
Sample records for terbium 147

  1. Elastic properties of terbium

    DEFF Research Database (Denmark)

    Spichkin, Y.I.; Bohr, Jakob; Tishin, A.M.


    The temperature dependence of the Young modulus along the crystallographic axes b and c (E(b) and E(c)), and the internal friction of a terbium single crystal have been measured. At 4.2 K, E(b) and E(c) are equal to 38 and 84.5 GPa, respectively. The lattice part of the Young modulus and the Debye...... temperature has been calculated. The origin of the Young modulus anomalies arising at the transition to the magnetically ordered state is discussed....

  2. Critical scattering of neutrons from terbium

    DEFF Research Database (Denmark)

    Als-Nielsen, Jens Aage; Dietrich, O.W.; Marshall, W.


    The inelasticity of the critical scattering of neutrons in terbium has been measured above the Neél temperature at the (0, 0, 2−Q) satellite position. The results show that dynamic slowing down of the fluctuations does occur in a second‐order phase transition in agreement with the general theory...

  3. Semiconductor composition containing iron, dysprosium, and terbium

    Energy Technology Data Exchange (ETDEWEB)

    Pooser, Raphael C.; Lawrie, Benjamin J.; Baddorf, Arthur P.; Malasi, Abhinav; Taz, Humaira; Farah, Annettee E.; Kalyanaraman, Ramakrishnan; Duscher, Gerd Josef Mansfred; Patel, Maulik K.


    An amorphous semiconductor composition includes 1 to 70 atomic percent iron, 15 to 65 atomic percent dysprosium, 15 to 35 atomic percent terbium, balance X, wherein X is at least one of an oxidizing element and a reducing element. The composition has an essentially amorphous microstructure, an optical transmittance of at least 50% in at least the visible spectrum and semiconductor electrical properties.

  4. Raman spectroscopy study of the doping effect of the encapsulated terbium halogenides on single-walled carbon nanotubes

    Energy Technology Data Exchange (ETDEWEB)

    Kharlamova, M.V.; Kramberger, C.; Mittelberger, A. [University of Vienna, Faculty of Physics, Vienna (Austria)


    In the present work, the doping effect of terbium chloride, terbium bromide, and terbium iodide on single-walled carbon nanotubes (SWCNTs) was compared by Raman spectroscopy. A precise investigation of the doping-induced alterations of the Raman modes of the filled SWCNTs was conducted. The shifts of the components of the Raman modes and modification of their profiles allowed concluding that the inserted terbium halogenides have acceptor doping effect on the SWCNTs, and the doping efficiency increases in the line with terbium iodide, terbium bromide, and terbium chloride. (orig.)

  5. Magnetocaloric effect of thin Terbium films (United States)

    Mello, V. D.; Anselmo, D. H. A. L.; Vasconcelos, M. S.; Almeida, N. S.


    We report a theoretical study of the magnetocaloric effect of Terbium (Tb) thin films due to finite size and surface effects in the helimagnetic phase, corresponding to a temperature range from TC=219 K to TN=231 K, for external fields of the order of kOe. For a Tb thin film of 6 monolayers submitted to an applied field (ΔH =30 kOe, ΔH =50 kOe and ΔH = 70 kOe) we report a significative change in adiabatic temperature, ΔT / ΔH , near the Néel temperature, of the order ten times higher than that observed for Tb bulk. On the other hand, for small values of the magnetic field, large thickness effects are found. For external field strength around few kOe, we have found that the thermal caloric efficiency increases remarkably for ultrathin films. For an ultrathin film with 6 monolayers, we have found ΔT / ΔH = 43 K/T while for thicker films, with 20 monolayers, ΔT / ΔH = 22 K/T. Our results suggest that thin films of Tb are a promising material for magnetocaloric effect devices for applications at intermediate temperatures.

  6. Femtosecond XUV spectroscopy of gadolinium and terbium

    Energy Technology Data Exchange (ETDEWEB)

    Carley, Robert; Frietsch, Bjoern; Doebrich, Kristian; Teichmann, Martin; Gahl, Cornelius; Noack, Frank [Max-Born-Institute, Berlin (Germany); Schwarzkopf, Olaf; Wernet, Philippe [Helmholtz-Zentrum fuer Materialien und Energie (BESSY II), Berlin (Germany); Weinelt, Martin [Max-Born-Institute, Berlin (Germany); Fachbereich Physik, Freie Universitaet, Berlin (Germany)


    We present recent results of time-resolved IR-pump-XUV-probe experiments on the ultrafast demagnetization of thin films of Gadolinium(0001) and Terbium(0001) on Tungsten(110). The experiments are the first to be done using a newly developed high-order harmonics (HHG) XUV beamline at the MBI. The beamline delivers monochromated XUV pulses of approximately 150 fs duration with a photon energy resolution of up to 150 meV. Following excitation by intense femtosecond infrared (IR) pulses, photoemission with 35 eV photons allows us to directly probe the 4f electrons and their interaction with the valence band, both in the bulk and at the surface, to follow the ultrafast magnetization dynamics in the Lanthanide metals. As signatures of ultrafast demagnetization of the metal by the IR pulse, we see for the first time, rapid strong reduction of the exchange splitting in the valence band. This is followed by a slower demagnetization due to the spin-lattice interaction.

  7. Green fluorescence of terbium ions in lithium fluoroborate glasses ...

    Indian Academy of Sciences (India)

    Glasses; terbium ion; oscillator strengths; fluorescence; lifetimes; fibre lasers. 1. Introduction. Today glasses are most favourable engineering materials for abundant applications due to the wide ability of property altering by compositional modifications. The considerable examination of glass science to achieve required ...

  8. Green fluorescence of terbium ions in lithium fluoroborate glasses ...

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science; Volume 39; Issue 3. Green fluorescence of terbium ions in lithium fluoroborate glasses for fibre lasers and display devices. G R DILLIP C MADHUKAR REDDY M RAJESH SHIVANAND CHAURASIA B DEVA PRASAD RAJU S W JOO. Volume 39 Issue 3 June 2016 pp 711-717 ...

  9. Terahertz Cherenkov radiation from ultrafast magnetization in terbium gallium garnet (United States)

    Gorelov, S. D.; Mashkovich, E. A.; Tsarev, M. V.; Bakunov, M. I.


    We report an experimental observation of terahertz Cherenkov radiation from a moving magnetic moment produced in terbium gallium garnet by a circularly polarized femtosecond laser pulse via the inverse Faraday effect. Contrary to some existing theoretical predictions, the polarity of the observed radiation unambiguously demonstrates the paramagnetic, rather than diamagnetic, nature of the ultrafast inverse Faraday effect. From measurements of the radiation field, the Verdet constant in the subpicosecond regime is ˜3-10 times smaller than its table quasistatic value.

  10. Terbium luminescence in alumina xerogel fabricated in porous anodic alumina matrix under various excitation conditions

    Energy Technology Data Exchange (ETDEWEB)

    Gaponenko, N. V., E-mail: [Belarusian State University of Informatics and Radioelectronics (Belarus); Kortov, V. S. [Yeltsin Ural Federal University (Russian Federation); Orekhovskaya, T. I.; Nikolaenko, I. A. [Belarusian State University of Informatics and Radioelectronics (Belarus); Pustovarov, V. A.; Zvonarev, S. V.; Slesarev, A. I. [Yeltsin Ural Federal University (Russian Federation); Prislopski, S. Ya. [National Academy of Sciences of Belarus, Stepanov Institute of Physics (Belarus)


    Terbium-doped alumina xerogel layers are synthesized by the sol-gel method in pores of a porous anodic alumina film 1 {mu}m thick with a pore diameter of 150-180 nm; the film is grown on a silicon substrate. The fabricated structures exhibit terbium photoluminescence with bands typical of trivalent terbium terms. Terbium X-ray luminescence with the most intense band at 542 nm is observed for the first time for such a structure. Morphological analysis of the structure by scanning electron microscopy shows the presence of xerogel clusters in pore channels, while the main pore volume remains unfilled and pore mouths remain open. The data obtained confirm the promising applications of fabricated structures for developing matrix converters of X-rays and other ionizing radiations into visible light. The possibilities of increasing luminescence intensity in the matrix converter are discussed.

  11. Optical Properties of Lithium Terbium Fluoride and Implications for Performance in High Power Lasers (Postprint) (United States)



  12. Detection of biothiols in cells by a terbium chelate-Hg (II) system (United States)

    Tan, Hongliang; Chen, Yang


    Great efforts have been devoted to the development of sensitive and specific analysis methods for biothiols because of their important roles in biological systems. We present a new detection system for biothiols that is based on the reversible quenching and restoration of fluorescence of terbium chelate caused by Hg2+ and thiol species. In the presence of biothiols, a restoration of fluorescence of terbium chelate after quenching by Hg2+ was observed due to the interaction of Hg2+ with thiol groups, and the restored fluorescence increased with the concentration of biothiols. This method was sensitive and selective for biothiols. The detection limit was 80 nM for glutathione, 100 nM for Hcy, and 400 nM for Cysteine, respectively. The terbium chelate-Hg (II) system was successfully applied to determine the levels of biothiols in cancer cells and urine samples. Further, it was also shown to be comparable to Ellman's assay. Compared to other fluorescence methods, the terbium chelate probe is advantageous because interference from short-lived nonspecific fluorescence can be efficiently eliminated due to the long fluorescence lifetime of terbium chelate, which allows for detection by time-resolved fluorescence. The terbium chelate probe can serve as a diagnostic tool for the detection of abnormal levels of biothiols in disease.

  13. Cryogenic temperature characteristics of Verdet constant of terbium sesquioxide ceramics (United States)

    Snetkov, I. L.; Palashov, O. V.


    The dependence of the Verdet constant on temperature in the (80-300 K) range for a promising magneto-active material terbium sesquioxide Tb2O3 at the wavelengths of 405-1064 nm is considered. For each of the studied wavelengths, the Verdet constant of the material cooled down to the liquid nitrogen temperature increased by more than a factor of 3.2 as compared to the room temperature value. Similarly to the other paramagnetics, the increase follows the law ∼1/T. Approximations for the temperature dependence of the Verdet constant have been obtained and the value of 1/V·(dV/dT) has been estimated. This information is needed to determine the angle of rotation as well as the variation of the extinction ratio of a Faraday isolator with temperature and extremely important at creation a cryogenic Faraday devices.

  14. Biogenic terbium oxide nanoparticles as the vanguard against osteosarcoma (United States)

    Iram, Sana; Khan, Salman; Ansary, Abu Ayoobul; Arshad, Mohd; Siddiqui, Sahabjada; Ahmad, Ejaz; Khan, Rizwan H.; Khan, Mohd Sajid


    The synthesis of inner transition metal nanoparticles via an ecofriendly route is quite difficult. This study, for the first time, reports synthesis of terbium oxide nanoparticles using fungus, Fusarium oxysporum. The biocompatible terbium oxide nanoparticles (Tb2O3 NPs) were synthesized by incubating Tb4O7 with the biomass of fungus F. oxysporum. Multiple physical characterization techniques, such as UV-visible and photoluminescence spectroscopy, TEM, SAED, and zeta-potential were used to confirm the synthesis, purity, optical and surface characteristics, crystallinity, size, shape, distribution, and stability of the nanoemulsion of Tb2O3 NPs. The Tb2O3 NPs were found to inhibit the propagation of MG-63 and Saos-2 cell-lines (IC50 value of 0.102 μg/mL) and remained non-toxic up to a concentration of 0.373 μg/mL toward primary osteoblasts. Cell viability decreased in a concentration-dependent manner upon exposure to 10 nm Tb2O3 NPs in the concentration range 0.023-0.373 μg/mL. Cell toxicity was evaluated by observing changes in cell morphology, cell viability, oxidative stress parameters, and FACS analysis. Morphological examinations of cells revealed cell shrinkage, nuclear condensation, and formation of apoptotic bodies. The level of ROS within the cells-an indicator of oxidative stress was significantly increased. The induction of apoptosis at concentrations ≤ IC50 was corroborated by 4‧,6-diamidino-2-phenylindole dihydrochloride (DAPI) staining (DNA damage and nuclear fragmentation). Flow-cytometric studies indicated that the response was dose dependent with a threshold effect.

  15. Autofluorescence-free Live-cell Imaging Using Terbium Nanoparticles. (United States)

    Cardoso Dos Santos, Marcelina; Goetz, Joan; Bartenlian, Hortense; Wong, Ka-Leung; Charbonniere, Loïc Joanny; Hildebrandt, Niko


    Fluorescent nanoparticles (NPs) have become irreplaceable tools for advanced cellular and sub-cellular imaging. While very bright NPs require excitation with UV or visible light, which can create strong autofluorescence of biological components, NIR-excitable NPs without autofluorescence issues exhibit much lower brightness. Here, we show the application of a new type of surface-photosensitized terbium NPs (Tb-NPs) for autofluorescence-free intracellular imaging in live HeLa cells. Combination of exceptionally high brightness, high photostability, and long photoluminecence (PL) lifetimes for highly efficient suppression of the short-lived autofluorescence, allowed for time-gated PL imaging of intracellular vesicles over 72 h without toxicity and at extremely low Tb-NP concentrations down to 12 pM. Detection of highly resolved long-lifetime (ms) PL decay curves from small (~10 µm2) areas within single cells within a few seconds emphasized the unprecedented photophysical properties of Tb-NPs for live-cell imaging that extend well beyond currently available nanometric imaging agents.

  16. Solar Thermochemical Hydrogen Production via Terbium Oxide Based Redox Reactions

    Directory of Open Access Journals (Sweden)

    Rahul Bhosale


    Full Text Available The computational thermodynamic modeling of the terbium oxide based two-step solar thermochemical water splitting (Tb-WS cycle is reported. The 1st step of the Tb-WS cycle involves thermal reduction of TbO2 into Tb and O2, whereas the 2nd step corresponds to the production of H2 through Tb oxidation by water splitting reaction. Equilibrium compositions associated with the thermal reduction and water splitting steps were determined via HSC simulations. Influence of oxygen partial pressure in the inert gas on thermal reduction of TbO2 and effect of water splitting temperature (TL on Gibbs free energy related to the H2 production step were examined in detail. The cycle (ηcycle and solar-to-fuel energy conversion (ηsolar-to-fuel efficiency of the Tb-WS cycle were determined by performing the second-law thermodynamic analysis. Results obtained indicate that ηcycle and ηsolar-to-fuel increase with the decrease in oxygen partial pressure in the inert flushing gas and thermal reduction temperature (TH. It was also realized that the recuperation of the heat released by the water splitting reactor and quench unit further enhances the solar reactor efficiency. At TH=2280 K, by applying 60% heat recuperation, maximum ηcycle of 39.0% and ηsolar-to-fuel of 47.1% for the Tb-WS cycle can be attained.

  17. Folate Receptor Targeted Alpha-Therapy Using Terbium-149

    CERN Document Server

    Müller, Cristina; Haller, Stephanie; Dorrer, Holger; Köster, Ulli; Johnston, Karl; Zhernosekov, Konstantin; Türler, Andreas; Schibli, Roger


    Terbium-149 is among the most interesting therapeutic nuclides for medical applications. It decays by emission of short-range α-particles (Eα = 3.967 MeV) with a half-life of 4.12 h. The goal of this study was to investigate the anticancer efficacy of a 149Tb-labeled DOTA-folate conjugate (cm09) using folate receptor (FR)-positive cancer cells in vitro and in tumor-bearing mice. 149Tb was produced at the ISOLDE facility at CERN. Radiolabeling of cm09 with purified 149Tb resulted in a specific activity of ~1.2 MBq/nmol. In vitro assays performed with 149Tb-cm09 revealed a reduced KB cell viability in a FR-specific and activity concentration-dependent manner. Tumor-bearing mice were injected with saline only (group A) or with 149Tb-cm09 (group B: 2.2 MBq; group C: 3.0 MBq). A significant tumor growth delay was found in treated animals resulting in an increased average survival time of mice which received 149Tb-cm09 (B: 30.5 d; C: 43 d) compared to untreated controls (A: 21 d). Analysis of blood parameters rev...

  18. Hardness and dielectric characteristics of flux grown terbium aluminate crystals

    Energy Technology Data Exchange (ETDEWEB)

    Sharma, K.K.; Kotru, P.N. [Jammu Univ. (India). Dept. of Physics; Tandon, R.P. [National Physical Laboratory, New Delhi (India); Wanklyn, B.M. [Clarendon Laboratory, University of Oxford, Oxford (United Kingdom)


    Results of indentation induced Vickers hardness testing and dielectric studies conducted on flux-grown terbium aluminate crystals are presented. It is shown that the Vickers hardness value (H{sub v}) is independent of indentation time, but depends on the applied load. Applying the concept of Hays and Kendall, the load independent values are estimated for (110) and (001) planes. Differential behaviour in the crack formation of two different planes (110) and (001) is observed, while (001) plane develops Palmqvist cracks in the whole load range of 10-100 g, (110) plane shows a transition from Palmqvist to median cracks at 70 g. The fracture toughness, brittleness index and yield strength are determined for both the planes. The hardness anisotropy is reported. The dielectric constant, dielectric loss and conductivity are shown to be dependent on temperature and frequency of the applied a.c. field. The dielectric constant versus temperature shows a transition peak at 230 C, which remains independent of the frequency of the applied a.c. field in the range 1 kHz-13 MHz. (orig.) 36 refs.

  19. 46 CFR 147.70 - Acetylene. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Acetylene. 147.70 Section 147.70 Shipping COAST GUARD... Special Requirements for Particular Materials § 147.70 Acetylene. (a) Seventeen cubic meters (600 standard cubic feet) or less of acetylene may be stowed on or below decks on any vessel. (b) More than 17 m3 (600...

  20. 7 CFR 1703.147 - Appeals. (United States)


    ... 7 Agriculture 11 2010-01-01 2010-01-01 false Appeals. 1703.147 Section 1703.147 Agriculture Regulations of the Department of Agriculture (Continued) RURAL UTILITIES SERVICE, DEPARTMENT OF AGRICULTURE RURAL DEVELOPMENT Distance Learning and Telemedicine Loan Program § 1703.147 Appeals. Any appeal must be...

  1. 46 CFR 147.100 - Radioactive materials. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Radioactive materials. 147.100 Section 147.100 Shipping... Stowage and Other Special Requirements for Particular Materials § 147.100 Radioactive materials. (a) Radioactive materials must not be brought on board, used in any manner, or stored on the vessel, unless the...

  2. 13 CFR 147.670 - Suspension. (United States)


    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Suspension. 147.670 Section 147...-FREE WORKPLACE (NONPROCUREMENT) Definitions § 147.670 Suspension. Suspension means an action taken by a..., subpart 9.4) and the common rule, Government-wide Debarment and Suspension (Nonprocurement), that...

  3. 9 CFR 147.21 - Flock sanitation. (United States)


    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Flock sanitation. 147.21 Section 147... LIVESTOCK IMPROVEMENT AUXILIARY PROVISIONS ON NATIONAL POULTRY IMPROVEMENT PLAN Sanitation Procedures § 147.21 Flock sanitation. To aid in the maintenance of healthy flocks, the following procedures should be...

  4. 32 CFR 147.18 - Introduction. (United States)


    ... 32 National Defense 1 2010-07-01 2010-07-01 false Introduction. 147.18 Section 147.18 National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE PERSONNEL, MILITARY AND CIVILIAN... Standards § 147.18 Introduction. The following investigative standards are established for all United States...

  5. 32 CFR 147.28 - Introduction. (United States)


    ... 32 National Defense 1 2010-07-01 2010-07-01 false Introduction. 147.28 Section 147.28 National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE PERSONNEL, MILITARY AND CIVILIAN... Temporary Access § 147.28 Introduction. The following minimum investigative standards, implementing section...

  6. 14 CFR 147.45 - Advertising. (United States)


    ... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Advertising. 147.45 Section 147.45... OTHER CERTIFICATED AGENCIES AVIATION MAINTENANCE TECHNICIAN SCHOOLS Operating Rules § 147.45 Advertising... aviation maintenance technician school indicates in advertising that it is a certificated school, it shall...

  7. Thermoluminescence of cerium and terbium -doped calcium pyrophosphate

    Energy Technology Data Exchange (ETDEWEB)

    Roman L, J.; Cruz Z, E. [UNAM, Instituto de Ciencias Nucleares, Circuito Exterior, Ciudad Universitaria, 04510 Mexico D. F. (Mexico); Lozano R, I. B.; Diaz G, J. A. I., E-mail: [IPN, Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada, Av. Legaria No. 694, 11500 Mexico D. F. (Mexico)


    The aim of this work is to report the thermoluminescence (Tl) response of Calcium Pyrophosphate phosphor doped with Cerium and Terbium impurities (Ca{sub 2}P{sub 2}O{sub 7}:Ce{sup 3+},Tb{sup 3+}). The phosphors were synthesized using the co-precipitation method and annealed at 900 degrees C by two hours for obtain the β phase. The intentional doping with Ce and Tb ions was 1 at.% and 0.1 at.%, whereas in the EDS results the concentration of impurities was 0.39 at.% and 0.05 at.%, respectively. The superficial morphology of phosphor is mainly composed by thin wafers of different size. All samples were exposed to gamma rays from {sup 60}Co in the Gammacell-200 irradiator. The Tl response of the phosphor was measured from Rt up to 350 degrees C and under nitrogen atmosphere in a Harshaw TLD 3500 reader. The glow curves of the Ca{sub 2}P{sub 2}O{sub 7}:Ce{sup 3+},Tb{sup 3+} powders showed a broad intense Tl peak centered at 165 degrees C and a shoulder at approximate 260 degrees C was observed. A linear Tl response in the range of absorbed dose of 0.2 to 10 Gy was obtained. Tl glow curves were analyzed using the initial rise (IR)and computerized glow curve deconvolution methods to evaluate the kinetics parameters such as activation energy (E), frequency factor (s) and kinetic order (b). (Author)

  8. Solvent polarity and oxygen sensitivity, rather than viscosity, determine lifetimes of biaryl-sensitised terbium luminescence. (United States)

    Walter, Edward R H; Williams, J A Gareth; Parker, David


    In a macrocyclic terbium complex incorporating a biaryl sensitiser, the observed variation of emission lifetime is shown to be determined by the solubility of oxygen in the solvent system and the relative energy of the chromophore excited state, rather than any dependence on solvent viscosity.

  9. Lanthanide complexes of a picolinate ligand derived from 1,4,7-triazacyclononane with potential application in magnetic resonance imaging and time-resolved luminescence imaging. (United States)

    Nonat, Aline; Gateau, Christelle; Fries, Pascal H; Mazzanti, Marinella


    The new potentially octadentate ligand, 1-(carboxymethyl)-4,7-bis[(6-carboxypyridin-2-yl)methyl]-1,4,7-triazacyclononane (H(3)bpatcn), in which two picolinate arms and one acetate arm are connected to the 1,4,7-triazacyclonane core, has been prepared. Potentiometric studies show an increased stability of the Gd(III) complex of H(3)bpatcn (logK(GdL)=15.8(2)) with respect to the Gd(III) complex of the analogous ligand 1,4,7-triazacyclononane-N,N',N''-triacetic acid (H(3)nota) (logK(GdL)=13.7), associated with an increased selectivity of H(3)bpatcn for gadolinium over calcium. The H(3)bpatcn ligand sensitises the terbium ion very efficiently, leading to a long-lived and highly luminescent terbium complex (quantum yield=43 %), in spite of the presence of a coordinated water molecule. (1)H proton NMR studies indicate that the metal ion is rigidly encapsulated by the three arms of the octadentate ligand H(3)bpatcn and that the macrocycle framework remains bound (through the five nitrogen and the three oxygen atoms) even at high temperature. A new theoretical method for interpreting the water proton relaxivity is presented. It is based on recent progresses in the description of the electronic spin relaxation and on an auxiliary probe solute. It replaces the Solomon, Bloembergen and Morgan (SBM) framework, which is questionable at low field, while avoiding resorting to simulations and/or sophisticated theories with additional unknown zero-field splitting (ZFS) parameters. The inclusion of two picolinate groups on a triazacyclononane framework affords the mono-aquo gadolinium complex [Gd(bpatcn)(H(2)O)] with favourable electron-relaxation properties (tau(eff)(S0)=125 ps). The optimisation of the electronic relaxation by ligand design is especially important to achieve high relaxivity in the new generation macromolecular complexes with long rotational correlation times.

  10. Dicty_cDB: CHP147 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CH (Link to library) CHP147 (Link to dictyBase) - - - Contig-U16471-1 CHP147P (Link to Original site) CHP...147F 556 CHP147Z 747 CHP147P 1283 - - Show CHP147 Library CH (Link to library) Clone ID CHP...e URL Representative seq. ID CHP...147P (Link to Original site) Representative DNA sequence >CHP147 (CHP147Q) /CSM/CH/CHP1-B/CHP...qeknqql leqeqnkn Translated Amino Acid sequence (All Frames) Frame A: llaywxkker*kkknfffff*nwyn*kcxvknihp

  11. Arginine-responsive terbium luminescent hybrid sensors triggered by two crown ether carboxylic acids

    Energy Technology Data Exchange (ETDEWEB)

    Jiang, Lasheng [Key Laboratory of Theoretical Chemistry of Environment, Ministry of Education, School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); Tang, Ke; Ding, Xiaoping [School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); Wang, Qianming, E-mail: [Key Laboratory of Theoretical Chemistry of Environment, Ministry of Education, School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); Zhou, Zhan; Xiao, Rui [School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China)


    Crown ether carboxylic acids constitute main building blocks for the synthesis of terbium containing covalent cross-linked luminescent materials. Both the complexes and the hybrid nanomaterials could exhibit remarkable green emissions in pure water. More importantly, they were found to have a profound effect on the luminescence responses to arginine compared with glutamic acid, histidine, tryptophan, threonine, tyrosine and phenylalanine in aqueous environment. The present study provided the possibility of using a host–guest mechanism as a way of signal transduction based on lanthanide supramolecular hybrid materials. - Highlights: • Crown ether carboxylic acids were found to sensitize terbium ions among a group of ethers. • The complexes and silica hybrid materials were both prepared and characterized. • They could exhibit remarkable green emissions in pure water.

  12. Comparative analysis of conjugated alkynyl chromophore-triazacyclononane ligands for sensitized emission of europium and terbium. (United States)

    Soulié, Marine; Latzko, Frédéric; Bourrier, Emmanuel; Placide, Virginie; Butler, Stephen J; Pal, Robert; Walton, James W; Baldeck, Patrice L; Le Guennic, Boris; Andraud, Chantal; Zwier, Jurriaan M; Lamarque, Laurent; Parker, David; Maury, Olivier


    A series of europium and terbium complexes based on a functionalized triazacyclononane carboxylate or phosphinate macrocyclic ligand is described. The influence of the anionic group, that is, carboxylate, methylphosphinate, or phenylphosphinate, on the photophysical properties was studied and rationalized on the basis of DFT calculated structures. The nature, number, and position of electron-donating or electron-withdrawing aryl substituents were varied systematically within the same phenylethynyl scaffold in order to optimize the brightness of the corresponding europium complexes and investigate their two-photon absorption properties. Finally, the europium complexes were examined in cell-imaging applications, and selected terbium complexes were studied as potential oxygen sensors. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. 9 CFR 147.42 - General. (United States)


    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false General. 147.42 Section 147.42 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE LIVESTOCK... subchapter without observance of such procedure when such action is deemed necessary in the public interest. ...

  14. 24 CFR 100.147 - Adjudication. (United States)


    ... DISCRIMINATORY CONDUCT UNDER THE FAIR HOUSING ACT Discrimination in Residential Real Estate-Related Transactions... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Adjudication. 100.147 Section 100.147 Housing and Urban Development Regulations Relating to Housing and Urban Development OFFICE OF...

  15. 19 CFR 147.1 - Definitions. (United States)


    ... (CONTINUED) TRADE FAIRS General Provisions § 147.1 Definitions. The following are general definitions for the purposes of part 147: (a) The Act. “The Act” means the Trade Fair Act of 1959. (Secs. 2-7, 73 Stat. 18, 19... Secretary of Commerce pursuant to the Trade Fair Act. (c) Fair operator. “Fair operator” means the party...

  16. 40 CFR 147.102 - Aquifer exemptions. (United States)


    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Aquifer exemptions. 147.102 Section 147.102 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS...) Granite Point. (ii) McArthur River Field. (iii) Middle Ground Shoal Field. (iv) Trading Bay Field. (3) The...

  17. 14 CFR 147.15 - Space requirements. (United States)


    ... areas equipped with washtank and degreasing equipment with air pressure or other adequate cleaning... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Space requirements. 147.15 Section 147.15 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION (CONTINUED) SCHOOLS AND...

  18. 9 CFR 147.23 - Hatchery sanitation. (United States)


    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Hatchery sanitation. 147.23 Section... AGRICULTURE LIVESTOCK IMPROVEMENT AUXILIARY PROVISIONS ON NATIONAL POULTRY IMPROVEMENT PLAN Sanitation Procedures § 147.23 Hatchery sanitation. An effective program for the prevention and control of Salmonella...

  19. 33 CFR 117.147 - Cerritos Channel. (United States)


    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Cerritos Channel. 117.147 Section... DRAWBRIDGE OPERATION REGULATIONS Specific Requirements California § 117.147 Cerritos Channel. (a) The draw of... immediately. Channel 13 (156.65 MHZ) or other assigned frequencies may be used. (b) The draw of the Henry Ford...

  20. 32 CFR 147.1 - Introduction. (United States)


    ... 32 National Defense 1 2010-07-01 2010-07-01 false Introduction. 147.1 Section 147.1 National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE PERSONNEL, MILITARY AND CIVILIAN... Introduction. The following adjudicative guidelines are established for all United States Government civilian...

  1. 13 CFR 147.660 - Recipient. (United States)


    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Recipient. 147.660 Section 147.660 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION GOVERNMENTWIDE REQUIREMENTS FOR DRUG-FREE..., partnership, association, unit of government (except a Federal agency) or legal entity, however organized...

  2. Spectrofluorimetric Determination of Human Serum Albumin Using Terbium-Danofloxacin Probe


    Ramezani, Amir M.; Manzoori, Jamshid L.; Amjadi, Mohammad; Jouyban, Abolghasem


    A spectrofluorimetric method is proposed for the determination of human serum albumin (HSA) and bovine serum albumin (BSA) using terbium-danofloxacin (Tb3+-Dano) as a fluorescent probe. These proteins remarkably enhance the fluorescence intensity of the Tb3+-Dano complex at 545 nm, and the enhanced fluorescence intensity of Tb3+-Dano is proportional to the concentration of proteins (HSA and BSA). Optimum conditions for the determination of HSA were investigated and found that the maximum resp...

  3. Dicty_cDB: CFC147 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CF (Link to library) CFC147 (Link to dictyBase) - - - Contig-U16381-1 CFC147F (Link to Original site) CFC...147F 122 - - - - - - Show CFC147 Library CF (Link to library) Clone ID CFC147 (Link Representative seq. ID CFC14...7F (Link to Original site) Representative DNA sequence >CFC147 (CFC147Q) /CSM/CF/CFC1-B/CFC147Q.Seq.d/ TACAT...nificant alignments: (bits) Value CFC147 (CFC147Q) /CSM/CF/CFC1-B/CFC147Q.Seq.d/ 218 1e-56 SLK648 (SLK648Q)

  4. Genetically Encoded FRET-Sensor Based on Terbium Chelate and Red Fluorescent Protein for Detection of Caspase-3 Activity

    Directory of Open Access Journals (Sweden)

    Alexander S. Goryashchenko


    Full Text Available This article describes the genetically encoded caspase-3 FRET-sensor based on the terbium-binding peptide, cleavable linker with caspase-3 recognition site, and red fluorescent protein TagRFP. The engineered construction performs two induction-resonance energy transfer processes: from tryptophan of the terbium-binding peptide to Tb3+ and from sensitized Tb3+ to acceptor—the chromophore of TagRFP. Long-lived terbium-sensitized emission (microseconds, pulse excitation source, and time-resolved detection were utilized to eliminate directly excited TagRFP fluorescence and background cellular autofluorescence, which lasts a fraction of nanosecond, and thus to improve sensitivity of analyses. Furthermore the technique facilitates selective detection of fluorescence, induced by uncleaved acceptor emission. For the first time it was shown that fluorescence resonance energy transfer between sensitized terbium and TagRFP in the engineered construction can be studied via detection of microsecond TagRFP fluorescence intensities. The lifetime and distance distribution between donor and acceptor were calculated using molecular dynamics simulation. Using this data, quantum yield of terbium ions with binding peptide was estimated.

  5. Dicty_cDB: AFF147 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFF147 (Link to dictyBase) - - - Contig-U15511-1 AFF147P (Link to Original site) AFF1...47F 120 AFF147Z 478 AFF147P 598 - - Show AFF147 Library AF (Link to library) Clone ID AFF1... URL Representative seq. ID AFF1...47P (Link to Original site) Representative DNA sequence >AFF147 (AFF147Q) /CSM/AF/AFF1-B/AFF1...omology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value AFF147 (AFF147Q) /CSM/AF/AFF1-B/AFF1

  6. Decay Properties of {sup 147}Nd

    Energy Technology Data Exchange (ETDEWEB)

    Baecklin, A. [Inst. of Physics, Univ. of Uppsala (Sweden); Swedish Research Councils' Laboratory, Studsvik, Nykoeping (Sweden); Malmskog, S.G. [AB Atomenergi, Nykoeping (Sweden)


    Electron and gamma transition energies and intensities in the decay of {sup 147}Nd have been studied using a double focussing beta spectrometer and a Ge(Li)-detector. From the deduced multipolarities of the transitions all levels in {sup 147}Pm are found to have positive parity in contrast to the fact that the neighbouring nucleus {sup 149}Pm has been found to have several low lying negative parity states.

  7. Dicty_cDB: CFD147 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CF (Link to library) CFD147 (Link to dictyBase) - - - Contig-U16381-1 CFD147F (Link to Original site) CFD...147F 107 - - - - - - Show CFD147 Library CF (Link to library) Clone ID CFD147 (Link Representative seq. ID CFD14...7F (Link to Original site) Representative DNA sequence >CFD147 (CFD147Q) /CSM/CF/CFD1-B/CFD147Q.Seq.d/ TGTAG...s: 3101297 Number of Hits to DB: 85,114,509 protein update 2009. 5.12 PSORT - 5' end seq. ID CFD147F 5' end seq. >CFD

  8. Dicty_cDB: CHR147 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CH (Link to library) CHR147 (Link to dictyBase) - - - Contig-U15337-1 | Contig-U16527-1 CHR...147P (Link to Original site) CHR147F 601 CHR147Z 802 CHR147P 1383 - - Show CHR147 Library CH (Link to library) Clone ID CHR...337-1 | Contig-U16527-1 Original site URL Representative seq. ID CHR147P (Link to Original site) Representative DNA sequence >CHR147 (CHR...147Q) /CSM/CH/CHR1-B/CHR147Q.Seq.d/ ATAGCAAGAATCATAGACCCGAGTCAATTGAAGTTGACAAAGGTTTACAAACTGTAAATC

  9. Green light emission in aluminum oxide powders doped with different terbium concentrations

    Energy Technology Data Exchange (ETDEWEB)

    Mariscal B, L; Falcony, C. [IPN, Centro de Investigacion y de Estudios Avanzados, 07360 Ciudad de Mexico (Mexico); Carmona T, S.; Murrieta, H.; Sanchez A, M. A. [UNAM, Instituto de Fisica, 04510 Ciudad de Mexico (Mexico); Vazquez A, R. [IPN, Escuela Superior de Computo, 07738 Ciudad de Mexico (Mexico); Garcia R, C. M., E-mail: [UNAM, Facultad de Ciencias, 04510 Ciudad de Mexico (Mexico)


    Different emission intensities presented in aluminum oxide phosphors corresponding to different concentrations of doping performed with terbium are analyzed. The phosphors were synthesized by the evaporation technique and were characterized by photo and cathodoluminescence, X-ray diffraction and EDS techniques for different incorporation percentages of terbium as dopant; they show characteristic transitions in 494, 543, 587 and 622 nm, corresponding to {sup 5}D{sub 4} → {sup 7}F{sub 6}, {sup 5}D{sub 4} → {sup 7}F{sub 5}, {sup 5}D{sub 4} → {sup 7}F{sub 4} and {sup 5}D{sub 4} → {sup 7}F{sub 3}, respectively when they are excited with λ{sub exc} = 380 nm wavelength at room temperature. The results of X-ray diffraction show the presence of α-Al{sub 2}O{sub 3} phases with peaks located at 2θ = 25.78, 35.34, 37.96, 43.56, 45.8, 52.74, 57.7, 61.5, 66.74, 68.44, 77.12 and 80.94, and the δ-Al{sub 2}O-3 phase 2θ = 32.82, 45.8, 61.36 and 66.74. These compounds were heat treated for two hours at 1100 degrees Celsius. EDS analyzes indicate that these compounds have close to 60% oxygen around of 40% aluminum in the presence of terbium as dopant which indicates a stoichiometry close to the expected one for alumina. (Author)

  10. Graphene quantum dots-terbium ions as novel sensitive and selective time-resolved luminescent probes. (United States)

    Llorent-Martínez, Eulogio J; Durán, Gema M; Ríos, Ángel; Ruiz-Medina, Antonio


    We propose an alternative approach for the development of analytical methods based on terbium-sensitized luminescence (TSL). TSL is based on the complexation between Tb(III) ions and fluorescent organic compounds that have appropriate functional groups to complex with Tb(III). We report the use of graphene quantum dot (GQDs) nanoparticles to improve the sensitivity and selectivity of TSL detection. GQDs can react with terbium ions through the carboxylic groups present in their structure. These Tb(III)-GQD complexes, formed in situ in aqueous solution, can be used as time-resolved luminescent probes. Ascorbic acid was selected as a target analyte to demonstrate the suitability of the proposed method. The selectivity of the TSL method was highly improved for most of the interferences tested. Under the optimum conditions [Tb(III) concentration 5 × 10-4 mol L-1, GQD concentration 4 mg L-1], a minimum 100% increase in selectivity was observed for several vitamins and common cations that may be present in the samples to be analyzed. In addition, the analytical signal showed a 30% enhancement with the use of GQDs compared with the use of merely Tb(III) ions, with a detection limit of 0.12 μg mL-1. The repeatability and intermediate precision were lower than 3% and 5%, respectively. From the results obtained, the implementation of GQDs in TSL can lead to the development of novel time-resolved luminescent probes with high analytical potential. Graphical abstract Quenching of Tb(III)-graphene quantum dot (GQD) luminescence by ascorbic acid (AA). TBL terbium-sensitized luminescence.

  11. Fluorescence study of some terbium-oligopeptide complexes in methanolic solution. (United States)

    Rabouan, S; Delage, J; Durand, W; Prognon, P; Barthes, D


    This study concerned the use of lanthanide chelates to detect glycyl-leucyl-phenylalanine (GLF) and its homologues. Spectroscopic analysis of peptides without or with terbium complexation revealed the formation of (LF)(3)(Tb)(2), (GF)(3)(Tb)(2), (GLF)(3)(Tb)(2) and (FL)(4)Tb, (FG)(4)Tb complexes with high stability constants in methanolic solutions (pK(d)>13). Lanthanide chelate emission displayed a large Stokes shift (>270 nm), which allowed Tb chelates of GLF and its derivatives to be used for detection purposes. However, this preliminary study indicated some important limitations associated with lanthanide chelation, such as high methanolic content.

  12. Electromagnetic properties of terbium gallium garnet at millikelvin temperatures and low photon energy (United States)

    Kostylev, Nikita; Goryachev, Maxim; Bushev, Pavel; Tobar, Michael E.


    Electromagnetic properties of single crystal terbium gallium garnet are characterised from room down to millikelvin temperatures using the whispering gallery mode method. Microwave spectroscopy is performed at low powers equivalent to a few photons in energy and conducted as functions of the magnetic field and temperature. A phase transition is detected close to the temperature of 3.5 K. This is observed for multiple whispering gallery modes causing an abrupt negative frequency shift and a change in transmission due to extra losses in the new phase caused by a change in complex magnetic susceptibility.

  13. Nuclear excitation functions from 40 to 200 MeV proton irradiation of terbium

    Energy Technology Data Exchange (ETDEWEB)

    Engle, Jonathan W., E-mail:; Mashnik, Stepan G.; Parker, Lauren A.; Jackman, Kevin R.; Bitteker, Leo J.; Ullmann, John L.; Gulley, Mark S.; Pillai, Chandra; John, Kevin D.; Birnbaum, Eva R.; Nortier, Francois M.


    Nuclear formation cross sections are reported for 26 radionuclides, measured with 40–200 MeV proton irradiations of terbium foils. These data provide the basis for the production of medically relevant radionuclides (e.g., {sup 152}Tb, {sup 155}Tb, {sup 155}Eu, and {sup 156}Eu) and {sup 153}Gd, a potential source used in ongoing efforts to characterize stellar nucleosynthesis routes. Computational predictions from the ALICE2011, CEM03.03, Bertini, and INCL + ABLA codes are compared with newly measured data to contribute to the ongoing process of code development, and yields are calculated for selected radionuclides using measured data.

  14. Dicty_cDB: CHF147 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CH (Link to library) CHF147 (Link to dictyBase) - - - Contig-U16327-1 - (Link to Original site) - - CHF1...47Z 579 - - - - Show CHF147 Library CH (Link to library) Clone ID CHF147 (Link to Representative seq. ID - (Link to ...Original site) Representative DNA sequence >CHF147 (CHF147Q) /CSM/CH/CHF1-B/CHF147Q.Seq.d/ XXXXXXXXXXAAAAAAA...omology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value CHF147 (CHF147Q) /CSM/CH/CHF1-B/CHF1

  15. Micelle-enhanced and terbium-sensitized spectrofluorimetric determination of gatifloxacin and its interaction mechanism (United States)

    Guo, Changchuan; Wang, Lei; Hou, Zhun; Jiang, Wei; Sang, Lihong


    A terbium-sensitized spectrofluorimetric method using an anionic surfactant, sodium dodecyl benzene sulfonate (SDBS), was developed for the determination of gatifloxacin (GFLX). A coordination complex system of GFLX-Tb 3+-SDBS was studied. It was found that SDBS significantly enhanced the fluorescence intensity of the complex (about 11-fold). Optimal experimental conditions were determined as follows: excitation and emission wavelengths of 331 and 547 nm, pH 7.0, 2.0 × 10 -4 mol l -1 terbium (III), and 2.0 × 10 -4 mol l -1 SDBS. The enhanced fluorescence intensity of the system (Δ If) showed a good linear relationship with the concentration of GFLX over the range of 5.0 × 10 -10 to 5.0 × 10 -8 mol l -1 with a correlation coefficient of 0.9996. The detection limit (3 σ) was determined as 6.0 × 10 -11 mol l -1. This method has been successfully applied to the determination of GFLX in pharmaceuticals and human urine/serum samples. Compared with most of other methods reported, the rapid and simple procedure proposed in the text offers higher sensitivity, wider linear range, and better stability. The interaction mechanism of the system is also studied by the research of ultraviolet absorption spectra, surface tension, solution polarity and fluorescence polarization.

  16. Circularly Polarized Luminescence in Enantiopure Europium and Terbium Complexes with Modular, All-Oxygen Donor Ligands (United States)

    Seitz, Michael; Do, King; Ingram, Andrew J.; Moore, Evan G.; Muller, Gilles; Raymond, Kenneth N.


    Abstract: Circulaly polarized luminescence from terbium(III) complexed and excited by chiral antenna ligands gives strong emission The modular synthesis of three new octadentate, enantiopure ligands are reported - one with the bidentate chelating unit 2-hydroxyisophthalamide (IAM) and two with 1-hydroxy-2-pyridinone (1,2-HOPO) units. A new design principle is introduced for the chiral, non-racemic hexamines which constitute the central backbones for the presented class of ligands. The terbium(III) complex of the IAM ligand, as well as the europium(III) complexes of the 1,2-HOPO ligands are synthesized and characterized by various techniques (NMR, UV, CD, luminescence spectroscopy). All species exhibit excellent stability and moderate to high luminescence efficiency (quantum yields ΦEu = 0.05–0.08 and ΦTb = 0.30–0.57) in aqueous solution at physiological pH. Special focus is put onto the properties of the complexes in regard to circularly polarized luminescence (CPL). The maximum luminescence dissymmetry factors (glum) in aqueous solution are high with |glum|max = 0.08 – 0.40. Together with the very favorable general properties (good stability, high quantum yields, long lifetimes), the presented lanthanide complexes can be considered as good candidates for analytical probes based on CPL in biologically relevant environments. PMID:19639983

  17. 19 CFR 147.0 - Scope. (United States)


    ...) TRADE FAIRS § 147.0 Scope. This part governs the entry of merchandise intended for exhibition or for use in constructing, installing, or maintaining foreign exhibits at trade fairs which have been so... merchandise, and the disposition of the merchandise after the fair has closed. The entry of articles which may...

  18. 19 CFR 147.11 - Entry. (United States)


    ...) TRADE FAIRS Procedure for Importation § 147.11 Entry. (a) Made in name of fair operator. All entries of articles for a fair shall be made at the port in the name of the fair operator which shall be deemed for... exhibition purposes under the Trade Fair Act of 1959. Mark Number Package and contents Quality Invoice value...

  19. 45 CFR 147.138 - Patient protections. (United States)


    ... INSURANCE REFORM REQUIREMENTS FOR THE GROUP AND INDIVIDUAL HEALTH INSURANCE MARKETS § 147.138 Patient... participant (in the individual market, primary subscriber) of the terms of the plan or health insurance.... If a group health plan, or a health insurance issuer offering group or individual health insurance...

  20. 27 CFR 44.147 - General. (United States)


    ... PAYMENT OF TAX, OR WITH DRAWBACK OF TAX Operations by Export Warehouse Proprietors Reports § 44.147 General. Every export warehouse proprietor shall make a report on Form 5220.4 of all tobacco products... any operations or transactions occurred during the period covered by the report. A copy of each report...

  1. Luminescent method of determination of composition of europium and terbium complexes in solution by change of intensity ratio of luminescence bands

    Energy Technology Data Exchange (ETDEWEB)

    Bel' tyukova, S.V.; Nazarenko, N.A.; Poluehktov, N.S.


    The complexes of europium and terbium with phenanthroline, ethylenediaminetetraacetate, nitrilotriacetate, some acids-phenol derivatives and ..beta..-diketones series have been used as an example to demonstrate that the value of the ratio of intensities on the two bands of europium(terbium) luminescence spectra - the one corresponding to the hypersensitive'' transition and the other, to the magnetic dipole one - can be used for determination of the complexes composition in solutions.

  2. Thermo-transferred thermoluminescence (TTTl) in potassium-yttrium double fluoride doped with terbium

    Energy Technology Data Exchange (ETDEWEB)

    Gallegos, A.; Rivera, T.; Diaz G, J. A. [IPN, Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada, Legaria 694, Col. Irrigacion, 11500 Mexico D. F. (Mexico); Azorin, J. [Universidad Autonoma Metropolitana, Unidad Iztapalapa, San Rafael Atlixco No. 186, Col. Vicentina, 09340 Mexico D. F. (Mexico); Azorin, J. C. [Universidad de Guanajuato, Division de Ciencias e Ingenierias-Campus Leon, Lomas del Bosque No. 103, Col. Lomas del Campestre, 37000 Leon, Guanajuato (Mexico); Licona, R.; Rivas, F.; Hernandez C, G. [Benemerita Universidad Autonoma de Puebla, Facultad de Ciencias Quimicas, 14 Sur y San Claudio, Ciudad Universitaria, Puebla de Zaragoza, Puebla (Mexico); Khaidukov, N. [Institute of General and Inorganic Chemistry, Lenin SK 11 Prospect 31, Moscow 117907 (Russian Federation)


    This paper presents results of studying the thermo-transferred thermoluminescence (TTTl) phenomenon in potassium-yttrium double fluoride doped with terbium (K{sub 2}YF{sub 5:}Tb) at different impurity concentrations (0.8%, 0.95% and 0.99%). Previously to study the TTTl phenomenon, structural characterization and chemical composition of the materials were determined. The structural studies were conducted using a scanning electron microscope; meanwhile, chemical composition was analyzed using energy dispersive X-ray spectroscopy. Thermoluminescence kinetics was studied irradiating the samples with {sup 137}Cs gamma rays as well as with {sup 90}Sr/{sup 90}Y beta rays, analyzing the glow curves by the deconvolution method for obtaining the kinetic parameters. (Author)

  3. The influence of pressure on the photoluminescence properties of a terbium-adipate framework (United States)

    Spencer, Elinor C.; Zhao, Jing; Ross, Nancy L.; Andrews, Michael B.; Surbella, Robert G.; Cahill, Christopher L.


    The influence of pressure (over the 0-4.7 GPa range) on the photoluminescence emissions and crystal structure of the known 3D terbium-adipate metal-organic framework material Tb-GWMOF6 has been evaluated by high-pressure single-crystal X-ray diffraction and spectroscopic techniques. The results from this study show that this complex lanthanide framework structure undergoes three phase transitions within the 0-4 GPa pressure range that involve alterations in the number of symmetry independent Tb3+ ion sites within the crystal lattice. These pressure induced modifications to the structure of Tb-GWMOF6 lead to pronounced changes in the profiles of the 5D4→7F5 emission spectra of this complex.

  4. Terbium Radionuclides for Theranostics Applications: A Focus On MEDICIS-PROMED (United States)

    Cavaier, R. Formento; Haddad, F.; Sounalet, T.; Stora, T.; Zahi, I.

    A new facility, named CERN-MEDICIS, is under construction at CERN to produce radionuclides for medical applications. In parallel, the MEDICIS-PROMED, a Marie Sklodowska-Curie innovative training network of the Horizon 2020 European Commission's program, is being coordinated by CERN to train young scientists on the production and use of innovative radionuclides and develop a network of experts within Europe. One program within MEDICIS-PROMED is to determine the feasibility of producing innovative radioisotopes for theranostics using a commercial middle-sized high-current cyclotron and the mass separation technology developed at CERN-MEDICIS. This will allow the production of high specific activity radioisotopes not achievable with the common post-processing by chemical separation. Radioisotopes of scandium, copper, arsenic and terbium have been identified. Preliminary studies of activation yield and irradiation parameters optimization for the production of Tb-149 will be described.

  5. Dielectric and conducting behavior of gadolinium-terbium fumarate heptahydrate crystals (United States)

    Shah, M. D.; Want, B.


    Gadolinium-terbium fumarate heptahydrate crystals were grown in silica gel by using single gel diffusion technique. The crystals were characterized by different physico-chemical techniques of characterization. Powder X-ray diffraction results showed that the grown material is purely crystalline in nature. Elemental analyses suggested the chemical formula of the compound to be Gd Tb (C4H2O4)3ṡ7H2O. Energy dispersive X-ray analysis confirmed the presence of Gd and Tb in the title compound. The dielectric and conductivity studies of the grown compound were carried as function of frequency of applied field and the temperature. The grown material showed a dielectric anomaly which was correlated with its thermal behavior. The ac conductivity of the material showed Jonscher's power law behavior: σ(ω)=σo+Aωs, with a temperature-dependent power exponent s(<1). The conductivity was found to be a function of temperature and frequency.

  6. Highly sensitive detection of dipicolinic acid with a water-dispersible terbium-metal organic framework. (United States)

    Bhardwaj, Neha; Bhardwaj, Sanjeev; Mehta, Jyotsana; Kim, Ki-Hyun; Deep, Akash


    The sensitive detection of dipicolinic acid (DPA) is strongly associated with the sensing of bacterial organisms in food and many types of environmental samples. To date, the demand for a sensitive detection method for bacterial toxicity has increased remarkably. Herein, we investigated the DPA detection potential of a water-dispersible terbium-metal organic framework (Tb-MOF) based on the fluorescence quenching mechanism. The Tb-MOF showed a highly sensitive ability to detect DPA at a limit of detection of 0.04nM (linear range of detection: 1nM to 5µM) and also offered enhanced selectivity from other commonly associated organic molecules. The present study provides a basis for the application of Tb-MOF for direct, convenient, highly sensitive, and specific detection of DPA in the actual samples. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. A New Bis(phthalocyaninato) Terbium Single-Ion Magnet with an Overall Excellent Magnetic Performance. (United States)

    Chen, Yuxiang; Ma, Fang; Chen, Xiaoxiang; Dong, Bowei; Wang, Kang; Jiang, Shangda; Wang, Chiming; Chen, Xin; Qi, Dongdong; Sun, Haoling; Wang, Bingwu; Gao, Song; Jiang, Jianzhuang


    Bulky and strong electron-donating dibutylamino groups were incorporated onto the peripheral positions of one of the two phthalocyanine ligands in the bis(phthalocyaninato) terbium complex, resulting in the isolation of heteroleptic double-decker (Pc)Tb{Pc[N(C4H9)2]8} {Pc = phthalocyaninate; Pc[N(C4H9)2]8 = 2,3,9,10,16,17,23,24-octakis(dibutylamino)phthalocyaninate} with the nature of an unsymmetrical molecular structure, a square-antiprismatic coordination geometry, an intensified coordination field strength, and the presence of organic radical-f interaction. As a total result of all these factors, this sandwich-type tetrapyrrole lanthanide single-ion magnet (SIM) exhibits an overall enhanced magnetic performance including a high blocking temperature (TB) of 30 K and large effective spin-reversal energy barrier of Ueff = 939 K, rendering it the best sandwich-type tetrapyrrole lanthanide SIM reported thus far.

  8. Ultralarge magneto-optic rotations and rotary dispersion in terbium gallium garnet single crystal. (United States)

    Shaheen, Amrozia; Majeed, Hassaan; Anwar, Muhammad Sabieh


    We report systematically acquired data on the Verdet constant of terbium gallium garnet for wavelengths ranging from visible to near-infrared (405-830 nm) regime. Our experimental method of Stokes polarimetry is based on the Fourier decomposition of the received light intensity and allows unambiguous determination of both the Faraday rotation and the ellipticity of the emergent light. Temperature-dependent investigations in the range of 8-300 K extend earlier reports and verify the Verdet's constant direct dependence on the magnetization, whose first-order approximation is simply a manifestation of the Curie's law. Further, a least-squares fitting of the experimental data correlates well with theoretical predictions. At a wavelength of 405 nm and temperature of 8 K, the rotation is approximately 500°.

  9. Terbium fluorescence as a sensitive, inexpensive probe for UV-induced damage in nucleic acids

    Energy Technology Data Exchange (ETDEWEB)

    El-Yazbi, Amira F.; Loppnow, Glen R., E-mail:


    Graphical abstract: -- Highlights: •Simple, inexpensive, mix-and-read assay for positive detection of DNA damage. •Recognition of undamaged DNA via hybridization to a hairpin probe. •Terbium(III) fluorescence reports the amount of damage by binding to ssDNA. •Tb/hairpin is a highly selective and sensitive fluorescent probe for DNA damage. -- Abstract: Much effort has been focused on developing methods for detecting damaged nucleic acids. However, almost all of the proposed methods consist of multi-step procedures, are limited, require expensive instruments, or suffer from a high level of interferences. In this paper, we present a novel simple, inexpensive, mix-and-read assay that is generally applicable to nucleic acid damage and uses the enhanced luminescence due to energy transfer from nucleic acids to terbium(III) (Tb{sup 3+}). Single-stranded oligonucleotides greatly enhance the Tb{sup 3+} emission, but duplex DNA does not. With the use of a DNA hairpin probe complementary to the oligonucleotide of interest, the Tb{sup 3+}/hairpin probe is applied to detect ultraviolet (UV)-induced DNA damage. The hairpin probe hybridizes only with the undamaged DNA. However, the damaged DNA remains single-stranded and enhances the intrinsic fluorescence of Tb{sup 3+}, producing a detectable signal directly proportional to the amount of DNA damage. This allows the Tb{sup 3+}/hairpin probe to be used for sensitive quantification of UV-induced DNA damage. The Tb{sup 3+}/hairpin probe showed superior selectivity to DNA damage compared to conventional molecular beacons probes (MBs) and its sensitivity is more than 2.5 times higher than MBs with a limit of detection of 4.36 ± 1.2 nM. In addition, this probe is easier to synthesize and more than eight times cheaper than MBs, which makes its use recommended for high-throughput, quantitative analysis of DNA damage.

  10. Fine- and hyperfine structure investigations of even configuration system of atomic terbium (United States)

    Stefanska, D.; Elantkowska, M.; Ruczkowski, J.; Furmann, B.


    In this work a parametric study of the fine structure (fs) and the hyperfine structure (hfs) for the even-parity configurations of atomic terbium (Tb I) is presented, based in considerable part on the new experimental results. Measurements on 134 spectral lines were performed by laser induced fluorescence (LIF) in a hollow cathode discharge lamp; on this basis, the hyperfine structure constants A and B were determined for 52 even-parity levels belonging to the configurations 4f85d6s2, 4f85d26s or 4f96s6p; in all the cases those levels were involved in the transitions investigated as the lower levels. For 40 levels the hfs was examined for the first time, and for the remaining 12 levels the new measurements supplement our earlier results. As a by-product, also preliminary values of the hfs constants for 84 odd-parity levels were determined (the investigations of the odd-parity levels system in the terbium atom are still in progress). This huge amount of new experimental data, supplemented by our earlier published results, were considered for the fine and hyperfine structure analysis. A multi-configuration fit of 7 configurations was performed, taking into account second-order of perturbation theory, including the effects of closed shell-open shell excitations. Predicted values of the level energies, as well as of magnetic dipole and electric quadrupole hyperfine structure constants A and B, are quoted in cases when no experimental values are available. By combining our experimental data with our own semi-empirical procedure it was possible to identify correctly the lower and upper level of the line 544.1440 nm measured by Childs with the use of the atomic-beam laser-rf double-resonance technique (Childs, J Opt Soc Am B 9;1992:191-6).

