Selection of G-quadruplex folding topology with LNA-modified human telomeric sequences in K+ solution

DEFF Research Database (Denmark)

Pradhan, Devranjan; Hansen, Lykke H; Vester, Birte

2011-01-01

G-rich nucleic acid oligomers can form G-quadruplexes built by G-tetrads stacked upon each other. Depending on the nucleotide sequence, G-quadruplexes fold mainly with two topologies: parallel, in which all G-tracts are oriented parallel to each other, or antiparallel, in which one or more G......-tracts are oriented antiparallel to the other G-tracts. In the former topology, all glycosidic bond angles conform to anti conformations, while in the latter topology they adopt both syn and anti conformations. It is of interest to understand the molecular forces that govern G-quadruplex folding. Here, we approach...... this problem by examining the impact of LNA (locked nucleic acid) modifications on the folding topology of the dimeric model system of the human telomere sequence. In solution, this DNA G-quadruplex forms a mixture of G-quadruplexes with antiparallel and parallel topologies. Using CD and NMR spectroscopies, we...

Binding modes and pathway of RHPS4 to human telomeric G-quadruplex and duplex DNA probed by all-atom molecular dynamics simulations with explicit solvent.

Science.gov (United States)

Mulholland, Kelly; Siddiquei, Farzana; Wu, Chun

2017-07-19

RHPS4, a potent binder to human telomeric DNA G-quadruplex, shows high efficacy in tumor cell growth inhibition. However, it's preferential binding to DNA G-quadruplex over DNA duplex (about 10 fold) remains to be improved toward its clinical application. A high resolution structure of the single-stranded telomeric DNA G-quadruplexes, or B-DNA duplex, in complex with RHPS4 is not available yet, and the binding nature of this ligand to these DNA forms remains to be elusive. In this study, we carried out 40 μs molecular dynamics binding simulations with a free ligand to decipher the binding pathway of RHPS4 to a DNA duplex and three G-quadruplex folders (parallel, antiparallel and hybrid) of the human telomeric DNA sequence. The most stable binding mode identified for the duplex, parallel, antiparallel and hybrid G-quadruplexes is an intercalation, bottom stacking, top intercalation and bottom intercalation mode, respectively. The intercalation mode with similar binding strength to both the duplex and the G-quadruplexes, explains the lack of binding selectivity of RHPS4 to the G-quadruplex form. Therefore, a ligand modification that destabilizes the duplex intercalation mode but stabilizes the G-quadruplex intercalation mode will improve the binding selectivity toward G-quadruplex. The intercalation mode of RHPS4 to both the duplex and the antiparallel and the hybrid G-quadruplex follows a base flipping-insertion mechanism rather than an open-insertion mechanism. The groove binding, the side binding and the intercalation with flipping out of base were observed to be intermediate states before the full intercalation state with paired bases.

Human telomere sequence DNA in water-free and high-viscosity solvents: G-quadruplex folding governed by Kramers rate theory.

Science.gov (United States)

Lannan, Ford M; Mamajanov, Irena; Hud, Nicholas V

2012-09-19

Structures formed by human telomere sequence (HTS) DNA are of interest due to the implication of telomeres in the aging process and cancer. We present studies of HTS DNA folding in an anhydrous, high viscosity deep eutectic solvent (DES) comprised of choline choride and urea. In this solvent, the HTS DNA forms a G-quadruplex with the parallel-stranded ("propeller") fold, consistent with observations that reduced water activity favors the parallel fold, whereas alternative folds are favored at high water activity. Surprisingly, adoption of the parallel structure by HTS DNA in the DES, after thermal denaturation and quick cooling to room temperature, requires several months, as opposed to less than 2 min in an aqueous solution. This extended folding time in the DES is, in part, due to HTS DNA becoming kinetically trapped in a folded state that is apparently not accessed in lower viscosity solvents. A comparison of times required for the G-quadruplex to convert from its aqueous-preferred folded state to its parallel fold also reveals a dependence on solvent viscosity that is consistent with Kramers rate theory, which predicts that diffusion-controlled transitions will slow proportionally with solvent friction. These results provide an enhanced view of a G-quadruplex folding funnel and highlight the necessity to consider solvent viscosity in studies of G-quadruplex formation in vitro and in vivo. Additionally, the solvents and analyses presented here should prove valuable for understanding the folding of many other nucleic acids and potentially have applications in DNA-based nanotechnology where time-dependent structures are desired.

Selectivity in ligand recognition of G-quadruplex loops.

Science.gov (United States)

Campbell, Nancy H; Patel, Manisha; Tofa, Amina B; Ghosh, Ragina; Parkinson, Gary N; Neidle, Stephen

2009-03-03

A series of disubstituted acridine ligands have been cocrystallized with a bimolecular DNA G-quadruplex. The ligands have a range of cyclic amino end groups of varying size. The crystal structures show that the diagonal loop in this quadruplex results in a large cavity for these groups, in contrast to the steric constraints imposed by propeller loops in human telomeric quadruplexes. We conclude that the nature of the loop has a significant influence on ligand selectivity for particular quadruplex folds.

A colorimetric platform for sensitively differentiating telomere DNA with different lengths, monitoring G-quadruplex and dsDNA based on silver nanoclusters and unmodified gold nanoparticles

Science.gov (United States)

Qu, Fei; Chen, Zeqiu; You, Jinmao; Song, Cuihua

2018-05-01

Human telomere DNA plays a vital role in genome integrity control and carcinogenesis as an indication for extensive cell proliferation. Herein, silver nanoclusters (Ag NCs) templated by polymer and unmodified gold nanoparticles (Au NPs) are designed as a new colorimetric platform for sensitively differentiating telomere DNA with different lengths, monitoring G-quadruplex and dsDNA. Ag NCs can produce the aggregation of Au NPs, so the color of Au NPs changes to blue and the absorption peak moves to 700 nm. While the telomere DNA can protect Au NPs from aggregation, the color turns to red again and the absorption band blue shift. Benefiting from the obvious color change, we can differentiate the length of telomere DNA by naked eyes. As the length of telomere DNA is longer, the variation of color becomes more noticeable. The detection limits of telomere DNA containing 10, 22, 40, 64 bases are estimated to be 1.41, 1.21, 0.23 and 0.22 nM, respectively. On the other hand, when telomere DNA forms G-quadruplex in the presence of K+, or dsDNA with complementary sequence, both G-quadruplex and dsDNA can protect Au NPs better than the unfolded telomere DNA. Hence, a new colorimetric platform for monitoring structure conversion of DNA is established by Ag NCs-Au NPs system, and to prove this type of application, a selective K+ sensor is developed.

Guanine base stacking in G-quadruplex nucleic acids

Science.gov (United States)

Lech, Christopher Jacques; Heddi, Brahim; Phan, Anh Tuân

2013-01-01

G-quadruplexes constitute a class of nucleic acid structures defined by stacked guanine tetrads (or G-tetrads) with guanine bases from neighboring tetrads stacking with one another within the G-tetrad core. Individual G-quadruplexes can also stack with one another at their G-tetrad interface leading to higher-order structures as observed in telomeric repeat-containing DNA and RNA. In this study, we investigate how guanine base stacking influences the stability of G-quadruplexes and their stacked higher-order structures. A structural survey of the Protein Data Bank is conducted to characterize experimentally observed guanine base stacking geometries within the core of G-quadruplexes and at the interface between stacked G-quadruplex structures. We couple this survey with a systematic computational examination of stacked G-tetrad energy landscapes using quantum mechanical computations. Energy calculations of stacked G-tetrads reveal large energy differences of up to 12 kcal/mol between experimentally observed geometries at the interface of stacked G-quadruplexes. Energy landscapes are also computed using an AMBER molecular mechanics description of stacking energy and are shown to agree quite well with quantum mechanical calculated landscapes. Molecular dynamics simulations provide a structural explanation for the experimentally observed preference of parallel G-quadruplexes to stack in a 5′–5′ manner based on different accessible tetrad stacking modes at the stacking interfaces of 5′–5′ and 3′–3′ stacked G-quadruplexes. PMID:23268444

Atomistic picture for the folding pathway of a hybrid-1 type human telomeric DNA G-quadruplex.

Directory of Open Access Journals (Sweden)

Yunqiang Bian

2014-04-01

Full Text Available In this work we studied the folding process of the hybrid-1 type human telomeric DNA G-quadruplex with solvent and K(+ ions explicitly modeled. Enabled by the powerful bias-exchange metadynamics and large-scale conventional molecular dynamic simulations, the free energy landscape of this G-DNA was obtained for the first time and four folding intermediates were identified, including a triplex and a basically formed quadruplex. The simulations also provided atomistic pictures for the structures and cation binding patterns of the intermediates. The results showed that the structure formation and cation binding are cooperative and mutually supporting each other. The syn/anti reorientation dynamics of the intermediates was also investigated. It was found that the nucleotides usually take correct syn/anti configurations when they form native and stable hydrogen bonds with the others, while fluctuating between two configurations when they do not. Misfolded intermediates with wrong syn/anti configurations were observed in the early intermediates but not in the later ones. Based on the simulations, we also discussed the roles of the non-native interactions. Besides, the formation process of the parallel conformation in the first two G-repeats and the associated reversal loop were studied. Based on the above results, we proposed a folding pathway for the hybrid-1 type G-quadruplex with atomistic details, which is new and more complete compared with previous ones. The knowledge gained for this type of G-DNA may provide a general insight for the folding of the other G-quadruplexes.

G-quadruplex formation in telomeres enhances POT1/TPP1 protection against RPA binding

Science.gov (United States)

Ray, Sujay; Bandaria, Jigar N.; Qureshi, Mohammad H.; Yildiz, Ahmet; Balci, Hamza

2014-01-01

Human telomeres terminate with a single-stranded 3′ G overhang, which can be recognized as a DNA damage site by replication protein A (RPA). The protection of telomeres (POT1)/POT1-interacting protein 1 (TPP1) heterodimer binds specifically to single-stranded telomeric DNA (ssTEL) and protects G overhangs against RPA binding. The G overhang spontaneously folds into various G-quadruplex (GQ) conformations. It remains unclear whether GQ formation affects the ability of POT1/TPP1 to compete against RPA to access ssTEL. Using single-molecule Förster resonance energy transfer, we showed that POT1 stably loads to a minimal DNA sequence adjacent to a folded GQ. At 150 mM K+, POT1 loading unfolds the antiparallel GQ, as the parallel conformation remains folded. POT1/TPP1 loading blocks RPA’s access to both folded and unfolded telomeres by two orders of magnitude. This protection is not observed at 150 mM Na+, in which ssTEL forms only a less-stable antiparallel GQ. These results suggest that GQ formation of telomeric overhangs may contribute to suppression of DNA damage signals. PMID:24516170

Xanthene and Xanthone Derivatives as G-Quadruplex Stabilizing Ligands

Directory of Open Access Journals (Sweden)

Alessandro Altieri

2013-10-01

Full Text Available Following previous studies on anthraquinone and acridine-based G-quadruplex ligands, here we present a study of similar aromatic cores, with the specific aim of increasing G-quadruplex binding and selectivity with respect to duplex DNA. Synthesized compounds include two and three-side chain xanthone and xanthene derivatives, as well as a dimeric “bridged” form. ESI and FRET measurements suggest that all the studied molecules are good G-quadruplex ligands, both at telomeres and on G-quadruplex forming sequences of oncogene promoters. The dimeric compound and the three-side chain xanthone derivative have been shown to represent the best compounds emerging from the different series of ligands presented here, having also high selectivity for G-quadruplex structures with respect to duplex DNA. Molecular modeling simulations are in broad agreement with the experimental data.

Inverting the G-Tetrad Polarity of a G-Quadruplex by Using Xanthine and 8-Oxoguanine.

Science.gov (United States)

Cheong, Vee Vee; Lech, Christopher Jacques; Heddi, Brahim; Phan, Anh Tuân

2016-01-04

G-quadruplexes are four-stranded nucleic acid structures that are built from consecutively stacked guanine tetrad (G-tetrad) assemblies. The simultaneous incorporation of two guanine base lesions, xanthine (X) and 8-oxoguanine (O), within a single G-tetrad of a G-quadruplex was recently shown to lead to the formation of a stable G⋅G⋅X⋅O tetrad. Herein, a judicious introduction of X and O into a human telomeric G-quadruplex-forming sequence is shown to reverse the hydrogen-bond polarity of the modified G-tetrad while preserving the original folding topology. The control exerted over G-tetrad polarity by joint X⋅O modification will be valuable for the design and programming of G-quadruplex structures and their properties. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Hybrid ligand-alkylating agents targeting telomeric G-quadruplex structures.

Science.gov (United States)

Doria, Filippo; Nadai, Matteo; Folini, Marco; Di Antonio, Marco; Germani, Luca; Percivalle, Claudia; Sissi, Claudia; Zaffaroni, Nadia; Alcaro, Stefano; Artese, Anna; Richter, Sara N; Freccero, Mauro

2012-04-14

The synthesis, physico-chemical properties and biological effects of a new class of naphthalene diimides (NDIs) capable of reversibly binding telomeric DNA and alkylate it through an electrophilic quinone methide moiety (QM), are reported. FRET and circular dichroism assays showed a marked stabilization and selectivity towards telomeric G4 DNA folded in a hybrid topology. NDI-QMs' alkylating properties revealed a good reactivity on single nucleosides and selectivity towards telomeric G4. A selected NDI was able to significantly impair the growth of melanoma cells by causing telomere dysfunction and down-regulation of telomerase expression. These findings points to our hybrid ligand-alkylating NDIs as possible tools for the development of novel targeted anticancer therapies. This journal is © The Royal Society of Chemistry 2012

RTEL1 dismantles T loops and counteracts telomeric G4-DNA to maintain telomere integrity.

Science.gov (United States)

Vannier, Jean-Baptiste; Pavicic-Kaltenbrunner, Visnja; Petalcorin, Mark I R; Ding, Hao; Boulton, Simon J

2012-05-11

T loops and telomeric G-quadruplex (G4) DNA structures pose a potential threat to genome stability and must be dismantled to permit efficient telomere replication. Here we implicate the helicase RTEL1 in the removal of telomeric DNA secondary structures, which is essential for preventing telomere fragility and loss. In the absence of RTEL1, T loops are inappropriately resolved by the SLX4 nuclease complex, resulting in loss of the telomere as a circle. Depleting SLX4 or blocking DNA replication abolished telomere circles (TCs) and rescued telomere loss in RTEL1(-/-) cells but failed to suppress telomere fragility. Conversely, stabilization of telomeric G4-DNA or loss of BLM dramatically enhanced telomere fragility in RTEL1-deficient cells but had no impact on TC formation or telomere loss. We propose that RTEL1 performs two distinct functions at telomeres: it disassembles T loops and also counteracts telomeric G4-DNA structures, which together ensure the dynamics and stability of the telomere. Copyright © 2012 Elsevier Inc. All rights reserved.

Structural Insight into the interaction of Flavonoids with Human Telomeric Sequence

Science.gov (United States)

Tawani, Arpita; Kumar, Amit

2015-01-01

Flavonoids are a group of naturally available compounds that are an attractive source for drug discovery. Their potential to act as anti-tumourigenic and anti-proliferative agents has been reported previously but is not yet fully understood. Targeting human telomeric G-quadruplex DNA could be one of the mechanisms by which these flavonoids exert anticancer activity. We have performed detailed biophysical studies for the interaction of four representative flavonoids, Luteolin, Quercetin, Rutin and Genistein, with the human telomeric G-quadruplex sequence tetramolecular d-(T2AG3T) (Tel7). In addition, we used NMR spectroscopy to derive the first model for the complex formed between Quercetin and G-quadruplex sequence. The model showed that Quercetin stabilises the G-quadruplex structure and does not open the G-tetrad. It interacts with the telomeric sequence through π-stacking at two sites: between T1pT2 and between G6pT7. Based on our findings, we suggest that Quercetin could be a potent candidate for targeting the telomere and thus, act as a potent anti-cancer agent. PMID:26627543

Higher-order human telomeric G-quadruplex DNA metalloenzymes enhance enantioselectivity in the Diels-Alder reaction.

Science.gov (United States)

Li, Yinghao; Jia, Guoqing; Wang, Changhao; Cheng, Mingpan; Li, Can

2015-03-02

Short human telomeric (HT) DNA sequences form single G-quadruplex (G4 ) units and exhibit structure-based stereocontrol for a series of reactions. However, for more biologically relevant higher-order HT G4 -DNAs (beyond a single G4 unit), the catalytic performances are unknown. Here, we found that higher-order HT G4 -DNA copper metalloenzymes (two or three G4 units) afford remarkably higher enantioselectivity (>90 % ee) and a five- to sixfold rate increase, compared to a single G4 unit, for the Diels-Alder reaction. Electron paramagnetic resonance (EPR) and enzymatic kinetic studies revealed that the distinct catalytic function between single and higher-order G4 -DNA copper metalloenzymes can be attributed to different Cu(II) coordination environments and substrate specificity. Our finding suggests that, like protein enzymes and ribozymes, higher-order structural organization is crucial for G4 -DNA-based catalysis. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Identification of New Natural DNA G-Quadruplex Binders Selected by a Structure-Based Virtual Screening Approach

Directory of Open Access Journals (Sweden)

Stefano Alcaro

2013-09-01

Full Text Available The G-quadruplex DNA structures are mainly present at the terminal portion of telomeres and can be stabilized by ligands able to recognize them in a specific manner. The recognition process is usually related to the inhibition of the enzyme telomerase indirectly involved and over-expressed in a high percentage of human tumors. There are several ligands, characterized by different chemical structures, already reported in the literature for their ability to bind and stabilize the G-quadruplex structures. Using the structural and biological information available on these structures; we performed a high throughput in silico screening of commercially natural compounds databases by means of a structure-based approach followed by docking experiments against the human telomeric sequence d[AG3(T2AG33]. We identified 12 best hits characterized by different chemical scaffolds and conformational and physicochemical properties. All of them were associated to an improved theoretical binding affinity with respect to that of known selective G-binders. Among these hits there is a chalcone derivative; structurally very similar to the polyphenol butein; known to remarkably inhibit the telomerase activity.

Ligand binding to telomeric G-quadruplex DNA investigated by funnel-metadynamics simulations.

Science.gov (United States)

Moraca, Federica; Amato, Jussara; Ortuso, Francesco; Artese, Anna; Pagano, Bruno; Novellino, Ettore; Alcaro, Stefano; Parrinello, Michele; Limongelli, Vittorio

2017-03-14

G-quadruplexes (G4s) are higher-order DNA structures typically present at promoter regions of genes and telomeres. Here, the G4 formation decreases the replicative DNA at each cell cycle, finally leading to apoptosis. The ability to control this mitotic clock, particularly in cancer cells, is fascinating and passes through a rational understanding of the ligand/G4 interaction. We demonstrate that an accurate description of the ligand/G4 binding mechanism is possible using an innovative free-energy method called funnel-metadynamics (FM), which we have recently developed to investigate ligand/protein interaction. Using FM simulations, we have elucidated the binding mechanism of the anticancer alkaloid berberine to the human telomeric G4 ( d [AG 3 (T 2 AG 3 ) 3 ]), computing also the binding free-energy landscape. Two ligand binding modes have been identified as the lowest energy states. Furthermore, we have found prebinding sites, which are preparatory to reach the final binding mode. In our simulations, the ions and the water molecules have been explicitly represented and the energetic contribution of the solvent during ligand binding evaluated. Our theoretical results provide an accurate estimate of the absolute ligand/DNA binding free energy ([Formula: see text] = -10.3 ± 0.5 kcal/mol) that we validated through steady-state fluorescence binding assays. The good agreement between the theoretical and experimental value demonstrates that FM is a most powerful method to investigate ligand/DNA interaction and can be a useful tool for the rational design also of G4 ligands.

Targeting G-quadruplex DNA Structures by EMICORON has a strong antitumor efficacy against advanced models of human colon cancer

DEFF Research Database (Denmark)

Porru, Manuela; Artuso, Simona; Salvati, Erica

2015-01-01

We previously identified EMICORON as a novel G-quadruplex (G4) ligand showing high selectivity for G4 structures over the duplex DNA, causing telomere damage and inhibition of cell proliferation in transformed and tumor cells. Here, we evaluated the antitumoral effect of EMICORON on advanced mode...

Toward the design of new DNA G-quadruplex ligands through rational analysis of polymorphism and binding data.

Science.gov (United States)

Artese, Anna; Costa, Giosuè; Distinto, Simona; Moraca, Federica; Ortuso, Francesco; Parrotta, Lucia; Alcaro, Stefano

2013-10-01

Human telomeres play a key role in protecting chromosomal ends from fusion events; they are composed of d(TTAGGG) repeats, ranging in size from 3 to 15 kb. They form G-quadruplex DNA structures, stabilized by G-quartets in the presence of cations, and are involved in several biological processes. In particular, a telomere maintenance mechanism is provided by a specialized enzyme called telomerase, a reverse transcriptase able to add multiple copies of the 5'-GGTTAG-3' motif to the end of the G-strand of the telomere and which is over-expressed in the majority of cancer cells. The central cation has a crucial role in maintaining the stability of the structure. Based on its nature, it can be associated with different topological telomeric quadruplexes, which depend also on the orientation of the DNA strands and the syn/anti conformation of the guanines. Such a polymorphism, confirmed by the different structures deposited in the Protein Data Bank (PDB), prompted us to apply a computational protocol in order to investigate the conformational properties of a set of known G-quadruplex ligands and their molecular recognition against six different experimental models of the human telomeric sequence d[AG3(T2AG3)3]. The average AutoDock correlation between theoretical and experimental data yielded an r2 value equal to 0.882 among all the studied models. Such a result was always improved with respect to those of the single folds, with the exception of the parallel structure (r2 equal to 0.886), thus suggesting a key role of this G4 conformation in the stacking interaction network. Among the studied binders, a trisubstituted acridine and a dibenzophenanthroline derivative were well recognized by the parallel and the mixed G-quadruplex structures, allowing the identification of specific key contacts with DNA and the further design of more potent or target specific G-quadruplex ligands. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Synthesis of potent G-quadruplex binders of macrocyclic heptaoxazole and evaluation of their activities.

Science.gov (United States)

Tera, Masayuki; Iida, Keisuke; Shin-ya, Kazuo; Nagasawa, Kazuo

2009-01-01

Guanine-rich DNA sequences form unique three-dimensional conformation known as G-quadruplexes (G-q). G-q structures have been found in telomere and in some oncogene promoter. Recently, it was suggested that G-q showed some biological activities including telomere shortening and transcriptional regulation. In this paper, we synthesized selective G-q binders and evaluated of their biological activities.

Effect of Urea on G-Quadruplex Stability.

Science.gov (United States)

Aslanyan, Lusine; Ko, Jordan; Kim, Byul G; Vardanyan, Ishkhan; Dalyan, Yeva B; Chalikian, Tigran V

2017-07-13

G-quadruplexes represent a class of noncanonical nucleic acid structures implicated in transcriptional regulation, cellular function, and disease. An understanding of the forces involved in stabilization and destabilization of the G-quadruplex conformation relative to the duplex or single-stranded conformation is a key to elucidating the biological role of G-quadruplex-based genomic switches and the quest for therapeutic means for controlled induction or suppression of a G-quadruplex at selected genomic loci. Solute-solvent interactions provide a ubiquitous and, in many cases, the determining thermodynamic force in maintaining and modulating the stability of nucleic acids. These interactions involve water as well as water-soluble cosolvents that may be present in the solution or in the crowded environment in the cell. We present here the first quantitative investigation of the effect of urea, a destabilizing cosolvent, on the conformational preferences of a G-quadruplex formed by the telomeric d[A(G 3 T 2 A) 3 G 3 ] sequence (Tel22). At 20 mM NaCl and room temperature, Tel22 undergoes a two-state urea-induced unfolding transition. An increase in salt mitigates the deleterious effect of urea on Tel22. The urea m-value of Tel22 normalized per change in solvent-accessible surface area, ΔS A , is similar to those for other DNA and RNA structures while being several-fold larger than that of proteins. Our results suggest that urea can be employed as an analytical tool in thermodynamic characterizations of G-quadruplexes in a manner similar to the use of urea in protein studies. We emphasize the need for further studies involving a larger selection of G-quadruplexes varying in sequence, topology (parallel, antiparallel, hybrid), and molecularity (monomolecular, bimolecular, tetramolecular) to outline the advantages and the limits of the use of urea in G-quadruplex studies. A deeper understanding of the effect of solvent and cosolvents on the differential stability of the

Putative DNA G-quadruplex formation within the promoters of Plasmodium falciparum var genes

Directory of Open Access Journals (Sweden)

Rowe J

2009-08-01

Full Text Available Abstract Background Guanine-rich nucleic acid sequences are capable of folding into an intramolecular four-stranded structure called a G-quadruplex. When found in gene promoter regions, G-quadruplexes can downregulate gene expression, possibly by blocking the transcriptional machinery. Here we have used a genome-wide bioinformatic approach to identify Putative G-Quadruplex Sequences (PQS in the Plasmodium falciparum genome, along with biophysical techniques to examine the physiological stability of P. falciparum PQS in vitro. Results We identified 63 PQS in the non-telomeric regions of the P. falciparum clone 3D7. Interestingly, 16 of these PQS occurred in the upstream region of a subset of the P. falciparum var genes (group B var genes. The var gene family encodes PfEMP1, the parasite's major variant antigen and adhesin expressed at the surface of infected erythrocytes, that plays a key role in malaria pathogenesis and immune evasion. The ability of the PQS found in the upstream regions of group B var genes (UpsB-Q to form stable G-quadruplex structures in vitro was confirmed using 1H NMR, circular dichroism, UV spectroscopy, and thermal denaturation experiments. Moreover, the synthetic compound BOQ1 that shows a higher affinity for DNA forming quadruplex rather than duplex structures was found to bind with high affinity to the UpsB-Q. Conclusion This is the first demonstration of non-telomeric PQS in the genome of P. falciparum that form stable G-quadruplexes under physiological conditions in vitro. These results allow the generation of a novel hypothesis that the G-quadruplex sequences in the upstream regions of var genes have the potential to play a role in the transcriptional control of this major virulence-associated multi-gene family.

Formation of a unique cluster of G-quadruplex structures in the HIV-1 Nef coding region: implications for antiviral activity.

Directory of Open Access Journals (Sweden)

Rosalba Perrone

Full Text Available G-quadruplexes are tetraplex structures of nucleic acids that can form in G-rich sequences. Their presence and functional role have been established in telomeres, oncogene promoters and coding regions of the human chromosome. In particular, they have been proposed to be directly involved in gene regulation at the level of transcription. Because the HIV-1 Nef protein is a fundamental factor for efficient viral replication, infectivity and pathogenesis in vitro and in vivo, we investigated G-quadruplex formation in the HIV-1 nef gene to assess the potential for viral inhibition through G-quadruplex stabilization. A comprehensive computational analysis of the nef coding region of available strains showed the presence of three conserved sequences that were uniquely clustered. Biophysical testing proved that G-quadruplex conformations were efficiently stabilized or induced by G-quadruplex ligands in all three sequences. Upon incubation with a G-quadruplex ligand, Nef expression was reduced in a reporter gene assay and Nef-dependent enhancement of HIV-1 infectivity was significantly repressed in an antiviral assay. These data constitute the first evidence of the possibility to regulate HIV-1 gene expression and infectivity through G-quadruplex targeting and therefore open a new avenue for viral treatment.

The G-quadruplex DNA stabilizing drug pyridostatin promotes DNA damage and downregulates transcription of Brca1 in neurons.

Science.gov (United States)

Moruno-Manchon, Jose F; Koellhoffer, Edward C; Gopakumar, Jayakrishnan; Hambarde, Shashank; Kim, Nayun; McCullough, Louise D; Tsvetkov, Andrey S

2017-09-12

The G-quadruplex is a non-canonical DNA secondary structure formed by four DNA strands containing multiple runs of guanines. G-quadruplexes play important roles in DNA recombination, replication, telomere maintenance, and regulation of transcription. Small molecules that stabilize the G-quadruplexes alter gene expression in cancer cells. Here, we hypothesized that the G-quadruplexes regulate transcription in neurons. We discovered that pyridostatin, a small molecule that specifically stabilizes G-quadruplex DNA complexes, induced neurotoxicity and promoted the formation of DNA double-strand breaks (DSBs) in cultured neurons. We also found that pyridostatin downregulated transcription of the Brca1 gene, a gene that is critical for DSB repair. Importantly, in an in vitro gel shift assay, we discovered that an antibody specific to the G-quadruplex structure binds to a synthetic oligonucleotide, which corresponds to the first putative G-quadruplex in the Brca1 gene promoter. Our results suggest that the G-quadruplex complexes regulate transcription in neurons. Studying the G-quadruplexes could represent a new avenue for neurodegeneration and brain aging research.

