
Sample records for terbium 144

  1. Elastic properties of terbium

    DEFF Research Database (Denmark)

    Spichkin, Y.I.; Bohr, Jakob; Tishin, A.M.


    The temperature dependence of the Young modulus along the crystallographic axes b and c (E(b) and E(c)), and the internal friction of a terbium single crystal have been measured. At 4.2 K, E(b) and E(c) are equal to 38 and 84.5 GPa, respectively. The lattice part of the Young modulus and the Debye...... temperature has been calculated. The origin of the Young modulus anomalies arising at the transition to the magnetically ordered state is discussed....

  2. Critical scattering of neutrons from terbium

    DEFF Research Database (Denmark)

    Als-Nielsen, Jens Aage; Dietrich, O.W.; Marshall, W.


    The inelasticity of the critical scattering of neutrons in terbium has been measured above the Neél temperature at the (0, 0, 2−Q) satellite position. The results show that dynamic slowing down of the fluctuations does occur in a second‐order phase transition in agreement with the general theory...

  3. Semiconductor composition containing iron, dysprosium, and terbium

    Energy Technology Data Exchange (ETDEWEB)

    Pooser, Raphael C.; Lawrie, Benjamin J.; Baddorf, Arthur P.; Malasi, Abhinav; Taz, Humaira; Farah, Annettee E.; Kalyanaraman, Ramakrishnan; Duscher, Gerd Josef Mansfred; Patel, Maulik K.


    An amorphous semiconductor composition includes 1 to 70 atomic percent iron, 15 to 65 atomic percent dysprosium, 15 to 35 atomic percent terbium, balance X, wherein X is at least one of an oxidizing element and a reducing element. The composition has an essentially amorphous microstructure, an optical transmittance of at least 50% in at least the visible spectrum and semiconductor electrical properties.

  4. Raman spectroscopy study of the doping effect of the encapsulated terbium halogenides on single-walled carbon nanotubes

    Energy Technology Data Exchange (ETDEWEB)

    Kharlamova, M.V.; Kramberger, C.; Mittelberger, A. [University of Vienna, Faculty of Physics, Vienna (Austria)


    In the present work, the doping effect of terbium chloride, terbium bromide, and terbium iodide on single-walled carbon nanotubes (SWCNTs) was compared by Raman spectroscopy. A precise investigation of the doping-induced alterations of the Raman modes of the filled SWCNTs was conducted. The shifts of the components of the Raman modes and modification of their profiles allowed concluding that the inserted terbium halogenides have acceptor doping effect on the SWCNTs, and the doping efficiency increases in the line with terbium iodide, terbium bromide, and terbium chloride. (orig.)

  5. Magnetocaloric effect of thin Terbium films (United States)

    Mello, V. D.; Anselmo, D. H. A. L.; Vasconcelos, M. S.; Almeida, N. S.


    We report a theoretical study of the magnetocaloric effect of Terbium (Tb) thin films due to finite size and surface effects in the helimagnetic phase, corresponding to a temperature range from TC=219 K to TN=231 K, for external fields of the order of kOe. For a Tb thin film of 6 monolayers submitted to an applied field (ΔH =30 kOe, ΔH =50 kOe and ΔH = 70 kOe) we report a significative change in adiabatic temperature, ΔT / ΔH , near the Néel temperature, of the order ten times higher than that observed for Tb bulk. On the other hand, for small values of the magnetic field, large thickness effects are found. For external field strength around few kOe, we have found that the thermal caloric efficiency increases remarkably for ultrathin films. For an ultrathin film with 6 monolayers, we have found ΔT / ΔH = 43 K/T while for thicker films, with 20 monolayers, ΔT / ΔH = 22 K/T. Our results suggest that thin films of Tb are a promising material for magnetocaloric effect devices for applications at intermediate temperatures.

  6. Femtosecond XUV spectroscopy of gadolinium and terbium

    Energy Technology Data Exchange (ETDEWEB)

    Carley, Robert; Frietsch, Bjoern; Doebrich, Kristian; Teichmann, Martin; Gahl, Cornelius; Noack, Frank [Max-Born-Institute, Berlin (Germany); Schwarzkopf, Olaf; Wernet, Philippe [Helmholtz-Zentrum fuer Materialien und Energie (BESSY II), Berlin (Germany); Weinelt, Martin [Max-Born-Institute, Berlin (Germany); Fachbereich Physik, Freie Universitaet, Berlin (Germany)


    We present recent results of time-resolved IR-pump-XUV-probe experiments on the ultrafast demagnetization of thin films of Gadolinium(0001) and Terbium(0001) on Tungsten(110). The experiments are the first to be done using a newly developed high-order harmonics (HHG) XUV beamline at the MBI. The beamline delivers monochromated XUV pulses of approximately 150 fs duration with a photon energy resolution of up to 150 meV. Following excitation by intense femtosecond infrared (IR) pulses, photoemission with 35 eV photons allows us to directly probe the 4f electrons and their interaction with the valence band, both in the bulk and at the surface, to follow the ultrafast magnetization dynamics in the Lanthanide metals. As signatures of ultrafast demagnetization of the metal by the IR pulse, we see for the first time, rapid strong reduction of the exchange splitting in the valence band. This is followed by a slower demagnetization due to the spin-lattice interaction.

  7. Green fluorescence of terbium ions in lithium fluoroborate glasses ...

    Indian Academy of Sciences (India)

    Glasses; terbium ion; oscillator strengths; fluorescence; lifetimes; fibre lasers. 1. Introduction. Today glasses are most favourable engineering materials for abundant applications due to the wide ability of property altering by compositional modifications. The considerable examination of glass science to achieve required ...

  8. Green fluorescence of terbium ions in lithium fluoroborate glasses ...

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science; Volume 39; Issue 3. Green fluorescence of terbium ions in lithium fluoroborate glasses for fibre lasers and display devices. G R DILLIP C MADHUKAR REDDY M RAJESH SHIVANAND CHAURASIA B DEVA PRASAD RAJU S W JOO. Volume 39 Issue 3 June 2016 pp 711-717 ...

  9. Terahertz Cherenkov radiation from ultrafast magnetization in terbium gallium garnet (United States)

    Gorelov, S. D.; Mashkovich, E. A.; Tsarev, M. V.; Bakunov, M. I.


    We report an experimental observation of terahertz Cherenkov radiation from a moving magnetic moment produced in terbium gallium garnet by a circularly polarized femtosecond laser pulse via the inverse Faraday effect. Contrary to some existing theoretical predictions, the polarity of the observed radiation unambiguously demonstrates the paramagnetic, rather than diamagnetic, nature of the ultrafast inverse Faraday effect. From measurements of the radiation field, the Verdet constant in the subpicosecond regime is ˜3-10 times smaller than its table quasistatic value.

  10. 22 CFR 144.140 - Employment. (United States)


    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Employment. 144.140 Section 144.140 Foreign... PROGRAMS OR ACTIVITIES CONDUCTED BY THE UNITED STATES DEPARTMENT OF STATE § 144.140 Employment. No qualified handicapped person shall, on the basis of handicap, be subjected to discrimination in employment...

  11. 40 CFR 144.1 - Purpose and scope of part 144. (United States)


    ... sections have been cleared by the Office of Management and Budget: Sections 144.11, 144.28(c)(d)(i), 144.31... or appropriate to carry out his functions” under SDWA. (e) Overview of the UIC program. An UIC... underground injections by five classes of wells (see definition of “well injection,” § 144.3). The five...

  12. Terbium luminescence in alumina xerogel fabricated in porous anodic alumina matrix under various excitation conditions

    Energy Technology Data Exchange (ETDEWEB)

    Gaponenko, N. V., E-mail: [Belarusian State University of Informatics and Radioelectronics (Belarus); Kortov, V. S. [Yeltsin Ural Federal University (Russian Federation); Orekhovskaya, T. I.; Nikolaenko, I. A. [Belarusian State University of Informatics and Radioelectronics (Belarus); Pustovarov, V. A.; Zvonarev, S. V.; Slesarev, A. I. [Yeltsin Ural Federal University (Russian Federation); Prislopski, S. Ya. [National Academy of Sciences of Belarus, Stepanov Institute of Physics (Belarus)


    Terbium-doped alumina xerogel layers are synthesized by the sol-gel method in pores of a porous anodic alumina film 1 {mu}m thick with a pore diameter of 150-180 nm; the film is grown on a silicon substrate. The fabricated structures exhibit terbium photoluminescence with bands typical of trivalent terbium terms. Terbium X-ray luminescence with the most intense band at 542 nm is observed for the first time for such a structure. Morphological analysis of the structure by scanning electron microscopy shows the presence of xerogel clusters in pore channels, while the main pore volume remains unfilled and pore mouths remain open. The data obtained confirm the promising applications of fabricated structures for developing matrix converters of X-rays and other ionizing radiations into visible light. The possibilities of increasing luminescence intensity in the matrix converter are discussed.

  13. Optical Properties of Lithium Terbium Fluoride and Implications for Performance in High Power Lasers (Postprint) (United States)



  14. Detection of biothiols in cells by a terbium chelate-Hg (II) system (United States)

    Tan, Hongliang; Chen, Yang


    Great efforts have been devoted to the development of sensitive and specific analysis methods for biothiols because of their important roles in biological systems. We present a new detection system for biothiols that is based on the reversible quenching and restoration of fluorescence of terbium chelate caused by Hg2+ and thiol species. In the presence of biothiols, a restoration of fluorescence of terbium chelate after quenching by Hg2+ was observed due to the interaction of Hg2+ with thiol groups, and the restored fluorescence increased with the concentration of biothiols. This method was sensitive and selective for biothiols. The detection limit was 80 nM for glutathione, 100 nM for Hcy, and 400 nM for Cysteine, respectively. The terbium chelate-Hg (II) system was successfully applied to determine the levels of biothiols in cancer cells and urine samples. Further, it was also shown to be comparable to Ellman's assay. Compared to other fluorescence methods, the terbium chelate probe is advantageous because interference from short-lived nonspecific fluorescence can be efficiently eliminated due to the long fluorescence lifetime of terbium chelate, which allows for detection by time-resolved fluorescence. The terbium chelate probe can serve as a diagnostic tool for the detection of abnormal levels of biothiols in disease.

  15. 14 CFR 1260.144 - Procurement procedures. (United States)


    ... 14 Aeronautics and Space 5 2010-01-01 2010-01-01 false Procurement procedures. 1260.144 Section 1260.144 Aeronautics and Space NATIONAL AERONAUTICS AND SPACE ADMINISTRATION GRANTS AND COOPERATIVE... dimensioned in the metric system of measurement. (vi) Preference, to the extent practicable and economically...

  16. Cryogenic temperature characteristics of Verdet constant of terbium sesquioxide ceramics (United States)

    Snetkov, I. L.; Palashov, O. V.


    The dependence of the Verdet constant on temperature in the (80-300 K) range for a promising magneto-active material terbium sesquioxide Tb2O3 at the wavelengths of 405-1064 nm is considered. For each of the studied wavelengths, the Verdet constant of the material cooled down to the liquid nitrogen temperature increased by more than a factor of 3.2 as compared to the room temperature value. Similarly to the other paramagnetics, the increase follows the law ∼1/T. Approximations for the temperature dependence of the Verdet constant have been obtained and the value of 1/V·(dV/dT) has been estimated. This information is needed to determine the angle of rotation as well as the variation of the extinction ratio of a Faraday isolator with temperature and extremely important at creation a cryogenic Faraday devices.

  17. Biogenic terbium oxide nanoparticles as the vanguard against osteosarcoma (United States)

    Iram, Sana; Khan, Salman; Ansary, Abu Ayoobul; Arshad, Mohd; Siddiqui, Sahabjada; Ahmad, Ejaz; Khan, Rizwan H.; Khan, Mohd Sajid


    The synthesis of inner transition metal nanoparticles via an ecofriendly route is quite difficult. This study, for the first time, reports synthesis of terbium oxide nanoparticles using fungus, Fusarium oxysporum. The biocompatible terbium oxide nanoparticles (Tb2O3 NPs) were synthesized by incubating Tb4O7 with the biomass of fungus F. oxysporum. Multiple physical characterization techniques, such as UV-visible and photoluminescence spectroscopy, TEM, SAED, and zeta-potential were used to confirm the synthesis, purity, optical and surface characteristics, crystallinity, size, shape, distribution, and stability of the nanoemulsion of Tb2O3 NPs. The Tb2O3 NPs were found to inhibit the propagation of MG-63 and Saos-2 cell-lines (IC50 value of 0.102 μg/mL) and remained non-toxic up to a concentration of 0.373 μg/mL toward primary osteoblasts. Cell viability decreased in a concentration-dependent manner upon exposure to 10 nm Tb2O3 NPs in the concentration range 0.023-0.373 μg/mL. Cell toxicity was evaluated by observing changes in cell morphology, cell viability, oxidative stress parameters, and FACS analysis. Morphological examinations of cells revealed cell shrinkage, nuclear condensation, and formation of apoptotic bodies. The level of ROS within the cells-an indicator of oxidative stress was significantly increased. The induction of apoptosis at concentrations ≤ IC50 was corroborated by 4‧,6-diamidino-2-phenylindole dihydrochloride (DAPI) staining (DNA damage and nuclear fragmentation). Flow-cytometric studies indicated that the response was dose dependent with a threshold effect.

  18. Autofluorescence-free Live-cell Imaging Using Terbium Nanoparticles. (United States)

    Cardoso Dos Santos, Marcelina; Goetz, Joan; Bartenlian, Hortense; Wong, Ka-Leung; Charbonniere, Loïc Joanny; Hildebrandt, Niko


    Fluorescent nanoparticles (NPs) have become irreplaceable tools for advanced cellular and sub-cellular imaging. While very bright NPs require excitation with UV or visible light, which can create strong autofluorescence of biological components, NIR-excitable NPs without autofluorescence issues exhibit much lower brightness. Here, we show the application of a new type of surface-photosensitized terbium NPs (Tb-NPs) for autofluorescence-free intracellular imaging in live HeLa cells. Combination of exceptionally high brightness, high photostability, and long photoluminecence (PL) lifetimes for highly efficient suppression of the short-lived autofluorescence, allowed for time-gated PL imaging of intracellular vesicles over 72 h without toxicity and at extremely low Tb-NP concentrations down to 12 pM. Detection of highly resolved long-lifetime (ms) PL decay curves from small (~10 µm2) areas within single cells within a few seconds emphasized the unprecedented photophysical properties of Tb-NPs for live-cell imaging that extend well beyond currently available nanometric imaging agents.

  19. Solar Thermochemical Hydrogen Production via Terbium Oxide Based Redox Reactions

    Directory of Open Access Journals (Sweden)

    Rahul Bhosale


    Full Text Available The computational thermodynamic modeling of the terbium oxide based two-step solar thermochemical water splitting (Tb-WS cycle is reported. The 1st step of the Tb-WS cycle involves thermal reduction of TbO2 into Tb and O2, whereas the 2nd step corresponds to the production of H2 through Tb oxidation by water splitting reaction. Equilibrium compositions associated with the thermal reduction and water splitting steps were determined via HSC simulations. Influence of oxygen partial pressure in the inert gas on thermal reduction of TbO2 and effect of water splitting temperature (TL on Gibbs free energy related to the H2 production step were examined in detail. The cycle (ηcycle and solar-to-fuel energy conversion (ηsolar-to-fuel efficiency of the Tb-WS cycle were determined by performing the second-law thermodynamic analysis. Results obtained indicate that ηcycle and ηsolar-to-fuel increase with the decrease in oxygen partial pressure in the inert flushing gas and thermal reduction temperature (TH. It was also realized that the recuperation of the heat released by the water splitting reactor and quench unit further enhances the solar reactor efficiency. At TH=2280 K, by applying 60% heat recuperation, maximum ηcycle of 39.0% and ηsolar-to-fuel of 47.1% for the Tb-WS cycle can be attained.

  20. Folate Receptor Targeted Alpha-Therapy Using Terbium-149

    CERN Document Server

    Müller, Cristina; Haller, Stephanie; Dorrer, Holger; Köster, Ulli; Johnston, Karl; Zhernosekov, Konstantin; Türler, Andreas; Schibli, Roger


    Terbium-149 is among the most interesting therapeutic nuclides for medical applications. It decays by emission of short-range α-particles (Eα = 3.967 MeV) with a half-life of 4.12 h. The goal of this study was to investigate the anticancer efficacy of a 149Tb-labeled DOTA-folate conjugate (cm09) using folate receptor (FR)-positive cancer cells in vitro and in tumor-bearing mice. 149Tb was produced at the ISOLDE facility at CERN. Radiolabeling of cm09 with purified 149Tb resulted in a specific activity of ~1.2 MBq/nmol. In vitro assays performed with 149Tb-cm09 revealed a reduced KB cell viability in a FR-specific and activity concentration-dependent manner. Tumor-bearing mice were injected with saline only (group A) or with 149Tb-cm09 (group B: 2.2 MBq; group C: 3.0 MBq). A significant tumor growth delay was found in treated animals resulting in an increased average survival time of mice which received 149Tb-cm09 (B: 30.5 d; C: 43 d) compared to untreated controls (A: 21 d). Analysis of blood parameters rev...

  1. Hardness and dielectric characteristics of flux grown terbium aluminate crystals

    Energy Technology Data Exchange (ETDEWEB)

    Sharma, K.K.; Kotru, P.N. [Jammu Univ. (India). Dept. of Physics; Tandon, R.P. [National Physical Laboratory, New Delhi (India); Wanklyn, B.M. [Clarendon Laboratory, University of Oxford, Oxford (United Kingdom)


    Results of indentation induced Vickers hardness testing and dielectric studies conducted on flux-grown terbium aluminate crystals are presented. It is shown that the Vickers hardness value (H{sub v}) is independent of indentation time, but depends on the applied load. Applying the concept of Hays and Kendall, the load independent values are estimated for (110) and (001) planes. Differential behaviour in the crack formation of two different planes (110) and (001) is observed, while (001) plane develops Palmqvist cracks in the whole load range of 10-100 g, (110) plane shows a transition from Palmqvist to median cracks at 70 g. The fracture toughness, brittleness index and yield strength are determined for both the planes. The hardness anisotropy is reported. The dielectric constant, dielectric loss and conductivity are shown to be dependent on temperature and frequency of the applied a.c. field. The dielectric constant versus temperature shows a transition peak at 230 C, which remains independent of the frequency of the applied a.c. field in the range 1 kHz-13 MHz. (orig.) 36 refs.

  2. Dicty_cDB: CHF144 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CH (Link to library) CHF144 (Link to dictyBase) - - - Contig-U16411-1 | Contig-U16470-1 CHF...144P (Link to Original site) CHF144F 557 CHF144Z 781 CHF144P 1318 - - Show CHF144 Library CH (Link to library) Clone ID CHF...411-1 | Contig-U16470-1 Original site URL Representative seq. ID CHF144P (Link to Original site) Representative DNA sequence >CHF144 (CHF...144Q) /CSM/CH/CHF1-B/CHF144Q.Seq.d/ TAATAAATAATAATTAAAATTTGCATATATAAAAGAAATAAAAATTTTTTATTTTTTGTA

  3. 9 CFR 381.144 - Packaging materials. (United States)


    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Packaging materials. 381.144 Section... Packaging materials. (a) Edible products may not be packaged in a container which is composed in whole or in... to health. All packaging materials must be safe for the intended use within the meaning of section...

  4. 27 CFR 44.144 - Opening. (United States)


    ... PAYMENT OF TAX, OR WITH DRAWBACK OF TAX Operations by Export Warehouse Proprietors Inventories § 44.144 Opening. An opening inventory shall be made by the export warehouse proprietor at the time of commencing... permit issued under § 44.93. A similar inventory shall be made by the export warehouse proprietor when he...

  5. 40 CFR 144.24 - Class V wells. (United States)


    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Class V wells. 144.24 Section 144.24... INJECTION CONTROL PROGRAM Authorization of Underground Injection by Rule § 144.24 Class V wells. (a) A Class V injection well is authorized by rule, subject to the conditions in § 144.84 (b) Duration of well...

  6. Thermoluminescence of cerium and terbium -doped calcium pyrophosphate

    Energy Technology Data Exchange (ETDEWEB)

    Roman L, J.; Cruz Z, E. [UNAM, Instituto de Ciencias Nucleares, Circuito Exterior, Ciudad Universitaria, 04510 Mexico D. F. (Mexico); Lozano R, I. B.; Diaz G, J. A. I., E-mail: [IPN, Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada, Av. Legaria No. 694, 11500 Mexico D. F. (Mexico)


    The aim of this work is to report the thermoluminescence (Tl) response of Calcium Pyrophosphate phosphor doped with Cerium and Terbium impurities (Ca{sub 2}P{sub 2}O{sub 7}:Ce{sup 3+},Tb{sup 3+}). The phosphors were synthesized using the co-precipitation method and annealed at 900 degrees C by two hours for obtain the β phase. The intentional doping with Ce and Tb ions was 1 at.% and 0.1 at.%, whereas in the EDS results the concentration of impurities was 0.39 at.% and 0.05 at.%, respectively. The superficial morphology of phosphor is mainly composed by thin wafers of different size. All samples were exposed to gamma rays from {sup 60}Co in the Gammacell-200 irradiator. The Tl response of the phosphor was measured from Rt up to 350 degrees C and under nitrogen atmosphere in a Harshaw TLD 3500 reader. The glow curves of the Ca{sub 2}P{sub 2}O{sub 7}:Ce{sup 3+},Tb{sup 3+} powders showed a broad intense Tl peak centered at 165 degrees C and a shoulder at approximate 260 degrees C was observed. A linear Tl response in the range of absorbed dose of 0.2 to 10 Gy was obtained. Tl glow curves were analyzed using the initial rise (IR)and computerized glow curve deconvolution methods to evaluate the kinetics parameters such as activation energy (E), frequency factor (s) and kinetic order (b). (Author)

  7. Dicty_cDB: SLF144 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLF144 (Link to dictyBase) - - - Contig-U09670-1 SLF144E (Link... to Original site) - - - - - - SLF144E 390 Show SLF144 Library SL (Link to library) Clone ID SLF144 (Link Representative seq. ID SLF14...4E (Link to Original site) Representative DNA sequence >SLF144 (SLF144Q) /CSM/SL/SLF1-B/SLF144Q.Seq.d/ AGGCA...mino Acid sequence (All Frames) Frame A: rh*sch*flftf*l*nlctsywsyr*srcpryisfnslk*lfr*ygigw*fn*sltkirt rgsf*i

  8. Dicty_cDB: SLB144 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLB144 (Link to dictyBase) - - - Contig-U16455-1 SLB144Z (Link... to Original site) - - SLB144Z 710 - - - - Show SLB144 Library SL (Link to library) Clone ID SLB144 (Link Representative seq. ID SLB14...4Z (Link to Original site) Representative DNA sequence >SLB144 (SLB144Q) /CSM/SL/SLB1-B/SLB144Q.Seq.d/ XXXXX...29 |pid:none) Acanthamoeba culbertsoni ef1a gene... 321 2e-86 AY643820_1( AY643820 |pid:none) Arcyria denuda

  9. Dicty_cDB: SHF144 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SH (Link to library) SHF144 (Link to dictyBase) - - - Contig-U16333-1 SHF144P (Link to Original site) SHF...144F 627 SHF144Z 547 SHF144P 1154 - - Show SHF144 Library SH (Link to library) Clone ID SHF...e URL Representative seq. ID SHF...144P (Link to Original site) Representative DNA sequence >SHF144 (SHF144Q) /CSM/SH/SHF1-B/SHF...iriisw*tsmcn*cf**ye*fw*f--- ---igisilstwsiikwcfrsv*xw*ckfqir**tf*rfsnyrvsiiq*lqsxhfndewy xryxsi*xfeiexxxps*s

  10. Solvent polarity and oxygen sensitivity, rather than viscosity, determine lifetimes of biaryl-sensitised terbium luminescence. (United States)

    Walter, Edward R H; Williams, J A Gareth; Parker, David


    In a macrocyclic terbium complex incorporating a biaryl sensitiser, the observed variation of emission lifetime is shown to be determined by the solubility of oxygen in the solvent system and the relative energy of the chromophore excited state, rather than any dependence on solvent viscosity.

  11. The 144Ce source for SOX (United States)

    Durero, M.; Vivier, M.; Agostini, M.; Altenmüller, K.; Appel, S.; Bellini, G.; Benziger, J.; Berton, N.; Bick, D.; Bonfini, G.; Bravo, D.; Caccianiga, B.; Calaprice, F.; Caminata, A.; Cavalcante, P.; Chepurnov, A.; Choi, K.; Cribier, M.; D'Angelo, D.; Davini, S.; Derbin, A.; Di Noto, L.; Drachnev, I.; Etenko, A.; Farinon, S.; Fischer, V.; Fomenko, K.; Franco, D.; Gabriele, F.; Gaffiot, J.; Galbiati, C.; Ghiano, C.; Giammarchi, M.; Goeger-Neff, M.; Goretti, A.; Gromov, M.; Hagner, C.; Houdy, T.; Hungerford, E.; Ianni, Aldo; Ianni, Andrea; Jonqueres, N.; Jedrzejczak, K.; Kaiser, M.; Kobychev, V.; Korablev, D.; Korga, G.; Kornoukhov; Kryn, D.; Lachenmaier, T.; Lasserre, T.; Laubenstein, M.; Lehnert, B.; Link, J.; Litvinovich, E.; Lombardi, F.; Lombardi, P.; Ludhova, L.; Lukyanchenko, G.; Machulin, I.; Manecki, S.; Maneschg, W.; Marcocci, S.; Maricic, J.; Mention, G.; Meroni, E.; Meyer, M.; Miramonti, L.; Misiaszek, M.; Montuschi, M.; Muratova, V.; Musenich, R.; Neumair, B.; Oberauer, L.; Obolensky, M.; Ortica, F.; Pallavicini, M.; Papp, L.; Perasso, L.; Pocar, A.; Ranucci, G.; Razeto, A.; Re, A.; Romani, A.; Roncin, R.; Rossi, N.; Schönert, S.; Scola, L.; Semenov, D.; Simgen, H.; Skorokhvatov, M.; Smirnov, O.; Sotnikov, A.; Sukhotin, S.; Suvorov; Tartaglia, R.; Testera, G.; Thurn, J.; Toropova, M.; Veyssiére, C.; Unzhakov, E.; Vogelaar, R. B.; von Feilitzsch, F.; Wang, H.; Weinz, S.; Winter, J.; Wojcik, M.; Wurm, M.; Yokley, Z.; Zaimidoroga, O.; Zavatarelli, S.; Zuber, K.; Zuzel, G.


    The SOX (Short distance neutrino Oscillations with BoreXino) project aims at testing the light sterile neutrino hypothesis. To do so, two artificials sources of antineutrinos and neutrinos respectively will be consecutively deployed at the Laboratori Nazionali del Gran Sasso (LNGS) in close vicinity to Borexino, a large liquid scintillator detector. This document reports on the source production and transportation. The source should exhibit a long lifetime and a high decay energy, a requirement fullfilled by the 144Ce-144Pr pair at secular equilibrium. It will be produced at FSUE “Mayak” PA using spent nuclear fuel. It will then be shielded and packed according to international regulation and shipped to LNGS across Europe. Knowledge of the Cerium antineutrino generator (CeANG) parameters is crucial for SOX as it can strongly impact the experiment sensitivity. Several apparatuses are being used or designed to characterize CeANG activity, radioactive emission and content. An overview of the measurements performed so far is presented here.

  12. MicroRNA-144 inhibits hepatocellular carcinoma cell proliferation ...

    Indian Academy of Sciences (India)

    MicroRNA 144 (miR-144), a small non-coding RNA, is frequently dysregulated in human several tumour progression,but its role and the underlying mechanisms in hepatocellular carcinoma (HCC) is poorly investigated. In thepresent study, the expression of miR-144 was firstly analysed in datasets derived from GSE21362 ...

  13. 19 CFR 144.36 - Withdrawal for transportation. (United States)


    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Withdrawal for transportation. 144.36 Section 144... § 144.36 Withdrawal for transportation. (a) Time limit. Merchandise may be withdrawn from warehouse for transportation to another port of entry if withdrawal for consumption or exportation can be accomplished at the...

  14. 19 CFR 144.23 - Endorsement in blank. (United States)


    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Endorsement in blank. 144.23 Section 144.23 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE... Merchandise from Warehouse § 144.23 Endorsement in blank. If the transferor wishes to do so, he may endorse...

  15. 19 CFR 144.25 - Deposit of forms. (United States)


    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Deposit of forms. 144.25 Section 144.25 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY... Warehouse § 144.25 Deposit of forms. Either the transferor or the transferee may deposit the endorsed...

  16. 42 CFR 456.144 - Data sources for studies. (United States)


    ... 42 Public Health 4 2010-10-01 2010-10-01 false Data sources for studies. 456.144 Section 456.144 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL ASSISTANCE PROGRAMS UTILIZATION CONTROL Utilization Control: Hospitals Ur Plan: Medical Care Evaluation Studies § 456.144 Data sources...

  17. 9 CFR 319.144 - Whole hog sausage. (United States)


    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Whole hog sausage. 319.144 Section 319.144 Animals and Animal Products FOOD SAFETY AND INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE AGENCY... CERTIFICATION DEFINITIONS AND STANDARDS OF IDENTITY OR COMPOSITION Sausage Generally: Fresh Sausage § 319.144...

  18. 19 CFR 144.1 - Merchandise eligible for warehousing. (United States)


    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Merchandise eligible for warehousing. 144.1 Section 144.1 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY... § 144.1 Merchandise eligible for warehousing. (a) Types of merchandise. Any merchandise subject to duty...

  19. 17 CFR 14.4 - Violation of Commodity Exchange Act. (United States)


    ... 17 Commodity and Securities Exchanges 1 2010-04-01 2010-04-01 false Violation of Commodity Exchange Act. 14.4 Section 14.4 Commodity and Securities Exchanges COMMODITY FUTURES TRADING COMMISSION RULES RELATING TO SUSPENSION OR DISBARMENT FROM APPEARANCE AND PRACTICE § 14.4 Violation of Commodity...

  20. 5 CFR 185.144 - Right to administrative offset. (United States)


    ... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Right to administrative offset. 185.144 Section 185.144 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS PROGRAM FRAUD CIVIL REMEDIES § 185.144 Right to administrative offset. The amount of any penalty or assessment...

  1. 19 CFR 144.3 - Allowance for damage. (United States)


    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Allowance for damage. 144.3 Section 144.3 Customs... (CONTINUED) WAREHOUSE AND REWAREHOUSE ENTRIES AND WITHDRAWALS General Provisions § 144.3 Allowance for damage. No abatement or allowance of duties shall be made on account of damage, loss, or deterioration of the...

  2. Arginine-responsive terbium luminescent hybrid sensors triggered by two crown ether carboxylic acids

    Energy Technology Data Exchange (ETDEWEB)

    Jiang, Lasheng [Key Laboratory of Theoretical Chemistry of Environment, Ministry of Education, School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); Tang, Ke; Ding, Xiaoping [School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); Wang, Qianming, E-mail: [Key Laboratory of Theoretical Chemistry of Environment, Ministry of Education, School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); Zhou, Zhan; Xiao, Rui [School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China)


    Crown ether carboxylic acids constitute main building blocks for the synthesis of terbium containing covalent cross-linked luminescent materials. Both the complexes and the hybrid nanomaterials could exhibit remarkable green emissions in pure water. More importantly, they were found to have a profound effect on the luminescence responses to arginine compared with glutamic acid, histidine, tryptophan, threonine, tyrosine and phenylalanine in aqueous environment. The present study provided the possibility of using a host–guest mechanism as a way of signal transduction based on lanthanide supramolecular hybrid materials. - Highlights: • Crown ether carboxylic acids were found to sensitize terbium ions among a group of ethers. • The complexes and silica hybrid materials were both prepared and characterized. • They could exhibit remarkable green emissions in pure water.

  3. Comparative analysis of conjugated alkynyl chromophore-triazacyclononane ligands for sensitized emission of europium and terbium. (United States)

    Soulié, Marine; Latzko, Frédéric; Bourrier, Emmanuel; Placide, Virginie; Butler, Stephen J; Pal, Robert; Walton, James W; Baldeck, Patrice L; Le Guennic, Boris; Andraud, Chantal; Zwier, Jurriaan M; Lamarque, Laurent; Parker, David; Maury, Olivier


    A series of europium and terbium complexes based on a functionalized triazacyclononane carboxylate or phosphinate macrocyclic ligand is described. The influence of the anionic group, that is, carboxylate, methylphosphinate, or phenylphosphinate, on the photophysical properties was studied and rationalized on the basis of DFT calculated structures. The nature, number, and position of electron-donating or electron-withdrawing aryl substituents were varied systematically within the same phenylethynyl scaffold in order to optimize the brightness of the corresponding europium complexes and investigate their two-photon absorption properties. Finally, the europium complexes were examined in cell-imaging applications, and selected terbium complexes were studied as potential oxygen sensors. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Spectrofluorimetric Determination of Human Serum Albumin Using Terbium-Danofloxacin Probe


    Ramezani, Amir M.; Manzoori, Jamshid L.; Amjadi, Mohammad; Jouyban, Abolghasem


    A spectrofluorimetric method is proposed for the determination of human serum albumin (HSA) and bovine serum albumin (BSA) using terbium-danofloxacin (Tb3+-Dano) as a fluorescent probe. These proteins remarkably enhance the fluorescence intensity of the Tb3+-Dano complex at 545 nm, and the enhanced fluorescence intensity of Tb3+-Dano is proportional to the concentration of proteins (HSA and BSA). Optimum conditions for the determination of HSA were investigated and found that the maximum resp...

  5. Genetically Encoded FRET-Sensor Based on Terbium Chelate and Red Fluorescent Protein for Detection of Caspase-3 Activity

    Directory of Open Access Journals (Sweden)

    Alexander S. Goryashchenko


    Full Text Available This article describes the genetically encoded caspase-3 FRET-sensor based on the terbium-binding peptide, cleavable linker with caspase-3 recognition site, and red fluorescent protein TagRFP. The engineered construction performs two induction-resonance energy transfer processes: from tryptophan of the terbium-binding peptide to Tb3+ and from sensitized Tb3+ to acceptor—the chromophore of TagRFP. Long-lived terbium-sensitized emission (microseconds, pulse excitation source, and time-resolved detection were utilized to eliminate directly excited TagRFP fluorescence and background cellular autofluorescence, which lasts a fraction of nanosecond, and thus to improve sensitivity of analyses. Furthermore the technique facilitates selective detection of fluorescence, induced by uncleaved acceptor emission. For the first time it was shown that fluorescence resonance energy transfer between sensitized terbium and TagRFP in the engineered construction can be studied via detection of microsecond TagRFP fluorescence intensities. The lifetime and distance distribution between donor and acceptor were calculated using molecular dynamics simulation. Using this data, quantum yield of terbium ions with binding peptide was estimated.

  6. Green light emission in aluminum oxide powders doped with different terbium concentrations

    Energy Technology Data Exchange (ETDEWEB)

    Mariscal B, L; Falcony, C. [IPN, Centro de Investigacion y de Estudios Avanzados, 07360 Ciudad de Mexico (Mexico); Carmona T, S.; Murrieta, H.; Sanchez A, M. A. [UNAM, Instituto de Fisica, 04510 Ciudad de Mexico (Mexico); Vazquez A, R. [IPN, Escuela Superior de Computo, 07738 Ciudad de Mexico (Mexico); Garcia R, C. M., E-mail: [UNAM, Facultad de Ciencias, 04510 Ciudad de Mexico (Mexico)


    Different emission intensities presented in aluminum oxide phosphors corresponding to different concentrations of doping performed with terbium are analyzed. The phosphors were synthesized by the evaporation technique and were characterized by photo and cathodoluminescence, X-ray diffraction and EDS techniques for different incorporation percentages of terbium as dopant; they show characteristic transitions in 494, 543, 587 and 622 nm, corresponding to {sup 5}D{sub 4} → {sup 7}F{sub 6}, {sup 5}D{sub 4} → {sup 7}F{sub 5}, {sup 5}D{sub 4} → {sup 7}F{sub 4} and {sup 5}D{sub 4} → {sup 7}F{sub 3}, respectively when they are excited with λ{sub exc} = 380 nm wavelength at room temperature. The results of X-ray diffraction show the presence of α-Al{sub 2}O{sub 3} phases with peaks located at 2θ = 25.78, 35.34, 37.96, 43.56, 45.8, 52.74, 57.7, 61.5, 66.74, 68.44, 77.12 and 80.94, and the δ-Al{sub 2}O-3 phase 2θ = 32.82, 45.8, 61.36 and 66.74. These compounds were heat treated for two hours at 1100 degrees Celsius. EDS analyzes indicate that these compounds have close to 60% oxygen around of 40% aluminum in the presence of terbium as dopant which indicates a stoichiometry close to the expected one for alumina. (Author)

  7. Graphene quantum dots-terbium ions as novel sensitive and selective time-resolved luminescent probes. (United States)

    Llorent-Martínez, Eulogio J; Durán, Gema M; Ríos, Ángel; Ruiz-Medina, Antonio


    We propose an alternative approach for the development of analytical methods based on terbium-sensitized luminescence (TSL). TSL is based on the complexation between Tb(III) ions and fluorescent organic compounds that have appropriate functional groups to complex with Tb(III). We report the use of graphene quantum dot (GQDs) nanoparticles to improve the sensitivity and selectivity of TSL detection. GQDs can react with terbium ions through the carboxylic groups present in their structure. These Tb(III)-GQD complexes, formed in situ in aqueous solution, can be used as time-resolved luminescent probes. Ascorbic acid was selected as a target analyte to demonstrate the suitability of the proposed method. The selectivity of the TSL method was highly improved for most of the interferences tested. Under the optimum conditions [Tb(III) concentration 5 × 10-4 mol L-1, GQD concentration 4 mg L-1], a minimum 100% increase in selectivity was observed for several vitamins and common cations that may be present in the samples to be analyzed. In addition, the analytical signal showed a 30% enhancement with the use of GQDs compared with the use of merely Tb(III) ions, with a detection limit of 0.12 μg mL-1. The repeatability and intermediate precision were lower than 3% and 5%, respectively. From the results obtained, the implementation of GQDs in TSL can lead to the development of novel time-resolved luminescent probes with high analytical potential. Graphical abstract Quenching of Tb(III)-graphene quantum dot (GQD) luminescence by ascorbic acid (AA). TBL terbium-sensitized luminescence.

  8. Fluorescence study of some terbium-oligopeptide complexes in methanolic solution. (United States)

    Rabouan, S; Delage, J; Durand, W; Prognon, P; Barthes, D


    This study concerned the use of lanthanide chelates to detect glycyl-leucyl-phenylalanine (GLF) and its homologues. Spectroscopic analysis of peptides without or with terbium complexation revealed the formation of (LF)(3)(Tb)(2), (GF)(3)(Tb)(2), (GLF)(3)(Tb)(2) and (FL)(4)Tb, (FG)(4)Tb complexes with high stability constants in methanolic solutions (pK(d)>13). Lanthanide chelate emission displayed a large Stokes shift (>270 nm), which allowed Tb chelates of GLF and its derivatives to be used for detection purposes. However, this preliminary study indicated some important limitations associated with lanthanide chelation, such as high methanolic content.

  9. Electromagnetic properties of terbium gallium garnet at millikelvin temperatures and low photon energy (United States)

    Kostylev, Nikita; Goryachev, Maxim; Bushev, Pavel; Tobar, Michael E.


    Electromagnetic properties of single crystal terbium gallium garnet are characterised from room down to millikelvin temperatures using the whispering gallery mode method. Microwave spectroscopy is performed at low powers equivalent to a few photons in energy and conducted as functions of the magnetic field and temperature. A phase transition is detected close to the temperature of 3.5 K. This is observed for multiple whispering gallery modes causing an abrupt negative frequency shift and a change in transmission due to extra losses in the new phase caused by a change in complex magnetic susceptibility.

  10. Nuclear excitation functions from 40 to 200 MeV proton irradiation of terbium

    Energy Technology Data Exchange (ETDEWEB)

    Engle, Jonathan W., E-mail:; Mashnik, Stepan G.; Parker, Lauren A.; Jackman, Kevin R.; Bitteker, Leo J.; Ullmann, John L.; Gulley, Mark S.; Pillai, Chandra; John, Kevin D.; Birnbaum, Eva R.; Nortier, Francois M.


    Nuclear formation cross sections are reported for 26 radionuclides, measured with 40–200 MeV proton irradiations of terbium foils. These data provide the basis for the production of medically relevant radionuclides (e.g., {sup 152}Tb, {sup 155}Tb, {sup 155}Eu, and {sup 156}Eu) and {sup 153}Gd, a potential source used in ongoing efforts to characterize stellar nucleosynthesis routes. Computational predictions from the ALICE2011, CEM03.03, Bertini, and INCL + ABLA codes are compared with newly measured data to contribute to the ongoing process of code development, and yields are calculated for selected radionuclides using measured data.

  11. 19 CFR 144.5 - Period of warehousing. (United States)


    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Period of warehousing. 144.5 Section 144.5 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY... warehousing. Merchandise must not remain in a bonded warehouse beyond 5 years from the date of importation or...

  12. 40 CFR 144.4 - Considerations under Federal law. (United States)


    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Considerations under Federal law. 144... (CONTINUED) UNDERGROUND INJECTION CONTROL PROGRAM General Provisions § 144.4 Considerations under Federal law. The following is a list of Federal laws that may apply to the issuance of permits under these rules...

  13. 33 CFR 144.01-30 - First-aid kit. (United States)


    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false First-aid kit. 144.01-30 Section...) OUTER CONTINENTAL SHELF ACTIVITIES LIFESAVING APPLIANCES Manned Platforms § 144.01-30 First-aid kit. On each manned platform a first-aid kit approved by the Commandant or the U.S. Bureau of Mines shall be...

  14. MicroRNA-144 inhibits hepatocellular carcinoma cell proliferation ...

    Indian Academy of Sciences (India)


    Jan 20, 2017 ... present study, the expression of miR-144 was firstly analysed in datasets derived from GSE21362 and TCGA, and then detected in HCC tissues and cell lines by quantitative RT-PCR (qRT-PCR) analysis. MiR-144 was shown to be significantly down-regulated in HCC tissues and cell lines. Subsequently ...

  15. 24 CFR 100.144 - Scope of privilege. (United States)


    ... DISCRIMINATORY CONDUCT UNDER THE FAIR HOUSING ACT Discrimination in Residential Real Estate-Related Transactions... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Scope of privilege. 100.144 Section 100.144 Housing and Urban Development Regulations Relating to Housing and Urban Development OFFICE OF...

  16. 21 CFR 522.144 - Arsenamide sodium aqueous injection. (United States)


    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Arsenamide sodium aqueous injection. 522.144 Section 522.144 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES... evidence of reduced liver function, a more conservative dosage schedule of 0.1 milliliter per pound of body...

  17. 21 CFR 133.144 - Granular and stirred curd cheese. (United States)


    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Granular and stirred curd cheese. 133.144 Section... (CONTINUED) FOOD FOR HUMAN CONSUMPTION CHEESES AND RELATED CHEESE PRODUCTS Requirements for Specific Standardized Cheese and Related Products § 133.144 Granular and stirred curd cheese. (a) Description. (1...

  18. 14 CFR 135.144 - Portable electronic devices. (United States)


    ... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Portable electronic devices. 135.144... Equipment § 135.144 Portable electronic devices. (a) Except as provided in paragraph (b) of this section, no... portable electronic device on any of the following U.S.-registered civil aircraft operating under this part...

  19. 27 CFR 20.144 - Packages of completely denatured alcohol. (United States)


    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Packages of completely denatured alcohol. 20.144 Section 20.144 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS DISTRIBUTION AND USE OF DENATURED ALCOHOL AND RUM Sale...

  20. 27 CFR 9.144 - Texas High Plains. (United States)


    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Texas High Plains. 9.144 Section 9.144 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT... Mexico; Texas” 1954, revised 1973. (2) “Brownfield, Texas; New Mexico” 1954, revised 1973. (3) “Hobbs...

  1. 49 CFR 572.144 - Thorax assembly and test procedure. (United States)


    ... 49 Transportation 7 2010-10-01 2010-10-01 false Thorax assembly and test procedure. 572.144...-year-Old Child Crash Test Dummy, Alpha Version § 572.144 Thorax assembly and test procedure. (a) Thorax (upper torso) assembly (refer to § 572.140(a)(1)(iv)). The thorax consists of the upper part of the torso...

  2. 40 CFR 61.144 - Standard for manufacturing. (United States)


    ... 40 Protection of Environment 8 2010-07-01 2010-07-01 false Standard for manufacturing. 61.144... § 61.144 Standard for manufacturing. (a) Applicability. This section applies to the following manufacturing operations using commercial asbestos. (1) The manufacture of cloth, cord, wicks, tubing, tape...

  3. 10 CFR 1.44 - Office of New Reactors. (United States)


    ... 10 Energy 1 2010-01-01 2010-01-01 false Office of New Reactors. 1.44 Section 1.44 Energy NUCLEAR... Office of New Reactors. The Office of New Reactors— (a) Develops, promulgates and implements regulations... safeguarding of nuclear reactor facilities licensed under part 52 of this chapter prior to initial commencement...

  4. 40 CFR 52.144 - Significant deterioration of air quality. (United States)


    ... quality. 52.144 Section 52.144 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR... deterioration of air quality. (a) The requirements of sections 160 through 165 of the Clean Act are not met... lands does not include approvable procedures for preventing the significant deterioration of air quality...

  5. 33 CFR 144.20-5 - Exposure suits. (United States)


    ... § 144.20-5 Exposure suits. This section applies to each MODU except those operating south of 32 degrees... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Exposure suits. 144.20-5 Section... MODU must carry an exposure suit for each person on board. The exposure suit must be stowed in a...

  6. Micelle-enhanced and terbium-sensitized spectrofluorimetric determination of gatifloxacin and its interaction mechanism (United States)

    Guo, Changchuan; Wang, Lei; Hou, Zhun; Jiang, Wei; Sang, Lihong


    A terbium-sensitized spectrofluorimetric method using an anionic surfactant, sodium dodecyl benzene sulfonate (SDBS), was developed for the determination of gatifloxacin (GFLX). A coordination complex system of GFLX-Tb 3+-SDBS was studied. It was found that SDBS significantly enhanced the fluorescence intensity of the complex (about 11-fold). Optimal experimental conditions were determined as follows: excitation and emission wavelengths of 331 and 547 nm, pH 7.0, 2.0 × 10 -4 mol l -1 terbium (III), and 2.0 × 10 -4 mol l -1 SDBS. The enhanced fluorescence intensity of the system (Δ If) showed a good linear relationship with the concentration of GFLX over the range of 5.0 × 10 -10 to 5.0 × 10 -8 mol l -1 with a correlation coefficient of 0.9996. The detection limit (3 σ) was determined as 6.0 × 10 -11 mol l -1. This method has been successfully applied to the determination of GFLX in pharmaceuticals and human urine/serum samples. Compared with most of other methods reported, the rapid and simple procedure proposed in the text offers higher sensitivity, wider linear range, and better stability. The interaction mechanism of the system is also studied by the research of ultraviolet absorption spectra, surface tension, solution polarity and fluorescence polarization.

  7. Circularly Polarized Luminescence in Enantiopure Europium and Terbium Complexes with Modular, All-Oxygen Donor Ligands (United States)

    Seitz, Michael; Do, King; Ingram, Andrew J.; Moore, Evan G.; Muller, Gilles; Raymond, Kenneth N.


    Abstract: Circulaly polarized luminescence from terbium(III) complexed and excited by chiral antenna ligands gives strong emission The modular synthesis of three new octadentate, enantiopure ligands are reported - one with the bidentate chelating unit 2-hydroxyisophthalamide (IAM) and two with 1-hydroxy-2-pyridinone (1,2-HOPO) units. A new design principle is introduced for the chiral, non-racemic hexamines which constitute the central backbones for the presented class of ligands. The terbium(III) complex of the IAM ligand, as well as the europium(III) complexes of the 1,2-HOPO ligands are synthesized and characterized by various techniques (NMR, UV, CD, luminescence spectroscopy). All species exhibit excellent stability and moderate to high luminescence efficiency (quantum yields ΦEu = 0.05–0.08 and ΦTb = 0.30–0.57) in aqueous solution at physiological pH. Special focus is put onto the properties of the complexes in regard to circularly polarized luminescence (CPL). The maximum luminescence dissymmetry factors (glum) in aqueous solution are high with |glum|max = 0.08 – 0.40. Together with the very favorable general properties (good stability, high quantum yields, long lifetimes), the presented lanthanide complexes can be considered as good candidates for analytical probes based on CPL in biologically relevant environments. PMID:19639983

  8. Phenotype abnormality: 144 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 144 decreased efficiency... in organ named chloroplast during process named chloroplast fission ... decreased efficiency ...

  9. 7 CFR 58.144 - Pasteurization or ultra-pasteurization. (United States)



  10. Luminescent method of determination of composition of europium and terbium complexes in solution by change of intensity ratio of luminescence bands

    Energy Technology Data Exchange (ETDEWEB)

    Bel' tyukova, S.V.; Nazarenko, N.A.; Poluehktov, N.S.


    The complexes of europium and terbium with phenanthroline, ethylenediaminetetraacetate, nitrilotriacetate, some acids-phenol derivatives and ..beta..-diketones series have been used as an example to demonstrate that the value of the ratio of intensities on the two bands of europium(terbium) luminescence spectra - the one corresponding to the hypersensitive'' transition and the other, to the magnetic dipole one - can be used for determination of the complexes composition in solutions.

  11. Thermo-transferred thermoluminescence (TTTl) in potassium-yttrium double fluoride doped with terbium

    Energy Technology Data Exchange (ETDEWEB)

    Gallegos, A.; Rivera, T.; Diaz G, J. A. [IPN, Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada, Legaria 694, Col. Irrigacion, 11500 Mexico D. F. (Mexico); Azorin, J. [Universidad Autonoma Metropolitana, Unidad Iztapalapa, San Rafael Atlixco No. 186, Col. Vicentina, 09340 Mexico D. F. (Mexico); Azorin, J. C. [Universidad de Guanajuato, Division de Ciencias e Ingenierias-Campus Leon, Lomas del Bosque No. 103, Col. Lomas del Campestre, 37000 Leon, Guanajuato (Mexico); Licona, R.; Rivas, F.; Hernandez C, G. [Benemerita Universidad Autonoma de Puebla, Facultad de Ciencias Quimicas, 14 Sur y San Claudio, Ciudad Universitaria, Puebla de Zaragoza, Puebla (Mexico); Khaidukov, N. [Institute of General and Inorganic Chemistry, Lenin SK 11 Prospect 31, Moscow 117907 (Russian Federation)


    This paper presents results of studying the thermo-transferred thermoluminescence (TTTl) phenomenon in potassium-yttrium double fluoride doped with terbium (K{sub 2}YF{sub 5:}Tb) at different impurity concentrations (0.8%, 0.95% and 0.99%). Previously to study the TTTl phenomenon, structural characterization and chemical composition of the materials were determined. The structural studies were conducted using a scanning electron microscope; meanwhile, chemical composition was analyzed using energy dispersive X-ray spectroscopy. Thermoluminescence kinetics was studied irradiating the samples with {sup 137}Cs gamma rays as well as with {sup 90}Sr/{sup 90}Y beta rays, analyzing the glow curves by the deconvolution method for obtaining the kinetic parameters. (Author)

  12. The influence of pressure on the photoluminescence properties of a terbium-adipate framework (United States)

    Spencer, Elinor C.; Zhao, Jing; Ross, Nancy L.; Andrews, Michael B.; Surbella, Robert G.; Cahill, Christopher L.


    The influence of pressure (over the 0-4.7 GPa range) on the photoluminescence emissions and crystal structure of the known 3D terbium-adipate metal-organic framework material Tb-GWMOF6 has been evaluated by high-pressure single-crystal X-ray diffraction and spectroscopic techniques. The results from this study show that this complex lanthanide framework structure undergoes three phase transitions within the 0-4 GPa pressure range that involve alterations in the number of symmetry independent Tb3+ ion sites within the crystal lattice. These pressure induced modifications to the structure of Tb-GWMOF6 lead to pronounced changes in the profiles of the 5D4→7F5 emission spectra of this complex.

  13. Terbium Radionuclides for Theranostics Applications: A Focus On MEDICIS-PROMED (United States)

    Cavaier, R. Formento; Haddad, F.; Sounalet, T.; Stora, T.; Zahi, I.

    A new facility, named CERN-MEDICIS, is under construction at CERN to produce radionuclides for medical applications. In parallel, the MEDICIS-PROMED, a Marie Sklodowska-Curie innovative training network of the Horizon 2020 European Commission's program, is being coordinated by CERN to train young scientists on the production and use of innovative radionuclides and develop a network of experts within Europe. One program within MEDICIS-PROMED is to determine the feasibility of producing innovative radioisotopes for theranostics using a commercial middle-sized high-current cyclotron and the mass separation technology developed at CERN-MEDICIS. This will allow the production of high specific activity radioisotopes not achievable with the common post-processing by chemical separation. Radioisotopes of scandium, copper, arsenic and terbium have been identified. Preliminary studies of activation yield and irradiation parameters optimization for the production of Tb-149 will be described.

  14. Dielectric and conducting behavior of gadolinium-terbium fumarate heptahydrate crystals (United States)

    Shah, M. D.; Want, B.


    Gadolinium-terbium fumarate heptahydrate crystals were grown in silica gel by using single gel diffusion technique. The crystals were characterized by different physico-chemical techniques of characterization. Powder X-ray diffraction results showed that the grown material is purely crystalline in nature. Elemental analyses suggested the chemical formula of the compound to be Gd Tb (C4H2O4)3ṡ7H2O. Energy dispersive X-ray analysis confirmed the presence of Gd and Tb in the title compound. The dielectric and conductivity studies of the grown compound were carried as function of frequency of applied field and the temperature. The grown material showed a dielectric anomaly which was correlated with its thermal behavior. The ac conductivity of the material showed Jonscher's power law behavior: σ(ω)=σo+Aωs, with a temperature-dependent power exponent s(<1). The conductivity was found to be a function of temperature and frequency.

  15. Highly sensitive detection of dipicolinic acid with a water-dispersible terbium-metal organic framework. (United States)

    Bhardwaj, Neha; Bhardwaj, Sanjeev; Mehta, Jyotsana; Kim, Ki-Hyun; Deep, Akash


    The sensitive detection of dipicolinic acid (DPA) is strongly associated with the sensing of bacterial organisms in food and many types of environmental samples. To date, the demand for a sensitive detection method for bacterial toxicity has increased remarkably. Herein, we investigated the DPA detection potential of a water-dispersible terbium-metal organic framework (Tb-MOF) based on the fluorescence quenching mechanism. The Tb-MOF showed a highly sensitive ability to detect DPA at a limit of detection of 0.04nM (linear range of detection: 1nM to 5µM) and also offered enhanced selectivity from other commonly associated organic molecules. The present study provides a basis for the application of Tb-MOF for direct, convenient, highly sensitive, and specific detection of DPA in the actual samples. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. A New Bis(phthalocyaninato) Terbium Single-Ion Magnet with an Overall Excellent Magnetic Performance. (United States)

    Chen, Yuxiang; Ma, Fang; Chen, Xiaoxiang; Dong, Bowei; Wang, Kang; Jiang, Shangda; Wang, Chiming; Chen, Xin; Qi, Dongdong; Sun, Haoling; Wang, Bingwu; Gao, Song; Jiang, Jianzhuang


    Bulky and strong electron-donating dibutylamino groups were incorporated onto the peripheral positions of one of the two phthalocyanine ligands in the bis(phthalocyaninato) terbium complex, resulting in the isolation of heteroleptic double-decker (Pc)Tb{Pc[N(C4H9)2]8} {Pc = phthalocyaninate; Pc[N(C4H9)2]8 = 2,3,9,10,16,17,23,24-octakis(dibutylamino)phthalocyaninate} with the nature of an unsymmetrical molecular structure, a square-antiprismatic coordination geometry, an intensified coordination field strength, and the presence of organic radical-f interaction. As a total result of all these factors, this sandwich-type tetrapyrrole lanthanide single-ion magnet (SIM) exhibits an overall enhanced magnetic performance including a high blocking temperature (TB) of 30 K and large effective spin-reversal energy barrier of Ueff = 939 K, rendering it the best sandwich-type tetrapyrrole lanthanide SIM reported thus far.

  17. Ultralarge magneto-optic rotations and rotary dispersion in terbium gallium garnet single crystal. (United States)

    Shaheen, Amrozia; Majeed, Hassaan; Anwar, Muhammad Sabieh


    We report systematically acquired data on the Verdet constant of terbium gallium garnet for wavelengths ranging from visible to near-infrared (405-830 nm) regime. Our experimental method of Stokes polarimetry is based on the Fourier decomposition of the received light intensity and allows unambiguous determination of both the Faraday rotation and the ellipticity of the emergent light. Temperature-dependent investigations in the range of 8-300 K extend earlier reports and verify the Verdet's constant direct dependence on the magnetization, whose first-order approximation is simply a manifestation of the Curie's law. Further, a least-squares fitting of the experimental data correlates well with theoretical predictions. At a wavelength of 405 nm and temperature of 8 K, the rotation is approximately 500°.

  18. Terbium fluorescence as a sensitive, inexpensive probe for UV-induced damage in nucleic acids

    Energy Technology Data Exchange (ETDEWEB)

    El-Yazbi, Amira F.; Loppnow, Glen R., E-mail:


    Graphical abstract: -- Highlights: •Simple, inexpensive, mix-and-read assay for positive detection of DNA damage. •Recognition of undamaged DNA via hybridization to a hairpin probe. •Terbium(III) fluorescence reports the amount of damage by binding to ssDNA. •Tb/hairpin is a highly selective and sensitive fluorescent probe for DNA damage. -- Abstract: Much effort has been focused on developing methods for detecting damaged nucleic acids. However, almost all of the proposed methods consist of multi-step procedures, are limited, require expensive instruments, or suffer from a high level of interferences. In this paper, we present a novel simple, inexpensive, mix-and-read assay that is generally applicable to nucleic acid damage and uses the enhanced luminescence due to energy transfer from nucleic acids to terbium(III) (Tb{sup 3+}). Single-stranded oligonucleotides greatly enhance the Tb{sup 3+} emission, but duplex DNA does not. With the use of a DNA hairpin probe complementary to the oligonucleotide of interest, the Tb{sup 3+}/hairpin probe is applied to detect ultraviolet (UV)-induced DNA damage. The hairpin probe hybridizes only with the undamaged DNA. However, the damaged DNA remains single-stranded and enhances the intrinsic fluorescence of Tb{sup 3+}, producing a detectable signal directly proportional to the amount of DNA damage. This allows the Tb{sup 3+}/hairpin probe to be used for sensitive quantification of UV-induced DNA damage. The Tb{sup 3+}/hairpin probe showed superior selectivity to DNA damage compared to conventional molecular beacons probes (MBs) and its sensitivity is more than 2.5 times higher than MBs with a limit of detection of 4.36 ± 1.2 nM. In addition, this probe is easier to synthesize and more than eight times cheaper than MBs, which makes its use recommended for high-throughput, quantitative analysis of DNA damage.

  19. Fine- and hyperfine structure investigations of even configuration system of atomic terbium (United States)

    Stefanska, D.; Elantkowska, M.; Ruczkowski, J.; Furmann, B.


    In this work a parametric study of the fine structure (fs) and the hyperfine structure (hfs) for the even-parity configurations of atomic terbium (Tb I) is presented, based in considerable part on the new experimental results. Measurements on 134 spectral lines were performed by laser induced fluorescence (LIF) in a hollow cathode discharge lamp; on this basis, the hyperfine structure constants A and B were determined for 52 even-parity levels belonging to the configurations 4f85d6s2, 4f85d26s or 4f96s6p; in all the cases those levels were involved in the transitions investigated as the lower levels. For 40 levels the hfs was examined for the first time, and for the remaining 12 levels the new measurements supplement our earlier results. As a by-product, also preliminary values of the hfs constants for 84 odd-parity levels were determined (the investigations of the odd-parity levels system in the terbium atom are still in progress). This huge amount of new experimental data, supplemented by our earlier published results, were considered for the fine and hyperfine structure analysis. A multi-configuration fit of 7 configurations was performed, taking into account second-order of perturbation theory, including the effects of closed shell-open shell excitations. Predicted values of the level energies, as well as of magnetic dipole and electric quadrupole hyperfine structure constants A and B, are quoted in cases when no experimental values are available. By combining our experimental data with our own semi-empirical procedure it was possible to identify correctly the lower and upper level of the line 544.1440 nm measured by Childs with the use of the atomic-beam laser-rf double-resonance technique (Childs, J Opt Soc Am B 9;1992:191-6).

  20. Structural and optical characterization of terbium doped ZnGa2O4 thin films deposited by RF magnetron sputtering (United States)

    Somasundaram, K.; Girija, K. G.; Sudarsan, V.; Selvin, P. Christopher; Vatsa, R. K.