  11. 33 CFR 147.1112 - Platform HIDALGO safety zone. (United States)


    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Platform HIDALGO safety zone. 147.1112 Section 147.1112 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OUTER CONTINENTAL SHELF ACTIVITIES SAFETY ZONES § 147.1112 Platform HIDALGO safety zone. (a...

  12. 19 CFR 147.13 - Transfer to fair building. (United States)


    ... TREASURY (CONTINUED) TRADE FAIRS Procedure for Importation § 147.13 Transfer to fair building. (a... 19 Customs Duties 2 2010-04-01 2010-04-01 false Transfer to fair building. 147.13 Section 147.13... to articles for a fair. (b) After entry. Upon the entry being made, a permit may be issued by the...

  13. 19 CFR 147.33 - Reimbursement by fair operator. (United States)


    ... THE TREASURY (CONTINUED) TRADE FAIRS Customs Supervision § 147.33 Reimbursement by fair operator. All... 19 Customs Duties 2 2010-04-01 2010-04-01 false Reimbursement by fair operator. 147.33 Section 147... reimbursed by the fair operator to the Government, payment to be made on demand to the port director for...

  14. 19 CFR 147.44 - Entry for another fair. (United States)


    ... TREASURY (CONTINUED) TRADE FAIRS Disposition of Articles Entered for Fairs § 147.44 Entry for another fair. Articles entered for a fair which are to be entered for another fair under the provisions of this part... 19 Customs Duties 2 2010-04-01 2010-04-01 false Entry for another fair. 147.44 Section 147.44...

  15. 40 CFR 147.2907 - Confidentiality of information. (United States)


    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Confidentiality of information. 147.2907 Section 147.2907 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER... Mineral Reserve-Class II Wells § 147.2907 Confidentiality of information. (a) The following information...

  16. 32 CFR 147.4 - Guideline B-Foreign influence. (United States)


    ... 32 National Defense 1 2010-07-01 2010-07-01 false Guideline B-Foreign influence. 147.4 Section 147... Adjudication § 147.4 Guideline B—Foreign influence. (a) The concern. A security risk may exist when an... affection, influence, or obligation are not citizens of the Untied States or may be subject to duress. These...

  17. 33 CFR 147.831 - Holstein Truss Spar safety zone. (United States)


    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Holstein Truss Spar safety zone. 147.831 Section 147.831 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OUTER CONTINENTAL SHELF ACTIVITIES SAFETY ZONES § 147.831 Holstein Truss Spar safety zone. (a) Description. Holstein, Green Canyon 645 ...

  18. 19 CFR 147.31 - Articles to be kept separate. (United States)


    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Articles to be kept separate. 147.31 Section 147... THE TREASURY (CONTINUED) TRADE FAIRS Customs Supervision § 147.31 Articles to be kept separate. Articles for exhibit at a fair shall be segregated from domestic articles and from imported articles...

  19. Structural and optical characterization of terbium doped ZnGa2O4 thin films deposited by RF magnetron sputtering (United States)

    Somasundaram, K.; Girija, K. G.; Sudarsan, V.; Selvin, P. Christopher; Vatsa, R. K.


    Tb3+ doped ZnGa2O4 nanophosphor (21 nm) has been synthesized via low temperature polyol route and subsequently thin films of the same were deposited on glass and ITO substrates by RF magnetron sputtering. The films were characterized by X-ray Diffraction and luminescence measurements. The XRD pattern showed that Tb3+ doped ZnGa2O4 nanophosphor has a cubic spinel phase. Luminescence behavior of the nanophosphor and as deposited sputtered film was investigated. The PL emission spectra of nanophosphor gave a broad ZnGa2O4 host emission band along with a strong terbium emission and the thin films showed only broad host emission band and there was no terbium ion emission.

  20. Determination of fluoxetine in pharmaceutical and biological samples based on the silver nanoparticle enhanced fluorescence of fluoxetine-terbium complex. (United States)

    Lotfi, Ali; Manzoori, Jamshid L


    In this study, a simple and sensitive spectrofluorimetric method is presented for the determination of fluoxetine based on the enhancing effect of silver nanoparticles (AgNPs) on the terbium-fluoxetine fluorescence emission. The AgNPs were prepared by a simple reduction method and characterized by UV-Vis spectroscopy and transmission electron microscopy. It was indicated that these AgNPs have a remarkable amplifying effect on the terbium-sensitized fluorescence of fluoxetine. The effects of various parameters such as AgNP and Tb(3+) concentration and the pH of the media were investigated. Under obtained optimal conditions, the fluorescence intensity of the terbium-fluoxetine-AgNP system was enhanced linearly by increasing the concentration of fluoxetine in the range of 0.008 to 19 mg/L. The limit of detection (b + 3s) was 8.3 × 10(-4) mg/L. The interference effects of common species found in real samples were also studied. The method had good linearity, recovery, reproducibility and sensitivity, and was satisfactorily applied for the determination of fluoxetine in tablet formulations, human urine and plasma samples. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  1. Neutron Diffraction and Electrical Transport Studies on Magnetic Transition in Terbium at High Pressures and Low Temperatures (United States)

    Thomas, Sarah; Montgomery, Jeffrey; Tsoi, Georgiy; Vohra, Yogesh; Weir, Samuel; Tulk, Christopher; Moreira Dos Santos, Antonio


    Neutron diffraction and electrical transport measurements have been carried out on the heavy rare earth metal terbium at high pressures and low temperatures in order to elucidate its transition from a helical antiferromagnetic to a ferromagnetic ordered phase as a function of pressure. The electrical resistance measurements using designer diamonds show a change in slope as the temperature is lowered through the ferromagnetic Curie temperature. The temperature of the ferromagnetic transition decreases at a rate of -16.7 K/GPa till 3.6 GPa, where terbium undergoes a structural transition from hexagonal close packed (hcp) to an α-Sm phase. Above this pressure, the electrical resistance measurements no longer exhibit a change in slope. In order to confirm the change in magnetic phase suggested by the electrical resistance measurements, neutron diffraction measurements were conducted at the SNAP beamline at the Oak Ridge National Laboratory. Measurements were made at pressures to 5.3 GPa and temperatures as low as 90 K. An abrupt increase in peak intensity in the neutron diffraction spectra signaled the onset of magnetic order below the Curie temperature. A magnetic phase diagram of rare earth metal terbium will be presented to 5.3 GPa and 90 K based on these studies.

  2. Study of Silver Nanoparticles Sensitized Fluorescence and Second-Order Scattering of Terbium(III-Pefloxacin Mesylate Complex and Determination of Pefloxacin Mesylate

    Directory of Open Access Journals (Sweden)

    Aiyun Li


    Full Text Available α-Keto acid of pefloxacin mesylate (PFLX can form the complex with Terbium(III. The intramolecular energy from PFLX to Terbium(III ion takes place when excited, and thus Terbium(III excited state is formed and then emits the characteristic fluorescence of Terbium(III, locating at 490, 545, 580, and 620 nm. The second-order scattering (SOS peak at 545 nm also appears for the complex with the exciting wavelength of 273 nm. When the silver nanoparticles are added to the system, the luminescence intensity at 545 nm greatly increased. So, with the adding of nanoparticles to the Terbium(III-PFLX complex, not only is the intramolecular energy promoted but also the SOS intensity is enhanced. The experimental results show that it is the silver nanoparticles with certain size and certain concentration which can greatly enhance the fluorescence-SOS intensity, and the relative intensity at 545 nm is proportional to the amount of PFLX. Based on this phenomenon, a novel method for the determination of PFLX has been developed and applied to the determination of PFLX in capsule and serum samples.

  3. Influence of crystalline structure on the luminescence properties of terbium orthotantalates

    Energy Technology Data Exchange (ETDEWEB)

    Siqueira, Kisla P.F. [Departamento de Química, Universidade Federal de Ouro Preto, Campus Morro do Cruzeiro, ICEB II, Ouro Preto 35400-000, Minas Gerais (Brazil); Carmo, Alexandre P. [Instituto Federal Fluminense, Campus Cabo Frio, RJ 28909-971 (Brazil); Bell, Maria J.V. [Departamento de Física, Universidade Federal de Juiz de Fora, Juiz de Fora 36036-330, MG (Brazil); Dias, Anderson, E-mail: [Departamento de Química, Universidade Federal de Ouro Preto, Campus Morro do Cruzeiro, ICEB II, Ouro Preto 35400-000, Minas Gerais (Brazil)


    Terbium orthotantalate powders were produced with M-fergusonite type (I2/a) and M′-fergusonite type (P2/a) structures. The samples were studied by X-ray diffraction, Raman scattering, and photoluminescence measurements (emission and decay curves). The results showed that crystalline materials were obtained with all the 18 Raman-active modes predicted by group theory calculations. Also, it was observed through photoluminescence decay curves that the Tb{sup 3+} ions occupies only one-symmetry site in both crystallographic arrangements. Photoluminescence emission curves exhibited some variation in spectral shape, peak position, and relative intensity as a consequence of their different crystalline arrangements. The dominated emission of Tb{sup 3+} ({sup 5}D{sub 4}→{sup 7}F{sub 5}) is centered with a maximum intensity at 549.2 nm (M-type) and 543.0 nm (M′-type). Fluorescence lifetimes for M-TbTaO{sub 4} and M′-TbTaO{sub 4} were determined as 33.4 μs and 1.25 ms, respectively. M′-type materials seems to be the most suitable for luminescent devices and could be a potential green luminescent material due to the strongest emission if compared with the M-fergusonite type. -- Highlights: ► Terbium orthotantalates were prepared in two different crystalline structures: I2/a and P2/a. ► XRD and Raman scattering showed that the different space groups obtained were exhibited all the 18 Raman-active modes. ► PL decay curves that the Tb{sup 3+} ions occupies only one-symmetry site in both crystallographic arrangements. ► Dominated emission of Tb{sup 3+} ({sup 5}D{sub 4}→{sup 7}F{sub 5}) is centered with a maximum intensity at 549 nm (M-type) and 543 nm (M′-type). ► Fluorescence lifetimes for M-TbTaO{sub 4} and M′-TbTaO{sub 4} were determined as 33.4 μs and 1.25 ms, respectively.

  4. Laser control and temperature switching of luminescence intensity in photostable transparent film based on terbium(III) β-diketonate complex (United States)

    Lapaev, Dmitry V.; Nikiforov, Victor G.; Safiullin, Georgy M.; Lobkov, Vladimir S.; Salikhov, Kev M.; Knyazev, Andrey A.; Galyametdinov, Yury G.


    The study of the terbium(III) and gadolinium(III) β-diketonate complexes by photoluminescence spectroscopy reveals considerable changes of the photophysical properties of the complexes under the UV laser irradiation. The measurements show the enhancement of the luminescence intensities in the vitrified transparent film of the terbium(III) complex as well as the gadolinium(III) complex under the 337 nm laser irradiation at room temperature. The irradiated film of the terbium(III) complex restores the initial photophysical properties after heating close to the melting temperature (∼353 K) and cooling. We observe no change of the luminescent properties of the irradiated film for months. These features can be used for the design of new lanthanide-based photostable systems with laser control of the luminescence intensity.

  5. 14 CFR Appendix B to Part 147 - General Curriculum Subjects (United States)


    ...) SCHOOLS AND OTHER CERTIFICATED AGENCIES AVIATION MAINTENANCE TECHNICIAN SCHOOLS Pt. 147, App. B Appendix B.... (3) 27. Perform algebraic operations involving addition, subtraction, multiplication, and division of...

  6. Development of functionalized terbium fluorescent nanoparticles for antibody labeling and time-resolved fluoroimmunoassay application. (United States)

    Ye, Zhiqiang; Tan, Mingqian; Wang, Guilan; Yuan, Jingli


    Silica-based functionalized terbium fluorescent nanoparticles were prepared, characterized and developed as a fluorescence probe for antibody labeling and time-resolved fluoroimmunoassay. The nanoparticles were prepared in a water-in-oil (W/O) microemulsion containing a strongly fluorescent Tb(3+) chelate, N,N,N(1),N(1)-[2,6-bis(3'-aminomethyl-1'-pyrazolyl)phenylpyridine] tetrakis(acetate)-Tb(3+) (BPTA-Tb(3+)), Triton X-100, octanol, and cyclohexane by controlling copolymerization of tetraethyl orthosilicate (TEOS) and 3-[2-(2-aminoethylamino)ethylamino]propyl-trimethoxysilane (AEPS) with ammonia water. The characterizations by transmission electron microscopy and fluorometric methods show that the nanoparticles are spherical and uniform in size, 45 +/- 3nm in diameter, strongly fluorescent with fluorescence quantum yield of 10% and a long fluorescence lifetime of 2.0ms. The amino groups directly introduced to the nanoparticle's surface by using AEPS in the preparation made the surface modification and bioconjugation of the nanoparticles easier. The nanoparticle-labeled anti-human alpha-fetoprotein antibody was prepared and used for time-resolved fluoroimmunoassay of alpha-fetoprotein (AFP) in human serum samples. The assay response is linear from 0.10ngml(-1) to about 100ngml(-1) with the detection limit of 0.10ngml(-1). The coefficient variations (CVs) of the method are less than 9.0%, and the recoveries are in the range of 84-98% for human serum sample measurements.

  7. Highly efficient precipitation of phosphoproteins using trivalent europium, terbium, and erbium ions

    Energy Technology Data Exchange (ETDEWEB)

    Guezel, Yueksel; Rainer, Matthias; Mirza, Munazza Raza; Bonn, Guenther K. [Leopold-Franzens University, Institute of Analytical Chemistry and Radiochemistry, Innsbruck (Austria)


    This study describes a highly efficient method for the selective precipitation of phosphoproteins by trivalent europium, terbium, and erbium metal ions. These metal cations belong to the group of lanthanides and are known to be hard acceptors with an overwhelming preference for oxygen-containing anions such as phosphates to which they form very tight ionic bonds. The method could be successfully applied to specifically precipitate phosphoproteins from complex samples including milk and egg white by forming solid metal-protein complexes. Owing to the low solubility product of the investigated lanthanide salts, the produced metal-protein complexes showed high stability. The protein pellets were extensively washed to remove nonphosphorylated proteins and contaminants. For the analysis of proteins the pellets were first dissolved in 30 % formic acid and subjected to matrix-assisted laser desorption/ionization-time of flight (MALDI-TOF) MS. For peptide mass-fingerprint analysis the precipitated phosphoproteins were enzymatically digested using microwave-assisted digestion. The method was found to be highly specific for the isolation and purification of phosphoproteins. Protein quantification was performed by colorimetric detection of total precipitated phosphoproteins and revealed more than 95 % protein recovery for each lanthanide salt. (orig.)

  8. A Terbium Sensitized Luminescence Method for the Assay of Flubiprofen in Pharmaceutical Formulations

    Directory of Open Access Journals (Sweden)

    Salma M.Z. Al-Kindy


    Full Text Available A sensitive time-resolved luminescence method for the determination of flubiprofen (FLP in methanol and in aqueous solution is described. The method is based on the luminescence sensitization of terbium (Tb3+ by the formation of a ternary complex with FLP in the presence of 4,7 diphenyl 1,10 phenanthroline (DPP as co-ligand, and Tween-20 as surfactant. The signal for Tb-FLP-DPP was monitored at λex  = 285 nm and λem  = 552 nm. Optimum conditions for the formation of the complex in an aqueous system were TRIS buffer, pH 8.0, DPP (2.5Å~10−7  M, Tween-20 (0.30% and 4Å~10-5  mol L-1  of Tb3+  which allowed the determination of 20–1000 ng mL-1  of FLP with a limit of detection (LOD of 10 ng mL-1 . The relative standard deviations of the method ranged between 0.6 and 1.4% indicating excellent reproducibility of the method. The proposed method was successfully applied for the assays of FLP in pharmaceutical formulations and spiked tap water samples with average recoveries of 87% – 95%.

  9. Sensitization effects of supramolecular assemblies on the luminescence of terbium-ion prulifloxacin complexes

    Energy Technology Data Exchange (ETDEWEB)

    Wang Hong; Yi Chongyue; Li Xue; Fang Fang [School of Chemistry and Chemical Engineering, Huazhong University of Science and Technology, Wuhan 430074 (China); Yang Yajiang, E-mail: [School of Chemistry and Chemical Engineering, Huazhong University of Science and Technology, Wuhan 430074 (China)


    Luminescence enhancement of terbium-ion prulifloxacin complexes (Tb(III)-PUFX) in supramolecular hydrogels formed by assembly of 1,3:2,4-di-O-benzylidene-D-sorbitol (DBS) was investigated by steady-state fluorescence, varying temperature fluorescence and time-resolved fluorescence. The luminescence images show that Tb(III)-PUFX were dispersed in the DBS gels. The luminescence intensity of Tb(III)-PUFX in the DBS gels was significantly increased in comparison with that in corresponding aqueous solutions. The varying temperature fluorescent spectra show that the luminescence intensity of Tb(III)-PUFX decreased with an increase in the temperature. This implies that the luminescence enhancement of Tb(III)-PUFX is related to the dissociation and the formation of the DBS assemblies. Time-resolved fluorescence measurements show slower rotational motion in DBS gels in comparison with that in the corresponding aqueous solutions. This may be ascribed to a unique microstructure of three-dimensional network formed by DBC aggregates, resulting in deactivation of the nonradiative relaxation. The images of field emission scanning electron microscopy and polarized optical microscopy indicate that the morphology of the DBS assemblies was not influenced upon addition of Tb(III)-PUFX to the DBS gels.

  10. A Nanoscale Multiresponsive Luminescent Sensor Based on a Terbium(III) Metal-Organic Framework. (United States)

    Dang, Song; Wang, Ting; Yi, Feiyan; Liu, Qinghui; Yang, Weiting; Sun, Zhong-Ming


    A nanoscale terbium-containing metal-organic framework (nTbL), with a layer-like structure and [H2 NMe2 ](+) cations located in the framework channels, was synthesized under hydrothermal conditions. The structure of the as-prepared sample was systematically confirmed by powder XRD and elemental analysis; the morphology was characterized by field-emission SEM and TEM. The photoluminescence studies revealed that rod-like nTbL exhibited bright-green emission, corresponding to (5)D4 →(7)FJ (J=6-3) transitions of the Tb(3+) ion under excitation. Further sensing measurements revealed that as-prepared nTbL could be utilized as a multiresponsive luminescent sensor, which showed significant and exclusive detection ability for Fe(3+) ions and phenylmethanol. These results highlight the practical applications of lanthanide-containing metal-organic frameworks as fluorescent probes. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Terbium-Doped VO2 Thin Films: Reduced Phase Transition Temperature and Largely Enhanced Luminous Transmittance. (United States)

    Wang, Ning; Duchamp, Martial; Dunin-Borkowski, Rafal E; Liu, Shiyu; Zeng, XianTing; Cao, Xun; Long, Yi


    Vanadium dioxide (VO2) is a well-known thermochromic material with large IR modulating ability, promising for energy-saving smart windows. The main drawbacks of VO2 are its high phase transition temperature (τ(c) = 68°C), low luminous transmission (T(lum)), and weak solar modulating ability (ΔT(sol)). In this paper, the terbium cation (Tb(3+)) doping was first reported to reduce τ(c) and increase T(lum) of VO2 thin films. Compared with pristine VO2, 2 at. % doping level gives both enhanced T(lum) and ΔT(sol) from 45.8% to 54.0% and 7.7% to 8.3%, respectively. The T(lum) increases with continuous Tb(3+) doping and reaches 79.4% at 6 at. % doping level, representing ∼73.4% relative increment compared with pure VO2. This has surpassed the best reported doped VO2 thin films. The enhanced thermochromic properties is meaningful for smart window applications of VO2 materials.

  12. Luminescent investigations of terbium(III) biosorption as a surrogate for heavy metals and radionuclides. (United States)

    Achyuthan, Komandoor E; Arango, Dulce C; Carles, Elizabeth L; Cutler, Christopher E; Meyer, Lauren A; Brozik, Susan M


    We describe a metal transport system for investigating the interfacial interactions between the anionic surface charge of a gram-negative bacterium (Escherichia coli) and a trivalent cationic metal, Tb3+. We believe this is the first description of the uptake kinetics, sub- and intracellular distribution, and temporal fate of Tb3+ ion in E. coli. We used the luminescence of the terbium-dipicolinic acid chelate to study metal ion transport. The bacteria had a high tolerance for the metal (IC(50) = 4 mM Tb3+). Metal ion transport was passive and metabolism independent. The uptake kinetics rapidly reached a maximum within 15 min, followed by a stasis for 60 min, and declining thereafter between 120 and 240 min, resulting in a biphasic curve. During this period, greater than one-third of the metal ion was sequestered within the cell. Our choice of a safe Biosafety Level I E. coli bacteria and the relatively non-toxic Tb3+ metal represents a model system for luminescent investigations of biosorption, for studying bacterial-water interfacial chemistry and for the bioremediation of heavy metals and radionuclides.

  13. 40 CFR 147.3009 - Area of review. (United States)


    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Area of review. 147.3009 Section 147.3009 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS (CONTINUED... the times exceeds injection to produce a net withdrawal; or (3) A suitable distance, not less than one...

  14. 41 CFR 105-53.147 - Public Buildings Service. (United States)


    ... space is used more effectively and efficiently; providing leadership in the development and maintenance... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Public Buildings Service. 105-53.147 Section 105-53.147 Public Contracts and Property Management Federal Property Management...

  15. 27 CFR 478.147 - Return of firearm. (United States)


    ... 27 Alcohol, Tobacco Products and Firearms 3 2010-04-01 2010-04-01 false Return of firearm. 478.147 Section 478.147 Alcohol, Tobacco Products, and Firearms BUREAU OF ALCOHOL, TOBACCO, FIREARMS, AND EXPLOSIVES, DEPARTMENT OF JUSTICE FIREARMS AND AMMUNITION COMMERCE IN FIREARMS AND AMMUNITION Exemptions...

  16. 32 CFR 147.9 - Guideline G-Alcohol consumption. (United States)


    ... 32 National Defense 1 2010-07-01 2010-07-01 false Guideline G-Alcohol consumption. 147.9 Section... Adjudication § 147.9 Guideline G—Alcohol consumption. (a) The concern. Excessive alcohol consumption often... worker who is a staff member of a recognized alcohol treatment program; (5) Habitual or binge consumption...

  17. 21 CFR 133.147 - Grated American cheese food. (United States)


    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Grated American cheese food. 133.147 Section 133...) FOOD FOR HUMAN CONSUMPTION CHEESES AND RELATED CHEESE PRODUCTS Requirements for Specific Standardized Cheese and Related Products § 133.147 Grated American cheese food. (a)(1) Grated American cheese food is...

  18. 40 CFR 147.1 - Purpose and scope. (United States)


    ... provisions of 40 CFR parts 124, 144, 145 and 146. A Federally-administered program is promulgated in those... of 40 CFR parts 124, 144, 146, and 148, and any other additional requirements pertinent to the... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Purpose and scope. 147.1 Section 147.1...

  19. 45 CFR 147.130 - Coverage of preventive health services. (United States)


    ... 45 Public Welfare 1 2010-10-01 2010-10-01 false Coverage of preventive health services. 147.130... § 147.130 Coverage of preventive health services. (a) Services—(1) In general. Beginning at the time... rating of A or B in the current recommendations of the United States Preventive Services Task Force with...

  20. 40 CFR 147.3005 - Radioactive waste injection wells. (United States)


    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Radioactive waste injection wells. 147... the Navajo, Ute Mountain Ute, and All Other New Mexico Tribes § 147.3005 Radioactive waste injection... dispose of radioactive waste (as defined in 10 CFR part 20, appendix B, table II, but not including high...

  1. 40 CFR 147.2921 - Schedule of compliance. (United States)


    ...-Class II Wells § 147.2921 Schedule of compliance. The permit may, when appropriate, specify a schedule... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Schedule of compliance. 147.2921.... (a) Any schedule of compliance shall require compliance as soon as possible, and in no case later...

  2. 40 CFR 98.147 - Records that must be retained. (United States)


    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Records that must be retained. 98.147... (CONTINUED) MANDATORY GREENHOUSE GAS REPORTING Glass Production § 98.147 Records that must be retained. In addition to the information required by § 98.3(g), you must retain the records listed in paragraphs (a), (b...

  3. 14 CFR 147.21 - General curriculum requirements. (United States)


    ... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false General curriculum requirements. 147.21... Requirements § 147.21 General curriculum requirements. (a) An applicant for an aviation maintenance technician school certificate and rating, or for an additional rating, must have an approved curriculum that is...

  4. 14 CFR 147.38 - Maintenance of curriculum requirements. (United States)


    ... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Maintenance of curriculum requirements. 147... § 147.38 Maintenance of curriculum requirements. (a) Each certificated aviation maintenance technician school shall adhere to its approved curriculum. With FAA approval, curriculum subjects may be taught at...

  5. 19 CFR 147.43 - Entry under the Customs laws. (United States)


    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Entry under the Customs laws. 147.43 Section 147.43 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF... the Customs laws. (a) Payment of duties and taxes. Any applicable duties and internal revenue taxes on...

  6. 9 CFR 147.22 - Hatching egg sanitation. (United States)


    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Hatching egg sanitation. 147.22... AGRICULTURE LIVESTOCK IMPROVEMENT AUXILIARY PROVISIONS ON NATIONAL POULTRY IMPROVEMENT PLAN Sanitation Procedures § 147.22 Hatching egg sanitation. Hatching eggs should be collected from the nests at frequent...

  7. 33 CFR 147.1104 - Platform ELLEN & ELLY safety zone. (United States)


    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Platform ELLEN & ELLY safety zone. 147.1104 Section 147.1104 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY... serving either structure, (2) a vessel under 100 feet in length overall not engaged in towing, or (3) a...

  8. 7 CFR 762.147 - Servicing shared appreciation agreements. (United States)


    ... service the account in accordance with § 762.149. (4) Paying the Agency. Any shared appreciation... 7 Agriculture 7 2010-01-01 2010-01-01 false Servicing shared appreciation agreements. 762.147 Section 762.147 Agriculture Regulations of the Department of Agriculture (Continued) FARM SERVICE AGENCY...

  9. Construction of the energy matrix for complex atoms. Part VIII: Hyperfine structure HPC calculations for terbium atom (United States)

    Elantkowska, Magdalena; Ruczkowski, Jarosław; Sikorski, Andrzej; Dembczyński, Jerzy


    A parametric analysis of the hyperfine structure (hfs) for the even parity configurations of atomic terbium (Tb I) is presented in this work. We introduce the complete set of 4fN-core states in our high-performance computing (HPC) calculations. For calculations of the huge hyperfine structure matrix, requiring approximately 5000 hours when run on a single CPU, we propose the methods utilizing a personal computer cluster or, alternatively a cluster of Microsoft Azure virtual machines (VM). These methods give a factor 12 performance boost, enabling the calculations to complete in an acceptable time.

  10. Spectrofluorimetric determination of human serum albumin using terbium-danofloxacin probe. (United States)

    Ramezani, Amir M; Manzoori, Jamshid L; Amjadi, Mohammad; Jouyban, Abolghasem


    A spectrofluorimetric method is proposed for the determination of human serum albumin (HSA) and bovine serum albumin (BSA) using terbium-danofloxacin (Tb(3+)-Dano) as a fluorescent probe. These proteins remarkably enhance the fluorescence intensity of the Tb(3+)-Dano complex at 545 nm, and the enhanced fluorescence intensity of Tb(3+)-Dano is proportional to the concentration of proteins (HSA and BSA). Optimum conditions for the determination of HSA were investigated and found that the maximum response was observed at: pH = 7.8, [Tb(3+)] = 8.5 × 10(-5) mol L(-1), [Dano] = 1.5 × 10(-4) mol L(-1). The calibration graphs for standard solutions of BSA, HSA, and plasma samples of HSA were linear in the range of 0.2 × 10(-6) - 1.3 × 10(-6) mol L(-1), 0.2 × 10(-6) - 1.4 × 10(-6) mol L(-1), and 0.2 × 10(-6) - 1 × 10(-6) mol L(-1), respectively. The detection limits (S/N = 3) for BSA, HSA, and plasma sample of HSA were 8.7 × 10(-8) mol L(-1), 6.2 × 10(-8) mol L(-1), and 8.1 × 10(-8) mol L(-1), respectively. The applicability of the method was checked using a number of real biological plasma samples and was compared with the UV spectrometric reference method. The results was showed that the method could be regarded as a simple, practical, and sensitive alternative method for determination of albumin in biological samples.

  11. Spectrofluorimetric Determination of Human Serum Albumin Using Terbium-Danofloxacin Probe

    Directory of Open Access Journals (Sweden)

    Amir M. Ramezani


    Full Text Available A spectrofluorimetric method is proposed for the determination of human serum albumin (HSA and bovine serum albumin (BSA using terbium-danofloxacin (Tb3+-Dano as a fluorescent probe. These proteins remarkably enhance the fluorescence intensity of the Tb3+-Dano complex at 545 nm, and the enhanced fluorescence intensity of Tb3+-Dano is proportional to the concentration of proteins (HSA and BSA. Optimum conditions for the determination of HSA were investigated and found that the maximum response was observed at: pH=7.8, [Tb3+] =8.5×10−5 mol L−1, [Dano] =1.5×10−4 mol L−1. The calibration graphs for standard solutions of BSA, HSA, and plasma samples of HSA were linear in the range of 0.2×10−6−1.3×10−6 mol L−1, 0.2×10−6−1.4×10−6 mol L−1, and 0.2×10−6−1×10−6 mol L−1, respectively. The detection limits (S/N = 3 for BSA, HSA, and plasma sample of HSA were 8.7×10−8 mol L−1, 6.2×10−8 mol L−1, and 8.1×10−8 mol L−1, respectively. The applicability of the method was checked using a number of real biological plasma samples and was compared with the UV spectrometric reference method. The results was showed that the method could be regarded as a simple, practical, and sensitive alternative method for determination of albumin in biological samples.

  12. Determination of flavonoids in pharmaceutical preparations using Terbium sensitized fluorescence method

    Directory of Open Access Journals (Sweden)

    M Shaghaghi


    Full Text Available "nBackground and the Purpose of the Study: The aim of this study was development and validation of a simple, rapid and sensitive spectrofluorimetric method for determination of total flavonoids in two topical formulations of Calendula officinalis, Ziziphus Spina-christi and an oral drop of Hypiran perforatum L. The proposed method is based on the formation of terbium (Tb3+ "n-flavonoids (quercetin as a reference standard complex at pH 7.0, which has fluorescence intensely with maximum emission at 545 nm when excited at 310 nm. "nMethod "n: For ointments masses of topical formulations were weighed and added to ethanol-aqueous buffer (pH 10.0 and the resulting mixtures were shaken and then two phases were separated by centrifugation. Aqueous phases were filtered and then diluted with water. For Hypiran drops an appropriate portion was diluted with ethanol and then aliquots of sample or standard solutions were determined according to the experimental procedure. "nResults "n: Under the optimum conditions, total concentrations of flavonoids (as quercetin equivalent in three tested formulations were found to be 0.204 mg/g (for Dermatin cream, 0.476 mg/g (for Calendula ointment and 13.50 μg/ml (for Hypiran drops. Analytical recoveries from samples spiked with different amounts of quercetin were 96.1-104.0 % with RSD % of less than 3.5. Conclusion : The proposed method which requires a simple dissolution step without any matrix interferences provided high sensitivity and selectivity and was easily applied to determine total flavonoids in real samples of three investigated formulations with excellent reproducibility.

  13. TOF SIMS analysis and generation of white photoluminescence from strontium silicate codoped with europium and terbium

    Energy Technology Data Exchange (ETDEWEB)

    Tshabalala, Modiehi A.; Swart, Hendrik C.; Ntwaeaborwa, Odireleng M., E-mail: [Department of Physics, University of the Free State, P.O Box 339, Bloemfontein 9300 South Africa (South Africa)


    White light emitting terbium (Tb{sup 3+}) and europium (Eu{sup 3+}) codoped strontium silicate (Sr{sub 2}SiO{sub 4}) phosphors were prepared by a solid state reaction process. The structure, particle morphology, chemical composition, ion distribution, photoluminescence (PL), and decay characteristics of the phosphors were analyzed by x-ray diffraction (XRD), scanning electron microscopy (SEM), time-of-flight secondary ion mass spectrometry (TOF-SIMS), and PL spectroscopy, respectively. The XRD data showed that our Sr{sub 2}SiO{sub 4} composed of two phases, namely, β-Sr{sub 2}SiO{sub 4} and α′-Sr{sub 2}SiO{sub 4}, and the α′-Sr{sub 2}SiO{sub 4} phase was more prominent than the β-Sr{sub 2}SiO{sub 4} phase. The SEM micrographs showed that the particles were agglomerated together and they did not have definite shapes. All ions (i.e., negative and positive) present in our materials were identified by TOF-SIMS. In addition, the chemical imaging performed with the TOF-SIMS demonstrated how the individual ions including the dopants (Eu{sup 3+} and Tb{sup 3+}) were distributed in the host lattice. White photoluminescence was observed when the Sr{sub 2}SiO{sub 4}:Tb{sup 3+}, Eu{sup 3+} phosphor was excited at 239 nm using a monochromatized xenon lamp as the excitation source. The phosphor exhibited fast decay lifetimes implying that it is not a good candidate for long afterglow applications.

  14. Synthesis, crystal structure and photophysical properties of europium(III) and terbium(III) complexes with pyridine-2,6-dicarboxamide

    NARCIS (Netherlands)

    Tanase, S.; Gallego, P.M.; Gelder, R. de; Fu, W.T.


    The reactions of pyridine-2,6-dicarboxamide with europium(III) and terbium(III) triflates led to the formation of mononuclear complexes of formula [Ln(pcam)(3)](CF3SO3)(3) (Ln = Eu 1, Tb 2; pcam stands for pyridine-2,6-dicarboxamide). From single-crystal X-ray diffraction analysis, the complexes

  15. Zinc sulfide and terbium-doped zinc sulfide films grown by traveling wave reactor atomic layer epitaxy

    CERN Document Server

    Yun, S J; Nam, K S


    Zinc sulfide (ZnS) and terbium-doped ZnS (ZnS:Tb) thin films were grown by traveling wave reactor atomic layer epitaxy (ALE). In the present work, ZnCl sub 2 , H sub 2 S, and tris (2,2,6,6-tetramethyl-3,5-heptandionato) terbium (Tb(tmhd) sub 3) were used as the precursors. The dependence of crystallinity and Cl content of ZnS films was investigated on the growth temperature. ZnS and ZnS:Tb films grown at temperatures ranging from 400 to 500 .deg. C showed a hexagonal-2H crystalline structure. The crystallinity of ZnS film was greatly enhanced as the temperature increased. At growth temperatures higher than 450.deg.C, the films showed preferred orientation with mainly (002) diffraction peak. The Cl content decreased from approximately 9 to 1 at.% with the increase in growth temperature from 400 to 500 .deg. C. The segregation of Cl near the surface region and the incorporation of O from Tb(tmhd) sub 3 during ALE process were also observed using Auger electron spectroscopy. The ALE-grown ZnS and ZnS:Tb films re...

  16. Commercializing potassium terbium fluoride, KTF (KTb3F10) faraday crystals for high laser power optical isolator applications (United States)

    Schlichting, Wolfgang; Stevens, Kevin; Foundos, Greg; Payne, Alexis


    Many scientific lasers and increasingly industrial laser systems operate in power regime, require high-performance optical isolators to prevent disruptive light feedback into the laser cavity. The optically active Faraday material is the key optical element inside the isolator. SYNOPTICS has been supplying the laser market with Terbium Gallium Garnet (TGG - Tb3Ga5O12) for many years. It is the most commonly used material for the 650-1100nm range and the key advantages for TGG include its cubic crystal structure for alignment free processing, little to no intrinsic birefringence, and ease of manufacture. However, for high-power laser applications TGG is limited by its absorption at 1064nm and its thermo-optic coefficient, dn/dT. Specifically, thermal lensing and depolarization effects become a limiting factor at high laser powers. While TGG absorption has improved significantly over the past few years, there is an intrinsic limit. Now, SYNOPTICS is commercializing the enhanced new crystal Potassium Terbium Fluoride KTF (KTb3F10) that exhibits much smaller nonlinear refractive index and thermo-optic coefficients, and still exhibits a Verdet constant near that of TGG. This cubic crystal has relatively low absorption and thermo-optic coefficients. It is now fully characterized and available for select production orders. At OPTIFAB in October 2017 we present recent results comparing the performance of KTF to TGG in optical isolators and show SYNOPTICS advances in large volume crystal growth and the production ramp up.

  17. Preparation and photoluminescence enhancement in terbium(III ternary complexes with β-diketone and monodentate auxiliary ligands

    Directory of Open Access Journals (Sweden)

    Devender Singh


    Full Text Available A series of new solid ternary complexes of terbium(III ion based on β-diketone ligand acetylacetone (acac and monodentate auxiliary ligands (aqua/urea/triphenylphosphineoxide/pyridine-N-oxide had been prepared. The structural characterizations of synthesized ternary compounds were studied by means of elemental analysis, infrared (IR, and proton nuclear magnetic resonance (NMR spectral techniques. The optical characteristics were investigated with absorption as well as photoluminescence spectroscopy. Thermal behavior of compounds was examined by TGA/DTA analysis and all metal complexes were found to have good thermal stability. The luminescence decay time of complexes were also calculated by monitoring at emission wavelength corresponding to 5D4 → 7F5 transition. A comparative inspection of the luminescent behavior of prepared ternary compounds was performed in order to determine the function of auxiliary ligands in the enhancement of luminescence intensity produced by central terbium(III ion. The color coordinates values suggested that compounds showed bright green emission in visible region in electromagnetic spectrum. Complexes producing green light could play a significant role in the fabrication of efficient light conversion molecular devices for display purposes and lightning systems.

  18. 7 CFR 58.147 - Insect and rodent control program. (United States)



  19. Synthesis and luminescent study of Ce{sup 3+}-doped terbium-yttrium aluminum garnet

    Energy Technology Data Exchange (ETDEWEB)

    Dotsenko, V.P., E-mail: [A.V. Bogatsky Physico-Chemical Institute, National Academy of Sciences of Ukraine, Lustdorfskaya doroga 86, 65080 Odessa (Ukraine); Berezovskaya, I.V.; Zubar, E.V.; Efryushina, N.P. [A.V. Bogatsky Physico-Chemical Institute, National Academy of Sciences of Ukraine, Lustdorfskaya doroga 86, 65080 Odessa (Ukraine); Poletaev, N.I.; Doroshenko, Yu.A. [Institute of Combustion and Advanced Technologies, Mechnikov Odessa National University, Dvoryanskaya 2, 65082 Odessa (Ukraine); Stryganyuk, G.B. [Ivan Franko National University of Lviv, Kirilo i Mefodii 8, 79005 Lviv (Ukraine); HASYLAB at DESY, Notkestrasse 85, 22607 Hamburg (Germany); Voloshinovskii, A.S. [Ivan Franko National University of Lviv, Kirilo i Mefodii 8, 79005 Lviv (Ukraine)


    Highlights: Black-Right-Pointing-Pointer Ce{sup 3+}-doped garnets (TYAG) were prepared using nanostructured reagents. Black-Right-Pointing-Pointer The Ce{sup 3+} ions cause a very efficient yellow emission of the samples. Black-Right-Pointing-Pointer The reasons for the long wavelength position of this emission are discussed. Black-Right-Pointing-Pointer Contribution from Al atoms to the conduction band of TYAG is quite essential. - Abstract: Terbium-yttrium aluminum garnets (TYAG) doped with Ce{sup 3+} ions have been prepared by solid state reactions between nanostructured oxides of aluminum and rare earths. The luminescent properties of Ce{sup 3+} ions in (Tb{sub 0.8}Y{sub 0.2}){sub 3(1-x)}Ce{sub 3x}Al{sub 5}O{sub 12} (x = 0.03) have been studied upon excitation in the 2-20 eV region. The substitution of Tb{sup 3+} for Y{sup 3+} in the garnet structure results in broadening the emission band and shifting its maximum towards the longer wavelengths. It was found that in addition to the 4f{sup n} {yields} 4f{sup n-1}5d excitation bands of Ce{sup 3+} and Tb{sup 3+} ions, the excitation spectra for the Ce{sup 3+} emission contain broad bands at 6.73 and {approx}9.5 eV. These bands are attributed to the Ce{sup 3+}-bound exciton formation and O 2p {yields} Al 3s, 3p transitions, respectively. In contrast to the predictions based on the results of electronic structure calculations on Y{sub 3}Al{sub 5}O{sub 12} and Tb{sub 4}Al{sub 2}O{sub 9}, the threshold of interband transitions in TYAG is at high energies ( Greater-Than-Or-Slanted-Equal-To 7.3 eV), and contributions from Al{sub tetr} and Al{sub oct} atoms to the conduction-band density of states are evaluated as quite essential.

  20. Structural variations in terbium(III) complexes with 1,3-adamantanedicarboxylate and diverse co-ligands

    Energy Technology Data Exchange (ETDEWEB)

    Thuéry, Pierre, E-mail:


    Terbium nitrate was reacted with 1,3-adamantanedicarboxylic acid (LH{sub 2}) under solvo-hydrothermal conditions with either N,N-dimethylformamide (DMF) or N,N-dimethylacetamide (DMA) as organic solvents. Hydrolysation of the latter co-solvents resulted in the formation of formate or acetate ions, which are present as co-ligands in the 1D coordination polymer [Tb(L)(HCOO)(H{sub 2}O){sub 2}] (1) and the 2D assembly [Tb(L)(CH{sub 3}COO)(H{sub 2}O)] (2). The increase in dimensionality in the latter arises from the higher connectivity provided by acetate versus formate, the L{sup 2−} ligand being bis-chelating in both cases. The complex [Tb{sub 2}(L){sub 3}(H{sub 2}O){sub 5}][Tb{sub 2}(L){sub 3}(H{sub 2}O){sub 4}]·3H{sub 2}O (3), another 1D species, crystallizes alongside crystals of 2. Further addition of cucurbit[6]uril (CB6), with DMF as co-solvent, gave the two complexes [Tb{sub 2}(L){sub 2}(CB6)(H{sub 2}O){sub 6}](NO{sub 3}){sub 2}·6H{sub 2}O (4) and [H{sub 2}NMe{sub 2}]{sub 2}[Tb(L)(HCOO){sub 2}]{sub 2}·CB6·3H{sub 2}O (5). Complex 4 crystallizes as a 3D framework in which Tb(L){sup +} chains are connected by tetradentate CB6 molecules, while 5 unites a carboxylate-bridged anionic 2D planar assembly and layers of CB6 molecules with counter-cations held at both portals. - Graphical abstract: One- to three-dimensional assemblies are formed in terbium(III) complexes with 1,3-adamantanedicarboxylate obtained under solvo-hydrothermal conditions, these species including formate or acetate co-ligands formed in situ, or additional cucurbit[6]uril molecules. - Highlights: • We report structures of terbium(III) complexes with 1,3-adamantanedicarboxylate. • Solvents able to generate co-ligands or counter-ions in situ have been used. • A 3D species including additional cucurbituril molecules is decribed. • One species displays an alternation of metal–organic and organic sheets.

  1. Complete Stokes polarimetry of magneto-optical Faraday effect in a terbium gallium garnet crystal at cryogenic temperatures. (United States)

    Majeed, Hassaan; Shaheen, Amrozia; Anwar, Muhammad Sabieh


    We report the complete determination of the polarization changes caused in linearly polarized incident light due to propagation in a magneto-optically active terbium gallium garnet (TGG) single crystal, at temperatures ranging from 6.3 to 300 K. A 28-fold increase in the Verdet constant of the TGG crystal is seen as its temperature decreases to 6.3 K. In contrast with polarimetry of light emerging from a Faraday material at room temperature, polarimetry at cryogenic temperatures cannot be carried out using the conventional fixed polarizer-analyzer technique because the assumption that ellipticity is negligible becomes increasingly invalid as temperature is lowered. It is shown that complete determination of light polarization in such a case requires the determination of its Stokes parameters, otherwise inaccurate measurements will result with negative implications for practical devices.

  2. Development of Optical Isolators for Visible Light Using Terbium Aluminum Garnet (Tb3Al5O12) Single Crystals (United States)

    Geho, Mikio; Takagi, Takashi; Chiku, Shinichiro; Fujii, Takashi


    We have recently reported the successful growth of incongruently melting terbium aluminum garnet (Tb3Al5O12; TAG) single crystals by the hybrid laser FZ (floating zone) method. Optical property evaluations confirmed a high transmittance and a larger Verdet constant than conventional Tb3Ga5O12 (TGG) crystals and/or Faraday glasses. In this study, we attempted to design, fabricate, and evaluate optical isolators in visible light through near-infrared (NIR) regions using TAG crystals. A finite element method (FEM) simulation of possible models led us to the preferable one based on a radially magnetized magnet. To realize this, we employed a pseudo-radially magnetized magnet. The target wavelengths of the prototype device were 408, 808, and 1064 nm. The typical extinction ratio was more than 30 dB and the insertion loss was less than 0.3 dB for AR-coated devices.

  3. [Expression and significance of CD147 protein in prostate cancer]. (United States)

    He, Hui-Chan; Han, Zhao-Dong; Dai, Qi-Shan; Zou, Jun; Zhang, Yang; Zhang, Zheng; Liang, Yu-Xiang; Ye, Yong-Kang; Chen, Zhi-Nan; Zhong, Wei-De


    To investigate the expression of CD147 in prostate cancer and discuss its diagnostic value in prostate cancer. The method of immunohistochemical SP was employed to detect the expression of CD147 in 101 cases of prostate cancer, 90 cases of benign prostatic hyperplasia, 36 cases of normal prostate and 15 cases of embryonic prostate by so as to evaluate its clinical significance in the histological classification and prognosis of prostate cancer. The CD147 expression was positively expressed in 67/101 (66.3%) of prostate cancer, 21/90 (23.3%) of benign prostatic hypertrophy, 2/36 (5.6%) of normal prostate and 0/15 (0.0) of embryonic prostate respectively. A positive expression of CD147 was dramatically associated with TNM stage (P prostatic capsule invasion (P = 0.002) and histological grade (P = 0.006). The detection of CD147 is helpful to raise the early diagnosis rate of prostate cancer. It will become a tumor marker of reflecting the malignant degree and predicting the prognosis of prostate cancer.

  4. A hydrometallurgical process for the recovery of terbium from fluorescent lamps: Experimental design, optimization of acid leaching process and process analysis. (United States)

    Innocenzi, Valentina; Ippolito, Nicolò Maria; De Michelis, Ida; Medici, Franco; Vegliò, Francesco


    Terbium and rare earths recovery from fluorescent powders of exhausted lamps by acid leaching with hydrochloric acid was the objective of this study. In order to investigate the factors affecting leaching a series of experiments was performed in according to a full factorial plan with four variables and two levels (4 2 ). The factors studied were temperature, concentration of acid, pulp density and leaching time. Experimental conditions of terbium dissolution were optimized by statistical analysis. The results showed that temperature and pulp density were significant with a positive and negative effect, respectively. The empirical mathematical model deducted by experimental data demonstrated that terbium content was completely dissolved under the following conditions: 90 °C, 2 M hydrochloric acid and 5% of pulp density; while when the pulp density was 15% an extraction of 83% could be obtained at 90 °C and 5 M hydrochloric acid. Finally a flow sheet for the recovery of rare earth elements was proposed. The process was tested and simulated by commercial software for the chemical processes. The mass balance of the process was calculated: from 1 ton of initial powder it was possible to obtain around 160 kg of a concentrate of rare earths having a purity of 99%. The main rare earths elements in the final product was yttrium oxide (86.43%) following by cerium oxide (4.11%), lanthanum oxide (3.18%), europium oxide (3.08%) and terbium oxide (2.20%). The estimated total recovery of the rare earths elements was around 70% for yttrium and europium and 80% for the other rare earths. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. Investigation of the luminescent properties of terbium-anthranilate complexes and application to the determination of anthranilic acid derivatives in aqueous solutions

    Energy Technology Data Exchange (ETDEWEB)

    Arnaud, N.; Georges, J


    The luminescent properties of terbium complexes with furosemide (FR), flufenamic (FF) acid, tolfenamic (TF) acid and mefenamic (MF) acid have been investigated in aqueous solutions. For all four compounds, complexation occurs when the carboxylic acid of the aminobenzoic group is dissociated and is greatly favoured in the presence of trioctylphosphine oxide as co-ligand and Triton X-100 as surfactant. Under optimum conditions, luminescence of the lanthanide ion is efficiently sensitised and the lifetime of the {sup 5}D{sub 4} resonance level of terbium in the complex is ranging between 1 and 1.9 ms, against 0.4 ms for the aqua ion. The sensitivity of the method for the determination of anthranilic acid derivatives is improved by one to two orders of magnitude with respect to that achieved using native fluorescence or terbium-sensitised luminescence in methanol. The limits of detection are 2x10{sup -10}, 5x10{sup -10} and 2x10{sup -9} mol l{sup -1} for flufenamic acid, furosemide and tolfenamic acid, and mefenamic acid, respectively, with within-run RSD values of less than 1%. The method has been applied to the determination of flufenamic acid in spiked calf sera with and without sample pretreatment. Depending on the method and the analyte concentration, the recovery was ranging between 83 and 113% and the lowest concentration attainable in serum samples was close to 1x10{sup -7} mol l{sup -1}.

  6. Phenotype abnormality: 147 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 147 decreased efficiency... in organ named cotyledon during process named cell-cell adhesion ... cotyledon ... decreased efficiency ... cell-cell adhesion ...

  7. 40 CFR 147.2903 - Prohibition of unauthorized injection. (United States)


    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Prohibition of unauthorized injection... PROGRAMS (CONTINUED) STATE, TRIBAL, AND EPA-ADMINISTERED UNDERGROUND INJECTION CONTROL PROGRAMS Osage Mineral Reserve-Class II Wells § 147.2903 Prohibition of unauthorized injection. (a) Any underground...

  8. 45 CFR 147.126 - No lifetime or annual limits. (United States)


    ... HEALTH INSURANCE REFORM REQUIREMENTS FOR THE GROUP AND INDIVIDUAL HEALTH INSURANCE MARKETS § 147.126 No... health insurance coverage on the first day of the first plan year (in the individual market, policy year... section, a group health plan, or a health insurance issuer offering group or individual health insurance...

  9. 40 CFR 147.2500 - State-administered program. (United States)


    ... Statutes Annotated (West 1974 and Supp. 1983); (3) Chapter 162, Pure Drinking Water, Wisconsin Statutes... Section 147.2500 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS... NR 113, Servicing Septic Tanks, Seepage Pits, Grease Traps or Privies, Wisconsin Administrative Code...

  10. 46 CFR 147.45 - Flammable and combustible liquids. (United States)


    ... Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) DANGEROUS CARGOES HAZARDOUS SHIPS' STORES... gasoline and diesel oil), other than liquids used as fuel for cooking, heating, and lighting under § 147.50... equipment must be stored in— (1) Integral tanks that form part of the vessel's structure; (2) An independent...

  11. 40 CFR 147.901 - EPA-administered program. (United States)


    ... lands, is administered by EPA. This program consists of the UIC program requirements of 40 CFR parts 124, 144, 146, 148, and any additional requirements set forth in the remainder of this subpart. Injection... (CONTINUED) STATE, TRIBAL, AND EPA-ADMINISTERED UNDERGROUND INJECTION CONTROL PROGRAMS Kentucky § 147.901 EPA...

  12. 40 CFR 147.751 - EPA-administered program. (United States)


    ... program consists of the UIC program requirements of 40 CFR parts 124, 144, 146, and 148 and the additional... (CONTINUED) STATE, TRIBAL, AND EPA-ADMINISTERED UNDERGROUND INJECTION CONTROL PROGRAMS Indiana § 147.751 EPA-administered program. (a) Contents. The UIC program for all classes of wells on Indian lands, and for Class I...

  13. 40 CFR 147.601 - EPA-administered program. (United States)


    ... administered by EPA. This program consists of the UIC program requirements of 40 CFR parts 124, 144, 146, 148, and any additional requirements set forth in the remainder of this subpart. Injection well owners and... (CONTINUED) STATE, TRIBAL, AND EPA-ADMINISTERED UNDERGROUND INJECTION CONTROL PROGRAMS Hawaii § 147.601 EPA...

  14. 40 CFR 147.801 - EPA-administered program. (United States)


    ... administered by EPA. This program consists of the UIC program requirements of 40 CFR parts 124, 144, 146, 148, and any additional requirements set forth in the remainder of this subpart. Injection well owners and... (CONTINUED) STATE, TRIBAL, AND EPA-ADMINISTERED UNDERGROUND INJECTION CONTROL PROGRAMS Iowa § 147.801 EPA...

  15. 40 CFR 147.101 - EPA-administered program. (United States)


    ... program requirements of 40 CFR parts 124, 144, 146, 148, and any additional requirements set forth in the... (CONTINUED) STATE, TRIBAL, AND EPA-ADMINISTERED UNDERGROUND INJECTION CONTROL PROGRAMS Alaska § 147.101 EPA-administered program. (a) Contents. The UIC program in the State of Alaska for Class I, III, IV, and V wells...

  16. 40 CFR 147.151 - EPA-administered program. (United States)


    ... Navajo Indian lands consists of the UIC program requirements of 40 CFR parts 124, 144, 146, 148, and any additional requirements set forth in the remainder of this subpart. Injection well owners and operators, and... (CONTINUED) STATE, TRIBAL, AND EPA-ADMINISTERED UNDERGROUND INJECTION CONTROL PROGRAMS Arizona § 147.151 EPA...

  17. 14 CFR Appendix D to Part 147 - Powerplant Curriculum Subjects (United States)


    ... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Powerplant Curriculum Subjects D Appendix D to Part 147 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION... starting systems (2) 17. Overhaul magneto and ignition harness. (2) 18. Inspect, service, troubleshoot, and...

  18. 45 CFR 147.100 - Basis and scope. (United States)


    ... Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES REQUIREMENTS RELATING TO HEALTH CARE ACCESS HEALTH INSURANCE REFORM REQUIREMENTS FOR THE GROUP AND INDIVIDUAL HEALTH INSURANCE MARKETS § 147.100 Basis and... Care Act that apply to group health plans and health insurance issuers in the Group and Individual...

  19. 45 CFR 147.128 - Rules regarding rescissions. (United States)



  20. 27 CFR 24.147 - Operations bond or unit bond. (United States)


    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Operations bond or unit... § 24.147 Operations bond or unit bond. Notwithstanding the provisions of § 24.146, each person... amended, give an operations bond or unit bond in accordance with the applicable provisions of 27 CFR part...

  1. 14 CFR Appendix A to Part 147 - Curriculum Requirements (United States)


    ... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Curriculum Requirements A Appendix A to... to Part 147—Curriculum Requirements This appendix defines terms used in appendices B, C, and D of this part, and describes the levels of proficiency at which items under each subject in each curriculum...

  2. 14 CFR 406.147 - Notice of hearing. (United States)


    ... consolidated with aviation hearing under 14 CFR part 13 subpart G. With the consent of the administrative law... Aeronautics and Space COMMERCIAL SPACE TRANSPORTATION, FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF... Transportation Adjudications § 406.147 Notice of hearing. (a) Notice. The administrative law judge must give each...

  3. Structural investigation and photoluminescent properties of gadolinium(III), europium(III) and terbium(III) 3-mercaptopropionate complexes. (United States)

    Souza, E R; Mazali, I O; Sigoli, F A


    This work reports on the synthesis, crystallographic determination and spectroscopic characterization of gadolinium(III), terbium(III) and europium(III) 3-mercaptopropionate complexes, aqua-tris(3-mercaptopropionate)lanthanide(III)--[Ln(mpa)3(H2O)]. The Judd-Ofelt intensity parameters were experimentally determined from emission spectrum of the [Eu(mpa)3(H2O)]complex and they were also calculated from crystallographic data. The complexes are coordination polymers, where the units of each complex are linked together by carboxylate groups leading to an unidimensional and parallel chains that by chemical interactions form a tridimensional framework. The emission spectrum profile of the [Eu(mpa)3(H2O)] complex is discussed based on point symmetry of the europium(III) ion, that explains the bands splitting observed in its emission spectrum. Photoluminescent analysis of the [Gd(mpa)3(H2O)] complex show no efficient ligand excitation but an intense charge transfer band. The excitation spectra of the [Eu(mpa)3(H2O)] and [Tb(mpa)3(H2O)] complexes do not show evidence of energy transfer from the ligand to the excited levels of these trivalent ions. Therefore the emission bands are originated only by direct f-f intraconfigurational excitation of the lantanide(III) ions.