G Quadruplex in Plants: A Ubiquitous Regulatory Element and Its Biological Relevance.

Science.gov (United States)

Yadav, Vikas; Hemansi; Kim, Nayun; Tuteja, Narendra; Yadav, Puja

2017-01-01

G quadruplexes (G4) are higher-order DNA and RNA secondary structures formed by G-rich sequences that are built around tetrads of hydrogen-bonded guanine bases. Potential G4 quadruplex sequences have been identified in G-rich eukaryotic non-telomeric and telomeric genomic regions. Upon function, G4 formation is known to involve in chromatin remodeling, gene regulation and has been associated with genomic instability, genetic diseases and cancer progression. The natural role and biological validation of G4 structures is starting to be explored, and is of particular interest for the therapeutic interventions for human diseases. However, the existence and physiological role of G4 DNA and G4 RNA in plants species have not been much investigated yet and therefore, is of great interest for the development of improved crop varieties for sustainable agriculture. In this context, several recent studies suggests that these highly diverse G4 structures in plants can be employed to regulate expression of genes involved in several pathophysiological conditions including stress response to biotic and abiotic stresses as well as DNA damage. In the current review, we summarize the recent findings regarding the emerging functional significance of G4 structures in plants and discuss their potential value in the development of improved crop varieties.

G Quadruplex in Plants: A Ubiquitous Regulatory Element and Its Biological Relevance

Directory of Open Access Journals (Sweden)

Vikas Yadav

2017-07-01

Full Text Available G quadruplexes (G4 are higher-order DNA and RNA secondary structures formed by G-rich sequences that are built around tetrads of hydrogen-bonded guanine bases. Potential G4 quadruplex sequences have been identified in G-rich eukaryotic non-telomeric and telomeric genomic regions. Upon function, G4 formation is known to involve in chromatin remodeling, gene regulation and has been associated with genomic instability, genetic diseases and cancer progression. The natural role and biological validation of G4 structures is starting to be explored, and is of particular interest for the therapeutic interventions for human diseases. However, the existence and physiological role of G4 DNA and G4 RNA in plants species have not been much investigated yet and therefore, is of great interest for the development of improved crop varieties for sustainable agriculture. In this context, several recent studies suggests that these highly diverse G4 structures in plants can be employed to regulate expression of genes involved in several pathophysiological conditions including stress response to biotic and abiotic stresses as well as DNA damage. In the current review, we summarize the recent findings regarding the emerging functional significance of G4 structures in plants and discuss their potential value in the development of improved crop varieties.

Determinants for Tight and Selective Binding of a Medicinal Dicarbene Gold(I) Complex to a Telomeric DNA G-Quadruplex: a Joint ESI MS and XRD Investigation.

Science.gov (United States)

Bazzicalupi, Carla; Ferraroni, Marta; Papi, Francesco; Massai, Lara; Bertrand, Benoît; Messori, Luigi; Gratteri, Paola; Casini, Angela

2016-03-18

The dicarbene gold(I) complex [Au(9-methylcaffein-8-ylidene)2 ]BF4 is an exceptional organometallic compound of profound interest as a prospective anticancer agent. This gold(I) complex was previously reported to be highly cytotoxic toward various cancer cell lines in vitro and behaves as a selective G-quadruplex stabilizer. Interactions of the gold complex with various telomeric DNA models have been analyzed by a combined ESI MS and X-ray diffraction (XRD) approach. ESI MS measurements confirmed formation of stable adducts between the intact gold(I) complex and Tel 23 DNA sequence. The crystal structure of the adduct formed between [Au(9-methylcaffein-8-ylidene)2 ](+) and Tel 23 DNA G-quadruplex was solved. Tel 23 maintains a characteristic propeller conformation while binding three gold(I) dicarbene moieties at two distinct sites. Stacking interactions appear to drive noncovalent binding of the gold(I) complex. The structural basis for tight gold(I) complex/G-quadruplex recognition and its selectivity are described. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Telomeric repeat-containing RNA/G-quadruplex-forming sequences cause genome-wide alteration of gene expression in human cancer cells in vivo.

Science.gov (United States)

Hirashima, Kyotaro; Seimiya, Hiroyuki

2015-02-27

Telomere erosion causes cell mortality, suggesting that longer telomeres enable more cell divisions. In telomerase-positive human cancer cells, however, telomeres are often kept shorter than those of surrounding normal tissues. Recently, we showed that cancer cell telomere elongation represses innate immune genes and promotes their differentiation in vivo. This implies that short telomeres contribute to cancer malignancy, but it is unclear how such genetic repression is caused by elongated telomeres. Here, we report that telomeric repeat-containing RNA (TERRA) induces a genome-wide alteration of gene expression in telomere-elongated cancer cells. Using three different cell lines, we found that telomere elongation up-regulates TERRA signal and down-regulates innate immune genes such as STAT1, ISG15 and OAS3 in vivo. Ectopic TERRA oligonucleotides repressed these genes even in cells with short telomeres under three-dimensional culture conditions. This appeared to occur from the action of G-quadruplexes (G4) in TERRA, because control oligonucleotides had no effect and a nontelomeric G4-forming oligonucleotide phenocopied the TERRA oligonucleotide. Telomere elongation and G4-forming oligonucleotides showed similar gene expression signatures. Most of the commonly suppressed genes were involved in the innate immune system and were up-regulated in various cancers. We propose that TERRA G4 counteracts cancer malignancy by suppressing innate immune genes. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

A Selective G-Quadruplex DNA-Stabilizing Ligand Based on a Cyclic Naphthalene Diimide Derivative

Directory of Open Access Journals (Sweden)

Md. Monirul Islam

2015-06-01

Full Text Available A cyclic naphthalene diimide (cyclic NDI, 1, carrying a benzene moiety as linker chain, was synthesized and its interaction with G-quadruplex DNAs of a-core and a-coreTT as a human telomeric DNA, c-kit and c-myc as DNA sequence at promoter region, or thrombin-binding aptamer (TBA studied based on UV-VIS and circular dichroism (CD spectroscopic techniques, thermal melting temperature measurement, and FRET-melting assay. The circular dichroism spectra showed that 1 induced the formation of different types of G-quadruplex DNA structure. Compound 1 bound to these G-quadruplexes with affinities in the range of 106–107 M−1 order and a 2:1 stoichiometry. Compound 1 showed 270-fold higher selectivity for a-core than dsDNA with a preferable a-core binding than a-coreTT, c-kit, c-myc and TBA in the presence of K+, which is supported by thermal melting studies. The FRET-melting assay also showed that 1 bound preferentially to human telomeric DNA. Compound 1 showed potent inhibition against telomerase activity with an IC50 value of 0.9 μM and preferable binding to G-quadruplexes DNA than our previously published cyclic NDI derivative 3 carrying a benzene moiety as longer linker chain.

A multi-functional guanine derivative for studying the DNA G-quadruplex structure.

Science.gov (United States)

Ishizuka, Takumi; Zhao, Pei-Yan; Bao, Hong-Liang; Xu, Yan

2017-10-23

In the present study, we developed a multi-functional guanine derivative, 8F G, as a G-quadruplex stabilizer, a fluorescent probe for the detection of G-quadruplex formation, and a 19 F sensor for the observation of the G-quadruplex. We demonstrate that the functional nucleoside bearing a 3,5-bis(trifluoromethyl)benzene group at the 8-position of guanine stabilizes the DNA G-quadruplex structure and fluoresces following the G-quadruplex formation. Furthermore, we show that the functional sensor can be used to directly observe DNA G-quadruplexes by 19 F-NMR in living cells. To our knowledge, this is the first study showing that the nucleoside derivative simultaneously allows for three kinds of functions at a single G-quadruplex DNA. Our results suggest that the multi-functional nucleoside derivative can be broadly used for studying the G-quadruplex structure and serves as a powerful tool for examining the molecular basis of G-quadruplex formation in vitro and in living cells.

Phenanthroline-2,9-bistriazoles as selective G-quadruplex ligands

DEFF Research Database (Denmark)

Nielsen, Mads Corvinius; Larsen, Anders Foller; Abdikadir, Faisal Hussein

2014-01-01

G-quadruplex (G4) ligands are currently receiving considerable attention as potential anticancer therapeutics. A series of phenanthroline-2,9-bistriazoles carrying tethered positive end groups has been synthesized and evaluated as G4 stabilizers. The compounds were efficiently assembled by copper......(I)-catalyzed azide-alkyne cycloaddition (CuAAC) in CH2Cl2 and water in the presence of a complexing agent. Characterization of the target compounds on telomeric and c-KIT G4 sequences led to the identification of guanidinium-substituted compounds as potent G4 DNA ligands with high selectivity over duplex DNA....... The diisopropylguanidium ligands exhibited high selectivity for the proto-oncogenic sequence c-KIT over the human telomeric sequence in the surface plasmon resonance (SPR) assay, whereas the compounds appeared potent on both G4 structures in the FRET melting temperature assay. The phenanthroline-2,9-bistriazole ligands...

G-Quadruplexes Involving Both Strands of Genomic DNA Are Highly Abundant and Colocalize with Functional Sites in the Human Genome.

Directory of Open Access Journals (Sweden)

Andrzej S Kudlicki

Full Text Available The G-quadruplex is a non-canonical DNA structure biologically significant in DNA replication, transcription and telomere stability. To date, only G4s with all guanines originating from the same strand of DNA have been considered in the context of the human nuclear genome. Here, I discuss interstrand topological configurations of G-quadruplex DNA, consisting of guanines from both strands of genomic DNA; an algorithm is presented for predicting such structures. I have identified over 550,000 non-overlapping interstrand G-quadruplex forming sequences in the human genome--significantly more than intrastrand configurations. Functional analysis of interstrand G-quadruplex sites shows strong association with transcription initiation, the results are consistent with the XPB and XPD transcriptional helicases binding only to G-quadruplex DNA with interstrand topology. Interstrand quadruplexes are also enriched in origin of replication sites. Several topology classes of interstrand quadruplex-forming sequences are possible, and different topologies are enriched in different types of structural elements. The list of interstrand quadruplex forming sequences, and the computer program used for their prediction are available at the web address http://moment.utmb.edu/allquads.

Unexpected Position-Dependent Effects of Ribose G-Quartets in G-Quadruplexes

Czech Academy of Sciences Publication Activity Database

Zhou, J.; Amrane, S.; Rosu, F.; Salgado, G.; Bian, Y.; Tateishi-Karimata, H.; Largy, E.; Korkut, D. N.; Bourdoncle, A.; Miyoshi, D.; Zhang, J.; Ju, H.; Wang, W.; Sugimoto, N.; Gabelica, V.; Mergny, Jean-Louis

2017-01-01

Roč. 139, č. 23 (2017), s. 7768-7779 ISSN 0002-7863 Institutional support: RVO:68081707 Keywords : human telomeric rna * electrospray mass-spectrometry * molecular crowding conditions * dna g-quadruplexes Subject RIV: BO - Biophysics OBOR OECD: Electrochemistry (dry cells, batteries, fuel cells, corrosion metals, electrolysis) Impact factor: 13.858, year: 2016

DNA adducts of antitumor cisplatin preclude telomeric sequences from forming G quadruplexes

Czech Academy of Sciences Publication Activity Database

Heringová, Pavla; Kašpárková, Jana; Brabec, Viktor

2009-01-01

Roč. 14, č. 6 (2009), s. 959-968 ISSN 0949-8257 R&D Projects: GA MZd(CZ) NR8562; GA MŠk(CZ) LC06030; GA MŠk(CZ) ME08017; GA MŠk(CZ) OC08003; GA AV ČR(CZ) 1QS500040581; GA AV ČR(CZ) KAN200200651; GA AV ČR(CZ) IAA400040803 Grant - others:GA MŠk(CZ) OC09018 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : cisplatin * DNA quadruplex * telomere Subject RIV: BO - Biophysics Impact factor: 3.415, year: 2009

Effect of Monovalent Ion Parameters on Molecular Dynamics Simulations of G-Quadruplexes

Czech Academy of Sciences Publication Activity Database

Havrila, Marek; Stadlbauer, Petr; Islam, Barira; Otyepka, M.; Šponer, Jiří

2017-01-01

Roč. 13, č. 8 (2017), s. 3911-3926 ISSN 1549-9618 R&D Projects: GA MŠk EF15_003/0000477; GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * amber force-field * nucleic-acid quadruplexes Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 5.245, year: 2016

Sugar-modified G-quadruplexes: effects of LNA-, 2′F-RNA– and 2′F-ANA-guanosine chemistries on G-quadruplex structure and stability

Science.gov (United States)

Li, Zhe; Lech, Christopher Jacques; Phan, Anh Tuân

2014-01-01

G-quadruplex-forming oligonucleotides containing modified nucleotide chemistries have demonstrated promising pharmaceutical potential. In this work, we systematically investigate the effects of sugar-modified guanosines on the structure and stability of a (4+0) parallel and a (3+1) hybrid G-quadruplex using over 60 modified sequences containing a single-position substitution of 2′-O-4′-C-methylene-guanosine (LNAG), 2′-deoxy-2′-fluoro-riboguanosine (FG) or 2′-deoxy-2′-fluoro-arabinoguanosine (FANAG). Our results are summarized in two parts: (I) Generally, LNAG substitutions into ‘anti’ position guanines within a guanine-tetrad lead to a more stable G-quadruplex, while substitutions into ‘syn’ positions disrupt the native G-quadruplex conformation. However, some interesting exceptions to this trend are observed. We discover that a LNAG modification upstream of a short propeller loop hinders G-quadruplex formation. (II) A single substitution of either FG or FANAG into a ‘syn’ position is powerful enough to perturb the (3+1) G-quadruplex. Substitution of either FG or FANAG into any ‘anti’ position is well tolerated in the two G-quadruplex scaffolds. FANAG substitutions to ‘anti’ positions are better tolerated than their FG counterparts. In both scaffolds, FANAG substitutions to the central tetrad layer are observed to be the most stabilizing. The observations reported herein on the effects of LNAG, FG and FANAG modifications on G-quadruplex structure and stability will enable the future design of pharmaceutically relevant oligonucleotides. PMID:24371274

Identification of the DNA-Binding Domains of Human Replication Protein A That Recognize G-Quadruplex DNA

Directory of Open Access Journals (Sweden)

Aishwarya Prakash

2011-01-01

Full Text Available Replication protein A (RPA, a key player in DNA metabolism, has 6 single-stranded DNA-(ssDNA- binding domains (DBDs A-F. SELEX experiments with the DBDs-C, -D, and -E retrieve a 20-nt G-quadruplex forming sequence. Binding studies show that RPA-DE binds preferentially to the G-quadruplex DNA, a unique preference not observed with other RPA constructs. Circular dichroism experiments show that RPA-CDE-core can unfold the G-quadruplex while RPA-DE stabilizes it. Binding studies show that RPA-C binds pyrimidine- and purine-rich sequences similarly. This difference between RPA-C and RPA-DE binding was also indicated by the inability of RPA-CDE-core to unfold an oligonucleotide containing a TC-region 5′ to the G-quadruplex. Molecular modeling studies of RPA-DE and telomere-binding proteins Pot1 and Stn1 reveal structural similarities between the proteins and illuminate potential DNA-binding sites for RPA-DE and Stn1. These data indicate that DBDs of RPA have different ssDNA recognition properties.

Seven essential questions on G-quadruplexes.

Science.gov (United States)

König, Sebastian L B; Evans, Amanda C; Huppert, Julian L

2010-08-01

The helical duplex architecture of DNA was discovered by Francis Crick and James Watson in 1951 and is well known and understood. However, nucleic acids can also adopt alternative structural conformations that are less familiar, although no less biologically relevant, such as the G-quadruplex. G-quadruplexes continue to be the subject of a rapidly expanding area of research, owing to their significant potential as therapeutic targets and their unique biophysical properties. This review begins by focusing on G-quadruplex structure, elucidating the intermolecular and intramolecular interactions underlying its formation and highlighting several substructural variants. A variety of methods used to characterize these structures are also outlined. The current state of G-quadruplex research is then addressed by proffering seven pertinent questions for discussion. This review concludes with an overview of possible directions for future research trajectories in this exciting and relevant field.

Quadruplexes in 'Dicty': crystal structure of a four-quartet G-quadruplex formed by G-rich motif found in the Dictyostelium discoideum genome.

Science.gov (United States)

Guédin, Aurore; Lin, Linda Yingqi; Armane, Samir; Lacroix, Laurent; Mergny, Jean-Louis; Thore, Stéphane; Yatsunyk, Liliya A

2018-06-01

Guanine-rich DNA has the potential to fold into non-canonical G-quadruplex (G4) structures. Analysis of the genome of the social amoeba Dictyostelium discoideum indicates a low number of sequences with G4-forming potential (249-1055). Therefore, D. discoideum is a perfect model organism to investigate the relationship between the presence of G4s and their biological functions. As a first step in this investigation, we crystallized the dGGGGGAGGGGTACAGGGGTACAGGGG sequence from the putative promoter region of two divergent genes in D. discoideum. According to the crystal structure, this sequence folds into a four-quartet intramolecular antiparallel G4 with two lateral and one diagonal loops. The G-quadruplex core is further stabilized by a G-C Watson-Crick base pair and a A-T-A triad and displays high thermal stability (Tm > 90°C at 100 mM KCl). Biophysical characterization of the native sequence and loop mutants suggests that the DNA adopts the same structure in solution and in crystalline form, and that loop interactions are important for the G4 stability but not for its folding. Four-tetrad G4 structures are sparse. Thus, our work advances understanding of the structural diversity of G-quadruplexes and yields coordinates for in silico drug screening programs and G4 predictive tools.

Interaction of pyrrolobenzodiazepine (PBD ligands with parallel intermolecular G-quadruplex complex using spectroscopy and ESI-MS.

Directory of Open Access Journals (Sweden)

Gajjela Raju

Full Text Available Studies on ligand interaction with quadruplex DNA, and their role in stabilizing the complex at concentration prevailing under physiological condition, has attained high interest. Electrospray ionization mass spectrometry (ESI-MS and spectroscopic studies in solution were used to evaluate the interaction of PBD and TMPyP4 ligands, stoichiometry and selectivity to G-quadruplex DNA. Two synthetic ligands from PBD family, namely pyrene-linked pyrrolo[2,1-c][1,4]benzodiazepine hybrid (PBD1, mixed imine-amide pyrrolobenzodiazepine dimer (PBD2 and 5,10,15,20-tetrakis(N-methyl-4-pyridylporphyrin (TMPyP4 were studied. G-rich single-stranded oligonucleotide d(5'GGGGTTGGGG3' designated as d(T(2G(8, from the telomeric region of Tetrahymena Glaucoma, was considered for the interaction with ligands. ESI-MS and spectroscopic methods viz., circular dichroism (CD, UV-Visible, and fluorescence were employed to investigate the G-quadruplex structures formed by d(T(2G(8 sequence and its interaction with PBD and TMPyP4 ligands. From ESI-MS spectra, it is evident that the majority of quadruplexes exist as d(T(2G(8(2 and d(T(2G(8(4 forms possessing two to ten cations in the centre, thereby stabilizing the complex. CD band of PBD1 and PBD2 showed hypo and hyperchromicity, on interaction with quadruplex DNA, indicating unfolding and stabilization of quadruplex DNA complex, respectively. UV-Visible and fluorescence experiments suggest that PBD1 bind externally where as PBD2 intercalate moderately and bind externally to G-quadruplex DNA. Further, melting experiments using SYBR Green indicate that PBD1 unfolds and PBD2 stabilizes the G-quadruplex complex. ITC experiments using d(T(2G(8 quadruplex with PBD ligands reveal that PBD1 and PBD2 prefer external/loop binding and external/intercalative binding to quadruplex DNA, respectively. From experimental results it is clear that the interaction of PBD2 and TMPyP4 impart higher stability to the quadruplex complex.

Interaction of Pyrrolobenzodiazepine (PBD) Ligands with Parallel Intermolecular G-Quadruplex Complex Using Spectroscopy and ESI-MS

Science.gov (United States)

Raju, Gajjela; Srinivas, Ragampeta; Santhosh Reddy, Vangala; Idris, Mohammed M.; Kamal, Ahmed; Nagesh, Narayana

2012-01-01

Studies on ligand interaction with quadruplex DNA, and their role in stabilizing the complex at concentration prevailing under physiological condition, has attained high interest. Electrospray ionization mass spectrometry (ESI-MS) and spectroscopic studies in solution were used to evaluate the interaction of PBD and TMPyP4 ligands, stoichiometry and selectivity to G-quadruplex DNA. Two synthetic ligands from PBD family, namely pyrene-linked pyrrolo[2,1-c][1,4]benzodiazepine hybrid (PBD1), mixed imine-amide pyrrolobenzodiazepine dimer (PBD2) and 5,10,15,20-tetrakis(N-methyl-4-pyridyl)porphyrin (TMPyP4) were studied. G-rich single-stranded oligonucleotide d(5′GGGGTTGGGG3′) designated as d(T2G8), from the telomeric region of Tetrahymena Glaucoma, was considered for the interaction with ligands. ESI-MS and spectroscopic methods viz., circular dichroism (CD), UV-Visible, and fluorescence were employed to investigate the G-quadruplex structures formed by d(T2G8) sequence and its interaction with PBD and TMPyP4 ligands. From ESI-MS spectra, it is evident that the majority of quadruplexes exist as d(T2G8)2 and d(T2G8)4 forms possessing two to ten cations in the centre, thereby stabilizing the complex. CD band of PBD1 and PBD2 showed hypo and hyperchromicity, on interaction with quadruplex DNA, indicating unfolding and stabilization of quadruplex DNA complex, respectively. UV-Visible and fluorescence experiments suggest that PBD1 bind externally where as PBD2 intercalate moderately and bind externally to G-quadruplex DNA. Further, melting experiments using SYBR Green indicate that PBD1 unfolds and PBD2 stabilizes the G-quadruplex complex. ITC experiments using d(T2G8) quadruplex with PBD ligands reveal that PBD1 and PBD2 prefer external/loop binding and external/intercalative binding to quadruplex DNA, respectively. From experimental results it is clear that the interaction of PBD2 and TMPyP4 impart higher stability to the quadruplex complex. PMID:22558271

Volumetric contributions of loop regions of G-quadruplex DNA to the formation of the tertiary structure.

Science.gov (United States)

Takahashi, Shuntaro; Sugimoto, Naoki

2017-12-01

DNA guanine-quadruplexes (G-quadruplexes) are unique DNA structures formed by guanine-rich sequences. The loop regions of G-quadruplexes play key roles in stability and topology of G-quadruplexes. Here, we investigated volumetric changes induced by pressure in the folding of the G-quadruplex formed by the thrombin binding aptamer (TBA) with mutations within the loop regions. The change of partial molar volume in the transition from coil to G-quadruplex, ∆V tr , of TBA with a mutation from T to A in the 5' most loop (TBA T3A) was 75.5cm 3 mol -1 , which was larger than that of TBA (54.6cm 3 mol -1 ). TBA with a G to T mutation in the central loop (TBA G8T) had thermal stability similar to TBA T3A but a smaller ∆V tr of 41.1cm 3 mol -1 . In the presence of poly(ethylene)glycol 200 (PEG200), ∆V tr values were 14.7cm 3 mol -1 for TBA T3A and 13.2cm 3 mol -1 for TBA G8T. These results suggest that the two mutations destabilize the G-quadruplex structure differently. Thus, volumetric data obtained using pressure-based thermodynamic analyses provides information about the dynamics of the loop regions and the roles of loops in the stabilities and folding of G-quadruplex structures. Copyright © 2017 Elsevier B.V. All rights reserved.

Multifunctional energy landscape for a DNA G-quadruplex: An evolved molecular switch

Czech Academy of Sciences Publication Activity Database

Cragnolini, T.; Chakraborty, D.; Šponer, Jiří; Derreumaux, P.; Pasquali, S.; Wales, D.J.

2017-01-01

Roč. 147, č. 15 (2017), č. článku 152715. ISSN 0021-9606 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * gb1 hairpin peptide Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 2.965, year: 2016

Expanding the potential of G-quadruplex structures: formation of a heterochiral TBA analogue.

Science.gov (United States)

Virgilio, Antonella; Varra, Michela; Scuotto, Maria; Capuozzo, Antonella; Irace, Carlo; Mayol, Luciano; Esposito, Veronica; Galeone, Aldo

2014-03-21

In order to expand the potential applications of G-quadruplex structures, we explored the ability of heterochiral oligodeoxynucleotides based on the thrombin-binding aptamer (TBA) sequence to fold into similar complexes, with particular focus on their resistance in biological environments. A combination of CD and NMR techniques was used. Similarly to TBA, the ODN ggTTggtgtggTTgg (lower case letters indicate L residues) is able to fold into a chair-like antiparallel G-quadruplex structure, but has a slightly higher thermal stability. The discovery that heterochiral ODNs are able to form stable G-quadruplex structures opens up new possibilities for their development in several fields, as aptamers, sensors and, as recently shown, as catalysts for enantioselective reactions. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

DNA and RNA Quadruplex-Binding Proteins

Czech Academy of Sciences Publication Activity Database

Brázda, Václav; Haroniková, Lucia; Liao, J.C.C.; Fojta, Miroslav

2014-01-01

Roč. 15, č. 10 (2014), s. 17493-17517 E-ISSN 1422-0067 R&D Projects: GA ČR(CZ) GBP206/12/G151 Institutional support: RVO:68081707 Keywords : DNA quadruplex * RNA quadruplex * telomere Subject RIV: BO - Biophysics Impact factor: 2.862, year: 2014

The Effects of Molecular Crowding on the Structure and Stability of G-Quadruplexes with an Abasic Site

Science.gov (United States)

Fujimoto, Takeshi; Nakano, Shu-ichi; Miyoshi, Daisuke; Sugimoto, Naoki

2011-01-01

Both cellular environmental factors and chemical modifications critically affect the properties of nucleic acids. However, the structure and stability of DNA containing abasic sites under cell-mimicking molecular crowding conditions remain unclear. Here, we investigated the molecular crowding effects on the structure and stability of the G-quadruplexes including a single abasic site. Structural analysis by circular dichroism showed that molecular crowding by PEG200 did not affect the topology of the G-quadruplex structure with or without an abasic site. Thermodynamic analysis further demonstrated that the degree of stabilization of the G-quadruplex by molecular crowding decreased with substitution of an abasic site for a single guanine. Notably, we found that the molecular crowding effects on the enthalpy change for G-quadruplex formation had a linear relationship with the abasic site effects depending on its position. These results are useful for predicting the structure and stability of G-quadruplexes with abasic sites in the cell-mimicking conditions. PMID:21949901

Structure of a Stable G-Hairpin

Czech Academy of Sciences Publication Activity Database

Gajarský, M.; Zivkovic, M.L.; Stadlbauer, Petr; Pagano, B.; Fiala, R.; Amato, J.; Tomáška, L´.; Šponer, Jiří; Plavec, J.; Trantírek, L.

2017-01-01

Roč. 139, č. 10 (2017), s. 3591-3594 ISSN 0002-7863 R&D Projects: GA ČR GA13-28310S; GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : g-quadruplex structures * human telomeric dna * single-stranded-dna * g-triplex Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 13.858, year: 2016

G-Quadruplex Forming Oligonucleotides as Anti-HIV Agents.