    Tb3+ doped ZnGa2O4 nanophosphor (21 nm) has been synthesized via low temperature polyol route and subsequently thin films of the same were deposited on glass and ITO substrates by RF magnetron sputtering. The films were characterized by X-ray Diffraction and luminescence measurements. The XRD pattern showed that Tb3+ doped ZnGa2O4 nanophosphor has a cubic spinel phase. Luminescence behavior of the nanophosphor and as deposited sputtered film was investigated. The PL emission spectra of nanophosphor gave a broad ZnGa2O4 host emission band along with a strong terbium emission and the thin films showed only broad host emission band and there was no terbium ion emission.

  1. Determination of fluoxetine in pharmaceutical and biological samples based on the silver nanoparticle enhanced fluorescence of fluoxetine-terbium complex. (United States)

    Lotfi, Ali; Manzoori, Jamshid L


    In this study, a simple and sensitive spectrofluorimetric method is presented for the determination of fluoxetine based on the enhancing effect of silver nanoparticles (AgNPs) on the terbium-fluoxetine fluorescence emission. The AgNPs were prepared by a simple reduction method and characterized by UV-Vis spectroscopy and transmission electron microscopy. It was indicated that these AgNPs have a remarkable amplifying effect on the terbium-sensitized fluorescence of fluoxetine. The effects of various parameters such as AgNP and Tb(3+) concentration and the pH of the media were investigated. Under obtained optimal conditions, the fluorescence intensity of the terbium-fluoxetine-AgNP system was enhanced linearly by increasing the concentration of fluoxetine in the range of 0.008 to 19 mg/L. The limit of detection (b + 3s) was 8.3 × 10(-4) mg/L. The interference effects of common species found in real samples were also studied. The method had good linearity, recovery, reproducibility and sensitivity, and was satisfactorily applied for the determination of fluoxetine in tablet formulations, human urine and plasma samples. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  2. Neutron Diffraction and Electrical Transport Studies on Magnetic Transition in Terbium at High Pressures and Low Temperatures (United States)

    Thomas, Sarah; Montgomery, Jeffrey; Tsoi, Georgiy; Vohra, Yogesh; Weir, Samuel; Tulk, Christopher; Moreira Dos Santos, Antonio


    Neutron diffraction and electrical transport measurements have been carried out on the heavy rare earth metal terbium at high pressures and low temperatures in order to elucidate its transition from a helical antiferromagnetic to a ferromagnetic ordered phase as a function of pressure. The electrical resistance measurements using designer diamonds show a change in slope as the temperature is lowered through the ferromagnetic Curie temperature. The temperature of the ferromagnetic transition decreases at a rate of -16.7 K/GPa till 3.6 GPa, where terbium undergoes a structural transition from hexagonal close packed (hcp) to an α-Sm phase. Above this pressure, the electrical resistance measurements no longer exhibit a change in slope. In order to confirm the change in magnetic phase suggested by the electrical resistance measurements, neutron diffraction measurements were conducted at the SNAP beamline at the Oak Ridge National Laboratory. Measurements were made at pressures to 5.3 GPa and temperatures as low as 90 K. An abrupt increase in peak intensity in the neutron diffraction spectra signaled the onset of magnetic order below the Curie temperature. A magnetic phase diagram of rare earth metal terbium will be presented to 5.3 GPa and 90 K based on these studies.

  3. 42 CFR 410.144 - Quality standards for deemed entities. (United States)


    ... of continuing diabetes education concerning educational principles and behavior change strategies... dental care. (ix) Behavior change strategies, goal setting, risk factor reduction, and problem solving...-Management Training and Diabetes Outcome Measurements § 410.144 Quality standards for deemed entities. An...

  4. 40 CFR 144.11 - Prohibition of unauthorized injection. (United States)


    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Prohibition of unauthorized injection... PROGRAMS (CONTINUED) UNDERGROUND INJECTION CONTROL PROGRAM General Program Requirements § 144.11 Prohibition of unauthorized injection. Any underground injection, except into a well authorized by rule or...

  5. 40 CFR 144.5 - Confidentiality of information. (United States)


    ... Section 144.5 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS... submissions, by stamping the words “confidential business information” on each page containing such... which deals with the existence, absence, or level of contaminants in drinking water. ...

  6. 19 CFR 144.37 - Withdrawal for exportation. (United States)


    ... provided for by law. In any case, the port director may require a special report of weight, gauge, or... not applicable with respect to purchasers at airport duty-free enterprises; and (vi) A statement on... file. Editorial Note: For Federal Register citations affecting § 144.37, see the List of CFR Sections...

  7. 33 CFR 144.10-1 - Lifesaving equipment. (United States)


    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Lifesaving equipment. 144.10-1... equipment. (a) Except as allowed in paragraph (b) of this section, no person may be on an unmanned platform unless the following lifesaving equipment is readily accessible on the platform: (1) A life preserver or...

  8. 22 CFR 144.150 - Program accessibility: Existing facilities. (United States)


    ... of achieving program accessibility include— (i) Using audio-visual materials and devices to depict... action that it can demonstrate would result in a fundamental alteration in the nature of a program or... § 144.150(a) would result in such alteration or burdens. The decision that compliance would result in...

  9. Study of Silver Nanoparticles Sensitized Fluorescence and Second-Order Scattering of Terbium(III-Pefloxacin Mesylate Complex and Determination of Pefloxacin Mesylate

    Directory of Open Access Journals (Sweden)

    Aiyun Li


    Full Text Available α-Keto acid of pefloxacin mesylate (PFLX can form the complex with Terbium(III. The intramolecular energy from PFLX to Terbium(III ion takes place when excited, and thus Terbium(III excited state is formed and then emits the characteristic fluorescence of Terbium(III, locating at 490, 545, 580, and 620 nm. The second-order scattering (SOS peak at 545 nm also appears for the complex with the exciting wavelength of 273 nm. When the silver nanoparticles are added to the system, the luminescence intensity at 545 nm greatly increased. So, with the adding of nanoparticles to the Terbium(III-PFLX complex, not only is the intramolecular energy promoted but also the SOS intensity is enhanced. The experimental results show that it is the silver nanoparticles with certain size and certain concentration which can greatly enhance the fluorescence-SOS intensity, and the relative intensity at 545 nm is proportional to the amount of PFLX. Based on this phenomenon, a novel method for the determination of PFLX has been developed and applied to the determination of PFLX in capsule and serum samples.

  10. Influence of crystalline structure on the luminescence properties of terbium orthotantalates

    Energy Technology Data Exchange (ETDEWEB)

    Siqueira, Kisla P.F. [Departamento de Química, Universidade Federal de Ouro Preto, Campus Morro do Cruzeiro, ICEB II, Ouro Preto 35400-000, Minas Gerais (Brazil); Carmo, Alexandre P. [Instituto Federal Fluminense, Campus Cabo Frio, RJ 28909-971 (Brazil); Bell, Maria J.V. [Departamento de Física, Universidade Federal de Juiz de Fora, Juiz de Fora 36036-330, MG (Brazil); Dias, Anderson, E-mail: [Departamento de Química, Universidade Federal de Ouro Preto, Campus Morro do Cruzeiro, ICEB II, Ouro Preto 35400-000, Minas Gerais (Brazil)


    Terbium orthotantalate powders were produced with M-fergusonite type (I2/a) and M′-fergusonite type (P2/a) structures. The samples were studied by X-ray diffraction, Raman scattering, and photoluminescence measurements (emission and decay curves). The results showed that crystalline materials were obtained with all the 18 Raman-active modes predicted by group theory calculations. Also, it was observed through photoluminescence decay curves that the Tb{sup 3+} ions occupies only one-symmetry site in both crystallographic arrangements. Photoluminescence emission curves exhibited some variation in spectral shape, peak position, and relative intensity as a consequence of their different crystalline arrangements. The dominated emission of Tb{sup 3+} ({sup 5}D{sub 4}→{sup 7}F{sub 5}) is centered with a maximum intensity at 549.2 nm (M-type) and 543.0 nm (M′-type). Fluorescence lifetimes for M-TbTaO{sub 4} and M′-TbTaO{sub 4} were determined as 33.4 μs and 1.25 ms, respectively. M′-type materials seems to be the most suitable for luminescent devices and could be a potential green luminescent material due to the strongest emission if compared with the M-fergusonite type. -- Highlights: ► Terbium orthotantalates were prepared in two different crystalline structures: I2/a and P2/a. ► XRD and Raman scattering showed that the different space groups obtained were exhibited all the 18 Raman-active modes. ► PL decay curves that the Tb{sup 3+} ions occupies only one-symmetry site in both crystallographic arrangements. ► Dominated emission of Tb{sup 3+} ({sup 5}D{sub 4}→{sup 7}F{sub 5}) is centered with a maximum intensity at 549 nm (M-type) and 543 nm (M′-type). ► Fluorescence lifetimes for M-TbTaO{sub 4} and M′-TbTaO{sub 4} were determined as 33.4 μs and 1.25 ms, respectively.

  11. Laser control and temperature switching of luminescence intensity in photostable transparent film based on terbium(III) β-diketonate complex (United States)

    Lapaev, Dmitry V.; Nikiforov, Victor G.; Safiullin, Georgy M.; Lobkov, Vladimir S.; Salikhov, Kev M.; Knyazev, Andrey A.; Galyametdinov, Yury G.


    The study of the terbium(III) and gadolinium(III) β-diketonate complexes by photoluminescence spectroscopy reveals considerable changes of the photophysical properties of the complexes under the UV laser irradiation. The measurements show the enhancement of the luminescence intensities in the vitrified transparent film of the terbium(III) complex as well as the gadolinium(III) complex under the 337 nm laser irradiation at room temperature. The irradiated film of the terbium(III) complex restores the initial photophysical properties after heating close to the melting temperature (∼353 K) and cooling. We observe no change of the luminescent properties of the irradiated film for months. These features can be used for the design of new lanthanide-based photostable systems with laser control of the luminescence intensity.

  12. Development of functionalized terbium fluorescent nanoparticles for antibody labeling and time-resolved fluoroimmunoassay application. (United States)

    Ye, Zhiqiang; Tan, Mingqian; Wang, Guilan; Yuan, Jingli


    Silica-based functionalized terbium fluorescent nanoparticles were prepared, characterized and developed as a fluorescence probe for antibody labeling and time-resolved fluoroimmunoassay. The nanoparticles were prepared in a water-in-oil (W/O) microemulsion containing a strongly fluorescent Tb(3+) chelate, N,N,N(1),N(1)-[2,6-bis(3'-aminomethyl-1'-pyrazolyl)phenylpyridine] tetrakis(acetate)-Tb(3+) (BPTA-Tb(3+)), Triton X-100, octanol, and cyclohexane by controlling copolymerization of tetraethyl orthosilicate (TEOS) and 3-[2-(2-aminoethylamino)ethylamino]propyl-trimethoxysilane (AEPS) with ammonia water. The characterizations by transmission electron microscopy and fluorometric methods show that the nanoparticles are spherical and uniform in size, 45 +/- 3nm in diameter, strongly fluorescent with fluorescence quantum yield of 10% and a long fluorescence lifetime of 2.0ms. The amino groups directly introduced to the nanoparticle's surface by using AEPS in the preparation made the surface modification and bioconjugation of the nanoparticles easier. The nanoparticle-labeled anti-human alpha-fetoprotein antibody was prepared and used for time-resolved fluoroimmunoassay of alpha-fetoprotein (AFP) in human serum samples. The assay response is linear from 0.10ngml(-1) to about 100ngml(-1) with the detection limit of 0.10ngml(-1). The coefficient variations (CVs) of the method are less than 9.0%, and the recoveries are in the range of 84-98% for human serum sample measurements.

  13. Highly efficient precipitation of phosphoproteins using trivalent europium, terbium, and erbium ions

    Energy Technology Data Exchange (ETDEWEB)

    Guezel, Yueksel; Rainer, Matthias; Mirza, Munazza Raza; Bonn, Guenther K. [Leopold-Franzens University, Institute of Analytical Chemistry and Radiochemistry, Innsbruck (Austria)


    This study describes a highly efficient method for the selective precipitation of phosphoproteins by trivalent europium, terbium, and erbium metal ions. These metal cations belong to the group of lanthanides and are known to be hard acceptors with an overwhelming preference for oxygen-containing anions such as phosphates to which they form very tight ionic bonds. The method could be successfully applied to specifically precipitate phosphoproteins from complex samples including milk and egg white by forming solid metal-protein complexes. Owing to the low solubility product of the investigated lanthanide salts, the produced metal-protein complexes showed high stability. The protein pellets were extensively washed to remove nonphosphorylated proteins and contaminants. For the analysis of proteins the pellets were first dissolved in 30 % formic acid and subjected to matrix-assisted laser desorption/ionization-time of flight (MALDI-TOF) MS. For peptide mass-fingerprint analysis the precipitated phosphoproteins were enzymatically digested using microwave-assisted digestion. The method was found to be highly specific for the isolation and purification of phosphoproteins. Protein quantification was performed by colorimetric detection of total precipitated phosphoproteins and revealed more than 95 % protein recovery for each lanthanide salt. (orig.)

  14. A Terbium Sensitized Luminescence Method for the Assay of Flubiprofen in Pharmaceutical Formulations

    Directory of Open Access Journals (Sweden)

    Salma M.Z. Al-Kindy


    Full Text Available A sensitive time-resolved luminescence method for the determination of flubiprofen (FLP in methanol and in aqueous solution is described. The method is based on the luminescence sensitization of terbium (Tb3+ by the formation of a ternary complex with FLP in the presence of 4,7 diphenyl 1,10 phenanthroline (DPP as co-ligand, and Tween-20 as surfactant. The signal for Tb-FLP-DPP was monitored at λex  = 285 nm and λem  = 552 nm. Optimum conditions for the formation of the complex in an aqueous system were TRIS buffer, pH 8.0, DPP (2.5Å~10−7  M, Tween-20 (0.30% and 4Å~10-5  mol L-1  of Tb3+  which allowed the determination of 20–1000 ng mL-1  of FLP with a limit of detection (LOD of 10 ng mL-1 . The relative standard deviations of the method ranged between 0.6 and 1.4% indicating excellent reproducibility of the method. The proposed method was successfully applied for the assays of FLP in pharmaceutical formulations and spiked tap water samples with average recoveries of 87% – 95%.

  15. Sensitization effects of supramolecular assemblies on the luminescence of terbium-ion prulifloxacin complexes

    Energy Technology Data Exchange (ETDEWEB)

    Wang Hong; Yi Chongyue; Li Xue; Fang Fang [School of Chemistry and Chemical Engineering, Huazhong University of Science and Technology, Wuhan 430074 (China); Yang Yajiang, E-mail: [School of Chemistry and Chemical Engineering, Huazhong University of Science and Technology, Wuhan 430074 (China)


    Luminescence enhancement of terbium-ion prulifloxacin complexes (Tb(III)-PUFX) in supramolecular hydrogels formed by assembly of 1,3:2,4-di-O-benzylidene-D-sorbitol (DBS) was investigated by steady-state fluorescence, varying temperature fluorescence and time-resolved fluorescence. The luminescence images show that Tb(III)-PUFX were dispersed in the DBS gels. The luminescence intensity of Tb(III)-PUFX in the DBS gels was significantly increased in comparison with that in corresponding aqueous solutions. The varying temperature fluorescent spectra show that the luminescence intensity of Tb(III)-PUFX decreased with an increase in the temperature. This implies that the luminescence enhancement of Tb(III)-PUFX is related to the dissociation and the formation of the DBS assemblies. Time-resolved fluorescence measurements show slower rotational motion in DBS gels in comparison with that in the corresponding aqueous solutions. This may be ascribed to a unique microstructure of three-dimensional network formed by DBC aggregates, resulting in deactivation of the nonradiative relaxation. The images of field emission scanning electron microscopy and polarized optical microscopy indicate that the morphology of the DBS assemblies was not influenced upon addition of Tb(III)-PUFX to the DBS gels.

  16. A Nanoscale Multiresponsive Luminescent Sensor Based on a Terbium(III) Metal-Organic Framework. (United States)

    Dang, Song; Wang, Ting; Yi, Feiyan; Liu, Qinghui; Yang, Weiting; Sun, Zhong-Ming


    A nanoscale terbium-containing metal-organic framework (nTbL), with a layer-like structure and [H2 NMe2 ](+) cations located in the framework channels, was synthesized under hydrothermal conditions. The structure of the as-prepared sample was systematically confirmed by powder XRD and elemental analysis; the morphology was characterized by field-emission SEM and TEM. The photoluminescence studies revealed that rod-like nTbL exhibited bright-green emission, corresponding to (5)D4 →(7)FJ (J=6-3) transitions of the Tb(3+) ion under excitation. Further sensing measurements revealed that as-prepared nTbL could be utilized as a multiresponsive luminescent sensor, which showed significant and exclusive detection ability for Fe(3+) ions and phenylmethanol. These results highlight the practical applications of lanthanide-containing metal-organic frameworks as fluorescent probes. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Terbium-Doped VO2 Thin Films: Reduced Phase Transition Temperature and Largely Enhanced Luminous Transmittance. (United States)

    Wang, Ning; Duchamp, Martial; Dunin-Borkowski, Rafal E; Liu, Shiyu; Zeng, XianTing; Cao, Xun; Long, Yi


    Vanadium dioxide (VO2) is a well-known thermochromic material with large IR modulating ability, promising for energy-saving smart windows. The main drawbacks of VO2 are its high phase transition temperature (τ(c) = 68°C), low luminous transmission (T(lum)), and weak solar modulating ability (ΔT(sol)). In this paper, the terbium cation (Tb(3+)) doping was first reported to reduce τ(c) and increase T(lum) of VO2 thin films. Compared with pristine VO2, 2 at. % doping level gives both enhanced T(lum) and ΔT(sol) from 45.8% to 54.0% and 7.7% to 8.3%, respectively. The T(lum) increases with continuous Tb(3+) doping and reaches 79.4% at 6 at. % doping level, representing ∼73.4% relative increment compared with pure VO2. This has surpassed the best reported doped VO2 thin films. The enhanced thermochromic properties is meaningful for smart window applications of VO2 materials.

  18. Luminescent investigations of terbium(III) biosorption as a surrogate for heavy metals and radionuclides. (United States)

    Achyuthan, Komandoor E; Arango, Dulce C; Carles, Elizabeth L; Cutler, Christopher E; Meyer, Lauren A; Brozik, Susan M


    We describe a metal transport system for investigating the interfacial interactions between the anionic surface charge of a gram-negative bacterium (Escherichia coli) and a trivalent cationic metal, Tb3+. We believe this is the first description of the uptake kinetics, sub- and intracellular distribution, and temporal fate of Tb3+ ion in E. coli. We used the luminescence of the terbium-dipicolinic acid chelate to study metal ion transport. The bacteria had a high tolerance for the metal (IC(50) = 4 mM Tb3+). Metal ion transport was passive and metabolism independent. The uptake kinetics rapidly reached a maximum within 15 min, followed by a stasis for 60 min, and declining thereafter between 120 and 240 min, resulting in a biphasic curve. During this period, greater than one-third of the metal ion was sequestered within the cell. Our choice of a safe Biosafety Level I E. coli bacteria and the relatively non-toxic Tb3+ metal represents a model system for luminescent investigations of biosorption, for studying bacterial-water interfacial chemistry and for the bioremediation of heavy metals and radionuclides.

  19. Construction of the energy matrix for complex atoms. Part VIII: Hyperfine structure HPC calculations for terbium atom (United States)

    Elantkowska, Magdalena; Ruczkowski, Jarosław; Sikorski, Andrzej; Dembczyński, Jerzy


    A parametric analysis of the hyperfine structure (hfs) for the even parity configurations of atomic terbium (Tb I) is presented in this work. We introduce the complete set of 4fN-core states in our high-performance computing (HPC) calculations. For calculations of the huge hyperfine structure matrix, requiring approximately 5000 hours when run on a single CPU, we propose the methods utilizing a personal computer cluster or, alternatively a cluster of Microsoft Azure virtual machines (VM). These methods give a factor 12 performance boost, enabling the calculations to complete in an acceptable time.

  20. Spectrofluorimetric determination of human serum albumin using terbium-danofloxacin probe. (United States)

    Ramezani, Amir M; Manzoori, Jamshid L; Amjadi, Mohammad; Jouyban, Abolghasem


    A spectrofluorimetric method is proposed for the determination of human serum albumin (HSA) and bovine serum albumin (BSA) using terbium-danofloxacin (Tb(3+)-Dano) as a fluorescent probe. These proteins remarkably enhance the fluorescence intensity of the Tb(3+)-Dano complex at 545 nm, and the enhanced fluorescence intensity of Tb(3+)-Dano is proportional to the concentration of proteins (HSA and BSA). Optimum conditions for the determination of HSA were investigated and found that the maximum response was observed at: pH = 7.8, [Tb(3+)] = 8.5 × 10(-5) mol L(-1), [Dano] = 1.5 × 10(-4) mol L(-1). The calibration graphs for standard solutions of BSA, HSA, and plasma samples of HSA were linear in the range of 0.2 × 10(-6) - 1.3 × 10(-6) mol L(-1), 0.2 × 10(-6) - 1.4 × 10(-6) mol L(-1), and 0.2 × 10(-6) - 1 × 10(-6) mol L(-1), respectively. The detection limits (S/N = 3) for BSA, HSA, and plasma sample of HSA were 8.7 × 10(-8) mol L(-1), 6.2 × 10(-8) mol L(-1), and 8.1 × 10(-8) mol L(-1), respectively. The applicability of the method was checked using a number of real biological plasma samples and was compared with the UV spectrometric reference method. The results was showed that the method could be regarded as a simple, practical, and sensitive alternative method for determination of albumin in biological samples.

  1. Spectrofluorimetric Determination of Human Serum Albumin Using Terbium-Danofloxacin Probe

    Directory of Open Access Journals (Sweden)

    Amir M. Ramezani


    Full Text Available A spectrofluorimetric method is proposed for the determination of human serum albumin (HSA and bovine serum albumin (BSA using terbium-danofloxacin (Tb3+-Dano as a fluorescent probe. These proteins remarkably enhance the fluorescence intensity of the Tb3+-Dano complex at 545 nm, and the enhanced fluorescence intensity of Tb3+-Dano is proportional to the concentration of proteins (HSA and BSA. Optimum conditions for the determination of HSA were investigated and found that the maximum response was observed at: pH=7.8, [Tb3+] =8.5×10−5 mol L−1, [Dano] =1.5×10−4 mol L−1. The calibration graphs for standard solutions of BSA, HSA, and plasma samples of HSA were linear in the range of 0.2×10−6−1.3×10−6 mol L−1, 0.2×10−6−1.4×10−6 mol L−1, and 0.2×10−6−1×10−6 mol L−1, respectively. The detection limits (S/N = 3 for BSA, HSA, and plasma sample of HSA were 8.7×10−8 mol L−1, 6.2×10−8 mol L−1, and 8.1×10−8 mol L−1, respectively. The applicability of the method was checked using a number of real biological plasma samples and was compared with the UV spectrometric reference method. The results was showed that the method could be regarded as a simple, practical, and sensitive alternative method for determination of albumin in biological samples.

  2. Determination of flavonoids in pharmaceutical preparations using Terbium sensitized fluorescence method

    Directory of Open Access Journals (Sweden)

    M Shaghaghi


    Full Text Available "nBackground and the Purpose of the Study: The aim of this study was development and validation of a simple, rapid and sensitive spectrofluorimetric method for determination of total flavonoids in two topical formulations of Calendula officinalis, Ziziphus Spina-christi and an oral drop of Hypiran perforatum L. The proposed method is based on the formation of terbium (Tb3+ "n-flavonoids (quercetin as a reference standard complex at pH 7.0, which has fluorescence intensely with maximum emission at 545 nm when excited at 310 nm. "nMethod "n: For ointments masses of topical formulations were weighed and added to ethanol-aqueous buffer (pH 10.0 and the resulting mixtures were shaken and then two phases were separated by centrifugation. Aqueous phases were filtered and then diluted with water. For Hypiran drops an appropriate portion was diluted with ethanol and then aliquots of sample or standard solutions were determined according to the experimental procedure. "nResults "n: Under the optimum conditions, total concentrations of flavonoids (as quercetin equivalent in three tested formulations were found to be 0.204 mg/g (for Dermatin cream, 0.476 mg/g (for Calendula ointment and 13.50 μg/ml (for Hypiran drops. Analytical recoveries from samples spiked with different amounts of quercetin were 96.1-104.0 % with RSD % of less than 3.5. Conclusion : The proposed method which requires a simple dissolution step without any matrix interferences provided high sensitivity and selectivity and was easily applied to determine total flavonoids in real samples of three investigated formulations with excellent reproducibility.

  3. TOF SIMS analysis and generation of white photoluminescence from strontium silicate codoped with europium and terbium

    Energy Technology Data Exchange (ETDEWEB)

    Tshabalala, Modiehi A.; Swart, Hendrik C.; Ntwaeaborwa, Odireleng M., E-mail: [Department of Physics, University of the Free State, P.O Box 339, Bloemfontein 9300 South Africa (South Africa)


    White light emitting terbium (Tb{sup 3+}) and europium (Eu{sup 3+}) codoped strontium silicate (Sr{sub 2}SiO{sub 4}) phosphors were prepared by a solid state reaction process. The structure, particle morphology, chemical composition, ion distribution, photoluminescence (PL), and decay characteristics of the phosphors were analyzed by x-ray diffraction (XRD), scanning electron microscopy (SEM), time-of-flight secondary ion mass spectrometry (TOF-SIMS), and PL spectroscopy, respectively. The XRD data showed that our Sr{sub 2}SiO{sub 4} composed of two phases, namely, β-Sr{sub 2}SiO{sub 4} and α′-Sr{sub 2}SiO{sub 4}, and the α′-Sr{sub 2}SiO{sub 4} phase was more prominent than the β-Sr{sub 2}SiO{sub 4} phase. The SEM micrographs showed that the particles were agglomerated together and they did not have definite shapes. All ions (i.e., negative and positive) present in our materials were identified by TOF-SIMS. In addition, the chemical imaging performed with the TOF-SIMS demonstrated how the individual ions including the dopants (Eu{sup 3+} and Tb{sup 3+}) were distributed in the host lattice. White photoluminescence was observed when the Sr{sub 2}SiO{sub 4}:Tb{sup 3+}, Eu{sup 3+} phosphor was excited at 239 nm using a monochromatized xenon lamp as the excitation source. The phosphor exhibited fast decay lifetimes implying that it is not a good candidate for long afterglow applications.

  4. Synthesis, crystal structure and photophysical properties of europium(III) and terbium(III) complexes with pyridine-2,6-dicarboxamide

    NARCIS (Netherlands)

    Tanase, S.; Gallego, P.M.; Gelder, R. de; Fu, W.T.


    The reactions of pyridine-2,6-dicarboxamide with europium(III) and terbium(III) triflates led to the formation of mononuclear complexes of formula [Ln(pcam)(3)](CF3SO3)(3) (Ln = Eu 1, Tb 2; pcam stands for pyridine-2,6-dicarboxamide). From single-crystal X-ray diffraction analysis, the complexes

  5. Zinc sulfide and terbium-doped zinc sulfide films grown by traveling wave reactor atomic layer epitaxy

    CERN Document Server

    Yun, S J; Nam, K S


    Zinc sulfide (ZnS) and terbium-doped ZnS (ZnS:Tb) thin films were grown by traveling wave reactor atomic layer epitaxy (ALE). In the present work, ZnCl sub 2 , H sub 2 S, and tris (2,2,6,6-tetramethyl-3,5-heptandionato) terbium (Tb(tmhd) sub 3) were used as the precursors. The dependence of crystallinity and Cl content of ZnS films was investigated on the growth temperature. ZnS and ZnS:Tb films grown at temperatures ranging from 400 to 500 .deg. C showed a hexagonal-2H crystalline structure. The crystallinity of ZnS film was greatly enhanced as the temperature increased. At growth temperatures higher than 450.deg.C, the films showed preferred orientation with mainly (002) diffraction peak. The Cl content decreased from approximately 9 to 1 at.% with the increase in growth temperature from 400 to 500 .deg. C. The segregation of Cl near the surface region and the incorporation of O from Tb(tmhd) sub 3 during ALE process were also observed using Auger electron spectroscopy. The ALE-grown ZnS and ZnS:Tb films re...

  6. Commercializing potassium terbium fluoride, KTF (KTb3F10) faraday crystals for high laser power optical isolator applications (United States)

    Schlichting, Wolfgang; Stevens, Kevin; Foundos, Greg; Payne, Alexis


    Many scientific lasers and increasingly industrial laser systems operate in power regime, require high-performance optical isolators to prevent disruptive light feedback into the laser cavity. The optically active Faraday material is the key optical element inside the isolator. SYNOPTICS has been supplying the laser market with Terbium Gallium Garnet (TGG - Tb3Ga5O12) for many years. It is the most commonly used material for the 650-1100nm range and the key advantages for TGG include its cubic crystal structure for alignment free processing, little to no intrinsic birefringence, and ease of manufacture. However, for high-power laser applications TGG is limited by its absorption at 1064nm and its thermo-optic coefficient, dn/dT. Specifically, thermal lensing and depolarization effects become a limiting factor at high laser powers. While TGG absorption has improved significantly over the past few years, there is an intrinsic limit. Now, SYNOPTICS is commercializing the enhanced new crystal Potassium Terbium Fluoride KTF (KTb3F10) that exhibits much smaller nonlinear refractive index and thermo-optic coefficients, and still exhibits a Verdet constant near that of TGG. This cubic crystal has relatively low absorption and thermo-optic coefficients. It is now fully characterized and available for select production orders. At OPTIFAB in October 2017 we present recent results comparing the performance of KTF to TGG in optical isolators and show SYNOPTICS advances in large volume crystal growth and the production ramp up.

  7. Preparation and photoluminescence enhancement in terbium(III ternary complexes with β-diketone and monodentate auxiliary ligands

    Directory of Open Access Journals (Sweden)

    Devender Singh


    Full Text Available A series of new solid ternary complexes of terbium(III ion based on β-diketone ligand acetylacetone (acac and monodentate auxiliary ligands (aqua/urea/triphenylphosphineoxide/pyridine-N-oxide had been prepared. The structural characterizations of synthesized ternary compounds were studied by means of elemental analysis, infrared (IR, and proton nuclear magnetic resonance (NMR spectral techniques. The optical characteristics were investigated with absorption as well as photoluminescence spectroscopy. Thermal behavior of compounds was examined by TGA/DTA analysis and all metal complexes were found to have good thermal stability. The luminescence decay time of complexes were also calculated by monitoring at emission wavelength corresponding to 5D4 → 7F5 transition. A comparative inspection of the luminescent behavior of prepared ternary compounds was performed in order to determine the function of auxiliary ligands in the enhancement of luminescence intensity produced by central terbium(III ion. The color coordinates values suggested that compounds showed bright green emission in visible region in electromagnetic spectrum. Complexes producing green light could play a significant role in the fabrication of efficient light conversion molecular devices for display purposes and lightning systems.

  8. 19 CFR 144.7 - Disposition of merchandise after expiration of warehousing period. (United States)


    ... warehousing period. 144.7 Section 144.7 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF... General Provisions § 144.7 Disposition of merchandise after expiration of warehousing period. Merchandise remaining in a bonded warehouse after the expiration of the warehousing period shall be disposed of in...

  9. 40 CFR 144.81 - Does this subpart apply to me? (United States)


    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Does this subpart apply to me? 144.81 Section 144.81 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS... Wells § 144.81 Does this subpart apply to me? This subpart applies to you if you own or operate a Class...

  10. 40 CFR 144.85 - Do these additional requirements apply to me? (United States)


    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Do these additional requirements apply to me? 144.85 Section 144.85 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED... of Class V Injection Wells § 144.85 Do these additional requirements apply to me? (a) Large-Capacity...

  11. 40 CFR 144.22 - Existing Class II enhanced recovery and hydrocarbon storage wells. (United States)


    ... and hydrocarbon storage wells. 144.22 Section 144.22 Protection of Environment ENVIRONMENTAL... of Underground Injection by Rule § 144.22 Existing Class II enhanced recovery and hydrocarbon storage wells. (a) An existing Class II enhanced recovery or hydrocarbon storage injection well is authorized by...

  12. 38 CFR 21.144 - Vocational course in a sheltered workshop or rehabilitation facility. (United States)


    ... sheltered workshop or rehabilitation facility. 21.144 Section 21.144 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS (CONTINUED) VOCATIONAL REHABILITATION AND EDUCATION Vocational Rehabilitation and Employment Under 38 U.S.C. Chapter 31 Special Rehabilitation Services § 21.144 Vocational course...

  13. 40 CFR 144.12 - Prohibition of movement of fluid into underground sources of drinking water. (United States)


    ... underground sources of drinking water. 144.12 Section 144.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS (CONTINUED) UNDERGROUND INJECTION CONTROL PROGRAM General Program Requirements § 144.12 Prohibition of movement of fluid into underground sources of drinking water...

  14. 40 CFR 144.80 - What is a Class V injection well? (United States)


    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false What is a Class V injection well? 144... PROGRAMS (CONTINUED) UNDERGROUND INJECTION CONTROL PROGRAM Requirements for Owners and Operators of Class V Injection Wells § 144.80 What is a Class V injection well? As described in § 144.6, injection wells are...

  15. 25 CFR 39.144 - What is the small high school adjustment? (United States)


    ... 25 Indians 1 2010-04-01 2010-04-01 false What is the small high school adjustment? 39.144 Section 39.144 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR EDUCATION THE INDIAN SCHOOL EQUALIZATION PROGRAM Indian School Equalization Formula Small School Adjustment § 39.144 What is the small high school adjustment? (a) The small high...

  16. Synthesis and luminescent study of Ce{sup 3+}-doped terbium-yttrium aluminum garnet

    Energy Technology Data Exchange (ETDEWEB)

    Dotsenko, V.P., E-mail: [A.V. Bogatsky Physico-Chemical Institute, National Academy of Sciences of Ukraine, Lustdorfskaya doroga 86, 65080 Odessa (Ukraine); Berezovskaya, I.V.; Zubar, E.V.; Efryushina, N.P. [A.V. Bogatsky Physico-Chemical Institute, National Academy of Sciences of Ukraine, Lustdorfskaya doroga 86, 65080 Odessa (Ukraine); Poletaev, N.I.; Doroshenko, Yu.A. [Institute of Combustion and Advanced Technologies, Mechnikov Odessa National University, Dvoryanskaya 2, 65082 Odessa (Ukraine); Stryganyuk, G.B. [Ivan Franko National University of Lviv, Kirilo i Mefodii 8, 79005 Lviv (Ukraine); HASYLAB at DESY, Notkestrasse 85, 22607 Hamburg (Germany); Voloshinovskii, A.S. [Ivan Franko National University of Lviv, Kirilo i Mefodii 8, 79005 Lviv (Ukraine)


    Highlights: Black-Right-Pointing-Pointer Ce{sup 3+}-doped garnets (TYAG) were prepared using nanostructured reagents. Black-Right-Pointing-Pointer The Ce{sup 3+} ions cause a very efficient yellow emission of the samples. Black-Right-Pointing-Pointer The reasons for the long wavelength position of this emission are discussed. Black-Right-Pointing-Pointer Contribution from Al atoms to the conduction band of TYAG is quite essential. - Abstract: Terbium-yttrium aluminum garnets (TYAG) doped with Ce{sup 3+} ions have been prepared by solid state reactions between nanostructured oxides of aluminum and rare earths. The luminescent properties of Ce{sup 3+} ions in (Tb{sub 0.8}Y{sub 0.2}){sub 3(1-x)}Ce{sub 3x}Al{sub 5}O{sub 12} (x = 0.03) have been studied upon excitation in the 2-20 eV region. The substitution of Tb{sup 3+} for Y{sup 3+} in the garnet structure results in broadening the emission band and shifting its maximum towards the longer wavelengths. It was found that in addition to the 4f{sup n} {yields} 4f{sup n-1}5d excitation bands of Ce{sup 3+} and Tb{sup 3+} ions, the excitation spectra for the Ce{sup 3+} emission contain broad bands at 6.73 and {approx}9.5 eV. These bands are attributed to the Ce{sup 3+}-bound exciton formation and O 2p {yields} Al 3s, 3p transitions, respectively. In contrast to the predictions based on the results of electronic structure calculations on Y{sub 3}Al{sub 5}O{sub 12} and Tb{sub 4}Al{sub 2}O{sub 9}, the threshold of interband transitions in TYAG is at high energies ( Greater-Than-Or-Slanted-Equal-To 7.3 eV), and contributions from Al{sub tetr} and Al{sub oct} atoms to the conduction-band density of states are evaluated as quite essential.

  17. Structural variations in terbium(III) complexes with 1,3-adamantanedicarboxylate and diverse co-ligands

    Energy Technology Data Exchange (ETDEWEB)

    Thuéry, Pierre, E-mail:


    Terbium nitrate was reacted with 1,3-adamantanedicarboxylic acid (LH{sub 2}) under solvo-hydrothermal conditions with either N,N-dimethylformamide (DMF) or N,N-dimethylacetamide (DMA) as organic solvents. Hydrolysation of the latter co-solvents resulted in the formation of formate or acetate ions, which are present as co-ligands in the 1D coordination polymer [Tb(L)(HCOO)(H{sub 2}O){sub 2}] (1) and the 2D assembly [Tb(L)(CH{sub 3}COO)(H{sub 2}O)] (2). The increase in dimensionality in the latter arises from the higher connectivity provided by acetate versus formate, the L{sup 2−} ligand being bis-chelating in both cases. The complex [Tb{sub 2}(L){sub 3}(H{sub 2}O){sub 5}][Tb{sub 2}(L){sub 3}(H{sub 2}O){sub 4}]·3H{sub 2}O (3), another 1D species, crystallizes alongside crystals of 2. Further addition of cucurbit[6]uril (CB6), with DMF as co-solvent, gave the two complexes [Tb{sub 2}(L){sub 2}(CB6)(H{sub 2}O){sub 6}](NO{sub 3}){sub 2}·6H{sub 2}O (4) and [H{sub 2}NMe{sub 2}]{sub 2}[Tb(L)(HCOO){sub 2}]{sub 2}·CB6·3H{sub 2}O (5). Complex 4 crystallizes as a 3D framework in which Tb(L){sup +} chains are connected by tetradentate CB6 molecules, while 5 unites a carboxylate-bridged anionic 2D planar assembly and layers of CB6 molecules with counter-cations held at both portals. - Graphical abstract: One- to three-dimensional assemblies are formed in terbium(III) complexes with 1,3-adamantanedicarboxylate obtained under solvo-hydrothermal conditions, these species including formate or acetate co-ligands formed in situ, or additional cucurbit[6]uril molecules. - Highlights: • We report structures of terbium(III) complexes with 1,3-adamantanedicarboxylate. • Solvents able to generate co-ligands or counter-ions in situ have been used. • A 3D species including additional cucurbituril molecules is decribed. • One species displays an alternation of metal–organic and organic sheets.

  18. Complete Stokes polarimetry of magneto-optical Faraday effect in a terbium gallium garnet crystal at cryogenic temperatures. (United States)

    Majeed, Hassaan; Shaheen, Amrozia; Anwar, Muhammad Sabieh


    We report the complete determination of the polarization changes caused in linearly polarized incident light due to propagation in a magneto-optically active terbium gallium garnet (TGG) single crystal, at temperatures ranging from 6.3 to 300 K. A 28-fold increase in the Verdet constant of the TGG crystal is seen as its temperature decreases to 6.3 K. In contrast with polarimetry of light emerging from a Faraday material at room temperature, polarimetry at cryogenic temperatures cannot be carried out using the conventional fixed polarizer-analyzer technique because the assumption that ellipticity is negligible becomes increasingly invalid as temperature is lowered. It is shown that complete determination of light polarization in such a case requires the determination of its Stokes parameters, otherwise inaccurate measurements will result with negative implications for practical devices.

  19. Development of Optical Isolators for Visible Light Using Terbium Aluminum Garnet (Tb3Al5O12) Single Crystals (United States)

    Geho, Mikio; Takagi, Takashi; Chiku, Shinichiro; Fujii, Takashi


    We have recently reported the successful growth of incongruently melting terbium aluminum garnet (Tb3Al5O12; TAG) single crystals by the hybrid laser FZ (floating zone) method. Optical property evaluations confirmed a high transmittance and a larger Verdet constant than conventional Tb3Ga5O12 (TGG) crystals and/or Faraday glasses. In this study, we attempted to design, fabricate, and evaluate optical isolators in visible light through near-infrared (NIR) regions using TAG crystals. A finite element method (FEM) simulation of possible models led us to the preferable one based on a radially magnetized magnet. To realize this, we employed a pseudo-radially magnetized magnet. The target wavelengths of the prototype device were 408, 808, and 1064 nm. The typical extinction ratio was more than 30 dB and the insertion loss was less than 0.3 dB for AR-coated devices.


    National Aeronautics and Space Administration — C USER'S GUIDE TO RAR 144 SECOND AVERAGED DATA FILES ---------------------------------------------------- This document describes the contents and format of the RAR...

  1. A hydrometallurgical process for the recovery of terbium from fluorescent lamps: Experimental design, optimization of acid leaching process and process analysis. (United States)

    Innocenzi, Valentina; Ippolito, Nicolò Maria; De Michelis, Ida; Medici, Franco; Vegliò, Francesco


    Terbium and rare earths recovery from fluorescent powders of exhausted lamps by acid leaching with hydrochloric acid was the objective of this study. In order to investigate the factors affecting leaching a series of experiments was performed in according to a full factorial plan with four variables and two levels (4 2 ). The factors studied were temperature, concentration of acid, pulp density and leaching time. Experimental conditions of terbium dissolution were optimized by statistical analysis. The results showed that temperature and pulp density were significant with a positive and negative effect, respectively. The empirical mathematical model deducted by experimental data demonstrated that terbium content was completely dissolved under the following conditions: 90 °C, 2 M hydrochloric acid and 5% of pulp density; while when the pulp density was 15% an extraction of 83% could be obtained at 90 °C and 5 M hydrochloric acid. Finally a flow sheet for the recovery of rare earth elements was proposed. The process was tested and simulated by commercial software for the chemical processes. The mass balance of the process was calculated: from 1 ton of initial powder it was possible to obtain around 160 kg of a concentrate of rare earths having a purity of 99%. The main rare earths elements in the final product was yttrium oxide (86.43%) following by cerium oxide (4.11%), lanthanum oxide (3.18%), europium oxide (3.08%) and terbium oxide (2.20%). The estimated total recovery of the rare earths elements was around 70% for yttrium and europium and 80% for the other rare earths. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. Investigation of the luminescent properties of terbium-anthranilate complexes and application to the determination of anthranilic acid derivatives in aqueous solutions

    Energy Technology Data Exchange (ETDEWEB)

    Arnaud, N.; Georges, J


    The luminescent properties of terbium complexes with furosemide (FR), flufenamic (FF) acid, tolfenamic (TF) acid and mefenamic (MF) acid have been investigated in aqueous solutions. For all four compounds, complexation occurs when the carboxylic acid of the aminobenzoic group is dissociated and is greatly favoured in the presence of trioctylphosphine oxide as co-ligand and Triton X-100 as surfactant. Under optimum conditions, luminescence of the lanthanide ion is efficiently sensitised and the lifetime of the {sup 5}D{sub 4} resonance level of terbium in the complex is ranging between 1 and 1.9 ms, against 0.4 ms for the aqua ion. The sensitivity of the method for the determination of anthranilic acid derivatives is improved by one to two orders of magnitude with respect to that achieved using native fluorescence or terbium-sensitised luminescence in methanol. The limits of detection are 2x10{sup -10}, 5x10{sup -10} and 2x10{sup -9} mol l{sup -1} for flufenamic acid, furosemide and tolfenamic acid, and mefenamic acid, respectively, with within-run RSD values of less than 1%. The method has been applied to the determination of flufenamic acid in spiked calf sera with and without sample pretreatment. Depending on the method and the analyte concentration, the recovery was ranging between 83 and 113% and the lowest concentration attainable in serum samples was close to 1x10{sup -7} mol l{sup -1}.

  3. Potential diagnostic implications of miR-144 overexpression in human oesophageal cancer

    Directory of Open Access Journals (Sweden)

    Priyanka Sharma


    Full Text Available Background & objectives: Insidious symptomatology, late clinical presentation and poor prognosis of oesophageal cancer (EC highlight the pressing need for novel non-invasive biomarkers for early tumour diagnosis and better prognosis. The present study was carried out to evaluate the clinical significance of circulating and tissue miR-144 expression in oesophageal cancer. Methods: Clinical significance of miR-144 expression was evaluated in preneoplastic (12 and neoplastic (35 oesophageal cancer tissues as well as matched distant non-malignant tissues using real-time PCR (qPCR. Circulating levels of miR-144 were also analyzed in serum samples of EC patients as well as normal individuals to determine the diagnostic potential of miR-144. Further, targets of miR-144 were predicted using bioinformatic tools and their gene ontology (GO terms were assigned. Results: Real-time PCR analysis revealed significant upregulation of miR-144 in 29 of 35 (83% EC tissues as compared to matched distant non-malignant tissues (P=0.010. a0 ll the dysplastic tissues showed upregulation of miR-144 as compared to their matched distant non-malignant tissues. Relative levels of circulating miR-144 in serum significantly distinguished EC patients from normal controls (P=0.015; AUC = 0.731 with high sensitivity of 94.7 per cent. Bioinformatically predicted target, PUR-aplha (PURA was found to be significantly (P=0.018 downregulated in 81 per cent (26/32 EC patients and its expression was found to be significantly and negatively correlated with miR-144 expression at mRNA level. Interpretation & conclusions: Our findings showed significant upregulation of miR-144 in serum samples of EC patients indicating its potential as minimally invasive marker. Further studies need to be done to understand the role of miR-144 in the pathogenesis of EC.

  4. 50 CFR 14.4 - What terms do I have to understand? (United States)


    ... domesticus; Cattle—Bos taurus; Dog (domestic)—Canis familiaris; European rabbit—Ortyctolagus cuniculus... 50 Wildlife and Fisheries 1 2010-10-01 2010-10-01 false What terms do I have to understand? 14.4 Section 14.4 Wildlife and Fisheries UNITED STATES FISH AND WILDLIFE SERVICE, DEPARTMENT OF THE INTERIOR...

  5. 7 CFR 457.144 - Northern potato crop insurance-processing quality endorsement. (United States)


    ... endorsement. 457.144 Section 457.144 Agriculture Regulations of the Department of Agriculture (Continued... Northern potato crop insurance—processing quality endorsement. The Northern Potato Crop Insurance Processing Quality Endorsement Provisions for the 2008 and succeeding crop years are as follows: 1...

  6. 19 CFR 144.12 - Contents of entry summary; estimated duties. (United States)


    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Contents of entry summary; estimated duties. 144... Procedures for Warehouse Entry § 144.12 Contents of entry summary; estimated duties. The entry summary, Customs Form 7501, shall show the value, classification, and rate of duty as approved by the port director...

  7. 40 CFR 144.82 - What must I do to protect underground sources of drinking water? (United States)


    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false What must I do to protect underground sources of drinking water? 144.82 Section 144.82 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS (CONTINUED) UNDERGROUND INJECTION CONTROL PROGRAM Requirements for Owners and...

  8. 26 CFR 1.4-4 - Short taxable year caused by death. (United States)


    ... 26 Internal Revenue 1 2010-04-01 2010-04-01 true Short taxable year caused by death. 1.4-4 Section... Normal Taxes and Surtaxes § 1.4-4 Short taxable year caused by death. An individual making a return for a... results from the death of the taxpayer. Tax on Corporations ...

  9. 14 CFR 91.144 - Temporary restriction on flight operations during abnormally high barometric pressure conditions. (United States)


    ... 14 Aeronautics and Space 2 2010-01-01 2010-01-01 false Temporary restriction on flight operations during abnormally high barometric pressure conditions. 91.144 Section 91.144 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION (CONTINUED) AIR TRAFFIC AND GENERAL...

  10. 19 CFR 144.42 - Combined entry for rewarehouse and withdrawal for consumption. (United States)


    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Combined entry for rewarehouse and withdrawal for consumption. 144.42 Section 144.42 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND... applicable to this type of entry, with the following exceptions: (1) Form of entry. A combined entry for...

  11. Structural investigation and photoluminescent properties of gadolinium(III), europium(III) and terbium(III) 3-mercaptopropionate complexes. (United States)

    Souza, E R; Mazali, I O; Sigoli, F A


    This work reports on the synthesis, crystallographic determination and spectroscopic characterization of gadolinium(III), terbium(III) and europium(III) 3-mercaptopropionate complexes, aqua-tris(3-mercaptopropionate)lanthanide(III)--[Ln(mpa)3(H2O)]. The Judd-Ofelt intensity parameters were experimentally determined from emission spectrum of the [Eu(mpa)3(H2O)]complex and they were also calculated from crystallographic data. The complexes are coordination polymers, where the units of each complex are linked together by carboxylate groups leading to an unidimensional and parallel chains that by chemical interactions form a tridimensional framework. The emission spectrum profile of the [Eu(mpa)3(H2O)] complex is discussed based on point symmetry of the europium(III) ion, that explains the bands splitting observed in its emission spectrum. Photoluminescent analysis of the [Gd(mpa)3(H2O)] complex show no efficient ligand excitation but an intense charge transfer band. The excitation spectra of the [Eu(mpa)3(H2O)] and [Tb(mpa)3(H2O)] complexes do not show evidence of energy transfer from the ligand to the excited levels of these trivalent ions. Therefore the emission bands are originated only by direct f-f intraconfigurational excitation of the lantanide(III) ions.

  12. Fluorometric determination of proteins using the terbium (III)-2-thenoyltrifluoroacetone-sodium dodecyl benzene sulfonate-protein system

    Energy Technology Data Exchange (ETDEWEB)

    Jia Zhen [Key Laboratory of Colloid and Interface Chemistry of Education Ministry, School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Department of Chemistry, Dezhou University, Dezhou 253023 (China); Yang Jinghe [Key Laboratory of Colloid and Interface Chemistry of Education Ministry, School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China)]. E-mail:; Wu Xia [Key Laboratory of Colloid and Interface Chemistry of Education Ministry, School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Wang Fei [Key Laboratory of Colloid and Interface Chemistry of Education Ministry, School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Guo Changying [Key Laboratory of Colloid and Interface Chemistry of Education Ministry, School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Liu Shufang [Key Laboratory of Colloid and Interface Chemistry of Education Ministry, School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China)


    It is found that in hexamethylene tetramine (HMTA)-HCl buffer of pH=8.00, proteins can enhance the fluorescence of terbium (III) (Tb{sup 3+})-2-thenoyltrifluoroacetone (TTA)-sodium dodecyl benzene sulfonate (SDBS) system. Based on this, a sensitive method for the determination of proteins is proposed. The experiments indicate that under the optimum conditions, the enhanced fluorescence intensity is in proportion to the concentration of proteins in the range of 4.0x10{sup -9}-7.5x10{sup -6}g/mL for bovine serum albumin (BSA), 5.0x10{sup -9}-1.5x10{sup -5}g/mL for human serum albumin (HSA), 1.0x10{sup -8}-7.5x10{sup -6}g/mL for egg albumin (EA). Their detection limits (S/N=3) are 0.5, 0.8 and 2.0ng/mL, respectively. The interaction mechanism is also studied.

  13. Terbium to Quantum Dot FRET Bioconjugates for Clinical Diagnostics: Influence of Human Plasma on Optical and Assembly Properties

    Directory of Open Access Journals (Sweden)

    Niko Hildebrandt


    Full Text Available Förster resonance energy transfer (FRET from luminescent terbium complexes (LTC as donors to semiconductor quantum dots (QDs as acceptors allows extraordinary large FRET efficiencies due to the long Förster distances afforded. Moreover, time-gated detection permits an efficient suppression of autofluorescent background leading to sub-picomolar detection limits even within multiplexed detection formats. These characteristics make FRET-systems with LTC and QDs excellent candidates for clinical diagnostics. So far, such proofs of principle for highly sensitive multiplexed biosensing have only been performed under optimized buffer conditions and interactions between real-life clinical media such as human serum or plasma and LTC-QD-FRET-systems have not yet been taken into account. Here we present an extensive spectroscopic analysis of absorption, excitation and emission spectra along with the luminescence decay times of both the single components as well as the assembled FRET-systems in TRIS-buffer, TRIS-buffer with 2% bovine serum albumin, and fresh human plasma. Moreover, we evaluated homogeneous LTC-QD FRET assays in QD conjugates assembled with either the well-known, specific biotin-streptavidin biological interaction or, alternatively, the metal-affinity coordination of histidine to zinc. In the case of conjugates assembled with biotin-streptavidin no significant interference with the optical and binding properties occurs whereas the histidine-zinc system appears to be affected by human plasma.

  14. Evidence of mass exchange between inside and outside of sonoluminescing bubble in aqueous solution of terbium chloride

    Energy Technology Data Exchange (ETDEWEB)

    Liang, Jinfu, E-mail: [School of Physics and Electronic Science, Guizhou Normal University, Guiyang 550001 (China); Chen, Weizhong, E-mail: [The Key Laboratory of Modern Acoustics, Ministry of Education, Institution of Acoustics, Nanjing University, Nanjing 210093 (China); Wang, Xun; Yang, Jing; Chen, Zhan [The Key Laboratory of Modern Acoustics, Ministry of Education, Institution of Acoustics, Nanjing University, Nanjing 210093 (China)


    Highlights: • Time-resolved spectra of SBSL were obtained for Tb{sup 3+} ions emission lines. • Mass exchange between inside and outside of SL bubble was probed via Tb{sup 3+} ions lines. • The argon rectification hypothesis was tested by time-resolved spectra of SBSL. • The rate of mass exchange inside an SBSL bubble increases with increasing sound pressure. - Abstract: Spectra of single-bubble sonoluminescence (SBSL) were obtained for Tb{sup 3+} ions emission lines from bubbles in an aqueous solution of terbium chloride (TbCl{sub 3}). The spectra provide experimental evidence to prove that an air bubble driven by strong ultrasound will not eventually become a rectified pure argon bubble, which is not as predicted by the argon rectification hypothesis. The time-resolved spectra of SBSL show a mass exchange of material such as Tb{sup 3+} ions between the inside and outside of the bubble. With increasing sound pressure, the rate of mass exchange and the SBSL intensity increases.

  15. Optical properties and electrical transport of thin films of terbium(III bis(phthalocyanine on cobalt

    Directory of Open Access Journals (Sweden)

    Peter Robaschik


    Full Text Available The optical and electrical properties of terbium(III bis(phthalocyanine (TbPc2 films on cobalt substrates were studied using variable angle spectroscopic ellipsometry (VASE and current sensing atomic force microscopy (cs-AFM. Thin films of TbPc2 with a thickness between 18 nm and 87 nm were prepared by organic molecular beam deposition onto a cobalt layer grown by electron beam evaporation. The molecular orientation of the molecules on the metallic film was estimated from the analysis of the spectroscopic ellipsometry data. A detailed analysis of the AFM topography shows that the TbPc2 films consist of islands which increase in size with the thickness of the organic film. Furthermore, the cs-AFM technique allows local variations of the organic film topography to be correlated with electrical transport properties. Local current mapping as well as local I–V spectroscopy shows that despite the granular structure of the films, the electrical transport is uniform through the organic films on the microscale. The AFM-based electrical measurements allow the local charge carrier mobility of the TbPc2 thin films to be quantified with nanoscale resolution.

  16. Highly luminescent charge-neutral europium(iii) and terbium(iii) complexes with tridentate nitrogen ligands. (United States)

    Senthil Kumar, Kuppusamy; Schäfer, Bernhard; Lebedkin, Sergei; Karmazin, Lydia; Kappes, Manfred M; Ruben, Mario


    We report on the synthesis of tridentate-nitrogen pyrazole-pyridine-tetrazole (L(1)H) and pyrazole-pyridine-triazole (L(2)H) ligands and their complexation with lanthanides (Ln = Gd(iii), Eu(iii) and Tb(iii)) resulting in stable, charge-neutral complexes Ln(L(1))3 and Ln(L(2))3, respectively. X-ray crystallographic analysis of the complexes with L(1) ligands revealed tricapped trigonal coordination geometry around the lanthanide ions. All complexes show bright photoluminescence (PL) in the solid state, indicating efficient sensitization of the lanthanide emission via the triplet states of the ligands. In particular, the terbium complexes show high PL quantum yields of 65 and 59% for L(1) and L(2), respectively. Lower PL efficiencies of the europium complexes (7.5 and 9%, respectively) are attributed to large energy gaps between the triplet states of the ligands and accepting levels of Eu(iii). The triplet state energy can be reduced by introducing an electron withdrawing (EW) group at the 4 position of the pyridine ring. Such substitution of L(1)H with a carboxylic ester (COOMe) EW group leads to a europium complex with increased PL quantum yield of 31%. A comparatively efficient PL of the complexes dissolved in ethanol indicates that the lanthanide ions are shielded against nonradiative deactivation via solvent molecules.

  17. Micelle enhanced and terbium sensitized spectrofluorimetric determination of danofloxacin in milk using molecularly imprinted solid phase extraction (United States)

    Kaur, Kuldeep; Saini, Shivender Singh; Malik, Ashok Kumar; Singh, Baldev


    An efficient molecularly imprinted solid phase extraction (MISPE)-spectrofluorimetric method was developed to sensitively determine danofloxacin (DAN) in milk samples. Solid phase extraction procedure using MISPE cartridges was first performed on milk samples and then spectrofluorimetric determination was done at 546 nm using an excitation wavelength of 285 nm in presence of terbium and sodium dodecyl benzene sulfonate (SDBS). It was found that SDBS significantly enhanced the fluorescence intensity of the DAN-Tb3+ complex. Various factors affecting the fluorescence intensity of DAN-Tb3+-SDBS system were studied and conditions were optimized. The enhanced fluorescence intensity of the system (ΔF) showed a good linear relationship with the concentration of DAN over the range of 8.4 × 10-9-3.4 × 10-7 mol L-1 with a correlation coefficient of 0.9996. The detection limit was determined as 2.0 × 10-9 mol L-1 and the limit of quantification was determined as 6.5 × 10-9 mol L-1. The MISPE-spectrofluorimetric procedure was successfully applied to the determination of DAN in milk samples. The method is simple, rapid, sensitive and allows interference free determination of DAN in complex fluorescent matrices like milk. The method can be used to determine whether the DAN residues in milk exceed MRLs or not.

  18. Study of quantum dot based on tin/yttrium mixed oxide doped with terbium to be used as biomarker

    Energy Technology Data Exchange (ETDEWEB)

    Paganini, Paula P.; Felinto, Maria Claudia F.C.; Kodaira, Claudia A., E-mail: paulapaganini@usp.b, E-mail: mfelinto@ipen.b, E-mail: [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil); Brito, Hermi F., E-mail: hefbrito@iq.usp.b [Universidade de Sao Paulo (USP), SP (Brazil). Inst. de Quimica. Lab. de Elementos do Bloco f; Nunes, Luiz Antonio O., E-mail: luizant@ifsc.usp.b [Universidade de Sao Paulo (USP), Sao Carlos, SP (Brazil). Inst. de Fisica. Dept. de Fisica e Informatica


    Quantum dots (semiconductors nanocrystals) have brought a promising field to develop a new generation of luminescent biomarkers. The use of lanthanides ions as luminescent markers has many advantages, for example a security method, low cost, high specificity and also the luminescence can be promptly measured with high sensibility and accuracy. These luminescent dots are functionalized with biomolecules. For the luminophore particle to be connect with biologicals molecules (for example covalent antibody) is necessary a previous chemical treatment to modify luminophore particle surface and this process is called functionalization. A prior chemical treatment with changes on the surface luminophore particle is necessary to couple the luminophore to biological molecules. This process can be used as coating which can protect these particles from being dissolved by acid as well as provide functional groups for biological conjugation. This work presents a photoluminescence study of nanoparticles based on tin/yttrium mixed oxides doped with terbium (SnO{sub 2}/Y{sub 2}O{sub 3}:Tb{sup 3+}), synthesized by coprecipitation method. The nanoparticles were submitted to thermal treatment and characterized by X-Ray Powder Diffraction (XRD) that showed cassiterite phase formation and the influence of thermal treatment on nanoparticles structures. These nanoparticles going to be functionalized with a natural polysaccharide (chitosan) in order to form microspheres. These microspheres going to be irradiated with gamma radiation to sterilization and it can be evaluated if the nanoparticles are resistant to irradiation and they do not lose functionality with this process. (author)

  19. Oyesiku et al., Afr J Tradit Complement Altern Med. (2013) 10(3):144 ...

    African Journals Online (AJOL)


  20. NODC Standard Format Marine Toxic Substances and Pollutants (F144) chemical identification codes (NODC Accession 9200273) (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This archival information package contains a listing of codes and chemical names that were used in NODC Standard Format Marine Toxic Substances and Pollutants (F144)...