  4. Fluorometric determination of proteins using the terbium (III)-2-thenoyltrifluoroacetone-sodium dodecyl benzene sulfonate-protein system

    Energy Technology Data Exchange (ETDEWEB)

    Jia Zhen [Key Laboratory of Colloid and Interface Chemistry of Education Ministry, School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Department of Chemistry, Dezhou University, Dezhou 253023 (China); Yang Jinghe [Key Laboratory of Colloid and Interface Chemistry of Education Ministry, School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China)]. E-mail:; Wu Xia [Key Laboratory of Colloid and Interface Chemistry of Education Ministry, School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Wang Fei [Key Laboratory of Colloid and Interface Chemistry of Education Ministry, School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Guo Changying [Key Laboratory of Colloid and Interface Chemistry of Education Ministry, School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Liu Shufang [Key Laboratory of Colloid and Interface Chemistry of Education Ministry, School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China)


    It is found that in hexamethylene tetramine (HMTA)-HCl buffer of pH=8.00, proteins can enhance the fluorescence of terbium (III) (Tb{sup 3+})-2-thenoyltrifluoroacetone (TTA)-sodium dodecyl benzene sulfonate (SDBS) system. Based on this, a sensitive method for the determination of proteins is proposed. The experiments indicate that under the optimum conditions, the enhanced fluorescence intensity is in proportion to the concentration of proteins in the range of 4.0x10{sup -9}-7.5x10{sup -6}g/mL for bovine serum albumin (BSA), 5.0x10{sup -9}-1.5x10{sup -5}g/mL for human serum albumin (HSA), 1.0x10{sup -8}-7.5x10{sup -6}g/mL for egg albumin (EA). Their detection limits (S/N=3) are 0.5, 0.8 and 2.0ng/mL, respectively. The interaction mechanism is also studied.

  5. Terbium to Quantum Dot FRET Bioconjugates for Clinical Diagnostics: Influence of Human Plasma on Optical and Assembly Properties

    Directory of Open Access Journals (Sweden)

    Niko Hildebrandt


    Full Text Available Förster resonance energy transfer (FRET from luminescent terbium complexes (LTC as donors to semiconductor quantum dots (QDs as acceptors allows extraordinary large FRET efficiencies due to the long Förster distances afforded. Moreover, time-gated detection permits an efficient suppression of autofluorescent background leading to sub-picomolar detection limits even within multiplexed detection formats. These characteristics make FRET-systems with LTC and QDs excellent candidates for clinical diagnostics. So far, such proofs of principle for highly sensitive multiplexed biosensing have only been performed under optimized buffer conditions and interactions between real-life clinical media such as human serum or plasma and LTC-QD-FRET-systems have not yet been taken into account. Here we present an extensive spectroscopic analysis of absorption, excitation and emission spectra along with the luminescence decay times of both the single components as well as the assembled FRET-systems in TRIS-buffer, TRIS-buffer with 2% bovine serum albumin, and fresh human plasma. Moreover, we evaluated homogeneous LTC-QD FRET assays in QD conjugates assembled with either the well-known, specific biotin-streptavidin biological interaction or, alternatively, the metal-affinity coordination of histidine to zinc. In the case of conjugates assembled with biotin-streptavidin no significant interference with the optical and binding properties occurs whereas the histidine-zinc system appears to be affected by human plasma.

  6. Evidence of mass exchange between inside and outside of sonoluminescing bubble in aqueous solution of terbium chloride

    Energy Technology Data Exchange (ETDEWEB)

    Liang, Jinfu, E-mail: [School of Physics and Electronic Science, Guizhou Normal University, Guiyang 550001 (China); Chen, Weizhong, E-mail: [The Key Laboratory of Modern Acoustics, Ministry of Education, Institution of Acoustics, Nanjing University, Nanjing 210093 (China); Wang, Xun; Yang, Jing; Chen, Zhan [The Key Laboratory of Modern Acoustics, Ministry of Education, Institution of Acoustics, Nanjing University, Nanjing 210093 (China)


    Highlights: • Time-resolved spectra of SBSL were obtained for Tb{sup 3+} ions emission lines. • Mass exchange between inside and outside of SL bubble was probed via Tb{sup 3+} ions lines. • The argon rectification hypothesis was tested by time-resolved spectra of SBSL. • The rate of mass exchange inside an SBSL bubble increases with increasing sound pressure. - Abstract: Spectra of single-bubble sonoluminescence (SBSL) were obtained for Tb{sup 3+} ions emission lines from bubbles in an aqueous solution of terbium chloride (TbCl{sub 3}). The spectra provide experimental evidence to prove that an air bubble driven by strong ultrasound will not eventually become a rectified pure argon bubble, which is not as predicted by the argon rectification hypothesis. The time-resolved spectra of SBSL show a mass exchange of material such as Tb{sup 3+} ions between the inside and outside of the bubble. With increasing sound pressure, the rate of mass exchange and the SBSL intensity increases.

  7. Optical properties and electrical transport of thin films of terbium(III bis(phthalocyanine on cobalt

    Directory of Open Access Journals (Sweden)

    Peter Robaschik


    Full Text Available The optical and electrical properties of terbium(III bis(phthalocyanine (TbPc2 films on cobalt substrates were studied using variable angle spectroscopic ellipsometry (VASE and current sensing atomic force microscopy (cs-AFM. Thin films of TbPc2 with a thickness between 18 nm and 87 nm were prepared by organic molecular beam deposition onto a cobalt layer grown by electron beam evaporation. The molecular orientation of the molecules on the metallic film was estimated from the analysis of the spectroscopic ellipsometry data. A detailed analysis of the AFM topography shows that the TbPc2 films consist of islands which increase in size with the thickness of the organic film. Furthermore, the cs-AFM technique allows local variations of the organic film topography to be correlated with electrical transport properties. Local current mapping as well as local I–V spectroscopy shows that despite the granular structure of the films, the electrical transport is uniform through the organic films on the microscale. The AFM-based electrical measurements allow the local charge carrier mobility of the TbPc2 thin films to be quantified with nanoscale resolution.

  8. Highly luminescent charge-neutral europium(iii) and terbium(iii) complexes with tridentate nitrogen ligands. (United States)

    Senthil Kumar, Kuppusamy; Schäfer, Bernhard; Lebedkin, Sergei; Karmazin, Lydia; Kappes, Manfred M; Ruben, Mario


    We report on the synthesis of tridentate-nitrogen pyrazole-pyridine-tetrazole (L(1)H) and pyrazole-pyridine-triazole (L(2)H) ligands and their complexation with lanthanides (Ln = Gd(iii), Eu(iii) and Tb(iii)) resulting in stable, charge-neutral complexes Ln(L(1))3 and Ln(L(2))3, respectively. X-ray crystallographic analysis of the complexes with L(1) ligands revealed tricapped trigonal coordination geometry around the lanthanide ions. All complexes show bright photoluminescence (PL) in the solid state, indicating efficient sensitization of the lanthanide emission via the triplet states of the ligands. In particular, the terbium complexes show high PL quantum yields of 65 and 59% for L(1) and L(2), respectively. Lower PL efficiencies of the europium complexes (7.5 and 9%, respectively) are attributed to large energy gaps between the triplet states of the ligands and accepting levels of Eu(iii). The triplet state energy can be reduced by introducing an electron withdrawing (EW) group at the 4 position of the pyridine ring. Such substitution of L(1)H with a carboxylic ester (COOMe) EW group leads to a europium complex with increased PL quantum yield of 31%. A comparatively efficient PL of the complexes dissolved in ethanol indicates that the lanthanide ions are shielded against nonradiative deactivation via solvent molecules.

  9. Micelle enhanced and terbium sensitized spectrofluorimetric determination of danofloxacin in milk using molecularly imprinted solid phase extraction (United States)

    Kaur, Kuldeep; Saini, Shivender Singh; Malik, Ashok Kumar; Singh, Baldev


    An efficient molecularly imprinted solid phase extraction (MISPE)-spectrofluorimetric method was developed to sensitively determine danofloxacin (DAN) in milk samples. Solid phase extraction procedure using MISPE cartridges was first performed on milk samples and then spectrofluorimetric determination was done at 546 nm using an excitation wavelength of 285 nm in presence of terbium and sodium dodecyl benzene sulfonate (SDBS). It was found that SDBS significantly enhanced the fluorescence intensity of the DAN-Tb3+ complex. Various factors affecting the fluorescence intensity of DAN-Tb3+-SDBS system were studied and conditions were optimized. The enhanced fluorescence intensity of the system (ΔF) showed a good linear relationship with the concentration of DAN over the range of 8.4 × 10-9-3.4 × 10-7 mol L-1 with a correlation coefficient of 0.9996. The detection limit was determined as 2.0 × 10-9 mol L-1 and the limit of quantification was determined as 6.5 × 10-9 mol L-1. The MISPE-spectrofluorimetric procedure was successfully applied to the determination of DAN in milk samples. The method is simple, rapid, sensitive and allows interference free determination of DAN in complex fluorescent matrices like milk. The method can be used to determine whether the DAN residues in milk exceed MRLs or not.

  10. Study of quantum dot based on tin/yttrium mixed oxide doped with terbium to be used as biomarker

    Energy Technology Data Exchange (ETDEWEB)

    Paganini, Paula P.; Felinto, Maria Claudia F.C.; Kodaira, Claudia A., E-mail: paulapaganini@usp.b, E-mail: mfelinto@ipen.b, E-mail: [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil); Brito, Hermi F., E-mail: hefbrito@iq.usp.b [Universidade de Sao Paulo (USP), SP (Brazil). Inst. de Quimica. Lab. de Elementos do Bloco f; Nunes, Luiz Antonio O., E-mail: luizant@ifsc.usp.b [Universidade de Sao Paulo (USP), Sao Carlos, SP (Brazil). Inst. de Fisica. Dept. de Fisica e Informatica


    Quantum dots (semiconductors nanocrystals) have brought a promising field to develop a new generation of luminescent biomarkers. The use of lanthanides ions as luminescent markers has many advantages, for example a security method, low cost, high specificity and also the luminescence can be promptly measured with high sensibility and accuracy. These luminescent dots are functionalized with biomolecules. For the luminophore particle to be connect with biologicals molecules (for example covalent antibody) is necessary a previous chemical treatment to modify luminophore particle surface and this process is called functionalization. A prior chemical treatment with changes on the surface luminophore particle is necessary to couple the luminophore to biological molecules. This process can be used as coating which can protect these particles from being dissolved by acid as well as provide functional groups for biological conjugation. This work presents a photoluminescence study of nanoparticles based on tin/yttrium mixed oxides doped with terbium (SnO{sub 2}/Y{sub 2}O{sub 3}:Tb{sup 3+}), synthesized by coprecipitation method. The nanoparticles were submitted to thermal treatment and characterized by X-Ray Powder Diffraction (XRD) that showed cassiterite phase formation and the influence of thermal treatment on nanoparticles structures. These nanoparticles going to be functionalized with a natural polysaccharide (chitosan) in order to form microspheres. These microspheres going to be irradiated with gamma radiation to sterilization and it can be evaluated if the nanoparticles are resistant to irradiation and they do not lose functionality with this process. (author)

  11. Investigation of the production of promethium-147 via particle accelerator (United States)

    Artun, Ozan


    In the present paper, we mainly aim to extend nuclear data of production of radionuclide promethium-147 used in nuclear battery technology due to its weak experimental measurement and theoretical calculation. Therefore, the cross-section for charged particle induced reactions on Nd target is calculated, and moreover, the reaction processes are simulated by particle accelerator with the energy range {{E}}_{{particle}} = 50 \\to 5 MeV and in the particle beam current of 20 mA to figure out yield, activity of reaction and integral yield. For a proper understanding of investigation, the obtained results are also discussed to determine the most suitable reaction and target material for the production of radionuclide promethium-147 via particle accelerator on the basis of process.

  12. Fermi-LAT Observation of Supernova Remnant S147

    Energy Technology Data Exchange (ETDEWEB)

    Katsuta, J.; Uchiyama, Y.; Tanaka, T.; /SLAC /KIPAC, Menlo Park; Tajima, H.; /SLAC /KIPAC, Menlo Park /Nagoya U., Solar-Terrestrial Environ. Lab.; Bechtol, K.; Funk, S.; Lande, J.; /SLAC /KIPAC, Menlo Park; Ballet, J.; /AIM, Saclay; Hanabata, Y.; /Hiroshima U.; Lemoine-Goumard, M.; /CENBG, Gradignan; Takahashi, T.; /JAXA, Sagamihara


    We present an analysis of gamma-ray data obtained with the Large Area Telescope (LAT) onboard the Fermi Gamma-ray Space Telescope in the region around SNR S147 (G180.0-1.7). A spatially extended gamma-ray source detected in an energy range of 0.2-10 GeV is found to coincide with SNR S147. We confirm its spatial extension at >5{sigma} confidence level. The gamma-ray flux is (3.8 {+-} 0.6) x 10{sup -8} photons cm{sup -2} s{sup -1}, corresponding to a luminosity of 1.3 x 10{sup 34} (d/1.3 kpc){sup 2} erg s{sup -1} in this energy range. The gamma-ray emission exhibits a possible spatial correlation with prominent H{alpha} filaments of S147. There is no indication that the gamma-ray emission comes from the associated pulsar PSR J0538+2817. The gamma-ray spectrum integrated over the remnant is likely dominated by the decay of neutral {pi} mesons produced through the proton-proton collisions in the filaments. Reacceleration of pre-existing CRs and subsequent adiabatic compression in the filaments is sufficient to provide the required energy density of high-energy protons.


    Energy Technology Data Exchange (ETDEWEB)

    Katsuta, J.; Uchiyama, Y.; Tanaka, T.; Tajima, H.; Bechtol, K.; Funk, S.; Lande, J. [W. W. Hansen Experimental Physics Laboratory, Kavli Institute for Particle Astrophysics and Cosmology, Department of Physics and SLAC National Accelerator Laboratory, Stanford University, Stanford, CA 94305 (United States); Ballet, J. [Laboratoire AIM, CEA-IRFU/CNRS/Universite Paris Diderot, Service d' Astrophysique, CEA Saclay, 91191 Gif sur Yvette (France); Hanabata, Y. [Department of Physical Sciences, Hiroshima University, Higashi-Hiroshima, Hiroshima 739-8526 (Japan); Lemoine-Goumard, M. [Universite Bordeaux 1, CNRS/IN2p3, Centre d' Etudes Nucleaires de Bordeaux Gradignan, 33175 Gradignan (France); Takahashi, T., E-mail:, E-mail: [Institute of Space and Astronautical Science, Japanese Aerospace Exploration Agency, 3-1-1 Yoshinodai, Chuo-ku, Sagamihara, Kanagawa 252-5210 (Japan)


    We present an analysis of gamma-ray data obtained with the Large Area Telescope on board the Fermi Gamma-ray Space Telescope in the region around supernova remnant (SNR) S147 (G180.0-1.7). A spatially extended gamma-ray source detected in an energy range of 0.2-10 GeV is found to coincide with SNR S147. We confirm its spatial extension at >5{sigma} confidence level. The gamma-ray flux is (3.8 {+-} 0.6) Multiplication-Sign 10{sup -8} photons cm{sup -2} s{sup -1}, corresponding to a luminosity of 1.3 Multiplication-Sign 10{sup 34} (d/1.3 kpc){sup 2} erg s{sup -1} in this energy range. The gamma-ray emission exhibits a possible spatial correlation with the prominent H{alpha} filaments of SNR S147. There is no indication that the gamma-ray emission comes from the associated pulsar PSR J0538+2817. The gamma-ray spectrum integrated over the remnant is likely dominated by the decay of neutral {pi} mesons produced through the proton-proton collisions in the filaments. The reacceleration of the pre-existing cosmic rays and subsequent adiabatic compression in the filaments is sufficient to provide the energy density required of high-energy protons.

  14. CD147 promotes the formation of functional osteoclasts through NFATc1 signalling

    Energy Technology Data Exchange (ETDEWEB)

    Nishioku, Tsuyoshi, E-mail: [Department of Clinical Pharmacology, Faculty of Pharmaceutical Sciences, Nagasaki International University, 2825-7 Huis Ten Bosch, Sasebo, Nagasaki 859-3298 (Japan); Department of Pharmaceutical Care and Health Sciences, Faculty of Pharmaceutical Sciences, Fukuoka University, 8-19-1 Nanakuma, Jonan-ku, Fukuoka 814-0180 (Japan); Terasawa, Mariko; Baba, Misaki; Yamauchi, Atsushi; Kataoka, Yasufumi [Department of Pharmaceutical Care and Health Sciences, Faculty of Pharmaceutical Sciences, Fukuoka University, 8-19-1 Nanakuma, Jonan-ku, Fukuoka 814-0180 (Japan)


    CD147, a membrane glycoprotein of the immunoglobulin superfamily, is highly upregulated during dynamic cellular events including tissue remodelling. Elevated CD147 expression is present in the joint of rheumatoid arthritis patients. However, the role of CD147 in bone destruction remains unclear. To determine whether CD147 is involved in osteoclastogenesis, we studied its expression in mouse osteoclasts and its role in osteoclast differentiation and function. CD147 expression was markedly upregulated during osteoclast differentiation. To investigate the role of CD147 in receptor activator of nuclear factor-kappa B ligand (RANKL)-induced osteoclastogenesis and bone resorption activity, osteoclast precursor cells were transfected with CD147 siRNA. Decreased CD147 expression inhibited osteoclast formation and bone resorption, inhibited RANKL-induced nuclear translocation of the nuclear factor of activated T cells (NFAT) c1 and decreased the expression of the d2 isoform of vacuolar ATPase Vo domain and cathepsin K. Therefore, CD147 plays a critical role in the differentiation and function of osteoclasts by upregulating NFATc1 through the autoamplification of its expression in osteoclastogenesis. - Highlights: • CD147 expression was markedly upregulated during osteoclast differentiation. • Downregulation of CD147 expression inhibited osteoclastgenesis and bone resorption. • Decreased CD147 expression inhibited RANKL-induced nuclear translocation of NFATc1.

  15. 9 CFR 147.9 - Standard test procedures for avian influenza. (United States)


    ... influenza. 147.9 Section 147.9 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE... Blood Testing Procedures § 147.9 Standard test procedures for avian influenza. (a) The agar gel immunodiffusion (AGID) test should be considered the basic screening test for antibodies to Type A influenza...

  16. 46 CFR 147.15 - Hazardous ships' stores permitted on board vessels. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Hazardous ships' stores permitted on board vessels. 147... HAZARDOUS SHIPS' STORES General Provisions § 147.15 Hazardous ships' stores permitted on board vessels...' stores if the material— (a) Is labeled according to § 147.30; and (b) Meets the requirements, if any, in...

  17. 13 CFR 147.105 - Does this part apply to me? (United States)


    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Does this part apply to me? 147.105 Section 147.105 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION GOVERNMENTWIDE REQUIREMENTS FOR DRUG-FREE WORKPLACE (NONPROCUREMENT) Purpose and Coverage § 147.105 Does this part apply to me...

  18. 9 CFR 147.8 - Procedures for preparing egg yolk samples for diagnostic tests. (United States)


    ... samples for diagnostic tests. 147.8 Section 147.8 Animals and Animal Products ANIMAL AND PLANT HEALTH... a representative sample of 30 eggs collected from a single day's production from the flock, must be... IgG antibodies set forth for testing serum in § 147.7 (for these tests the resultant supernatant...

  19. 9 CFR 147.3 - The stained-antigen, rapid, whole-blood test. 3 (United States)


    ...-blood test. 3 147.3 Section 147.3 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE... Blood Testing Procedures § 147.3 The stained-antigen, rapid, whole-blood test. 3 3 The procedure... necessary. The test plate should be rocked from side to side a few times to mix the antigen and blood...

  20. The retinal specific CD147 Ig0 domain: from molecular structure to biological activity

    Energy Technology Data Exchange (ETDEWEB)

    Redzic, Jasmina S.; Armstrong, Geoffrey S.; Isern, Nancy G.; Jones, David N.M.; Kieft, Jeffrey S.; Eisenmesser, Elan Z.


    CD147 is a type I transmembrane protein that is involved in inflammatory diseases, cancer progression, and multiple human pathogens utilize CD147 for efficient infection. In several cancers, CD147 expression is so high that it is now used as a prognostic marker. The two primary isoforms of CD147 that are related to cancer progression have been identified, differing in their number of immunoglobulin (Ig)-like domains. These include CD147 Ig1-Ig2 that is ubiquitously expressed in most tissues and CD147 Ig0-Ig1-Ig2 that is retinal specific and implicated in retinoblastoma. However, little is known in regard to the retinal specific CD147 Ig0 domain despite its potential role in retinoblastoma. Thus, here we have extensively characterized the CD147 Ig0 domain by elucidating its three-dimensional structure through crystallography and its solution behavior through several biophysical methods that include nuclear magnetic resonance. Furthermore, we have utilized this data together with mutagenesis to probe the biological activity of CD147-containing proteins both with and without the CD147 Ig0 domain within several model cell lines. Our findings reveal that the CD147 Ig0 domain is a potent stimulator of interleukin-6, which is a well-known contributor to retinoblastoma and suggest that the CD147 Ig0 domain has its own receptor distinct from that of the other CD147 Ig-like domains, CD147 Ig1-Ig2. Furthermore, we show that the CD147 Ig0 dimer is the functional unit required for activity and can be disrupted by a single point mutation.

  1. Gadolinium(III) complexes of 1,4,7-triazacyclononane based picolinate ligands: simultaneous optimization of water exchange kinetics and electronic relaxation. (United States)

    Nonat, Aline; Giraud, Marion; Gateau, Christelle; Fries, Pascal H; Helm, Lothar; Mazzanti, Marinella


    The two new tripodal picolinate H(3)ebpatcn (1-carboxyethyl-4,7-bis((6-carboxypyridin-2-yl)methyl)-1,4,7-triazacyclononane) and H(4)pbpatcn (1-methylphosphonic-acid-4,7-bis((6-carboxypyridin-2-yl)methyl)-1,4,7-triazacyclononane) ligands based on the 1,4,7-triazacyclononane anchor were prepared and their lanthanide complexes were characterized by NMR, fluorescence and potentiometric studies. The [Gd(ebpatcn)(H(2)O)] complex displays a relaxivity of r(1) = 4.68 mM(-1) s(-1) at 45 MHz and 298 K, whereas r(1) = 4.55 mM(-1) s(-1) was measured for [Gd(Hpbpatcn)(H(2)O)] under the same conditions. The modified scaffold of the ligands with respect to the previously reported H(3)bpatcn (1-(carboxymethyl)-4,7-bis[(6-carboxypyridin-2-yl)methyl]-1,4,7-triazacyclononane) leads to an optimization of the properties of these gadolinium complexes. The replacement of an acetate binding group of the H(3)bpatcn ligand with a propionate group (H(3)ebpatcn) or a phosphonate group (H(4)pbpatcn) leads to a faster exchange rate of the coordinated water molecule in both mono-aquo gadolinium complexes. The resulting water exchange rate is optimized for the future design of high relaxivity macromolecular gadolinium based contrast agents with a value measured by O(17) NMRD of k(ex) = 34 x 10(6) s(-1) for [Gd(Hpbpatcn)(H(2)O)] falling in the range of optimum values of (30 to 50) x 10(6) s(-1) predicted by the SBM theory. The water exchange rate k(ex)(298) = 86 x 10(6) s(-1) of the complex [Gd(ebpatcn)(H(2)O)] is the fastest reported in the literature for a neutral complex with only one inner-sphere water molecule. The relatively high stability of these modified gadolinium complexes (pGd = 14.1 for Gd(pbpatcn) and 13.1 for Gd(ebpatcn)) is similar to that of the [Gd(bpatcn)(H(2)O)] complex (pGd = 13.6). The high luminescence efficiency is also retained for the terbium complex. However, whereas the longitudinal electronic spin relaxation time keeps a value for [Gd(ebpatcn)(H(2)O)], which is long

  2. Terbium-doped gadolinium oxysulfide (Gd2O2S:Tb) scintillation-based polymer optical fibre sensor for real time monitoring of radiation dose in oncology (United States)

    Lewis, E.; O'Keeffe, S.; Grattan, M.; Hounsell, A.; McCarthy, D.; Woulfe, P.; Cronin, J.; Mihai, L.; Sporea, D.; Santhanam, A.; Agazaryan, N.


    A PMMA based plastic optical fibre sensor for use in real time radiotherapy dosimetry is presented. The optical fibre tip is coated with a scintillation material, terbium-doped gadolinium oxysulfide (Gd2O2S:Tb), which fluoresces when exposed to ionising radiation (X-Ray). The emitted visible light signal penetrates the sensor optical fibre and propagates along the transmitting fibre at the end of which it is remotely monitored using a fluorescence spectrometer. The results demonstrate good repeatability, with a maximum percentage error of 0.5% and the response is independent of dose rate.

  3. Importance of N-Glycosylation on CD147 for Its Biological Functions

    Directory of Open Access Journals (Sweden)

    Yang Bai


    Full Text Available Glycosylation of glycoproteins is one of many molecular changes that accompany malignant transformation. Post-translational modifications of proteins are closely associated with the adhesion, invasion, and metastasis of tumor cells. CD147, a tumor-associated antigen that is highly expressed on the cell surface of various tumors, is a potential target for cancer diagnosis and therapy. A significant biochemical property of CD147 is its high level of glycosylation. Studies on the structure and function of CD147 glycosylation provide valuable clues to the development of targeted therapies for cancer. Here, we review current understanding of the glycosylation characteristics of CD147 and the glycosyltransferases involved in the biosynthesis of CD147 N-glycans. Finally, we discuss proteins regulating CD147 glycosylation and the biological functions of CD147 glycosylation.

  4. Compact all-fiber optical Faraday components using 65-wt%-terbium-doped fiber with a record Verdet constant of -32 rad/(Tm). (United States)

    Sun, L; Jiang, S; Marciante, J R


    A compact all-fiber Faraday isolator and a Faraday mirror are demonstrated. At the core of each of these components is an all-fiber Faraday rotator made of a 4-cm-long, 65-wt%-terbium-doped silicate fiber. The effective Verdet constant of the terbium-doped fiber is measured to be -32 rad/(Tm), which is 27 x larger than that of silica fiber. This effective Verdet constant is the largest value measured to date in any fiber and is 83% of the Verdet constant of commercially available crystal used in bulk optics-based isolators. Combining the all-fiber Faraday rotator with fiber polarizers results in a fully fusion spliced all-fiber isolator whose isolation is measured to be 19 dB. Combining the all-fiber Faraday rotator with a fiber Bragg grating results in an all-fiber Faraday mirror that rotates the polarization state of the reflected light by 88 +/- 4 degrees .

  5. Picomolar Traces of Americium(III) Introduce Drastic Changes in the Structural Chemistry of Terbium(III): A Break in the "Gadolinium Break". (United States)

    Welch, Jan M; Müller, Danny; Knoll, Christian; Wilkovitsch, Martin; Giester, Gerald; Ofner, Johannes; Lendl, Bernhard; Weinberger, Peter; Steinhauser, Georg


    The crystallization of terbium 5,5'-azobis[1H-tetrazol-1-ide] (ZT) in the presence of trace amounts (ca. 50 Bq, ca. 1.6 pmol) of americium results in 1) the accumulation of the americium tracer in the crystalline solid and 2) a material that adopts a different crystal structure to that formed in the absence of americium. Americium-doped [Tb(Am)(H 2 O) 7 ZT] 2 ZT⋅10 H 2 O is isostructural to light lanthanide (Ce-Gd) 5,5'-azobis[1H-tetrazol-1-ide] compounds, rather than to the heavy lanthanide (Tb-Lu) 5,5'-azobis[1H-tetrazol-1-ide] (e.g., [Tb(H 2 O) 8 ] 2 ZT 3 ⋅6 H 2 O) derivatives. Traces of Am seem to force the Tb compound into a structure normally preferred by the lighter lanthanides, despite a 10 8 -fold Tb excess. The americium-doped material was studied by single-crystal X-ray diffraction, vibrational spectroscopy, radiochemical neutron activation analysis, and scanning electron microcopy. In addition, the inclusion properties of terbium 5,5'-azobis[1H-tetrazol-1-ide] towards americium were quantified, and a model for the crystallization process is proposed. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. The level of CD147 expression correlates with cyclophilin-induced signalling and chemotaxis

    Directory of Open Access Journals (Sweden)

    Constant Stephanie


    Full Text Available Abstract Background Previous studies identified CD147 as the chemotactic receptor on inflammatory leukocytes for extracellular cyclophilins (eCyp. However, CD147 is not known to associate with signal transducing molecules, so other transmembrane proteins, such as proteoglycans, integrins, and CD98, were suggested as receptor or co-receptor for eCyp. CD147 is ubiquitously expressed on many cell types, but relationship between the level of CD147 expression and cellular responses to eCyp has never been analyzed. Given the role of eCyp in pathogenesis of many diseases, it is important to know whether cellular responses to eCyp are regulated at the level of CD147 expression. Results Here, we manipulated CD147 expression levels on HeLa cells using RNAi and investigated the signalling and chemotactic responses to eCypA. Both Erk activation and chemotaxis correlated with the level of CD147 expression, with cells exhibiting low level expression being practically unresponsive to eCypA. Conclusions Our results provide the first demonstration of a chemotactic response of HeLa cells to eCypA, establish a correlation between the level of CD147 expression and the magnitude of cellular responses to eCypA, and indicate that CD147 may be a limiting factor in the receptor complex determining cyclophilin-induced Erk activation and cell migration.

  7. Tumor Vesicle—Associated CD147 Modulates the Angiogenic Capability of Endothelial Cells

    Directory of Open Access Journals (Sweden)

    Danilo Millimaggi


    Full Text Available Matrix metalloproteinase (MMP degradation of extracellular matrix is thought to play an important role in invasion, angiogenesis, tumor growth, and metastasis. Several studies have demonstrated that CD147/ extracellular MMP inducer, a membrane-spanning molecule highly expressed in tumor cells, may be involved in the progression of malignancies by regulating expression of MMP in peritumoral stromal cells. In the present study we show that CD147 is expressed in microvesicles derived from epithelial ovarian cancer cells and that CD147-positive vesicles may promote an angiogenic phenotype in endothelial cells in vitro. Vesicles shed by human ovarian carcinoma cell lines OVCAR3, SKOV3, and A2780 expressed different levels of CD147 and stimulated proangiogenic activities of human umbilical vein endothelial cells (HUVECs in a CD147-dependent fashion (OVCAR3 > SKOV3 > A2780. Moreover, vesicles shed by ovarian carcinoma cell line CABA I with low CD147 expression had no significant effect on the development of angiogenic phenotype in HUVECs. The treatment of OVCAR3 cells with small interfering RNA against CD147 suppressed the angiogenic potential of OVCAR3-derived microvesicles. However, transfection of CD147 cDNA into the CABA I cell line enabled CABA I-derived vesicles to induce angiogenesis and to promote MMP genes expression in HUVECs. We therefore conclude that vesicles shed by ovarian cancer cells may induce proangiogenic activities of HUVECs by a CD147-mediated mechanism.

  8. Crystal structures of two mononuclear complexes of terbium(III) nitrate with the tripodal alcohol 1,1,1-tris-(hy-droxy-meth-yl)propane. (United States)

    Gregório, Thaiane; Giese, Siddhartha O K; Nunes, Giovana G; Soares, Jaísa F; Hughes, David L


    Two new mononuclear cationic complexes in which the TbIII ion is bis-chelated by the tripodal alcohol 1,1,1-tris-(hy-droxy-meth-yl)propane (H3LEt, C6H14O3) were prepared from Tb(NO3)3·5H2O and had their crystal and mol-ecular structures solved by single-crystal X-ray diffraction analysis after data collection at 100 K. Both products were isolated in reasonable yields from the same reaction mixture by using different crystallization conditions. The higher-symmetry complex dinitratobis[1,1,1-tris-(hy-droxy-meth-yl)propane]-terbium(III) nitrate di-meth-oxy-ethane hemisolvate, [Tb(NO3)2(H3LEt)2]NO3·0.5C4H10O2, 1, in which the lanthanide ion is 10-coordinate and adopts an s-bicapped square-anti-prismatic coordination geometry, contains two bidentate nitrate ions bound to the metal atom; another nitrate ion functions as a counter-ion and a half-mol-ecule of di-meth-oxy-ethane (completed by a crystallographic twofold rotation axis) is also present. In product aqua-nitratobis[1,1,1-tris-(hy-droxy-meth-yl)propane]-terbium(III) dinitrate, [Tb(NO3)(H3LEt)2(H2O)](NO3)2, 2, one bidentate nitrate ion and one water mol-ecule are bound to the nine-coordinate terbium(III) centre, while two free nitrate ions contribute to charge balance outside the tricapped trigonal-prismatic coordination polyhedron. No free water mol-ecule was found in either of the crystal structures and, only in the case of 1, di-meth-oxy-ethane acts as a crystallizing solvent. In both mol-ecular structures, the two tripodal ligands are bent to one side of the coordination sphere, leaving room for the anionic and water ligands. In complex 2, the methyl group of one of the H3LEt ligands is disordered over two alternative orientations. Strong hydrogen bonds, both intra- and inter-molecular, are found in the crystal structures due to the number of different donor and acceptor groups present.

  9. The response behavior of PPy-DB18C6 electrode to terbium(III in acetonitrile and its thermodynamic application

    Directory of Open Access Journals (Sweden)

    Mohammad Hossein Arbab Zavar


    Full Text Available Polypyrrole modified electrode prepared by electropolymerization of pyrrole in the presence of a complexing ligand, dibenzo-18-crown-6(DB18C6, was prepared and investigated as a Tb3+-selective electrode in acetonitrile. The potentiometric response of the electrode was linear within the Tb3+ concentration range 1 × 10−5–1 × 10−2 M with a Nernstian slope of 20.9 mVdecade−1 in AN. The electrode was applied to study the complexation of the terbium(III ion in acetonitrile with such other basic aprotic solvent molecules (D as dimethyl sulfoxide, N,N-dimethyl formamide, propylene carbonate and pyridine. The successive complex formation constant (βi and Gibbs energies of transfer (ΔGtr of Tb3+ in AN in relation to such D were obtained.

  10. Luminescence and Magnetic Properties of Two Three-Dimensional Terbium and Dysprosium MOFs Based on Azobenzene-4,4′-Dicarboxylic Linker

    Directory of Open Access Journals (Sweden)

    Belén Fernández


    Full Text Available We report the in situ formation of two novel metal-organic frameworks based on terbium and dysprosium ions using azobenzene-4,4′-dicarboxylic acid (H2abd as ligand, synthesized by soft hydrothermal routes. Both materials show isostructural three-dimensional networks with channels along a axis and display intense photoluminescence properties in the solid state at room temperature. Textural properties of the metal-organic frameworks (MOFs have been fully characterized although no appreciable porosity was obtained. Magnetic properties of these materials were studied, highlighting the dysprosium material displays slightly frequency-dependent out of phase signals when measured under zero external field and under an applied field of 1000 Oe.

  11. 29 CFR 1910.147 - The control of hazardous energy (lockout/tagout). (United States)


    ... devices. Energy source. Any source of electrical, mechanical, hydraulic, pneumatic, chemical, thermal, or... 29 Labor 5 2010-07-01 2010-07-01 false The control of hazardous energy (lockout/tagout). 1910.147... § 1910.147 The control of hazardous energy (lockout/tagout). (a) Scope, application and purpose—(1) Scope...

  12. 9 CFR 147.11 - Laboratory procedure recommended for the bacteriological examination of salmonella. (United States)


    ... the bacteriological examination of salmonella. 147.11 Section 147.11 Animals and Animal Products... procedure recommended for the bacteriological examination of salmonella. (a) For egg- and meat-type chickens... 25 birds, and birds from Salmonella enteritidis (SE) positive environments should be cultured in...

  13. 9 CFR 147.26 - Procedures for establishing isolation and maintaining sanitation and good management practices... (United States)


    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Procedures for establishing isolation... infections. 147.26 Section 147.26 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE... rodent population and other pests under control; (6) Tailor vaccination programs to needs of farm and...

  14. 40 CFR 147.501 - EPA-administered program-Class II wells and Indian lands. (United States)


    ... 40 CFR parts 124, 144, 146, 148, and any additional requirements set forth in the remainder of this... wells and Indian lands. 147.501 Section 147.501 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS (CONTINUED) STATE, TRIBAL, AND EPA-ADMINISTERED UNDERGROUND INJECTION...

  15. 19 CFR 147.32 - Detail of officers to protect the revenue. (United States)


    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Detail of officers to protect the revenue. 147.32...; DEPARTMENT OF THE TREASURY (CONTINUED) TRADE FAIRS Customs Supervision § 147.32 Detail of officers to protect the revenue. The port director shall detail an officer to act as his representative at the fair and...

  16. 40 CFR 147.3016 - Criteria and standards applicable to Class V wells. (United States)


    ... Class V wells. 147.3016 Section 147.3016 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... standards applicable to Class V wells. In addition to the criteria and standards applicable to Class V wells... within the Class IV category but that are used to dispose of radioactive wastes (as defined in 10 CFR...

  17. 9 CFR 147.14 - Procedures to determine status and effectiveness of sanitation monitored program. (United States)


    ... effectiveness of sanitation monitored program. 147.14 Section 147.14 Animals and Animal Products ANIMAL AND... status and effectiveness of sanitation monitored program. The following monitoring procedures 10 may be... sanitation program. (1) Culture the surface of cased eggs periodically for fecal contaminating organisms as...

  18. Luminescent europium and terbium complexes of dipyridoquinoxaline and dipyridophenazine ligands as photosensitizing antennae: structures and biological perspectives. (United States)

    Dasari, Srikanth; Patra, Ashis K


    The europium(III) and terbium(III) complexes, namely [Eu(dpq)(DMF)2(NO3)3] (1), [Eu(dppz)2(NO3)3] (2), [Tb(dpq)(DMF)2Cl3] (3), and [Tb(dppz)(DMF)2Cl3] (4), where dipyrido[3,2-d:2',3'-f]quinoxaline (dpq in 1 and 3), dipyrido[3,2-a:2',3'-c]phenazine (dppz in 2 and 4) and N,N'-dimethylformamide (DMF) have been isolated, characterized from their physicochemical data, luminescence studies and their interaction with DNA, serum albumin protein and photo-induced DNA cleavage activity are studied. The X-ray crystal structures of complexes 1-4 show discrete mononuclear Ln(3+)-based structures. The Eu(3+) in [Eu(dpq)(DMF)2(NO3)3] (1) and [Eu(dppz)2(NO3)3] (2) as [Eu(dppz)2(NO3)3]·dppz (2a) adopts a ten-coordinated bicapped dodecahedron structure with a bidentate N,N-donor dpq ligand, two DMF and three NO3(-) anions in 1 and two bidentate N,N-donor dppz ligands and three NO3(-) anions in 2. Complexes 3 and 4 show a seven-coordinated mono-capped octahedron structure where Tb(3+) contains bidentate dpq/dppz ligands, two DMF and three Cl(-) anions. The complexes are highly luminescent in nature indicating efficient photo-excited energy transfer from the dpq/dppz antenna to Ln(3+) to generate long-lived emissive excited states for characteristic f → f transitions. The time-resolved luminescence spectra of complexes 1-4 show typical narrow emission bands attributed to the (5)D0 → (7)F(J) and (5)D4 → (7)F(J) f-f transitions of Eu(3+) and Tb(3+) ions respectively. The number of inner-sphere water molecules (q) was determined from luminescence lifetime measurements in H2O and D2O confirming ligand-exchange reactions with water in solution. The complexes display significant binding propensity to the CT-DNA giving binding constant values in the range of 1.0 × 10(4)-6.1 × 10(4) M(-1) in the order 2, 4 (dppz) > 1, 3 (dpq). DNA binding data suggest DNA groove binding with the partial intercalation nature of the complexes. All the complexes also show binding propensity (K(BSA)

  19. Solution characterization of the extracellular region of CD147 and its interaction with its enzyme ligand cyclophilin-A

    Energy Technology Data Exchange (ETDEWEB)

    Schlegel, Jennifer; Redzic, Jasmina S.; Porter, Christopher; Yurchenko, Vyacheslav; Bukrinsky, Michael; Labeikovsky, Wladimir; Armstrong, Geoffrey S.; Zhang, Fengli; Isern, Nancy G.; Degregori, James; Hodges, Robert; Eisenmesser, Elan Z.


    The CD147 receptor plays an integral role in numerous diseases by stimulating the expression of several protein families and serving as the receptor for extracellular cyclophilins, however, neither CD147 nor its interactions with its cyclophilin ligands have been well characterized in solution. CD147 is a unique protein in that it can function both at the cell membrane and after being released from cells where it continues to retain activity. Thus, the CD147 receptor functions through at least two mechanisms that include both cyclophilin-independent and cyclophilin-dependent modes of action. In regard to CD147 cyclophilin-independent activity, CD147 homophilic interactions are thought to underlie its activity. In regard to CD147 cyclophilin-dependent activity, cyclophilin/CD147 interactions may represent a novel means of signaling since cyclophilins are also peptidyl-prolyl isomerases.

  20. CD147 deficiency blocks IL-8 secretion and inhibits lung cancer-induced osteoclastogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Hongkai; Zhuo, Yunyun; Hu, Xu; Shen, Weiwei; Zhang, Ying; Chu, Tongwei, E-mail:


    Bone is a frequent target of lung cancer metastasis, which is associated with significant morbidity and poor prognosis; however, the molecular basis of this process is still unknown. This study investigated the role of extracellular matrix metalloproteinase inducer (also known as cluster of differentiation (CD)147) in osteoclastogenesis resulting from bone metastasis, based on the enrichment of this glycoprotein on the surface of many malignant bone tumors. RNA interference was used to silence CD147 expression in A549 human lung cancer cells. Compared with conditioned medium (CM) from control cells (A549-CM), CM from CD147-deficient cells (A549-si-CM) suppressed receptor activator of nuclear factor κB ligand-stimulated osteoclastogenesis in RAW 264.7 cells and bone marrow-derived macrophages. The mRNA levels of osteoclast-specific genes such as tartrate-resistant acid phosphatase, calcitonin receptor, and cathepsin K were also reduced in the presence of A549-si-CM. CD147 knockdown in A549 cells decreased interleukin (IL)-8mRNA and protein expression. IL-8 is present in large amounts in A549-CM and mimicked its inductive effect on osteoclastogenesis; this was reversed by depletion of IL-8 from the medium. Taken together, these results indicate that CD147 promotes lung cancer-induced osteoclastogenesis by modulating IL-8 secretion, and suggest that CD147 is a potential therapeutic target for cancer-associated bone resorption in lung cancer patients. - Highlights: • Bone loss frequently results from lung cancer metastasis. • Cluster of differentiation (CD)147 was depleted in A549 lung adenocarcinoma cells. • RAW 264.7 cell osteoclastogenesis was blocked by medium from CD147-deficient cells. • Interleukin (IL)-8 level was reduced in the conditioned medium. • Osteoclastogenesis induced by lung tumor cells requires CD147-mediated IL-8 release.

  1. Spin Waves in Terbium

    DEFF Research Database (Denmark)

    Jensen, J.; Houmann, Jens Christian Gylden


    The selection rules for the linear couplings between magnons and phonons propagating in the c direction of a simple basal-plane hcp ferromagnet are determined by general symmetry considerations. The acoustic-optical magnon-phonon interactions observed in the heavy-rare-earth metals have been expl...... by Liu. The coupled magnon—transverse-phonon system for the c direction of Tb is analyzed in detail, and the strengths of the couplings are deduced as a function of wave vector by combining the experimental studies with the theory....

  2. Spin Waves in Terbium

    DEFF Research Database (Denmark)

    Jensen, J.; Houmann, Jens Christian Gylden; Bjerrum Møller, Hans


    The energies of spin waves propagating in the c direction of Tb have been studied by inelastic neutron scattering, as a function of a magnetic field applied along the easy and hard directions in the basal plane, and as a function of temperature. From a general spin Hamiltonian, consistent...... with the symmetry, we deduce the dispersion relation for the spin waves in a basal-plane ferromagnet. This phenomenological spin-wave theory accounts for the observed behavior of the magnon energies in Tb. The two q⃗-dependent Bogoliubov components of the magnon energies are derived from the experimental results...

  3. 9 CFR 147.10 - Laboratory procedure recommended for the bacteriological examination of egg-type breeding flocks... (United States)


    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Laboratory procedure recommended for... environments. 147.10 Section 147.10 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE...) Enrichment culture of organ (non-intestinal) tissues using a non- selective broth, § 147.11(a)(2) of this...

  4. 40 CFR 147.2650 - State-administered program-Class I, II, III, IV, and V wells. (United States)


    ... CONTROL PROGRAMS Puerto Rico § 147.2650 State-administered program—Class I, II, III, IV, and V wells. The... 40 Protection of Environment 22 2010-07-01 2010-07-01 false State-administered program-Class I, II, III, IV, and V wells. 147.2650 Section 147.2650 Protection of Environment ENVIRONMENTAL PROTECTION...

  5. 40 CFR 147.2000 - State-administered program-Class I, II, III, IV, and V wells. (United States)


    ... CONTROL PROGRAMS Rhode Island § 147.2000 State-administered program—Class I, II, III, IV, and V wells. The... 40 Protection of Environment 22 2010-07-01 2010-07-01 false State-administered program-Class I, II, III, IV, and V wells. 147.2000 Section 147.2000 Protection of Environment ENVIRONMENTAL PROTECTION...

  6. 33 CFR 147.847 - Safety Zone; BW PIONEER Floating Production, Storage, and Offloading System Safety Zone. (United States)


    ... Production, Storage, and Offloading System Safety Zone. 147.847 Section 147.847 Navigation and Navigable... ZONES § 147.847 Safety Zone; BW PIONEER Floating Production, Storage, and Offloading System Safety Zone. (a) Description. The BW PIONEER, a Floating Production, Storage and Offloading (FPSO) system, is in...

  7. 19 CFR 147.23 - Compliance with Plant Quarantine Act and Federal Food, Drug, and Cosmetic Act. (United States)


    ... Food, Drug, and Cosmetic Act. 147.23 Section 147.23 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION... Laws § 147.23 Compliance with Plant Quarantine Act and Federal Food, Drug, and Cosmetic Act. (a) Plant... the plant quarantine regulations. (b) Federal Food, Drug, and Cosmetic Act. The entry of food products...

  8. Crystal field analysis of Pm$^{3+}$ (4$^{f4}) and Sm$^{3+}$ (4$^{f5}) and lattice location studies of $^{147}$Nd and $^{147}$Pm in w-AlN

    CERN Document Server

    Vetter, Ulrich; Nijjar, Anmol S; Zandi, Bahram; Öhl, Gregor; Wahl, Ulrich; De Vries, Bart; Hofsäss, Hans; Dietrich, Marc


    We report a detailed crystal field analysis of Pm3+ and Sm3+ as well as lattice location studies of 147Pm and 147Nd in 2H-aluminum nitride (w-AlN). The isotopes of mass 147 were produced by nuclear fission and implanted at an energy of 60 keV. The decay chain of interest in this work is 147Nd→147Pm→147Sm (stable). Lattice location studies applying the emission channeling technique were carried out using the β− particles and conversion electrons emitted in the radioactive decay of 147Nd→147Pm. The samples were investigated as implanted, and also they were investigated after annealing to temperatures of 873 K as well as 1373 K. The main fraction of about 60% of both 147Pm as well as 147Nd atoms was located on substitutional Al sites in the AlN lattice; the remainder of the ions were located randomly within the AlN lattice. Following radioactive decay of 147Nd, the cathodoluminescence spectra of Pm3+ and Sm3+ were obtained between 500 nm and 1050 nm at sample temperatures between 12 K and 300 K. High-re...

  9. CD147 (EMMPRIN/Basigin) in kidney diseases: from an inflammation and immune system viewpoint. (United States)

    Kosugi, Tomoki; Maeda, Kayaho; Sato, Waichi; Maruyama, Shoichi; Kadomatsu, Kenji


    The glycosylated transmembrane protein CD147/basigin, also known as extracellular matrix metalloproteinase (MMP) inducer (EMMPRIN), contributes to cell survival, migration and cancer invasion. In normal kidneys, high expression of CD147 is detected only in the basolateral side of tubular epithelial cells (TECs). The pathophysiological roles of CD147 in the kidneys are diverse, ranging from involvement in the occurrence of acute kidney injury (AKI) that is frequently accompanied by ischemia, inflammation and a loss of self-tolerance to the progression of chronic kidney disease (CKD) that is caused by an imbalance in extracellular matrix protein turnover. In AKI induced by ischemia, it is the CD147 on neutrophils, rather than that on TECs, that coordinately participates in massive neutrophil recruitment via acting as a physiological ligand for E-selectin, which is specifically enhanced in the endothelium upon inflammatory stimulation. In the CKD that follows AKI, a molecular circuit involving CD147, MMPs and transforming growth factor-β may be involved in the pathogenesis of progressive fibrosis through hyaluronan production and macrophage infiltration. Whereas CD147 thus plays deleterious roles in ischemic and fibrotic kidney injuries, CD147 expression on lymphocytes might decrease the disease activity of lupus nephritis (LN) by functioning as a potential negative regulator of the extraordinary proliferation of lymphocytes that occurs in this disease. In line with these basic studies, our clinical data indicate the potential of plasma CD147 to function as a critical biomarker for both ischemic AKI and LN. CD147 is also involved in crosstalk between the kidneys and distant organs, which may be mediated by chemotactic cytokines that are derived from circulating inflammatory cells and damaged organs. Disruption of such a vicious chain reaction involving CD147 would therefore be required in order to overcome kidney diseases. Multidisciplinary research regarding CD147

  10. CD147 as a Novel Prognostic Biomarker for Hepatocellular Carcinoma: A Meta-Analysis

    Directory of Open Access Journals (Sweden)

    Fei Peng


    Full Text Available We conducted a meta-analysis to investigate the controversial association of CD147 expression with HCC prognosis and clinicopathological characteristics. Eight studies from PubMed (1966–2016, EMBASE (1980–2016, Cochrane Library (1996–2016, Web of Science (1945–2016, China National Knowledge Infrastructure (1982–2016, and Wanfang databases (1988–2016 were considered. The associations between CD147 expression and clinicopathological parameters and overall survival (OS or DFS/RFS were reassessed using the meta-analysis for odds ratio (OR or hazard ratio (HR and 95% confidence interval (CI. CD147 expression was associated with DFS/RFS (HR = 3.26; 95% CI: 1.82–5.83; P<0.0001 but not with OS (HR = 1.35; 95% CI: 0.56–3.29; P=0.51. We also delved deeper into the association between median survival time and CD147 expression owing to significant heterogeneity and found significant differences between high and low CD147 expression groups with respect to median survival time. CD147 expression was closely associated with the TNM stage (OR = 0.18; 95% CI: 0.04–0.85; P=0.03 and venous invasion (OR = 6.29; 95% CI: 1.70–23.20; P=0.006. In contrast, there was no association between CD147 expression and tumor stage, cirrhosis, differentiation, lymph node metastasis, HBsAg, and serum AFP levels. Thus, CD147 expression is potentially closely related to HCC survival and associated clinicopathological parameters, paving the way for further research.

  11. Synthesis and crystal structure of terbium(III) meta-oxoborate Tb(BO{sub 2}){sub 3} ({identical_to} TbB{sub 3}O{sub 6}); Synthese und Kristallstruktur von Terbium(III)-meta-Oxoborat Tb(BO{sub 2}){sub 3} ({identical_to} TbB{sub 3}O{sub 6})

    Energy Technology Data Exchange (ETDEWEB)

    Nikelski, Tanja; Schleid, Thomas [Institut fuer Anorganische Chemie der Universitaet Stuttgart (Germany)


    The terbium meta-oxoborate Tb(BO{sub 2}){sub 3} ({identical_to} TbB{sub 3}O{sub 6}) is obtained as single crystals by the reaction of terbium, Tb{sub 4}O{sub 7} and TbCl{sub 3} with an excess of B{sub 2}O{sub 3} in gastight sealed platinum ampoules at 950 C after three weeks. The compound appears to be air- and water-resistant and crystallizes as long, thin, colourless needles which tend to growth-twinning due to their marked fibrous habit. The crystal structure of Tb(BO{sub 2}){sub 3} (orthorhombic, Pnma; a = 1598.97(9), b = 741.39(4), c = 1229.58(7) pm; Z = 16) contains strongly corrugated oxoborate layers {sub {infinity}}{sup 2}{l_brace}(BO{sub 2}){sup -}{r_brace} built of vertex-linked [BO{sub 4}]{sup 5-} tetrahedra (d(B-O) = 143 - 154 pm, and angsph;(O-B-O) = 102-115 ) which spread out parallel (100). The four crystallographically different Tb{sup 3+} cations all exhibit coordination numbers of eight towards the oxygen atoms (d(Tb-O) = 228-287 pm). The corresponding metal cation polyhedra [TbO{sub 8}]{sup 13+} too convene to layers (composition: {sub {infinity}}{sup 2}{l_brace}(Tb{sub 2}O{sub 11}){sup 16-}{r_brace}) which are likewise oriented parallel to the (100) plane. (Abstract Copyright [2003], Wiley Periodicals, Inc.) [German] Das Terbium-meta-Oxoborat Tb(BO{sub 2}){sub 3} ({identical_to} TbB{sub 3}O{sub 6}) entsteht einkristallin bei der Reaktion von Terbium, Tb{sub 4}O{sub 7} und TbCl{sub 3} mit einem Ueberschuss von B{sub 2}O{sub 3} in gasdicht verschlossenen Platinampullen nach drei Wochen bei 950 C. Die Verbindung ist luft- und wasserstabil und faellt in langen, duennen, farblosen Nadeln an, die aufgrund ihres ausgepraegt faserigen Habitus zur Wachstumsverzwillingung neigen. Die Kristallstruktur von Tb(BO{sub 2}){sub 3} (orthorhombisch, Pnma; a = 1598, 97(9), b = 741, 39(4), c = 1229, 58(7) pm; Z = 16) enthaelt parallel (100) verlaufende, stark gewellte Oxoborat-Schichten {sub {infinity}}{sup 2}{l_brace}(BO{sub 2}){sup -}{r_brace} aus

  12. An integrated logic system for time-resolved fluorescent "turn-on" detection of cysteine and histidine base on terbium (III) coordination polymer-copper (II) ensemble. (United States)

    Xue, Shi-Fan; Lu, Ling-Fei; Wang, Qi-Xian; Zhang, Shengqiang; Zhang, Min; Shi, Guoyue


    Cysteine (Cys) and histidine (His) both play indispensable roles in many important biological activities. An enhanced Cys level can result in Alzheimer's and cardiovascular diseases. Likewise, His plays a significant role in the growth and repair of tissues as well as in controlling the transmission of metal elements in biological bases. Therefore, it is meaningful to detect Cys and His simultaneously. In this work, a novel terbium (III) coordination polymer-Cu (II) ensemble (Tb(3+)/GMP-Cu(2+)) was proposed. Guanosine monophosphate (GMP) can self-assemble with Tb(3+) to form a supramolecular Tb(3+) coordination polymer (Tb(3+)/GMP), which can be suited as a time-resolved probe. The fluorescence of Tb(3+)/GMP would be quenched upon the addition of Cu(2+), and then the fluorescence of the as-prepared Tb(3+)/GMP-Cu(2+) ensemble would be restored again in the presence of Cys or His. By incorporating N-Ethylmaleimide and Ni(2+) as masking agents, Tb(3+)/GMP-Cu(2+) was further exploited as an integrated logic system and a specific time-resolved fluorescent "turn-on" assay for simultaneously sensing His and Cys was designed. Meanwhile it can also be used in plasma samples, showing great potential to meet the need of practical application. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Synthesis and photoluminescence properties of cerium-doped terbium-yttrium aluminum garnet phosphor for white light-emitting diodes applications (United States)

    Wang, Jun; Han, Tao; Lang, Tianchun; Tu, Mingjing; Peng, Lingling


    Cerium-doped terbium-yttrium aluminum garnet phosphors were synthesized using the solid-state reaction method. The crystalline phase, morphology, and photoluminescence properties were characterized by x-ray diffraction (XRD), scanning electron microscope (SEM), and fluorescence spectrophotometer, respectively. The XRD results indicate that with an increase of the amount of x (Tb3+), all of the samples have a pure garnet crystal structure without secondary phases. The SEM images reveal that the samples are composed of sphere-like crystallites, which exhibit different degrees of agglomeration. The luminescent properties of Ce ions in )Al5O12∶Ce0.1 have been studied, and it was found that the emission band shifted toward a longer wavelength. The redshift is attributed to the lowering of the 5d energy level centroid of Ce, which can be explained by the nephelauxetic effect and compression effect. These phosphors were coated on blue light-emitting diode (LED) chips to fabricate white light-emitting diodes (WLEDs), and their color-rendering indices, color temperatures, and luminous efficiencies were measured. As a consequence of the addition of Tb, the blue LED pumped )Al5O12∶Ce0.1 phosphors WLEDs showed good optical properties.