Science.gov (United States)

Musumeci, Domenica; Riccardi, Claudia; Montesarchio, Daniela

2015-09-22

Though a variety of different non-canonical nucleic acids conformations have been recognized, G-quadruplex structures are probably the structural motifs most commonly found within known oligonucleotide-based aptamers. This could be ascribed to several factors, as their large conformational diversity, marked responsiveness of their folding/unfolding processes to external stimuli, high structural compactness and chemo-enzymatic and thermodynamic stability. A number of G-quadruplex-forming oligonucleotides having relevant in vitro anti-HIV activity have been discovered in the last two decades through either SELEX or rational design approaches. Improved aptamers have been obtained by chemical modifications of natural oligonucleotides, as terminal conjugations with large hydrophobic groups, replacement of phosphodiester linkages with phosphorothioate bonds or other surrogates, insertion of base-modified monomers, etc. In turn, detailed structural studies have elucidated the peculiar architectures adopted by many G-quadruplex-based aptamers and provided insight into their mechanism of action. An overview of the state-of-the-art knowledge of the relevance of putative G-quadruplex forming sequences within the viral genome and of the most studied G-quadruplex-forming aptamers, selectively targeting HIV proteins, is here presented.

Intermolecular G-quadruplex structure-based fluorescent DNA detection system.

Science.gov (United States)

Zhou, Hui; Wu, Zai-Sheng; Shen, Guo-Li; Yu, Ru-Qin

2013-03-15

Adopting multi-donors to pair with one acceptor could improve the performance of fluorogenic detection probes. However, common dyes (e.g., fluorescein) in close proximity to each other would self-quench the fluorescence, and the fluorescence is difficult to restore. In this contribution, we constructed a novel "multi-donors-to-one acceptor" fluorescent DNA detection system by means of the intermolecular G-quadruplex (IGQ) structure-based fluorescence signal enhancement combined with the hairpin oligonucleotide. The novel IGQ-hairpin system was characterized using the p53 gene as the model target DNA. The proposed system showed an improved assay performance due to the introduction of IGQ-structure into fluorescent signaling probes, which could inhibit the background fluorescence and increase fluorescence restoration amplitude of fluoresceins upon target DNA hybridization. The proof-of-concept scheme is expected to provide new insight into the potential of G-quadruplex structure and promote the application of fluorescent oligonucleotide probes in fundamental research, diagnosis, and treatment of genetic diseases. Copyright © 2012 Elsevier B.V. All rights reserved.

RecQ-core of BLM unfolds telomeric G-quadruplex in the absence of ATP

Czech Academy of Sciences Publication Activity Database

Budhathoki, J.B.; Ray, S.; Urban, Václav; Janščák, Pavel; Jodh, J.G.; Balci, H.

2014-01-01

Roč. 42, č. 18 (2014), s. 11528-11545 ISSN 0305-1048 R&D Projects: GA ČR GA204/09/0565 Grant - others:U.S. National Science Foundation through the Physics Frontiers Center Program(US) 1430124 Institutional support: RVO:68378050 Keywords : single-stranded DNA * RECQ5 helicase * G-quadruplex structures Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 9.112, year: 2014

Investigation of ‘Head-to-Tail’-Connected Oligoaryl N,O-Ligands as Recognition Motifs for Cancer-Relevant G-Quadruplexes

Directory of Open Access Journals (Sweden)

Natalia Rizeq

2017-12-01

Full Text Available Oligomeric compounds, constituted of consecutive N,O-heteroaromatic rings, introduce useful and tunable properties as alternative ligands for biomolecular recognition. In this study, we have explored a synthetic scheme relying on Van Leusen oxazole formation, in conjunction with C–H activation of the formed oxazoles and their subsequent C–C cross-coupling to 2-bromopyridines in order to assemble a library of variable-length, ‘head-to-tail’-connected, pyridyl-oxazole ligands. Through investigation of the interaction of the three longer ligands (5-mer, 6-mer, 7-mer with cancer-relevant G-quadruplex structures (human telomeric/22AG and c-Myc oncogene promoter/Myc2345-Pu22, the asymmetric pyridyl-oxazole motif has been demonstrated to be a prominent recognition element for G-quadruplexes. Fluorescence titrations reveal excellent binding affinities of the 7-mer and 6-mer for a Na+-induced antiparallel 22AG G-quadruplex (KD = 0.6 × 10−7 M−1 and 0.8 × 10−7 M−1, respectively, and satisfactory (albeit lower affinities for the 22AG/K+ and Myc2345-Pu22/K+ G-quadruplexes. All ligands tested exhibit substantial selectivity for G-quadruplex versus duplex (ds26 DNA, as evidenced by competitive Förster resonance energy transfer (FRET melting assays. Additionally, the 7-mer and 6-mer are capable of promoting a sharp morphology transition of 22AG/K+ G-quadruplex.

Macrocyclic G-quadruplex ligands

DEFF Research Database (Denmark)

Nielsen, M C; Ulven, Trond

2010-01-01

are macrocyclic structures which have been modeled after the natural product telomestatin or from porphyrin-based ligands discovered in the late 1990s. These two structural classes of G-quadruplex ligands are reviewed here with special attention to selectivity and structure-activity relationships, and with focus...

Electrochemical and AFM Characterization of G-Quadruplex Electrochemical Biosensors and Applications

Science.gov (United States)

2018-01-01

Guanine-rich DNA sequences are able to form G-quadruplexes, being involved in important biological processes and representing smart self-assembling nanomaterials that are increasingly used in DNA nanotechnology and biosensor technology. G-quadruplex electrochemical biosensors have received particular attention, since the electrochemical response is particularly sensitive to the DNA structural changes from single-stranded, double-stranded, or hairpin into a G-quadruplex configuration. Furthermore, the development of an increased number of G-quadruplex aptamers that combine the G-quadruplex stiffness and self-assembling versatility with the aptamer high specificity of binding to a variety of molecular targets allowed the construction of biosensors with increased selectivity and sensitivity. This review discusses the recent advances on the electrochemical characterization, design, and applications of G-quadruplex electrochemical biosensors in the evaluation of metal ions, G-quadruplex ligands, and other small organic molecules, proteins, and cells. The electrochemical and atomic force microscopy characterization of G-quadruplexes is presented. The incubation time and cations concentration dependence in controlling the G-quadruplex folding, stability, and nanostructures formation at carbon electrodes are discussed. Different G-quadruplex electrochemical biosensors design strategies, based on the DNA folding into a G-quadruplex, the use of G-quadruplex aptamers, or the use of hemin/G-quadruplex DNAzymes, are revisited. PMID:29666699

Controlling the stoichiometry and strand polarity of a tetramolecular G-quadruplex structure by using a DNA origami frame

Science.gov (United States)

Rajendran, Arivazhagan; Endo, Masayuki; Hidaka, Kumi; Lan Thao Tran, Phong; Mergny, Jean-Louis; Sugiyama, Hiroshi

2013-01-01

Guanine-rich oligonucleotides often show a strong tendency to form supramolecular architecture, the so-called G-quadruplex structure. Because of the biological significance, it is now considered to be one of the most important conformations of DNA. Here, we describe the direct visualization and single-molecule analysis of the formation of a tetramolecular G-quadruplex in KCl solution. The conformational changes were carried out by incorporating two duplex DNAs, with G–G mismatch repeats in the middle, inside a DNA origami frame and monitoring the topology change of the strands. In the absence of KCl, incorporated duplexes had no interaction and laid parallel to each other. Addition of KCl induced the formation of a G-quadruplex structure by stably binding the duplexes to each other in the middle. Such a quadruplex formation allowed the DNA synapsis without disturbing the duplex regions of the participating sequences, and resulted in an X-shaped structure that was monitored by atomic force microscopy. Further, the G-quadruplex formation in KCl solution and its disruption in KCl-free buffer were analyzed in real-time. The orientation of the G-quadruplex is often difficult to control and investigate using traditional biochemical methods. However, our method using DNA origami could successfully control the strand orientations, topology and stoichiometry of the G-quadruplex. PMID:23863846

Multifunctional energy landscape for a DNA G-quadruplex: An evolved molecular switch

Science.gov (United States)

Cragnolini, Tristan; Chakraborty, Debayan; Šponer, Jiří; Derreumaux, Philippe; Pasquali, Samuela; Wales, David J.

2017-10-01

We explore the energy landscape for a four-fold telomere repeat, obtaining interconversion pathways between six experimentally characterised G-quadruplex topologies. The results reveal a multi-funnel system, with a variety of intermediate configurations and misfolded states. This organisation is identified with the intrinsically multi-functional nature of the system, suggesting a new paradigm for the classification of such biomolecules and clarifying issues regarding apparently conflicting experimental results.

Pyrrolobenzodiazepines (PBDs do not bind to DNA G-quadruplexes.

Directory of Open Access Journals (Sweden)

Khondaker M Rahman

Full Text Available The pyrrolo[2,1-c][1,4] benzodiazepines (PBDs are a family of sequence-selective, minor-groove binding DNA-interactive agents that covalently attach to guanine residues. A recent publication in this journal (Raju et al, PloS One, 2012, 7, 4, e35920 reported that two PBD molecules were observed to bind with high affinity to the telomeric quadruplex of Tetrahymena glaucoma based on Electrospray Ionisation Mass Spectrometry (ESI-MS, Circular Dichroism, UV-Visible and Fluorescence spectroscopy data. This was a surprising result given the close 3-dimensional shape match between the structure of all PBD molecules and the minor groove of duplex DNA, and the completely different 3-dimensional structure of quadruplex DNA. Therefore, we evaluated the interaction of eight PBD molecules of diverse structure with a range of parallel, antiparallel and mixed DNA quadruplexes using DNA Thermal Denaturation, Circular Dichroism and Molecular Dynamics Simulations. Those PBD molecules without large C8-substitutents had an insignificant affinity for the eight quadruplex types, although those with large π-system-containing C8-substituents (as with the compounds evaluated by Raju and co-workers were found to interact to some extent. Our molecular dynamics simulations support the likelihood that molecules of this type, including those examined by Raju and co-workers, interact with quadruplex DNA through their C8-substituents rather than the PBD moiety itself. It is important for the literature to be clear on this matter, as the mechanism of action of these agents will be under close scrutiny in the near future due to the growing number of PBD-based agents entering the clinic as both single-agents and as components of antibody-drug conjugates (ADCs.

Biochemical techniques for the characterization of G-quadruplex structures: EMSA, DMS footprinting, and DNA polymerase stop assay.

Science.gov (United States)

Sun, Daekyu; Hurley, Laurence H

2010-01-01

The proximal promoter region of many human growth-related genes contains a polypurine/polypyrimidine tract that serves as multiple binding sites for Sp1 or other transcription factors. These tracts often contain a guanine-rich sequence consisting of four runs of three or more contiguous guanines separated by one or more bases, corresponding to a general motif known for the formation of an intramolecular G-quadruplex. Recent results provide strong evidence that specific G-quadruplex structures form naturally within these polypurine/polypyrimidine tracts in many human promoter regions, raising the possibility that the transcriptional control of these genes can be modulated by G-quadruplex-interactive agents. In this chapter, we describe three general biochemical methodologies, electrophoretic mobility shift assay (EMSA), dimethylsulfate (DMS) footprinting, and the DNA polymerase stop assay, which can be useful for initial characterization of G-quadruplex structures formed by G-rich sequences.

Extended molecular dynamics of a c-kit promoter quadruplex

Czech Academy of Sciences Publication Activity Database

Islam, B.; Stadlbauer, Petr; Krepl, Miroslav; Koča, J.; Neidle, S.; Haider, S.; Šponer, Jiří

2015-01-01

Roč. 43, č. 18 (2015), s. 8673-8693 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP208/11/1822 Institutional support: RVO:68081707 Keywords : TELOMERIC G-QUADRUPLEX * INTRAMOLECULAR DNA QUADRUPLEXES * GASTROINTESTINAL STROMAL TUMOR Subject RIV: BO - Biophysics Impact factor: 9.202, year: 2015

Distance-dependent duplex DNA destabilization proximal to G-quadruplex/i-motif sequences

Science.gov (United States)

König, Sebastian L. B.; Huppert, Julian L.; Sigel, Roland K. O.; Evans, Amanda C.

2013-01-01

G-quadruplexes and i-motifs are complementary examples of non-canonical nucleic acid substructure conformations. G-quadruplex thermodynamic stability has been extensively studied for a variety of base sequences, but the degree of duplex destabilization that adjacent quadruplex structure formation can cause has yet to be fully addressed. Stable in vivo formation of these alternative nucleic acid structures is likely to be highly dependent on whether sufficient spacing exists between neighbouring duplex- and quadruplex-/i-motif-forming regions to accommodate quadruplexes or i-motifs without disrupting duplex stability. Prediction of putative G-quadruplex-forming regions is likely to be assisted by further understanding of what distance (number of base pairs) is required for duplexes to remain stable as quadruplexes or i-motifs form. Using oligonucleotide constructs derived from precedented G-quadruplexes and i-motif-forming bcl-2 P1 promoter region, initial biophysical stability studies indicate that the formation of G-quadruplex and i-motif conformations do destabilize proximal duplex regions. The undermining effect that quadruplex formation can have on duplex stability is mitigated with increased distance from the duplex region: a spacing of five base pairs or more is sufficient to maintain duplex stability proximal to predicted quadruplex/i-motif-forming regions. PMID:23771141

Loss of loop adenines alters human telomere d[AG3(TTAG3)3] quadruplex folding

Czech Academy of Sciences Publication Activity Database

Babinský, M.; Fiala, R.; Kejnovská, Iva; Bednářová, Klára; Marek, R.; Sagi, J.; Sklenář, V.; Vorlíčková, Michaela

2014-01-01

Roč. 42, č. 22 (2014), s. 14031-14041 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP205/12/0466 Institutional support: RVO:68081707 Keywords : human telomere * DNA quadruplex * cellular DNA Subject RIV: BO - Biophysics Impact factor: 9.112, year: 2014

Structure and possible function of a G-quadruplex in the long terminal repeat of the proviral HIV-1 genome.

Science.gov (United States)

De Nicola, Beatrice; Lech, Christopher J; Heddi, Brahim; Regmi, Sagar; Frasson, Ilaria; Perrone, Rosalba; Richter, Sara N; Phan, Anh Tuân

2016-07-27

The long terminal repeat (LTR) of the proviral human immunodeficiency virus (HIV)-1 genome is integral to virus transcription and host cell infection. The guanine-rich U3 region within the LTR promoter, previously shown to form G-quadruplex structures, represents an attractive target to inhibit HIV transcription and replication. In this work, we report the structure of a biologically relevant G-quadruplex within the LTR promoter region of HIV-1. The guanine-rich sequence designated LTR-IV forms a well-defined structure in physiological cationic solution. The nuclear magnetic resonance (NMR) structure of this sequence reveals a parallel-stranded G-quadruplex containing a single-nucleotide thymine bulge, which participates in a conserved stacking interaction with a neighboring single-nucleotide adenine loop. Transcription analysis in a HIV-1 replication competent cell indicates that the LTR-IV region may act as a modulator of G-quadruplex formation in the LTR promoter. Consequently, the LTR-IV G-quadruplex structure presented within this work could represent a valuable target for the design of HIV therapeutics. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

DNA secondary structures: stability and function of G-quadruplex structures

Science.gov (United States)

Bochman, Matthew L.; Paeschke, Katrin; Zakian, Virginia A.

2013-01-01

In addition to the canonical double helix, DNA can fold into various other inter- and intramolecular secondary structures. Although many such structures were long thought to be in vitro artefacts, bioinformatics demonstrates that DNA sequences capable of forming these structures are conserved throughout evolution, suggesting the existence of non-B-form DNA in vivo. In addition, genes whose products promote formation or resolution of these structures are found in diverse organisms, and a growing body of work suggests that the resolution of DNA secondary structures is critical for genome integrity. This Review focuses on emerging evidence relating to the characteristics of G-quadruplex structures and the possible influence of such structures on genomic stability and cellular processes, such as transcription. PMID:23032257

Fragile X mental retardation protein recognizes a G quadruplex structure within the survival motor neuron domain containing 1 mRNA 5'-UTR.

Science.gov (United States)

McAninch, Damian S; Heinaman, Ashley M; Lang, Cara N; Moss, Kathryn R; Bassell, Gary J; Rita Mihailescu, Mihaela; Evans, Timothy L

2017-07-25

G quadruplex structures have been predicted by bioinformatics to form in the 5'- and 3'-untranslated regions (UTRs) of several thousand mature mRNAs and are believed to play a role in translation regulation. Elucidation of these roles has primarily been focused on the 3'-UTR, with limited focus on characterizing the G quadruplex structures and functions in the 5'-UTR. Investigation of the affinity and specificity of RNA binding proteins for 5'-UTR G quadruplexes and the resulting regulatory effects have also been limited. Among the mRNAs predicted to form a G quadruplex structure within the 5'-UTR is the survival motor neuron domain containing 1 (SMNDC1) mRNA, encoding a protein that is critical to the spliceosome. Additionally, this mRNA has been identified as a potential target of the fragile X mental retardation protein (FMRP), whose loss of expression leads to fragile X syndrome. FMRP is an RNA binding protein involved in translation regulation that has been shown to bind mRNA targets that form G quadruplex structures. In this study we have used biophysical methods to investigate G quadruplex formation in the 5'-UTR of SMNDC1 mRNA and analyzed its interactions with FMRP. Our results show that SMNDC1 mRNA 5'-UTR forms an intramolecular, parallel G quadruplex structure comprised of three G quartet planes, which is bound specifically by FMRP both in vitro and in mouse brain lysates. These findings suggest a model by which FMRP might regulate the translation of a subset of its mRNA targets by recognizing the G quadruplex structure present in their 5'-UTR, and affecting their accessibility by the protein synthesis machinery.

Structure variations of TBA G-quadruplex induced by 2'-O-methyl nucleotide in K+ and Ca2+ environments.

Science.gov (United States)

Zhao, Xiaoyang; Liu, Bo; Yan, Jing; Yuan, Ying; An, Liwen; Guan, Yifu

2014-10-01

Thrombin binding aptamer (TBA), a 15-mer oligonucleotide of d(GGTTGGTGTGGTTGG) sequence, folds into a chair-type antiparallel G-quadruplex in the K(+) environment, and each of two G-tetrads is characterized by a syn-anti-syn-anti glycosidic conformation arrangement. To explore its folding topology and structural stability, 2'-O-methyl nucleotide (OMe) with the C3'-endo sugar pucker conformation and anti glycosidic angle was used to selectively substitute for the guanine residues of G-tetrads of TBA, and these substituted TBAs were characterized using a circular dichroism spectrum, thermally differential spectrum, ultraviolet stability analysis, electrophoresis mobility shift assay, and thermodynamic analysis in K(+) and Ca(2+) environments. Results showed that single substitutions for syn-dG residues destabilized the G-quadruplex structure, while single substitutions for anti-dG residues could preserve the G-quadruplex in the K(+) environment. When one or two G-tetrads were modified with OMe, TBA became unstructured. In contrast, in Ca(2+) environment, the native TBA appeared to be unstructured. When two G-tetrads were substituted with OMe, TBA seemed to become a more stable parallel G-4 structure. Further thermodynamic data suggested that OMe-substitutions were an enthalpy-driven event. The results in this study enrich our understanding about the effects of nucleotide derivatives on the G-quadruplex structure stability in different ionic environments, which will help to design G-quadruplex for biological and medical applications. © The Author 2014. Published by ABBS Editorial Office in association with Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences.

Multimerization rules for G-quadruplexes

Czech Academy of Sciences Publication Activity Database

Kolesnikova, Sofia; Hubálek, Martin; Bednárová, Lucie; Cvačka, Josef; Curtis, Edward A.

2017-01-01

Roč. 45, č. 15 (2017), s. 8684-8696 ISSN 0305-1048 Institutional support: RVO:61388963 Keywords : tetramolecular G-quadruplexes * RNA G-quadruplexes * circular dichroism Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 10.162, year: 2016 https://academic.oup.com/nar/article/45/15/8684/4002725/Multimerization-rules-for-Gquadruplexes

Transcriptional control by G-quadruplexes: In vivo roles and perspectives for specific intervention.

Science.gov (United States)

Armas, Pablo; David, Aldana; Calcaterra, Nora B

2017-01-01

G-quadruplexes are non-canonical DNA secondary structures involved in several genomic and molecular processes. Here, we summarize the main G-quadruplex features and evidences proving the in vivo role on the transcriptional regulation of genes required for zebrafish embryonic development. We also discuss alternative strategies for specifically interfering G-quadruplex in vivo.

G-quadruplexes as novel cis-elements controlling transcription during embryonic development.

Science.gov (United States)

David, Aldana P; Margarit, Ezequiel; Domizi, Pablo; Banchio, Claudia; Armas, Pablo; Calcaterra, Nora B

2016-05-19

G-quadruplexes are dynamic structures folded in G-rich single-stranded DNA regions. These structures have been recognized as a potential nucleic acid based mechanism for regulating multiple cellular processes such as replication, transcription and genomic maintenance. So far, their transcriptional role in vivo during vertebrate embryonic development has not yet been addressed. Here, we performed an in silico search to find conserved putative G-quadruplex sequences (PQSs) within proximal promoter regions of human, mouse and zebrafish developmental genes. Among the PQSs able to fold in vitro as G-quadruplex, those present in nog3, col2a1 and fzd5 promoters were selected for further studies. In cellulo studies revealed that the selected G-quadruplexes affected the transcription of luciferase controlled by the SV40 nonrelated promoter. G-quadruplex disruption in vivo by microinjection in zebrafish embryos of either small ligands or DNA oligonucleotides complementary to the selected PQSs resulted in lower transcription of the targeted genes. Moreover, zebrafish embryos and larvae phenotypes caused by the presence of complementary oligonucleotides fully resembled those ones reported for nog3, col2a1 and fzd5 morphants. To our knowledge, this is the first work revealing in vivo the role of conserved G-quadruplexes in the embryonic development, one of the most regulated processes of the vertebrates biology. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

G-quadruplexes Significantly Stimulate Pif1 Helicase-catalyzed Duplex DNA Unwinding*

Science.gov (United States)

Duan, Xiao-Lei; Liu, Na-Nv; Yang, Yan-Tao; Li, Hai-Hong; Li, Ming; Dou, Shuo-Xing; Xi, Xu-Guang

2015-01-01

The evolutionarily conserved G-quadruplexes (G4s) are faithfully inherited and serve a variety of cellular functions such as telomere maintenance, gene regulation, DNA replication initiation, and epigenetic regulation. Different from the Watson-Crick base-pairing found in duplex DNA, G4s are formed via Hoogsteen base pairing and are very stable and compact DNA structures. Failure of untangling them in the cell impedes DNA-based transactions and leads to genome instability. Cells have evolved highly specific helicases to resolve G4 structures. We used a recombinant nuclear form of Saccharomyces cerevisiae Pif1 to characterize Pif1-mediated DNA unwinding with a substrate mimicking an ongoing lagging strand synthesis stalled by G4s, which resembles a replication origin and a G4-structured flap in Okazaki fragment maturation. We find that the presence of G4 may greatly stimulate the Pif1 helicase to unwind duplex DNA. Further studies reveal that this stimulation results from G4-enhanced Pif1 dimerization, which is required for duplex DNA unwinding. This finding provides new insights into the properties and functions of G4s. We discuss the observed activation phenomenon in relation to the possible regulatory role of G4s in the rapid rescue of the stalled lagging strand synthesis by helping the replicator recognize and activate the replication origin as well as by quickly removing the G4-structured flap during Okazaki fragment maturation. PMID:25627683

APTO-253 Stabilizes G-quadruplex DNA, Inhibits MYC Expression, and Induces DNA Damage in Acute Myeloid Leukemia Cells.

Science.gov (United States)

Local, Andrea; Zhang, Hongying; Benbatoul, Khalid D; Folger, Peter; Sheng, Xia; Tsai, Cheng-Yu; Howell, Stephen B; Rice, William G

2018-06-01

APTO-253 is a phase I clinical stage small molecule that selectively induces CDKN1A (p21), promotes G 0 -G 1 cell-cycle arrest, and triggers apoptosis in acute myeloid leukemia (AML) cells without producing myelosuppression in various animal species and humans. Differential gene expression analysis identified a pharmacodynamic effect on MYC expression, as well as induction of DNA repair and stress response pathways. APTO-253 was found to elicit a concentration- and time-dependent reduction in MYC mRNA expression and protein levels. Gene ontogeny and structural informatic analyses suggested a mechanism involving G-quadruplex (G4) stabilization. Intracellular pharmacokinetic studies in AML cells revealed that APTO-253 is converted intracellularly from a monomer to a ferrous complex [Fe(253) 3 ]. FRET assays demonstrated that both monomeric APTO-253 and Fe(253) 3 stabilize G4 structures from telomeres, MYC, and KIT promoters but do not bind to non-G4 double-stranded DNA. Although APTO-253 exerts a host of mechanistic sequelae, the effect of APTO-253 on MYC expression and its downstream target genes, on cell-cycle arrest, DNA damage, and stress responses can be explained by the action of Fe(253) 3 and APTO-253 on G-quadruplex DNA motifs. Mol Cancer Ther; 17(6); 1177-86. ©2018 AACR . ©2018 American Association for Cancer Research.

GNG Motifs Can Replace a GGG Stretch during G-Quadruplex Formation in a Context Dependent Manner.

Directory of Open Access Journals (Sweden)

Kohal Das

Full Text Available G-quadruplexes are one of the most commonly studied non-B DNA structures. Generally, these structures are formed using a minimum of 4, three guanine tracts, with connecting loops ranging from one to seven. Recent studies have reported deviation from this general convention. One such deviation is the involvement of bulges in the guanine tracts. In this study, guanines along with bulges, also referred to as GNG motifs have been extensively studied using recently reported HOX11 breakpoint fragile region I as a model template. By strategic mutagenesis approach we show that the contribution from continuous G-tracts may be dispensible during G-quadruplex formation when such motifs are flanked by GNGs. Importantly, the positioning and number of GNG/GNGNG can also influence the formation of G-quadruplexes. Further, we assessed three genomic regions from HIF1 alpha, VEGF and SHOX gene for G-quadruplex formation using GNG motifs. We show that HIF1 alpha sequence harbouring GNG motifs can fold into intramolecular G-quadruplex. In contrast, GNG motifs in mutant VEGF sequence could not participate in structure formation, suggesting that the usage of GNG is context dependent. Importantly, we show that when two continuous stretches of guanines are flanked by two independent GNG motifs in a naturally occurring sequence (SHOX, it can fold into an intramolecular G-quadruplex. Finally, we show the specific binding of G-quadruplex binding protein, Nucleolin and G-quadruplex antibody, BG4 to SHOX G-quadruplex. Overall, our study provides novel insights into the role of GNG motifs in G-quadruplex structure formation which may have both physiological and pathological implications.

A new cationic porphyrin derivative (TMPipEOPP with large side arm substituents: a highly selective G-quadruplex optical probe.

Directory of Open Access Journals (Sweden)

Li-Na Zhu

Full Text Available The discovery of uncommon DNA structures and speculation about their potential functions in genes has brought attention to specific DNA structure recognition. G-quadruplexes are four-stranded nucleic acid structures formed by G-rich DNA (or RNA sequences. G-rich sequences with a high potential to form G-quadruplexes have been found in many important genomic regions. Porphyrin derivatives with cationic side arm substituents are important G-quadruplex-binding ligands. For example, 5,10,15,20-Tetrakis(N-methylpyridinium-4-yl-21H,23H-porphyrin (TMPyP4, interacts strongly with G-quadruplexes, but has poor selectivity for G-quadruplex versus duplex DNA. To increase the G-quadruplex recognition specificity, a new cationic porphyrin derivative, 5,10,15,20-tetra-{4-[2-(1-methyl-1-piperidinylethoxy]phenyl} porphyrin (TMPipEOPP, with large side arm substituents was synthesized, and the interactions between TMPipEOPP and different DNA structures were compared. The results show that G-quadruplexes cause large changes in the UV-Vis absorption and fluorescence spectra of TMPipEOPP, but duplex and single-stranded DNAs do not, indicating that TMPipEOPP can be developed as a highly specific optical probe for discriminating G-quadruplex from duplex and single-stranded DNA. Visual discrimination is also possible. Job plot and Scatchard analysis suggest that a complicated binding interaction occurs between TMPipEOPP and G-quadruplexes. At a low [G-quadruplex]/[TMPipEOPP] ratio, one G-quadruplex binds two TMPipEOPP molecules by end-stacking and outside binding modes. At a high [G-quadruplex]/[TMPipEOPP] ratio, two G-quadruplexes bind to one TMPipEOPP molecule in a sandwich-like end-stacking mode.

A new cationic porphyrin derivative (TMPipEOPP) with large side arm substituents: a highly selective G-quadruplex optical probe.

