent H.; Stempora, Linda L.; Ford, Mandy L.

    2012-01-01

    Blockade of the CD40/CD154 pathway remains one of the most effective means of promoting graft survival following transplantation. However, the effects of CD40/CD154 antagonsim on dendritic cell (DC) phenotype and functionality following transplantation remain incompletely understood. To dissect the effects of CD154/CD40 blockade on DC activation in vivo, we generated hematopoietic chimeras in mice that expressed a surrogate minor antigen (OVA). Adoptive transfer of OVA-specific CD4+ and CD8+ T cells led to chimerism rejection, which was inhibited by treatment with CD154 blockade. Surprisingly, CD154 antagonism did not alter the expression of MHC and costimulatory molecules on CD11c+ DC compared to untreated controls. However, DCs isolated from anti-CD154 treated animals exhibited a significant reduction in inflammatory cytokine secretion. Combined blockade of inflammatory cytokines IL-6 and IL-12p40 attenuated the expansion of antigen-specific CD4+ and CD8+ T cells and transiently inhibited the rejection of OVA-expressing cells. These results suggest that a major effect of CD154 antagonism in vivo is an impairment in the provision of signal three during donor-reactive T cell programming, as opposed to an impact on the provision of signal two. We conclude that therapies designed to target inflammatory cytokines during donor-reactive T cell activation may be beneficial in attenuating these responses and prolonging graft survival. PMID:23002440

  2. Relationship between metalloproteinase 2 and 9 concentrations and soluble CD154 expression in Iranian patients with multiple sclerosis

    Directory of Open Access Journals (Sweden)

    Javad Sanchooli

    2014-05-01

    Full Text Available Matrix metalloproteinases (MMPs play a critical role in the blood–brain barrier permeability and in invasion of the leukocytes into the central nervous system during multiple sclerosis (MS. In this respect, in the present study, we have evaluated the possible role of MMP-9 and MMP-2 on the expression of soluble CD154 (sCD154 and membrane-bound isoform of the CD154 in Iranian MS patients. The expressions of the aforementioned protein-related genes were analyzed at the levels of messenger RNA and proteins by real-time reverse transcription polymerase chain reaction, enzyme-linked immunosorbent assay, and Western blotting. The results showed a high expression of CD154 isoforms, MMP-9 and MMP-2, in MS patients in contrast to controls (p 3-fold in patients with a higher MMPs/tissue inhibitor of metalloproteinase 1 (TIMP-1 ratio. Furthermore, secondary-progressive MS patients with exacerbate period showed higher positive correlation between increasing sCD154 concentration and overexpression of MMP-2 (p < 0.001. Our data demonstrate that following the exacerbation period, sCD154 concentration is increased in patients, which is mutually related to the MMPs/TIMP-1 ratio. This relationship may represent a new link between sCD154 concentration and the MMPs/TIMP-1 ratio with prognostic implications.

  3. Platelet-associated CD40/CD154 mediates remote tissue damage after mesenteric ischemia/reperfusion injury.

    Directory of Open Access Journals (Sweden)

    Peter H Lapchak

    Full Text Available Several innate and adaptive immune cell types participate in ischemia/reperfusion induced tissue injury. Amongst them, platelets have received little attention as contributors in the process of tissue damage after ischemia reperfusion (I/R injury. It is currently unknown whether platelets participate through the immunologically important molecules including, CD40 and when activated, CD154 (CD40L, in the pathogenesis of I/R injury. We hypothesized that constitutive expression of CD40 and activation-induced expression of CD154 on platelets mediate local mesenteric and remote lung tissue damage after I/R injury. Wild type (WT; C57BL/6J, CD40 and CD154 deficient mice underwent mesenteric ischemia for 30 minutes followed by reperfusion for 3 hours. WT mice subjected to mesenteric I/R injury displayed both local intestinal and remote lung damage. In contrast, there was significantly less intestinal damage and no remote lung injury in CD40 and CD154 deficient mice when compared to WT mice. Platelet-depleted WT mice transfused with platelets from CD40 or CD154 deficient mice failed to reconstitute remote lung damage. In contrast, when CD40 or CD154 deficient mice were transfused with WT platelets lung tissue damage was re-established. Together, these findings suggest that multiple mechanisms are involved in local and remote tissue injury and also identify platelet-expressed CD40 and/or CD154 as mediators of remote tissue damage.

  4. Crystallographic and mutational analysis of the CD40-CD154 complex and its implications for receptor activation.

    Science.gov (United States)

    An, Hyun-Jung; Kim, Young Jin; Song, Dong Hyun; Park, Beom Suk; Kim, Ho Min; Lee, Ju Dong; Paik, Sang-Gi; Lee, Jie-Oh; Lee, Hayyoung

    2011-04-01

    CD40 is a tumor necrosis factor receptor (TNFR) family protein that plays an important role in B cell development. CD154/CD40L is the physiological ligand of CD40. We have determined the crystal structure of the CD40-CD154 complex at 3.5 Å resolution. The binding site of CD40 is located in a crevice formed between two CD154 subunits. Charge complementarity plays a critical role in the CD40-CD154 interaction. Some of the missense mutations found in hereditary hyper-IgM syndrome can be mapped to the CD40-CD154 interface. The CD40 interaction area of one of the CD154 subunits is twice as large as that of the other subunit forming the binding crevice. This is because cysteine-rich domain 3 (CRD3) of CD40 has a disulfide bridge in an unusual position that alters the direction of the ladder-like structure of CD40. The Ser(132) loop of CD154 is not involved in CD40 binding but its substitution significantly reduces p38- and ERK-dependent signaling by CD40, whereas JNK-dependent signaling is not affected. These findings suggest that ligand-induced di- or trimerization is necessary but not sufficient for complete activation of CD40.

  5. Selective Sensing of Fe(3+) and Al(3+) Ions and Detection of 2,4,6-Trinitrophenol by a Water-Stable Terbium-Based Metal-Organic Framework.

    Science.gov (United States)

    Cao, Li-Hui; Shi, Fang; Zhang, Wen-Min; Zang, Shuang-Quan; Mak, Thomas C W

    2015-10-26

    A water-stable luminescent terbium-based metal-organic framework (MOF), {[Tb(L1 )1.5 (H2 O)]⋅3 H2 O}n (Tb-MOF), with rod-shaped secondary building units (SBUs) and honeycomb-type tubular channels has been synthesized and structurally characterized by single-crystal X-ray diffraction. The high green emission intensity and the microporous nature of the Tb-MOF indicate that it can potentially be used as a luminescent sensor. In this work, we show that Tb-MOF can selectively sense Fe(3+) and Al(3+) ions from mixed metal ions in water through different detection mechanisms. In addition, it also exhibits high sensitivity for 2,4,6-trinitrophenol (TNP) in the presence of other nitro aromatic compounds in aqueous solution by luminescence quenching experiments. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Association between Serum Soluble CD154 Levels and Mortality in Patients with Malignant Middle Cerebral Artery Infarction

    Directory of Open Access Journals (Sweden)

    Leonardo Lorente

    2015-05-01

    Full Text Available Background: CD154 and its soluble counterpart (sCD154 are proteins of the tumor necrosis factor (TNF family and exhibit proinflamatory and procoagulant properties. Higher circulating sCD154 levels have been found in ischemic stroke patients than in controls. However, the association between circulating sCD154 levels and mortality in ischemic stroke patients has not been reported, and was the focus of this study. Methods: This was a multicenter, observational and prospective study carried out in six Spanish Intensive Care Units. We measured serum sCD154 from 50 patients with severe malignant middle cerebral artery infarction (MMCAI, defined as Glasgow Coma Scale (GCS lower than 9, at the moment of the severe MMCAI diagnosis and from 50 healthy controls. The end-point of the study was 30-day mortality. Results: We found higher serum sCD154 levels in patients with severe MMCAI than in healthy controls (p < 0.001. We found higher serum sCD154 levels (p < 0.001 in non-surviving (n = 26 than in surviving MMCAI patients (n = 24. Multiple binomial logistic regression analysis showed that serum sCD154 levels >1.41 ng/mmL were associated with 30-day mortality (OR = 10.25; 95% CI = 2.34–44.95; p = 0.002. Conclusions: The new more important finding of our study was that serum sCD154 levels in MMCAI patients were associated with mortality.

  7. Update on CD40 and CD154 blockade in transplant models.

    Science.gov (United States)

    Zhang, Tianshu; Pierson, Richard N; Azimzadeh, Agnes M

    2015-01-01

    Generation of an effective immune response against foreign antigens requires two distinct molecular signals: a primary signal provided by the binding of antigen-specific T-cell receptor to peptide-MHC on antigen-presenting cells and a secondary signal delivered via the engagement of costimulatory molecules. Among various costimulatory signaling pathways, the interactions between CD40 and its ligand CD154 have been extensively investigated given their essential roles in the modulation of adaptive immunity. Here, we review current understanding of the role CD40/CD154 costimulation pathway has in alloimmunity, and summarize recent mechanistic and preclinical advances in the evaluation of candidate therapeutic approaches to target this receptor-ligand pair in transplantation.

  8. Thermoregulation in unrestrained rats during and after exposure to 1.5-4 G

    Science.gov (United States)

    Giacchino, J.; Horwitz, B. A.; Horowitz, J. M.

    1979-01-01

    Unrestrained rats were exposed to cold for 1 h during and immediately after exposure to hypergravic fields (1.5-4 G) to determine if they recover their ability to thermoregulate on reentry to 1-G conditions. In contrast to the decreased body temperatures observed when cold exposure occurred concurrently with acceleration, hypothalamic, carotid, and brown fat temperatures did not fall when rats were exposed to cold immediately after return to 1 G. These results support the hypothesis that the thermoregulatory alterations seen under hypergravic conditions are manifestations of an effect of ongoing exposure to hypergravity and can be reversed on termination of acceleration. The reversibility of the thermoregulatory impairment is apparently unaffected by the magnitude of the acceleration field over a range of 1.5-4 G.

  9. Picomolar traces of americium(III) introduce drastic changes in the structural chemistry of terbium(III). A break in the ''gadolinium break''

    Energy Technology Data Exchange (ETDEWEB)

    Welch, Jan M. [TU Wien, Atominstitut, Vienna (Austria); Mueller, Danny; Knoll, Christian; Wilkovitsch, Martin; Weinberger, Peter [TU Wien, Institute of Applied Synthetic Chemistry, Vienna (Austria); Giester, Gerald [University of Vienna, Institute of Mineralogy and Crystallography, Vienna (Austria); Ofner, Johannes; Lendl, Bernhard [TU Wien, Institute of Chemical Technologies and Analytics, Vienna (Austria); Steinhauser, Georg [Leibniz Universitaet Hannover, Institute of Radioecology and Radiation Protection (Germany)

    2017-10-16

    The crystallization of terbium 5,5{sup '}-azobis[1H-tetrazol-1-ide] (ZT) in the presence of trace amounts (ca. 50 Bq, ca. 1.6 pmol) of americium results in 1) the accumulation of the americium tracer in the crystalline solid and 2) a material that adopts a different crystal structure to that formed in the absence of americium. Americium-doped [Tb(Am)(H{sub 2}O){sub 7}ZT]{sub 2} ZT.10 H{sub 2}O is isostructural to light lanthanide (Ce-Gd) 5,5{sup '}-azobis[1H-tetrazol-1-ide] compounds, rather than to the heavy lanthanide (Tb-Lu) 5,5{sup '}-azobis[1H-tetrazol-1-ide] (e.g., [Tb(H{sub 2}O){sub 8}]{sub 2}ZT{sub 3}.6 H{sub 2}O) derivatives. Traces of Am seem to force the Tb compound into a structure normally preferred by the lighter lanthanides, despite a 10{sup 8}-fold Tb excess. The americium-doped material was studied by single-crystal X-ray diffraction, vibrational spectroscopy, radiochemical neutron activation analysis, and scanning electron microscopy. In addition, the inclusion properties of terbium 5,5{sup '}-azobis[1H-tetrazol-1-ide] towards americium were quantified, and a model for the crystallization process is proposed. (copyright 2017 Wiley-VCH Verlag GmbH and Co. KGaA, Weinheim)

  10. Orbital ordering in {sup 154}SmNiO{sub 3}

    Energy Technology Data Exchange (ETDEWEB)

    Medarde, M.; Rosenkranz, S. [Paul Scherrer Inst. (PSI), Villigen (Switzerland); Rodrigeuez-Carvajal, J. [Laboratoire Leon Brillouin (LLB) - Centre d`Etudes de Saclay, 91 - Gif-sur-Yvette (France); Lacorre, P. [Lab. Fluorures, LeMans (France); Trounov, V. [PNPI, Gatchina (Russian Federation); Fernandez-Diaz, M.T. [Institut Max von Laue - Paul Langevin, 75 - Paris (France)

    1997-09-01

    We have investigated the existence of a structural distortion associated to the k = (1/2 0 1/2) orbital ordering recently proposed to explain the magnetic structure of RNiO{sub 3} perovskites (R = rare earth). Our results on a {sup 154}SmNiO{sub 3} powder sample indicate that, if existing, the associated superstructure reflections are as a maximum 10{sup 4} times smaller than the largest nuclear reflection. (author) 2 figs., 3 refs.

  11. Yeast Interacting Proteins Database: YNL154C, YDR264C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available YNL154C YCK2 Palmitoylated plasma membrane-bound casein kinase I isoform; shares re... gene name YCK2 Bait description Palmitoylated plasma membrane-bound casein kinase I isoform; shares redunda...ature on prey (YPD) 11 Literature shared by bait and prey 5 Literature sharing score 14 CuraGen (0 or 1) 0 S

  12. A metabolomic assessment of NAC154 transcription factor overexpression in field grown poplar stem wood.

    Science.gov (United States)

    Jervis, Judith; Hildreth, Sherry B; Sheng, Xiaoyan; Beers, Eric P; Brunner, Amy M; Helm, Richard F

    2015-07-01

    Several xylem-associated regulatory genes have been identified that control processes associated with wood formation in poplar. Prominent among these are the NAC domain transcription factors (NACs). Here, the putative involvement of Populus NAC154, a co-ortholog of the Arabidopsis gene SND2, was evaluated as a regulator of "secondary" biosynthetic processes in stem internode tissues by interrogating aqueous methanolic extracts from control and transgenic trees. Comprehensive untargeted metabolite profiling was accomplished with a liquid chromatography-mass spectrometry platform that utilized two different chromatographic supports (HILIC and reversed phase) and both positive and negative ionization modes. Evaluation of current and previous year tissues provided datasets for assessing the effects of NAC154 overexpression in wood maturation processes. Phenolic glycoside levels as well as those of oligolignols, sucrose and arginine were modulated with phenotypic and chemotypic traits exhibiting similar trends. Specifically, increased levels of arginine in the NAC154 overexpressing tissues supports a role for the transcription factor in senescence/dormancy-associated processes. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. AGR-3/4 Data Qualification Report for ATR Cycles 151A, 151B, 152A, 152B, 154A, and 154B

    Energy Technology Data Exchange (ETDEWEB)

    Binh T. Pham

    2014-02-01

    This data report provides the qualification status of Advanced Gas Reactor-3/4 (AGR-3/4) fuel irradiation experimental data from Advanced Test Reactor (ATR) Cycles 151A, 151B, 152A, 152B, 154A, and 154B, as recorded in the Nuclear Data Management and Analysis System (NDMAS). Of these cycles, ATR Cycle 152A is a low power cycle that occurred when the ATR core was briefly at low power. The irradiation data are not used for physics and thermal calculation, but the qualification status of these cycle data is still covered in this report. On the other hand, during ATR Cycles 153A (unplanned Outage cycle) and 153B (Power Axial Locator Mechanism [PALM] cycle), the AGR-3/4 was pulled out from the ATR core and stored in the canal to avoid being overheated. Therefore, qualification of the AGR-3/4 irradiation data from these 2 cycles was excluded in this report. By the end of ATR Cycle 154B, AGR-3/4 was irradiated for a total of 264.1 effective full power days. The AGR-3/4 data streams addressed in this report include thermocouple (TC) temperatures, sweep gas data (flow rates, pressure, and moisture content), and Fission Product Monitoring System (FPMS) data (release rates and release-to-birth rate ratios [R/Bs]) for each of the twelve capsules in the AGR-3/4 experiment. The final data qualification status for these data streams is determined by a Data Review Committee (DRC) composed of AGR technical leads, Sitewide Quality Assurance (QA), and NDMAS analysts. The DRC convened on February 12, 2014, reviewed the data acquisition process, and considered whether the data met the requirements for data collection as specified in QA-approved Very High Temperature Reactor (VHTR) Technology Development Office (TDO) data collection plans. The DRC also examined the results of NDMAS data testing and statistical analyses, and confirmed the qualification status of the data as given in this report.

  14. 33 CFR 154.1047 - Response plan development and evaluation criteria for facilities that handle, store, or transport...

    Science.gov (United States)

    2010-07-01

    ...) POLLUTION FACILITIES TRANSFERRING OIL OR HAZARDOUS MATERIAL IN BULK Response Plans for Oil Facilities § 154...) Sonar, sampling equipment, or other methods for locating the petroleum oil on the bottom or suspended in...

  15. Expression of CD154 by a Simian Immunodeficiency Virus Vector Induces Only Transitory Changes in Rhesus Macaques

    OpenAIRE

    Vida L. Hodara; Velasquillo, M. Cristina; Parodi, Laura M.; Giavedoni, Luis D.

    2005-01-01

    Human immunodeficiency virus infection is characterized by dysregulation of antigen-presenting cell function and defects in cell-mediated immunity. Recent evidence suggests that impaired ability of CD4+ T cells to upregulate the costimulatory molecule CD154 is at the core of this dysregulation. To test the hypothesis that increased expression of CD154 on infected CD4+ T cells could modulate immune function, we constructed a replication-competent simian immunodeficiency virus (SIV) vector that...

  16. 46 CFR 154.610 - Design temperature not colder than 0 °C (32 °F).

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Design temperature not colder than 0 °C (32 °F). 154... DANGEROUS CARGOES SAFETY STANDARDS FOR SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES Design, Construction and Equipment Materials § 154.610 Design temperature not colder than 0 °C (32 °F). Materials for...

  17. Neutralizing interleukin-4 prevents transplant arteriosclerosis mediated by indirect pathway T cells under CD40-CD154 costimulation blockade.

    Science.gov (United States)

    Spriewald, Bernd M; Ensminger, Stephan M; Bushell, Andrew; Wood, Kathryn J

    2008-12-15

    Blockade of the CD40-CD154 costimulatory pathway can prolong allograft survival, but does not prevent the development of transplant arteriosclerosis in several models. In this study, we investigated the mechanisms of CD40-CD154-independent transplant arteriosclerosis in major histocompatibility complex (MHC)-class I-mismatched aortic allografts. MHC class I-mismatched CBK (H2k+Kb) donor aortas were transplanted into CBA (H2k) recipients who can only recognize the graft through CD8+ T cells and CD4+ T cells responding to the class I MHC mismatch through the indirect pathway of allorecognition. Recipients were treated with anti-CD154 antibody (MR1) alone or in combination with anti-CD8 (YTS169) or anti-interleukin (IL)-4 (11B11) antibodies. Grafts were analyzed by histology on days 30 and 60 and for intragraft mRNA expression on day 14 after transplantation. Repeated treatment with anti-CD154 alone or in combination with anti-CD8 antibody did not prevent intimal proliferation compared with untreated controls (65%+/-6%, 62%+/-9%, and 71%+/-7% luminal occlusion, respectively, 60 days after transplantation). In both treatment groups, the expression of IL-4, IL-5, and eotaxin was increased compared with control grafts, and an eosinophilic infiltration was observed. Neutralizing IL-4 in combination with CD40-CD154 blockade and CD8+ T-cell depletion abrogated transplant arteriosclerosis (9%+/-4% luminal occlusion 60 days after transplantation). Prolonged treatment with anti-CD154 was not able to prevent the development of transplant arteriosclerosis in MHC class I-mismatched aortic allografts, in the presence or absence of CD8+ T cells. This CD40-CD154 pathway resistant transplant arteriosclerosis was mediated by IL-4, because neutralizing IL-4 in addition to CD40-CD154 costimulation blockade and CD8+ T-cell depletion prevented its development.

  18. Sodium terbium(III polyphosphate

    Directory of Open Access Journals (Sweden)

    Abdelghani Oudahmane

    2010-04-01

    Full Text Available Single crystals of the title compound, NaTb(PO34, were obtained by solid-state reaction. This compound belongs to type II of long-chain polyphosphates with the general formula AIBIII(PO34. It is isotypic with the NaNd(PO34 and NaEr(PO34 homologues. The crystal structure is built up of infinite crenelated chains of corner-sharing PO4 tetrahedra with a repeating unit of four tetrahedra. These chains, extending parallel to [100], are linked by isolated TbO8 square antiprisms, forming a three-dimensional framework. The Na+ ions are located in channels running along [010] and are surrounded by six oxygen atoms in a distorted octahedral environment within a cut-off distance <2.9 Å.

  19. Two regimes of galaxy dynamics: mass models of NGC 5055 and DDO 154

    Science.gov (United States)

    Jovanović, Milena

    2017-08-01

    We derive detailed dynamical models for two galaxies, the massive spiral galaxy NGC 5055 and the dwarf irregular DDO 154. We used Navarro, Frenk & White (NFW) and isothermal halo models for the dark matter (DM) distribution, along with the most recent and reliable radio observations of H i to determine the rotation curves of these galaxies. Contributions from the neutral gas and the luminous matter were accounted for. For NGC 5055, the latest stellar population synthesis (SPS) models, combining metallicity and age as indicators of the stellar mass-to-light ratio (M/L) were used to better constrain both the DM model and the contribution to the total mass from all components. The isothermal dark halo model successfully fitted both observed rotation curves with realistic values for stellar M/L, while the NFW model needed further constraints for M/L to fit the rotation curve of DDO 154. In the case of NGC 5055, we found the best-fitting M/L in the 3.6 μm band (M/L3.6) for stellar disc to be 0.57 ± 0.04 for isothermal, and 0.50 ± 0.05 for NFW DM model. The most probable value for M/L3.6 from SPS models is 0.46, which is in agreement within uncertainties with our best-fitting NFW model. In the case of DDO 154, we obtained the stellar disc M/L3.6 of 0.25 ± 0.20 for the isothermal DM model. The stellar disc M/L3.6 for the NFW model was fixed to 0.26, as best reasonable value. For NGC 5055, we derived radial profiles of stellar M/L for our best estimate for a particular DM model.

  20. Near-barrier transfer reactions in the sup 36 S+ sup 144,154 Sm systems

    Energy Technology Data Exchange (ETDEWEB)

    Fernandez Niello, J.O.; Testoni, J.E.; di Tada, M.; Pacheco, A.J. (TANDAR, Departamento de Fisica, Comision Nacional de Energia Atomica, Avenida del Libertador 8250, 1429 Buenos Aires (Argentina)); Napoli, D.R.; Stefanini, A.M.; Corradi, L.; Million, B.; Narayanasamy, M.; Spolaore, P. (Istituto Nazionale di Fisica Nucleare, Laboratori Nazionali di Legnaro, Padova (Italy)); Beghini, S.; Montagnoli, G.; Scarlassara, F.; Segato, G.F.; Signorini, C.; Soramel, F. (Dipartimento di Fisica, Universita e Istituto Nazionale di Fisica Nucleare, Padova (Italy))

    1992-02-01

    Angular distributions and {ital Q}-value spectra for transfer reactions in the systems {sup 36}S+{sup 144,154}Sm have been measured at two energies close to the Coulomb barrier. Mass and charge identification was achieved using a time-of-flight system followed by an ionization chamber. Transfer probabilities were analyzed considering direct and sequential barrier penetration mechanisms. The dependence of the cross sections on the static quadrupole deformation of the targets was compared with the predictions of a semiclassical approach. The relative yields of the different channels were analyzed in the light of a random-walk approach based on the reaction {ital Q} values.

  1. Allospecific CD154+ T-cells associate with rejection risk after pediatric liver transplantation

    OpenAIRE

    AshokKumar, Chethan; Talukdar, Anjan; Sun, Qing; Higgs, Brandon W; Janosky, Janine; Wilson, Patrick; Mazariegos, George; Jaffe, Ronald; Demetris, Anthony; Dobberstein, Jennifer; Soltys, Kyle; Bond, Geoffrey; Thomson, Angus; Zeevi, Adriana; Sindhi, Rakesh

    2008-01-01

    Antigen-specific T-cells, which express CD154 rapidly, but remain untested in alloimmunity, were measured with flow cytometry in 16-hour MLR of 58 identically-immunosuppressed children with liver transplantation (LTx), to identify Rejectors (who had experienced biopsy-proven rejection within 60 days post-transplantation). Thirty one children were sampled once, cross-sectionally. Twenty seven children were sampled longitudinally, pre-LTx, and at 1–60 and 61–200 days after LTx. Results were cor...

  2. CD40 ligand (CD154) takes part in regulation of the transition to mononuclear cell dominance during peritonitis.

    Science.gov (United States)

    Mazar, Julia; Agur, Timna; Rogachev, Boris; Ziv, Nadav Yehuda; Zlotnik, Moshe; Chaimovitz, Cidio; Douvdevani, Amos

    2005-04-01

    CD40 is a member of the tumor necrosis factor (TNF) family of receptors whose ligand (CD154) is found mainly on membranes of activated mononuclear cells. CD154-CD40 cross-linking is a central event in antigen presentation, B-cell activation, and regulation of cytokine and chemokine secretion from various types of cells. We have previously demonstrated in vitro the presence of CD40 on human peritoneal mesothelial cells (PMC) and have also shown that CD40 ligation synergizes with interferon-gamma (IFN-gamma) to up-regulate CC chemokine secretion from these cells. The aim of the present study was to investigate the role of CD40 ligation in leukocyte recruitment during peritonitis. Peritonitis was induced in mice by bacterial inoculation, CD40 levels were analyzed on PMC by reverse transcription-polymerase chain reaction (RT-PCR) and immunohistochemistry. CD154 levels on leukocytes were analyzed by flow cytometry and RT-PCR. Chemokines mRNA levels were analyzed by RT-PCR. CD154 was blocked in vivo using monoclonal antibodies. Results. In mice inoculated by Staphylococcus epidermidis or Escherichia coli, CD40 in PMC increased twofold at 24 hours and CD154 was induced and reached a peak at 48 hours. In both Gram-positive and Gram-negative-peritonitis, peritoneal macrophages were the main peritoneal leukocyte population to express CD154. Similar results were observed in human subjects during peritonitis. Injection of CD154 blocking monoclonal antibody (MR1) reduced the mononuclear infiltrate by 50% and had no effect on granulocyte recruitment 48 hours after inoculation of S. epidermidis. Our data suggest that CD40 plays a significant role in the process of the mononuclear infiltration during peritonitis.

  3. CD154+ CD4+ T-cell dependence for effective memory influenza virus-specific CD8+ T-cell responses.

    Science.gov (United States)

    Olson, Matthew R; Seah, Shirley Gk; Edenborough, Kathryn; Doherty, Peter C; Lew, Andrew M; Turner, Stephen J

    2014-08-01

    CD40-CD154 (CD40 ligand) interactions are essential for the efficient priming of CD8(+) cytotoxic T lymphocyte (CTL) responses. This is typically via CD4(+)CD154(+) T-cell-dependent 'licensing' of CD40(+) dendritic cells (DCs); however, DCs infected with influenza A virus (IAV) upregulate CD154 expression, thus enabling efficient CTL priming in the absence of CD4(+) T activation. Therefore, it is unclear whether CD4 T cells and DCs have redundant or unique roles in the priming of primary and secondary CTL responses after infection. Here we determine the precise cellular interactions involved in CD40-CD154 regulation of both primary and secondary IAV-specific CTL responses. Infection of both CD40 KO and CD154 KO mice resulted in diminished quantitative and qualitative CTL responses after both primary and secondary infection. Adoptive transfer of CD154(+), but not CD154 KO, CD4 T cells into CD154 KO mice restored both primary and secondary IAV-specific CD8 T-cell responses. These data show that, although CD154 expression on CD4 T cells and other cell types (that is, DCs) may be redundant for the priming of primary CTL responses, CD154 expression by CD4 T cells is required for the priming memory CD8 T cells that are capable of fully responding to secondary infection.

  4. Vaccination Produces CD4 T Cells with a Novel CD154-CD40-Dependent Cytolytic Mechanism.

    Science.gov (United States)

    Coler, Rhea N; Hudson, Thomas; Hughes, Sean; Huang, Po-Wei D; Beebe, Elyse A; Orr, Mark T

    2015-10-01

    The discovery of new vaccines against infectious diseases and cancer requires the development of novel adjuvants with well-defined activities. The TLR4 agonist adjuvant GLA-SE elicits robust Th1 responses to a variety of vaccine Ags and is in clinical development for both infectious diseases and cancer. We demonstrate that immunization with a recombinant protein Ag and GLA-SE also induces granzyme A expression in CD4 T cells and produces cytolytic cells that can be detected in vivo. Surprisingly, these in vivo CTLs were CD4 T cells, not CD8 T cells, and this cytolytic activity was not dependent on granzyme A/B or perforin. Unlike previously reported CD4 CTLs, the transcription factors Tbet and Eomes were not necessary for their development. CTL activity was also independent of the Fas ligand-Fas, TRAIL-DR5, and canonical death pathways, indicating a novel mechanism of CTL activity. Rather, the in vivo CD4 CTL activity induced by vaccination required T cell expression of CD154 (CD40L) and target cell expression of CD40. Thus, vaccination with a TLR4 agonist adjuvant induces CD4 CTLs, which kill through a previously unknown CD154-dependent mechanism. Copyright © 2015 by The American Association of Immunologists, Inc.

  5. Persistent Polyclonal B Cell Lymphocytosis B Cells Can Be Activated through CD40-CD154 Interaction

    Directory of Open Access Journals (Sweden)

    Emmanuelle Dugas-Bourdages

    2014-01-01

    Full Text Available Persistent polyclonal B cell lymphocytosis (PPBL is a rare disorder, diagnosed primarily in adult female smokers and characterized by an expansion of CD19+CD27+IgM+ memory B cells, by the presence of binucleated lymphocytes, and by a moderate elevation of serum IgM. The clinical course is usually benign, but it is not known whether or not PPBL might be part of a process leading to the emergence of a malignant proliferative disorder. In this study we sought to investigate the functional response of B cells from patients with PPBL by use of an optimal memory B cell culture model based on the CD40-CD154 interaction. We found that the proliferation of PPBL B cells was almost as important as that of B cells from normal controls, resulting in high immunoglobulin secretion with in vitro isotypic switching. We conclude that the CD40-CD154 activation pathway is functional in the memory B cell population of PPBL patients, suggesting that the disorder may be due to either a dysfunction of other cells in the microenvironment or a possible defect in another B cell activation pathway.