  1. 40 CFR 144.83 - Do I need to notify anyone about my Class V injection well? (United States)


    ... written request within the time frame specified. You can start injecting again only if you receive a... Class V injection well? 144.83 Section 144.83 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... Operators of Class V Injection Wells § 144.83 Do I need to notify anyone about my Class V injection well...

  2. Terbium-doped gadolinium oxysulfide (Gd2O2S:Tb) scintillation-based polymer optical fibre sensor for real time monitoring of radiation dose in oncology (United States)

    Lewis, E.; O'Keeffe, S.; Grattan, M.; Hounsell, A.; McCarthy, D.; Woulfe, P.; Cronin, J.; Mihai, L.; Sporea, D.; Santhanam, A.; Agazaryan, N.


    A PMMA based plastic optical fibre sensor for use in real time radiotherapy dosimetry is presented. The optical fibre tip is coated with a scintillation material, terbium-doped gadolinium oxysulfide (Gd2O2S:Tb), which fluoresces when exposed to ionising radiation (X-Ray). The emitted visible light signal penetrates the sensor optical fibre and propagates along the transmitting fibre at the end of which it is remotely monitored using a fluorescence spectrometer. The results demonstrate good repeatability, with a maximum percentage error of 0.5% and the response is independent of dose rate.

  3. Pyrolysis of UR-144, a synthetic cannabinoid, augments an affinity to human CB1receptor and cannabimimetic effects in mice. (United States)

    Kaizaki-Mitsumoto, Asuka; Hataoka, Kyoko; Funada, Masahiko; Odanaka, Yuki; Kumamoto, Hiroki; Numazawa, Satoshi


    Drug abusers most often smoke 'herbal incense' as a cigarette or inhale it using a smoking tool. Smoking may cause pyrolysis of the drug and produce decomposed products of which biological effect has never been investigated. The synthetic cannabinoid UR-144 is known to undergo thermal degradation, giving a ring-opened isomer, so-called UR-144 degradant. The present study demonstrates by using UR-144 as a model drug that the smoke of burned UR-144 contains the UR-144 degradant. The UR-144 degradant showed approximately four fold higher agonist activity to human CB 1 receptor and augmented hypothermic and akinetic actions in mice compared to UR-144. These results indicate that smoking behavior may increase psychological actions of the certain synthetic cannabinoids.

  4. Compact all-fiber optical Faraday components using 65-wt%-terbium-doped fiber with a record Verdet constant of -32 rad/(Tm). (United States)

    Sun, L; Jiang, S; Marciante, J R


    A compact all-fiber Faraday isolator and a Faraday mirror are demonstrated. At the core of each of these components is an all-fiber Faraday rotator made of a 4-cm-long, 65-wt%-terbium-doped silicate fiber. The effective Verdet constant of the terbium-doped fiber is measured to be -32 rad/(Tm), which is 27 x larger than that of silica fiber. This effective Verdet constant is the largest value measured to date in any fiber and is 83% of the Verdet constant of commercially available crystal used in bulk optics-based isolators. Combining the all-fiber Faraday rotator with fiber polarizers results in a fully fusion spliced all-fiber isolator whose isolation is measured to be 19 dB. Combining the all-fiber Faraday rotator with a fiber Bragg grating results in an all-fiber Faraday mirror that rotates the polarization state of the reflected light by 88 +/- 4 degrees .

  5. Picomolar Traces of Americium(III) Introduce Drastic Changes in the Structural Chemistry of Terbium(III): A Break in the "Gadolinium Break". (United States)

    Welch, Jan M; Müller, Danny; Knoll, Christian; Wilkovitsch, Martin; Giester, Gerald; Ofner, Johannes; Lendl, Bernhard; Weinberger, Peter; Steinhauser, Georg


    The crystallization of terbium 5,5'-azobis[1H-tetrazol-1-ide] (ZT) in the presence of trace amounts (ca. 50 Bq, ca. 1.6 pmol) of americium results in 1) the accumulation of the americium tracer in the crystalline solid and 2) a material that adopts a different crystal structure to that formed in the absence of americium. Americium-doped [Tb(Am)(H 2 O) 7 ZT] 2 ZT⋅10 H 2 O is isostructural to light lanthanide (Ce-Gd) 5,5'-azobis[1H-tetrazol-1-ide] compounds, rather than to the heavy lanthanide (Tb-Lu) 5,5'-azobis[1H-tetrazol-1-ide] (e.g., [Tb(H 2 O) 8 ] 2 ZT 3 ⋅6 H 2 O) derivatives. Traces of Am seem to force the Tb compound into a structure normally preferred by the lighter lanthanides, despite a 10 8 -fold Tb excess. The americium-doped material was studied by single-crystal X-ray diffraction, vibrational spectroscopy, radiochemical neutron activation analysis, and scanning electron microcopy. In addition, the inclusion properties of terbium 5,5'-azobis[1H-tetrazol-1-ide] towards americium were quantified, and a model for the crystallization process is proposed. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Retention Characteristics of CBTi144 Thin Films Explained by Means of X-Ray Photoemission Spectroscopy

    Directory of Open Access Journals (Sweden)

    G. Biasotto


    Full Text Available CaBi4Ti4O15 (CBTi144 thin films were grown on Pt/Ti/SiO2/Si substrates using a soft chemical solution and spin-coating method. Structure and morphology of the films were characterized by the X-ray Diffraction (XRD, Fourier-transform infrared spectroscopy (FT-IR, Raman analysis, X-ray photoemission spectroscopy (XPS, and transmission electron microscopy (TEM. The films present a single phase of layered-structured perovskite with polar axis orient. The a/b-axis orientation of the ferroelectric film is considered to be associated with the preferred orientation of the Pt bottom electrode. XPS measurements were employed to understand the nature of defects on the retention behavior of CBTi144 films. We have observed that the main source of retention-free characteristic of the capacitors is the oxygen environment in the CBTi144 lattice.

  7. Structural characterization of CYP144A1 - a cytochrome P450 enzyme expressed from alternative transcripts in Mycobacterium tuberculosis (United States)

    Chenge, Jude; Kavanagh, Madeline E.; Driscoll, Max D.; McLean, Kirsty J.; Young, Douglas B.; Cortes, Teresa; Matak-Vinkovic, Dijana; Levy, Colin W.; Rigby, Stephen E. J.; Leys, David; Abell, Chris; Munro, Andrew W.


    Mycobacterium tuberculosis (Mtb) causes the disease tuberculosis (TB). The virulent Mtb H37Rv strain encodes 20 cytochrome P450 (CYP) enzymes, many of which are implicated in Mtb survival and pathogenicity in the human host. Bioinformatics analysis revealed that CYP144A1 is retained exclusively within the Mycobacterium genus, particularly in species causing human and animal disease. Transcriptomic annotation revealed two possible CYP144A1 start codons, leading to expression of (i) a “full-length” 434 amino acid version (CYP144A1-FLV) and (ii) a “truncated” 404 amino acid version (CYP144A1-TRV). Computational analysis predicted that the extended N-terminal region of CYP144A1-FLV is largely unstructured. CYP144A1 FLV and TRV forms were purified in heme-bound states. Mass spectrometry confirmed production of intact, His6-tagged forms of CYP144A1-FLV and -TRV, with EPR demonstrating cysteine thiolate coordination of heme iron in both cases. Hydrodynamic analysis indicated that both CYP144A1 forms are monomeric. CYP144A1-TRV was crystallized and the first structure of a CYP144 family P450 protein determined. CYP144A1-TRV has an open structure primed for substrate binding, with a large active site cavity. Our data provide the first evidence that Mtb produces two different forms of CYP144A1 from alternative transcripts, with CYP144A1-TRV generated from a leaderless transcript lacking a 5‧-untranslated region and Shine-Dalgarno ribosome binding site.

  8. Determination of Rigidity of Protein Bound Au(144) Clusters by Electron Cryomicroscopy. (United States)

    Sexton, Jonathan Z; Ackerson, Christopher J


    A method for estimating the positional displacement of protein bound gold nanoparticles is presented and used to estimate the rigidity of linkage of Au(144) nanoparticles bound to a tetrameric model protein. We observe a distribution of displacement values where most Au(144) clusters are immobilized to within 3Å relative to the protein center of mass. The shape of the distribution suggests two physical processes of thermal motion and protein deformation. The application of this and similar rigid gold nanoparticle/protein conjugates in high resolution single particle electron cryo-microscopy is discussed.

  9. Sex Differences in Left-Handedness: A Meta-Analysis of 144 Studies (United States)

    Papadatou-Pastou, Marietta; Martin, Maryanne; Munafo, Marcus R.; Jones, Gregory V.


    Human handedness, a marker for language lateralization in the brain, continues to attract great research interest. A widely reported but not universal finding is a greater male tendency toward left-handedness. Here the authors present a meta-analysis of k = 144 studies, totaling N = 1,787,629 participants, the results of which demonstrate that the…

  10. Crystal Structure of the Murine Cytomegalovirus MHC-I Homolog m144

    Energy Technology Data Exchange (ETDEWEB)

    Natarajan,K.; Hicks, A.; Mans, J.; Robinson, H.; Guan, R.; Mariuzza, R.; Margulies, D.


    Large DNA viruses of the herpesvirus family produce proteins that mimic host MHC-I molecules as part of their immunoevasive strategy. The m144 glycoprotein, expressed by murine cytomegalovirus, is thought to be an MHC-I homolog whose expression prolongs viral survival in vivo by preventing natural killer cell activation. To explore the structural basis of this m144 function, we have determined the three-dimensional structure of an m144/{beta}2-microglobulin ({beta}2m) complex at 1.9 {angstrom} resolution. This structure reveals the canonical features of MHC-I molecules including readily identifiable {alpha}1, {alpha}2, and {alpha}3 domains. A unique disulfide bond links the {alpha}1 helix to the {beta}-sheet floor, explaining the known thermal stability of m144. Close juxtaposition of the {alpha}1 and {alpha}2 helices and the lack of critical residues that normally contribute to anchoring the peptide N and C termini eliminates peptide binding. A region of 13 amino acid residues, corresponding to the amino-terminal portion of the {alpha}2 helix, is missing in the electron density map, suggesting an area of structural flexibility that may be involved in ligand binding.

  11. 40 CFR 144.7 - Identification of underground sources of drinking water and exempted aquifers. (United States)


    ... PROTECTION AGENCY (CONTINUED) WATER PROGRAMS (CONTINUED) UNDERGROUND INJECTION CONTROL PROGRAM General Provisions § 144.7 Identification of underground sources of drinking water and exempted aquifers. (a) The..., except where exempted under paragraph (b) of this section, as an underground source of drinking water...

  12. 49 CFR 176.144 - Segregation of Class 1 (explosive) materials. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Segregation of Class 1 (explosive) materials. 176... VESSEL Detailed Requirements for Class 1 (Explosive) Materials Segregation § 176.144 Segregation of Class... any ferrous metal or aluminum alloy, unless separated by a partition. (e) Segregation on deck: When...

  13. Homozygosity Mapping and Genetic Analysis of Autosomal Recessive Retinal Dystrophies in 144 Consanguineous Pakistani Families (United States)

    Li, Lin; Chen, Yabin; Jiao, Xiaodong; Jin, Chongfei; Jiang, Dan; Tanwar, Mukesh; Ma, Zhiwei; Huang, Li; Ma, Xiaoyin; Sun, Wenmin; Chen, Jianjun; Ma, Yan; M'hamdi, Oussama; Govindarajan, Gowthaman; Cabrera, Patricia E.; Li, Jiali; Gupta, Nikhil; Naeem, Muhammad Asif; Khan, Shaheen N.; Riazuddin, Sheikh; Akram, Javed; Ayyagari, Radha; Sieving, Paul A.; Riazuddin, S. Amer; Hejtmancik, J. Fielding


    Purpose The Pakistan Punjab population has been a rich source for identifying genes causing or contributing to autosomal recessive retinal degenerations (arRD). This study was carried out to delineate the genetic architecture of arRD in the Pakistani population. Methods The genetic origin of arRD in a total of 144 families selected only for having consanguineous marriages and multiple members affected with arRD was examined. Of these, causative mutations had been identified in 62 families while only the locus had been identified for an additional 15. The remaining 67 families were subjected to homozygosity exclusion mapping by screening of closely flanking microsatellite markers at 180 known candidate genes/loci followed by sequencing of the candidate gene for pathogenic changes. Results Of these 67 families subjected to homozygosity mapping, 38 showed homozygosity for at least one of the 180 regions, and sequencing of the corresponding genes showed homozygous cosegregating mutations in 27 families. Overall, mutations were detected in approximately 61.8 % (89/144) of arRD families tested, with another 10.4% (15/144) being mapped to a locus but without a gene identified. Conclusions These results suggest the involvement of unmapped novel genes in the remaining 27.8% (40/144) of families. In addition, this study demonstrates that homozygosity mapping remains a powerful tool for identifying the genetic defect underlying genetically heterogeneous arRD disorders in consanguineous marriages for both research and clinical applications. PMID:28418496

  14. 42 CFR 413.144 - Depreciation: Allowance for depreciation on fully depreciated or partially depreciated assets. (United States)


    ... 42 Public Health 2 2010-10-01 2010-10-01 false Depreciation: Allowance for depreciation on fully... SKILLED NURSING FACILITIES Capital-Related Costs § 413.144 Depreciation: Allowance for depreciation on fully depreciated or partially depreciated assets. (a) Principle. Depreciation on assets being used by a...

  15. Nanostructures via noncovalent synthesis: 144 hydrogen bonds bring together 27 components

    NARCIS (Netherlands)

    Paraschiv, V.; Crego Calama, Mercedes; Fokkens, R.H.; Padberg, Clemens J.; Timmerman, P.; Reinhoudt, David


    This paper describes the spontaneous and reversible assembly of 20 kDa synthetic hydrogen-bonded assemblies via the formation of 144 cooperative hydrogen bonds. These nanostructures (3.0 × 5.5 nm), consisting of 27 different components, have been carefully characterized using a combination of 1H NMR

  16. Cytochrome P450-mediated metabolism of the synthetic cannabinoids UR-144 and XLR-11

    DEFF Research Database (Denmark)

    Nielsen, Line Marie; Holm, Niels Bjerre; Olsen, Lars


    In recent years, synthetic cannabinoids have emerged in the illicit drug market, in particular via the Internet, leading to abuse of these drugs. There is currently limited knowledge about the specific enzymes involved in the metabolism of these drugs. In this study, we investigated the cytochrome...... of UR-144 and XLR-11, while inhibition of the other CYP enzymes in HLM had only minor effects. Thus, CYP3A4 is the major contributor to the CYP mediated metabolism of UR-144 and XLR-11 with minor contributions from CYP1A2. Users of UR-144 and XLR-11 are thus subject to the influence of potential drug-drug...... the specific CYP enzymes involved in the metabolism of UR-144 and XLR-11 utilizing a panel of nine recombinant enzymes (CYP1A2, 2B6, 2C8, 2C9, 2C18, 2C19, 2D6, 3A4, and 2E1). This is followed by an investigation of the effect of specific inhibitors targeted against CYP1A2, 2B6, 2C9, 2C19, 2D6 and 3A4 in human...

  17. Physical and genetic characterization of the IncI plasmid R144-drd3

    NARCIS (Netherlands)

    Hartskeerl, R.A.; Guchte, M. v.d.; Zuidweg, E.M.; Hoekstra, W.P.M.


    A physical and genetic map of the IncI plasmid R144-drd3 was obtained by determining restriction endonuclease sites and by physical and genetic analysis of cloned fragments, of TnI insertion mutants and of deletion mutants.

  18. Crystal structures of two mononuclear complexes of terbium(III) nitrate with the tripodal alcohol 1,1,1-tris-(hy-droxy-meth-yl)propane. (United States)

    Gregório, Thaiane; Giese, Siddhartha O K; Nunes, Giovana G; Soares, Jaísa F; Hughes, David L


    Two new mononuclear cationic complexes in which the TbIII ion is bis-chelated by the tripodal alcohol 1,1,1-tris-(hy-droxy-meth-yl)propane (H3LEt, C6H14O3) were prepared from Tb(NO3)3·5H2O and had their crystal and mol-ecular structures solved by single-crystal X-ray diffraction analysis after data collection at 100 K. Both products were isolated in reasonable yields from the same reaction mixture by using different crystallization conditions. The higher-symmetry complex dinitratobis[1,1,1-tris-(hy-droxy-meth-yl)propane]-terbium(III) nitrate di-meth-oxy-ethane hemisolvate, [Tb(NO3)2(H3LEt)2]NO3·0.5C4H10O2, 1, in which the lanthanide ion is 10-coordinate and adopts an s-bicapped square-anti-prismatic coordination geometry, contains two bidentate nitrate ions bound to the metal atom; another nitrate ion functions as a counter-ion and a half-mol-ecule of di-meth-oxy-ethane (completed by a crystallographic twofold rotation axis) is also present. In product aqua-nitratobis[1,1,1-tris-(hy-droxy-meth-yl)propane]-terbium(III) dinitrate, [Tb(NO3)(H3LEt)2(H2O)](NO3)2, 2, one bidentate nitrate ion and one water mol-ecule are bound to the nine-coordinate terbium(III) centre, while two free nitrate ions contribute to charge balance outside the tricapped trigonal-prismatic coordination polyhedron. No free water mol-ecule was found in either of the crystal structures and, only in the case of 1, di-meth-oxy-ethane acts as a crystallizing solvent. In both mol-ecular structures, the two tripodal ligands are bent to one side of the coordination sphere, leaving room for the anionic and water ligands. In complex 2, the methyl group of one of the H3LEt ligands is disordered over two alternative orientations. Strong hydrogen bonds, both intra- and inter-molecular, are found in the crystal structures due to the number of different donor and acceptor groups present.

  19. Biological effects of inhaled {sup 144}CeCl{sub 3} in beagle dogs

    Energy Technology Data Exchange (ETDEWEB)

    Hahn, F.F.; Boecker, B.B.; Griffith, W.C.; Muggenburg, B.A. [Inhalation Toxicology Research Institute, Albuquerque, NM (United States)


    The biological effects of {sup 144}Ce were studied in beagle dogs that were exposed to graded activity levels of {sup 144}CeCl{sub 3} via a single, brief inhalation exposure and observed for their life span. The long-term retained body burdens ranged from 0.06 to 13 MBq/kg with a median of 1.2 MBq/kg. After a short residence time in the lung, most of the {sup 144}Ce was translocated to liver and skeleton, where the {sup 144}Ce was retained with a half-time approaching the physical half-life of {sup 144}Ce was retained with a half-time approaching the physical half-life of {sup 144}Ce, 284 days. Significant radiation doses were delivered to the lung, 28 Gy (median) and 2.5-370 Gy (range); liver, 68 Gy (median) and 6.1-250 Gy (range); and skeleton, 21 Gy (median) and 1.9-100 Gy (range). Lesions induced by the {beta}-particle radiation were noted in the lung, liver, skeleton, bone marrow, and oral and nasal mucosae closely associated with bond. Early deaths (within 2.5 years) were generally related to hematological dyscrasia, radiation pneumonitis, or hepatocellular degeneration and atrophy. Neoplasms that occurred relatively early, from 2.2-6.8 years after exposure, were noted in the liver, bone, bone marrow and oral mucosa closely associated with bone. Neoplasms that occurred later, beyond 7 years after exposure, were noted in the liver, lung and nasal mucosa closely associated with bone. Increased numbers of neoplasms were not found in two other organs that had relatively high radiation doses, namely the thyroid and kidney. Only one primary bone tumor was noted, but 11 tumors of bone-associated tissues (oral and nasal mucosae and bone marrow) were found. Radiation doses and effects in tissues adjacent to bone, especially those of epithelial or marrow origin, should be considered when determining risks from internally deposited bone-seeking radionuclides, such as {sup 144}Ce. 59 refs., 8 figs., 10 tabs.

  20. Structure of the Bacteriophage [phi]KZ Lytic Transglycosylase gp144

    Energy Technology Data Exchange (ETDEWEB)

    Fokine, Andrei; Miroshnikov, Konstantin A.; Shneider, Mikhail M.; Mesyanzhinov, Vadim V.; Rossmann, Michael G. (SOIBC); (Purdue)


    Lytic transglycosylases are enzymes that act on the peptidoglycan of bacterial cell walls. They cleave the glycosidic linkage between N-acetylmuramoyl and N-acetylglucosaminyl residues with the concomitant formation of a 1,6-anhydromuramoyl product. The x-ray structure of the lytic transglycosylase gp144 from the Pseudomonas bacteriophage {phi}KZ has been determined to 2.5-{angstrom} resolution. This protein is probably employed by the bacteriophage in the late stage of the virus reproduction cycle to destroy the bacterial cell wall to release the phage progeny. {phi}KZ gp144 is a 260-residue {alpha}-helical protein composed of a 70-residue N-terminal cell wall-binding domain and a C-terminal catalytic domain. The fold of the N-terminal domain is similar to the peptidoglycan-binding domain from Streptomyces albus G d-Ala-d-Ala carboxypeptidase and to the N-terminal prodomain of human metalloproteinases that act on extracellular matrices. The C-terminal catalytic domain of gp144 has a structural similarity to the catalytic domain of the transglycosylase Slt70 from Escherichia coli and to lysozymes. The gp144 catalytic domain has an elongated groove that can bind at least five sugar residues at sites A-E. As in other lysozymes, the peptidoglycan cleavage (catalyzed by Glu{sup 115} in gp144) occurs between sugar-binding subsites D and E. The x-ray structure of the {phi}KZ transglycosylase complexed with the chitotetraose (N-acetylglucosamine){sub 4} has been determined to 2.6-{angstrom} resolution. The N-acetylglucosamine residues of the chitotetraose bind in sites A-D.

  1. The response behavior of PPy-DB18C6 electrode to terbium(III in acetonitrile and its thermodynamic application

    Directory of Open Access Journals (Sweden)

    Mohammad Hossein Arbab Zavar


    Full Text Available Polypyrrole modified electrode prepared by electropolymerization of pyrrole in the presence of a complexing ligand, dibenzo-18-crown-6(DB18C6, was prepared and investigated as a Tb3+-selective electrode in acetonitrile. The potentiometric response of the electrode was linear within the Tb3+ concentration range 1 × 10−5–1 × 10−2 M with a Nernstian slope of 20.9 mVdecade−1 in AN. The electrode was applied to study the complexation of the terbium(III ion in acetonitrile with such other basic aprotic solvent molecules (D as dimethyl sulfoxide, N,N-dimethyl formamide, propylene carbonate and pyridine. The successive complex formation constant (βi and Gibbs energies of transfer (ΔGtr of Tb3+ in AN in relation to such D were obtained.

  2. Luminescence and Magnetic Properties of Two Three-Dimensional Terbium and Dysprosium MOFs Based on Azobenzene-4,4′-Dicarboxylic Linker

    Directory of Open Access Journals (Sweden)

    Belén Fernández


    Full Text Available We report the in situ formation of two novel metal-organic frameworks based on terbium and dysprosium ions using azobenzene-4,4′-dicarboxylic acid (H2abd as ligand, synthesized by soft hydrothermal routes. Both materials show isostructural three-dimensional networks with channels along a axis and display intense photoluminescence properties in the solid state at room temperature. Textural properties of the metal-organic frameworks (MOFs have been fully characterized although no appreciable porosity was obtained. Magnetic properties of these materials were studied, highlighting the dysprosium material displays slightly frequency-dependent out of phase signals when measured under zero external field and under an applied field of 1000 Oe.

  3. Effectiveness of antihypertensive therapy in HIV-positive patients: evaluation to 144 weeks

    Directory of Open Access Journals (Sweden)

    K Falasca


    Full Text Available Hypertension is more prevalent among HIV-infected subjects than in the general population, contributing to increased cardiovascular risk in HIV+ patients. The angiotensin II receptor blocker telmisartan is also a partial peroxisome proliferator activated receptor (PPAR-γ agonist, with documented effects on improving hypertension, lipid metabolism and renal function. Therefore telmisartan was found to be the first choice for treatment of HIV+ hypertensive patients. Aim of this study was to evaluate the durability on 144 weeks of treatment with telmisartan in HIV+ patients. 13 HIV+ Caucasian male patients treated with combined antiretroviral therapy (cART and discovered to be naïve hypertensive, were given 80 mg telmisartan daily. Systolic (SBP and diastolic (DBP blood pressure, viro-immunological, lipid and metabolic parameters, including triglycerides, cholesterol, insulin resistance (HOMA-IR, inflammatory markers, C-reactive protein (CRP, erythrocyte sedimentation rate (ESR, indexes of renal function and cardiovascular risk, microalbuminuria, cystatin C, were measured at baseline (T0, and after 24 (T24, 48 (T48, 72 (T72, 96 (T96, 120 (T120 and 144 (T144 weeks. Treatment with telmisartan decreased SBP and DBP levels during the 144 weeks of observation. We also observed improved HDL-cholesterol, HOMA-IR, microalbuminuria and cystatin C at the end of study. Triglycerides and total cholesterol significantly decreased and HDL-cholesterol significantly increased. Total cholesterol/HDL cholesterol ratio improved significantly. Throughout in the course of the trial our patients showed a significant improvement of the percentage of CD4+ and CD8+. Eventually in all 144 weeks of therapy with telmisartan 80 mg/day have not observed adverse events or dropouts. Telmisartan was effective in improving hypertension, lipid metabolism and renal function in 144 weeks of evaluation. It determines the improvement of cystatin C and microalbuminuria, markers of

  4. 40 CFR 144.21 - Existing Class I, II (except enhanced recovery and hydrocarbon storage) and III wells. (United States)


    ... recovery and hydrocarbon storage) and III wells. 144.21 Section 144.21 Protection of Environment... hydrocarbon storage) and III wells. (a) An existing Class I, II (except enhanced recovery and hydrocarbon... decision; or (9) For Class II wells (except enhanced recovery and hydrocarbon storage), five years after...

  5. Luminescent europium and terbium complexes of dipyridoquinoxaline and dipyridophenazine ligands as photosensitizing antennae: structures and biological perspectives. (United States)

    Dasari, Srikanth; Patra, Ashis K


    The europium(III) and terbium(III) complexes, namely [Eu(dpq)(DMF)2(NO3)3] (1), [Eu(dppz)2(NO3)3] (2), [Tb(dpq)(DMF)2Cl3] (3), and [Tb(dppz)(DMF)2Cl3] (4), where dipyrido[3,2-d:2',3'-f]quinoxaline (dpq in 1 and 3), dipyrido[3,2-a:2',3'-c]phenazine (dppz in 2 and 4) and N,N'-dimethylformamide (DMF) have been isolated, characterized from their physicochemical data, luminescence studies and their interaction with DNA, serum albumin protein and photo-induced DNA cleavage activity are studied. The X-ray crystal structures of complexes 1-4 show discrete mononuclear Ln(3+)-based structures. The Eu(3+) in [Eu(dpq)(DMF)2(NO3)3] (1) and [Eu(dppz)2(NO3)3] (2) as [Eu(dppz)2(NO3)3]·dppz (2a) adopts a ten-coordinated bicapped dodecahedron structure with a bidentate N,N-donor dpq ligand, two DMF and three NO3(-) anions in 1 and two bidentate N,N-donor dppz ligands and three NO3(-) anions in 2. Complexes 3 and 4 show a seven-coordinated mono-capped octahedron structure where Tb(3+) contains bidentate dpq/dppz ligands, two DMF and three Cl(-) anions. The complexes are highly luminescent in nature indicating efficient photo-excited energy transfer from the dpq/dppz antenna to Ln(3+) to generate long-lived emissive excited states for characteristic f → f transitions. The time-resolved luminescence spectra of complexes 1-4 show typical narrow emission bands attributed to the (5)D0 → (7)F(J) and (5)D4 → (7)F(J) f-f transitions of Eu(3+) and Tb(3+) ions respectively. The number of inner-sphere water molecules (q) was determined from luminescence lifetime measurements in H2O and D2O confirming ligand-exchange reactions with water in solution. The complexes display significant binding propensity to the CT-DNA giving binding constant values in the range of 1.0 × 10(4)-6.1 × 10(4) M(-1) in the order 2, 4 (dppz) > 1, 3 (dpq). DNA binding data suggest DNA groove binding with the partial intercalation nature of the complexes. All the complexes also show binding propensity (K(BSA)

  6. Machine learning methods enable predictive modeling of antibody feature:function relationships in RV144 vaccinees.

    Directory of Open Access Journals (Sweden)

    Ickwon Choi


    Full Text Available The adaptive immune response to vaccination or infection can lead to the production of specific antibodies to neutralize the pathogen or recruit innate immune effector cells for help. The non-neutralizing role of antibodies in stimulating effector cell responses may have been a key mechanism of the protection observed in the RV144 HIV vaccine trial. In an extensive investigation of a rich set of data collected from RV144 vaccine recipients, we here employ machine learning methods to identify and model associations between antibody features (IgG subclass and antigen specificity and effector function activities (antibody dependent cellular phagocytosis, cellular cytotoxicity, and cytokine release. We demonstrate via cross-validation that classification and regression approaches can effectively use the antibody features to robustly predict qualitative and quantitative functional outcomes. This integration of antibody feature and function data within a machine learning framework provides a new, objective approach to discovering and assessing multivariate immune correlates.

  7. Machine learning methods enable predictive modeling of antibody feature:function relationships in RV144 vaccinees. (United States)

    Choi, Ickwon; Chung, Amy W; Suscovich, Todd J; Rerks-Ngarm, Supachai; Pitisuttithum, Punnee; Nitayaphan, Sorachai; Kaewkungwal, Jaranit; O'Connell, Robert J; Francis, Donald; Robb, Merlin L; Michael, Nelson L; Kim, Jerome H; Alter, Galit; Ackerman, Margaret E; Bailey-Kellogg, Chris


    The adaptive immune response to vaccination or infection can lead to the production of specific antibodies to neutralize the pathogen or recruit innate immune effector cells for help. The non-neutralizing role of antibodies in stimulating effector cell responses may have been a key mechanism of the protection observed in the RV144 HIV vaccine trial. In an extensive investigation of a rich set of data collected from RV144 vaccine recipients, we here employ machine learning methods to identify and model associations between antibody features (IgG subclass and antigen specificity) and effector function activities (antibody dependent cellular phagocytosis, cellular cytotoxicity, and cytokine release). We demonstrate via cross-validation that classification and regression approaches can effectively use the antibody features to robustly predict qualitative and quantitative functional outcomes. This integration of antibody feature and function data within a machine learning framework provides a new, objective approach to discovering and assessing multivariate immune correlates.

  8. The high precision measurement of the 144Ce activity in the SOX experiment (United States)

    Di Noto, L.; Agostini, M.; Althenmüller, K.; Appel, S.; Bellini, G.; Benziger, J.; Berton, N.; Bick, D.; Bonfini, G.; Bravo—Berguño, D.; Caccianiga, B.; Calaprice, F.; Caminata, A.; Cavalcante, P.; Cereseto, R.; Chepurnov, A.; Choi, K.; Cribier, M.; DAngelo, D.; Davini, S.; Derbin, A.; Drachnev, I.; Durero, M.; Etenko, A.; Farinon, S.; Fischer, V.; Fomenko, K.; Franco, D.; Gabriele, F.; Gaffiot, J.; Galbiati, C.; Ghiano, C.; Giammarchi, M.; Göeger-Neff, M.; Goretti, A.; Gromov, M.; Hagner, C.; Houdy, Th; Hungerford, E.; Ianni, Aldo; Ianni, Andrea; Jonquères, N.; Jedrzejczak, K.; Kaiser, M.; Kobychev, V.; Korablev, D.; Korga, G.; Kornoukhov, V.; Kryn, D.; Lachenmaier, T.; Lasserre, T.; Laubenstein, M.; Lehnert, T.; Link, J.; Litvinovich, E.; Lombardi, F.; Lombardi, P.; Ludhova, L.; Lukyanchenko, G.; Machulin, I.; Manecki, S.; Maneschg, W.; Marcocci, S.; Maricic, J.; Mention, G.; Meroni, E.; Meyer, M.; Miramonti, L.; Misiaszek, M.; Montuschi, M.; Mosteiro, P.; Muratova, V.; Musenich, R.; Neumair, B.; Oberauer, L.; Obolensky, M.; Ortica, F.; Pallavicini, M.; Papp, L.; Perasso, L.; Pocar, A.; Ranucci, G.; Razeto, A.; Re, A.; Romani, A.; Roncin, R.; Rossi, C.; Rossi, N.; Schönert, S.; Scola, L.; Semenov, D.; Simgen, H.; Skorokhvatov, M.; Smirnov, O.; Sotnikov, A.; Sukhotin, S.; Suvorov, Y.; Tartaglia, R.; Testera, G.; Thurn, J.; Toropova, M.; Veyssière, C.; Vivier, M.; Unzhakov, E.; Vogelaar, R. B.; von Feilitzsch, F.; Wang, H.; Weinz, S.; Winter, J.; Wojcik, M.; Wurm, M.; Yokley, Z.; Zaimidoroga, O.; Zavatarelli, S.; Zuber, K.; Zuzel, G.


    In order to perform a resolutive measurement to clarify the neutrino anomalies and to observe possible short distance neutrino oscillations, the SOX (Short distance neutrino Oscillations with BoreXino) experiment is under construction. In the first phase, a 100 kCi 144Ce-144Pr antineutrino source will be placed under the Borexino detector at the Laboratori Nazionali del Gran Sasso (LNGS), in center of Italy, and the rate measurement of the antineutrino events, observed by the very low radioactive background Borexino detector, will be compared with the high precision (< 1%) activity measurement performed by two calorimeters. The source will be embedded in a 19 mm thick tungsten alloy shield and both the calorimeters have been conceived for measuring the thermal heat absorbed by a water flow. In this report the design of the calorimeters will be described in detail and very preliminary results will be also shown.

  9. Change of deformation at the backbending in the yrast superdeformed band of {sup 144}Gd

    Energy Technology Data Exchange (ETDEWEB)

    Ur, C.A.; Bolzonella, G.P.; Bazzacco, D. [dell`Universita, Padova (Italy)]|[INFN, Padova (Italy)] [and others


    A mean lifetime measurement using the Doppler shift attenuation method has been performed at GASP in order to extract the quadrupole moment of the yrast SD band of {sup 144}Gd. The extracted intrinsic quadrupole moments, being Q{sub 0}=13.7 eb above the backbending and Q{sub 0}=11.8 eb below the backbending, are consistent with a change of deformation from {beta}{sub 2}=0.51 (at {beta}{sub 4} {approx} 0.050) to {beta}{sub 2}=0.45 (at {beta}{sub 4} {approx}0.035). The experimental results are in nice agreement with the theoretical predictions, which revealed that the second well in {sup 144}Gd arises essentially from the very favored shell structure at N=80 and Z=64. The occupation at higher frequency of the aligned N=6 proton orbitals drives the nucleus to a slightly more deformed shape.

  10. Replication of JC Virus DNA in the G144 Oligodendrocyte Cell Line Is Dependent Upon Akt. (United States)

    Peterson, Jesse N; Lin, Brian; Shin, Jong; Phelan, Paul J; Tsichlis, Philip; Schwob, James E; Bullock, Peter A


    Progressive multifocal leukoencephalopathy (PML) is an often-fatal demyelinating disease of the central nervous system. PML results when oligodendrocytes within immunocompromised individuals are infected with the human JC virus (JCV). We have identified an oligodendrocyte precursor cell line, termed G144, that supports robust levels of JCV DNA replication, a central part of the JCV life cycle. In addition, we have determined that JC virus readily infects G144 cells. Furthermore, we have determined that JCV DNA replication in G144 cells is stimulated by myristoylated (i.e., constitutively active) Akt and reduced by the Akt-specific inhibitor MK2206. Thus, this oligodendrocyte-based model system will be useful for a number of purposes, such as studies of JCV infection, establishing key pathways needed for the regulation of JCV DNA replication, and identifying inhibitors of this process.IMPORTANCE The disease progressive multifocal leukoencephalopathy (PML) is caused by the infection of particular brain cells, termed oligodendrocytes, by the JC virus. Studies of PML, however, have been hampered by the lack of an immortalized human cell line derived from oligodendrocytes. Here, we report that the G144 oligodendrocyte cell line supports both infection by JC virus and robust levels of JCV DNA replication. Moreover, we have established that the Akt pathway regulates JCV DNA replication and that JCV DNA replication can be inhibited by MK2206, a compound that is specific for Akt. These and related findings suggest that we have established a powerful oligodendrocyte-based model system for studies of JCV-dependent PML. Copyright © 2017 American Society for Microbiology.

  11. Gene expression analysis of embryonic stem cells expressing VE-cadherin (CD144 during endothelial differentiation

    Directory of Open Access Journals (Sweden)

    Libermann Towia


    Full Text Available Abstract Background Endothelial differentiation occurs during normal vascular development in the developing embryo. This process is recapitulated in the adult when endothelial progenitor cells are generated in the bone marrow and can contribute to vascular repair or angiogenesis at sites of vascular injury or ischemia. The molecular mechanisms of endothelial differentiation remain incompletely understood. Novel approaches are needed to identify the factors that regulate endothelial differentiation. Methods Mouse embryonic stem (ES cells were used to further define the molecular mechanisms of endothelial differentiation. By flow cytometry a population of VEGF-R2 positive cells was identified as early as 2.5 days after differentiation of ES cells, and a subset of VEGF-R2+ cells, that were CD41 positive at 3.5 days. A separate population of VEGF-R2+ stem cells expressing the endothelial-specific marker CD144 (VE-cadherin was also identified at this same time point. Channels lined by VE-cadherin positive cells developed within the embryoid bodies (EBs formed by differentiating ES cells. VE-cadherin and CD41 expressing cells differentiate in close proximity to each other within the EBs, supporting the concept of a common origin for cells of hematopoietic and endothelial lineages. Results Microarray analysis of >45,000 transcripts was performed on RNA obtained from cells expressing VEGF-R2+, CD41+, and CD144+ and VEGF-R2-, CD41-, and CD144-. All microarray experiments were performed in duplicate using RNA obtained from independent experiments, for each subset of cells. Expression profiling confirmed the role of several genes involved in hematopoiesis, and identified several putative genes involved in endothelial differentiation. Conclusion The isolation of CD144+ cells during ES cell differentiation from embryoid bodies provides an excellent model system and method for identifying genes that are expressed during endothelial differentiation and that

  12. Structure & bonding of the gold-subhalide cluster I-Au144Cl60[z]. (United States)

    Tlahuice-Flores, Alfredo; Black, David M; Bach, Stephan B H; Jose-Yacamán, Miguel; Whetten, Robert L


    The structure and bonding of the gold-subhalide compounds Au144Cl60([z]) are related to those of the ubiquitous thiolated gold clusters, or Faradaurates, by iso-electronic substitution of thiolate by chloride. Exact I-symmetry holds for the [z] = [2+,4+] charge-states, in accordance with new electrospray mass spectrometry measurements and the predicted electron shell filling. The high symmetry facilitates analysis of the global structure as well as the bonding network, with some striking results.

  13. Focusing of 3C144 Source Radiation by the Solar Corona (United States)

    Galanin, V. V.; Derevjagin, V. G.; Kravetz, R. O.

    The research of solar corona by the compact cosmic source radiation was made on URAN-4 radio telescope. In the period from June 6 to June 20 2012 the flow of Crab nebula was measured on the 20 MHz and 25 MHz frequencies. During the eclipse we observe the great increase of 3C144 flow, which is compare with the flow of 3C461 source. Data and results of measurement analysis is presented.

  14. Inhibiting microRNA-144 abates oxidative stress and reduces apoptosis in hearts of streptozotocin-induced diabetic mice. (United States)

    Yu, Manli; Liu, Yu; Zhang, Bili; Shi, Yicheng; Cui, Ling; Zhao, Xianxian


    Hyperglycemia-induced reactive oxygen species (ROS) generation contributes to the development of diabetic cardiomyopathy. However, little is known about the role of microRNAs in the regulation of ROS formation and myocardial apoptosis in streptozotocin (STZ)-induced diabetic mice. It was observed that microRNA-144 (miR-144) level was lower in heart tissues of STZ-induced diabetic mice. High glucose exposure also reduced miR-144 levels in cultured cardiomyocytes. Moreover, miR-144 modulated high glucose-induced oxidative stress in cultured cardiomyocytes by directly targeting nuclear factor-erythroid 2-related factor 2 (Nrf2), which was a central regulator of cellular response to oxidative stress. The miR-144 mimics aggravated high glucose-induced ROS formation and apoptosis in cardiomyocytes, which could be attenuated by treatment with Dh404, an activator of Nrf2. Meanwhile, inhibition of miR-144 suppressed ROS formation and apoptosis induced by high glucose in cultured cardiomyocytes. What was more important is that reduced myocardial oxidative stress and apoptosis and improved cardiac function were identified in STZ-induced diabetic mice when treated with miR-144 antagomir. Although miR-144 cannot explain the increased oxidative stress in STZ, therapeutic interventions directed at decreasing miR-144 may help to decrease oxidative stress in these hearts. Inhibition of miR-144 might have clinical potential to abate oxidative stress as well as to reduce cardiomyocyte apoptosis and improve cardiac function in diabetic cardiomyopathy. Copyright © 2015 Elsevier Inc. All rights reserved.

  15. Spin Waves in Terbium

    DEFF Research Database (Denmark)

    Jensen, J.; Houmann, Jens Christian Gylden


    The selection rules for the linear couplings between magnons and phonons propagating in the c direction of a simple basal-plane hcp ferromagnet are determined by general symmetry considerations. The acoustic-optical magnon-phonon interactions observed in the heavy-rare-earth metals have been expl...... by Liu. The coupled magnon—transverse-phonon system for the c direction of Tb is analyzed in detail, and the strengths of the couplings are deduced as a function of wave vector by combining the experimental studies with the theory....

  16. Spin Waves in Terbium

    DEFF Research Database (Denmark)

    Jensen, J.; Houmann, Jens Christian Gylden; Bjerrum Møller, Hans


    The energies of spin waves propagating in the c direction of Tb have been studied by inelastic neutron scattering, as a function of a magnetic field applied along the easy and hard directions in the basal plane, and as a function of temperature. From a general spin Hamiltonian, consistent...... with the symmetry, we deduce the dispersion relation for the spin waves in a basal-plane ferromagnet. This phenomenological spin-wave theory accounts for the observed behavior of the magnon energies in Tb. The two q⃗-dependent Bogoliubov components of the magnon energies are derived from the experimental results...

  17. Near-barrier transfer reactions in the sup 36 S+ sup 144,154 Sm systems

    Energy Technology Data Exchange (ETDEWEB)

    Fernandez Niello, J.O.; Testoni, J.E.; di Tada, M.; Pacheco, A.J. (TANDAR, Departamento de Fisica, Comision Nacional de Energia Atomica, Avenida del Libertador 8250, 1429 Buenos Aires (Argentina)); Napoli, D.R.; Stefanini, A.M.; Corradi, L.; Million, B.; Narayanasamy, M.; Spolaore, P. (Istituto Nazionale di Fisica Nucleare, Laboratori Nazionali di Legnaro, Padova (Italy)); Beghini, S.; Montagnoli, G.; Scarlassara, F.; Segato, G.F.; Signorini, C.; Soramel, F. (Dipartimento di Fisica, Universita e Istituto Nazionale di Fisica Nucleare, Padova (Italy))


    Angular distributions and {ital Q}-value spectra for transfer reactions in the systems {sup 36}S+{sup 144,154}Sm have been measured at two energies close to the Coulomb barrier. Mass and charge identification was achieved using a time-of-flight system followed by an ionization chamber. Transfer probabilities were analyzed considering direct and sequential barrier penetration mechanisms. The dependence of the cross sections on the static quadrupole deformation of the targets was compared with the predictions of a semiclassical approach. The relative yields of the different channels were analyzed in the light of a random-walk approach based on the reaction {ital Q} values.

  18. Comprehensive sieve analysis of breakthrough HIV-1 sequences in the RV144 vaccine efficacy trial.

    Directory of Open Access Journals (Sweden)

    Paul T Edlefsen


    Full Text Available The RV144 clinical trial showed the partial efficacy of a vaccine regimen with an estimated vaccine efficacy (VE of 31% for protecting low-risk Thai volunteers against acquisition of HIV-1. The impact of vaccine-induced immune responses can be investigated through sieve analysis of HIV-1 breakthrough infections (infected vaccine and placebo recipients. A V1/V2-targeted comparison of the genomes of HIV-1 breakthrough viruses identified two V2 amino acid sites that differed between the vaccine and placebo groups. Here we extended the V1/V2 analysis to the entire HIV-1 genome using an array of methods based on individual sites, k-mers and genes/proteins. We identified 56 amino acid sites or "signatures" and 119 k-mers that differed between the vaccine and placebo groups. Of those, 19 sites and 38 k-mers were located in the regions comprising the RV144 vaccine (Env-gp120, Gag, and Pro. The nine signature sites in Env-gp120 were significantly enriched for known antibody-associated sites (p = 0.0021. In particular, site 317 in the third variable loop (V3 overlapped with a hotspot of antibody recognition, and sites 369 and 424 were linked to CD4 binding site neutralization. The identified signature sites significantly covaried with other sites across the genome (mean = 32.1 more than did non-signature sites (mean = 0.9 (p < 0.0001, suggesting functional and/or structural relevance of the signature sites. Since signature sites were not preferentially restricted to the vaccine immunogens and because most of the associations were insignificant following correction for multiple testing, we predict that few of the genetic differences are strongly linked to the RV144 vaccine-induced immune pressure. In addition to presenting results of the first complete-genome analysis of the breakthrough infections in the RV144 trial, this work describes a set of statistical methods and tools applicable to analysis of breakthrough infection genomes in general vaccine

  19. Synthesis and crystal structure of terbium(III) meta-oxoborate Tb(BO{sub 2}){sub 3} ({identical_to} TbB{sub 3}O{sub 6}); Synthese und Kristallstruktur von Terbium(III)-meta-Oxoborat Tb(BO{sub 2}){sub 3} ({identical_to} TbB{sub 3}O{sub 6})

    Energy Technology Data Exchange (ETDEWEB)

    Nikelski, Tanja; Schleid, Thomas [Institut fuer Anorganische Chemie der Universitaet Stuttgart (Germany)


    The terbium meta-oxoborate Tb(BO{sub 2}){sub 3} ({identical_to} TbB{sub 3}O{sub 6}) is obtained as single crystals by the reaction of terbium, Tb{sub 4}O{sub 7} and TbCl{sub 3} with an excess of B{sub 2}O{sub 3} in gastight sealed platinum ampoules at 950 C after three weeks. The compound appears to be air- and water-resistant and crystallizes as long, thin, colourless needles which tend to growth-twinning due to their marked fibrous habit. The crystal structure of Tb(BO{sub 2}){sub 3} (orthorhombic, Pnma; a = 1598.97(9), b = 741.39(4), c = 1229.58(7) pm; Z = 16) contains strongly corrugated oxoborate layers {sub {infinity}}{sup 2}{l_brace}(BO{sub 2}){sup -}{r_brace} built of vertex-linked [BO{sub 4}]{sup 5-} tetrahedra (d(B-O) = 143 - 154 pm, and angsph;(O-B-O) = 102-115 ) which spread out parallel (100). The four crystallographically different Tb{sup 3+} cations all exhibit coordination numbers of eight towards the oxygen atoms (d(Tb-O) = 228-287 pm). The corresponding metal cation polyhedra [TbO{sub 8}]{sup 13+} too convene to layers (composition: {sub {infinity}}{sup 2}{l_brace}(Tb{sub 2}O{sub 11}){sup 16-}{r_brace}) which are likewise oriented parallel to the (100) plane. (Abstract Copyright [2003], Wiley Periodicals, Inc.) [German] Das Terbium-meta-Oxoborat Tb(BO{sub 2}){sub 3} ({identical_to} TbB{sub 3}O{sub 6}) entsteht einkristallin bei der Reaktion von Terbium, Tb{sub 4}O{sub 7} und TbCl{sub 3} mit einem Ueberschuss von B{sub 2}O{sub 3} in gasdicht verschlossenen Platinampullen nach drei Wochen bei 950 C. Die Verbindung ist luft- und wasserstabil und faellt in langen, duennen, farblosen Nadeln an, die aufgrund ihres ausgepraegt faserigen Habitus zur Wachstumsverzwillingung neigen. Die Kristallstruktur von Tb(BO{sub 2}){sub 3} (orthorhombisch, Pnma; a = 1598, 97(9), b = 741, 39(4), c = 1229, 58(7) pm; Z = 16) enthaelt parallel (100) verlaufende, stark gewellte Oxoborat-Schichten {sub {infinity}}{sup 2}{l_brace}(BO{sub 2}){sup -}{r_brace} aus

  20. MicroRNA-144 Regulates Hepatic ABCA1 and Plasma HDL Following Activation of the Nuclear Receptor FXR (United States)

    de Aguiar Vallim, Thomas Q.; Tarling, Elizabeth J.; Kim, Tammy; Civelek, Mete; Baldán, Ángel; Esau, Christine; Edwards, Peter A.


    Rationale The bile acid receptor Farnesoid-X-Receptor (FXR) regulates many aspects of lipid metabolism by various complex and not fully understood molecular mechanisms. We set out to investigate the molecular mechanisms for FXR-dependent regulation of lipid and lipoprotein metabolism. Objective To identify FXR-regulated microRNAs that were subsequently involved in regulating lipid metabolism. Methods and Results ATP binding cassette transporter A1 (ABCA1) is a major determinant of plasma High Density Lipoprotein (HDL)-cholesterol levels. Here we show that activation of the nuclear receptor FXR in vivo increases hepatic levels of miR-144, which in turn lower hepatic ABCA1 and plasma HDL levels. We identified two complementary sequences to miR-144 in the 3′ untranslated region (UTR) of ABCA1 mRNA that are necessary for miR-144-dependent regulation. Overexpression of miR-144 in vitro decreased both cellular ABCA1 protein and cholesterol efflux to lipid-poor apolipoprotein A-I (ApoA-I) protein, whilst overexpression in vivo reduced hepatic ABCA1 protein and plasma HDL-cholesterol. Conversely, silencing miR-144 in mice increased hepatic ABCA1 protein and HDL-cholesterol. In addition, we utilized tissue-specific FXR deficient mice to show that induction of miR-144 and FXR-dependent hypolipidemia requires hepatic, but not intestinal FXR. Finally, we identified functional FXR response elements (FXREs) upstream of the miR-144 locus, consistent with direct FXR regulation. Conclusion We have identified a novel pathway involving FXR, miR-144 and ABCA1 that together regulate plasma HDL cholesterol. PMID:23519696

  1. miR-144 attenuates the host response to influenza virus by targeting the TRAF6-IRF7 signaling axis.

    Directory of Open Access Journals (Sweden)

    Carrie M Rosenberger


    Full Text Available Antiviral responses must rapidly defend against infection while minimizing inflammatory damage, but the mechanisms that regulate the magnitude of response within an infected cell are not well understood. miRNAs are small non-coding RNAs that suppress protein levels by binding target sequences on their cognate mRNA. Here, we identify miR-144 as a negative regulator of the host antiviral response. Ectopic expression of miR-144 resulted in increased replication of three RNA viruses in primary mouse lung epithelial cells: influenza virus, EMCV, and VSV. We identified the transcriptional network regulated by miR-144 and demonstrate that miR-144 post-transcriptionally suppresses TRAF6 levels. In vivo ablation of miR-144 reduced influenza virus replication in the lung and disease severity. These data suggest that miR-144 reduces the antiviral response by attenuating the TRAF6-IRF7 pathway to alter the cellular antiviral transcriptional landscape.

  2. MicroRNA-144-3p suppresses tumor growth and angiogenesis by targeting SGK3 in hepatocellular carcinoma. (United States)

    Wu, Manya; Huang, Chaoyuan; Huang, Xinping; Liang, Rong; Feng, Yan; Luo, Xiaoling


    In our previous studies, the Illumine Soledad massively parallel signature sequencing of miRNomes in non‑tumor and hepatocellular carcinoma (HCC) tissues revealed that microRNA (miR)-144-3p was significantly downregulated in HCC, but its role in HCC development, especially angiogenesis, remains unclear. In this investigation, we found recovering miR‑144‑3p expression can significantly suppress the growth, migration and induced angiogenic capacity of HCC cells through both in vivo and in vitro experiments. Moreover, clinical correlation analysis showed that low expression of miR‑144‑3p was positively correlated to poor disease-free survival (DFS) of HCC patients. Mechanistically, serum and glucocorticoid kinase 3 (SGK3), the putative targets of miR‑144‑3p, was predicted by Target Scan database and identified to be suppressed by miR‑144‑3p so that inhibiting the activation of mTOR-VEGF downstream signals was activated by the phosphoinositide 3-kinase (PI3K)-independent pathway. Hence, we concluded that miR‑144‑3p, which is frequently downregulated in HCC, can inhibit proliferation, migration and repress angiogenesis by regulating SGK3 activation with PI3K independent signal pathway, and acts as a prognostic factor for HCC patients.

  3. Direct Evidence of Octupole Deformation in Neutron-Rich $^{144}$Ba

    CERN Document Server

    Bucher, B; Wu, C Y; Janssens, R V F; Cline, D; Hayes, A B; Albers, M; Ayangeakaa, A D; Butler, P A; Campbell, C M; Carpenter, M P; Chiara, C J; Clark, J A; Crawford, H L; Cromaz, M; David, H M; Dickerson, C; Gregor, E T; Harker, J; Hoffman, C R; Kay, B P; Kondev, F G; Korichi, A; Lauritsen, T; Macchiavelli, A O; Pardo, R C; Richard, A; Riley, M A; Savard, G; Scheck, M; Seweryniak, D; Smith, M K; Vondrasek, R; Wiens, A


    The neutron-rich nucleus $^{144}$Ba ($t_{1/2}$=11.5 s) is expected to exhibit some of the strongest octupole correlations among nuclei with mass numbers $A$ less than 200. Until now, indirect evidence for such strong correlations has been inferred from observations such as enhanced $E1$ transitions and interleaving positive- and negative-parity levels in the ground-state band. In this experiment, the octupole strength was measured directly by sub-barrier, multi-step Coulomb excitation of a post-accelerated 650-MeV $^{144}$Ba beam on a 1.0-mg/cm$^2$ $^{208}$Pb target. The measured value of the matrix element, $\\langle 3_1^- \\| \\mathcal{M}(E3) \\| 0_1^+ \\rangle=0.65(^{+17}_{-23})$ $e$b$^{3/2}$, corresponds to a reduced $B(E3)$ transition probability of 48($^{+25}_{-34}$) W.u. This result represents an unambiguous determination of the octupole collectivity, is larger than any available theoretical prediction, and is consistent with octupole deformation.

  4. 24 CFR 943.144 - What financial impact do operations of a subsidiary, affiliate, or joint venture have on a PHA? (United States)


    ... of a subsidiary, affiliate, or joint venture have on a PHA? 943.144 Section 943.144 Housing and Urban... CONSORTIA AND JOINT VENTURES Subsidiaries, Affiliates, Joint Ventures in Public Housing § 943.144 What financial impact do operations of a subsidiary, affiliate, or joint venture have on a PHA? Income generated...

  5. An integrated logic system for time-resolved fluorescent "turn-on" detection of cysteine and histidine base on terbium (III) coordination polymer-copper (II) ensemble. (United States)

    Xue, Shi-Fan; Lu, Ling-Fei; Wang, Qi-Xian; Zhang, Shengqiang; Zhang, Min; Shi, Guoyue


    Cysteine (Cys) and histidine (His) both play indispensable roles in many important biological activities. An enhanced Cys level can result in Alzheimer's and cardiovascular diseases. Likewise, His plays a significant role in the growth and repair of tissues as well as in controlling the transmission of metal elements in biological bases. Therefore, it is meaningful to detect Cys and His simultaneously. In this work, a novel terbium (III) coordination polymer-Cu (II) ensemble (Tb(3+)/GMP-Cu(2+)) was proposed. Guanosine monophosphate (GMP) can self-assemble with Tb(3+) to form a supramolecular Tb(3+) coordination polymer (Tb(3+)/GMP), which can be suited as a time-resolved probe. The fluorescence of Tb(3+)/GMP would be quenched upon the addition of Cu(2+), and then the fluorescence of the as-prepared Tb(3+)/GMP-Cu(2+) ensemble would be restored again in the presence of Cys or His. By incorporating N-Ethylmaleimide and Ni(2+) as masking agents, Tb(3+)/GMP-Cu(2+) was further exploited as an integrated logic system and a specific time-resolved fluorescent "turn-on" assay for simultaneously sensing His and Cys was designed. Meanwhile it can also be used in plasma samples, showing great potential to meet the need of practical application. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Synthesis and photoluminescence properties of cerium-doped terbium-yttrium aluminum garnet phosphor for white light-emitting diodes applications (United States)

    Wang, Jun; Han, Tao; Lang, Tianchun; Tu, Mingjing; Peng, Lingling


    Cerium-doped terbium-yttrium aluminum garnet phosphors were synthesized using the solid-state reaction method. The crystalline phase, morphology, and photoluminescence properties were characterized by x-ray diffraction (XRD), scanning electron microscope (SEM), and fluorescence spectrophotometer, respectively. The XRD results indicate that with an increase of the amount of x (Tb3+), all of the samples have a pure garnet crystal structure without secondary phases. The SEM images reveal that the samples are composed of sphere-like crystallites, which exhibit different degrees of agglomeration. The luminescent properties of Ce ions in )Al5O12∶Ce0.1 have been studied, and it was found that the emission band shifted toward a longer wavelength. The redshift is attributed to the lowering of the 5d energy level centroid of Ce, which can be explained by the nephelauxetic effect and compression effect. These phosphors were coated on blue light-emitting diode (LED) chips to fabricate white light-emitting diodes (WLEDs), and their color-rendering indices, color temperatures, and luminous efficiencies were measured. As a consequence of the addition of Tb, the blue LED pumped )Al5O12∶Ce0.1 phosphors WLEDs showed good optical properties.

  7. Study on the fluorescent enhancement effect in terbium-gadolinium-protein-sodium dodecyl benzene sulfonate system and its application on sensitive detection of protein at nanogram level. (United States)

    Sun, Changxia; Yang, Jinghe; Wu, Xia; Liu, Shufang; Su, Benyu


    The co-luminescence effect in a terbium-gadolinium-protein-sodium dodecyl benzene sulfonate (SDBS) system is reported here. Based on it, the sensitive quantitative analysis of protein at nanogram levels is established. The co-luminescence mechanism is studied using fluorescence, resonance light scattering (RLS), absorption spectroscopy and NMR measurement. It is considered that protein could be unfolded by SDBS, then a efficacious intramolecular fluorescent energy transfer occurs from unfolded protein to rare earth ions through SDBS acting as a "transfer bridge" to enhance the emission fluorescence of Tb3+ in this ternary complex of Tb-SDBS-BSA, where energy transfer from protein to SDBS by aromatic ring stacking is the most important step. Cooperating with the intramolecular energy transfer above is the intermolecular energy transfer between the simultaneous existing complexes of both Tb3+ and Gd3+. The fluorescence quantum yield is increased by an energy-insulating sheath, which is considered to be another reason for the resulting enhancement of the fluorescence. Förster theory is used to calculate the distribution of enhancing factors and has led to a greater understanding of the mechanisms of energy transfer.

  8. [Studies on luminescence properties of seven ternary complexes of terbium with 1,10-phenanthroline and benzoic acid and its derivatives]. (United States)

    Gao, Zhi-hua; Wang, Shu-ping; Liu, Cui-ge; Ma, Rui-xia; Wang, Rui-fen


    Seven ternary complexes of Tb(III) were synthesized with benzoic acid (BA), o-, m-, p-methylbenzoic acid (o-MBA, m-MBA, p-MBA), and o-, m-, p-methoxybenzoic acid (o-MOBA, m-MOBA, p-MOBA) as the first ligand, and 1,10-phenanthroline (phen) as the second ligand. The content of C, H and N were measured by using a Flash-EA model 1112 elemental analyzer. Excitation and luminescence spectra of the title solid complexes were recorded by using a Hitachi F-4500 fluorescence spectrophotometer at room temperature. The effects of different varieties and different positions of replacing benzoic acid as the first ligand on fluorescence properties of the ternary complexes of terbium were discussed. The results indicated that the intensity of 5D4-->7F6 (489 nm) and 5D4-->7F5 (545 nm) of substituting benzoic acid complexes was stronger than benzoic acid. Three ternary complexes of Tb(III) with o-, m-, p-methylbenzoic acid showed emission intensity in the consecution: Tb(o-MBA)3 phenMOBA)3phen x H2O>Tb(m-MOBA)3phen x H2O>Tb(p-MOBA)3 phen.