Science.gov (United States)

Zhu, Li-Na; Zhao, Shu-Juan; Wu, Bin; Li, Xiao-Zeng; Kong, De-Ming

2012-01-01

The discovery of uncommon DNA structures and speculation about their potential functions in genes has brought attention to specific DNA structure recognition. G-quadruplexes are four-stranded nucleic acid structures formed by G-rich DNA (or RNA) sequences. G-rich sequences with a high potential to form G-quadruplexes have been found in many important genomic regions. Porphyrin derivatives with cationic side arm substituents are important G-quadruplex-binding ligands. For example, 5,10,15,20-Tetrakis(N-methylpyridinium-4-yl)-21H,23H-porphyrin (TMPyP4), interacts strongly with G-quadruplexes, but has poor selectivity for G-quadruplex versus duplex DNA. To increase the G-quadruplex recognition specificity, a new cationic porphyrin derivative, 5,10,15,20-tetra-{4-[2-(1-methyl-1-piperidinyl)ethoxy]phenyl} porphyrin (TMPipEOPP), with large side arm substituents was synthesized, and the interactions between TMPipEOPP and different DNA structures were compared. The results show that G-quadruplexes cause large changes in the UV-Vis absorption and fluorescence spectra of TMPipEOPP, but duplex and single-stranded DNAs do not, indicating that TMPipEOPP can be developed as a highly specific optical probe for discriminating G-quadruplex from duplex and single-stranded DNA. Visual discrimination is also possible. Job plot and Scatchard analysis suggest that a complicated binding interaction occurs between TMPipEOPP and G-quadruplexes. At a low [G-quadruplex]/[TMPipEOPP] ratio, one G-quadruplex binds two TMPipEOPP molecules by end-stacking and outside binding modes. At a high [G-quadruplex]/[TMPipEOPP] ratio, two G-quadruplexes bind to one TMPipEOPP molecule in a sandwich-like end-stacking mode.

Folding of guanine quadruplex molecules-funnel-like mechanism or kinetic partitioning? An overview from MD simulation studies

Czech Academy of Sciences Publication Activity Database

Šponer, Jiří; Bussi, G.; Stadlbauer, Petr; Kührová, P.; Banáš, P.; Islam, Barira; Haider, S.; Neidle, S.; Otyepka, M.

2017-01-01

Roč. 1861, č. 5 (2017), s. 1246-1263 ISSN 0304-4165 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * parallel g-quadruplex Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 4.702, year: 2016

G-Quadruplex Identification in the Genome of Protozoan Parasites Points to Naphthalene Diimide Ligands as New Antiparasitic Agents.

Science.gov (United States)

Belmonte-Reche, Efres; Martínez-García, Marta; Guédin, Aurore; Zuffo, Michela; Arévalo-Ruiz, Matilde; Doria, Filippo; Campos-Salinas, Jenny; Maynadier, Marjorie; López-Rubio, José Juan; Freccero, Mauro; Mergny, Jean-Louis; Pérez-Victoria, José María; Morales, Juan Carlos

2018-02-08

G-quadruplexes (G4) are DNA secondary structures that take part in the regulation of gene expression. Putative G4 forming sequences (PQS) have been reported in mammals, yeast, bacteria, and viruses. Here, we present PQS searches on the genomes of T. brucei, L. major, and P. falciparum. We found telomeric sequences and new PQS motifs. Biophysical experiments showed that EBR1, a 29 nucleotide long highly repeated PQS in T. brucei, forms a stable G4 structure. G4 ligands based on carbohydrate conjugated naphthalene diimides (carb-NDIs) that bind G4's including hTel could bind EBR1 with selectivity versus dsDNA. These ligands showed important antiparasitic activity. IC 50 values were in the nanomolar range against T. brucei with high selectivity against MRC-5 human cells. Confocal microscopy confirmed these ligands localize in the nucleus and kinetoplast of T. brucei suggesting they can reach their potential G4 targets. Cytotoxicity and zebrafish toxicity studies revealed sugar conjugation reduces intrinsic toxicity of NDIs.

Xanthine and 8-oxoguanine in G-quadruplexes: formation of a G·G·X·O tetrad.

Science.gov (United States)

Cheong, Vee Vee; Heddi, Brahim; Lech, Christopher Jacques; Phan, Anh Tuân

2015-12-02

G-quadruplexes are four-stranded structures built from stacked G-tetrads (G·G·G·G), which are planar cyclical assemblies of four guanine bases interacting through Hoogsteen hydrogen bonds. A G-quadruplex containing a single guanine analog substitution, such as 8-oxoguanine (O) or xanthine (X), would suffer from a loss of a Hoogsteen hydrogen bond within a G-tetrad and/or potential steric hindrance. We show that a proper arrangement of O and X bases can reestablish the hydrogen-bond pattern within a G·G·X·O tetrad. Rational incorporation of G·G·X·O tetrads in a (3+1) G-quadruplex demonstrated a similar folding topology and thermal stability to that of the unmodified G-quadruplex. pH titration conducted on X·O-modified G-quadruplexes indicated a protonation-deprotonation equilibrium of X with a pKa ∼6.7. The solution structure of a G-quadruplex containing a G·G·X·O tetrad was determined, displaying the same folding topology in both the protonated and deprotonated states. A G-quadruplex containing a deprotonated X·O pair was shown to exhibit a more electronegative groove compared to that of the unmodified one. These differences are likely to manifest in the electronic properties of G-quadruplexes and may have important implications for drug targeting and DNA-protein interactions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

A mRNA-Responsive G-Quadruplex-Based Drug Release System

Directory of Open Access Journals (Sweden)

Hidenobu Yaku

2015-04-01

Full Text Available G-quadruplex-based drug delivery carriers (GDDCs were designed to capture and release a telomerase inhibitor in response to a target mRNA. Hybridization between a loop on the GDDC structure and the mRNA should cause the G-quadruplex structure of the GDDC to unfold and release the bound inhibitor, anionic copper(II phthalocyanine (CuAPC. As a proof of concept, GDDCs were designed with a 10-30-mer loop, which can hybridize with a target sequence in epidermal growth factor receptor (EGFR mRNA. Structural analysis using circular dichroism (CD spectroscopy showed that the GDDCs form a (3 + 1 type G-quadruplex structure in 100 mM KCl and 10 mM MgCl2 in the absence of the target RNA. Visible absorbance titration experiments showed that the GDDCs bind to CuAPC with Ka values of 1.5 × 105 to 5.9 × 105 M−1 (Kd values of 6.7 to 1.7 μM at 25 °C, depending on the loop length. Fluorescence titration further showed that the G-quadruplex structure unfolds upon binding to the target RNA with Ka values above 1.0 × 108 M−1 (Kd values below 0.01 μM at 25 °C. These results suggest the carrier can sense and bind to the target RNA, which should result in release of the bound drug. Finally, visible absorbance titration experiments demonstrated that the GDDC release CuAPC in response to the target RNA.

Mms1 is an assistant for regulating G-quadruplex DNA structures.

Science.gov (United States)

Schwindt, Eike; Paeschke, Katrin

2017-11-02

The preservation of genome stability is fundamental for every cell. Genomic integrity is constantly challenged. Among those challenges are also non-canonical nucleic acid structures. In recent years, scientists became aware of the impact of G-quadruplex (G4) structures on genome stability. It has been shown that folded G4-DNA structures cause changes in the cell, such as transcriptional up/down-regulation, replication stalling, or enhanced genome instability. Multiple helicases have been identified to regulate G4 structures and by this preserve genome stability. Interestingly, although these helicases are mostly ubiquitous expressed, they show specificity for G4 regulation in certain cellular processes (e.g., DNA replication). To this date, it is not clear how this process and target specificity of helicases are achieved. Recently, Mms1, an ubiquitin ligase complex protein, was identified as a novel G4-DNA-binding protein that supports genome stability by aiding Pif1 helicase binding to these regions. In this perspective review, we discuss the question if G4-DNA interacting proteins are fundamental for helicase function and specificity at G4-DNA structures.

Clustered abasic lesions profoundly change the structure and stability of human telomeric G-quadruplexes

Czech Academy of Sciences Publication Activity Database

Kejnovská, Iva; Bednářová, Klára; Renčiuk, Daniel; Dvořáková, Zuzana; Školáková, Petra; Trantírek, L.; Fiala, R.; Vorlíčková, Michaela; Sagi, J.

2017-01-01

Roč. 45, č. 8 (2017), s. 4294-4305 ISSN 0305-1048 R&D Projects: GA MŠk EF15_003/0000477; GA ČR GAP205/12/0466; GA ČR GA13-28310S; GA ČR(CZ) GA15-06785S; GA MŠk(CZ) LQ1601 Institutional support: RVO:68081707 Keywords : dna-damage clusters * k+ solution * guanine quadruplexes Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 10.162, year: 2016

Efficient Long-Range Hole Transport Through G-Quadruplexes.

Science.gov (United States)

Wu, Jingyuan; Meng, Zhenyu; Lu, Yunpeng; Shao, Fangwei

2017-10-09

DNA offers a means of long-range charge transport for biology and electric nanodevices. Here, a series of tetra-stranded G-quadruplexes were assembled within a dendritic DNA architecture to explore oxidative charge transport (hole transport) through the G-quadruplex. Efficient charge transport was achieved over 28 Å upon UV irradiation. Over a longer G-quadruplex bridge, hole transport was escalated to a higher efficiency, which resulted in a higher yield than that of the optimal duplex DNA for charge transport, that is, the adenine tract. Efficient long-range hole transport suggests tetra-stranded G-quadruplexes, instead of an oxidation hotspot, hold better potential as an electron conduit than duplex DNA. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Superhelicity Constrains a Localized and R-Loop-Dependent Formation of G-Quadruplexes at the Upstream Region of Transcription.

Science.gov (United States)

Zheng, Ke-Wei; He, Yi-de; Liu, Hong-He; Li, Xin-Min; Hao, Yu-Hua; Tan, Zheng

2017-10-20

Transcription induces formation of intramolecular G-quadruplex structures at the upstream region of a DNA duplex by an upward transmission of negative supercoiling through the DNA. Currently the regulation of such G-quadruplex formation remains unclear. Using plasmid as a model, we demonstrate that while it is the dynamic negative supercoiling generated by a moving RNA polymerase that triggers a formation of a G-quadruplex, the constitutional superhelicity determines the potential and range of the formation of a G-quadruplex by constraining the propagation of the negative supercoiling. G-quadruplex formation is maximal in negatively supercoiled and nearly abolished in relaxed plasmids while being moderate in nicked and linear ones. The formation of a G-quadruplex strongly correlates with the presence of an R-loop. Preventing R-loop formation virtually abolished G-quadruplex formation even in the negatively supercoiled plasmid. Enzymatic action and protein binding that manipulate supercoiling or its propagation all impact the formation of G-quadruplexes. Because chromosomes and plasmids in cells in their natural form are maintained in a supercoiled state, our findings reveal a physical basis that justifies the formation and regulation of G-quadruplexes in vivo. The structural features involved in G-quadruplex formation may all serve as potential targets in clinical and therapeutic applications.

DNA breaks and repair in interstitial telomere sequences: Influence of chromatin structure

International Nuclear Information System (INIS)

Revaud, D.

2009-06-01

Interstitial Telomeric Sequences (ITS) are over-involved in spontaneous and radiationinduced chromosome aberrations in chinese hamster cells. We have performed a study to investigate the origin of their instability, spontaneously or after low doses irradiation. Our results demonstrate that ITS have a particular chromatin structure: short nucleotide repeat length, less compaction of the 30 nm chromatin fiber, presence of G-quadruplex structures. These features would modulate breaks production and would favour the recruitment of alternative DNA repair mechanisms, which are prone to produce chromosome aberrations. These pathways could be at the origin of chromosome aberrations in ITS whereas NHEJ and HR Double Strand Break repair pathways are rather required for a correct repair in these regions. (author)

Fully integrated graphene electronic biosensor for label-free detection of lead (II) ion based on G-quadruplex structure-switching.

Science.gov (United States)

Li, Yijun; Wang, Cheng; Zhu, Yibo; Zhou, Xiaohong; Xiang, Yu; He, Miao; Zeng, Siyu

2017-03-15

This work presents a fully integrated graphene field-effect transistor (GFET) biosensor for the label-free detection of lead ions (Pb 2+ ) in aqueous-media, which first implements the G-quadruplex structure-switching biosensing principle in graphene nanoelectronics. We experimentally illustrate the biomolecular interplay that G-rich DNA single-strands with one-end confined on graphene surface can specifically interact with Pb 2+ ions and switch into G-quadruplex structures. Since the structure-switching of electrically charged DNA strands can disrupt the charge distribution in the vicinity of graphene surface, the carrier equilibrium in graphene sheet might be altered, and manifested by the conductivity variation of GFET. The experimental data and theoretical analysis show that our devices are capable of the label-free and specific quantification of Pb 2+ with a detection limit down to 163.7ng/L. These results first verify the signaling principle competency of G-quadruplex structure-switching in graphene electronic biosensors. Combining with the advantages of the compact device structure and convenient electrical signal, a label-free GFET biosensor for Pb 2+ monitoring is enabled with promising application potential. Copyright © 2016 Elsevier B.V. All rights reserved.

G-Quadruplex DNAzyme Molecular Beacon for Amplified Colorimetric Biosensing of Pseudostellaria heterophylla

Directory of Open Access Journals (Sweden)

Juan Hu

2013-01-01

Full Text Available With an internal transcribed spacer of 18 S, 5.8 S and 26 S nuclear ribosomal DNA (nrDNA ITS as DNA marker, we report a colorimetric approach for authentication of Pseudostellaria heterophylla (PH and its counterfeit species based on the differentiation of the nrDNA ITS sequence. The assay possesses an unlabelled G-quadruplex DNAzyme molecular beacon (MB probe, employing complementary sequence as biorecognition element and 1:1:1:1 split G-quadruplex halves as reporter. In the absence of target DNA (T-DNA, the probe can shape intermolecular G-quadruplex structures capable of binding hemin to form G-quadruplex-hemin DNAzyme and catalyze the oxidation of ABTS2− to blue-green ABTS•− by H2O2. In the presence of T-DNA, T-DNA can hybridize with the complementary sequence to form a duplex structure, hindering the formation of the G-quadruplex structure and resulting in the loss of the catalytic activity. Consequently, a UV-Vis absorption signal decrease is observed in the ABTS2−-H2O2 system. The “turn-off” assay allows the detection of T-DNA from 1.0 × 10−9 to 3.0 × 10−7 mol·L−1 (R2 = 0.9906, with a low detection limit of 3.1 × 10−10 mol·L−1. The present study provides a sensitive and selective method and may serve as a foundation of utilizing the DNAzyme MB sensor for identifying traditional Chinese medicines.

Cation Coordination Alters the Conformation of a Thrombin-Binding G-Quadruplex DNA Aptamer That Affects Inhibition of Thrombin.

Science.gov (United States)

Zavyalova, Elena; Tagiltsev, Grigory; Reshetnikov, Roman; Arutyunyan, Alexander; Kopylov, Alexey

2016-10-01

Thrombin-binding aptamers are promising anticoagulants. HD1 is a monomolecular antiparallel G-quadruplex with two G-quartets linked by three loops. Aptamer-thrombin interactions are mediated with two TT-loops that bind thrombin exosite I. Several cations were shown to be coordinated inside the G-quadruplex, including K + , Na + , NH 4 + , Ba 2+ , and Sr 2+ ; on the contrary, Mn 2+ was coordinated in the grooves, outside the G-quadruplex. K + or Na + coordination provides aptamer functional activity. The effect of other cations on aptamer functional activity has not yet been described, because of a lack of relevant tests. Interactions between aptamer HD1 and a series of cations were studied. A previously developed enzymatic method was applied to evaluate aptamer inhibitory activity. The structure-function correlation was studied using the characterization of G-quadruplex conformation by circular dichroism spectroscopy. K + coordination provided the well-known high inhibitory activity of the aptamer, whereas Na + coordination supported low activity. Although NH 4 + coordination yielded a typical antiparallel G-quadruplex, no inhibitory activity was shown; a similar effect was observed for Ba 2+ and Sr 2+ coordination. Mn 2+ coordination destabilized the G-quadruplex that drastically diminished aptamer inhibitory activity. Therefore, G-quadruplex existence per se is insufficient for aptamer inhibitory activity. To elicit the nature of these effects, we thoroughly analyzed nuclear magnetic resonance (NMR) and X-ray data on the structure of the HD1 G-quadruplex with various cations. The most reasonable explanation is that cation coordination changes the conformation of TT-loops, affecting thrombin binding and inhibition. HD1 counterparts, aptamers 31-TBA and NU172, behaved similarly with some distinctions. In 31-TBA, an additional duplex module stabilized antiparallel G-quadruplex conformation at high concentrations of divalent cations; whereas in NU172, a different

G-Quadruplex conformational change driven by pH variation with potential application as a nanoswitch.

Science.gov (United States)

Yan, Yi-Yong; Tan, Jia-Heng; Lu, Yu-Jing; Yan, Siu-Cheong; Wong, Kwok-Yin; Li, Ding; Gu, Lian-Quan; Huang, Zhi-Shu

2013-10-01

G-Quadruplex is a highly polymorphic structure, and its behavior in acidic condition has not been well studied. Circular dichroism (CD) spectra were used to study the conformational change of G-quadruplex. The thermal stabilities of the G-quadruplex were measured with CD melting. Interconversion kinetics profiles were investigated by using CD kinetics. The fluorescence of the inserted 2-Aminopurine (Ap) was monitored during pH change and acrylamide quenching, indicating the status of the loop. Proton NMR was adopted to help illustrate the change of the conformation. G-Quadruplex of specific loop was found to be able to transform upon pH variation. The transformation was resulted from the loop rearrangement. After screening of a library of diverse G-quadruplex, a sequence exhibiting the best transformation property was found. A pH-driven nanoswitch with three gears was obtained based on this transition cycle. Certain G-quadruplex was found to go through conformational change at low pH. Loop was the decisive factor controlling the interconversion upon pH variation. G-Quadruplex with TT central loop could be converted in a much milder condition than the one with TTA loop. It can be used to design pH-driven nanodevices such as a nanoswitch. These results provide more insights into G-quadruplex polymorphism, and also contribute to the design of DNA-based nanomachines and logic gates. © 2013.

Dynamic DNA binding, junction recognition and G4 melting activity underlie the telomeric and genome-wide roles of human CST.

Science.gov (United States)

Bhattacharjee, Anukana; Wang, Yongyao; Diao, Jiajie; Price, Carolyn M

2017-12-01

Human CST (CTC1-STN1-TEN1) is a ssDNA-binding complex that helps resolve replication problems both at telomeres and genome-wide. CST resembles Replication Protein A (RPA) in that the two complexes harbor comparable arrays of OB-folds and have structurally similar small subunits. However, the overall architecture and functions of CST and RPA are distinct. Currently, the mechanism underlying CST action at diverse replication issues remains unclear. To clarify CST mechanism, we examined the capacity of CST to bind and resolve DNA structures found at sites of CST activity. We show that CST binds preferentially to ss-dsDNA junctions, an activity that can explain the incremental nature of telomeric C-strand synthesis following telomerase action. We also show that CST unfolds G-quadruplex structures, thus providing a mechanism for CST to facilitate replication through telomeres and other GC-rich regions. Finally, smFRET analysis indicates that CST binding to ssDNA is dynamic with CST complexes undergoing concentration-dependent self-displacement. These findings support an RPA-based model where dissociation and re-association of individual OB-folds allow CST to mediate loading and unloading of partner proteins to facilitate various aspects of telomere replication and genome-wide resolution of replication stress. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Studies of G-quadruplexes formed within self-assembled DNA mini-circles.

Science.gov (United States)

Klejevskaja, Beata; Pyne, Alice L B; Reynolds, Matthew; Shivalingam, Arun; Thorogate, Richard; Hoogenboom, Bart W; Ying, Liming; Vilar, Ramon

2016-10-13

We have developed self-assembled DNA mini-circles that contain a G-quadruplex-forming sequence from the c-Myc oncogene promoter and demonstrate by FRET that the G-quadruplex unfolding kinetics are 10-fold slower than for the simpler 24-mer G-quadruplex that is commonly used for FRET experiments.

Biophysical Characterization of G-Quadruplex Recognition in the PITX1 mRNA by the Specificity Domain of the Helicase RHAU.

Directory of Open Access Journals (Sweden)

Emmanuel O Ariyo

Full Text Available Nucleic acids rich in guanine are able to fold into unique structures known as G-quadruplexes. G-quadruplexes consist of four tracts of guanylates arranged in parallel or antiparallel strands that are aligned in stacked G-quartet planes. The structure is further stabilized by Hoogsteen hydrogen bonds and monovalent cations centered between the planes. RHAU (RNA helicase associated with AU-rich element is a member of the ATP-dependent DExH/D family of RNA helicases and can bind and resolve G-quadruplexes. RHAU contains a core helicase domain with an N-terminal extension that enables recognition and full binding affinity to RNA and DNA G-quadruplexes. PITX1, a member of the bicoid class of homeobox proteins, is a transcriptional activator active during development of vertebrates, chiefly in the anterior pituitary gland and several other organs. We have previously demonstrated that RHAU regulates PITX1 levels through interaction with G-quadruplexes at the 3'-end of the PITX1 mRNA. To understand the structural basis of G-quadruplex recognition by RHAU, we characterize a purified minimal PITX1 G-quadruplex using a variety of biophysical techniques including electrophoretic mobility shift assays, UV-VIS spectroscopy, circular dichroism, dynamic light scattering, small angle X-ray scattering and nuclear magnetic resonance spectroscopy. Our biophysical analysis provides evidence that the RNA G-quadruplex, but not its DNA counterpart, can adopt a parallel orientation, and that only the RNA can interact with N-terminal domain of RHAU via the tetrad face of the G-quadruplex. This work extends our insight into how the N-terminal region of RHAU recognizes parallel G-quadruplexes.

Altered biochemical specificity of G-quadruplexes with mutated tetrads

Czech Academy of Sciences Publication Activity Database

Švehlová, Kateřina; Lawrence, M. S.; Bednárová, Lucie; Curtis, Edward A.

2016-01-01

Roč. 44, č. 22 (2016), s. 10789-10803 ISSN 0305-1048 Institutional support: RVO:61388963 Keywords : G-quadruplex * G motif GTP aptamer * peroxidase deoxyribozyme Subject RIV: CE - Biochemistry Impact factor: 10.162, year: 2016 https://academic.oup.com/nar/article/44/22/10789/2333933/Altered-biochemical-specificity-of-G-quadruplexes

G-quadruplex induced chirality of methylazacalix[6]pyridine via unprecedented binding stoichiometry: en route to multiplex controlled molecular switch

Science.gov (United States)

Guan, Ai-Jiao; Shen, Meng-Jie; Xiang, Jun-Feng; Zhang, En-Xuan; Li, Qian; Sun, Hong-Xia; Wang, Li-Xia; Xu, Guang-Zhi; Tang, Ya-Lin; Xu, Li-Jin; Gong, Han-Yuan

2015-05-01

Nucleic acid based molecular device is a developing research field which attracts great interests in material for building machinelike nanodevices. G-quadruplex, as a new type of DNA secondary structures, can be harnessed to construct molecular device owing to its rich structural polymorphism. Herein, we developed a switching system based on G-quadruplexes and methylazacalix[6]pyridine (MACP6). The induced circular dichroism (CD) signal of MACP6 was used to monitor the switch controlled by temperature or pH value. Furthermore, the CD titration, Job-plot, variable temperature CD and 1H-NMR experiments not only confirmed the binding mode between MACP6 and G-quadruplex, but also explained the difference switching effect of MACP6 and various G-quadruplexes. The established strategy has the potential to be used as the chiral probe for specific G-quadruplex recognition.

UvrD in Deinococcus radiodurans is optimized for processing G-quadruplex DNA

International Nuclear Information System (INIS)

Das, Anubrata; Misra, H.S.

2015-01-01

Deinococcus radiodurans R1 is a radiation resistant Gram-positive bacterium capable of tolerating very high doses of DNA-damaging agents such as gamma radiation (D10 ∼ 12kGy) desiccation (∼ 5% relative humidity), UVC radiation (D10 ∼ 800J/m 2 ) and hydrogen peroxide (40 mM). It achieves this by using a complex regulatory mechanism and novel proteins. Recently bioinformatic analysis showed several stretches of guanine runs in D.radiodurans genome, which could form G-quartets. The role of G-quartets in regulatory processes is well documented in various organisms. The presence of G -quartets in D. radiodurans means that there are regulatory or structural proteins which would bind to these elements. Several proteins are known to bind G-quartets. Finding the proteins which would bind to G4 DNA is difficult as no specific motifs are available for binding these elements. Also most of the known proteins that are shown to bind to G-quadruplex DNA are of eukaryotic nature. To overcome these challenges we defined a set of known G-quadruplex binding proteins and used a smith-waterman algorithm with our own scoring matrix to homologs of G-quadruplex binding proteins in D.radiodurans. Using bioinformatics analysis, we showed that UvrD (DR 1775) of D. radiodurans has ability to bind/translocate along G-quadruplex DNA, a novel feature in prokaryotes. The translocase activity of DR1775 is ATP specific and this ATPase activity is attenuated by ssDNA. Data supporting UvrD of D. radiodurans as a G-quadruplex DNA metabolizing proteins would be presented. (author)

Local epigenetic reprogramming induced by G-quadruplex ligands

Science.gov (United States)

Guilbaud, Guillaume; Murat, Pierre; Recolin, Bénédicte; Campbell, Beth C.; Maiter, Ahmed; Sale, Julian E.; Balasubramanian, Shankar

2017-11-01

DNA and histone modifications regulate transcriptional activity and thus represent valuable targets to reprogram the activity of genes. Current epigenetic therapies target the machinery that regulates these modifications, leading to global transcriptional reprogramming with the potential for extensive undesired effects. Epigenetic information can also be modified as a consequence of disrupting processive DNA replication. Here, we demonstrate that impeding replication by small-molecule-mediated stabilization of G-quadruplex nucleic acid secondary structures triggers local epigenetic plasticity. We report the use of the BU-1 locus of chicken DT40 cells to screen for small molecules able to induce G-quadruplex-dependent transcriptional reprogramming. Further characterization of the top hit compound revealed its ability to induce a dose-dependent inactivation of BU-1 expression in two steps: the loss of H3K4me3 and then subsequent DNA cytosine methylation, changes that were heritable across cell divisions even after the compound was removed. Targeting DNA secondary structures thus represents a potentially new approach for locus-specific epigenetic reprogramming.

RPA-mediated unfolding of systematically varying G-quadruplex structures.

Science.gov (United States)

Ray, Sujay; Qureshi, Mohammad H; Malcolm, Dominic W; Budhathoki, Jagat B; Celik, Uğur; Balci, Hamza

2013-05-21

G-quadruplex (GQ) is a noncanonical nucleic acid structure that is formed by guanine rich sequences. Unless it is destabilized by proteins such as replication protein A (RPA), GQ could interfere with DNA metabolic functions, such as replication or repair. We studied RPA-mediated GQ unfolding using single-molecule FRET on two groups of GQ structures that have different loop lengths and different numbers of G-tetrad layers. We observed a linear increase in the steady-state stability of the GQ against RPA-mediated unfolding with increasing number of layers or decreasing loop length. The stability demonstrated by different GQ structures varied by at least three orders of magnitude. Those with shorter loops (less than three nucleotides long) or a greater number of layers (more than three layers) maintained a significant folded population even at physiological RPA concentration (≈1 μM), raising the possibility of physiological viability of such GQ structures. Finally, we measured the transition time between the start and end of the RPA-mediated GQ unfolding process to be 0.35 ± 0.10 s for all GQ constructs we studied, despite significant differences in their steady-state stabilities. We propose a two-step RPA-mediated GQ unfolding mechanism that is consistent with our observations. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Structural anatomy of telomere OB proteins.