  14. Study on the fluorescent enhancement effect in terbium-gadolinium-protein-sodium dodecyl benzene sulfonate system and its application on sensitive detection of protein at nanogram level. (United States)

    Sun, Changxia; Yang, Jinghe; Wu, Xia; Liu, Shufang; Su, Benyu


    The co-luminescence effect in a terbium-gadolinium-protein-sodium dodecyl benzene sulfonate (SDBS) system is reported here. Based on it, the sensitive quantitative analysis of protein at nanogram levels is established. The co-luminescence mechanism is studied using fluorescence, resonance light scattering (RLS), absorption spectroscopy and NMR measurement. It is considered that protein could be unfolded by SDBS, then a efficacious intramolecular fluorescent energy transfer occurs from unfolded protein to rare earth ions through SDBS acting as a "transfer bridge" to enhance the emission fluorescence of Tb3+ in this ternary complex of Tb-SDBS-BSA, where energy transfer from protein to SDBS by aromatic ring stacking is the most important step. Cooperating with the intramolecular energy transfer above is the intermolecular energy transfer between the simultaneous existing complexes of both Tb3+ and Gd3+. The fluorescence quantum yield is increased by an energy-insulating sheath, which is considered to be another reason for the resulting enhancement of the fluorescence. Förster theory is used to calculate the distribution of enhancing factors and has led to a greater understanding of the mechanisms of energy transfer.

  15. [Studies on luminescence properties of seven ternary complexes of terbium with 1,10-phenanthroline and benzoic acid and its derivatives]. (United States)

    Gao, Zhi-hua; Wang, Shu-ping; Liu, Cui-ge; Ma, Rui-xia; Wang, Rui-fen


    Seven ternary complexes of Tb(III) were synthesized with benzoic acid (BA), o-, m-, p-methylbenzoic acid (o-MBA, m-MBA, p-MBA), and o-, m-, p-methoxybenzoic acid (o-MOBA, m-MOBA, p-MOBA) as the first ligand, and 1,10-phenanthroline (phen) as the second ligand. The content of C, H and N were measured by using a Flash-EA model 1112 elemental analyzer. Excitation and luminescence spectra of the title solid complexes were recorded by using a Hitachi F-4500 fluorescence spectrophotometer at room temperature. The effects of different varieties and different positions of replacing benzoic acid as the first ligand on fluorescence properties of the ternary complexes of terbium were discussed. The results indicated that the intensity of 5D4-->7F6 (489 nm) and 5D4-->7F5 (545 nm) of substituting benzoic acid complexes was stronger than benzoic acid. Three ternary complexes of Tb(III) with o-, m-, p-methylbenzoic acid showed emission intensity in the consecution: Tb(o-MBA)3 phenMOBA)3phen x H2O>Tb(m-MOBA)3phen x H2O>Tb(p-MOBA)3 phen.

  16. Increased expression of CD147 and MMP-9 is correlated with poor prognosis of salivary duct carcinoma. (United States)

    Piao, Songlin; Zhao, Shu; Guo, Fulin; Xue, Jie; Yao, Guodong; Wei, Zhili; Huang, Qi; Sun, Yao; Zhang, Bin


    The aim of this study was to investigate expression of CD147 and MMP-9 in salivary duct carcinoma (SDC) so as to determine whether these two genes may be correlated with poor prognosis of SDC. We examined the significance of the CD147 and MMP-9 expression in SDC (n = 35), non-cancerous salivary tissue (n = 20) in previously untreated patients using immunohistochemical staining. Furthermore, we analyzed the correlation between the expression of these two genes and various clinicopathologic factors including survival status of patients with SDC. Positive stain of CD147 and MMP-9 was seen in all 35 cases of tumor samples. A statistical correlation was observed between CD147 and MMP-9 expression in SDC tissues. The incidences of high expression were 45.71% for CD147 and 51.43% for MMP-9 in 35 SDC tissues, respectively. High expression of CD147 and MMP-9 was significantly correlated with clinical feature and shorter progression-free survival (PFS) (P (CD147) = 0.031; P (MMP-9) = 0.020) and overall survival (OS) (P (CD147) = 0.044; P (MMP-9) = 0.013). CD147 and MMP-9 expression is correlated with invasion, metastasis and shorter PFS/OS of SDC. Patients with high expression of CD147 and MMP-9 had poor prognosis than SDC patients with low expression.

  17. Stabilized Polymer Micelles for the Development of IT-147, an Epothilone D Drug-Loaded Formulation

    Directory of Open Access Journals (Sweden)

    Adam Carie


    Full Text Available Epothilones have demonstrated promising potential for oncology applications but suffer from a narrow therapeutic window. Epothilone D stabilizes microtubules leading to apoptosis, is active against multidrug-resistant cells, and is efficacious in animal tumor models despite lack of stability in rodent plasma. Clinical development was terminated in phase II due to dose limiting toxicities near the efficacious dose. Taken together, this made epothilone D attractive for encapsulation in a stabilized polymer micelle for improved safety and efficacy. We have designed a library of triblock copolymers to develop IT-147, a lead formulation of epothilone D that extends plasma circulation for accumulation in the tumor environment, and potentially decrease systemic exposure to reduce dose limiting toxicities. The drug loading efficiency for IT-147 exceeds 90%, is 75 nm in diameter, and demonstrates pH-dependent release of epothilone D without chemical conjugation or enzymatic activation. Administration of IT-147 at 20 mg/kg increases exposure of epothilone D to the plasma compartment over 6-fold compared to free drug. At the same dose, 20 mg/kg epothilone D from IT-147 is considered the no observed adverse effect level (NOAEL but is the maximum tolerated dose for free drug. Consequently, IT-147 is positioned to be a safer, more effective means to deliver epothilone D.

  18. Full-length soluble CD147 promotes MMP-2 expression and is a potential serological marker in detection of hepatocellular carcinoma (United States)


    Background As a surface glycoprotein, CD147 is capable of stimulating the production of matrix metalloproteinases (MMPs) from neighboring fibroblasts. The aim of the present study is to explore the role of soluble CD147 on MMPs secretion from hepatocellular carcinoma (HCC) cells, and to investigate the diagnostic value of serum soluble CD147 in the HCC detection. Methods We identified the form of soluble CD147 in cell culture supernate of HCC cells and serum of patients with HCC, and explored the role of soluble CD147 on MMPs secretion. Serum CD147 levels were detected by the enzyme-linked immunosorbent assay, and the value of soluble CD147 as a marker in HCC detection was analyzed. Results Full length soluble CD147 was presented in the culture medium of HCC cells and serum of patients with HCC. The extracellular domain of soluble CD147 promoted the expression of CD147 and MMP-2 from HCC cells. Knockdown of CD147 markedly diminished the up-regulation of CD147 and MMP-2 which induced by soluble CD147. Soluble CD147 activated ERK, FAK, and PI3K/Akt pathways, leading to the up-regulation of MMP-2. The level of soluble CD147 in serum of patients with HCC was significantly elevated compared with healthy individuals (P Soluble CD147 levels were found to be associated with HCC tumor size (P = 0.007) and Child-Pugh grade (P = 0.007). Moreover, soluble CD147 showed a better performance in distinguishing HCC compared with alpha-fetoprotein. Conclusions The extracellular domain of soluble CD147 enhances the secretion of MMP-2 from HCC cells, requiring the cooperation of membrane CD147 and activation of ERK, FAK, and PI3K/Akt signaling. The measurement of soluble CD147 may offer a useful approach in diagnosis of HCC. PMID:24996644

  19. Near-IR TRGB Distance to Dwarf Elliptical Galaxy NGC 147

    Directory of Open Access Journals (Sweden)

    A. Kang


    Full Text Available We report the distance modulus of nearby dwarf elliptical galaxy NGC 147 estimated from the Tip of Red-giant Branch (TRGB method applying to the color-magnitude diagrams and luminosity functions in the near-infrared JHK bands. Apparent magnitudes of TRGBs in each band are obtained by applying Savitzky-Golay filter to the luminosity functions, and the theoretical absolute magnitudes are estimated from Yonsei-Yale isochrones. The derived values of distance modulus to NGC 147 are (m-M=23.69±0.12, 23.78±0.17, and 23.85±0.22 for J, H, and K bands, respectively. Distance modulus in bolometric magnitude is also derived as (m-M=23.87±0.11. We compare the derived values of the TRGB distance modulus to NGC 147 in the near-infrared bands with the previous results in other bands.

  20. Co-expression of CD147 and GLUT-1 indicates radiation resistance and poor prognosis in cervical squamous cell carcinoma. (United States)

    Huang, Xin-Qiong; Chen, Xiang; Xie, Xiao-Xue; Zhou, Qin; Li, Kai; Li, Shan; Shen, Liang-Fang; Su, Juan


    The aim of this study was to investigate the association of CD147 and GLUT-1, which play important roles in glycolysis in response to radiotherapy and clinical outcomes in patients with locally advanced cervical squamous cell carcinoma (LACSCC). The records of 132 female patients who received primary radiation therapy to treat LACSCC at FIGO stages IB-IVA were retrospectively reviewed. Forty-seven patients with PFS (progression-free survival) of less than 36 months were regarded as radiation-resistant. Eighty-five patients with PFS longer than 36 months were regarded as radiation-sensitive. Using pretreatment paraffin-embedded tissues, we evaluated CD147 and GLUT-1 expression by immunohistochemistry. Overexpression of CD147, GLUT-1, and CD147 and GLUT-1 combined were 44.7%, 52.9% and 36.5%, respectively, in the radiation-sensitive group, and 91.5%, 89.4% and 83.0%, respectively, in the radiation-resistant group. The 5-year progress free survival (PFS) rates in the CD147-low, CD147-high, GLUT-1-low, GLUT-1-high, CD147- and/or GLUT-1-low and CD147- and GLUT-1- dual high expression groups were 66.79%, 87.10%, 52.78%, 85.82%, 55.94%, 82.90% and 50.82%, respectively. CD147 and GLUT-1 co-expression, FIGO stage and tumor diameter were independent poor prognostic factors for patients with LACSCC in multivariate Cox regression analysis. Patients with high expression of CD147 alone, GLUT-1 alone or co-expression of CD147 and GLUT-1 showed greater resistance to radiotherapy and a shorter PFS than those with low expression. In particular, co-expression of CD147 and GLUT-1 can be considered as a negative independent prognostic factor.

  1. The Biological Function and Clinical Utilization of CD147 in Human Diseases: A Review of the Current Scientific Literature


    Lijuan Xiong; Edwards, Carl K.; Lijun Zhou


    CD147 or EMMPRIN is a member of the immunoglobulin superfamily in humans. It is widely expressed in human tumors and plays a central role in the progression of many cancers by stimulating the secretion of matrix metalloproteinases (MMPs) and cytokines. CD147 regulates cell proliferation, apoptosis, and tumor cell migration, metastasis and differentiation, especially under hypoxic conditions. CD147 is also important to many organ systems. This review will provide a detailed overview of the dis...

  2. MicroRNA-147b regulates vascular endothelial barrier function by targeting ADAM15 expression.

    Directory of Open Access Journals (Sweden)

    Victor Chatterjee

    Full Text Available A disintegrin and metalloproteinase15 (ADAM15 has been shown to be upregulated and mediate endothelial hyperpermeability during inflammation and sepsis. This molecule contains multiple functional domains with the ability to modulate diverse cellular processes including cell adhesion, extracellular matrix degradation, and ectodomain shedding of transmembrane proteins. These characteristics make ADAM15 an attractive therapeutic target in various diseases. The lack of pharmacological inhibitors specific to ADAM15 prompted our efforts to identify biological or molecular tools to alter its expression for further studying its function and therapeutic implications. The goal of this study was to determine if ADAM15-targeting microRNAs altered ADAM15-induced endothelial barrier dysfunction during septic challenge by bacterial lipopolysaccharide (LPS. An in silico analysis followed by luciferase reporter assay in human vascular endothelial cells identified miR-147b with the ability to target the 3' UTR of ADAM15. Transfection with a miR-147b mimic led to decreased total, as well as cell surface expression of ADAM15 in endothelial cells, while miR-147b antagomir produced an opposite effect. Functionally, LPS-induced endothelial barrier dysfunction, evidenced by a reduction in transendothelial electric resistance and increase in albumin flux across endothelial monolayers, was attenuated in cells treated with miR-147b mimics. In contrast, miR-147b antagomir exerted a permeability-increasing effect in vascular endothelial cells similar to that caused by LPS. Taken together, these data suggest the potential role of miR147b in regulating endothelial barrier function by targeting ADAM15 expression.

  3. Self-diffusion coefficients of the trivalent f-element ion series in dilute and moderately dilute aqueous solutions: A comparative study between europium, gadolinium, terbium and berkelium (United States)

    Rafik, Besbes; Noureddine, Ouerfelli; Abderabbou, Abdelmanef; Habib, Latrous


    We have continued the studies on the trivalent ions of the 4f and 5f elements. In this paper, we compare the transport properties (self-diffusion coefficient) of the trivalent aquo ions over two ranges of concentrations (0 — 2×10-3M) and (2×10-3 — 1.5M). Self-diffusion coefficients, D, of the trivalent f-element aquo ion series have been determined in aqueous background electrolytes of Gd(NO3)3 and Nd(ClO4)3, at pH=2.5 (HNO3, HClO4) and at 25°C using the open-end capillary method (O.E.C.M.). This method measures the transportation time of ions across a fixed distance. In this paper, we complete a measurement of self-diffusion coefficient for terbium. We optimized the pH to avoid hydrolysis, ion-pairing and complexation of the trivalent 4f and 5f ions. The variation of D versus √C is not linear for dilute solutions (0 — 2×10-3M) and quasi-linear in moderate concentrations (C<=1.5 M). Similar behavior was observed for Tb, as compared with those for Bk, Eu and Gd. We complete the comparison variation of D/D° versus √C for all studied 4f and 5f elements from concentration 0 to 1.5M and we obtained the same variation with √C for all studied elements. All 4f and 5f elements studied follow the Nernst-Hartley expression.

  4. Terbium-based time-gated Förster resonance energy transfer imaging for evaluating protein-protein interactions on cell membranes. (United States)

    Lindén, Stina; Singh, Manish Kumar; Wegner, K David; Regairaz, Marie; Dautry, François; Treussart, François; Hildebrandt, Niko


    Fluorescence imaging of cells and subcellular compartments is an essential tool to investigate biological processes and to evaluate the development and progression of diseases. In particular, protein-protein interactions can be monitored by Förster resonance energy transfer (FRET) between two proximal fluorophores that are attached to specific recognition biomolecules such as antibodies. We investigated the membrane expression of E- and N-cadherins in three different cell lines used as model systems to study epithelial to mesenchymal transition (EMT) and a possible detection of circulating tumour cells (CTCs). EMT is a key process in cancer metastasis, during which epithelial markers (such as E-cadherin) are down-regulated in the primary tumour whereas mesenchymal markers (such as N-cadherin) are up-regulated, leading to enhanced cell motility, intravasation, and appearance of CTCs. Various FRET donor-acceptor pairs and protein recognition strategies were utilized, in which Lumi4-Tb terbium complexes (Tb) and different organic dyes were conjugated to several distinct E- and N-cadherin-specific antibodies. Pulsed excitation of Tb at low repetition rates (100 Hz) and time-gated (TG) imaging of both the Tb-donor and the dye-acceptor photoluminescence (PL) allowed efficient detection of the EMT markers as well as FRET in the case of sufficient donor-acceptor proximity. Efficient FRET was observed only between two E-cadherin-specific antibodies and further experiments indicated that these antibodies recognized the same E-cadherin molecule, suggesting a limited accessibility of cadherins when they are clustered at adherens junctions. The investigated Tb-to-dye FRET systems provided reduced photobleaching compared to the AlexaFluor 488-568 donor-acceptor pair. Our results demonstrate the applicability and advantages of Tb-based TG FRET for efficient and stable imaging of antibody-antibody interactions on different cell lines. They also reveal the limitations of

  5. A broad G protein-coupled receptor internalization assay that combines SNAP-tag labeling, diffusion-enhanced resonance energy transfer, and a highly emissive terbium cryptate acceptor

    Directory of Open Access Journals (Sweden)

    Angélique eLEVOYE


    Full Text Available Although G protein-coupled receptor (GPCR internalization has long been considered a major aspect of the desensitization process that tunes ligand responsiveness, internalization is also involved in receptor resensitization and signaling, as well as the ligand scavenging function of some atypical receptors. Internalization thus contributes to the diversity of GPCR-dependent signaling, and its dynamics and quantification in living cells has generated considerable interest. We developed a robust and sensitive assay to follow and quantify ligand-induced and constitutive GPCR internalization but also receptor recycling in living cells. This assay is based on diffusion-enhanced resonance energy transfer (DERET between cell surface GPCRs labeled with a luminescent terbium cryptate donor and a fluorescein acceptor present in the culture medium. GPCR internalization results in a quantifiable reduction of energy transfer. This method yields a high signal-to-noise ratio due to time-resolved measurements. For various GPCRs belonging to different classes, we demonstrated that constitutive and ligand-induced internalization could be monitored as a function of time and ligand concentration, thus allowing accurate quantitative determination of kinetics of receptor internalization but also half-maximal effective or inhibitory concentrations of compounds. In addition to its selectivity and sensitivity, we provided evidence that DERET-based internalization assay is particularly suitable for characterizing biased ligands. Furthermore, the determination of a Z’-factor value of 0.45 indicates the quality and suitability of DERET-based internalization assay for high-throughput screening (HTS of compounds that may modulate GPCRs internalization.

  6. 33 CFR 147.827 - Marlin Tension Leg Platform safety zone. (United States)


    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Marlin Tension Leg Platform... SECURITY (CONTINUED) OUTER CONTINENTAL SHELF ACTIVITIES SAFETY ZONES § 147.827 Marlin Tension Leg Platform safety zone. (a) Description. The Marlin Tension Leg Platform (Marlin TLP), Viasca Knoll, Block 915 (VK...

  7. 9 CFR 147.1 - The standard tube agglutination test. 1 (United States)


    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false The standard tube agglutination test... Blood Testing Procedures § 147.1 The standard tube agglutination test. 1 1 The procedure described is a... alternate medium for the preparation of tube agglutination antigen. The TG medium, formerly used for the...

  8. 9 CFR 147.7 - Standard test procedures for mycoplasma. 5 (United States)


    ... Blood Testing Procedures § 147.7 Standard test procedures for mycoplasma. 5 5 For additional information... pipette or standardized loop (rinsed between samples) to 11/2 inch squares on a ruled glass plate. Limit... deposit resuspended to give a 25 percent suspension of packed RBC's in Alsever's solution. (In testing...

  9. 19 CFR 147.45 - Merchandise from a foreign-trade zone. (United States)


    ...; DEPARTMENT OF THE TREASURY (CONTINUED) TRADE FAIRS Disposition of Articles Entered for Fairs § 147.45 Merchandise from a foreign-trade zone. Articles entered for a fair from a foreign-trade zone status of “zone-restricted merchandise” can afterwards be entered for consumption from a fair if the Foreign-Trade Zones...

  10. 33 CFR 147.837 - Marco Polo Tension Leg Platform safety zone. (United States)


    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Marco Polo Tension Leg Platform... SECURITY (CONTINUED) OUTER CONTINENTAL SHELF ACTIVITIES SAFETY ZONES § 147.837 Marco Polo Tension Leg Platform safety zone. (a) Description. Marco Polo Tension Leg Platform, Green Canyon 608 (GC 608), located...

  11. 33 CFR 147.809 - Mars Tension Leg Platform safety zone. (United States)


    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Mars Tension Leg Platform safety... SECURITY (CONTINUED) OUTER CONTINENTAL SHELF ACTIVITIES SAFETY ZONES § 147.809 Mars Tension Leg Platform safety zone. (a) Description. The Mars Tension Leg Platform (Mars TLP) is located at position 28°10′10.29...

  12. Prognostic Indications of Elevated MCT4 and CD147 across Cancer Types: A Meta-Analysis

    Directory of Open Access Journals (Sweden)

    Cory D. Bovenzi


    Full Text Available Background. Metabolism in the tumor microenvironment can play a critical role in tumorigenesis and tumor aggression. Metabolic coupling may occur between tumor compartments; this phenomenon can be prognostically significant and may be conserved across tumor types. Monocarboxylate transporters (MCTs play an integral role in cellular metabolism via lactate transport and have been implicated in metabolic synergy in tumors. The transporters MCT1 and MCT4 are regulated via expression of their chaperone, CD147. Methods. We conducted a meta-analysis of existing publications on the relationship between MCT1, MCT4, and CD147 expression and overall survival and disease-free survival in cancer, using hazard ratios derived via multivariate Cox regression analyses. Results. Increased MCT4 expressions in the tumor microenvironment, cancer cells, or stromal cells were all associated with decreased overall survival and decreased disease-free survival (p<0.001 for all analyses. Increased CD147 expression in cancer cells was associated with decreased overall survival and disease-free survival (p<0.0001 for both analyses. Few studies were available on MCT1 expression; MCT1 expression was not clearly associated with overall or disease-free survival. Conclusion. MCT4 and CD147 expression correlate with worse prognosis across many cancer types. These results warrant further investigation of these associations.

  13. 46 CFR 147.50 - Fuel for cooking, heating, and lighting. (United States)


    ... SHIPS' STORES Stowage and Other Special Requirements for Particular Materials § 147.50 Fuel for cooking... and commercial standard fuel oil No. 1, No. 2, and No. 3 are prohibited for cooking, heating, or... used, a non-flammable priming liquid must be used. (4) Fuel tanks for fixed stoves must be separated...

  14. 40 CFR 147.651 - EPA-administered program-Indian lands. (United States)


    ... requirements of 40 CFR parts 124, 144, 146, 148, and any additional requirements set forth in the remainder of this subpart. Injection well owners and operators, and EPA shall comply with these requirements. (b... PROGRAMS (CONTINUED) STATE, TRIBAL, AND EPA-ADMINISTERED UNDERGROUND INJECTION CONTROL PROGRAMS Idaho § 147...

  15. 40 CFR 147.1001 - EPA-administered program-Indian lands. (United States)


    ... requirements of 40 CFR parts 124, 144, 146, 148, and any additional requirements set forth in the remainder of this subpart. Injection well owners and operators and EPA shall comply with these requirements. (b... PROGRAMS (CONTINUED) STATE, TRIBAL, AND EPA-ADMINISTERED UNDERGROUND INJECTION CONTROL PROGRAMS Maine § 147...

  16. 32 CFR 147.11 - Guideline I-Emotional, mental, and personality disorders. (United States)


    ... professional that an individual's previous emotional, mental, or personality disorder is cured, under control... 32 National Defense 1 2010-07-01 2010-07-01 false Guideline I-Emotional, mental, and personality... CLASSIFIED INFORMATION Adjudication § 147.11 Guideline I—Emotional, mental, and personality disorders. (a...

  17. 29 CFR 780.147 - Practices performed on farm products-special factors considered. (United States)


    ... in Conjunction Withâ the Farming Operations § 780.147 Practices performed on farm products—special... commodities is incident to or in conjunction with the farming operations of a farmer or a farm, it is also... between operations incident to agriculture and operations of commercial or industrial processors who...

  18. 27 CFR 28.147 - Return of beer or beer concentrate. (United States)


    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Return of beer or beer... BUREAU, DEPARTMENT OF THE TREASURY LIQUORS EXPORTATION OF ALCOHOL Removal of Beer and Beer Concentrate...-Trade Zone § 28.147 Return of beer or beer concentrate. Beer or beer concentrate removed without payment...

  19. 46 CFR 147A.31 - Removal of fumigation material and warning signs. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Removal of fumigation material and warning signs. 147A... material and warning signs. After ventilation is completed and a marine chemist or other qualified person... vessel, shall ensure that all warning signs are removed and fumigation containers and materials are...

  20. 10 CFR 30.19 - Self-luminous products containing tritium, krypton-85, or promethium-147. (United States)


    ... 10 Energy 1 2010-01-01 2010-01-01 false Self-luminous products containing tritium, krypton-85, or... DOMESTIC LICENSING OF BYPRODUCT MATERIAL Exemptions § 30.19 Self-luminous products containing tritium... transfer for sale or distribution self-luminous products containing tritium, krypton-85, or promethium-147...

  1. 40 CFR 147.1401 - State administered program-Class I, III, IV and V wells. (United States)


    ... CONTROL PROGRAMS Nebraska § 147.1401 State administered program—Class I, III, IV and V wells. The UIC program for Class I, III, IV, and V wells in the State of Nebraska, except those on Indian lands, is the... 40 Protection of Environment 22 2010-07-01 2010-07-01 false State administered program-Class I...

  2. Spherical harmonics based descriptor for neural network potentials: Structure and dynamics of Au147 nanocluster (United States)

    Jindal, Shweta; Chiriki, Siva; Bulusu, Satya S.


    We propose a highly efficient method for fitting the potential energy surface of a nanocluster using a spherical harmonics based descriptor integrated with an artificial neural network. Our method achieves the accuracy of quantum mechanics and speed of empirical potentials. For large sized gold clusters (Au147), the computational time for accurate calculation of energy and forces is about 1.7 s, which is faster by several orders of magnitude compared to density functional theory (DFT). This method is used to perform the global minimum optimizations and molecular dynamics simulations for Au147, and it is found that its global minimum is not an icosahedron. The isomer that can be regarded as the global minimum is found to be 4 eV lower in energy than the icosahedron and is confirmed from DFT. The geometry of the obtained global minimum contains 105 atoms on the surface and 42 atoms in the core. A brief study on the fluxionality in Au147 is performed, and it is concluded that Au147 has a dynamic surface, thus opening a new window for studying its reaction dynamics.

  3. 32 CFR 147.15 - Guideline M-Misuse of Information technology systems. (United States)


    ... 32 National Defense 1 2010-07-01 2010-07-01 false Guideline M-Misuse of Information technology... CLASSIFIED INFORMATION Adjudication § 147.15 Guideline M—Misuse of Information technology systems. (a) The... ability to properly protect classified systems, networks, and information. Information Technology Systems...

  4. 33 CFR 147.839 - Mad Dog Truss Spar Platform safety zone. (United States)


    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Mad Dog Truss Spar Platform... SECURITY (CONTINUED) OUTER CONTINENTAL SHELF ACTIVITIES SAFETY ZONES § 147.839 Mad Dog Truss Spar Platform safety zone. (a) Description. Mad Dog Truss Spar Platform, Green Canyon 782 (GC 782), located at position...

  5. Crystal structure of an eight-coordinate terbium(III ion chelated by N,N′-bis(2-hydroxybenzyl-N,N′-bis(pyridin-2-ylmethylethylenediamine (bbpen2− and nitrate

    Directory of Open Access Journals (Sweden)

    Thaiane Gregório


    Full Text Available The reaction of terbium(III nitrate pentahydrate in acetonitrile with N,N′-bis(2-hydroxybenzyl-N,N′-bis(pyridin-2-ylmethylethylenediamine (H2bbpen, previously deprotonated with triethylamine, produced the mononuclear compound [N,N′-bis(2-oxidobenzyl-κO-N,N′-bis(pyridin-2-ylmethyl-κNethylenediamine-κ2N,N′](nitrato-κ2O,O′terbium(III, [Tb(C28H28N4O2(NO3]. The molecule lies on a twofold rotation axis and the TbIII ion is eight-coordinate with a slightly distorted dodecahedral coordination geometry. In the symmetry-unique part of the molecule, the pyridine and benzene rings are both essentially planar and form a dihedral angle of 61.42 (7°. In the molecular structure, the N4O4 coordination environment is defined by the hexadentate bbpen ligand and the bidentate nitrate anion. In the crystal, a weak C—H...O hydrogen bond links molecules into a two-dimensional network parallel to (001.

  6. A new approach to determine {sup 147}Pm in irradiated fuel solutions

    Energy Technology Data Exchange (ETDEWEB)

    Brennetot, R.; Stadelmann, G.; Caussignac, C.; Gombert, C.; Fouque, M.; Lamouroux, Ch. [CEA, Dept Chim Phys, Serv Etud Comportement Radionucleides, Lab Anal Nucl Isotop et Elementaires, Ctr Etud Sacl, F-91191 Gif Sur Yvette, (France)


    Developments carried out in the Laboratory of Isotopic Nuclear and Elementary Analyses in order to quantify {sup 147}Pm in spent nuclear fuels analyzed at the CEA within the framework of the Burn Up Credit research program for neutronic code validation are presented here. This determination is essential for safety-criticality Studies. The quantity and the nature of the radionuclides in irradiated fuel solutions force LIS to separate the elements of interest before measuring their isotopic content by mass spectrometry. The main objective of this study is to modify the separation protocol used in our laboratory in order to recover and to measure the {sup 147}Pm at the same time as the other lanthanides and actinides determined by mass spectrometry. A very complete study oil synthetic solution (containing or not {sup 147}Pm) Was undertaken in order to determine the yield of the various stages of separation carried out before obtaining the isolated Pm fraction from the whole of the elements present in the spent fuel Solutions. With the lack of natural tracer to carry out the measurement with the isotope dilution technique, the great number of isotopes in fuel, the originality of this work tests oil the use of another present lanthanide in fuel to define the output of separation. The yields were measured at the conclusion of each stage of separation with two others lanthanides in order to show that one of them could be used as a tracer to correct the measurement of the {sup 147}Pm with the separation yield. The total yield (at the conclusion of the two stages of separation) was measured at the same time by ICP-MS and liquid scintillation. This last determination made it possible to validate the use of the Sm-147 (natural) to measure the {sup 147}Pm in ICP-MS since the outputs determined in liquid scintillation and ICP-MS (starting from the radioactive decrease of the source having been used to make the synthetic solution) were equivalent. It is the first time that such


    Energy Technology Data Exchange (ETDEWEB)

    Geha, M. [Astronomy Department, Yale University, New Haven, CT 06520 (United States); Weisz, D. [Astronomy Department, Box 351580, University of Washington, Seattle, WA 98195 (United States); Grocholski, A. [Department of Physics and Astronomy, Louisiana State University, Baton Rouge, LA 70803 (United States); Dolphin, A. [Raytheon, 1151 E. Hermans Road, Tucson, AZ 85756 (United States); Marel, R. P. van der [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States); Guhathakurta, P., E-mail: [UCO/Lick Observatory, University of California, Santa Cruz, 1156 High Street, Santa Cruz, CA 95064 (United States)


    We present the deepest optical photometry for any dwarf elliptical (dE) galaxy based on Hubble Space Telescope Advanced Camera for Surveys (ACS) observations of the Local Group dE galaxies NGC 147 and NGC 185. Our F606W and F814W color–magnitude diagrams are the first to reach below the oldest main sequence turnoff in a dE galaxy, allowing us to determine full star formation histories in these systems. The ACS fields are located roughly ∼1.5 effective radii from the galaxy center to avoid photometric crowding. While both ACS fields show unambiguous evidence for old and intermediate age stars, the mean age of NGC 147 is ∼4–5 Gyr younger as compared to NGC 185. In NGC 147, only 40% of stars were in place 12.5 Gyr ago (z ∼ 5), with the bulk of the remaining stellar population forming between 5 to 7 Gyr. In contrast, 70% of stars were formed in NGC 185 prior to 12.5 Gyr ago with the majority of the remaining population forming between 8 to 10 Gyr ago. Star formation has ceased in both ACS fields for at least 3 Gyr. Previous observations in the central regions of NGC 185 show evidence for star formation as recent as 100 Myr ago, and a strong metallicity gradient with radius. This implies a lack of radial mixing between the center of NGC 185 and our ACS field. The lack of radial gradients in NGC 147 suggests that our inferred SFHs are more representative of its global history. We interpret the inferred differences in star formation histories to imply an earlier infall time into the M31 environment for NGC 185 as compared to NGC 147.

  8. 40 CFR 147.1653 - Existing Class I, II (except enhanced recovery and hydrocarbon storage) and III wells authorized... (United States)


    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Existing Class I, II (except enhanced recovery and hydrocarbon storage) and III wells authorized by rule. 147.1653 Section 147.1653 Protection of... recovery and hydrocarbon storage) and III wells authorized by rule. Maximum injection pressure. The owner...

  9. 40 CFR 147.1953 - Existing Class I, II (except enhanced recovery and hydrocarbon storage) and III wells authorized... (United States)


    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Existing Class I, II (except enhanced recovery and hydrocarbon storage) and III wells authorized by rule. 147.1953 Section 147.1953 Protection of... enhanced recovery and hydrocarbon storage) and III wells authorized by rule. Maximum injection pressure...

  10. 40 CFR 147.503 - Existing Class II (except enhanced recovery and hydrocarbon storage) wells authorized by rule. (United States)


    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Existing Class II (except enhanced recovery and hydrocarbon storage) wells authorized by rule. 147.503 Section 147.503 Protection of... recovery and hydrocarbon storage) wells authorized by rule. Maximum injection pressure. To meet the...

  11. 40 CFR 147.1453 - Existing Class I, II (except enhanced recovery and hydrocarbon storage) and III wells authorized... (United States)


    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Existing Class I, II (except enhanced recovery and hydrocarbon storage) and III wells authorized by rule. 147.1453 Section 147.1453 Protection of... recovery and hydrocarbon storage) and III wells authorized by rule. Maximum injection pressure. The owner...

  12. 40 CFR 147.2153 - Existing Class I, II (except enhanced recovery and hydrocarbon storage) and III wells authorized... (United States)


    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Existing Class I, II (except enhanced recovery and hydrocarbon storage) and III wells authorized by rule. 147.2153 Section 147.2153 Protection of... recovery and hydrocarbon storage) and III wells authorized by rule. Maximum injection pressure. The owner...

  13. 40 CFR 147.1353 - Existing Class I, II (except enhanced recovery and hydrocarbon storage) and III wells authorized... (United States)


    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Existing Class I, II (except enhanced recovery and hydrocarbon storage) and III wells authorized by rule. 147.1353 Section 147.1353 Protection of... recovery and hydrocarbon storage) and III wells authorized by rule. Maximum injection pressure. The owner...

  14. 40 CFR 147.1153 - Existing Class I, II (except enhanced recovery and hydrocarbon storage) and III wells authorized... (United States)


    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Existing Class I, II (except enhanced recovery and hydrocarbon storage) and III wells authorized by rule. 147.1153 Section 147.1153 Protection of... recovery and hydrocarbon storage) and III wells authorized by rule. Maximum injection pressure. The owner...

  15. 9 CFR 147.16 - Procedure for the evaluation of mycoplasma reactors by in vivo bio-assay (enrichment). (United States)


    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Procedure for the evaluation of mycoplasma reactors by in vivo bio-assay (enrichment). 147.16 Section 147.16 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE LIVESTOCK IMPROVEMENT AUXILIARY...

  16. 10 CFR 32.22 - Self-luminous products containing tritium, krypton-85 or promethium-147: Requirements for license... (United States)


    ... 10 Energy 1 2010-01-01 2010-01-01 false Self-luminous products containing tritium, krypton-85 or... containing tritium, krypton-85 or promethium-147: Requirements for license to manufacture, process, produce... self-luminous products containing tritium, krypton-85, or promethium-147, or to initially transfer such...

  17. 40 CFR 147.2800 - State-administered program-Class I, II, III, IV, and V wells. (United States)


    ... I, II, III, IV, and V wells. The UIC program for Class I, II, III, IV, and V wells in the... 40 Protection of Environment 22 2010-07-01 2010-07-01 false State-administered program-Class I, II, III, IV, and V wells. 147.2800 Section 147.2800 Protection of Environment ENVIRONMENTAL PROTECTION...

  18. 17 CFR 14.7 - Finding of violation of Commodity Exchange Act or Federal securities laws in another proceeding. (United States)


    ... 17 Commodity and Securities Exchanges 1 2010-04-01 2010-04-01 false Finding of violation of Commodity Exchange Act or Federal securities laws in another proceeding. 14.7 Section 14.7 Commodity and Securities Exchanges COMMODITY FUTURES TRADING COMMISSION RULES RELATING TO SUSPENSION OR DISBARMENT FROM...

  19. Understanding β-mannanase from Streptomyces sp. CS147 and its potential application in lignocellulose based biorefining. (United States)

    Yoo, Hah Y; Pradeep, G C; Lee, Soo K; Park, Don H; Cho, Seung S; Choi, Yun H; Yoo, Jin C; Kim, Seung W


    Hydrolytic enzymes such as cellulase and hemicellulase have been attracted in lignocellulose based biorefinery. Especially, mannanase has been a growing interest in industrial applications due to its importance in the bioconversion. In this study, an extracellular endo-β-1,4-D-mannanase was produced by Streptomyces sp. CS147 (Mn147) and purified 8.5-fold with a 43.4% yield using Sephadex G-50 column. The characterization of Mn147 was performed, and the results were as follows: molecular weight of ∼25 kDa with an optimum temperature of 50°C and pH of 11.0. The effect of metal ions and various reagents on Mn147 was strongly activated by Ca(+2) but inhibited by Mg(+2) , Fe(+2) , hydrogen peroxide, EDTA and EGTA. Km and Vmax values of Mn147 were 0.13 mg/mL and 294 μmol/min mg, respectively, when different concentrations (3.1 to 50 mg/mL) of locust bean gum galactomannan were used as substrate. In enzymatic hydrolysis of heterogeneous substrate (spent coffee grounds), Mn147 shows a similar conversion compared to commercial enzymes. In addition, lignocellulosic biomass can be hydrolyzed to oligosaccharides (reducing sugars), which can be further utilized for the production of biomaterials. These results showed that Mn147 is attractive in quest of potential bioindustrial applications. Copyright © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. The Biological Function and Clinical Utilization of CD147 in Human Diseases: A Review of the Current Scientific Literature

    Directory of Open Access Journals (Sweden)

    Lijuan Xiong


    Full Text Available CD147 or EMMPRIN is a member of the immunoglobulin superfamily in humans. It is widely expressed in human tumors and plays a central role in the progression of many cancers by stimulating the secretion of matrix metalloproteinases (MMPs and cytokines. CD147 regulates cell proliferation, apoptosis, and tumor cell migration, metastasis and differentiation, especially under hypoxic conditions. CD147 is also important to many organ systems. This review will provide a detailed overview of the discovery, characterization, molecular structure, diverse biological functions and regulatory mechanisms of CD147 in human physiological and pathological processes. In particular, recent studies have demonstrated the potential application of CD147 not only as a phenotypic marker of activated regulatory T cells but also as a potential diagnostic marker for early-stage disease. Moreover, CD147 is recognized as an effective therapeutic target for hepatocellular carcinoma (HCC and other cancers, and exciting clinical progress has been made in HCC treatment using CD147-directed monoclonal antibodies.

  1. Large scale structural optimization of trimetallic Cu-Au-Pt clusters up to 147 atoms (United States)

    Wu, Genhua; Sun, Yan; Wu, Xia; Chen, Run; Wang, Yan


    The stable structures of Cu-Au-Pt clusters up to 147 atoms are optimized by using an improved adaptive immune optimization algorithm (AIOA-IC method), in which several motifs, such as decahedron, icosahedron, face centered cubic, sixfold pancake, and Leary tetrahedron, are randomly selected as the inner cores of the starting structures. The structures of Cu8AunPt30-n (n = 1-29), Cu8AunPt47-n (n = 1-46), and partial 75-, 79-, 100-, and 147-atom clusters are analyzed. Cu12Au93Pt42 cluster has onion-like Mackay icosahedral motif. The segregation phenomena of Cu, Au and Pt in clusters are explained by the atomic radius, surface energy, and cohesive energy.

  2. Ovarian metastases resection from extragenital primary sites: outcome and prognostic factor analysis of 147 patients


    Li Wenhua; Wang Huaying; Wang Jian; Lv, Fangfang; Zhu Xiaodong; Wang Zhonghua


    Abstract Background To explore the outcomes and prognostic factors of ovarian metastasectomy intervention on overall survival from extragenital primary cancer. Methods Patients with ovarian metastases from extragenital primary cancer confirmed by laparotomy surgery and ovarian metastases resection were retrospectively collected in a single institution during an 8-year period. A total of 147 cases were identified and primary tumor sites were colorectal region (49.0%), gastric (40.8%), breast (...

  3. Heterotopic ossification after hip arthroplasty: a randomized double-blind multicenter study tenoxicam in 147 hips

    DEFF Research Database (Denmark)

    Gebuhr, Peter Henrik; Sletgård, J; Dalsgård, J


    147 patients due to have a cemented total hip arthroplasty were randomized to 4 groups. They received either tenoxicam 20 mg or 40 mg, or placebo, for 5 days or morphine on the day of operation and placebo for 4 days. During the first 5 days 14 patients were excluded. The patients were followed f...... that tenoxicam 20 mg for 5 days postoperatively can reduce heterotopic ossification after cemented total hip arthroplasty....

  4. 147 | Page

    African Journals Online (AJOL)

    Fr. Ikenga

    negatively affects the habitat structure by acidifying the soil, halting cellular respiration and starving the roots of plants of vital oxygen.13When an area of the mangrove has been destroyed by oil, such an area can no longer be supportive of the growth of native plants species until bacterial remediation has taken place.

  5. 13 CFR 147.220 - By when must I publish my drug-free workplace statement and establish my drug-free awareness... (United States)


    ...-free workplace statement and establish my drug-free awareness program? 147.220 Section 147.220 Business... workplace statement and establish my drug-free awareness program? If you are a new recipient that does not already have a policy statement as described in § 147.205 and an ongoing awareness program as described in...

  6. Optimized design of shields for diagnostic X rays with NCRP 147 technique; Diseno optimizado de blindajes para rayos X diagnostico con tecnica NCRP 147

    Energy Technology Data Exchange (ETDEWEB)

    Gama T, G. [Calidad XXI SA de CV, Zacatecas 67-007 Col. Roma, 06700 Mexico D.F. (Mexico)]. e-mail:


    A comparison among the design techniques of shielding for X-ray diagnostic rooms with the NCRP 49 (1976) report technique, AAPM 39 (1993) Y the one of the NCRP 147 (2005) technique. The designs correspond to a room of conventional X-rays, one of fluoroscopy, one of tomography Y one of mammography. In all the cases it demonstrates that the NCRP 49 technique overestimate the shieldings. The causes of the overestimation of the NCRP 49 can be attributed to: a) high values of the work charge that don't consider the spectral fluence of the photons that are present in each room, b) to the differences in the values of the kerma in air without attenuation for the dispersed primary radiation Y of leakage among both reports. (Author)

  7. Selective Sensing of Fe(3+) and Al(3+) Ions and Detection of 2,4,6-Trinitrophenol by a Water-Stable Terbium-Based Metal-Organic Framework. (United States)

    Cao, Li-Hui; Shi, Fang; Zhang, Wen-Min; Zang, Shuang-Quan; Mak, Thomas C W


    A water-stable luminescent terbium-based metal-organic framework (MOF), {[Tb(L1 )1.5 (H2 O)]⋅3 H2 O}n (Tb-MOF), with rod-shaped secondary building units (SBUs) and honeycomb-type tubular channels has been synthesized and structurally characterized by single-crystal X-ray diffraction. The high green emission intensity and the microporous nature of the Tb-MOF indicate that it can potentially be used as a luminescent sensor. In this work, we show that Tb-MOF can selectively sense Fe(3+) and Al(3+) ions from mixed metal ions in water through different detection mechanisms. In addition, it also exhibits high sensitivity for 2,4,6-trinitrophenol (TNP) in the presence of other nitro aromatic compounds in aqueous solution by luminescence quenching experiments. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Metabolic characterization and transformation of the non-dairy Lactococcus lactis strain KF147, for production of ethanol from xylose

    DEFF Research Database (Denmark)

    Petersen, Kia Vest; Liu, Jianming; Chen, Jun


    over-expression of phosphoketolase increased the flux through the phosphoketolase pathway. In general, significant amounts of the mixed-acid products, including lactate, formate, acetate and ethanol, were formed irrespective of xylose concentrations. To demonstrate the potential of KF147 for converting......The non-dairy lactic acid bacterium Lactococcus lactis KF147 can utilize xylose as the sole energy source. To assess whether KF147 could serve as a platform organism for converting second generation sugars into useful chemicals, we characterized growth and product formation for KF147 when grown...... the arcA gene encoding the arginine deiminase. The fermentation product profile suggested two routes for xylose degradation, the phosphoketolase pathway and the pentose phosphate pathway. Inactivation of the phosphoketolase pathway redirected the entire flux through the pentose phosphate pathway whereas...

  9. Picomolar traces of americium(III) introduce drastic changes in the structural chemistry of terbium(III). A break in the ''gadolinium break''

    Energy Technology Data Exchange (ETDEWEB)

    Welch, Jan M. [TU Wien, Atominstitut, Vienna (Austria); Mueller, Danny; Knoll, Christian; Wilkovitsch, Martin; Weinberger, Peter [TU Wien, Institute of Applied Synthetic Chemistry, Vienna (Austria); Giester, Gerald [University of Vienna, Institute of Mineralogy and Crystallography, Vienna (Austria); Ofner, Johannes; Lendl, Bernhard [TU Wien, Institute of Chemical Technologies and Analytics, Vienna (Austria); Steinhauser, Georg [Leibniz Universitaet Hannover, Institute of Radioecology and Radiation Protection (Germany)


    The crystallization of terbium 5,5{sup '}-azobis[1H-tetrazol-1-ide] (ZT) in the presence of trace amounts (ca. 50 Bq, ca. 1.6 pmol) of americium results in 1) the accumulation of the americium tracer in the crystalline solid and 2) a material that adopts a different crystal structure to that formed in the absence of americium. Americium-doped [Tb(Am)(H{sub 2}O){sub 7}ZT]{sub 2} ZT.10 H{sub 2}O is isostructural to light lanthanide (Ce-Gd) 5,5{sup '}-azobis[1H-tetrazol-1-ide] compounds, rather than to the heavy lanthanide (Tb-Lu) 5,5{sup '}-azobis[1H-tetrazol-1-ide] (e.g., [Tb(H{sub 2}O){sub 8}]{sub 2}ZT{sub 3}.6 H{sub 2}O) derivatives. Traces of Am seem to force the Tb compound into a structure normally preferred by the lighter lanthanides, despite a 10{sup 8}-fold Tb excess. The americium-doped material was studied by single-crystal X-ray diffraction, vibrational spectroscopy, radiochemical neutron activation analysis, and scanning electron microscopy. In addition, the inclusion properties of terbium 5,5{sup '}-azobis[1H-tetrazol-1-ide] towards americium were quantified, and a model for the crystallization process is proposed. (copyright 2017 Wiley-VCH Verlag GmbH and Co. KGaA, Weinheim)

  10. CD147-mediated chemotaxis of CD4+CD161+ T cells may contribute to local inflammation in rheumatoid arthritis. (United States)

    Lv, Minghua; Miao, Jinlin; Zhao, Peng; Luo, Xing; Han, Qing; Wu, Zhenbiao; Zhang, Kui; Zhu, Ping


    CD161 is used as a surrogate marker for Th17 cells, which are implicated in the pathogenesis of rheumatoid arthritis (RA). In this study, we evaluated the percentage, clinical significance, and CD98 and CD147 expression of CD4+CD161+ T cells. The potential role of CD147 and CD98 in cyclophilin A-induced chemotaxis of CD4+CD161+ T cells was analyzed. Thirty-seven RA patients, 15 paired synovial fluid (SF) of RA, and 22 healthy controls were recruited. The cell populations and surface expression of CD98 and CD147 were analyzed by flow cytometry. Spearman's rank correlation coefficient and multiple linear regression were applied to calculate the correlations. Chemotaxis assay was used to investigate CD4+CD161+ T cell migration. We found that the percentage of CD4+CD161+ T cells and their expression of CD147 and CD98 in SF were higher than in the peripheral blood of RA patients. Percentage of SF CD4+CD161+ T cells was positively correlated with 28-Joint Disease Activity Score (DAS28). CD147 monoclonal antibody (HAb18) attenuated the chemotactic ability of CD4+CD161+ T cells. An increased CD4+CD161+ T cell percentage and expression of CD147 and CD98 were shown in RA SF. Percentage of SF CD4+CD161+ T cells can be used as a predictive marker of disease activity in RA. CD147 block significantly decreased the chemotactic index of CD4+CD161+ cells induced by cyclophilin A (CypA). These results imply that the accumulation of CD4+CD161+ T cells in SF and their high expression of CD147 may be associated with CypA-mediated chemotaxis and contribute to local inflammation in RA.

  11. 40 CFR 147.850 - State-administered program-Class I, III, IV and V wells. (United States)


    ... PROGRAMS Kansas § 147.850 State-administered program—Class I, III, IV and V wells. The UIC program for Class I, III, IV and V wells in the State of Kansas, except those on Indian lands as described in § 147... 40 Protection of Environment 22 2010-07-01 2010-07-01 false State-administered program-Class I...

  12. MicroRNAs 146a and 147b Biomarkers for Colorectal Tumor’s Localization

    Directory of Open Access Journals (Sweden)

    Inés Omrane


    Full Text Available The recently identified class of microRNAs (miRs provided a new insight into cancer research, since abnormalities of members of microRNAs family have been found in various types of cancer. However, the relationship between five miRNAs (miR146a, miR155, miR21, miR135a, and miR147b and colorectal cancer remains unclear. In the present study, we examined expression of these miRNAs in 25 pair-matched colon cancer tissues and normal colon mucosa. The expression levels of miR146a, miR155, miR21, miR135a, and miR147b were quantified by real-time PCR. We found that miR21, miR146a, and miR135a were all expressed at higher levels in colon tumors. On the other hand, miR146a and miR147b expressions are significantly higher in left colon compared to right colon. These two miRs, especially miR146a, seemed to be markers for the left colon tumors. Moreover, significant proportional and inverse correlations were found between miR expressions in tumor and healthy tissue, and the correlations profiles were different depending on cancer localization. Taken together, these results lead us to suggest the presence of different mechanisms regulating miRs expression and consequently their target genes in left and right colon. So the pathway of colorectal carcinogenesis would be different according to the site of the tumor.

  13. Time-of-flight and activation experiments on 147Pm and 171Tm for astrophysics

    Directory of Open Access Journals (Sweden)

    Guerrero C.


    Full Text Available The neutron capture cross section of several key unstable isotopes acting as branching points in the s-process are crucial for stellar nucleosynthesis studies, but they are very challenging to measure due to the difficult production of sufficient sample material, the high activity of the resulting samples, and the actual (n,γ measurement, for which high neutron fluxes and effective background rejection capabilities are required. As part of a new program to measure some of these important branching points, radioactive targets of 147Pm and 171Tm have been produced by irradiation of stable isotopes at the ILL high flux reactor. Neutron capture on 146Nd and 170Er at the reactor was followed by beta decay and the resulting matrix was purified via radiochemical separation at PSI. The radioactive targets have been used for time-of-flight measurements at the CERN n_TOF facility using the 19 and 185 m beam lines during 2014 and 2015. The capture cascades were detected using a set of four C6D6 scintillators, allowing to observe the associated neutron capture resonances. The results presented in this work are the first ever determination of the resonance capture cross section of 147Pm and 171Tm. Activation experiments on the same 147Pm and 171Tm targets with a high-intensity 30 keV quasi-Maxwellian flux of neutrons will be performed using the SARAF accelerator and the Liquid-Lithium Target (LiLiT in order to extract the corresponding Maxwellian Average Cross Section (MACS. The status of these experiments and preliminary results will be presented and discussed as well.

  14. Time-of-flight and activation experiments on 147Pm and 171Tm for astrophysics (United States)

    Guerrero, C.; Lerendegui-Marco, J.; Domingo-Pardo, C.; Casanovas, A.; Dressler, R.; Halfon, S.; Heinitz, S.; Kivel, N.; Köster, U.; Paul, M.; Quesada-Molina, J. M.; Schumann, D.; Tarifeño-Saldivia, A.; Tessler, M.; Weissman, L.; Aberle, O.; Andrzejewski, J.; Audouin, L.; Bacak, M.; Balibrea, J.; Barbagallo, M.; Becvar, F.; Berthoumieux, E.; Billowes, J.; Bosnar, D.; Brown, A.; Caamaño, M.; Calviño, F.; Calviani, M.; Cano-Ott, D.; Cardella, R.; Cerutti, F.; Chen, Y. H.; Chiaveri, E.; Colonna, N.; Cortés, G.; Cortés-Giraldo, M. A.; Cosentino, L.; Damone, L. A.; Diakaki, M.; Dupont, E.; Durán, I.; Fernández-Domínguez, B.; Ferrari, A.; Ferreira, P.; Finocchiaro, P.; Göbel, K.; García, A. R.; Gawlik, A.; Gilardoni, S.; Glodariu, T.; Gonçalves, I. F.; González, E.; Griesmayer, E.; Gunsing, F.; Harada, H.; Heyse, J.; Jenkins, D. G.; Jericha, E.; Käppeler, F.; Kadi, Y.; Kalamara, A.; Kavrigin, P.; Kimura, A.; Kivel, N.; Kokkoris, M.; Krticka, M.; Kurtulgil, D.; Leal-Cidoncha, E.; Lederer, C.; Leeb, H.; Meo, S. Lo; Lonsdale, S. J.; Macina, D.; Marganiec, J.; Martínez, T.; Masi, A.; Massimi, C.; Mastinu, P.; Mastromarco, M.; Maugeri, E. A.; Mazzone, A.; Mendoza, E.; Mengoni, A.; Milazzo, P. M.; Mingrone, F.; Musumarra, A.; Negret, A.; Nolte, R.; Oprea, A.; Patronis, N.; Pavlik, A.; Perkowski, J.; Porras, I.; Praena, J.; Radeck, D.; Rauscher, T.; Reifarth, R.; Rout, P. C.; Rubbia, C.; Ryan, J. A.; Sabaté-Gilarte, M.; Saxena, A.; Schillebeeckx, P.; Smith, A. G.; Sosnin, N. V.; Stamatopoulos, A.; Tagliente, G.; Tain, J. L.; Tassan-Got, L.; Tsinganis, A.; Valenta, S.; Vannini, G.; Variale, V.; Vaz, P.; Ventura, A.; Vlachoudis, V.; Vlastou, R.; Wallner, A.; Warren, S.; Weiss, C.; Woods, P. J.; Wright, T.; Žugec, P.


    The neutron capture cross section of several key unstable isotopes acting as branching points in the s-process are crucial for stellar nucleosynthesis studies, but they are very challenging to measure due to the difficult production of sufficient sample material, the high activity of the resulting samples, and the actual (n,γ) measurement, for which high neutron fluxes and effective background rejection capabilities are required. As part of a new program to measure some of these important branching points, radioactive targets of 147Pm and 171Tm have been produced by irradiation of stable isotopes at the ILL high flux reactor. Neutron capture on 146Nd and 170Er at the reactor was followed by beta decay and the resulting matrix was purified via radiochemical separation at PSI. The radioactive targets have been used for time-of-flight measurements at the CERN n_TOF facility using the 19 and 185 m beam lines during 2014 and 2015. The capture cascades were detected using a set of four C6D6 scintillators, allowing to observe the associated neutron capture resonances. The results presented in this work are the first ever determination of the resonance capture cross section of 147Pm and 171Tm. Activation experiments on the same 147Pm and 171Tm targets with a high-intensity 30 keV quasi-Maxwellian flux of neutrons will be performed using the SARAF accelerator and the Liquid-Lithium Target (LiLiT) in order to extract the corresponding Maxwellian Average Cross Section (MACS). The status of these experiments and preliminary results will be presented and discussed as well.

  15. KCNQ1 mutation Q147R is associated with atrial fibrillation and prolonged QT interval

    DEFF Research Database (Denmark)

    Lundby, Alicia; Ravn, Lasse Steen; Svendsen, Jesper Hastrup


    BACKGROUND: Atrial fibrillation (AF) and long QT syndrome (LQTS) are cardiac arrhythmia disorders that have been related to dysfunction of the voltage-gated potassium channel subunit Kv7.1 encoded by the KCNQ1 gene. OBJECTIVE: The purpose of this study was functional assessment of a mutation in Kv7.......1 identified in a proband with permanent AF and prolonged QT interval. We investigated whether this KCNQ1 missense mutation could form the genetic basis for AF and LQTS simultaneously in this patient. METHODS: We investigated the functional consequences of the novel mutation KCNQ1 Q147R by heterologous...

  16. Tackling the s-process stellar neutron density via the 147Pm(n,?) reaction

    CERN Multimedia

    Branching points along the reaction path of the slow nucleosynthesis process are very special isotopes for which there is competition between neutron capture and β-decay. The accurate knowledge of the decay properties and capture cross sections in the vicinity of these branching points are of key importance for determining the stellar conditions, namely the neutron density and temperature during the main s-process component in low-mass AGB stars. However, accurate values of these quantities, in particular capture cross sections at the corresponding stellar temperatures, are difficult to measure; thus data are very scarce and, when existing, very limited. For the particular and important case of the branching at A=147/148, the main branching point is $^{147}$Pm; for which there was a very challenging and successful activation measurement in 2003 at the stellar neutron energy of kT=25 keV using just 28 ng of material. In the main s-process, however, 95% of the neutron exposure takes place during H-burning epis...

  17. Sodium terbium(III polyphosphate

    Directory of Open Access Journals (Sweden)

    Abdelghani Oudahmane


    Full Text Available Single crystals of the title compound, NaTb(PO34, were obtained by solid-state reaction. This compound belongs to type II of long-chain polyphosphates with the general formula AIBIII(PO34. It is isotypic with the NaNd(PO34 and NaEr(PO34 homologues. The crystal structure is built up of infinite crenelated chains of corner-sharing PO4 tetrahedra with a repeating unit of four tetrahedra. These chains, extending parallel to [100], are linked by isolated TbO8 square antiprisms, forming a three-dimensional framework. The Na+ ions are located in channels running along [010] and are surrounded by six oxygen atoms in a distorted octahedral environment within a cut-off distance <2.9 Å.