  9. Au99(SPh)42 nanomolecules: aromatic thiolate ligand induced conversion of Au144(SCH2CH2Ph)60. (United States)

    Nimmala, Praneeth Reddy; Dass, Amala


    A new aromatic thiolate protected gold nanomolecule Au99(SPh)42 has been synthesized by reacting the highly stable Au144(SCH2CH2Ph)60 with thiophenol, HSPh. The ubiquitous Au144(SR)60 is known for its high stability even at elevated temperature and in the presence of excess thiol. This report demonstrates for the first time the reactivity of the Au144(SCH2CH2Ph)60 with thiophenol to form a different 99-Au atom species. The resulting Au99(SPh)42 compound, however, is unreactive and highly stable in the presence of excess aromatic thiol. The molecular formula of the title compound is determined by high resolution electrospray mass spectrometry (ESI-MS) and confirmed by the preparation of the 99-atom nanomolecule using two ligands, namely, Au99(SPh)42 and Au99(SPh-OMe)42. This mass spectrometry study is an unprecedented advance in nanoparticle reaction monitoring, in studying the 144-atom to 99-atom size evolution at such high m/z (∼12k) and resolution. The optical and electrochemical properties of Au99(SPh)42 are reported. Other substituents on the phenyl group, HS-Ph-X, where X = -F, -CH3, -OCH3, also show the Au144 to Au99 core size conversion, suggesting minimal electronic effects for these substituents. Control experiments were conducted by reacting Au144(SCH2CH2Ph)60 with HS-(CH2)n-Ph (where n = 1 and 2), bulky ligands like adamantanethiol and cyclohexanethiol. It was observed that conversion of Au144 to Au99 occurs only when the phenyl group is directly attached to the thiol, suggesting that the formation of a 99-atom species is largely influenced by aromaticity of the ligand and less so on the bulkiness of the ligand.

  10. Atomistic Simulations of Functional Au-144(SR)(60) Gold Nanoparticles in Aqueous Environment

    DEFF Research Database (Denmark)

    Heikkila, E.; Gurtovenko, A. A.; Martinez-Seara, H.


    of the nanoparticle together with surrounding ions and water. We focus on Au-144 nanoparticles that comprise a nearly spherical Au core (diameter similar to 2 nm), a passivating Au-S interface, and functionalized alkanethiol chains. Cationic and anionic AuNPs have been modeled with amine and carboxyl terminal groups...... and Cl-/Na+ counterions, respectively. The radial distribution functions show that the side chains and terminal groups show significant flexibility. The orientation of water is distinct in the first solvation shell, and AuNPs cause a long-range effect in the solvent structure. The radial electrostatic...... in aqueous solutions. They suggest that electrostatics is one of the central factors in complexation of AuNPs with other nanomaterials and biological systems, and that effects of electrostatics as water-mediated interactions are relatively long-ranged, which likely plays a role in, e.g., the interplay...

  11. Lifetime tumor risk coefficients for beagle dogs that inhaled cerium-144 chloride

    Energy Technology Data Exchange (ETDEWEB)

    Boecker, B.B.; Hahn, F.F.; Griffith, W.C. [and others


    Reported here is one of the life-span radionuclide toxicology studies being conducted at ITRI in Beagle dogs. These studies are examining the life-span health risks of inhaled {Beta}-, {gamma}- and {alpha}-emitting radionuclides to expand available knowledge on these risks especially for the many cases for which human data are not available. The outcomes of these studies are providing important information on dosimetry and dose-response relationships for these inhaled radionuclides and the relative importance of a broad range of dose- and effect-modifying factors. A number of these studies are currently coming to completion. Much of the ITRI effort is being directed to final reviews of the dosimetric, clinical, and pathologic results and writing summary manuscripts. Radiation doses and effects in tissues adjacent to bone, specifically those of epithelial or marrow origin, should be considered when determining risks from internally deposited, bone-seeking radionuclides such as {sup 144}Ce.

  12. Identification of low-energy isovector octupole states in 144Nd (United States)

    Thürauf, M.; Scheck, M.; Bernards, C.; Blanc, A.; Cooper, N.; Defrance, G.; Jentschel, M.; Jolie, J.; Kaleja, O.; Köster, U.; Kröll, T.; Mutti, P.; Simpson, G. S.; Soldner, T.; Tezgel, M.; Urban, W.; Vanhoy, J.; Werner, M.; Werner, V.; Zell, K. O.


    Recently, first candidates for low-lying isovector states in the octupole sector were suggested. The unambiguous identification of those states will contribute to the decomposition of the octupole-octupole residual interaction in an isoscalar and isovector part. This will help us understand the octupole degree of freedom. In 144Nd the 3- state at 2778 keV is a good candidate for such a “mixed-symmetry’' octupole state. In order to clarify the nature of this state, a 143Nd(n, γ)-experiment was conducted with the EXILL-setup. Following neutron capture the 3- states are populated and EXILL provides the opportunity to determine the multipole-mixing ratios of the 3i -→31 - transitions. For the transition from the “mixed-symmetry” octupole state to the symmetric 31 - state we expect a strong M1 component.

  13. Loss of the miR-144/451 cluster impairs ischaemic preconditioning-mediated cardioprotection by targeting Rac-1 (United States)

    Wang, Xiaohong; Zhu, Hongyan; Zhang, Xiaowei; Liu, Yong; Chen, Jing; Medvedovic, Mario; Li, Hongliang; Weiss, Mitchell J.; Ren, Xiaoping; Fan, Guo-Chang


    Aims While a wealth of data has uncovered distinct microRNA (miR) expression alterations in hypertrophic and ischaemic/reperfused (I/R) hearts, little is known about miR regulation and response to ischaemic preconditioning (IPC). Methods and results We analysed miRs in murine hearts preconditioned with six cycles of 4 min ischaemia via coronary artery occlusion, followed by 4 min reperfusion in vivo. Both miRs within the miR-144/451 cluster were the most elevated among a cohort of 21 dysregulated miRs in preconditioned hearts, compared with shams. To investigate the significance of this finding, we examined IPC-mediated cardioprotection within a miR-144/451-knockout (KO) mouse model. Wild-type (WT) hearts exposed to IPC followed by I/R (30 min/24 h) showed a smaller infarction size compared with mice treated with I/R alone. In contrast, IPC failed to protect miR-144/451-KO hearts against infarct caused by I/R treatment. Thus, the miR-144/451 cluster is required for IPC-elicited cardioprotection. Rac-1, a key component of NADPH oxidase, was mostly up-regulated in KO hearts among three bona fide targets (Rac-1, 14-3-3ζ, and CUGBP2) for both miR-144 and miR-451. Accordingly, reactive oxygen species (ROS) levels were markedly increased in KO hearts upon IPC, compared with IPC-WT hearts. Pre-treatment of KO hearts with a Rac-1 inhibitor NSC23766 (20 mg/kg, ip) reduced IPC-triggered ROS levels and restored IPC-elicited cardioprotection. Using antagomiRs, we showed that miR-451 was largely responsible for IPC-mediated cardioprotection. Conclusion Loss of the miR-144/451 cluster limits IPC cardioprotection by up-regulating Rac-1-mediated oxidative stress signalling. PMID:22354898

  14. Self-diffusion coefficients of the trivalent f-element ion series in dilute and moderately dilute aqueous solutions: A comparative study between europium, gadolinium, terbium and berkelium (United States)

    Rafik, Besbes; Noureddine, Ouerfelli; Abderabbou, Abdelmanef; Habib, Latrous


    We have continued the studies on the trivalent ions of the 4f and 5f elements. In this paper, we compare the transport properties (self-diffusion coefficient) of the trivalent aquo ions over two ranges of concentrations (0 — 2×10-3M) and (2×10-3 — 1.5M). Self-diffusion coefficients, D, of the trivalent f-element aquo ion series have been determined in aqueous background electrolytes of Gd(NO3)3 and Nd(ClO4)3, at pH=2.5 (HNO3, HClO4) and at 25°C using the open-end capillary method (O.E.C.M.). This method measures the transportation time of ions across a fixed distance. In this paper, we complete a measurement of self-diffusion coefficient for terbium. We optimized the pH to avoid hydrolysis, ion-pairing and complexation of the trivalent 4f and 5f ions. The variation of D versus √C is not linear for dilute solutions (0 — 2×10-3M) and quasi-linear in moderate concentrations (C<=1.5 M). Similar behavior was observed for Tb, as compared with those for Bk, Eu and Gd. We complete the comparison variation of D/D° versus √C for all studied 4f and 5f elements from concentration 0 to 1.5M and we obtained the same variation with √C for all studied elements. All 4f and 5f elements studied follow the Nernst-Hartley expression.

  15. Terbium-based time-gated Förster resonance energy transfer imaging for evaluating protein-protein interactions on cell membranes. (United States)

    Lindén, Stina; Singh, Manish Kumar; Wegner, K David; Regairaz, Marie; Dautry, François; Treussart, François; Hildebrandt, Niko


    Fluorescence imaging of cells and subcellular compartments is an essential tool to investigate biological processes and to evaluate the development and progression of diseases. In particular, protein-protein interactions can be monitored by Förster resonance energy transfer (FRET) between two proximal fluorophores that are attached to specific recognition biomolecules such as antibodies. We investigated the membrane expression of E- and N-cadherins in three different cell lines used as model systems to study epithelial to mesenchymal transition (EMT) and a possible detection of circulating tumour cells (CTCs). EMT is a key process in cancer metastasis, during which epithelial markers (such as E-cadherin) are down-regulated in the primary tumour whereas mesenchymal markers (such as N-cadherin) are up-regulated, leading to enhanced cell motility, intravasation, and appearance of CTCs. Various FRET donor-acceptor pairs and protein recognition strategies were utilized, in which Lumi4-Tb terbium complexes (Tb) and different organic dyes were conjugated to several distinct E- and N-cadherin-specific antibodies. Pulsed excitation of Tb at low repetition rates (100 Hz) and time-gated (TG) imaging of both the Tb-donor and the dye-acceptor photoluminescence (PL) allowed efficient detection of the EMT markers as well as FRET in the case of sufficient donor-acceptor proximity. Efficient FRET was observed only between two E-cadherin-specific antibodies and further experiments indicated that these antibodies recognized the same E-cadherin molecule, suggesting a limited accessibility of cadherins when they are clustered at adherens junctions. The investigated Tb-to-dye FRET systems provided reduced photobleaching compared to the AlexaFluor 488-568 donor-acceptor pair. Our results demonstrate the applicability and advantages of Tb-based TG FRET for efficient and stable imaging of antibody-antibody interactions on different cell lines. They also reveal the limitations of

  16. A broad G protein-coupled receptor internalization assay that combines SNAP-tag labeling, diffusion-enhanced resonance energy transfer, and a highly emissive terbium cryptate acceptor

    Directory of Open Access Journals (Sweden)

    Angélique eLEVOYE


    Full Text Available Although G protein-coupled receptor (GPCR internalization has long been considered a major aspect of the desensitization process that tunes ligand responsiveness, internalization is also involved in receptor resensitization and signaling, as well as the ligand scavenging function of some atypical receptors. Internalization thus contributes to the diversity of GPCR-dependent signaling, and its dynamics and quantification in living cells has generated considerable interest. We developed a robust and sensitive assay to follow and quantify ligand-induced and constitutive GPCR internalization but also receptor recycling in living cells. This assay is based on diffusion-enhanced resonance energy transfer (DERET between cell surface GPCRs labeled with a luminescent terbium cryptate donor and a fluorescein acceptor present in the culture medium. GPCR internalization results in a quantifiable reduction of energy transfer. This method yields a high signal-to-noise ratio due to time-resolved measurements. For various GPCRs belonging to different classes, we demonstrated that constitutive and ligand-induced internalization could be monitored as a function of time and ligand concentration, thus allowing accurate quantitative determination of kinetics of receptor internalization but also half-maximal effective or inhibitory concentrations of compounds. In addition to its selectivity and sensitivity, we provided evidence that DERET-based internalization assay is particularly suitable for characterizing biased ligands. Furthermore, the determination of a Z’-factor value of 0.45 indicates the quality and suitability of DERET-based internalization assay for high-throughput screening (HTS of compounds that may modulate GPCRs internalization.

  17. Utilizing assumption for project of stand for solid state targets activation on inner beams of AIC-144 cyclotron; Zalozenia uzytkowe do projektu stanowiska do aktywacji tarcz w stanie stalym na wiazce wewnetrznej cyklotronu AIC-144

    Energy Technology Data Exchange (ETDEWEB)

    Petelenz, B. [The H. Niewodniczanski Inst. of Nuclear Physics, Cracow (Poland)


    General assumptions for project of target activation stand at AIC-144 cyclotron are presented. The project predicts production of {sup 67}Ga, {sup 111}In, {sup 201}Tl, {sup 139}Ce, {sup 88}Y, {sup 123}I and {sup 211}At isotopes using various target backings. Directions concerning target cooling and beam parameters are also described 25 refs, 1 tab

  18. Crystal structure of an eight-coordinate terbium(III ion chelated by N,N′-bis(2-hydroxybenzyl-N,N′-bis(pyridin-2-ylmethylethylenediamine (bbpen2− and nitrate

    Directory of Open Access Journals (Sweden)

    Thaiane Gregório


    Full Text Available The reaction of terbium(III nitrate pentahydrate in acetonitrile with N,N′-bis(2-hydroxybenzyl-N,N′-bis(pyridin-2-ylmethylethylenediamine (H2bbpen, previously deprotonated with triethylamine, produced the mononuclear compound [N,N′-bis(2-oxidobenzyl-κO-N,N′-bis(pyridin-2-ylmethyl-κNethylenediamine-κ2N,N′](nitrato-κ2O,O′terbium(III, [Tb(C28H28N4O2(NO3]. The molecule lies on a twofold rotation axis and the TbIII ion is eight-coordinate with a slightly distorted dodecahedral coordination geometry. In the symmetry-unique part of the molecule, the pyridine and benzene rings are both essentially planar and form a dihedral angle of 61.42 (7°. In the molecular structure, the N4O4 coordination environment is defined by the hexadentate bbpen ligand and the bidentate nitrate anion. In the crystal, a weak C—H...O hydrogen bond links molecules into a two-dimensional network parallel to (001.

  19. Investigations of the level scheme of {sup 144}Gd and lifetimes in the quadrupole bands

    Energy Technology Data Exchange (ETDEWEB)

    Lieder, R.M.; Gast, W.; Jaeger, H.M.; Mihailescu, L. [Institut fuer Kernphysik, Forschungszentrum Juelich, D-52425, Juelich (Germany); Pasternak, A.A.; Podsvirova, E.O. [Institut fuer Kernphysik, Forschungszentrum Juelich, D-52425, Juelich (Germany); A.F. Ioffe Physical Technical Institute RAS, RU-194021, St. Petersburg (Russian Federation); Efimov, A.D. [A.F. Ioffe Physical Technical Institute RAS, RU-194021, St. Petersburg (Russian Federation); Mikhajlov, V.M. [Physical Institute, St. Petersburg State University, RU-198904, St. Petersburg (Russian Federation); Wyss, R. [Royal Institute of Technology, Physics Department Frescati, S-10405, Stockholm (Sweden); Venkova, T. [Institute of Nuclear Research and Nuclear Energy, Bulgarian Academy of Sciences, BG-1784, Sofia (Bulgaria); Bazzacco, D.; Lunardi, S.; Menegazzo, R.; Rossi Alvarez, C. [Dipartimento di Fisica dell' Universita and Istituto Nazionale di Fisica Nucleare, Sezione di Padova, I-35131, Padova (Italy); Angelis, G. de; Napoli, D.R. [Istituto Nazionale di Fisica Nucleare, Laboratori Nazionali di Legnaro, I-35020, Legnaro (Italy); Rzaca-Urban, T.; Urban, W. [Institute of Experimental Physics, University of Warsaw, PL-00-681, Warszawa (Poland); Dewald, A. [Institut fuer Kernphysik, Universitaet zu Koeln, D-50937, Koeln (Germany)


    For a level scheme investigation of {sup 144}Gd an experiment with the {gamma}-spectrometer EUROBALL III has been carried out and lifetimes have been measured with the {gamma}-spectrometer GASP using the Doppler-shift attenuation method. The high-spin states have been populated in these experiments by means of the {sup 100}Mo({sup 48}Ti,4n) reaction at 215 MeV and the {sup 114}Cd({sup 36}S,6n) reaction at E=182 MeV, respectively. The known quadrupole band has been modified and a new one has been established. Reduced E2 transition probabilities B(E2) were determined for seven members of these quadrupole bands. They show values between {approx}60 and 130 W.u. and this considerable enhancement gives evidence for a significant nuclear deformation. A ({pi}h{sub 11/2}){sup 2} x ({nu}h{sub 11/2}){sup -2} configuration may be assigned to one of the quadrupole bands according to total Routhian surface calculations. The spin dependence of the B(E2) values has been explained by IBM calculations involving high-spin quasiparticle excitations. (orig.)

  20. Sleep Apnea and Hypoventilation in Patients with Down Syndrome: Analysis of 144 Polysomnogram Studies

    Directory of Open Access Journals (Sweden)

    Zheng Fan


    Full Text Available Patients with Down syndrome (DS are at risk for both obstructive sleep apnea (OSA and central sleep apnea (CSA; however, it is unclear how these components evolve as patients age and whether patients are also at risk for hypoventilation. A retrospective review of 144 diagnostic polysomnograms (PSG in a tertiary care facility over 10 years was conducted. Descriptive data and exploratory correlation analyses were performed. Sleep disordered breathing was common (seen in 78% of patients with an average apnea-hypopnea index (AHI = 10. The relative amount of obstructive apnea was positively correlated with age and body mass index (BMI. The relative amount of central sleep apnea was associated with younger age in the very youngest group (0–3 years. Hypoventilation was common occurring in more than 22% of patients and there was a positive correlation between the maximum CO2 and BMI. Sleep disordered breathing, including hypoventilation, was common in patients with DS. The obstructive component increased significantly with age and BMI, while the central component occurred most in the very young age group. Due to the high risk of hypoventilation, which has not been previously highlighted, it may be helpful to consider therapies to target both apnea and hypoventilation in this population.

  1. 143rd and 144th meetings of the Governing Board of the Pension Fund

    CERN Multimedia


    The Governing Board of the Pension Fund held its 143rd and 144th meetings on 16 May and 13 June respectively. At the first of these two meetings, the Board took note of the report by the Austrian Court of Audit on the 2005 financial year and of the associated comments by the Administration of the Fund. It also listened to a report by the Chairman of the Investment Committee on the latter's 10 May meeting, at which the two fund managers responsible for the "QUAM" and "Far East Ex-Japan" portfolios had been interviewed and their performances judged satisfactory. The Committee had also decided to commission ORTEC to carry out a full assets/liabilities modelling study during the current year. During the meeting, the Board also approved a document setting out its position on the CERN debt to the Pension Fund, which would be submitted to the Finance Committee and Council in June. It underlined that the reimbursement of the debt would be advantageous for the Fund as well as for the Laboratory and that it would re...

  2. Spatiotemporal structure of a laser beam over 144 km in a Canary Islands experiment. (United States)

    Gurvich, Alexandre S; Gorbunov, Michael E; Fedorova, Olga V; Kirchengast, Gottfried; Proschek, Veronika; González Abad, Gonzalo; Tereszchuk, Keith A


    We analyzed the observations of scintillations in a laser beam (532 nm, ~200 mW power) traveling along a 144 km path at an altitude of 2.2-2.4 km above sea level, just above the atmospheric boundary layer, between the islands of La Palma and Tenerife. The observations were performed during nighttime on 18 July 2011, by means of a telescope with an aperture diameter of 1 m. Strong scintillations were observed. The estimates of spatial spectra and correlation functions indicated that the observed intensity fields possess, statistically, a locally isotropic structure, which agrees with the idea of a locally isotropic turbulence. The estimates of spatial autospectra and autocorrelation functions of the intensity field indicated that the characteristic scale of the internal structure of the observed clusters is 6.5-8 mm, while the characteristic size of the clusters is 4-5 cm. The major contribution to the observed scintillations comes from the inhomogeneities of the intensity field with scales from 1-2 cm up to 10-12 cm. The analysis of the cross-spectra indicated that the hypothesis of frozen turbulence introduced by Taylor can be used for the description of spatiotemporal structure of intensity fluctuations of laser beams traveling through long paths in the atmosphere.

  3. Fever of unknown origin in adults: evaluation of 144 cases in a non-university hospital. (United States)

    Zenone, Thierry


    The spectrum of diseases found in series of fever of unknown origin shows variation in relation to selection bias; particularly, selection of the most difficult cases in tertiary reference university centres. We present a series of 144 patients presenting to a non-university hospital between 1999 and 2005 (secondary level of the health care system) with a community-acquired fever of unknown origin. In 37 cases (25.7%), the reason for fever could not be explained. Among the 107 patients with a final diagnosis (74.3%), non-infectious inflammatory disorders represented the most prevalent category (35.5%), surpassing infections (30.8%), miscellaneous causes (20.6%) and malignancies (13.5%). 13 entities accounted for over 68% of diagnoses (sinusitis and occult dental infections, Q fever, Epstein-Barr virus and cytomegalovirus infections, lymphoma, colo-rectal adenocarcinoma, adult-onset Still disease, systemic lupus erythematosus, giant cell arteritis and/or polymyalgia rheumatica, rheumatoid arthritis, polyarteritis nodosa, factitious fever and habitual hyperthermia). As demonstrated in other studies, non-infectious inflammatory diseases emerge as the most prevalent diagnostic category. Giant cell arteritis and polymyalgia rheumatica were particularly frequent in the elderly. Epstein-Barr virus and cytomegalovirus infections and habitual hyperthermia were particularly frequent in the youngest patients. There were no major differences in repartition of diagnostic categories between this series and historical university series.

  4. The high-affinity peptidoglycan binding domain of Pseudomonas phage endolysin KZ144

    Energy Technology Data Exchange (ETDEWEB)

    Briers, Yves [Division of Gene Technology, Department of Biosystems, Katholieke Universiteit Leuven, Kasteelpark Arenberg 21, B-3001 Leuven (Belgium); Schmelcher, Mathias; Loessner, Martin J. [Institute of Food Science and Nutrition, ETH Zuerich, Schmelzbergstrasse 7, CH-8092 Zuerich (Switzerland); Hendrix, Jelle; Engelborghs, Yves [Laboratory of Biomolecular Dynamics, Department of Chemistry, Katholieke Universiteit Leuven, Celestijnenlaan 200G, B-3001 Leuven (Belgium); Volckaert, Guido [Division of Gene Technology, Department of Biosystems, Katholieke Universiteit Leuven, Kasteelpark Arenberg 21, B-3001 Leuven (Belgium); Lavigne, Rob, E-mail: [Division of Gene Technology, Department of Biosystems, Katholieke Universiteit Leuven, Kasteelpark Arenberg 21, B-3001 Leuven (Belgium)


    The binding affinity of the N-terminal peptidoglycan binding domain of endolysin KZ144 (PBD{sub KZ}), originating from Pseudomonas aeruginosa bacteriophage {phi}KZ, has been examined using a fusion protein of PBD{sub KZ} and green fluorescent protein (PBD{sub KZ}-GFP). A fluorescence recovery after photobleaching analysis of bound PBD{sub KZ}-GFP molecules showed less than 10% fluorescence recovery in the bleached area within 15 min. Surface plasmon resonance analysis confirmed this apparent high binding affinity revealing an equilibrium affinity constant of 2.95 x 10{sup 7} M{sup -1} for the PBD{sub KZ}-peptidoglycan interaction. This unique domain, which binds to the peptidoglycan of all tested Gram-negative species, was harnessed to improve the specific activity of the peptidoglycan hydrolase domain KMV36C. The chimeric peptidoglycan hydrolase (PBD{sub KZ}-KMV36C) exhibits a threefold higher specific activity than the native catalytic domain (KMV36C). These results demonstrate that the modular assembly of functional domains is a rational approach to improve the specific activity of endolysins from phages infecting Gram-negatives.

  5. Stereotypical hand movements in 144 subjects with Rett syndrome from the population-based Australian database. (United States)

    Carter, Philippa; Downs, Jenny; Bebbington, Ami; Williams, Simon; Jacoby, Peter; Kaufmann, Walter E; Leonard, Helen


    Stereotypic hand movements are a feature of Rett Syndrome but few studies have observed their nature systematically. Video data in familiar settings were obtained on subjects (n = 144) identified from an Australian population-based database. Hand stereotypies were demonstrated by most subjects (94.4%), 15 categories were observed and midline wringing was seen in approximately 60% of subjects. There was a median of two stereotypies per subject but this number decreased with age. Clapping and mouthing of hands were more prevalent in girls younger than 8 years and wringing was more prevalent in women 19 years or older. Clapping was commoner in those with p.R306C and early truncating mutations, and much rarer in those with p.R106W, p.R270X, p.R168X, and p.R255X. Stereotypies tended to be less frequent in those with more severe mutations. Otherwise, there were no clear relationships between our categories of stereotypies and mutation. Approximately a quarter each had predominantly right and left handed stereotypies and for the remaining half, no clear laterality was seen. Results were similar for all cases and when restricted to those with a pathogenic mutation. Hand stereotypies changed with increasing age but limited relationships with MECP2 mutations were identified. (c) 2009 Movement Disorder Society.

  6. Greenhouse gas measurements over a 144 km open path in the Canary Islands

    Directory of Open Access Journals (Sweden)

    J. S. A. Brooke


    Full Text Available A new technique for the satellite remote sensing of greenhouse gases in the atmosphere via the absorption of short-wave infrared laser signals transmitted between counter-rotating satellites in low Earth orbit has recently been proposed; this would enable the acquisition of a long-term, stable, global set of altitude-resolved concentration measurements. We present the first ground-based experimental demonstration of this new infrared-laser occultation method, in which the atmospheric absorption of CO2 near 2.1 μm was measured over a ~144 km path length between two peaks in the Canary Islands (at an altitude of ~2.4 km, using relatively low power diode lasers (~4 to 10 mW. The retrieved CO2 volume mixing ratio of 400 ppm (±15 ppm is consistent within experimental uncertainty with simultaneously recorded in situ validation measurements. We conclude that the new method has a sound basis for monitoring CO2 in the free atmosphere; other greenhouse gases such as methane, nitrous oxide and water vapour can be monitored in the same way.

  7. Identification of a novel homozygous mutation (S144I) in a Malay patient with maple syrup urine disease. (United States)

    Ali, Ernie Zuraida; Yunus, Zabedah Md; Desa, Norsiah Md; Hock, Ngu Lock


    Maple syrup urine disease (MSUD) is a rare autosomal recessive metabolic disorder of branched-chain amino acid metabolism caused by the defective function of branched-chain α-ketoacid dehydrogenase complex (BCKDH). It is characterised by increased plasma leucine, isoleucine, and valine levels, and mutations can be detected in any one of the BCKDHA, BCKDHB, and DBT genes. In this study, we describe the molecular basis of a novel mutation found in one MSUD Malay patient from consanguineous parents. A homozygous mutation has been detected in this patient whose both parents carried a heterozygous mutation at DNA coding region c.431G>T in exon 4, which resulted in a substitution of serine to isoleucine at codon 144 (p.S144I). In silico analysis predicted S144I to be potentially damaging. The mutation was located on the alpha helical region of the BCKDHA protein, and it is predicted to affect the stability of protein due to the loss of various polar interactions between local secondary structures. Homology analysis revealed that this mutation occurred in a highly conserved region (100%). This result indicates that S144I mutation is likely pathogenic and may contribute to the classic form of MSUD in this patient.

  8. The potential impact of RV144-like vaccines in rural South Africa: a study using the STDSIM microsimulation model.

    NARCIS (Netherlands)

    Hontelez, J.A.; Nagelkerke, N.; Barnighausen, T.; Bakker, R.; Tanser, F.; Newell, M.L.; Lurie, M.N.; Baltussen, R.M.P.M.; Vlas, S.J. de


    BACKGROUND: The only successful HIV vaccine trial to date is the RV144 trial of the ALVAC/AIDSVAX vaccine in Thailand, which showed an overall incidence reduction of 31%. Most cases were prevented in the first year, suggesting a rapidly waning efficacy. Here, we predict the population level impact

  9. Met144Ala mutation of the copper-containing nitrite reductase from Alcaligenes xylosoxidans reverses the intramolecular electron transfer

    DEFF Research Database (Denmark)

    Farver, Ole; Eady, Robert R; Sawers, Gary


    Pulse radiolysis has been employed to investigate the intramolecular electron transfer (ET) between the type 1 (T1) and type 2 (T2) copper sites in the Met144Ala Alcaligenes xylosoxidans nitrite reductase (AxCuNiR) mutant. This mutation increases the reduction potential of the T1 copper center...

  10. Cosmic-ray history derived from the {sup 54}Mn, {sup 56}Ni and {sup 144}Pm chronometers

    Energy Technology Data Exchange (ETDEWEB)

    Zaerpoor, K.; Chan, Y.D.; DiGregorio, D.E.; Dragowsky, M.R.; Hindi, M.M.; Isaac, M.C.P.; Krane, K.S.; Larimer, R.-M.; Macchiavelli, A.O.; Macleod, R. W.; Miocinovic, P.; Norman, E.B.; Robinson, S.J


    Sources of {sup 54}Mn, {sup 56}Ni, and {sup 144}Pm were placed at the center of the Gammasphere array and searches were made for the astrophysically interesting {beta}{sup +} decay modes of these isotopes. The results of these searches are presented and the implications for cosmic-ray physics are discussed.

  11. Human cytomegalovirus UL55, UL144, and US28 genotype distribution in infants infected congenitally or postnatally. (United States)

    Paradowska, Edyta; Studzińska, Mirosława; Suski, Patrycja; Kasztelewicz, Beata; Wiśniewska-Ligier, Małgorzata; Zawilińska, Barbara; Gaj, Zuzanna; Nowakowska, Dorota


    Cytomegalovirus (CMV) is the most common cause of congenital infection. This pathogen exhibits extensive genetic variability in the genes that encode structural envelope glycoproteins, regulatory proteins, and proteins that contribute to immune evasion. However, the role of specific viral strains in the outcome of congenital CMV infection is unclear. Variation in the UL55 gene encoding glycoprotein B (gB), the UL144 gene encoding TNF α-like receptor, and the US28 gene encoding β-chemokine receptor was determined in 60 newborn infants with congenital CMV infection and 90 infants with postnatal or undefined CMV infection. CMV polymorphisms were studied in relation to disease outcome and viral load. Genotyping was performed by a sequencing analysis of PCR-amplified fragments, and the viral load was measured by quantitative real-time PCR. The results demonstrated that (1) the UL55 and US28 genotype distributions were similar among the group of congenital and postnatal CMV infection; (2) the UL144 B1 genotype was more prevalent in congenital than in postnatal infection and was detected in 70% of newborns with asymptomatic congenital infection; and (3) none of the examined genotype was significantly linked with symptomatic CMV infection. No relationship was observed between genotype and viral load. The results revealed that UL55, UL144, and US28 polymorphisms are not associated with the outcome of CMV infection in infants, but the presence of UL144 B1 genotype might be virological marker of asymptomatic infection at birth. © 2015 Wiley Periodicals, Inc.

  12. Trueperella pyogenes multispecies infections in domestic animals: a retrospective study of 144 cases (2002 to 2012). (United States)

    Ribeiro, M G; Risseti, R M; Bolaños, C A D; Caffaro, K A; de Morais, A C B; Lara, G H B; Zamprogna, T O; Paes, A C; Listoni, F J P; Franco, M M J


    Formerly, Arcanobacterium pyogenes was recently renamed Trueperella pyogenes. This opportunistic bacterium is related to miscellaneous pyogenic infections in animals. Most studies involving T. pyogenes are case reports, whereas few surveys have focused the major aspects of T. pyogenes infections involving a case series study design. The aim of this study was to retrospectively evaluate selected epidemiological and clinical aspects, as well as the in vitro antimicrobial susceptibility pattern of 144 cases of T. pyogenes infections among domestic animals from 2002 to 2012. T. pyogenes was isolated from different clinical specimens from cattle, goats, sheep, pigs, horses, dogs, and buffaloes. Correlations were assessed by the Chi-square or Fisher's exact tests. Mastitis (45.1%), abscesses (18.0%), pneumonia (11.1%), and lymphadenitis (9.0%) were the most common clinical manifestations. In addition, the organism was also isolated from other miscellaneous clinical specimens from cases of septicemia, encephalitis, pyometra, prostatitis, orchitis, seminal vesiculitis, pericarditis, and omphalitis. No statistical association was observed between T. pyogenes infections and age, gender, or season across the study. The most effective drugs against the pathogen were florfenicol (99.1%), cefoperazone (96.0%), cephalexin (95.0%), and ceftiofur (94.8%). High resistance rates were observed against trimethoprim-sulfamethoxazole (49.3%), followed by norfloxacin (10.9%) and tetracycline (9.2%). This study highlights the diversity of clinical manifestations and the opportunistic behavior of T. pyogenes infections in domestic animals, with predominance of mastitis, abscesses, pneumonia, and lymphadenitis. It also reinforces the importance of knowing the susceptibility profile before initiating therapy, to improve antimicrobial therapy approaches.

  13. Insight into 144 patients with ocular vascular events during VEGF antagonist injections

    Directory of Open Access Journals (Sweden)

    Shami M


    Full Text Available Ahmad M Mansour1, Maha Shahin2, Peter K Kofoed3, Maurizio B Parodi4, Michel Shami5, Stephen G Schwartz6, Collaborative Anti-VEGF Ocular Vascular Complications GroupDepartment of Ophthalmology, 1American University of Beirut, Beirut, Lebanon, Rafic Hariri University Hospital, Beirut, Lebanon; 2Mansoura University, Mansoura City, Egypt; 3Glostrup Hospital, University of Copenhagen, Denmark, National Eye Clinic, Kennedy Center, Glostrup, Denmark; 4University Vita-Salute, Scientific Institute San Raffaele, Milan, Italy; 5Texas Tech University Health Sciences Center, Lubbock, TX, USA; 6Bascom Palmer Eye Institute, University of Miami Miller School of Medicine, Naples and Miami, FL, USAAim: To record ocular vascular events following injections of vascular endothelium growth factor (VEGF antagonists.Methods: Collaborative multicenter case series (48 cases, literature reviews (32 cases, and reports to the FDA (64 cases of patients that had vascular occlusions during anti-VEGF therapy were collected and analyzed.Results: A total of 144 cases of ocular vascular events were identified, with these diagnosed a median of 15 days after anti-VEGF injection. The majority of patients had pre-existing risk factors for cardiovascular events and nine patients had a prior history of glaucoma. Mean visual acuity dropped by 6.4 lines with severe visual loss after injection to NLP (five eyes, LP (six eyes, and HM (two eyes. The overall risk of ocular vascular events following a VEGF antagonist injection was 0.108% in the general population and 2.61% in the diabetic population. Mean retinal arterial constriction after intravitreal bevacizumab in 13 eyes was 21% (standard deviation = 27%, and mean retinal venous constriction was 8% (standard deviation = 30%.Conclusion: Ocular vascular events are rare during anti-VEGF therapy, but can lead to severe visual loss and may be caused by a number of factors including the vasoconstrictor effect of the drug, a post-injection rise

  14. Kolejność obowiązku alimentacyjnego z art. 144 kodeksu rodzinnego i opiekuńczego


    Szlęzak, Andrzej


    The problem of alimentary duties between step-parents and step-children has often been referred to in the works of legal writers. However, the question of the sequence of the said duties has not been satisfactorily explained. The authors, despite the wording of sec. 144, are unanimous that it should be determined with regardless of the principles of social coexistence. In the present paper, the author undertakes the task of proving that the adoption of the said principles in...

  15. 29 CFR 780.144 - “As an incident to or in conjunction with” the farming operations. (United States)


    ... 29 Labor 3 2010-07-01 2010-07-01 false âAs an incident to or in conjunction withâ the farming... in Conjunction Withâ the Farming Operations § 780.144 “As an incident to or in conjunction with” the farming operations. In order for practices other than actual farming operations to constitute “agriculture...

  16. Effects of the dimeric PSD-95 inhibitor UCCB01-144 in mouse models of pain, cognition and motor function

    DEFF Research Database (Denmark)

    Andreasen, Jesper T; Nasser, Arafat; Caballero-Puntiverio, Maitane


    NMDAR antagonism shows analgesic action in humans and animal pain models, but disrupts cognitive and motor functions. NMDAR-dependent NO production requires tethering of the NMDAR to neuronal NO synthase (nNOS) by the postsynaptic density protein-95 (PSD-95). Perturbing the NMDAR/PSD-95/nNOS inte...... in the STFP test. Collectively, UCCB01-144 reversed both CFA and SNI-induced hypersensitivity, but the efficacy in the SNI model was only transient. This suggests that enhanced BBB permeability of PSD-95 inhibitors improves the analgesic action in neuropathic pain states.......NOS interaction has therefore been proposed as an alternative analgesic mechanism. We recently reported that UCCB01-125, a dimeric PSD-95 inhibitor with limited blood-brain-barrier permeability, reduced mechanical hypersensitivity in the complete Freund's adjuvant (CFA) inflammatory pain model, without disrupting...... of neuropathic pain. Potential cognitive effects of UCCB01-144 were examined using the social transmission of food preference (STFP) test and the V-maze test, and motor coordination was assessed with the rotarod test. UCCB01-144 (10mg/kg) reversed CFA-induced mechanical hypersensitivity after 1h, and completely...

  17. Selective Sensing of Fe(3+) and Al(3+) Ions and Detection of 2,4,6-Trinitrophenol by a Water-Stable Terbium-Based Metal-Organic Framework. (United States)

    Cao, Li-Hui; Shi, Fang; Zhang, Wen-Min; Zang, Shuang-Quan; Mak, Thomas C W


    A water-stable luminescent terbium-based metal-organic framework (MOF), {[Tb(L1 )1.5 (H2 O)]⋅3 H2 O}n (Tb-MOF), with rod-shaped secondary building units (SBUs) and honeycomb-type tubular channels has been synthesized and structurally characterized by single-crystal X-ray diffraction. The high green emission intensity and the microporous nature of the Tb-MOF indicate that it can potentially be used as a luminescent sensor. In this work, we show that Tb-MOF can selectively sense Fe(3+) and Al(3+) ions from mixed metal ions in water through different detection mechanisms. In addition, it also exhibits high sensitivity for 2,4,6-trinitrophenol (TNP) in the presence of other nitro aromatic compounds in aqueous solution by luminescence quenching experiments. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Picomolar traces of americium(III) introduce drastic changes in the structural chemistry of terbium(III). A break in the ''gadolinium break''

    Energy Technology Data Exchange (ETDEWEB)

    Welch, Jan M. [TU Wien, Atominstitut, Vienna (Austria); Mueller, Danny; Knoll, Christian; Wilkovitsch, Martin; Weinberger, Peter [TU Wien, Institute of Applied Synthetic Chemistry, Vienna (Austria); Giester, Gerald [University of Vienna, Institute of Mineralogy and Crystallography, Vienna (Austria); Ofner, Johannes; Lendl, Bernhard [TU Wien, Institute of Chemical Technologies and Analytics, Vienna (Austria); Steinhauser, Georg [Leibniz Universitaet Hannover, Institute of Radioecology and Radiation Protection (Germany)


    The crystallization of terbium 5,5{sup '}-azobis[1H-tetrazol-1-ide] (ZT) in the presence of trace amounts (ca. 50 Bq, ca. 1.6 pmol) of americium results in 1) the accumulation of the americium tracer in the crystalline solid and 2) a material that adopts a different crystal structure to that formed in the absence of americium. Americium-doped [Tb(Am)(H{sub 2}O){sub 7}ZT]{sub 2} ZT.10 H{sub 2}O is isostructural to light lanthanide (Ce-Gd) 5,5{sup '}-azobis[1H-tetrazol-1-ide] compounds, rather than to the heavy lanthanide (Tb-Lu) 5,5{sup '}-azobis[1H-tetrazol-1-ide] (e.g., [Tb(H{sub 2}O){sub 8}]{sub 2}ZT{sub 3}.6 H{sub 2}O) derivatives. Traces of Am seem to force the Tb compound into a structure normally preferred by the lighter lanthanides, despite a 10{sup 8}-fold Tb excess. The americium-doped material was studied by single-crystal X-ray diffraction, vibrational spectroscopy, radiochemical neutron activation analysis, and scanning electron microscopy. In addition, the inclusion properties of terbium 5,5{sup '}-azobis[1H-tetrazol-1-ide] towards americium were quantified, and a model for the crystallization process is proposed. (copyright 2017 Wiley-VCH Verlag GmbH and Co. KGaA, Weinheim)

  19. Metabolic Profile of Synthetic Cannabinoids 5F-PB-22, PB-22, XLR-11 and UR-144 by Cunninghamella elegans. (United States)

    Watanabe, Shimpei; Kuzhiumparambil, Unnikrishnan; Nguyen, My Ann; Cameron, Jane; Fu, Shanlin


    The knowledge of metabolic profile of synthetic cannabinoids is important for the detection of drugs in urinalysis due to the typical absence or low abundance of parent cannabinoids in human urine. The fungus Cunninghamella elegans has been reported to be a useful tool for metabolism study and thus applicability to synthetic cannabinoid metabolism was examined. In this study, 8-quinolinyl 1-(5-fluoropentyl)-1H-indole-3-carboxylate (5F-PB-22), 8-quinolinyl 1-pentyl-1H-indole-3-carboxylate (PB-22), [1-(5-fluoropentyl)-1H-indol-3-yl](2,2,3,3-tetramethylcyclopropyl)methanone (XLR-11) and (1-pentyl-1H-indol-3-yl)(2,2,3,3-tetramethylcyclopropyl)methanone (UR-144) were incubated with C. elegans and the metabolites were identified using liquid chromatography-quadrupole time-of-flight mass spectrometry. The obtained metabolites were compared with reported human metabolites to assess the suitability of the fungus to extrapolate human metabolism. 5F-PB-22 underwent dihydroxylation, dihydrodiol formation, oxidative defluorination, oxidative defluorination to carboxylic acid, ester hydrolysis and glucosidation, alone and/or in combination. The metabolites of PB-22 were generated by hydroxylation, dihydroxylation, trihydroxylation, dihydrodiol formation, ketone formation, carboxylation, ester hydrolysis and glucosidation, alone and/or in combination. XLR-11 was transformed through hydroxylation, dihydroxylation, aldehyde formation, carboxylation, oxidative defluorination, oxidative defluorination to carboxylic acid and glucosidation, alone and/or in combination. UR-144 was metabolised by hydroxylation, dihydroxylation, trihydroxylation, aldehyde formation, ketone formation, carboxylation, N-dealkylation and combinations. These findings were consistent with previously reported human metabolism except for the small extent of ester hydrolysis observed and the absence of glucuronidation. Despite the limitations, C. elegans demonstrated the capacity to produce a wide variety of

  20. Novel ZnO:Ag nanocomposites induce significant oxidative stress in human fibroblast malignant melanoma (Ht144 cells

    Directory of Open Access Journals (Sweden)

    Syeda Arooj


    Full Text Available The use of photoactive nanoparticles (NPs such as zinc oxide (ZnO and its nanocomposites has become a promising anticancer strategy. However, ZnO has a low photocatalytic decomposition rate and the incorporation of metal ions such as silver (Ag improves their activity. Here different formulations of ZnO:Ag (1, 3, 5, 10, 20 and 30% Ag were synthesized by a simple co-precipitation method and characterized by powder X-ray diffraction, scanning electron microscopy, Rutherford back scattering and diffuse reflectance spectroscopy for their structure, morphology, composition and optical band gap. The NPs were investigated with regard to their different photocatalytic cytotoxic effects in human malignant melanoma (HT144 and normal (HCEC cells. The ZnO:Ag nanocomposites killed cancer cells more efficiently than normal cells under daylight exposure. Nanocomposites having higher Ag content (10, 20 and 30% were more toxic compared to low Ag content (1, 3 and 5%. For HT144, under daylight exposure, the IC50 values were ZnO:Ag (10%: 23.37 μg/mL, ZnO:Ag (20%: 19.95 μg/mL, and ZnO:Ag (30%: 15.78 μg/mL. ZnO:Ag (30% was toxic to HT144 (IC50: 23.34 μg/mL in dark as well. The three nanocomposites were further analyzed with regard to their ability to generate reactive oxygen species (ROS and induce lipid peroxidation. The particles led to an increase in levels of ROS at cytotoxic concentrations, but only HT144 showed strongly induced MDA level. Finally, NPs were investigated for the ROS species they generated in vitro. A highly significant increase of 1O2 in the samples exposed to daylight was observed. Hydroxyl radical species, HO•, were also generated to a lesser extent. Thus, the incorporation of Ag into ZnO NPs significantly improves their photo-oxidation capabilities. ZnO:Ag nanocomposites could provide a new therapeutic option to selectively target cancer cells.

  1. CeLAND: search for a 4th light neutrino state with a 3 PBq 144Ce-144Pr electron antineutrino generator in KamLAND

    Energy Technology Data Exchange (ETDEWEB)

    Gando, A; Gando, Y; Hayashida, S; Ikeda, H; Inoue, K; Ishidoshiro, K; Ishikawa, H; Koga, M; Matsuda, R; Matsuda, S; Mitsui, T; Motoki, D; Nakamura, K; Oki, Y; Otani, M; Shimizu, I; Shirai, J; Suekane, F; Suzuki, A; Takemoto, Y; Tamae, K; Ueshima, K; Watanabe, H; Xu, BD; Yamada, S; Yamauchi, Y; Yoshida, H; Cribier, M; Durero, M; Fischer, V; Gaffiot, J; Jonqueres, N; Kouchner, A; Lasserre, T; Leterme, D; Letourneau, A; Lhuillier, D; Mention, G; Rampal, G; Scola, L; Veyssiere, C; Vivier, M; Yala, P; Berger, BE; Kozlov, A; Banks, T; Dwyer, D; Fujikawa, BK; Han, K; Kolomensky, YG; Mei, Y; O' Donnell, T; Decowski, P; Markoff, DM; Yoshida, S; Kornoukhov, VN; Gelis, TVM; Tikhomirov, GV; Learned, JG; Maricic, J; Matsuno, S; Milincic, R; Karwowski, HJ; Efremenko, Y; Detwiler, A; Enomoto, S


    The reactor neutrino and gallium anomalies can be tested with a 3-4 PBq (75-100 kCi scale) 144Ce-144Pr antineutrino beta-source deployed at the center or next to a large low-background liquid scintillator detector. The antineutrino generator will be produced by the Russian reprocessing plant PA Mayak as early as 2014, transported to Japan, and deployed in the Kamioka Liquid Scintillator Anti-Neutrino Detector (KamLAND) as early as 2015. KamLAND's 13 m diameter target volume provides a suitable environment to measure the energy and position dependence of the detected neutrino flux. A characteristic oscillation pattern would be visible for a baseline of about 10 m or less, providing a very clean signal of neutrino disappearance into a yet-unknown, sterile neutrino state. This will provide a comprehensive test of the electron dissaperance neutrino anomalies and could lead to the discovery of a 4th neutrino state for Δm$2\\atop{new}$ ≳ 0.1 eV2 and sin2(2θnew) > 0.05.

  2. S-nitrosylation of TRIM72 at cysteine 144 is critical for protection against oxidation-induced protein degradation and cell death. (United States)

    Kohr, Mark J; Evangelista, Alicia M; Ferlito, Marcella; Steenbergen, Charles; Murphy, Elizabeth


    Oxidative stress and membrane damage following myocardial ischemia/reperfusion injury are important contributors to cardiomyocyte death and the loss of myocardial function. Our previous study identified cysteine 144 (C144) of tripartite motif-containing protein 72 (TRIM72) as a potential site for S-nitrosylation (SNO). TRIM72 is a cardioprotective membrane repair protein that can be both activated and targeted for degradation by different oxidative modifications. Consistent with the potential regulation of TRIM72 by various oxidative modifications, we found that SNO levels increased at C144 of TRIM72 with ischemic preconditioning. Therefore, to investigate the role of C144 in the regulation of TRIM72 function, we mutated C144 of TRIM72 to a serine residue (TRIM72(C144S)), and expressed either TRIM72(WT) or TRIM72(C144S) in HEK-293 cells, which lack endogenous TRIM72, in order to examine the effect of this mutation on the functional stability of TRIM72 and on cell survival. We hypothesized that SNO of TRIM72 stabilizes the protein, thus allowing for membrane repair and enhanced cell survival. Upon treatment with hydrogen peroxide (H2O2), we found that TRIM72(WT) levels were decreased, but not TRIM72(C144S) and this correlated with increased H2O2-induced cell death in TRIM72(WT) cells. Additionally, we found that treatment with the cardioprotective S-nitrosylating agent S-nitrosoglutathione (GSNO), was able to preserve TRIM72(WT) protein levels and enhance TRIM72(WT)-mediated cell survival, but had no effect on TRIM72(C144S) levels. Consistent with our hypothesis, GSNO was also found to increase SNO levels and inhibit H2O2-induced irreversible oxidation for TRIM72(WT) without affecting TRIM72(C144S). In further support of our hypothesis, GSNO blocked the ischemia/reperfusion-induced decrease in TRIM72 levels and reduced infarct size in a Langendorff-perfused heart model. The results of these studies have important implications for cardioprotection and suggest that

  3. MicroRNA-144 regulates hepatic ATP binding cassette transporter A1 and plasma high-density lipoprotein after activation of the nuclear receptor farnesoid X receptor. (United States)

    de Aguiar Vallim, Thomas Q; Tarling, Elizabeth J; Kim, Tammy; Civelek, Mete; Baldán, Ángel; Esau, Christine; Edwards, Peter A


    The bile acid receptor farnesoid X receptor (FXR) regulates many aspects of lipid metabolism by variouscomplex and incompletely understood molecular mechanisms. We set out to investigate the molecular mechanisms for FXR-dependent regulation of lipid and lipoprotein metabolism. To identify FXR-regulated microRNAs that were subsequently involved in regulating lipid metabolism. ATP binding cassette transporter A1 (ABCA1) is a major determinant of plasma high-density lipoprotein (HDL)-cholesterol levels. Here, we show that activation of the nuclear receptor FXR in vivo increases hepatic levels of miR-144, which in turn lowers hepatic ABCA1 and plasma HDL levels. We identified 2 complementary sequences to miR-144 in the 3' untranslated region of ABCA1 mRNA that are necessary for miR-144-dependent regulation. Overexpression of miR-144 in vitro decreased both cellular ABCA1 protein and cholesterol efflux to lipid-poor apolipoprotein A-I protein, whereas overexpression in vivo reduced hepatic ABCA1 protein and plasma HDL-cholesterol. Conversely, silencing miR-144 in mice increased hepatic ABCA1 protein and HDL-cholesterol. In addition, we used tissue-specific FXR-deficient mice to show that induction of miR-144 and FXR-dependent hypolipidemia requires hepatic, but not intestinal, FXR. Finally, we identified functional FXR response elements upstream of the miR-144 locus, consistent with direct FXR regulation. We have identified a novel pathway involving FXR, miR-144, and ABCA1 that together regulate plasma HDL-cholesterol.

  4. Sodium terbium(III polyphosphate

    Directory of Open Access Journals (Sweden)

    Abdelghani Oudahmane


    Full Text Available Single crystals of the title compound, NaTb(PO34, were obtained by solid-state reaction. This compound belongs to type II of long-chain polyphosphates with the general formula AIBIII(PO34. It is isotypic with the NaNd(PO34 and NaEr(PO34 homologues. The crystal structure is built up of infinite crenelated chains of corner-sharing PO4 tetrahedra with a repeating unit of four tetrahedra. These chains, extending parallel to [100], are linked by isolated TbO8 square antiprisms, forming a three-dimensional framework. The Na+ ions are located in channels running along [010] and are surrounded by six oxygen atoms in a distorted octahedral environment within a cut-off distance <2.9 Å.

  5. Preliminary evaluation of neutron capture cross sections for /sup 144/Sm, /sup 145/Sm and /sup 145/Pm

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, D.G.; Gardner, M.A.


    We have made preliminary neutron-capture cross-section calculations of the Hauser-Feshbach type for the isotopes /sup 144/Sm, /sup 145/Sm, and /sup 145/Pm to investigate the production of radioactive /sup 145/Pm by neutron capture on the stable isotope /sup 144/Sm. The calculations were made for incident neutron energies from 2.5 MeV to about 1/sup -4/ or 10/sup -5/ MeV, wherever the first unbound resonance was estimated to occur in each case. At that energy, the calculated value was reduced by a somewhat arbitrary factor, and the excitation function extended down to thermal energy using a (E/sub n/)/sup -1/2/ energy dependence. Since very large uncertainties are associated with the position and magnitude of the first unbound resonance and the subsequent extrapolation back to thermal energy, the cross sections in this low-energy region should not be considered more accurate than +- a factor of 10. For incident neutron energies above each step, the calculations represent an average through the separated and overlapping resonance regions and may be accurate to better than +- a factor of 2. 18 refs., 7 figs., 5 tabs.

  6. MicroRNA-144 dysregulates the transforming growth factor-β signaling cascade and contributes to the development of bronchiolitis obliterans syndrome after human lung transplantation. (United States)

    Xu, Zhongping; Ramachandran, Sabarinathan; Gunasekaran, Muthukumar; Zhou, Fangyu; Trulock, Elbert; Kreisel, Daniel; Hachem, Ramsey; Mohanakumar, Thalachallour


    Bronchiolitis obliterans syndrome (BOS), chronic lung allograft rejection, remains an impediment for the function of the transplanted organ. In this study, we defined the role of the microRNA (miRNA) miR-144 in fibroproliferation leading to BOS. Biopsy specimens were obtained from 20 lung transplant recipients with BOS((+)) and 19 without BOS((-)). Expression of miR-144 and its target, transforming growth factor-β (TGF-β)-induced factor homeobox 1(TGIF1), were analyzed by real-time polymerase chain reaction and Western blot. Overexpression of miR-144 and luciferase reporter genes were performed to elucidate miRNA-target interactions. The function of miR-144 was evaluated by transfecting fibroblasts and determining the response to TGF-β by analyzing Sma- and Mad-related family (Smads), fibroblast growth factor, TGF-β, and vascular endothelial growth factor. Smooth muscle actin-α-positive stress fibers and F-actin filaments in lung fibroblasts were analyzed by immunofluorescence. Analysis of miR-144 in the biopsy specimens demonstrated 4.1 ± 0.8-fold increases in BOS(+) compared with BOS(-) patients, with a significant reduction in TGIF1 (3.6 ± 1.2-fold), a corepressor of Smads. In vitro transfection confirmed that over-expression of miR-144 results in a reduction in TGIF1 and an increase in SMAD2, SMAD4, fibroblast growth factor-6, TGF-β, and vascular endothelial growth factor. Increasing miR-144 by transfecting, increased smooth muscle actin-α and fibronectin, and knockdown of miR-144 diminished fibrogenesis in MRC-5 fibroblasts. miR-144 is a critical regulator of the TGF-β signaling cascade and is over-expressed in lungs with BOS. Therefore, miR-144 is a potential target toward preventing fibrosis leading to BOS after lung transplant. Copyright © 2015 International Society for Heart and Lung Transplantation. Published by Elsevier Inc. All rights reserved.

  7. Mechanical 144 GHz beam steering with all-metallic epsilon-near-zero lens antenna

    Energy Technology Data Exchange (ETDEWEB)

    Pacheco-Peña, V., E-mail:; Torres, V., E-mail:; Orazbayev, B., E-mail:; Beruete, M., E-mail:; Sorolla, M. [Antennas Group-TERALAB, Universidad Pública de Navarra, Campus Arrosadía, 31006 Pamplona (Spain); Navarro-Cía, M., E-mail: [Optical and Semiconductor Devices Group, Department of Electrical and Electronic Engineering, Imperial College London, London SW7 2BT (United Kingdom); Centre for Plasmonics and Metamaterials, Imperial College London, London SW7 2AZ (United Kingdom); Centre for Terahertz Science and Engineering, Imperial College London, London SW7 2AZ (United Kingdom); Engheta, N., E-mail: [Department of Electrical and Systems Engineering, University of Pennsylvania, Philadelphia, Pennsylvania 19104 (United States)


    An all-metallic steerable beam antenna composed of an ε-near-zero (ENZ) metamaterial lens is experimentally demonstrated at 144 GHz (λ{sub 0} = 2.083 mm). The ENZ lens is realized by an array of narrow hollow rectangular waveguides working just near and above the cut-off of the TE{sub 10} mode. The lens focal arc on the xz-plane is initially estimated analytically as well as numerically and compared with experimental results demonstrating good agreement. Next, a flange-ended WR-6.5 waveguide is placed along the lens focal arc to evaluate the ENZ-lens antenna steerability. A gain scan loss below 3 dB is achieved for angles up to ±15°.

  8. CDCC calculations of fusion of 6Li with targets 144Sm and 154Sm: effect of resonance states (United States)

    Gómez Camacho, A.; Lubian, J.; Zhang, H. Q.; Zhou, Shan-Gui


    Continuum Discretized Coupled-Channel (CDCC) model calculations of total, complete and incomplete fusion cross sections for reactions of the weakly bound 6Li with 144,154Sm targets at energies around the Coulomb barrier are presented. In the cluster structure frame of 6Li→α+d, short-range absorption potentials are considered for the interactions between the ground state of the projectile 6Li and α-d fragments with the target. In order to separately calculate complete and incomplete fusion and to reduce double-counting, the corresponding absorption potentials are chosen to be of different range. Couplings to low-lying excited states 2+, 3‑ of 144Sm and 2+, 4+ of 154Sm are included. So, the effect on total fusion from the excited states of the target is investigated. Similarly, the effect on fusion due to couplings to resonance breakup states of 6Li, namely, l=2, J π =3+,2+,1+ is also calculated. The latter effect is determined by using two approaches, (a) by considering only resonance state couplings and (b) by omitting these states from the full discretized energy space. Among other things, it is found that both resonance and non-resonance continuum breakup couplings produce fusion suppression at all the energies considered. A. Gómez Camacho from CONACYT, México, J. Lubian from CNPq, FAPERJ, Pronex, Brazil. S.G.Z was partly supported by the NSF of China (11120101005, 11275248, 11525524, 11621131001, 11647601, 11711540016), 973 Program of China (2013CB834400) and the Key Research Program of Frontier Sciences of CAS. H.Q.Z. from NSF China (11375266)

  9. N-terminal Prion Protein Peptides (PrP(120-144)) Form Parallel In-register β-Sheets via Multiple Nucleation-dependent Pathways. (United States)

    Wang, Yiming; Shao, Qing; Hall, Carol K


    The prion diseases are a family of fatal neurodegenerative diseases associated with the misfolding and accumulation of normal prion protein (PrP(C)) into its pathogenic scrapie form (PrP(Sc)). Understanding the fundamentals of prion protein aggregation and the molecular architecture of PrP(Sc) is key to unraveling the pathology of prion diseases. Our work investigates the early-stage aggregation of three prion protein peptides, corresponding to residues 120-144 of human (Hu), bank vole (BV), and Syrian hamster (SHa) prion protein, from disordered monomers to β-sheet-rich fibrillar structures. Using 12 μs discontinuous molecular dynamics simulations combined with the PRIME20 force field, we find that the Hu-, BV-, and SHaPrP(120-144) aggregate via multiple nucleation-dependent pathways to form U-shaped, S-shaped, and Ω-shaped protofilaments. The S-shaped HuPrP(120-144) protofilament is similar to the amyloid core structure of HuPrP(112-141) predicted by Zweckstetter. HuPrP(120-144) has a shorter aggregation lag phase than BVPrP(120-144) followed by SHaPrP(120-144), consistent with experimental findings. Two amino acid substitutions I138M and I139M retard the formation of parallel in-register β-sheet dimers during the nucleation stage by increasing side chain-side chain association and reducing side chain interaction specificity. On average, HuPrP(120-144) aggregates contain more parallel β-sheet content than those formed by BV- and SHaPrP(120-144). Deletion of the C-terminal residues 138-144 prevents formation of fibrillar structures in agreement with the experiment. This work sheds light on the amyloid core structures underlying prion strains and how I138M, I139M, and S143N affect prion protein aggregation kinetics. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  10. Crystal structure of a mixed-ligand terbium(III coordination polymer containing oxalate and formate ligands, having a three-dimensional fcu topology

    Directory of Open Access Journals (Sweden)

    Chainok Kittipong


    Full Text Available The title compound, poly[(μ3-formato(μ4-oxalatoterbium(III], [Tb(CHO2(C2O4]n, is a three-dimensional coordination polymer, and is isotypic with the LaIII, CeIII and SmIII analogues. The asymmetric unit contains one TbIII ion, one formate anion (CHO2− and half of an oxalate anion (C2O42−, the latter being completed by application of inversion symmetry. The TbIII ion is nine-coordinated in a distorted tricapped trigonal–prismatic manner by two chelating carboxylate groups from two C2O42− ligands, two carboxylate oxygen atoms from another two C2O42− ligands and three oxygen atoms from three CHO2− ligands, with the Tb—O bond lengths and the O—Tb—O bond angles ranging from 2.4165 (19 to 2.478 (3 Å and 64.53 (6 to 144.49 (4°, respectively. The CHO2− and C2O42− anions adopt μ3-bridging and μ4-chelating-bridging coordination modes, respectively, linking adjacent TbIII ions into a three-dimensional 12-connected fcu topology with point symbol (324.436.56. The title compound exhibits thermal stability up to 623 K, and also displays strong green photoluminescence in the solid state at room temperature.