Science.gov (United States)

Horvath, Martin P

2011-10-01

Telomere DNA-binding proteins protect the ends of chromosomes in eukaryotes. A subset of these proteins are constructed with one or more OB folds and bind with G+T-rich single-stranded DNA found at the extreme termini. The resulting DNA-OB protein complex interacts with other telomere components to coordinate critical telomere functions of DNA protection and DNA synthesis. While the first crystal and NMR structures readily explained protection of telomere ends, the picture of how single-stranded DNA becomes available to serve as primer and template for synthesis of new telomere DNA is only recently coming into focus. New structures of telomere OB fold proteins alongside insights from genetic and biochemical experiments have made significant contributions towards understanding how protein-binding OB proteins collaborate with DNA-binding OB proteins to recruit telomerase and DNA polymerase for telomere homeostasis. This review surveys telomere OB protein structures alongside highly comparable structures derived from replication protein A (RPA) components, with the goal of providing a molecular context for understanding telomere OB protein evolution and mechanism of action in protection and synthesis of telomere DNA.

Single-strand DNA binding protein SSB1 facilitates TERT recruitment to telomeres and maintains telomere G-overhangs

Science.gov (United States)

Pandita, Raj K.; Chow, Tracy T.; Udayakumar, Durga; Bain, Amanda L.; Cubeddu, Liza; Hunt, Clayton R.; Shi, Wei; Horikoshi, Nobuo; Zhao, Yong; Wright, Woodring E.; Khanna, Kum Kum; Shay, Jerry W.; Pandita, Tej K.

2015-01-01

Proliferating mammalian stem and cancer cells express telomerase (TERT) in an effort to extend chromosomal G-overhangs and maintain telomere ends. Telomerase-expressing cells also have higher levels of the single-stranded DNA binding protein SSB1, which has a critical role in DNA double-strand break repair. Here we report that SSB1 binds specifically to G-strand telomeric DNA in vitro and associates with telomeres in vivo. SSB1 interacted with the TERT catalytic subunit and regulates its interaction with telomeres. Deletion of SSB1 reduced TERT interaction with telomeres and lead to G-overhang loss. While SSB1 was recruited to DSB sites, we found no corresponding change in TERT levels at these sites, implying that SSB1-TERT interaction relied upon a specific chromatin structure or context. Our findings offer an explanation for how telomerase is recruited to telomeres to facilitate G-strand DNA extension, a critical step in maintaining telomere ends and cell viability in all cancer cells. PMID:25589350

Synthesis and Molecular Modeling of Thermally Stable DNA G-Quadruplexes with Anthraquinone Insertions

DEFF Research Database (Denmark)

Gouda, Alaa S.; Amine, Mahasen S.; Pedersen, Erik Bjerregaard

2017-01-01

Two new phosphoramidite building blocks for DNA synthesis were synthesized from 1,5- and 2,6-dihydroxyanthraquinones through alkylation with 3-bromo-1-propanol followed by DMT-protection. The novel synthesized 1,5- and 2,6-disubstituted anthraquinone monomers H15 and H26 are incorporated into a G...... anthraquinone-modified quadruplexes revealed no change of the antiparallel structure when compared with the wild type under potassium buffer conditions. The significantly increased thermostabilities were interpreted by molecular modeling of anthraquinone-modified G-quadruplexes....

Evaluation of the effect of polymorphism on G-quadruplex-ligand interaction by means of spectroscopic and chromatographic techniques

Science.gov (United States)

Benito, S.; Ferrer, A.; Benabou, S.; Aviñó, A.; Eritja, R.; Gargallo, R.

2018-05-01

Guanine-rich sequences may fold into highly ordered structures known as G-quadruplexes. Apart from the monomeric G-quadruplex, these sequences may form multimeric structures that are not usually considered when studying interaction with ligands. This work studies the interaction of a ligand, crystal violet, with three guanine-rich DNA sequences with the capacity to form multimeric structures. These sequences correspond to short stretches found near the promoter regions of c-kit and SMARCA4 genes. Instrumental techniques (circular dichroism, molecular fluorescence, size-exclusion chromatography and electrospray ionization mass spectrometry) and multivariate data analysis were used for this purpose. The polymorphism of G-quadruplexes was characterized prior to the interaction studies. The ligand was shown to interact preferentially with the monomeric G-quadruplex; the binding stoichiometry was 1:1 and the binding constant was in the order of 105 M-1 for all three sequences. The results highlight the importance of DNA treatment prior to interaction studies.

Escherichia coli DNA polymerase I can disrupt G-quadruplex structures during DNA replication.

Science.gov (United States)

Teng, Fang-Yuan; Hou, Xi-Miao; Fan, San-Hong; Rety, Stephane; Dou, Shuo-Xing; Xi, Xu-Guang

2017-12-01

Non-canonical four-stranded G-quadruplex (G4) DNA structures can form in G-rich sequences that are widely distributed throughout the genome. The presence of G4 structures can impair DNA replication by hindering the progress of replicative polymerases (Pols), and failure to resolve these structures can lead to genetic instability. In the present study, we combined different approaches to address the question of whether and how Escherichia coli Pol I resolves G4 obstacles during DNA replication and/or repair. We found that E. coli Pol I-catalyzed DNA synthesis could be arrested by G4 structures at low protein concentrations and the degree of inhibition was strongly dependent on the stability of the G4 structures. Interestingly, at high protein concentrations, E. coli Pol I was able to overcome some kinds of G4 obstacles without the involvement of other molecules and could achieve complete replication of G4 DNA. Mechanistic studies suggested that multiple Pol I proteins might be implicated in G4 unfolding, and the disruption of G4 structures requires energy derived from dNTP hydrolysis. The present work not only reveals an unrealized function of E. coli Pol I, but also presents a possible mechanism by which G4 structures can be resolved during DNA replication and/or repair in E. coli. © 2017 Federation of European Biochemical Societies.

Quinone methides tethered to naphthalene diimides as selective G-quadruplex alkylating agents.

Science.gov (United States)

Di Antonio, Marco; Doria, Filippo; Richter, Sara N; Bertipaglia, Carolina; Mella, Mariella; Sissi, Claudia; Palumbo, Manlio; Freccero, Mauro

2009-09-16

We have developed novel G-quadruplex (G-4) ligand/alkylating hybrid structures, tethering the naphthalene diimide moiety to quaternary ammonium salts of Mannich bases, as quinone-methide precursors, activatable by mild thermal digestion (40 degrees C). The bis-substituted naphthalene diimides were efficiently synthesized, and their reactivity as activatable bis-alkylating agents was investigated in the presence of thiols and amines in aqueous buffered solutions. The electrophilic intermediate, quinone-methide, involved in the alkylation process was trapped, in the presence of ethyl vinyl ether, in a hetero Diels-Alder [4 + 2] cycloaddition reaction, yielding a substituted 2-ethoxychroman. The DNA recognition and alkylation properties of these new derivatives were investigated by gel electrophoresis, circular dichroism, and enzymatic assays. The alkylation process occurred preferentially on the G-4 structure in comparison to other DNA conformations. By dissecting reversible recognition and alkylation events, we found that the reversible process is a prerequisite to DNA alkylation, which in turn reinforces the G-quadruplex structural rearrangement.

Single-strand DNA-binding protein SSB1 facilitates TERT recruitment to telomeres and maintains telomere G-overhangs.

Science.gov (United States)

Pandita, Raj K; Chow, Tracy T; Udayakumar, Durga; Bain, Amanda L; Cubeddu, Liza; Hunt, Clayton R; Shi, Wei; Horikoshi, Nobuo; Zhao, Yong; Wright, Woodring E; Khanna, Kum Kum; Shay, Jerry W; Pandita, Tej K

2015-03-01

Proliferating mammalian stem and cancer cells express telomerase [telomerase reverse transcriptase (TERT)] in an effort to extend chromosomal G-overhangs and maintain telomere ends. Telomerase-expressing cells also have higher levels of the single-stranded DNA-binding protein SSB1, which has a critical role in DNA double-strand break (DSB) repair. Here, we report that SSB1 binds specifically to G-strand telomeric DNA in vitro and associates with telomeres in vivo. SSB1 interacts with the TERT catalytic subunit and regulates its interaction with telomeres. Deletion of SSB1 reduces TERT interaction with telomeres and leads to G-overhang loss. Although SSB1 is recruited to DSB sites, we found no corresponding change in TERT levels at these sites, implying that SSB1-TERT interaction relies upon a specific chromatin structure or context. Our findings offer an explanation for how telomerase is recruited to telomeres to facilitate G-strand DNA extension, a critical step in maintaining telomere ends and cell viability in all cancer cells. Cancer Res; 75(5); 858-69. ©2015 AACR. ©2015 American Association for Cancer Research.

Utilization of circular dichroism and electrospray ionization mass spectrometry to understand the formation and conversion of G-quadruplex DNA at the human c-myb proto-oncogene.

Science.gov (United States)

Fu, Hengqing; Yang, Pengfei; Hai, Jinhui; Li, Huihui

2018-10-05

G-quadruplex DNAs are involved in a number of key biological processes, including gene expression, transcription, and apoptosis. The c-myb oncogene contains a number of GGA repeats in its promoter which forms G-quadruplex, thus it could be used as a target in cancer therapeutics. Several in-vitro studies have used Circular Dichroism (CD) spectroscopy or electrospray ionization mass spectrometry (ESI-MS) to demonstrate formation and stability of G-quadruplex DNA structure in the promoter region of human c-myb oncogene. The factors affecting the c-myb G-quadruplex structures were investigated, such as cations (i.e. K + , NH 4 + and Na + ) and co-solutes (methanol and polyethylene glycol). The results indicated that the presence of cations and co-solutes could change the G-quadruplex structural population and promote its thermodynamic stabilization as indicated by CD melting curves. It indicated that the co-solutes preferentially stabilize the c-myb G-quadruplex structure containing both homo- and hetero-stacking. In addition, protopine was demonstrated as a binder of c-myb G-quadruplex as screened from a library of natural alkaloids using ESI-MS method. CD spectra showed that it could selectively stabilize the c-myb G-quadruplex structure compared to other six G-quadruplexes from tumor-related G-rich sequences and the duplex DNAs (both long and short-chain ones). The binding of protopine could induce the change in the G-quadruplex structural populations. Therefore, protopine with its high binding specificity could be considered as a precursor for the design of drugs to target and regulate c-myb oncogene transcription. Copyright © 2018 Elsevier B.V. All rights reserved.

Simultaneous G-Quadruplex DNA Logic.

Science.gov (United States)

Bader, Antoine; Cockroft, Scott L

2018-04-03

A fundamental principle of digital computer operation is Boolean logic, where inputs and outputs are described by binary integer voltages. Similarly, inputs and outputs may be processed on the molecular level as exemplified by synthetic circuits that exploit the programmability of DNA base-pairing. Unlike modern computers, which execute large numbers of logic gates in parallel, most implementations of molecular logic have been limited to single computing tasks, or sensing applications. This work reports three G-quadruplex-based logic gates that operate simultaneously in a single reaction vessel. The gates respond to unique Boolean DNA inputs by undergoing topological conversion from duplex to G-quadruplex states that were resolved using a thioflavin T dye and gel electrophoresis. The modular, addressable, and label-free approach could be incorporated into DNA-based sensors, or used for resolving and debugging parallel processes in DNA computing applications. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

A twice-as-smart synthetic G-quartet: PyroTASQ is both a smart quadruplex ligand and a smart fluorescent probe.

Science.gov (United States)

Laguerre, Aurélien; Stefan, Loic; Larrouy, Manuel; Genest, David; Novotna, Jana; Pirrotta, Marc; Monchaud, David

2014-09-03

Recent and unambiguous evidences of the formation of DNA and RNA G-quadruplexes in cells has provided solid support for these structures to be considered as valuable targets in oncology. Beyond this, they have lent further credence to the anticancer strategies relying on small molecules that selectively target these higher-order DNA/RNA architectures, referred to as G-quadruplex ligands. They have also shed bright light on the necessity of designing multitasking ligands, displaying not only enticing quadruplex interacting properties (affinity, structural selectivity) but also additional features that make them usable for detecting quadruplexes in living cells, notably for determining whether, when, and where these structures fold and unfold during the cell cycle and also for better assessing the consequences of their stabilization by external agents. Herein, we report a brand new design of such multitasking ligands, whose structure experiences a quadruplex-promoted conformational switch that triggers not only its quadruplex affinity (i.e., smart ligands, which display high affinity and selectivity for DNA/RNA quadruplexes) but also its fluorescence (i.e., smart probes, which behave as selective light-up fluorescent reporters on the basis of a fluorogenic electron redistribution). The first prototype of such multifunctional ligands, termed PyroTASQ, represents a brand new generation of quadruplex ligands that can be referred to as "twice-as-smart" quadruplex ligands.

Development of a carbazole-based fluorescence probe for G-quadruplex DNA: The importance of side-group effect on binding specificity

Science.gov (United States)

Wang, Ming-Qi; Ren, Gui-Ying; Zhao, Shuang; Lian, Guang-Chang; Chen, Ting-Ting; Ci, Yang; Li, Hong-Yao

2018-06-01

G-quadruplex DNAs are highly prevalent in the human genome and involved in many important biological processes. However, many aspects of their biological mechanism and significance still need to be elucidated. Therefore, the development of fluorescent probes for G-quadruplex detection is important for the basic research. We report here on the development of small molecular dyes designed on the basis of carbazole scaffold by introducing styrene-like substituents at its 9-position, for the purpose of G-quadruplex recognition. Results revealed that the side group on the carbazole scaffold was very important for their ability to selectively recognize G-quadruplex DNA structures. 1a with the pyridine side group displayed excellent fluorescence signal turn-on property for the specific discrimination of G-quadruplex DNAs against other nucleic acids. The characteristics of 1a were further investigated with UV-vis spectrophotometry, fluorescence, circular dichroism, FID assay and molecular docking to validate the selectivity, sensitivity and detailed binding mode toward G-quadruplex DNAs.

A G-quadruplex-containing RNA activates fluorescence in a GFP-like fluorophore

Energy Technology Data Exchange (ETDEWEB)

Huang, Hao; Suslov, Nikolai B.; Li, Nan-Sheng; Shelke, Sandip A.; Evans, Molly E.; Koldobskaya, Yelena; Rice, Phoebe A.; Piccirilli, Joseph A. [UC

2014-08-21

Spinach is an in vitro–selected RNA aptamer that binds a GFP-like ligand and activates its green fluorescence. Spinach is thus an RNA analog of GFP and has potentially widespread applications for in vivo labeling and imaging. We used antibody-assisted crystallography to determine the structures of Spinach both with and without bound fluorophore at 2.2-Å and 2.4-Å resolution, respectively. Spinach RNA has an elongated structure containing two helical domains separated by an internal bulge that folds into a G-quadruplex motif of unusual topology. The G-quadruplex motif and adjacent nucleotides comprise a partially preformed binding site for the fluorophore. The fluorophore binds in a planar conformation and makes extensive aromatic stacking and hydrogen bond interactions with the RNA. Our findings provide a foundation for structure-based engineering of new fluorophore-binding RNA aptamers.

6-Thioguanine alters the structure and stability of duplex DNA and inhibits quadruplex DNA formation.

Science.gov (United States)

Marathias, V M; Sawicki, M J; Bolton, P H

1999-07-15

The ability to chemically synthesize biomolecules has opened up the opportunity to observe changes in structure and activity that occur upon single atom substitution. In favorable cases this can provide information about the roles of individual atoms. The substitution of 6-thioguanine (6SG) for guanine is a potentially very useful single atom substitution as 6SG has optical, photocrosslinking, metal ion binding and other properties of potential utility. In addition, 6-mercaptopurine is a clinically important pro-drug that is activated by conversion into 6SG by cells. The results presented here indicate that the presence of 6SG blocks the formation of quadruplex DNA. The presence of 6SG alters the structure and lowers the thermal stability of duplex DNA, but duplex DNA can be formed in the presence of 6SG. These results indicate that some of the cytotoxic activity of 6SG may be due to disruption of the quadruplex structures formed by telomere and other DNAs. This additional mode of action is consistent with the delayed onset of cytotoxicity.

Use of alternative alkali chlorides in RT and PCR of polynucleotides containing G quadruplex structures.

Science.gov (United States)

Ramos-Alemán, Fabiola; González-Jasso, Eva; Pless, Reynaldo C

2018-02-15

Several alkali chlorides were compared for their use in reverse transcription (RT) and PCR of different types of nucleic acid templates. On a test region of biological DNA incapable of forming G quadruplex (G4) structures, Taq DNA polymerase showed similar PCR performance with 50 mM KCl, CsCl, LiCl, and NaCl. In contrast, on a synthetic model polydeoxyribonucleotide prone to G4 formation, good PCR amplification was obtained with 50 mM CsCl, but little or none with LiCl or KCl. Similarly, in RT of a G4-prone model polyribonucleotide, MMLV reverse transcriptase produced a good yield with 50 mM CsCl, mediocre yields with LiCl or without added alkali chloride, and a poor yield with 50 mM KCl. The full RT-PCR assay starting from the G4-prone polyribonucleotide, showed good results with CsCl in both stages, poor results with LiCl, and no product formation with KCl. The model polynucleotides showed fast G quadruplex formation under PCR or RT conditions with 50 mM KCl, but not with CsCl or LiCl. The results argue for the use of CsCl instead of KCl for RT and PCR of G4-prone sequences. No advantage was observed when using the 7-deaza type nucleotide analog c 7 dGTP in PCR amplification of the G4-prone polydeoxyribonucleotide. Copyright © 2017 Elsevier Inc. All rights reserved.

Detection of G-Quadruplex Structures Formed by G-Rich Sequences from Rice Genome and Transcriptome Using Combined Probes.

Science.gov (United States)

Chang, Tianjun; Li, Weiguo; Ding, Zhan; Cheng, Shaofei; Liang, Kun; Liu, Xiangjun; Bing, Tao; Shangguan, Dihua

2017-08-01

Putative G-quadruplex (G4) forming sequences (PQS) are highly prevalent in the genome and transcriptome of various organisms and are considered as potential regulation elements in many biological processes by forming G4 structures. The formation of G4 structures highly depends on the sequences and the environment. In most cases, it is difficult to predict G4 formation by PQS, especially PQS containing G2 tracts. Therefore, the experimental identification of G4 formation is essential in the study of G4-related biological functions. Herein, we report a rapid and simple method for the detection of G4 structures by using a pair of complementary reporters, hemin and BMSP. This method was applied to detect G4 structures formed by PQS (DNA and RNA) searched in the genome and transcriptome of Oryza sativa. Unlike most of the reported G4 probes that only recognize part of G4 structures, the proposed method based on combined probes positively responded to almost all G4 conformations, including parallel, antiparallel, and mixed/hybrid G4, but did not respond to non-G4 sequences. This method shows potential for high-throughput identification of G4 structures in genome and transcriptome. Furthermore, BMSP was observed to drive some PQS to form more stable G4 structures or induce the G4 formation of some PQS that cannot form G4 in normal physiological conditions, which may provide a powerful molecular tool for gene regulation.

Fluorescence detection of DNA, adenosine-5'-triphosphate (ATP), and telomerase activity by zinc(II)-protoporphyrin IX/G-quadruplex labels.

Science.gov (United States)

Zhang, Zhanxia; Sharon, Etery; Freeman, Ronit; Liu, Xiaoqing; Willner, Itamar

2012-06-05

The zinc(II)-protoporphyrin IX (ZnPPIX) fluorophore binds to G-quadruplexes, and this results in the enhanced fluorescence of the fluorophore. This property enabled the development of DNA sensors, aptasensors, and a sensor following telomerase activity. The DNA sensor is based on the design of a hairpin structure that includes a "caged" inactive G-quadruplex sequence. Upon opening the hairpin by the analyte DNA, the resulting fluorescence of the ZnPPIX/G-quadruplex provides the readout signal for the sensing event (detection limit 5 nM). Addition of Exonuclease III to the system allows the recycling of the analyte and its amplified analysis (detection limit, 200 pM). The association of the ZnPPIX to G-quadruplex aptamer-substrate complexes allowed the detection of adenosine-5'-triphosphate (ATP, detection limit 10 μM). Finally, the association of ZnPPIX to the G-quadruplex repeat units of telomers allowed the detection of telomerase activity originating from 380 ± 20 cancer 293T cell extract.

Effects of trimethylamine N-oxide and urea on DNA duplex and G-quadruplex.

Science.gov (United States)

Ueda, Yu-Mi; Zouzumi, Yu-Ki; Maruyama, Atsushi; Nakano, Shu-Ichi; Sugimoto, Naoki; Miyoshi, Daisuke

2016-01-01

We systematically investigated effects of molecular crowding with trimethylamine N -oxide (TMAO) as a zwitterionic and protective osmolyte and urea as a nonionic denaturing osmolyte on conformation and thermodynamics of the canonical DNA duplex and the non-canonical DNA G-quadruplex. It was found that TMAO and urea stabilized and destabilized, respectively, the G-quadruplex. On the other hand, these osmolytes generally destabilize the duplex; however, it was observed that osmolytes having the trimethylamine group stabilized the duplex at the lower concentrations because of a direct binding to a groove of the duplex. These results are useful not only to predict DNA structures and their thermodynamics under physiological environments in living cells, but also design of polymers and materials to regulate structure and stability of DNA sequences.

Molecular recognition of naphthalene diimide ligands by telomeric quadruplex-DNA: the importance of the protonation state and mediated hydrogen bonds.

Science.gov (United States)

Spinello, A; Barone, G; Grunenberg, J

2016-01-28

In depth Monte Carlo conformational scans in combination with molecular dynamics (MD) simulations and electronic structure calculations were applied in order to study the molecular recognition process between tetrasubstituted naphthalene diimide (ND) guests and G-quadruplex (G4) DNA receptors. ND guests are a promising class of telomere stabilizers due to which they are used in novel anticancer therapeutics. Though several ND guests have been studied experimentally in the past, the protonation state under physiological conditions is still unclear. Based on chemical intuition, in the case of N-methyl-piperazine substitution, different protonation states are possible and might play a crucial role in the molecular recognition process by G4-DNA. Depending on the proton concentration, different nitrogen atoms of the N-methyl-piperazine might (or might not) be protonated. This fact was considered in our simulation in terms of a case by case analysis, since the process of molecular recognition is determined by possible donor or acceptor positions. The results of our simulations show that the electrostatic interactions between the ND ligands and the G4 receptor are maximized in the case of the protonation of the terminal nitrogen atoms, forming compact ND G4 complexes inside the grooves. The influence of different protonation states in terms of the ability to form hydrogen bonds with the sugar-phosphate backbone, as well as the importance of mediated vs. direct hydrogen bonding, was analyzed in detail by MD and relaxed force constant (compliance constant) simulations.

Fluorescent Dansyl-Guanosine Conjugates that Bind c-MYC Promoter G-Quadruplex and Downregulate c-MYC Expression.

Science.gov (United States)

Pavan Kumar, Y; Saha, Puja; Saha, Dhurjhoti; Bessi, Irene; Schwalbe, Harald; Chowdhury, Shantanu; Dash, Jyotirmayee

2016-03-02

The four-stranded G-quadruplex present in the c-MYC P1 promoter has been shown to play a pivotal role in the regulation of c-MYC transcription. Small-molecule compounds capable of inhibiting the c-MYC promoter activity by stabilising the c-MYC G-quadruplex could potentially be used as anticancer agents. In this context, here we report the synthesis of dansyl-guanosine conjugates through one-pot modular click reactions. The dansyl-guanosine conjugates can selectively detect c-MYC G-quadruplex over other biologically relevant quadruplexes and duplex DNA and can be useful as staining reagents for selective visualisation of c-MYC G-quadruplex over duplex DNA by gel electrophoresis. NMR spectroscopic titrations revealed the preferential binding sites of these dansyl ligands to the c-MYC G-quadruplex. A dual luciferase assay and qRT-PCR revealed that a dansyl-bisguanosine ligand represses the c-MYC expression, possibly by stabilising the c-MYC G-quadruplex. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Co-transcriptional formation of DNA:RNA hybrid G-quadruplex and potential function as constitutional cis element for transcription control.

Science.gov (United States)

Zheng, Ke-wei; Xiao, Shan; Liu, Jia-quan; Zhang, Jia-yu; Hao, Yu-hua; Tan, Zheng

2013-05-01

G-quadruplex formation in genomic DNA is considered to regulate transcription. Previous investigations almost exclusively focused on intramolecular G-quadruplexes formed by DNA carrying four or more G-tracts, and structure formation has rarely been studied in physiologically relevant processes. Here, we report an almost entirely neglected, but actually much more prevalent form of G-quadruplexes, DNA:RNA hybrid G-quadruplexes (HQ) that forms in transcription. HQ formation requires as few as two G-tracts instead of four on a non-template DNA strand. Potential HQ sequences (PHQS) are present in >97% of human genes, with an average of 73 PHQSs per gene. HQ modulates transcription under both in vitro and in vivo conditions. Transcriptomal analysis of human tissues implies that maximal gene expression may be limited by the number of PHQS in genes. These features suggest that HQs may play fundamental roles in transcription regulation and other transcription-mediated processes.

Spectroscopic insights into quadruplexes of five-repeat telomere DNA sequences upon G-block damage

Czech Academy of Sciences Publication Activity Database

Dvořáková, Zuzana; Vorlíčková, Michaela; Renčiuk, Daniel

2017-01-01

Roč. 1861, č. 11 (2017), s. 2750-2757 ISSN 0304-4165 R&D Projects: GA ČR(CZ) GJ17-19170Y Institutional support: RVO:68081707 Keywords : k+ solution * guanine quadruplexes Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 4.702, year: 2016

Can We Execute Reliable MM-PBSA Free Energy Computations of Relative Stabilities of Different Guanine Quadruplex Folds?

Czech Academy of Sciences Publication Activity Database

Islam, B.; Stadlbauer, Petr; Neidle, S.; Haider, S.; Šponer, Jiří

2016-01-01

Roč. 120, č. 11 (2016), s. 2899-2912 ISSN 1520-6106 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : MOLECULAR-DYNAMICS SIMULATIONS * TELOMERIC G-QUADRUPLEX * AMBER FORCE-FIELD Subject RIV: BO - Biophysics Impact factor: 3.177, year: 2016

RNA synthesis is modulated by G-quadruplex formation in Hepatitis C virus negative RNA strand.

Science.gov (United States)

Chloé, Jaubert; Amina, Bedrat; Laura, Bartolucci; Carmelo, Di Primo; Michel, Ventura; Jean-Louis, Mergny; Samir, Amrane; Marie-Line, Andreola

2018-05-25

DNA and RNA guanine-rich oligonucleotides can form non-canonical structures called G-quadruplexes or "G4" that are based on the stacking of G-quartets. The role of DNA and RNA G4 is documented in eukaryotic cells and in pathogens such as viruses. Yet, G4 have been identified only in a few RNA viruses, including the Flaviviridae family. In this study, we analysed the last 157 nucleotides at the 3'end of the HCV (-) strand. This sequence is known to be the minimal sequence required for an efficient RNA replication. Using bioinformatics and biophysics, we identified a highly conserved G4-prone sequence located in the stem-loop IIy' of the negative strand. We also showed that the formation of this G-quadruplex inhibits the in vitro RNA synthesis by the RdRp. Furthermore, Phen-DC3, a specific G-quadruplex binder, is able to inhibit HCV viral replication in cells in conditions where no cytotoxicity was measured. Considering that this domain of the negative RNA strand is well conserved among HCV genotypes, G4 ligands could be of interest for new antiviral therapies.

A G-quadruplex-based Label-free Fluorometric Aptasensor for Adenosine Triphosphate Detection.

Science.gov (United States)

Li, Li Juan; Tian, Xue; Kong, Xiang Juan; Chu, Xia

2015-01-01

A G-quadruplex-based, label-free fluorescence assay was demonstrated for the detection of adenosine triphosphate (ATP). A double-stranded DNA (dsDNA), hybridized by ATP-aptamer and its complementary sequence, was employed as a substrate for ATP binding. SYBR Green I (SG I) was a fluorescent probe and exonuclease III (Exo III) was a nuclease to digest the dsDNA. Consequently, in the absence of ATP, the dsDNA was inset with SG I and was digested by Exo III, resulting in a low background signal. In the presence of ATP, the aptamer in dsDNA folded into a G-quadruplex structure that resisted the digestion of Exo III. SG I was inserted into the structure, showing high fluorescence. Owing to a decrease of the background noise, a high signal-to-noise ratio could be obtained. This sensor can detect ATP with a concentration ranging from 50 μM to 5 mM, and possesses a capacity for the sensitive determination of other targets.