  6. Self-assembly in aqueous solution of wheel-shaped Mo154 oxide clusters into vesicles.

    Science.gov (United States)

    Liu, Tianbo; Diemann, Ekkehard; Li, Huilin; Dress, Andreas W M; Müller, Achim

    2003-11-06

    Surfactants and membrane lipids readily assemble into complex structures such as micelles, liposomes or hollow vesicles owing to their amphiphilic character-the fact that part of their structure is attracted to polar environments while another part is attracted to non-polar environments. The self-assembly of complex structures also occurs in polyoxometallate chemistry, as exemplified by the molybdenum blue solutions known for centuries. But while the presence of nanometre-sized metal oxide aggregates in these solutions has long been recognized, unravelling the composition and formation process of these aggregates proved difficult. Recent work has indicated that discrete, wheel-shaped mixed-valence polyoxomolybdate clusters of the type [Mo154] (refs 2-4) assemble into well-defined nanometre-sized aggregates, including spherical structures. Here we report light-scattering data and transmission electron microscopy images of hollow spherical structures with an average, almost monodisperse radius of about 45 nm and composed of approximately 1,165 [Mo154] wheel-shaped clusters. The clusters appear to lie flat and homogeneously distributed on the vesicle surface. Unlike conventional lipid vesicles, the structures we observe are not stabilized by hydrophobic interactions. Instead, we believe the polyoxomolybdate-based vesicles form owing to a subtle interplay between short-range van der Waals attraction and long-range electrostatic repulsion, with important further stabilization arising from hydrogen bonding involving water molecules encapsulated between the wheel-shaped clusters and in the vesicles' interior.

  7. The Interaction of CD154 with the α5β1 Integrin Inhibits Fas-Induced T Cell Death.

    Directory of Open Access Journals (Sweden)

    Meriem Bachsais

    Full Text Available CD154, a critical regulator of the immune response, is usually associated with chronic inflammatory, autoimmune diseases as well as malignant disorders. In addition to its classical receptor CD40, CD154 is capable of binding other receptors, members of the integrin family, the αIIbβ3, αMβ2 and α5β1. Given the role attributed to integrins and particularly the β1 integrins in inhibiting apoptotic events in normal as well as malignant T cells, we were highly interested in investigating the role of the CD154/α5β1 interaction in promoting survival of malignant T cells contributing as such to tumor development and/or propagation. To support our hypothesis, we first show that soluble CD154 binds to the T-cell acute lymphoblastic leukemia cell line, Jurkat E6.1 in a α5β1-dependent manner. Binding of soluble CD154 to α5β1 integrin of Jurkat cells leads to the activation of key survival proteins, including the p38 and ERK1/2 mitogen-activated protein kinases (MAPKs, phosphoinositide 3 kinase (PI-3K, and Akt. Interestingly, soluble CD154 significantly inhibits Fas-mediated apoptosis in T cell leukemia-lymphoma cell lines, Jurkat E6.1 and HUT78 cells, an important hallmark of T cell survival during malignancy progression. These anti-apoptotic effects were mainly mediated by the activation of the PI-3K/Akt pathway but also involved the p38 and the ERK1/2 MAPKs cascades. Our data also demonstrated that the CD154-triggered inhibition of the Fas-mediated cell death response was dependent on a suppression of caspase-8 cleavage, but independent of de novo protein synthesis or alterations in Fas expression on cell surface. Together, our results highlight the impact of the CD154/α5β1 interaction in T cell function/survival and identify novel targets for the treatment of malignant disorders, particularly of T cell origin.

  8. The X-ray emission mechanism in the protostellar jet HH 154

    Science.gov (United States)

    Bonito, R.; Orlando, S.; Peres, G.; Favata, F.; Rosner, R.

    2004-09-01

    We study the mechanism causing the X-ray emission recently detected in protostellar jets, by performing a detailed modeling of the interaction between a supersonic jet originating from a young stellar object and the ambient medium, for various values of density contrast, ν, between the ambient density and the jet, and of Mach number, M; radiative losses and thermal conduction have been taken into account. Here we report a representative case which reproduces, without any ad hoc assumption, the characteristics of the X-ray emission recently observed in the protostellar jet HH 154. We find that the X-ray emission originates from a localized blob, consistent with observations, which moves with velocity v ˜ 500 km s-1; we therefore predict the X-ray source to have a detectable proper motion.

  9. Study of XK and {gamma} photon emission following decay of {sup 154}Eu

    Energy Technology Data Exchange (ETDEWEB)

    Terechtchenko, E. E-mail: tee@vniim.ru; Rasko, M.; Sepman, S.; Zanevsky, A.; Tuan, A. Tran; Amiot, M.N.; Bobin, C.; Morel, J

    2004-04-01

    A joint project has been established between VNIIM (D.I. Mendeleyev Institute for Metrology) and LNHB (Laboratoire National Henri Becquerel) to determine as accurately as possible the X- and {gamma}-ray emission probabilities of {sup 154}Eu. Point sources were prepared by VNIIM, and absolute measurements of activity per unit mass were undertaken by both laboratories using coincidence, anti-coincidence and 4{pi}-{gamma} counting methods. Other point sources and one aliquot were also prepared for precise {gamma}-ray spectrometry measurements. Absolute photon emission probabilities were determined with a maximum uncertainty of 0.5% for the most intense lines, supporting the development of this nuclide as a multigamma standard.

  10. [Influence of blocking B7/CD28 and CD40/CD154 co-stimulatory signals on immune function of sensitized mice].

    Science.gov (United States)

    Ye, Qi-Xiang; Xu, Lu-Hong; Xu, Wei; Fang, Jian-Pei

    2014-06-01

    This study was aimed to explore the effects of blocking B7/CD28 and CD40/CD154 co-stimulatory signals on immune function of sensitized mice', and provide the evidences of acquired immune tolerance for allogeneic bone marrow transplantation. The mice sensitized on 7 day before transplant were divided into 4 groups: (1)CTLA4Ig+ anti-CD154 isotype control IgG; (2)anti-CD154 +CTLA4Ig isotype control IgG; (3)CTLA4Ig and anti-CD154; (4)isotype control IgG of CTLA4Ig and anti-CD154. CTLA4Ig and anti-CD154 used in normal BALB/c mice as isotype control IgG. Each mouse in all groups received CTLA4Ig and anti-CD154 (or corresponding isotype control IgG) 500 µg respectively, and was injected via tail vein on 7 day before transplant. There were 5 mice in each group. The mice were sacrificed on day 0, then the number of CD19(+)CD69(+)B cells, CD44(high)/CD62L(high) and CD44(high)/CD62L(low)/- T cells were measured by flow cytometry. Changes of cytokines and sensitized antibody were tested by ELISA or flow cytometry. The results showed that the numbers of CD19(+)CD69(+)B cells were significantly increased in comparison with the normal group (P CD154 co-stimulatory signals (P CD154 co-stimulatory signals. Blocking these two signals together, displayed a synergistic effect (P CD154 treated groups significantly decreased as compared with sensitized group (P CD154 co-stimulatory signal can inhibit the cellular and humoral immune function, whereas blocking these two signals together displays a synergistic effect.

  11. Hyperexpression of CD40 ligand (CD154) in inflammatory bowel disease and its contribution to pathogenic cytokine production

    NARCIS (Netherlands)

    Liu, Z.; Colpaert, S.; D'Haens, G. R.; Kasran, A.; de Boer, M.; Rutgeerts, P.; Geboes, K.; Ceuppens, J. L.

    1999-01-01

    CD40 ligand (CD40L or CD154), a type II membrane protein with homology to TNF, is transiently expressed on activated T cells and known to be important for B cell Ig production and for activation and differentiation of monocytes and dendritic cells. Both Crohn's disease and ulcerative colitis are

  12. Antigen-specific induced Foxp3+ regulatory T cells are generated following CD40/CD154 blockade

    Science.gov (United States)

    Ferrer, Ivana R.; Wagener, Maylene E.; Song, Minqing; Kirk, Allan D.; Larsen, Christian P.; Ford, Mandy L.

    2011-01-01

    Blockade of the CD40/CD154 pathway potently attenuates T-cell responses in models of autoimmunity, inflammation, and transplantation. Indeed, CD40 pathway blockade remains one of the most powerful methods of prolonging graft survival in models of transplantation. But despite this effectiveness, the cellular and molecular mechanisms underlying the protective effects of CD40 pathway blockade are incompletely understood. Furthermore, the relative contributions of deletion, anergy, and regulation have not been measured in a model in which donor-reactive CD4+ and CD8+ T-cell responses can be assessed simultaneously. To investigate the impact of CD40/CD154 pathway blockade on graft-specific T-cell responses, a transgenic mouse model was used in which recipients containing ovalbumin-specific CD4+ and CD8+ TCR transgenic T cells were grafted with skin expressing ovalbumin in the presence or absence of anti-CD154 and donor-specific transfusion. The results indicated that CD154 blockade altered the kinetics of donor-reactive CD8+ T-cell expansion, delaying differentiation into IFN-γ+ TNF+ multifunctional cytokine producers. The eventual differentiation of cytokine-producing effectors in tolerant animals coincided with the emergence of an antigen-specific CD4+ CD25hi Foxp3+ T-cell population, which did not arise from endogenous natural Treg but rather were peripherally generated from naïve Foxp3− precursors. PMID:22143783

  13. 75 FR 64947 - 154th Meeting of the Advisory Council on Employee Welfare and Pension Benefit Plans; Notice of...

    Science.gov (United States)

    2010-10-20

    ... Pension Benefit Plans; Notice of Meeting; Notice #0;#0;Federal Register / Vol. 75, No. 202 / Wednesday... Meeting of the Advisory Council on Employee Welfare and Pension Benefit Plans; Notice of Meeting Pursuant... (ERISA), 29 U.S.C. 1142, the 154th open meeting of the Advisory Council on Employee Welfare and Pension...

  14. 33 CFR 154.1240 - Specific requirements for animal fats and vegetable oils facilities that could reasonably be...

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Specific requirements for animal fats and vegetable oils facilities that could reasonably be expected to cause substantial harm to the... Animal Fats and Vegetable Oils Facilities § 154.1240 Specific requirements for animal fats and vegetable...

  15. 42 CFR 84.154 - Airflow resistance test; Type B and Type BE supplied-air respirators; minimum requirements.

    Science.gov (United States)

    2010-10-01

    ... APPROVAL OF RESPIRATORY PROTECTIVE DEVICES Supplied-Air Respirators § 84.154 Airflow resistance test; Type B and Type BE supplied-air respirators; minimum requirements. (a) Airflow resistance shall be... diameter. (b) Airflow resistance shall not exceed 38 mm. (1.5 inches) of water-column height to air drawn...

  16. 33 CFR 154.1045 - Response plan development and evaluation criteria for facilities that handle, store, or transport...

    Science.gov (United States)

    2010-07-01

    ... the National Oil and Hazardous Substances Pollution Contingency Plan Product Schedule (which is contained in 40 CFR part 300, and available online from the U.S. Government Printing Office). (ii... or the annual plan review required under § 154.1065(a). Facility owners or operators are not required...

  17. In situ demonstration of CD40- and CD154-positive cells in psoriatic lesions and keratinocyte production of chemokines by CD40 ligation in vitro

    NARCIS (Netherlands)

    Pasch, Marcel C.; Timár, Krisztina K.; van Meurs, Marjan; Heydendael, Vera M. R.; Bos, Jan D.; Laman, Jon D.; Asghar, Syed S.

    2004-01-01

    In psoriatic lesions, T cells and keratinocytes are in an activated state. Ligation of CD40 expressed on activated keratinocytes with CD154 expressed on activated T cells is thought to be involved in the pathogenesis of psoriasis. However, the presence of CD40(+) and CD154(+) cells in psoriatic skin

  18. Chimpanzee CD4+ T cells are relatively insensitive to HIV-1 envelope-mediated inhibition of CD154 up-regulation

    NARCIS (Netherlands)

    Rutjens, Erik; Vermeulen, Joost; Verstrepen, Babs; Hofman, Sam; Prins, Jan M.; Srivastava, Indresh; Heeney, Jonathan L.; Koopman, Gerrit

    2008-01-01

    CD40-CD154 interaction forms a key event in regulation of crosstalk between dendritic cells and CD4 T cells. In human immunodeficiency virus (HIV)-1 infected patients CD154 expression is impaired, and the resulting loss of immune responsiveness by CD4+ T cells contributes to a progressive state of

  19. In situ demonstration of CD40- and CD154-positive cells in psoriatic lesions and keratinocyte production of chemokines by CD40 ligation in vitro.

    NARCIS (Netherlands)

    Pasch, M.C.; Timar, K.K.; Meurs, M. van; Heydendael, V.M.; Bos, J.D.; Laman, J.D.; Asghar, S.S.

    2004-01-01

    In psoriatic lesions, T cells and keratinocytes are in an activated state. Ligation of CD40 expressed on activated keratinocytes with CD154 expressed on activated T cells is thought to be involved in the pathogenesis of psoriasis. However, the presence of CD40(+) and CD154(+) cells in psoriatic skin

  20. Organic dyes as small molecule protein-protein interaction inhibitors for the CD40-CD154 costimulatory interaction.

    Science.gov (United States)

    Buchwald, Peter; Margolles-Clark, Emilio; Kenyon, Norma S; Ricordi, Camillo

    2010-01-01

    It is becoming increasingly clear that small molecules can often act as effective protein-protein interaction (PPI) inhibitors, an area of increasing interest for its many possible therapeutic applications. We have identified several organic dyes and related small molecules that (i) concentration-dependently inhibit the important CD40-CD154 costimulatory interaction with activities in the low micromolar (microM) range, (ii) show selectivity toward this particular PPI, (iii) seem to bind on the surface of CD154, and (iv) concentration-dependently inhibit the CD154-induced B cell proliferation. They were identified through an iterative activity screening/structural similarity search procedure starting with suramin as lead, and the best smaller compounds, the main focus of the present work, achieved an almost 3-fold increase in ligand efficiency (DeltaG(0)/nonhydrogen atom = 0.8 kJ/N(nHa)) approaching the average of known promising small-molecule PPI inhibitors (approximately 1.0 kJ/N(nHa)). Since CD154 is a member of the tumor necrosis factor (TNF) superfamily of cell surface interaction molecules, inhibitory activities on the TNF-R1-TNF-alpha interactions were also determined to test for specificity, and the compounds selected here all showed more than 30-fold selectivity toward the CD40-CD154 interaction. Because of their easy availability in various structural scaffolds and because of their good protein-binding ability, often explored for tissue-specific staining and other purposes, such organic dyes can provide a valuable addition to the chemical space searched to identify small molecule PPI inhibitors in general. (c) 2009 John Wiley & Sons, Ltd.

  1. Stimulation-dependent induction of CD154 on a subset of CD4+ FoxP3+ T-regulatory cells

    Science.gov (United States)

    Li, Wen; Carlson, Timothy L.; Green, William R.

    2013-01-01

    CD40-ligand/CD154 is predominantly expressed on activated CD4 T cells and plays a central role in regulating CD4 T-cell-dependent responses. To define the relative abilities of CD4 T-cell functional subsets in the induction of CD154—specifically FoxP3− effector, versus FoxP3+ regulatory, CD4 T cells—multiple CD4 T cell preparations were isolated from B6 and B6.FoxP3-GFP mice and stimulated in vitro to examine the kinetics of stimulation-dependent CD154 expression. CD154 was induced in 40–60% of total CD4 T cells in various cell preparations. However, despite similar kinetics of CD154-induced expression, the average percentage of CD154 expression among CD4+ FoxP3+ T regulatory (Treg) cells was only about 4–9%. Such differential, stimulation-dependent CD154 induction by total CD4+ T cells versus CD4+ FoxP3+ Treg cells was consistent, despite multiple stimulation conditions utilizing a variety of cell preparations of different composition. Similar induction of CD154 occurred irrespective of whether the CD4+ FoxP3+ Treg cells were first sorted to 98% purity and stimulated in vitro alone, or stimulated as non-purified cells in the presence of CD4+ FoxP3− T effector cells, suggesting that CD154 induction by CD4+ FoxP3+ Treg cells is regulated by cell-intrinsic mechanisms. Differential CD154 induction may be a key factor in determining the distinguishable functions of FoxP3− T-effector, versus FoxP3+ Treg, CD4+ T cells. PMID:21496498

  2. Establishment of long-term CD154-dependent porcine B-cell cultures

    Science.gov (United States)

    Takamatsu, H; Andersen, J K; Denyer, M S; Parkhouse, R M E

    1999-01-01

    Cells of the B-cell lineage play an essential part in the immune response, not only as the producers of antigen-specific antibodies, but also as antigen-presenting cells. Unlike T cells, however, the establishment of long-term normal B-cell lines has proved to be exceedingly difficult. In this paper we demonstrate that cell membrane-expressed CD154 (CD40 ligand) is able to support the continual growth of porcine mesenteric lymph node B-cell cultures for more than 4 months without the addition of exogenous cytokines, such as interleukin-4 (IL-4). Addition of IL-4, but not interferon-γ (IFN-γ) or IL-13, to these cultures enhanced proliferation, as, to a lesser extent, did addition of IL-2. Interestingly, however, whilst IFN-γ-supplemented cultures largely consisted of immunoglobulin M (IgM)-positive cells, cultures with IL-13 or IL-4 contained a significantly increased proportion of IgG-positive cells. PMID:10447734

  3. New neutron-rich isotope production in 154Sm+160Gd

    Directory of Open Access Journals (Sweden)

    Ning Wang

    2016-09-01

    Full Text Available Deep inelastic scattering in 154Sm+160Gd at energies above the Bass barrier is for the first time investigated with two different microscopic dynamics approaches: improved quantum molecular dynamics (ImQMD model and time dependent Hartree–Fock (TDHF theory. No fusion is observed from both models. The capture pocket disappears for this reaction due to strong Coulomb repulsion and the contact time of the di-nuclear system formed in head-on collisions is about 700 fm/c at an incident energy of 440 MeV. The isotope distribution of fragments in the deep inelastic scattering process is predicted with the simulations of the latest ImQMD-v2.2 model together with a statistical code (GEMINI for describing the secondary decay of fragments. More than 40 extremely neutron-rich unmeasured nuclei with 58≤Z≤76 are observed and the production cross sections are at the order of μb to mb. The multi-nucleon transfer reaction of Sm+Gd could be an alternative way to synthesize new neutron-rich lanthanides which are difficult to be produced with traditional fusion reactions or fission of actinides.

  4. A europium- and terbium-coated magnetic nanocomposite as sorbent in dispersive solid phase extraction coupled with ultra-high performance liquid chromatography for antibiotic determination in meat samples.

    Science.gov (United States)

    Castillo-García, M L; Aguilar-Caballos, M P; Gómez-Hens, A

    2015-12-18

    A new magnetic dispersive solid-phase extraction approach based on Eu- and Tb-coated magnetic nanocomposites, combined with ultra-high performance liquid chromatography with fluorometric detection, is reported for the extraction and simultaneous determination of veterinary antibiotics. The method is aimed at monitoring of potential residues of three tetracyclines, namely oxytetracycline, tetracycline, chlortetracycline and three acidic quinolones, such as oxolinic acid, nalidixic acid and flumequine, chosen as model analytes, in animal muscle samples. The nanocomposites were obtained by synthesizing magnetic nanoparticles by a co-precipitation method and their coating with terbium and europium ions. The limits of detection obtained using standard solutions were: 1.0, 1.5, 3.8, 0.25, 0.7 and 1.2ngmL(-1), which corresponds to 3.3, 5.0, 12.7, 0.8, 2.3 and 4.0μgkg(-1) for oxytetracycline, tetracycline, chlortetracycline, oxolinic acid, nalidixic acid and flumequine, respectively, in meat samples. The precision values, obtained in the presence of the sample matrix, were in the ranges 0.12-2.0% and 2.6-15.4% for retention times and areas, respectively. The selectivity of the method was checked by assaying different veterinary drugs, finding that most of them did not interfere at the same concentration levels as that of analytes. A recovery study was performed in the presence of chicken and pork muscle samples, which provided values in the range of 61.5-102.6%. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. The Level of Europium-154 Contaminating Samarium-153-EDTMP Activates the Radiation Alarm System at the US Homeland Security Checkpoints

    Directory of Open Access Journals (Sweden)

    Mohammed Najeeb Al Hallak

    2009-08-01

    Full Text Available 153Sm-EDTMP is a radiopharmaceutical composed of EDTMP (ethylenediamine-tetramethylenephosphonate and Samarium-153 [1]. 153Sm-EDTMP has an affinity for skeletal tissue and concentrates in areas with increased bone turnover; thus, it is successfully used in relieving pain related to diffuse bone metastases [1]. The manufacturing process of 153Sm-EDTMP leads to contamination with 154Eu (Europium-154 [2]. A previous study only alluded to the retention of 154Eu in the bones after receiving treatment with 153Sm-EDTMP [2]. Activation of the alarm at security checkpoints after 153Sm-EDTMP therapy has not been previously reported. Two out of 15 patients who received 153Sm-EDTMP at Roger Maris Cancer Center (Fargo, N. Dak., USA activated the radiation activity sensors while passing through checkpoints; one at a US airport and the other while crossing theAmerican-Canadian border. We assume that the 154Eu which remained in the patients’ bones activated the sensors. Methods: In order to investigate this hypothesis, we obtained the consent from 3 of our 15 patients who received 153Sm-EDTMP within the previous 4 months to 2 years, including the patient who had activated the radiation alarm at the airport. The patients were scanned with a handheld detector and a gamma camera for energies from 511 keV to 1.3 MeV. Results: All three patients exhibited identical spectral images, and further analysis showed that the observed spectra are the result of 154Eu emissions. Conclusion: Depending on the detection thresholds and windows used by local and federal authorities, the remaining activity of 154Eu retained in patients who received 153Sm-EDTMP could be sufficient enough to increase the count rates above background levels and activate the sensors. At Roger Maris Cancer Center, patients are now informed of the potential consequences of 153Sm-EDTMP therapy prior to initiating treatment. In addition, patients treated with 153Sm-EDTMP at Roger Maris Cancer Center

  6. Allospecific CD154 + T-cytotoxic memory cells as potential surrogate for rejection risk in pediatric intestine transplantation.

    Science.gov (United States)

    Sindhi, Rakesh; Ashokkumar, Chethan; Higgs, Brandon W; Gilbert, P B; Sun, Qing; Ranganathan, Sarangarajan; Jaffe, Ron; Snyder, Sara; Ningappa, Mylarappa; Soltys, Kyle A; Bond, Geoffrey J; Mazariegos, George V; Abu-Elmagd, Kareem; Zeevi, Adriana

    2012-02-01

    Clinical end-points dictate large trial enrollments and exclude children with the rare intestine transplant procedure (ITx), who experience higher drug-related morbidity. We evaluate the novel rejection-risk parameter, allo-(antigen)-specific CD154 + TcMs (i) as surrogates for ACR using Prentice's criteria, (ii) for association with immunosuppression targets to determine Fleming's surrogate end-point designation, and (iii) as time-to-event end-point in a simulated comparison of alemtuzumab (NCT#01208337, n = 14) and rabbit anti-human thymocyte globulin (rATG, n = 16) among 30 children with ITx. CD154 + TcM were measured in MLR before, and at 1-60 and 61-200 days after ITx (NCT#01163578). CD154 + TcM correlate significantly with rejection severity (Spearman r = 0.685, p = 2.03E-5) and associate with biopsy-proven ITx rejection with sensitivity/specificity of 94%/84% [corrected] independent of immunosuppressant. Previously stated sensitivity of 90% is incorrect. [corrected]. The rejection-risk threshold of CD154 + TcM resolves rapidly in 200-day follow-up (46 ± 20 vs. 158 ± 59 days, p = 0.009, K-M) with alemtuzumab, which demonstrates lower 90-day ACR incidence (50% vs. 69%, p=NS, Fisher's exact), and is associated with accelerated prednisone minimization to ≤2.5 mg/day, compared with rATG (120 ± 28 vs. 180 ± 30 days, p = 0.027, K-M). As a surrogate end-point, time-to-rejection-risk resolution measured with CD154 + TcM portends 50% reduction in sample sizes in a simulated trial of alemtuzumab vs. rATG. Rejection-risk assessment with CD154 + TcM may enable informed immunosuppression minimization, and preliminary efficacy comparisons in pediatric ITx. © 2011 John Wiley & Sons A/S.

  7. The Level of Europium-154 Contaminating Samarium-153-EDTMP Activates the Radiation Alarm System at the US Homeland Security Checkpoints.

    Science.gov (United States)

    Najeeb Al Hallak, Mohammed; McCurdy, Matt; Zouain, Nicolas; Hayes, Justin

    2009-08-28

    (153)Sm-EDTMP is a radiopharmaceutical composed of EDTMP (ethylenediamine-tetramethylenephosphonate) and Samarium-153 [1]. (153)Sm-EDTMP has an affinity for skeletal tissue and concentrates in areas with increased bone turnover; thus, it is successfully used in relieving pain related to diffuse bone metastases [1]. The manufacturing process of (153)Sm-EDTMP leads to contamination with (154)Eu (Europium-154) [2]. A previous study only alluded to the retention of (154)Eu in the bones after receiving treatment with (153)Sm-EDTMP [2]. Activation of the alarm at security checkpoints after (153)Sm-EDTMP therapy has not been previously reported. Two out of 15 patients who received (153)Sm-EDTMP at Roger Maris Cancer Center (Fargo, N. Dak., USA) activated the radiation activity sensors while passing through checkpoints; one at a US airport and the other while crossing the American-Canadian border. We assume that the (154)Eu which remained in the patients' bones activated the sensors. METHODS: In order to investigate this hypothesis, we obtained the consent from 3 of our 15 patients who received (153)Sm-EDTMP within the previous 4 months to 2 years, including the patient who had activated the radiation alarm at the airport. The patients were scanned with a handheld detector and a gamma camera for energies from 511 keV to 1.3 MeV. RESULTS: All three patients exhibited identical spectral images, and further analysis showed that the observed spectra are the result of (154)Eu emissions. CONCLUSION: Depending on the detection thresholds and windows used by local and federal authorities, the remaining activity of (154)Eu retained in patients who received (153)Sm-EDTMP could be sufficient enough to increase the count rates above background levels and activate the sensors. At Roger Maris Cancer Center, patients are now informed of the potential consequences of (153)Sm-EDTMP therapy prior to initiating treatment. In addition, patients treated with (153)Sm-EDTMP at Roger Maris Cancer

  8. T cells responding to Trypanosoma cruzi detected by membrane TNF-α and CD154 in chagasic patients.

    Science.gov (United States)

    Ripoll, Juan G; Giraldo, Nicolás A; Bolaños, Natalia I; Roa, Nubia; Rosas, Fernando; Cuéllar, Adriana; Puerta, Concepción J; González, John M

    2018-03-01

    Chagas disease is a parasitic infection whose pathogenesis is related to parasite persistence and a dysfunctional cellular immune response. Variability in cytokine secretion among chronic Trypanosoma cruzi-infected patients might preclude the identification of the pool of antigen specific T cells. The goal of this study was to determine the fraction of T cells responding to T. cruzi antigen measured by the expression of membrane TNF-α and CD154. A total of 21 chagasic patients, 11 healthy and 5 non-chagasic cardiomyopathy controls were analyzed. PBMCs were short-term cultured in the presence of anti-CD28, anti-CD49d, anti-TNF-α, and TACE (TNF-α converting enzyme) inhibitor either under T. cruzi-lysate or polyclonal stimuli. Cells were stained with anti-CD3, anti-CD4, anti-CD8, and anti-CD154, and analyzed with flow cytometry. CD4+ and CD8+ T cells in chagasic patients displayed higher percentages of membrane-bound TNF-α+ and CD154+ compared with controls after T. cruzi-antigen stimulation. Both markers displayed a positive correlation in the T cell subpopulations analyzed. Symptomatic chagasic patients were differentiated from asymptomatic patients based on the expression of CD154 and membrane TNF-α in TCD4+ and TCD8+ compartments, respectively. These results show that both markers could be useful for assessing the pool of antigen-specific T cells in chronic chagasic patients. © 2017 The Authors. Immunity, Inflammation and Disease Published by John Wiley & Sons Ltd.

  9. KLF10 Mediated Epigenetic Dysregulation of Epithelial CD40/CD154 Promotes Endometriosis.

    Science.gov (United States)

    Delaney, Abigail A; Khan, Zaraq; Zheng, Ye; Correa, Luiz F; Zanfagnin, Valentina; Shenoy, Chandra C; Schoolmeester, John K; Saadalla, Abdulrahman M; El-Nashar, Sherif; Famuyide, Abimbola O; Subramaniam, Malayannan; Hawse, John R; Khazaie, Khashayarsha; Daftary, Gaurang S

    2016-09-01

    Endometriosis is a highly prevalent, chronic, heterogeneous, fibro-inflammatory disease that remains recalcitrant to conventional therapy. We previously showed that loss of KLF11, a transcription factor implicated in uterine disease, results in progression of endometriosis. Despite extensive homology, co-expression, and human disease association, loss of the paralog Klf10 causes a unique inflammatory, cystic endometriosis phenotype in contrast to fibrotic progression seen with loss of Klf11. We identify here for the first time a novel role for KLF10 in endometriosis. In an animal endometriosis model, unlike wild-type controls, Klf10(-/-) animals developed cystic lesions with massive immune infiltrate and minimal peri-lesional fibrosis. The Klf10(-/-) disease progression phenotype also contrasted with prolific fibrosis and minimal immune cell infiltration seen in Klf11(-/-) animals. We further found that lesion genotype rather than that of the host determined each unique disease progression phenotype. Mechanistically, KLF10 regulated CD40/CD154-mediated immune pathways. Both inflammatory as well as fibrotic phenotypes are the commonest clinical manifestations in chronic fibro-inflammatory diseases such as endometriosis. The complementary, paralogous Klf10 and Klf11 models therefore offer novel insights into the mechanisms of inflammation and fibrosis in a disease-relevant context. Our data suggests that divergence in underlying gene dysregulation critically determines disease-phenotype predominance rather than the conventional paradigm of inflammation being precedent to fibrotic scarring. Heterogeneity in clinical progression and treatment response are thus likely from disparate gene regulation profiles. Characterization of disease phenotype-associated gene dysregulation offers novel approaches for developing targeted, individualized therapy for recurrent and recalcitrant chronic disease. © 2016 by the Society for the Study of Reproduction, Inc.

  10. CD154 blockade alters innate immune cell recruitment and programs alloreactive CD8+ T cells into KLRG-1(high short-lived effector T cells.

    Directory of Open Access Journals (Sweden)

    Ivana R Ferrer

    Full Text Available CD154/CD40 blockade combined with donor specific transfusion remains one of the most effective therapies in prolonging allograft survival. Despite this, the mechanisms by which these pathways synergize to prevent rejection are not completely understood. Utilizing a BALB/c (H2-K(d to B6 (H2-K(b fully allogeneic skin transplant model system, we performed a detailed longitudinal analysis of the kinetics and magnitude of CD8(+ T cell expansion and differentiation in the presence of CD154/CD40 pathway blockade. Results demonstrated that treatment with anti-CD154 vs. DST had distinct and opposing effects on activated CD44(high CD62L(low CD8(+ T cells in skin graft recipients. Specifically, CD154 blockade delayed alloreactive CD8(+ T cell responses, while DST accelerated them. DST inhibited the differentiation of alloreactive CD8(+ T cells into multi-cytokine producing effectors, while CD40/CD154 blockade led to the diminution of the KLRG-1(low long-lived memory precursor population compared with either untreated or DST treated animals. Moreover, only CD154 blockade effectively inhibited CXCL1 expression and neutrophil recruitment into the graft. When combined, anti-CD154 and DST acted synergistically to profoundly diminish the absolute number of IFN-γ producing alloreactive CD8(+ T cells, and intra-graft expression of inflammatory chemokines. These findings demonstrate that the previously described ability of anti-CD154 and DST to result in alloreactive T cell deletion involves both delayed kinetics of T cell expansion and differentiation and inhibited development of KLRG-1(low memory precursor cells.