  18. RNA interference targeting CD147 inhibits the proliferation, invasiveness, and metastatic activity of thyroid carcinoma cells by down-regulating glycolysis. (United States)

    Huang, Peng; Chang, Shi; Jiang, Xiaolin; Su, Juan; Dong, Chao; Liu, Xu; Yuan, Zhengtai; Zhang, Zhipeng; Liao, Huijun


    A high rate of glycolytic flux, even in the presence of oxygen, is a key metabolic hallmark of cancer cells. Lactate, the end product of glycolysis, decreases the extracellular pH and contributes to the proliferation, invasiveness and metastasis of tumor cells. CD147 play a crucial role in tumorigenicity, invasion and metastasis; and CD147 also interacts strongly and specifically with monocarboxylate transporter1 (MCT1) that mediates the transport of lactate. The objective of this study was to determine whether CD147 is involved, via its association with MCT1 to transport lactate, in glycolysis, contributing to the progression of thyroid carcinoma. The expression levels of CD147 in surgical specimens of normal thyroid, nodular goiter (NG), well-differentiated thyroid carcinoma (WDTC), and undifferentiated thyroid carcinoma (UDTC) were determined using immunohistochemical techniques. The effects of CD147 silencing on cell proliferation, invasiveness, metastasis, co-localization with MCT1, glycolysis rate and extracellular pH of thyroid cancer cells (WRO and FRO cell lines) were measured after CD147 was knocked-down using siRNA targeting CD147. Immunohistochemical analysis of thyroid carcinoma (TC) tissues revealed significant increases in signal for CD147 compared with normal tissue or NG, while UDTC expressed remarkably higher levels of CD147 compared with WDTC. Furthermore, silencing of CD147 in TC cells clearly abrogated the expression of MCT1 and its co-localization with CD147 and dramatically decreased both the glycolysis rate and extracellular pH. Thus, cell proliferation, invasiveness, and metastasis were all significantly decreased by siRNA. These results demonstrate in vitro that the expression of CD147 correlates with the degree of dedifferentiation of thyroid cancer, and show that CD147 interacts with MCT1 to regulate tumor cell glycolysis, resulting in the progression of thyroid carcinoma.

  19. Study of the superdeformed states of the gadolinium nuclei: neutron excitations in {sup 147}Gd nucleus; Etude des etats superdeformes de noyaux de Gadolinium: Excitations neutron dans le noyau {sup 147}Gd

    Energy Technology Data Exchange (ETDEWEB)

    Khadiri, Najia [Institut de Recherche Subatomique, CNRS-IN2P3 - Universite Louis Pasteur, 67 - Strasbourg (France)


    This work is devoted to nuclear structure studies of superdeformed states in the second potential well. Under focus are the gadolinium isotopes and in particular the {sup 147}Gd nucleus. High spin states in {sup 147}Gd have been populating by {sup 122}Sn ({sup 30}Si,5n){sup 147}Gd fusion-evaporation reaction with a silicon beam of 158 MeV delivered by the VIVITRON accelerator of the Institut de Recherches Subatomiques. The nucleus {gamma} de-excitations have been measured using the EUROGAM II {gamma}-ray multidetector. On the basis of multiple coincidences, four new superdeformed (SD) rotational bands have been assigned to {sup 147}Gd nucleus. Nuclear structures corresponding to these bands have been investigated by shell model calculations using a harmonic oscillator potential with cranking, in the Nilsson Strutinsky formalism. Comparison of dynamical moments of inertia of band (1) and (5) in {sup 147}Gd with {sup 148}Gd(2) and {sup 146}Gd(1) SD bands has fixed the role of the [651 1/2]{alpha} = -1/2 orbital crossing frequency. Theoretical calculations reproduce quite well the {sup 148}Gd(2), {sup 127}Gd(1,5) and G{sup 146}Gd(1) dynamical moments of inertia. Using the particle hole excitation nature of {sup 149,148,147,146}Gd bands, effective spin alignment of [651 1/2]{alpha}= {+-}1/2, [770 1/2]{alpha} = -1/2 and [441 1/2]{alpha} = +1/2 orbitals have been deduced from the experiment in agreement with the theoretical values. Of particular interest, the spin alignment measured for the [441 1/2]{alpha} +1/2 orbital, with a value close to zero, is in contradiction with the value predicted by the Pseudo SU(3) model, formalism often used to explain the identical band phenomenon. (author) 68 refs., 41 figs., 17 tabs.

  20. Effects of matrix metalloproteinase inhibitor doxycycline and CD147 antagonist peptide-9 on gallbladder carcinoma cell lines. (United States)

    Wang, Shihang; Liu, Chao; Liu, Xinjiang; He, Yanxin; Shen, Dongfang; Luo, Qiankun; Dong, Yuxi; Dong, Haifeng; Pang, Zhigang


    Gallbladder carcinoma is the most common and aggressive malignancy of the biliary tree and highly expresses CD147, which is closely related to disease prognosis in a variety of human cancers. Doxycycline exhibited anti-tumor properties in many cancer cells. CD147 antagonist peptide-9 is a polypeptide and can specifically bind to CD147. The effect of these two drugs on gallbladder cancer cells has not been studied. The aim of this study is to investigate the effect of doxycycline and antagonist peptide-9 on gallbladder carcinoma cells and the possible mechanism of inhibition on cancer cell of doxycycline. To investigate the effects of doxycycline and antagonist peptide-9 on gallbladder carcinoma cells (GBC-SD and SGC-996), cell proliferation, CD147 expression, and early-stage apoptosis rate were measured after treated with doxycycline. Matrix metalloproteinase-2 and matrix metalloproteinase-9 activities were measured after treated with different concentrations of doxycycline, antagonist peptide-9, and their combination. The results demonstrated that doxycycline inhibited cell proliferation, reduced CD147 expression level, and induced an early-stage apoptosis response in GBC-SD and SGC-996 cells. The matrix metalloproteinase-2 and matrix metalloproteinase-9 activities were inhibited by antagonist peptide-9 and doxycycline, and the inhibitory effects were enhanced by combined drugs in gallbladder carcinoma cell lines. Taken together, doxycycline showed inhibitory effects on gallbladder carcinoma cell lines and reduced the expression of CD147, and this may be the mechanism by which doxycycline inhibits cancer cells. This study provides new information and tries to implement the design of adjuvant therapy method for gallbladder carcinoma.

  1. Inhibition of CD147 expression by RNA interference reduces proliferation, invasion and increases chemosensitivity in cancer stem cell-like HT-29 cells. (United States)

    Chen, Jie; Pan, Yuqin; He, Bangshun; Ying, Houqun; Wang, Feng; Sun, Huiling; Deng, Qiwen; Liu, Xian; Lin, Kang; Peng, Hongxin; Cho, William C; Wang, Shukui


    The association between CD147 and cancer stem cells (CSCs) provides a new angle for cancer treatments. The aim of this study was to investigate the biological roles of CD147 in colorectal CSCs. The Oct4-green fluorescent protein (GFP) vector was used to isolate CSCs and pYr-mir30-shRNA was used to generate short hairpin RNA (shRNA) specifically for CD147. After RNA interference (RNAi), CD147 was evaluated by reverse transcription‑quantitative PCR and western blot analysis, and its biological functions were assessed by MTT and invasion assays. The results showed that the differentiation of isolated CSC-like HT-29 cells was blocked and these cells were highly positive for CD44 and CD147. RNAi-mediated CD147 silencing reduced the expression of CD147 at both mRNA and protein levels. Moreover, the activities of proliferation and invasion were decreased obviously in CSCs. Knockdown of CD147 increased the chemosensitivity of CSC-like cells to gemcitabine, cisplatin, docetaxel at 0.1, 1 and 10 µM respectively, however, there was no significant difference among the three groups to paclitaxel at 10 µM. In conclusion, these results suggest that CD147 plays an important role in colorectal CSCs and might be regarded as a novel CSC-specific targeted strategy against colorectal cancer.

  2. RNAi-mediated silencing of CD147 inhibits tumor cell proliferation, invasion and increases chemosensitivity to cisplatin in SGC7901 cells in vitro

    Directory of Open Access Journals (Sweden)

    Zhu Chan


    Full Text Available Abstract Background CD147 is a widely distributed cell surface glycoprotein that belongs to the Ig superfamily. CD147 has been implicated in numerous physiological and pathological activities. Enriched on the surface of many tumor cells, CD147 promotes tumor growth, invasion, metastasis and angiogenesis and confers resistance to some chemotherapeutic drugs. In this study, we investigated the possible role of CD147 in the progression of gastric cancer. Methods Short hairpin RNA (shRNA expressing vectors targeting CD147 were constructed and transfected into human gastric cancer cells SGC7901 and CD147 expression was monitored by quantitative realtime RT-PCR and Western blot. Cell proliferation, the activities of MMP-2 and MMP-9, the invasive potential and chemosensitivity to cisplatin of SGC7901 cells were determined by MTT, gelatin zymography, Transwell invasion assay and MTT, respectively. Results Down-regulation of CD147 by RNAi approach led to decreased cell proliferation, MMP-2 and MMP-9 activities and invasive potential of SGC7901 cells as well as increased chemosensitivity to cisplatin. Conclusion CD147 involves in proliferation, invasion and chemosensitivity of human gastric cancer cell line SGC7901, indicating that CD147 may be a promising therapeutic target for gastric cancer.

  3. Production, separation and target preparation of 171Tm an 147Pm for neutron cross section measurements

    CERN Document Server

    Heinitz, S; Schumann, D; Dressler, R; Kivel, N; Guerrero, C; Köster, U; Tessler, M; Paul, M; Halfon, S


    The knowledge of the neutron capture cross sections of s-process branching point isotopes represents a basic requirement for the understanding of star evolution. Since such branching point isotopes are by definition radioactive, the measurement of their cross sections from thermal to stellar energies becomes a challenging task. Considerable amounts of material have to be produced, representing a significant radioactive hazard. We report here on the production and separation of 3.5 mg 171Tm from 240 mg 170Er2O3 and 72 µg 147Pm from 100 mg 146Nd2O3 irradiated at the ILL high flux reactor. Thin targets were prepared with high chemical and radioisotopic purity suitable for neutron capture measurements at n_TOF CERN and the SARAF-LiLiT facility.

  4. Bis(1,4,7-trithiacyclononanenickel(II bis(tetrafluoridoborate nitromethane disolvate

    Directory of Open Access Journals (Sweden)

    Bruce C. Noll


    Full Text Available The homoleptic thioether title complex, [Ni(C6H12S32](BF42·2CH3NO2, shows the expeced hexakis(thioether octahedral environment around the NiII atom. It crystallized as two crystallographically independent complex cations, [Ni(9S32]2+ (9S3 = 1,4,7-trithiacyclononane, within the unit cell where each NiII lies on an inversion center. In addition to the complex cations, there are two crystallographically independent BF4− anions present to balance the charge, and each shows disorder along a pseudo-C3 axis with ratios of 0.53 (2:0.47 (2 and 0.55 (2:0.45 (2. Two nitromethane solvent molecules per complex cation are also present in the unit cell.

  5. Galectin-3 induces clustering of CD147 and integrin-β1 transmembrane glycoprotein receptors on the RPE cell surface.

    Directory of Open Access Journals (Sweden)

    Claudia S Priglinger

    Full Text Available Proliferative vitreoretinopathy (PVR is a blinding disease frequently occurring after retinal detachment surgery. Adhesion, migration and matrix remodeling of dedifferentiated retinal pigment epithelial (RPE cells characterize the onset of the disease. Treatment options are still restrained and identification of factors responsible for the abnormal behavior of the RPE cells will facilitate the development of novel therapeutics. Galectin-3, a carbohydrate-binding protein, was previously found to inhibit attachment and spreading of retinal pigment epithelial cells, and thus bares the potential to counteract PVR-associated cellular events. However, the identities of the corresponding cell surface glycoprotein receptor proteins on RPE cells are not known. Here we characterize RPE-specific Gal-3 containing glycoprotein complexes using a proteomic approach. Integrin-β1, integrin-α3 and CD147/EMMPRIN, a transmembrane glycoprotein implicated in regulating matrix metalloproteinase induction, were identified as potential Gal-3 interactors on RPE cell surfaces. In reciprocal immunoprecipitation experiments we confirmed that Gal-3 associated with CD147 and integrin-β1, but not with integrin-α3. Additionally, association of Gal-3 with CD147 and integrin-β1 was observed in co-localization analyses, while integrin-α3 only partially co-localized with Gal-3. Blocking of CD147 and integrin-β1 on RPE cell surfaces inhibited binding of Gal-3, whereas blocking of integrin-α3 failed to do so, suggesting that integrin-α3 is rather an indirect interactor. Importantly, Gal-3 binding promoted pronounced clustering and co-localization of CD147 and integrin-β1, with only partial association of integrin-α3. Finally, we show that RPE derived CD147 and integrin-β1, but not integrin-α3, carry predominantly β-1,6-N-actyl-D-glucosamine-branched glycans, which are high-affinity ligands for Gal-3. We conclude from these data that extracellular Gal-3 triggers

  6. Galectin-3 induces clustering of CD147 and integrin-β1 transmembrane glycoprotein receptors on the RPE cell surface. (United States)

    Priglinger, Claudia S; Szober, Christoph M; Priglinger, Siegfried G; Merl, Juliane; Euler, Kerstin N; Kernt, Marcus; Gondi, Gabor; Behler, Jennifer; Geerlof, Arie; Kampik, Anselm; Ueffing, Marius; Hauck, Stefanie M


    Proliferative vitreoretinopathy (PVR) is a blinding disease frequently occurring after retinal detachment surgery. Adhesion, migration and matrix remodeling of dedifferentiated retinal pigment epithelial (RPE) cells characterize the onset of the disease. Treatment options are still restrained and identification of factors responsible for the abnormal behavior of the RPE cells will facilitate the development of novel therapeutics. Galectin-3, a carbohydrate-binding protein, was previously found to inhibit attachment and spreading of retinal pigment epithelial cells, and thus bares the potential to counteract PVR-associated cellular events. However, the identities of the corresponding cell surface glycoprotein receptor proteins on RPE cells are not known. Here we characterize RPE-specific Gal-3 containing glycoprotein complexes using a proteomic approach. Integrin-β1, integrin-α3 and CD147/EMMPRIN, a transmembrane glycoprotein implicated in regulating matrix metalloproteinase induction, were identified as potential Gal-3 interactors on RPE cell surfaces. In reciprocal immunoprecipitation experiments we confirmed that Gal-3 associated with CD147 and integrin-β1, but not with integrin-α3. Additionally, association of Gal-3 with CD147 and integrin-β1 was observed in co-localization analyses, while integrin-α3 only partially co-localized with Gal-3. Blocking of CD147 and integrin-β1 on RPE cell surfaces inhibited binding of Gal-3, whereas blocking of integrin-α3 failed to do so, suggesting that integrin-α3 is rather an indirect interactor. Importantly, Gal-3 binding promoted pronounced clustering and co-localization of CD147 and integrin-β1, with only partial association of integrin-α3. Finally, we show that RPE derived CD147 and integrin-β1, but not integrin-α3, carry predominantly β-1,6-N-actyl-D-glucosamine-branched glycans, which are high-affinity ligands for Gal-3. We conclude from these data that extracellular Gal-3 triggers clustering of CD147 and

  7. Spongionella secondary metabolites, promising modulators of immune response through CD147 receptor modulation

    Directory of Open Access Journals (Sweden)

    Jon Andoni Sánchez


    Full Text Available The modulation of the immune system can have multiple applications such as cancer treatment, and a wide type of processes involving inflammation where the potent chemotactic agent cyclophilin A (Cyp A is implicated. The Porifera phylum, in which Spongionella is encompassed, is the main producer of marine bioactive compounds. Four secondary metabolites obtained from Spongionella (Gracilin H, A, L and Tetrahydroaplysulphurin-1 were described to hit Cyp A and to block the release of inflammation mediators. Based on these results some role of Spongionella compounds on other steps of the signalling pathway mediated by this chemotactic agent can be hypothesised. In the present paper we studied the effect of these four compounds on the surface membrane CD147 receptor expression, on the extracellular levels of Cyp A and on the ability to migrate of concanavalin (Con A-activated T lymphocytes. Similarly to a well-known immunosuppressive agent cyclosporine A (CsA, Gracilin H, A, L and tetrahydroaplysulphurin-1 were able to reduce the CD147 membrane expression and to block the release of Cyp A to the medium. Besides, by using Cyp A as chemotactic agent, T cell migration was inhibited when cells were previously incubated with Gracilin A and Gracilin L. These positive results lead us to test the in vivo effect of Gracilin H and L in a mouse ear delayed hypersensitive reaction. Thus, both compounds efficiently reduce the ear swelling as well as the inflammatory cell infiltration. These results provide more evidences for their potential therapeutic application in immune related diseases of Spongionella compounds.

  8. Inhibition of Ovarian Cancer Chemoresistance and Metastasis with Antagonists of Hyaluronan-CD44-CD147 Interactions (United States)


    measured after sacrifice. P values: Control siRNA vs. Combo = 0.0068; Control siRNA + Cisplatin vs. Combo = 0.0047; Control siRNA vs. CD147 siRNA...2006. Acylation of CD44 and its association with lipid rafts are required for receptor and hyaluronan endocytosis . J Biol Chem. 281:34601-34609. Toole

  9. 17 CFR 147.3 - General requirement of open meetings; grounds upon which meetings may be closed. (United States)


    ... COMMODITY FUTURES TRADING COMMISSION OPEN COMMISSION MEETINGS § 147.3 General requirement of open meetings... 15 through 21 of this chapter; (F) Reports concerning option positions of large traders required to... significant financial speculation in currencies, securities, or commodities, (ii) significantly endanger the...

  10. 40 CFR 147.51 - State-administered program-Class I, III, IV, and V wells. (United States)


    ... PROGRAMS Alabama § 147.51 State-administered program—Class I, III, IV, and V wells. The UIC program for Class I, III, IV and V wells in the State of Alabama, except those on Indian lands, is the program... for Class I, III, IV, and V UIC Program,” September 21, 1982; (3) Letter from Alabama Chief Assistant...

  11. 40 CFR 147.2550 - State-administered program-Class I, III, IV and V wells. (United States)


    ... CONTROL PROGRAMS Wyoming § 147.2550 State-administered program—Class I, III, IV and V wells. The UIC program for Class I, III, IV and V wells in the State of Wyoming, except those on Indian lands is the... 40 Protection of Environment 22 2010-07-01 2010-07-01 false State-administered program-Class I...

  12. 40 CFR 147.251 - EPA-administered program-Class I, III, IV and V wells and Indian lands. (United States)


    ... INJECTION CONTROL PROGRAMS California § 147.251 EPA-administered program—Class I, III, IV and V wells and Indian lands. (a) Contents. The UIC program in the State of California for Class I, III, IV and V wells... 40 Protection of Environment 22 2010-07-01 2010-07-01 false EPA-administered program-Class I, III...

  13. 40 CFR 147.500 - State-administered program-Class I, III, IV, and V wells. (United States)


    ... CONTROL PROGRAMS Florida § 147.500 State-administered program—Class I, III, IV, and V wells. The UIC program for Class I, III, IV, and V wells in the State of Florida, except for those on Indian lands is... 40 Protection of Environment 22 2010-07-01 2010-07-01 false State-administered program-Class I...

  14. 40 CFR 147.1601 - State-administered program-Class I, III, IV and V wells. (United States)


    ... CONTROL PROGRAMS New Mexico § 147.1601 State-administered program—Class I, III, IV and V wells. The UIC program for Class I, III, IV and V injection wells in the State of New Mexico, except for those on Indian... 40 Protection of Environment 22 2010-07-01 2010-07-01 false State-administered program-Class I...

  15. 40 CFR 147.2250 - State-administered program-Class I, III, IV, and V wells. (United States)


    ... CONTROL PROGRAMS Utah § 147.2250 State-administered program—Class I, III, IV, and V wells. The UIC program for Class I, III, IV, and V wells in the State of Utah, except those on Indian lands, is administered... 40 Protection of Environment 22 2010-07-01 2010-07-01 false State-administered program-Class I...

  16. 40 CFR 147.1301 - State-administered program-Class I, III, IV, and V wells. (United States)


    ... CONTROL PROGRAMS Missouri § 147.1301 State-administered program—Class I, III, IV, and V wells. The UIC program for Class I, III, IV, and V wells in the State of Missouri, other than those on Indian lands, is... 40 Protection of Environment 22 2010-07-01 2010-07-01 false State-administered program-Class I...

  17. 40 CFR 147.301 - EPA-administered program-Class I, III, IV, V wells and Indian lands. (United States)


    ... INJECTION CONTROL PROGRAMS Colorado § 147.301 EPA-administered program—Class I, III, IV, V wells and Indian lands. (a) Contents. The UIC program for Class I, III, IV and V wells on all lands in Colorado... 40 Protection of Environment 22 2010-07-01 2010-07-01 false EPA-administered program-Class I, III...

  18. 40 CFR 147.1850 - State-administered program-Class I, III, IV and V wells. (United States)


    ... CONTROL PROGRAMS Oklahoma § 147.1850 State-administered program—Class I, III, IV and V wells. The UIC program for Class I, III, IV, and V wells in the State of Oklahoma, except those on Indian lands, is the... 40 Protection of Environment 22 2010-07-01 2010-07-01 false State-administered program-Class I...

  19. 40 CFR 147.1751 - State-administered program-Class I, III, IV and V wells. (United States)


    ... CONTROL PROGRAMS North Dakota § 147.1751 State-administered program—Class I, III, IV and V wells. The UIC program for Class I, III, IV, and V wells in the State of North Dakota, except those on Indian lands, is... 40 Protection of Environment 22 2010-07-01 2010-07-01 false State-administered program-Class I...

  20. 40 CFR 147.200 - State-administered program-Class I, III, IV, and V wells. (United States)


    ... CONTROL PROGRAMS Arkansas § 147.200 State-administered program—Class I, III, IV, and V wells. The UIC program for Class I, III, IV and V wells in the State of Arkansas, except those wells on Indian lands, is... 40 Protection of Environment 22 2010-07-01 2010-07-01 false State-administered program-Class I...

  1. 40 CFR 147.700 - State-administered program-Class I, III, IV, and V wells. (United States)


    ... CONTROL PROGRAMS Illinois § 147.700 State-administered program—Class I, III, IV, and V wells. The UIC program for Class I, III, IV and V wells in the State of Illinois, except those on Indian lands, is the... 40 Protection of Environment 22 2010-07-01 2010-07-01 false State-administered program-Class I...

  2. 40 CFR 147.1250 - State-administered program-Class I, III, IV, and V wells. (United States)


    ... CONTROL PROGRAMS Mississippi § 147.1250 State-administered program—Class I, III, IV, and V wells. The UIC program for Class I, III, IV and V wells in the State of Mississippi, except those on Indian lands, is the... 40 Protection of Environment 22 2010-07-01 2010-07-01 false State-administered program-Class I...

  3. Vegetation response to the 14.7 and11.5 ka yrs BP climate transitions: is vegetation lagging climate?

    NARCIS (Netherlands)

    Hoek, W.Z.


    The transition from the Last Glacial towards the Holocene is marked by two rapid increases in temperature. These climate transitions are recorded in detail in the Greenland ice-cores, and these records reveal that the climate shifts around 14.7 and 11.5 ka cal. BP seem to have occurred within a few

  4. Monitoring microevolution of OXA-48-producing Klebsiella pneumoniae ST147 in a hospital setting by SMRT sequencing. (United States)

    Zautner, Andreas E; Bunk, Boyke; Pfeifer, Yvonne; Spröer, Cathrin; Reichard, Utz; Eiffert, Helmut; Scheithauer, Simone; Groß, Uwe; Overmann, Jörg; Bohne, Wolfgang


    Carbapenemase-producing Klebsiella pneumoniae pose an increasing risk for healthcare facilities worldwide. A continuous monitoring of ST distribution and its association with resistance and virulence genes is required for early detection of successful K. pneumoniae lineages. In this study, we used WGS to characterize MDR blaOXA-48-positive K. pneumoniae isolated from inpatients at the University Medical Center Göttingen, Germany, between March 2013 and August 2014. Closed genomes for 16 isolates of carbapenemase-producing K. pneumoniae were generated by single molecule real-time technology using the PacBio RSII platform. Eight of the 16 isolates showed identical XbaI macrorestriction patterns and shared the same MLST, ST147. The eight ST147 isolates differed by only 1-25 SNPs of their core genome, indicating a clonal origin. Most of the eight ST147 isolates carried four plasmids with sizes of 246.8, 96.1, 63.6 and 61.0 kb and a novel linear plasmid prophage, named pKO2, of 54.6 kb. The blaOXA-48 gene was located on a 63.6 kb IncL plasmid and is part of composite transposon Tn1999.2. The ST147 isolates expressed the yersinabactin system as a major virulence factor. The comparative whole-genome analysis revealed several rearrangements of mobile genetic elements and losses of chromosomal and plasmidic regions in the ST147 isolates. Single molecule real-time sequencing allowed monitoring of the genetic and epigenetic microevolution of MDR OXA-48-producing K. pneumoniae and revealed in addition to SNPs, complex rearrangements of genetic elements.

  5. Periodontitis promotes the diabetic development of obese rat via miR-147 induced classical macrophage activation. (United States)

    Xu, Ran; Zeng, Guang; Wang, Shuyong; Tao, Hong; Ren, Le; Zhang, Zhe; Zhang, Qingna; Zhao, Jinxiu; Gao, Jing; Li, Daxu


    Emerging evidence has indicated the bad effect of periodontal inflammation on diabetes control. However, the exact regulatory mechanisms within the association between periodontitis and diabetic development remain unclear. This study aims to investigate the function of microRNAs in regulating periodontitis-induced inflammation in an obese rat model. Experimental periodontitis was introduced into OLETF and LETO rat. Intraperitoneal glucose tolerance test was performed to detect diabetic development. Serum cytokines levels and microRNAs expression were detected by ELISA and RT-PCR analysis respectively. And, macrophages were isolated for gain- and loss-of-function studies, to investigate the regulatory mechanism of miR-147 in periodontitis-induced inflammation. Periodontitis induced proinflammatory response with classical activated macrophages in both rats, but distinctively aggravated the impaired glucose tolerance of OLETF rat with spontaneous type 2 diabetes. Analysis for serum microRNAs expression showed the distinctive and synergistic upregulation of miR-147 with periodontitis-induced effects in rats, while further experiments demonstrated the positive regulatory mechanism of miR-147 on classical activated macrophages with overexpressed proinflammatory markers, showing M1 phenotype. This study provided new evidence for the positive effect of periodontal inflammation on diabetic development, while the regulatory mechanism of miR-147 on classical macrophage activation, was verified, and presumed to contribute to the impaired glucose tolerance aggravated by periodontitis in obese rats. Besides, this study indicated the application of miR-147 for therapeutic approach in the treatment of diabetes with periodontitis. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  6. 76 FR 81999 - Submission for Review: Verification of Who Is Getting Payments, RI 38-107 and RI 38-147 (United States)


    ... MANAGEMENT Submission for Review: Verification of Who Is Getting Payments, RI 38-107 and RI 38-147 AGENCY: [email protected] or faxed to (202) 395-6974. SUPPLEMENTARY INFORMATION: RI 38-107, Verification of Who..., must verify that the entitled person is indeed receiving the monies payable. RI 38-147, Verification of...

  7. Downregulation of CD147 expression by RNA interference inhibits HT29 cell proliferation, invasion and tumorigenicity in vitro and in vivo. (United States)

    Li, Rui; Pan, Yuqin; He, Bangshun; Xu, Yeqiong; Gao, Tianyi; Song, Guoqi; Sun, Huiling; Deng, Qiwen; Wang, Shukui


    We investigated the effect of CD147 silencing on HT29 cell proliferation and invasion. We constructed a novel short hairpin RNA (shRNA) expression vector pYr-mir30-shRNA. The plasmid was transferred to HT29 cells. The expression of CD147, MCT1 (lactate transporters monocarboxylate transporter 1) and MCT4 (lactate transporters monocarboxylate transporter 4) were monitored by quantitative PCR and western blotting, respectively. The MMP-2 (matrix metalloproteinase-2) and MMP-9 (matrix metalloproteinase-9) activities were determined by gelatin zymography assay, while the intracellular lactate concentration was determined by the lactic acid assay kit. WST-8 assay was used to determine the HT29 cell proliferation and the chemosensitivity. Invasion assay was used to determine the invasion of HT29 cells. In addition, we established a colorectal cancer model, and detected CD147 expression in vivo. The results showed that the expression of CD147 and MCT1 was significantly reduced at both mRNA and protein levels, and also the activity of MMP-2 and MMP-9 was reduced. The proliferation and invasion were decreased, but chemosensitivity to cisplatin was increased. In vivo, the CD147 expression was also significantly decreased, and reduced the tumor growth after CD147 gene silencing. The results demonstrated that silencing of CD147 expression inhibited the proliferation and invasion, suggesting CD147 silencing might be an adjuvant gene therapy strategy to chemotherapy.

  8. Complications after 147 consecutive vertebral column resections for severe pediatric spinal deformity: a multicenter analysis. (United States)

    Lenke, Lawrence G; Newton, Peter O; Sucato, Daniel J; Shufflebarger, Harry L; Emans, John B; Sponseller, Paul D; Shah, Suken A; Sides, Brenda A; Blanke, Kathy M


    Retrospective multicenter review. Determine the definition, indications, results, and outcomes, focusing on complications of vertebral column resection (VCR) for severe pediatric spinal deformity. The strict definition of the VCR procedure, indications, results, outcomes, and the numerous, potentially serious complications are unknown or controversial, and a large multicenter review has never been performed. A total of 147 patients treated by 7 pediatric spinal deformity surgeons were reviewed-seventy-four females and 73 males, with an average age of 13.7 years, an average of 1.6 (range, 1-5) vertebrae resected, and an average follow-up of 17 months (range, 0.5-64 mo). The strict definition of VCR used was a "3-column circumferential vertebral osteotomy creating a segmental defect with sufficient instability to require provisional instrumentation." Indications for a VCR were divided into 5 diagnostic categories: kyphoscoliosis (n = 52), severe scoliosis (n = 37), congenital deformity (n = 28), global kyphosis (n = 17), and angular kyphosis (n = 13). Eighty-four primary and 63 revision patients with 174 operative procedures, 127 posterior-only (17 staged), and 20 patients combined anterior-posterior (10 staged) were reviewed. Average preoperative upright, flexibility, and postoperative Cobb measures (% correction or average kyphosis decrease) were kyphoscoliosis: 91°, 65°, 44° (51% coronal), 104°, 81°, and 47° (decrease, 57° sagittal); severe scoliosis: 104°, 78°, and 33° (67%); congenital deformity: 47°, 38°, 22° (46% coronal), 56°, 48°, and 32° (decrease, 24° sagittal); global kyphosis: 101°, 79°, and 47° (decrease, 54°); and angular kyphosis: 88°, 90°, and 38° (decrease, 50°), respectively. Operative time averaged 545 minutes (range, 204-1355 min) and estimated blood loss averaged 1610 mL (range, 50-8244 mL) for an average 65% blood volume loss (range, 6%-316%). Eighty-six patients (59%) developed a complication, 39 patients (27%) having

  9. Technical Evaluation Report for Symposium AVT-147: Computational Uncertainty in Military Vehicle Design (United States)

    Radespiel, Rolf; Hemsch, Michael J.


    The complexity of modern military systems, as well as the cost and difficulty associated with experimentally verifying system and subsystem design makes the use of high-fidelity based simulation a future alternative for design and development. The predictive ability of such simulations such as computational fluid dynamics (CFD) and computational structural mechanics (CSM) have matured significantly. However, for numerical simulations to be used with confidence in design and development, quantitative measures of uncertainty must be available. The AVT 147 Symposium has been established to compile state-of-the art methods of assessing computational uncertainty, to identify future research and development needs associated with these methods, and to present examples of how these needs are being addressed and how the methods are being applied. Papers were solicited that address uncertainty estimation associated with high fidelity, physics-based simulations. The solicitation included papers that identify sources of error and uncertainty in numerical simulation from either the industry perspective or from the disciplinary or cross-disciplinary research perspective. Examples of the industry perspective were to include how computational uncertainty methods are used to reduce system risk in various stages of design or development.

  10. Measurements of the cosmic microwave background temperature at 1.47 GHz

    Energy Technology Data Exchange (ETDEWEB)

    Bensadoun, Marc John [Univ. of California, Berkeley, CA (United States)


    A radiofrequency-gain total power radiometer measured the intensity of the cosmic microwave background (CMB) at a frequency of 1.47 GHz (20.4 cm wavelength) from White Mountain, California, in September 1988 and from the South Pole, Antarctica, in December 1989. The CMB thermodynamic temperature, TCMB, is 2.27 ± 0.25 K (68% C.L.) measured from White Mountain and 2.26 ± 0.21 K from the South Pole site. The combined result is 2.27 ± 0.19 K. The correction for galactic emission has been derived from scaled low-frequency maps and constitutes the main source, of error. The atmospheric signal is found by extrapolation from zenith scan measurements at higher frequencies. The result is consistent with previous low-frequency measurements, including a measurement at 1.41 GHz (Levin et al. 1988) made with an earlier version of this instrument. The result is ~2.5 σ (~l% probability) from the 2.74 ± 0.02,K global average CMB temperature.

  11. Extracellular matrix metalloproteinase inducer (EMMPRIN/CD147) as a novel regulator of myogenic cell differentiation. (United States)

    Attia, Mohamed; Mohamed, Attia; Huet, Eric; Eric, Huet; Delbé, Jean; Jean, Delbé; Ledoux, Dominique; Dominique, Ledoux; Menashi, Suzanne; Suzanne, Menashi; Martelly, Isabelle; Isabelle, Martelly


    Matrix metalloproteinases (MMPs) are thought to play an important role in skeletal muscle cell growth and differentiation. In view of the MMP inducing function of EMMPRIN/CD147, its role in myogenic cell differentiation was investigated. EMMPRIN level increased during differentiation of both rat primary myoblasts derived from satellite cells and mouse C2.7 myogenic cells and was associated with an alteration in its molecular forms. In parallel, expression of pro-MMP-9 gradually decreased and that of pro-MMP-2 and active MMP-2 increased. While small interfering RNA (siRNA) inhibition of EMMPRIN expression accelerated cell differentiation, exogenously added recombinant EMMPRIN inhibited differentiation by an MMP-mediated mechanism, as the MMP inhibitor marimastat abrogated EMMPRIN's effect. Our results further suggest that EMMPRIN regulates differentiation through an MMP activation of transforming growth factor beta (TGFβ), a known inhibitor of myoblast's differentiation, as the increased activation and signaling of TGFβ by EMMPRIN was attenuated in the presence of marimastat. EMMPRIN inhibition may thus represent a novel strategy in the treatment of muscular degenerative disorders.

  12. Hepatitis B X-interacting protein promotes cisplatin resistance and regulates CD147 via Sp1 in ovarian cancer. (United States)

    Zou, Wei; Ma, Xiangdong; Yang, Hong; Hua, Wei; Chen, Biliang; Cai, Guoqing


    Ovarian cancer is the highest mortality rate of all female reproductive malignancies. Drug resistance is a major cause of treatment failure in malignant tumors. Hepatitis B X-interacting protein acts as an oncoprotein, regulates cell proliferation, and migration in breast cancer. We aimed to investigate the effects and mechanisms of hepatitis B X-interacting protein on resistance to cisplatin in human ovarian cancer cell lines. The mRNA and protein levels of hepatitis B X-interacting protein were detected using RT-PCR and Western blotting in cisplatin-resistant and cisplatin-sensitive tissues, cisplatin-resistant cell lines A2780/CP and SKOV3/CP, and cisplatin-sensitive cell lines A2780 and SKOV3. Cell viability and apoptosis were measured to evaluate cellular sensitivity to cisplatin in A2780/CP cells. Luciferase reporter gene assay was used to determine the relationship between hepatitis B X-interacting protein and CD147. The in vivo function of hepatitis B X-interacting protein on tumor burden was assessed in cisplatin-resistant xenograft models. The results showed that hepatitis B X-interacting protein was highly expressed in ovarian cancer of cisplatin-resistant tissues and cells. Notably, knockdown of hepatitis B X-interacting protein significantly reduced cell viability in A2780/CP compared with cisplatin treatment alone. Hepatitis B X-interacting protein and cisplatin cooperated to induce apoptosis and increase the expression of c-caspase 3 as well as the Bax/Bcl-2 ratio. We confirmed that hepatitis B X-interacting protein up-regulated CD147 at the protein expression and transcriptional levels. Moreover, we found that hepatitis B X-interacting protein was able to activate the CD147 promoter through Sp1. In vivo, depletion of hepatitis B X-interacting protein decreased the tumor volume and weight induced by cisplatin. Taken together, these results indicate that hepatitis B X-interacting protein promotes cisplatin resistance and regulated CD147 via Sp1 in

  13. Comparative study between NCRP-49 and NCRP-147 methodologies for shielding calculus to fluoroscopy rooms; Estudo comparativo entre as metodologias da NCRP-49 e da NCRP-147 para calculo de blindagem para salas de fluoroscopia

    Energy Technology Data Exchange (ETDEWEB)

    Ferreira, Christiano Eduardo Martins


    The walls of a fluoroscopy room must be shielded to prevent unnecessary exposures to technicians and public individuals. Thus this dissertation aims to describe the methodologies contained in two documents which are references for the calculation of shielding those rooms. They are the National Council on Radiation Protection and Measurements Report No. 49 (NCRP Report No. 49) and No. 147 (NCRP Report No. 147), the latter being more recent publication. And based on such description was made a comparative study between the two methodologies, using for this, as a benchmark, spreadsheets computer program developed by Wolfram Mathematica 6. With that we could reach the final thickness of the barriers to a Standard Plan for a fluoroscopy room (provided by Siemens) and noted that the NCRP-49 presents a methodology with results more conservative. (author)

  14. In vitro and in vivo prostate cancer metastasis and chemoresistance can be modulated by expression of either CD44 or CD147.

    Directory of Open Access Journals (Sweden)

    Jingli Hao

    Full Text Available CD44 and CD147 are associated with cancer metastasis and progression. Our purpose in the study was to investigate the effects of down-regulation of CD44 or CD147 on the metastatic ability of prostate cancer (CaP cells, their docetaxel (DTX responsiveness and potential mechanisms involved in vitro and in vivo. CD44 and CD147 were knocked down (KD in PC-3M-luc CaP cells using short hairpin RNA (shRNA. Expression of CD44, CD147, MRP2 (multi-drug resistance protein-2 and MCT4 (monocarboxylate tranporter-4 was evaluated using immunofluorescence and Western blotting. The DTX dose-response and proliferation was measured by MTT and colony assays, respectively. The invasive potential was assessed using a matrigel chamber assay. Signal transduction proteins in PI3K/Akt and MAPK/Erk pathways were assessed by Western blotting. An in vivo subcutaneous (s.c. xenograft model was established to assess CaP tumorigenecity, lymph node metastases and DTX response. Our results indicated that KD of CD44 or CD147 decreased MCT4 and MRP2 expression, reduced CaP proliferation and invasive potential and enhanced DTX sensitivity; and KD of CD44 or CD147 down-regulated p-Akt and p-Erk, the main signal modulators associated with cell growth and survival. In vivo, CD44 or CD147-KD PC-3M-luc xenografts displayed suppressed tumor growth with increased DTX responsiveness compared to control xenografts. Both CD44 and CD147 enhance metastatic capacity and chemoresistance of CaP cells, potentially mediated by activation of the PI3K and MAPK pathways. Selective targeting of CD44/CD147 alone or combined with DTX may limit CaP metastasis and increase chemosensitivity, with promise for future CaP treatment.

  15. Neutron Capture Cross Sections of the s-Process Branching Points 147Pm, 171Tm, and 204Tl (United States)

    Guerrero, Carlos; Domingo-Pardo, Cesar; Lerendegui-Marco, Jorge; Casanovas, Adria; Cortes-Giraldo, Miguel A.; Dressler, Rugard; Halfon, Shlomi; Heinitz, Stephan; Kivel, Niko; Köster, Ulli; Paul, Michael; Quesada-Molina, Jose Manuel; Schumann, Dorothea; Tarifeño-Saldivia, Ariel; Tessler, Moshe; Weissman, Leo

    The neutron capture cross section of several key unstable isotopes acting as branching points in the s-process are crucial for stellar nucleosynthesis studies, but they are very challenging to measure due to the difficult production of sufficient sample material, the high activity of the resulting samples, and the actual (n, γ) measurement, for which high neutron fluxes and effective background rejection capabilities are required. As part of a new program to measure some of these important branching points, radioactive targets of 147Pm, 171Tm, and 204Tl have been produced by irradiation of stable isotopes (146Nd, 170Er, and 203Tl) at the Institut Laue-Langevin (ILL) high flux reactor. After breeding in the reactor and a certain cooling period, the resulting mixed 204Tl/203Tl sample was used directly while 147Pm and 171Tm were radiochemically separated in non-carrier-added quality at the Paul Scherrer Institut (PSI), then prepared as targets. A set of theses samples has been used for time-of-flight measurements at the CERN n_TOF facility using the 19 and 185 m beam lines, during 2014 and 2015. The capture cascades were detected with a set of four C6D6 scintillators, allowing to observe the associated neutron capture resonances. The results presented in this work are the first ever determination of the resonance capture cross sections of 147Pm, 171Tm, and 204Tl. Activation experiments on the same 147Pm and 171Tm targets with a high-intensity quasi-Maxwellian flux of neutrons have been performed using the SARAF accelerator and the Liquid-Lithium Target (LiLiT) in order to extract the corresponding Maxwellian Average Cross Section (MACS). The experimental setups are here described together with the first, preliminary results of the n_TOF measurement.

  16. 40 CFR 147.1050 - State-administered program-Class I, II, III, IV, and V wells. (United States)


    ... CONTROL PROGRAMS Maryland § 147.1050 State-administered program—Class I, II, III, IV, and V wells. The UIC program for Class I, II, III, IV, and V wells in the State of Maryland, except those wells on Indian lands... 40 Protection of Environment 22 2010-07-01 2010-07-01 false State-administered program-Class I, II...

  17. 40 CFR 147.650 - State-administrative program-Class I, II, III, IV, and V wells. (United States)


    ... CONTROL PROGRAMS Idaho § 147.650 State-administrative program—Class I, II, III, IV, and V wells. The UIC program for Class I, II, III, IV, and V wells in the State of Idaho, other than those on Indian lands, is... 40 Protection of Environment 22 2010-07-01 2010-07-01 false State-administrative program-Class I...

  18. Removal of a Guenther Tulip retrievable inferior vena cava filter after 147 days in a pediatric patient

    Energy Technology Data Exchange (ETDEWEB)

    Mody, Rekha N.; Stokes, LeAnn S.; Bream, Peter R.; Spottswood, Stephanie E. [Vanderbilt University Medical Center, Department of Radiology, Nashville, TN (United States)


    A Guenther Tulip retrievable inferior vena cava filter was placed in a 9-year-old boy with T-cell ALL who had both iliofemoral deep vein thrombosis (DVT) and acute intracranial hemorrhage. The filter was removed 147 days after placement, when the patient was no longer at increased risk for DVT or pulmonary embolus. Removal of the filter did not compromise flow through the vena cava. (orig.)

  19. EMMPRIN/CD147 deficiency disturbs ameloblast-odontoblast cross-talk and delays enamel mineralization. (United States)

    Khaddam, Mayssam; Huet, Eric; Vallée, Benoît; Bensidhoum, Morad; Le Denmat, Dominique; Filatova, Anna; Jimenez-Rojo, Lucia; Ribes, Sandy; Lorenz, Georg; Morawietz, Maria; Rochefort, Gael Y; Kiesow, Andreas; Mitsiadis, Thimios A; Poliard, Anne; Petzold, Matthias; Gabison, Eric E; Menashi, Suzanne; Chaussain, Catherine


    Tooth development is regulated by a series of reciprocal inductive signaling between the dental epithelium and mesenchyme, which culminates with the formation of dentin and enamel. EMMPRIN/CD147 is an Extracellular Matrix MetalloPRoteinase (MMP) INducer that mediates epithelial-mesenchymal interactions in cancer and other pathological processes and is expressed in developing teeth. Here we used EMMPRIN knockout (KO) mice to determine the functional role of EMMPRIN on dental tissue formation. We report a delay in enamel deposition and formation that is clearly distinguishable in the growing incisor and associated with a significant reduction of MMP-3 and MMP-20 expression in tooth germs of KO mice. Insufficient basement membrane degradation is evidenced by a persistent laminin immunostaining, resulting in a delay of both odontoblast and ameloblast differentiation. Consequently, enamel volume and thickness are decreased in adult mutant teeth but enamel maturation and tooth morphology are normal, as shown by micro-computed tomographic (micro-CT), nanoindentation, and scanning electron microscope analyses. In addition, the dentino-enamel junction appears as a rough calcified layer of approximately 10±5μm thick (mean±SD) in both molars and growing incisors of KO adult mice. These results indicate that EMMPRIN is involved in the epithelial-mesenchymal cross-talk during tooth development by regulating the expression of MMPs. The mild tooth phenotype observed in EMMPRIN KO mice suggests that the direct effect of EMMPRIN may be limited to a short time window, comprised between basement membrane degradation allowing direct cell contact and calcified matrix deposition. Copyright © 2014 Elsevier Inc. All rights reserved.

  20. A europium- and terbium-coated magnetic nanocomposite as sorbent in dispersive solid phase extraction coupled with ultra-high performance liquid chromatography for antibiotic determination in meat samples. (United States)

    Castillo-García, M L; Aguilar-Caballos, M P; Gómez-Hens, A


    A new magnetic dispersive solid-phase extraction approach based on Eu- and Tb-coated magnetic nanocomposites, combined with ultra-high performance liquid chromatography with fluorometric detection, is reported for the extraction and simultaneous determination of veterinary antibiotics. The method is aimed at monitoring of potential residues of three tetracyclines, namely oxytetracycline, tetracycline, chlortetracycline and three acidic quinolones, such as oxolinic acid, nalidixic acid and flumequine, chosen as model analytes, in animal muscle samples. The nanocomposites were obtained by synthesizing magnetic nanoparticles by a co-precipitation method and their coating with terbium and europium ions. The limits of detection obtained using standard solutions were: 1.0, 1.5, 3.8, 0.25, 0.7 and 1.2ngmL(-1), which corresponds to 3.3, 5.0, 12.7, 0.8, 2.3 and 4.0μgkg(-1) for oxytetracycline, tetracycline, chlortetracycline, oxolinic acid, nalidixic acid and flumequine, respectively, in meat samples. The precision values, obtained in the presence of the sample matrix, were in the ranges 0.12-2.0% and 2.6-15.4% for retention times and areas, respectively. The selectivity of the method was checked by assaying different veterinary drugs, finding that most of them did not interfere at the same concentration levels as that of analytes. A recovery study was performed in the presence of chicken and pork muscle samples, which provided values in the range of 61.5-102.6%. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. A novel role of EMMPRIN/CD147 in transformation of quiescent fibroblasts to cancer-associated fibroblasts by breast cancer cells (United States)

    Xu, Jing; Lu, Yang; Qiu, Songbo; Chen, Zhi-Nan; Fan, Zhen


    We tested the novel hypothesis that EMMPRIN/CD147, a transmembrane glycoprotein overexpressed in breast cancer cells, has a previously unknown role in transforming fibroblasts to cancer-associated fibroblasts, and that cancer-associated fibroblasts in turn induce epithelial-to-mesenchymal transition of breast cancer cells. Co-culture of fibroblasts with breast cancer cells or treatment of fibroblasts with breast cancer cell conditioned culture medium or recombinant EMMPRIN/CD147 induced expression of α-SMA in the fibroblasts in an EMMPRIN/CD147-dependent manner and promoted epithelial-to-mesenchymal transition of breast cancer cells and enhanced cell migration potential. These findings support a novel role of EMMPRIN/CD147 in regulating the interaction between cancer and stroma. PMID:23474495

  2. Ovarian metastases resection from extragenital primary sites: outcome and prognostic factor analysis of 147 patients

    Directory of Open Access Journals (Sweden)

    Li Wenhua


    Full Text Available Abstract Background To explore the outcomes and prognostic factors of ovarian metastasectomy intervention on overall survival from extragenital primary cancer. Methods Patients with ovarian metastases from extragenital primary cancer confirmed by laparotomy surgery and ovarian metastases resection were retrospectively collected in a single institution during an 8-year period. A total of 147 cases were identified and primary tumor sites were colorectal region (49.0%, gastric (40.8%, breast (8.2%, biliary duct (1.4% and liver (0.7%. The pathological and clinical features were evaluated. Patients’ outcome with different primary tumor sites and predictive factors for overall survival were also investigated by univariate and multivariate analysis. Results Metachronous ovarian metastasis occurred in 92 (62.6% and synchronous in 55 (37.4% patients. Combined metastases occurred in 40 (27.2%. Bilateral metastasis was found in 97 (66% patients. The median ovarian metastasis tumor size was 9 cm. There were 39 (26.5% patients with massive ascites ≥ 1000 mL on intraoperative evaluation. With a median follow-up of 48 months, the median OS after ovarian metastasectomy for all patients was 8.2 months (95% CI 7.2-9.3 months. In univariate analyses, there is significant (8.0 months vs. 41.0 months, P = 0.000 difference in OS between patients with gastrointestinal cancer origin from breast origin, and between patients with gastric origin from colorectal origin (7.4 months vs. 8.8 months, P = 0.036. In univariate analyses, synchronous metastases, locally invasion, massive intraoperative ascites (≥ 1000 mL, and combined metastasis, were identified as significant poor prognostic factors. In multivariate analyses combined metastasis (RR, 1.72; 95% CI, 1.09-2.69, P = 0.018, locally invasion (RR, 1.62; 95% CI, 1.03-2.54, P = 0.038 and massive intraoperative ascites (RR, 1.58; 95% CI, 1.02-2.49, P = 0.04 were independent factors for predicting

  3. Ovarian metastases resection from extragenital primary sites: outcome and prognostic factor analysis of 147 patients. (United States)

    Li, Wenhua; Wang, Huaying; Wang, Jian; L V, Fangfang; Zhu, Xiaodong; Wang, Zhonghua


    To explore the outcomes and prognostic factors of ovarian metastasectomy intervention on overall survival from extragenital primary cancer. Patients with ovarian metastases from extragenital primary cancer confirmed by laparotomy surgery and ovarian metastases resection were retrospectively collected in a single institution during an 8-year period. A total of 147 cases were identified and primary tumor sites were colorectal region (49.0%), gastric (40.8%), breast (8.2%), biliary duct (1.4%) and liver (0.7%). The pathological and clinical features were evaluated. Patients' outcome with different primary tumor sites and predictive factors for overall survival were also investigated by univariate and multivariate analysis. Metachronous ovarian metastasis occurred in 92 (62.6%) and synchronous in 55 (37.4%) patients. Combined metastases occurred in 40 (27.2%). Bilateral metastasis was found in 97 (66%) patients. The median ovarian metastasis tumor size was 9 cm. There were 39 (26.5%) patients with massive ascites ≥ 1000 mL on intraoperative evaluation. With a median follow-up of 48 months, the median OS after ovarian metastasectomy for all patients was 8.2 months (95% CI 7.2-9.3 months). In univariate analyses, there is significant (8.0 months vs. 41.0 months, P = 0.000) difference in OS between patients with gastrointestinal cancer origin from breast origin, and between patients with gastric origin from colorectal origin (7.4 months vs. 8.8 months, P = 0.036). In univariate analyses, synchronous metastases, locally invasion, massive intraoperative ascites (≥ 1000 mL), and combined metastasis, were identified as significant poor prognostic factors. In multivariate analyses combined metastasis (RR, 1.72; 95% CI, 1.09-2.69, P = 0.018), locally invasion (RR, 1.62; 95% CI, 1.03-2.54, P = 0.038) and massive intraoperative ascites (RR, 1.58; 95% CI, 1.02-2.49, P = 0.04) were independent factors for predicting unfavorable overall survival. Ovarian

  4. HAb18G/CD147 cell-cell contacts confer resistance of a HEK293 subpopulation to anoikis in an E-cadherin-dependent manner

    Directory of Open Access Journals (Sweden)

    Zhu Ping


    Full Text Available Abstract Background Acquisition of resistance to "anoikis" facilitates the survival of cells under independent matrix-deficient conditions, such as cells in tumor progression and the production of suspension culture cells for biomedical engineering. There is evidence suggesting that CD147, an adhesion molecule associated with survival of cells in tumor metastasis and cell-cell contacts, plays an important role in resistance to anoikis. However, information regarding the functions of CD147 in mediating cell-cell contacts and anoikis-resistance remains limited and even self-contradictory. Results An anoikis-resistant clone (HEK293ar, derived from anoikis-sensitive parental Human Embryonic Kidney 293 cells, survived anoikis by the formation of cell-cell contacts. The expression of HAb18G/CD147 (a member of the CD147 family was upregulated and the protein was located at cell-cell junctions. Upregulation of HAb18G/CD147 in suspended HEK293ar cells suppressed anoikis by mediating the formation of cell-cell adhesions. Anoikis resistance in HEK293ar cells also required E-cadherin-mediated cell-cell contacts. Knock-down of HAb18G/CD147 and E-cadherin inhibited cell-cell contacts formation and increased anoikis sensitivity respectively. When HAb18G/CD147 was downregulated, E-cadherin expression in HEK293ar cells was significantly suppressed; however, knockdown of E-cadherin by E-cadherin siRNA or blocking of E-cadherin binding activity with a specific antibody and EDTA had no significant effect on HAb18G/CD147 expression. Finally, pretreatment with LY294002, a phosphoinositide 3-kinase (PI3K/AKT inhibitor, disrupted cell-cell contacts and decreased cell number, but this was not the case in cells treated with the extracellular signal-regulated kinase (ERK inhibitor PD98059. Conclusions Our results provide new evidence that HAb18G/CD147-mediated cell-cell contact confers anoikis resistance in an E-cadherin-dependent manner; and cell-cell contact mediated

  5. Water in orthopyroxene from abyssal spinel peridotites of the East Pacific Rise (ODP Leg 147: Hess Deep) (United States)

    Hesse, Kirsten T.; Gose, Jürgen; Stalder, Roland; Schmädicke, Esther


    Abyssal spinel peridotites from Hess Deep, East Pacific Rise (ODP Leg 147) were investigated concerning their major, minor, and trace element mineral chemistry and the incorporation of structural water in orthopyroxene. The rocks are partially serpentinized harzburgites containing primary minerals of olivine, orthopyroxene, clinopyroxene, and spinel. Orthopyroxene is enstatitic with Mg# (Mg/(Mg + Fe)) between 0.90 and 0.92 and Al2O3 from 0.5 to 2.9 wt.%. The residual harzburgite experienced high degrees of melt removal in the spinel peridotite stability field. The average degree of partial melting was calculated to be 17.5% (range: 16.4-17.8%). Trace element data of ortho- and clinopyroxenes reflect this strong depletion, characteristic for the restitic nature of abyssal peridotites. Mantle re-equilibration temperatures around 1000 °C indicate that, after melt extraction and before exhumation to the ocean floor, the rocks experienced significant cooling in the spinel peridotite facies. Water contents of orthopyroxene range from 86 to 233 wt. ppm H2O with an average concentration of 142 wt. ppm H2O. These results represent the first data on water contents in the sub-pacific mantle obtained by direct measurements of sub-oceanic peridotite. The water contents are not related to mineral chemistry, stratigraphy, melting degree, mantle equilibrium conditions or oxidation state. Calculated post-melt peridotite water contents vary between 40 and 100 wt. ppm H2O. Compared to Mid-Atlantic Ridge peridotites, the East Pacific Rise samples of Leg 147 contain somewhat lower water concentrations than samples from Leg 153 and considerably higher contents than those of Leg 209 (Gose et al., 2009; Schmädicke et al., 2011). In Leg 147, the strongest OH absorbtion band occurs at 3420 cm- 1, wheras orthopyroxene from MAR peridotite (Legs 153 and 209) has its strongest absorbtion band at 3566 and 3522 cm- 1. The mantle equilibrium temperature of Leg 147 peridotites is lower than that

  6. Evaluation of (89Zr-labeled human anti-CD147 monoclonal antibody as a positron emission tomography probe in a mouse model of pancreatic cancer.