Design, synthesis and evaluation of 4,7-diamino-1,10-phenanthroline G-quadruplex ligands

DEFF Research Database (Denmark)

Nielsen, Mads Corvinius; Borch, Jonas; Ulven, Trond

2009-01-01

the central ionic column. Introduction of positively charged side chains results in compounds with appreciable G-quadruplex stabilizing properties and high aqueous solubility, with the longer side chains giving more potent compounds. Ligands carrying guanidine side chains in general show higher quadruplex...... stabilizing activity and distinctly slower kinetic properties than their amino and dimethylamino analogues, possibly due to specific hydrogen bond interactions with the G-quadruplex loops....

Behavior of the guanine base in G-quadruplexes probed by the fluorescent guanine analog, 6-methyl isozanthopterin

Energy Technology Data Exchange (ETDEWEB)

Han, Ji Hoon; Chitrapriya, Nataraj; Lee, Hyun Suk; Lee, Young Ae; Kim, Seog K. [Dept. of Chemistry, Yeungnam University, Gyeongsan (Korea, Republic of); Jung, Maeng Joon [Dept. of Chemistry, Kyungpook National University, Daegu (Korea, Republic of)

2017-02-15

In this study, circular dichroism (CD) spectrum and fluorescence techniques were used to examine the dynamic properties and microenvironment of the guanine base (G) at the central loop and at the middle of the G-stem of the G-quadruplex formed from the G{sub 3}T{sub 2}G{sub 3}TGTG{sub 3}T{sub 2}G{sub 3} sequence (G-quadruplex 1), in which the G base at the 10th and 13th position were replaced with a fluorescent G analog, 6-methyl isoxanthopterin (6MI) (G-quadruplex 2 and 3, respectively). For all G-quadruplexes, the CD spectrum revealed a positive band at 263 nm and a shoulder at 298 nm, and the thermal melting profiles were the sum of at least two sigmoidal curves. These observations indicated the presence of two conformers in the G-quadruplex. The fluorescence intensity of G-quadruplex 2 was greater than 3, as expected from the extent of stacking interaction, which is larger in the G(6MI)G sequence than the T(6MI)T sequence. The efficiency of fluorescence quenching by the polar acrylamide quencher and negatively charged I− quencher were larger for G-quadruplex 3, suggesting that 6MI in the G(6MI)G stem is exposed more to the aqueous environment compared to that in the T(6MI)T central loop. In the latter case, 6MI may direct to the center of the top G-quartet layer. The possibility of hydrogen bond formation between the carbonyl group of 6MI and the acrylamide of the G-quadruplex 3 was proposed.

Shedding lights on the flexible-armed porphyrins: Human telomeric G4 DNA interaction and cell photocytotoxicity research.

Science.gov (United States)

Sun, Xiang-Yu; Zhao, Ping; Jin, Shu-Fang; Liu, Min-Chao; Wang, Xia-Hong; Huang, Yu-Min; Cheng, Zhen-Feng; Yan, Si-Qi; Li, Yan-Yu; Chen, Ya-Qing; Zhong, Yan-Mei

2017-08-01

DNA polymorphism exerts a fascination on a large scientific community. Without crystallographic structural data, clarification of the binding modes between G-quadruplex (G4) and ligand (complex) is a challenging job. In the present work, three porphyrin compounds with different flexible carbon chains (arms) were designed, synthesized and characterized. Their binding, folding and stabilizing abilities to human telomeric G4 DNA structures were comparatively researched. Positive charges at the end of the flexible carbon chains seem to be favorable for the DNA-porphyrin interactions, which were evidenced by the spectral results and further confirmed by the molecular docking calculations. Biological function analysis demonstrated that these porphyrins show no substantial inhibition to Hela, A549 and BEL 7402 cancer cell lines under dark while exhibit broad inhibition under visible light. This significantly enhanced photocytotoxicity relative to the dark control is an essential property of photochemotherapeutic agents. The feature of the flexible arms emerges as critical influencing factors in the cell photocytotoxicity. Moreover, an ROS-mediated mitochondrial dysfunction pathway was suggested for the cell apoptosis induced by these flexible-armed porphyrins. It is found that the porphyrins with positive charges located at the end of the flexible arms represent an exciting opportunity for photochemotherapeutic anti-cancer drug design. Copyright © 2017. Published by Elsevier B.V.

DNA sensors and aptasensors based on the hemin/G-quadruplex-controlled aggregation of Au NPs in the presence of L-cysteine.

Science.gov (United States)

Niazov-Elkan, Angelica; Golub, Eyal; Sharon, Etery; Balogh, Dora; Willner, Itamar

2014-07-23

L-cysteine induces the aggregation of Au nanoparticles (NPs), resulting in a color transition from red to blue due to interparticle plasmonic coupling in the aggregated structure. The hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme catalyzes the aerobic oxidation of L-cysteine to cystine, a process that inhibits the aggregation of the NPs. The degree of inhibition of the aggregation process is controlled by the concentration of the DNAzyme in the system. These functions are implemented to develop sensing platforms for the detection of a target DNA, for the analysis of aptamer-substrate complexes, and for the analysis of L-cysteine in human urine samples. A hairpin DNA structure that includes a recognition site for the DNA analyte and a caged G-quadruplex sequence, is opened in the presence of the target DNA. The resulting self-assembled hemin/G-quadruplex acts as catalyst that controls the aggregation of the Au NPs. Also, the thrombin-binding aptamer folds into a G-quadruplex nanostructure upon binding to thrombin. The association of hemin to the resulting G-quadruplex aptamer-thrombin complex leads to a catalytic label that controls the L-cysteine-mediated aggregation of the Au NPs. The hemin/G-qaudruplex-controlled aggregation of Au NPs process is further implemented for visual and spectroscopic detection of L-cysteine concentration in urine samples. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Delineation of G-Quadruplex Alkylation Sites Mediated by 3,6-Bis(1-methyl-4-vinylpyridinium iodide)carbazole-Aniline Mustard Conjugates.

Science.gov (United States)

Chen, Chien-Han; Hu, Tsung-Hao; Huang, Tzu-Chiao; Chen, Ying-Lan; Chen, Yet-Ran; Cheng, Chien-Chung; Chen, Chao-Tsen

2015-11-23

A new G-quadruplex (G-4)-directing alkylating agent BMVC-C3M was designed and synthesized to integrate 3,6-bis(1-methyl-4-vinylpyridinium iodide)carbazole (BMVC) with aniline mustard. Various telomeric G-4 structures (hybrid-2 type and antiparallel) and an oncogene promoter, c-MYC (parallel), were constructed to react with BMVC-C3M, yielding 35 % alkylation yield toward G-4 DNA over other DNA categories (alkylation adducts by electrospray ionization mass spectroscopy (ESI-MS) revealed the stepwise DNA alkylation mechanism of aniline mustard for the first time. Furthermore, the monoalkylation sites and intrastrand cross-linking sites were determined and found to be dependent on G-4 topology based on the results of footprinting analysis in combination with mass spectroscopic techniques and in silico modeling. The results indicated that BMVC-C3M preferentially alkylated at A15 (H26), G12 (H24), and G2 (c-MYC), respectively, as monoalkylated adducts and formed A15-C3M-A21 (H26), G12-C3M-G4 (H24), and G2-C3M-G4/G17 (c-MYC), respectively, as cross-linked dialkylated adducts. Collectively, the stability and site-selective cross-linking capacity of BMVC-C3M provides a credible tool for the structural and functional characterization of G-4 DNAs in biological systems. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Hsa-miR-1587 G-quadruplex formation and dimerization induced by NH4+, molecular crowding environment and jatrorrhizine derivatives.

Science.gov (United States)

Tan, Wei; Yi, Long; Zhu, Zhentao; Zhang, Lulu; Zhou, Jiang; Yuan, Gu

2018-03-01

A guanine-rich human mature microRNA, miR-1587, was discovered to form stable intramolecular G-quadruplexes in the presence of K + , Na + and low concentration of NH 4 + (25mM) by electrospray ionization mass spectrometry (ESI-MS) combined with circular dichroism (CD) spectroscopy. Furthermore, under high concentration of NH 4 + (100mM) or molecular crowding environments, miR-1587 formed a dimeric G-quadruplex through 3'-to-3' stacking of two monomeric G-quadruplex subunits with one ammonium ion sandwiched between the interfaces. Specifically, two synthesized jatrorrhizine derivatives with terminal amine groups could also induce the dimerization of miR-1587 G-quadruplex and formed 1:1 and 2:1 complexes with the dimeric G-quadruplex. In contrast, jatrorrhizine could bind with the dimeric miR-1587 G-quadruplex, but could not induce dimerization of miR-1587 G-quadruplex. These results provide a new strategy to regulate the functions of miR-1587 through induction of G-quadruplex formation and dimerization. Copyright © 2017 Elsevier B.V. All rights reserved.

High-resolution AFM structure of DNA G-wires in aqueous solution.

Science.gov (United States)

Bose, Krishnashish; Lech, Christopher J; Heddi, Brahim; Phan, Anh Tuân

2018-05-17

We investigate the self-assembly of short pieces of the Tetrahymena telomeric DNA sequence d[G 4 T 2 G 4 ] in physiologically relevant aqueous solution using atomic force microscopy (AFM). Wire-like structures (G-wires) of 3.0 nm height with well-defined surface periodic features were observed. Analysis of high-resolution AFM images allowed their classification based on the periodicity of these features. A major species is identified with periodic features of 4.3 nm displaying left-handed ridges or zigzag features on the molecular surface. A minor species shows primarily left-handed periodic features of 2.2 nm. In addition to 4.3 and 2.2 nm ridges, background features with periodicity of 0.9 nm are also observed. Using molecular modeling and simulation, we identify a molecular structure that can explain both the periodicity and handedness of the major G-wire species. Our results demonstrate the potential structural diversity of G-wire formation and provide valuable insight into the structure of higher-order intermolecular G-quadruplexes. Our results also demonstrate how AFM can be combined with simulation to gain insight into biomolecular structure.

G-Quadruplexes influence pri-microRNA processing.

Science.gov (United States)

Rouleau, Samuel G; Garant, Jean-Michel; Bolduc, François; Bisaillon, Martin; Perreault, Jean-Pierre

2018-02-01

RNA G-Quadruplexes (G4) have been shown to possess many biological functions, including the regulation of microRNA (miRNA) biogenesis and function. However, their impact on pri-miRNA processing remains unknown. We identified G4 located near the Drosha cleavage site in three distinct pri-miRNAs: pri-mir200c, pri-mir451a, and pri-mir497. The folding of the potential G4 motifs was determined in solution. Subsequently, mutations disrupting G4 folding led to important changes in the mature miRNAs levels in cells. Moreover, using small antisense oligonucleotides binding to the pri-miRNA, it was possible to modulate, either positively or negatively, the mature miRNA levels. Together, these data demonstrate that G4 motifs could contribute to the regulation of pri-mRNA processing, a novel role for G4. Considering that bio-informatics screening indicates that between 9% and 50% of all pri-miRNAs contain a putative G4, these structures possess interesting potential as future therapeutic targets.

G-Quadruplexes in DNA Replication: A Problem or a Necessity?

Science.gov (United States)

Valton, Anne-Laure; Prioleau, Marie-Noëlle

2016-11-01

DNA replication is a highly regulated process that ensures the correct duplication of the genome at each cell cycle. A precise cell type-specific temporal program controls the duplication of complex vertebrate genomes in an orderly manner. This program is based on the regulation of both replication origin firing and replication fork progression. G-quadruplexes (G4s), DNA secondary structures displaying noncanonical Watson-Crick base pairing, have recently emerged as key controllers of genome duplication. Here we discuss the various means by which G4s affect this fundamental cellular process. Copyright © 2016 Elsevier Ltd. All rights reserved.

Exploring the Dynamics of Propeller Loops in Human Telomeric DNA Quadruplexes Using Atomistic Simulations

Science.gov (United States)

2017-01-01

We have carried out a series of extended unbiased molecular dynamics (MD) simulations (up to 10 μs long, ∼162 μs in total) complemented by replica-exchange with the collective variable tempering (RECT) approach for several human telomeric DNA G-quadruplex (GQ) topologies with TTA propeller loops. We used different AMBER DNA force-field variants and also processed simulations by Markov State Model (MSM) analysis. The slow conformational transitions in the propeller loops took place on a scale of a few μs, emphasizing the need for long simulations in studies of GQ dynamics. The propeller loops sampled similar ensembles for all GQ topologies and for all force-field dihedral-potential variants. The outcomes of standard and RECT simulations were consistent and captured similar spectrum of loop conformations. However, the most common crystallographic loop conformation was very unstable with all force-field versions. Although the loss of canonical γ-trans state of the first propeller loop nucleotide could be related to the indispensable bsc0 α/γ dihedral potential, even supporting this particular dihedral by a bias was insufficient to populate the experimentally dominant loop conformation. In conclusion, while our simulations were capable of providing a reasonable albeit not converged sampling of the TTA propeller loop conformational space, the force-field description still remained far from satisfactory. PMID:28475322

The G-quadruplex augments translation in the 5' untranslated region of transforming growth factor β2.

Science.gov (United States)

Agarwala, Prachi; Pandey, Satyaprakash; Mapa, Koyeli; Maiti, Souvik

2013-03-05

Transforming growth factor β2 (TGFβ2) is a versatile cytokine with a prominent role in cell migration, invasion, cellular development, and immunomodulation. TGFβ2 promotes the malignancy of tumors by inducing epithelial-mesenchymal transition, angiogenesis, and immunosuppression. As it is well-documented that nucleic acid secondary structure can regulate gene expression, we assessed whether any secondary motif regulates its expression at the post-transcriptional level. Bioinformatics analysis predicts an existence of a 23-nucleotide putative G-quadruplex sequence (PG4) in the 5' untranslated region (UTR) of TGFβ2 mRNA. The ability of this stretch of sequence to form a highly stable, intramolecular parallel quadruplex was demonstrated using ultraviolet and circular dichroism spectroscopy. Footprinting studies further validated its existence in the presence of a neighboring nucleotide sequence. Following structural characterization, we evaluated the biological relevance of this secondary motif using a dual luciferase assay. Although PG4 inhibits the expression of the reporter gene, its presence in the context of the entire 5' UTR sequence interestingly enhances gene expression. Mutation or removal of the G-quadruplex sequence from the 5' UTR of the gene diminished the level of expression of this gene at the translational level. Thus, here we highlight an activating role of the G-quadruplex in modulating gene expression of TGFβ2 at the translational level and its potential to be used as a target for the development of therapeutics against cancer.

Effect of ATRX and G-Quadruplex Formation by the VNTR Sequence on α-Globin Gene Expression.

Science.gov (United States)

Li, Yue; Syed, Junetha; Suzuki, Yuki; Asamitsu, Sefan; Shioda, Norifumi; Wada, Takahito; Sugiyama, Hiroshi

2016-05-17

ATR-X (α-thalassemia/mental retardation X-linked) syndrome is caused by mutations in chromatin remodeler ATRX. ATRX can bind the variable number of tandem repeats (VNTR) sequence in the promoter region of the α-globin gene cluster. The VNTR sequence, which contains the potential G-quadruplex-forming sequence CGC(GGGGCGGGG)n , is involved in the downregulation of α-globin expression. We investigated G-quadruplex and i-motif formation in single-stranded DNA and long double-stranded DNA. The promoter region without the VNTR sequence showed approximately twofold higher luciferase activity than the promoter region harboring the VNTR sequence. G-quadruplex stabilizers hemin and TMPyP4 reduced the luciferase activity, whereas expression of ATRX led to a recovery in reporter activity. Our results demonstrate that stable G-quadruplex formation by the VNTR sequence downregulates the expression of α-globin genes and that ATRX might bind to and resolve the G-quadruplex. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

“One Ring to Bind Them All”—Part I: The Efficiency of the Macrocyclic Scaffold for G-Quadruplex DNA Recognition

Directory of Open Access Journals (Sweden)

David Monchaud

2010-01-01

Full Text Available Macrocyclic scaffolds are particularly attractive for designing selective G-quadruplex ligands essentially because, on one hand, they show a poor affinity for the “standard” B-DNA conformation and, on the other hand, they fit nicely with the external G-quartets of quadruplexes. Stimulated by the pioneering studies on the cationic porphyrin TMPyP4 and the natural product telomestatin, follow-up studies have developed, rapidly leading to a large diversity of macrocyclic structures with remarkable-quadruplex binding properties and biological activities. In this review we summarize the current state of the art in detailing the three main categories of quadruplex-binding macrocycles described so far (telomestatin-like polyheteroarenes, porphyrins and derivatives, polyammonium cyclophanes, and in addressing both synthetic issues and biological aspects.

Improved Inhibition of Telomerase by Short Twisted Intercalating Nucleic Acids under Molecular Crowding Conditions

DEFF Research Database (Denmark)

Agarwal, Tani; Pradhan, Devranjan; Géci, Imrich

2012-01-01

Human telomeric DNA has the ability to fold into a 4-stranded G-quadruplex structure. Several G-quadruplex ligands are known to stabilize the structure and thereby inhibit telomerase activity. Such ligands have demonstrated efficient telomerase inhibition in dilute conditions, but under molecular...

DNA breaks and repair in interstitial telomere sequences: Influence of chromatin structure; Etude des cassures de l'ADN et des mecanismes de reparation dans les sequences telomeriques interstitielles: Influence de la structure chromatinienne

Energy Technology Data Exchange (ETDEWEB)

Revaud, D.

2009-06-15

Interstitial Telomeric Sequences (ITS) are over-involved in spontaneous and radiationinduced chromosome aberrations in chinese hamster cells. We have performed a study to investigate the origin of their instability, spontaneously or after low doses irradiation. Our results demonstrate that ITS have a particular chromatin structure: short nucleotide repeat length, less compaction of the 30 nm chromatin fiber, presence of G-quadruplex structures. These features would modulate breaks production and would favour the recruitment of alternative DNA repair mechanisms, which are prone to produce chromosome aberrations. These pathways could be at the origin of chromosome aberrations in ITS whereas NHEJ and HR Double Strand Break repair pathways are rather required for a correct repair in these regions. (author)

Toehold strand displacement-driven assembly of G-quadruplex DNA for enzyme-free and non-label sensitive fluorescent detection of thrombin.

Science.gov (United States)

Xu, Yunying; Zhou, Wenjiao; Zhou, Ming; Xiang, Yun; Yuan, Ruo; Chai, Yaqin

2015-02-15

Based on a new signal amplification strategy by the toehold strand displacement-driven cyclic assembly of G-quadruplex DNA, the development of an enzyme-free and non-label aptamer sensing approach for sensitive fluorescent detection of thrombin is described. The target thrombin associates with the corresponding aptamer of the partial dsDNA probes and liberates single stranded initiation sequences, which trigger the toehold strand displacement assembly of two G-quadruplex containing hairpin DNAs. This toehold strand displacement reaction leads to the cyclic reuse of the initiation sequences and the production of DNA assemblies with numerous G-quadruplex structures. The fluorescent dye, N-Methyl mesoporphyrin IX, binds to these G-quadruplex structures and generates significantly amplified fluorescent signals to achieve highly sensitive detection of thrombin down to 5 pM. Besides, this method shows high selectivity towards the target thrombin against other control proteins. The developed thrombin sensing method herein avoids the modification of the probes and the involvement of any enzyme or nanomaterial labels for signal amplification. With the successful demonstration for thrombin detection, our approach can be easily adopted to monitor other target molecules in a simple, low-cost, sensitive and selective way by choosing appropriate aptamer/ligand pairs. Copyright © 2014 Elsevier B.V. All rights reserved.

Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

Energy Technology Data Exchange (ETDEWEB)

Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

2014-04-25

Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

Allelic Dropout During Polymerase Chain Reaction due to G-Quadruplex Structures and DNA Methylation Is Widespread at Imprinted Human Loci

Directory of Open Access Journals (Sweden)

Aaron J. Stevens

2017-03-01

Full Text Available Loss of one allele during polymerase chain reaction (PCR amplification of DNA, known as allelic dropout, can be caused by a variety of mechanisms. Allelic dropout during PCR may have profound implications for molecular diagnostic and research procedures that depend on PCR and assume biallelic amplification has occurred. Complete allelic dropout due to the combined effects of cytosine methylation and G-quadruplex formation was previously described for a differentially methylated region of the human imprinted gene, MEST. We now demonstrate that this parent-of-origin specific allelic dropout can potentially occur at several other genomic regions that display genomic imprinting and have propensity for G-quadruplex formation, including AIM1, BLCAP, DNMT1, PLAGL1, KCNQ1, and GRB10. These findings demonstrate that systematic allelic dropout during PCR is a general phenomenon for regions of the genome where differential allelic methylation and G-quadruplex motifs coincide, and suggest that great care must be taken to ensure biallelic amplification is occurring in such situations.

Fluorescence enhancement upon G-quadruplex folding: synthesis, structure, and biophysical characterization of a dansyl/cyclodextrin-tagged thrombin binding aptamer.

Science.gov (United States)

De Tito, Stefano; Morvan, François; Meyer, Albert; Vasseur, Jean-Jacques; Cummaro, Annunziata; Petraccone, Luigi; Pagano, Bruno; Novellino, Ettore; Randazzo, Antonio; Giancola, Concetta; Montesarchio, Daniela

2013-11-20

A novel fluorescent thrombin binding aptamer (TBA), conjugated with the environmentally sensitive dansyl probe at the 3'-end and a β-cyclodextrin residue at the 5'-end, has been efficiently synthesized exploiting Cu(I)-catalyzed azide-alkyne cycloaddition procedures. Its conformation and stability in solution have been studied by an integrated approach, combining in-depth NMR, CD, fluorescence, and DSC studies. ITC measurements have allowed us to analyze in detail its interaction with human thrombin. All the collected data show that this bis-conjugated aptamer fully retains its G-quadruplex formation ability and thrombin recognition properties, with the terminal appendages only marginally interfering with the conformational behavior of TBA. Folding of this modified aptamer into the chairlike, antiparallel G-quadruplex structure, promoted by K(+) and/or thrombin binding, typical of TBA, is associated with a net fluorescence enhancement, due to encapsulation of dansyl, attached at the 3'-end, into the apolar cavity of the β-cyclodextrin at the 5'-end. Overall, the structural characterization of this novel, bis-conjugated TBA fully demonstrates its potential as a diagnostic tool for thrombin recognition, also providing a useful basis for the design of suitable aptamer-based devices for theranostic applications, allowing simultaneously both detection and inhibition or modulation of the thrombin activity.

Prospect of bioflavonoid fisetin as a quadruplex DNA ligand: a biophysical approach.

Directory of Open Access Journals (Sweden)

Bidisha Sengupta

Full Text Available Quadruplex (G4 forming sequences in telomeric DNA and c-myc promoter regions of human DNA are associated with tumorogenesis. Ligands that can facilitate or stabilize the formation and increase the stabilization of G4 can prevent tumor cell proliferation and have been regarded as potential anti-cancer drugs. In the present study, steady state and time-resolved fluorescence measurements provide important structural and dynamical insights into the free and bound states of the therapeutically potent plant flavonoid fisetin (3,3',4',7-tetrahydroxyflavone in a G4 DNA matrix. The excited state intra-molecular proton transfer (ESPT of fisetin plays an important role in observing and understanding the binding of fisetin with the G4 DNA. Differential absorption spectra, thermal melting, and circular dichroism spectroscopic studies provide evidences for the formation of G4 DNA and size exclusion chromatography (SEC proves the binding and 1∶1 stoichiometry of fisetin in the DNA matrix. Comparative analysis of binding in the presence of EtBr proves that fisetin favors binding at the face of the G-quartet, mostly along the diagonal loop. Time resolved fluorescence anisotropy decay analysis indicates the increase in the restrictions in motion from the free to bound fisetin. We have also investigated the fingerprints of the binding of fisetin in the antiparallel quadruplex using Raman spectroscopy. Preliminary results indicate fisetin to be a prospective candidate as a G4 ligand.

Prospect of Bioflavonoid Fisetin as a Quadruplex DNA Ligand: A Biophysical Approach

Science.gov (United States)

Sengupta, Bidisha; Pahari, Biswapathik; Blackmon, Laura; Sengupta, Pradeep K.

2013-01-01

Quadruplex (G4) forming sequences in telomeric DNA and c-myc promoter regions of human DNA are associated with tumorogenesis. Ligands that can facilitate or stabilize the formation and increase the stabilization of G4 can prevent tumor cell proliferation and have been regarded as potential anti-cancer drugs. In the present study, steady state and time-resolved fluorescence measurements provide important structural and dynamical insights into the free and bound states of the therapeutically potent plant flavonoid fisetin (3,3′,4′,7-tetrahydroxyflavone) in a G4 DNA matrix. The excited state intra-molecular proton transfer (ESPT) of fisetin plays an important role in observing and understanding the binding of fisetin with the G4 DNA. Differential absorption spectra, thermal melting, and circular dichroism spectroscopic studies provide evidences for the formation of G4 DNA and size exclusion chromatography (SEC) proves the binding and 1∶1 stoichiometry of fisetin in the DNA matrix. Comparative analysis of binding in the presence of EtBr proves that fisetin favors binding at the face of the G-quartet, mostly along the diagonal loop. Time resolved fluorescence anisotropy decay analysis indicates the increase in the restrictions in motion from the free to bound fisetin. We have also investigated the fingerprints of the binding of fisetin in the antiparallel quadruplex using Raman spectroscopy. Preliminary results indicate fisetin to be a prospective candidate as a G4 ligand. PMID:23785423

A light-up probe targeting for Bcl-2 2345 G-quadruplex DNA with carbazole TO

Science.gov (United States)

Gu, Yingchun; Lin, Dayong; Tang, Yalin; Fei, Xuening; Wang, Cuihong; Zhang, Baolian; Zhou, Jianguo

2018-02-01

As its significant role, the selective recognition of G-quadruplex with specific structures and functions is important in biological and medicinal chemistry. Carbazole derivatives have been reported as a kind of fluorescent probe with many excellent optical properties. In the present study, the fluorescence of the dye (carbazole TO) increased almost 70 fold in the presence of bcl-2 2345 G4 compared to that alone in aqueous buffer condition with almost no fluorescence and 10-30 fold than those in the presence of other DNAs. The binding study results by activity inhibition of G4/Hemin peroxidase experiment, NMR titration and molecular docking simulation showed the high affinity and selectivity to bcl-2 2345 G4 arises from its end-stacking interaction with G-quartet. It is said that a facile approach with excellent sensitive, good selectivity and quick response for bcl-2 2345 G-quadruplex was developed and may be used for antitumor recognition or antitumor agents.

Thermal stability of DNA quadruplex-duplex hybrids.

Science.gov (United States)

Lim, Kah Wai; Khong, Zi Jian; Phan, Anh Tuân

2014-01-14

DNA has the capacity to adopt several distinct structural forms, such as duplex and quadruplex helices, which have been implicated in cellular processes and shown to exhibit important functional properties. Quadruplex-duplex hybrids, generated from the juxtaposition of these two structural elements, could find applications in therapeutics and nanotechnology. Here we used NMR and CD spectroscopy to investigate the thermal stability of two classes of quadruplex-duplex hybrids comprising fundamentally distinct modes of duplex and quadruplex connectivity: Construct I involves the coaxial orientation of the duplex and quadruplex helices with continual base stacking across the two components; Construct II involves the orthogonal orientation of the duplex and quadruplex helices with no base stacking between the two components. We have found that for both constructs, the stability of the quadruplex generally increases with the length of the stem-loop incorporated, with respect to quadruplexes comprising nonstructured loops of the same length, which showed a continuous drop in stability with increasing loop length. The stability of these complexes, particularly Construct I, can be substantially influenced by the base-pair steps proximal to the quadruplex-duplex junction. Bulges at the junction are largely detrimental to the adoption of the desired G-quadruplex topology for Construct I but not for Construct II. These findings should facilitate future design and prediction of quadruplex-duplex hybrids.

Unique C. elegans telomeric overhang structures reveal the evolutionarily conserved properties of telomeric DNA

Czech Academy of Sciences Publication Activity Database

Školáková, Petra; Foldynová-Trantírková, Silvie; Bednářová, Klára; Fiala, R.; Vorlíčková, Michaela; Trantírek, L.