  11. Transformation of Au144(SCH2CH2Ph)60 to Au133(SPh-tBu)52 Nanomolecules: Theoretical and Experimental Study. (United States)

    Nimmala, Praneeth Reddy; Theivendran, Shevanuja; Barcaro, Giovanni; Sementa, Luca; Kumara, Chanaka; Jupally, Vijay Reddy; Apra, Edoardo; Stener, Mauro; Fortunelli, Alessandro; Dass, Amala


    Ultrastable gold nanomolecule Au144(SCH2CH2Ph)60 upon etching with excess tert-butylbenzenethiol undergoes a core-size conversion and compositional change to form an entirely new core of Au133(SPh-tBu)52. This conversion was studied using high-resolution electrospray mass spectrometry which shows that the core size conversion is initiated after 22 ligand exchanges, suggesting a relatively high stability of the Au144(SCH2CH2Ph)38(SPh-tBu)22 intermediate. The Au144 → Au133 core size conversion is surprisingly different from the Au144 → Au99 core conversion reported in the case of thiophenol, -SPh. Theoretical analysis and ab initio molecular dynamics simulations show that rigid p-tBu groups play a crucial role by reducing the cluster structural freedom, and protecting the cluster from adsorption of exogenous and reactive species, thus rationalizing the kinetic factors that stabilize the Au133 core size. This 144-atom to 133-atom nanomolecule's compositional change is reflected in optical spectroscopy and electrochemistry.

  12. Activating and sustaining c-Myc by depletion of miR-144/451 gene locus contributes to B-lymphomagenesis. (United States)

    Ding, Lan; Zhang, Yanqing; Han, Lingling; Fu, Lei; Mei, Xia; Wang, Jijun; Itkow, Jacobi; Elabid, Afaf Elabid Ibrahim; Pang, Lei; Yu, Duonan


    Hyper activity of protooncogene c-Myc is one of the hallmarks of highly aggressive lymphomas. However, the mechanism of how c-Myc is subjected to activation and amplification is still not well defined. In this study, we use gene knockout strategy to show that targeted depletion of a well-conserved microRNA gene locus miR-144/451 initiates tumorigenesis including B-lymphoma development in aged mice. This is due, at least in part, to the direct activation of the c-Myc gene by loss of miR-144/451 expression in hematopoietic cells. Moreover, oncoprotein c-Myc inversely regulates miR-144/451 expression by directly binding to the miR-144/451 promoter region, forming a miRNA-Myc positive feedback loop to safeguard the high level of c-Myc in B-lymphocytes. We also demonstrate that this miRNA-Myc crosstalk is disrupted in human diffuse large B-cell lymphomas with aberrant c-Myc expression. Therefore, our findings provide strong evidence, for the first time, that deficiency of miR-144/451 expression may play a bona fide role in derepression of silenced c-Myc, which contributes to tumor development including B-lymphomagenesis.

  13. Cirurgia de revascularização do miocárdio no idoso: estudo descritivo de 144 casos Revascularization surgery of the myocardium in the elderly patients: descriptive study in 144 patients

    Directory of Open Access Journals (Sweden)

    Maurílio Onofre DEININGER


    Full Text Available Realizamos análise retrospectiva de todos os pacientes com idade igual ou superior a 70 anos, submetidos à operação de revascularização do miocárdio isolada, no período de janeiro de 1992 a dezembro de 1997, objetivando avaliar a morbimortalidade. Do total de 144 pacientes, 92 (63,9% eram do sexo masculino, idade entre 70 e 84 anos, média de 73,51 anos e desvio padrão de 2,82. A grande maioria encontrava-se com angina classe funcional III ou IV (79,16%. Tiveram relação com a ocorrência de maior mortalidade, a presença no período pré-operatório de: obesidade (p = 0,004, insuficiência cardíaca congestiva (classe III/IV - p = 0,03 e/ou infarto agudo do miocárdio (A retrospective analysis involving seventy-year-old patients as well as those over seventy who have undergone CABG as a single procedure, during Jannuary 1992 to December 1997, was carried out with the purpose of assessing their morbidity with mortality. Of the 144 patients, 92 (63.9% were males, aged 70 to 84 (average age 73.51 and standard deviation 2.82. Most of those, 114 (79.16%, suffered from angina belonging to the functional class III or IV. The occurrence in the pre-operative period of obesity (p = 0.004, heart failure (III/IV class - p = 0.03 and/or acute myocardial infection (less than 21 days - p = 0.01 demonstrated a definite relationship with mortality. There were 120 (83.34% patients with lesions in three or more vessels (average 3.48 anastomoses/patients.The pediculate internal mammary artery was employed in 126 patients (87.5% and that rate increased to 98.9% in the last two years. The main complications in the post-operation period leading to death were either infections (p < 0.0001, prolonged ventilatory support (p < 0.0001, renal failure with dialysis (p < 0.0001 and/or low cardiac output (p = 0.003. As to statistical analysis the Student T test, the Chi-square test and Fisher's exact test were used. Surgical mortality totalling 5.5% (8/144 in the

  14. Development of a computational model applied to a unitary 144 cm{sup 2} proton exchange membrane fuel cell; Desenvolvimento de um modelo numerico computacional aplicado a uma celula a combustivel unitaria de 144 CM{sup 2} tipo PEM

    Energy Technology Data Exchange (ETDEWEB)

    Robalinho, Eric


    This work presents the development of a numerical computer model and methodology to study and design polymeric exchange membrane fuel cell - PEM. For the validation of experimental results, a sequence of routines, appropriate to fit the data obtained in the laboratory, was described. At the computational implementation it was created a new strategy of coupling two 3-dimensional models to satisfy the requirements of the comprehensive model of the fuel cell, including its various geometries and materials, as well as the various physical and chemical processes simulated. To effective assessment of the real cell analogy with numerical model, numerical studies were carried out. Comparisons with values obtained in the literature, characterization of variables through laboratory experiments and estimates from models already tested in the literature were also performed. Regarding the experimental part, a prototype of a fuel cell unit of 144 cm of geometric area was designed, produced and operated at laboratory with the purpose of validating the numerical computer model proposed, with positive results. The results of simulations for the 2D and 3D geometries proposed are presented in the form of polarization curves, highlighting the catalytic layer model based on the geometry of agglomerates. Parametric and sensitivity studies are presented to illustrate the change in performance of the fuel cell studied. The final model is robust and useful as a tool for design and optimization of PEM type fuel cells in a wide range of operating conditions. (author)

  15. Development of a computational model applied to a unitary 144 CM{sup 2} proton exchange membrane fuel cell; Desenvolvimento de um modelo numerico computacional aplicado a uma celula a combustivel unitaria de 144 CM{sup 2} tipo PEM

    Energy Technology Data Exchange (ETDEWEB)

    Robalinho, Eric


    This work presents the development of a numerical computer model and methodology to study and design polymeric exchange membrane fuel cell - PEM. For the validation of experimental results, a sequence of routines, appropriate to fit the data obtained in the laboratory, was described. At the computational implementation it was created a new strategy of coupling two 3-dimensional models to satisfy the requirements of the comprehensive model of the fuel cell, including its various geometries and materials, as well as the various physical and chemical processes simulated. To effective assessment of the real cell analogy with numerical model, numerical studies were carried out. Comparisons with values obtained in the literature, characterization of variables through laboratory experiments and estimates from models already tested in the literature were also performed. Regarding the experimental part, a prototype of a fuel cell unit of 144 cm{sup 2} of geometric area was designed, produced and operated at laboratory with the purpose of validating the numerical computer model proposed, with positive results. The results of simulations for the 2D and 3D geometries proposed are presented in the form of polarization curves, highlighting the catalytic layer model based on the geometry of agglomerates. Parametric and sensitivity studies are presented to illustrate the change in performance of the fuel cell studied. The final model is robust and useful as a tool for design and optimization of PEM type fuel cells in a wide range of operating conditions. (author)

  16. Ligand-modulated interactions between charged monolayer-protected Au144(SR)60 gold nanoparticles in physiological saline. (United States)

    Villarreal, Oscar D; Chen, Liao Y; Whetten, Robert L; Yacaman, Miguel J


    In order to determine how functionalized gold nanoparticles (AuNPs) interact in a near-physiological environment, we performed all-atom molecular dynamics simulations on the icosahedral Au144 nanoparticles each coated with a homogeneous set of 60 thiolates selected from one of these five (5) types: 11-mercapto-1-undecanesulfonate -SC11H22(SO3(-)), 5-mercapto-1-pentanesulfonate -SC5H10(SO3(-)), 5-mercapto-1-pentaneamine -SC5H10(NH3(+)), 4-mercapto-benzoate -SPh(COO(-)), or 4-mercapto-benzamide -SPh(CONH3(+)). These thiolates were selected to elucidate how the aggregation behavior of AuNPs depends on ligand parameters, including the charge of the terminal group (anionic vs. cationic), and its length and conformational flexibility. For this purpose, each functionalized AuNP was paired with a copy of itself, placed in an aqueous cell, neutralized by 120 Na(+)/Cl(-) counter-ions and salinated with a 150 mM concentration of NaCl, to form five (5) systems of like-charged AuNPs pairs in a saline. We computed the potential of mean force (the reversible work of separation) as a function of the intra-pair distance and, based on which, the aggregation affinities. We found that the AuNPs coated with negatively charged, short ligands have very high affinities. Structurally, a significant number of Na(+) counter-ions reside on a plane between the AuNPs, mediating the interaction. Each such ion forms a "salt bridge" (or "ionic bonds") to both of the AuNPs when they are separated by its diameter plus 0.2-0.3 nm. The positively charged AuNPs have much weaker affinities, as Cl(-) counter-ions form fewer and weaker salt bridges between the AuNPs. In the case of Au144(SC11H22(SO3(-)))60 pair, the flexible ligands fluctuate much more than the other four cases. The large fluctuations disfavor the forming of salt bridges between two AuNPs, but enable hydrophobic contact between the exposed hydrocarbon chains of the two AuNPs, which are subject to an effective attraction at a separation

  17. [Breast asymmetry of the teenager and the young adult. Stability of the result in time. About 144 patients]. (United States)

    Ellart, J; François, C; Calibre, C; Guerreschi, P; Duquennoy-Martinot, V


    Breast asymmetry is defined by a difference in breast shape and/or volume. The goal of this study was to assess the stability of the surgical results and to highlight predictive factors for deterioration in results. This retrospective and monocentric study included all patients presenting constitutional isolated asymmetry, Poland's syndrome, asymmetric tuberous breast or pectus excavatum treated between 1980 and 2015. The statistical analysis included 144 patients and contained two parts. The first analysis compared patients with or without breast implant. Results were significant only for symmetry of shape, with better outcomes without breast implant (P=0.0170). The second analysis compared the subgroups of patients with breast asymmetry, according to the etiology. Patients with tuberous breasts and constitutional isolated asymmetry have been compared. We found a significant difference only regarding the long-term results (P=0.0091). Patients with tuberous breasts had deteriorating in results over time. Patients with Poland's syndrome, compared to patients with constitutional isolated asymmetry, had significantly less good results for symmetry of volume, of shape, of areola, and for early results (Pbreast implant, weight variations, pregnancies and breast-feeding, the use of hormonal treatments, ageing and tuberous malformation. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  18. CT and MRI findings of 144 patients with West syndrome. Characterization of the cerebral lesion and its topography

    Energy Technology Data Exchange (ETDEWEB)

    Hamano, Shin-ichiro; Tanaka, Manabu; Mochizuki, Mika; Sugiyama, Nobuyoshi; Nara, Takahiro; Oguma, Eiji [Saitama Children' s Medical Center, Iwatsuki (Japan); Eto, Yoshikatsu [Jikei Univ., Tokyo (Japan). School of Medicine


    In West syndrome, although classified as a generalized epilepsy, there are some patients reported to have became seizure-free and have good outcomes in the developmental aspect after resections of localized lesions. We reviewed computed tomography and magnetic resonance imaging of 144 patients with West syndrome and classified them into four categories depending on the distribution of lesion: normal group, diffuse group, disseminated group, localized group. Thirty-three patients belong to the normal group after having reviewed images from computed tomography and magnetic resonance imaging. The diffuse group consisted of 83 patients presenting morphologic abnormalities such as, diffuse cerebral atrophy, periventricular leukomalesia or polycystic encephalomalesia; the disseminated group included 17 patients having a diagnosis of tuberoius sclerosis, multiple cortical dysplasia or multiple cortical heterotopias. The lesions of all eleven patients with localized cerebral lesions involved the temporal and/or occipital lobes. Nine of the eleven patients with localized cerebral lesions had the lesions on the right side. These results suggest that the specificity of lesion topography of temporo-occipital regions and the right-side in West syndrome will have a close correlation with normal brain maturation, from the viewpoint of development of myelination and cerebral blood flow, and related with the genesis of West syndrome. (author)

  19. Isoscalar giant dipole resonance in Zr-90, Sn-116, Sm-144 and Pb-208 excited by 240 MeV alpha particle scattering

    NARCIS (Netherlands)

    Clark, HL; Lui, YW; Youngblood, DH; Bachtr, K; Garg, U; Harakeh, MN; Kalantar-Nayestanaki, N


    The giant resonance regions of Zr-90, Sn-116, Sm-144 and (208)pb were investigated using 240 MeV a particle scattering at small angles including 0 degrees. E1 strengths corresponding to 91+/-11%, 89+/-10%, 105+/-12% and 95+/-13% of the isoscalar E1 energy-weighted sum rule were identified between 18

  20. Identification and expression analysis of miR-144-5p and miR-130b-5p in dairy cattle

    Directory of Open Access Journals (Sweden)

    Z. Li


    Full Text Available MicroRNAs (miRNAs can coordinate the main pathways involved in innate and adaptive immune responses by regulating gene expression. To explore the resistance to mastitis in cows, miR-144-5p and miR-130b-5p were identified in bovine mammary gland tissue and 14 potential target genes belonging to the chemokine signaling pathway, the arginine and proline metabolism pathway and the mRNA surveillance pathway were predicted. Subsequently, we estimated the relative expression of miR-144-5p and miR-130b-5p in cow mammary tissues by using stem-loop quantitative real-time polymerase chain reaction. The results showed that the relative expression of miR-144-5p and miR-130b-5p in the mastitis-infected mammary tissues (n = 5 was significantly downregulated 0.14-fold (p < 0. 01 and upregulated 3.34-fold (p < 0. 01, respectively, compared to healthy tissues (n = 5. Our findings reveal that miR-144-5p and miR-130b-5p may have important roles in resistance to mastitis in dairy cattle.

  1. Effects of the dimeric PSD-95 inhibitor UCCB01-144 on functional recovery after fimbria-fornix transection in rats

    DEFF Research Database (Denmark)

    Sommer, Jens Bak; Bach, Anders; Rytter, Hana Malá


    . UCCB01-144 or saline was injected into the lateral tail vein of rats immediately after sham surgery or FF-transection, and effects on spatial delayed alternation in a T-maze were assessed over a 28-day period. Task acquisition was significantly impaired in FF-transected animals, but there were...

  2. Anti-L1CAM radioimmunotherapy is more effective with the radiolanthanide terbium-161 compared to lutetium-177 in an ovarian cancer model

    Energy Technology Data Exchange (ETDEWEB)

    Gruenberg, Juergen; Lindenblatt, Dennis; Cohrs, Susan; Fischer, Eliane [Paul Scherrer Institute, Center for Radiopharmaceutical Sciences ETH-PSI-USZ, Villigen (Switzerland); Dorrer, Holger [Paul Scherrer Institute, Laboratory of Radiochemistry and Environmental Chemistry, Villigen (Switzerland); Zhernosekov, Konstantin [ITG Isotope Technologies Garching GmbH, Garching (Germany); Koester, Ulli [Institut Laue-Langevin, Grenoble (France); Tuerler, Andreas [Paul Scherrer Institute, Laboratory of Radiochemistry and Environmental Chemistry, Villigen (Switzerland); University of Bern, Department of Chemistry and Biochemistry, Berne (Switzerland); Schibli, Roger [Paul Scherrer Institute, Center for Radiopharmaceutical Sciences ETH-PSI-USZ, Villigen (Switzerland); ETH Zurich, Department of Chemistry and Applied Biosciences, Zurich (Switzerland)


    The L1 cell adhesion molecule (L1CAM) is considered a valuable target for therapeutic intervention in different types of cancer. Recent studies have shown that anti-L1CAM radioimmunotherapy (RIT) with {sup 67}Cu- and {sup 177}Lu-labelled internalising monoclonal antibody (mAb) chCE7 was effective in the treatment of human ovarian cancer xenografts. In this study, we directly compared the therapeutic efficacy of anti-L1CAM RIT against human ovarian cancer under equitoxic conditions with the radiolanthanide {sup 177}Lu and the potential alternative {sup 161}Tb in an ovarian cancer therapy model. Tb was produced by neutron bombardment of enriched {sup 160}Gd targets. {sup 161}Tb and {sup 177}Lu were used for radiolabelling of DOTA-conjugated antibodies. The in vivo behaviour of the radioimmunoconjugates (RICs) was assessed in IGROV1 tumour-bearing nude mice using biodistribution experiments and SPECT/CT imaging. After ascertaining the maximal tolerated doses (MTD) the therapeutic impact of 50 % MTD of {sup 177}Lu- and {sup 161}Tb-DOTA-chCE7 was evaluated in groups of ten mice by monitoring the tumour size of subcutaneous IGROV1 tumours. The average number of DOTA ligands per antibody was 2.5 and maximum specific activities of 600 MBq/mg were achieved under identical radiolabelling conditions. RICs were stable in human plasma for at least 48 h. {sup 177}Lu- and {sup 161}Tb-DOTA-chCE7 showed high tumour uptake (37.8-39.0 %IA/g, 144 h p.i.) with low levels in off-target organs. SPECT/CT images confirmed the biodistribution data. {sup 161}Tb-labelled chCE7 revealed a higher radiotoxicity in nude mice (MTD: 10 MBq) than the {sup 177}Lu-labelled counterpart (MTD: 12 MBq). In a comparative therapy study with equitoxic doses, tumour growth inhibition was better by 82.6 % for the {sup 161}Tb-DOTA-chCE7 than the {sup 177}Lu-DOTA-chCE7 RIT. Our study is the first to show that anti-L1CAM {sup 161}Tb RIT is more effective compared to {sup 177}Lu RIT in ovarian cancer xenografts

  3. Genetic engineering of EcoRI mutants with altered amino acid residues in the DNA binding site: physicochemical investigations give evidence for an altered monomer/dimer equilibrium for the Gln144Lys145 and Gln144Lys145Lys200 mutants. (United States)

    Geiger, R; Rüter, T; Alves, J; Fliess, A; Wolfes, H; Pingoud, V; Urbanke, C; Maass, G; Pingoud, A; Düsterhöft, A


    We have genetically engineered the Arg200----Lys mutant, the Glu144Arg145----GlnLys double mutant, and the Glu144Arg145Arg200----GlnLysLys triple mutant of the EcoRI endonuclease in extension of previously published work on site-directed mutagenesis of the EcoRI endonuclease in which Glu144 had been exchanged for Gln and Arg145 for Lys [Wolfes et al. (1986) Nucleic Acids Res. 14, 9063]. All these mutants carry modifications in the DNA binding site. Mutant EcoRI proteins were purified to homogeneity and characterized by physicochemical techniques. All mutants have a very similar secondary structure composition. However, whereas the Lys200 mutant is not impaired in its capacity to form a dimer, the Gln144Lys145 and Gln144Lys145Lys200 mutants have a very much decreased propensity to form a dimer or tetramer depending on concentration as shown by gel filtration and analytical ultracentrifugation. This finding may explain the results of isoelectric focusing experiments which show that these two mutants have a considerably more basic pI than expected for a protein in which an acidic amino acid was replaced by a neutral one. Furthermore, while wild-type EcoRI and the Lys200 mutant are denatured in an irreversible manner upon heating to 60 degrees C, the thermal denaturation process as shown by circular dichroism spectroscopy is fully reversible with the Gln144Lys145 double mutant and the Gln144Lys145Lys200 triple mutant. All EcoRI endonuclease mutants described here have a residual enzymatic activity with wild-type specificity, since Escherichia coli cells overexpressing the mutant proteins can only survive in the presence of EcoRI methylase. The detailed analysis of the enzymatic activity and specificity of the purified mutant proteins is the subject of the accompanying paper [Alves et al. (1989) Biochemistry (following paper in this issue)].

  4. A europium- and terbium-coated magnetic nanocomposite as sorbent in dispersive solid phase extraction coupled with ultra-high performance liquid chromatography for antibiotic determination in meat samples. (United States)

    Castillo-García, M L; Aguilar-Caballos, M P; Gómez-Hens, A


    A new magnetic dispersive solid-phase extraction approach based on Eu- and Tb-coated magnetic nanocomposites, combined with ultra-high performance liquid chromatography with fluorometric detection, is reported for the extraction and simultaneous determination of veterinary antibiotics. The method is aimed at monitoring of potential residues of three tetracyclines, namely oxytetracycline, tetracycline, chlortetracycline and three acidic quinolones, such as oxolinic acid, nalidixic acid and flumequine, chosen as model analytes, in animal muscle samples. The nanocomposites were obtained by synthesizing magnetic nanoparticles by a co-precipitation method and their coating with terbium and europium ions. The limits of detection obtained using standard solutions were: 1.0, 1.5, 3.8, 0.25, 0.7 and 1.2ngmL(-1), which corresponds to 3.3, 5.0, 12.7, 0.8, 2.3 and 4.0μgkg(-1) for oxytetracycline, tetracycline, chlortetracycline, oxolinic acid, nalidixic acid and flumequine, respectively, in meat samples. The precision values, obtained in the presence of the sample matrix, were in the ranges 0.12-2.0% and 2.6-15.4% for retention times and areas, respectively. The selectivity of the method was checked by assaying different veterinary drugs, finding that most of them did not interfere at the same concentration levels as that of analytes. A recovery study was performed in the presence of chicken and pork muscle samples, which provided values in the range of 61.5-102.6%. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. A Whitham-Theory Sonic-Boom Analysis of the TU-144 Aircraft at a Mach Number of 2.2 (United States)

    Mack, Robert J.


    Officially, the Tu-144 was the first supersonic-cruise, passenger-carrying aircraft to enter commercial service. Design, construction, and testing were carried out by the Soviet Union, flight certification was by the Soviet Union, and the only regular passenger flights were scheduled and flown across the territory of the Soviet Union. Although it was not introduced to international passenger service, there were many significant engineering accomplishments achieved in the design, production, and flight of this aircraft. Development of the aircraft began with a prototype stage. Systematic testing and redesign led to a production aircraft in discrete stages that measurably improved the performance of the aircraft from the starting concept to final aircraft certification. It flew in competition with the English-French Concorde for a short time, but was withdrawn from national commercial service due to a lack of interest by airlines outside the Soviet Union. NASA became interested in the Tu- 144 aircraft when it was offered for use as a flying "testbed" in the study of operating characteristics of a supersonic-cruise commercial airplane. Since it had been in supersonic-cruise service, the Tu- 144 had operational characteris'tics similar to those anticipated in the conceptual aircraft designs being studied by the United States aircraft companies. In addition to the other operational tests being conducted on the Tu-144 aircraft, it was proposed that two sets of sonic-boom pressure signature measurements be made. The first set would be made on the ground, using techniques and devices similar to those in reference I and many other subsequent studies. A second set would be made in the air with an instrumented aircraft flying close under the Tu-144 in supersonic flight. Such in-flight measurements would require pressure gages that were capable of accurately recording the flow-field overpressures generated by the Tu- 144 at relatively close distances under the vehicle

  6. Compact Nd:YAG laser operating at 1.06, 1.32, and 1.44 μm for dental caries effective disinfection (United States)

    Dostálová, Tat'jana; Jelínková, Helena; Kadlecová, Martina; Němec, Michal; Å ulc, Jan; Fibrich, Martin; Nejezchleb, Karel; Kapitch, Nickalai; Å koda, Václav


    The analysis of the disinfection effect of Nd:YAG laser radiation was investigated for patients with high concentration of Streptococcus mutans in saliva (positive result in Saliva-check mutans test). For the interaction the Nd:YAG laser system generated separate switchable wavelengths with the maximum output energies 1.1, 0.6, and 0.3 J for wavelength 1.06 μm, 1.32, μm and 1.44 μm, respectively, was used. Our study proved that after the laser irradiation the Saliva-check test showed negative presence of Streptococcus mutans. The disinfection effect was confirmed for all used radiation wavelength. For 1.44 μm this effect was reached with a smallest energy density.

  7. A Controlled and Retrospective Study of 144 Chronic Low Back Pain Patients to Evaluate the Effectiveness of an Intensive Functional Restoration Program in France


    Isabelle Caby; Nicolas Olivier; Frédérick Janik; Jacques Vanvelcenaher; Patrick Pelayo


    Study Design: A controlled and retrospective study of 144 chronic low back pain patients to evaluate the effectiveness of an intensive functional restoration program in France. Objective: Evaluating the efficiency of an intensive, dynamic and multidisciplinary functional restoration program in patients with chronic low back pain (LBP), during 6 and 12 months follow up. Summary of background data: Chronic low back pain disease has a multifactor nature, involving physical, psychological profess...

  8. A novel arginine to tryptophan (R144W mutation in troponin T (cTnT gene in an indian multigenerational family with dilated cardiomyopathy (FDCM.

    Directory of Open Access Journals (Sweden)

    Deepa Selvi Rani

    Full Text Available Cardiomyopathy is a major cause of heart failure and sudden cardiac death; several mutations in sarcomeric protein genes have been associated with this disease. Our aim in the present study is to investigate the genetic variations in Troponin T (cTnT gene and its association with dilated cardiomyopathy (DCM in south-Indian patients. Analyses of all the exons and exon-intron boundaries of cTnT in 147 DCM and in 207 healthy controls had revealed a total of 15 SNPs and a 5 bp INDEL; of which, polymorphic SNPs were compared with the HapMap population data. Interestingly, a novel R144W mutation, that substitutes polar-neutral tryptophan for a highly conserved basic arginine in cTnT, altering the charge drastically, was identified in a DCM, with a family history of sudden-cardiac death (SCD. This mutation was found within the tropomyosin (TPM1 binding domain, and was evolutionarily conserved across species, therefore it is expected to have a significant impact on the structure and function of the protein. Family studies had revealed that the R144W is co-segregating with disease in the family as an autosomal dominant trait, but it was completely absent in 207 healthy controls and in 162 previously studied HCM patients. Further screening of the proband and three of his family members (positive for R144W mutant with eight other genes β-MYH7, MYBPC3, TPM1, TNNI3, TTN, ACTC, MYL2 and MYL3, did not reveal any disease causing mutation, proposing the absence of compound heterozygosity. Therefore, we strongly suggest that the novel R144W unique/private mutant identified in this study is associated with FDCM. This is furthermore signifying the unique genetic architecture of Indian population.

  9. Determination of the B(E3,0$^{+}$ $\\rightarrow$ 3$^{-}$) strength in the octupole correlated nuclei $^{142,144}$Ba using Coulomb excitation

    CERN Multimedia

    We propose to exploit the unique capability of ISOLDE to provide intense post-accelerated $^{142}$Ba and $^{144}$Ba ion beams from the HIE-ISOLDE facility to enable the Coulomb excitation of the first 3$^-$ state in these nuclei. By measuring the $\\gamma$-ray yields of the E1 decays from the 3$^-$ state using the MINIBALL array, we can obtain the interesting transition matrix element. The results will give quantitative information about octupole correlations in these nuclei.

  10. Subcellular co-localization of aluminum (III) phthalocyanine chloride tetrasulphonate with fluorescent markers in the human melanoma cell-line HT-144

    CSIR Research Space (South Africa)

    Ndhundhuma, I


    Full Text Available , and bladder cancer. Methyl- tetrahydroxyphenyl chlorin (Temoporfin) is approved in the European Union, Norway and Iceland for palliative treatment of head and neck cancer [8]. Other approved photosensitizers are 5-aminolevulinic acid (approved in USA..., NR) was purchased from Biochrom AG (Berlin, Germany) and used according to the manufacturer's instructions. Cell culture Cultures of human metastatic melanoma cell line (HT-144 cells, ATCC No HTB-63TM, LGC Standards GmbH, Wesel, Germany) were...

  11. Crystal structures of three 1-[4-(4-bromo-but-oxy)-phen-yl] chalcone derivatives: (E)-1-[4-(4-bromo-but-oxy)-phen-yl]-3-phenyl-prop-2-en-1-one, (E)-1-[4-(4-bromo-but-oxy)-phen-yl]-3-(4-meth-oxy-phen-yl)prop-2-en-1-one and (E)-1-[4-(4-bromo-but-oxy)-phen-yl]-3-(3,4-di-meth-oxy-phen-yl)prop-2-en-1-one. (United States)

    Maragatham, Gunasekaran; Selvarani, Sivasamy; Rajakumar, Perumal; Lakshmi, Srinivasakannan


    The crystal structures of three chalcones with a bromo-substituted but-oxy side chain, viz. (E)-1-[4-(4-bromo-but-oxy)-phen-yl]-3-phenyl-prop-2-en-1-one, C19H19BrO2, (I), (E)-1-[4-(4-bromo-but-oxy)-phen-yl]-3-(4-meth-oxy-phen-yl)prop-2-en-1-one, C20H21BrO3, (II), and (E)-1-[4-(4-bromo-but-oxy)-phen-yl]-3-(3,4-di-meth-oxy-phen-yl)prop-2-en-1-one, C21H23BrO4, (III), are reported. In all mol-ecules, the conformation of the keto group with respect to the olefinic bond is s-cis. Mol-ecules of (I) and (II) are nearly planar, while mol-ecule (III) is not planar. In the crystal of compounds (I) and (II), mol-ecules are linked into chains parallel to the c axis by C-H⋯π inter-actions. In the crystal of compound (III), mol-ecules are linked by a pairs of C-H⋯O hydrogen bonds, forming inversion dimers. Weak C-Br⋯π inter-actions are also observed in (III).

  12. Response by gender of HIV-1-infected subjects treated with abacavir/lamivudine plus atazanavir, with or without ritonavir, for 144 weeks (United States)

    Squires, Kathleen E; Young, Benjamin; Santiago, Lizette; Dretler, Robin H; Walmsley, Sharon L; Zhao, Henry H; Pakes, Gary E; Ross, Lisa L; Shaefer, Mark S


    Purpose The 144-week results of the open-label, multicenter Atazanavir/Ritonavir Induction with Epzicom Study (ARIES) were stratified by gender to compare treatment responses. Methods A total of 369 HIV-infected, antiretroviral-naïve subjects receiving once-daily abacavir/lamivudine + atazanavir/ritonavir (ATV/r) whose HIV-1 RNA was <50 copies/mL by week 30 were randomized 1:1 at week 36 to maintain or discontinue ritonavir for 108 subsequent weeks. Between- and within-treatment gender-related efficacy and safety differences were analyzed. Results Subjects were 85% male; 64% white; and had a mean age of 39 years, baseline median HIV-1 RNA of 114,815 copies/mL, and median CD4+ cell count of 198 cells/mm3. Gender (ATV [n=189]: 29 females/160 males; ATV/r [n=180]: 25 females/155 males) and most other demographics were similar between groups; more females than males were black (65% vs 25%) and fewer females had baseline HIV-1 RNA ≥100,000 copies/mL (41% vs 58%). At week 144, no significant differences between genders were observed in proportion maintaining HIV-1 RNA <50 copies/mL (ATV, 79% vs 77%; ATV/r, 60% vs 75%) or <400 copies/mL (ATV, 83% vs 84%; ATV/r, 68% vs 82%) (intent-to-treat-exposed: time to loss of virologic response analysis); median CD4+ change from baseline (ATV, +365 vs +300 cells/mm3; ATV/r, +344 vs +301 cells/mm3); proportion with treatment-related grade 2–4 adverse events (baseline to week 144: ATV, 41% vs 31%; ATV/r, 36% vs 43%; weeks 36 to 144: ATV, 14% vs 13%; ATV/r, 24% vs 23%); or proportion developing fasting lipid changes. Female and male virologic failure rates (ATV, 0 vs 5; ATV/r, 2 vs 4) and proportions completing the study were similar during the extension phase. Primary withdrawal reasons were loss to follow-up and pregnancy for females and loss to follow-up and other for males. Conclusion Over 144 weeks, no significant gender differences were observed in efficacy, safety, or fasting lipid changes with abacavir/lamivudine +ATV or

  13. Association of Leisure-Time Physical Activity With Risk of 26 Types of Cancer in 1.44 Million Adults. (United States)

    Moore, Steven C; Lee, I-Min; Weiderpass, Elisabete; Campbell, Peter T; Sampson, Joshua N; Kitahara, Cari M; Keadle, Sarah K; Arem, Hannah; Berrington de Gonzalez, Amy; Hartge, Patricia; Adami, Hans-Olov; Blair, Cindy K; Borch, Kristin B; Boyd, Eric; Check, David P; Fournier, Agnès; Freedman, Neal D; Gunter, Marc; Johannson, Mattias; Khaw, Kay-Tee; Linet, Martha S; Orsini, Nicola; Park, Yikyung; Riboli, Elio; Robien, Kim; Schairer, Catherine; Sesso, Howard; Spriggs, Michael; Van Dusen, Roy; Wolk, Alicja; Matthews, Charles E; Patel, Alpa V


    Leisure-time physical activity has been associated with lower risk of heart-disease and all-cause mortality, but its association with risk of cancer is not well understood. To determine the association of leisure-time physical activity with incidence of common types of cancer and whether associations vary by body size and/or smoking. We pooled data from 12 prospective US and European cohorts with self-reported physical activity (baseline, 1987-2004). We used multivariable Cox regression to estimate hazard ratios (HRs) and 95% confidence intervals for associations of leisure-time physical activity with incidence of 26 types of cancer. Leisure-time physical activity levels were modeled as cohort-specific percentiles on a continuous basis and cohort-specific results were synthesized by random-effects meta-analysis. Hazard ratios for high vs low levels of activity are based on a comparison of risk at the 90th vs 10th percentiles of activity. The data analysis was performed from January 1, 2014, to June 1, 2015. Leisure-time physical activity of a moderate to vigorous intensity. Incident cancer during follow-up. A total of 1.44 million participants (median [range] age, 59 [19-98] years; 57% female) and 186 932 cancers were included. High vs low levels of leisure-time physical activity were associated with lower risks of 13 cancers: esophageal adenocarcinoma (HR, 0.58; 95% CI, 0.37-0.89), liver (HR, 0.73; 95% CI, 0.55-0.98), lung (HR, 0.74; 95% CI, 0.71-0.77), kidney (HR, 0.77; 95% CI, 0.70-0.85), gastric cardia (HR, 0.78; 95% CI, 0.64-0.95), endometrial (HR, 0.79; 95% CI, 0.68-0.92), myeloid leukemia (HR, 0.80; 95% CI, 0.70-0.92), myeloma (HR, 0.83; 95% CI, 0.72-0.95), colon (HR, 0.84; 95% CI, 0.77-0.91), head and neck (HR, 0.85; 95% CI, 0.78-0.93), rectal (HR, 0.87; 95% CI, 0.80-0.95), bladder (HR, 0.87; 95% CI, 0.82-0.92), and breast (HR, 0.90; 95% CI, 0.87-0.93). Body mass index adjustment modestly attenuated associations for several cancers, but 10 of 13 inverse

  14. A Controlled and Retrospective Study of 144 Chronic Low Back Pain Patients to Evaluate the Effectiveness of an Intensive Functional Restoration Program in France. (United States)

    Caby, Isabelle; Olivier, Nicolas; Janik, Frédérick; Vanvelcenaher, Jacques; Pelayo, Patrick


    A controlled and retrospective study of 144 chronic low back pain patients to evaluate the effectiveness of an intensive functional restoration program in France. Evaluating the efficiency of an intensive, dynamic and multidisciplinary functional restoration program in patients with chronic low back pain (LBP), during 6 and 12 months follow up. Chronic low back pain disease has a multifactor nature, involving physical, psychological professional and social factors. A functional restoration program (FRP) has been included in a multidisciplinary training program which provides an efficient therapeutic solution. However, the effectiveness of an FRP has not been yet established. 144 subjects (71 males, 73 females) with chronic low back pain were included in a functional restoration program. The FRP includes physiotherapy and occupational therapy interventions together with psychological counselling. Patients participated as in- or outpatients 6 h per day, 5 days a week over 5 weeks. Pain intensity, trunk flexibility, trunk strength, lifting ability, quality of life and return to work were recorded before, immediately after, and at 6 months and 12 months after the treatment period. All outcome measures were significantly higher just after the FRP (144 patients) and at 6 and 12 months (from available data in 31 subjects) compared to pre-treatment values. This FRP for chronic low back pain maintained its benefits whatever the patient's activities. The effects reflected on all outcome measures, both on short and long term follow-up. The multidisciplinary FRP for chronic low back pain patients durably stopped the de-conditioning syndrome and involved new life-style habits for the patient, daily pain management and a return to work.

  15. A Controlled and Retrospective Study of 144 Chronic Low Back Pain Patients to Evaluate the Effectiveness of an Intensive Functional Restoration Program in France

    Directory of Open Access Journals (Sweden)

    Isabelle Caby


    Full Text Available Study Design: A controlled and retrospective study of 144 chronic low back pain patients to evaluate the effectiveness of an intensive functional restoration program in France. Objective: Evaluating the efficiency of an intensive, dynamic and multidisciplinary functional restoration program in patients with chronic low back pain (LBP, during 6 and 12 months follow up. Summary of background data: Chronic low back pain disease has a multifactor nature, involving physical, psychological professional and social factors. A functional restoration program (FRP has been included in a multidisciplinary training program which provides an efficient therapeutic solution. However, the effectiveness of an FRP has not been yet established. Methods: 144 subjects (71 males, 73 females with chronic low back pain were included in a functional restoration program. The FRP includes physiotherapy and occupational therapy interventions together with psychological counselling. Patients participated as in- or outpatients 6 h per day, 5 days a week over 5 weeks. Pain intensity, trunk flexibility, trunk strength, lifting ability, quality of life and return to work were recorded before, immediately after, and at 6 months and 12 months after the treatment period. Results: All outcome measures were significantly higher just after the FRP (144 patients and at 6 and 12 months (from available data in 31 subjects compared to pre-treatment values. This FRP for chronic low back pain maintained its benefits whatever the patient’s activities. Conclusions: The effects reflected on all outcome measures, both on short and long term follow-up. The multidisciplinary FRP for chronic low back pain patients durably stopped the de-conditioning syndrome and involved new life-style habits for the patient, daily pain management and a return to work.

  16. Effects of bioisosteric fluorine in synthetic cannabinoid designer drugs JWH-018, AM-2201, UR-144, XLR-11, PB-22, 5F-PB-22, APICA, and STS-135. (United States)

    Banister, Samuel D; Stuart, Jordyn; Kevin, Richard C; Edington, Amelia; Longworth, Mitchell; Wilkinson, Shane M; Beinat, Corinne; Buchanan, Alexandra S; Hibbs, David E; Glass, Michelle; Connor, Mark; McGregor, Iain S; Kassiou, Michael


    Synthetic cannabinoid (SC) designer drugs featuring bioisosteric fluorine substitution are identified by forensic chemists and toxicologists with increasing frequency. Although terminal fluorination of N-pentyl indole SCs is sometimes known to improve cannabinoid type 1 (CB1) receptor binding affinity, little is known of the effects of fluorination on functional activity of SCs. This study explores the in vitro functional activities of SC designer drugs JWH-018, UR-144, PB-22, and APICA, and their respective terminally fluorinated analogues AM-2201, XLR-11, 5F-PB-22, and STS-135 at human CB1 and CB2 receptors using a FLIPR membrane potential assay. All compounds demonstrated agonist activity at CB1 (EC50 = 2.8-1959 nM) and CB2 (EC50 = 6.5-206 nM) receptors, with the fluorinated analogues generally showing increased CB1 receptor potency (∼2-5 times). Additionally, the cannabimimetic activities and relative potencies of JWH-018, AM-2201, UR-144, XLR-11, PB-22, 5F-PB-22, APICA, and STS-135 in vivo were evaluated in rats using biotelemetry. All SCs dose-dependently induced hypothermia and reduced heart rate at doses of 0.3-10 mg/kg. There was no consistent trend for increased potency of fluorinated SCs over the corresponding des-fluoro SCs in vivo. Based on magnitude and duration of hypothermia, the SCs were ranked for potency (PB-22 > 5F-PB-22 = JWH-018 > AM-2201 > APICA = STS-135 = XLR-11 > UR-144).

  17. Determination of the B(E3;0$^+\\!\\rightarrow$ 3$^{-}$) strength in the octupole correlated nucleus $^{144}$Ba using Coulomb excitation

    CERN Multimedia

    We propose to exploit the unique capability of ISOLDE to provide intense post-accelerated $^{144}$Ba ion beams from the REX facility to enable the Coulomb excitation of the first 3$^{-}$ state in this nucleus. By measuring the $\\gamma$-ray yields of the E1 decay connecting the 3$^{-}$ and 2$^{+}$ states using the MINIBALL array, we can obtain the interesting transition matrix element. The result will give quantitative information about octupole correlations in this nucleus. We require 27 shifts to fulfill the aims of the experiment.

  18. Design and Study of a DC/DC Converter for High Power, 14.4 V and 300 A for Automotive Applications


    Julio Cesar Lopes de Oliveira; Carlos Henrique Gonc¸alves Treviso


    The shortage of the automotive market in relation to options for sources of high power car audio systems, led to development of this work. Thus, we developed a source with stabilized voltage with 4320 W effective power. Designed to the voltage of 14.4 V and a choice of two currents: 30 A load option in battery banks and 300 A at full load. This source can also be considered as a source of general use dedicated commercial with a simple control circuit in analog form based ...

  19. Estimation of continental 187Os/186Os values by using 187Os/186Os and 143Nd/144Nd ratios in marine manganese nodules


    Turekian, Karl K.; Luck, Jean-Marc


    The relationship between 187Os/186Os and 143Nd/144Nd in different manganese nodule fields is used to determine the 187Os/186Os ratio of the continental terrains bounding the major ocean basins. The Atlantic Ocean drainages yield 187Os/186Os of about 11; the Pacific Ocean, between 25 and 36; and the western Indian Ocean, 20. By assuming a two-component continental crust composed of “ultramafic rocks” (high Os concentration, low 187Os/186Os) and “granite” with only radiogenic 187Os produced in ...

  20. Remaining Sites Verification Package for the 100-F-31, 144-F Sanitary Sewer System, Waste Site Reclassification Form 2006-033

    Energy Technology Data Exchange (ETDEWEB)

    L. M. Dittmer


    The 100-F-31 waste site is a former septic system that supported the inhalation laboratories, also referred to as the 144-F Particle Exposure Laboratory (132-F-2 waste site), which housed animals exposed to particulate material. The 100-F-31 waste site has been remediated to achieve the remedial action objectives specified in the Remaining Sites ROD. The results of verification sampling show that residual contaminant concentrations do not preclude any future uses and allow for unrestricted use of shallow zone soils. The results also demonstrate that residual contaminant concentrations are protective of groundwater and the Columbia River.

  1. Durability of Stavudine, Lamivudine and Nevirapine among Advanced HIV-1 Infected Patients with/without Prior Co-administration of Rifampicin: A 144-week Prospective Study

    Directory of Open Access Journals (Sweden)

    Prasithisirikul Wisit


    Full Text Available Abstract Background To date, data on the durability of a regimen of stavudine, lamivudine and nevirapine are very limited, particularly from the resource-limited settings. Methods A prospective cohort study was conducted among 140 antiretroviral-naïve patients who were enrolled to initiate d4T, 3TC and NVP between November 2004 and March 2005. The objectives were to determine immunological and virological responses after 144 weeks of antiretroviral therapy. Seventy patients with tuberculosis also received rifampicin during the early period of antiviral treatment (TB group. Results Of all, median (IQR baseline CD4 cell count was 31 (14–79 cells/mm3; median (IQR baseline HIV-1 RNA was 433,500 (169,000–750,000 copies/mL. The average body weight was 55 kilograms. By intention-to-treat analysis at 144 weeks, the overall percentage of patients who achieved plasma HIV-1 RNA P = 0.731. Eight (5.8% patients discontinued d4T due to neuropathy and/or symptomatic lactic acidosis. Conclusion The overall durability and efficacy of antiviral response of d4T, 3TC and NVP are satisfied and they are not different between HIV-1 infected patients with and without co-administration of rifampicin due to tuberculosis. However, stavudine-related adverse effects are concerns. Trial registration Identifier NCT00703898

  2. Response by gender of HIV-1-infected subjects treated with abacavir/lamivudine plus atazanavir, with or without ritonavir, for 144 weeks

    Directory of Open Access Journals (Sweden)

    Squires KE


    Full Text Available Kathleen E Squires,1 Benjamin Young,2,3 Lizette Santiago,4 Robin H Dretler,5 Sharon L Walmsley,6 Henry H Zhao,7 Gary E Pakes,8 Lisa L Ross,8 Mark S Shaefer8 On behalf of the ARIES Study Team 1Thomas Jefferson University, Philadelphia, PA, 2Apex Family Medicine and Research, Denver, CO, 3International Association of Physicians in AIDS Care, Washington DC, USA; 4HOPE Clinic and Wellness Center, San Juan, Puerto Rico; 5ID Specialists of Atlanta, Decatur, GA, USA; 6University Health Network, Toronto, ON, Canada; 7GlaxoSmithKline, 8ViiV Healthcare, Research Triangle Park, NC, USA Purpose: The 144-week results of the open-label, multicenter Atazanavir/Ritonavir Induction with Epzicom Study (ARIES were stratified by gender to compare treatment responses.Methods: A total of 369 HIV-infected, antiretroviral-naïve subjects receiving once-daily abacavir/lamivudine + atazanavir/ritonavir (ATV/r whose HIV-1 RNA was <50 copies/mL by week 30 were randomized 1:1 at week 36 to maintain or discontinue ritonavir for 108 subsequent weeks. Between- and within-treatment gender-related efficacy and safety differences were analyzed.Results: Subjects were 85% male; 64% white; and had a mean age of 39 years, baseline median HIV-1 RNA of 114,815 copies/mL, and median CD4+ cell count of 198 cells/mm3. Gender (ATV [n=189]: 29 females/160 males; ATV/r [n=180]: 25 females/155 males and most other demographics were similar between groups; more females than males were black (65% vs 25% and fewer females had baseline HIV-1 RNA ≥100,000 copies/mL (41% vs 58%. At week 144, no significant differences between genders were observed in proportion maintaining HIV-1 RNA <50 copies/mL (ATV, 79% vs 77%; ATV/r, 60% vs 75% or <400 copies/mL (ATV, 83% vs 84%; ATV/r, 68% vs 82% (intent-to-treat-exposed: time to loss of virologic response analysis; median CD4+ change from baseline (ATV, +365 vs +300 cells/mm3; ATV/r, +344 vs +301 cells/mm3; proportion with treatment-related grade 2–4

  3. CD8 and CD4 epitope predictions in RV144: no strong evidence of a T-cell driven sieve effect in HIV-1 breakthrough sequences from trial participants.

    Directory of Open Access Journals (Sweden)

    Kalpana Dommaraju

    Full Text Available The modest protection afforded by the RV144 vaccine offers an opportunity to evaluate its mechanisms of protection. Differences between HIV-1 breakthrough viruses from vaccine and placebo recipients can be attributed to the RV144 vaccine as this was a randomized and double-blinded trial. CD8 and CD4 T cell epitope repertoires were predicted in HIV-1 proteomes from 110 RV144 participants. Predicted Gag epitope repertoires were smaller in vaccine than in placebo recipients (p = 0.019. After comparing participant-derived epitopes to corresponding epitopes in the RV144 vaccine, the proportion of epitopes that could be matched differed depending on the protein conservation (only 36% of epitopes in Env vs 84-91% in Gag/Pol/Nef for CD8 predicted epitopes or on vaccine insert subtype (55% against CRF01_AE vs 7% against subtype B. To compare predicted epitopes to the vaccine, we analyzed predicted binding affinity and evolutionary distance measurements. Comparisons between the vaccine and placebo arm did not reveal robust evidence for a T cell driven sieve effect, although some differences were noted in Env-V2 (0.022≤p-value≤0.231. The paucity of CD8 T cell responses identified following RV144 vaccination, with no evidence for V2 specificity, considered together both with the association of decreased infection risk in RV 144 participants with V-specific antibody responses and a V2 sieve effect, lead us to hypothesize that this sieve effect was not T cell specific. Overall, our results did not reveal a strong differential impact of vaccine-induced T cell responses among breakthrough infections in RV144 participants.

  4. Search for 14.4 keV solar axions emitted in the M1-transition of $^{57}$Fe nuclei with CAST

    CERN Document Server

    Andriamonje, S; Autiero, D; Barth, K; Belov, A; Beltrán, B; Bräuninger, H; Carmona, J M; Cebrián, S; Collar, J I; Dafni, T; Davenport, M; Di Lella, L; Eleftheriadis, C; Englhauser, J; Fanourakis, G K; Ferrer-Ribas, E; Fischer, H; Franz, J; Friedrich, P; Geralis, T; Giomataris, Yu; Gninenko, S; Gómez, H; Hasinoff, M; Heinsius, F H; Hoffmann, D H H; Irastorza, I G; Jacoby, J; Jakovčić, K; Kang, D; Königsmann, K C; Kotthaus, R; Krčmar, M; Kousouris, K; Kuster, M; Lakić, B; Lasseur, C; Liolios, A; Ljubičić, A; Lutz, G; Luzón, G; Miller, D; Morales, J; Ortiz, A; Papaevangelou, T; Placci, A; Raffelt, G; Riege, H; Rodríguez, A; Ruz, J; Savvidis, I; Semertzidis, Y; Serpico, P; Stewart, L; Vieira, J; Villar, J; Vogel, J; Walckiers, L; Zioutas, K


    We have searched for 14.4 keV solar axions or more general axion-like particles (ALPs), that may be emitted in the M1 nuclear transition of 57Fe, by using the axion-to-photon conversion in the CERN Axion Solar Telescope (CAST) with evacuated magnet bores (Phase I). From the absence of excess of the monoenergetic X-rays when the magnet was pointing to the Sun, we set model-independent constraints on the coupling constants of pseudoscalar particles that couple to two photons and to a nucleon g_{a\\gamma} |-1.19 g_{aN}^{0}+g_{aN}^{3}|<1.36\\times 10^{-16} GeV^{-1} for m_{a}<0.03 eV at the 95% confidence level.

  5. Search for 14.4-KeV Solar Axions Emitted in the M1-Transition of Fe-57 Nuclei with CAST

    Energy Technology Data Exchange (ETDEWEB)

    Andriamonje, S.; Aune, S.; /DAPNIA, Saclay; Autiero, D.; /CERN /Lyon, IPN; Barth, K.; /CERN; Belov, A.; /Moscow, INR; Beltran, B.; /Zaragoza U. /Queen' s U., Kingston; Brauninger, H.; /Garching, Max Planck Inst., MPE; Carmona, J.M.; Cebrian, S.; /Zaragoza U.; Collar, J.I.; /Chicago U., EFI /Chicago U., KICP; Dafni, T.; /DAPNIA, Saclay /Darmstadt, Tech. Hochsch. /Zaragoza U.; Davenport, M.; /CERN; Di Lella, L.; /CERN /Pisa, Scuola Normale Superiore; Eleftheriadis, C.; /Aristotle U., Thessaloniki; Englhauser, J.; /Garching, Max Planck Inst., MPE; Fanourakis, G.; /Democritos Nucl. Res. Ctr.; Ferrer-Ribas, E.; /DAPNIA, Saclay; Fischer, H.; Franz, J.; /Freiburg U.; Friedrich, P.; /Garching, Max Planck Inst., MPE; Geralis, T.; /Democritos Nucl. Res. Ctr. /DAPNIA, Saclay /Moscow, INR /Zaragoza U. /British Columbia U. /Freiburg U. /Darmstadt, Tech. Hochsch. /DAPNIA, Saclay /Zaragoza U. /Frankfurt U. /Boskovic Inst., Zagreb /Freiburg U. /Munich, Max Planck Inst. /Boskovic Inst., Zagreb /Democritos Nucl. Res. Ctr. /Darmstadt, Tech. Hochsch. /Garching, Max Planck Inst., MPE /Boskovic Inst., Zagreb /CERN /Aristotle U., Thessaloniki /Boskovic Inst., Zagreb /Munich, Max Planck Inst. /Zaragoza U. /Chicago U., EFI /Chicago U., KICP /Stanford U., Phys. Dept. /SLAC /Zaragoza U. /CERN /DAPNIA, Saclay /CERN /Munich, Max Planck Inst. /Darmstadt, Tech. Hochsch. /Zaragoza U. /Aristotle U., Thessaloniki /Patras U. /Brookhaven /CERN /Munich, Max Planck Inst. /CERN /Chicago U., EFI /Chicago U., KICP /Zaragoza U. /Freiburg U. /CERN /CERN /Patras U.


    We have searched for 14.4 keV solar axions or more general axion-like particles (ALPs), that may be emitted in the M1 nuclear transition of 57Fe, by using the axion-to-photon conversion in the CERN Axion Solar Telescope (CAST) with evacuated magnet bores (Phase I). From the absence of excess of the monoenergetic X-rays when the magnet was pointing to the Sun, we set model-independent constraints on the coupling constants of pseudoscalar particles that couple to two photons and to a nucleon g{sub ay}|-1.19g{sub aN}{sup 0}+g{sub aN}{sup 3}| < 1.36 x 10{sup -16} GeV{sup -1} for ma < 0.03 eV at the 95% confidence level.

  6. STEM Electron Diffraction and High Resolution Images Used in the Determination of the Crystal Structure of Au144(SR)60Cluster. (United States)

    Bahena, Daniel; Bhattarai, Nabraj; Santiago, Ulises; Tlahuice, Alfredo; Ponce, Arturo; Bach, Stephan B H; Yoon, Bokwon; Whetten, Robert L; Landman, Uzi; Jose-Yacaman, Miguel


    Determination of the total structure of molecular nanocrystals is an outstanding experimental challenge that has been met, in only a few cases, by single-crystal X-ray diffraction. Described here is an alternative approach that is of most general applicability and does not require the fabrication of a single crystal. The method is based on rapid, time-resolved nanobeam electron diffraction (NBD) combined with high-angle annular dark field scanning/transmission electron microscopy (HAADF-STEM) images in a probe corrected STEM microscope, operated at reduced voltages. The results are compared with theoretical simulations of images and diffraction patterns obtained from atomistic structural models derived through first-principles density functional theory (DFT) calculations. The method is demonstrated by application to determination of the structure of the Au 144 (SCH 2 CH 2 Ph) 60 cluster.

  7. Estimation of continental 187Os/186Os values by using 187Os/186Os and 143Nd/144Nd ratios in marine manganese nodules (United States)

    Turekian, Karl K.; Luck, Jean-Marc


    The relationship between 187Os/186Os and 143Nd/144Nd in different manganese nodule fields is used to determine the 187Os/186Os ratio of the continental terrains bounding the major ocean basins. The Atlantic Ocean drainages yield 187Os/186Os of about 11; the Pacific Ocean, between 25 and 36; and the western Indian Ocean, 20. By assuming a two-component continental crust composed of “ultramafic rocks” (high Os concentration, low 187Os/186Os) and “granite” with only radiogenic 187Os produced in accessory Re-bearing molybdenite, the ultramafic contribution to weathering is about 0.2%. Some or most of this may come from the alteration of oceanic ultramafics. PMID:16578780

  8. Spectroscopic analysis of lithium terbium tetrafluoride

    DEFF Research Database (Denmark)

    Christensen, H.P.


    . The rare-earth site in LiTbF4 possesses S4 symmetry, which allows six crystal-field parameters. ζ and the six Bim were varied to obtain the best agreement with the experimentally observed levels. Keeping F2=434 cm-1 fixed, a fit with a standard deviation of 12 cm-1 was obtained at 10 K with the following...... were calculated by diagonalizing an effective spin-orbit and crystal-field Hamiltonian in an LS basis. H=Σλi(L→·S→)i+ΣαiΣBimOim, where the parameters λi are functions of the spin-orbit parameter ζ and the Slater parameter F2. The Oim and αi are Racah operators and reduced matrix elements, respectively...

  9. Inelastic critical scattering of neutrons from terbium

    DEFF Research Database (Denmark)

    Als-Nielsen, Jens Aage; Dietrich, O.W.; Marshall, W.


    We have measured the inelasticity of the critical neutron scattering in Tb above the Néel temperature. The results show that dynamical slowing down of fluctuations does occur at a second order phase transition.......We have measured the inelasticity of the critical neutron scattering in Tb above the Néel temperature. The results show that dynamical slowing down of fluctuations does occur at a second order phase transition....

  10. Hidden Components in Aqueous "Gold-144" Fractionated by PAGE: High-Resolution Orbitrap ESI-MS Identifies the Gold-102 and Higher All-Aromatic Au-pMBA Cluster Compounds. (United States)

    Alvarez, Marcos M; Chen, Jenny; Plascencia-Villa, Germán; Black, David M; Griffith, Wendell P; Garzón, Ignacio L; José-Yacamán, Miguel; Demeler, Borries; Whetten, Robert L


    Experimental and theoretical evidence reveals the resilience and stability of the larger aqueous gold clusters protected with p-mercaptobenzoic acid ligands (pMBA) of composition Aun(pMBA)p or (n, p). The Au144(pMBA)60, (144, 60), or gold-144 aqueous gold cluster is considered special because of its high symmetry, abundance, and icosahedral structure as well as its many potential uses in material and biological sciences. Yet, to this date, direct confirmation of its precise composition and total structure remains elusive. Results presented here from characterization via high-resolution electrospray ionization mass spectrometry on an Orbitrap instrument confirm Au102(pMBA)44 at isotopic resolution. Further, what usually appears as a single band for (144, 60) in electrophoresis (PAGE) is shown to also contain the (130, 50), recently determined to have a truncated-decahedral structure, and a (137, 56) component in addition to the dominant (144, 60) compound of chiral-icosahedral structure. This finding is significant in that it reveals the existence of structures never before observed in all-aromatic water-soluble species while pointing out the path toward elucidation of the thermodynamic control of protected gold nanocrystal formation.

  11. 144__Olukosi_drinking wate

    African Journals Online (AJOL)


    Oxygen Demand (BOD5), Dissolved oxygen, Total Dissolved Solids (TDS), Nitrate, Electrical conductivity and pH using standard methods. The values for conductivity (441.57 ±. 107.13µhos/cm) and TDS (220.78 ± 53.56mg/l) were significantly higher for the borehole water samples (P<0.05), while the pH (7.27 ± 0.11) and ...

  12. 144 | P a g e

    African Journals Online (AJOL)

    Fr. Ikenga

    type is materialism. In its essential tenets, it holds that matter is the one and only kind of being - the primary substance and that the universe is a material world and all objects of experience are composed of matter.1 In its most ..... With the crisis of the concept of God, the galaxy of the ethical and spiritual values attendant to ...

  13. Hb San Cataldo [β144(HC1)Lys→Thr; HBB: C.434A > C]: A New Hemoglobin Variant with Increased Affinity for Oxygen. (United States)

    Vinciguerra, Margherita; Passarello, Cristina; Cassarà, Filippo; Leto, Filippo; Cannata, Monica; Crivello, Anna; Di Salvo, Veronica; Maggio, Aurelio; Giambona, Antonino


    A 59-year-old Italian woman came to our center for revaluation of a previous diagnosis of polycythemia vera. The patient presented with a lifelong history of polycythemia, no increase in white blood cells (WBCs) and platelets, and a negative bone marrow biopsy. Analysis of hemoglobin (Hb) fractions showed an abnormal fast moving Hb component. We aimed to determine if this variant was the cause of polycythemia in this patient. A complete blood count (CBC) was performed by an automated cell counter and Hb fractions were determined by high performance liquid chromatography (HPLC). Standard stability tests and oxygen affinity evaluation were also performed. Genomic DNA was extracted from peripheral blood leukocytes using the phenol chloroform method and the entire β-globin gene was analyzed by direct sequencing. At the hematological level, no anemia or hemolysis was observed but an abnormal Hb fraction was detected using cation exchange HPLC. Molecular analysis of the β-globin gene showed heterozygosity for an AAG > ACG substitution at codon 144, resulting in a Lys→Thr amino acid replacement. We demonstrated that this is a new Hb variant with increased oxygen affinity. Its altered physiology is caused by the reduction of 2,3-diphosphoglycerate (2,3-DPG) effects, due to an amino acid substitution in the central pocket near the C-terminal of the β chain. We called this new variant Hb San Cataldo for the native city of proband.