  11. Exploratory computational assessment of possible binding modes for small molecule inhibitors of the CD40-CD154 co-stimulatory interaction.

    Science.gov (United States)

    Ganesan, L; Vidović, D; Schürer, S C; Buchwald, P

    2012-05-01

    Protein-protein interactions (PPI) tend to involve extensive, flat, and featureless interfaces that are difficult to disrupt by small molecule binding. However, recently, PPIs are being recognized as increasingly valuable 'druggable' targets. We have identified several small molecule inhibitors of the immunologically relevant CD40-CD154 co-stimulatory interaction that bind to the homotrimeric CD154, a member of the tumor necrosis factor superfamily (TNFSF). Recently, on the basis of the co-crystal structure of CD154 with another small molecule (BIO8898), it has been suggested that these PPIs could be particularly susceptible to small molecule blockade due to a subunit fracture mechanism resulting in a distortion of the trimeric structure. To investigate whether this mechanism can occur with our organic dye-related inhibitors, we performed exploratory computational docking experiments. Possible druggable pockets that can serve as binding sites for small molecule inhibitors were identified with the FFT map algorithm both along the CD154-CD40 binding interface (competitive, orthosteric model) and in the interior core of the CD154 trimer corresponding to the BIO8898 binding site (allosteric model). Docking experiments (using Glide) were performed at these sites using the PDB ID: 3QD6 (CD40-CD154) and 3LKJ (BIO8898-CD154) co-crystal structures, respectively. The docking algorithm was able to better discriminate binders from non-binders at the deeper allosteric site than at the competitive site. Accordingly, an allosteric inhibitory mechanism that involves intercalation between monomeric subunits seems feasible for our small molecules making the constitutively trimeric CD154 a likely druggable target.

  12. CD154 Is Released from T-cells by a Disintegrin and Metalloproteinase Domain-containing Protein 10 (ADAM10) and ADAM17 in a CD40 Protein-dependent Manner*

    Science.gov (United States)

    Yacoub, Daniel; Benslimane, Nadir; Al-Zoobi, Loubna; Hassan, Ghada; Nadiri, Amal; Mourad, Walid

    2013-01-01

    CD154 (CD40 ligand) is a type II transmembrane protein that belongs to the tumor necrosis factor superfamily. The soluble form of CD154 (sCD154), which results from the shedding of membrane-bound CD154, plays a key role in the production of proinflammatory cytokines and has been linked to various autoimmune and vascular disorders. Therefore, elucidating the mechanisms by which CD154 is released from the cell surface following its interaction with its various receptors is of primordial importance. Using co-culture experiments, we show that CD154 is shed predominantly upon its engagement with CD40. Indeed, only CD40 (both membrane-bound and soluble) and not α5β1 or αMβ2 is involved in the cleavage and release of CD154 from Jurkat E6.1 T-cells. Interestingly, CD154 is cleaved independently of the formation of cell surface CD40 homodimers and independently of its association into lipid rafts. In contrast, we found that the protein kinase C (PKC) signaling family and the matrix metalloproteinases ADAM10 and ADAM17 are intimately involved in this process. In conclusion, our data indicate that CD154 is released from T-cells by ADAM10 and ADAM17 upon CD40 ligation. These findings add significant insights into the mechanisms by which CD154 is down-regulated and may lead to the generation of novel therapeutic targets for the treatment of CD154-associated disorders. PMID:24189063

  13. CD154 is released from T-cells by a disintegrin and metalloproteinase domain-containing protein 10 (ADAM10) and ADAM17 in a CD40 protein-dependent manner.

    Science.gov (United States)

    Yacoub, Daniel; Benslimane, Nadir; Al-Zoobi, Loubna; Hassan, Ghada; Nadiri, Amal; Mourad, Walid

    2013-12-13

    CD154 (CD40 ligand) is a type II transmembrane protein that belongs to the tumor necrosis factor superfamily. The soluble form of CD154 (sCD154), which results from the shedding of membrane-bound CD154, plays a key role in the production of proinflammatory cytokines and has been linked to various autoimmune and vascular disorders. Therefore, elucidating the mechanisms by which CD154 is released from the cell surface following its interaction with its various receptors is of primordial importance. Using co-culture experiments, we show that CD154 is shed predominantly upon its engagement with CD40. Indeed, only CD40 (both membrane-bound and soluble) and not α5β1 or αMβ2 is involved in the cleavage and release of CD154 from Jurkat E6.1 T-cells. Interestingly, CD154 is cleaved independently of the formation of cell surface CD40 homodimers and independently of its association into lipid rafts. In contrast, we found that the protein kinase C (PKC) signaling family and the matrix metalloproteinases ADAM10 and ADAM17 are intimately involved in this process. In conclusion, our data indicate that CD154 is released from T-cells by ADAM10 and ADAM17 upon CD40 ligation. These findings add significant insights into the mechanisms by which CD154 is down-regulated and may lead to the generation of novel therapeutic targets for the treatment of CD154-associated disorders.

  14. Endoscopic repair in 154 cases of urethral occlusion: the promise of guided optical urethral reconstruction.

    Science.gov (United States)

    al-Ali, M; al-Shukry, M

    1997-01-01

    We determined whether optical urethral reconstruction, with the use of a Béniqué bougie in the proximal urethra and transrectal digital guidance, is effective for the treatment of long and severe urethral occlusions. However, with some skill the procedure can be done without the bougie for the treatment of short occlusions. During a 9-year period 154 men with complete urethral occlusion underwent core through optical urethrotomy via transrectal digital guidance, using the Béniqué bougie in 89 (58%). A total of 400 urethrotomies was performed. All lesions were in the posterior urethra except 8 in the pendulous portion. There were 64 war related injuries (41.6%). Combined voiding and retrograde urethrography was not useful to measure the length of the occlusion due to failure of proximal urethral filling. Guided optical urethral reconstruction consisted of optical urethrotomy performed with a Béniqué bougie introduced proximally through the suprapubic catheter site and into the proximal urethra with the index finger of the operator in the rectum. The same procedure was performed blindly without use of the bougie in 65 patients (42%), and in 43 with lesions shorter than 1 cm. and 4 with multiple annular lesions. We also used the blind technique successfully to reestablish 18 occlusions longer than 1 cm. For optimal epithelialization of the urethral tract we suggest leaving a silicone catheter indwelling for 3 months. No prophylactic antibiotics were given. Of the patients 54 (35%) were cured after 1 procedure, whereas the remaining 100 (65%) required 1 to 9 additional urethrotomies (mean 3). Patients with an uninstrumented urethra who were treated initially with suprapubic catheterization required 1 to 6 urethrotomies (mean 2), compared to 1 to 10 (mean 3) for those who had undergone a prior procedure. Hematuria occurred in 9% of the patients, symptomatic urinary tract infection in 7% and slight extravasation in 3.2%. One patient had stress incontinence. Our

  15. Protocol-based management of 154 cases of pediatric liver abscess.

    Science.gov (United States)

    Roy Choudhury, Subhasis; Khan, Niyaz Ahmed; Saxena, Rahul; Yadav, Partap Singh; Patel, Jigar N; Chadha, Rajiv

    2017-02-01

    Although liver abscess (LA) is prevalent worldwide, especially in developing countries, there is a paucity of data regarding the protocol for management of LA in children. The aim of this study was to analyze the outcome of a protocol-based management of pediatric LA from a single institution. This prospective observational study was conducted in a tertiary-care children's hospital and included all patients with LA managed over a 5-year period. Detailed clinical, laboratory, microbiological and imaging parameters were recorded, and the patients were treated according to a standardized management protocol. Small abscesses (managed with antimicrobial therapy alone. Liquefied abscesses on imaging were additionally subjected to US guided percutaneous needle aspirations (PNA). Large abscesses pointing to the surface were treated by percutaneous drainage (PCD). Ruptured LA, abscess inaccessible to image-guided drainage and those not responding to other modes of treatment were subjected to open surgical drainage (OSD). Pleural collections were treated by aspirations or intercostal tube drainage. Outcome was analyzed in terms of duration of recovery and complications including mortality. Over the 5-year period, 154 pediatric LA patients underwent protocol-based management. The mean age of the patients was 6.76 years with the male:female being 1.26:1. Medical management alone, PNA, PCD and OSD were successful in 38 (24.6%), 76 (49.3%), 11 (7.14%) and 29 (18.8%) cases, respectively. Pleural collections developed in 43 (27.9%) patients out of which aspiration/drainage was needed in 24 (55.81%) cases. The mean duration of hospital stay was 20.67 ± 9.52 days. Ongoing sepsis and multi-organ failure lead to mortality in 6 (3.8%) cases; rest of the patients were doing well on follow-up. Ultra-sonography was useful for the initial diagnosis, monitoring the progress and management of LA in children. The outcome of a protocol-based management of LA in children was favorable.

  16. Increased soluble CD154 (CD40 ligand) levels in xenograft recipients correlate with the development of de novo anti-pig IgG antibodies.

    Science.gov (United States)

    Ezzelarab, Mohamed B; Ekser, Burcin; Isse, Kumiko; Iwase, Hayato; Morelli, Adrian E; Ayares, David; Cooper, David K C

    2014-03-15

    De novo anti-pig antibodies are associated with acute humoral xenograft rejection. We explored the relative efficacy of CD40/CD154-pathway blockade versus CD28/B7-pathway blockade in the prevention of de novo anti-pig IgG antibodies in xenograft recipients. After α1,3-galactosyltransferase gene-knockout pig artery patch xenotransplantation, recipient baboons received no immunosuppression (IS; n=3), or anti-CD154mAb-based (n=5) or CTLA4-Ig-based (n=5) IS. CD4 T-cell and CD20 B-cell numbers in blood were determined. Serum anti-pig IgG antibodies and serum soluble (s)CD154 levels were measured. In lymph nodes, germinal center formation was examined and numbers of proliferating cells were evaluated by Ki-67 staining. After transplantation, with no IS, CD4 T-cell and CD20 B-cell numbers were increased, but were reduced by IS.In lymph nodes, with no IS, there was enhanced germinal center formation, which was significantly reduced by anti-CD154mAb-based (PCD154 and circulating sCD154, thus preventing subsequent stimulation of B cells and activation of lymphoid follicles in secondary lymphoid tissues.

  17. Activation of CD40 with platelet derived CD154 promotes reactive oxygen species dependent death of human hepatocytes during hypoxia and reoxygenation.

    Directory of Open Access Journals (Sweden)

    Ricky H Bhogal

    Full Text Available BACKGROUND: Hypoxia and hypoxia-reoxygenation (H-R are pathogenic factors in many liver diseases that lead to hepatocyte death as a result of reactive oxygen species (ROS accumulation. The tumor necrosis factor super-family member CD154 can also induce hepatocyte apoptosis via activation of its receptor CD40 and induction of autocrine/paracrine Fas Ligand/CD178 but the relationship between CD40 activation, ROS generation and apoptosis is poorly understood. We hypothesised that CD40 activation and ROS accumulation act synergistically to drive human hepatocyte apoptosis. METHODS: Human hepatocytes were isolated from liver tissue and exposed to an in vitro model of hypoxia and H-R in the presence or absence of CD154 and/or various inhibitors. Hepatocyte ROS production, apoptosis and necrosis were determined by labelling cells with 2',7'-dichlorofluorescin, Annexin-V and 7-AAD respectively in a three-colour reporter flow cytometry assay. RESULTS: Exposure of human hepatocytes to recombinant CD154 or platelet-derived soluble CD154 augments ROS accumulation during H-R resulting in NADPH oxidase-dependent apoptosis and necrosis. The inhibition of c-Jun N-terminal Kinase and p38 attenuated CD154-mediated apoptosis but not necrosis. CONCLUSIONS: CD154-mediated apoptosis of hepatocytes involves ROS generation that is amplified during hypoxia-reoxygenation. This finding provides a molecular mechanism to explain the role of platelets in hepatocyte death during ischemia-reperfusion injury.

  18. Activation of CD40 with platelet derived CD154 promotes reactive oxygen species dependent death of human hepatocytes during hypoxia and reoxygenation.

    Science.gov (United States)

    Bhogal, Ricky H; Weston, Christopher J; Curbishley, Stuart M; Adams, David H; Afford, Simon C

    2012-01-01

    Hypoxia and hypoxia-reoxygenation (H-R) are pathogenic factors in many liver diseases that lead to hepatocyte death as a result of reactive oxygen species (ROS) accumulation. The tumor necrosis factor super-family member CD154 can also induce hepatocyte apoptosis via activation of its receptor CD40 and induction of autocrine/paracrine Fas Ligand/CD178 but the relationship between CD40 activation, ROS generation and apoptosis is poorly understood. We hypothesised that CD40 activation and ROS accumulation act synergistically to drive human hepatocyte apoptosis. Human hepatocytes were isolated from liver tissue and exposed to an in vitro model of hypoxia and H-R in the presence or absence of CD154 and/or various inhibitors. Hepatocyte ROS production, apoptosis and necrosis were determined by labelling cells with 2',7'-dichlorofluorescin, Annexin-V and 7-AAD respectively in a three-colour reporter flow cytometry assay. Exposure of human hepatocytes to recombinant CD154 or platelet-derived soluble CD154 augments ROS accumulation during H-R resulting in NADPH oxidase-dependent apoptosis and necrosis. The inhibition of c-Jun N-terminal Kinase and p38 attenuated CD154-mediated apoptosis but not necrosis. CD154-mediated apoptosis of hepatocytes involves ROS generation that is amplified during hypoxia-reoxygenation. This finding provides a molecular mechanism to explain the role of platelets in hepatocyte death during ischemia-reperfusion injury.

  19. The Periplasmic Cavity of LacY Mutant Cys154→Gly: How Open is Open?

    Science.gov (United States)

    Jiang, Xiaoxu; Driessen, Arnold J. M.; Feringa, Ben L.; Kaback, H. Ronald

    2013-01-01

    The lactose permease from Escherichia coli (LacY) is a galactoside/H+ symporter that catalyzes the coupled stoichiometric transport of a sugar and an H + across the cytoplasmic membrane. x-ray crystal structures of WT LacY and the conformationally restricted mutant Cys154→Gly exhibit an inward-facing conformation with a tightly sealed periplasmic side and a deep central cleft or cavity open to the cytoplasm. Although the crystal structures may give the impression that LacY is a rigid molecule, multiple converging lines of evidence demonstrate that galactoside binding to WT LacY induces reciprocal opening and closing of periplasmic and cytoplasmic cavities, respectively. By this means, the sugar- and H+-binding sites in the middle of the molecule are exposed alternatively to either side of the membrane. In contrast to the crystal structure, biochemical/biophysical studies with mutant Cys154→Gly show that the periplasmic side is paralyzed in an open-outward conformation. In this study, a rigid, funnel-shaped, maleimide-containing molecule was used to probe the periplasmic cavity of a pseudo WT and the Cys154→Gly mutant by site-directed alkylation. The findings provide strong support for previous observations and indicate further that the external opening of the periplasmic cleft in the mutant is patent to the extent of at least 8.5 Å in the absence of sugar or about half that of the WT cavity with bound galactoside. PMID:23962108

  20. Nuclear structure effects of the nuclei {sup 152,154,156}Dy at high excitation energy and large angular momentum

    Energy Technology Data Exchange (ETDEWEB)

    Martin, V. [Analisis Numerico, Facultad de Informatica, Universidad Politecnica de Madrid, E-28660 Madrid (Spain); Egido, J.L. [Departamento de Fisica Teorica C-XI, Universidad Autonoma de Madrid, E-28049 Madrid (Spain)

    1995-06-01

    Using the finite-temperature Hartree-Fock-Bogoliubov formalism we analyze the properties of the nuclei {sup 152,154,156}Dy at the quasicontinuum region from {ital I}=0{h_bar} to 70{h_bar} and excitation energy up to approximately 16 MeV. We discuss energy gaps, shapes, moments of inertia, and entropy among others. The role of shape fluctuations is studied in the frame of classical statistics and we find large effects on several observables. A very rich structure is found in terms of excitation energy and angular momentum.

  1. T cells interact with T cells via CD40-CD154 to promote autoimmunity in T1D

    Science.gov (United States)

    Baker, Rocky L; Mallevaey, Thierry; Gapin, Laurent; Haskins, Kathryn

    2013-01-01

    Summary We have investigated the role of CD40 signaling in islet-reactive, diabetogenic CD4 Th1 T cell clones. Using multispectral flow cytometry, we showed that CD40 and CD154 are co-expressed and form complexes on the surface of activated T cells. We also demonstrate that activated T cells can transactivate CD4+CD40+ T cells through the CD40-CD154 pathway. To investigate the role of CD40 signaling on Th1 cells, we used the diabetogenic clone BDC-5.2.9 retrovirally transduced with a truncated form of the CD40 molecule to produce a CD40 dominant-negative T cell clone. Upon challenge with antigen in vitro, the production of IFN-γ by BDC-5.2.9 CD40DN was greatly reduced and in vivo, the dominant-negative variant was unable to induce diabetes. Transduction with the CD40DN vector was also effective in preventing transfer of disease by primary NOD CD4 T cells. Ex vivo analysis of pancreatic infiltrates after transfer of BDC-5.2.9 CD40DN revealed an overall reduction of cell numbers and cytokine production by both T cells and macrophages. These data indicate that CD40 is an important signaling molecule on autoreactive CD4 T cells and contributes to their pathogenic effector function. PMID:22488364

  2. Vaccination produces CD4 T cells with a novel CD154-CD40 dependent cytolytic mechanism ¶

    Science.gov (United States)

    Coler, Rhea N.; Hudson, Thomas; Hughes, Sean; Huang, Po-wei D.; Beebe, Elyse A.; Orr, Mark T.

    2015-01-01

    The discovery of new vaccines against infectious diseases and cancer requires the development of novel adjuvants with well-defined activities. The TLR4 agonist adjuvant GLA-SE elicits robust TH1 responses to a variety of vaccine antigens and is in clinical development for both infectious diseases and cancer. We demonstrate that immunization with a recombinant protein antigen and GLA-SE also induces granzyme A expression in CD4 T cells and produces cytolytic cells that can be detected in vivo. Surprisingly these in vivo CTLs were CD4 T cells, not CD8 T cells and this cytolytic activity was not dependent on granzyme A/B or perforin. Unlike previously reported CD4 CTLs the transcription factors Tbet and Eomes were not necessary for their development. CTL activity was also independent of the FasL-Fas, TRAIL-DR5, and canonical death pathways, indicating a novel mechanism of CTL activity. Rather, the in vivo CD4 CTL activity induced by vaccination required T cell expression of CD154 (CD40 ligand) and target cell expression of CD40. Thus, vaccination with a TLR4 agonist adjuvant induces CD4 CTLs which kill through a previously unknown CD154-dependent mechanism. PMID:26297758

  3. Method for the validation of immunohistochemical staining using SCID mouse xenografts: expression of CD40 and CD154 in human non-small cell lung cancer.

    Science.gov (United States)

    Ishikawa, Keidai; Miyamoto, Masaki; Yoshioka, Tatsuya; Kadoya, Masatoshi; Li, Li; Mishra, Roshan; Ichinokawa, Kazuomi; Shoji, Yasuhito; Matsumura, Yoshiyuki; Hida, Yasuhiro; Kaga, Kichizo; Kato, Tatsuya; Kaji, Mitsuhito; Ohbuchi, Toshiro; Itoh, Tomoo; Dosaka-Akita, Hirotoshi; Matsui, Yoshiro; Hirano, Satoshi

    2013-04-01

    This report proposes a concept for the standardization of immunohistochemical evaluation. Immunohistochemical staining has several problems associated with the sensitivity of the technical process and standardization of the assessment of potent staining. We provided data focusing on this concept through immunostaining for CD154 in non-small cell lung cancer (NSCLC). We used two types of anti-CD154 antibody as primary antibodies in immunohistochemical staining, as previously reported. Western blot analysis confirmed strong CD154 expression in the cultured cell line PC10, but not in LK2. We also assessed CD154 expression in SCID mouse xenografts of these cell lines. SCID xenograft data on western blot analysis were consistent with those of cultured cell lines. These xenografts could thus be used as positive or negative tissue controls for CD154 immunostaining. Primary antibodies should therefore be confirmed as recognizing target lesions, while control tissue specimens should be objectively confirmed as having target products using another experimental method. Our method would allow results to be unified at more than one laboratory and could act as an objective control assessment method in immunohistochemistry.

  4. NF-κB is involved in the regulation of CD154 (CD40 ligand) expression in primary human T cells

    Science.gov (United States)

    Srahna, M; Remacle, J E; Annamalai, K; Pype, S; Huylebroeck, D; Boogaerts, M A; Vandenberghe, P

    2001-01-01

    Cognate interactions between CD154 (CD40 ligand, CD40L) on activated T cells and its receptor CD40 on various antigen-presenting cells are involved in thymus-dependent humoral immune responses and multiple other cell-mediated immune responses. We have studied the regulation of CD154 expression in human T cells after activation with anti-CD3 and anti-CD28 antibodies or after pharmacological activation of protein kinase C with phorbol 12-myristate 13-acetate, and the calcium ionophore ionomycin. Under these conditions, transcription of the CD154 gene was rapidly induced without requiring de novo protein synthesis. Pharmacological inhibitors of NF-κB activation down-regulated CD154 mRNA and protein levels. Cyclosporin A, an inhibitor of NF-AT activation, acted similarly, and the effects of both inhibitors were additive. A potential NF-κB binding site is present within the CD154 promoter at positions −1190 to −1181. In electrophoretic mobility shift assays, this sequence was specifically bound by NF-κB present in nuclear extracts from activated T cells. Furthermore, in transient co-transfection of Jurkat T cells, p65 activated the transcription of a reporter construct containing a multimer of this NF-κB binding site. These observations demonstrate a role of NF-κB transcription factors in the regulation of CD40L expression in activated primary human T cells. PMID:11529914

  5. Separate cis-trans pathways post-transcriptionally regulate murine CD154 (CD40 ligand) expression: a novel function for CA repeats in the 3'-untranslated region.

    Science.gov (United States)

    Hamilton, B JoNell; Wang, Xiao-Wei; Collins, Jane; Bloch, Donald; Bergeron, Alan; Henry, Brian; Terry, Benjamin M; Zan, Moe; Mouland, Andrew J; Rigby, William F C

    2008-09-12

    We report a role for CA repeats in the 3'-untranslated region (3'-UTR) in regulating CD154 expression. Human CD154 is encoded by an unstable mRNA; this instability is conferred in cis by a portion of its 3'-UTR that includes a polypyrimidine-rich region and CA dinucleotide repeat. We demonstrate similar instability activity with the murine CD154 3'-UTR. This instability element mapped solely to a conserved 100-base CU-rich region alone, which we call a CU-rich response element. Surprisingly, the CA dinucleotide-rich region also regulated reporter expression but at the level of translation. This activity was associated with poly(A) tail shortening and regulated by heterogeneous nuclear ribonucleoprotein L levels. We conclude that the CD154 3'-UTR contains dual cis-acting elements, one of which defines a novel function for exonic CA dinucleotide repeats. These findings suggest a mechanism for the association of 3'-UTR CA-rich response element polymorphisms with CD154 overexpression and the subsequent risk of autoimmune disease.

  6. CD4+ T helper cells use CD154-CD40 interactions to counteract T reg cell-mediated suppression of CD8+ T cell responses to influenza.

    Science.gov (United States)

    Ballesteros-Tato, André; León, Beatriz; Lund, Frances E; Randall, Troy D

    2013-07-29

    CD4(+) T cells promote CD8(+) T cell priming by licensing dendritic cells (DCs) via CD40-CD154 interactions. However, the initial requirement for CD40 signaling may be replaced by the direct activation of DCs by pathogen-derived signals. Nevertheless, CD40-CD154 interactions are often required for optimal CD8(+) T cell responses to pathogens for unknown reasons. Here we show that CD40 signaling is required to prevent the premature contraction of the influenza-specific CD8(+) T cell response. CD40 is required on DCs but not on B cells or T cells, whereas CD154 is required on CD4(+) T cells but not CD8(+) T cells, NKT cells, or DCs. Paradoxically, even though CD154-expressing CD4(+) T cells are required for robust CD8(+) T cell responses, primary CD8(+) T cell responses are apparently normal in the absence of CD4(+) T cells. We resolved this paradox by showing that the interaction of CD40-bearing DCs with CD154-expressing CD4(+) T cells precludes regulatory T cell (T reg cell)-mediated suppression and prevents premature contraction of the influenza-specific CD8(+) T cell response. Thus, CD4(+) T helper cells are not required for robust CD8(+) T cell responses to influenza when T reg cells are absent.

  7. C4b binding protein binds to CD154 preventing CD40 mediated cholangiocyte apoptosis: a novel link between complement and epithelial cell survival.

    Directory of Open Access Journals (Sweden)

    Kevin T Williams

    Full Text Available Activation of CD40 on hepatocytes and cholangiocytes is critical for amplifying Fas-mediated apoptosis in the human liver. C4b-Binding Protein (C4BP has been reported to act as a potential surrogate ligand for CD40, suggesting that it could be involved in modulating liver epithelial cell survival. Using surface plasmon resonance (BiaCore analysis supported by gel filtration we have shown that C4BP does not bind CD40, but it forms stable high molecular weight complexes with soluble CD40 ligand (sCD154. These C4BP/sCD154 complexes bound efficiently to immobilised CD40, but when applied to cholangiocytes they failed to induce apoptosis or proliferation or to activate NFkB, AP-1 or STAT 3, which are activated by sCD154 alone. Thus C4BP can modulate CD40/sCD154 interactions by presenting a high molecular weight multimeric sCD154/C4BP complex that suppresses critical intracellular signalling pathways, permitting cell survival without inducing proliferation. Immunohistochemistry demonstrated co-localisation and enhanced expression of C4BP and CD40 in human liver cancers. These findings suggest a novel pathway whereby components of the complement system and TNF ligands and receptors might be involved in modulating epithelial cell survival in chronic inflammation and malignant disease.

  8. Human circulating group 2 innate lymphoid cells can express CD154 and promote IgE production.

    Science.gov (United States)

    Maggi, Laura; Montaini, Gianni; Mazzoni, Alessio; Rossettini, Beatrice; Capone, Manuela; Rossi, Maria Caterina; Santarlasci, Veronica; Liotta, Francesco; Rossi, Oliviero; Gallo, Oreste; De Palma, Raffaele; Maggi, Enrico; Cosmi, Lorenzo; Romagnani, Sergio; Annunziato, Francesco

    2017-03-01

    Protection against helminths consists of adaptive responses by T H 2 cells and innate responses by group 2 innate lymphoid cells (ILC2s), with these latter being well characterized in mice but less so in human subjects. We sought to characterize human circulating ILC2s and compare their functional profile with that of autologous T H 2 cells. Circulating ILC2s and T H 2 cells were isolated by means of fluorescence-activated cell sorting and magnetic cell sorting and expanded in vitro. ILC2s were then stimulated with phorbol 12-myristate 13-acetate plus ionomycin, IL-25 plus IL-33 (IL-25/IL-33), or a mixture of Toll-like receptor ligands to evaluate their ability to produce cytokines, express CD154, and induce IgE production by autologous B cells. Cytokines and transcription factor gene methylation were assessed. ILC2s expressed GATA-3, retinoic acid orphan receptor (RORC) 2, and RORα; were able to produce IL-5, IL-13, and IL-4; and, accordingly, were characterized by demethylation of IL4, IL13, IL5, GATA3, and RORC2, whereas the IFNG, IFNG promoter, and TBX21 regions of interest were methylated. ILC2s expressed TLR1, TLR4, and TLR6, and TLR stimulation induced IL-5 and IL-13 production. Moreover, ILC2s expressed CD154 in response to phorbol 12-myristate 13-acetate plus ionomycin, IL-25/IL-33, or a mixture of TLR ligands. Stimulated ILC2s also induced IgM, IgG, IgA, and IgE production by B cells. Finally, circulating ILC2s from atopic patients were not different in numbers and frequency but expressed higher IL-4 levels than those from nonatopic subjects. This study provides the first evidence that human ILC2s can express CD154 and stimulate the production of IgE by B lymphocytes through IL-25/IL-33 stimulation or TLR triggering. Copyright © 2016 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  9. Evaluation of CD86/CD28 and CD40/CD154 pathways in regulating monocyte-derived CD80 expression during their interaction with allogeneic endothelium.

    Science.gov (United States)

    Wang, P; Liu, Z; Wu, C; Zhu, B; Wang, Y; Xu, H

    2008-10-01

    This study was designed to examine the role of monocyte-derived CD80 in providing costimulation to CD4+ cells, and to determine whether monocyte-derived CD80 expression is regulated by CD86/CD28 and CD40/CD154 pathways during allogeneic immunoresponses. Human endothelial cells (EC) and purified monocytes cocultured with or without CD4+ cells were analyzed by real-time quantitative polymerase chain reaction (RT-PCR) and florescence-activated cell scanning (FACS). Peripheral blood mononuclear cells (PBMC)-EC cocultures with or without costimulation blockade were analyzed by FACS. The effects of CD154 and CD28 blockade to inhibit lymphocyte proliferation were evaluated by mixed lymphocyte-EC reaction (MLER). RT-PCR demonstrated upregulation of CD80 transcripts in EC-stimulated monocytes in the absence of CD4+ cells. However, the surface expression of CD80 was undetectable. The expression of CD80 was restored in the presence of CD4+ cells. Additionally, CD80 blockade partially inhibited CD4+ cell proliferation induced by EC-conditioned monocytes. Monocytes demonstrated upregulation of CD80 on the surface during PBMC-EC interaction. CD86, CD28, and CD154 blockade did not prevent upregulation of monocyte-derived CD80 expression. CD28 and CD154 blockade partially inhibited lymphocyte proliferation of MLER. In summary, EC-stimulated monocytes upregulated CD80 expression at the transcript level but not on their surface in the absence of T cells. The surface expression of monocyte-derived CD80 is upregulated on EC-stimulated monocytes in the presence of T cells. CD154/CD40 and CD28/CD86 blockade cannot prevent monocyte-derived CD80 expression, suggesting that CD80 upregulation is through a CD154- or CD86-independent pathway. Specific therapy to prevent monocyte activation may be required for successful allograft transplantation.

  10. Numerical simulation of the electromagnetic decay of the nuclei {sup 152,154,156}Dy with self-consistent collective strength functions

    Energy Technology Data Exchange (ETDEWEB)

    Martin, V. [Analisis Numerico, Facultad de Informatica, Universidad Politecnica de Madrid, E-28660 Madrid (Spain); Egido, J.L. [Departamento de Fisica Teorica C-XI, Universidad Autonoma de Madrid, E-28049 Madrid (Spain); Khoo, T.L.; Lauritsen, T. [Argonne National Laboratory, Argonne, Illinois 60439 (United States)

    1995-06-01

    The electromagnetic decay of the nuclei {sup 152,154,156}Dy is analyzed using microscopic Hartree-Fock calculations at finite temperature. The theoretical collective transition probabilities are implemented in numerical simulations to produce theoretical spectra. Thermal shape fluctuations are also taken into account. The inclusion of these correlation is crucial in order to understand the main features of the collective {ital E}2 spectra of these isotopes at different energies. The theoretical calculations suggest a shape change as responsible for the unusual features of the spectrum of the nucleus {sup 154}Dy at high energy.