2015-01-01

Roč. 43, č. 9 (2015), s. 4733-4745 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GA13-28310S; GA ČR(CZ) GAP205/12/0466 Institutional support: RVO:68081707 ; RVO:60077344 Keywords : NUCLEASE HYPERSENSITIVE ELEMENT * G-QUADRUPLEX STRUCTURES * I-MOTIF Subject RIV: BO - Biophysics Impact factor: 9.202, year: 2015

A label-free luminescent switch-on assay for ATP using a G-quadruplex-selective iridium(III) complex.

Science.gov (United States)

Leung, Ka-Ho; Lu, Lihua; Wang, Modi; Mak, Tsun-Yin; Chan, Daniel Shiu-Hin; Tang, Fung-Kit; Leung, Chung-Hang; Kwan, Hiu-Yee; Yu, Zhiling; Ma, Dik-Lung

2013-01-01

We report herein the G-quadruplex-selective property of a luminescent cyclometallated iridium(III) complex for the detection of adenosine-5'-triphosphate (ATP) in aqueous solution. The ATP-binding aptamer was employed as the ATP recognition unit, while the iridium(III) complex was used to monitor the formation of the G-quadruplex structure induced by ATP. The sensitivity and fold enhancement of the assay were higher than those of the previously reported assay using the organic dye crystal violet as a fluorescent probe. This label-free luminescent switch-on assay exhibits high sensitivity and selectivity towards ATP with a limit of detection of 2.5 µM.

A label-free luminescent switch-on assay for ATP using a G-quadruplex-selective iridium(III complex.

Directory of Open Access Journals (Sweden)

Ka-Ho Leung

Full Text Available We report herein the G-quadruplex-selective property of a luminescent cyclometallated iridium(III complex for the detection of adenosine-5'-triphosphate (ATP in aqueous solution. The ATP-binding aptamer was employed as the ATP recognition unit, while the iridium(III complex was used to monitor the formation of the G-quadruplex structure induced by ATP. The sensitivity and fold enhancement of the assay were higher than those of the previously reported assay using the organic dye crystal violet as a fluorescent probe. This label-free luminescent switch-on assay exhibits high sensitivity and selectivity towards ATP with a limit of detection of 2.5 µM.

Allelic Dropout During Polymerase Chain Reaction due to G-Quadruplex Structures and DNA Methylation Is Widespread at Imprinted Human Loci.

Science.gov (United States)

Stevens, Aaron J; Taylor, Millie G; Pearce, Frederick Grant; Kennedy, Martin A

2017-03-10

Loss of one allele during polymerase chain reaction (PCR) amplification of DNA, known as allelic dropout, can be caused by a variety of mechanisms. Allelic dropout during PCR may have profound implications for molecular diagnostic and research procedures that depend on PCR and assume biallelic amplification has occurred. Complete allelic dropout due to the combined effects of cytosine methylation and G-quadruplex formation was previously described for a differentially methylated region of the human imprinted gene, MEST We now demonstrate that this parent-of-origin specific allelic dropout can potentially occur at several other genomic regions that display genomic imprinting and have propensity for G-quadruplex formation, including AIM1 , BLCAP , DNMT1 , PLAGL1 , KCNQ1 , and GRB10 These findings demonstrate that systematic allelic dropout during PCR is a general phenomenon for regions of the genome where differential allelic methylation and G-quadruplex motifs coincide, and suggest that great care must be taken to ensure biallelic amplification is occurring in such situations. Copyright © 2017 Stevens et al.

DNA Sequences Proximal to Human Mitochondrial DNA Deletion Breakpoints Prevalent in Human Disease Form G-quadruplexes, a Class of DNA Structures Inefficiently Unwound by the Mitochondrial Replicative Twinkle Helicase*

Science.gov (United States)

Bharti, Sanjay Kumar; Sommers, Joshua A.; Zhou, Jun; Kaplan, Daniel L.; Spelbrink, Johannes N.; Mergny, Jean-Louis; Brosh, Robert M.

2014-01-01

Mitochondrial DNA deletions are prominent in human genetic disorders, cancer, and aging. It is thought that stalling of the mitochondrial replication machinery during DNA synthesis is a prominent source of mitochondrial genome instability; however, the precise molecular determinants of defective mitochondrial replication are not well understood. In this work, we performed a computational analysis of the human mitochondrial genome using the “Pattern Finder” G-quadruplex (G4) predictor algorithm to assess whether G4-forming sequences reside in close proximity (within 20 base pairs) to known mitochondrial DNA deletion breakpoints. We then used this information to map G4P sequences with deletions characteristic of representative mitochondrial genetic disorders and also those identified in various cancers and aging. Circular dichroism and UV spectral analysis demonstrated that mitochondrial G-rich sequences near deletion breakpoints prevalent in human disease form G-quadruplex DNA structures. A biochemical analysis of purified recombinant human Twinkle protein (gene product of c10orf2) showed that the mitochondrial replicative helicase inefficiently unwinds well characterized intermolecular and intramolecular G-quadruplex DNA substrates, as well as a unimolecular G4 substrate derived from a mitochondrial sequence that nests a deletion breakpoint described in human renal cell carcinoma. Although G4 has been implicated in the initiation of mitochondrial DNA replication, our current findings suggest that mitochondrial G-quadruplexes are also likely to be a source of instability for the mitochondrial genome by perturbing the normal progression of the mitochondrial replication machinery, including DNA unwinding by Twinkle helicase. PMID:25193669

Simultaneous Binding of Hybrid Molecules Constructed with Dual DNA-Binding Components to a G-Quadruplex and Its Proximal Duplex.

Science.gov (United States)

Asamitsu, Sefan; Obata, Shunsuke; Phan, Anh Tuân; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi

2018-03-20

A G-quadruplex (quadruplex) is a nucleic acid secondary structure adopted by guanine-rich sequences and is considered to be relevant to various pharmacological and biological contexts. Although a number of researchers have endeavored to discover and develop quadruplex-interactive molecules, poor ligand designability originating from topological similarity of the skeleton of diverse quadruplexes has remained a bottleneck for gaining specificity for individual quadruplexes. This work reports on hybrid molecules that were constructed with dual DNA-binding components, a cyclic imidazole/lysine polyamide (cIKP), and a hairpin pyrrole/imidazole polyamide (hPIP), with the aim toward specific quadruplex targeting by reading out the local duplex DNA sequence adjacent to designated quadruplexes in the genome. By means of circular dichroism (CD), fluorescence resonance energy transfer (FRET), surface plasmon resonance (SPR), and NMR techniques, we showed the dual and simultaneous recognition of the respective segment via hybrid molecules, and the synergistic and mutual effect of each binding component that was appropriately linked on higher binding affinity and modest sequence specificity. Monitoring quadruplex and duplex imino protons of the quadruplex/duplex motif titrated with hybrid molecules clearly revealed distinct features of the binding of hybrid molecules to the respective segments upon their simultaneous recognition. A series of the systematic and detailed binding assays described here showed that the concept of simultaneous recognition of quadruplex and its proximal duplex by hybrid molecules constructed with the dual DNA-binding components may provide a new strategy for ligand design, enabling targeting of a large variety of designated quadruplexes at specific genome locations. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Quadruplexes of human telomere DNA

Czech Academy of Sciences Publication Activity Database

Vorlíčková, Michaela; Chládková, Jana; Kejnovská, Iva; Kypr, Jaroslav

2007-01-01

Roč. 24, č. 6 (2007), s. 710 ISSN 0739-1102. [The 15th Conversation . 19.06.2007-23.06.2007, Albany] R&D Projects: GA ČR(CZ) GA204/07/0057; GA AV ČR(CZ) IAA100040701 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : DNA tetraplex * human telomere * CD spectroscopy Subject RIV: BO - Biophysics

Escherichia coli and Neisseria gonorrhoeae UvrD helicase unwinds G4 DNA structures.

Science.gov (United States)

Shukla, Kaustubh; Thakur, Roshan Singh; Ganguli, Debayan; Rao, Desirazu Narasimha; Nagaraju, Ganesh

2017-10-18

G-quadruplex (G4) secondary structures have been implicated in various biological processes, including gene expression, DNA replication and telomere maintenance. However, unresolved G4 structures impede replication progression which can lead to the generation of DNA double-strand breaks and genome instability. Helicases have been shown to resolve G4 structures to facilitate faithful duplication of the genome. Escherichia coli UvrD (EcUvrD) helicase plays a crucial role in nucleotide excision repair, mismatch repair and in the regulation of homologous recombination. Here, we demonstrate a novel role of E. coli and Neisseria gonorrhoeae UvrD in resolving G4 tetraplexes. EcUvrD and N gonorrhoeae UvrD were proficient in unwinding previously characterized tetramolecular G4 structures. Notably, EcUvrD was equally efficient in resolving tetramolecular and bimolecular G4 DNA that were derived from the potential G4-forming sequences from the genome of E. coli Interestingly, in addition to resolving intermolecular G4 structures, EcUvrD was robust in unwinding intramolecular G4 structures. These data for the first time provide evidence for the role of UvrD in the resolution of G4 structures, which has implications for the in vivo role of UvrD helicase in G4 DNA resolution and genome maintenance. © 2017 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

TMPyP4 porphyrin distorts RNA G-quadruplex structures of the disease-associated r(GGGGCC)n repeat of the C9orf72 gene and blocks interaction of RNA-binding proteins.

Science.gov (United States)

Zamiri, Bita; Reddy, Kaalak; Macgregor, Robert B; Pearson, Christopher E

2014-02-21

Certain DNA and RNA sequences can form G-quadruplexes, which can affect genetic instability, promoter activity, RNA splicing, RNA stability, and neurite mRNA localization. Amyotrophic lateral sclerosis and frontotemporal dementia can be caused by expansion of a (GGGGCC)n repeat in the C9orf72 gene. Mutant r(GGGGCC)n- and r(GGCCCC)n-containing transcripts aggregate in nuclear foci, possibly sequestering repeat-binding proteins such as ASF/SF2 and hnRNPA1, suggesting a toxic RNA pathogenesis, as occurs in myotonic dystrophy. Furthermore, the C9orf72 repeat RNA was recently demonstrated to undergo the noncanonical repeat-associated non-AUG translation (RAN translation) into pathologic dipeptide repeats in patient brains, a process that is thought to depend upon RNA structure. We previously demonstrated that the r(GGGGCC)n RNA forms repeat tract length-dependent G-quadruplex structures that bind the ASF/SF2 protein. Here we show that the cationic porphyrin (5,10,15,20-tetra(N-methyl-4-pyridyl) porphyrin (TMPyP4)), which can bind some G-quadruplex-forming sequences, can bind and distort the G-quadruplex formed by r(GGGGCC)8, and this ablates the interaction of either hnRNPA1 or ASF/SF2 with the repeat. These findings provide proof of concept that nucleic acid binding small molecules, such as TMPyP4, can distort the secondary structure of the C9orf72 repeat, which may beneficially disrupt protein interactions, which may ablate either protein sequestration and/or RAN translation into potentially toxic dipeptides. Disruption of secondary structure formation of the C9orf72 RNA repeats may be a viable therapeutic avenue, as well as a means to test the role of RNA structure upon RAN translation.

Designing a New Class of Bases for Nucleic Acid Quadruplexes and Quadruplex-Active Ligands.

Science.gov (United States)

Bazzi, Sophia; Novotný, Jan; Yurenko, Yevgen P; Marek, Radek

2015-06-22

A new class of quadruplex nucleobases, derived from 3-deazaguanine, has been designed for various applications as smart quadruplex ligands as well as quadruplex-based aptamers, receptors, and sensors. An efficient strategy for modifying the guanine quadruplex core has been developed and tested by using quantum chemistry methods. Several potential guanine derivatives modified at the 3- or 8-position or both are analyzed, and the results compared to reference systems containing natural guanine. Analysis of the formation energies (BLYP-D3(BJ)/def2-TZVPP level of theory, in combination with the COSMO model for water) in model systems consisting of two and three stacked tetrads with Na(+) /K(+) ion(s) inside the internal channel indicates that the formation of structures with 3-halo-3-deazaguanine bases leads to a substantial gain in energy, as compared to the corresponding reference guanine complexes. The results cast light on changes in the noncovalent interactions (hydrogen bonding, stacking, and ion coordination) in a quadruplex stem upon modification of the guanine core. In particular, the enhanced stability of the modified quadruplexes was shown to originate mainly from increased π-π stacking. Our study suggests the 3-halo-3-deazaguanine skeleton as a potential building unit for quadruplex systems and smart G-quadruplex ligands. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Tetrasubstituted phenanthrolines as highly potent, water-soluble, and selective g-quadruplex ligands

DEFF Research Database (Denmark)

Larsen, Anders Foller; Nielsen, Mads Corvinius; Ulven, Trond

2012-01-01

Small molecules capable of stabilizing the G-quadruplex (G4) structure are of interest for the development of improved anticancer drugs. Novel 4,7-diamino-substituted 1,10-phenanthroline-2,9-dicarboxamides that represent hybrid structures of known phenanthroline-based ligands have been designed....... An efficient synthetic route to the compounds has been developed and their interactions with various G4 sequences have been evaluated by Förster resonance energy transfer (FRET) melting assays, fluorescent intercalator displacement (FID), electrospray ionization mass spectrometry (ESI-MS), and circular...... dichroism (CD) spectroscopy. The preferred compounds have high aqueous solubility and are strong and potent G4 binders with a high selectivity over duplex DNA; thus, they represent a significant improvement over the lead compounds. Two of the compounds are inhibitors of HeLa and HT1080 cell proliferation....

Amyloid Precursor Protein Translation Is Regulated by a 3'UTR Guanine Quadruplex.

Directory of Open Access Journals (Sweden)

Ezekiel Crenshaw

Full Text Available A central event in Alzheimer's disease is the accumulation of amyloid β (Aβ peptides generated by the proteolytic cleavage of the amyloid precursor protein (APP. APP overexpression leads to increased Aβ generation and Alzheimer's disease in humans and altered neuronal migration and increased long term depression in mice. Conversely, reduction of APP expression results in decreased Aβ levels in mice as well as impaired learning and memory and decreased numbers of dendritic spines. Together these findings indicate that therapeutic interventions that aim to restore APP and Aβ levels must do so within an ideal range. To better understand the effects of modulating APP levels, we explored the mechanisms regulating APP expression focusing on post-transcriptional regulation. Such regulation can be mediated by RNA regulatory elements such as guanine quadruplexes (G-quadruplexes, non-canonical structured RNA motifs that affect RNA stability and translation. Via a bioinformatics approach, we identified a candidate G-quadruplex within the APP mRNA in its 3'UTR (untranslated region at residues 3008-3027 (NM_201414.2. This sequence exhibited characteristics of a parallel G-quadruplex structure as revealed by circular dichroism spectrophotometry. Further, as with other G-quadruplexes, the formation of this structure was dependent on the presence of potassium ions. This G-quadruplex has no apparent role in regulating transcription or mRNA stability as wild type and mutant constructs exhibited equivalent mRNA levels as determined by real time PCR. Instead, we demonstrate that this G-quadruplex negatively regulates APP protein expression using dual luciferase reporter and Western blot analysis. Taken together, our studies reveal post-transcriptional regulation by a 3'UTR G-quadruplex as a novel mechanism regulating APP expression.

G-quadruplex-based structural transitions in 15-mer DNA oligonucleotides varying in lengths of internal oligo(dG) stretches detected by voltammetric techniques

Czech Academy of Sciences Publication Activity Database

Vidláková, Pavlína; Pivoňková, Hana; Kejnovská, Iva; Trnková, L.; Vorlíčková, Michaela; Fojta, Miroslav; Havran, Luděk

2015-01-01

Roč. 407, č. 19 (2015), s. 5817-5826 ISSN 1618-2642 R&D Projects: GA ČR GAP206/12/2378 Institutional support: RVO:68081707 Keywords : Oligonucleotides * Electrochemical methods * G-quadruplex Subject RIV: BO - Biophysics Impact factor: 3.125, year: 2015

c-MYC G-quadruplex binding by the RNA polymerase I inhibitor BMH-21 and analogues revealed by a combined NMR and biochemical Approach.

Science.gov (United States)

Musso, Loana; Mazzini, Stefania; Rossini, Anna; Castagnoli, Lorenzo; Scaglioni, Leonardo; Artali, Roberto; Di Nicola, Massimo; Zunino, Franco; Dallavalle, Sabrina

2018-03-01

Pyridoquinazolinecarboxamides have been reported as RNA polymerase I inhibitors and represent a novel class of potential antitumor agents. BMH-21, was reported to intercalate with GC-rich rDNA, resulting in nucleolar stress as a primary mechanism of cytotoxicity. The interaction of BMH-21 and analogues with DNA G-quadruplex structures was studied by NMR and molecular modelling. The cellular response was investigated in a panel of human tumor cell lines and protein expression was examined by Western Blot analysis. We explored the ability of BMH-21 and its analogue 2 to bind to G-quadruplex present in the c-MYC promoter, by NMR and molecular modelling studies. We provide evidence that both compounds are not typical DNA intercalators but are effective binders of the tested G-quadruplex. The interaction with c-MYC G-quadruplex was reflected in down-regulation of c-Myc expression in human tumor cells. The inhibitory effect was almost complete in lymphoma cells SUDHL4 characterized by overexpression of c-Myc protein. This downregulation reflected an early and persistent modulation of cMyc mRNA. Given the relevance of c-MYC in regulation of ribosome biogenesis, it is conceivable that the inhibition of c-MYC contributes to the perturbation of nuclear functions and RNA polymerase I activity. Similar experiments with CX-5461, another RNA polymerase I transcription inhibitor, indicate the same behaviour in G-quadruplex stabilization. Our results support the hypothesis that BMH-21 and analogue compounds share the same mechanism, i.e. G-quadruplex binding as a primary event of a cascade leading to inhibition of RNA polymerase I and apoptosis. Copyright © 2017 Elsevier B.V. All rights reserved.

Stability of Human Telomere Quadruplexes at High DNA Concentrations

Czech Academy of Sciences Publication Activity Database

Kejnovská, Iva; Vorlíčková, Michaela; Brázdová, Marie; Sagi, J.

2014-01-01

Roč. 101, č. 4 (2014), s. 428-438 ISSN 0006-3525 R&D Projects: GA ČR(CZ) GAP205/12/0466 Institutional support: RVO:68081707 Keywords : quadruplex * DNA concentration * folding topology Subject RIV: BO - Biophysics Impact factor: 2.385, year: 2014

Ball with hair: modular functionalization of highly stable G-quadruplex DNA nano-scaffolds through N2-guanine modification.

Science.gov (United States)

Lech, Christopher Jacques; Phan, Anh Tuân

2017-06-20

Functionalized nanoparticles have seen valuable applications, particularly in the delivery of therapeutic and diagnostic agents in biological systems. However, the manufacturing of such nano-scale systems with the consistency required for biological application can be challenging, as variation in size and shape have large influences in nanoparticle behavior in vivo. We report on the development of a versatile nano-scaffold based on the modular functionalization of a DNA G-quadruplex. DNA sequences are functionalized in a modular fashion using well-established phosphoramidite chemical synthesis with nucleotides containing modification of the amino (N2) position of the guanine base. In physiological conditions, these sequences fold into well-defined G-quadruplex structures. The resulting DNA nano-scaffolds are thermally stable, consistent in size, and functionalized in a manner that allows for control over the density and relative orientation of functional chemistries on the nano-scaffold surface. Various chemistries including small modifications (N2-methyl-guanine), bulky aromatic modifications (N2-benzyl-guanine), and long chain-like modifications (N2-6-amino-hexyl-guanine) are tested and are found to be generally compatible with G-quadruplex formation. Furthermore, these modifications stabilize the G-quadruplex scaffold by 2.0-13.3 °C per modification in the melting temperature, with concurrent modifications producing extremely stable nano-scaffolds. We demonstrate the potential of this approach by functionalizing nano-scaffolds for use within the biotin-avidin conjugation approach. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Triplex intermediates in folding of human telomeric quadruplexes probed by microsecond-scale molecular dynamics simulations

Czech Academy of Sciences Publication Activity Database

Stadlbauer, Petr; Trantírek, L.; Cheatham III, T. E.; Koča, J.; Šponer, Jiří

105C, OCT2014 (2014), s. 22-35 ISSN 0300-9084 R&D Projects: GA ČR(CZ) GAP208/12/1822; GA ČR(CZ) GA13-28310S Institutional support: RVO:68081707 Keywords : G-DNA folding * Quadruplex * Triplex Subject RIV: BO - Biophysics Impact factor: 2.963, year: 2014

G-quadruplex DNA sequences are evolutionarily conserved and associated with distinct genomic features in Saccharomyces cerevisiae.

Directory of Open Access Journals (Sweden)

John A Capra

2010-07-01

Full Text Available G-quadruplex DNA is a four-stranded DNA structure formed by non-Watson-Crick base pairing between stacked sets of four guanines. Many possible functions have been proposed for this structure, but its in vivo role in the cell is still largely unresolved. We carried out a genome-wide survey of the evolutionary conservation of regions with the potential to form G-quadruplex DNA structures (G4 DNA motifs across seven yeast species. We found that G4 DNA motifs were significantly more conserved than expected by chance, and the nucleotide-level conservation patterns suggested that the motif conservation was the result of the formation of G4 DNA structures. We characterized the association of conserved and non-conserved G4 DNA motifs in Saccharomyces cerevisiae with more than 40 known genome features and gene classes. Our comprehensive, integrated evolutionary and functional analysis confirmed the previously observed associations of G4 DNA motifs with promoter regions and the rDNA, and it identified several previously unrecognized associations of G4 DNA motifs with genomic features, such as mitotic and meiotic double-strand break sites (DSBs. Conserved G4 DNA motifs maintained strong associations with promoters and the rDNA, but not with DSBs. We also performed the first analysis of G4 DNA motifs in the mitochondria, and surprisingly found a tenfold higher concentration of the motifs in the AT-rich yeast mitochondrial DNA than in nuclear DNA. The evolutionary conservation of the G4 DNA motif and its association with specific genome features supports the hypothesis that G4 DNA has in vivo functions that are under evolutionary constraint.

Nucleotide Pool Depletion Induces G-Quadruplex-Dependent Perturbation of Gene Expression

Directory of Open Access Journals (Sweden)

Charikleia Papadopoulou

2015-12-01

Full Text Available Nucleotide pool imbalance has been proposed to drive genetic instability in cancer. Here, we show that slowing replication forks by depleting nucleotide pools with hydroxyurea (HU can also give rise to both transient and permanent epigenetic instability of a reporter locus, BU-1, in DT40 cells. HU induces stochastic formation of Bu-1low variants in dividing cells, which have lost the H3K4me3 present in untreated cells. This instability is potentiated by an intragenic G quadruplex, which also promotes local H2Ax phosphorylation and transient heterochromatinization. Genome-wide, gene expression changes induced by HU significantly overlap with those resulting from loss of the G4-helicases FANCJ, WRN, and BLM. Thus, the effects of global replication stress induced by nucleotide pool depletion can be focused by local replication impediments caused by G quadruplex formation to induce epigenetic instability and changes in gene expression, a mechanism that may contribute to selectable transcriptional changes in cancer.

Sites of instability in the human TCF3 (E2A) gene adopt G-quadruplex DNA structures in vitro

Science.gov (United States)

Williams, Jonathan D.; Fleetwood, Sara; Berroyer, Alexandra; Kim, Nayun; Larson, Erik D.

2015-01-01

The formation of highly stable four-stranded DNA, called G-quadruplex (G4), promotes site-specific genome instability. G4 DNA structures fold from repetitive guanine sequences, and increasing experimental evidence connects G4 sequence motifs with specific gene rearrangements. The human transcription factor 3 (TCF3) gene (also termed E2A) is subject to genetic instability associated with severe disease, most notably a common translocation event t(1;19) associated with acute lymphoblastic leukemia. The sites of instability in TCF3 are not randomly distributed, but focused to certain sequences. We asked if G4 DNA formation could explain why TCF3 is prone to recombination and mutagenesis. Here we demonstrate that sequences surrounding the major t(1;19) break site and a region associated with copy number variations both contain G4 sequence motifs. The motifs identified readily adopt G4 DNA structures that are stable enough to interfere with DNA synthesis in physiological salt conditions in vitro. When introduced into the yeast genome, TCF3 G4 motifs promoted gross chromosomal rearrangements in a transcription-dependent manner. Our results provide a molecular rationale for the site-specific instability of human TCF3, suggesting that G4 DNA structures contribute to oncogenic DNA breaks and recombination. PMID:26029241

Separation of the potential G-quadruplex ligands from the butanol extract of Zanthoxylum ailanthoides Sieb. & Zucc. by countercurrent chromatography and preparative high performance liquid chromatography.

Science.gov (United States)

Han, Tian; Cao, Xueli; Xu, Jing; Pei, Hairun; Zhang, Hong; Tang, Yalin

2017-07-21

G-quadruplex DNA structure is considered to be a very attractive target for antitumor drug design due to its unique role in maintaining telomerase activities. Therefore, discovering ligands with high stability of G-quadruplex structure is of great interest. In this paper, pH-zone refining counter current chromatography (CCC) and preparative high performance liquid chromatography (HPLC) were employed for the separation of potent G-quadruplex ligands from the n-butanol fraction of the crude extract of Zanthoxylum ailanthoides, which is a traditional Chinese medicine recently found to display high inhibitory activity against several human cancer cells. The 75% aqueous ethanol extract of the stem bark of Z. ailanthoides and its fractions with petroleum ether, ethyl acetate and n-butanol displayed almost the same G-quadruplex stabilization ability. Here, pH-zone refining CCC was used for the separation of the alkaloids from the n-butanol fraction by a seldom used solvent system composed of dichloromethane-methanol-water (4:1:2.5) with 10mM TEA in the organic stationary phase as retainer and 10mM HCl in the aqueous mobile phase as eluter. Compounds I, II and III were obtained, with purity greater than 95%, in the quantities of 31.2, 94.0, and 26.4mg respectively from 300mg of lipophilic fraction within 80min, which were identified as three tetrahydroprotoberberines isolated for the first time in this plant. In addition, a phenylpropanoid glycoside compound IV (Syringin), an isoquinoline (Magnoflorine, V), and two lignin isomers (+)-lyoniresiol-3α-O-β-d-glucopyranoside (VI) and (-)-lyoniresinol -3α-O-β-D -glucopyranoside (VII) were isolated by traditional CCC together with preparative HPLC. Compounds IV, V, VI and VII were obtained, with purity greater than 95%, in the quantities of 4.0, 13.2, 6.7, and 6.5mg respectively from 960mg of hydrophilic fraction. Among the seven isolated compounds, tetrahydroprotoberberine I, II and III were found to display remarkable

Surface Plasmon Resonance kinetic analysis of the interaction between G-quadruplex nucleic acids and an anti-G-quadruplex monoclonal antibody.

Science.gov (United States)

Lago, Sara; Nadai, Matteo; Rossetto, Monica; Richter, Sara N

2018-06-01

G-quadruplexes (G4s) are nucleic acids secondary structures formed in guanine-rich sequences. Anti-G4 antibodies represent a tool for the direct investigation of G4s in cells. Surface Plasmon Resonance (SPR) is a highly sensitive technology, suitable for assessing the affinity between biomolecules. We here aimed at improving the orientation of an anti-G4 antibody on the SPR sensor chip to optimize detection of binding antigens. SPR was employed to characterize the anti-G4 antibody interaction with G4 and non-G4 oligonucleotides. Dextran-functionalized sensor chips were used both in covalent coupling and capturing procedures. The use of two leading molecule for orienting the antibody of interest allowed to improve its activity from completely non-functional to 65% active. The specificity of the anti-G4 antobody for G4 structures could thus be assessed with high sensitivity and reliability. Optimization of the immobilization protocol for SPR biosensing, allowed us to determine the anti-G4 antibody affinity and specificity for G4 antigens with higher sensitivity with respect to other in vitro assays such as ELISA. Anti-G4 antibody specificity is a fundamental assumption for the future utilization of this kind of antibodies for monitoring G4s directly in cells. The heterogeneous orientation of amine-coupling immobilized ligands is a general problem that often leads to partial or complete inactivation of the molecules. Here we describe a new strategy for improving ligand orientation: driving it from two sides. This principle can be virtually applied to every molecule that loses its activity or is poorly immobilized after standard coupling to the SPR chip surface. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

Oligomer formation and G-quadruplex binding by purified murine Rif1 protein, a key organizer of higher-order chromatin architecture.