    Directory of Open Access Journals (Sweden)

    Aya Sugyo

    Full Text Available INTRODUCTION: Pancreatic cancer is an aggressive cancer and its prognosis remains poor. Therefore, additional effective therapy is required to augment and/or complement current therapy. CD147, high expression in pancreatic cancer, is involved in the metastatic process and is considered a good candidate for targeted therapy. CD147-specfic imaging could be useful for selection of appropriate patients. Therefore, we evaluated the potential of a fully human anti-CD147 monoclonal antibody 059-053 as a new positron emission tomography (PET probe for pancreatic cancer. METHODS: CD147 expression was evaluated in four pancreatic cancer cell lines (MIA Paca-2, PANC-1, BxPC-3, and AsPC-1 and a mouse cell line A4 as a negative control. Cell binding, competitive inhibition and internalization assays were conducted with (125I-, (67Ga-, or (89Zr-labeled 059-053. In vivo biodistribution of (125I- or (89Zr-labeled 059-053 was conducted in mice bearing MIA Paca-2 and A4 tumors. PET imaging with [(89Zr]059-053 was conducted in subcutaneous and orthotopic tumor mouse models. RESULTS: Among four pancreatic cancer cell lines, MIA Paca-2 cells showed the highest expression of CD147, while A4 cells had no expression. Immunohistochemical staining showed that MIA Paca-2 xenografts also highly expressed CD147 in vivo. Radiolabeled 059-053 specifically bound to MIA Paca-2 cells with high affinity, but not to A4. [(89Zr]059-053 uptake in MIA Paca-2 tumors increased with time from 11.0±1.3% injected dose per gram (ID/g at day 1 to 16.9±3.2% ID/g at day 6, while [(125I]059-053 uptake was relatively low and decreased with time, suggesting that 059-053 was internalized into tumor cells in vivo and (125I was released from the cells. PET with [(89Zr]059-053 clearly visualized subcutaneous and orthotopic tumors. CONCLUSION: [(89Zr]059-053 is a promising PET probe for imaging CD147 expression in pancreatic cancer and has the potential to select appropriate patients with CD147

  7. Comparison of the binding behavior of several histidine-containing proteins with immobilized copper(II) complexes of 1,4,7-triazacyclononane and 1,4-bis(1,4,7-triazacyclononan-1-yl)butane. (United States)

    Graham, Bim; Spiccia, Leone; Hearn, Milton T W


    The protein binding characteristics of the immobilized binucleating chelate system, 1,4-bis(1,4,7-triazacyclononan-1-yl)butane (tacn(2)butane), complexed with Cu(2+) ions have been investigated with hen egg white lysozyme, horse skeletal muscle myoglobin and horse heart cytochrome C, as well as three histidine-rich proteins, serum albumin, transferrin, and α(2)-macroglobulin, present in partially fractionated human serum. The effects of pH, ionic strength and elution buffers on protein binding have been examined and compared with those of the analogous immobilized mononuclear copper complex of 1,4,7-triazacyclononane (tacn). The Cu(2+)-tacn(2)butane system was generally found to exhibit higher protein binding affinities than the Cu(2+)-tacn system, suggesting that the presence of immobilized binuclear copper(II) species leads to enhanced coordinative interaction with surface-exposed amino acid residues of the studied proteins. However, under some buffer conditions the dependencies of protein binding and elution on pH and ionic strength with these immobilized metal ion affinity chromatographic (IMAC) systems were consistent with electrostatic, hydrophobic and π-bonding interactions playing a significant secondary role in addition to the dominant coordinative interactions. As such, the results indicated that the selectivities were not solely dependent on the histidine content of the protein. In accord with this conclusion, differences in the selectivities of the Cu(2+)-tacn and Cu(2+)-tacn(2)butane adsorbents for serum albumin, transferrin, and α(2)-macroglobulin were observed depending on the choice of elution buffer. This attribute suggests that additional selectivity features can be realised for the separation of specific proteins with this new class of adsorbent. Copyright © 2011. Published by Elsevier B.V.

  8. Characterization of an Avipoxvirus From a Bald Eagle ( Haliaeetus leucocephalus ) Using Novel Consensus PCR Protocols for the rpo147 and DNA-Dependent DNA Polymerase Genes. (United States)

    Stephen, Alexa A; Leone, Angelique M; Toplon, David E; Archer, Linda L; Wellehan, James F X


    A juvenile female bald eagle ( Haliaeetus leucocephalus ) was presented with emaciation and proliferative periocular lesions. The eagle did not respond to supportive therapy and was euthanatized. Histopathologic examination of the skin lesions revealed plaques of marked epidermal hyperplasia parakeratosis, marked acanthosis and spongiosis, and eosinophilic intracytoplasmic inclusion bodies. Novel polymerase chain reaction (PCR) assays were done to amplify and sequence DNA polymerase and rpo147 genes. The 4b gene was also analyzed by a previously developed assay. Bayesian and maximum likelihood phylogenetic analyses of the obtained sequences found it to be poxvirus of the genus Avipoxvirus and clustered with other raptor isolates. Better phylogenetic resolution was found in rpo147 rather than the commonly used DNA polymerase. The novel consensus rpo147 PCR assay will create more accurate phylogenic trees and allow better insight into poxvirus history.

  9. Utilization, at hot temperature, of an ion exchange resin column. Application to the separation of {sup 91}Y - {sup 147}Pm; Utilisation, a chaud, dune colonne de resine echangeuse d'ions. Application a la separation {sup 91} Y - {sup 147} Pm

    Energy Technology Data Exchange (ETDEWEB)

    Bloch, G.; Cohen, P. [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires


    The fission products with long period can be separate by fractional elution, to ambient temperature, on column of an ion exchange resin. The separation of the couple {sup 91}Y + {sup 147}Pm being particularly long, we tried to improve it while using a heated column. For this study, we specified the effect of the temperature on the factor of separation: {alpha}, ratio between the Kd partition coefficients of {sup 147}Pm and {sup 91}Y: {alpha}= Kd ({sup 147}Pm) / Kd ({sup 91}Y). (M.B.) [French] Les produits de fission a periode longue peuvent etre separes par elution fractionnee, a temperature ambiante, sur colonne de resine echangeuse d'ions. La separation du couple {sup 91}Y + {sup 147}Pm etant particulerement longue, nous avons cherche a l'ameliorer en utilisant une colonne chauffee. A l'occasion de cette etude, nous avons ete amenes a preciser l'effet de la temperature sur le facteur de separation: {alpha}, rapport entre les coefficients de partage Kd de {sup 147}Pm et {sup 91}Y: {alpha} = Kd({sup 147}Pm) / Kd({sup 91}Y). (M.B.)

  10. A new 147-56 hPa water vapor product from the UARS Microwave Limb Sounder (United States)

    Read, W. G.; Wu, D. L.; Waters, J. W.; Pumphrey, H. C.


    Measurements of H2O in the tropopause region have been obtained by production of a new data set from the Microwave Limb Sounder (MLS) on the Upper Atmosphere Research Satellite (UARS). A modified version of the retrieval scheme used to produce upper tropospheric humidity (UTH) from the MLS 203 GHz radiometer was applied to the MLS 183 GHz radiometer measurements to produce useful H2O data at 147, 121, 100, 83, 68, and 56 hPa. These new data, for the first 18 months of the UARS mission when the MLS 183 GHz radiometer was operational, fill an important "gap" around 100 hPa where previous MLS H2O data were generally not useful. Characteristics of the new data set are discussed and compared with National Oceanic and Atmospheric Administration (NOAA), Climate Monitoring and Diagnostics Laboratory (CMDL) frost-point hygrometer, and UARS Halogen Occultation Experiment (HALOE) measurements.

  11. OH(A 2Sigma(+) - X 2Pi) emission from dissociative excitation of HO2 at 147 nm (United States)

    Suto, M.; Lee, L. C.


    The photodissociation processes of the HO2 radical have been studied using the Xe resonance line at 147 nm as a light source. HO2 radical was produced by the reaction H + O2 + He HO2 + He in a flow tube, and the HO2 concentration was measured by a titration method HO2 + NO - OH + NO2. An observed emission in the 310 + or -10 nm region was found to be due solely to photodissociation and is attributed to the OH(A 2Sigma(+) - X 2Pi) system. This emission was studied as a function of O2 and H2 pressure added to the flow tube. Other possible photoemission processes were considered, including photoexcitation of OH, photodissociative excitation of H2O2, emission from the reaction O(D-1) + H, and metastable O2 produced from photodissociation of HO2. It is concluded that the emission intensities produced from these processes is negligible.

  12. Does a distal forearm fracture lead to evaluation for osteoporosis? A retrospective cohort study in 147 Danish women

    DEFF Research Database (Denmark)

    Rud, Bo; Greibe, Rasmus; Hyldstrup, Lars


    for a densitometry to estimate the prevalence of osteoporosis. From May 1, 2001 to April 30, 2002, 147 women presented with a low-trauma distal forearm fractures. According to the review of hospital records, none of the women was referred for bone densitometry or spine X-rays. One woman had calcium and vitamin D...... supplementation (CVDS) prescribed and two were recommended to consult their GPs for osteoporosis follow-up. In primary care, 12 women were referred for densitometry or spine X-rays, and 11 women started CVDS after the fracture. Women with risk factors for osteoporosis in addition to the forearm fracture were...... not more likely to be referred for densitometry or spine X-rays (p = 0.10). The prevalence of osteoporosis was 24% among the 79 women who underwent densitometry. Our study demonstrates a low use of available measures to reduce the risk of future fracture in women with a low-trauma distal forearm fracture...

  13. Does a distal forearm fracture lead to evaluation for osteoporosis? A retrospective cohort study in 147 Danish women

    DEFF Research Database (Denmark)

    Rud, Bo; Greibe, Rasmus; Hyldstrup, Lars


    for a densitometry to estimate the prevalence of osteoporosis. From May 1, 2001 to April 30, 2002, 147 women presented with a low-trauma distal forearm fractures. According to the review of hospital records, none of the women was referred for bone densitometry or spine X-rays. One woman had calcium and vitamin D......In postmenopausal women, a low-trauma distal forearm fracture is a risk factor for osteoporosis and future fracture, which indicates osteoporosis follow-up according to prevailing guidelines. We decided to determine how often women over 45 yr presenting with a low-trauma distal forearm fracture...... to a Danish emergency department during a 1-yr period were followed up for osteoporosis. We performed a retrospective review of hospital records and we sent the women and their general practitioners (GPs) questionnaires regarding the follow-up undertaken in primary care. Finally, we invited the women...

  14. The two mayor warming phases of the last deglaciation at ~14.7 and ~11.5 kyr cal BP in Europe: climate reconstructions and AGCM experiments.

    NARCIS (Netherlands)

    Renssen, H.; Isarin, R.F.B.


    During the last deglaciation two distinct warming phases occurred in the N Atlantic region at ∼14.7 and ∼11.5 ka cal BP. These two shifts are the transitions from (1) GS-2a (Greenland Stadial 2a) to GI-1e (Greenland Interstadial 1e) and (2) GS-1 to the Preboreal. In this study we characterise these

  15. 40 CFR 147.2101 - EPA-administered program-Class I, III, IV and V wells and all wells on Indian lands. (United States)


    ... UNDERGROUND INJECTION CONTROL PROGRAMS South Dakota § 147.2101 EPA-administered program—Class I, III, IV and V wells and all wells on Indian lands. (a) Contents. The UIC program for all Class I, III, IV, and V wells... program for Class I, III, IV and V wells on all lands in South Dakota, including Indian lands, and for...

  16. Atmospheric variability over the 14,7 kyr BP stadial-interstadial transition in the North Atlantic region as simulated by an AGCM

    NARCIS (Netherlands)

    Renssen, H.; Bogaart, P.W.


    The ECHAM4-T42 atmospheric general circulation model was applied to study the change in atmospheric variability in the North Atlantic region over the similar to14.7 kyr cal BP climatic transition from Greenland Stadial 2a (GS-2a, end of Pleniglacial) to Greenland Interstadial le (GI-le, start Late

  17. Oesophageal heat exchangers with a diameter of 11mm or 14.7mm are equally effective and safe for targeted temperature management. (United States)

    Schroeder, Daniel C; Guschlbauer, Maria; Maul, Alexandra C; Cremer, Daniel A; Becker, Ingrid; de la Puente Bethencourt, David; Paal, Peter; Padosch, Stephan A; Wetsch, Wolfgang A; Annecke, Thorsten; Böttiger, Bernd W; Sterner-Kock, Anja; Herff, Holger


    Targeted temperature management (TTM) is widely used in critical care settings for conditions including hepatic encephalopathy, hypoxic ischemic encephalopathy, meningitis, myocardial infarction, paediatric cardiac arrest, spinal cord injury, traumatic brain injury, ischemic stroke and sepsis. Furthermore, TTM is a key treatment for patients after out-of-hospital cardiac-arrest (OHCA). However, the optimal cooling method, which is quick, safe and cost-effective still remains controversial. Since the oesophagus is adjacent to heart and aorta, fast heat-convection to the central blood-stream could be achieved with a minimally invasive oesophageal heat exchanger (OHE). To date, the optimal diameter of an OHE is still unknown. While larger diameters may cause thermal- or pressure-related tissue damage after long-term exposure to the oesophageal wall, smaller diameter (e.g., gastric tubes, up to 11mm) may not provide effective cooling rates. Thus, the objective of the study was to compare OHE-diameters of 11mm (OHE11) and 14.7mm (OHE14.7) and their effects on tissue and cooling capability. Pigs were randomized to OHE11 (N = 8) or OHE14.7 (N = 8). After cooling, pigs were maintained at 33°C for 1 hour. After 10h rewarming, oesophagi were analyzed by means of histopathology. The oesophagus of four animals from a separate study that underwent exactly the identical preparation and cooling protocol described above but received a maintenance period of 24h were used as histopathological controls. Mean cooling rates were 2.8±0.4°C°C/h (OHE11) and 3.0±0.3°C °C/h (OHE14.7; p = 0.20). Occasional mild acute inflammatory transepithelial infiltrates were found in the cranial segment of the oesophagus in all groups including controls. Deviations from target temperature were 0.1±0.4°C (OHE11) and 0±0.1°C (OHE14.7; p = 0.91). Rewarming rates were 0.19±0.07°C °C/h (OHE11) and 0.20±0.05°C °C/h (OHE14.7; p = 0.75). OHE with diameters of 11 mm and 14.7 mm achieve effective

  18. Involvement of CD147 in overexpression of MMP-2 and MMP-9 and enhancement of invasive potential of PMA-differentiated THP-1

    Directory of Open Access Journals (Sweden)

    Tang Hao


    Full Text Available Abstract Background During infection and inflammation, circulating blood monocytes migrate from the intravascular compartments to the extravascular compartments, where they mature into tissue macrophages. The maturation process prepares the cells to actively participate in the inflammatory and immune responses, and many factors have been reported to be involved in the process. We found in our study that CD147 played a very important role in this process. Results By using PMA-differentiated human monocyte cells line THP-1, we found that CD147 mediated matrix metalloproteinases (MMPs expression of the leukemic THP-1 cells and thus enhanced the invasiveness of THP-1 cells. After 24 hours of PMA-induced monocyte differentiation, the mean fluorescence intensity of CD147 in differentiated THP-1 cells (289.61 ± 31.63 was higher than that of the undifferentiated THP-1 cells (205.1 ± 19.25. There was a significant increase of the levels of proMMP-2, proMMP-9 and their activated forms in the differentiated THP-1 cells. Invasion assays using reconstituted basement membrane showed a good correlation between the invasiveness of THP-1 cells and the production of MMP-2 and MMP-9. The difference in the MMPs expression and the invasive ability was significantly blocked by HAb18G/CD147 antagonistic peptide AP-9. The inhibitory rate of the secretion of proMMP-9 in the undifferentiated THP-1 cells was 45.07%. The inhibitory rate of the secretion of proMMP-9, the activated MMP-9 and proMMP-2 in the differentiated THP-1 cells was 52.90%, 53.79% and 47.80%, respectively. The inhibitory rate of invasive potential in the undifferentiated cells and the differentiated THP-1 cells was 41.82 % and 25.15%, respectively. Conclusion The results suggest that the expression of CD147 is upregulated during the differentiation of monocyte THP-1 cells to macrophage cells, and CD147 induces the secretion and activation of MMP-2 and MMP-9 and enhances the invasive ability of THP-1

  19. Oesophageal heat exchangers with a diameter of 11mm or 14.7mm are equally effective and safe for targeted temperature management.

    Directory of Open Access Journals (Sweden)

    Daniel C Schroeder

    Full Text Available Targeted temperature management (TTM is widely used in critical care settings for conditions including hepatic encephalopathy, hypoxic ischemic encephalopathy, meningitis, myocardial infarction, paediatric cardiac arrest, spinal cord injury, traumatic brain injury, ischemic stroke and sepsis. Furthermore, TTM is a key treatment for patients after out-of-hospital cardiac-arrest (OHCA. However, the optimal cooling method, which is quick, safe and cost-effective still remains controversial. Since the oesophagus is adjacent to heart and aorta, fast heat-convection to the central blood-stream could be achieved with a minimally invasive oesophageal heat exchanger (OHE. To date, the optimal diameter of an OHE is still unknown. While larger diameters may cause thermal- or pressure-related tissue damage after long-term exposure to the oesophageal wall, smaller diameter (e.g., gastric tubes, up to 11mm may not provide effective cooling rates. Thus, the objective of the study was to compare OHE-diameters of 11mm (OHE11 and 14.7mm (OHE14.7 and their effects on tissue and cooling capability.Pigs were randomized to OHE11 (N = 8 or OHE14.7 (N = 8. After cooling, pigs were maintained at 33°C for 1 hour. After 10h rewarming, oesophagi were analyzed by means of histopathology. The oesophagus of four animals from a separate study that underwent exactly the identical preparation and cooling protocol described above but received a maintenance period of 24h were used as histopathological controls.Mean cooling rates were 2.8±0.4°C°C/h (OHE11 and 3.0±0.3°C °C/h (OHE14.7; p = 0.20. Occasional mild acute inflammatory transepithelial infiltrates were found in the cranial segment of the oesophagus in all groups including controls. Deviations from target temperature were 0.1±0.4°C (OHE11 and 0±0.1°C (OHE14.7; p = 0.91. Rewarming rates were 0.19±0.07°C °C/h (OHE11 and 0.20±0.05°C °C/h (OHE14.7; p = 0.75.OHE with diameters of 11 mm and 14.7 mm achieve

  20. Spectroscopic analysis of lithium terbium tetrafluoride

    DEFF Research Database (Denmark)

    Christensen, H.P.


    . The rare-earth site in LiTbF4 possesses S4 symmetry, which allows six crystal-field parameters. ζ and the six Bim were varied to obtain the best agreement with the experimentally observed levels. Keeping F2=434 cm-1 fixed, a fit with a standard deviation of 12 cm-1 was obtained at 10 K with the following...... were calculated by diagonalizing an effective spin-orbit and crystal-field Hamiltonian in an LS basis. H=Σλi(L→·S→)i+ΣαiΣBimOim, where the parameters λi are functions of the spin-orbit parameter ζ and the Slater parameter F2. The Oim and αi are Racah operators and reduced matrix elements, respectively...

  1. Inelastic critical scattering of neutrons from terbium

    DEFF Research Database (Denmark)

    Als-Nielsen, Jens Aage; Dietrich, O.W.; Marshall, W.


    We have measured the inelasticity of the critical neutron scattering in Tb above the Néel temperature. The results show that dynamical slowing down of fluctuations does occur at a second order phase transition.......We have measured the inelasticity of the critical neutron scattering in Tb above the Néel temperature. The results show that dynamical slowing down of fluctuations does occur at a second order phase transition....

  2. Abnormalities in soluble CD147 / MMPs / TIMPs axis in Ankylosing Spondylitis patients with and without a history of Acute Anterior Uveitis / Anomalii ale axei CD147 solubil / MMPs / TIMPs la pacienții cu spondilită anchilozantă cu sau fără uveită acută anterioară

    Directory of Open Access Journals (Sweden)

    Mitulescu Traian Costin


    Full Text Available Spondilita Anchilozantă (SA este prototipul formei axiale a spondiloartritelor. În pofida studiilor extinse, sunt încă incomplet înțelese mecansimele complexe legate de procesele celulare și moleculare anormale din SA. Printre mediatorii inflamației, cum ar fi citokinele proinflamatoare, NOS-2, chemokinele, care conduc la inflamație, metaloproteinazele de matrice (MMPs joacă un rol important în procesele inflamatoare care caracterizează SA. De aceea, ne-am propus să evaluăm dacă perturbări ale homeostaziei inductorului extracelular de MMPs (EMMPRIN/CD147, MMPs și inhibitorilor tisulari ai MMPs (TIMPs joacă un rol în evoluția SA în special la pacienții care au în istoricul lor Uveită Acută Anterioară (UAA. În acest scop seruri de la pacienți cu SA și de la donatori sănătoși (DS au fost analizate pentru nivelurile de CD147 solubil (sCD147, MMP-3 și TIMP-1 prin tehnica imunoenzimatica ELISA și pentru activitatea gelatinazelor MMP-2 si MMP-9 folosind gelatin zimografia. Rezultatele experimentale au arătat că nivelurile de sCD147, MMP-3 si TIMP-1 sunt semnificativ crescute la pacienții cu SA comparativ cu DS. sCD147 ca și raportul MMP-2/sCD147 a diferențiat pacienții cu UAA de cei fără UAA în istoricul lor. La pacienții cu SA rapoartele MMP-2/sCD147, MMP-3/sCD147 și MMP-3/TIMP-1 au sugerat dezechilibrul dintre MMPs și reglatorii lor. Aceste rezultate sugerează că rapoartele MMPs/sCD147 pot deveni biomarkeri potențiali pentru întărirea caracterizării pacienților cu SA și pentru a prognoza evoluția bolii. Corelațiile pozitive și negative dintre anumite caracteristici experimentale și/sau clinice ale pacienților cu SA și terapie subliniază de asemenea utilitatea evaluării acestor biomarkeri pentru a identifica o terapie individualizată și eficientă.

  3. Evaluation of cellobiose dehydrogenase and laccase containing culture fluids of Termitomyces sp. OE147 for degradation of Reactive blue 21

    Directory of Open Access Journals (Sweden)

    Rishabh Gangwar


    Full Text Available This study evaluates culture filtrate, rich in cellobiose dehydrogenase and laccases, of Termitomyces sp. OE 147, in decolouration and degradation of Reactive blue (RB 21. About 35% decolouration was achieved at low volumes of the culture supernatant without addition of external redox mediators. An optimized dye to culture fluid ratio (75 ppm: 0.1 ml at a pH of 4–5 resulted in removal of colour by 60%. The degradation products of RB21 were analysed by Electron Spray Ionization-Mass Spectrometry and several small molecules (of m/z 106–199 were detected. These were concluded to be o-Xylene, 2,3-Dihydro-1H-isoindole, Isoindole-1,3-dione, 2,Benzenesulfonyl-ethanol, (4-Hydroxy-phenyl-sulfamic acid, 2,3-Dihydro-1H-isoindole-5-sulfonic acid and proposed to result from joint action of cellobiose dehydrogenase, laccase, peroxidases and unidentified oxidoreductases present in the culture fluids. Based on the products formed and the known reactions of these enzymes, a degradation pathway was proposed for RB21. The culture fluid was also effective in decolouration (by about 50% and detoxification (by ∼25% of the combined effluent collected from a local mill indicating a treatment process that bypasses use of H2O2 and toxic mediators.

  4. Inhaled /sup 147/Pm and/or total-body gamma radiation: Early mortality and morbidity in rats

    Energy Technology Data Exchange (ETDEWEB)

    Filipy, R.E.; Lauhala, K.E.; McGee, D.R.; Cannon, W.C.; Buschbom, R.L.; Decker, J.R.; Kuffel, E.G.; Park, J.F.; Ragan, H.A.; Yaniv, S.S.; Scott, B.R.


    Rats were given doses of /sup 60/Co gamma radiation and/or lung burdens of /sup 147/Pm (in fused aluminosilicate particles) within lethal ranges in an experiment to determine and compare morbidity and mortality responses for the radiation insults within 1 year after exposure. Radiation-induced morbidity was assessed by measuring changes in body weights, hematologic parameters, and pulmonary-function parameters. Acute mortality and morbidity from inhaled promethium were caused primarily by radiation pneumonitis and pulmonary fibrosis that occurred more than 53 days after exposure. Acute mortality and morbidity from total-body gamma irradiation occurred within 30 days of exposure and resulted from the bone-marrow radiation syndrome. Gamma radiation caused transient morbidity, reflected by immediately depressed blood cell levels and by reduced body weight gain in animals that survived the acute gamma radiation syndrome. Inhaled promethium caused a loss of body weight and diminished pulmonary function, but its only effect on blood cell levels was lymphocytopenia. Combined gamma irradiation and promethium lung burdens were synergistic, in that animals receiving both radiation insults had higher morbidity and mortality rates than would be predicted based on the effect of either kind of radiation alone. Promethium lung burdens enhanced the effect of gamma radiation in rats within the first 30 days of exposure, and gamma radiation enhanced the later effect of promethium lung burdens. 70 refs., 68 figs., 21 tabs.

  5. Deconvolution of [sup 204]Tl/[sup 36]Cl and [sup 147]Pm/[sup 45]Ca dual mixtures

    Energy Technology Data Exchange (ETDEWEB)

    Grau Carles, A. (Inst. de Investigacion Basica, CIEMAT, Madrid (Spain)); Rodriguez Barquero, L. (Inst. de Investigacion Basica, CIEMAT, Madrid (Spain)); Grau Malonda, A. (Inst. de Investigacion Basica, CIEMAT, Madrid (Spain))


    Technical characteristics of liquid scintillation counting include high counting efficiency, well-defined sample preparation procedures and a high capacity to measure a large number of samples. However, poor resolution and quenching limit the capability of measuring double-labeled samples when the maximum beta-ray energies are close. The simultaneous standardization of [sup 35]S and [sup 14]C was described in a previous paper, involving an improved spectrum unfolding method. This procedure has been tested with two other types of close maximum beta-energy nuclides: [sup 204]Tl and [sup 36]Cl have 710 and 763 keV maximum beta-energies respectively, and cannot be standardized simultaneously by double window methods. However, spectral shape differences permit their deconvolution with great accuracy. Both [sup 147]Pm and [sup 45]Ca (224 and 255 keV maximum beta-energies) have also been standardized. Samples with different quench values and activity ratios have been assayed, and the limitations have been determined. (orig.)

  6. Identification of the neutron-rich nuclides /sup 147; 148/Ba and half- life determination of the heavy isotopes of Rb, Sr, Y, Cs, Ba and La

    CERN Document Server

    Amiel, S; Nir-El, Y; Shmid, M


    The neutron nuclides /sup 147; 148/Ba were produced in the thermal neutron induced fission of /sup 235/U. A new surface ionization integrated target ion source operating at temperatures in the region of 1800 degrees C permits the measurement of half-lives of isotopes down to about 0.1 sec due to the very fast release of atoms from the target. Isotopes of Rb, Sr, Cs, and Ba were separated by positive surface ionization and their half-lives measured using beta activity detected by a silicon surface barrier detector with a depletion depth of 300 mu . The isotopes /sup 147/Ba and /sup 148/Ba were identified for the first time and their half-lives were found to be 0.72+or-0.07 sec and 0.47+or-0.20 sec, respectively. (0 refs).

  7. Poly(N-4-vinylbenzyl-1,4,7-triazacyclononane Copper Complex Grafted Solid Catalyst for Oxidative Polymerization of 2,6-Dimethylphenol

    Directory of Open Access Journals (Sweden)

    Kei Saito


    Full Text Available A new solid phase catalyst, poly(N-4-vinylbenzyl-1,4,7-triazacyclononane copper(I complex, grafted onto polystyrene particles, has been employed for the oxidative polymerization of 2,6-dimethylphenol using an aqueous biphasic (water/toluene solvent system. The solid catalyst was synthesized by first grafting N-(4-vinylbenzyl-1,4,7-triaza-cyclononane onto polystyrene particles using a radical mediated polymerization method and next by creating the polymer-metal complex of copper-triazacyclononane with these modified particles. Poly(2,6-dimethyl-1,4-phenylene oxide was successfully obtained from the polymerization of 2,6-dimethylphenol using this new metal-organic solid phase catalyst.

  8. Psychotic spectrum symptoms across the lifespan are related to lifetime suicidality among 147 patients with bipolar I or major depressive disorder


    Gesi, C; Carmassi, C; Miniati, M; Benvenuti, A.; Massimetti, G; Dell'Osso, L.


    Background Conflicting evidence exists about the relationship between psychotic symptoms and suicidality in mood disorders. We aimed to investigate the lifetime suicidality and its relationship with dimensions of the psychotic spectrum over the lifespan among subjects with bipolar I (BD I) or major depressive disorder (MDD). Methods 147 Consecutive out- and inpatients with BD I or MDD presenting for treatment at 11 Italian Departments of Psychiatry were administered the Structured Clinical In...

  9. Radiometallurgical examination of 1.47 enriched I&E fuel elements for PT-IP-247-A

    Energy Technology Data Exchange (ETDEWEB)

    Teats, R.


    Under the conditions of PT-IP-247-A, four columns of self-supported and four columns of rib-supported I&E 1.47% enriched fuel elements were irradiated to determine their relative performance under severe operating conditions. Four of the self-supported and two of the rib-supported control elements were received for nation. The two rib-supported control pieces, which were classified as ``near failures`` had received average exposures of 353 and 359 MWD/T at average specific power levels of 91 and 108 KW/ft before they were discharged because of other ruptured pieces in the tubes. The nominal specified canned fuel dimensions of the rib supported elements was 1.445 in. OD, .310 in bore, and 7.640 in. long. The first two self-supported elements were selected for examination on the basis of high weight losses sustained during irradiation, and the second two were selected to determine the effect of specific power levels on the AlSi bonding. The average specific power levels of the four self-supported elements varied from 79 to 110 KW/ft and the exposure varied from 845 MWD/T to 949 MWD/T. The nominal canned dimensions of the self-supported elements, which were made oversize to attain high annular coolant temperatures with respect to the interior coolant channel, were 1.460 in. OD, .375 in. bore, and 7.640 in. long. The eight bridge rail supports were spot welded on and gave an effective rib outside diameter of 1.600 in. All of the components were X-8001 aluminum alloy.

  10. Performance, Return to Competition, and Reinjury After Tommy John Surgery in Major League Baseball Pitchers: A Review of 147 Cases. (United States)

    Makhni, Eric C; Lee, Randall W; Morrow, Zachary S; Gualtieri, Anthony P; Gorroochurn, Prakash; Ahmad, Christopher S


    Pitching performance metrics, durability, and reinjury after Tommy John surgery in professional baseball players have not been well described. The purpose of this study was to determine the likelihood of return to professional competition, reinjury rate, and change in performance after Tommy John surgery in Major League Baseball pitchers. The hypothesis was that performance metrics and durability will decline after surgery. Cohort study; Level of evidence, 3. Publicly available records were accessed to generate a list of all Major League Baseball pitchers from 1999 to 2011 who had undergone ulnar collateral ligament reconstruction at any point in their careers; those with multiple reconstructive procedures were excluded. Return to active (≥1 game) or established (≥10 games) competition and/or placement on the disabled list was documented for each player. Among established players, pitching performance was compared pre- and postoperatively, as well as with age-matched control pitchers. Of 147 pitchers included, 80% returned to pitch in at least 1 Major League Baseball game. Only 67% of established pitchers returned to the same level of competition postoperatively, and 57% of established players returned to the disabled list because of injuries to the throwing arm. Finally, performance declined across several metrics after surgery compared with preinjury levels, such as earned run average, batting average against, walks plus hits per inning pitched, percentage of pitches thrown in the strike zone, innings pitched, percentage fastballs thrown, and average fastball velocity (P 50%), and performance declines across several major metrics after surgery. Patients undergoing Tommy John surgery should be counseled appropriately regarding the likelihood of return to preinjury levels of competition and performance. © 2014 The Author(s).

  11. AGR-2 Final Data Qualification Report for U.S. Capsules - ATR Cycles 147A Through 154B

    Energy Technology Data Exchange (ETDEWEB)

    Pham, Binh T. [Idaho National Lab. (INL), Idaho Falls, ID (United States). Very High-Temperature Reactor Technology Development Office; Einerson, Jeffrey J. [Idaho National Lab. (INL), Idaho Falls, ID (United States). Very High-Temperature Reactor Technology Development Office


    This report provides the data qualification status of AGR-2 fuel irradiation experimental data in four U.S. capsules from all 15 Advanced Test Reactor (ATR) Cycles 147A, 148A, 148B, 149A, 149B, 150A, 150B, 151A, 151B, 152A, 152B, 153A, 153B, 154A, and 154B, as recorded in the Nuclear Data Management and Analysis System (NDMAS). Thus, this report covers data qualification status for the entire AGR-2 irradiation and will replace four previously issued AGR-2 data qualification reports (e.g., INL/EXT-11-22798, INL/EXT-12-26184, INL/EXT-13-29701, and INL/EXT-13-30750). During AGR-2 irradiation, two cycles, 152A and 153A, occurred when the ATR core was briefly at low power, so AGR-2 irradiation data are not used for physics and thermal calculations. Also, two cycles, 150A and 153B, are Power Axial Locator Mechanism (PALM) cycles when the ATR power is higher than during normal cycles. During the first PALM cycle, 150A, the experiment was temporarily moved from the B-12 location to the ATR water canal and during the second PALM cycle, 153B, the experiment was temporarily moved from the B-12 location to the I-24 location to avoid being overheated. During the “Outage” cycle, 153A, seven flow meters were installed downstream from seven Fission Product Monitoring System (FPMS) monitors to measure flows from the monitors and these data are included in the NDMAS database.

  12. 145 - 147 Chonoko

    African Journals Online (AJOL)

    DR. AMIN


    Jun 1, 2011 ... ABSTRACT. Phytochemical screening and antibacterial activity of the extracts of Cucurbita pepo (backpeel and seeds) against Staphylococcus aureus and Salmonella typhi were carried out using standard procedures. The extraction was achieved using percolation method with ethanol and methanol as.

  13. Euler systems (AM-147)

    CERN Document Server

    Rubin, Karl


    One of the most exciting new subjects in Algebraic Number Theory and Arithmetic Algebraic Geometry is the theory of Euler systems. Euler systems are special collections of cohomology classes attached to p-adic Galois representations. Introduced by Victor Kolyvagin in the late 1980s in order to bound Selmer groups attached to p-adic representations, Euler systems have since been used to solve several key problems. These include certain cases of the Birch and Swinnerton-Dyer Conjecture and the Main Conjecture of Iwasawa Theory. Because Selmer groups play a central role in Arithmetic Algebraic G

  14. Pages 140 -147.pmd

    African Journals Online (AJOL)


    Microalbuminuria was found in 1 of the 2 subjects who had features of DM and in one subject with sickle cell anemia. Conclusion: The .... Female. 316. 51.4. Age group. 10-14years 407 66.2. 15-17years 177. 28.8. 18-19years 31. 5.0. School type. Private. 366. 59.5. Public. 249. 40.5. Social class. I. 234. 38.1. II. 71. 11.5. III.

  15. Sex-specific effect of CPB2 Ala147Thr but not Thr325Ile variants on the risk of venous thrombosis: A comprehensive meta-analysis.

    Directory of Open Access Journals (Sweden)

    Nora Zwingerman

    Full Text Available Thrombin activatable fibrinolysis inhibitor (TAFI, encoded by the Carboxypeptidase B2 gene (CPB2, is an inhibitor of fibrinolysis and plays a role in the pathogenesis of venous thrombosis. Experimental findings support a functional role of genetic variants in CPB2, while epidemiological studies have been unable to confirm associations with risk of venous thrombosis. Sex-specific effects could underlie the observed inconsistent associations between CPB2 genetic variants and venous thrombosis.A comprehensive literature search was conducted for associations between Ala147Thr and Thr325Ile variants with venous thrombosis. Authors were contacted to provide sex-specific genotype counts from their studies. Combined and sex-specific random effects meta-analyses were used to estimate a pooled effect estimate for primary and secondary genetic models.A total of 17 studies met the inclusion criteria. A sex-specific meta-analysis applying a dominant model supported a protective effect of Ala147Thr on venous thrombosis in females (OR = 0.81, 95%CI: 0.68,0.97; p = 0.018, but not in males (OR = 1.06, 95%CI:0.96-1.16; p = 0.263. The Thr325Ile did not show a sex-specific effect but showed variation in allele frequencies by geographic region. A subgroup analysis of studies in European countries showed decreased risk, with a recessive model (OR = 0.83, 95%CI:0.71-0.97, p = 0.021 for venous thrombosis.A comprehensive literature review, including unpublished data, provided greater statistical power for the analyses and decreased the likelihood of publication bias influencing the results. Sex-specific analyses explained apparent discrepancies across genetic studies of Ala147Thr and venous thrombosis. While, careful selection of genetic models based on population genetics, evolutionary and biological knowledge can increase power by decreasing the need to adjust for testing multiple models.

  16. Gulf of Mexico Sales 147 and 150: Central and Western planning areas. Final environmental impact statement, Volume 1: Sections 1 through 4.C

    Energy Technology Data Exchange (ETDEWEB)


    This Final Environmental Impact Statement (EIS) covers the proposed 1994 Gulf of Mexico OCS oil and gas lease sales [Central Gulf of Mexico Sale 147 (March 1994) and Western Gulf of Mexico Sale 150 (August 1994)]. This document includes the purpose and background of the proposed actions, the alternatives, the descriptions of the affected environment, and the potential environmental impacts of the proposed actions and alternatives. Proposed mitigating measures and their effects are analyzed, in addition to potential cumulative impacts resulting from proposed activities.

  17. (Depth-dose curves of the beta reference fields (147)Pm, (85)Kr and (90)Sr/(90)Y produced by the beta secondary standard BSS2. (United States)

    Brunzendorf, Jens


    The most common reference fields in beta dosimetry are the ISO 6980 series 1 radiation fields produced by the beta secondary standard BSS2 and its predecessor BSS. These reference fields require sealed beta radiation sources ((147)Pm, (85)Kr or (90)Sr/(90)Y) in combination with a source-specific beam-flattening filter, and are defined only at a given distance from the source. Every radiation sources shipped with the BSS2 is sold with a calibration certificate of the Physikalisch-Technische Bundesanstalt. The calibration workflow also comprises regular depth-dose measurements. This work publishes complete depth-dose curves of the series 1 sources (147)Pm, (85)Kr and (90)Sr/(90)Y in ICRU tissue up to a depth of 11 mm,when all electrons are stopped. For this purpose, the individual depth-dose curves of all BSS2 sources calibrated so far have been determined, i.e. the complete datasets of all BSS2 beta sources have been re-evaluated. It includes 191 depth-dose curves of 116 different sources comprising more than 2200 data points in total. Appropriate analytical representations of the nuclide-specific depth-dose curves are provided for the first time.

  18. The Synthesis of 1,4,7-Triazacyclononane Conjugated Amyloid-phillic Compound and Its Binding Affinity to the β-Amyloid Fibril

    Energy Technology Data Exchange (ETDEWEB)

    Kang, Jong Min; Jo, Jee Hye [Sejong University, Seoul (Korea, Republic of)


    The development of new compounds which have affinity for the β-amyloid fibril would lead to the new compounds that could have therapeutic effects on AD. Previously, we generated new amyloid-phillic amide derivative of Chrysamine G and found that this compound protect human astrocyte cells against Aβ-induced toxicity. As conjugation of amyloid-philic molecules with suitable metal chelating ligands could lead to new diagnostic molecules for in vivo quantification of amyloid deposition and new probes for amyloid structure, we designed the compound, which was conjugate of 1,4,7-triazacyclo-nonane and the amyloid-philic compound 1. Here, we would like to report the synthesis of compound 2 and its binding property of β-amyloid fibril. The synthesis of compound was achieved by combining three fragments the biphenyl amine, isophthalic acid 5 and 1,4,7-triazacyclononane. The synthesis of isophthalic acid part 5 commenced with esterfication of isophthalic acid in methanol with HCl to produce the monoester 4 in 38% yield. Treatment of the monoester 4 with oxalyl chloride afforded the acyl chloride 5 in 95% yield.

  19. Lentivirus mediated RNA interference of EMMPRIN (CD147) gene inhibits the proliferation, matrigel invasion and tumor formation of breast cancer cells. (United States)

    Yang, Jing; Wang, Rong; Li, Hongjiang; Lv, Qing; Meng, Wentong; Yang, Xiaoqin


    Overexpression of extracellular matrix metalloproteinase inducer (EMMPRIN) or cluster of differentiation 147 (CD147), a glycoprotein enriched on the plasma membrane of tumor cells, promotes proliferation, invasion, metastasis, and survival of malignant tumor cells. In this study, we sought to examine the expression of EMMPRIN in breast tumors, and to identify the potential roles of EMMPRIN on breast cancer cells. EMMPRIN expression in breast cancer tissues was assessed by immunohistochemistry. We used a lentivirus vector-based RNA interference (RNAi) approach expressing short hairpin RNA (shRNA) to knockdown EMMPRIN gene in breast cancer cell lines MDA-MB-231 and MCF-7. In vitro, Cell proliferative, invasive potential were determined by Cell Counting Kit (CCK-8), cell cycle analysis and matrigel invasion assay, respectively. In vivo, tumorigenicity was monitored by inoculating tumor cells into breast fat pad of female nude mice. EMMPRIN was over-expressed in breast tumors and breast cancer cell lines. Down-regulation of EMMPRIN by lentivirus vector-based RNAi led to decreased cell proliferative, decreased matrigel invasion in vitro, and attenuated tumor formation in vivo. High expression of EMMPRIN plays a crucial role in breast cancer cell proliferation, matrigel invasion and tumor formation.

  20. The first case of revealing of Klebsiella pneumoniae ST147, producing NDM-1 carbapenemase, in trauma and orthopedic hospital in Russia

    Directory of Open Access Journals (Sweden)

    V. V. Shabanova


    Full Text Available Present report describes the first case of isolation of NDM-1 carbapenemase-producing K. pneumoniae in a patient with wound infection after open tibial fracture. Identical isolates were twice detected in various microbial associations: first time during therapy with ampicillin/sulbactam, second time after the relapse of wound infection during therapy with cephoperazone/sulbactam with vancomycin. The strain of K. pneumoniae was resistant to all beta-lactams, aminoglycosides and fluoroquinolones, but retained susceptibility to tigecycline and polymyxin B. The presence of blaNDM-1 was detected by PCR and Sanger sequencing. On the basis of multilocus sequence typing K. pneumoniae isolate was classified as sequence-type 147 (ST147. Eradication of the pathogen, successful osteosynthesis of tibial bones and skin-muscle flap plasty of the extensive wound were completed together with combined dioxydin and phosphomycin therapy. Due to the danger of the emergence of nosocomial infection sources and of the development of the potentially incurable nosocomial implant-associated infection, detection of NDM-1 carbapenemase-producing K. pneumoniae strain in a trauma and orthopedic in-patient clinic is alarming.

  1. Evaluation of MCT1, MCT4 and CD147 Genes in Peripheral Blood Cells of Breast Cancer Patients and Their Potential Use as Diagnostic and Prognostic Markers. (United States)

    Luz, Maria Cláudia de B; Perez, Matheus M; Azzalis, Ligia A; Sousa, Luiz Vinícius de A; Adami, Fernando; Fonseca, Fernando L A; Alves, Beatriz da C A


    Patients with breast cancer-the deadliest cancer among women-are at constant risk of developing metastasis. Oxidative stress and hypoxia are common feature of tumor cells that can proliferate even in a resultant metabolic acidosis. Despite the low extracellular pH, intracellular pH of tumor cells remains relatively normal, or even more alkaline due to the action of a membrane protein family known as monocarboxylate transporters (MCTs). The objective of this study was to verify the diagnostic and prognostic value of MCT1, MCT4 and CD147 in tumor and peripheral blood samples of patients with breast cancer undergoing chemotherapic treatment. Differential expression of MCT1, MCT4 and CD147 obtained by qPCR was determined by 2-ΔΔCq method between biological samples (tumor and serial samples of peripheral) of patients (n = 125) and healthy women (n = 25). tumor samples with higher histological grades have shown higher expression of these markers; this higher expression was also observed in blood samples obtained at diagnosis of patients when compared to healthy women and in patients with positive progression of the disease (metastasis development). markers studied here could be a promising strategy in routine laboratory evaluations as breast cancer diagnosis and prognosis.

  2. CD147 is a regulatory subunit of the gamma-secretase complex inAlzheimer's disease amyloid beta-peptide production

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Shuxia; Zhou, Hua; Walian, Peter J.; Jap, Bing K.


    {gamma}-secretase is a membrane protein complex that cleaves the {beta}-amyloid precursor protein (APP) within the transmembrane region, following prior processing by {beta}-secretase, producing amyloid {beta}-peptides (A{beta}{sub 40} and A{beta}{sub 42}). Errant production of A{beta}-peptides that substantially increases A{beta}{sub 42} production has been associated with the formation of amyloid plaques in Alzheimer's disease patients. Biophysical and genetic studies indicate that presenilin-1 (Psn-1), which contains the proteolytic active site, and three other membrane proteins, nicastrin (Nct), APH-1, and PEN-2 are required to form the core of the active {gamma}-secretase complex. Here, we report the purification of the native {gamma}-secretase complexes from HeLa cell membranes and the identification of an additional {gamma}-secretase complex subunit, CD147, a transmembrane glycoprotein with two immunoglobulin-like domains. The presence of this subunit as an integral part of the complex itself was confirmed through co-immunoprecipitation studies of the purified protein from HeLa cells and solubilized complexes from other cell lines such as neural cell HCN-1A and HEK293. Depletion of CD147 by RNA interference was found to increase the production of A{beta} peptides without changing the expression level of the other {gamma}-secretase components or APP substrates while CD147 overexpression had no statistically significant effect on amyloid {beta}-peptide production, other {gamma}-secretase components or APP substrates, indicating that the presence of the CD147 subunit within the {gamma}-secretase complex directly down-modulates the production of A{beta}-peptides. {gamma}-secretase was first recognized through its role in the production of the A{beta} peptides that are pathogenic in Alzheimer's disease (AD) (1). {gamma}-secretase is a membrane protein complex with unusual aspartyl protease activity that cleaves a variety of type I membrane proteins

  3. Chemical separation of Nd from geological samples for chronological studies using (146)Sm-(142)Nd and (147)Sm-(143)Nd systematics. (United States)

    Kagami, Saya; Yokoyama, Tetsuya


    Sm-Nd dating, which involves long-lived (147)Sm-(143)Nd and short-lived (146)Sm-(142)Nd systematics, has been widely used in the field of geosciences. To obtain precise and accurate ages of geological samples, the determination of highly precise Nd isotope ratios with nearly complete removal of Ce and Sm is indispensable to avoid mass spectral interference. In this study, we developed a three-step column chemistry procedure for separating Nd from geological samples that includes cation exchange chromatography for separating major elements from rare earth elements (REEs), oxidative extraction chromatography using Ln Resin coupled with HNO3 + KBrO3 for separating tetravalent Ce from the remaining REEs, and final purification of Nd using Ln Resin. This method enables high recovery of Nd (>91%) with effective separation of Nd from Ce and Sm (Ce/Nd systematics, respectively. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. A study of nuclear structure for 244Cm, 241Am, 238Pu, 210Po, 147Pm, 137Cs, 90Sr and 63Ni nuclei used in nuclear battery (United States)

    Artun, Ozan


    In this paper, we intend to extend the nuclear data of 244Cm, 241Am, 238Pu, 210Po, 147Pm, 137Cs, 90Sr and 63Ni nuclei used in nuclear battery technology, because, these nuclei are quite important for space investigations in radioisotope thermoelectric generator (RTG) and for microelectronic technologies in betavoltaic batteries. Therefore, the nuclear structure properties of nuclei such as separation energies, neutron skin thicknesses, proton, charge and neutron density distributions as a function of radius, the root mean square (rms) proton, charge and neutron radii, binding energies per particle, have been investigated by Hartree-Fock with eight different Skyrme forces. The obtained results have been compared with the experimental data in literature and relativistic mean field theory (RMFT) results.

  5. Abnormal creatine transport of mutations in monocarboxylate transporter 12 (MCT12) found in patients with age-related cataract can be partially rescued by exogenous chaperone CD147. (United States)

    Stäubli, Andrina; Capatina, Nadejda; Fuhrer, Yvonne; Munier, Francis L; Labs, Stephan; Schorderet, Daniel F; Tiwari, Amit; Verrey, Francois; Heon, Elise; Cheng, Ching-Yu; Wong, Tien-Yin; Berger, Wolfgang; Camargo, Simone M R; Kloeckener-Gruissem, Barbara


    Membrane transporters influence biological functions in the ocular lens. Here, we investigate the monocarboxylate transporter 12 (MCT12), also called creatine transporter 2 (CRT2), which is found in the ocular lens and is involved in cataract. As the age-related form affects about half of the population world-wide, understanding relevant pathomechanisms is a prerequisite for exploring non-invasive treatments. We screened the coding exons of the gene SLC16A12 in 877 patients from five cohorts, including Caucasian and Asian ethnicities. A previously identified risk factor, SNP rs3740030, displayed different frequencies in the Asian cohorts but risk could not be established. In 15 patients 13 very rare heterozygous nucleotide substitutions were identified, of which eight led to non-synonymous and four to synonymous amino acid exchanges and one mapped to the canonical splice site in intron 3. Their impact on creatine transport was tested in Xenopus laevis oocytes and human HEK293T cells. Four variants (p.Ser158Pro, p.Gly205Val, p.Pro395Gln and p.Ser453Arg) displayed severe reduction in both model systems, indicating conserved function. Two of these, p.Gly205Val, and p.Ser453Arg, did not localize to the oocyte membrane, suggesting possible impacts on protein interactions for transporter processing. In support, exogenously supplied excess of MCT12's chaperone CD147 in HEK293T cells led to a partial recovery of the defective uptake activity from p.Gly205Val and also from mutant p.Pro395Gln, which did localize to the membrane. Our findings provide first insight in the molecular requirements of creatine transporter, with particular emphasis on rescuing effects by its chaperone CD147, which can provide useful pharmacological information for substrate delivery. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email:

  6. Syntheses in Aqueous Solution and Crystal Structure of a Triamido-Bridged Dicobalt(III) Complex with the Ligands 1,4,7-Triazacyclononane and 3-Thiapentane-1,5-diamine

    DEFF Research Database (Denmark)

    Kofod, Pauli; Larsen, Erik; Larsen, Sine


    The reaction of Co(tacn)(daes)3+ [tacn = 1,4,7-triazacyclonane; daes = (3-thiapentane-1,5-diamine = di(2-aminoethyl)sulfide)] in 4 M NaOH yields nearly quantitively the triamido-bridged dicobalt(III) complex: 7--triazacyclononane-2kappa3N1,N4,N7-dicobalt(III) ion, in the following abbreviated as Co...

  7. Mono- and Dinuclear Transition Metal Complexes of the Hexadentate Ligand Tris(4-tert-butyl-2-mercaptobenzyl)-1,4,7-triazacyclononane (L). (United States)

    Beissel, Thomas; Glaser, Thorsten; Kesting, Frank; Wieghardt, Karl; Nuber, Bernhard


    The hexadentate, pendant arm macrocycle 1,4,7-tris(4-tert-butyl-2-mercaptobenzyl)-1,4,7-triazacyclononane (H(3)L) has been synthesized and isolated as its trihydrochloride, H(3)L.3HCl, or sodium salt, Na(3)L, and its coordination chemistry with first-row transition metals has been studied. Mononuclear complexes of the type [LM(III)] (M = Ga (1), In (2), V (3), Cr (4), Mn (5), Fe,Co (6)) have been isolated as have the one-electron-oxidized forms [LM]PF(6) (M = V(IV) (3a), Mn(IV) (5a)). The crystal structure of 6 has been determined by single-crystal X-ray crystallography. Complex 6 crystallizes in the orthorhombic space group Iba2, with cell constants a = 14.206(8) Å, b = 22.53(1) Å, c = 26.07(1) Å, V = 8344.0(3) Å(3), and Z = 8. The cobalt(III) ion is in a distorted octahedral fac-N(3)S(3) donor set. The reaction of L with divalent metal chlorides in a 1:2 ratio in methanol affords the homodinuclear complexes [LM(II)(2)Cl] (M = Mn (7), Co (8), Ni (9), Zn (10), Cd (11)) where one metal is six- (N(3)MS(3)) and the other is four-coordinate (S(3)MCl); the two polyhedra are linked by three &mgr;(2)-thiolato bridges. Heterodinuclear complexes of the type [LM(1)M(2)Cl] have been obtained from [LM(2)Cl] species by abstraction of the four-coordinate metal ion and replacement by a different metal ion. The complexes [LZn(II)M(II)Cl] (M = Fe (12), Co (13), Ni (14)), [LNi(II)M(II)Cl] (M = Co (15), Zn (16)), and [LMn(II)M(II)Cl] (M = Fe (17), Co (18), Ni (19), Zn (20), Cd (21), Hg (22)) have been isolated as solid materials. The crystal structure of 14 has been determined by X-ray crystallography. Complex 14 crystallizes in the orthorhombic space group P2(1)2(1)2(1), with cell constants a = 15.45(1) Å, b = 17.77(1) Å, c = 17.58(1) Å, V = 4826.5(4) Å(3), and Z = 4. The linkage isomers 14 and 16 show characteristic electronic spectra for octahedrally and tetrahedrally coordinated Ni(II), respectively. The electronic structures of new complexes have been investigated by UV

  8. Sluggish Hadean geodynamics: Evidence from coupled 146,147Sm-142,143Nd systematics in Eoarchean supracrustal rocks of the Inukjuak domain (Québec) (United States)

    Caro, G.; Morino, P.; Mojzsis, S. J.; Cates, N. L.; Bleeker, W.


    The discovery of deficits in 142Nd/144Nd in mafic rocks of the Nuvvuagittuq supracrustal belt (NSB) has triggered a debate about the possible preservation of Hadean (pre-3.85 Ga) crustal remnants in the little-known but areally extensive Innuksuac complex (3.6-3.8 Ga, Inukjuak domain, Northeast Superior Province, Canada). Geochronological investigations in the NSB, however, are hampered by the poor preservation and highly disturbed isotopic record of various mafic (amphibolite) lithologies that host the 142Nd anomalies. Here we present 146Sm-142Nd and 147Sm-143Nd data for rocks of extrusive magmatic and sedimentary protoliths from the Ukaliq supracrustal belt, a newly discovered volcano-sedimentary enclave enclosed in granitoid gneisses of the Inukjuak domain. Our study also includes the first 146Sm-142Nd data for quartz-magnetite rocks (banded iron-formation; BIF) of the NSB and the Eoarchean Isua supracrustal belt (ISB) in southern West Greenland. We show that Ukaliq amphibolites carry variably negative 142Nd anomalies, ranging from 0 to -10 ppm, which are positively correlated with their Sm/Nd ratio. If considered as an isochron relationship, the 146Sm-142Nd array yields an apparent Hadean emplacement age of 4215-76+50 Ma. The negative 142Nd anomalies, however, appear to be mainly restricted to amphibolites with boninitic affinities, likely reflecting inheritance from an enriched mantle source. In contrast, tholeiitic and ultramafic lavas have normal μ142Nd regardless of their Sm/Nd ratio. Furthermore, BIF from Ukaliq and Nuvvuagittuq lack the negative 142Nd anomalies that should have been produced by in situ decay of 146Sm had these sediments been deposited prior to ca. 4.1 Ga. Instead, they exhibit μ142Nd identical to that measured in Isua BIF. Collectively, our results suggest that the 146Sm-142Nd array characterizing mafic lithologies of Ukaliq and Nuvvuagittuq is an inherited signature with doubtful chronological significance. We interpret the volcanic

  9. Sex differences in the photoperiodic regulation of RF-Amide related peptide (RFRP) and its receptor GPR147 in the syrian hamster

    DEFF Research Database (Denmark)

    Henningsen, Jo B; Poirel, Vincent-Joseph; Mikkelsen, Jens D


    RF-(Arg-Phe) related peptides (RFRP-1 and -3) are considered to play a role in the seasonal regulation of reproduction; however, the effect of the peptides depends on species and gender. This study aimed at comparing the RFRP system in male and female Syrian hamsters over long and short photoperi......RF-(Arg-Phe) related peptides (RFRP-1 and -3) are considered to play a role in the seasonal regulation of reproduction; however, the effect of the peptides depends on species and gender. This study aimed at comparing the RFRP system in male and female Syrian hamsters over long and short...... photoperiods to investigate the neuroanatomical basis of these differential effects. The neuroanatomical distribution of RFRP neurons and fibers, revealed using an antiserum recognizing RFRP-1 and -3, as well as GPR147 mRNA, are similar in male and female Syrian hamsters. RFRP neurons are mainly found...... in the anteroventral-periventricular nucleus is higher only in females adjusted to a short photoperiod. Our results suggest that the RFRP system, which is strongly regulated by photoperiod in both male and female Syrian hamsters, is particularly important in females, with a distinct role in the anteroventral...