  14. Excitation energy dependence of fragment-mass distributions from fission of 180,190Hg formed in fusion reactions of 36Ar + 144,154Sm

    Directory of Open Access Journals (Sweden)

    K. Nishio


    Full Text Available Mass distributions of fission fragments from the compound nuclei 180Hg and 190Hg formed in fusion reactions 36Ar + 144Sm and 36Ar + 154Sm, respectively, were measured at initial excitation energies of E⁎(Hg180=33–66 MeV and E⁎(Hg190=48–71 MeV. In the fission of 180Hg, the mass spectra were well reproduced by assuming only an asymmetric-mass division, with most probable light and heavy fragment masses A¯L/A¯H=79/101. The mass asymmetry for 180Hg agrees well with that obtained in the low-energy β+/EC-delayed fission of 180Tl, from our earlier ISOLDE(CERN experiment. Fission of 190Hg is found to proceed in a similar way, delivering the mass asymmetry of A¯L/A¯H=83/107, throughout the measured excitation energy range. The persistence as a function of excitation energy of the mass-asymmetric fission for both proton-rich Hg isotopes gives strong evidence for the survival of microscopic effects up to effective excitation energies of compound nuclei as high as 40 MeV. This behavior is different from fission of actinide nuclei and heavier mercury isotope 198Hg.

  15. CDCC calculations of elastic scattering for the systems 6Li+144Sm and 6Li+208Pb. Effect of resonances of 6Li on elastic scattering angular distributions (United States)

    Gómez Camacho, A.


    Calculations of elastic scattering angular distributions for reactions of the weakly bound projectile 6Li with targets 144Sm and 208Pb at energies above the barrier, are performed with the Continuum Discretized Coupled-Channel method (CDCC). Ground, resonant and nonresonant continuum states of 6Li are included up to some maximum energy epsilonmax for which convergence is achieved. In the three-body system, global interactions are used for the α-target and d - target sub-systems. The effect of continuum resonant states of 6Li, i.e., l = 2, jπ = 3+, 2+ and 1+ on elastic scattering angular distributions is investigated by extracting these states from the continuum space. It is found that the calculated elastic scattering angular distributions are in good agreement with the measurements for most of the cases studied where consideration of couplings to continuum states is essential. It is also found that the resonance character of the continuum states is in some cases important to obtain agreement with the data.

  16. Collision-induced dissociation of monolayer protected clusters Au144 and Au130 in an electrospray time-of-flight mass spectrometer. (United States)

    Black, David M; Bhattarai, Nabraj; Whetten, Robert L; Bach, Stephan B H


    Gas-phase reactions of larger gold clusters are poorly known because generation of the intact parent species for mass spectrometric analysis remains quite challenging. Herein we report in-source collision-induced dissociation (CID) results for the monolayer protected clusters (MPCs) Au144(SR)60 and Au130(SR)50, where R- = PhCH2CH2-, in a Bruker micrOTOF time-of-flight mass spectrometer. A sample mixture of the two clusters was introduced into the mass spectrometer by positive mode electrospray ionization. Standard source conditions were used to acquire a reference mass spectrum, exhibiting negligible fragmentation, and then the capillary-skimmer potential difference was increased to induce in-source CID within this low-pressure region (∼4 mbar). Remarkably, distinctive fragmentation patterns are observed for each MPC[3+] parent ion. An assignment of all the major dissociation products (ions and neutrals) is deduced and interpreted by using the distinguishing characteristics in the standard structure-models for the respective MPCs. Also, we propose a ring-forming elimination mechanism to explain R-H neutral loss, as separate from the channels leading to RS-SR or (AuSR)4 neutrals.

  17. Site directed mutagenesis experiments suggest that Glu 111, Glu 144 and Arg 145 are essential for endonucleolytic activity of EcoRI. (United States)

    Wolfes, H; Alves, J; Fliess, A; Geiger, R; Pingoud, A


    We have constructed a plasmid (pRIF 309+) carrying the EcoRI restriction endonuclease gene and the f1 origin of replication. Upon transformation of this plasmid into E. coli and infection with bacteriophage f1 single stranded plasmids are produced which can be used for sequencing and site directed mutagenesis. Using this single stranded DNA and synthetic oligodeoxynucleotides we have introduced point mutations at defined positions of the EcoRI gene. Since in pRIF309+ the EcoRI gene is under the control of the pL-promoter, high level expression of the mutated EcoRI gene could be obtained upon induction. Mutant EcoRI enzymes were purified to homogeneity and characterized in structural and functional terms. Our results demonstrate that the Glu 111----Gln, Glu 144----Gln and Arg 145----Lys -mutants adopt a very similar conformation as the wild type enzyme, but have by two orders of magnitude smaller specific activities than the wild type enzyme, mainly due to a reduction of the Vmax-value.

  18. 1 λ × 1.44 Tb/s free-space IM-DD transmission employing OAM multiplexing and PDM. (United States)

    Zhu, Yixiao; Zou, Kaiheng; Zheng, Zhennan; Zhang, Fan


    We report the experimental demonstration of single wavelength terabit free-space intensity modulation direct detection (IM-DD) system employing both orbital angular momentum (OAM) multiplexing and polarization division multiplexing (PDM). In our experiment, 12 OAM modes with two orthogonal polarization states are used to generate 24 channels for transmission. Each channel carries 30 Gbaud Nyquist PAM-4 signal. Therefore an aggregate gross capacity record of 1.44 Tb/s (12 × 2 × 30 × 2 Gb/s) is acheived with a modulation efficiency of 48 bits/symbol. After 0.8m free-space transmission, the bit error rates (BERs) of all the channels are below the 20% hard-decision forward error correction (HD-FEC) threshold of 1.5 × 10(-2). After applying the decision directed recursive least square (DD-RLS) based filter and post filter, the BERs of two polarizations can be reduced from 5.3 × 10(-3) and 7.3 × 10(-3) to 2.2 × 10(-3) and 3.4 × 10(-3), respectively.

  19. Efficacy and safety of a once-daily single-tablet regimen of tenofovir, lamivudine, and efavirenz assessed at 144 weeks among antiretroviral-naive and experienced HIV-1-infected Thai adults

    NARCIS (Netherlands)

    Avihingsanon, A.; Maek, A.N.W.; Gatechompol, S.; Sapsirisavat, V.; Thiansanguankul, W.; Sophonphan, J.; Thammajaruk, N.; Ubolyam, S.; Burger, D.M.; Ruxrungtham, K.


    OBJECTIVE: To assess the efficacy and safety of a new single-tablet regimen (STR) of tenofovir disoproxil fumarate (TDF) 300mg, lamivudine (3TC) 300mg, and efavirenz (EFV) 600mg in HIV-infected Thai patients. METHODS: This was a prospective study performed for 144 weeks among 51 treatment-naive

  20. Construction of All-Solid-State Batteries based on a Sulfur-Graphene Composite and Li9.54 Si1.74 P1.44 S11.7 Cl0.3 Solid Electrolyte. (United States)

    Xu, Ruochen; Wu, Zhang; Zhang, Shenzhao; Wang, Xiuli; Xia, Yan; Xia, Xinhui; Huang, Xiaohua; Tu, Jiangping


    Herein an effective way for construction of all-solid-state lithium-sulfur batteries (LSBs) with sulfur/reduced graphene oxide (rGO) and Li9.54 Si1.74 P1.44 S11.7 Cl0.3 solid electrolyte is reported. In the composite cathode, the Li9.54 Si1.74 P1.44 S11.7 Cl0.3 powder is homogeneously mixed with the S/rGO composite to enhance the ionic conductivity. Coupled with a metallic Li anode and solid electrolyte, the designed S/rGO-Li9.54 Si1.74 P1.44 S11.7 Cl0.3 composite cathode exhibits a high specific capacity and good cycling stability. A high initial discharge capacity of 969 mAh g(-1) is achieved at a current density of 80 mA g(-1) at room temperature and the cell retains a reversible capacity of over 827 mAh g(-1) after 60 cycles. The enhanced performance is attributed to the intimate contact between the S/rGO and Li9.54 Si1.74 P1.44 S11.7 Cl0.3 electrolyte, and high electrical conductivity of rGO and high ionic conductivity of the solid electrolyte. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. A Brief Review of Past INL Work Assessing Radionuclide Content in TMI-2 Melted Fuel Debris: The Use of 144Ce as a Surrogate for Pu Accountancy

    Energy Technology Data Exchange (ETDEWEB)

    D. L. Chichester; S. J. Thompson


    This report serves as a literature review of prior work performed at Idaho National Laboratory, and its predecessor organizations Idaho National Engineering Laboratory (INEL) and Idaho National Engineering and Environmental Laboratory (INEEL), studying radionuclide partitioning within the melted fuel debris of the reactor of the Three Mile Island 2 (TMI-2) nuclear power plant. The purpose of this review is to document prior published work that provides supporting evidence of the utility of using 144Ce as a surrogate for plutonium within melted fuel debris. When the TMI-2 accident occurred no quantitative nondestructive analysis (NDA) techniques existed that could assay plutonium in the unconventional wastes from the reactor. However, unpublished work performed at INL by D. W. Akers in the late 1980s through the 1990s demonstrated that passive gamma-ray spectrometry of 144Ce could potentially be used to develop a semi-quantitative correlation for estimating plutonium content in these materials. The fate and transport of radioisotopes in fuel from different regions of the core, including uranium, fission products, and actinides, appear to be well characterized based on the maximum temperature reached by fuel in different parts of the core and the melting point, boiling point, and volatility of those radioisotopes. Also, the chemical interactions between fuel, fuel cladding, control elements, and core structural components appears to have played a large role in determining when and how fuel relocation occurred in the core; perhaps the most important of these reaction appears to be related to the formation of mixed-material alloys, eutectics, in the fuel cladding. Because of its high melting point, low volatility, and similar chemical behavior to plutonium, the element cerium appears to have behaved similarly to plutonium during the evolution of the TMI-2 accident. Anecdotal evidence extrapolated from open-source literature strengthens this logical feasibility for

  2. Categorizing renal oncocytic neoplasms on core needle biopsy: a morphologic and immunophenotypic study of 144 cases with clinical follow-up. (United States)

    Alderman, Megan A; Daignault, Stephanie; Wolf, J Stuart; Palapattu, Ganesh S; Weizer, Alon Z; Hafez, Khaled S; Kunju, Lakshmi P; Wu, Angela J


    There is limited literature on renal oncocytic neoplasms diagnosed on core biopsy. All renal oncocytic neoplasm core biopsies from 2006 to 2013 were retrospectively reviewed. Morphologic features and an immunohistochemical panel of CK7, c-KIT, and S100A1 were assessed. Concordance with resection diagnosis, statistical analysis including a random forest classification, and follow-up were recorded. The post-immunohistochemical diagnoses of 144 renal oncocytic core biopsies were favor oncocytoma (67%), favor renal cell carcinoma (RCC) (12%), and cannot exclude RCC (21%). Diagnosis was revised following immunohistochemistry in 7% of cases. The most common features for oncocytoma (excluding dense granular cytoplasm) were nested architecture, edematous stroma, binucleation and tubular architecture; the most common features for favor RCC were sheet-like architecture, nuclear pleomorphism, papillary architecture, and prominent cell borders. High nuclear grade, necrosis, extensive papillary architecture, raisinoid nuclei, and frequent mitoses were not seen in oncocytomas. Comparing the pathologist and random forest classification, the overall out-of-bag estimate of classification error dropped from 23% to 13% when favor RCC and cannot exclude RCC were combined into 1 category. Resection was performed in 19% (28 cases) with a 94% concordance (100% of favor RCC biopsies and 90% of cannot exclude RCC biopsies confirmed as RCC; 83% of favor oncocytomas confirmed); ablation in 23%; and surveillance in 46%. Follow-up was available in 92% (median follow-up, 33months) with no adverse outcomes. Renal oncocytic neoplasms comprise a significant subset (16%) of all core biopsies, and the majority (78%) can be classified as favor oncocytoma or favor RCC. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. Regulation of plasma factor XIII levels in healthy individuals; a major impact by subunit B intron K c.1952+144 C>G polymorphism. (United States)

    Mezei, Zoltán A; Katona, Éva; Kállai, Judit; Bereczky, Zsuzsanna; Molnár, Éva; Kovács, Bettina; Ajzner, Éva; Bagoly, Zsuzsa; Miklós, Tünde; Muszbek, László


    The regulation of plasma factor XIII (FXIII) levels in healthy individuals has been only partially explored. The identification of major non-genetic and genetic regulatory factors might provide important information on the contribution of FXIII to the risk of cardio/cerebrovascular diseases. To determine the effect of age, smoking, BMI, fibrinogen concentration on plasma FXIII activity, complex FXIII antigen (FXIII-A2B2) and total FXIII-B subunit (tFXIII-B) level, to correlate FXIII-B level with the other two FXIII parameters and to assess the variation of FXIII levels in carriers of major FXIII subunit polymorphisms. 268 healthy individuals were enrolled in the study. FXIII activity was measured by the ammonia release assay; FXIII-A2B2 and tFXIII-B were determined by ELISAs. FXIII-A p.Val34Leu, FXIII-B p.His95Arg and FXIII-B intron K c.1952+144 C>G polymorphisms were identified by RT-PCR using melting point analysis with fluorescence resonance energy transfer detection. All investigated FXIII parameters showed significant positive correlation with age and fibrinogen level; gender and BMI influenced only tFXIII-B. A highly significant positive correlation was demonstrated between tFXIII-B and the other FXIII parameters. FXIII-A p.Val34Leu polymorphism had only slight, if any effect on FXIII levels. The FXIII-B Arg95 allele moderately increased all three FXIII parameters, but the effect became statistically significant only after adjustment. The FXIII-B intron K G allele drastically decreased FXIII levels, and it seemed to be in synergism with the FXIII-A Leu34 allele. Plasma FXIII levels are subjected to multifactorial regulation, in which age, fibrinogen level and FXIII-B intron K polymorphism are major determinants. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. Neutron fluence and energy reconstruction with the IRSN recoil detector μ-TPC at 27 keV, 144 keV and 565 keV

    Energy Technology Data Exchange (ETDEWEB)

    Maire, D.; Lebreton, L.; Richer, J.P. [IRSN, PRP-HOM, SDE, LMDN, 13115 Saint Paul-Lez-Durance (France); Bosson, G.; Bourrion, O.; Guillaudin, O.; Riffard, Q.; Santos, D. [CNRS/IN2P3-UJF-INPG, LPSC, 38000 Grenoble (France)


    The French Institute for Radioprotection and Nuclear Safety (IRSN), associated to the French Metrology Institute (LNE), is developing a time projection chamber using a Micromegas anode: μ-TPC. This work is carried out in collaboration with the Laboratory of Subatomic Physics and Cosmology (LPSC). The aim is to characterize with a primary procedure the energy distribution of neutron fluence in the energy range 8 keV - 1 MeV. The time projection chambers are gaseous detectors, which are able to measure charged particles energy and to reconstruct their track if a pixelated anode is used. In our case, the gas is used as a (n, p) converter in order to detect neutrons down to few keV. Coming from elastic collisions with neutrons, recoil protons lose a part of their kinetic energy by ionizing the gas. The ionization electrons are drifted toward a pixelated anode (2D projection), read at 50 MHz by a self-triggered electronic system to obtain the third track dimension. The neutron energy is reconstructed event by event thanks to proton scattering angle and proton energy measurements. The scattering angle is deduced from the 3D track. The proton energy is obtained by charge collection measurements, knowing the ionization quenching factor (i.e. the part of proton kinetic energy lost by ionizing the gas). The fluence is calculated thanks to the detected events number and the simulated detector response. The μ-TPC is a new reliable detector which enables to measure energy distribution of the neutron fluence without deconvolution or neutron calibration contrary to usual gaseous counters. The μ-TPC is still being developed and measurements have been carried out at the AMANDE facility, with neutrons energies going from 8 keV to 565 keV. After the context and the μ-TPC working principle presentation, measurements of the neutron energy and fluence at 27.2 keV, 144 keV and 565 keV are shown and compared to the complete detector simulation. This work shows the first direct

  5. 87Sr/86Sr and 143Nd/144Nd for disentangling anthropogenic and natural REE contributions in river water during flood events. (United States)

    Hissler, Christophe; Stille, Peter; Pfister, Laurent


    The sustainable management of water resources is one of the greatest challenges of the 21st century. Water is a vital resource that is increasingly put under pressure from multiple perspectives. While the global population is on the rise, socio-economic development makes equally rapid progress - eventually compromising access to clean water bodies. Multiple pollution sources constitute an immediate threat to aquatic ecosystems and are likely to cause long lasting contaminations of water bodies that are critical for drinking and/or irrigation water production. There is a pressing need for an adequate quantification of anthropogenic impacts on the critical zone of river basins and the identification of the temporal dynamics of these impacts. As an example, despite the work done to assess the environmental impact of REE pollutions in larger river systems, we are still lacking information on the dynamics of these anthropogenic compounds in relation to rapid hydrological changes. Filling these knowledge gaps is a pre-requisite for the design and implementation of sustainable water resources management strategies. In order to better constrain the relative contributions of both anthropogenic and geogenic trace element sources we propose using a multitracer approach combining elemental and 87Sr/86Sr, 143Nd/144Nd, and 206Pb/207Pb isotopic ratios. The use of these three separate isotopic systems together with REE concentrations is new in the field of anthropogenic source identification in river systems. We observed enrichments in Anthropogenic Rare Earth Elements (AREE) for dissolved Gd and suspended Nd loads of river water. With increasing discharge, AREE anomalies progressively disappeared and gave way to the geogenic chemical signature of the basin in both dissolved and suspended loads. The isotopic data confirm these observations and shed new light on the trace elements sources. On the one hand, dissolved loads have peculiar isotopic characteristics and carry mainly

  6. Profiling of Greenhouse Gases from Space by Infrared-Laser Occultation and Demonstration by a 144 km Crosslink Experiment at the Canary Islands (United States)

    Kirchengast, G.; Schweitzer, S.; Proschek, V.; Bernath, P.; Thomas, B.; Wang, J.; Brooke, J.; Tereszchuk, K.; Gonzalez Abad, G.; Hargreaves, R.; Beale, C. A.; Martin, P.; Kasiutsich, V.; Gerbig, C.; Kolle, O.; Loescher, A.


    Low Earth Orbit (LEO) transmitter and receiver satellites provide the basis for LEO-LEO microwave and infrared-laser occultation (LMIO), a new active limb sounding method for climate benchmark profiling of greenhouse gases (GHGs), thermodynamic variables and wind in the free atmosphere (Kirchengast and Schweitzer, GRL, 38, L13701, 2011). The LEO-LEO infrared-laser occultation (LIO) part of LMIO can provide accurate profiles of all main GHGs, including CO2, CH4, N2O, H2O, O3, and isotopes 13CO2 and 18OCO, by exploiting differential absorption between carefully selected absorption ("on-line") and reference ("off-line") laser signals targeting suitable GHG absorption lines within 2 to 2.5 μm. This spectral range resides in the "hole" between the shortwave-solar and longwave-terrestrial Planck spectra so that natural background radiation is minimal to negligible. We present the fundamentals and discuss the estimated performance of LMIO-based GHG profiling, including from quasi-realistic end-to-end performance simulations considering also aerosols and clouds. We found monthly-mean GHG profiles, assuming 30 to 40 native profiles averaged per climatological "grid cell" per month, accurate to LIO sounding along a ~144 km link at ~2.4 km altitude between observatories at the islands of La Palma and Tenerife being part of the Canary Islands (ESA-funded experiment project by Bernath et al.; Univ. York, Univ. Graz, Univ. Manchester, MPI Jena). With transmitter and receiver breadboard equipment built for four infrared-laser signals we aimed in this campaign at CO2, CH4, and H2O measurements under field conditions somewhat akin to a LIO space-based link. Despite of the practical challenges of such long-range observations, especially related to the needed fine adjustments of laser beam pointing under windy high-altitude conditions, we achieved first good data for retrieving these GHGs so that the basic demonstration of the experimental feasibility of LIO was successful. We will

  7. Predicting live birth, preterm delivery, and low birth weight in infants born from in vitro fertilisation: a prospective study of 144,018 treatment cycles.

    Directory of Open Access Journals (Sweden)

    Scott M Nelson


    Full Text Available The extent to which baseline couple characteristics affect the probability of live birth and adverse perinatal outcomes after assisted conception is unknown.We utilised the Human Fertilisation and Embryology Authority database to examine the predictors of live birth in all in vitro fertilisation (IVF cycles undertaken in the UK between 2003 and 2007 (n = 144,018. We examined the potential clinical utility of a validated model that pre-dated the introduction of intracytoplasmic sperm injection (ICSI as compared to a novel model. For those treatment cycles that resulted in a live singleton birth (n = 24,226, we determined the associates of potential risk factors with preterm birth, low birth weight, and macrosomia. The overall rate of at least one live birth was 23.4 per 100 cycles (95% confidence interval [CI] 23.2-23.7. In multivariable models the odds of at least one live birth decreased with increasing maternal age, increasing duration of infertility, a greater number of previously unsuccessful IVF treatments, use of own oocytes, necessity for a second or third treatment cycle, or if it was not unexplained infertility. The association of own versus donor oocyte with reduced odds of live birth strengthened with increasing age of the mother. A previous IVF live birth increased the odds of future success (OR 1.58, 95% CI 1.46-1.71 more than that of a previous spontaneous live birth (OR 1.19, 95% CI 0.99-1.24; p-value for difference in estimate <0.001. Use of ICSI increased the odds of live birth, and male causes of infertility were associated with reduced odds of live birth only in couples who had not received ICSI. Prediction of live birth was feasible with moderate discrimination and excellent calibration; calibration was markedly improved in the novel compared to the established model. Preterm birth and low birth weight were increased if oocyte donation was required and ICSI was not used. Risk of macrosomia increased with advancing

  8. Enhancement of solubility in Escherichia coli and purification of an aminotransferase from Sphingopyxis sp. MTA144 for deamination of hydrolyzed fumonisin B1

    Directory of Open Access Journals (Sweden)

    Hartinger Doris


    Full Text Available Abstract Background Fumonisin B1 is a cancerogenic mycotoxin produced by Fusarium verticillioides and other fungi. Sphingopyxis sp. MTA144 can degrade fumonisin B1, and a key enzyme in the catabolic pathway is an aminotransferase which removes the C2-amino group from hydrolyzed fumonisin B1. In order to study this aminotransferase with respect to a possible future application in enzymatic fumonisin detoxification, we attempted expression of the corresponding fumI gene in E. coli and purification of the enzyme. Since the aminotransferase initially accumulated in inclusion bodies, we compared the effects of induction level, host strain, expression temperature, solubility enhancers and a fusion partner on enzyme solubility and activity. Results When expressed from a T7 promoter at 30°C, the aminotransferase accumulated invariably in inclusion bodies in DE3 lysogens of the E. coli strains BL21, HMS174, Rosetta 2, Origami 2, or Rosetta-gami. Omission of the isopropyl-beta-D-thiogalactopyranoside (IPTG used for induction caused a reduction of expression level, but no enhancement of solubility. Likewise, protein production but not solubility correlated with the IPTG concentration in E. coli Tuner(DE3. Addition of the solubility enhancers betaine and sorbitol or the co-enzyme pyridoxal phosphate showed no effect. Maltose-binding protein, used as an N-terminal fusion partner, promoted solubility at 30°C or less, but not at 37°C. Low enzyme activity and subsequent aggregation in the course of purification and cleavage indicated that the soluble fusion protein contained incorrectly folded aminotransferase. Expression in E. coli ArcticExpress(DE3, which co-expresses two cold-adapted chaperonins, at 11°C finally resulted in production of appreciable amounts of active enzyme. Since His tag-mediated affinity purification from this strain was hindered by co-elution of chaperonin, two steps of chromatography with optimized imidazole concentration in the

  9. Predicting Live Birth, Preterm Delivery, and Low Birth Weight in Infants Born from In Vitro Fertilisation: A Prospective Study of 144,018 Treatment Cycles (United States)

    Nelson, Scott M.; Lawlor, Debbie A.


    Background The extent to which baseline couple characteristics affect the probability of live birth and adverse perinatal outcomes after assisted conception is unknown. Methods and Findings We utilised the Human Fertilisation and Embryology Authority database to examine the predictors of live birth in all in vitro fertilisation (IVF) cycles undertaken in the UK between 2003 and 2007 (n = 144,018). We examined the potential clinical utility of a validated model that pre-dated the introduction of intracytoplasmic sperm injection (ICSI) as compared to a novel model. For those treatment cycles that resulted in a live singleton birth (n = 24,226), we determined the associates of potential risk factors with preterm birth, low birth weight, and macrosomia. The overall rate of at least one live birth was 23.4 per 100 cycles (95% confidence interval [CI] 23.2–23.7). In multivariable models the odds of at least one live birth decreased with increasing maternal age, increasing duration of infertility, a greater number of previously unsuccessful IVF treatments, use of own oocytes, necessity for a second or third treatment cycle, or if it was not unexplained infertility. The association of own versus donor oocyte with reduced odds of live birth strengthened with increasing age of the mother. A previous IVF live birth increased the odds of future success (OR 1.58, 95% CI 1.46–1.71) more than that of a previous spontaneous live birth (OR 1.19, 95% CI 0.99–1.24); p-value for difference in estimate <0.001. Use of ICSI increased the odds of live birth, and male causes of infertility were associated with reduced odds of live birth only in couples who had not received ICSI. Prediction of live birth was feasible with moderate discrimination and excellent calibration; calibration was markedly improved in the novel compared to the established model. Preterm birth and low birth weight were increased if oocyte donation was required and ICSI was not used. Risk of macrosomia

  10. Combination of Hb Heze [β144(HC1)Lys→Arg; HBB: c.434A>G] and β0-Thalassemia in a Chinese Patient with β-Thalassemia Intermedia. (United States)

    Li, Yan; Yan, Jin-Mei; Zhou, Jian-Ying; Lu, Yue-Cheng; Li, Dong-Zhi


    We first report a novel β chain variant, Hb Heze [β144(HC1)Lys→Arg; HBB: c.434A>G], in a Chinese family. Heterozygous inheritance of the mutation results in a mild β-thalassemia (β-thal) phenotype, whereas compound heterozygosity of Hb Heze with β0-thal appears as the cause of β-thal intermedia (β-TI) in our case.

  11. 2-{5-(1,3-Benzodioxol-5-yl-1-[4-(4-chlorophenyl-1,3-thiazol-2-yl]-4,5-dihydro-1H-pyrazol-3-yl}pyrazine

    Directory of Open Access Journals (Sweden)

    Suban Syed Shafi


    Full Text Available A simple method for the synthesis of a pyrazolyl thiazole derivative containing a piperonal moiety was developed. Thus, 2-{5-(1,3-benzodioxol-5-yl-1-[4-(4-chlorophenyl-1,3-thiazol-2-yl]-4,5-dihydro-1H-pyrazol-3-yl}pyrazine was synthesized using microwave irradiation and characterized by NMR, IR and LCMS data.

  12. Interference of N-(1-[4-(4-fluophenoxy)butyl]-piperidinyl)-N-methyl-2-benzothiazolamin e with Na+/H+exchange and Na+/Ca2+exchange in purified cardiac sarcolemmal membranes

    NARCIS (Netherlands)

    Scheufler, E.; Heers, C.; Wilffert, B.; Peters, Thies; Pierce, G.N.


    The effect of R 56865 (N-[1-[4-(4-fluorophenoxy) butyl]-piperidinyl]-N-methyl-2-benzothiazolamine, CAS 104606-13-5) on Na+/H+exchange and Na+/Ca2+exchange was studied in isolated cardiac sarcolemmal vesicles. R 56865 inhibited Na+/H+exchange with an ED50of 180 μmol/l at a concentration of 0.05

  13. Cross sections of the 144Sm(n,α141Nd and 66Zn(n,α63Ni reactions at 4.0, 5.0 and 6.0 MeV

    Directory of Open Access Journals (Sweden)

    Yury Gledenov


    Full Text Available Cross sections of the 144Sm(n,α141Nd and 66Zn(n,α63Ni reactions were measured at En = 4.0, 5.0 and 6.0 MeV performed at the 4.5-MV Van de Graaff Accelerator of Peking University, China. A double-section gridded ionization chamber was used to detect the alpha particles. The foil samples of 144Sm2O3 and enriched 66Zn were placed at the common cathode plate of the chamber. Monoenergetic neutrons were produced by a deuterium gas target through the 2H(d,n3He reaction. The neutron flux was monitored by a BF3 long counter. Cross sections of the 238U(n,f reaction were used as the standard to perform the (n,α reaction measurement. Present results are compared with existing measurements and evaluations. They are generally in agreement with TALYS-1.6 code calculations. For the 144Sm(n,α141Nd reaction our measurements support the data of JEF-2.2. For the 66Zn(n,α63Ni reaction present results support the data of EAF-2010 and TENDL-2015 data.

  14. Cross sections of the 144Sm(n,α)141Nd and 66Zn(n,α)63Ni reactions at 4.0, 5.0 and 6.0 MeV (United States)

    Yury, Gledenov; Guohui, Zhang; Khuukhenkhuu, Gonchigdorj; Milana, Sedysheva; Lubos, Krupa; Sansarbayar, Enkhbold; Igor, Chuprakov; Zhimin, Wang; Xiao, Fan; Luyu, Zhang; Huaiyong, Bai


    Cross sections of the 144Sm(n,α)141Nd and 66Zn(n,α)63Ni reactions were measured at En = 4.0, 5.0 and 6.0 MeV performed at the 4.5-MV Van de Graaff Accelerator of Peking University, China. A double-section gridded ionization chamber was used to detect the alpha particles. The foil samples of 144Sm2O3 and enriched 66Zn were placed at the common cathode plate of the chamber. Monoenergetic neutrons were produced by a deuterium gas target through the 2H(d,n)3He reaction. The neutron flux was monitored by a BF3 long counter. Cross sections of the 238U(n,f) reaction were used as the standard to perform the (n,α) reaction measurement. Present results are compared with existing measurements and evaluations. They are generally in agreement with TALYS-1.6 code calculations. For the 144Sm(n,α)141Nd reaction our measurements support the data of JEF-2.2. For the 66Zn(n,α)63Ni reaction present results support the data of EAF-2010 and TENDL-2015 data.

  15. The threshold anomaly from the simultaneous calculation of elastic scattering and fusion cross sections for the systems {sup 9}Be+{sup 144}Sm and {sup 9}Be+{sup 64}Zn for energies around the barrier

    Energy Technology Data Exchange (ETDEWEB)

    Camacho, A. G.; Aguilera, E. F.; Quiroz, E. M. [Departamento de Aceleradores, ININ, La Marquesa, 52750 Estado de Mexico (Mexico); Gomes, P. R. S.; Lubian, J. [Instituto de Fisica, Universidade Federal Fluminenese, Av. Litoranea s/n, Gragoata, Niteroi, 24210-340 Rio de Janeiro (Brazil)


    The energy dependence of the optical potential is used to study the threshold anomaly for reactions with the weakly bound projectile {sup 9}Be on {sup 144}Sm and {sup 64}Zn for energies around the Coulomb barrier. The energy dependent potential parameters are obtained from a simultaneous X{sup 2}-analysis of elastic scattering and fusion data. There are signatures that in fact, the so-called breakup threshold anomaly shows up for these systems. This finding is in agreement with other calculations involving weakly bound projectiles. (Author)

  16. Inelastic scattering of neutrons by spin waves in terbium

    DEFF Research Database (Denmark)

    Bjerrum Møller, Hans; Houmann, Jens Christian Gylden


    Measurements of spin-wave dispersion relations for magnons propagating in symmetry directions in ferromagnetic Tb; it is first experiment to give detailed information on magnetic excitations in heavy rare earths; Tb was chosen for these measurements because it is one of few rare-earth metals whic...... does not have very high thermal-neutron capture cross section, so that inelastic neutron scattering experiments can give satisfactory information on magnon dispersion relations....

  17. Coherent magnetic structures in terbium/holmium superlattices

    DEFF Research Database (Denmark)

    Bryn-Jacobsen, C.; Cowley, R.A.; McMorrow, D.F.


    Neutron-scattering techniques have been used to investigate the magnetic properties of three Tb/Ho superlattices grown by molecular-beam epitaxy. It is revealed that for temperatures in the range T = 10 to T-N(Ho)approximate to 130 K, there is a basal-plane ferromagnetic alignment of Tb moments w...

  18. 29 CFR 14.4 - Definitions. (United States)


    ... security. (c) Courier—an individual designated by appropriate authority to protect classified and... the transaction of public business; this includes material preserved by an agency or its legitimate...

  19. GPCR Interaction: 144 [GRIPDB[Archive

    Lifescience Database Archive (English)

    Full Text Available RET (SRET) Radioligand binding, Measurement of cAMP accumulation, Immunoprecipitation, Western Immunoblottin...g, Immunocytochemistry Staining and Fluorescent Imaging, Measurement of ERK phosphorylation NP_057167.2 ...

  20. The real Fatou conjecture (AM-144)

    CERN Document Server

    Graczyk, Jacek


    In 1920, Pierre Fatou expressed the conjecture that--except for special cases--all critical points of a rational map of the Riemann sphere tend to periodic orbits under iteration. This conjecture remains the main open problem in the dynamics of iterated maps. For the logistic family x- ax(1-x), it can be interpreted to mean that for a dense set of parameters ""a,"" an attracting periodic orbit exists. The same question appears naturally in science, where the logistic family is used to construct models in physics, ecology, and economics. In this book, Jacek Graczyk and Grzegorz Swiatek provi

  1. 45 CFR 144.103 - Definitions. (United States)


    ....117. State means each of the several States, the District of Columbia, Puerto Rico, the Virgin Islands... vaccines), or Title XXII of the PHS Act. (4) Continuation coverage means coverage under a COBRA...

  2. Reference: 144 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available gulates lateral root development in Arabidopsis. 6 996-1006 15584963 2004 Dec The Plant journal Chakrabarty Pranjib K|Nodzon Lisa A|Pi Li-Ya|Song Wen-Yuan|Wang Yongsheng|Xu Wei-Hui

  3. 10 CFR 600.144 - Procurement procedures. (United States)


    ... practicable, of technical requirements in terms of functions to be performed or performance required... products and services dimensioned in the metric system of measurement. (vi) Preference, to the extent... small businesses, minority-owned firms, and women's business enterprises, whenever possible. Recipients...

  4. 40 CFR 144.3 - Definitions. (United States)


    ... or revisions. Appropriate Act and regulations means the Solid Waste Disposal Act, as amended by the... “drywell” that receives untreated sanitary waste containing human excreta, and which sometimes has an open... reissuance, or termination, as discussed in § 124.5 is not a “draft permit.” Drilling mud means a heavy...

  5. 7 CFR 1703.144 - Completed application. (United States)


    ... objectives and activities; and (4) A budget for capital expenditures reflecting the line item costs for the... toll charges, system maintenance, salaries, training, and any other general operating expenses, provide... the applicant is requesting a loan for telecommunications transmission facilities): (1) The...

  6. Publications | Page 144 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    IDRC works with developing-country researchers and institutions to build local capacity through funding, knowledge sharing, and training. Through books, articles, research publications, and studies, we aim to widen the impact of our investment and advance development research. We share the results of our funded ...

  7. 144 Sanchita Hati and Dipankar Datta

    Indian Academy of Sciences (India)

    Lit is a hard (h) acid, Cs" a soft (s) acid, F a hard base and I a soft base. Li+ i + Cst F = Lit F + Cs"I AH = - 12.1 kcal mol. (1) h S S h h h s is. As indicated by the AH value, reaction (1) proceeds in a direction where h binds hand s binds s, in conformity with the HSAB principle. This principle can be said to be the first step ...

  8. 22 CFR 144.103 - Definitions. (United States)


    ..., auxiliary aids useful for persons with impaired vision include readers, brailled materials, audio recordings... hearing include telephone handset amplifiers, telephones compatible with hearing aids, telecommunication... person who is a member of a class of persons otherwise entitled by statute, regulation, or agency policy...

  9. Experimental test of a newly developed single-moderator, multi-detector, directional neutron spectrometer in reference monochromatic fields from 144 keV to 16.5 MeV

    Energy Technology Data Exchange (ETDEWEB)

    Bedogni, R., E-mail: [INFN – LNF, via E. Fermi n. 40, 00044 Frascati (Roma) (Italy); Gómez-Ros, J.M. [INFN – LNF, via E. Fermi n. 40, 00044 Frascati (Roma) (Italy); CIEMAT, Av. Complutense 40, 28040 Madrid (Spain); Pola, A.; Bortot, D. [Politecnico di Milano, Dipartimento di Energia, via La Masa 34, 20156 Milano (Italy); INFN – Milano, Via Celoria 16, 20133 Milano (Italy); Gentile, A. [INFN – LNF, via E. Fermi n. 40, 00044 Frascati (Roma) (Italy); Introini, M.V. [Politecnico di Milano, Dipartimento di Energia, via La Masa 34, 20156 Milano (Italy); INFN – Milano, Via Celoria 16, 20133 Milano (Italy); Buonomo, B. [INFN – LNF, via E. Fermi n. 40, 00044 Frascati (Roma) (Italy); Lorenzoli, M. [Politecnico di Milano, Dipartimento di Energia, via La Masa 34, 20156 Milano (Italy); INFN – Milano, Via Celoria 16, 20133 Milano (Italy); Mazzitelli, M. [INFN – LNF, via E. Fermi n. 40, 00044 Frascati (Roma) (Italy); Sacco, D. [INFN – LNF, via E. Fermi n. 40, 00044 Frascati (Roma) (Italy); INAIL – DPIA, Via di Fontana Candida n.1, 00040 Monteporzio Catone (Italy)


    A new directional neutron spectrometer called CYSP (CYlindrical SPectrometer) was developed within the NESCOFI@BTF (2011–2013) collaboration. The device, composed by seven active thermal neutron detectors located along the axis of a cylindrical moderator, was designed to simultaneously respond from the thermal domain up to hundreds of MeV neutrons. The new spectrometer condenses the performance of the Bonner Sphere Spectrometer in a single moderator; thus requiring only one exposure to determine the whole spectrum. The CYSP response matrix, determined with MCNP, has been experimentally evaluated with monochromatic reference neutron fields from 144 keV to 16.5 MeV, plus a {sup 252}Cf source, available at NPL (Teddington, UK). The results of the experiment confirmed the correctness of the response matrix within an overall uncertainty of ±2.5%. The new active spectrometer CYSP offers an innovative option for real-time monitoring of directional neutron fields as those produced in neutron beam-lines.

  10. The association of the effect of lithium in the maintenance treatment of bipolar disorder with lithium plasma levels : a post hoc analysis of a double-blind study comparing switching to lithium or placebo in patients who responded to quetiapine (Trial 144)

    NARCIS (Netherlands)

    Nolen, Willem A.; Weisler, Richard H.

    Nolen WA, Weisler RH. The association of the effect of lithium in the maintenance treatment of bipolar disorder with lithium plasma levels: a post hoc analysis of a double-blind study comparing switching to lithium or placebo in patients who responded to quetiapine (Trial 144). Bipolar Disord 2012:

  11. Design of the experimental apparatus to obtain a thermal neutron beam, intermediate-energy neutrons (2-144 keV) and high-energy photons (6 MeV) by means of the TRIGA reactor at the ENEA Casaccia center

    CERN Document Server

    Laitano, R F


    Design of the experimental apparatus to obtain a thermal neutron beam, intermediate-energy neutrons (2-144 keV) and high-energy photons (6 MeV) by means of the TRIGA reactor at the ENEA Casaccia center

  12. The effect of solid solution treatment on the hardness and microstructure of 0.6%wt C-10.8%wt Mn-1.44%wt Cr austenitic manganese steel (United States)

    Nurjaman, F.; Bahfie, F.; Astuti, W.; Shofi, A.


    Austenitic manganese steel is steel alloy that has high manganese content (10-14%wt Mn). The characteristics of austenitic manganese steel are good in toughness, ductility, and wear resistance. Effect of solid solution treatment on the hardness and microstructure of austenitic manganese steel was studied in this experiment. The solid solution treatment process of austenitic manganese steel, 0.6%wt C-10.8%wt Mn-1.44%wt Cr, was conducted by heating the material at varied temperatures (950°C, 1000°C, 1050°C) for an hour and then quenching it in two different quenching media, i.e. oil and water. Further, the samples were tempered at three different temperatures (300°C, 400°C, and 500°C) for 2 hours. The treated materials were analyzed by Rockwell Hardness Tester to obtain the information of materials hardness and by an optical microscope and XRD to investigate the microstructure phase of the treated materials. Heating the austenitic manganese steel at 950°C for an hour followed by water quenching dissolved all carbide in as-cast condition and resulted the fully austenitic on its microstructure. Carbide precipitation occurred due to the prolongation of soaking time in solid solution treatment and tempering process. The optimum hardness of sample was 53.3 HRC, which was resulted by heating this material until 1000°C for an hour, followed by water quenching and tempering at 400°C for 2 hours.

  13. Efficacy of initial antiretroviral therapy for HIV-1 infection in adults: a systematic review and meta-analysis of 114 studies with up to 144 weeks' follow-up.

    Directory of Open Access Journals (Sweden)

    Frederick J Lee

    Full Text Available BACKGROUND: A comprehensive assessment of initial HIV-1 treatment success may inform study design and treatment guidelines. METHODS: Group-based, systematic review and meta-analysis of initial antiretroviral therapy studies, in adults, of ≥ 48 weeks duration, reported through December 31, 2012. Size-weighted, intention-to-treat efficacy was calculated. Parameters of study design/eligibility, participant and treatment characteristics were abstracted. Multivariable, random effects, linear regression models with backwards, stepwise selection were then used to identify variables associated with efficacy. OUTCOME MEASURES: Antiviral efficacy (undetectable plasma viral load and premature cessation of therapy. RESULTS: 114 studies were included (216 treatment groups; 40,124 participants; mean CD4 count 248 cells/µL [SD 81]; mean HIV-1 plasma viral load log10 4.9 [SD 0.2]. Mean efficacy across all groups was 60% (SD 16 over a mean 82 weeks' follow-up (SD 38. Efficacy declined over time: 66% (SD 16 at 48 weeks, 60% (SD 16 at 96 weeks, 52% (SD 18 at 144 weeks. The most common reason for treatment cessation was participant decision (11%, SD 6.6. Efficacy was higher with 'Preferred' than 'Alternative' regimens (as defined by 2013 United States antiretroviral guidelines: 75% vs. 65%, respectively, difference 10%; 95%CI 7.6 to 15.4; p<0.001. In 98 groups (45% reporting efficacy stratified by pre-treatment viral load (< or ≥100,000 copies/mL, efficacy was greater for the lower stratum (70% vs. 62%, respectively, difference 8.4%; 95%CI 6.0 to 10.9; p<0.001. This difference persisted within 'Preferred' regimens. Greatest efficacy was associated with use of tenofovir-emtricitabine (vs. other nucleoside analogue backbones and integrase strand transfer inhibitors (vs. other third drug classes. CONCLUSION: Initial antiretroviral treatments for HIV-1 to date appear to have suboptimal long-term efficacy, but are more effective when commenced at plasma viral loads

  14. Appendix to Health and Safety Laboratory environmental quarterly, March 1, 1976--June 1, 1976. [Tabulated data on content of lead in surface air and /sup 7/Be, /sup 95/Zr, /sup 137/Cs, /sup 144/Ce, and /sup 90/Sr in surface air, milk, drinking water, and foods sampled in USA

    Energy Technology Data Exchange (ETDEWEB)

    Hardy, E.P. Jr.


    Tabulated data are presented on: the monthly deposition of /sup 89/Sr and /sup 90/Sr at some 100 world land sites; the content of lead and /sup 7/Be, /sup 95/Zr, /sup 137/Cs, and /sup 144/Ce in samples of surface air from various world sites; and the content of /sup 90/Sr in samples of milk, drinking water, and animal and human diets collected at various locations throughout the USA. (CH)

  15. Yeast Interacting Proteins Database: YGR144W, YGR144W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available mitochondrial genome stability in response to DNA damaging agents Rows with this bait as bait (1) Rows with...mitochondrial genome stability in response to DNA damaging agents Rows with this prey as prey (2) Rows with...mitochondrial genome stability in response to DNA damaging agents Rows with this bait as bait Rows with this...mitochondrial genome stability in response to DNA damaging agents Rows with this prey as prey Rows with this

  16. Monoclonal Antibodies, Derived from Humans Vaccinated with the RV144 HIV Vaccine Containing the HVEM Binding Domain of Herpes Simplex Virus (HSV) Glycoprotein D, Neutralize HSV Infection, Mediate Antibody-Dependent Cellular Cytotoxicity, and Protect Mice from Ocular Challenge with HSV-1. (United States)

    Wang, Kening; Tomaras, Georgia D; Jegaskanda, Sinthujan; Moody, M Anthony; Liao, Hua-Xin; Goodman, Kyle N; Berman, Phillip W; Rerks-Ngarm, Supachai; Pitisuttithum, Punnee; Nitayapan, Sorachai; Kaewkungwal, Jaranit; Haynes, Barton F; Cohen, Jeffrey I


    The RV144 HIV vaccine trial included a recombinant HIV glycoprotein 120 (gp120) construct fused to a small portion of herpes simplex virus 1 (HSV-1) glycoprotein D (gD) so that the first 40 amino acids of gp120 were replaced by the signal sequence and the first 27 amino acids of the mature form of gD. This region of gD contains most of the binding site for HVEM, an HSV receptor important for virus infection of epithelial cells and lymphocytes. RV144 induced antibodies to HIV that were partially protective against infection, as well as antibodies to HSV. We derived monoclonal antibodies (MAbs) from peripheral blood B cells of recipients of the RV144 HIV vaccine and showed that these antibodies neutralized HSV-1 infection in cells expressing HVEM, but not the other major virus receptor, nectin-1. The MAbs mediated antibody-dependent cellular cytotoxicity (ADCC), and mice that received the MAbs and were then challenged by corneal inoculation with HSV-1 had reduced eye disease, shedding, and latent infection. To our knowledge, this is the first description of MAbs derived from human recipients of a vaccine that specifically target the HVEM binding site of gD. In summary, we found that monoclonal antibodies derived from humans vaccinated with the HVEM binding domain of HSV-1 gD (i) neutralized HSV-1 infection in a cell receptor-specific manner, (ii) mediated ADCC, and (iii) reduced ocular disease in virus-infected mice. IMPORTANCE Herpes simplex virus 1 (HSV-1) causes cold sores and neonatal herpes and is a leading cause of blindness. Despite many trials, no HSV vaccine has been approved. Nectin-1 and HVEM are the two major cellular receptors for HSV. These receptors are expressed at different levels in various tissues, and the role of each receptor in HSV pathogenesis is not well understood. We derived human monoclonal antibodies from persons who received the HIV RV144 vaccine that contained the HVEM binding domain of HSV-1 gD fused to HIV gp120. These antibodies were

  17. pi --p Elastic Scattering at 1.44 Bev

    CERN Document Server

    Steinberger, J; Schwartz, M; Samios, Nicholas P; Leitner, Jack


    An investigation of pi -+p elastic scattering, made in a liquid propane bubble chamber, is reported. Identification of events is made on the basis of kinematics. The problem of contamination by pion scattering from protons bound in carbon is considered in some detail; it is shown that the latter requires a correction of only 4±2.5% of the total number of events. The angular distribution is presented. It shows a large diffraction peak at small angles and an approximately isotropic plateau over the backward hemisphere. The forward peak is fitted to a black-sphere diffraction pattern with a radius of (1.08±0.06) x 10-13 cm. The total elastic cross section is found to be sigma e=10.1±0.80 mb.

  18. South of Sahara | Page 144 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Selon les statistiques, 20 % des Ougandais présentent un handicap physique. Malgré tout, peu de recherches ont été menées dans le but de jeter un éclairage sur le vécu des personnes handicapées. Cette absence d'études officielles et de données concrètes fait en sorte les organismes de défense des droits des ...

  19. Dicty_cDB: VHJ144 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available ted Amino Acid sequence yifnlnhfflffiskklhfnnsnsy*nvwfyi*rpfsstsr*n*rwfkrpkntrwwwwww wwyfskwwcspww*RILNVVLTL...FCYNSIIIIKSNKIIIFGSSSILKKK--- ---YIFNLNHFFLFFISKKLHFNNSNSY*nvwfyi*rpfsstsr*n*rwfkrpkntrwww wwwww...plvvkdsqcsfnfillqfdnyy*snkiiilgs Frame B: yifnlnhfflffiskklhfnnsnsy*nvwfyi*rpfsstsr*n*rwfkrpkntrwwwwww wwyfs...kwwcspww*RILNVVLTLFCYNSIIIIKSNKIIIFGSSSILKKK--- ---YIFNLNHFFLFFISKKLHFNNSNSY*nvwfyi*rpfsstsr*n*rwfkrpkntrwww wwwww

  20. 40 CFR 144.52 - Establishing permit conditions. (United States)


    ... comply with the financial responsibility requirements of subpart F of this part. (8) Mechanical integrity... injection wells unless waived by the Regional Administrator. (7) Financial responsibility. (i) The permittee, including the transferor of a permit, is required to demonstrate and maintain financial responsibility and...

  1. South of Sahara | Page 144 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    This case study discusses the need for rural access to agro-meteorological forecasts and advice by establishing an early warning and agrometeorological information system. Through this project, researchers note the importance of using local knowledge in adjusting forecasts and advice to the realities of the region and ...

  2. 144 review article lassa fever: another infectious menace

    African Journals Online (AJOL)

    Dr Oboro VO

    final gene products- the nucleo protein (NP or. N) and the envelope glycol ... The virus is excreted in urine for three to nine weeks from .... 150. When Lassa fever infects pregnant women late in their third trimester, it is necessary to abort the pregnancy for the mother to have a good change of survival (20). This is because the ...

  3. 10 CFR 72.144 - Quality assurance program. (United States)


    ..., and applicant for a CoC shall take into account the need for special controls, processes, test... uniqueness of the item; (3) The need for special controls and surveillance over processes and equipment; (4... quality history and degree of standardization of the item. (d) The licensee, applicant for a license...

  4. What we do | Page 144 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Asian Partnership for Avian Influenza Research : Effectiveness of Control Measures. Highly pathogenic avian influenza (HPAI) caused by viruses of the H5N1 subtype is a major disease of poultry that affects humans at a low rate. China, Far East Asia, Thailand, Viet Nam, Central Asia, South Asia, Cambodia, Indonesia.

  5. Publications | Page 144 | CRDI - Centre de recherches pour le ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Indonesia's Fires and Haze : The Cost of Catastrophe (mise à jour en 2006). De septembre à novembre 1997, les incendies qui ont fait rage en Indonésie ont rejeté suffisamment de fumée dans l'atmosphère pour recouvrir toutes les régions d'un brouillard qui a atteint le sud de la Thaïlande et les Philippines au nord, ...

  6. 34 CFR 668.144 - Application for test approval. (United States)


    ... EDUCATION, DEPARTMENT OF EDUCATION STUDENT ASSISTANCE GENERAL PROVISIONS Approval of Independently... defensible standard errors of the mean and were not disproportionately composed of any race or gender; and (B... statistically significant differences in performance; and (vii) Additional guidance on the interpretation of...

  7. 144 original article epidemiological significance of the colonization ...

    African Journals Online (AJOL)


    Knowledge of Group B Streptococcus (GBS) carriage and infections in Africa is very scanty but few cases have been reported in Nigeria in particular. Streptococcus agalactiae has been reported to cause infections and diseases in non-parturients and adults ranging from bacteremia, osteomylitis, arthritis, and endocarditis to ...

  8. 40 CFR 86.144-94 - Calculations; exhaust emissions. (United States)


    ... × (COconc/1,000,000) (4) Carbon dioxide mass: CO2mass=Vmix × DensityCO2 × (CO2conc/100) (5) Methanol mass... petroleum fuel with hydrogen to carbon ratio of 1.85:1. (C) COe= COem for methanol-fuel or natural gas-fuel...=Density of total hydrocarbon. (A) For gasoline-fuel, diesel-fuel and methanol fuel; DensityHC=16.33 g/ft3...

  9. Dicty_cDB: SFJ144 [Dicty_cDB

    Lifescience Database Archive (English)


  10. 40 CFR 144.70 - Wording of the instruments. (United States)


    ..., with a Federal Reserve bank, but the books and records of the Trustee shall at all times show that all... to hold any security in bearer form or in book entry, or to combine certificates representing such... of the Fund and all brokerage commissions incurred by the Fund shall be paid from the Fund. All other...

  11. Dicty_cDB: SSE144 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 4e-77 (Q9NZK5) RecName: Full=Cat eye syndrome critical region protein ... 290 1e-76 AF190746_1( AF190746...1e-76 (Q5RC46) RecName: Full=Cat eye syndrome critical region protein ... 289 2e-76 AJ720326_1( AJ720326

  12. What we do | Page 144 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Impacts from rising sea levels, coastal flooding and storm surges are becoming a challenging policy issue for planners, local authorities and stakeholders in ... as a panacea for many of the ills afflicting society, as well as a means to improve service delivery and involve a greater percentage of the population in governance.

  13. Dicty_cDB: VSG144 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available ces producing significant alignments: (bits) Value VSJ115 (VSJ115Q) /CSM/VS/VSJ1-A/VSJ115Q.Seq.d/ 68 2e-11 V... 9 Homology vs DNA Score E Sequences producing significant alignments: (bits) Value

  14. 19 CFR 144.34 - Transfer to another warehouse. (United States)


    ... section is eligible to participate. (ii) The importer must have a centralized inventory control system... the port in which the applicant's centralized inventory control system exists, with copies to all... covered by the same centralized inventory control system. Only blanket exemption requests will be...

  15. 144 Food Security: Agriculture and Gender Relations in Post ...

    African Journals Online (AJOL)



    Oct 17, 2010 ... terms of resource distribution to produce food and purchasing power to buy food where it is not produced. Given women's crucial role in food production and provision, any set of strategies for sustainable food security must address their limited access to productive resources. Women's limited access to.

  16. Dicty_cDB: VFG144 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 10 X02407 |X02407.1 D.discoideum mRNA for cysteine proteinase 1. 70 1e-18 3 AF250284 |AF250284.1 Amsacta moore...i entomopoxvirus, complete genome. 76 1e-10 3 U30297 |U30297.1 Amsacta moorei entomopoxvirus filament-asso

  17. Dicty_cDB: AFA144 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available tial cds. 64 2e-09 2 CD450751 |CD450751.1 USDA-FP_102714 Adult Alate Brown Citrus Aphid..._100461 Adult Alate Brown Citrus Aphid Toxoptera citricida cDNA clone WHWTC-07_A07 5', mRNA sequence. 46 0.0

  18. 19 CFR 144.38 - Withdrawal for consumption. (United States)


    ... provided in § 141.61(e) of this chapter. (b) Withdrawal for exportation to Canada or Mexico. A withdrawal for exportation to Canada or Mexico or for entry into a duty-deferral program in Canada or Mexico is...) Textiles and textile products. Textiles and textile products subject to quota, visa or export license...

  19. 49 CFR 1.44 - Reservation of authority. (United States)


    ... intervene or appear before courts and administrative agencies to present the views of the Department. (e...)). (7) Authority to determine the maximum limit of age for appointment of air traffic controllers as... 5209, March 10, 1972) which are reserved to the head of the Department. (g) Procurement. Exercise of...

  20. 10 CFR 63.144 - Quality assurance program change. (United States)


    ... administrative improvements and clarifications, spelling corrections, punctuation, or editorial items, the... correct spelling, punctuation, or editorial items). (3) DOE shall maintain records of quality assurance...

  1. 30 CFR 14.4 - Application procedures and requirements. (United States)


    ... construction (number of plies, solid woven); (vii) Carcass fabric by textile type and weight (ounces per square... rationale must be included in the application. (f) Equivalent non-MSHA product safety standard. An applicant may request an equivalency determination to this part under § 6.20 of this chapter, for a non-MSHA...

  2. Cerium-144-induced lung gumors in two strains of mice

    Energy Technology Data Exchange (ETDEWEB)

    Hahn, F.F.; Griffith, W.C.


    A major problem in the extrapolation of radiation cancer risk factors from one species or population to another is the choice of the risk model to use, either absolute or relative. The purpose of this study was to compare absolute and relative risk models in predicting the lung-tumor risks between a low lung-tumor incidence strain of mice and a high-incidence strain of mice. The conclusion from this study is that absolute risk is more accurate than relative risk for predicting lung tumor risk from high to low lung-tumor incidence strains of mice.

  3. Dicty_cDB: VSI144 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available (merA) gene... 49 9e-05 U75324_2( U75324 |pid:none) Cloning vector pJB3Tc20, complete sequ... 49 9e-05 AB114188_15(...c... 49 9e-05 AB027254_3( AB027254 |pid:none) Cloning vector pSB4 tetR, tetA, hy... 49 9e-05 protein

  4. Dicty_cDB: SFA144 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available rerio chitobiase, di-N-acety... 111 2e-23 BC095064_1( BC095064 |pid:none) Danio rerio chitobiase, di-N-acety...BC072723_1( BC072723 |pid:none) Danio rerio chitobiase, di-N-acety... 111 2e-23 AK008791_1( AK008791 |pid:none)...107 2e-22 (Q8R242) RecName: Full=Di-N-acetylchitobiase; EC=3.2.1.... 107 2e-22 AC115592_28( AC115592 |pid:none)

  5. Dicty_cDB: VSB144 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available Botrytis cinerea strain T4 cDNA library under conditions of nitrogen deprivation. 72 4e-14 2 AL111854...Botrytis cinerea strain T4 cDNA library under conditions of nitrogen deprivation. 72 4e-14 2 AL111255...Botrytis cinerea strain T4 cDNA library under conditions of nitrogen deprivation. 72 5e-14 2 AL116832...Botrytis cinerea strain T4 cDNA library under conditions of nitrogen deprivation. 72 5e-14 2 AL116249...Botrytis cinerea strain T4 cDNA library under conditions of nitrogen deprivation. 72 5e-14 2 AL115920

  6. 33 CFR 144.01-25 - Ring life buoys. (United States)


    ... water light will pull free of the bracket. ... have a water light of an approved automatic electric type constructed in accordance with 46 CFR Subpart 161.010. A water light constructed in accordance with former 46 CFR Subpart 161.001 that was installed...

  7. 33 CFR 144.01-10 - Equipment for life floats. (United States)


    ... feet) nor more than 4 meters (12 feet) in length. The water light must be mounted on a bracket so that when the life float is launched, the water light will pull free of the bracket. (c) Two paddles shall... 1/2 inch in diameter. (b) Each life float must have a water light of an approved automatic electric...

  8. Dicty_cDB: VFL144 [Dicty_cDB

    Lifescience Database Archive (English)


  9. Dicty_cDB: AFJ144 [Dicty_cDB

    Lifescience Database Archive (English)


  10. Dicty_cDB: SFL144 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available |pid:none) Pneumocystis carinii f. sp. carinii he... 320 5e-86 EU679414_1( EU679414 |pid:none) Tetranychus... cinnabarinus heat shoc... 318 2e-85 EU679412_1( EU679412 |pid:none) Tetranychus ci

  11. All projects related to | Page 144 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    A Rights-Based Approach to Internet Policy and Governance for the Advancement of Economic, Social, and Cultural Rights. Project. The debate on Internet freedom has intensified over the last few years as governments and civil society organizations explore policies to safeguard online civil liberties and online security.

  12. Dicty_cDB: SFC144 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available protein, complete cds. 331 2e-87 1 CF644841 |CF644841.1 K26_B01 Filamentous WCFS1 complete genome; segment 9/11. 30 4.4 2 CF641582 |CF641582.1 D41_E10 Filamentous Forced Diploid Ust...ilago maydis cDNA 3', mRNA sequence. 34 4.6 2 CF643189 |CF643189.1 D60_G10 Filamentous Forced Diploid Ustila...go maydis cDNA 3', mRNA sequence. 34 4.6 2 CF643884 |CF643884.1 K13_G06 Filamentous Force

  13. What we do | Page 144 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Healthy and Sustainable Horticulture Production in the Central Andes. Horticultural production in mid-altitude Andean valleys uses substantial amounts of highly hazardous and mutagenic pesticides. North And Central America, South America. PROJECT ...