  11. Low-energy dipole modes in the heavy deformed nucleus 154Sm via inelastic polarized proton scattering at 0°

    Directory of Open Access Journals (Sweden)

    Poltoratska I.

    2012-12-01

    Full Text Available A high resolution proton scattering experiment has been performed on the heavy deformed nucleus 154Sm at extreme forward angles with 300 MeV polarized protons at RCNP, Osaka. Our scientific goal is to investigate the impact of ground state deformation on the properties of the pygmy dipole resonance and on the spin-M1 resonance showing a double-humped structure in heavy deformed nuclei. The (p, p′ cross sections can be decomposed into E1 and M1 parts in two independent ways based either on a multipole decomposition of the cross sections or on spin-transfer observables as has been demonstrated for the case of 208Pb. We present the method and preliminary results from the analysis of polarization transfer observables.

  12. Experimental investigation of the 0{sub 2}{sup +} band in {sup 154}Sm as a β-vibrational band

    Energy Technology Data Exchange (ETDEWEB)

    Smallcombe, J., E-mail: james.smallcombe@outlook.com [Department of Physics, University of York, Heslington, York YO10 5DD (United Kingdom); Davies, P.J.; Barton, C.J.; Jenkins, D.G. [Department of Physics, University of York, Heslington, York YO10 5DD (United Kingdom); Andersson, L.L.; Butler, P.A.; Cox, D.M.; Herzberg, R.-D.; Mistry, A.; Parr, E. [Oliver Lodge Laboratory, University of Liverpool, Liverpool L69 9ZE (United Kingdom); Grahn, T.; Greenlees, P.T. [Department of Physics, University of Jyväskylä, FI-40014 (Finland); Hauschild, K. [Department of Physics, University of Jyväskylä, FI-40014 (Finland); CSNSM-IN2P3-CNRS, Université Paris-Sud, 91406 Orsay (France); Herzan, A.; Jakobsson, U.; Jones, P.; Julin, R.; Juutinen, S.; Ketelhut, S.; Leino, M. [Department of Physics, University of Jyväskylä, FI-40014 (Finland); and others

    2014-05-01

    A study of {sup 154}Sm through γ-ray and internal conversion electron coincidence measurements was performed using the Silicon And GErmanium spectrometer (SAGE). An upper limit for the ρ{sup 2}(E0;2{sub 2}{sup +}→2{sub 1}{sup +}) and measurement of the ρ{sup 2}(E0;4{sub 2}{sup +}→4{sub 1}{sup +}) monopole transitions strengths were determined. The extracted transition strength for each is significantly lower than that predicted by either the Bohr and Mottelson β-vibration description or the interacting boson model. Hence, the long standing interpretation of these states as a collective band built on the 0{sub 2}{sup +} state, which is conventionally assigned as a Bohr and Mottelson β vibration is questionable.

  13. Photoluminescence around 1.54 mu m wavelength from Erbium-doped silicon dependence on annealing temperature

    CERN Document Server

    Xu Fei; Cheng Guo An; ZengYuXin; XiaoZhiSong; YiZhongZhen; ZhangTongHe

    2002-01-01

    Er ions were implanted into Si substrates using metal vapor vacuum arc (MEVVA) ion source implanter, and Er-doped Si thin films have been formed after rapid thermal annealing (RTA). It was analyzed by Rutherford back-scattering spectroscopy (RBS) that Er concentrations in the thin films were close to 10 at% corresponding to the level of approx 10 sup 2 sup 1 atoms/cm sup 3 and Er segregation in the surface layer of the thin films appeared with increasing the temperature of RTA. The recovery of irradiation damage, Er segregation and Si solid phase epitaxy of Si amorphous layers were closely dependent on annealing temperature, which would influence on photoluminescence around 1.54 mu m from Er-doped Si thin film

  14. Optical amplification and electroluminescence at 1.54 μm in Er-doped zinc silicate germanate on silicon

    Science.gov (United States)

    Baker, C. C.; Heikenfeld, J.; Yu, Z.; Steckl, A. J.

    2004-03-01

    Optical amplification and electroluminescence at 1.5 μm is reported in Er-doped Zn2Si0.5Ge0.5O4 (ZSG:Er) on silicon. ZSG:Er films were deposited by rf sputtering from a composite target in Ar/O2 mixtures. Channel waveguides were fabricated by plasma etching with Cl/Ar. The refractive index of ZSG:Er was found to be 1.75 at 1.54 μm. Signal enhancement greater than 13 dB and an internal gain of ˜2 dB have been achieved by optically pumping a 4.7 cm ZSG:Er amplifier. Electroluminescence at 1.5 μm was achieved using an ac device structure with a ZSG:Er central layer and upper and lower dielectric layers.

  15. CDCC calculations of fusion of 6Li with targets 144Sm and 154Sm: effect of resonance states

    Science.gov (United States)

    Gómez Camacho, A.; Lubian, J.; Zhang, H. Q.; Zhou, Shan-Gui

    2017-12-01

    Continuum Discretized Coupled-Channel (CDCC) model calculations of total, complete and incomplete fusion cross sections for reactions of the weakly bound 6Li with 144,154Sm targets at energies around the Coulomb barrier are presented. In the cluster structure frame of 6Li→α+d, short-range absorption potentials are considered for the interactions between the ground state of the projectile 6Li and α-d fragments with the target. In order to separately calculate complete and incomplete fusion and to reduce double-counting, the corresponding absorption potentials are chosen to be of different range. Couplings to low-lying excited states 2+, 3‑ of 144Sm and 2+, 4+ of 154Sm are included. So, the effect on total fusion from the excited states of the target is investigated. Similarly, the effect on fusion due to couplings to resonance breakup states of 6Li, namely, l=2, J π =3+,2+,1+ is also calculated. The latter effect is determined by using two approaches, (a) by considering only resonance state couplings and (b) by omitting these states from the full discretized energy space. Among other things, it is found that both resonance and non-resonance continuum breakup couplings produce fusion suppression at all the energies considered. A. Gómez Camacho from CONACYT, México, J. Lubian from CNPq, FAPERJ, Pronex, Brazil. S.G.Z was partly supported by the NSF of China (11120101005, 11275248, 11525524, 11621131001, 11647601, 11711540016), 973 Program of China (2013CB834400) and the Key Research Program of Frontier Sciences of CAS. H.Q.Z. from NSF China (11375266)

  16. AGR-2 Final Data Qualification Report for U.S. Capsules - ATR Cycles 147A Through 154B

    Energy Technology Data Exchange (ETDEWEB)

    Pham, Binh T. [Idaho National Lab. (INL), Idaho Falls, ID (United States). Very High-Temperature Reactor Technology Development Office; Einerson, Jeffrey J. [Idaho National Lab. (INL), Idaho Falls, ID (United States). Very High-Temperature Reactor Technology Development Office

    2014-07-01

    This report provides the data qualification status of AGR-2 fuel irradiation experimental data in four U.S. capsules from all 15 Advanced Test Reactor (ATR) Cycles 147A, 148A, 148B, 149A, 149B, 150A, 150B, 151A, 151B, 152A, 152B, 153A, 153B, 154A, and 154B, as recorded in the Nuclear Data Management and Analysis System (NDMAS). Thus, this report covers data qualification status for the entire AGR-2 irradiation and will replace four previously issued AGR-2 data qualification reports (e.g., INL/EXT-11-22798, INL/EXT-12-26184, INL/EXT-13-29701, and INL/EXT-13-30750). During AGR-2 irradiation, two cycles, 152A and 153A, occurred when the ATR core was briefly at low power, so AGR-2 irradiation data are not used for physics and thermal calculations. Also, two cycles, 150A and 153B, are Power Axial Locator Mechanism (PALM) cycles when the ATR power is higher than during normal cycles. During the first PALM cycle, 150A, the experiment was temporarily moved from the B-12 location to the ATR water canal and during the second PALM cycle, 153B, the experiment was temporarily moved from the B-12 location to the I-24 location to avoid being overheated. During the “Outage” cycle, 153A, seven flow meters were installed downstream from seven Fission Product Monitoring System (FPMS) monitors to measure flows from the monitors and these data are included in the NDMAS database.

  17. Spectroscopic analysis of lithium terbium tetrafluoride

    DEFF Research Database (Denmark)

    Christensen, H.P.

    1978-01-01

    . The rare-earth site in LiTbF4 possesses S4 symmetry, which allows six crystal-field parameters. ζ and the six Bim were varied to obtain the best agreement with the experimentally observed levels. Keeping F2=434 cm-1 fixed, a fit with a standard deviation of 12 cm-1 was obtained at 10 K with the following...... were calculated by diagonalizing an effective spin-orbit and crystal-field Hamiltonian in an LS basis. H=Σλi(L→·S→)i+ΣαiΣBimOim, where the parameters λi are functions of the spin-orbit parameter ζ and the Slater parameter F2. The Oim and αi are Racah operators and reduced matrix elements, respectively...

  18. Inelastic critical scattering of neutrons from terbium

    DEFF Research Database (Denmark)

    Als-Nielsen, Jens Aage; Dietrich, O.W.; Marshall, W.

    1967-01-01

    We have measured the inelasticity of the critical neutron scattering in Tb above the Néel temperature. The results show that dynamical slowing down of fluctuations does occur at a second order phase transition.......We have measured the inelasticity of the critical neutron scattering in Tb above the Néel temperature. The results show that dynamical slowing down of fluctuations does occur at a second order phase transition....

  19. ZNT7 binds to CD40 and influences CD154-triggered p38 MAPK activity in B lymphocytes-a possible regulatory mechanism for zinc in immune function

    Science.gov (United States)

    Zinc deficiency impairs immune system leading to frequent infections. Although it is known that zinc plays critical roles in maintaining healthy immune function, the underlying molecular targets are largely unknown. In this study, we showed that zinc is important for the CD154-CD40-mediated activati...

  20. Prevention of experimental colitis in SCID mice reconstituted with CD45RBhigh CD4+ T cells by blocking the CD40-CD154 interactions

    NARCIS (Netherlands)

    Liu, Z.; Geboes, K.; Colpaert, S.; Overbergh, L.; Mathieu, C.; Heremans, H.; de Boer, M.; Boon, L.; D'Haens, G.; Rutgeerts, P.; Ceuppens, J. L.

    2000-01-01

    Increased expression of CD40 and CD40 ligand (CD40L or CD154) has been found in inflamed mucosa of human inflammatory bowel disease (IBD), and interactions between these molecules seem to be involved in local cytokine production by macrophages. However, the precise role of CD40 signaling in the

  1. Blockade of CD40-CD154 at the time of donor-specific blood transfusion does not lead to prolonged kidney allograft survival in nonhuman primates

    NARCIS (Netherlands)

    Ringers, J; Haanstra, KG; Kroczek, RA; Kliem, K; Kuhn, EM; Wubben, J; Ossevoort, MA; Volk, HD; Jonker, M

    2002-01-01

    Background. In rodents it has been demonstrated that blockade of the CD40-CD154 (CD40L) pathway at the time of donor-specific blood transfusion (DST) can result in indefinite graft survival. Because it has been reported in the past that DST in monkeys can have a favorable effect on graft outcome and

  2. LHC dipoles flood into CERN : the dipole nr 154 crowns the efforts of the LHC teams for increasing the fabrication rate of the magnets.

    CERN Multimedia

    Maximilien Brice

    2003-01-01

    On 3 December the "tableau" on the 4th floor in building 30 indicated 1078 dipoles to completion - or in other words, 154 dipoles had by this day been delivered to CERN, enough to complete the first octant of the machine. CERN has also now received enough superconducting cable - the "heart" of the magnets - for 600 dipoles, nearly half the total number of 1232.

  3. Suppression effect of silicon (Si on Er3+ 1.54μm excitation in ZnO thin films

    Directory of Open Access Journals (Sweden)

    Bo Xu

    2016-08-01

    Full Text Available We have investigated the photoluminescence (PL characteristics of ZnO:Er thin films on Si (100 single crystal and SiO2-on-silicon (SiO2 substrates, synthesized by radio frequency magnetron sputtering. Rutherford backscattering/channeling spectrometry (RBS, X-ray diffraction (XRD and atomic force microscope (AFM were used to analyze the properties of thin films. The diffusion depth profiles of Si were determined by second ion mass spectrometry (SIMS. Infrared spectra were obtained from the spectrometer and related instruments. Compared with the results at room temperature (RT, PL (1.54μm intensity increased when samples were annealed at 250°C and decreased when at 550°C. A new peak at 1.15μm from silicon (Si appeared in 550°C samples. The Si dopants in ZnO film, either through the diffusion of Si from the substrate or ambient, directly absorbed the energy of pumping light and resulted in the suppression of Er3+ 1.54μm excitation. Furthermore, the energy transmission efficiency between Si and Er3+ was very low when compared with silicon nanocrystal (Si-NC. Both made the PL (1.54μm intensity decrease. All the data in experiments proved the negative effects of Si dopants on PL at 1.54μm. And further research is going on.

  4. Functional Interaction of CD154 Protein with α5β1 Integrin Is Totally Independent from Its Binding to αIIbβ3 Integrin and CD40 Molecules*

    Science.gov (United States)

    El Fakhry, Youssef; Alturaihi, Haydar; Yacoub, Daniel; Liu, Lihui; Guo, Wenyan; Leveillé, Claire; Jung, Daniel; Khzam, Lara Bou; Merhi, Yahye; Wilkins, John A.; Li, Hongmin; Mourad, Walid

    2012-01-01

    In addition to its classical CD40 receptor, CD154 also binds to αIIbβ3, α5β1, and αMβ2 integrins. Binding of CD154 to these receptors seems to play a key role in the pathogenic processes of chronic inflammation. This investigation was aimed at analyzing the functional interaction of CD154 with CD40, αIIbβ3, and α5β1 receptors. We found that the binding affinity of CD154 for αIIbβ3 is ∼4-fold higher than for α5β1. We also describe the generation of sCD154 mutants that lost their ability to bind CD40 or αIIbβ3 and show that CD154 residues involved in its binding to CD40 or αIIbβ3 are distinct from those implicated in its interaction to α5β1, suggesting that sCD154 may bind simultaneously to different receptors. Indeed, sCD154 can bind simultaneously to CD40 and α5β1 and biologically activate human monocytic U937 cells expressing both receptors. The simultaneous engagement of CD40 and α5β1 activates the mitogen-activated protein kinases, p38, and extracellular signal-related kinases 1/2 and synergizes in the release of inflammatory mediators MMP-2 and -9, suggesting a cross-talk between these receptors. PMID:22461623

  5. Blockade of CD40-CD154 costimulatory pathway promotes long-term survival of full-thickness porcine corneal grafts in nonhuman primates: clinically applicable xenocorneal transplantation.

    Science.gov (United States)

    Choi, H J; Lee, J J; Kim, D H; Kim, M K; Lee, H J; Ko, A Y; Kang, H J; Park, C; Wee, W R

    2015-03-01

    The porcine cornea may be a good solution for the shortage of human donor corneas because its size and refractive properties are comparable to those of the human cornea. However, antigenic differences need to be overcome to apply xenocorneal transplantation in actual clinical practice. We aimed to investigate the feasibility of full-thickness porcine corneas as human corneal substitutes using a CD40-CD154 costimulatory pathway blocking strategy in a clinically applicable pig-to-nonhuman primate corneal transplantation model. As a result, the mean survival time of the xenocorneal grafts in recipients who received anti-CD154 antibody-based immunosuppressants (POD318 (n = 4); >933, >243, 318 and >192) was significantly longer than that in controls (POD28 (n = 3); 21, 28 and 29; p = 0.010, log-rank test). Administration of anti-CD154 antibodies markedly reduced inflammatory cellular infiltrations (predominantly CD8 T cells and macrophages) into the xenocorneal grafts and almost completely blocked xenoantigen-triggered increases in Th1-associated cytokines, chemokines and C3a in the aqueous humor. Moreover, systemic expansion of memory T cells was effectively controlled and responses of anti-Gal/donor pig-specific antibodies were considerably diminished by programmed injection of anti-CD154 antibodies. Consequently, porcine corneas might be promising human corneal substitutes when the transplantation is accompanied by potent immunosuppression such as a CD40-CD154 costimulatory pathway blockade. © Copyright 2015 The American Society of Transplantation and the American Society of Transplant Surgeons.

  6. Tier 2 safety Basis Document for the B151 Complex (B151, B152, and B154)

    Energy Technology Data Exchange (ETDEWEB)

    Cooper, G A

    2006-12-07

    This Safety Basis Document (SBD) has been prepared for the B151 Complex at Site 200 to meet the current contractual requirements at Lawrence Livermore National Laboratory (LLNL). B151 Complex consists of three separate complex and distinct buildings: B151, B152, and B154, represented within this document as facility segments. Based upon its chemical and radiological inventories, Segment B151 is classified as a Low Hazard facility segment. All other hazards associated with Segment B151 operations have been determined to be LSI. Based upon their inventories, Segment B152 and Segment B154 are each classified as LSI facility segments. However, for operational flexibility involving radiological materials, CMS chooses to classify each of these as Low Hazard facility segments. Changes in operations, maximum inventories, materials, or release potential that could result in larger consequences, or that could negatively impact the safety of the facility, will necessitate a re-evaluation of these facility classifications. This SBD is governed by the LLNL Non-Nuclear Work Smart Standards (WSSs) requirements including the ES&H Manual, Document 3.1, Non-Nuclear Safety Basis Program [LLNL, 2004a] and the DOE Explosives Safety Manual (ESM) [LLNL, 2004b]. This SBD demonstrates that the three segments of B151 Complex can be operated as Low Hazard facility segments without undue risks to co-located workers, the public, or the environment. This SBD: (1) Provides a systematic identification of the safety and health hazards associated with operations in the B151 Complex, (2) Compares facility inventories of explosives, biological materials, chemicals, radioisotopes with LLNL threshold values for each facility hazard classification criteria, (3) Examines standard and non-standard industrial hazards, (4) Examines the hazards of greatest significance, (5) Qualitatively discusses the programs that evaluate and control these hazards to ensure the protection of co-located workers, the public

  7. Particle-γ coincidence spectroscopy of the N = 90 nucleus {sup 154}Gd by (p, tγ)

    Energy Technology Data Exchange (ETDEWEB)

    Allmond, J.M. [Oak Ridge National Laboratory, Physics Division, Oak Ridge, TN (United States); University of Richmond, Department of Physics, Richmond, VA (United States); Beausang, C.W.; Ross, T.J.; Brooks, W.; Darakchieva, B.K. [University of Richmond, Department of Physics, Richmond, VA (United States); Humby, P. [University of Richmond, Department of Physics, Richmond, VA (United States); University of Surrey, Department of Physics, Guildford, Surrey (United Kingdom); Basunia, M.S.; Fallon, P.; Jeppesen, H.B.; McMahan, M.A.; Phair, L.; Rasmussen, J.O. [Lawrence Berkeley National Laboratory, Nuclear Science Division, Berkeley, CA (United States); Bernstein, L.A. [Lawrence Berkeley National Laboratory, Nuclear Science Division, Berkeley, CA (United States); University of California, Department of Nuclear Engineering, Berkeley, CA (United States); Bleuel, D.L.; Burke, J.T.; Scielzo, N.D. [Lawrence Livermore National Laboratory, Livermore, CA (United States); Brown, N. [Georgia Institute of Technology, School of Physics, Atlanta, GA (United States); Dudziak, K.R.; LeBlanc, J.D.; Meyer, D.A. [Rhodes College, Department of Physics, Memphis, TN (United States); Evans, K.E. [University of California, Department of Nuclear Engineering, Berkeley, CA (United States); Lesher, S.R. [Lawrence Livermore National Laboratory, Livermore, CA (United States); University of Wisconsin-La Crosse, Department of Physics, La Crosse, WI (United States); Stroberg, S.R. [University of California, Department of Nuclear Engineering, Berkeley, CA (United States); TRIUMF, Vancouver, British Columbia (Canada); Wiedeking, M. [Lawrence Livermore National Laboratory, Livermore, CA (United States); iThemba LABS, Department of Nuclear Physics, P.O. Box 722, Somerset West (South Africa)

    2017-03-15

    A segmented Si-telescope and HPGe array, STARS-LIBERACE, was used to study the {sup 156}Gd(p, tγ){sup 154}Gd direct reaction by particle-γ coincidence spectroscopy. New cross sections with a 25MeV proton beam are reported and compared to previous (p, t) and (t, p) studies. Furthermore, additional evidence for coexisting K{sup π} = 0{sub 1}{sup +}, 2{sub 1}{sup +} and 0{sub 2}{sup +}, 2{sub 2}{sup +} configurations at N = 90 is presented. Direct and indirect population patterns of the low-lying states are also explored. Review of the new and existing evidence favors an interpretation based on a configuration-dependent pairing interaction. The weakening of monopole pairing strength and an increase in quadrupole pairing strength could bring 2p-2h 0{sup +} states below 2Δ. This may account for a large number of the low-lying 0{sup +} states observed in two-nucleon transfer reactions. A hypothesis for the origin of the 0{sub 2}{sup +} and 0{sub 3}{sup +} states is provided. (orig.)

  8. Intratumoral injection of Ad-ISF35 (Chimeric CD154) breaks tolerance and induces lymphoma tumor regression.

    Science.gov (United States)

    Urquiza, Mauricio; Melo-Cardenas, Johanna; Aguillon, Robier; Kipps, Thomas J; Castro, Januario E

    2015-01-01

    Ad-ISF35, an adenovirus vector encoding a membrane-bound engineered CD154 chimeric protein (ISF35), induces complete A20 lymphoma tumor regression in mice after intratumoral direct injection (IDI). Ad-ISF35 induced durable local and systemic antitumor responses associated with a rapid tumor infiltration of macrophages and neutrophils as well as increased levels of proinflammatory cytokines in the tumor microenvironment. Ad-ISF35 IDI transduced preferentially fibroblasts and macrophages present in the tumor microenvironment, and ISF35 protein expression was observed in only 0.25% of cells present in the tumor. Moreover, Ad-ISF35 IDI induced upregulation of CD40 in tumor and immune regulatory cells, including those that did not express ISF35, suggesting the presence of a strong bystander effect. These responses resulted in the generation of IFN-γ-secreting cytotoxic lymphocytes and the production of specific cytotoxic antibodies against lymphoma cells. Overall, cellular immune therapy based on ISF35 induced phenotypic changes in the tumor cells and tumor microenvironment that were associated with a break in tumor immune tolerance and a curative antitumor effect in this lymphoma mouse model. Our data highlight the potential activity that modulation of costimulatory signaling has in cancer therapy.

  9. Spin distribution of evaporation residues formed in complete and incomplete fusion in 16O+154Sm system

    Directory of Open Access Journals (Sweden)

    D. Singh

    2017-11-01

    Full Text Available Spin distributions for several evaporation residues populated in the 16O+154Sm system have been measured at projectile energy ≈ 6.2 MeV/A by using the charged particle–γ-coincidence technique. The measured spin distributions of the evaporation residues populated through incomplete fusion associated with ‘fast’ α and 2α-emission channels are found to be entirely different from fusion–evaporation channels. It is observed that the mean input angular momentum for the evaporation residues formed in incomplete fusion channel is relatively higher than that observed for evaporation residues in complete fusion channels. The feeding intensity profile of evaporation residues populated through complete fusion and incomplete fusion have also been studied. The incomplete fusion channels are found to have narrow range feeding only for high spin states, while complete fusion channels are strongly fed over a broad spin range and widely populated. Comparison of present results with earlier data suggests that the mean input angular momentum values are relatively smaller for spherical target than that of deformed target using the same projectile and incident energy highlighting the role of target deformation in incomplete fusion dynamics.

  10. Clinical features and outcomes in 154 patients with haemorrhagic moyamoya disease: comparison of conservative treatment and surgical revascularization.

    Science.gov (United States)

    Huang, Zheng; Ding, Xuehu; Men, Weidong; Zhang, Dong; Zhao, Yuanli; Wang, Rong; Wang, Shuo; Zhao, Jizong

    2015-10-01

    Rebleeding is an unsatisfactory outcome for patients with haemorrhagic MMD. This study mainly investigated clinical features and outcomes in haemorrhagic MMD. A retrospective review was performed on a total of 154 patients with haemorrhagic MMD comprising 126 surgically treated and 28 conservatively treated patients. There were 102 female and 52 male patients with a mean age at the initial bleeding of 33.95 years. Preoperative rebleeding occurred in 37 patients, and multivariate Cox regression analysis demonstrated that age at the time of initial bleeding (P revascularization, perioperative ischaemic stroke occurred in five (4.03%) and intracranial bleeding in four (3.23%). The mean follow-up period was 36.12  months. Recurrent bleeding occurred in six (10.17%) of 59 patients treated with direct revascularization, seven (20.69%) of 34 patients treated with indirect revascularization, two (6.45%) of 31 patients treated with combined revascularization and six (21.43%) of 28 patients treated conservatively. Kaplan-Meier analysis revealed no statistical differences in preventing rebleeding between direct, indirect and combined revascularization and conservative treatment (P = 0.311). Age at the initial bleeding is a risk factor for rebleeding in haemorrhagic MMD. Although surgical revascularization show the tendency to decrease the rebleeding rate, there is no statistical difference between direct revascularization, indirect revascularization, combined revascularization and conservative treatment in preventing rebleeding. Further study is needed to determine whether surgical revascularization is effective in select population or with certain techniques.

  11. Spin distribution of evaporation residues formed in complete and incomplete fusion in 16O+154Sm system

    Science.gov (United States)

    Singh, D.; Linda, Sneha B.; Giri, Pankaj K.; Mahato, Amritraj; Tripathi, R.; Kumar, Harish; Afzal Ansari, M.; Sathik, N. P. M.; Ali, Rahbar; Kumar, Rakesh; Muralithar, S.; Singh, R. P.

    2017-11-01

    Spin distributions for several evaporation residues populated in the 16O+154Sm system have been measured at projectile energy ≈ 6.2 MeV/A by using the charged particle-γ-coincidence technique. The measured spin distributions of the evaporation residues populated through incomplete fusion associated with 'fast' α and 2α-emission channels are found to be entirely different from fusion-evaporation channels. It is observed that the mean input angular momentum for the evaporation residues formed in incomplete fusion channel is relatively higher than that observed for evaporation residues in complete fusion channels. The feeding intensity profile of evaporation residues populated through complete fusion and incomplete fusion have also been studied. The incomplete fusion channels are found to have narrow range feeding only for high spin states, while complete fusion channels are strongly fed over a broad spin range and widely populated. Comparison of present results with earlier data suggests that the mean input angular momentum values are relatively smaller for spherical target than that of deformed target using the same projectile and incident energy highlighting the role of target deformation in incomplete fusion dynamics.

  12. [Dynamic alteration of CD154/CD40 and its effects on Th1/Th2 polarization in inducible co-stimulator ligand knockout mice infected with Schistosoma japonicum].

    Science.gov (United States)

    Wang, Yu; Xia, Chao-ming

    2015-12-18

    To analyze effect on the CD154-CD40 signaling pathway and Th1/Th2 polarization by deficient inducible co-stimulator (ICOS)-ICOS ligand (ICOSL) signaling in mice infected with Schistosoma japonicum. ICOSL knockout (ICOSL-KO) mice and wild-type C57BL/6J mice were used as experimental Schistosomiasis model infected with Schistosoma japonicum. The expressions of CD154 and CD40 on splenocytes and on inflammatory cells around granulomatous infiltration of liver in mice infected with Schistosoma japonicum were analyzed by flow cytometry,immunohistochemical staining, respectively, on the day before infection (0 week)and at the end of 4, 7, 12, 16 and 20 weeks post-infection. The splenocytes of the mice were stimulated with soluble egg antigen(SEA) for 72 hours, then the concentrations of interferon gamma(IFN-γ) and interleukin-4 (IL-4) in the culture supernatants were measured by sandwich enzyme-linked immunosorbent assay (ELISA) kits. The levels of SEA-specific antibodies of IgG and IgG1 and IgG2a were measured in the mice sera by ELISA. The granulomatous pathology in the mice liver was dynamically observed by hematoxylin and eosin (HE) staining. Compared with the wild-type C57BL/6J mice, the expressions of CD154 on CD4+ T splenocytes [(18.62 ± 4.76)% vs.(27.91 ± 3.94)%, (22.44 ± 4.67)% vs.(40.86 ± 5.21)%, (25.50 ± 6.81)% vs.(43.81 ± 8.41)%, (20.22 ± 5.28)% vs.(40.95 ± 7.34)%, (17.87 ± 4.59)% vs.(33.16 ± 6.31)%, all PCD154[(0.319 ± 0.066) vs.(0.488 ± 0.086), (0.389 ± 0.067) vs.(0.596 ± 0.082), (0.378 ± 0.064) vs.(0.543 ± 0.072), (0.348 ± 0.069) vs.(0.523 ± 0.076), all PCD154 and CD40 and impairment of Th2 immune response in the ICOSL-KO mice infected with Schistosoma japonicum, accompanying with notedly reduced hepatic granulomatous pathology. The ICOS-ICOSL signaling has a regulatory effect on CD154-CD40 signaling pathway, and may play an important role in the hepatic egg granuloma formation of Schistosomiasis.

  13. Study of Association of CD40-CD154 Gene Polymorphisms with Disease Susceptibility and Cardiovascular Risk in Spanish Rheumatoid Arthritis Patients

    Science.gov (United States)

    García-Bermúdez, Mercedes; González-Juanatey, Carlos; López-Mejías, Raquel; Teruel, María; Corrales, Alfonso; Miranda-Filloy, José A.; Castañeda, Santos; Balsa, Alejandro; Fernández-Gutierrez, Benjamín; González-Álvaro, Isidoro; Gómez-Vaquero, Carmen; Blanco, Ricardo; Llorca, Javier

    2012-01-01

    Objective Rheumatoid arthritis (RA) is a chronic inflammatory disease associated with increased cardiovascular (CV) mortality. Since CD40-CD154 binding has direct consequences on inflammation process initiation, we aimed to replicate previous findings related to disease susceptibility in Spanish RA population. Furthermore, as the major complication in RA disease patients is the development of CV events due to accelerated atherosclerosis, and elevated levels of CD40L/CD154 are present in patients with acute myocardial infarction, we assessed the potential association of CD40 and CD154/CD40L gene variants with CV risk in Spanish RA patients. Methods One thousand five hundred and seventy-five patients fulfilling the 1987 ACR classification criteria for RA and 1600 matched controls were genotyped for the CD40 rs1883832, rs4810485 and rs1535045 and CD154 rs3092952 and rs3092920 gene polymorphisms, using predesigned TaqMan single nucleotide polymorphism genotyping assays. Afterwards, we investigated the influence of CD40-CD154 gene variants in the development of CV events. Also, in a subgroup of 273 patients without history of CV events, we assessed the influence of these polymorphisms in the risk of subclinical atherosclerosis determined by carotid ultrasonography. Results Nominally significant differences in the allele frequencies for the rs1883832 CD40 gene polymorphism between RA patients and controls were found (p = 0.038). Although we did not observe a significant association of CD40-CD154 gene variants with the development of CV events, an ANCOVA model adjusted for sex, age at the time of the ultrasonography assessment, follow-up time, traditional CV risk factors and anti-cyclic citrullinated peptide antibodies disclosed a significant association (p = 0.0047) between CD40 rs1535045 polymorphism and carotid intima media thickness, a surrogate marker of atherosclerosis. Conclusion Data from our pilot study indicate a potential association of rs1883832 CD40

  14. Study of association of CD40-CD154 gene polymorphisms with disease susceptibility and cardiovascular risk in Spanish rheumatoid arthritis patients.