  10. Measurement of keV-neutron capture cross sections and capture gamma-ray spectra of {sup 147,148,149,150,152,154}Sm

    Energy Technology Data Exchange (ETDEWEB)

    Duamet, B.; Igashira, Masayuki; Mizumachi, Mari; Mizuno, Satoshi; Hori, Jun-ichi; Masuda, Koji; Ohsaki, Toshiro [Research Laboratory for Nuclear Reactors, Tokyo Institute of Technology, Tokyo (Japan)


    The neutron capture cross sections and capture {gamma}-ray spectra of {sup 147,148,149,150,152,154}Sm were measured in the neutron energy region of 10 to 90 keV and at 550 keV. A neutron time-of-flight method was adopted with a 1.5-ns pulsed neutron source by the {sup 7}Li(p, n){sup 7}Be reaction and with a large anti-Compton NaI(Tl) {gamma}-ray spectrometer. A pulse-height weighting technique was applied to observed capture {gamma}-ray pulse-height spectra to derive capture yields. The capture cross sections were obtained with the error of about 5% by using the standard capture cross sections of {sup 197}Au. The present results were compared with the evaluated values of JENDL-3.2 and previous measurements. The capture {gamma}-ray spectra were obtained by unfolding the observed capture {gamma}-ray pulse-height spectra. An anomalous shoulder was cleary observed around 3 MeV in the {gamma}-ray spectra of {sup 150,152,154}Sm, and the energy position of the shoulder was consistent with the systematics obtained in our previous work. (author)

  11. Dinuclear 1,4,7-triazacyclononane (tacn) complexes of cobalt(III) with amido and tacn bridges. Synthesis, characterization and reversible acid-accelerated bridge cleavage

    DEFF Research Database (Denmark)

    Andersen, Peter; Glerup, Jørgen; Gumm, Andreas


    Amido-bridged dinuclear cobalt(III) complexes with 1,4,7-triazacyclononane (tacn) were synthesized from [Co(tacn)(O3SCF3)3] by treatment with potassium amide in liquid ammonia at 100 degrees C. Two isomeric triply bridged complexes, [(tacn)Co(mu-NH2)3Co(tacn)]3+ and [(tacn)Co(mu-NH2)2[mu......-tacn(-H)]Co(NH3)]3+, were isolated as perchlorates, and the crystal structure of the perrhenate of the latter complex was determined by X-ray diffraction. In this compound a nitrogen atom (deprotonated) from one of the tacn ligands forms a third bridge together with two amido bridges. In 1.0 M (Na,H)ClO4 ([H+] 0......)]4+. An isolated perchlorate of this complex appeared to be the salt of the trans-ammineaqua isomer as determined by X-ray diffraction. Equilibration from both sides fits the first-order rate constant dependence k(obs)=6.2(3) x 10(-5)[H+] + 2.1(2) x 10(-5)(s(-1)) at 40 degrees C. Prolonged treatment of the two...


    Energy Technology Data Exchange (ETDEWEB)

    Van Weeren, R. J.; Jones, C.; Forman, W. R. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Intema, H. T. [National Radio Astronomy Observatory, 1003 Lopezville Road, Socorro, NM 87801-0387 (United States); Lal, D. V. [National Centre for Radio Astrophysics, TIFR, Pune University Campus, Post Bag 3, Pune 411 007 (India); Bonafede, A.; Brüggen, M.; De Gasperin, F. [Hamburger Sternwarte, Gojenbergsweg 112, D-21029 Hamburg (Germany); Röttgering, H. J. A.; Stroe, A. [Leiden Observatory, Leiden University, P.O. Box 9513, NL-2300 RA Leiden (Netherlands); Hoeft, M. [Thüringer Landessternwarte Tautenburg, Sternwarte 5, D-07778, Tautenburg (Germany); Nuza, S. E., E-mail: [Leibniz-Institut für Astrophysik Potsdam (AIP), An der Sternwarte 16, D-14482 Potsdam (Germany)


    Recent X-ray and Sunyaev-Zel'dovich (SZ) observations have dramatically increased the number of known distant galaxy clusters. In some merging, low-redshift (z < 0.4) clusters, centrally located, diffuse, extended radio emission (radio halos) has been found. Using the Giant Metrewave Radio Telescope (GMRT), we report the detection of diffuse radio emission in the binary-merging cluster PLCK G147.3–16.6 located at z = 0.65. We classify the emission as a giant radio halo due to its large physical extent of about 0.9 Mpc and its low-surface brightness. We measure an integrated flux density of 7.3 ± 1.1 mJy at 610 MHz for the radio halo, resulting in a 1.4 GHz radio power of 5.1 × 10{sup 24} W Hz{sup –1}. The radio halo power is consistent with that expected from the known correlation between X-ray luminosity or the cluster integrated SZ signal and radio power. Our observations also suggest that more of these distant radio halos could be discovered with the GMRT.

  13. A New Mechanism of Vitamin C Effects on A/FM/1/47(H1N1 Virus-Induced Pneumonia in Restraint-Stressed Mice

    Directory of Open Access Journals (Sweden)

    Ying Cai


    Full Text Available It is well known that vitamin C could protect against influenza infection, but little is known about the mechanisms. This study aimed to investigate the influence and possible mechanisms of vitamin C on pneumonia induced by influenza virus in stressed mice. Results showed that restraint stress significantly increased the mortality and the severity of pneumonia in mice caused by A/FM/1/47(H1N1 virus infection, which was attenuated by oral administration of vitamin C (125 and 250 mg/kg. Moreover, vitamin C administration significantly decreased expression of susceptibility genes, including mitochondrial antiviral signaling (MAVS and interferon regulatory factor 3 (IRF3, and increased expression of NF-κB. These work in conjunction to induce type I interferons (IFNs and elicit innate antiviral response as key factors in RIG-I-mediated signal transduction pathway. The above effects of vitamin C were further found to relate with inhibition of excess CORT synthesis by regulating steroid hydroxylating enzymes in adrenal gland. In conclusion, the protective effects of vitamin C on influenza virus-caused pneumonia might be related to its inhibition of CORT synthesis, which reduces the susceptibility to influenza viral infection in restraint-stressed mice. These findings provide a new mechanism for the effects of vitamin C on influenza virus-induced pneumonia in restraint-stressed mice.

  14. Psychotic spectrum symptoms across the lifespan are related to lifetime suicidality among 147 patients with bipolar I or major depressive disorder. (United States)

    Gesi, Camilla; Carmassi, Claudia; Miniati, Mario; Benvenuti, Antonella; Massimetti, Gabriele; Dell'Osso, Liliana


    Conflicting evidence exists about the relationship between psychotic symptoms and suicidality in mood disorders. We aimed to investigate the lifetime suicidality and its relationship with dimensions of the psychotic spectrum over the lifespan among subjects with bipolar I (BD I) or major depressive disorder (MDD). 147 Consecutive out- and inpatients with BD I or MDD presenting for treatment at 11 Italian Departments of Psychiatry were administered the Structured Clinical Interview for DSM-IV Axis I Disorders, the Structured Clinical Interview for the Psychotic Spectrum (SCI-PSY, lifetime version) and the Mood Spectrum Self-Report (MOODS-SR, lifetime version). Subjects with psychotic features did not differ from those without for MOODS-SR suicidality score. Controlling for age, gender and diagnosis (MDD/BD I), the SCI-PSY total score (p = .007) and Paranoid (p = .042), Schizoid (p = .007) and Interpersonal Sensitivity (p Schizoid symptoms, show a significant relationship with lifetime suicidality. Our findings highlight the potential usefulness of a spectrum approach in the assessment of psychotic symptoms and suicide risk among subjects with BD I or MDD.

  15. Comparative study for 147 Candida spp. identification and echinocandins susceptibility in isolates obtained from blood cultures in 15 hospitals, Medellin, Colombia. (United States)

    Berrio, Indira; Maldonado, Natalia; De Bedout, Catalina; Arango, Karen; Cano, Luz Elena; Valencia, Yorlady; Jiménez-Ortigosa, Cristina; Perlin, David S; Gómez, Beatriz L; Robledo, Carlos; Robledo, Jaime


    Invasive candidiasis has high impact on morbidity and mortality in hospitalized patients. Accurate and timely methods for identification of Candida species and determination of equinocandins susceptibility become a priority for laboratories of clinical microbiology. A study was performed to compare MALDI-TOF MS identification to sequencing of D1/D2 region of rRNA gene complex 28 subunit, in 147 isolates obtained from patients with candidemia. Susceptibility testing was performed by broth microdilution method and Etest ® . DNA sequencing of FKS1 and FKS2 genes was performed. In this study, the most common species were C. albicans (40.8%), followed by C. parapsilosis (23.1%) and C. tropicalis (17.0%). Overall agreement between the results of identification by MALDI-TOF MS and molecular identification was 99.3%. Anidulafungin and caspofungin susceptibility by broth microdilution method were 98% and 88.4%, respectively. Susceptibility to anidulafungin and caspofungin by Etest was 93.9% and 98.6%. Categorical agreement between Etest and broth microdilution method was 91.8% for anidulafungin and 89.8% for caspofungin; with lower agreements in C. parapsilosis for anidulafungin (76.5%) and C. glabrata for caspofungin (40.0%). No mutations related to resistance were found in FKS genes, although 54 isolates presented synonymous polymorphisms in the hot spots sequenced. MALDI TOF MS is a good alternative for routine identification of Candida isolates. DNA sequencing of FKS genes suggests that isolates analyzed are susceptible to echinocandins; alternatively, unknown resistance mechanisms or limitations related to antifungal susceptibility tests may explain the resistance found in few isolates. Copyright © 2017. Published by Elsevier Ltd.

  16. Role of Xpert MTB/RIF in differentiating tuberculosis from sarcoidosis in patients with mediastinal lymphadenopathy undergoing EBUS-TBNA: a study of 147 patients. (United States)

    Dhooria, Sahajal; Gupta, Nalini; Bal, Amanjit; Sehgal, Inderpaul Singh; Aggarwal, Ashutosh Nath; Sethi, Sunil; Behera, Digambar; Agarwal, Ritesh


    In patients with intrathoracic lymphadenopathy, differentiating tuberculosis from sarcoidosis is often difficult. We hypothesized that Xpert MTB/RIF assay, a semi-automated hemi-nested PCR would help in this regard. To evaluate the performance of Xpert MTB/RIF in the differential diagnosis of tuberculosis and sarcoidosis. This was a retrospective analysis of patients with intrathoracic lymphadenopathy who underwent endobronchial ultrasound (EBUS)-guided transbronchial needle aspiration (TBNA), and were diagnosed as either tuberculosis or sarcoidosis. The results of Xpert MTB/RIF assay, tuberculin skin test and endosonographic characteristics (heterogeneous echotexture and coagulation necrosis sign) of the lymph nodes were compared between the two groups. During the study period, 465 EBUS procedures were performed and a diagnosis of sarcoidosis (n=94) or tuberculosis (n=53) was made in 147 patients. Xpert MTB/RIF was positive in 26 (49.1%) and two (2.1%) patients with tuberculosis and sarcoidosis, respectively. The sensitivity, specificity, positive and negative predictive values of Xpert MTB/RIF in the diagnosis of tuberculosis were 49.1 %, 97.9%, 92.9% and 77.3%, respectively. The presence of any of the four features namely positive Xpert MTB/RIF, positive tuberculin skin test, heterogeneous echotexture of the lymph nodes, or the presence of endosonographic coagulation necrosis sign yielded a sensitivity and negative predictive value of 83.0% and 88.0%, respectively in the diagnosis of tuberculosis versus sarcoidosis. Xpert MTB/RIF has good specificity and positive predictive value in the diagnosis of tuberculosis, and is a useful investigation in separating tuberculosis from sarcoidosis.

  17. Variable Stars in Local Group Galaxies. III. And VII, NGC 147, and NGC 185: Insight into the Building Blocks of the M31 Halo (United States)

    Monelli, M.; Fiorentino, G.; Bernard, E. J.; Martínez-Vázquez, C. E.; Bono, G.; Gallart, C.; Dall’Ora, M.; Stetson, P. B.


    We present the discovery of 1568 RR Lyrae stars in three of the most luminous M31 satellites: And VII (573), NGC 147 (177), and NGC 185 (818). We use their properties to study the formation history of Local Group spiral haloes, and in particular, to infer about the nature of their possible building blocks by comparison with available data for RR Lyrae stars in the halo and in a sample of satellites of M31 and the Milky Way. We find that the brightest satellites and the halos of both galaxies host a number of High Amplitude Short Period (HASP) RR Lyrae variable stars, which are missing in the faintest satellites. HASP variable stars have been shown by Fiorentino et al. to be tracers of a population of stars as metal-rich as [Fe/H] ≃ ‑1.5 and older than ≃ 10 {Gyr}. This suggests that the metal-rich M31 and MW halo component, which manifests through the HASP phenomenon, comes from massive dwarf galaxy building blocks, as the low-mass dwarfs did not chemically enrich fast enough to produce them. All detected variable stars are new discoveries; in particular, this work presents the first detections of RR Lyrae stars in And VII. Moreover, a number of candidate Anomalous Cepheids, and binary and long-period variable stars have been detected. We provide pulsation properties (period, amplitude, mean magnitude), light curves, and time series photometry for all of the variable stars in the three galaxies. Based on observations made with the NASA/ESA Hubble Space Telescope, obtained at the Space Telescope Science Institute, which is operated by the Association of Universities for Research in Astronomy, Inc., under NASA contract NAS 5-26555. These observations are associated with programs #10430 and #11724.

  18. Phase I Trial of the Pan-PI3K Inhibitor Pilaralisib (SAR245408/XL147) in Patients with Chronic Lymphocytic Leukemia (CLL) or Relapsed/Refractory Lymphoma. (United States)

    Brown, Jennifer R; Davids, Matthew S; Rodon, Jordi; Abrisqueta, Pau; Kasar, Siddha N; Lager, Joanne; Jiang, Jason; Egile, Coumaran; Awan, Farrukh T


    This phase I expansion-cohort study evaluated the safety, pharmacokinetics, pharmacodynamics, and preliminary efficacy of the pan-PI3K inhibitor pilaralisib (SAR245408/XL147) in patients with chronic lymphocytic leukemia (CLL) or relapsed or refractory lymphoma. Patients were treated with the maximum tolerated dose of pilaralisib previously determined in patients with solid tumors (600 mg capsules once daily). Adverse events (AE) and response were evaluated. Plasma pharmacokinetics and pharmacodynamic effects on cytokines and chemokines were also assessed. Twenty-five patients were included in the study: 10 with CLL and 15 with lymphoma. The most frequent AEs of any grade were diarrhea (92.0%), pyrexia (52.0%), and fatigue (44.0%). The most frequent grade ≥3 AEs were neutropenia (32.0%), diarrhea (20.0%), and anemia (16.0%). Pilaralisib exposure on cycle 1 day 28 was similar to exposure in patients with solid tumors. In patients with CLL, pilaralisib significantly reduced plasma levels of several cytokines and chemokines involved in B-cell trafficking. Five patients (50.0%) with CLL and 3 patients (20.0%) with lymphoma had a partial response. Six patients (60.0%) with CLL had nodal shrinkage ≥50%. Overall, 14 patients (56.0%; 7 patients with CLL and 7 patients with lymphoma) had progression-free survival ≥6 months. Pilaralisib demonstrated an acceptable safety profile in patients with CLL and lymphoma, generally consistent with findings in patients with solid tumors. Single-agent pilaralisib showed preliminary clinical activity in patients with CLL and lymphoma, supporting further development. ©2015 American Association for Cancer Research.

  19. Okiyo 147-154.pmd

    African Journals Online (AJOL)

    Prof. Adipala Ekwamu

    Moisture stress and aluminium toxicity in sorghum production can be overcome by breeding for tolerance. This study was set up to determine the response of sorghum (Sorghum bicolor L.) genotypes to post- anthesis drought and aluminium toxicity. Sorghum inbred P1 with stay green drought tolerance was crossed with P2, ...

  20. 147__Sale_Cassava1

    African Journals Online (AJOL)


    plywood, confectionery, feed and pharmaceutical sectors (Moyo, et al. 2004; Kaaya and Eboku, 2010). However, poor drying during processing or storage, especially during the rainy season, often results in contamination by fungi such as Aspergillus, Fusarium and Penicillium that produce mycotoxins. Aflatoxins are among ...

  1. Inelastic scattering of neutrons by spin waves in terbium

    DEFF Research Database (Denmark)

    Bjerrum Møller, Hans; Houmann, Jens Christian Gylden


    Measurements of spin-wave dispersion relations for magnons propagating in symmetry directions in ferromagnetic Tb; it is first experiment to give detailed information on magnetic excitations in heavy rare earths; Tb was chosen for these measurements because it is one of few rare-earth metals whic...... does not have very high thermal-neutron capture cross section, so that inelastic neutron scattering experiments can give satisfactory information on magnon dispersion relations....

  2. Coherent magnetic structures in terbium/holmium superlattices

    DEFF Research Database (Denmark)

    Bryn-Jacobsen, C.; Cowley, R.A.; McMorrow, D.F.


    Neutron-scattering techniques have been used to investigate the magnetic properties of three Tb/Ho superlattices grown by molecular-beam epitaxy. It is revealed that for temperatures in the range T = 10 to T-N(Ho)approximate to 130 K, there is a basal-plane ferromagnetic alignment of Tb moments w...

  3. Partial pressure (or fugacity) of carbon dioxide, salinity and other variables collected from time series observations using Bubble type equilibrator for autonomous carbon dioxide (CO2) measurement, Carbon dioxide (CO2) gas analyzer and other instruments from MOORING JKEO_147E_38N in the North Pacific Ocean from 2007-02-18 to 2007-10-03 (NODC Accession 0100070) (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NCEI Accession 0100070 includes chemical, meteorological, physical and time series data collected from MOORING JKEO_147E_38N in the North Pacific Ocean from...

  4. Current meter data from moored current meter casts in the SW Pacific (limit-147 E to 140 W) as part of the Equatorial Pacific Ocean Climate Studies (EPOCS) project from 1985-09-29 to 1986-04-01 (NODC Accession 8800136) (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Current meter data were collected using moored current meter casts in the SW Pacific (limit-147 E to 140 W) from September 29, 1985 to June 1, 1986. Data were...

  5. Oceanographic data from ADCP, microprofiler, and thermistor casts from the MOANA WAVE from the SW Pacific (limit-147 E to 140 W) as part of the Tropical Ocean Global Atmosphere (TOGA) and the Coupled Ocean-Atmosphere Response Experiment (COARE) from 01 July 1992 to 30 June 1993 (NODC Accession 9600029) (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Oceanographic data were collected from ADCP, microprofiler, and thermister casts from the MOANA WAVE from the SW Pacific (limit-147 E to 140 W) from 01 July 1992 to...

  6. Geochemistry of Fast-Spreading Lower Oceanic Crust: Results from Drilling at the Hess Deep Rift (ODP Leg 147 and IODP Expedition 345; East Pacific Rise) (United States)

    Godard, M.; Falloon, T.; Gillis, K. M.; Akizawa, N.; de Brito Adriao, A.; Koepke, J.; Marks, N.; Meyer, R.; Saha, A.; Garbe-Schoenberg, C. D.


    The Hess Deep Rift, where the Cocos Nazca Ridge propagates into the young, fast-spread East Pacific Rise crust, exposes a dismembered, but nearly complete, lower crustal section. The extensive exposures of the plutonic crust were drilled at 3 sites during ODP Leg 147 (Nov. 1992-Jan. 1993) and IODP Expedition 345 (Dec. 2012-Feb. 2013). We report preliminary results of a bulk rock geochemical study (major and trace elements) carried out on 109 samples representative of the different drilled lithologies. The shallowest gabbroic rocks were sampled at ODP Site 894. They comprise gabbronorite, gabbro, olivine gabbro and gabbronorite. They have evolved compositions with Mg# 39-55, Yb 4-8 x chondrite and Eu/Eu* 1-1.6. Olivine gabbro and troctolite were dominant at IODP Site U1415, with minor gabbro, gabbronorite and clinopyroxene oikocryst-bearing troctolite and gabbro. All U1415 gabbroic rocks have primitive compositions except for one gabbronorite rubble that is similar in composition to the shallow gabbros. Olivine gabbro, gabbro and gabbronorite overlap in composition: they have high Mg# (79-87) and Ni (130-570 ppm), low TiO2 (0.1-0.3 wt.%) and Yb (1.3-2.3 x chondrite) and positive Eu anomaly (Eu/Eu*=1.9-2.7). Troctolite has high Mg# (81-89), Ni (260-1500 ppm) and low TiO2 (4). ODP Site 895 recovered sequences of highly depleted harzburgite, dunite and troctolite (Yb down to <0.1xchondrite) that are interpreted as a mantle-crust transition zone. Basalts were recovered at Sites 894 and U1415: they have low Yb (0.5-0.9xN6MORB) and are depleted in the most incompatible elements (Ce/Yb=0.6-0.9xN-MORB). The main geochemical characteristics of Site U1415 and 894 gabbroic rocks are consistent with formation as a cumulate sequence from a common parental MORB melt; troctolites are the most primitive end-member of this sequence. They overlap in composition with the most primitive of slow and fast spread crust gabbroic rocks.

  7. Characterization of the factor VIII defect in 147 patients with sporadic hemophilia A: Family studies indicate a mutation type-dependent sex ratio of mutation frequencies

    Energy Technology Data Exchange (ETDEWEB)

    Becker, J.; Schmidt, W.; Olek, K. [Univ. of Bonn (Germany)] [and others


    The clinical manifestation of hemophilia A is caused by a wide range of different mutations. In this study the factor VIII genes of 147 severe hemophilia A patients-all exclusively from sporadic families-were screened for mutations by use of the complete panel of modern DNA techniques. The pathogenous defect could be characterized in 126 patients (85.7%). Fifty-five patients (37.4%) showed a F8A-gene inversion, 47 (32.0%) a point mutation, 14 (9.5%) a small deletion, 8 (5.4%) a large deletion, and 2 (1.4%) a small insertion. Further, four (2.7%) mutations were localized but could not be sequenced yet. No mutation could be identified in 17 patients (11.6%). Sixteen (10.9%) of the P identified mutations occurred in the B domain. Four of these were located in an adenosine nucleotide stretch at codon 1192, indicating a mutation hotspot. Somatic mosaicisms were detected in 3 (3.9%) of 76 patients` mothers, comprising 3 of 16 de novo mutations in the patients` mothers. Investigation of family relatives allowed detection of a de novo mutation in 16 of 76 two-generation and 28 of 34 three-generation families. On the basis of these data, the male:female ratio of mutation frequencies (k) was estimated as k = 3.6. By use of the quotients of mutation origin in maternal grandfather to patient`s mother or to maternal grandmother, k was directly estimated as k = 15 and k = 7.5, respectively. Considering each mutation type separately, we revealed a mutation type-specific sex ratio of mutation frequencies. Point mutations showed a 5-to-10-fold-higher and inversions a >10-fold- higher mutation rate in male germ cells, whereas deletions showed a >5-fold-higher mutation rate in female germ cells. Consequently, and in accordance with the data of other diseases like Duchenne muscular dystrophy, our results indicate that at least for X-chromosomal disorders the male:female mutation rate of a disease is determined by its proportion of the different mutation types. 68 refs., 1 fig., 5 tabs.

  8. Synthesis, structure, and DNA cleavage properties of copper(II) complexes of 1,4,7-triazacyclononane ligands featuring pairs of guanidine pendants. (United States)

    Tjioe, Linda; Joshi, Tanmaya; Brugger, Joël; Graham, Bim; Spiccia, Leone


    Two new ligands, L(1) and L(2), have been prepared via N-functionalization of 1,4,7-triazacyclononane (tacn) with pairs of ethyl- or propyl-guanidine pendants, respectively. The X-ray crystal structure of [CuL(1)](ClO4)2 (C1) isolated from basic solution (pH 9) indicates that a secondary amine nitrogen from each guanidine pendants coordinates to the copper(II) center in addition to the nitrogen atoms in the tacn macrocycle, resulting in a five-coordinate complex with intermediate square-pyramidal/trigonal bipyramidal geometry. The guanidines adopt an unusual coordination mode in that their amine nitrogen nearest to the tacn macrocycle binds to the copper(II) center, forming very stable five-membered chelate rings. A spectrophotometric pH titration established the pK(app) for the deprotonation and coordination of each guanidine group to be 3.98 and 5.72, and revealed that [CuL(1)](2+) is the only detectable species present in solution above pH ∼ 8. The solution speciation of the CuL(2) complex (C2) is more complex, with at least 5 deprotonation steps over the pH range 4-12.5, and mononuclear and binuclear complexes coexisting. Analysis of the spectrophotometric data provided apparent deprotonation constants, and suggests that solutions at pH ∼ 7.5 contain the maximum proportion of polynuclear complexes. Complex C1 exhibits virtually no cleavage activity toward the model phosphate diesters, bis(p-nitrophenyl)phosphate (BNPP) and 2-hydroxypropyl-p-nitrophenyl phosphate (HPNPP), while C2 exhibits moderate activity. For C2, the respective kobs values measured at pH 7.0 (7.24 (± 0.08) × 10(-5) s(-1) (BNPP at 50 °C) and 3.2 (± 0.3) × 10(-5) s(-1) (HPNPP at 25 °C)) are 40- and 10-times faster than [Cu(tacn)(OH2)2](2+) complex. Both complexes cleave supercoiled pBR 322 plasmid DNA, indicating that the guanidine pendants of [CuL(1)](2+) may have been displaced from the copper coordination sphere to allow for DNA binding and subsequent cleavage. The rate of DNA

  9. Search for the standard-model Higgs boson in the associated WH production with 1.47 fb{sup -1} data of the ATLAS experiment at the LHC; Suche des Standardmodell Higgs-Boson bei der assoziierten WH-Produktion mit 1.47 fb{sup -1} Daten des ATLAS-Experimentes am LHC

    Energy Technology Data Exchange (ETDEWEB)

    Verlage, Tobias


    The Large Hadron Collider is a particle accelerator at CERN, in which since March 30th 2010 protons are brought to collision at a c. m. energy of √(s)=7 TeV. These events can be observed b y means of the ATLAS detector, one of two universal detectors at the Large Hadron Collider. One of the main purposes of the ATLAS detector is the search for the Standard-Model Higgs boson. This thesis describes a study on the search for the Standard-Model Higgs boson, whereby the production of the Higgs boson in association with a vector boson W{sup ±} and the subsequent decay in a bottom-quark pair iks studied. For this token data of the ATLAS detector, which correspond to an integrated luminosity of 1.47 fb{sup -1}, are compared with simulated physical events. An analysis based on cuts for the separation of the signal events of background processes is presented. Furthermore systematic uncertainties are determined. Finally an upper exclusion limit of the production rate for a Standard-Model Higgs boson in dependence of its mass in the range from 110 GeV to 139 GeV is calculated and discussed. The strongest exclusion limit can be posed for a Higgs boson with a mass of 110 GeV. For this a 16-fold larger production rate as that of the Standard-Model prediction can be excluded with a confidence level of 95%. For the whole studied mass range an upper exclusion limit for Higgs bosons with 16-29-fold increased Standard-Model production rate results.

  10. Chemical stratification in the post-magma ocean Earth inferred from coupled 146,147Sm-142,143Nd systematics in ultramafic rocks of the Saglek block (3.25-3.9 Ga; northern Labrador, Canada) (United States)

    Morino, Précillia; Caro, Guillaume; Reisberg, Laurie; Schumacher, Aimeryc


    The coupled 146,147Sm-142,143Nd chronometer has the potential to provide precise constraints on both the age and the composition of silicate reservoirs generated by magma ocean processes on accreting planets. Application of this chronometer to early Earth differentiation, however, is made difficult by the poor preservation and complex geological history of Eoarchean rocks hosting 142Nd anomalies, which often prevents accurate determination of their initial 143Nd/144Nd ratios. In order to better constrain the chronological aspects of Earth's formation, we investigated the 146,147Sm-142,143Nd systematics of well-preserved mafic/ultramafic enclaves of the Archean Saglek block of northern Labrador (3.25-3.9 Ga). Our results show that two distinct ultramafic suites are present within the Hebron/Saglek fjords region. The first group of samples, with μ142 Nd = 1.6 ± 2.8 and ε143Ndi = 0.4 ± 0.4, yields a whole-rock isochron age of 3365 ± 100 Ma and is tentatively suggested to be associated with the Mesoarchean Upernavik formation. The second group, with μ142 Nd = 8.6 ± 3.3 ppm and ε143Ndi = 1.4 ± 0.6, yields an Eoarchean date of 3782 ± 93 Ma, and is assigned to the Nulliak assemblage. Application of coupled 146,147Sm-142,143Nd chronometry to the Nulliak suite yields a model age of differentiation of 4.40-0.06+0.05 Ga, and a corresponding (147Sm/144Nd)source ratio of 0.211 ± 0.007 for the early depleted mantle. These estimates are remarkably similar to those obtained for a tholeiitic lava of the Abitibi greenstone belt (Theo's flow, 2.7 Ga) based on the 142,143Nd dataset of Debaille et al. (2013). Viewed in conjunction with previous 142,143Nd data, our results provide a precise estimate of the age of primordial differentiation of Earth's mantle, 160-20+30 Myr after formation of the solar system. This chronological constraint, combined with evidence for late solidification of the lunar magma ocean, strongly supports a young age for the giant impact and the Earth

  11. Thermodynamic and kinetic studies of the equilibration reaction between the sulfur and carbon bonded forms of a cobalt(III) complex with the ligands 1,4,7-triazycyclononane and 1,4-diaza-7-thiacyclodecane

    DEFF Research Database (Denmark)

    Song, Y.S.; Becker, J.; Kofod, Pauli


    -sulfur complex to form the alkyl complex gave 100% loss of deuterium. It is concluded that the labile methylene proton is bound to the carbon atom which in the alkyl complex is bound to cobalt(III). From the kinetic data it is estd. that the carbanion reacts with water 270 times faster than it is captured......The new cyclic thioether 1,4-diaza-7-thiacyclodecane, dathicd, has been synthesized and used for the prepn. of the sulfur- and carbon-bonded cobalt(III) complexes: [Co(tacn)(S-dathicd)]Cl3.5H2O and [Co(tacn)(C-dathicd)](ClO4)2 (tacn, 1,4,7-triazacyclononane; C-dathicd, 1,4-diamino-7-thiacyclodecan...

  12. La Intersectorialidad en la prevención del embarazo adolescente: análisis del proceso de implementación del CONPES 147 en el municipio de Popayán


    De los Reyes Benavides, Ángela Paola; Rocha Noriega, Elkin; Gómez Correa, Karen Cristina


    El presente trabajo de grado tuvo como propósito analizar la implementación del proyecto piloto del CONPES 147 de 2012 “Lineamientos para el desarrollo de una estrategia para la prevención del embarazo en la adolescencia y la promoción de proyectos de vida para los niños, niñas, adolescentes y jóvenes en edades entre 6 y 19 años” en el municipio de Popayán, el cual tuvo cuatro líneas estratégicas: (i) el fortalecimiento de la intersectorialidad; (ii) la promoción del desarrollo humano y los p...

  13. Detailed crystallization study of co-precipitated Y{sub 1.47} Gd{sub 1.53} Fe{sub 5} O{sub 12} and relevant magnetic properties

    Energy Technology Data Exchange (ETDEWEB)

    Serra, Rogerio Arving [Instituto de Criminalistica Carlos Eboli (ICCE), Rio de Janeiro, RJ (Brazil); Ogasawara, Tsuneharu; Ogasawara, Angelica Soares [Universidade Federal do Rio de Janeiro (UFRJ), RJ (Brazil). Coordenacao dos Programas de Pos-graduacao de Engenharia (COPPE). Dept. de Engenharia Metalurgica e de Materiais]. E-mail:


    The crystallization process of co-precipitated Y{sub 1.5}Gd{sub 1.5}Fe{sub 5}O{sub 12} powder heated up to 1000 deg C at rate of 5 deg C min{sup -1} was investigated. Above 810 deg C crystalline Y{sub 1.47}Gd{sub 1.53}Fe{sub 5}O{sub 12} was obtained with a lattice parameter of 12.41 A and a theoretical density of 5.84 g cm{sup -3}. Dry pressed rings were sintered at 1270 and 1320 deg C, increasing the grain-size from 3.1 to 6.5 {mu}m, the theoretical density by 87.6 to 95.3% and decreasing H{sub c} from 2.9725 to 1.4005 Oe. Additionally, Hc increased when the frequency of the hysteresis graph varied from 60 Hz to 10 kHz, the curie temperature was 282.4 deg C and Ms equalled 9.25 emu g{sup -1} (0.17 kG) agreeing well with the B{sub s}-value of the hysteresis graph and literature values. (author)

  14. Magnetocaloric properties of as-quenched Ni{sub 50.4}Mn{sub 34.9}In{sub 14.7} ferromagnetic shape memory alloy ribbons

    Energy Technology Data Exchange (ETDEWEB)

    Sanchez Llamazares, J.L. [Instituto Potosino de Investigacion Cientifica y Tecnologica (IPICYT), San Luis Potosi, S.L.P. (Mexico); Garcia, C. [MIT, Department of Materials Science and Engineering, Massachusetts (United States); Hernando, B.; Prida, V.M. [Universidad de Oviedo, Departamento de Fisica, Facultad de Ciencias, Oviedo (Spain); Baldomir, D.; Serantes, D. [Universidade de Santiago de Compostela, Departamento de Fisica Aplicada, Facultad de Fisica, Santiago de Compostela (Spain); Gonzalez, J. [UPV, Departamento Fisica de Materiales, Facultad de Quimica, San Sebastian (Spain)


    The temperature dependences of magnetic entropy change and refrigerant capacity have been calculated for a maximum field change of {delta} H=30 kOe in as-quenched ribbons of the ferromagnetic shape memory alloy Ni{sub 50.4}Mn{sub 34.9}In{sub 14.7} around the structural reverse martensitic transformation and magnetic transition of austenite. The ribbons crystallize into a single-phase austenite with the L2{sub 1}-type crystal structure and Curie point of 284 K. At 262 K austenite starts its transformation into a 10-layered structurally modulated monoclinic martensite. The first- and second-order character of the structural and magnetic transitions was confirmed by the Arrott plot method. Despite the superior absolute value of the maximum magnetic entropy change obtained in the temperature interval where the reverse martensitic transformation occurs ({delta}S{sub M} {sup max}=7.2 Jkg{sup -1}K{sup -1}) with respect to that obtained around the ferromagnetic transition of austenite ({delta} S{sub M} {sup max}=2.6 Jkg{sup -1}K{sup -1}), the large average hysteretic losses due to the effect of the magnetic field on the phase transformation as well as the narrow thermal dependence of the magnetic entropy change make the temperature interval around the ferromagnetic transition of austenite of a higher effective refrigerant capacity (RC{sup magn}{sub eff}=95Jkg{sup -1} versus RC{sup struct}{sub eff}=60Jkg{sup -1}). (orig.)

  15. Characteristics and error estimation of stratospheric ozone and ozone-related species over Poker Flat (65° N, 147° W, Alaska observed by a ground-based FTIR spectrometer from 2001 to 2003

    Directory of Open Access Journals (Sweden)

    K. Mizutani


    Full Text Available It is important to obtain the year-to-year trend of stratospheric minor species in the context of global changes. An important example is the trend in global ozone depletion. The purpose of this paper is to report the accuracy and precision of measurements of stratospheric chemical species that are made at our Poker Flat site in Alaska (65° N, 147° W. Since 1999, minor atmospheric molecules have been observed using a Fourier-Transform solar-absorption infrared Spectrometer (FTS at Poker Flat. Vertical profiles of the abundances of ozone, HNO3, HCl, and HF for the period from 2001 to 2003 were retrieved from FTS spectra using Rodgers' formulation of the Optimal Estimation Method (OEM. The accuracy and precision of the retrievals were estimated by formal error analysis. Errors for the total column were estimated to be 5.3%, 3.4%, 5.9%, and 5.3% for ozone, HNO3, HCl, and HF, respectively. The ozone vertical profiles were in good agreement with profiles derived from collocated ozonesonde measurements that were smoothed with averaging kernel functions that had been obtained with the retrieval procedure used in the analysis of spectra from the ground-based FTS (gb-FTS. The O3, HCl, and HF columns that were retrieved from the FTS measurements were consistent with Earth Probe/Total Ozone Mapping Spectrometer (TOMS and HALogen Occultation Experiment (HALOE data over Alaska within the error limits of all the respective datasets. This is the first report from the Poker Flat FTS observation site on a number of stratospheric gas profiles including a comprehensive error analysis.

  16. Reference: 147 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available ession of trichomes and overproduction of root hairs similarly as observed for TRY and CPC suggesting that ETC2 has similar properties. The etc2 single mutant shows an increase

  17. 19__138 - 147_Hamidu_Groundwater

    African Journals Online (AJOL)


    2-Department of Geology, Faculty of Earth a. Correspondence author: ABSTRACT. The Sedimentary (Chad formation) and Ba investigated for groundwater suitability for using aquifer properties derived from pump method for single well tests. The mean valu capacity recorded for the area are 4.06×10. Boreholes yield ranges ...

  18. 147-IJBCS-Article-Dr Osemeahon

    African Journals Online (AJOL)


    Department of Chemistry, Federal University of Technology, Yola, Nigeria. * Corresponding author, Email: ABSTRACT. This work investigates the ... problems of depletion of ozone layer in the atmosphere largely responsible for global climatic change. With the advert of the regulations on.

  19. 32 CFR 147.2 - Adjudicative process. (United States)


    ... whole person concept. Available, reliable information about the person, past and present, favorable and...) Guideline I: Emotional, mental, and personality disorders. (10) Guideline J: Criminal conduct. (11... behavior. Notwithstanding, the whole person concept, pursuit of further investigations may be terminated by...

  20. Publications | Page 147 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    IDRC works with developing-country researchers and institutions to build local capacity through funding, knowledge sharing, and training. Through books, articles, research publications, and studies, we aim to widen the impact of our investment and advance development research. We share the results of our funded ...

  1. Publications | Page 147 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    In March 2004, Kiddhu Makubuya, Uganda's Minister for Education and Sports, and Professor Romain Murenzi, Rwanda's... Medicinal plant potential and profits in Latin America. Panama's Darién National Park is the largest national park in Central America and a UNESCO World Heritage site. Within the park three distinct ...

  2. 47 CFR 101.147 - Frequency assignments. (United States)


    ... stations in the Public Mobile Services and with stations in the International Fixed Public Radio... are shared with fixed and mobile stations licensed in other services. (5) Frequencies in this band are... licensee's products or services, excluding video entertainment material, to a licensee's customer or for...

  3. Publications | Page 147 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    The University of Saskatchewan hosted the Linking Agriculture, Nutrition and Health Conference where representatives from research, industry and ... on Tobacco Control (FCTC) interventions, such as alternative livelihoods for tobacco farmers, product regulation, education and curbing illicit trade in tobacco products.

  4. 13 CFR 147.605 - Award. (United States)


    ... Business Credit and Assistance SMALL BUSINESS ADMINISTRATION GOVERNMENTWIDE REQUIREMENTS FOR DRUG-FREE... or cooperative agreement, in the form of money or property in lieu of money. (2) A block grant or a... that provides services instead of money. (2) Loans. (3) Loan guarantees. (4) Interest subsidies. (5...

  5. 9 CFR 147.41 - Definitions. (United States)


    ... purposes of meat or egg production and competitive showing. Game birds. Domesticated fowl, such as pheasants, partridge, quail, grouse, and guineas, but not doves and pigeons. Meat type chickens. Chickens bred for the primary purpose of producing meat. Plan Conference. A meeting convened for the purpose of...

  6. QTL Information Table: 147 [Q-TARO

    Lifescience Database Archive (English)

    Full Text Available qIN2-1 Morphological trait Dwarf 2nd internode length RFLP C)Interval BIL Koshihika...ri Kasalath B C86 jsa Yamamoto, T., Taguchi-Shiobara, F., Ukai, Y., Sasaki, T., and Yano, M. (2001). Mapping Quantitative Trai

  7. 147-IJBCS-Article-Dr Osemeahon

    African Journals Online (AJOL)


    not true of industrial paints. Because of the special requirements of the industrial coatings, satisfactory water-based polymers with the required properties have not yet been developed (Gooch, 1997). Therefore a significant challenge in this drive to reduce. VOC is the need for the water-borne technology to deliver the ...

  8. 78 FR 147 - Proposed Collections; Comment Requests (United States)


    ... Claims on, Unaffiliated Foreigners.'' DATES: Written comments should be received on or before March 4... Foreigners;'' and Treasury International Capital Form CQ-2, ``Commercial Liabilities to, and Claims on, Unaffiliated Foreigners.'' OMB Number: 1505-0024. Abstract: Forms CQ-1 and CQ-2 are part of the Treasury...

  9. 40 CFR 147.2902 - Definitions. (United States)


    ... loss of drilling mud into porous ground, or to prevent water, gas, or other fluid from entering the... connection with conventional oil or natural gas production and may be commingled with waste waters from gas... hazardous waste at the time of injection; (b) For enhanced recovery of oil or natural gas; and (c) For...

  10. Photoluminescence studies of a Terbium(III) complex as a fluorescent probe for DNA detection

    Energy Technology Data Exchange (ETDEWEB)

    Khorasani-Motlagh, Mozhgan, E-mail:; Noroozifar, Meissam; Niroomand, Sona; Moodi, Asieh


    The photoluminescence properties of a Tb(III) complex of the form [Tb(phen){sub 2}Cl{sub 3}·OH{sub 2}] (phen=1,10-phenanthroline) in different solvents are presented. It shows the characteristic luminescence of the corresponding Ln{sup 3+} ion in the visible region. The emission intensity of this complex in coordinating solvent is higher than non-coordinating one. The suggested mechanism for the energy transfer between the ligand and Tb{sup 3+} ion is the intramolecular energy transfer mechanism. The interactions of the Tb(III) complex with fish salmon DNA are studied by fluorescence spectroscopy, circular dichroism study and viscosity measurements. The results of fluorescence titration reveal that DNA strongly quenches the intrinsic fluorescence of the complex through a static quenching procedure. The binding constant (K{sub b}) of the above metal complex at 25 °C is determined by the fluorescence titration method and it is found to be (8.06±0.01)×10{sup 3} M{sup −1}. The thermodynamic parameters (ΔH{sup 0}>0, ΔS{sup 0}>0 and ΔG{sup 0}<0) indicate that the hydrophobic interactions play a major role in DNA–Tb complex association. The results support the claim that the title complex bonds to FS-DNA by a groove mode. -- Highlights: • Photoluminescence of [Tb(phen){sub 2}Cl{sub 3}·OH{sub 2}] in different solvents are studied. • Tb(III) complex shows good binding affinity to FS DNA with K{sub b}=(8.06±0.01)×10{sup 3} M{sup −1}. • Viscosity of DNA almost unchanged by increasing amount of Tb complex. • CD spectrum of DNA has a little change with increasing amount of Tb complex. • Thermodynamic parameters indicate that the binding reaction is entropically driven.

  11. Lanthanides in Nuclear Medicine. The Production of Terbium-149 by Heavy Ion Beams

    CERN Document Server

    Dmitriev, S N; Zaitseva, N G; Maslov, O D; Molokanova, L G; Starodub, G Ya; Shishkin, S V; Shishkina, T V


    Among radioactive isotopes of lanthanide series elements, finding the increasing using in nuclear medicine, alpha-emitter {149}Tb (T_{1/2} = 4.118 h; EC 76.2 %; beta^+ 7.1 %; alpha 16.7 %) is considered as a perspective radionuclide for radioimmunotherapy. The aim of the present work is to study experimental conditions of the {149}Tb production in reactions Nd({12}C, xn){149}Dy (4.23 min; beta^+, EC)\\to {149}Tb when the Nd targets have been irradiated by heavy ions of carbon. On the basis of results of formation and decay of {149}Dy\\to{149}Tb evaluation of the {149}Tb activity, is made which can be received under optimum conditions (enriched {142}Nd target, {12}C ions with the energy 120 MeV and up to current 100 mu A, time of irradiating 8-10 hours). Under these conditions {149}Tb can be obtained up to 30 GBq (up to 0.8 Ci).

  12. Poly[[aqua-?3-picolinato-?2-picolinato-dipicolinatopotassium(I)terbium(III)] 2.5-hydrate


    Filipe A. Almeida Paz; João Rocha; Jacek Klinowski; Tito Trindade; Nogueira,Helena I. S.; Soares-Santos, Paula C. R.; Cunha-Silva, Lu?s


    In the title compound, [KTb(C6H4NO2)4(H2O)]·2.5H2O, each Tb3+ centre is coordinated by four N and five O atoms from five distinct picolinate ligands in a geometry resembling a highly distorted tricapped trigonal prism. One of the ligands establishes a skew bridge between neighbouring Tb3+ centres, leading to the formation of one-dimensional anionic polymeric chains, {[(C6H4NO2)4Tb]−}n, running along the direction [010]. Each K+ cation is seven-coordinated by six O atoms from one an...

  13. Spin waves in terbium. III. Magnetic anisotropy at zero wave vector

    DEFF Research Database (Denmark)

    Houmann, Jens Christian Gylden; Jensen, J.; Touborg, P.


    The energy gap at zero wave vector in the spin-wave dispersion relation of ferromagnetic. Tb has been studied by inelastic neutron scattering. The energy was measured as a function of temperature and applied magnetic field, and the dynamic anisotropy parameters were deduced from the results....... The axial anisotropy is found to depend sensitively on the orientation of the magnetic moments in the basal plane. This behavior is shown to be a convincing indication of considerable two-ion contributions to the magnetic anisotropy at zero wave vector. With the exception of the sixfold basal...... the effects of zero-point deviations from the fully aligned ground state, and we tentatively propose polarization-dependent two-ion couplings as their origin....

  14. Structural and Magnetic Anisotropy in Amorphous Terbium-Iron Thin Films (United States)

    Hufnagel, Todd Clayton


    High density, removable media magnetooptic disk drives have recently begun to make significant gains in the information mass storage market. The media in these disks are amorphous rare-earth/transition-metal (RE-TM) alloys. One vital property of these materials is a large perpendicular magnetic anisotropy; that is, an easy axis of magnetization which is perpendicular to the plane of the film. A variety of theories, sometimes contradictory, have been proposed to account for this surprising presence of an anisotropic property in an amorphous material. Recent research indicates that there is an underlying atomic-scale structural anisotropy which is responsible for the observed magnetic anisotropy. Several different types of structural anisotropy have been proposed to account for the observed magnetic anisotropy, including pair-ordering anisotropy (anisotropic chemical short-range order) and bond orientation anisotropy (an anisotropy in coordination number or distances independent of chemical ordering). We have studied the structural origins of perpendicular magnetic anisotropy in amorphous Tb-Fe thin films by employing high-energy and anomalous dispersion x-ray scattering. The as-deposited films show a clear structural anisotropy, with a preference for Tb-Fe near neighbors to align in the out-of-plane direction. These films also have a large perpendicular magnetic anisotropy. Upon annealing, the magnetic anisotropy energy drops significantly, and we see a corresponding reduction in the structural anisotropy. The radial distribution functions indicate that the number of Tb-Fe near-neighbors increases in the in-plane direction, but does not change in the out-of-plane direction. Therefore, the distribution of Tb-Fe near-neighbors becomes more uniform upon annealing. We propose that the observed reduction in perpendicular magnetic anisotropy energy is a result of this change in structure. Our results support the pair -ordering anisotropy model of the structural anisotropy in amorphous Tb-Fe thin films. We see no evidence to support the bond orientation anisotropy model.

  15. Luminescence properties of terbium-doped Li3PO4 phosphor for ...

    Indian Academy of Sciences (India)

    Antonov-Romanovskii et al [2] firstly suggested applications of OSL for personal dosime- try. This technique got momentum for personnel dosime- try after the development of α-Al2O3:C. OSL properties of α-Al2O3:C have been investigated for personnel dosimetry, environmental dosimetry, medical dosimetry and space.

  16. Luminescence properties of terbium-doped Li3PO4 phosphor for ...

    Indian Academy of Sciences (India)

    The powder X-ray diffraction (PXRD), photoluminescence (PL) emission and excitation spectra, thermoluminescence (TL) and optically stimulated luminescence (OSL) were measured. The particle size was calculated using the Debye Scherrer formula and found to be 79.42 nm. PL emission spectra of Li 3 PO 4 :Tb 3 + ...

  17. Charge-transfer-based terbium MOF nanoparticles as fluorescent pH sensor for extreme acidity. (United States)

    Qi, Zewan; Chen, Yang


    Newly emerged metal organic frameworks (MOFs) have aroused the great interest in designing functional materials by means of its flexible structure and component. In this study, we used lanthanide Tb 3+ ions and small molecular ligands to design and assemble a kind of pH-sensitive MOF nanoparticle based on intramolecular-charge-transfer effect. This kind of made-to-order MOF nanoparticle for H + is highly specific and sensitive and could be used to fluorescently indicate pH value of strong acidic solution via preset mechanism through luminescence of Tb 3+ . The long luminescence lifetime of Tb 3+ allows eliminating concomitant non-specific fluorescence by time-revised fluorescence techniques, processing an advantage in sensing H + in biological media with strong autofluorescence. Our method showed a great potential of MOF structures in designing and constructing sensitive sensing materials for specific analytes directly via the assembly of functional ions/ligands. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Assessment of terbium (III) as a luminescent probe for the detection of tuberculosis biomarkers

    Energy Technology Data Exchange (ETDEWEB)

    Bamogo, W. [CNRS, IRAMIS, UMR 3685 NIMBE/LEDNA, F-91191 Gif-sur-Yvette (France); Mugherli, L. [CEA, IRAMIS, UMR 3685 NIMBE/LEDNA, F-91191 Gif-sur-Yvette (France); Banyasz, A. [CNRS, IRAMIS, LIDyL/Laboratoire Francis Perrin, URA 2453, F-91191 Gif-sur-Yvette (France); Novelli-Rousseau, A.; Mallard, F. [BioMérieux SA, F-38000 Grenoble (France); Tran-Thi, T.-H., E-mail: [CNRS, IRAMIS, UMR 3685 NIMBE/LEDNA, F-91191 Gif-sur-Yvette (France)


    A detection method for nicotinic acid, a specific metabolite marker of Mycobacterium tuberculosis present in cultures and patients' breath, is studied in complex solutions containing other metabolites and in biological media such as urine, saliva and breath condensate. The method is based on the analysis of the luminescence increase of Tb{sup 3+} complexes in the presence of nicotinic acid due to the energy transfer from the excited ligand to the lanthanide ion. It is shown that other potential markers found in M. tuberculosis culture supernatant, such as methyl phenylacetate, p-methyl anisate, methyl nicotinate and 2-methoxy biphenyl, can interfere with nicotinic acid via a competitive absorption of the excitation photons. A new strategy to circumvent these interferences is proposed with an upstream trapping of volatile markers preceding the detection of nicotinic acid in the liquid phase via the luminescence of Tb{sup 3+} complexes. The cost of the method is evaluated and compared with the Xpert MTB/RIF test endorsed by the World Health Organization. - Highlights: • Nicotinic acid, a specific marker of M. tuberculosis, can be detected via luminescence. • The detection limit with a commercial phosphorimeter is 0.4 µmol·L{sup -1}. • Other metabolites of M. tuberculosis can interfere via absorbed excitation light. • The interference can be removed via trapping of the most volatile metabolites. • A breath analysis procedure's cost is compared with the Xpert TBM/RIF test.

  19. A highly porous luminescent terbium-organic framework for reversible anion sensing

    Energy Technology Data Exchange (ETDEWEB)

    Wong, K.L.; Law, G.L.; Wong, W.T. [Department of Chemistry, The University of Hong Kong, Pokfulam Road, Hong Kong (China); Yang, Y.Y. [School of Chemistry and Chemical Engineering, Sun Yat-Sen University, Guangzhou 510275 (China)


    Unique tailored porous frameworks incorporating a lanthanide metal center have been designed to function as chemical detectors. A flexible multidentate ligand, mucic acid, is used to differentiate between several anions, thus creating an organic framework that is ideally suited for applications in gas separation, sensors, and chemical switches. (Abstract Copyright [2006], Wiley Periodicals, Inc.)

  20. Synthesis and characterization of wide bandgap semiconductors doped with terbium for electroluminescent devices


    Montañez Huamán, Liz Margarita


    En el presente trabajo de investigación se ha estudiado propiedades estequiometrias, estructurales y de emisión de luz de semiconductor de amplio ancho de banda dopados con terbio. La difracción de rayos-X en ángulo rasante confirma el estado amorfo de las películas. Los espectros de absorción infrarroja muestran la formación de óxidos en las películas y la espectroscopia de foto-electrones de rayos-X revela la formación de oxinitruro de aluminio y oxicarburo de silicio. Las pe...

  1. Synthesis and characterization of terbium-doped SrSnO3 pigments

    Czech Academy of Sciences Publication Activity Database

    Dohnalová, Ž.; Gorodylova, N.; Šulcová, P.; Vlček, Milan


    Roč. 40, č. 8 (2014), s. 12637-12645 ISSN 0272-8842 Institutional support: RVO:61389013 Keywords : pigments * solid state reaction * perovskites Subject RIV: CA - Inorganic Chemistry Impact factor: 2.605, year: 2014

  2. An optical material for the detection of β-hydroxybutyrate based on a terbium complex (United States)

    Wang, Xiaomiao; Chen, Huili; Li, Hua


    A novel Tb3+ complex (Tb(C14H10O4)ṡCl, TbL2) based on benzoic acid (L+H) was successfully synthesized, and gave a weak green emission in methanol-water (V:V, 4:1, pH 4.49). With the addition of β-hydroxybutyrate (β-HB) to a semi-aqueous solution of TbL2, an increment of the luminescent intensity at 545 nm assigned to 5D4 → 7F5 transition of Tb3+ was measured, which was evident to the naked eye. The response showed high selectivity for β-HB compared with other common anions including Cl-, NO3-, CO32-, PO43-, HPO42-, HPO4-, CO42-, PO74-, SO42-, lactate, AcO-, citrate, malate therefore it has the potential to be applied as a luminescent sensor for β-HB.

  3. Measurement of dose speed absorbed in depth imparted by sources external secondary patterns of beta radiation. Part 1 Measurement of dose speed absorbed in the surface of soft fabric for isotopes of {sup 90}Sr/{sup 90}Y, {sup 147}Pm and {sup 204}TI; Medicion de rapidez de dosis absorbida en profundidad impartida por fuentes patrones secundarios de radiacion beta externos. Parte 1. Medicion de rapidez de dosis absorbida en la superficie de tejido blando para isotopos de {sup 90}Sr/{sup 90}Y, {sup 147}Pm y {sup 204}TI

    Energy Technology Data Exchange (ETDEWEB)

    Alvarez R, J.T. [ININ, 52045 Ocoyoacac, Estado de Mexico (Mexico)


    The dose speed was measured absorbed for depth zero, (superficial) in soft equivalent fabric, for the secondary pattern{sup s} four sources of beta radiation, (Nr. 86): {sup 90}Sr/{sup 90}Y, (1850 MBq and 74 MBq respectively); {sup 147}Pm, (518 MBq) and {sup 204}TI, (18.5 MBq). The measurement is carried out to different distances of source-detecting separation, (11.0, 30.0 and 50.0 cm for the source of 1850 MBq, 30.0 cm for that of 74 MBq; 11.00 cm for the source of {sup 147}Pmand to contact for all the sources); maintaining the radiation sheaf aligned the one axis of symmetry of the detector, ({alpha} 0 degrees). The detector employed was a extrapolation chambers of variable electrodes and electrode fixed collector, (30 mm of diameter). In accordance with the principle of Bragg-Gray the volume of the chambers is varied and they register the variations of the current of collected ionization, correcting until for a maximum of thirteen correction factors that take into account the deviation to the suppositions that it establishes this principle. The certain values of the speed of superficial absorbed dose are in the following intervals: {sup 90}Sr/{sup 90}Y, (1850 MBq, 0.0, 11.0, 30.0 and 50.0 cm): 43.164 mGy S-t, 0.544 mGy s-1 ,0.075 mGy s{sup -1} and 0.027 mGy s{sup -1}, respectively, with a Global Analysis of the order of 1.17%, 1.17%, 1.14% and 1.66%, K J; {sup 90}Sr / {sup 90}Y, (74 MBq, 0.0 and 30 cm): 1.536 mGy s{sup -1} and 0.002 mGy s{sup -1}, with Global Analysis of 1.19.0% and 5.22%, (K = 1) respectively, for the {sup 147}Pm, (0.0 and 11.0 in the interval of: 0.36 {mu}Gy s{sup -1} and 0.43 {mu}Gy s{sup -1}, with one Global Analysis of 1 .42% and 4.28%, (K = 1), respectively; and finally for the {sup 204}TI, (0.0 cm) in the interval of 0.10 {mu}Gy s{sup -1} with a Global Analysis of 1.27%. He calculates of the Global Analysis one carries out of agreement with those recommendations of the BIPM. In all the cases of source-detecting arrangement with

  4. 147.pdf | jul252008 | currsci | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    REGISTRATIONS CLOSED. Announcement of selected candidates will commence towards the end of February. Associates – 2017. Posted on 30 August 2017. Click here to see the list · 83rd Annual Meeting. Posted on 01 December 2017. [3 – 5 December 2017 at NEHU, Shillong] · Tweets by IAScBng · Recent Refresher ...

  5. Dicty_cDB: VSB147 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available t infected midgut library, clone Tse33h07_p1c. 84 2e-12 1 BX557472 |BX557472.1 Glossina morsitans morsitans ...(Tseatse fly) EST from adult infected midgut library, clone Tse32f02_p1c. 84 2e-12 1 BX569353 |BX569353.1 Gl...(Tseatse fly) EST from adult infected midgut library, clone Tse31h04_p1c. 84 2e-12 1 BX564658 |BX564658.1 Gl

  6. 40 CFR 147.2050 - State-administered program. (United States)


    .... Sections 48-1-10, 48-1-90, 48-1-100, 48-1-110 (Law. Co-op. 1976 and Supp. 1983). (2) South Carolina... Ann. Sections 48-1-10 to 48-1-350 (Law. Co-op. 1976 and Supp. 1983). (2) State Safe Drinking Water Act, S.C. Code Ann. Sections 44-55-10 to 44-55-100 (Law. Co-op. 1976 and Supp. 1983). (3) Administrative...