  14. Categorizing renal oncocytic neoplasms on core needle biopsy: a morphologic and immunophenotypic study of 144 cases with clinical follow-up. Alderman MA, Daignault S, Wolf JS Jr, Palapattu GS, Weizer AZ, Hafez KS, Kunju LP, Wu AJ. Hum Pathol.September 2016;55:1-10. (United States)

    Kryvenko, Oleksandr N


    There is limited literature on renal oncocytic neoplasms diagnosed on core biopsy. All renal oncocytic neoplasm core biopsies from 2006 to 2013 were, retrospectively, reviewed. Morphologic features and an immunohistochemical panel of CK7, c-KIT, and S100A1 were assessed. Concordance with resection diagnosis, statistical analysis including a random forest classification, and follow-up were recorded. The postimmunohistochemical diagnoses of 144 renal oncocytic core biopsies were favor oncocytoma (67%), favor renal cell carcinoma (RCC) (12%), and cannot exclude RCC (21%). Diagnosis was revised following immunohistochemistry in 7% of cases. The most common features for oncocytoma (excluding dense granular cytoplasm) were nested architecture, edematous stroma, binucleation and tubular architecture; the most common features for favor RCC were sheet-like architecture, nuclear pleomorphism, papillary architecture, and prominent cell borders. High nuclear grade, necrosis, extensive papillary architecture, raisinoid nuclei, and frequent mitoses were not seen in oncocytomas. Comparing the pathologist and random forest classification, the overall out-of-bag estimate of classification error dropped from 23% to 13% when favor RCC and cannot exclude RCC was combined into 1 category. Resection was performed in 19% (28 cases) with a 94% concordance (100% of favor RCC biopsies and 90% of cannot exclude RCC biopsies confirmed as RCC; 83% of favor oncocytomas confirmed); ablation in 23%; and surveillance in 46%. Follow-up was available in 92% (median follow-up, 33 months) with no adverse outcomes. Renal oncocytic neoplasms comprise a significant subset (16%) of all core biopsies, and the majority (78%) can be classified as favor oncocytoma or favor RCC. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Photoluminescence studies of a Terbium(III) complex as a fluorescent probe for DNA detection

    Energy Technology Data Exchange (ETDEWEB)

    Khorasani-Motlagh, Mozhgan, E-mail:; Noroozifar, Meissam; Niroomand, Sona; Moodi, Asieh


    The photoluminescence properties of a Tb(III) complex of the form [Tb(phen){sub 2}Cl{sub 3}·OH{sub 2}] (phen=1,10-phenanthroline) in different solvents are presented. It shows the characteristic luminescence of the corresponding Ln{sup 3+} ion in the visible region. The emission intensity of this complex in coordinating solvent is higher than non-coordinating one. The suggested mechanism for the energy transfer between the ligand and Tb{sup 3+} ion is the intramolecular energy transfer mechanism. The interactions of the Tb(III) complex with fish salmon DNA are studied by fluorescence spectroscopy, circular dichroism study and viscosity measurements. The results of fluorescence titration reveal that DNA strongly quenches the intrinsic fluorescence of the complex through a static quenching procedure. The binding constant (K{sub b}) of the above metal complex at 25 °C is determined by the fluorescence titration method and it is found to be (8.06±0.01)×10{sup 3} M{sup −1}. The thermodynamic parameters (ΔH{sup 0}>0, ΔS{sup 0}>0 and ΔG{sup 0}<0) indicate that the hydrophobic interactions play a major role in DNA–Tb complex association. The results support the claim that the title complex bonds to FS-DNA by a groove mode. -- Highlights: • Photoluminescence of [Tb(phen){sub 2}Cl{sub 3}·OH{sub 2}] in different solvents are studied. • Tb(III) complex shows good binding affinity to FS DNA with K{sub b}=(8.06±0.01)×10{sup 3} M{sup −1}. • Viscosity of DNA almost unchanged by increasing amount of Tb complex. • CD spectrum of DNA has a little change with increasing amount of Tb complex. • Thermodynamic parameters indicate that the binding reaction is entropically driven.

  16. Lanthanides in Nuclear Medicine. The Production of Terbium-149 by Heavy Ion Beams

    CERN Document Server

    Dmitriev, S N; Zaitseva, N G; Maslov, O D; Molokanova, L G; Starodub, G Ya; Shishkin, S V; Shishkina, T V


    Among radioactive isotopes of lanthanide series elements, finding the increasing using in nuclear medicine, alpha-emitter {149}Tb (T_{1/2} = 4.118 h; EC 76.2 %; beta^+ 7.1 %; alpha 16.7 %) is considered as a perspective radionuclide for radioimmunotherapy. The aim of the present work is to study experimental conditions of the {149}Tb production in reactions Nd({12}C, xn){149}Dy (4.23 min; beta^+, EC)\\to {149}Tb when the Nd targets have been irradiated by heavy ions of carbon. On the basis of results of formation and decay of {149}Dy\\to{149}Tb evaluation of the {149}Tb activity, is made which can be received under optimum conditions (enriched {142}Nd target, {12}C ions with the energy 120 MeV and up to current 100 mu A, time of irradiating 8-10 hours). Under these conditions {149}Tb can be obtained up to 30 GBq (up to 0.8 Ci).

  17. Poly[[aqua-?3-picolinato-?2-picolinato-dipicolinatopotassium(I)terbium(III)] 2.5-hydrate


    Filipe A. Almeida Paz; João Rocha; Jacek Klinowski; Tito Trindade; Nogueira,Helena I. S.; Soares-Santos, Paula C. R.; Cunha-Silva, Lu?s


    In the title compound, [KTb(C6H4NO2)4(H2O)]·2.5H2O, each Tb3+ centre is coordinated by four N and five O atoms from five distinct picolinate ligands in a geometry resembling a highly distorted tricapped trigonal prism. One of the ligands establishes a skew bridge between neighbouring Tb3+ centres, leading to the formation of one-dimensional anionic polymeric chains, {[(C6H4NO2)4Tb]−}n, running along the direction [010]. Each K+ cation is seven-coordinated by six O atoms from one an...

  18. Spin waves in terbium. III. Magnetic anisotropy at zero wave vector

    DEFF Research Database (Denmark)

    Houmann, Jens Christian Gylden; Jensen, J.; Touborg, P.


    The energy gap at zero wave vector in the spin-wave dispersion relation of ferromagnetic. Tb has been studied by inelastic neutron scattering. The energy was measured as a function of temperature and applied magnetic field, and the dynamic anisotropy parameters were deduced from the results....... The axial anisotropy is found to depend sensitively on the orientation of the magnetic moments in the basal plane. This behavior is shown to be a convincing indication of considerable two-ion contributions to the magnetic anisotropy at zero wave vector. With the exception of the sixfold basal...... the effects of zero-point deviations from the fully aligned ground state, and we tentatively propose polarization-dependent two-ion couplings as their origin....

  19. Structural and Magnetic Anisotropy in Amorphous Terbium-Iron Thin Films (United States)

    Hufnagel, Todd Clayton


    High density, removable media magnetooptic disk drives have recently begun to make significant gains in the information mass storage market. The media in these disks are amorphous rare-earth/transition-metal (RE-TM) alloys. One vital property of these materials is a large perpendicular magnetic anisotropy; that is, an easy axis of magnetization which is perpendicular to the plane of the film. A variety of theories, sometimes contradictory, have been proposed to account for this surprising presence of an anisotropic property in an amorphous material. Recent research indicates that there is an underlying atomic-scale structural anisotropy which is responsible for the observed magnetic anisotropy. Several different types of structural anisotropy have been proposed to account for the observed magnetic anisotropy, including pair-ordering anisotropy (anisotropic chemical short-range order) and bond orientation anisotropy (an anisotropy in coordination number or distances independent of chemical ordering). We have studied the structural origins of perpendicular magnetic anisotropy in amorphous Tb-Fe thin films by employing high-energy and anomalous dispersion x-ray scattering. The as-deposited films show a clear structural anisotropy, with a preference for Tb-Fe near neighbors to align in the out-of-plane direction. These films also have a large perpendicular magnetic anisotropy. Upon annealing, the magnetic anisotropy energy drops significantly, and we see a corresponding reduction in the structural anisotropy. The radial distribution functions indicate that the number of Tb-Fe near-neighbors increases in the in-plane direction, but does not change in the out-of-plane direction. Therefore, the distribution of Tb-Fe near-neighbors becomes more uniform upon annealing. We propose that the observed reduction in perpendicular magnetic anisotropy energy is a result of this change in structure. Our results support the pair -ordering anisotropy model of the structural anisotropy in amorphous Tb-Fe thin films. We see no evidence to support the bond orientation anisotropy model.

  20. Luminescence properties of terbium-doped Li3PO4 phosphor for ...

    Indian Academy of Sciences (India)

    Antonov-Romanovskii et al [2] firstly suggested applications of OSL for personal dosime- try. This technique got momentum for personnel dosime- try after the development of α-Al2O3:C. OSL properties of α-Al2O3:C have been investigated for personnel dosimetry, environmental dosimetry, medical dosimetry and space.

  1. Luminescence properties of terbium-doped Li3PO4 phosphor for ...

    Indian Academy of Sciences (India)

    The powder X-ray diffraction (PXRD), photoluminescence (PL) emission and excitation spectra, thermoluminescence (TL) and optically stimulated luminescence (OSL) were measured. The particle size was calculated using the Debye Scherrer formula and found to be 79.42 nm. PL emission spectra of Li 3 PO 4 :Tb 3 + ...

  2. Charge-transfer-based terbium MOF nanoparticles as fluorescent pH sensor for extreme acidity. (United States)

    Qi, Zewan; Chen, Yang


    Newly emerged metal organic frameworks (MOFs) have aroused the great interest in designing functional materials by means of its flexible structure and component. In this study, we used lanthanide Tb 3+ ions and small molecular ligands to design and assemble a kind of pH-sensitive MOF nanoparticle based on intramolecular-charge-transfer effect. This kind of made-to-order MOF nanoparticle for H + is highly specific and sensitive and could be used to fluorescently indicate pH value of strong acidic solution via preset mechanism through luminescence of Tb 3+ . The long luminescence lifetime of Tb 3+ allows eliminating concomitant non-specific fluorescence by time-revised fluorescence techniques, processing an advantage in sensing H + in biological media with strong autofluorescence. Our method showed a great potential of MOF structures in designing and constructing sensitive sensing materials for specific analytes directly via the assembly of functional ions/ligands. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Assessment of terbium (III) as a luminescent probe for the detection of tuberculosis biomarkers

    Energy Technology Data Exchange (ETDEWEB)

    Bamogo, W. [CNRS, IRAMIS, UMR 3685 NIMBE/LEDNA, F-91191 Gif-sur-Yvette (France); Mugherli, L. [CEA, IRAMIS, UMR 3685 NIMBE/LEDNA, F-91191 Gif-sur-Yvette (France); Banyasz, A. [CNRS, IRAMIS, LIDyL/Laboratoire Francis Perrin, URA 2453, F-91191 Gif-sur-Yvette (France); Novelli-Rousseau, A.; Mallard, F. [BioMérieux SA, F-38000 Grenoble (France); Tran-Thi, T.-H., E-mail: [CNRS, IRAMIS, UMR 3685 NIMBE/LEDNA, F-91191 Gif-sur-Yvette (France)


    A detection method for nicotinic acid, a specific metabolite marker of Mycobacterium tuberculosis present in cultures and patients' breath, is studied in complex solutions containing other metabolites and in biological media such as urine, saliva and breath condensate. The method is based on the analysis of the luminescence increase of Tb{sup 3+} complexes in the presence of nicotinic acid due to the energy transfer from the excited ligand to the lanthanide ion. It is shown that other potential markers found in M. tuberculosis culture supernatant, such as methyl phenylacetate, p-methyl anisate, methyl nicotinate and 2-methoxy biphenyl, can interfere with nicotinic acid via a competitive absorption of the excitation photons. A new strategy to circumvent these interferences is proposed with an upstream trapping of volatile markers preceding the detection of nicotinic acid in the liquid phase via the luminescence of Tb{sup 3+} complexes. The cost of the method is evaluated and compared with the Xpert MTB/RIF test endorsed by the World Health Organization. - Highlights: • Nicotinic acid, a specific marker of M. tuberculosis, can be detected via luminescence. • The detection limit with a commercial phosphorimeter is 0.4 µmol·L{sup -1}. • Other metabolites of M. tuberculosis can interfere via absorbed excitation light. • The interference can be removed via trapping of the most volatile metabolites. • A breath analysis procedure's cost is compared with the Xpert TBM/RIF test.

  4. A highly porous luminescent terbium-organic framework for reversible anion sensing

    Energy Technology Data Exchange (ETDEWEB)

    Wong, K.L.; Law, G.L.; Wong, W.T. [Department of Chemistry, The University of Hong Kong, Pokfulam Road, Hong Kong (China); Yang, Y.Y. [School of Chemistry and Chemical Engineering, Sun Yat-Sen University, Guangzhou 510275 (China)


    Unique tailored porous frameworks incorporating a lanthanide metal center have been designed to function as chemical detectors. A flexible multidentate ligand, mucic acid, is used to differentiate between several anions, thus creating an organic framework that is ideally suited for applications in gas separation, sensors, and chemical switches. (Abstract Copyright [2006], Wiley Periodicals, Inc.)

  5. Synthesis and characterization of wide bandgap semiconductors doped with terbium for electroluminescent devices


    Montañez Huamán, Liz Margarita


    En el presente trabajo de investigación se ha estudiado propiedades estequiometrias, estructurales y de emisión de luz de semiconductor de amplio ancho de banda dopados con terbio. La difracción de rayos-X en ángulo rasante confirma el estado amorfo de las películas. Los espectros de absorción infrarroja muestran la formación de óxidos en las películas y la espectroscopia de foto-electrones de rayos-X revela la formación de oxinitruro de aluminio y oxicarburo de silicio. Las pe...

  6. Synthesis and characterization of terbium-doped SrSnO3 pigments

    Czech Academy of Sciences Publication Activity Database

    Dohnalová, Ž.; Gorodylova, N.; Šulcová, P.; Vlček, Milan


    Roč. 40, č. 8 (2014), s. 12637-12645 ISSN 0272-8842 Institutional support: RVO:61389013 Keywords : pigments * solid state reaction * perovskites Subject RIV: CA - Inorganic Chemistry Impact factor: 2.605, year: 2014

  7. An optical material for the detection of β-hydroxybutyrate based on a terbium complex (United States)

    Wang, Xiaomiao; Chen, Huili; Li, Hua


    A novel Tb3+ complex (Tb(C14H10O4)ṡCl, TbL2) based on benzoic acid (L+H) was successfully synthesized, and gave a weak green emission in methanol-water (V:V, 4:1, pH 4.49). With the addition of β-hydroxybutyrate (β-HB) to a semi-aqueous solution of TbL2, an increment of the luminescent intensity at 545 nm assigned to 5D4 → 7F5 transition of Tb3+ was measured, which was evident to the naked eye. The response showed high selectivity for β-HB compared with other common anions including Cl-, NO3-, CO32-, PO43-, HPO42-, HPO4-, CO42-, PO74-, SO42-, lactate, AcO-, citrate, malate therefore it has the potential to be applied as a luminescent sensor for β-HB.

  8. Kaposi’s sarcoma in Brazilian AIDS patients: a study of 144 cases Sarcoma de Kaposi em pacientes com AIDS: estudo de 144 casos


    Birman, Esther G.; SILVEIRA, Fernando R. X.; GODOY, Luzia F.; Catalina R. COSTA


    One hundred and forty-four Brazilian AIDS patients presenting with Kaposi’s sarcoma (KS) were evaluated with respect to the frequency of oral neoplasms and their clinical features. The majority of the patients were young male adults (age range: 21-40 years old), from which 11.1 % presented with oral KS (OKS) exclusively. Oral and skin lesions were associated in 25% of the cases, while only four patients showed association between oral and visceral KS; 49.3% of the cases were exclusively derma...

  9. Kaposi’s sarcoma in Brazilian AIDS patients: a study of 144 cases Sarcoma de Kaposi em pacientes com AIDS: estudo de 144 casos

    Directory of Open Access Journals (Sweden)

    Esther G. BIRMAN


    Full Text Available One hundred and forty-four Brazilian AIDS patients presenting with Kaposi’s sarcoma (KS were evaluated with respect to the frequency of oral neoplasms and their clinical features. The majority of the patients were young male adults (age range: 21-40 years old, from which 11.1 % presented with oral KS (OKS exclusively. Oral and skin lesions were associated in 25% of the cases, while only four patients showed association between oral and visceral KS; 49.3% of the cases were exclusively dermatological. The hard palate was the main site affected, followed by the oropharynx. The localization of KS was found to be similarly frequent in the tongue, gingiva and other sites of the oral mucosa. Candidosis was the prevailing fungal disease; in 20% of the cases it was restricted to the oral mucosa and in 80% it was systemic. No high frequency of paracoccidioidomicosis and cryptococcosis was detected. The prevailing bacterial disease was Tuberculosis and there was only one case of syphilis. Among the viral diseases, the most frequently detected was herpes simplex, followed by molusco contagiosum, condiloma acuminatum and cytomegaloviroses at lower frequencies. Pneumonia caused by Pneumocystes carinii and toxoplasmosis were also identified. The authors emphasise the importance of oral examination in HIV-infected patients bearing in mind several aspects related especially to KS, and stress the need for an interdisciplinary team in the management of these patients, in order to provide better quality of life as well as rapid diagnosis and treatment.Foram estudados pacientes brasileiros portadores de SIDA apresentando sarcoma de Kaposi (SK. O perfil de idade mostrou um grupo com média de idade entre 21 e 40 anos, sendo que 11,1% da amostra apresentava SK exclusivamente na cavidade bucal, observando-se em 25% da amostra uma associação de lesões bucais e na pele. Somente quatro pacientes apresentaram associação de lesões bucais e viscerais, enquanto 49,3% eram portadores de lesões exclusivamente em pele. O palato duro foi a região intrabucal mais afetada, seguida de orofaringe, língua, gengiva entre outras localizações menos freqüentes. Doença fúngica, principalmente candidíase, foi observada exclusivamente na cavidade bucal. Paracoccidioidomicose e criptococose estavam presentes em menor escala. Doenças bacterianas foram representadas quase exclusivamente pela tuberculose, com apenas um caso de sífilis. Entre as doenças virais, herpes simples recidivante foi a mais encontrada, seguida de casos de molusco contagioso, condiloma acuminado e citomegaloviroses, em menor escala. Em relação às doenças causadas por protozoários foram identificados pneumonia por Pneumocystes carinii e toxoplasmose. É enfatizada pelos autores a necessidade de um exame bucal acurado nos portadores de SIDA, tendo em vista os vários aspectos clínicos, principalmente relacionados ao SK. Há uma necessidade de constante atuação interdisciplinar, com vistas não só à obtenção de maior qualidade de vida para esses pacientes bem como para maior rapidez no diagnóstico e tratamento.

  10. Caracterización morfológica de 144 accesiones de Tadehagi triquetrum Morphological charaterization of accessions 144 of Tadehagi triquetrum

    Directory of Open Access Journals (Sweden)

    Carlos Augusto Martínez Mamián


    Full Text Available Se realizó la caracterización morfológica de 114 accesiones de Tadehagi triquetrum provenientes de Tailandia, Vietnam, China, Indonesia y Papúa Nueva Guinea. Dicho material vegetal hace parte del banco de germoplasma del programa de forrajes del Centro Internacional de Agricultura Tropical (CIAT. Estas accesiones se utilizan en alimentación animal e inicialmente fueron sembradas en el invernadero del programa de forrajes del CIAT Palmira y después de 8 semanas se trasplantaron al sitio definitivo en los terrenos de la subestación experimental del CIAT Santander de Quilichao. Cada accesión fue sembrada en una hilera de tres plantas, a las cuales se les realizó descripciones cualitativas y cuantitativas de cada uno de los órganos de la planta (hojas, tallo, inflorescencia, flor, fruto y semilla. Se observaron tres tipos de hojas según la forma; oblongas, ovadas y entre oblongas y ovadas. También se hallaron tres tipos de hábito de crecimiento; erecto, ascendente y postrado. Además se encontró que la especie presenta hojas compuestas, pinnadas con terminación aguda, y peciolo alado, tallos con ramas simpondiales no leñosas, de crecimiento herbáceo, con inflorescencias de tipo racimosas simples axiales y terminales, flores completas con los cuatro verticilos, hermafroditas, de estambres cognados diadelfos y con un promedio de diez estambres por flor, los frutos son legumbres dehiscentes con un promedio de 4 semillas por vaina que se caracterizan por ser tridimensionales con un peso promedio de 0,37 g por 100 semillas.Morphological characterization was performed of 114 accessions of Tadehagi triquetrum from Thailand, Vietnam, China, Indonesia and Papua New Guinea. The plant material is part of genebank fodder program of the International Center for Tropical Agriculture (CIAT. These accessions are used in animal feed and initially were sown in the greenhouse of CIAT forage program Palmira and after 8 weeks were transplanted to the final location on the grounds of the CIAT experimental substation Santander de Quilichao. Each accession was planted in a row of three plants, which were subjected to qualitative and quantitative descriptions of each of the organs of the plant (leaves, stem, inflorescence, flower, fruit and seed. During the morphological description of the accessions were three types of leaves in the form, oblong, ovate and oblong, ovate between. There were also three types of growth habit, erect, ascending and prostrate. It was also found that the species Tadehagi triquetrum has compound leaves, pinnate with acute termination and winged petioles, stems with no branches simpondiales growing woody herb with simple racemose type inflorescences axial and terminal, complete with four flower whorls, hermaphrodites, stamens diadelphous cognates with an average of 10 per flower, the fruits are dehiscent legumes with an average of 4 seeds per pod which are characterized by three-dimensional with an average weight of 0.37 g per 100 seeds.

  11. pH dependent photophysical studies of new europium and terbium complexes of tripodal ligand: Experimental and semiempirical approach

    Energy Technology Data Exchange (ETDEWEB)

    Akbar, Rifat [Department of Chemistry, Sant Longowal Institute of Engineering & Technology, Longowal, Punjab 148106 (India); Baral, Minati [Department of Chemistry, National Institute of Technology Kurukshetra, Haryana 136119 (India); Kanungo, B K, E-mail: [Department of Chemistry, Sant Longowal Institute of Engineering & Technology, Longowal, Punjab 148106 (India)


    The photophysical properties of adduct of a novel nonadentate tripodal ligand, 5,5′-(2-(((8-hydroxyquinolin-5-yl)methylamino)methyl)-2-methylpropane-1, 3-diyl)bis(azanediyl)bis(methylene diquinolin-8-ol, (TAME5OX), with Eu{sup 3+} and Tb{sup 3+} metal ions have been probed for photonics applications. The absorption spectroscopy of these complexes show remarkable spectral changes due to characteristic lanthanide transitions, which support the use of TAME5OX as a sensitive optical pH based sensor to detect Ln{sup 3+} metal ions in biological systems. In addition, these complexes have also been shown to exhibit strong green fluorescence allowing simultaneous sensing within the visible region under physiological pH in competitive medium for both Eu{sup 3+} and Tb{sup 3+} ions. The intense fluorescence from these compounds were revealed to intermittently get quenched under acidic as well as basic conditions due to the photoinduced intramolecular electron transfer from excited 8-hydroxyquinoline (8-HQ) moiety to metal ion, just an opposite process. This renders these compounds the OFF–ON–OFF type of pH-dependent fluorescent sensor. The thermodynamic stability and aqueous coordination chemistry of the chelator with the said lanthanide ions have also been probed by potentiometric, UV–visible and fluorescence spectrophotometric method. TAME5OX has been found to form two protonated complexes [Ln(H{sub 5}L)]{sup 5+} and [Ln(H{sub 4}L)]{sup 4+} below pH 2.5 with both metal ions, which consecutively deprotonates through one proton process with rise of pH. The formation constants (log β{sub 11n}) of neutral complexes have been determined to be 33.51 and 32.16 with pLn (pLn=−log[Ln{sup 3+}]) values of 16.14 and 19.48 for Eu{sup 3+} and Tb{sup 3+} ions, respectively, calculated at pH 7.4, indicating TAME5OX is a good lanthanide synthetic chelator. The emission lifetimes of the Eu{sup 3+} and Tb{sup 3+} complexes recorded in D{sub 2}O and H{sub 2}O suggest the presence of water molecules in the first coordination sphere of the metal ions. NMR titrations were carried out to determine the stoichiometry of chelates. The complexe's coordination geometries were optimized by using PM7 as sparkle/PM7 model. The theoretical electronic behavior was evaluated to support the experimental findings, based on ZINDO/S methodology at configuration interaction with single excitations (CIS) level. These results emphasize the capability of the use of the theoretical models in prediction of geometries and all other calculations of compounds containing lanthanide ions and create new interesting possibilities for the design in-silico of novel and highly efficient lanthanide–organic edifice. - Highlights: • Photophysical behavior of Eu{sup 3+} and Tb{sup 3+} complexes of TAME5OX has been investigated. • This tripodal ligand forms thermodynamically stable Ln{sup 3+} complexes. • These compounds exhibit strong green fluorescence under physiological pH. • Green fluorescence gets quenched under acidic and basic conditions, due to PET process. • This renders these compounds the OFF–ON–OFF type of pH-dependent fluorescent sensors.

  12. Visible photoluminescence in polycrystalline terbium doped aluminum nitride (Tb:AlN) ceramics with high thermal conductivity (United States)

    Wieg, A. T.; Kodera, Y.; Wang, Z.; Imai, T.; Dames, C.; Garay, J. E.


    Thermal management continues to be one of the major challenges in the development of high powered light sources such as solid state lasers. In particular, the relatively low thermal conductivity of standard photoluminescent (PL) materials limits the overall power output and/or duty cycle. We present a method based on current activated pressure assisted densification for the fabrication of high thermal conductivity PL materials: rare earth doped polycrystalline bulk aluminum nitride. Specifically, the ceramics are translucent and are doped with Tb3+, allowing for emission in the visible. Remarkably, the ceramics have a room temperature thermal conductivity of 94 W/(m K) which is almost seven times higher than that of the state of the art host material, Nd-doped yttrium aluminum garnet. These light emitting properties coupled with very high thermal conductivity should enable the development of a wide variety of more powerful light sources.

  13. Preparation of extractive resins for producing terbium-161; Preparacion de resinas extractivas para produccion de terbio-161

    Energy Technology Data Exchange (ETDEWEB)

    De la Cruz B, C. C.; Monroy G, F. [ININ, Carretera Mexico-Toluca s/n, 52750 Ocoyoacac, Estado de Mexico (Mexico)], e-mail:


    This paper presents the development of a methodology for extractive resins preparation to base of HDEHP, which allows to separation of Tb from Gd generating an own technology of preparation of these resins. The study included the extractive resins preparation from 6 different supports: kieselguhr Dg, alumina, red volcanic rock, chiluca, quarry and fluorite; two treatment types of of supports and varied concentrations of HDEHP extractant (di(2-etil hexyl) orthophosphoric acid), in order to determine which resin has improved efficiency of Gd and Tb separation, and radionuclide purity of {sup 161}Tb. Resins were prepared to base of kieselguhr to determine the most appropriate silicon deposition process. Two silicon deposition treatments were realized: treatment I , by contact with silicon deposition solution (dimethyldichlorosilane / heptane 1:30) and treatment II by contact with vapors of dimethyldichlorosilane in vacuum. The extractant retention was carried out to different concentrations of HDEHP / acetone: 1:4, 1:8, 1:15, 1:20, 1:30 and 1:40. According to the results, there is not direct relation of HDEHP concentration used in extractive resins preparation to base of kieselguhr over the efficiency of Gd and Tb separation and of radionuclide purity of {sup 161}Tb. The effect of support in the efficiency of Gd and Tb separation was studied to prepare resins with the supports kieselguhr, alumina, quarry, chiluca, volcanic rock and fluorite, using the silicon deposition treatment II for the supports and a concentration of HDEHP / acetone 1:20, for extractant retention. Only resins based on kieselguhr could separate to Gd from Tb quantitatively, the resin at a concentration of HDEHP / Acetone 1:20 was the best results obtained in Gd and Tb separation, achieving a separation efficiency greater than 90% and a radionuclide purity higher than 99%. (Author)

  14. Synthesis and Characterization of Europium(III) and Terbium(III) Complexes: An Advanced Undergraduate Inorganic Chemistry Experiment (United States)

    Swavey, Shawn


    Undergraduate laboratories rarely involve lanthanide coordination chemistry. This is unfortunate in light of the ease with which many of these complexes are made and the interesting and instructive photophysical properties they entail. The forbidden nature of the 4f transitions associated with the lanthanides is overcome by incorporation of…

  15. Sensitized green emission of terbium with dibenzoylmethane and 1, 10 phenanthroline in polyvinyl alcohol and polyvinyl pyrrolidone blends (United States)

    Kumar, Brijesh; Kaur, Gagandeep; Rai, S. B.


    Tb doped polyvinyl alcohol: polyvinyl pyrrolidone blends with dibenzoylmethane (DBM) and 1, 10 Phenanthroline (Phen) have been prepared by solution cast technique. Bond formation amongst the ligands and Tb3 + ions in the doped polymer has been confirmed employing Fourier Transform Infrared (FTIR) techniques. Optical properties of the Tb3 + ions have been investigated using UV-Vis absorption, excitation and fluorescence studies excited by different radiations. Addition of dimethylbenzoate and 1, 10 Phenanthroline to the polymer blend increases the luminescence from Tb3 + ions along with energy transfer from the polymer blend itself. Luminescence decay curve analysis affirms the non-radiative energy transfer from DBM and Phen to Tb3 + ions, which is identified as the reason behind this enhancement. The fluorescence decay time of PVA-PVP host decreases from 6.02 ns to 2.31 ns showing an evidence of energy transfer from the host blend to the complexed Tb ions. Similarly the lifetime of DBM and Phen and both in the blend reduces in the complexed system showing the feasibility of energy transfer from these excited DBM and Phen to Tb3 + and is proposed as the cause of the above observations. These entire phenomena have been explained by the energy level diagram.

  16. A Terbium Metal-Organic Framework for Highly Selective and Sensitive Luminescence Sensing of Hg2+Ions in Aqueous Solution. (United States)

    Xia, Tifeng; Song, Tao; Zhang, Gege; Cui, Yuanjing; Yang, Yu; Wang, Zhiyu; Qian, Guodong


    A series of isomorphic lanthanide metal-organic frameworks (MOFs) Ln(TATAB)⋅(DMF) 4 (H 2 O)(MeOH) 0.5 (LnTATAB, Ln=Eu, Tb, Sm, Dy, Gd; H 3 TATAB=4,4',4''-s-triazine-1,3,5-triyltri-p-aminobenzoic acid) have been solvothermally synthesized and structurally characterized. Among these MOFs, TbTATAB exhibits good water stability and a high fluorescence quantum yield. Because mercury ions (Hg 2+ ) have a high affinity to nitrogen atoms, and the space between multiple nitrogen atoms from triazine and imino groups is suitable for interacting with Hg 2+ ions, TbTATAB shows highly selective and sensitive detection of Hg 2+ in aqueous solution with a detection limit of 4.4 nm. Furthermore, it was successfully applied to detect Hg 2+ ions in natural water samples. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Atomistic simulations of anionic Au-144(SR)(60) nanoparticles interacting with asymmetric model lipid membranes

    DEFF Research Database (Denmark)

    Heikkila, E.; Martinez-Seara, H.; Gurtovenko, A. A.


    , it forms relatively weak contacts with the zwitterionic head groups (in particular choline) of the phosphatidylcholine lipids. Consequently, AuNP- does not immerse deeply in the leaflet, enabling, e.g., lateral diffusion of the nanoparticle along the surface. On the cytosolic side, AuNP- remains...

  18. 40 CFR 421.144 - Standards of performance for new sources. (United States)


    ... 40 Protection of Environment 28 2010-07-01 2010-07-01 true Standards of performance for new... monthly average mg/kg (pounds per million pounds) of antimony contained in sodium antimonate product... (1) (1) 1 Within the range of 7.5 to 10.0 at all times. (b) Fouled Anolyte. NSPS for the Primary...

  19. Page 1 144 M S Raghunathan and A Ramanathan Proof. The ...

    Indian Academy of Sciences (India)

    trivialisation extending A, x T- H. The point in this is that the torus Twhich a priori k sits in T gets identified as a subtorus of G by evaluation at xo and the morphism of tori. Int #:T-S, when Tand S are considered as subtori of G coincides with the restriction of the inner automorphism Intºſ(x0) of G. This completes the proof of ...

  20. 76 FR 144 - Agency Information Collection Activities; Submission for OMB Review; Comment Request; Extension (United States)


    ... requirements described below has been submitted to the Office of Management and Budget (``OMB'') for review, as... requiring used car dealers to disclose information about warranty coverage, if any, and the mechanical... information about warranty coverage. Request for Comments Under the Paperwork Reduction Act (``PRA''), 44 U.S...

  1. 40 CFR 144.61 - Definitions of terms as used in this subpart. (United States)


    ... capital means current assets minus current liabilities. Net worth means total assets minus total... after deducting liabilities; such assets would not include intangibles such as goodwill and rights to...

  2. 28 CFR 14.4 - Administrative claims; evidence and information to be submitted. (United States)


    ... last employment or occupation. (3) Full names, addresses, birth dates, kinship, and marital status of... and suffering prior to death are claimed, a physician's detailed statement specifying the injuries... condition in the interval between injury and death. (8) Any other evidence or information which may have a...

  3. 17 CFR 230.144A - Private resales of securities to institutions. (United States)


    ... participations; repurchase agreements; securities owned but subject to a repurchase agreement; and currency, interest rate and commodity swaps. (3) The aggregate value of securities owned and invested on a...

  4. Timing Results Using an FPGA-Based TDC with Large Arrays of 144 SiPMs (United States)

    Aguilar, A.; González, A. J.; Torres, J.; García-Olcina, R.; Martos, J.; Soret, J.; Conde, P.; Hernández, L.; Sánchez, F.; Benlloch, J. M.


    Silicon photomultipliers (SiPMs) have become an alternative to traditional tubes due to several features. However, their implementation to form large arrays is still a challenge especially due to their relatively high intrinsic noise, depending on the chosen readout. In this contribution, two modules composed of 12 ×12 SiPMs with an area of roughly 50 mm×50 mm are used in coincidence. Coincidence resolving time (CRT) results with a field-programmable gate array, in combination with a time to digital converter, are shown as a function of both the sensor bias voltage and the digitizer threshold. The dependence of the CRT on the sensor matrix temperature, the amount of SiPM active area and the crystal type is also analyzed. Measurements carried out with a crystal array of 2 mm pixel size and 10 mm height have shown time resolutions for the entire 288 SiPM two-detector set-up as good as 800 ps full width at half maximum (FWHM).

  5. 40 CFR 144.86 - What are the definitions I need to know? (United States)


    ... approval a program that sets out how States will conduct local assessments, including: delineating the... Protection Program, States will begin to conduct local assessments for each public water system in their..., hospitals or nursing homes, office buildings, and other facilities. (f) Delineation. Once a State's Drinking...

  6. 49 CFR 173.144 - Other Regulated Materials (ORM)-Definitions. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Other Regulated Materials (ORM)-Definitions. 173... Materials (ORM)—Definitions. For the purpose of this subchapter, “ORM-D material” means a material such as a... which exceptions are provided in the § 172.101 table. Each ORM-D material and category of ORM-D material...

  7. 27 CFR 478.144 - Relief from disabilities under the Act. (United States)


    ..., TOBACCO, FIREARMS, AND EXPLOSIVES, DEPARTMENT OF JUSTICE FIREARMS AND AMMUNITION COMMERCE IN FIREARMS AND... record (Department of Defense Form 214), charge sheet (Department of Defense Form 458), and final court...

  8. Page 1 144 K. KonDAL REDDY AND N. V. SUBBA RAO N-benzyl ...

    Indian Academy of Sciences (India)

    In 5 (or 6)-nitro benzimidazoles, the electronegative nitro group should stabilise the ... reduced. And the tautomer (Ia) to the extent present, decidedly being more reactive ... N-methyl-2, 5-dinitro aniline-2, 5-dinitro aniline (10 g. with methyl ...

  9. 25 CFR 170.144 - What are eligible highway safety projects? (United States)


    ..., defensive driving, and Mothers Against Drunk Drivers; (h) Development of a highway safety plan designed to reduce traffic accidents and deaths, injuries, and property damage; (i) Collecting data on traffic-related deaths, injuries and accidents; (j) Impaired driver initiatives; (k) Child safety seat programs...

  10. 40 CFR 144.63 - Financial assurance for plugging and abandonment. (United States)


    ... and abandonment expenditures by submitting itemized bills to the Regional Administrator. Within 60 days after receiving bills for plugging and abandonment activities, the Regional Administrator will...) Notices of nonpayment as required by the trust agreement. (4) The bond must guarantee that the owner or...

  11. 40 CFR 98.144 - Monitoring and QA/QC requirements. (United States)


    ... testing method published by an industry consensus standards organization (e.g., ASTM, ASME, API, etc.). ... certified laboratory using ASTM D3682-01 (Reapproved 2006) Standard Test Method for Major and Minor Elements...

  12. Yeast Interacting Proteins Database: YMR032W, YER144C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available required for cytokinesis; regulates actomyosin ring dynamics and septin localization; interacts with the formins...required for cytokinesis; regulates actomyosin ring dynamics and septin localization; interacts with the formins

  13. Yeast Interacting Proteins Database: YER144C, YMR032W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available required for cytokinesis; regulates actomyosin ring dynamics and septin localization; interacts with the formins...required for cytokinesis; regulates actomyosin ring dynamics and septin localization; interacts with the formins

  14. 87Sr/ 86Sr, 143Nd/ 144Nd and REEs in Silurian phosphatic fossils (United States)

    Bertram, C. J.; Elderfield, H.; Aldridge, R. J.; Conway Morris, S.


    The feasibility of using the chemistry of phosphatic fossil material to trace palaeo-seawater composition for the Silurian has been evaluated. Contrary to Recent material, fossil fish are shown to be unreliable for Sr isotope stratigraphy. Conodonts, however, may be used by employing 0.2M HNO 3 dissolution, except for samples showing degrees of thermal maturation greater than colour alteration index (CAI) values of 2.5. Samples from the same stratigraphic levels from the U.K., Czechoslovakia, Gotland and the U.S.A. gave similar 87Sr/ 86Sr ratios, suggesting that they have recorded the original seawater value. Significant inter-specific differences occur in REE concentrations and Nd isotopic compositions of conodont elements, and Ce and Eu anomalies vary with REE content. This suggests that artefacts are introduced at the same time that large amounts of REEs are incorporated into the apatite. Preliminary results for the Sr isotopic composition of Silurian seawater are presented. Values are generally lower than previously suggested, showing an increase in 87Sr/ 86Sr from ˜ 0.70825 at 435 Ma rising to ˜ 0.70875 at 418 Ma and levelling off in the Late Silurian. The overall rate of increase in seawater ratio is about2-3 × 10 -5 Ma -1 and can be accounted for by the widespread decrease in volcanism compared with the Ordovician; a proportionally greater flux of Sr to the oceans from continental erosion of only ˜ 10% would account for the long-term increase in seawater 87Sr/ 86Sr ratio throughout the Silurian.

  15. The assessment of REE patterns and 143Nd/ 144Nd ratios in fish remains (United States)

    Grandjean, Patricia; Cappetta, Henri; Michard, Annie; Albarède, Francis


    The REE content and isotopic composition of Sr and Nd have been determined in fish teeth ranging in age from the Trias to the present and from various localities mostly around the Atlantic. These measurements have been carried out on Selachian and Teleost remains from the same locality in Togo and show no appreciable difference, which suggests, with the help of a mass balance calculation of the Ce anomaly, that diagenetic effects are not responsible for the REE enrichment of biogenic phosphates. One group of fossil teeth has about 3 times the REE abundances of shale and a shale-normalized pattern with a minimum at Sm: it is thought to reflect deposition in the open-sea environment. A second group has REE concentration about 10 times higher than the first group with either a regular light REE enrichment or, more frequently, a maximum in the middle REE, both being probably indicative of deposition in estuarine or near-shore conditions. The shape of the REE spectra and the size of the Ce anomaly can be used semi-quantitatively to determine the depth of deposition. The results presented here on Late Cretaceous/Eocene fish teeth samples from Morocco reflect an increasing influx of deep waters with a lowLa/Yb ratio and strong negative Ce anomaly, which agrees well with the evolution of sediment chemistry and microfauna associations. In contrast, ɛ Nd is typical of the water mass in which the fish debris decayed. Examples of nearly isolated basins identified with Nd isotopes include the South Atlantic prior to the Lutetian (ɛ Nd ≈ -13.5), the Miocene Persian Gulf (ɛ Nd = -3.1), and Bolivia during the Late Cretaceous (ɛ Nd = -12.8). Togo and Guinea-Bissau results suggest that, in the South Atlantic, the meridional oceanic circulation had not started before 45 Ma ago. Combination of REE andɛ Nd data suggests that the assignment of Jurassic-Cretaceous samples measured so far to open-sea water masses is still ambiguous.

  16. Yeast Interacting Proteins Database: YGR113W, YIL144W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available indle checkpoint activity, kinetochore assembly and clustering Rows with this prey as prey (2) Rows with thi...heckpoint activity, kinetochore assembly and clustering Rows with this prey as pr

  17. Yeast Interacting Proteins Database: YOL069W, YIL144W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available complex (Ndc80p-Nuf2p-Spc24p-Spc25p); involved in chromosome segregation, spindle checkpoint activity and kinetochore clustering...vity, kinetochore assembly and clustering Rows with this prey as prey (2) Rows with this prey as bait (0) 12...-Nuf2p-Spc24p-Spc25p); involved in chromosome segregation, spindle checkpoint activity and kinetochore clustering...d coiled-coil protein involved in chromosome segregation, spindle checkpoint activity, kinetochore assembly and clustering

  18. SU-F-J-144: Scatter and Leakage Survey of An Integrated MR-Linac System

    Energy Technology Data Exchange (ETDEWEB)

    Wang, J; Bosco, G; Darenbourg, B; Ibbott, G [UT MD Anderson Cancer Center, Houston, TX (United States)


    Purpose: To assess the scatter and leakage radiation of an integrated 1.5T MRI-Linac system. Methods: A 150cc chamber (model 96020C, Inovision) was used in all the scatter and leakage measurements, after being recalibrated for MV energy by the Accredited Dosimetry Calibration Laboratory at MD Anderson. The scatter radiation was measured by placing a 25 cm stack of solid-water materials at iso-center on the patient couch to simulate patient scatter. Gantry angles were positioned at 0 degree (beam pointing downward) and 270 (beam pointing laterally). Scatter radiation was measured at selective locations inside the RF room. Beam stopper leakage was measured at the exterior panel of the gantry. The head leakage was measured at 1 meter away from the Linac head in the direction which was determined to be the area of maximum leakage by wrapped films test. All measurements were repeated with the 1.5T magnetic field turned off to study the effect of magnetic field. Results: When the magnet was on (B=1.5T), the maximum head leakage at 1 meter was 191.6mR/1000MU. The scatter radiation at 1 meter from the iso-center was 1.091R/1000MU when the radiation beam was pointing downward, 1.296R/1000MU when the beam pointed laterally. The beam stopper leakage was measured as 299.4 mR/1000MU at the exterior panel of the gantry. When magnet was off (B=0), the head leakage was measured as 198.6mR/1000MU. The scatter radiation at 1 meter was 1.153R/1000MU when beam pointed downward, 1.287R/1000MU when beam pointed laterally. The beam stopper leakage was measured as 309.4 mR/1000MU at the exterior panel of the gantry. Conclusion: The measurements indicate that the scatter and leakage radiation from the integrated MR-Linac system are in-line with the expected values. The beam stopper leakage is approximately 300 mR/1000MU. The leakage and scatter difference with the magnetic field ON and OFF was within 5%. The authors received a corporate sponsored grant from Elekta which is the vendor of the MR-Linac system studied in this work.

  19. Insight into 144 patients with ocular vascular events during VEGF antagonist injections


    Shami M; Parodi MB; Mansour AM; Kofoed PK; Shahin M; Schwartz SG


    Ahmad M Mansour1, Maha Shahin2, Peter K Kofoed3, Maurizio B Parodi4, Michel Shami5, Stephen G Schwartz6, Collaborative Anti-VEGF Ocular Vascular Complications GroupDepartment of Ophthalmology, 1American University of Beirut, Beirut, Lebanon, Rafic Hariri University Hospital, Beirut, Lebanon; 2Mansoura University, Mansoura City, Egypt; 3Glostrup Hospital, University of Copenhagen, Denmark, National Eye Clinic, Kennedy Center, Glostrup, Denmark; 4University Vita-Salute, Scientific Institute San...

  20. SU-F-T-144: Analytical Closed Form Approximation for Carbon Ion Bragg Curves in Water

    Energy Technology Data Exchange (ETDEWEB)

    Tuomanen, S; Moskvin, V; Farr, J [St. Jude Children’s Research Hospital, Memphis, TN (United States)


    Purpose: Semi-empirical modeling is a powerful computational method in radiation dosimetry. A set of approximations exist for proton ion depth dose distribution (DDD) in water. However, the modeling is more complicated for carbon ions due to fragmentation. This study addresses this by providing and evaluating a new methodology for DDD modeling of carbon ions in water. Methods: The FLUKA, Monte Carlo (MC) general-purpose transport code was used for simulation of carbon DDDs for energies of 100–400 MeV in water as reference data model benchmarking. Based on Thomas Bortfeld’s closed form equation approximating proton Bragg Curves as a basis, we derived the critical constants for a beam of Carbon ions by applying models of radiation transport by Lee et. al. and Geiger to our simulated Carbon curves. We hypothesized that including a new exponential (κ) residual distance parameter to Bortfeld’s fluence reduction relation would improve DDD modeling for carbon ions. We are introducing an additional term to be added to Bortfeld’s equation to describe fragmentation tail. This term accounts for the pre-peak dose from nuclear fragments (NF). In the post peak region, the NF transport will be treated as new beams utilizing the Glauber model for interaction cross sections and the Abrasion- Ablation fragmentation model. Results: The carbon beam specific constants in the developed model were determined to be : p= 1.75, β=0.008 cm-1, γ=0.6, α=0.0007 cm MeV, σmono=0.08, and the new exponential parameter κ=0.55. This produced a close match for the plateau part of the curve (max deviation 6.37%). Conclusion: The derived semi-empirical model provides an accurate approximation of the MC simulated clinical carbon DDDs. This is the first direct semi-empirical simulation for the dosimetry of therapeutic carbon ions. The accurate modeling of the NF tail in the carbon DDD will provide key insight into distal edge dose deposition formation.

  1. Anexos PID 16/17_144_Santamaría et al.


    Santamaría Ciordia, Leticia



  2. 40 CFR 144.39 - Modification or revocation and reisssuance of permits. (United States)


    ... determines good cause exists for modification of a compliance schedule, such as an act of God, strike, flood... causes listed in paragraphs (a) and (b) of this section for modification or revocation and reissuance or both exist. If cause exists, the Director may modify or revoke and reissue the permit accordingly...

  3. 46 CFR 502.144 - Notice of time and place of hearing; postponement of hearing. (United States)


    ... 46 Shipping 9 2010-10-01 2010-10-01 false Notice of time and place of hearing; postponement of... and place of hearing; postponement of hearing. (a) Notice of hearing will designate the time and place..., or electronic mail. (b) Motions for postponement of any hearing date shall be filed in accordance...

  4. Measurement Instruments for Assessing the Performance of Professional Learning Communities. REL 2016-144 (United States)

    Blitz, Cynthia L.; Schulman, Rebecca


    For more than a decade education practitioners have promoted the professional learning community (PLC) as an effective way to provide professional development to teachers. As more PLCs are established in schools and districts nationwide, education stakeholders--researchers, practitioners, administrators, and policymakers--are interested in…

  5. Caracterización morfológica de 144 accesiones de Tadehagi triquetrum

    Directory of Open Access Journals (Sweden)

    Martínez Mamián Carlos Augusto


    Full Text Available

    Se realizó la caracterización morfológica de 114 accesiones de Tadehagi triquetrum provenientes de Tailandia, Vietnam, China, Indonesia y Papúa Nueva Guinea. Dicho material vegetal hace parte del banco de germoplasma del programa de forrajes del Centro Internacional de Agricultura Tropical (CIAT. Estas accesiones se utilizan en alimentación animal e inicialmente fueron sembradas en el invernadero del programa de forrajes del CIAT Palmira y después de 8 semanas se trasplantaron al sitio definitivo en los terrenos de la subestación experimental del CIAT Santander de Quilichao. Cada accesión fue sembrada en una hilera de tres plantas, a las cuales se les realizó descripciones cualitativas y cuantitativas de cada uno de los órganos de la planta (hojas, tallo, inflorescencia, flor, fruto y semilla.

    Se observaron tres tipos de hojas según la forma; oblongas, ovadas y entre oblongas y ovadas. También se hallaron tres tipos de hábito de crecimiento; erecto, ascendente y postrado. Además se encontró que la especie presenta hojas compuestas, pinnadas con terminación aguda, y peciolo alado, tallos con ramas simpondiales no leñosas, de crecimiento herbáceo, con inflorescencias de tipo racimosas simples axiales y terminales, flores completas con los cuatro verticilos, hermafroditas, de estambres cognados diadelfos y con un promedio de diez estambres por flor, los frutos son legumbres dehiscentes con un promedio de 4 semillas por vaina que se caracterizan por ser tridimensionales con un peso promedio de 0,37 g por 100 semillas.

  6. Caracterización morfológica de 144 accesiones de Tadehagi triquetrum

    Directory of Open Access Journals (Sweden)

    Carlos Augusto Martínez Mamián


    Full Text Available Se realizó la caracterización morfológica de 114 accesiones de Tadehagi triquetrum provenientes de Tailandia, Vietnam, China, Indonesia y Papúa Nueva Guinea. Dicho material vegetal hace parte del banco de germoplasma del programa de forrajes del Centro Internacional de Agricultura Tropical (CIAT. Estas accesiones se utilizan en alimentación animal e inicialmente fueron sembradas en el invernadero del programa de forrajes del CIAT Palmira y después de 8 semanas se trasplantaron al sitio definitivo en los terrenos de la subestación experimental del CIAT Santander de Quilichao. Cada accesión fue sembrada en una hilera de tres plantas, a las cuales se les realizó descripciones cualitativas y cuantitativas de cada uno de los órganos de la planta (hojas, tallo, inflorescencia, flor, fruto y semilla. Se observaron tres tipos de hojas según la forma; oblongas, ovadas y entre oblongas y ovadas. También se hallaron tres tipos de hábito de crecimiento; erecto, ascendente y postrado. Además se encontró que la especie presenta hojas compuestas, pinnadas con terminación aguda, y peciolo alado, tallos con ramas simpondiales no leñosas, de crecimiento herbáceo, con inflorescencias de tipo racimosas simples axiales y terminales, flores completas con los cuatro verticilos, hermafroditas, de estambres cognados diadelfos y con un promedio de diez estambres por flor, los frutos son legumbres dehiscentes con un promedio de 4 semillas por vaina que se caracterizan por ser tridimensionales con un peso promedio de 0,37 g por 100 semillas.

  7. 40 CFR 144.28 - Requirements for Class I, II, and III wells authorized by rule. (United States)


    ...; (iii) External pressure, internal pressure, and axial loading; (iv) Hole size; (v) Size and grade of... proposed test or measurement to be made; (D) The amount, size, and location (by depth) of casing to be left... casing and cementing requirements, the following factors shall be considered: (i) Depth to the injection...

  8. 40 CFR 144.89 - How do I close my Class V injection well? (United States)


    ... history and records showing proper waste disposal. The use of a semi-permanent plug as the means to... cesspool or motor vehicle waste disposal well, you must plug or otherwise close the well in a manner that...) of a motor vehicle waste disposal well to another type of Class V well. Motor vehicle wells may only...

  9. Page 1 144 V V Karisovnik et all links make a major contribution to ...

    Indian Academy of Sciences (India)

    links make a major contribution to the SQUID output noise. To improve the quality of ceramics, other methods of weak link preparation are required. This paper presents the results of our work on making If. HTSC SQUIDs and. SQUID-based magnetometers. 2. Weak link formation by scribing. Our first HTSC rif.

  10. Review: Diario de campo. Izquierdo Chaparro, R. (2013. Madrid: Caballo de Troya. 144 pp.

    Directory of Open Access Journals (Sweden)

    Soledad García Gómez


    Full Text Available The draft of a qualitative research report is the product of a hard and exciting task that involves a rigorous analysis of data  collected applying such techniques as the interview. To give sense to the textual data collected or to let the meanings of the data arise is a challenge, from the point of view of the scientific community that holds an interpretative or critical research paradigm. The later writing of the final report is also an important task because it will be the testimony or witness of the work done and of all the findings.

  11. 20 CFR 220.144 - Evaluation guides for a self-employed claimant. (United States)


    ... performed in making managerial decisions about the production of the crop, such as when to plant, cultivate... hours, skills, energy output, efficency, duties, and responsibilities, is comparable to that of... the claimant materially participates in the production or the management of the production of the...

  12. 14.4 ‘Innovation for speech language pathology’ - a new educational seminar


    Kogovšek, Damjana; Umanski, Daniil


    ‘Innovation for SLP’ is a semester-long educational seminar we have recently developed for advanced speech language pathology (SLP) students in Slovenia. The seminar is designed to provide students with tools for creative problem solving in their future professional environment.

  13. CCDC 954774: Experimental Crystal Structure Determination : Dimethylammonium tri-terbium tris(4'-(tetrazol-2-id-5-yl)biphenyl-4-carboxylate) tetrahydroxide trihydrate unknown solvate

    KAUST Repository

    Xue, Dongxu


    An entry from the Cambridge Structural Database, the world’s repository for small molecule crystal structures. The entry contains experimental data from a crystal diffraction study. The deposited dataset for this entry is freely available from the CCDC and typically includes 3D coordinates, cell parameters, space group, experimental conditions and quality measures.

  14. CCDC 959634: Experimental Crystal Structure Determination : octakis(mu~3~-Hydroxo)-undecakis(mu~2~-2-fluorobenzoato)-(N,N-dimethylformamide)-nitrato-hexa-aqua-hexa-terbium

    KAUST Repository

    Guillerm, Vincent


    An entry from the Cambridge Structural Database, the world’s repository for small molecule crystal structures. The entry contains experimental data from a crystal diffraction study. The deposited dataset for this entry is freely available from the CCDC and typically includes 3D coordinates, cell parameters, space group, experimental conditions and quality measures.

  15. CCDC 954773: Experimental Crystal Structure Determination : Dimethylammonium tri-terbium tris(4-(tetrazol-2-id-5-yl)benzoate) tetrahydroxide trihydrate unknown solvate

    KAUST Repository

    Xue, Dongxu


    An entry from the Cambridge Structural Database, the world’s repository for small molecule crystal structures. The entry contains experimental data from a crystal diffraction study. The deposited dataset for this entry is freely available from the CCDC and typically includes 3D coordinates, cell parameters, space group, experimental conditions and quality measures.

  16. CCDC 954775: Experimental Crystal Structure Determination : Dimethylammonium tri-terbium tris(2-fluoro-4-(1H-tetrazol-5-yl)benzoate) tetrahydroxide tetradecahydrate

    KAUST Repository

    Xue, Dongxu


    An entry from the Cambridge Structural Database, the world’s repository for small molecule crystal structures. The entry contains experimental data from a crystal diffraction study. The deposited dataset for this entry is freely available from the CCDC and typically includes 3D coordinates, cell parameters, space group, experimental conditions and quality measures.

  17. CCDC 1411423: Experimental Crystal Structure Determination : catena-[dimethylammonium hexakis(mu-fumarato)-octakis(mu-hydroxo)-hexa-terbium N,N-dimethylformamide solvate hexahydrate

    KAUST Repository

    Assen, Ayalew H.


    An entry from the Cambridge Structural Database, the world’s repository for small molecule crystal structures. The entry contains experimental data from a crystal diffraction study. The deposited dataset for this entry is freely available from the CCDC and typically includes 3D coordinates, cell parameters, space group, experimental conditions and quality measures.

  18. CCDC 1410946: Experimental Crystal Structure Determination : catena-[dimethylammonium tris(mu-naphthalene-1,4-dicarboxylato)-tetrakis(mu-hydroxo)-triaqua-tri-terbium(iii) unknown solvate

    KAUST Repository

    Xue, Dongxu


    An entry from the Cambridge Structural Database, the world’s repository for small molecule crystal structures. The entry contains experimental data from a crystal diffraction study. The deposited dataset for this entry is freely available from the CCDC and typically includes 3D coordinates, cell parameters, space group, experimental conditions and quality measures.

  19. Phthalimides: Supramolecular Interactions in Crystals, Hypersensitive Solution 1H-NMR Dynamics and Energy Transfer to Europium(III and Terbium(III States

    Directory of Open Access Journals (Sweden)

    David J. Williams


    Full Text Available Detailed crystal structures and 1H-NMR characteristics of some alkylaminephthalimides, including dendritic polyphthalimides, are reported. These investigations were undertaken in order to obtain a better understanding of the relationship between solid-state supramolecular interactions, their persistence in solution and associated dynamics of magnetically hypersensitive phthalimide aromatic AA'BB'-AA'XX' proton NMR resonances. Some alkylamine phthalimides feature folded molecular geometries, which we attribute to n-π interactions among proximal amine-phthalimide sites; those alkylamine-phthalimides that have no possibility for such interactions feature fully extended phthalimide functionalities. Accordingly, alkylamine phthalimide compounds with folded solid-state geometries feature solvent and temperature dependent hypersensitive AA'BB'-AA'XX' 1H-NMR line profiles, which we attribute to the n-π interactions. Luminescence of Eu3+(5D0 and Tb3+(5D4 states show well defined metal ion environments in their complexes with dendritic phthalimides, as well as relatively weak phthalimide-lanthanide(III interactions.

  20. Analysis of tryptophan at nmoll(-1) level based on the fluorescence enhancement of terbium-gadolinium-tryptophan-sodium dodecyl benzene sulfonate system. (United States)

    Liu, Shufang; Yang, Jinghe; Wu, Xia; Su, Benyu; Sun, Changxia; Wang, Feng


    It is found that Tb(3+) can react with tryptophan (Trp) and sodium dodecyl benzene sulfonate (SDBS), and emits the intrinsic fluoresence of Tb(3+). The fluorescence intensity can be enhanced by La(3+), Gd(3+), Lu(3+), Sc(3+) and Y(3+), among which Gd(3+) has the greatest enhancement. This is a new co-luminescence system. The studies indicate that in the Tb-Gd-Trp-SDBS system, there is both Tb-Trp-SDBS and Gd-Trp-SDBS complexes, and they aggregate together and form a large congeries. The fluorescence enhancement of the Tb-Gd-Trp-SDBS system is considered to originate from intramolecular and intermolecular energy transfers, and the energy-insulating sheath effect of Gd-Trp-SDBS complex. Under the optimum conditions, the enhanced intensity of fluorescence is in proportion to the concentration of Trp in the range from 4x10(-8) to 4x10(-5)moll(-1). The detection limit is 10(-9)moll(-1). The proposed method is one of the most sensitive fluoremetries of Trp.

  1. Preparation, characterization, and properties of PMMA-doped polymer film materials: a study on the effect of terbium ions on luminescence and lifetime enhancement. (United States)

    Zhang, Hui-Jie; Fan, Rui-Qing; Wang, Xin-Ming; Wang, Ping; Wang, Yu-Lei; Yang, Yu-Lin


    Poly(methylmethacrylate) (PMMA) doped with Tb-based imidazole derivative coordination polymer {[Tb(3)(L)(μ(3)-OH)(7)]·H(2)O}(n) (1) (L = N,N'-bis(acetoxy)biimidazole) was synthesized and its photophysical properties were studied. The L'(L' = N,N'-bis(ethylacetate)biimidazole) ligand was synthesized by an N-alkylation reaction process followed by ester hydrolysis to produce ligand L. Polymer 1 and ligand L' have been characterized by (1)H NMR and IR spectroscopy, elemental analysis, PXRD and X-ray single-crystal diffraction. Coordination polymer 1 is the first observation of a CdCl(2) structure constructed with hydroxy groups and decorated by ligand L in lanthanide N-heterocyclic coordination polymers. In the 2D layered structure of 1, each Tb3 metal center is connected with three Tb1 and three Tb2 metal centers by seven hydroxyl groups in different directions, resulting in a six-membered ring. After doping, not only the luminescence intensity and lifetime enhanced, but also their thermal stability was increased in comparison with 1. When 1 was doped into poly(methylmethacrylate) (1@PMMA), polymer film materials were formed with the PMMA polymer matrix (w/w = 2.5%-12.5%) acting as a co-sensitizer for Tb(3+) ions. The luminescence intensity of the Tb(3+) emission at 544 nm increases when the content of Tb(3+) was 10%. The lifetime of 1@PMMA (914.88 μs) is more than four times longer than that of 1 (196.24 μs). All τ values for the doped polymer systems are higher than coordination polymer 1, indicating that radiative processes are operative in all the doped polymer films. This is because PMMA coupling with the O-H oscillators from {[Tb(3)(L)(μ(3)-OH)(7)]·H(2)O}(n) can suppress multiphonon relaxation. According to the variable-temperature luminescence (VT-luminescence) investigation, 1@PMMA was confirmed to be a stable green luminescent polymer film material.