    Directory of Open Access Journals (Sweden)

    Mercedes García-Bermúdez

    Full Text Available OBJECTIVE: Rheumatoid arthritis (RA is a chronic inflammatory disease associated with increased cardiovascular (CV mortality. Since CD40-CD154 binding has direct consequences on inflammation process initiation, we aimed to replicate previous findings related to disease susceptibility in Spanish RA population. Furthermore, as the major complication in RA disease patients is the development of CV events due to accelerated atherosclerosis, and elevated levels of CD40L/CD154 are present in patients with acute myocardial infarction, we assessed the potential association of CD40 and CD154/CD40L gene variants with CV risk in Spanish RA patients. METHODS: One thousand five hundred and seventy-five patients fulfilling the 1987 ACR classification criteria for RA and 1600 matched controls were genotyped for the CD40 rs1883832, rs4810485 and rs1535045 and CD154 rs3092952 and rs3092920 gene polymorphisms, using predesigned TaqMan single nucleotide polymorphism genotyping assays. Afterwards, we investigated the influence of CD40-CD154 gene variants in the development of CV events. Also, in a subgroup of 273 patients without history of CV events, we assessed the influence of these polymorphisms in the risk of subclinical atherosclerosis determined by carotid ultrasonography. RESULTS: Nominally significant differences in the allele frequencies for the rs1883832 CD40 gene polymorphism between RA patients and controls were found (p=0.038. Although we did not observe a significant association of CD40-CD154 gene variants with the development of CV events, an ANCOVA model adjusted for sex, age at the time of the ultrasonography assessment, follow-up time, traditional CV risk factors and anti-cyclic citrullinated peptide antibodies disclosed a significant association (p=0.0047 between CD40 rs1535045 polymorphism and carotid intima media thickness, a surrogate marker of atherosclerosis. CONCLUSION: Data from our pilot study indicate a potential association of rs

  15. Detection of Foreign Antigen-specific CD4+Foxp3+ Regulatory T Cells by MHC Class II Tetramer and Intracellular CD154 Staining

    Science.gov (United States)

    Choi, Jin Young

    2013-01-01

    The unrestricted population of CD4+Foxp3+ regulatory T (Treg) cells, which have been known to control the expression of autoimmune diseases and protective immunity to inflammatory reactions, has led to greater appreciation of functional plasticity. Detecting and/or isolating Ag-specific CD4+Foxp3+ Tregs at the single cell level are required to study their function and plasticity. In this study, we established and compared both MHC class II tetramer and intracellular CD154 staining, in order to detect CD4+Foxp3+ Treg specific for foreign Ag in acute and chronic infections with lymphocytic choriomeningitis virus (LCMV). Our results revealed that MHC class II tetramer staining showed a lower detection rate of LCMV GP66-77-specific CD4+ T cells because most of MHC class II tetramers were unbound and unstable when combined staining was performed with intracellular cytokines. In contrast, intracellular CD154 staining was revealed to be easier and simple for detecting LCMV GP66-77-specific CD4+ T cells, compared to MHC class II tetramer staining. Subsequently, we employed intracellular CD154 staining to detect LCMV GP66-77-specific CD4+Foxp3+ Tregs using Foxp3GFP knock-in mouse, and found that LCMV GP66-77-specific CD4+Foxp3+ Tregs and polyclonal CD4+Foxp3+ Tregs showed differential expansion in mice infected with LCMV Arms or Cl13 at acute (8 and 13 days pi) and chronic phases (35 days pi). Therefore, our results provide insight into the valuable use of intracellular CD154 staining to detect and characterize foreign Ag-specific CD4+Foxp3+ Treg in various models. PMID:24385945

  16. Detection of Foreign Antigen-specific CD4(+)Foxp3(+) Regulatory T Cells by MHC Class II Tetramer and Intracellular CD154 Staining.

    Science.gov (United States)

    Choi, Jin Young; Eo, Seong Kug

    2013-12-01

    The unrestricted population of CD4(+)Foxp3(+) regulatory T (Treg) cells, which have been known to control the expression of autoimmune diseases and protective immunity to inflammatory reactions, has led to greater appreciation of functional plasticity. Detecting and/or isolating Ag-specific CD4(+)Foxp3(+) Tregs at the single cell level are required to study their function and plasticity. In this study, we established and compared both MHC class II tetramer and intracellular CD154 staining, in order to detect CD4(+)Foxp3(+) Treg specific for foreign Ag in acute and chronic infections with lymphocytic choriomeningitis virus (LCMV). Our results revealed that MHC class II tetramer staining showed a lower detection rate of LCMV GP66-77-specific CD4(+) T cells because most of MHC class II tetramers were unbound and unstable when combined staining was performed with intracellular cytokines. In contrast, intracellular CD154 staining was revealed to be easier and simple for detecting LCMV GP66-77-specific CD4(+) T cells, compared to MHC class II tetramer staining. Subsequently, we employed intracellular CD154 staining to detect LCMV GP66-77-specific CD4(+)Foxp3(+) Tregs using Foxp3(GFP) knock-in mouse, and found that LCMV GP66-77-specific CD4(+)Foxp3(+) Tregs and polyclonal CD4(+)Foxp3(+) Tregs showed differential expansion in mice infected with LCMV Arms or Cl13 at acute (8 and 13 days pi) and chronic phases (35 days pi). Therefore, our results provide insight into the valuable use of intracellular CD154 staining to detect and characterize foreign Ag-specific CD4(+)Foxp3(+) Treg in various models.

  17. Draft Genome Sequence of Saccharomonospora sp. Strain LRS4.154, a Moderately Halophilic Actinobacterium with the Biotechnologically Relevant Polyketide Synthase and Nonribosomal Peptide Synthetase Systems

    Science.gov (United States)

    Alonso-Carmona, Scarlett; Vera-Gargallo, Blanca; de la Haba, Rafael R.; Ventosa, Antonio; Sandoval-Trujillo, Horacio

    2017-01-01

    ABSTRACT The draft genome sequence of Saccharomonospora sp. strain LRS4.154, a moderately halophilic actinobacterium, has been determined. The genome has 4,860,108 bp, a G+C content of 71.0%, and 4,525 open reading frames (ORFs). The clusters of PKS and NRPS genes, responsible for the biosynthesis of a large number of biomolecules, were identified in the genome. PMID:28546487

  18. [Organizational problems of disaster victim identification in mass casualties as exemplified by Tu 154-M and Airbus A310 passenger plane crashes].

    Science.gov (United States)

    Volkov, A V; Kolkutin, V V; Klevno, V A; Shkol'nikov, B V; Kornienko, I V

    2008-01-01

    Managerial experience is described that was gained during the large-scale work on victim identification following mass casualties in the Tu 154-M and Airbus A310 passenger plane crashes. The authors emphasize the necessity to set up a specialized agency of constant readiness meeting modern requirements for the implementation of a system of measures for personality identification. This agency must incorporate relevant departments of the Ministries of Health, Defense, and Emergency Situations as well as investigative authorities and other organizations.

  19. Preparation of activated carbon from doum stone and its application on adsorption of 60Co and 152+154Eu: Equilibrium, kinetic and thermodynamic studies.

    Science.gov (United States)

    Hamed, Mostafa M; Ali, M M S; Holiel, M

    2016-11-01

    Removal of radionuclides from wastewater before discharging to environment is necessary for the safety of living beings. Activated carbon prepared from doum stone (DS), an agricultural waste by-product, has been used for the sorption of 60Co and 152+154Eu radionuclides from aqueous solutions. DS has been characterized by different analytical tools. The efficiency of the adsorbent was investigated using batch sorption technique under different experimental conditions. The equilibrium sorption data were analyzed using Freundlich and Langmuir isotherm models. The kinetic experimental data were analyzed using four kinetic models including pseudo-first order, pseudo-second order, Elovich and intraparticle diffusion model to examine the mechanism of sorption and potential rate-controlling step. The maximum capacity of DS was found to be 121 mg/g and 166 mg/g for cobalt and europium, respectively. Sorption efficiency of DS to remove 60Co, 152+154Eu and 134Cs from real radioactive wastewater and environmental (river water and sea water) samples was also investigated. The results revealed that the prepared DS as low cost could be used as a promising material for the simultaneous removal of different radionuclides such as 60Co, 152+154Eu and 134Cs, or trivalent actinides such as 241, 242m,243Am from real radioactive waste and environmental water samples. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. Antitumor activity of an oncolytic adenoviral-CD40 ligand (CD154) transgene construct in human breast cancer cells.

    Science.gov (United States)

    Gomes, Erica M; Rodrigues, Margret S; Phadke, Anagha P; Butcher, Lindsay D; Starling, Cherry; Chen, Salina; Chang, Dongkun; Hernandez-Alcoceba, Ruben; Newman, Joseph T; Stone, Marvin J; Tong, Alex W

    2009-02-15

    CD40 ligand (CD40L, CD154) plays a central role in immunoregulation and also directly modulates epithelial cell growth and differentiation. We previously showed that the CD40 receptor is commonly expressed in primary breast cancer tissues. In this proof-of-principle study, we examined the breast cancer growth-regulatory activities of an oncolytic adenoviral construct carrying the CD40L transgene (AdEHCD40L). In vitro and in vivo evaluations were carried out on AdEHCD40L to validate selective viral replication and CD40L transgene activity in hypoxia inducing factor-1alpha and estrogen receptor-expressing human breast cancer cells. AdEHCD40L inhibited the in vitro growth of CD40+ human breast cancer lines (T-47D, MDA-MB-231, and BT-20) by up to 80% at a low multiplicity of infection of 1. Incorporation of the CD40L transgene reduced the effective dose needed to achieve 50% growth inhibition (ED50) by approximately 10-fold. In contrast, viral and transgene expression of AdEHCD40L, as well its cytotoxicity, was markedly attenuated in nonmalignant cells. Intratumoral injections with AdEHCD40L reduced preexisting MDA-MB-231 xenograft growth in severe combined immunodeficient mice by >99% and was significantly more effective (P<0.003) than parental virus AdEH (69%) or the recombinant CD40L protein (49%). This enhanced antitumor activity correlated with cell cycle blockade and increased apoptosis in AdEHCD40L-infected tumor cells. These novel findings, together with the previously known immune-activating features of CD40L, support the potential applicability of AdEHCD40L for experimental treatment of human breast cancer.

  1. Lymphoscintigraphy of the lower limbs: a retrospective study of 154 cases from March 2009 to June 2010

    Energy Technology Data Exchange (ETDEWEB)

    Barral, Carlyle Marques; Carvalho, Luciana Araujo; Stehling, Alexandre Pace; Silva, Antonio Carlos Moura da; Castro, Atena Cipriano; Ivo, Claudio Santana; Korman, Daniel Einstoss; Couto, Eneida de Melo; Magalhaes, Leonardo Neuenschwander; Felix, Marco Tulio Marques; Machado, Fernando Santana [ECOAR Medicina Diagnostica, Belo Horizonte, MG (Brazil)

    2013-07-01

    Introduction: Lymphoscintigraphy of the lower limbs (LLL) is an effective method to assess lymphatic function. Objective: to present the case of 154 patients undergoing LLL between March 2009 and June 2010. Methods: Images of the pelvis and lower limbs were acquired after simultaneous intradermal administration of 1.0 mCi of 99mTc-Dextran 500 in 0.1mL in the interdigital space of the first and second toes, bilaterally. Results: 129 (83.77%) patients were female, mean age was 51.48 years, with 32 patients (20.78%) aged between 40 and 49 years. 58 patients (37.66%) had body mass index between 25 and 30 kg/m², 92 patients (59.74%) reported edema, lymphedema or swelling as the reason for examination. 93 patients (60.39%) without previous vascular surgery or procedure, 108 patients (70.13%) without previous inflammation, erysipelas or trauma. 103 patients (66.88%) presented with bilateral swelling upon examination, with 48 patients (31.17%) reporting edema that worsened in the evening. 77 patients (50%) with symptoms for over a year. 31 patients (20.13%) were hypertensive. Scintigraphic findings: 149 patients (96.75%) with some abnormality caracteupon examination, 38 with severe bilateral delay in lymphatic transit time, 85 (55.19%) with normo functioning lymph nodes, 62 patients with bilateral radiotracer drainage via small saphenous veins, 84 patients (54.55%) without collateral vessels, 92 (59.74%) without lymphatic retention, 85 patients (55.19%) without dermal backflow. 15 patients (9.74%) showed lymph nodes in the popliteal region. Conclusions: lower limb lymphoscintigraphy is available as a method to detect lymphedema and changes in lymphatic drainage, and is important for initial investigative screenings, early stage assessments of edema, and for monitoring therapeutic, clinical or surgical interventions. (author)

  2. Gene immunotherapy of chronic lymphocytic leukemia: a phase I study of intranodally injected adenovirus expressing a chimeric CD154 molecule.

    Science.gov (United States)

    Castro, Januario E; Melo-Cardenas, Johanna; Urquiza, Mauricio; Barajas-Gamboa, Juan S; Pakbaz, Ramin S; Kipps, Thomas J

    2012-06-15

    New therapies for chronic lymphocytic leukemia (CLL) are needed, particularly those that can eradicate residual disease and elicit anti-CLL immune responses. CD40 ligation on CLL cells, which can be achieved using adenovirus encoding chimeric CD154 (Ad-ISF35), enhances their ability to function as antigen-presenting cells and increases their sensitivity to clearance by immune-effector mechanisms. In this study, we report the results of a first-in-man phase I trial of intranodal direct injection (IDI) of Ad-ISF35 in patients with CLL to evaluate toxicity, safety, and tolerability. Fifteen patients received a single IDI of 1 × 10(10) to 33 × 10(10) Ad-ISF35 viral particles (vp), with a defined maximum tolerated dose as 1 × 10(11) vp. Although the most common adverse events were transient grade 1 to 2 pain at the injection site and flu-like symptoms following IDI, some patients receiving the highest dose had transient, asymptomatic grade 3 to 4 hypophosphatemia, neutropenia, or transaminitis. Increased expression of death receptor, immune costimulatory molecules, and Ad-ISF35 vector DNA was detected in circulating CLL cells. Notably, we also observed preliminary clinical responses, including reductions in leukemia cell counts, lymphadenopathy, and splenomegaly. Six patients did not require additional therapy for more than 6 months, and three achieved a partial remission. In conclusion, Ad-ISF35 IDI was safely delivered in patients with CLLs and induced systemic biologic and clinical responses. These results provide the rationale for phase II studies in CLLs, lymphomas, and CD40-expressing solid tumors.

  3. Revisiting the Ceara Rise, equatorial Atlantic Ocean: isotope stratigraphy of ODP Leg 154 from 0 to 5 Ma

    Directory of Open Access Journals (Sweden)

    R. H. Wilkens

    2017-07-01

    Full Text Available Isotope stratigraphy has become the method of choice for investigating both past ocean temperatures and global ice volume. Lisiecki and Raymo (2005 published a stacked record of 57 globally distributed benthic δ18O records versus age (LR04 stack. In this study LR04 is compared to high-resolution records collected at all of the sites drilled during ODP Leg 154 on the Ceara Rise, in the western equatorial Atlantic Ocean. Newly developed software is used to check data splices of the Ceara Rise sites and better align out-of-splice data with in-splice data. Core images recovered from core table photos are depth and age scaled and greatly assist in the data analysis. The entire splices of ODP sites 925, 926, 927, 928 and 929 were reviewed. Most changes were minor although several were large enough to affect age models based on orbital tuning. A Ceara Rise composite record of benthic δ18O is out of sync with LR04 between 1.80 and 1.90 Ma, where LR04 exhibits two maxima but Ceara Rise data contain only one. The interval between 4.0 and 4.5 Ma in the Ceara Rise compilation is decidedly different from LR04, reflecting both the low amplitude of the signal over this interval and the limited amount of data available for the LR04 stack. A regional difference in benthic δ18O of 0.2 ‰ relative to LR04 was found. Independent tuning of Site 926 images and physical property data to the Laskar et al. (2004 orbital solution and integration of available benthic stable isotope data from the Ceara Rise provides a new regional reference section for the equatorial Atlantic covering the last 5 million years.

  4. Relationship Between Enterococcus faecalis Infective Endocarditis and Colorectal Neoplasm: Preliminary Results From a Cohort of 154 Patients.

    Science.gov (United States)

    Pericàs, Juan M; Corredoira, Juan; Moreno, Asunción; García-País, M José; Falces, Carlos; Rabuñal, Ramón; Mestres, Carlos A; Alonso, M Pilar; Marco, Francesc; Quintana, Eduard; Almela, Manel; Paré, Juan C; Llopis, Jaume; Castells, Antoni; Miró, José M

    2017-06-01

    The association between Streptococcus bovis group infective endocarditis and colorectal neoplasm (CRN) is well-known. However, no studies have assessed the association between Enterococcus faecalis infective endocarditis (EFIE) and CRN. We aimed to determine whether the prevalence of CRN is higher in patients with EFIE and an unclear source of infection than in patients with EFIE and a known source of infection or in the general population. Retrospective analysis of a cohort of 154 patients with definite EFIE (109 with an unclear source of infection and 45 with an identified source) from 2 Spanish teaching hospitals to determine the prevalence of CRN and other colorectal diseases. In the group with an unknown source of infection, 61 patients (56%) underwent colonoscopy; of these, 31 (50.8%) had CRN. Nonadvanced colorectal adenoma was detected in 22 patients (36%), advanced adenoma in 5 (8.2%), and colorectal carcinoma (CRC) in 4 (6.6%). Among patients who survived the EFIE episode with ≥ 2 years of follow-up, 1 case of CRC was subsequently diagnosed. Only 6 patients (13.3%) with an identified focus of infection underwent colonoscopy; 1 of these patients (16.7%) was diagnosed with CRN. The prevalence of adenomas was slightly higher than that of the Spanish population in the same age range, whereas that of CRC was 17-fold higher. CRN was found in more than half of patients with EFIE and an unclear focus of infection who underwent colonoscopy. Colonoscopy should be recommended in patients with EFIE and an unclear source of infection. Copyright © 2017 Sociedad Española de Cardiología. Published by Elsevier España, S.L.U. All rights reserved.

  5. 154 ORIGINAL ARTICLE

    African Journals Online (AJOL)

    boaz

    The samples were cultured on bile aesculinazide agar and the isolates were identified with microgen test kit. The enterococcal strains isolated include. Enterococcus faecalis, Enterococcus faecium, Enterococcus mundtii, Enterococcus gallinarum, Enterococcus casseliflavus,. Enterococcus dispar, Enterococcoushirae and ...

  6. 154 ORIGINAL ARTICLE

    African Journals Online (AJOL)

    boaz

    Les exemples inclus et de l'environnement clinique. Les échantillons cliniques inclus les selles, l'urine et d'écouvillons plaie tandis que les échantillons environnementaux inclus écouvillons prélevés sur des fournisseurs de soins de santé les mains, étage, lits, poignée de porte, un brassard, stéthoscope, lavabo, toilettes ...

  7. The type 2 diabetes risk allele of TMEM154-rs6813195 associates with decreased beta cell function in a study of 6,486 Danes.

    Directory of Open Access Journals (Sweden)

    Marie Neergaard Harder

    Full Text Available A trans-ethnic meta-analysis of type 2 diabetes genome-wide association studies has identified seven novel susceptibility variants in or near TMEM154, SSR1/RREB1, FAF1, POU5F1/TCF19, LPP, ARL15 and ABCB9/MPHOSPH9. The aim of our study was to investigate associations between these novel risk variants and type 2 diabetes and pre-diabetic traits in a Danish population-based study with measurements of plasma glucose and serum insulin after an oral glucose tolerance test in order to elaborate on the physiological impact of the variants.Case-control analyses were performed in up to 5,777 patients with type 2 diabetes and 7,956 individuals with normal fasting glucose levels. Quantitative trait analyses were performed in up to 5,744 Inter99 participants naïve to glucose-lowering medication. Significant associations between TMEM154-rs6813195 and the beta cell measures insulinogenic index and disposition index and between FAF1-rs17106184 and 2-hour serum insulin levels were selected for further investigation in additional Danish studies and results were combined in meta-analyses including up to 6,486 Danes.We confirmed associations with type 2 diabetes for five of the seven SNPs (TMEM154-rs6813195, FAF1-rs17106184, POU5F1/TCF19-rs3130501, ARL15-rs702634 and ABCB9/MPHOSPH9-rs4275659. The type 2 diabetes risk C-allele of TMEM154-rs6813195 associated with decreased disposition index (n=5,181, β=-0.042, p=0.012 and insulinogenic index (n=5,181, β=-0.032, p=0.043 in Inter99 and these associations remained significant in meta-analyses including four additional Danish studies (disposition index n=6,486, β=-0.042, p=0.0044; and insulinogenic index n=6,486, β=-0.037, p=0.0094. The type 2 diabetes risk G-allele of FAF1-rs17106184 associated with increased levels of 2-hour serum insulin (n=5,547, β=0.055, p=0.017 in Inter99 and also when combining effects with three additional Danish studies (n=6,260, β=0.062, p=0.0040.Studies of type 2 diabetes intermediary

  8. Hepatic in vitro toxicity assessment of PBDE congeners BDE47, BDE153 and BDE154 in Atlantic salmon (Salmo salar L.)

    Energy Technology Data Exchange (ETDEWEB)

    Softeland, Liv, E-mail: lso@nifes.no [National Institute of Nutrition and Seafood Research, PO Box 2029 Nordnes, N-5817 Bergen (Norway); Petersen, Kjell [Computational Biology Unit, Bergen Centre for Computational Science, Uni Research AS, Thormohlensgt 55, N5008 Bergen (Norway); Stavrum, Anne-Kristin [Dept of Clinical Medicine, University of Bergen (Norway); Wu, Terence [Yale University W.M. Keck Biotechnology Resource, 300 George St., Room G001, New Haven, CT 06511 (United States); Olsvik, Pal A. [National Institute of Nutrition and Seafood Research, PO Box 2029 Nordnes, N-5817 Bergen (Norway)

    2011-10-15

    The brominated flame retardant congeners BDE47, BDE153 and BDE154 are among the congeners accumulating to the highest degree in fish. In order to gain knowledge about the toxicological effects of PBDEs in fish, microarray-based transcriptomic and 2D-DIGE/MALDI-TOF/TOF proteomic approaches were used to screen for effects in primary Atlantic salmon hepatocytes exposed to these congeners alone or in combination (PBDE-MIX). A small set of stress related transcripts and proteins were differentially expressed in the PBDE exposed hepatocytes. The PBDE-MIX, and BDE153 to a lesser degree, seems to have induced metabolic disturbances by affecting several pathways related to glucose homeostasis. Further, effects on cell cycle control and proliferation signal pathways in PBDE-MIX-exposed hepatocytes clearly suggest that the PBDE exposure affected cell proliferation processes. CYP1A was 7.41- and 7.37-fold up-regulated in hepatocytes exposed to BDE47 and PBDE-MIX, respectively, and was the only biotransformation pathway affected by the PBDE exposure. The factorial design and PLS regression analyses of the effect of the PBDE-MIX indicated that BDE47 contributed the most to the observed CYP1A response, suggesting that this congener should be incorporated in the toxic equivalent (TEQ) concept in future risk assessment of dioxin-like chemicals. Additionally, a significant up-regulation of the ER-responsive genes VTG and ZP3 was observed in cells exposed to BDE47 and PBDE-MIX. Further analyses suggested that BDE47 and BDE154 have an estrogenic effect in male fish. The data also suggested an antagonistic interaction between BDE153 and BDE154. In conclusion, this study shows that PBDEs can affect several biological systems in Atlantic salmon cells, and demonstrates the need for more studies on the simultaneous exposure to chemical mixtures to identify combined effects of chemicals.

  9. S-glutathionylation of glyceraldehyde-3-phosphate dehydrogenase induces formation of C150-C154 intrasubunit disulfide bond in the active site of the enzyme.

    Science.gov (United States)

    Barinova, K V; Serebryakova, M V; Muronetz, V I; Schmalhausen, E V

    2017-12-01

    Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a glycolytic protein involved in numerous non-glycolytic functions. S-glutathionylated GAPDH was revealed in plant and animal tissues. The role of GAPDH S-glutathionylation is not fully understood. Rabbit muscle GAPDH was S-glutathionylated in the presence of H 2 O 2 and reduced glutathione (GSH). The modified protein was assayed by MALDI-MS analysis, differential scanning calorimetry, dynamic light scattering, and ultracentrifugation. Incubation of GAPDH in the presence of H 2 O 2 together with GSH resulted in the complete inactivation of the enzyme. In contrast to irreversible oxidation of GAPDH by H 2 O 2 , this modification could be reversed in the excess of GSH or dithiothreitol. By data of MALDI-MS analysis, the modified protein contained both mixed disulfide between Cys150 and GSH and the intrasubunit disulfide bond between Cys150 and Cys154 (different subunits of tetrameric GAPDH may contain different products). S-glutathionylation results in loosening of the tertiary structure of GAPDH, decreases its affinity to NAD + and thermal stability. The mixed disulfide between Cys150 and GSH is an intermediate product of S-glutathionylation: its subsequent reaction with Cys154 results in the intrasubunit disulfide bond in the active site of GAPDH. The mixed disulfide and the C150-C154 disulfide bond protect GAPDH from irreversible oxidation and can be reduced in the excess of thiols. Conformational changes that were observed in S-glutathionylated GAPDH may affect interactions between GAPDH and other proteins (ligands), suggesting the role of S-glutathionylation in the redox signaling. The manuscript considers one of the possible mechanisms of redox regulation of cell functions. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Crystal structure of monoclinic samarium and cubic europium sesquioxides and bound coherent neutron scattering lengths of the isotopes {sup 154}Sm and {sup 153}Eu

    Energy Technology Data Exchange (ETDEWEB)

    Kohlmann, Holger [Leipzig Univ. (Germany). Inst. of Inorganic Chemistry; Hein, Christina; Kautenburger, Ralf [Saarland Univ., Saarbruecken (Germany). Inorganic Solid State Chemistry; Hansen, Thomas C.; Ritter, Clemens [Institut Laue-Langevin, Grenoble (France); Doyle, Stephen [Karlsruhe Institute of Technology, Eggenstein-Leopoldshafen (Germany). Inst. for Synchrotron Radiation (ISS)

    2016-11-01

    The crystal structures of monoclinic samarium and cubic europium sesquioxide, Sm{sub 2}O{sub 3} and Eu{sub 2}O{sub 3}, were reinvestigated by powder diffraction methods (laboratory X-ray, synchrotron, neutron). Rietveld analysis yields more precise structural parameters than previously known, especially for oxygen atoms. Interatomic distances d(Sm-O) in Sm{sub 2}O{sub 3} range from 226.3(4) to 275.9(2) pm [average 241.6(3) pm] for the monoclinic B type Sm{sub 2}O{sub 3} [space group C2/m, a = 1418.04(3) pm, b = 362.660(7) pm, c = 885.48(2) pm, β = 100.028(1) ], d(Eu-O) in Eu{sub 2}O{sub 3} from 229.9(2) to 238.8(2) pm for the cubic bixbyite (C) type [space group Ia anti 3, a = 1086.87(1) pm]. Neutron diffraction at 50 K and 2 K did not show any sign for magnetic ordering in Sm{sub 2}O{sub 3}. Isotopically enriched {sup 154}Sm{sub 2}O{sub 3} and {sup 153}Eu{sub 2}O{sub 3} were used for the neutron diffraction work because of the enormous absorption cross section of the natural isotopic mixtures for thermal neutrons. The isotopic purity was determined by inductively coupled plasma - mass spectrometry to be 98.9% for {sup 154}Sm and 99.8% for {sup 153}Eu. Advanced analysis of the neutron diffraction data suggest that the bound coherent scattering lengths of {sup 154}Sm and {sup 153}Eu need to be revised. We tentatively propose b{sub c}({sup 154}Sm) = 8.97(6) fm and b{sub c}({sup 153}Eu) = 8.85(3) fm for a neutron wavelength of 186.6 pm to be better values for these isotopes, showing up to 8% deviation from accepted literature values. It is shown that inaccurate scattering lengths may result in severe problems in crystal structure refinements causing erroneous structural details such as occupation parameters, which might be critically linked to physical properties like superconductivity in multinary oxides.

  11. The generation of thymus-independent germinal centers depends on CD40 but not on CD154, the T cell-derived CD40-ligand.

    Science.gov (United States)

    Gaspal, Fabrina M C; McConnell, Fiona M; Kim, Mi-Yeon; Gray, David; Kosco-Vilbois, Marie H; Raykundalia, Chandra R; Botto, Marina; Lane, Peter J L

    2006-07-01

    In this report, we show that the formation of germinal center (GC)-like structures to thymus-independent type 2 antigens in mice depends on intact signals through CD40, but does not depend on T cell-derived CD40-ligand (CD154). In addition, we show that follicular dendritic cells (FDC) are also critical to thymus-independent GC formation, as their depletion by blockade of lymphotoxin-beta receptor signals abrogated GC development unless the responding B cells bound antigen with high affinity. Further evidence that immune complexes drove this CD40-dependent B cell proliferation was provided by the observation that an antibody that detects immune complexes containing complement component 4 on FDC also inhibited thymus-independent GC formation when injected in vivo at the time of immunization. Finally, we show that thymus-independent B cell proliferation was associated with class switching to IgG3, as IgG3(+) antigen-specific switched B cells could be visualized directly in GC, suggesting that immune complexes can provide the signals for class switching within GC in the absence of CD154.

  12. Characterization of Cichopeptins, New Phytotoxic Cyclic Lipodepsipeptides Produced by Pseudomonas cichorii SF1-54 and Their Role in Bacterial Midrib Rot Disease of Lettuce.

    Science.gov (United States)

    Huang, Chien-Jui; Pauwelyn, Ellen; Ongena, Marc; Debois, Delphine; Leclère, Valerie; Jacques, Philippe; Bleyaert, Peter; Höfte, Monica

    2015-09-01

    The lettuce midrib rot pathogen Pseudomonas cichorii SF1-54 produces seven bioactive compounds with biosurfactant properties. Two compounds exhibited necrosis-inducing activity on chicory leaves. The structure of the two phytotoxic compounds, named cichopeptin A and B, was tentatively characterized. They are related cyclic lipopeptides composed of an unsaturated C12-fatty acid chain linked to the N-terminus of a 22-amino acid peptide moiety. Cichopeptin B differs from cichopeptin A only in the last C-terminal amino acid residue, which is probably Val instead of Leu/Ile. Based on peptide sequence similarity, cichopeptins are new cyclic lipopeptides related to corpeptin, produced by the tomato pathogen Pseudomonas corrugata. Production of cichopeptin is stimulated by glycine betaine but not by choline, an upstream precursor of glycine betaine. Furthermore, a gene cluster encoding cichopeptin synthethases, cipABCDEF, is responsible for cichopeptin biosynthesis. A cipA-deletion mutant exhibited significantly less virulence and rotten midribs than the parental strain upon spray inoculation on lettuce. However, the parental and mutant strains multiplied in lettuce leaves at a similar rate. These results demonstrate that cichopeptins contribute to virulence of P. cichorii SF1-54 on lettuce.