    African Journals Online (AJOL)

    Fr. Ikenga

    , abuse and exploitation, all have detrimental effects on children. To ignore their association with crime is to engage in victim blaming' see I O. Connor, 'Models of Juvenile Justice', Paper presented at the Australian Institute of criminology ...

  8. What we do | Page 147 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    BRICS). Brazil, Russia, India, China and South Africa (BRICS) have put innovation at the centre of their development strategies. Brazil, South America, China, Far East Asia, India, South Africa, North Of Sahara, South Of Sahara, North And Central ...

  9. 32 CFR 147.10 - Guideline H-Drug involvement. (United States)


    ... Controlled Substances Act of 1970, as amended (e.g., marijuana or cannabis, depressants, narcotics... use of a drug or use of a legal drug in a manner that deviates from approved medical direction. (b..., sale, or distribution; (3) Diagnosis by a credentialed medical professional (e.g., physician, clinical...

  10. Dicty_cDB: SLD147 [Dicty_cDB

    Lifescience Database Archive (English)


  11. 9 CFR 147.24 - Cleaning and disinfecting. (United States)


    ... AGRICULTURE LIVESTOCK IMPROVEMENT AUXILIARY PROVISIONS ON NATIONAL POULTRY IMPROVEMENT PLAN Sanitation... other exposed surfaces. Empty the residual feed from the feed system and feed pans and remove it from... housings and shutters, feeding equipment, watering equipment, etc. Use high pressure and high volume water...

  12. What we do | Page 147 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Avian Influenza Policy Analysis. The highly pathogenic avian influenza (HPAI) virus H5N1 produces severe disease and high mortality in domestic poultry, waterfowl and other bird species. Far East Asia, Indonesia, Thailand, Viet Nam, Central Asia, South Asia, Cambodia, China, Canada. PROJECT ...

  13. 40 CFR 147.2925 - Standard permit conditions. (United States)


    ... conditions. Proper operation and maintenance also includes adequate operator staffing and training, adequate... document and all attachments and that, based on my inquiry of those individuals immediately responsible for...

  14. What we do | Page 147 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    provide developing-country researchers financial resources, advice, and training to help them find solutions to local problems. encourage knowledge sharing with policymakers, researchers, and communities around the world. foster new talent by offering fellowships and awards. strive to get new knowledge into the hands ...

  15. Publications | Page 147 | CRDI - Centre de recherches pour le ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    TICs en las PYMES de Centroamérica : Impacto de la adopción de las tecnologías de la información y la comunicación. La révolution numérique, les ... Ensayos toxicológicos y métodos de evaluación de calidad de aguas: Estandarización, intercalibración, resultados y aplicaciones. Ce livre présente des concepts et des ...

  16. Dicty_cDB: VHC147 [Dicty_cDB

    Lifescience Database Archive (English)


  17. What we do | Page 147 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Competition Policy and Development Forums 2007 and 2008. This grant will support the organization of two high-level forums on competition and development immediately prior to the global conferences of the International Competition Network, to be held in Russia (May 2007) and Japan (April 2008), respectively. Japan ...

  18. Dicty_cDB: AFL147 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available |BE471638.1 EST416491 potato stolon, Cornell University Solanum tuberosum cDNA clone cSTA29J22, mRNA...|BE343505.1 EST408667 potato stolon, Cornell University Solanum tuberosum cDNA clone cSTA25K17, mRNA

  19. 14 CFR 25.147 - Directional and lateral control. (United States)


    ... VSR1 for heading changes up to 15 degrees (except that the heading change at which the rudder pedal... propeller in the minimum drag position; (2) The power required for level flight at 1.3 V SR1, but not more than maximum continuous power; (3) The most unfavorable center of gravity; (4) Landing gear retracted...

  20. 40 CFR 147.451 - EPA-administered program. (United States)


    ... requirements of 40 CFR parts 124, 144, 146, 148, and any additional requirements set forth in the remainder of this subpart. Injection well owners and operators, and EPA shall comply with these requirements. (b... (CONTINUED) STATE, TRIBAL, AND EPA-ADMINISTERED UNDERGROUND INJECTION CONTROL PROGRAMS District of Columbia...

  1. 147 between the holocaust museum in washington dc and ghana's

    African Journals Online (AJOL)


    concerns trade relations, the middle passage and the African diaspora. A fifteen to twenty minutes film was commissioned from the famous Ghanaian filmmaker, Kwaw Ansah “in other to orient visitors to the themes of the exhibition.” The artifacts of the exhibition include archaeological materials, including nineteenth century ...

  2. Dicty_cDB: VSF147 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 451J2415). 50 0.003 1 CD722181 |CD722181.1 oj06e07.y1 Human lacrimal gland, unamplified: oj Homo sapiens cDN...eles gambiae cDNA clone 19600449692125 5', mRNA sequence. 50 0.003 1 CD723035 |CD723035.1 oj17b11.y1 Human lacrimal gland, unam

  3. 32 CFR 147.6 - Guidance D-Sexual behavior. (United States)


    ... criminal offense, indicates a personality or emotional disorder, may subject the individual to coercion...) and emotional, mental and personality disorders (Guideline I) in determining how to resolve the... disqualifying include: (1) Sexual behavior of a criminal nature, whether or not the individual has been...

  4. 9 CFR 147.46 - Committee consideration of proposed changes. (United States)


    .... (8) Meat-type commercial turkeys. (9) Commercial upland game birds and waterfowl and raised-for... proposed changes falling in their respective fields: (1) Egg-type breeding chickens. (2) Meat-type breeding chickens. (3) Breeding turkeys. (4) Breeding waterfowl, exhibition poultry, and game birds. (5) Breeding...

  5. Dicty_cDB: CHQ147 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available No valid letters to be indexed on context 0 ANTI-DNA BLAST search was processed by このメールアドレスはスパムボットから保護されています。閲覧するにはJavaScriptを有効にする必要があります。 document.getElementById('cloak08b64cd735cbe0dcd152651c7adaa1c6').innerHTML = ''; var prefix = 'ma' + 'il' + 'to'; var path = 'hr' + 'ef' + '='; var addy08b64cd735cbe0dcd152651c7adaa1c6 = 'blast' + '@'; addy08b64cd735cbe0dcd152651c7adaa1c6 = addy08b64cd735cbe0dcd152651c7adaa1c6 + 'nig' + '.' + 'ac' + '.' + 'jp'; var addy_text08b64cd735cbe0dcd152651c7adaa1c6 = 'blast' + '@' + 'nig' + '.' + 'ac' + '.' + 'jp';document.getElementById('cloak08b64cd735cbe0dcd152651c7adaa1c6').innerHTML += ''+addy_text08b64cd735cbe0dcd152651c7adaa1c6+''; , National

  6. 11 CFR 100.147 - Volunteer activity for party committees. (United States)


    ... general public communications or political advertising. Such payment is not for costs incurred in... public communication or political advertising. For the purposes of this paragraph, the term direct mail... a state or local committee of a political party of the costs of campaign materials (such as pins...

  7. Extracellular Matrix Metalloproteinase Inducer EMMPRIN (CD147 in Cardiovascular Disease

    Directory of Open Access Journals (Sweden)

    Saskia N. I. von Ungern-Sternberg


    Full Text Available The receptor EMMPRIN is involved in the development and progression of cardiovascular diseases and in the pathogenesis of myocardial infarction. There are several binding partners of EMMPRIN mediating the effects of EMMPRIN in cardiovascular diseases. EMMPRIN interaction with most binding partners leads to disease progression by mediating cytokine or chemokine release, the activation of platelets and monocytes, as well as the formation of monocyte-platelet aggregates (MPAs. EMMPRIN is also involved in atherosclerosis by mediating the infiltration of pro-inflammatory cells. There is also evidence that EMMPRIN controls energy metabolism of cells and that EMMPRIN binding partners modulate intracellular glycosylation and trafficking of EMMPRIN towards the cell membrane. In this review, we systematically discuss these multifaceted roles of EMMPRIN and its interaction partners, such as Cyclophilins, in cardiovascular disease.

  8. Dicty_cDB: SFF147 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 6 11 BD092935 |BD092935.1 Methods and compositions for synthesis of long chain polyunsaturated fatty acids i...n plants. 90 9e-47 6 BD082645 |BD082645.1 Methods and compositions for synthesis of long chain polyunsaturat...ed fatty acids. 90 9e-47 6 BD082630 |BD082630.1 Methods and compositions for synthesis of long chain poly-un

  9. 147.pdf | jul252004 | currsci | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    How to combat infectious diseases: The role of Science Academies · Academy Public Lecture and INSA–Leopoldina Lecture by Prof. Jörg Hacker, President, German Academy of Sciences Leopoldina. 4 December, 2017, 4 PM Faculty Hall, Indian Institute ...

  10. Dicty_cDB: AHA147 [Dicty_cDB

    Lifescience Database Archive (English)


  11. 40 CFR 147.350 - State-administered program. (United States)


    ... FR on March 26, 1984 (49 FR 11179); the effective date of this program is March 26, 1984. This...) Connecticut General Statutes Annotated, title 22a (Environmental Protection), chapter 439, sections 22a-1...

  12. 40 CFR 147.2905 - Plugging and abandonment. (United States)


    ... termination of injection. The Regional Administrator may extend the time to plug, but only if no fluid... to prevent movement of fluid into an USDW. (c) The owner/operator shall notify the Osage UIC office... full of mud as casing is removed. No surface casing shall be removed without written approval from the...

  13. Dicty_cDB: SFK147 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available ul extensions: 462 Number of sequences better than 10.0: 0 Number of HSP's better than 10.0 without gapping:...B: 7,939,383 Number of extensions: 416863 Number of successful extensions: 21980 Number of sequences better


    African Journals Online (AJOL)

    The reactivity of condensing aldehyde is an important factor in the synthesis. Presence of alcohol enhances the formation of products. This fact have been utilized for alkali catalyzed synthesis of many arylidene flavanones been reported by them. The special feature of long conjugation with 4-keto group of flavanone moiety.

  15. 40 CFR 147.950 - State-administered program. (United States)


    ... of Drilling Mud and Salt Water Generated from Drilling and Production of Oil and Gas Wells...) Amendment to Statewide Order No. 29-B (Amendment concerning the offsite disposal of drilling mud and... disposal of nonhazardous oilfield waste) (March 20, 1984, effective May 20, 1984); (vii) Amendment to...


    African Journals Online (AJOL)

    at 517 n.m. Curcumin used as standard drug to compare the activity. EXPERIMENTAL PROTOCOL FOR ANTI-. BACTERIAL ACTIVITY: The media used in present study, nutrient agar and nutrient broth, were prepared according to Indian pharmacopoeia .The pH of the solution was adjusted to 6.5-6.6 by using 1M sodium ...

  17. South of Sahara | Page 147 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    —through public grants, loans from development banks, multilateral and bilateral donors, or the private sector. Despite the availability of funding, there are many challenges limiting access to these monies. These include difficulty accessing ...

  18. All projects related to | Page 147 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Surveying Public Attitudes of Security Sector Reforms in the Arab World. Project. One constant in the ebb and flow of the Arab Spring has been the increased influence of public opinion on public policy. Topic: PUBLIC OPINION, SAFETY, PUBLIC SERVICES, NORTH AFRICA, STATE INTERVENTION, MIDDLE EAST.

  19. 14 CFR Appendix C to Part 147 - Airframe Curriculum Subjects (United States)


    ... inspect movable primary and secondary flight control surfaces. (3) 27. Jack aircraft. g. airframe... landing gear, retraction systems, shock struts, brakes, wheels, tires, and steering systems. b. hydraulic and pneumatic power systems (2) 30. Repair hydraulic and pneumatic power systems components. (3) 31...

  20. Dicty_cDB: SSC147 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 66 5e-10 U13853_1( U13853 |pid:none) pGEX-4T1 cloning vector, complete sequ... 65 2e-09 U85201_1( U85201...comple... 65 2e-09 FJ526990_1( FJ526990 |pid:none) Cloning vector pEG(KT), complete s... 65 2e-09 EF025374_1(

  1. 32 CFR 147.14 - Guideline L-Outside activities. (United States)


    ... compensated, volunteer, or employment with: (1) A foreign country; (2) Any foreign national; (3) A representative of any foreign interest; (4) Any foreign, domestic, or international organization or person engaged in analysis, discussion, or publication of material on intelligence, defense, foreign affairs, or...

  2. Piirivalve saab 147 miljoni eest uhke helikopteri / Sigrid Laev

    Index Scriptorium Estoniae

    Laev, Sigrid


    Eesti piirivalve saab helikopteri Agusta Bell, kopteri soetamine täidab Schnegen Facility programmi eesmärki, mille kohaselt tuleb EL-i välispiiride valve viia vastavusse Schengeni õigusruumi nõuetega. Raha ostmiseks annab abiprogramm Schengen Facility

  3. 45 CFR 147.108 - Prohibition of preexisting condition exclusions. (United States)


    ... additional examples illustrating the definition of a preexisting condition exclusion, see § 146.111(a)(1)(ii... that C has type 2 diabetes. (ii) Conclusion. In this Example 2, M's denial of C's application for...

  4. 21 CFR 131.147 - Dry whole milk. (United States)


    ... fruit juice. (ii) Natural and artificial food flavoring. (d) Methods of analysis. The following referenced methods of analysis are from “Official Methods of Analysis of the Association of Official Analytical Chemists,” 13th Ed. (1980), which is incorporated by reference. Copies may be obtained from the...

  5. 32 CFR 147.8 - Guideline F-Financial considerations. (United States)


    ...) Financial problems that are linked to gambling, drug abuse, alcoholism, or other issues of security concern. (c) Conditions that could mitigate security concerns include: (1) The behavior was not recent; (2) It was an isolated incident; (3) The conditions that resulted in the behavior were largely beyond the...

  6. Page 1 Multiprocessor & multicomputer systems 147 total capacity of ...

    Indian Academy of Sciences (India)

    min [ki (L/d), k2 N]. With unit constants, we can safely assume min (L/d, N) as a figure of merit. A similar measure was considered for the performance comparison of various multicomputers (Reed & Schwetman 1983). The computation capability being proportional to N, we can define the computation communication ...

  7. 9 CFR 147.47 - Conference consideration of proposed changes. (United States)


    ... recommends for adoption as follows: “Mr. Chairman. The committee for Egg-type chickens recommends the... not approve as follows: “Mr. Chairman. The Committee for Egg-type chickens does not approve Proposal... which he represents. (h) A roll call of States for a recorded vote will be used when requested by a...

  8. 33 CFR 147.10 - Establishment of safety zones. (United States)


    ... period when construction equipment and materials are within 500 meters of the construction site until the... charts whose referenced horizontal datum is the North American Datum of 1983 (NAD 83), unless such...

  9. Measurement of dose equivalent with personal dosemeters and instrumentation of radiological protection in the new operative magnitudes ICRU, for external fields of radiation beta. Part IV. Survey of the angular response of instruments used in radiological protection in secondary patron fields of beta radiation ({sup 90}Sr/{sup 90}Y (1850 MBq and 74 MBq), {sup 204}TI (18.5 MBq) and {sup 147}Pm (518 MBq)); Medicion de dosis equivalente con dosimetros personales e instrumentacion de proteccion radiologica en las nuevas magnitudes operativas ICRU, para campos de radiacion beta externos. Parte IV. Estudio de la respuesta angular de instrumentos empleados en proteccion radiologica en campos patrones secundarios de radiacion beta ({sup 90}Sr/{sup 90}Y (1850 MBq y 74 MBq), {sup 204}TI (18.5 MBq) y {sup 147}Pm(518 MBq))

    Energy Technology Data Exchange (ETDEWEB)

    Alvarez R, J.T. [ININ, 52045 Ocoyoacac, Estado de Mexico (Mexico)


    Tests type were made (type test) in the following commercial instrumentation commonly used in radiological protection: Geiger-Mueller Counters (FH40 FE), Plastic Scintillators (NE-BP/6/4A), Ionization Chambers (RO-5) and Proportional Counters (HP-100A; gas:P-10). With object of checking the possibility that these they can carry out the new operative unit ICRU, H' (0.07; {alpha}). The tests consisted on determining the energy and angular response of the detectors in secondary patron fields of beta radiation, for isotopes of {sup 90}Sr/{sup 90}Y (1850 MBq and 74 MBq and {sup 147}Pm(518 MBq). The results show the inadequate of these commercial instruments for the realization of the H' operative unit (0.07; {alpha}) in beta external fields. Due to flaws in the design, construction and calibration of the instruments for this type of radiation fields (Author)

  10. pH dependent photophysical studies of new europium and terbium complexes of tripodal ligand: Experimental and semiempirical approach

    Energy Technology Data Exchange (ETDEWEB)

    Akbar, Rifat [Department of Chemistry, Sant Longowal Institute of Engineering & Technology, Longowal, Punjab 148106 (India); Baral, Minati [Department of Chemistry, National Institute of Technology Kurukshetra, Haryana 136119 (India); Kanungo, B K, E-mail: [Department of Chemistry, Sant Longowal Institute of Engineering & Technology, Longowal, Punjab 148106 (India)


    The photophysical properties of adduct of a novel nonadentate tripodal ligand, 5,5′-(2-(((8-hydroxyquinolin-5-yl)methylamino)methyl)-2-methylpropane-1, 3-diyl)bis(azanediyl)bis(methylene diquinolin-8-ol, (TAME5OX), with Eu{sup 3+} and Tb{sup 3+} metal ions have been probed for photonics applications. The absorption spectroscopy of these complexes show remarkable spectral changes due to characteristic lanthanide transitions, which support the use of TAME5OX as a sensitive optical pH based sensor to detect Ln{sup 3+} metal ions in biological systems. In addition, these complexes have also been shown to exhibit strong green fluorescence allowing simultaneous sensing within the visible region under physiological pH in competitive medium for both Eu{sup 3+} and Tb{sup 3+} ions. The intense fluorescence from these compounds were revealed to intermittently get quenched under acidic as well as basic conditions due to the photoinduced intramolecular electron transfer from excited 8-hydroxyquinoline (8-HQ) moiety to metal ion, just an opposite process. This renders these compounds the OFF–ON–OFF type of pH-dependent fluorescent sensor. The thermodynamic stability and aqueous coordination chemistry of the chelator with the said lanthanide ions have also been probed by potentiometric, UV–visible and fluorescence spectrophotometric method. TAME5OX has been found to form two protonated complexes [Ln(H{sub 5}L)]{sup 5+} and [Ln(H{sub 4}L)]{sup 4+} below pH 2.5 with both metal ions, which consecutively deprotonates through one proton process with rise of pH. The formation constants (log β{sub 11n}) of neutral complexes have been determined to be 33.51 and 32.16 with pLn (pLn=−log[Ln{sup 3+}]) values of 16.14 and 19.48 for Eu{sup 3+} and Tb{sup 3+} ions, respectively, calculated at pH 7.4, indicating TAME5OX is a good lanthanide synthetic chelator. The emission lifetimes of the Eu{sup 3+} and Tb{sup 3+} complexes recorded in D{sub 2}O and H{sub 2}O suggest the presence of water molecules in the first coordination sphere of the metal ions. NMR titrations were carried out to determine the stoichiometry of chelates. The complexe's coordination geometries were optimized by using PM7 as sparkle/PM7 model. The theoretical electronic behavior was evaluated to support the experimental findings, based on ZINDO/S methodology at configuration interaction with single excitations (CIS) level. These results emphasize the capability of the use of the theoretical models in prediction of geometries and all other calculations of compounds containing lanthanide ions and create new interesting possibilities for the design in-silico of novel and highly efficient lanthanide–organic edifice. - Highlights: • Photophysical behavior of Eu{sup 3+} and Tb{sup 3+} complexes of TAME5OX has been investigated. • This tripodal ligand forms thermodynamically stable Ln{sup 3+} complexes. • These compounds exhibit strong green fluorescence under physiological pH. • Green fluorescence gets quenched under acidic and basic conditions, due to PET process. • This renders these compounds the OFF–ON–OFF type of pH-dependent fluorescent sensors.

  11. Visible photoluminescence in polycrystalline terbium doped aluminum nitride (Tb:AlN) ceramics with high thermal conductivity (United States)

    Wieg, A. T.; Kodera, Y.; Wang, Z.; Imai, T.; Dames, C.; Garay, J. E.


    Thermal management continues to be one of the major challenges in the development of high powered light sources such as solid state lasers. In particular, the relatively low thermal conductivity of standard photoluminescent (PL) materials limits the overall power output and/or duty cycle. We present a method based on current activated pressure assisted densification for the fabrication of high thermal conductivity PL materials: rare earth doped polycrystalline bulk aluminum nitride. Specifically, the ceramics are translucent and are doped with Tb3+, allowing for emission in the visible. Remarkably, the ceramics have a room temperature thermal conductivity of 94 W/(m K) which is almost seven times higher than that of the state of the art host material, Nd-doped yttrium aluminum garnet. These light emitting properties coupled with very high thermal conductivity should enable the development of a wide variety of more powerful light sources.

  12. Preparation of extractive resins for producing terbium-161; Preparacion de resinas extractivas para produccion de terbio-161

    Energy Technology Data Exchange (ETDEWEB)

    De la Cruz B, C. C.; Monroy G, F. [ININ, Carretera Mexico-Toluca s/n, 52750 Ocoyoacac, Estado de Mexico (Mexico)], e-mail:


    This paper presents the development of a methodology for extractive resins preparation to base of HDEHP, which allows to separation of Tb from Gd generating an own technology of preparation of these resins. The study included the extractive resins preparation from 6 different supports: kieselguhr Dg, alumina, red volcanic rock, chiluca, quarry and fluorite; two treatment types of of supports and varied concentrations of HDEHP extractant (di(2-etil hexyl) orthophosphoric acid), in order to determine which resin has improved efficiency of Gd and Tb separation, and radionuclide purity of {sup 161}Tb. Resins were prepared to base of kieselguhr to determine the most appropriate silicon deposition process. Two silicon deposition treatments were realized: treatment I , by contact with silicon deposition solution (dimethyldichlorosilane / heptane 1:30) and treatment II by contact with vapors of dimethyldichlorosilane in vacuum. The extractant retention was carried out to different concentrations of HDEHP / acetone: 1:4, 1:8, 1:15, 1:20, 1:30 and 1:40. According to the results, there is not direct relation of HDEHP concentration used in extractive resins preparation to base of kieselguhr over the efficiency of Gd and Tb separation and of radionuclide purity of {sup 161}Tb. The effect of support in the efficiency of Gd and Tb separation was studied to prepare resins with the supports kieselguhr, alumina, quarry, chiluca, volcanic rock and fluorite, using the silicon deposition treatment II for the supports and a concentration of HDEHP / acetone 1:20, for extractant retention. Only resins based on kieselguhr could separate to Gd from Tb quantitatively, the resin at a concentration of HDEHP / Acetone 1:20 was the best results obtained in Gd and Tb separation, achieving a separation efficiency greater than 90% and a radionuclide purity higher than 99%. (Author)

  13. Synthesis and Characterization of Europium(III) and Terbium(III) Complexes: An Advanced Undergraduate Inorganic Chemistry Experiment (United States)

    Swavey, Shawn


    Undergraduate laboratories rarely involve lanthanide coordination chemistry. This is unfortunate in light of the ease with which many of these complexes are made and the interesting and instructive photophysical properties they entail. The forbidden nature of the 4f transitions associated with the lanthanides is overcome by incorporation of…

  14. Sensitized green emission of terbium with dibenzoylmethane and 1, 10 phenanthroline in polyvinyl alcohol and polyvinyl pyrrolidone blends (United States)

    Kumar, Brijesh; Kaur, Gagandeep; Rai, S. B.


    Tb doped polyvinyl alcohol: polyvinyl pyrrolidone blends with dibenzoylmethane (DBM) and 1, 10 Phenanthroline (Phen) have been prepared by solution cast technique. Bond formation amongst the ligands and Tb3 + ions in the doped polymer has been confirmed employing Fourier Transform Infrared (FTIR) techniques. Optical properties of the Tb3 + ions have been investigated using UV-Vis absorption, excitation and fluorescence studies excited by different radiations. Addition of dimethylbenzoate and 1, 10 Phenanthroline to the polymer blend increases the luminescence from Tb3 + ions along with energy transfer from the polymer blend itself. Luminescence decay curve analysis affirms the non-radiative energy transfer from DBM and Phen to Tb3 + ions, which is identified as the reason behind this enhancement. The fluorescence decay time of PVA-PVP host decreases from 6.02 ns to 2.31 ns showing an evidence of energy transfer from the host blend to the complexed Tb ions. Similarly the lifetime of DBM and Phen and both in the blend reduces in the complexed system showing the feasibility of energy transfer from these excited DBM and Phen to Tb3 + and is proposed as the cause of the above observations. These entire phenomena have been explained by the energy level diagram.

  15. A Terbium Metal-Organic Framework for Highly Selective and Sensitive Luminescence Sensing of Hg2+Ions in Aqueous Solution. (United States)

    Xia, Tifeng; Song, Tao; Zhang, Gege; Cui, Yuanjing; Yang, Yu; Wang, Zhiyu; Qian, Guodong


    A series of isomorphic lanthanide metal-organic frameworks (MOFs) Ln(TATAB)⋅(DMF) 4 (H 2 O)(MeOH) 0.5 (LnTATAB, Ln=Eu, Tb, Sm, Dy, Gd; H 3 TATAB=4,4',4''-s-triazine-1,3,5-triyltri-p-aminobenzoic acid) have been solvothermally synthesized and structurally characterized. Among these MOFs, TbTATAB exhibits good water stability and a high fluorescence quantum yield. Because mercury ions (Hg 2+ ) have a high affinity to nitrogen atoms, and the space between multiple nitrogen atoms from triazine and imino groups is suitable for interacting with Hg 2+ ions, TbTATAB shows highly selective and sensitive detection of Hg 2+ in aqueous solution with a detection limit of 4.4 nm. Furthermore, it was successfully applied to detect Hg 2+ ions in natural water samples. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Anti-L1CAM radioimmunotherapy is more effective with the radiolanthanide terbium-161 compared to lutetium-177 in an ovarian cancer model

    Energy Technology Data Exchange (ETDEWEB)

    Gruenberg, Juergen; Lindenblatt, Dennis; Cohrs, Susan; Fischer, Eliane [Paul Scherrer Institute, Center for Radiopharmaceutical Sciences ETH-PSI-USZ, Villigen (Switzerland); Dorrer, Holger [Paul Scherrer Institute, Laboratory of Radiochemistry and Environmental Chemistry, Villigen (Switzerland); Zhernosekov, Konstantin [ITG Isotope Technologies Garching GmbH, Garching (Germany); Koester, Ulli [Institut Laue-Langevin, Grenoble (France); Tuerler, Andreas [Paul Scherrer Institute, Laboratory of Radiochemistry and Environmental Chemistry, Villigen (Switzerland); University of Bern, Department of Chemistry and Biochemistry, Berne (Switzerland); Schibli, Roger [Paul Scherrer Institute, Center for Radiopharmaceutical Sciences ETH-PSI-USZ, Villigen (Switzerland); ETH Zurich, Department of Chemistry and Applied Biosciences, Zurich (Switzerland)


    The L1 cell adhesion molecule (L1CAM) is considered a valuable target for therapeutic intervention in different types of cancer. Recent studies have shown that anti-L1CAM radioimmunotherapy (RIT) with {sup 67}Cu- and {sup 177}Lu-labelled internalising monoclonal antibody (mAb) chCE7 was effective in the treatment of human ovarian cancer xenografts. In this study, we directly compared the therapeutic efficacy of anti-L1CAM RIT against human ovarian cancer under equitoxic conditions with the radiolanthanide {sup 177}Lu and the potential alternative {sup 161}Tb in an ovarian cancer therapy model. Tb was produced by neutron bombardment of enriched {sup 160}Gd targets. {sup 161}Tb and {sup 177}Lu were used for radiolabelling of DOTA-conjugated antibodies. The in vivo behaviour of the radioimmunoconjugates (RICs) was assessed in IGROV1 tumour-bearing nude mice using biodistribution experiments and SPECT/CT imaging. After ascertaining the maximal tolerated doses (MTD) the therapeutic impact of 50 % MTD of {sup 177}Lu- and {sup 161}Tb-DOTA-chCE7 was evaluated in groups of ten mice by monitoring the tumour size of subcutaneous IGROV1 tumours. The average number of DOTA ligands per antibody was 2.5 and maximum specific activities of 600 MBq/mg were achieved under identical radiolabelling conditions. RICs were stable in human plasma for at least 48 h. {sup 177}Lu- and {sup 161}Tb-DOTA-chCE7 showed high tumour uptake (37.8-39.0 %IA/g, 144 h p.i.) with low levels in off-target organs. SPECT/CT images confirmed the biodistribution data. {sup 161}Tb-labelled chCE7 revealed a higher radiotoxicity in nude mice (MTD: 10 MBq) than the {sup 177}Lu-labelled counterpart (MTD: 12 MBq). In a comparative therapy study with equitoxic doses, tumour growth inhibition was better by 82.6 % for the {sup 161}Tb-DOTA-chCE7 than the {sup 177}Lu-DOTA-chCE7 RIT. Our study is the first to show that anti-L1CAM {sup 161}Tb RIT is more effective compared to {sup 177}Lu RIT in ovarian cancer xenografts. These results suggest that {sup 161}Tb is a promising candidate for future clinical applications in combination with internalising antibodies. (orig.)

  17. CCDC 954774: Experimental Crystal Structure Determination : Dimethylammonium tri-terbium tris(4'-(tetrazol-2-id-5-yl)biphenyl-4-carboxylate) tetrahydroxide trihydrate unknown solvate

    KAUST Repository

    Xue, Dongxu


    An entry from the Cambridge Structural Database, the world’s repository for small molecule crystal structures. The entry contains experimental data from a crystal diffraction study. The deposited dataset for this entry is freely available from the CCDC and typically includes 3D coordinates, cell parameters, space group, experimental conditions and quality measures.

  18. CCDC 959634: Experimental Crystal Structure Determination : octakis(mu~3~-Hydroxo)-undecakis(mu~2~-2-fluorobenzoato)-(N,N-dimethylformamide)-nitrato-hexa-aqua-hexa-terbium

    KAUST Repository

    Guillerm, Vincent


    An entry from the Cambridge Structural Database, the world’s repository for small molecule crystal structures. The entry contains experimental data from a crystal diffraction study. The deposited dataset for this entry is freely available from the CCDC and typically includes 3D coordinates, cell parameters, space group, experimental conditions and quality measures.

  19. CCDC 954773: Experimental Crystal Structure Determination : Dimethylammonium tri-terbium tris(4-(tetrazol-2-id-5-yl)benzoate) tetrahydroxide trihydrate unknown solvate

    KAUST Repository

    Xue, Dongxu


    An entry from the Cambridge Structural Database, the world’s repository for small molecule crystal structures. The entry contains experimental data from a crystal diffraction study. The deposited dataset for this entry is freely available from the CCDC and typically includes 3D coordinates, cell parameters, space group, experimental conditions and quality measures.

  20. CCDC 954775: Experimental Crystal Structure Determination : Dimethylammonium tri-terbium tris(2-fluoro-4-(1H-tetrazol-5-yl)benzoate) tetrahydroxide tetradecahydrate

    KAUST Repository

    Xue, Dongxu


    An entry from the Cambridge Structural Database, the world’s repository for small molecule crystal structures. The entry contains experimental data from a crystal diffraction study. The deposited dataset for this entry is freely available from the CCDC and typically includes 3D coordinates, cell parameters, space group, experimental conditions and quality measures.

  1. CCDC 1411423: Experimental Crystal Structure Determination : catena-[dimethylammonium hexakis(mu-fumarato)-octakis(mu-hydroxo)-hexa-terbium N,N-dimethylformamide solvate hexahydrate

    KAUST Repository

    Assen, Ayalew H.


    An entry from the Cambridge Structural Database, the world’s repository for small molecule crystal structures. The entry contains experimental data from a crystal diffraction study. The deposited dataset for this entry is freely available from the CCDC and typically includes 3D coordinates, cell parameters, space group, experimental conditions and quality measures.

  2. CCDC 1410946: Experimental Crystal Structure Determination : catena-[dimethylammonium tris(mu-naphthalene-1,4-dicarboxylato)-tetrakis(mu-hydroxo)-triaqua-tri-terbium(iii) unknown solvate

    KAUST Repository

    Xue, Dongxu


    An entry from the Cambridge Structural Database, the world’s repository for small molecule crystal structures. The entry contains experimental data from a crystal diffraction study. The deposited dataset for this entry is freely available from the CCDC and typically includes 3D coordinates, cell parameters, space group, experimental conditions and quality measures.

  3. Phthalimides: Supramolecular Interactions in Crystals, Hypersensitive Solution 1H-NMR Dynamics and Energy Transfer to Europium(III and Terbium(III States

    Directory of Open Access Journals (Sweden)

    David J. Williams


    Full Text Available Detailed crystal structures and 1H-NMR characteristics of some alkylaminephthalimides, including dendritic polyphthalimides, are reported. These investigations were undertaken in order to obtain a better understanding of the relationship between solid-state supramolecular interactions, their persistence in solution and associated dynamics of magnetically hypersensitive phthalimide aromatic AA'BB'-AA'XX' proton NMR resonances. Some alkylamine phthalimides feature folded molecular geometries, which we attribute to n-π interactions among proximal amine-phthalimide sites; those alkylamine-phthalimides that have no possibility for such interactions feature fully extended phthalimide functionalities. Accordingly, alkylamine phthalimide compounds with folded solid-state geometries feature solvent and temperature dependent hypersensitive AA'BB'-AA'XX' 1H-NMR line profiles, which we attribute to the n-π interactions. Luminescence of Eu3+(5D0 and Tb3+(5D4 states show well defined metal ion environments in their complexes with dendritic phthalimides, as well as relatively weak phthalimide-lanthanide(III interactions.

  4. Analysis of tryptophan at nmoll(-1) level based on the fluorescence enhancement of terbium-gadolinium-tryptophan-sodium dodecyl benzene sulfonate system. (United States)

    Liu, Shufang; Yang, Jinghe; Wu, Xia; Su, Benyu; Sun, Changxia; Wang, Feng


    It is found that Tb(3+) can react with tryptophan (Trp) and sodium dodecyl benzene sulfonate (SDBS), and emits the intrinsic fluoresence of Tb(3+). The fluorescence intensity can be enhanced by La(3+), Gd(3+), Lu(3+), Sc(3+) and Y(3+), among which Gd(3+) has the greatest enhancement. This is a new co-luminescence system. The studies indicate that in the Tb-Gd-Trp-SDBS system, there is both Tb-Trp-SDBS and Gd-Trp-SDBS complexes, and they aggregate together and form a large congeries. The fluorescence enhancement of the Tb-Gd-Trp-SDBS system is considered to originate from intramolecular and intermolecular energy transfers, and the energy-insulating sheath effect of Gd-Trp-SDBS complex. Under the optimum conditions, the enhanced intensity of fluorescence is in proportion to the concentration of Trp in the range from 4x10(-8) to 4x10(-5)moll(-1). The detection limit is 10(-9)moll(-1). The proposed method is one of the most sensitive fluoremetries of Trp.

  5. Preparation, characterization, and properties of PMMA-doped polymer film materials: a study on the effect of terbium ions on luminescence and lifetime enhancement. (United States)

    Zhang, Hui-Jie; Fan, Rui-Qing; Wang, Xin-Ming; Wang, Ping; Wang, Yu-Lei; Yang, Yu-Lin


    Poly(methylmethacrylate) (PMMA) doped with Tb-based imidazole derivative coordination polymer {[Tb(3)(L)(μ(3)-OH)(7)]·H(2)O}(n) (1) (L = N,N'-bis(acetoxy)biimidazole) was synthesized and its photophysical properties were studied. The L'(L' = N,N'-bis(ethylacetate)biimidazole) ligand was synthesized by an N-alkylation reaction process followed by ester hydrolysis to produce ligand L. Polymer 1 and ligand L' have been characterized by (1)H NMR and IR spectroscopy, elemental analysis, PXRD and X-ray single-crystal diffraction. Coordination polymer 1 is the first observation of a CdCl(2) structure constructed with hydroxy groups and decorated by ligand L in lanthanide N-heterocyclic coordination polymers. In the 2D layered structure of 1, each Tb3 metal center is connected with three Tb1 and three Tb2 metal centers by seven hydroxyl groups in different directions, resulting in a six-membered ring. After doping, not only the luminescence intensity and lifetime enhanced, but also their thermal stability was increased in comparison with 1. When 1 was doped into poly(methylmethacrylate) (1@PMMA), polymer film materials were formed with the PMMA polymer matrix (w/w = 2.5%-12.5%) acting as a co-sensitizer for Tb(3+) ions. The luminescence intensity of the Tb(3+) emission at 544 nm increases when the content of Tb(3+) was 10%. The lifetime of 1@PMMA (914.88 μs) is more than four times longer than that of 1 (196.24 μs). All τ values for the doped polymer systems are higher than coordination polymer 1, indicating that radiative processes are operative in all the doped polymer films. This is because PMMA coupling with the O-H oscillators from {[Tb(3)(L)(μ(3)-OH)(7)]·H(2)O}(n) can suppress multiphonon relaxation. According to the variable-temperature luminescence (VT-luminescence) investigation, 1@PMMA was confirmed to be a stable green luminescent polymer film material.

  6. Changing Single-Molecule Magnet Properties of a Windmill-Like Distorted Terbium(III) α-Butoxy-Substituted Phthalocyaninato Double-Decker Complex by Protonation/Deprotonation. (United States)

    Horii, Yoji; Horie, Yusuke; Katoh, Keiichi; Breedlove, Brian K; Yamashita, Masahiro


    Synthesis, structures, and magnetic properties of α-butoxy-substituted phthalocyaninato double-decker complexes Tb(α-obPc)2 (1-) (α-obPc: dianion of 1,4,8,11,15,18,22,25-octa(n-butoxy)phthalocyaninato) with protonated (1H), deprotonated (1[HDBU]), and diprotonated forms (1H2+) are discussed. X-ray analysis was used to confirm the position of the proton in 1H, and it was revealed that the protonation induced asymmetric distortion in 1H. In contrast, 1[HDBU] was distorted in a highly symmetric windmill-like fashion. 1H is arranged in a slipped column array in the crystal packing, whereas 1[HDBU] is arranged in a one-dimensional fashion, in which the magnetic easy axes of 1[HDBU] lie along the same line. From direct-current (dc) magnetic measurements, ferromagnetic Tb-Tb interactions occur in both 1H and 1[HDBU], and magnetic hysteresis was observed. However, the area of the magnetic hysteresis in 1[HDBU] is larger than that in 1H, meaning that magnetic relaxation time (τ) is longer in 1[HDBU]. In addition, the results of alternating-current magnetic measurements in a zero dc magnetic field indicate that τ of 1[HDBU] is longer as compared to 1H. In other words, protonation/deprotonation affects not only the molecular structures and crystal packing but also the single-molecule magnet properties.

  7. A Water-Stable Dual-Channel Luminescence Sensor for UO22+Ions Based on an Anionic Terbium(III) Metal-Organic Framework. (United States)

    Ye, Junwei; Bogale, Raji F; Shi, Yangwei; Chen, Yanzhen; Liu, Xigang; Zhang, Siqi; Yang, Yaoyao; Zhao, Jianzhang; Ning, Guiling


    A stable 3D Tb III -based metal-organic framework [Tb(BPDC) 2 ]⋅(CH 3 ) 2 NH 2 (DUT-101) was synthesized, and it is the first efficient dual-channel luminescence sensor for aqueous UO 2 2+ ions. DUT-101 contains an anionic three-dimensional framework and protonated dimethylamine molecules embedded within the channels. The intense green emission of DUT-101 could be highly selectively and sensitively quenched by UO 2 2+ ions even in the presence of other competing metal ions. A possible sensing mechanism was proposed based on both suppression of luminescence resonance energy transfer and enhancement of intermolecular electron transfer. Furthermore, visual green fluorescent test papers based on DUT-101 were fabricated and could be used to discriminate UO 2 2+ ions among various metal ions. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. [?-N,N?-Bis(3-meth?oxy-2-oxidobenzyl?idene)propane-1,3-diamine]trinitratocopper(II)terbium(III) acetone solvate


    Zhang Fang; Liu Fei


    In the title complex, [CuTb(C19H20N2O4)(NO3)3]·CH3COCH3, the CuII atom is four-coordinated by two O atoms and two N atoms from the deprotonated Schiff base in a square-planar geometry, while the TbIII atom is ten-coordinated by four O atoms from the deprotonated Schiff base and six O atoms from three bidentate nitrate anions. The compound is isostructural with the previously reported GdIII analogue [Elmali & Elerman (2004). Z. Naturforsch. Teil B, 59, 535–540], which was described ...

  9. Crystal structure of a mixed-ligand terbium(III coordination polymer containing oxalate and formate ligands, having a three-dimensional fcu topology

    Directory of Open Access Journals (Sweden)

    Chainok Kittipong


    Full Text Available The title compound, poly[(μ3-formato(μ4-oxalatoterbium(III], [Tb(CHO2(C2O4]n, is a three-dimensional coordination polymer, and is isotypic with the LaIII, CeIII and SmIII analogues. The asymmetric unit contains one TbIII ion, one formate anion (CHO2− and half of an oxalate anion (C2O42−, the latter being completed by application of inversion symmetry. The TbIII ion is nine-coordinated in a distorted tricapped trigonal–prismatic manner by two chelating carboxylate groups from two C2O42− ligands, two carboxylate oxygen atoms from another two C2O42− ligands and three oxygen atoms from three CHO2− ligands, with the Tb—O bond lengths and the O—Tb—O bond angles ranging from 2.4165 (19 to 2.478 (3 Å and 64.53 (6 to 144.49 (4°, respectively. The CHO2− and C2O42− anions adopt μ3-bridging and μ4-chelating-bridging coordination modes, respectively, linking adjacent TbIII ions into a three-dimensional 12-connected fcu topology with point symbol (324.436.56. The title compound exhibits thermal stability up to 623 K, and also displays strong green photoluminescence in the solid state at room temperature.

  10. Heterotopic ossification after hip arthroplasty: a randomized double-blind multicenter study tenoxicam in 147 hips

    DEFF Research Database (Denmark)

    Gebuhr, Peter Henrik; Sletgård, J; Dalsgård, J


    for 1 year, during which another 10 patients were excluded. At follow-up, significantly fewer patients had heterotopic ossifications in the tenoxicam groups than in the placebo and morphine groups. There was no significant difference between the 2 tenoxicam-treated groups, and we therefore conclude...... that tenoxicam 20 mg for 5 days postoperatively can reduce heterotopic ossification after cemented total hip arthroplasty....

  11. 9 CFR 147.5 - The microagglutination test for pullorum-typhoid. (United States)


    ... SERVICE, DEPARTMENT OF AGRICULTURE LIVESTOCK IMPROVEMENT AUXILIARY PROVISIONS ON NATIONAL POULTRY... the serum samples from the blood clot to a microplate as described in “Applied Microbiology,” volume... described in “Applied Microbiology,” volume 21, No. 3, March 1971, pages 394-399. (3) Dilute the microtest...

  12. 40 CFR 147.52 - State-administered program-Hydraulic Fracturing of Coal Beds. (United States)


    ... hydraulic fracturing of coal beds in the State of Alabama, except those on Indian lands, is the program..., 1999, to Dr. Donald F. Oltz, Supervisor, State Oil and Gas Board of Alabama, Subject: Attorney General...

  13. 40 CFR 147.1800 - State-administered program-Class II wells. (United States)


    ... program application: (a) Incorporation by reference. The requirements set forth in the State statutes and... 1509.22 (Page 1978 and Supp. 1982); (2) Rules of the Division of Oil and Gas, Ohio Administrative Code..., Environmental Law Section, for the Attorney General of Ohio, September 30, 1982. (d) The Program Description and...

  14. 40 CFR 147.250 - State-administered program-Class II wells. (United States)


    ... Laws for Conservation of Petroleum and Gas, California Public Resources Code Div. 3, Chapt. 1, §§ 3000... Division of Oil and Gas, approved by EPA pursuant to SDWA section 1425. (a) Incorporation by reference. The... Memorandum of Agreement between EPA Region IX and the California Division of Oil and Gas, signed by the EPA...

  15. 40 CFR 147.1400 - State-administered program-Class II wells. (United States)


    ... State of Nebraska, except those on Indian lands, is the program administered by the Nebraska Oil and Gas..., 1984. (1) Rules and Regulations of the Nebraska Oil and Gas Conservation Commission, Rules 1 through 6...-906 (Reissue 1988). (b) Other laws. The following statutes and regulations, although not incorporated...

  16. 14 CFR 91.147 - Passenger carrying flights for compensation or hire. (United States)


    ... receive a Letter of Authorization from the Flight Standards District Office nearest to its principal place of business by September 11, 2007. (c) Each application for a Letter of Authorization must include the following information: (1) Name of Operator, agent, and any d/b/a (doing-business-as) under which...

  17. Tekeli et al., Afr J Tradit Complement Altern Med. (2014) 11(4):147 ...

    African Journals Online (AJOL)


    agent and can form the basis for pharmacological studies. ... stress can damage lipids, proteins, enzymes, carbohydrates and DNA in cells ... commonly have been used to prevent oxidative deterioration of fats and oily foods (Topçu et al., 2008). .... are of considerable physiological and morphological importance in plants.

  18. Tekeli et al., Afr J Tradit Complement Altern Med. (2014) 11(4):147 ...

    African Journals Online (AJOL)


    Lo, K.M., Cheung, P.C.K. (2005). Antioxidant activity of extracts from the fruiting bodies of Agrocybe aegerita var. alba. Food Chem. 89, 533-. 539. 14. Nguefack, J., Budde, B.B., Jakobsen, M. (2004). Five essential oils from aromatic plants of Cameroon: their antibacterial activity and ability to permeabilize the cytoplasmic ...

  19. 76 FR 147 - Proposed Data Collections Submitted for Public Comment and Recommendations (United States)


    ... extensive research on managing collaborations during times of extraordinary pressure where response to surge... from the County or local public health agency, and one coordinator or collaboration leader) will be... preparedness 10 1 1 10 coordinator/collaboration leader Rural (Greenville, Phoenix, Seattle only: 3 1 1 3...

  20. 40 CFR 147.50 - State-administered program-Class II wells. (United States)


    ... (Cumm. Supp. 1989); (2) State Oil and Gas Board of Alabama Administrative Code, Oil and Gas Report 1 (supplemented through May 1989), Rules and Regulations Governing the Conservation of Oil and Gas in Alabama, and... Alabama, except those on Indian lands, is the program administered by the State Oil and Gas Board of...

  1. Abbasi Shiran J see Albadi J 147 Abdullah RS see El-Sakka SS 1883

    Indian Academy of Sciences (India)

    1115. Chattopadhyaya M see Alam M M. 1217. Chaudhury P. Study of structure and spectroscopy of water–hydroxide ion clusters: A combined simulated annealing and DFT- based approach. 659. Chauhan S M S. Sulfonated graphenes catalyzed synthesis of expanded porphyrins and their supramolecular interactions with.

  2. 9 CFR 147.15 - Laboratory procedure recommended for the bacteriological examination of mycoplasma reactors. 11 (United States)


    ... incubation, inoculate broth culture onto a plate of Mycoplasma Agar Medium (MAM). (See paragraph (g) of this section.) Several cultures may be inoculated on one plate by using a wire loop or a cotton swab. Incubate... culture as needed to maintain the original isolates. Incubate tubes at 37 °C for at least 21 days before...

  3. Comparative biokinetics of trivalent radionuclides with similar ionic dimensions: promethium-147, curium-242 and americium-241. (United States)

    Priest, N D


    Data on the distribution and redistribution patterns in the laboratory rat of three trivalent elements with a similar ionic radius have been compared. This showed that these distributions for the two ions with the same ionic radius (111 pm), i.e., those of promethium (a lanthanoid) and curium (an actinoid), were indistinguishable and that americium, with a slightly larger ion size (111.5 pm), behaved similarly. The results are consistent with the suggestion that ion size is the only important factor controlling the deposition and redistribution patterns of trivalent lanthanoids and actinoids in rats. The result is important because it suggests that the same radiological protection dosimetry models should be used for trivalent actinoids and lanthanoids, that human volunteer data generated for lanthanoid isotopes can be used to predict the behavior of actinoids with the same ion size, and that appropriate pairs of beta-particle-emitting lanthanoid and alpha-particle-emitting actinoids could be used to study the relative toxicity of alpha and beta particles in experimental animals.

  4. 40 CFR 147.353 - EPA-administered program-Indian lands. (United States)


    ... requirements of 40 CFR parts 124, 144, 146, 148, and any additional requirements set forth in the remainder of this subpart. Injection well owners and operators, and EPA shall comply with these requirements. (b... PROGRAMS (CONTINUED) STATE, TRIBAL, AND EPA-ADMINISTERED UNDERGROUND INJECTION CONTROL PROGRAMS Connecticut...

  5. 40 CFR 147.951 - EPA-administered program-Indian lands. (United States)


    ... program requirements of 40 CFR parts 124, 144, 146, 148, and any additional requirements set forth in the remainder of this subpart. Injection well owners and operators, and EPA shall comply with these requirements... PROGRAMS (CONTINUED) STATE, TRIBAL, AND EPA-ADMINISTERED UNDERGROUND INJECTION CONTROL PROGRAMS Louisiana...

  6. 40 CFR 147.1053 - EPA-administered program-Indian lands. (United States)


    ... program requirements of 40 CFR parts 124, 144, 146, 148, and any additional requirements set forth in the remainder of this subpart. Injection well owners and operators, and EPA shall comply with these requirements... PROGRAMS (CONTINUED) STATE, TRIBAL, AND EPA-ADMINISTERED UNDERGROUND INJECTION CONTROL PROGRAMS Maryland...

  7. 40 CFR 147.205 - EPA-administered program-Indian lands. (United States)


    ... requirements of 40 CFR parts 124, 144, 146, 148 and any additional requirements set forth in this subpart. Injection well owners and operators, and EPA shall comply with these requirements. (b) Effective date. The... PROGRAMS (CONTINUED) STATE, TRIBAL, AND EPA-ADMINISTERED UNDERGROUND INJECTION CONTROL PROGRAMS Arkansas...

  8. 40 CFR 147.553 - EPA-administered program-Indian lands. (United States)


    ... program requirements of 40 CFR parts 124, 144, 146, 148, and any additional requirements set forth in the remainder of this subpart. Injection well owners and operators, and EPA shall comply with these requirements... PROGRAMS (CONTINUED) STATE, TRIBAL, AND EPA-ADMINISTERED UNDERGROUND INJECTION CONTROL PROGRAMS Georgia...

  9. 40 CFR 147.1101 - EPA-administered program-Indian lands. (United States)


    ... UIC program requirements of 40 CFR parts 124, 144, 146, 148, and any additional requirements set forth in the remainder of this subpart. Injection well owners and operators, and EPA shall comply with... PROGRAMS (CONTINUED) STATE, TRIBAL, AND EPA-ADMINISTERED UNDERGROUND INJECTION CONTROL PROGRAMS...

  10. 40 CFR 147.2404 - EPA-administered program-Colville Reservation. (United States)


    ... CFR part 124, 144 and 146 and any additional requirements set forth in the remainder of this subpart...) WATER PROGRAMS (CONTINUED) STATE, TRIBAL, AND EPA-ADMINISTERED UNDERGROUND INJECTION CONTROL PROGRAMS... Indian Reservation consists of a prohibition of all Class I, II, III and IV injection wells and of a...

  11. 40 CFR 147.403 - EPA-administered program-Indian lands. (United States)


    ... requirements of 40 CFR parts 124, 144, 146, 148, and any additional requirements set forth in the remainder of this subpart. Injection well owners and operators and EPA shall comply with these requirements. (b... PROGRAMS (CONTINUED) STATE, TRIBAL, AND EPA-ADMINISTERED UNDERGROUND INJECTION CONTROL PROGRAMS Delaware...

  12. 40 CFR 147.60 - EPA-administered program-Indian lands. (United States)


    ... requirements of 40 CFR parts 124, 144, 146, 148 and any additional requirements set forth in the remainder of this subpart. Injection well owners and operators, and EPA shall comply with these requirements. (b... PROGRAMS (CONTINUED) STATE, TRIBAL, AND EPA-ADMINISTERED UNDERGROUND INJECTION CONTROL PROGRAMS Alabama...

  13. 40 CFR 147.703 - EPA-administered program-Indian lands. (United States)


    ... program requirements of 40 CFR parts 124, 144, 146, 148, and any additional requirements set forth in the remainder of this subpart. Injection well owners and operators, and EPA shall comply with these requirements... PROGRAMS (CONTINUED) STATE, TRIBAL, AND EPA-ADMINISTERED UNDERGROUND INJECTION CONTROL PROGRAMS Illinois...

  14. 40 CFR 147.860 - EPA-administered program-Indian lands. (United States)


    ... program requirements of 40 CFR parts 124, 144, 146, 148, and any additional requirements set forth in the remainder of this subpart. Injection well owners and operators, and EPA shall comply with these requirements... PROGRAMS (CONTINUED) STATE, TRIBAL, AND EPA-ADMINISTERED UNDERGROUND INJECTION CONTROL PROGRAMS Kansas...

  15. Team Attributes & Team Performance - FY14-7 Expert Performance and Measurement (United States)


    up? Professionalization - the social process by which any trade or occupation transforms itself into a true " profession of the highest integrity...unclassified b. ABSTRACT unclassified c. THIS PAGE unclassified Standard Form 298 (Rev. 8-98) Prescribed by ANSI Std Z39-18 2 Fall 2014 SEI Research... TRADEMARK , OR COPYRIGHT INFRINGEMENT. This material has been approved for public release and unlimited distribution. This material may be

  16. Page 1 Ramey Nichel Reductions-/ 147 Method B-Carbazole (4g ...

    Indian Academy of Sciences (India)

    nickel, the alcohol in the reaction mixture was removed by distillation. The reduction product was isolated by means of ether and when purified according to Adkins and Coonradt, gave 0.3 g of unreacted carbazole, 19g. (yield, 46%) of tetrahydrocarbazole, m.p. 110° and 0.2g. of a mixture of octa and dodecahydrocarbazole.

  17. SU-F-J-147: Magnetic Field Dose Response Considerations for a Linac Monitor Chamber

    Energy Technology Data Exchange (ETDEWEB)

    Reynolds, M; Fallone, B [Cross Cancer Institute, Edmonton, AB (Canada)


    Purpose: The impact of magnetic fields on the readings of a linac monitor chamber have not yet been investigated. Herein we examine the total dose response as well as any deviations in the beam parameters of flatness and symmetry when a Varian monitor chamber is irradiated within an applied magnetic field. This work has direct application to the development of Linac-MR systems worldwide. Methods: A Varian monitor chamber was modeled in the Monte Carlo code PENELOPE and irradiated in the presence of a magnetic field with a phase space generated from a model of a Linac-MR prototype system. The magnetic field strength was stepped from 0 to 3.0T in both parallel and perpendicular directions with respect to the normal surface of the phase space. Dose to each of the four regions in the monitor chamber were scored separately for every magnetic field adaptation to evaluate the effect of the magnetic field on flatness and symmetry. Results: When the magnetic field is perpendicular to the phase space normal we see a change in dose response with a maximal deviation (10–25% depending on the chamber region) near 0.75T. In the direction of electron deflection we expectedly see opposite responses in chamber regions leading to a measured asymmetry. With a magnetic field parallel to the phase space normal we see no measured asymmetries, however there is a monotonic rise in dose response leveling off at about +12% near 2.5T. Conclusion: Attention must be given to correct for the strength and direction of the magnetic field at the location of the linac monitor chamber in hybrid Linac-MR devices. Elsewise the dose sampled by these chambers may not represent the actual dose expected at isocentre; additionally there may be a need to correct for the symmetry of the beam recorded by the monitor chamber. Fallone is a co-founder and CEO of MagnetTx Oncology Solutions (under discussions to license Alberta bi-planar linac MR for commercialization).

  18. 9 CFR 147.12 - Procedures for collection, isolation, and identification of Salmonella from environmental samples... (United States)


    ... sanitizing soap prior to the sampling. Outer clothing, including gloves, should be changed between visits to... strength skim milk from USDA-APHIS “Recommended Sample Collection Methods for Environmental Samples.... Autoclave the assembled DS sampler bundle and transfer it with sterile forceps or other aseptic method to a...

  19. Page 1 Integral equation method in transonic flow 147 instead of (6 ...

    Indian Academy of Sciences (India)

    1974). Generally satisfactory results have been obtained by their use. A drawback of the above substitution immediately noticed from (12) is that the velocity perturba- tions in the semi-infinite regions identically before and after the profile vanish.

  20. 40 CFR 147.3400 - Navajo Indian lands-Class II wells. (United States)


    ... located: Within the exterior boundaries of the formal Navajo Reservation, including the three satellite... outside those exterior boundaries (collectively referred to as “Navajo Indian lands for which EPA has... application: (a) Incorporation by reference. The requirements set forth in the Navajo Nation Statutes...