  2. Changing Single-Molecule Magnet Properties of a Windmill-Like Distorted Terbium(III) α-Butoxy-Substituted Phthalocyaninato Double-Decker Complex by Protonation/Deprotonation. (United States)

    Horii, Yoji; Horie, Yusuke; Katoh, Keiichi; Breedlove, Brian K; Yamashita, Masahiro


    Synthesis, structures, and magnetic properties of α-butoxy-substituted phthalocyaninato double-decker complexes Tb(α-obPc)2 (1-) (α-obPc: dianion of 1,4,8,11,15,18,22,25-octa(n-butoxy)phthalocyaninato) with protonated (1H), deprotonated (1[HDBU]), and diprotonated forms (1H2+) are discussed. X-ray analysis was used to confirm the position of the proton in 1H, and it was revealed that the protonation induced asymmetric distortion in 1H. In contrast, 1[HDBU] was distorted in a highly symmetric windmill-like fashion. 1H is arranged in a slipped column array in the crystal packing, whereas 1[HDBU] is arranged in a one-dimensional fashion, in which the magnetic easy axes of 1[HDBU] lie along the same line. From direct-current (dc) magnetic measurements, ferromagnetic Tb-Tb interactions occur in both 1H and 1[HDBU], and magnetic hysteresis was observed. However, the area of the magnetic hysteresis in 1[HDBU] is larger than that in 1H, meaning that magnetic relaxation time (τ) is longer in 1[HDBU]. In addition, the results of alternating-current magnetic measurements in a zero dc magnetic field indicate that τ of 1[HDBU] is longer as compared to 1H. In other words, protonation/deprotonation affects not only the molecular structures and crystal packing but also the single-molecule magnet properties.

  3. A Water-Stable Dual-Channel Luminescence Sensor for UO22+Ions Based on an Anionic Terbium(III) Metal-Organic Framework. (United States)

    Ye, Junwei; Bogale, Raji F; Shi, Yangwei; Chen, Yanzhen; Liu, Xigang; Zhang, Siqi; Yang, Yaoyao; Zhao, Jianzhang; Ning, Guiling


    A stable 3D Tb III -based metal-organic framework [Tb(BPDC) 2 ]⋅(CH 3 ) 2 NH 2 (DUT-101) was synthesized, and it is the first efficient dual-channel luminescence sensor for aqueous UO 2 2+ ions. DUT-101 contains an anionic three-dimensional framework and protonated dimethylamine molecules embedded within the channels. The intense green emission of DUT-101 could be highly selectively and sensitively quenched by UO 2 2+ ions even in the presence of other competing metal ions. A possible sensing mechanism was proposed based on both suppression of luminescence resonance energy transfer and enhancement of intermolecular electron transfer. Furthermore, visual green fluorescent test papers based on DUT-101 were fabricated and could be used to discriminate UO 2 2+ ions among various metal ions. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. [?-N,N?-Bis(3-meth?oxy-2-oxidobenzyl?idene)propane-1,3-diamine]trinitratocopper(II)terbium(III) acetone solvate


    Zhang Fang; Liu Fei


    In the title complex, [CuTb(C19H20N2O4)(NO3)3]·CH3COCH3, the CuII atom is four-coordinated by two O atoms and two N atoms from the deprotonated Schiff base in a square-planar geometry, while the TbIII atom is ten-coordinated by four O atoms from the deprotonated Schiff base and six O atoms from three bidentate nitrate anions. The compound is isostructural with the previously reported GdIII analogue [Elmali & Elerman (2004). Z. Naturforsch. Teil B, 59, 535–540], which was described ...

  5. 143rd and 144th meetings of the Governing Board of the Pension Fund

    CERN Multimedia


    During the meeting, the Board also approved a document setting out its position on the CERN debt to the Pension Fund, which would be submitted to the Finance Committee and Council in June. It underlined that the reimbursement of the debt would be advantageous for the Fund as well as for the Laboratory and that it would reduce the Fund's dependence on the employer, in line with international accounting practices. The second of the two meetings was essentially devoted to examining the actuary's report on the Fund's position with respect to its actuarial commitments as at 1st January 2006. The report, the first of its kind, follows the Board's decision to commission actuarial studies to check the Fund's position in open fund terms between three-yearly actuarial reviews. Based on the Fund's position as at the end of 2005 and taking account of the Council's decisions in December 2005, it reveals a net improvement in the Fund's long-term (30-year) financial balance. However, the actuary states in the conclusions t...

  6. Mineral X, a new thalcusite homologue from the Ilimaussaq complex, South Greenland Contribution to the mineralogy of Ilimaussaq, no. 144

    DEFF Research Database (Denmark)

    Karup-Møller, Sven; Makovicky, E.


    Mineral X is assumed to be a new member of the thalcusite homologous series with the structural formula TlCu2NS2N+1 with N=1.5. It was found in loose ussingite-analcime boulders on the Taseq slope towards the Narsaq Elv in the northern part of the Ilimaussaq complex in South Greenland in associat...

  7. KEA-144: Final Results of the Ground Operations Demonstration Unit for Liquid Hydrogen (GODU-LH2) Project (United States)

    Notardonato, William; Fesmire, James; Swanger, Adam; Jumper, Kevin; Johnson, Wesley; Tomsik, Thomas


    GODU-LH2 system has successfully met all test objectives at the 33%, 67%, and 100% tank fill level. Complete control over the state of the fluid has been demonstrated using Integrated Refrigeration and Storage (IRAS). Almost any desired point along the H2saturation curve can essentially be "dialed in" and maintained indefinitely. System can also be used to produce densified hydrogen in large quantities to the triple point. Exploring multiple technology infusion paths. Studying implementation of IRAS technology into new LH2sphere for EM-2 at LC39B. Technical interchange also occurring with STMD, LSP, ULA, DoE, KIST, Kawasaki, Shell Oil, SpaceX, US Coast Guard, and Virgin Galactic.

  8. NODC Standard Format Marine Toxic Substances and Pollutants (F144) Data (1971-1989) (NODC Accession 0014199) (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This data type contains data on ambient concentrations of toxic substances and other pollutants in the marine environment. The data derive from laboratory analyses...

  9. Machtsensible geographiedidaktische Konzepte des interkulturellen Lernens – Potenziale einer postkolonialen Perspektive. GW-Unterricht|GW-Unterricht 144


    Schröder, Birte


    Ziel dieses Beitrags ist es erstens, Potenziale einer postkolonialen Perspektive für eine Rekonzeptualisierung des interkulturellen Lernens im Geographieunterricht aufzuzeigen. Zweitens – und damit eng verbunden – geht es um eine Ausdifferenzierung des Machtverständnisses in der interkulturellen Geographiedidaktik. Drittens zeigt der Aufsatz anhand empirischer Daten auf, inwiefern der Blick auf heterogene lebensweltliche Zugehörigkeitserfahrungen und Wissensbestände von Schülerinnen und Schül...

  10. Interpersonal relationships between professionals and mothers of premature from Kangaroo-Unit - doi:10.5020/18061230.2010.p144

    Directory of Open Access Journals (Sweden)

    Fabiane Elpidio de Sá


    Full Text Available Objective: To understand the interpersonal relationships between professionals and mothers of premature newborns of the Kangaroo Unit. Methods: This was an exploratory study of qualitative approach. The interviews were conducted with 10 mothers and 7 professionals who joined in Kangaroo Program and then analyzed by the content analysis technique. The guiding questions used were related to feelings perceived in relation to the Kangaroo method, related to mother-child dyad and interpersonal relationships. Results: Mothers reported on their speeches: “safe to be with the baby in Kangaroo Method” and “sense of maternal feeling during breastfeeding”, while in the professionals’ discourses have emerged: “guidelines on caring for the babies”, “the embracement by the team” and “the importance of family support.” Conclusions: The interaction between professionals and mothers of Kangaroo Unit facilitates the permanence of the binomial in the method, therefore develops feelings of security, tranquility and confidence to take care of the baby. It is important that the team be aware of the difficulties, supporting them in the weakest moments and sharing their fears, doubts and concerns over the baby’s hospitalization.

  11. 47 CFR 25.144 - Licensing provisions for the 2.3 GHz satellite digital audio radio service. (United States)


    ... different regions within that satellite's coverage area. (6) Operators of SDARS terrestrial repeaters are... 47 Telecommunication 2 2010-10-01 2010-10-01 false Licensing provisions for the 2.3 GHz satellite... (CONTINUED) COMMON CARRIER SERVICES SATELLITE COMMUNICATIONS Applications and Licenses Space Stations § 25...

  12. CCDC 1410822: Experimental Crystal Structure Determination : heptakis(dimethylammonium) dodecakis(mu-hydroxo)-bis(mu-oxo)-nonaaqua-nona-terbium tris(octakis(mu-hydroxo)-triaqua-bis(2-fluorobenzoato)-bis(formato)-hexa-terbium) dodecakis(5-[(4-carboxylatophenyl)methoxy]benzene-1,3-dicarboxylate) unknown solvate

    KAUST Repository

    Alezi, Dalal


    An entry from the Cambridge Structural Database, the world’s repository for small molecule crystal structures. The entry contains experimental data from a crystal diffraction study. The deposited dataset for this entry is freely available from the CCDC and typically includes 3D coordinates, cell parameters, space group, experimental conditions and quality measures.



  14. A validated spectrofluorimetric method for the determination of citalopram in bulk and pharmaceutical preparations based on the measurement of the silver nanoparticles-enhanced fluorescence of citalopram/terbium complexes. (United States)

    Khan, Muhammad Naeem; Shah, Jasmin; Jan, Muhammad Rasul; Lee, Sang Hak


    A simple, sensitive, and accurate spectrofluorimetric method was developed for the determination of citalopram in bulk and pharmaceutical preparations. The method is based on the enhancement of the weak fluorescence signal (FL) of the Tb (III)-citalopram system in the presence of silver nanoparticles. Fluorescence intensities were measured at 555 nm after excitation at 281 nm. Prepared silver nanoparticles (AgNPs) were characterized by UV-Visible spectra and transmission electron microscopy (TEM). Various factors affecting the formation of citalopram-Tb (III)-AgNPs complexes were studied and optimized. The fluorescence intensity versus concentration plot was linear over the range 0.02-14 μg mL(-1), with an excellent correlation coefficient of 0.9978. The limit of detection (LOD) and limit of quantification (LOQ) were found to be 7.15 × 10(-6) μg mL(-1) and 2.38 × 10(-5) μg mL(-1) respectively. The proposed method was found to have good reproducibility with a relative standard deviation of 3.66% (n = 6). The interference effects of common excipients found in pharmaceutical preparations were studied. The developed method was validated statistically by performing recoveries studies and successfully applied for the assay of citalopram in bulk powder and pharmaceutical preparations. Percent recoveries were found to range from 98.98% to 100.97% for bulk powder and from 96.57% to 101.77% for pharmaceutical preparations.

  15. A "plug-and-play" approach to the preparation of transparent luminescent hybrid materials based on poly(methyl methacrylate), a calix[4]arene cross-linking agent, and terbium ions. (United States)

    Driscoll, Christopher R; Reid, Brodie L; McIldowie, Matthew J; Muzzioli, Sara; Nealon, Gareth L; Skelton, Brian W; Stagni, Stefano; Brown, David H; Massi, Massimiliano; Ogden, Mark I


    A novel methodology to prepare transparent luminescent hybrid materials is reported. Using a calixarene ionophore as a PMMA cross-linker avoids problems, such as phase segregation, and produces a polymer monolith that can be loaded with the metal ion required for luminescence post-synthesis. This approach is versatile and will simplify the production of such materials.

  16. CCDC 954772: Experimental Crystal Structure Determination : catena-(Dimethylammonium tris(mu~4~-3-fluorobiphenyl-4,4'-dicarboxylato)-tetrakis(mu~3~-hydroxo)-triaqua-tri-terbium unknown solvate)

    KAUST Repository

    Xue, Dongxu


    An entry from the Cambridge Structural Database, the world’s repository for small molecule crystal structures. The entry contains experimental data from a crystal diffraction study. The deposited dataset for this entry is freely available from the CCDC and typically includes 3D coordinates, cell parameters, space group, experimental conditions and quality measures.

  17. CCDC 1410820: Experimental Crystal Structure Determination : heptakis(dimethylammonium) heptacosa-terbium dodecakis((1,1'-biphenyl)-3,4',5-tricarboxylate) hexakis(2-fluorobenzoate) hexakis(formate) hexatriacontakis(hydroxide) bis(oxide) unknown solvate hydrate

    KAUST Repository

    Alezi, Dalal


    An entry from the Cambridge Structural Database, the world’s repository for small molecule crystal structures. The entry contains experimental data from a crystal diffraction study. The deposited dataset for this entry is freely available from the CCDC and typically includes 3D coordinates, cell parameters, space group, experimental conditions and quality measures.

  18. Terbium doped SnO2 nanoparticles as white emitters and SnO2:5Tb/Fe3O4 magnetic luminescent nanohybrids for hyperthermia application and biocompatibility with HeLa cancer cells. (United States)

    Singh, Laishram Priyobarta; Singh, Ningthoujam Premananda; Srivastava, Sri Krishna


    SnO2:5Tb (SnO2 doped with 5 at% Tb(3+)) nanoparticles were synthesised by a polyol method and their luminescence properties at different annealing temperatures were studied. Characterization of nanomaterials was done by X-ray diffraction (XRD), Fourier transformation infrared spectroscopy (FTIR), transmission electron microscopy (TEM) and vibrating sample magnetometry (VSM). XRD studies indicate that the prepared nanoparticles were of tetragonal structures. Upon Tb(3+) ion incorporation into SnO2, Sn(4+) changes to Sn(2+) and, on annealing again at higher temperature, Sn(2+) changes to Sn(4+). The prepared nanoparticles were spherical in shape. Sn-O vibrations were found from the FTIR studies. In photoluminescence studies, the intensity of the emission peaks of Tb(3+) ions increases with the increase of annealing temperature, and emission spectra lie in the region of white emission in the CIE diagram. CCT calculations show that the SnO2:5Tb emission lies in cold white emission. Quantum yields up to 38% can be obtained for 900 °C annealed samples. SnO2:5Tb nanoparticles were well incorporated into the PVA polymer and such a material incorporated into the polymer can be used for display devices. The SnO2:5Tb/Fe3O4 nanohybrid was prepared and investigated for hyperthermia applications at different concentrations of the nanohybrid. This achieves a hyperthermia temperature (42 °C) under an AC magnetic field. The hybrid nanomaterial SnO2:5Tb/Fe3O4 was found to exhibit biocompatibility with HeLa cells (human cervical cancer cells) at concentrations up to 74% for 100 μg L(-1). Also, this nanohybrid shows green emission and thus it will be helpful in tracing magnetic nanoparticles through optical imaging in vivo and in vitro application.

  19. Filmes delgados luminescentes obtidos a partir de hidroxicarbonatos de ítrio ativados por európio ou térbio Luminescent thin films obtained from ytrium hydroxycarbonates activated by terbium or europium

    Directory of Open Access Journals (Sweden)

    Emy Niyama


    Full Text Available These films were obtained by dip coating. Parameters like dislocation velocity; number of deposits, suspension concentration, and number of deposits followed or not by heat treatment between each deposit and calcination temperature were evaluated for establishing the best homogeneity. The obtained films were characterized in terms of their morphology, optical quality and photoluminescence by scanning electron microscopy (SEM, UV-vis absorption spectrophotometry and luminescence spectroscopy, respectively. The morphologic and luminescent characteristics showed dip coating as good laboratory technique for development of thin films for optical applications.

  20. Cellule État de l’Environnement Wallon (2003 Tableau de bord de l’environnement wallon 2003, Ed MRW –DGRNE, 144 p.

    Directory of Open Access Journals (Sweden)

    Emilie Thuillier


    Full Text Available Le Tableau de bord de l'environnement wallon 2003 fait suite au Rapport sur l’état de l'environnement wallon 2000 et constitue la première édition qui sera éditée annuellement. Cette initiative est le fruit d’une collaboration entre, d’une part, la Direction Générale des Ressources Naturelles et de l’Environnement du Ministère de la Région wallone et, d’autre part, une coordination inter-universitaire fondée sur une équipe scientifique pluridisciplinaire permanente coordonnée par Edwin ZACCAÏ...

  1. Copyright and Related Issues Relevant to Digital Preservation and Dissemination of Unpublished Pre-1972 Sound Recordings by Libraries and Archives. CLIR Publication No. 144 (United States)

    Besek, June M.


    This report addresses the question of what libraries and archives are legally empowered to do to preserve and make accessible for research their holdings of unpublished pre-1972 sound recordings. The report's author, June M. Besek, is executive director of the Kernochan Center for Law, Media and the Arts at Columbia Law School. Unpublished sound…

  2. Alaska Open-file Report 144 Assessment of Thermal Springs Sites Aleutian Arc, Atka Island to Becherof Lake -- Preliminary Results and Evaluation

    Energy Technology Data Exchange (ETDEWEB)

    Motyka, R.J.; Moorman, M.A.; Liss, S.A.


    Twenty of more than 30 thermal spring areas reported to exist in the Aleutian arc extending from Atka Island to Becherof Lake were investigated during July and August, 1980. Thermal activity of three of these sites had diminished substantially or no longer existed. At least seven more sites where thermal-spring activity is probable or certain were not visited because of their remoteness or because of time constraints. The existence of several other reported thermal spring sites could not be verified; these sites are considered questionable. On the basis of geothermometry, subsurface reservoir temperatures in excess of 150 C are estimated for 10 of the thermal spring sites investigated. These sites all occur in or near regions of Recent volcanism. Five of the sites are characterized by fumaroles and steaming ground, indicating the presence of at least a shallow vapor-dominated zone. Two, the Makushin Valley and Glacier Valley thermal areas, occur on the flanks of active Mukushin Volcano located on Unalaska Island, and may be connected to a common source of heat. Gas geothermometry suggests that the reservoir feeding the Kliuchef thermal field, located on the flanks of Kliuchef volcano of northeast Atka Island, may be as high as 239 C.

  3. CRED Subsurface Temperature Recorder (STR); Guam; Long: 144.70392, Lat: 13.24217 (WGS84); Sensor Depth: 5.18m; Data Date Range: 20090410-20110507. (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Data from Coral Reef Ecosystem Division (CRED), NOAA Pacific Islands Fisheries Science Center (PIFSC) Subsurface Temperature Recorders (STR) provide a time series of...

  4. CRED Subsurface Temperature Recorder (STR); CNMI, FDP; Long: 144.90023, Lat: 20.53725 (WGS84); Sensor Depth: 31.70m; Data Range: 20070603-20090428. (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Data from Coral Reef Ecosystem Division (CRED), NOAA Pacific Islands Fisheries Science Center (PIFSC) Subsurface Temperature Recorders (STR) provide a time series of...

  5. Impact of sexual maturation on upper and lower limb strength on adolescents DOI:10.5007/1980-0037.2010v12n3p144

    Directory of Open Access Journals (Sweden)

    Diego Augusto Santos Silva


    Full Text Available Biological and sexual maturation is one of the most important variables for the interpretation of the results of performance and health studies analyzing upper (ULS and lower limb strength (LLS, with performance varying according to maturation stage. Since menarche is a marker of maturation, the aim of this study was to compare ULS and LLS between adoles-cents who already had their first menarche and those who did not. A cross-sectional study was conducted on 128 adolescents aged 11 to 14 years and divided into two groups: adolescents who did not report the presence of menarche (n=72, adolescents who reported menarche (n=56. ULS was evaluated by the hand grip test using a manual dynamometer. The vertical jump test was used for the evaluation of LLS. Descriptive statistics and covariance analysis (ANCOVA were used for data analysis, with age, body weight, height and BMI as covariables. The level of significance was set at 5% (p<0.05. ULS differed between G1 (17.8±4.4 kg/f and G2 (21.5±3.9 kg/f (p<0.05. However, no difference in LLS was observed between groups (G1 = 23.7±6.7 cm; G2 = 24.1±6.7 cm. The presence of menarche might be one of the events improving the performance in the ULS test, but the same cannot be inferred when analyzing LLS.

  6. 144. Evolución del manejo de la rotura traumática de aorta: 30 años de experiencia

    Directory of Open Access Journals (Sweden)

    V.X. Mosquera Rodríguez


    Conclusiones: El manejo conservador de la RTA puede ser una opción terapéutica en pacientes altamente seleccionados, y requiere un estricto seguimiento clinicorradiológico. El tratamiento quirúrgico, abierto o endovascular, tiene unos excelentes resultados tanto a corto como a largo plazo.

  7. FASBにおける長期性資産の減損-SFAS144を中心にして-




    米国の財務会計基準審議会(Financial Accounting Standards Board、以下:FASB)が、1995年3月に、長期性資産の減損および処分(the Impairment or Disposal of Long-Lived Assets)に関する財務会計基準書121号(Statement of Financial Accounting Standard No.121、以下:SFAS121)「長期性資産の減損および処分する長期性資産の会計」を公表した。SFAS121が公表された当初から、処分する長期性資産に関する会計において、既存の基準、すなわち、会計原則審議会意見書30号(Accounting Principles Board Opinion 30、以下:APBO30)「営業成績の報告―事業セグメントの処分ならびに異常、非経常、非反複的事象および取引の影響の報告」との整合性が問題となっていた。...

  8. The use of neoadjuvant platinum-based chemotherapy in locally advanced breast cancer that is triple negative: retrospective analysis of 144 patients. (United States)

    Hurley, Judith; Reis, Isildinha M; Rodgers, Steven E; Gomez-Fernandez, Carmen; Wright, Jean; Leone, Jose Pablo; Larrieu, Rene; Pegram, Mark D


    Triple-negative breast cancers comprise about 20 % of breast cancers. They have poor prognosis and have no standard therapy. The aim of this study was to evaluate pathologic complete response (pCR), progression-free survival (PFS), and overall survival (OS) in patients with TNBC treated with neoadjuvant platinum-based chemotherapy. This is a retrospective study of one hundred and forty-four women with TNBC treated with neoadjuvant platinum-containing chemotherapy for locally advanced breast cancer at the University of Miami between January 1, 1999, and January 1, 2011. The medical record was reviewed to obtain data on clinical characteristics, including ethnicity, race, age, clinical stage, treatment regimen, and vital status. This study was approved by the University of Miami IRB. All patients had locally advanced breast cancer with at least one of the following features at presentation: T3, T4, N2, and N3. The mean tumor size by palpation was 9.4 cm. The clinical T-stage at presentation was 1.4 % T1, 8.3 % T2, 52.8 % T3, and 37.5 % T4 (19.4 % T4d). The nodal status by physical exam at presentation was 23 % N0, 37.5 % N1, 34 % N2, and 5.5 % N3. pCR in breast and axilla was seen in 31 %. PFS and OS were 55 and 59 %, respectively, at 7 years. Cisplatin offered a survival advantage over carboplatin in both PFS (P = 0.007) and OS (P = 0.018). Node positivity was the most important predictor of survival. Cisplatin/docetaxel neoadjuvant therapy was well tolerated and an effective therapy in locally advanced TNB.

  9. Radiological evidence of femoroacetabular impingement in mild slipped capital femoral epiphysis: a mean follow-up of 14.4 years after pinning in situ. (United States)

    Fraitzl, C R; Käfer, W; Nelitz, M; Reichel, H


    Conventional treatment of mild slipped capital femoral epiphysis consists of fixation in situ with wires or screws. Recent contributions to the literature suggest that even a mild slip may lead to early damage of the acetabular labrum and adjacent cartilage by abutment of a prominent femoral metaphysis. It has been suggested that the appropriate treatment in mild slipped capital femoral epiphysis should not only prevent further slipping of the epiphysis, but also address potential femoroacetabular impingement by restoring the anatomy of the proximal femur. Between October 1984 and December 1995 we treated 16 patients for unilateral mild slipped capital femoral epiphysis by fixation in situ with Kirschner wires. In this study we have reviewed these patients for clinical and radiological evidence of femoroacetabular impingement. There was little clinical indication of impingement but radiological evaluation assessing the femoral head-neck ratio and measuring the Nötzli alpha angle on the anteroposterior and cross-table radiographs showed significant alterations in the proximal femur. None of the affected hips had a normal head-neck ratio and the mean alpha angle was 86 degrees (55 degrees to 99 degrees ) and 55 degrees (40 degrees to 94 degrees ) on the anteroposterior and lateral cross-table radiographs, respectively. While our clinical data favours conventional treatment, our radiological findings are in support of restoring the anatomy of the proximal femur to avoid or delay the development of femoroacetabular impingement following mild slipped capital femoral epiphysis.

  10. The time-like electromagnetic form factors of the charged pseudoscalar mesons from 144 to 90 GeV/sup 2/

    CERN Document Server

    Bernardini, M; Brunini, P L; Fiorentino, E; Massam, Thomas; Monari, L; Palmonari, F; Rimondi, F; Zichichi, A


    The study of 620 hadron pairs produced in the s-range (1.44-9.0) GeV /sup 2/, has yielded 110 collinear hadronic events. Their identification in terms of pi and K mesons allows the determination of the time-like electromagnetic from factors of these pseudoscalar mesons in the above time-like range. The total number of (e/sup +or-/e /sup -/) events observed in the same experimental conditions is 18048. (10 refs).

  11. Estudo genético-clínico de 144 pacientes portadores de deficiência auditiva não sindrômica\\".


    Nancy Mizue Kokitsu Nakata


    A deficiência auditiva constitui uma importante categoria de defeitos congênitos que podem se manifestar isoladamente ou fazer parte do espectro fenotípico de várias síndromes. O presente trabalho refere-se ao estudo genéticoclínico de pacientes portadores de deficiência auditiva não sindrômica, com os objetivos de estabelecer a razão sexual, tipo, grau, simetria, lateralidade e progressão da deficiência auditiva; determinar diagnósticos etiológicos prováveis da deficiência auditiva, estabele...

  12. Synthesis and characterization of spherical Tb-MCM-41

    Energy Technology Data Exchange (ETDEWEB)

    Pires, Luiza H.O., E-mail: [Universidade Federal do Para, Instituto de Ciencias Exatas e Naturais, Laboratorio de Catalise e Oleoquimica, CP 479, CEP 66075-110, Belem, PA (Brazil); Queiroz, Renan M.; Souza, Ruth P.; Costa, Carlos E.F. da; Zamian, Jose R. [Universidade Federal do Para, Instituto de Ciencias Exatas e Naturais, Laboratorio de Catalise e Oleoquimica, CP 479, CEP 66075-110, Belem, PA (Brazil); Weber, Ingrid T. [Universidade Federal de Pernambuco, Centro de Ciencias Exatas e da Natureza, Av. Prof. Luis Barros Freire, s/n, Cidade Universitaria, 50670-901 Recife, PE (Brazil); Filho, Geraldo N. da Rocha [Universidade Federal do Para, Instituto de Ciencias Exatas e Naturais, Laboratorio de Catalise e Oleoquimica, CP 479, CEP 66075-110, Belem, PA (Brazil)


    Spherical MCM-41 was synthesized at room temperature and functionalized by means of direct synthesis method. Evidence for the terbium presence in the silica matrix was obtained by means of EDX. Scanning electron microscopy (SEM) micrographs showed that terbium incorporation did not change significantly MCM-41 morphology. The maintenance of the hexagonal structure was confirmed by X-ray diffraction (XRD) pattern analysis. The cell parameter increase and the surface area decrease, observed by N{sub 2} adsorption-desorption technique, were taken as evidence of terbium introduction inside the MCM-41 framework. By FT-IR spectra it was found that the main features of the silica framework were maintained. The presence of a strong absorption band centered at ca. 220 nm in the diffuse reflectance UV-vis spectra could indicate the presence of tetra-coordinated terbium in the silica network of Tb-MCM-41 samples.

  13. Therapeutic use of radioactive isotopes

    CERN Multimedia

    Caroline Duc


    In December, researchers from ISOLDE-CERN, the Paul Scherrer Institute (PSI) and the Institut Laue-Langevin (ILL) published the results of an in vivo study which successfully proved the effectiveness of four terbium isotopes for diagnosing and treating cancerous tumours.   Four terbium isotopes suitable for clinical purposes. “ISOLDE is the only installation capable of supplying terbium isotopes of such purity and intensity in the case of three out of the four types used in this study,” explains Karl Johnson, a physicist at ISOLDE.  “Producing over a thousand different isotopes, our equipment offers the widest choice of isotopes in the world!” Initially intended for fundamental physics research, ISOLDE has diversified its activities over time to invest in various projects in the materials science, biochemistry and nuclear medicine fields. The proof-of-concept study has confirmed that the four terbium isotopes 149Tb, 152Tb, 155Tb produ...

  14. Thermal History Using Microparticle Trap Luminescence (United States)


    and thermoluminescence of terbium-activated silicates and aluminates " . Radiat. Meas. 43, 323-326 (2008). HDTRA1-07-1-0016 University of...of terbium-activated silicates and aluminates " . 15th Solid State Dosimetry Conference, Delft, The Netherlands, July 8-13 (2007). 2 INTRODUCTION...increased to 500°C until combustion occurred (- 7 min). The remaining powder was collected, crushed in a agate mortar, and annealed (typically at 900

  15. Efficacy and safety of a once-daily single-tablet regimen of tenofovir, lamivudine, and efavirenz assessed at 144 weeks among antiretroviral-naïve and experienced HIV-1-infected Thai adults

    Directory of Open Access Journals (Sweden)

    Anchalee Avihingsanon


    Conclusions: This generic STR TDF/3TC/EFV is effective and well-tolerated. These findings lend support to the use of this generic STR as first-line antiretroviral therapy in resource-limited settings.

  16. Physical data collected from Seaglider SG144 during Ocean Station PAPA June 2008 in the North Pacific Ocean, Gulf of Alaska deployed from 2008-06-08 to 2008-08-30 (NCEI Accession 0155762) (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Seaglider is a buoyancy driven autonomous underwater vehicle (AUV) developed by scientists and engineers at the University of Washington's School of Oceanography and...

  17. (E-1-(4,4′′-Difluoro-5′-methoxy-1,1′:3′,1′′-terphenyl-4′-yl-3-(6-methoxynaphthalen-2-ylprop-2-en-1-one

    Directory of Open Access Journals (Sweden)

    Hoong-Kun Fun


    Full Text Available In the title compound, C33H24F2O3, the central benzene ring makes dihedral angles of 44.71 (10, 47.80 (10 and 63.68 (9° with the two fluoro-substituted benzene rings and the naphthalene ring system, respectively. In the crystal, molecules are connected via intermolecular C—H...F and C—H...O hydrogen bonds. Furthermore, the crystal structure is stabilized by weak C—H...π and π–π interactions [centroid–centroid distance = 3.6816 (13 Å].

  18. Talking Over the Years Sandra Evans Talking Over the Years and Jane Gamer (Eds) Brunner-Routledge 290 pp £17.99 158391 144 8 1583911448 [Formula: see text]. (United States)


    This book addresses a relatively neglected area in the care of older adults. Its theoretical position is from a psychodynamic perspective - often thought not to be relevant to older adults. The chapters in part one give a brief account of the theories of eminent psychotherapists such as Melanie Kline, Erik Erickson and Sigmund Freud. Within each of these chapters, however, is not only the theoretical frame but also clinical examples relevant to all professions caring for older adults.

  19. CRED Sea Surface Temperature (SST) Buoy; CNMI, GUA; Long: 144.79778, Lat: 13.51902 (WGS84); Sensor Depth: 0.33m; Data Range: 20030924-20040531. (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Data from Coral Reef Ecosystem Division (CRED), NOAA Pacific Islands Fisheries Science Center (PIFSC) Sea Surface Temperature (SST) Buoys provide a time series of...

  20. CRED Sea Surface Temperature (SST) Buoy; CNMI, GUA; Long: 144.80048, Lat: 13.52900 (WGS84); Sensor Depth: 0.19m; Data Range: 20070513-20090405. (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Data from Coral Reef Ecosystem Division (CRED), NOAA Pacific Islands Fisheries Science Center (PIFSC) Sea Surface Temperature (SST) Buoys provide a time series of...

  1. CRED Sea Surface Temperature (SST) Buoy; CNMI, GUA; Long: 144.80047, Lat: 13.52900 (WGS84); Sensor Depth: 0.33m; Data Range: 20051005-20070513. (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Data from Coral Reef Ecosystem Division (CRED), NOAA Pacific Islands Fisheries Science Center (PIFSC) Sea Surface Temperature (SST) Buoys provide a time series of...

  2. Geochemical and multi-isotopic (87Sr/86Sr, 143Nd/144Nd, 238U/235U) perspectives of sediment sources, depositional conditions, and diagenesis of the Marcellus Shale, Appalachian Basin, USA (United States)

    Phan, Thai T.; Gardiner, James B.; Capo, Rosemary C.; Stewart, Brian W.


    We investigate sediment sources, depositional conditions and diagenetic processes affecting the Middle Devonian Marcellus Shale in the Appalachian Basin, eastern USA, a major target of natural gas exploration. Multiple proxies, including trace metal contents, rare earth elements (REE), the Sm-Nd and Rb-Sr isotope systems, and U isotopes were applied to whole rock digestions and sequentially extracted fractions of the Marcellus shale and adjacent units from two locations in the Appalachian Basin. The narrow range of εNd values (from -7.8 to -6.4 at 390 Ma) is consistent with derivation of the clastic sedimentary component of the Marcellus Shale from a well-mixed source of fluvial and eolian material of the Grenville orogenic belt, and indicate minimal post-depositional alteration of the Sm-Nd system. While silicate minerals host >80% of the REE in the shale, data from sequentially extracted fractions reflect post-depositional modifications at the mineralogical scale, which is not observed in whole rock REE patterns. Limestone units thought to have formed under open ocean (oxic) conditions have δ238U values and REE patterns consistent with modern seawater. The δ238U values in whole rock shale and authigenic phases are greater than those of modern seawater and the upper crust. The δ238U values of reduced phases (the oxidizable fraction consisting of organics and sulfide minerals) are ∼0.6‰ greater than that of modern seawater. Bulk shale and carbonate cement extracted from the shale have similar δ238U values, and are greater than δ238U values of adjacent limestone units. We suggest these trends are due to the accumulation of chemically and, more likely, biologically reduced U from anoxic to euxinic bottom water as well as the influence of diagenetic reactions between pore fluids and surrounding sediment and organic matter during diagenesis and catagenesis.

  3. Multibeam collection for TN144: Multibeam data collected aboard Thomas G. Thompson from 2002-04-22 to 2002-04-26, departing from Seattle, WA and returning to Seattle, WA (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This data set is part of a larger set of data called the Multibeam Bathymetry Database (MBBDB) where other similar data can be found at...

  4. CRED Ocean Data Platform (ODP), Acoustic Doppler Profiler (ADP); Guam, SRR; Long: 144.41784, Lat: 12.83819 (WGS84); Sensor Depth: 20.40m; Data Range: 20030929-20050908. (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The Ocean Data Platform (ODP) is placed on the sea floor to measure water current profiles, waves, temperature and conductivity. The ODP consists of an upward...

  5. CRED Ocean Data Platform (ODP), Acoustic Doppler Profiler (ADP); Guam, SRR; Long: 144.41778, Lat: 12.83819 (WGS84); Sensor Depth: 20.42m; Data Range: 20051007-20070121. (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The Ocean Data Platform (ODP) is placed on the sea floor to measure water current profiles, waves, temperature and conductivity. The ODP consists of an upward...

  6. Physical data collected from Seaglider SG144 during Ocean Station PAPA June 2009 in the North Pacific Ocean, Gulf of Alaska deployed from 2009-06-14 to 2010-04-02 (NCEI Accession 0155879) (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Seaglider is a buoyancy driven autonomous underwater vehicle (AUV) developed by scientists and engineers at the University of Washington's School of Oceanography and...

  7. A Review of Introducing Issues with Opposing Viewpoints: Animal Rights. By Lauri S. Friedman. Greenhaven Press: Farmington Hills, MI, USA, 2010; Hardcover, 144 pp; Price: $33.58; ISBN: 978-0737749373

    Directory of Open Access Journals (Sweden)

    Lee J. Markowitz


    Full Text Available Given the volatile nature of animal rights issues and the extensive array of writings on the topic, one might expect several introductory anthologies to be available. The only anthologies in print, however, are scholarly tomes (listed below geared towards more advanced readers. Fortunately, Lauri S. Friedman, author of dozens of anthologies on controversial topics such as gun control, national security, terrorism, fast food, sexually transmitted diseases, and many other topics, fills this void well with her volume titled Introducing Issues with Opposing Viewpoints: Animal Rights. She has included articles by influential authors in a diverse range of lay outlets such as The Wall Street Journal, Slate, Guardian, Christianity Today, Food & Wine, among others. Below, I describe the contents of the book, its strengths and weaknesses, and how educators might use the book in classroom settings.

  8. CRED Subsurface Temperature Recorder (STR); Farallon de Pajaros, Commonwealth of the Northern Mariana Islands; Long: 144.88559, Lat: 20.54514 (WGS84); Sensor Depth: 18.90m; Data Date Range: 20090428-20110417. (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Data from Coral Reef Ecosystem Division (CRED), NOAA Pacific Islands Fisheries Science Center (PIFSC) Subsurface Temperature Recorders (STR) provide a time series of...

  9. Users of Virtual Reference Are More Satisfied with the Service They Receive than the Providers of that Service Think They Are. A Review of: Hansen, D., Johnson, M., Norton, E., & McDonough, A. (2009. Virtual provider pessimism: Analysing instant messaging reference encounters with the pair perception comparison method. Information Research, 14(4. Retrieved from paper416.html

    Directory of Open Access Journals (Sweden)

    Carol D. Howe


    Full Text Available Objective – To examine provider pessimism by comparing user and provider perception of the same instant messaging reference transaction.Design – Instant messaging users and providers completed post-reference transaction surveys which were analyzed using the pair perception comparison method.Setting – A large research university in the United States.Subjects – Two hundred undergraduate journalism students (users of the instant messaging service and 51 Master of Library Science (MLS students enrolled in a reference services class (providers of the instant messaging service.Methods – The authors created a research help webpage from which users could access the instant messaging service. Prior to service availability, providers received reference instruction and demonstrated reference aptitude through in-class activities. The authors briefed providers on the project and provided a wiki containing resources they might need during reference transactions. Providers worked in two-hour shifts, and two providers were available during each shift. The service was available for one week while potential users completed a journalism assignment. The authors asked both users and providers of the service to complete an online survey at the conclusion of the reference transaction. Users and providers completed different surveys, but both types included the following four elements: questions to aid in matching a user to a provider; questions about satisfaction with the service based on guidelines put forth by the Reference and User Services Association (RUSA; open-ended questions about the reference transaction; and questions regarding demographics, prior reference service usage, and knowledge of instant messaging. There were 55 valid reference transactions, and from those, the authors matched 26 pairs of user and provider surveys. The authors analyzed paired surveys to (a compare the user’s perception of the reference transaction with the provider’s guess about the user’s perception and (b compare the provider’s self-perception of the reference transaction with the provider’s guess about the user’s perception. The authors introduced the pair perception comparison method for the analysis using two-tailed paired t-tests and Wilcoxon signed-rank tests.Main Results – Analysis of background information showed that users were younger on average than providers and used instant messaging more frequently. Even so, most users and providers felt comfortable with instant messaging.When providers were asked to guess how satisfied overall they thought the user was with the reference transaction, they reported on average that the user was less satisfied than the user actually was. These results were statistically significant. The authors found no significant difference between the providers’ overall satisfaction with the service they provided and their guesses about the users’ overall satisfaction.The authors also analyzed the matched pairs on 14 specific aspects of satisfaction gathered from surveys. When comparing the users’ satisfaction with the service they received and the providers’ guesses about the users’ satisfaction, the providers underestimated the users’ satisfaction on average for all 14 dimensions. The authors found statistically significant differences with regard to 7 of the 14 dimensions: tempo, ease of use, friendliness, understanding, accuracy, follow up, and spelling. When comparing the providers’ satisfaction with a given reference transaction and their guesses about the users’ satisfaction with the same reference transaction, the authors found significant differences for 3 of the 14 dimensions: interest, resource type, and accuracy.Conclusion – This study has shown for instant messaging reference what other studies have shown for face-to-face reference—that provider pessimism exists. Whatever the environment, providers of reference tend to judge themselves more harshly than the people they are helping judge them. Based on a review of the literature, the authors further note that both expert and novice reference providers experience such pessimism. The authors are hopeful that providers will view these results as evidence of their own competence during instant messaging reference transactions.The results of this study provide valuable information for training instant messaging providers. For example, the fact that providers thought users were less satisfied with the tempo of the reference transaction than they really were suggested to the authors that instant messaging providers need not be so concerned about giving a quick answer. An accurate answer is more desirable. In the same vein, providers thought that users were more concerned with spelling than they really were. Both of these cases, and others gleaned from the results, provide insight into what aspects of the reference transaction providers should spend their time and effort on.Finally, the authors introduced the pair perception comparison method to compare feedback from matched pairs on individual reference transactions, a methodology not used in any earlier studies. They deemed this method to be an effective way to uncover biases and false assumptions.

  10. On the quenching of trivalent terbium luminescence by ligand low lying triplet state energy and the role of the {sup 7}F{sub 5} level: The [Tb(tta){sub 3} (H{sub 2}O){sub 2}] case

    Energy Technology Data Exchange (ETDEWEB)

    Souza, A.S., E-mail: [Departamento de Química Fundamental, Universidade Federal de Pernambuco, 50670-901 Recife, PE (Brazil); Nunes, L.A. [Instituto de Física de São Carlos, Universidade de São Paulo, 13560-970 São Carlos, SP (Brazil); Felinto, M.C.F.C. [Instituto de Pesquisas Energéticas e Nucleares-IPEN, 05505-800 São Paulo, SP (Brazil); Brito, H.F. [Instituto de Química, Universidade de São Paulo, 05508-900 São Paulo, SP (Brazil); Malta, O.L. [Departamento de Química Fundamental, Universidade Federal de Pernambuco, 50670-901 Recife, PE (Brazil)


    In this work we discuss the observed Tb{sup 3+} ion luminescence quenching, due to the relative ligand low lying triplet state energy, in the [Tb(tta){sub 3} (H{sub 2}O){sub 2}] compound at low and room temperature (tta=thenoyltrifluoroacetonate). Theoretical energy transfer rates, for both multipolar and exchange mechanisms, were calculated and discussed on the basis of selection rules and energy mismatch conditions from the [Tb(tta){sub 3} (H{sub 2}O){sub 2}] emission spectra. We have concluded that the exchange mechanism by far dominates, in the present case, and that the long first excited state {sup 7}F{sub 5} lifetime (in the millisecond scale) plays a crucial role in the Tb{sup 3+} luminescence quenching. - Highlights: • The energy exchange between the ligand T{sub 1} and Tb{sup 3+5}D{sub 4} levels occur by the exchange interaction. • The Tb{sup 3+} first excited {sup 7}F{sub 5} level plays a crucial role in this process due to its long lifetime. • At room temperature the energy exchanged between the {sup 5}D{sub 4} level of the Tb{sup 3+} ion and the T{sub 1} of the ligand is lost via the intersystem crossing T{sub 1} → S{sub 0} channel.

  11. Synthesis, structure, and magnetic properties of a new family of tetra-nuclear {Mn2(III)Ln2}(Ln = Dy, Gd, Tb, Ho) clusters with an arch-type topology: single-molecule magnetism behavior in the dysprosium and terbium analogues. (United States)

    Chandrasekhar, Vadapalli; Bag, Prasenjit; Speldrich, Manfred; van Leusen, Jan; Kögerler, Paul


    Sequential reaction of Mn(II) and lanthanide(III) salts with a new multidentate ligand, 2,2'-(2-hydroxy-3-methoxy-5-methylbenzylazanediyl)diethanol (LH3), containing two flexible ethanolic arms, one phenolic oxygen, and a methoxy group afforded heterometallic tetranuclear complexes [Mn2Dy2(LH)4(μ-OAc)2](NO3)2·2CH3OH·3H2O (1), [Mn2Gd2(LH)4(μ-OAc)2](NO3)2·2CH3OH·3H2O (2), [Mn2Tb2(LH)4(μ-OAc)2](NO3)2·2H2O·2CH3OH·Et2O (3), and [Mn2Ho2(LH)4(μ-OAc)2]Cl2·5CH3OH (4). All of these dicationic complexes possess an arch-like structural topology containing a central Mn(III)-Ln-Ln-Mn(III) core. The two central lanthanide ions are connected via two phenolate oxygen atoms. The remaining ligand manifold assists in linking the central lanthanide ions with the peripheral Mn(III) ions. Four doubly deprotonated LH(2-) chelating ligands are involved in stabilizing the tetranuclear assembly. A magnetochemical analysis reveals that single-ion effects dominate the observed susceptibility data for all compounds, with comparably weak Ln···Ln and very weak Ln···Mn(III) couplings. The axial, approximately square-antiprismatic coordination environment of the Ln(3+) ions in 1-4 causes pronounced zero-field splitting for Tb(3+), Dy(3+), and Ho(3+). For 1 and 3, the onset of a slowing down of the magnetic relaxation was observed at temperatures below approximately 5 K (1) and 13 K (3) in frequency-dependent alternating current (AC) susceptibility measurements, yielding effective relaxation energy barriers of ΔE = 16.8 cm(-1) (1) and 33.8 cm(-1) (3).

  12. Reactive Chemical Vapor Deposition Method as New Approach for Obtaining Electroluminescent Thin Film Materials

    Directory of Open Access Journals (Sweden)

    Valentina V. Utochnikova


    Full Text Available The new reactive chemical vapor deposition (RCVD method has been proposed for thin film deposition of luminescent nonvolatile lanthanide aromatic carboxylates. This method is based on metathesis reaction between the vapors of volatile lanthanide dipivaloylmethanate (Ln(dpm3 and carboxylic acid (HCarb orH2Carb′ and was successfully used in case of HCarb. Advantages of the method were demonstrated on example of terbium benzoate (Tb(bz3 and o-phenoxybenzoate thin films, and Tb(bz3 thin films were successfully examined in the OLED with the following structure glass/ITO/PEDOT:PSS/TPD/Tb(bz3/Ca/Al. Electroluminescence spectra of Tb(bz3 showed only typical luminescent bands, originated from transitions of the terbium ion. Method peculiarities for deposition of compounds of dibasic acids H2Carb′ are established on example of terbium and europium terephtalates and europium 2,6-naphtalenedicarboxylate.

  13. Spatial resolution in X-ray imaging with scintillating glass optical fiber plates (United States)

    Pavan, P.; Zanella, G.; Zannoni, R.; Marigo, A.


    Some scintillating optical fiber plates, fabricated with terbium glasses are tested for their intrinsic spatial resolution under X-ray irradiation and the result is compared with a typical phosphor screen. The spatial resolution (CTF and MTF) is measured as a function of spatial frequency and the standard deviation of the corresponding Gaussian PSF is derived.


    DEFF Research Database (Denmark)


    The present invention concerns a chemical process for preparing nanoparticles of an alloy comprising both a noble metal, such as platinum, and a non-noble transition or lanthanide metal, such as yttrium, gadolinium or terbium. The process is carried out by reduction with hydrogen and removal...

  15. Multiplet effects in the electronic structure of heavy rare-earth metals

    NARCIS (Netherlands)

    Lebegue, S.; Svane, A.; Katsnelson, M.I.; Lichtenstein, A.I.; Eriksson, O.


    The spectroscopic properties of elemental terbium, dysprosium, holmium, and erbium are investigated using first-principles calculations taking into account intra-atomic correlation effects. In order to describe the strongly localized f electrons together with the conduction bands, we have used the

  16. Performance of 20 Ci 137Cs γ-ray Compton spectrometer for the ...

    Indian Academy of Sciences (India)

    The in-house 137Cs spectrometer is very useful for the measurement of momentum densities of heavy materials. The performance of the machine is assessed using aluminum, terbium and mercury samples and the exper- imental data from comparable apparatus. Keywords. Compton scattering; electron momentum density; ...

  17. Author Details

    African Journals Online (AJOL)

    Pengkiliya, P. Vol 67 (2014) - Articles Interaction of 3-Hydroxypicolinamide with TbIII and its Sensitizing Effect on Terbium Luminescence as a Function of pH and Medium Abstract PDF. ISSN: 0379-4350. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about ...

  18. Author Details

    African Journals Online (AJOL)

    Devi, TP. Vol 67 (2014) - Articles Interaction of 3-Hydroxypicolinamide with TbIII and its Sensitizing Effect on Terbium Luminescence as a Function of pH and Medium Abstract PDF. ISSN: 0379-4350. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about AJOL ...

  19. THz near-field Faraday imaging in hybrid metamaterials

    NARCIS (Netherlands)

    Kumar, N.; Strikwerda, A.C.; Fan, K.; Zhang, X.; Averitt, R.D.; Planken, P.C.M.; Adam, A.J.L.


    We report on direct measurements of the magnetic near-field of metamaterial split ring resonators at terahertz frequencies using a magnetic field sensitive material. Specifically, planar split ring resonators are fabricated on a single magneto-optically active terbium gallium garnet crystal.

  20. Synthesis and photoluminescence properties of CaSixOy:Tb3+ phosphors prepared using solution-combustion method

    CSIR Research Space (South Africa)

    Dejene, FB


    Full Text Available to Ca3Si2O7 as the terbium concentration increase. Broad band excitations peaking between 280 - 360 nm derived from excited states of Tb3+ ions were observed for all powders grown from various Tb compositions. The green emission peak at 545 nm due...

  1. Scanning Electron Microscope-Cathodoluminescence Analysis of Rare-Earth Elements in Magnets. (United States)

    Imashuku, Susumu; Wagatsuma, Kazuaki; Kawai, Jun


    Scanning electron microscope-cathodoluminescence (SEM-CL) analysis was performed for neodymium-iron-boron (NdFeB) and samarium-cobalt (Sm-Co) magnets to analyze the rare-earth elements present in the magnets. We examined the advantages of SEM-CL analysis over conventional analytical methods such as SEM-energy-dispersive X-ray (EDX) spectroscopy and SEM-wavelength-dispersive X-ray (WDX) spectroscopy for elemental analysis of rare-earth elements in NdFeB magnets. Luminescence spectra of chloride compounds of elements in the magnets were measured by the SEM-CL method. Chloride compounds were obtained by the dropwise addition of hydrochloric acid on the magnets followed by drying in vacuum. Neodymium, praseodymium, terbium, and dysprosium were separately detected in the NdFeB magnets, and samarium was detected in the Sm-Co magnet by the SEM-CL method. In contrast, it was difficult to distinguish terbium and dysprosium in the NdFeB magnet with a dysprosium concentration of 1.05 wt% by conventional SEM-EDX analysis. Terbium with a concentration of 0.02 wt% in an NdFeB magnet was detected by SEM-CL analysis, but not by conventional SEM-WDX analysis. SEM-CL analysis is advantageous over conventional SEM-EDX and SEM-WDX analyses for detecting trace rare-earth elements in NdFeB magnets, particularly dysprosium and terbium.

  2. Performance of 20 Ci 137Cs γ-ray Compton spectrometer for the ...

    Indian Academy of Sciences (India)

    ... than the conventional 241Am Compton spectrometers. The in-house 137Cs spectrometer is very useful for the measurement of momentum densities of heavy materials. The performance of the machine is assessed using aluminum, terbium and mercury samples and the experimental data from comparable apparatus.

  3. Faraday isolator based on TSAG crystal for high power lasers. (United States)

    Mironov, E A; Palashov, O V


    A Faraday isolator based on a new magneto-optical medium, TSAG (terbium scandium aluminum garnet) crystal, has been constructed and investigated experimentally. The device provides an isolation ratio of more than 30 dB at 500 W laser power. It is shown that this medium can be used in Faraday isolators for kilowatt-level laser powers.

  4. 1. Novel Dopants in Silica Based Fibers. 2. Applications of Embedded Optical Fiber Sensors in Reinforced Concrete Buildings and Structures (United States)


    effects in fibers, and nonlinear phenomena in fibers. We also use NMR, ESR and Raman techniques to study incorporation of novel as well as...neodymium, erbium, holmium or terbium. These products can be vacuum dried at elevated temperature. The acac-compound is less expensive since the hfa

  5. Time-gated FRET nanoassemblies for rapid and sensitive intra- and extracellular fluorescence imaging

    NARCIS (Netherlands)

    Afsari, Hamid Samareh; Cardoso Dos Santos, Marcelina; Lindén, Stina; Chen, Ting; Qiu, Xue; van Bergen En Henegouwen, Paul M P|info:eu-repo/dai/nl/071919481; Jennings, Travis L; Susumu, Kimihiro; Medintz, Igor L; Hildebrandt, Niko; Miller, Lawrence W

    Time-gated Förster resonance energy transfer (FRET) using the unique material combination of long-lifetime terbium complexes (Tb) and semiconductor quantum dots (QDs) provides many advantages for highly sensitive and multiplexed biosensing. Although time-gated detection can efficiently suppress

  6. Bulletin of Materials Science | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science; Volume 39; Issue 7. Issue front cover thumbnail. Volume 39, Issue 7. December 2016, pages 1619-1889. pp 1619-1623. Luminescence properties of terbium-doped Li 3 PO 4 phosphor for radiation dosimetry · C B PALAN N S BAJAJ S K OMANWAR · More Details Abstract ...

  7. Interaction of 3-Hydroxypicolinamide with Tb III and its Sensitizing ...

    African Journals Online (AJOL)

    Interaction of 3-Hydroxypicolinamide with Tb III and its Sensitizing Effect on Terbium Luminescence as a Function of pH and Medium. ... The complex formed exists asML2 species in which HPA behaves as anO,O,N,N-chelating ligand. The solid complex is isolated from aqueous medium and characterized employing ...

  8. Lanthanide Enhanced Luminescence (LEL) with One and Two Photon Excitation of Quantum Dyes(copyright) Lanthanide(III)-Macrocycles

    National Research Council Canada - National Science Library

    Leif, Robert C; Becker, Margie C; Bromm Jr., Al; Chen, Nanguang; Cowan, Ann E; Vallarino, Lidia M; Yang, Sean; Zucker, Robert M


    .... Preliminary studies indicate that cells stained with the europium Quantum Dye can be observed both by conventional UV laser excitation and by infrared two-photon confocal microscopy. An enhancer has been found that enables the observation of simultaneous emissions from both the europium and terbium Quantum Dyes.

  9. Kinetically inert lanthanide complexes as reporter groups for binding of potassium by 18-crown-6

    DEFF Research Database (Denmark)

    Junker, Anne Kathrine Ravnsborg; Tropiano, Manuel; Faulkner, Stephen


    in a copper(I)-catalyzed alkyne-azide cycloaddition (CuAAC) “click” reaction with azide-functionalized crown ethers. The resulting complexes were investigated using NMR and optical methods. Titrations with potassium chloride in methanol observing the sensititzed europium- and terbium-centered emissions were...

  10. 40 CFR 145.11 - Requirements for permitting. (United States)


    ... movement of fluids into underground sources of drinking water); (7) Section 144.13—(Elimination of Class IV...) Section 144.33—(Area Permits); (13) Section 144.34—(Emergency permits); (14) Section 144.35—(Effect of... conditions); (20) Section 144.52—(Establishing permit conditions); (21) Section 144.53(a)—(Schedule of...

  11. ORF Alignment: NC_003076 [GENIUS II[Archive

    Lifescience Database Archive (English)


  12. (4R,4aS,4bS,7R,10aR-4-Hydroxy-4a,7-dimethyl-2-(propan-2-yl-1,4,4a,4b,5,6,7,8,10,10a-decahydrophenanthren-1-one

    Directory of Open Access Journals (Sweden)

    Ignez Caracelli


    Full Text Available In the title compound, C19H28O2, the A ring adopts a chair conformation, and each of the B and C rings adopts a distorted half-chair conformation with the methine C atom in the CH2C(HC(=O residue, common to both rings, lying 0.6397 (19 and 0.6328 (18 Å out of the approximate plane defined by the remaining five C atoms (r.m.s. deviations = 0.0791 and 0.0901 Å for rings B and C, respectively. Helical supramolecular chains along the a axis mediated by hydroxy–carbonyl O—H...O hydrogen bonds feature in the crystal packing.

  13. A comunicação interna em empresas de confecção de Monte Sião

    Directory of Open Access Journals (Sweden)

    Maria Rita dos Santos


    Full Text Available Este artigo aborda a comunicação interna no contexto de vinte duas micro e pequenas malharias de Monte Sião, Minas Gerais, e as ferramentas utilizadas para aperfeiçoar o uso da comunicação integrada ao processo de gestão e difusão de conhecimento, para atingir aos objetivos organizacionais. Também, discute-se a utilidade de uma teoria para análise de consequências da comunicação dirigida ao público interno em empresas. Relatam-se conceitos publicados em pesquisa bibliográfica; a assimilação de conceitos emitidos ao colaborador e suas relações com comunicação, comportamento de colaborador e objetivos da empresa, e conclusões com sugestões para dirigentes das empresas.Palavras-chave: gestão de empresas; comunicação; linguística

  14. ORF Alignment: NC_000921 [GENIUS II[Archive

    Lifescience Database Archive (English)


  15. Luminescent properties of Al{sub 2}O{sub 3}: Tb powders; Propiedades luminiscentes de polvos de Al{sub 2}O{sub 3}: Tb

    Energy Technology Data Exchange (ETDEWEB)

    Esparza G, A.E.; Garcia, M.; Falcony, C.; Azorin N, J. [CICATA-IPN, Legaria 694, Col. Irrigacion, 11500 Mexico D.F. (Mexico)


    In this work the photo luminescent and cathode luminescent characteristics of aluminium oxide (Al{sub 2}O{sub 3}) powders impurified with terbium (Tb) were studied for their use in dosimetry. The optical, structural, morphological characteristics of the powders as function of variation in the impurity concentration and the annealing temperature will be presented. As regards the optical properties of powders (photoluminescence and cathode luminescence) it was observed a characteristic emission associated with radiative transitions between electron energy levels of terbium, the spectra associated with this emission consists of several peaks associated with such transitions. In the structural and morphological characterization (X-ray diffraction and scanning electron microscopy) it was appreciated that in accordance the annealing temperature of powders is augmented it is evident the apparition of certain crystalline phases. The results show that this is a promissory material for radiation dosimetry. (Author)

  16. Plastic optical fibre sensor for in-vivo radiation monitoring during brachytherapy (United States)

    Woulfe, P.; Sullivan, F. J.; Lewis, E.; O'Keeffe, S.


    An optical fibre sensor is presented for applications in real-time in-vivo monitoring of the radiation dose a cancer patient receives during seed implantation in Brachytherapy. The sensor is based on radioluminescence whereby radiation sensitive scintillation material is embedded in the core of a 1mm plastic optical fibre. Three scintillation materials are investigated: thallium-doped caesium iodide (CsI:Tl), terbium-doped gadolinium oxysulphide (Gd2O2S:Tb) and europium-doped lanthanum oxysulphide (La2O2S:Eu). Terbium-doped gadolinium oxysulphide was identified as being the most suitable scintillator and further testing demonstrates its measureable response to different activities of Iodine-125, the radio-active source commonly used in Brachytherapy for treating prostate cancer.

  17. [Luminescent cytochemical methods of detecting microorganisms]. (United States)

    Ivanovskaia, N P; Osin, N S; Khramov, E N; Zlobin, V N


    The paper shows that the luminescence cytochemical technique can be used for identification of microorganisms and microbiological synthesis products. The method is based on the interaction of specific fluorescence probes (ANS, terbium ions, and beta-diketonate complexes of europium, as well as metal-containing porphyrines) with major microbial intracellular components and toxins. Unlike classical microbiological, immunochemical or biochemical methods of detection, the proposed method has a reasonable versatility, specificity, sensitivity, rapid action, and possible automation.

  18. Radiotherapy dosimetry based on plastic optical fibre sensors (United States)

    O'Keeffe, S.; Grattan, M.; Hounsell, A.; McCarthy, D.; Woulfe, P.; Cronin, J.; Lewis, E.


    The use of a PMMA based plastic optical fibre in radiotherapy dosimetry is presented. The optical fibre tip is coated with a scintillation material, terbium-doped gadolinium oxysulfide (Gd2O2S:Tb), which fluoresces under ionising radiation. The emitted signal penetrates the fibre and propagates along the fibre where it is remotely monitored using a fluorescence spectrometer. The results demonstrate good repeatability, with a maximum percentage error of 0.59% and the response is independent of dose rate.

  19. Luminescent Lanthanide Metal Organic Frameworks for cis-Selective Isoprene Polymerization Catalysis


    Samantha Russell; Thierry Loiseau; Christophe Volkringer; Marc Visseaux


    In this study, we are combining two areas of chemistry; solid-state coordination polymers (or Metal-Organic Framework—MOF) and polymerization catalysis. MOF compounds combining two sets of different lanthanide elements (Nd3+, Eu3+/Tb3+) were used for that purpose: the use of neodymium was required due to its well-known catalytic properties in dienes polymerization. A second lanthanide, europium or terbium, was included in the MOF structure with the aim to provide luminescent properties. Sev...

  20. Modeled Neutron Induced Nuclear Reaction Cross Sections for Radiochemsitry in the region of Thulium, Lutetium, and Tantalum I. Results of Built in Spherical Symmetry in a Deformed Region

    Energy Technology Data Exchange (ETDEWEB)

    Hoffman, R. D. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)


    We have developed a set of modeled nuclear reaction cross sections for use in radiochemical diagnostics. Systematics for the input parameters required by the Hauser-Feshbach statistical model were developed and used to calculate neutron induced nuclear reaction cross sections for targets ranging from Terbium (Z = 65) to Rhenium (Z = 75). Of particular interest are the cross sections on Tm, Lu, and Ta including reactions on isomeric targets.