  13. Measurement of keV-neutron capture cross sections and capture gamma-ray spectra of {sup 147,148,149,150,152,154}Sm

    Energy Technology Data Exchange (ETDEWEB)

    Duamet, B.; Igashira, Masayuki; Mizumachi, Mari; Mizuno, Satoshi; Hori, Jun-ichi; Masuda, Koji; Ohsaki, Toshiro [Research Laboratory for Nuclear Reactors, Tokyo Institute of Technology, Tokyo (Japan)

    1999-10-01

    The neutron capture cross sections and capture {gamma}-ray spectra of {sup 147,148,149,150,152,154}Sm were measured in the neutron energy region of 10 to 90 keV and at 550 keV. A neutron time-of-flight method was adopted with a 1.5-ns pulsed neutron source by the {sup 7}Li(p, n){sup 7}Be reaction and with a large anti-Compton NaI(Tl) {gamma}-ray spectrometer. A pulse-height weighting technique was applied to observed capture {gamma}-ray pulse-height spectra to derive capture yields. The capture cross sections were obtained with the error of about 5% by using the standard capture cross sections of {sup 197}Au. The present results were compared with the evaluated values of JENDL-3.2 and previous measurements. The capture {gamma}-ray spectra were obtained by unfolding the observed capture {gamma}-ray pulse-height spectra. An anomalous shoulder was cleary observed around 3 MeV in the {gamma}-ray spectra of {sup 150,152,154}Sm, and the energy position of the shoulder was consistent with the systematics obtained in our previous work. (author)

  14. Intense 1.54 μm fluorescence of Er3+/Yb3+ codoped phosphate glass and the three-photon phenomenon of near infrared upconversion luminescence

    Science.gov (United States)

    Luo, Lanjun; Song, Feng; Yu, Xiaochen; Wang, Wentao; Ming, Chengguo; Han, Lin; Yu, Yin; Wu, Hao; Tian, Jianguo

    2010-02-01

    Transparent P2O5-CaO-Na2O glasses codoped with Er3+ and Yb3+ ions were fabricated by high-temperature melting technique. Strong near infrared and visible upconversion luminescence were observed under 975 nm laser diode excitation, and the luminescence processes were explained in details. For 1.54 μm band, the calculated peak emission cross sections is 1.04×10-20 cm2, and it is better than that in germinate, tellurite, silicate, and other phosphate glasses. The near infrared upconversion emission around 828 nm contains two-photon and three-photon processes, and it is attributed to the transition S43/2→I413/2, which enhances the population of the upper level for 1.54 μm laser emission and reduces the energy loss due to upconversion. Efficient near infrared fluorescence indicates Er3+/Yb3+ codoped phosphate glass is a promising laser and amplifier material.

  15. CD4+ T helper cells use CD154–CD40 interactions to counteract T reg cell–mediated suppression of CD8+ T cell responses to influenza

    Science.gov (United States)

    Ballesteros-Tato, André; León, Beatriz; Lund, Frances E.

    2013-01-01

    CD4+ T cells promote CD8+ T cell priming by licensing dendritic cells (DCs) via CD40–CD154 interactions. However, the initial requirement for CD40 signaling may be replaced by the direct activation of DCs by pathogen-derived signals. Nevertheless, CD40–CD154 interactions are often required for optimal CD8+ T cell responses to pathogens for unknown reasons. Here we show that CD40 signaling is required to prevent the premature contraction of the influenza-specific CD8+ T cell response. CD40 is required on DCs but not on B cells or T cells, whereas CD154 is required on CD4+ T cells but not CD8+ T cells, NKT cells, or DCs. Paradoxically, even though CD154-expressing CD4+ T cells are required for robust CD8+ T cell responses, primary CD8+ T cell responses are apparently normal in the absence of CD4+ T cells. We resolved this paradox by showing that the interaction of CD40-bearing DCs with CD154-expressing CD4+ T cells precludes regulatory T cell (T reg cell)–mediated suppression and prevents premature contraction of the influenza-specific CD8+ T cell response. Thus, CD4+ T helper cells are not required for robust CD8+ T cell responses to influenza when T reg cells are absent. PMID:23835849

  16. Role of silicon excess in Er-doped silicon-rich nitride light emitting devices at 1.54 μm

    Energy Technology Data Exchange (ETDEWEB)

    Ramírez, J. M., E-mail: jmramirez@el.ub.edu; Berencén, Y.; Garrido, B. [MIND-IN2UB, Department Electrònica, Universitat de Barcelona, Martí i Franquès 1, Barcelona 08028 (Spain); Cueff, S. [Institut des Nanotechnologies de Lyon, École Centrale de Lyon, Écully 69134 (France); Labbé, C. [Centre de Recherche sur les Ions, les Matériaux et la Photonique (CIMAP), UMR 6252 CNRS/CEA/Ensicaen/UCBN, Caen 14050 (France)

    2014-08-28

    Erbium-doped silicon-rich nitride electroluminescent thin-films emitting at 1.54 μm have been fabricated and integrated within a metal-oxide-semiconductor structure. By gradually varying the stoichiometry of the silicon nitride, we uncover the role of silicon excess on the optoelectronic properties of devices. While the electrical transport is mainly enabled in all cases by Poole-Frenkel conduction, power efficiency and conductivity are strongly altered by the silicon excess content. Specifically, the increase in silicon excess remarkably enhances the conductivity and decreases the charge trapping; however, it also reduces the power efficiency. The main excitation mechanism of Er{sup 3+} ions embedded in silicon-rich nitrides is discussed. The optimum Si excess that balances power efficiency, conductivity, and charge trapping density is found to be close to 16%.

  17. Investigation of low-energy dipole modes in the heavy deformed nucleus 154Sm via inelastic polarized proton scattering at zero degree

    Directory of Open Access Journals (Sweden)

    Krugmann A.

    2014-03-01

    Full Text Available A high resolution proton scattering experiment has been performed on the heavy deformed nucleus 154Sm at extreme forward angles with 295 MeV polarized protons at RCNP, Osaka. Our scientific goal is to investigate the impact of ground state deformation on the properties of the pygmy dipole resonance and on the spin-M1 resonance in heavy deformed nuclei. The (p,p’ cross sections can be decomposed into E1 and M1 parts in two independent ways based either on a multipole decomposition of the cross sections or on spin-transfer observables as has been demonstrated for the case of 208Pb. We present the method and preliminary results from the analysis of polarization transfer observables.

  18. Resíduos de glifosato e ácido aminometilfosfônico e teores de isoflavonas em soja BRS 244 RR e BRS 154

    OpenAIRE

    Bohm,Giani Mariza Bärwald; Genovese,Maria Inés; Pigosso,Gustavo; Trichez,Daniel; Rombaldi,Cesar Valmor

    2008-01-01

    A principal forma de controle das plantas daninhas durante o cultivo de soja geneticamente modificada (GM RR) BRS 244 RR é o uso de glifosato. Porém, existem dúvidas quanto à segurança desse herbicida, à qualidade dos grãos e do solo da soja GM RR cultivada em Planossolo. Resíduos da molécula do glifosato e do metabólito ácido aminometilfosfônico (AMPA) podem estar presentes nos grãos, bem como, podem afetar a concentração de isoflavonas. Por isso, avaliaram-se as sojas BRS 244 RR e BRS 154 c...

  19. 1.54  μm photoluminescence from Er:Ox centers at extremely low concentration in silicon at 300 K.

    Science.gov (United States)

    Celebrano, Michele; Ghirardini, Lavinia; Finazzi, Marco; Shimizu, Yasuo; Tu, Yuan; Inoue, Koji; Nagai, Yasuyoshi; Shinada, Takahiro; Chiba, Yuki; Abdelghafar, Ayman; Yano, Maasa; Tanii, Takashi; Prati, Enrico

    2017-09-01

    The demand for single photon emitters at λ=1.54  μm, which follows from the consistent development of quantum networks based on optical fiber technologies, makes Er:Ox centers in Si a viable resource, thanks to the I13/24→I415/2 optical transition of Er(3+). While its implementation in high-power applications is hindered by the extremely low emission rate, the study of such systems in the low concentration regime remains relevant for quantum technologies. In this Letter, we explore the room-temperature photoluminescence at the telecomm wavelength from very low implantation doses of Er:Ox in Si. The lower-bound number of optically active Er atoms detected is of the order of 10(2), corresponding to a higher-bound value for the emission rate per individual ion of about 10(4)  s(-1).

  20. Resíduos de glifosato e ácido aminometilfosfônico e teores de isoflavonas em soja BRS 244 RR e BRS 154 Residues of glyphosate and aminomethylphosphonic acid and levels of isoflavones in BRS 244 RR and BRS 154 soybean

    Directory of Open Access Journals (Sweden)

    Giani Mariza Bärwald Bohm

    2008-12-01

    Full Text Available A principal forma de controle das plantas daninhas durante o cultivo de soja geneticamente modificada (GM RR BRS 244 RR é o uso de glifosato. Porém, existem dúvidas quanto à segurança desse herbicida, à qualidade dos grãos e do solo da soja GM RR cultivada em Planossolo. Resíduos da molécula do glifosato e do metabólito ácido aminometilfosfônico (AMPA podem estar presentes nos grãos, bem como, podem afetar a concentração de isoflavonas. Por isso, avaliaram-se as sojas BRS 244 RR e BRS 154 cultivadas nos seguintes tratamentos: T1 - soja BRS 244 RR, sem aplicação de herbicida, com capina manual aos 28 dias após o plantio (dap; T2 - soja BRS 154 sem aplicação de herbicida, com capina manual também aos 28 dap; T3 - soja BRS 244 RR com uma aplicação de glifosato a 960 g ia ha-1 aos 28 dap; T4 - soja BRS 244 RR com duas aplicações de glifosato a 960 g ia ha-1 aos 28 e 56 dap; T5 - soja BRS 244 RR com uma aplicação de herbicida imazetapir a 100 g ia ha-1 aos 28 dap; T6 - soja BRS 154 com uma aplicação de herbicida imazetapir a 100 g ia ha-1 aos 28 dap. Verificou-se que a aplicação de glifosato no controle de plantas daninhas resultou em teores elevados de glifosato e ácido aminometilfosfônico no solo. Nos grãos, o teor de isoflavonas não parece ser significativamente afetado pela aplicação de glifosato, mas os resíduos desse herbicida foram superiores ao permitido pela legislação vigente, que é de 10 mg.kg-1.The use of Glyphosate is the best way to control weed growing when cultivating genetically modified soybean (GMRR BRS 244 RR. However, there have been doubts about the safety of this herbicide use concerning its effects on the quality of grains and on the soil of Albaqualf cultivated GMRR soybean. Glyphosate and the metabolite aminomethylphosphonic acid (AMPA residues can be present in the grains and affect the isoflavones concentration. Therefore, BRS 244 RR and BRS 154 soybeans with the following

  1. Dual function of the hemagglutinin H5 fused to chicken CD154 in a potential strategy of DIVA against avian influenza disease: preliminary study

    Directory of Open Access Journals (Sweden)

    A.G. Pose

    2015-09-01

    Full Text Available In this study we demonstrated that the vaccine candidate against avian influenza virus H5N1 based on the hemagglutinin H5 (HA fused to the chicken CD154 (HACD can also be used for differentiating infected from vaccinated animals (DIVA. As the strategy of DIVA requires at least two proteins, we obtained a variant of the nucleoprotein (NP49-375 in E. coli. After its purification by IMAC, the competence of the proteins NP49-375 and HACD as coating antigens in indirect ELISA assays were tested by using the sera of chickens immunized with the proteins HA and HACD and the reference sera from several avian influenza subtypes. Together with these sera, the sera from different species of birds and the sera of chickens infected with other avian viral diseases were analyzed by competition ELISA assays coated with the proteins NP49-375 and HACD. The results showed that the segment CD154 in the chimeric protein HACD did not interfere with the recognition of the molecule HA by its specific antibodies. Also, we observed variable detection levels when the reference sera were analyzed in the ELISA plates coated with the protein NP49-375. Moreover, only the antibodies of the reference serum subtype H5 were detected in the ELISA plates coated with the protein HACD. The competition ELISA assays showed percentages of inhibition of 88-91% for the positives sera and less than 20% for the negative sera. We fixed the cut-off value of these assays at 25%. No antibody detection was observed in the sera from different species of birds or the sera of chickens infected with other avian viral diseases. This study supported the fact that the ELISA assays using the proteins NP49-375 and HACD could be valuable tools for avian influenza surveillance and as a strategy of DIVA for counteracting the highly pathogenic avian influenza virus H5N1 outbreaks.

  2. Clinical role of HER2 gene amplification and chromosome 17: a study on 154 IHC-equivocal cases of invasive breast carcinoma patients.

    Science.gov (United States)

    Afzal, Muhammad; Amir, Mohammed; Hassan, Muhammad Jawad; Hussain, Muhammad Sikander; Aziz, Muhammad Naveed; Murad, Sheeba; Murtaza, Iram; Anees, Mariam; Sultan, Aneesa

    2016-07-01

    Accurate evaluation of human epidermal growth factor receptor 2 (HER2) status is quite crucial for invasive breast tumor patients in order to select anti-HER2 therapy for effective clinical outcomes. Immunohistochemistry (IHC) assay is routinely used to evaluate the HER2 oncoprotein overexpression but is unable to explain the chromosomal and genetic alterations and has been considered as a hot issue in IHC-equivocal cases. We investigated these molecular aberrations in correlation with prognostic factors. A cohort of 154 IHC-equivocal (+2) cases was selected and retrospectively analyzed by dual-probe fluorescence in situ hybridization (FISH) assay by using locus-specific HER2 and centromere enumeration probes (CEP17) for the identification of HER2 proto-oncogene amplification and chromosomal copy number per cell, respectively. The data were analyzed by SPSS 16.0 version using chi-square test (p cases (23.4 %) showing HER2 gene amplification (average HER2 gene copies per cell >4 or 2) in concordance with HER2 oncoprotein overexpression, and significant correlation was observed with prognostic parameters including histological type, tumor grade II to III, histology and pathological type, lymphatic invasion, ductal carcinoma in situ (DCIS), and estrogen-positive and progesterone-negative receptors. Of the 154 cases, 18 cases (11.7 %) showed polysomy 17 with CEP17 probe signals per cell ≥3 and 22 cases (14.3 %) presented monosomy 17 (CEP17 probe signals per cell ≤1). Our data indicate that the use of anti-HER2 therapy should not be suggested unless true evaluation of HER2 protein expression is made regarding gene amplification essentially in IHC-ambiguous invasive breast tumors.

  3. The non-peptide CRH1-antagonist CP-154,526 elicits a paradoxical route-dependent activation of the HPA axis.

    Science.gov (United States)

    Zaretsky, Dmitry V; Zaretskaia, Maria V; Sarkar, Sumit; Rusyniak, Daniel E; DiMicco, Joseph A

    2017-07-13

    The corticotropin-releasing hormone (CRH) plays an important role in mediating physiological response to stress and is thought to be involved in the development of various psychiatric disorders. In this paper, we compare the differences between the effect of intraperitoneal (i.p.) and intraarterial (i.a.) administration of the non-peptide CRH1 antagonist CP-154,526 (CP) (10 and 20mg/kg) on plasma adrenocorticotropic hormone levels (ACTH), heart rate, MAP, and c-Fos expression in the paraventricular nucleus of the hypothalamus. Intraperitoneal, but not i.a., injection of CP resulted in an increase in plasma ACTH (from 105±13 to 278±51pg/ml after 20mg/kg). This effect was accompanied by a dramatic increase in c-Fos expression in cells immunoreactive for CRH in the paraventricular nucleus of the hypothalamus. When the drug was administered i.p., CP-induced activation of the HPA appears to mask the inhibitory effect of CP on stress-induced ACTH secretion, an effect which was readily apparent when the drug was given i.a. Intraperitoneal administration of CP also increased the baseline MAP which may account for previous reports that treatment with this drug attenuated the increases associated with stress. CP given by either route had no effect on baseline heart rate or stress-induced tachycardia. Thus, in all studies in which CP 154,526 is given, the route of delivery must be given careful consideration. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Friedreich's Ataxia Variants I154F and W155R Diminish Frataxin-Based Activation of the Iron-Sulfur Cluster Assembly Complex

    Energy Technology Data Exchange (ETDEWEB)

    Tsai, Chi-Lin; Bridwell-Rabb, Jennifer; Barondeau, David P

    2011-11-07

    Friedreich's ataxia (FRDA) is a progressive neurodegenerative disease that has been linked to defects in the protein frataxin (Fxn). Most FRDA patients have a GAA expansion in the first intron of their Fxn gene that decreases protein expression. Some FRDA patients have a GAA expansion on one allele and a missense mutation on the other allele. Few functional details are known for the ~15 different missense mutations identified in FRDA patients. Here in vitro evidence is presented that indicates the FRDA I154F and W155R variants bind more weakly to the complex of Nfs1, Isd11, and Isu2 and thereby are defective in forming the four-component SDUF complex that constitutes the core of the Fe-S cluster assembly machine. The binding affinities follow the trend Fxn ~ I154F > W155F > W155A ~ W155R. The Fxn variants also have diminished ability to function as part of the SDUF complex to stimulate the cysteine desulfurase reaction and facilitate Fe-S cluster assembly. Four crystal structures, including the first for a FRDA variant, reveal specific rearrangements associated with the loss of function and lead to a model for Fxn-based activation of the Fe-S cluster assembly complex. Importantly, the weaker binding and lower activity for FRDA variants correlate with the severity of disease progression. Together, these results suggest that Fxn facilitates sulfur transfer from Nfs1 to Isu2 and that these in vitro assays are sensitive and appropriate for deciphering functional defects and mechanistic details for human Fe-S cluster biosynthesis.

  5. Production cross sections of elements near the N=126 shell in Ca48-induced reactions with Gd154,Tb159,Dy162, and Ho165 targets

    Science.gov (United States)

    Mayorov, D. A.; Werke, T. A.; Alfonso, M. C.; Bennett, M. E.; Folden, C. M.

    2014-08-01

    Excitation functions for shell-stabilized evaporation residues produced in Ca48-induced reactions with Gd154,Tb159,Dy162, and Ho165 targets have been measured in experiments performed at the Cyclotron Institute at Texas A&M University. The examined energy range predominantly covers the 3n and 4n evaporation channels with higher cross sections measured for the 4n products. The σ4n are nearly invariant within experimental uncertainty in reactions with Tb159,Dy162, and Ho165 with the maxima at 12.6 ± 1.9, 12.6 ± 1.7, and 9.4 ± 1.3 mb, respectively. For the reaction with Gd154, the maximum is slightly lower at 4.0 ± 0.6 mb. A simple model to describe the measured production cross sections was employed. Capture was estimated by using the "diffused barrier formula" from the "fusion by diffusion" model proposed by Świątecki et al. [Phys. Rev. C 71, 014602 (2005)]., 10.1103/PhysRevC.71.014602 The fusion probability was estimated by using a phenomenological expression presented by Siwek-Wilczyńska et al. [Int. J. Mod. Phys. E 17, 12 (2008)]., 10.1142/S0218301308009501 The survival probability was calculated according to the formula of Vandenbosch and Huizenga [Nuclear Fission (Academic, New York, 1973)], derived from transition-state theory. The best agreement is reached between calculation and experiment upon inclusion of collective effects in the calculation of the survival probability, shown previously to be important for production of weakly deformed nuclei. This, in turn, challenges the expectation that strong shell stabilization benefits the production cross section. The present data are compared with earlier studies on production of neutron-deficient nuclei in Ca-induced reactions with lanthanide targets.

  6. Social Health Insurance-Based Simultaneous Screening for 154 Mutations in 19 Deafness Genes Efficiently Identified Causative Mutations in Japanese Hearing Loss Patients.

    Directory of Open Access Journals (Sweden)

    Kentaro Mori

    Full Text Available Sensorineural hearing loss is one of the most common neurosensory disorders in humans. The incidence of SNHL is estimated to be 1 in 500-1000 newborns. In more than half of these patients, the hearing loss is associated with genetic causes. In Japan, genetic testing for the patients with SNHL using the Invader assay to screen for 46 mutations in 13 deafness genes was approved by the Ministry of Health, Labour and Welfare for inclusion in social health insurance coverage in 2012. Furthermore, from August 2015, this genetic testing has been expanded to screen for 154 mutations in 19 deafness genes using targeted genomic enrichment with massively parallel DNA sequencing combined with the Invader assay and TaqMan genotyping. For this study we analyzed 717 unrelated Japanese hearing loss patients. The total allele frequency of 154 mutations in 19 deafness genes was 32.64% (468/1434 and the total numbers of cases associated with at least one mutation was 44.07% (316/717. Among these, we were able to diagnose 212 (30% patients, indicating that the present screening could efficiently identify causative mutations in hearing loss patients. It is noteworthy that 27 patients (3.8% had coexistent multiple mutations in different genes. Five of these 27 patients (0.7%, 5/717 overall were diagnosed with genetic hearing loss affected by concomitant with responsible mutations in more than two different genes. For patients identified with multiple mutations in different genes, it is necessary to consider that several genes might have an impact on their phenotypes.

  7. TL1A increases expression of CD25, LFA-1, CD134 and CD154, and induces IL-22 and GM-CSF production from effector CD4 T-cells

    DEFF Research Database (Denmark)

    Reichwald, Kirsten; Jørgensen, Tina Z.; Skov, Søren

    2014-01-01

    together with IL-12, IL-15 and IL-18 increases expression of the co-stimulatory molecules CD154 (CD40 ligand) and CD134 (OX40) on previously activated CD4+ T cells. This indicates that TL1A functions as a co-stimulatory molecule, decreasing the activation threshold of T-cells. We have previously shown...

  8. Abrogation of CD40–CD154 Signaling Impedes the Homeostasis of Thymic Resident Regulatory T Cells by Altering the Levels of IL-2, but Does Not Affect Regulatory T Cell Development

    Science.gov (United States)

    Cuss, Steven M.

    2012-01-01

    Identification of costimulatory signals required for murine regulatory T (Treg) cell development relies on measuring the frequency of total thymic Treg cells. However, the thymus contains both resident and newly developed Treg cells; whether such signals target both populations is unknown. In this study, we show that CD40–CD154 blockade specifically targeted thymic resident Treg cells, but not, as was previously believed, newly developed Treg cells. Unlike CD28–CD80/CD86 signals, CD40–CD154 signals were not required for Treg cell precursor development. Instead we demonstrate that homeostatic proliferation of thymic resident Treg cells was dependent on CD40–CD154 signals maintaining IL-2 levels. Furthermore, in newborn mice, where all Treg cells are newly developed, blockade of CD40–CD154 signals had no effect on thymic Treg numbers or their proliferation. Our studies highlight the complexity in the study of thymic Treg cell development due to the heterogeneity of thymic Treg cells. PMID:22802415

  9. The proportion of CD40+ mucosal macrophages is increased in inflammatory bowel disease whereas CD40 ligand (CD154)+ T cells are relatively decreased, suggesting differential modulation of these costimulatory molecules in human gut lamina propria.

    Science.gov (United States)

    Carlsen, Hege S; Yamanaka, Takeshi; Scott, Helge; Rugtveit, Jarle; Brandtzaeg, Per

    2006-11-01

    Signal transduction through binding of CD40 on antigen-presenting cells and CD40 ligand (CD154) on T cells appears to be crucial for mutual cellular activation. Antibodies aimed at blocking the CD40-CD154 costimulatory pathway dampen the severity of experimental colitis. To elucidate the microanatomical basis for signaling through this costimulatory pathway in human inflammatory bowel disease, we studied in situ the cellular distribution of these 2 molecules on lamina propria macrophages and T cells, respectively. Colonic specimens from 8 patients with ulcerative colitis and 8 with Crohn's disease, 8 small bowel specimens of Crohn's disease, and histologically normal control samples (6 from colon and 6 from small bowel) were included. Multicolor immunofluorescence in situ staining was performed to determine the percentage of subepithelial macrophages expressing CD40 and that of lamina propria T cells expressing CD154 while avoiding cells in lymphoid aggregates. The proportion of subepithelial CD40CD68 macrophages was significantly increased in normal colon compared with normal small bowel and showed further elevation in both colon and small bowel afflicted with inflammatory bowel disease. In addition, on a per-CD68-cell basis, CD40 expression was significantly increased in severely inflamed compared with moderately inflamed colonic specimens. Conversely, the proportion of CD154 T cells was similar in colon and small bowel, and interestingly, it was significantly reduced in colonic inflammatory bowel disease. Our findings suggested that modulation of CD40 expression by subepithelial macrophages and CD154 by lamina propria T cells is inversely modulated in the human gut.

  10. miR-125b and miR-155 contribute to BCL2 repression and proliferation in response to CD40 ligand (CD154) in human leukemic B-cells.

    Science.gov (United States)

    Willimott, Shaun; Wagner, Simon D

    2012-01-20

    Developmental stage-specific regulation of BCL2 occurs during B-cell maturation and has a role in normal immunity. CD40 signaling promotes proliferation and rescues B-cells from apoptosis, partly through induction of BCL2L1 and BCL2A1 and repression of BCL2. We previously showed that a stromal cell/CD40 ligand (CD154) culture system reproduced this switch in survival protein expression in primary human leukemic B-cells and we employed this model system to investigate BCL2 repression. BCL2 was post-transcriptionally regulated and the repressed BCL2 mRNA was associated with non-polysomal, but dense fractions on sucrose density gradients. Microarrays identified a set of miRNA that were induced by culture conditions and potentially able to bind to the BCL2 3'-UTR. Luciferase reporter assays demonstrated that miR-125b and miR-155 repressed BCL2 mRNA but while stromal cell contact alone was sufficient to induce strongly miR-125b this did not cause BCL2 repression. miR-155, which is the most abundant miRNA under basal conditions, specifically required CD154 for further induction above a threshold to exert its full repressive effects. Anti-miR-125b and anti-miR-155 prevented CD154-mediated repression of BCL2 and reduced CD154-mediated proliferation in the MEC1 B-cell line. We suggest that miR-155 and miR-125b, which are induced by CD154 and stromal cell signals, contribute to regulating proliferation and that BCL2 is one of their target mRNAs.

  11. miR-125b and miR-155 Contribute to BCL2 Repression and Proliferation in Response to CD40 Ligand (CD154) in Human Leukemic B-cells*

    Science.gov (United States)

    Willimott, Shaun; Wagner, Simon D.

    2012-01-01

    Developmental stage-specific regulation of BCL2 occurs during B-cell maturation and has a role in normal immunity. CD40 signaling promotes proliferation and rescues B-cells from apoptosis, partly through induction of BCL2L1 and BCL2A1 and repression of BCL2. We previously showed that a stromal cell/CD40 ligand (CD154) culture system reproduced this switch in survival protein expression in primary human leukemic B-cells and we employed this model system to investigate BCL2 repression. BCL2 was post-transcriptionally regulated and the repressed BCL2 mRNA was associated with non-polysomal, but dense fractions on sucrose density gradients. Microarrays identified a set of miRNA that were induced by culture conditions and potentially able to bind to the BCL2 3′-UTR. Luciferase reporter assays demonstrated that miR-125b and miR-155 repressed BCL2 mRNA but while stromal cell contact alone was sufficient to induce strongly miR-125b this did not cause BCL2 repression. miR-155, which is the most abundant miRNA under basal conditions, specifically required CD154 for further induction above a threshold to exert its full repressive effects. Anti-miR-125b and anti-miR-155 prevented CD154-mediated repression of BCL2 and reduced CD154-mediated proliferation in the MEC1 B-cell line. We suggest that miR-155 and miR-125b, which are induced by CD154 and stromal cell signals, contribute to regulating proliferation and that BCL2 is one of their target mRNAs. PMID:22139839

  12. Higher percentage of CD3⁺CD154⁺ T lymphocytes predicts efficacy of TNF-α inhibitors in active axial SpA patients.

    Science.gov (United States)

    Lin, Zhiming; Lin, Qu; Liao, Zetao; Li, Qiuxia; Zhang, Fucheng; Wei, Qiujing; Cao, Shuangyan; Gu, Jieruo

    2014-12-01

    The objective of this study was to evaluate which subtypes of T lymphocytes (CD3(+)CD28(+) and CD3(+)CD154(+)) could predict clinical efficacy after TNF-α inhibitor treatment in active axial SpA patients. Patients who fulfilled Assessment of SpondyloArthritis international Society (ASAS) criteria for axial SpA had a BASDAI of ≥40 mm. All patients received TNF-α inhibitor treatment for 12 weeks. ASAS20 was used to evaluate the effect of the treatment at week 12. We detected the percentage of CD3(+)CD28(+) and CD3(+)CD154(+) T lymphocytes on lymphocyte cells in the peripheral blood in patients and healthy controls. We evaluated whether the percentage of the above subtypes of T lymphocytes could predict clinical efficacy by ROC curve analysis. Fifty-eight healthy controls and 74 active axial SpA patients were included. Mean age was 26.28 ± 9.08 and 26.95 ± 8.13 years for healthy controls and patients, respectively (p = 0.767). The percentage of CD3(+)CD154(+) T lymphocytes was significantly higher in axial SpA patients than in healthy controls (1.62 ± 1.89 % vs 0.79 ± 0.52 %, p SpA patients with TNF-α inhibitor treatment (AUC = 0.733, p = 0.014). High percentage of CD3(+)CD154(+) is over-expressed on lymphocytes in peripheral blood of active SpA patients and can be down-regulated by TNF-α inhibitor therapy. High-percentage of CD3(+)CD154(+) T lymphocytes may predict clinical efficacy of TNF-α inhibitor treatment in active axial SpA patients.

  13. CD154-CD40 T-cell co-stimulation pathway is a key mechanism in kidney ischemia-reperfusion injury.

    Science.gov (United States)

    de Ramon, Laura; Ripoll, Elia; Merino, Ana; Lúcia, Marc; Aran, Josep M; Pérez-Rentero, S; Lloberas, Nuria; Cruzado, Josep M; Grinyó, Josep M; Torras, Juan

    2015-09-01

    Ischemia-reperfusion occurs in a great many clinical settings and contributes to organ failure or dysfunction. CD154-CD40 signaling in leukocyte-endothelial cell interactions or T-cell activation facilitates tissue inflammation and injury. Here we tested a siRNA anti-CD40 in rodent warm and cold ischemia models to check the therapeutic efficacy and anti-inflammatory outcome of in vivo gene silencing. In the warm ischemia model different doses were used, resulting in clear renal function improvement and a structural renoprotective effect. Renal ischemia activated the CD40 gene and protein expression, which was inhibited by intravenous siRNA administration. CD40 gene silencing improved renal inflammatory status, as seen by the reduction of CD68 and CD3 T-cell infiltrates, attenuated pro-inflammatory, and enhanced anti-inflammatory mediators. Furthermore, siRNA administration decreased a spleen pro-inflammatory monocyte subset and reduced TNFα secretion by splenic T cells. In the cold ischemia model with syngeneic and allogeneic renal transplantation, the most effective dose induced similar functional and structural renoprotective effects. Our data show the efficacy of our siRNA in modulating both the local and the systemic inflammatory milieu after an ischemic insult. Thus, CD40 silencing could emerge as a novel therapeutic strategy in solid organ transplantation.

  14. Excitation energy dependence of fragment-mass distributions from fission of 180,190Hg formed in fusion reactions of 36Ar + 144,154Sm

    Directory of Open Access Journals (Sweden)

    K. Nishio

    2015-09-01

    Full Text Available Mass distributions of fission fragments from the compound nuclei 180Hg and 190Hg formed in fusion reactions 36Ar + 144Sm and 36Ar + 154Sm, respectively, were measured at initial excitation energies of E⁎(Hg180=33–66 MeV and E⁎(Hg190=48–71 MeV. In the fission of 180Hg, the mass spectra were well reproduced by assuming only an asymmetric-mass division, with most probable light and heavy fragment masses A¯L/A¯H=79/101. The mass asymmetry for 180Hg agrees well with that obtained in the low-energy β+/EC-delayed fission of 180Tl, from our earlier ISOLDE(CERN experiment. Fission of 190Hg is found to proceed in a similar way, delivering the mass asymmetry of A¯L/A¯H=83/107, throughout the measured excitation energy range. The persistence as a function of excitation energy of the mass-asymmetric fission for both proton-rich Hg isotopes gives strong evidence for the survival of microscopic effects up to effective excitation energies of compound nuclei as high as 40 MeV. This behavior is different from fission of actinide nuclei and heavier mercury isotope 198Hg.

  15. Intratumoral delivery of CD154 homolog (Ad-ISF35) induces tumor regression: analysis of vector biodistribution, persistence and gene expression.

    Science.gov (United States)

    Melo-Cardenas, J; Urquiza, M; Kipps, T J; Castro, J E

    2012-05-01

    Ad-ISF35 is an adenovirus (Ad) vector that encodes a mouse-human chimeric CD154. Ad-ISF35 induces activation of chronic lymphocytic leukemia (CLL) cells converting them into CLL cells capable of promoting immune recognition and anti-leukemia T-cell activation. Clinical trials in humans treated with Ad-ISF35-transduced leukemia cells or intranodal injection of Ad-ISF35 have shown objective clinical responses. To better understand the biology of Ad-ISF35 and to contribute to its clinical development, we preformed studies to evaluate biodistribution, persistence and toxicity of repeat dose intratumoral administration of Ad-ISF35 in a mouse model. Ad-ISF35 intratumoral administration induced tumor regression in more than 80% of mice bearing A20 tumors. There were no abnormalities in the serum chemistry. Mice receiving Ad-ISF35 presented severe extramedullary hematopoiesis and follicular hyperplasia in the spleen and extramedullary hematopoiesis with lymphoid hyperplasia in lymph nodes. After Ad-ISF35 injection, the vector was found primarily in the injected tumors with a biodistribution pattern that showed a rapid clearance with no evidence of Ad-ISF35 accumulation or persistence in the injected tumor or peripheral organs. Furthermore, pre-existing antibodies against Ad-5 did not abrogate Ad-ISF35 anti-tumor activity. In conclusion, intratumoral administration of Ad-ISF35 induced tumor regression in A20 tumor bearing mice without toxicities and with no evidence of vector accumulation or persistence.

  16. Large-moment antiferromagnetic order in overdoped high-Tc superconductor 154SmFeAsO1-x D x.

    Science.gov (United States)

    Iimura, Soshi; Okanishi, Hiroshi; Matsuishi, Satoru; Hiraka, Haruhiro; Honda, Takashi; Ikeda, Kazutaka; Hansen, Thomas C; Otomo, Toshiya; Hosono, Hideo

    2017-05-30

    In iron-based superconductors, high critical temperature (Tc) superconductivity over 50 K has only been accomplished in electron-doped hREFeAsO (hRE is heavy rare earth (RE) element). Although hREFeAsO has the highest bulk Tc (58 K), progress in understanding its physical properties has been relatively slow due to difficulties in achieving high-concentration electron doping and carrying out neutron experiments. Here, we present a systematic neutron powder diffraction study of 154SmFeAsO1-x D x , and the discovery of a long-range antiferromagnetic ordering with x ≥ 0.56 (AFM2) accompanying a structural transition from tetragonal to orthorhombic. Surprisingly, the Fe magnetic moment in AFM2 reaches a magnitude of 2.73 μB/Fe, which is the largest in all nondoped iron pnictides and chalcogenides. Theoretical calculations suggest that the AFM2 phase originates in kinetic frustration of the Fe-3dxy orbital, in which the nearest-neighbor hopping parameter becomes zero. The unique phase diagram, i.e., highest-Tc superconducting phase adjacent to the strongly correlated phase in electron-overdoped regime, yields important clues to the unconventional origins of superconductivity.

  17. 46 CFR 154.615 - Design temperature below 0 °C (32 °F) and down to −55 °C (−67 °F).

    Science.gov (United States)

    2010-10-01

    ... LIQUEFIED GASES Design, Construction and Equipment Materials § 154.615 Design temperature below 0 °C (32 °F... 46 Shipping 5 2010-10-01 2010-10-01 false Design temperature below 0 °C (32 °F) and down to â55... tanks and secondary barriers for a design temperature below 0 °C (32 °F) and down to −55 °C (−67 °F...

  18. CD154 and IL-2 signaling of CD4+ T cells play a critical role in multiple phases of CD8+ CTL responses following adenovirus vaccination.

    Directory of Open Access Journals (Sweden)

    Channakeshava Sokke Umeshappa

    Full Text Available Adenoviral (AdV vectors represent most commonly utilized viral vaccines in clinical studies. While the role of CD8(+ cytotoxic T lymphocyte (CTL responses in mediating AdV-induced protection is well understood, the involvement of CD4(+ T cell-provided signals in the development of functional CD8(+ CTL responses remain unclear. To explore CD4(+ T helper signals required for AdVova-stimulated CTL responses, we established an adoptive transfer system by transferring CD4(+ T cells derived from various knock out and transgenic mice into wild-type and/or CD4-deficient animals, followed by immunizing with recombinant ovalbumin (OVA-expressing AdVova vector. Without CD4(+ T help, both primary and memory CTL responses were greatly reduced in this model, and were associated with increased PD-1 expression. The provision of OVA-specific CD4(+ T help in CD4(+ T cell-deficient mice restored AdVova-induced primary CTL responses, and supported survival and recall responses of AdVova-stimulated memory CTLs. These effects were specifically mediated by CD4(+ T cell-produced IL-2 and CD154 signals. Adoptive transfer of "helped" or "unhelped" effector and memory CTLs into naïve CD4(+ T cell-deficient or -sufficient mice also revealed an additional role for polyclonal CD4(+ T cell environment in the survival of AdVova-stimulated CTLs, partially explaining the extension of CTL contraction phase. Finally, during recall responses, CD4(+ T cell environment, particularly involving memory CD4(+ T cells, greatly enhanced expansion of memory CTLs. Collectively, our data strongly suggest a critical role for CD4(+ T help in multiple phases of AdV-stimulated CTL responses, and could partially explain certain failures in AdV-based immunization trials targeting malignant tumors and chronic diseases that are often associated with compromised CD4(+ T cell population and function.

  19. Anti-CD154 mAb and rapamycin induce T regulatory cell mediated tolerance in rat-to-mouse islet transplantation.

    Directory of Open Access Journals (Sweden)

    Yannick D Muller

    Full Text Available BACKGROUND: Anti-CD154 (MR1 monoclonal antibody (mAb and rapamycin (RAPA treatment both improve survival of rat-to-mouse islet xenograft. The present study investigated the effect of combined RAPA/MR1 treatment on rat-to-mouse islet xenograft survival and analyzed the role of CD4(+CD25(+Foxp3(+ T regulatory cells (Treg in the induction and maintenance of the ensuing tolerance. METHODOLOGY/PRINCIPAL FINDINGS: C57BL/6 mice were treated with MR1/RAPA and received additional monoclonal anti-IL2 mAb or anti CD25 mAb either early (0-28 d or late (100-128 d post-transplantation. Treg were characterised in the blood, spleen, draining lymph nodes and within the graft of tolerant and rejecting mice by flow cytometry and immunohistochemistry. Fourteen days of RAPA/MR1 combination therapy allowed indefinite islet graft survival in >80% of the mice. Additional administration of anti-IL-2 mAb or depleting anti-CD25 mAb at the time of transplantation resulted in rejection (100% and 89% respectively, whereas administration at 100 days post transplantation lead to lower rejection rates (25% and 40% respectively. Tolerant mice showed an increase of Treg within the graft and in draining lymph nodes early post transplantation, whereas 100 days post transplantation no significant increase of Treg was observed. Rejecting mice showed a transient increase of Treg in the xenograft and secondary lymphoid organs, which disappeared within 7 days after rejection. CONCLUSIONS/SIGNIFICANCES: These results suggest a critical role for Treg in the induction phase of tolerance early after islet xenotransplantation. These encouraging data support the need of developing further Treg therapy for overcoming the species barrier in xenotransplantation.

  20. Daily life changes and adaptations investigated in 154 families with a child suffering from a rare disability at a public centre for rare diseases in Northern Italy.

    Science.gov (United States)

    Silibello, G; Vizziello, P; Gallucci, M; Selicorni, A; Milani, D; Ajmone, P F; Rigamonti, C; De Stefano, S; Bedeschi, M F; Lalatta, Faustina

    2016-08-31

    Living with a disabled child has profound effects on the entire family. With a prevalence of developmental disabilities around 2,5 %, there is a considerable need to promote improvements in the health care system. Little is known about changes and adaptations in the lives of affected families and this paucity of information hinders the improvement of services. This study sought to explore the needs and changes in the everyday life of families with children suffering from rare diseases of varying severity, with and without mental disability. The aim was to measure the socio-demographic characteristics, health care problems and living conditions of a large cohort of families with an affected member. A sample of 154 families was recruited between September 2011 and April 2013 to respond to a 136 item questionnaire that explored different areas of concern (diagnosis and follow-up of clinical specialists, relationship with pediatrician, rehabilitation, school, work, institutional and/or private support, child care needs and family relationships). All parents answered the questionnaire. They were satisfied with the services provided in particular for diagnosis and follow-up, relationships with the family pediatrician, rehabilitation services and school, regardless of the severity of condition, presence of intellectual disability (ID) or absence of diagnosis. Negative scores were reported for institutional and/or private support and family relationships in severe conditions. The Health Care System should maintain a family-centered care and a multi-agency working, improving quality of life of families with disabled child to allow adaptation. At present these services are uncoordinated and financial support is poor, resulting in a heavy burden for these families.

  1. Influence of daily dosage and frequency of administration of rifampicin-levofloxacin therapy on tolerance and effectiveness in 154 patients treated for prosthetic joint infections.

    Science.gov (United States)

    Nguyen, S; Robineau, O; Titecat, M; Blondiaux, N; Valette, M; Loiez, C; Beltrand, E; Migaud, H; Senneville, E

    2015-08-01

    Data on the tolerance and effectiveness of rifampicin-levofloxacin combination therapy (RLCT) in patients treated for prosthetic joint infections (PJIs) according to daily dosage are lacking. A review of the clinical data from patients treated with RLCT for PJIs in a French referent center for PJIs was conducted. A total of 154 patients (75 F/79 M), with a median age of 64.1 years and median body weight of 83.1 kg, were included. The median daily dosages of rifampicin and levofloxacin were, respectively, 1,200 mg (range 300-2,100) and 750 mg (range 500-1,500), corresponding to a mean daily dose per kg of, respectively, 16.2 ± 4.3 mg/kg and 10.1 ± 3.0 mg/kg. After a mean follow-up period of 55.6 ± 27.1 months (range 24-236), 127 patients (82.5 %) were in remission. Adverse events attributable to rifampicin and levofloxacin were reported in 48 (31.2 %) and 13 (8.4 %) patients (p levofloxacin daily dosage on both tolerance and patient outcome. Our results suggest that adjusting rifampicin daily doses to the patient total body weight when combined with levofloxacin for the treatment of PJIs is associated with a poor tolerance. High daily doses of rifampicin (>600 mg) and levofloxacin (750 mg) do not improve patient outcome when compared to lower daily doses in this setting.

  2. Inelastic scattering of neutrons by spin waves in terbium

    DEFF Research Database (Denmark)

    Bjerrum Møller, Hans; Houmann, Jens Christian Gylden

    1966-01-01

    Measurements of spin-wave dispersion relations for magnons propagating in symmetry directions in ferromagnetic Tb; it is first experiment to give detailed information on magnetic excitations in heavy rare earths; Tb was chosen for these measurements because it is one of few rare-earth metals whic...... does not have very high thermal-neutron capture cross section, so that inelastic neutron scattering experiments can give satisfactory information on magnon dispersion relations....

  3. Coherent magnetic structures in terbium/holmium superlattices

    DEFF Research Database (Denmark)

    Bryn-Jacobsen, C.; Cowley, R.A.; McMorrow, D.F.

    1997-01-01

    Neutron-scattering techniques have been used to investigate the magnetic properties of three Tb/Ho superlattices grown by molecular-beam epitaxy. It is revealed that for temperatures in the range T = 10 to T-N(Ho)approximate to 130 K, there is a basal-plane ferromagnetic alignment of Tb moments w...

  4. Okiyo 147-154.pmd

    African Journals Online (AJOL)

    Prof. Adipala Ekwamu

    Moisture stress and aluminium toxicity in sorghum production can be overcome by breeding for tolerance. This study was set up to determine the response of sorghum (Sorghum bicolor L.) genotypes to post- anthesis drought and aluminium toxicity. Sorghum inbred P1 with stay green drought tolerance was crossed with P2, ...

  5. Clonal analysis of the T-cell response to in vivo expressed Mycobacterium tuberculosis protein Rv2034, using a CD154 expression based T-cell cloning method.

    Directory of Open Access Journals (Sweden)

    Susanna Commandeur

    Full Text Available Tuberculosis (TB, caused by Mycobacterium tuberculosis (Mtb, remains a leading cause of death worldwide. A better understanding of the role of CD4+ and CD8+ T cells, which are both important to TB protection, is essential to unravel the mechanisms of protection and to identify the key antigens seen by these T cells. We have recently identified a set of in vivo expressed Mtb genes (IVE-TB which is expressed during in vivo pulmonary infection in mice, and shown that their encoded antigens are potently recognized by polyclonal T cells from tuberculin skin test-positive, in vitro ESAT-6/CFP10-responsive individuals. Here we have cloned T cells specific for one of these newly identified in vivo expressed Mtb (IVE-TB antigens, Rv2034. T cells were enriched based on the expression of CD154 (CD40L, which represents a new method for selecting antigen-specific (low frequency T cells independent of their specific function. An Rv2034-specific CD4+ T-cell clone expressed the Th1 markers T-bet, IFN-γ, TNF-α, IL-2 and the cytotoxicity related markers granzyme B and CD107a as measured by flow cytometry. The clone specifically recognized Rv2034 protein, Rv2034 peptide p81-100 and Mtb lysate. Remarkably, while the recognition of the dominant p81-100 epitope was HLA-DR restricted, the T-cell clone also recognized a neighboring epitope (p88-107 in an HLA-DR- as well as HLA-DQ1-restricted fashion. Importantly, the T-cell clone was able to inhibit Mtb outgrowth from infected monocytes significantly. The characterization of the polyfunctional and Mtb inhibitory T-cell response to IVE-TB Rv2034 at the clonal level provides detailed further insights into the potential of IVE-TB antigens as new vaccine candidate antigens in TB. Our new approach allowed the identification of T-cell subsets that likely play a significant role in controlling Mtb infection, and can be applied to the analysis of T-cell responses in patient populations.

  6. La legge 154/2001 in tema di "Misure contro la violenza nelle relazioni familiari": cosa è cambiato nel nostro Paese dopo la sua entrata in vigore?

    Directory of Open Access Journals (Sweden)

    Susanna Vezzadini

    2007-09-01

    Full Text Available Domestic violence is a crime. All international and national studies on this subject have contributed to uncovering part of it, shedding light on a very serious and dramatic reality. For that reason, in April 2001, the Italian Parliament passed the law n. 154 concerning “Measures against domestic violence”, therefore affirming in by this act its will to respond to the problem. The law, which is considered an example of a “normative act against the blackmail of fear”, consists of a series of guide lines to prevent the offender from repeating the crime. In view of this, it is essential to find out today what has actually changed in Italy six years after its coming into force. La violence intrafamiliale est un délit. Les études réalisées à l'échelle internationale, tout comme les études nationales, ont ouvert une brèche sur cette réalité dont la gravité est déconcertante. Cependant le Parlement italien a approuvé en avril 2001, la loi relative aux "Mesures contre la violence dans la famille", affirmant ainsi sa volonté de répondre concrètement au problème de la violence domestique en Italie. Cette loi, présentée par les législateurs comme un example "d'acte normatif contre le chantage de la peur", contient une série de provisions destinées à empêcher à l'offenseur de réitérer son crime, introduisant des instruments procéduraux contre les abus intrafamiliaux. Face à de telles innovations, il est d'autant plus utile de continuer à se demander ce qui a changé en Italie, six ans après l'entrée en viguer de la loi.

  7. AGR-2 Data Qualification Report for ATR Cycles 151B-2, 152A, 152B, 153A, 153B and 154A

    Energy Technology Data Exchange (ETDEWEB)

    Binh T. Pham; Jeffrey J. Einerson

    2013-09-01

    This report documents the data qualification status of AGR-2 fuel irradiation experimental data from Advanced Test Reactor (ATR) Cycles 152A, 152B, 153A, 153B, and 154A, as recorded in the Nuclear Data Management and Analysis System (NDMAS). The AGR-2 data streams addressed include thermocouple (TC) temperatures, sweep gas data (flow rate, pressure, and moisture content), and fission product monitoring system (FPMS) data for each of the six capsules in the experiment. A total of 13,400,520 every minute instantaneous TC and sweep gas data records were received and processed by NDMAS for this period. Of these data, 8,911,791 records (66.5% of the total) were determined to be Qualified based on NDMAS accuracy testing and data validity assessment. For temperature, there were 4,266,081 records (74% of the total TC data) that were Failed due to TC instrument failures. For sweep gas flows, there were 222,648 gas flow records (2.91% of the flow data) that were Failed. The inlet gas flow failures due to gas flow cross-talk and leakage problems that occurred after Cycle 150A were corrected by using the same gas mixture in all six capsules and the Leadout. For FPMS data, NDMAS received and processed preliminary release rate and release-to-birth rate ratio (R/B) data for three reactor cycles (Cycles 149B, 150B, and 151A) . This data consists of 45,983 release rate records and 45,235 R/B records for the 12 radionuclides reported. The qualification status of these FPMS data has been set to In Process until receipt of Quality Assurance-approved data generator reports. All of the above data have been processed and tested using a SAS®-based enterprise application software system, stored in a secure Structured Query Language database, made available on the NDMAS Web portal (http://ndmas.inl.gov), and approved by the INL STIM for release to both internal and appropriate external Very High Temperature Reactor Program participants.

  8. Metabolism of 15-(4'-[[sup 123]I]iodophenyl)pentadecanoic acid ([[sup 123]I]IPPA) in the rat heart; identification of new metabolites by high pressure liquid chromatography and fast atom bombardment-mass spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Eisenhut, Michael; Suetterle, Andreas (Heidelberg Univ. (Germany). Abt. fuer Klinische Nuklearmedizin); Lehmann, W.D. (Deutsches Krebsforschungszentrum, Heidelberg (Germany))

    1993-08-01

    The metabolism of 15-(4'-iodophenyl)pentadecanoic acid (IPPA) in the heart muscle is commonly believed to end at 4-iodobenzoic acid as the main and final product of [beta]-oxidation. However, investigation of the metabolic fate of IPPA in Langendorff rat hearts using high pressure liquid chromatography (HPLC) and negative fast atom bombardment mass spectrometry (FAB-MS) revealed new results. This metabolic behaviour may be of importance for the interpretation of sequential heart scintigraphy performed with [[sup 123]I]IPPA. (author).

  9. Substitution of arginine for glycine at position 154 of the {alpha}1 chain of type I collagen in a variant of osteogenesis imperfecta: Comparison to previous cases with the same mutation

    Energy Technology Data Exchange (ETDEWEB)

    Zhuang, J.; Tromp, G.; Kuivaniemi, H.; Prockop, D.J. [Thomas Jefferson Univ., Philadelphia, PA (United States); Castells, S. [Univ. Hospital of Brooklyn, NY (United States)

    1996-01-11

    A substitution of arginine for glycine at amino acid position 154 of the {alpha}1(I) collagen chain was found in a father and his three children. The phenotype of the patients includes manifestations of types I and III/IV osteogenesis imperfecta, but appears to be milder than that of the previously described two unrelated patients that had the identical mutation in the {alpha}1(I) collagen chain. The variability in the phenotype raises the possibility of epistatic loci or environmental effects on expression of the disorder. 35 refs., 3 figs., 2 tabs.

  10. 46 CFR 154.625 - Design temperature below 0 °C (32 °F) and down to −165 °C (−265 °F).

    Science.gov (United States)

    2010-10-01

    ... LIQUEFIED GASES Design, Construction and Equipment Materials § 154.625 Design temperature below 0 °C (32 °F... 46 Shipping 5 2010-10-01 2010-10-01 false Design temperature below 0 °C (32 °F) and down to â165... process piping for a design temperature below 0 °C (32 °F) and down to −165 °C (−265 °F) must meet § 56.50...

  11. 46 CFR 154.620 - Design temperature below −55 °C (−67 °F) and down to −165 °C (−265 °F).

    Science.gov (United States)

    2010-10-01

    ... LIQUEFIED GASES Design, Construction and Equipment Materials § 154.620 Design temperature below −55 °C (−67... 46 Shipping 5 2010-10-01 2010-10-01 false Design temperature below â55 °C (â67 °F) and down to... design temperature below −55 °C (−67 °F) and down to −165 °C (−265 °F) must: (a) Meet § 54.25-10(b)(2...

  12. The measurement of g{sub 1}{sup n} polarized structure of the neutron by the E154 experiment at SLAC; Mesure de la fonction de structure polarisee g{sub 1}{sup n} du neutron par l`experience E154 au SLAC

    Energy Technology Data Exchange (ETDEWEB)

    Incerti, Sebastien [Ecole Doctorale des Sciences Fondamentales, Universite Blaise Pascal, U.F.R. de Recherche Scientifique et Technique, F-63177 Aubiere (France)

    1998-01-21

    This thesis presents the precision measurement of the neutron polarized structure g{sub 1}{sup n} performed by the E154 collaboration at the Standford Linear Accelerator Center, USA, in autumn 1995, using a 48.3 GeV polarized electron beam scattered off a polarized Helium 3 target. The scattered electrons were detected using two spectrometer arms, covering the deep inelastic scattering range: 0.0134 < x < 0.7 and 1 GeV{sup 2} < Q{sup 2} < 17 GeV{sup 2} at an average value of Q{sup 2} = 5 GeV{sup 2}. Two electromagnetic calorimeters have been designed by the LPC in Clermont-Ferrand and the SphN-CEA in Saclay to measure the scattered electron energy and to eject the contaminating hadron background using, a cellular automaton and a neural network, widely described in this thesis. The analysis performed in Clermont-Ferrand and presented in this document led us to the integral on the measurement region of g{sub 1}{sup n} equaling: - 0.34 {+-} 0.003{sub STAT} {+-} 0.004{sub SYST} {+-} 0.001{sub EVOL} at Q{sup 2} = 5 GeV{sup 2}, where our data have been evolved to Q{sup 2} = 5 GeV{sup 2} using the next-to-leading order DGLAP evolution equations and a world parametrization of the polarized parton distributions. The Ellis and Jaffe sum rule is clearly violated. Using different low x extrapolations, our integral is compatible with the Bjorken sum rule. The quark contribution to the nucleon spin is {Delta}{Sigma} = 29 {+-} 6 % in the M S-bar scheme and {Delta}{Sigma} = 37 {+-} 7% in the AB scheme, at Q{sup 2} = 5 GeV{sup 2}. The gluon contribution seems to be positive and within the range: 0 < {Delta}G < 2. (author) 245 refs., 170 figs., 60 tabs.

  13. Comparison of optimised germanium gamma spectrometry and multicollector inductively coupled plasma mass spectrometry for the determination of {sup 134}Cs, {sup 137}Cs and {sup 154}Eu single ratios in highly burnt UO{sub 2}

    Energy Technology Data Exchange (ETDEWEB)

    Caruso, S. [Laboratory for Reactor Physics and Systems Behaviour, Paul Scherrer Institute, CH-5232 Villigen PSI (Switzerland); Ecole Polytechnique Federale de Lausanne (EPFL), CH-1015 Lausanne (Switzerland)], E-mail: stefano.caruso@nok.ch; Guenther-Leopold, I. [Laboratory for Materials Behaviour, Paul Scherrer Institute, CH-5232 Villigen PSI (Switzerland); Murphy, M.F.; Jatuff, F. [Laboratory for Reactor Physics and Systems Behaviour, Paul Scherrer Institute, CH-5232 Villigen PSI (Switzerland); Chawla, R. [Laboratory for Reactor Physics and Systems Behaviour, Paul Scherrer Institute, CH-5232 Villigen PSI (Switzerland); Ecole Polytechnique Federale de Lausanne (EPFL), CH-1015 Lausanne (Switzerland)

    2008-05-15

    Non-destructive and destructive methods have been compared to validate their corresponding assessed accuracies in the measurement of {sup 134}Cs/{sup 137}Cs and {sup 154}Eu/{sup 137}Cs isotopic concentration ratios in four spent UO{sub 2} fuel samples with very high (52 and 71 GWd/t) and ultra-high (91 and 126 GWd/t) burnup values, and about 10 (in the first three samples) and 4 years (in the latter sample) cooling time. The non-destructive technique tested was high-resolution gamma spectrometry using a high-purity germanium detector (HPGe) and a special tomographic station for the handling of highly radioactive 400 mm spent fuel segments that included a tungsten collimator, lead filter (to enhance the signal to Compton background ratio and reduce the dead time) and paraffin wax (to reduce neutron damage). The non-destructive determination of these isotopic concentration ratios has been particularly challenging for these segments because of the need to properly derive non-Gaussian gamma-peak areas and subtract the background from perturbing capture gammas produced by the intrinsic high-intensity neutron emissions from the spent fuel. Additionally, the activity distribution within each pin was determined tomographically to correct appropriately for self-attenuation and geometrical effects. The ratios obtained non-destructively showed a 1{sigma} statistical error in the range 1.9-2.9%. The destructive technique used was a high-performance liquid chromatographic separation system, combined online to a multicollector inductively coupled plasma mass spectrometer (HPLC-MC-ICP-MS), for the analysis of dissolved fuel solutions. During the mass spectrometric analyses, special care was taken in the optimisation of the chromatographic separation for Eu and the interfering element Gd, as also in the mathematical correction of the {sup 154}Gd background from the {sup 154}Eu signal. The ratios obtained destructively are considerably more precise (1{sigma} statistical error in

  14. Search for scalar diphoton resonances with 15.4~fb$^{-1}$ of data collected at $\\sqrt{s}$=13 TeV in 2015 and 2016 with the ATLAS detector

    CERN Document Server

    The ATLAS collaboration

    2016-01-01

    A search for new spin-0 resonances decaying into two photons in the ATLAS experiment at the LHC is described. The analysis is based on $pp$ collision data corresponding to an integrated luminosity of 15.4 fb$^{-1}$ at $\\sqrt{s}$=13~\\TeV\\ recorded in 2015 and 2016. A deviation from the Standard Model background-only hypothesis corresponding to 3.4 standard deviations is observed in the 2015 data for a resonance mass hypothesis of 730~GeV. No significant excess at such mass over the background expectation is observed in the 2016 data. The global significance is estimated to be less than one standard deviation. Limits on the production cross section times branching ratio to two photons of such resonances are reported.

  15. Anti-CD25 mAb, anti-IL2 mAb, and IL2 block tolerance induction through anti-CD154 mAb and rapamycin in xenogeneic islet transplantation.

    Science.gov (United States)

    Pan, H; Lu, H M; Hu, W-M; Tian, B-L; Liu, X-B; Zhang, Z-D; Mai, G

    2007-12-01

    We have used anti-CD154 monoclonal antibody (mAb; MR1) and rapamycin (rapa) to induce tolerance to islet xenografts. The aim of this study was to investigate whether classical anergy and/or regulation by interleukin (IL)2-dependent CD25+ T regulatory cells played roles in the induction and maintenance of tolerance in this model. Streptozotocin-induced diabetic mice were transplanted with rat islets. We performed the following groups: control group, islet transplantation without therapy; rapamycin group, 0.2 mg/kg by oral gavage on days 0, 1, 2, and every other day to day 14; anti-CD154 mAb (MR1) group, 0.5 mg intraperitoneally on days 0, 2, and 4; combination therapy group with rapa and MR1. We then administered in addition to the combination therapy with early (from days 0 to 14 [for IL2] or to 28 [for anti-IL2 mAb and anti-CD25 mAb] post-transplantation) or late (from days 100 to 114 [for IL2] or to 128 [for anti-IL2 mAb and anti-CD25 mAb] posttransplantation) recombinant IL2 (2000 U, intraperitoneally twice a day), a neutralizing anti-IL2 mAb (S4B6-1, 0.3 mg intraperitoneally twice weekly), and a depleting anti-CD25 mAb (PC61, 0.3 mg intraperitoneally twice weekly), respectively. Histology was performed at time of rejection. Rapa and MR1 therapy alone significantly prolonged xenograft survival compared to the control group: median graft survival was 34 days versus 17 days (P200 days, PIL2 was administered early with MR1 and rapa, rapid rejection developed in 18 of 18 mice (MGS 7 days), whereas when IL2 was given late, only 3 of 10 developed rejection. Early administration of anti-IL2 mAb led to rejection in 10 of 10 mice (MGS 42 days), whereas late administration led to rejection in only one of four mice. Early administration of anti-CD25 mAb led to rejection in eight of nine mice (MGS 49 days), whereas late administration led to rejection in only three of seven mice. Rapa and MR1 allowed indefinite graft survival of islet xenografts. Classical anergy and

  16. IL-2-Mediated In Vivo Expansion of Regulatory T Cells Combined with CD154–CD40 Co-Stimulation Blockade but Not CTLA-4 Ig Prolongs Allograft Survival in Naive and Sensitized Mice

    Directory of Open Access Journals (Sweden)

    Dela Golshayan

    2017-04-01

    Full Text Available In recent years, regulatory T cells (Treg-based immunotherapy has emerged as a promising strategy to promote operational tolerance after solid organ transplantation (SOT. However, a main hurdle for the therapeutic use of Treg in transplantation is their low frequency, particularly in non-lymphopenic hosts. We aimed to expand Treg directly in vivo and determine their efficacy in promoting donor-specific tolerance, using a stringent experimental model. Administration of the IL-2/JES6-1 immune complex at the time of transplantation resulted in significant expansion of donor-specific Treg, which suppressed alloreactive T cells. IL-2-mediated Treg expansion in combination with short-term CD154–CD40 co-stimulation blockade, but not CTLA-4 Ig or rapamycin, led to tolerance to MHC-mismatched skin grafts in non-lymphopenic mice, mainly by hindering alloreactive CD8+ effector T cells and the production of alloantibodies. Importantly, this treatment also allowed prolonged survival of allografts in the presence of either donor-specific or cross-reactive memory cells. However, late rejection occurred in sensitized hosts, partly mediated by activated B cells. Overall, these data illustrate the potential but also some important limitations of Treg-based therapy in clinical SOT as well as the importance of concomitant immunomodulatory strategies in particular in sensitized hosts.

  17. The relation of a family history of alcoholism, obstetric complications and family environment to behavioral problems among 154 adolescents in Germany: results from the children of alcoholics study in Pomerania.

    Science.gov (United States)

    Barnow, Sven; Lucht, Michael; Hamm, Alfons; John, Ulrich; Freyberger, Harald-J

    2004-01-01

    Behavioral problems in adolescence have been shown to be associated with the presence of a positive family history of alcoholism (FH+), obstetric complications (OCs), and negative parenting practices. This study tested the relation of these factors to aggression/delinquency and attention problems in an untreated population sample of 154 adolescents in Pomerania. Furthermore, we evaluated the predictive strength of a FH+, OCs and negative parenting styles in a prospective subsample of 127 adolescents using a hierarchical regression analysis. Group comparisons between offspring with higher vs. lower values on aggression/delinquency revealed that only rejection by the parents was significantly more often reported by teenagers with higher measures on these behavioral problems. Offspring with higher values on attention problems had more OCs reported by the mother and also had more feelings of parental rejection compared to controls. The results of the hierarchical regression analysis showed that parental rejection was the only significant predictor for both aggression/delinquency, and attention problems measured 1 year after the initial assessment. We conclude that parental rejection is a major risk factor for both aggression/delinquency and attention problems. Reflecting the fact that these behavioral problems have been reported to be strongly associated with later substance misuse, the improvement of parenting practices should be considered in prevention and intervention programs. Copyright 2004 S. Karger AG, Basel

  18. Signature inversion in πh{sub 11/2} x νi{sub 13/2} band of {sup 152}Eu and {sup 154,156}Tb

    Energy Technology Data Exchange (ETDEWEB)

    Kumar, Sushil [Akal University, Department of Physics, Talwandi Sabo (India); Maharishi Markandeshwar University, Department of Physics, Mullana (India); Singh, Sukhjeet [Akal University, Department of Physics, Talwandi Sabo (India); Sharma, Vandana; Sharma, J.K. [Maharishi Markandeshwar University, Department of Physics, Mullana (India)

    2017-04-15

    The phenomenon of signature inversion observed in the πh{sub 11/2} x νi{sub 13/2} band of {sup 152}Eu and {sup 156}Tb nuclides is revisited through the axially symmetric two quasiparticle plus rotor model approach. The magnitude of experimentally observed signature splitting and point of signature inversion, which could not be explicitly reproduced in the earlier calculations, is successfully reproduced in the present study. Some of the critical issues, such as violation of the well-established Gallagher Moszkowski (GM) rule for eight GM doublets appearing in the basis space of earlier calculations of {sup 152}Eu and {sup 156}Tb, are fixed and also the ambiguity regarding spin assignment to this band observed in {sup 156}Tb is resolved. These calculations are further extended to the same band (πh{sub 11/2} x νi{sub 13/2}) observed in {sup 154}Tb nuclide and signature inversion observed in this band is successfully reproduced. (orig.)

  19. TL1A increases expression of CD25, LFA-1, CD134 and CD154, and induces IL-22 and GM-CSF production from effector CD4 T-cells.

    Directory of Open Access Journals (Sweden)

    Kirsten Reichwald

    Full Text Available Elevated levels of the cytokine TL1A is associated with several autoimmune diseases e.g. rheumatoid arthritis and inflammatory bowel disease. However, the exact role of TL1A remains elusive. In this study, we investigated the function of TL1A in a pro-inflammatory setting. We show that TL1A together with IL-12, IL-15 and IL-18 increases expression of the co-stimulatory molecules CD154 (CD40 ligand and CD134 (OX40 on previously activated CD4+ T cells. This indicates that TL1A functions as a co-stimulatory molecule, decreasing the activation threshold of T-cells. We have previously shown that TL1A co-stimulation strongly induces IL-6 in human healthy leukocytes. Interestingly, the cytokine-activated effector T-cells did not produce IL-6 in response to TL1A, indicating distinct effects of TL1A on different cell populations. We further show that this co-stimulation increases the expression of CD25 (IL-2Rα and CD11a (α-chain of LFA-1 on CD4 T-cells, likely governing increased IL-2/IL-15 sensitivity and cell-cell contact. Along with this, TL1A co-stimulation caused a specific induction of IL-22 and GM-CSF from the activated T-cells. These results substantially contribute to the explanation of TL1A's role in inflammation. Our results suggest that TL1A should be considered as a target for immunotherapeutic treatment of rheumatoid arthritis and inflammatory bowel disease.

  20. The FUT2 secretor variant p.Trp154Ter influences serum vitamin B12 concentration via holo-haptocorrin, but not holo-transcobalamin, and is associated with haptocorrin glycosylation.

    Science.gov (United States)

    Velkova, Aneliya; Diaz, Jennifer E L; Pangilinan, Faith; Molloy, Anne M; Mills, James L; Shane, Barry; Sanchez, Erica; Cunningham, Conal; McNulty, Helene; Cropp, Cheryl D; Bailey-Wilson, Joan E; Wilson, Alexander F; Brody, Lawrence C

    2017-12-15

    Vitamin B12 deficiency is common in older individuals. Circulating vitamin B12 concentration can be used to diagnose deficiency, but this test has substantial false positive and false negative rates. We conducted genome-wide association studies (GWAS) in which we resolved total serum vitamin B12 into the fractions bound to transcobalamin and haptocorrin: two carrier proteins with very different biological properties. We replicated reported associations between total circulating vitamin B12 concentrations and a common null variant in FUT2. This allele determines the secretor phenotype in which blood group antigens are found in non-blood body fluids. Vitamin B12 bound to haptocorrin (holoHC) remained highly associated with FUT2 rs601338 (p.Trp154Ter). Transcobalamin bound vitamin B12 (holoTC) was not influenced by this variant. HoloTC is the bioactive the form of the vitamin and is taken up by all tissues. In contrast, holoHC is only taken up by the liver. Using holoHC from individuals with known FUT2 genotypes, we demonstrated that FUT2 rs601338 genotype influences the glycosylation of haptocorrin. We then developed an experimental model demonstrating that holoHC is transported into cultured hepatic cells (HepG2) via the asialoglycoprotein receptor (ASGR). Our data challenge current published hypotheses on the influence of genetic variation on this clinically important measure and are consistent with a model in which FUT2 rs601338 influences holoHC by altering haptocorrin glycosylation, whereas B12 bound to non-glycosylated transcobalamin (i.e. holoTC) is not affected. Our findings explain some of the observed disparity between use of total B12 or holoTC as first-line clinical tests of vitamin B12 status. Published by Oxford University Press 2017. This work is written by US Government employees and is in the public domain in the US.

  1. 46 CFR 154.431 - Model test.

    Science.gov (United States)

    2010-10-01

    ...(c). (b) Analyzed data of a model test for the primary and secondary barrier of the membrane tank... Model test. (a) The primary and secondary barrier of a membrane tank, including the corners and joints...

  2. BDML Metadata: 154 [SSBD[Archive

    Lifescience Database Archive (English)

    Full Text Available Ce_KK_P002 BDML file for quantitative information about nuclear division dynamics o...f R08D7.1(RNAi) embryo quantitative information about nuclear division dynamics in R08D7.1(RNAi) embryo C. e

  3. 32 CFR 154.48 - Issuing clearance.

    Science.gov (United States)

    2010-07-01

    ... provided there has been no additional investigation or development of derogatory information. (c) Personnel... Chiefs of Staff, initiates an SBI (or PR) for access to SCI on a military member, DIS will return the...

  4. Reference: 154 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available n Arabidopsis provides an elegant paradigm for cell patterning during development. Here, we describe a new gene, SCRAMBLED (SCM), re...quired for cells to appropriately interpret their locatio...n within the developing root epidermis. SCM encodes a receptor-like kinase protein with a predicted extracel...lular domain of six leucine-rich repeats and an intracellular serine-threonine kinase domain. SCM regulates the expre...iption factor genes that define the cell fates. Further, the SCM gene is expressed throughout the developing root. Therefore

  5. 33 CFR 154.1020 - Definitions.

    Science.gov (United States)

    2010-07-01

    ... visibility, and currents within the COTP zone in which the systems or equipment are intended to function. Animal fat means a non-petroleum oil, fat, or grease derived from animals, and not specifically... chapter extending seaward to 50 nautical miles. Oil means oil of any kind or in any form, including, but...

  6. 46 CFR 154.1830 - Warning sign.

    Science.gov (United States)

    2010-10-01

    ... (2) Facing outboard towards the water so that the sign may be seen from the water. (b) Except as provided in paragraph (e) of this section, each warning sign must have the following words: (1) Warning. (2) Dangerous Cargo. (3) No Visitors. (4) No Smoking. (5) No Open Lights. (c) Each letter in the words on the...

  7. 154 THE NEUROTIC CHRISTIAN: IMPLICATIONS FOR CHRISTIAN ...

    African Journals Online (AJOL)

    Introduction. Neurosis was the term first used to classify psychological disorders in which anxiety is the ... neuroses, though obsolete psychodynamic term, is used to describe psychological disorder thought to result from ... Church amongst other things focuses on the individual: his salvation, his happiness, his wellbeing and ...

  8. 45 CFR 400.154 - Employability services.

    Science.gov (United States)

    2010-10-01

    ...-sufficiency plan and an individual employability plan, world-of-work and job orientation, job clubs, job... emphasis on English as it relates to obtaining and retaining a job. (e) Vocational training, including...

  9. 33 CFR 154.735 - Safety requirements.

    Science.gov (United States)

    2010-07-01

    ..., scale, and sediment does not apply if personnel use breathing apparatus which protect them from the tank... that access to the marine transfer area is limited to— (1) Personnel who work at the facility including...

  10. 32 CFR 154.31 - Authorized requesters.

    Science.gov (United States)

    2010-07-01

    ... National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE SECURITY DEPARTMENT OF DEFENSE.... (b) Defense Agencies—Directors of Security and activity commanders. (c) Organization of the Joint Chiefs of Staff—Chief, Security Division. (d) Office of the Secretary of Defense—Director for Personnel...

  11. 7 CFR 932.154 - Handler transfer.

    Science.gov (United States)

    2010-01-01

    ... Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements... to destinations outside the area except fresh market outlets. For natural condition and processed... a destination outside the area, except fresh market outlets, two copies of said form shall be...

  12. 154-IJBCS-Article-Dr Koanga Mogtomo

    African Journals Online (AJOL)

    RHUMSIKI

    1990.Adenovirus types 40 and 41 and rotaviruses associated with diarrhea in children from Guatemala. J. Clin. Microbiol., 28: 1780–1784. De Jong JC, Bijlsma K, Wermenbol AG,. Verweij-Uijterwaal MW, Vander Avoort. HG, Wood DJ, Bailey AS, Osterhaus. AD.1993. Detection, typing and sub- typing of enteric adenoviruses ...

  13. Publications | Page 154 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    The aim of this paper is to contribute to the empirical literature that evaluates the effects of public financial support on total innovation expenditure, innovation and productivity. We apply propensity score matching techniques to analyze the impact of public financial support to innovation in... Mitigating food losses in Benin ...

  14. Publications | Page 154 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Significance of social networks in sustainable land management in Central Ethiopia and Eastern Uganda (open access). Fostering collective action is necessary for scaling sustainable land management (SLM) innovations. This paper analyses the significance of social networks in SLM among agricultural rural communities ...

  15. Publications | Page 154 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    (open access). This final report is concerned with the role played by the CINBIOSE node in the Community of Practice in Ecosystem Approaches to Human Health: Latin America and the Caribbean and should be seen as a complement of the final report of this Community. This role primarily involved (i) support to.

  16. 32 CFR 154.16 - Security clearance.

    Science.gov (United States)

    2010-07-01

    ... U.S. Senate and House of Representatives do not require personnel security clearances. They may be... part. The Director, Washington Headquarters Services (WHS) will initiate the required investigation...

  17. 32 CFR 154.3 - Definitions.

    Science.gov (United States)

    2010-07-01

    ... employment, suspension from employment of more than 14 days, reduction in grade, reduction in pay, or... information. Information that, by itself, is not of sufficient importance or magnitude to justify an...

  18. 46 CFR 154.345 - Air locks.

    Science.gov (United States)

    2010-10-01

    ... mechanically ventilated to make the pressure in the space greater than that in the air lock; and (2) Has a... when the pressure in the space falls to or below the pressure in the air lock. ... a gas-safe space. (b) Each air lock must: (1) Consist of two steel doors, at least 1.5 m (4.9 ft...

  19. 33 CFR 154.1055 - Exercises.

    Science.gov (United States)

    2010-07-01

    ...). (2) Spill management team tabletop exercises (annually). In a 3-year period, at least one of these... facility response plan exercise requirements. These guidelines are available from the TASC DEPT Warehouse...

  20. Environmental Radiation Data (ERD) Journal Report 154

    Science.gov (United States)

    RadNet environmental radiation monitoring data report for the period of April - June 2013. The report includes results for air, drinking water, precipitation samples collected as part of EPA's RadNet monitoring program.

  1. 154-IJBCS-Article-Dr Koanga Mogtomo

    African Journals Online (AJOL)

    RHUMSIKI

    Adenovirus is recognized as the most common cause of severe gastroenteritis in children less than 5 years of age. Due to the lack of recent reports about the surveillance of enteric adenovirus (EAd) infection in. Cameroon, in this study we assessed the prevalence rate of HAV infection on 65 stool samples belonging to 65.

  2. 32 CFR 154.13 - Sensitive positions.

    Science.gov (United States)

    2010-07-01

    ... maintenance of intrusion detection systems deployed to safeguard DoD personnel and property. (F) Any other... report required in subpart K. (e) Billet control system for Top Secret. (1) To standardize and control...

  3. 32 CFR 154.19 - Reinvestigation.

    Science.gov (United States)

    2010-07-01

    ...) Allegations related to disqualification. Whenever questionable behavior patterns develop, derogatory... Inquiry (SII), psychiatric, drug or alcohol evaluation, as appropriate, may be requested to resolve all... duties. In extremely limited instances, extraordinary national security implications associated with...

  4. Fungal Planet description sheets: 154–213

    NARCIS (Netherlands)

    Crous, P.W.; Wingfield, M.J.; Guarro, J.; Cheewangkoon, R.; Bank, van der M.; Swart, W.J.; Stchigel, A.M.; Cano-Lira, J.F.; Roux, J.; Madrid, H.; Damm, U.; Wood, A.R.; Shuttleworth, L.A.; Hodges, C.S.; Munster, M.; Jesús Yáñez-Morales, de M.; Zúñiga-Estrada, L.; Cruywagen, E.M.; Hoog, de G.S.; Silvera, C.; Najafzadeh, J.; Davison, E.M.; Davison, P.J.N.; Barrett, M.D.; Barrett, R.L.; Manamgoda, D.S.; Minnis, A.M.; Kleczewski, N.M.; Flory, S.L.; Castlebury, L.A.; Clay, K.; Hyde, K.D.; Maússe-Sitoe, S.N.D.; Chen, S.; Lechat, C.; Hairaud, M.; Lesage-Meessen, L.; Pawlowska, J.; Wilk, M.; Sliwinska-Wyrzychowska, A.; Metrak, M.; Wrzosek, M.; Pavlic-Zupanc, D.; Maleme, H.M.; Slippers, B.; Mac Cormack, W.P.; Archuby, D.I.; Grünwald, N.J.; Tellería, M.T.; Dueñas, M.; Martín, M.P.; Marincowitz, S.; Beer, de Z.W.; Perez, C.A.; Gené, J.; Marin-Felix, Y.; Groenewald, J.Z.

    2013-01-01

    Novel species of microfungi described in the present study include the following from South Africa: Camarosporium aloes, Phaeococcomyces aloes and Phoma aloes from Aloe, C. psoraleae, Diaporthe psoraleae and D. psoraleae-pinnatae from Psoralea, Colletotrichum euphorbiae from Euphorbia, Coniothyrium

  5. Photoluminescence studies of a Terbium(III) complex as a fluorescent probe for DNA detection

    Energy Technology Data Exchange (ETDEWEB)

    Khorasani-Motlagh, Mozhgan, E-mail: mkhorasani@chem.usb.ac.ir; Noroozifar, Meissam; Niroomand, Sona; Moodi, Asieh

    2013-11-15

    The photoluminescence properties of a Tb(III) complex of the form [Tb(phen){sub 2}Cl{sub 3}·OH{sub 2}] (phen=1,10-phenanthroline) in different solvents are presented. It shows the characteristic luminescence of the corresponding Ln{sup 3+} ion in the visible region. The emission intensity of this complex in coordinating solvent is higher than non-coordinating one. The suggested mechanism for the energy transfer between the ligand and Tb{sup 3+} ion is the intramolecular energy transfer mechanism. The interactions of the Tb(III) complex with fish salmon DNA are studied by fluorescence spectroscopy, circular dichroism study and viscosity measurements. The results of fluorescence titration reveal that DNA strongly quenches the intrinsic fluorescence of the complex through a static quenching procedure. The binding constant (K{sub b}) of the above metal complex at 25 °C is determined by the fluorescence titration method and it is found to be (8.06±0.01)×10{sup 3} M{sup −1}. The thermodynamic parameters (ΔH{sup 0}>0, ΔS{sup 0}>0 and ΔG{sup 0}<0) indicate that the hydrophobic interactions play a major role in DNA–Tb complex association. The results support the claim that the title complex bonds to FS-DNA by a groove mode. -- Highlights: • Photoluminescence of [Tb(phen){sub 2}Cl{sub 3}·OH{sub 2}] in different solvents are studied. • Tb(III) complex shows good binding affinity to FS DNA with K{sub b}=(8.06±0.01)×10{sup 3} M{sup −1}. • Viscosity of DNA almost unchanged by increasing amount of Tb complex. • CD spectrum of DNA has a little change with increasing amount of Tb complex. • Thermodynamic parameters indicate that the binding reaction is entropically driven.

  6. Lanthanides in Nuclear Medicine. The Production of Terbium-149 by Heavy Ion Beams

    CERN Document Server

    Dmitriev, S N; Zaitseva, N G; Maslov, O D; Molokanova, L G; Starodub, G Ya; Shishkin, S V; Shishkina, T V

    2001-01-01

    Among radioactive isotopes of lanthanide series elements, finding the increasing using in nuclear medicine, alpha-emitter {149}Tb (T_{1/2} = 4.118 h; EC 76.2 %; beta^+ 7.1 %; alpha 16.7 %) is considered as a perspective radionuclide for radioimmunotherapy. The aim of the present work is to study experimental conditions of the {149}Tb production in reactions Nd({12}C, xn){149}Dy (4.23 min; beta^+, EC)\\to {149}Tb when the Nd targets have been irradiated by heavy ions of carbon. On the basis of results of formation and decay of {149}Dy\\to{149}Tb evaluation of the {149}Tb activity, is made which can be received under optimum conditions (enriched {142}Nd target, {12}C ions with the energy 120 MeV and up to current 100 mu A, time of irradiating 8-10 hours). Under these conditions {149}Tb can be obtained up to 30 GBq (up to 0.8 Ci).

  7. Poly[[aqua-?3-picolinato-?2-picolinato-dipicolinatopotassium(I)terbium(III)] 2.5-hydrate

    OpenAIRE

    Filipe A. Almeida Paz; João Rocha; Jacek Klinowski; Tito Trindade; Nogueira,Helena I. S.; Soares-Santos, Paula C. R.; Cunha-Silva, Lu?s

    2008-01-01

    In the title compound, [KTb(C6H4NO2)4(H2O)]·2.5H2O, each Tb3+ centre is coordinated by four N and five O atoms from five distinct picolinate ligands in a geometry resembling a highly distorted tricapped trigonal prism. One of the ligands establishes a skew bridge between neighbouring Tb3+ centres, leading to the formation of one-dimensional anionic polymeric chains, {[(C6H4NO2)4Tb]−}n, running along the direction [010]. Each K+ cation is seven-coordinated by six O atoms from one an...

  8. Spin waves in terbium. III. Magnetic anisotropy at zero wave vector

    DEFF Research Database (Denmark)

    Houmann, Jens Christian Gylden; Jensen, J.; Touborg, P.

    1975-01-01

    The energy gap at zero wave vector in the spin-wave dispersion relation of ferromagnetic. Tb has been studied by inelastic neutron scattering. The energy was measured as a function of temperature and applied magnetic field, and the dynamic anisotropy parameters were deduced from the results....... The axial anisotropy is found to depend sensitively on the orientation of the magnetic moments in the basal plane. This behavior is shown to be a convincing indication of considerable two-ion contributions to the magnetic anisotropy at zero wave vector. With the exception of the sixfold basal...... the effects of zero-point deviations from the fully aligned ground state, and we tentatively propose polarization-dependent two-ion couplings as their origin....

  9. Structural and Magnetic Anisotropy in Amorphous Terbium-Iron Thin Films

    Science.gov (United States)

    Hufnagel, Todd Clayton

    1995-01-01

    High density, removable media magnetooptic disk drives have recently begun to make significant gains in the information mass storage market. The media in these disks are amorphous rare-earth/transition-metal (RE-TM) alloys. One vital property of these materials is a large perpendicular magnetic anisotropy; that is, an easy axis of magnetization which is perpendicular to the plane of the film. A variety of theories, sometimes contradictory, have been proposed to account for this surprising presence of an anisotropic property in an amorphous material. Recent research indicates that there is an underlying atomic-scale structural anisotropy which is responsible for the observed magnetic anisotropy. Several different types of structural anisotropy have been proposed to account for the observed magnetic anisotropy, including pair-ordering anisotropy (anisotropic chemical short-range order) and bond orientation anisotropy (an anisotropy in coordination number or distances independent of chemical ordering). We have studied the structural origins of perpendicular magnetic anisotropy in amorphous Tb-Fe thin films by employing high-energy and anomalous dispersion x-ray scattering. The as-deposited films show a clear structural anisotropy, with a preference for Tb-Fe near neighbors to align in the out-of-plane direction. These films also have a large perpendicular magnetic anisotropy. Upon annealing, the magnetic anisotropy energy drops significantly, and we see a corresponding reduction in the structural anisotropy. The radial distribution functions indicate that the number of Tb-Fe near-neighbors increases in the in-plane direction, but does not change in the out-of-plane direction. Therefore, the distribution of Tb-Fe near-neighbors becomes more uniform upon annealing. We propose that the observed reduction in perpendicular magnetic anisotropy energy is a result of this change in structure. Our results support the pair -ordering anisotropy model of the structural anisotropy in amorphous Tb-Fe thin films. We see no evidence to support the bond orientation anisotropy model.

  10. Luminescence properties of terbium-doped Li3PO4 phosphor for ...

    Indian Academy of Sciences (India)

    Antonov-Romanovskii et al [2] firstly suggested applications of OSL for personal dosime- try. This technique got momentum for personnel dosime- try after the development of α-Al2O3:C. OSL properties of α-Al2O3:C have been investigated for personnel dosimetry, environmental dosimetry, medical dosimetry and space.

  11. Luminescence properties of terbium-doped Li3PO4 phosphor for ...

    Indian Academy of Sciences (India)

    The powder X-ray diffraction (PXRD), photoluminescence (PL) emission and excitation spectra, thermoluminescence (TL) and optically stimulated luminescence (OSL) were measured. The particle size was calculated using the Debye Scherrer formula and found to be 79.42 nm. PL emission spectra of Li 3 PO 4 :Tb 3 + ...

  12. Charge-transfer-based terbium MOF nanoparticles as fluorescent pH sensor for extreme acidity.

    Science.gov (United States)

    Qi, Zewan; Chen, Yang

    2017-01-15

    Newly emerged metal organic frameworks (MOFs) have aroused the great interest in designing functional materials by means of its flexible structure and component. In this study, we used lanthanide Tb 3+ ions and small molecular ligands to design and assemble a kind of pH-sensitive MOF nanoparticle based on intramolecular-charge-transfer effect. This kind of made-to-order MOF nanoparticle for H + is highly specific and sensitive and could be used to fluorescently indicate pH value of strong acidic solution via preset mechanism through luminescence of Tb 3+ . The long luminescence lifetime of Tb 3+ allows eliminating concomitant non-specific fluorescence by time-revised fluorescence techniques, processing an advantage in sensing H + in biological media with strong autofluorescence. Our method showed a great potential of MOF structures in designing and constructing sensitive sensing materials for specific analytes directly via the assembly of functional ions/ligands. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Assessment of terbium (III) as a luminescent probe for the detection of tuberculosis biomarkers

    Energy Technology Data Exchange (ETDEWEB)

    Bamogo, W. [CNRS, IRAMIS, UMR 3685 NIMBE/LEDNA, F-91191 Gif-sur-Yvette (France); Mugherli, L. [CEA, IRAMIS, UMR 3685 NIMBE/LEDNA, F-91191 Gif-sur-Yvette (France); Banyasz, A. [CNRS, IRAMIS, LIDyL/Laboratoire Francis Perrin, URA 2453, F-91191 Gif-sur-Yvette (France); Novelli-Rousseau, A.; Mallard, F. [BioMérieux SA, F-38000 Grenoble (France); Tran-Thi, T.-H., E-mail: thu-hoa.tran-thi@cea.fr [CNRS, IRAMIS, UMR 3685 NIMBE/LEDNA, F-91191 Gif-sur-Yvette (France)

    2015-10-08

    A detection method for nicotinic acid, a specific metabolite marker of Mycobacterium tuberculosis present in cultures and patients' breath, is studied in complex solutions containing other metabolites and in biological media such as urine, saliva and breath condensate. The method is based on the analysis of the luminescence increase of Tb{sup 3+} complexes in the presence of nicotinic acid due to the energy transfer from the excited ligand to the lanthanide ion. It is shown that other potential markers found in M. tuberculosis culture supernatant, such as methyl phenylacetate, p-methyl anisate, methyl nicotinate and 2-methoxy biphenyl, can interfere with nicotinic acid via a competitive absorption of the excitation photons. A new strategy to circumvent these interferences is proposed with an upstream trapping of volatile markers preceding the detection of nicotinic acid in the liquid phase via the luminescence of Tb{sup 3+} complexes. The cost of the method is evaluated and compared with the Xpert MTB/RIF test endorsed by the World Health Organization. - Highlights: • Nicotinic acid, a specific marker of M. tuberculosis, can be detected via luminescence. • The detection limit with a commercial phosphorimeter is 0.4 µmol·L{sup -1}. • Other metabolites of M. tuberculosis can interfere via absorbed excitation light. • The interference can be removed via trapping of the most volatile metabolites. • A breath analysis procedure's cost is compared with the Xpert TBM/RIF test.

  14. A highly porous luminescent terbium-organic framework for reversible anion sensing

    Energy Technology Data Exchange (ETDEWEB)

    Wong, K.L.; Law, G.L.; Wong, W.T. [Department of Chemistry, The University of Hong Kong, Pokfulam Road, Hong Kong (China); Yang, Y.Y. [School of Chemistry and Chemical Engineering, Sun Yat-Sen University, Guangzhou 510275 (China)

    2006-04-18

    Unique tailored porous frameworks incorporating a lanthanide metal center have been designed to function as chemical detectors. A flexible multidentate ligand, mucic acid, is used to differentiate between several anions, thus creating an organic framework that is ideally suited for applications in gas separation, sensors, and chemical switches. (Abstract Copyright [2006], Wiley Periodicals, Inc.)

  15. Synthesis and characterization of wide bandgap semiconductors doped with terbium for electroluminescent devices

    OpenAIRE

    Montañez Huamán, Liz Margarita

    2016-01-01

    En el presente trabajo de investigación se ha estudiado propiedades estequiometrias, estructurales y de emisión de luz de semiconductor de amplio ancho de banda dopados con terbio. La difracción de rayos-X en ángulo rasante confirma el estado amorfo de las películas. Los espectros de absorción infrarroja muestran la formación de óxidos en las películas y la espectroscopia de foto-electrones de rayos-X revela la formación de oxinitruro de aluminio y oxicarburo de silicio. Las pe...

  16. Synthesis and characterization of terbium-doped SrSnO3 pigments

    Czech Academy of Sciences Publication Activity Database

    Dohnalová, Ž.; Gorodylova, N.; Šulcová, P.; Vlček, Milan

    2014-01-01

    Roč. 40, č. 8 (2014), s. 12637-12645 ISSN 0272-8842 Institutional support: RVO:61389013 Keywords : pigments * solid state reaction * perovskites Subject RIV: CA - Inorganic Chemistry Impact factor: 2.605, year: 2014

  17. An optical material for the detection of β-hydroxybutyrate based on a terbium complex

    Science.gov (United States)

    Wang, Xiaomiao; Chen, Huili; Li, Hua

    2014-02-01

    A novel Tb3+ complex (Tb(C14H10O4)ṡCl, TbL2) based on benzoic acid (L+H) was successfully synthesized, and gave a weak green emission in methanol-water (V:V, 4:1, pH 4.49). With the addition of β-hydroxybutyrate (β-HB) to a semi-aqueous solution of TbL2, an increment of the luminescent intensity at 545 nm assigned to 5D4 → 7F5 transition of Tb3+ was measured, which was evident to the naked eye. The response showed high selectivity for β-HB compared with other common anions including Cl-, NO3-, CO32-, PO43-, HPO42-, HPO4-, CO42-, PO74-, SO42-, lactate, AcO-, citrate, malate therefore it has the potential to be applied as a luminescent sensor for β-HB.

  18. Partial molar volume of paracetamol in water, 0.1 M HCl and 0.154 M NaCl at T = (298.15, 303.15, 308.15 and 310.65) K and at 101.325 kPa

    Energy Technology Data Exchange (ETDEWEB)

    Iqbal, Muhammad Javed [Department of Chemistry, Quaid-i-Azam University, Islamabad, Capital 54320 (Pakistan)]. E-mail: mjiqauchem@yahoo.com; Malik, Qaisar Mahmood [Department of Chemistry, Quaid-i-Azam University, Islamabad, Capital 54320 (Pakistan)]. E-mail: qaisar_@hotmail.com

    2005-12-15

    The apparent molar volume of paracetamol (4-acetamidophenol) in water, 0.1 M HCl and 0.154 M NaCl as solvents at (298.15, 303.15, 308.15 and 310.65) K temperatures and at a pressure of 101.325 kPa were determined from the density data obtained with the help of a vibrating-tube Anton Paar DMA-48 densimeter. The partial molar volume, V {sub m}, of paracetamol in these solvents at different temperatures was evaluated by extrapolating the apparent molar volume versus molality plots to m = 0. In addition, the partial molar expansivity, E {sup .}, the isobaric coefficient of thermal expansion, {alpha} {sub p}, and the interaction coefficient, S {sub v}, have also been computed. The expansivity data show dependence of E {sup .} values on the structure of the solute molecules.

  19. 40 CFR 154.1 - Purpose and scope.

    Science.gov (United States)

    2010-07-01

    ... pesticides, and the benefits of use of those pesticides, in an open and responsive manner. The issuance of a... for formal proceedings, or that the benefits of the pesticide's use outweigh the risks. Following... Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS SPECIAL REVIEW...

  20. 1/54 CROSS-BORDER JURISDICTION AND ASSISTANCE IN ...

    African Journals Online (AJOL)

    Dr Tanya du Plessis

    date for common law and equity as at 12 November 1993 with a limited number of statutes being expressly ..... decision of a court as is seen in the case of Re English, Scottish and Australian. Chartered Bank,51 in which a .... receiver to assets in the jurisdiction or direct the establishment of ancillary receivership proceedings ...