Science.gov (United States)

Moriyama, Kenji; Yoshizawa-Sugata, Naoko; Masai, Hisao

2018-03-09

Rap1-interacting protein 1 (Rif1) regulates telomere length in budding yeast. We previously reported that, in metazoans and fission yeast, Rif1 also plays pivotal roles in controlling genome-wide DNA replication timing. We proposed that Rif1 may assemble chromatin compartments that contain specific replication-timing domains by promoting chromatin loop formation. Rif1 also is involved in DNA lesion repair, restart after replication fork collapse, anti-apoptosis activities, replicative senescence, and transcriptional regulation. Although multiple physiological functions of Rif1 have been characterized, biochemical and structural information on mammalian Rif1 is limited, mainly because of difficulties in purifying the full-length protein. Here, we expressed and purified the 2418-amino-acid-long, full-length murine Rif1 as well as its partially truncated variants in human 293T cells. Hydrodynamic analyses indicated that Rif1 forms elongated or extended homo-oligomers in solution, consistent with the presence of a HEAT-type helical repeat segment known to adopt an elongated shape. We also observed that the purified murine Rif1 bound G-quadruplex (G4) DNA with high specificity and affinity, as was previously shown for Rif1 from fission yeast. Both the N-terminal (HEAT-repeat) and C-terminal segments were involved in oligomer formation and specifically bound G4 DNA, and the central intrinsically disordered polypeptide segment increased the affinity for G4. Of note, pulldown assays revealed that Rif1 simultaneously binds multiple G4 molecules. Our findings support a model in which Rif1 modulates chromatin loop structures through binding to multiple G4 assemblies and by holding chromatin fibers together. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

Nonlinear optical and G-Quadruplex DNA stabilization properties of novel mixed ligand copper(II) complexes and coordination polymers: Synthesis, structural characterization and computational studies

Science.gov (United States)

Rajasekhar, Bathula; Bodavarapu, Navya; Sridevi, M.; Thamizhselvi, G.; RizhaNazar, K.; Padmanaban, R.; Swu, Toka

2018-03-01

The present study reports the synthesis and evaluation of nonlinear optical property and G-Quadruplex DNA Stabilization of five novel copper(II) mixed ligand complexes. They were synthesized from copper(II) salt, 2,5- and 2,3- pyridinedicarboxylic acid, diethylenetriamine and amide based ligand (AL). The crystal structure of these complexes were determined through X-ray diffraction and supported by ESI-MAS, NMR, UV-Vis and FT-IR spectroscopic methods. Their nonlinear optical property was studied using Gaussian09 computer program. For structural optimization and nonlinear optical property, density functional theory (DFT) based B3LYP method was used with LANL2DZ basis set for metal ion and 6-31G∗ for C,H,N,O and Cl atoms. The present work reveals that pre-polarized Complex-2 showed higher β value (29.59 × 10-30e.s.u) as compared to that of neutral complex-1 (β = 0.276 × 10-30e.s.u.) which may be due to greater advantage of polarizability. Complex-2 is expected to be a potential material for optoelectronic and photonic technologies. Docking studies using AutodockVina revealed that complex-2 has higher binding energy for both G-Quadruplex DNA (-8.7 kcal/mol) and duplex DNA (-10.1 kcal/mol). It was also observed that structure plays an important role in binding efficiency.

Identifying the impact of G-quadruplexes on Affymetrix 3' arrays using cloud computing.

Science.gov (United States)

Memon, Farhat N; Owen, Anne M; Sanchez-Graillet, Olivia; Upton, Graham J G; Harrison, Andrew P

2010-01-15

A tetramer quadruplex structure is formed by four parallel strands of DNA/ RNA containing runs of guanine. These quadruplexes are able to form because guanine can Hoogsteen hydrogen bond to other guanines, and a tetrad of guanines can form a stable arrangement. Recently we have discovered that probes on Affymetrix GeneChips that contain runs of guanine do not measure gene expression reliably. We associate this finding with the likelihood that quadruplexes are forming on the surface of GeneChips. In order to cope with the rapidly expanding size of GeneChip array datasets in the public domain, we are exploring the use of cloud computing to replicate our experiments on 3' arrays to look at the effect of the location of G-spots (runs of guanines). Cloud computing is a recently introduced high-performance solution that takes advantage of the computational infrastructure of large organisations such as Amazon and Google. We expect that cloud computing will become widely adopted because it enables bioinformaticians to avoid capital expenditure on expensive computing resources and to only pay a cloud computing provider for what is used. Moreover, as well as financial efficiency, cloud computing is an ecologically-friendly technology, it enables efficient data-sharing and we expect it to be faster for development purposes. Here we propose the advantageous use of cloud computing to perform a large data-mining analysis of public domain 3' arrays.

Long-range charge transport in single G-quadruplex DNA molecules

DEFF Research Database (Denmark)

Livshits, Gideon I.; Stern, Avigail; Rotem, Dvir

2014-01-01

DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set-ups, and transport......DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set......-ups, and transporting significant current through individual DNA-based molecules remains a considerable challenge. Here, we report reproducible charge transport in guanine-quadruplex (G4) DNA molecules adsorbed on a mica substrate. Currents ranging from tens of picoamperes to more than 100 pA were measured in the G4......-DNA over distances ranging from tens of nanometres to more than 100 nm. Our experimental results, combined with theoretical modelling, suggest that transport occurs via a thermally activated long-range hopping between multi-tetrad segments of DNA. These results could re-ignite interest in DNA...

Low-Energy Electron-Induced Strand Breaks in Telomere-Derived DNA Sequences-Influence of DNA Sequence and Topology.

Science.gov (United States)

Rackwitz, Jenny; Bald, Ilko

2018-03-26

During cancer radiation therapy high-energy radiation is used to reduce tumour tissue. The irradiation produces a shower of secondary low-energy (DNA very efficiently by dissociative electron attachment. Recently, it was suggested that low-energy electron-induced DNA strand breaks strongly depend on the specific DNA sequence with a high sensitivity of G-rich sequences. Here, we use DNA origami platforms to expose G-rich telomere sequences to low-energy (8.8 eV) electrons to determine absolute cross sections for strand breakage and to study the influence of sequence modifications and topology of telomeric DNA on the strand breakage. We find that the telomeric DNA 5'-(TTA GGG) 2 is more sensitive to low-energy electrons than an intermixed sequence 5'-(TGT GTG A) 2 confirming the unique electronic properties resulting from G-stacking. With increasing length of the oligonucleotide (i.e., going from 5'-(GGG ATT) 2 to 5'-(GGG ATT) 4 ), both the variety of topology and the electron-induced strand break cross sections increase. Addition of K + ions decreases the strand break cross section for all sequences that are able to fold G-quadruplexes or G-intermediates, whereas the strand break cross section for the intermixed sequence remains unchanged. These results indicate that telomeric DNA is rather sensitive towards low-energy electron-induced strand breakage suggesting significant telomere shortening that can also occur during cancer radiation therapy. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Human telomeric G-quadruplex formation and highly selective fluorescence detection of toxic strontium ions.

Science.gov (United States)

Qu, Konggang; Zhao, Chuanqi; Ren, Jinsong; Qu, Xiaogang

2012-03-01

Strontium ions play important roles in biological systems. The inhalation of strontium can cause severe respiratory difficulties, anaphylactic reaction and extreme tachycardia. Strontium can replace calcium in organisms, inhibit normal calcium absorption and induce strontium "rickets" in childhood. Thus, the development of sensitive and selective methods for the determination of trace amounts of Sr(2+) in aqueous media is of considerable importance for environmental and human health protection. A number of methodologies, such as X-ray energy dispersive spectrometry, inductively coupled argon plasma atomic emission spectroscopy (ICP-AES), atomic absorption spectrometry (AAS) and instrumental thermal neutron activation analysis, have been reported. However, these methods are somewhat complex, costly, time consuming and, especially, need special instruments. Thus, the design of convenient and inexpensive approaches for the sensitive and selective detection of Sr(2+) with rapid, easy manipulation is in ever-increasing demand. To the best of our knowledge, using DNA conformational change to detect Sr(2+) has not yet been reported. Herein we utilized thiazole orange (TO) as a signal reporter to devise a simple Sr(2+) detection assay based on Sr(2+) induced human telomeric DNA conformational change in the presence of SWNTs. The limit of detection is 10 nM Sr(2+) (0.87 μg L(-1)), far below 4 mg L(-1), the U.S. Federal threshold in drinking water defined by the U.S. EPA.

Genome-wide Control of Heterochromatin Replication by the Telomere Capping Protein TRF2.

Science.gov (United States)

Mendez-Bermudez, Aaron; Lototska, Liudmyla; Bauwens, Serge; Giraud-Panis, Marie-Josèphe; Croce, Olivier; Jamet, Karine; Irizar, Agurtzane; Mowinckel, Macarena; Koundrioukoff, Stephane; Nottet, Nicolas; Almouzni, Genevieve; Teulade-Fichou, Mare-Paule; Schertzer, Michael; Perderiset, Mylène; Londoño-Vallejo, Arturo; Debatisse, Michelle; Gilson, Eric; Ye, Jing

2018-05-03

Hard-to-replicate regions of chromosomes (e.g., pericentromeres, centromeres, and telomeres) impede replication fork progression, eventually leading, in the event of replication stress, to chromosome fragility, aging, and cancer. Our knowledge of the mechanisms controlling the stability of these regions is essentially limited to telomeres, where fragility is counteracted by the shelterin proteins. Here we show that the shelterin subunit TRF2 ensures progression of the replication fork through pericentromeric heterochromatin, but not centromeric chromatin. In a process involving its N-terminal basic domain, TRF2 binds to pericentromeric Satellite III sequences during S phase, allowing the recruitment of the G-quadruplex-resolving helicase RTEL1 to facilitate fork progression. We also show that TRF2 is required for the stability of other heterochromatic regions localized throughout the genome, paving the way for future research on heterochromatic replication and its relationship with aging and cancer. Copyright © 2018 Elsevier Inc. All rights reserved.

Colorimetric detection of genetically modified organisms based on exonuclease III-assisted target recycling and hemin/G-quadruplex DNAzyme amplification.

Science.gov (United States)

Zhang, Decai; Wang, Weijia; Dong, Qian; Huang, Yunxiu; Wen, Dongmei; Mu, Yuejing; Yuan, Yong

2017-12-21

An isothermal colorimetric method is described for amplified detection of the CaMV 35S promoter sequence in genetically modified organism (GMO). It is based on (a) target DNA-triggered unlabeled molecular beacon (UMB) termini binding, and (b) exonuclease III (Exo III)-assisted target recycling, and (c) hemin/G-quadruplex (DNAzyme) based signal amplification. The specific binding of target to the G-quadruplex sequence-locked UMB triggers the digestion of Exo III. This, in turn, releases an active G-quadruplex segment and target DNA for successive hybridization and cleavage. The Exo III impellent recycling of targets produces numerous G-quadruplex sequences. These further associate with hemin to form DNAzymes and hence will catalyze H 2 O 2 -mediated oxidation of the chromogenic enzyme substrate ABTS 2- causing the formation of a green colored product. This finding enables a sensitive colorimetric determination of GMO DNA (at an analytical wavelength of 420 nm) at concentrations as low as 0.23 nM. By taking advantage of isothermal incubation, this method does not require sophisticated equipment or complicated syntheses. Analyses can be performed within 90 min. The method also discriminates single base mismatches. In our perception, it has a wide scope in that it may be applied to the detection of many other GMOs. Graphical abstract An isothermal and sensitive colorimetric method is described for amplified detection of CaMV 35S promoter sequence in genetically modified organism (GMO). It is based on target DNA-triggered molecular beacon (UMB) termini-binding and exonuclease III assisted target recycling, and on hemin/G-quadruplex (DNAzyme) signal amplification.

Porous platinum nanotubes labeled with hemin/G-quadruplex based electrochemical aptasensor for sensitive thrombin analysis via the cascade signal amplification.

Science.gov (United States)

Sun, Aili; Qi, Qingan; Wang, Xuannian; Bie, Ping

2014-07-15

For the first time, a sensitive electrochemical aptasensor for thrombin (TB) was developed by using porous platinum nanotubes (PtNTs) labeled with hemin/G-quadruplex and glucose dehydrogenase (GDH) as labels. Porous PtNTs with large surface area exhibited the peroxidase-like activity. Coupling with GDH and hemin/G-quadruplex as NADH oxidase and HRP-mimicking DNAzyme, the cascade signal amplification was achieved by the following ways: in the presence of glucose and NAD(+) in the working buffer, GDH electrocatalyzed the oxidation of glucose with the production of NADH. Then, hemin/G-quadruplex as NADH oxidase catalyzed the oxidation of NADH to in situ generate H2O2. Based on the corporate electrocatalysis of PtNTs and hemin/G-quadruplex toward H2O2, the electrochemical signal was significantly amplified, allowing the detection limit of TB down to 0.15 pM level. Moreover, the proposed strategy was simple because the intercalated hemin offered the readout signal, avoiding the adding of additional redox mediator as signal donator. Such an electrochemical aptasensor is highly promising for sensitive detection of other proteins in clinical diagnostics. Copyright © 2014 Elsevier B.V. All rights reserved.

Enantioselective light switch effect of Δ- and Λ-[Ru(phenanthroline)2 dipyrido[3,2-a:2', 3'-c]phenazine]2+ bound to G-quadruplex DNA.

Science.gov (United States)

Park, Jin Ha; Lee, Hyun Suk; Jang, Myung Duk; Han, Sung Wook; Kim, Seog K; Lee, Young-Ae

2018-06-01

The interaction of Δ- and Λ-[Ru(phen) 2 DPPZ] 2+ (DPPZ = dipyrido[3,2-a:2', 3'-c]phenazine, phen = phenanthroline) with a G-quadruplex formed from 5'-G 2 T 2 G 2 TGTG 2 T 2 G 2-3 '(15-mer) was investigated. The well-known enhancement of luminescence intensity (the 'light-switch' effect) was observed for the [Ru(phen) 2 DPPZ] 2+ complexes upon formation of an adduct with the G-quadruplex. The emission intensity of the G-quadruplex-bound Λ-isomer was 3-fold larger than that of the Δ-isomer when bound to the G-quadruplex, which is opposite of the result observed in the case of double stranded DNA (dsDNA); the light switch effect is larger for the dsDNA-bound Δ-isomer. In the job plot of the G-quadruplex with Δ- and Λ-[Ru(phen) 2 DPPZ] 2+ , a major inflection point for the two isomers was observed at x ≈ .65, which suggests a binding stoichiometry of 2:1 for both enantiomers. When the G base at the 8th position was replaced with 6-methyl isoxanthopterin (6MI), a fluorescent guanine analog, the excited energy of 6-MI transferred to bound Δ- or Λ-[Ru(phen) 2 DPPZ] 2+ , which suggests that at least a part of both Ru(II) enantiomers is close to or in contact with the diagonal loop of the G-quadruplex. A luminescence quenching experiment using [Fe(CN) 6 ] 4- for the G-quadruplex-bound Ru(II) complex revealed downward bending curves for both enantiomers in the Stern-Volmer plot, which suggests the presence of Ru(II) complexes that are both accessible and inaccessible to the quencher and may be related to the 2:1 binding stoichiometry.

G-quadruplex recognition activities of E. Coli MutS

Directory of Open Access Journals (Sweden)

Ehrat Edward A

2012-07-01

Full Text Available Abstract Background Guanine quadruplex (G4 DNA is a four-stranded structure that contributes to genome instability and site-specific recombination. G4 DNA folds from sequences containing tandemly repetitive guanines, sequence motifs that are found throughout prokaryote and eukaryote genomes. While some cellular activities have been identified with binding or processing G4 DNA, the factors and pathways governing G4 DNA metabolism are largely undefined. Highly conserved mismatch repair factors have emerged as potential G4-responding complexes because, in addition to initiating heteroduplex correction, the human homologs bind non-B form DNA with high affinity. Moreover, the MutS homologs across species have the capacity to recognize a diverse range of DNA pairing variations and damage, suggesting a conserved ability to bind non-B form DNA. Results Here, we asked if E. coli MutS and a heteroduplex recognition mutant, MutS F36A, were capable of recognizing and responding to G4 DNA structures. We find by mobility shift assay that E. coli MutS binds to G4 DNA with high affinity better than binding to G-T heteroduplexes. In the same assay, MutS F36A failed to recognize G-T mismatched oligonucleotides, as expected, but retained an ability to bind to G4 DNA. Association with G4 DNA by MutS is not likely to activate the mismatch repair pathway because nucleotide binding did not promote release of MutS or MutS F36A from G4 DNA as it does for heteroduplexes. G4 recognition activities occur under physiological conditions, and we find that M13 phage harboring G4-capable DNA poorly infected a MutS deficient strain of E. coli compared to M13mp18, suggesting functional roles for mismatch repair factors in the cellular response to unstable genomic elements. Conclusions Taken together, our findings demonstrate that E. coli MutS has a binding activity specific for non-B form G4 DNA, but such binding appears independent of canonical heteroduplex repair activation.

A label-free ultrasensitive fluorescence detection of viable Salmonella enteritidis using enzyme-induced cascade two-stage toehold strand-displacement-driven assembly of G-quadruplex DNA.

Science.gov (United States)

Zhang, Peng; Liu, Hui; Ma, Suzhen; Men, Shuai; Li, Qingzhou; Yang, Xin; Wang, Hongning; Zhang, Anyun

2016-06-15

The harm of Salmonella enteritidis (S. enteritidis ) to public health mainly by contaminating fresh food and water emphasizes the urgent need for rapid detection techniques to help control the spread of the pathogen. In this assay, an newly designed capture probe complex that contained specific S. enteritidis-aptamer and hybridized signal target sequence was used for viable S. enteritidis recognition directly. In the presence of the target S. enteritidis, single-stranded target sequences were liberated and initiated the replication-cleavage reaction, producing numerous G-quadruplex structures with a linker on the 3'-end. And then, the sensing system took innovative advantage of quadratic linker-induced strand-displacement for the first time to release target sequence in succession, leading to the cyclic reuse of the target sequences and cascade signal amplification, thereby achieving the successive production of G-quadruplex structures. The fluorescent dye, N-Methyl mesoporphyrin IX, binded to these G-quadruplex structures and generated significantly enhanced fluorescent signals to achieve highly sensitive detection of S. enteritidis down to 60 CFU/mL with a linear range from 10(2) to 10(7)CFU/mL. By coupling the cascade two-stage target sequences-recyclable toehold strand-displacement with aptamer-based target recognition successfully, it is the first report on a novel non-label, modification-free and DNA extraction-free ultrasensitive fluorescence biosensor for detecting viable S. enteritidis directly, which can discriminate from dead S. enteritidis. Copyright © 2016 Elsevier B.V. All rights reserved.

Enhanced anti-HIV-1 activity of G-quadruplexes comprising locked nucleic acids and intercalating nucleic acids

DEFF Research Database (Denmark)

Pedersen, Erik Bjerregaard; Nielsen, Jakob Toudahl; Nielsen, Claus

2011-01-01

Two G-quadruplex forming sequences, 50-TGGGAG and the 17-mer sequence T30177, which exhibit anti-HIV-1 activity on cell lines, were modified using either locked nucleic acids (LNA) or via insertions of (R)-1-O-(pyren-1-ylmethyl)glycerol (intercalating nucleic acid, INA) or (R)-1-O-[4-(1......-pyrenylethynyl)phenylmethyl]glycerol (twisted intercalating nucleic acid, TINA). Incorporation of LNA or INA/TINA monomers provide as much as 8-fold improvement of anti-HIV-1 activity. We demonstrate for the first time a detailed analysis of the effect the incorporation of INA/TINA monomers in quadruplex forming...

The role of alkali metal cations in the stabilization of guanine quadruplexes: why K(+) is the best.

Science.gov (United States)

Zaccaria, F; Paragi, G; Fonseca Guerra, C

2016-08-21

The alkali metal ion affinity of guanine quadruplexes has been studied using dispersion-corrected density functional theory (DFT-D). We have done computational investigations in aqueous solution that mimics artificial supramolecular conditions where guanine bases assemble into stacked quartets as well as biological environments in which telomeric quadruplexes are formed. In both cases, an alkali metal cation is needed to assist self-assembly. Our quantum chemical computations on these supramolecular systems are able to reproduce the experimental order of affinity of the guanine quadruplexes for the cations Li(+), Na(+), K(+), Rb(+), and Cs(+). The strongest binding is computed between the potassium cation and the quadruplex as it occurs in nature. The desolvation and the size of alkali metal cations are thought to be responsible for the order of affinity. Until now, the relative importance of these two factors has remained unclear and debated. By assessing the quantum chemical 'size' of the cation, determining the amount of deformation of the quadruplex needed to accommodate the cation and through the energy decomposition analysis (EDA) of the interaction energy between the cation and the guanines, we reveal that the desolvation and size of the alkali metal cation are both almost equally responsible for the order of affinity.

Computational Analysis of G-Quadruplex Forming Sequences across Chromosomes Reveals High Density Patterns Near the Terminal Ends.

Directory of Open Access Journals (Sweden)

Julia H Chariker

Full Text Available G-quadruplex structures (G4 are found throughout the human genome and are known to play a regulatory role in a variety of molecular processes. Structurally, they have many configurations and can form from one or more DNA strands. At the gene level, they regulate gene expression and protein synthesis. In this paper, chromosomal-level patterns of distribution are analyzed on the human genome to identify high-level distribution patterns potentially related to global functional processes. Here we show unique high density banding patterns on individual chromosomes that are highly correlated, appearing in a mirror pattern, across forward and reverse DNA strands. The highest density of G4 sequences occurs within four megabases of one end of most chromosomes and contains G4 motifs that bind with zinc finger proteins. These findings suggest that G4 may play a role in global chromosomal processes such as those found in meiosis.

Label-Free and Ultrasensitive Biomolecule Detection Based on Aggregation Induced Emission Fluorogen via Target-Triggered Hemin/G-Quadruplex-Catalyzed Oxidation Reaction.

Science.gov (United States)

Li, Haiyin; Chang, Jiafu; Gai, Panpan; Li, Feng

2018-02-07

Fluorescence biosensing strategy has drawn substantial attention due to their advantages of simplicity, convenience, sensitivity, and selectivity, but unsatisfactory structure stability, low fluorescence quantum yield, high cost of labeling, and strict reaction conditions associated with current fluorescence methods severely prohibit their potential application. To address these challenges, we herein propose an ultrasensitive label-free fluorescence biosensor by integrating hemin/G-quadruplex-catalyzed oxidation reaction with aggregation induced emission (AIE) fluorogen-based system. l-Cysteine/TPE-M, which is carefully and elaborately designed and developed, obviously contributes to strong fluorescence emission. In the presence of G-rich DNA along with K + and hemin, efficient destruction of l-cysteine occurs due to hemin/G-quadruplex-catalyzed oxidation reactions. As a result, highly sensitive fluorescence detection of G-rich DNA is readily realized, with a detection limit down to 33 pM. As a validation for the further development of the proposed strategy, we also successfully construct ultrasensitive platforms for microRNA by incorporating the l-cysteine/TPE-M system with target-triggered cyclic amplification reaction. Thus, this proposed strategy is anticipated to find use in basic biochemical research and clinical diagnosis.

G-quadruplex and G-rich sequence stimulate Pif1p-catalyzed downstream duplex DNA unwinding through reducing waiting time at ss/dsDNA junction

Science.gov (United States)

Zhang, Bo; Wu, Wen-Qiang; Liu, Na-Nv; Duan, Xiao-Lei; Li, Ming; Dou, Shuo-Xing; Hou, Xi-Miao; Xi, Xu-Guang

2016-01-01

Alternative DNA structures that deviate from B-form double-stranded DNA such as G-quadruplex (G4) DNA can be formed by G-rich sequences that are widely distributed throughout the human genome. We have previously shown that Pif1p not only unfolds G4, but also unwinds the downstream duplex DNA in a G4-stimulated manner. In the present study, we further characterized the G4-stimulated duplex DNA unwinding phenomenon by means of single-molecule fluorescence resonance energy transfer. It was found that Pif1p did not unwind the partial duplex DNA immediately after unfolding the upstream G4 structure, but rather, it would dwell at the ss/dsDNA junction with a ‘waiting time’. Further studies revealed that the waiting time was in fact related to a protein dimerization process that was sensitive to ssDNA sequence and would become rapid if the sequence is G-rich. Furthermore, we identified that the G-rich sequence, as the G4 structure, equally stimulates duplex DNA unwinding. The present work sheds new light on the molecular mechanism by which G4-unwinding helicase Pif1p resolves physiological G4/duplex DNA structures in cells. PMID:27471032

The SARS-unique domain (SUD of SARS coronavirus contains two macrodomains that bind G-quadruplexes.

Directory of Open Access Journals (Sweden)

Jinzhi Tan

2009-05-01

Full Text Available Since the outbreak of severe acute respiratory syndrome (SARS in 2003, the three-dimensional structures of several of the replicase/transcriptase components of SARS coronavirus (SARS-CoV, the non-structural proteins (Nsps, have been determined. However, within the large Nsp3 (1922 amino-acid residues, the structure and function of the so-called SARS-unique domain (SUD have remained elusive. SUD occurs only in SARS-CoV and the highly related viruses found in certain bats, but is absent from all other coronaviruses. Therefore, it has been speculated that it may be involved in the extreme pathogenicity of SARS-CoV, compared to other coronaviruses, most of which cause only mild infections in humans. In order to help elucidate the function of the SUD, we have determined crystal structures of fragment 389-652 ("SUD(core" of Nsp3, which comprises 264 of the 338 residues of the domain. Both the monoclinic and triclinic crystal forms (2.2 and 2.8 A resolution, respectively revealed that SUD(core forms a homodimer. Each monomer consists of two subdomains, SUD-N and SUD-M, with a macrodomain fold similar to the SARS-CoV X-domain. However, in contrast to the latter, SUD fails to bind ADP-ribose, as determined by zone-interference gel electrophoresis. Instead, the entire SUD(core as well as its individual subdomains interact with oligonucleotides known to form G-quadruplexes. This includes oligodeoxy- as well as oligoribonucleotides. Mutations of selected lysine residues on the surface of the SUD-N subdomain lead to reduction of G-quadruplex binding, whereas mutations in the SUD-M subdomain abolish it. As there is no evidence for Nsp3 entering the nucleus of the host cell, the SARS-CoV genomic RNA or host-cell mRNA containing long G-stretches may be targets of SUD. The SARS-CoV genome is devoid of G-stretches longer than 5-6 nucleotides, but more extended G-stretches are found in the 3'-nontranslated regions of mRNAs coding for certain host-cell proteins

Getting in (and out of) the loop: regulating higher order telomere structures.

Science.gov (United States)

Luke-Glaser, Sarah; Poschke, Heiko; Luke, Brian

2012-01-01

The DNA at the ends of linear chromosomes (the telomere) folds back onto itself and forms an intramolecular lariat-like structure. Although the telomere loop has been implicated in the protection of chromosome ends from nuclease-mediated resection and unscheduled DNA repair activities, it potentially poses an obstacle to the DNA replication machinery during S-phase. Therefore, the coordinated regulation of telomere loop formation, maintenance, and resolution is required in order to establish a balance between protecting the chromosome ends and promoting their duplication prior to cell division. Until recently, the only factor known to influence telomere looping in human cells was TRF2, a component of the shelterin complex. Recent work in yeast and mouse cells has uncovered additional regulatory factors that affect the loop structure at telomeres. In the following "perspective" we outline what is known about telomere looping and highlight the latest results regarding the regulation of this chromosome end structure. We speculate about how the manipulation of the telomere loop may have therapeutic implications in terms of diseases associated with telomere dysfunction and uncontrolled proliferation.

Mechanism and manipulation of DNA:RNA hybrid G-quadruplex formation in transcription of G-rich DNA.

Science.gov (United States)

Zhang, Jia-yu; Zheng, Ke-wei; Xiao, Shan; Hao, Yu-hua; Tan, Zheng

2014-01-29

We recently reported that a DNA:RNA hybrid G-quadruplex (HQ) forms during transcription of DNA that bears two or more tandem guanine tracts (G-tract) on the nontemplate strand. Putative HQ-forming sequences are enriched in the nearby 1000 nt region right downstream of transcription start sites in the nontemplate strand of warm-blooded animals, and HQ regulates transcription under both in vitro and in vivo conditions. Therefore, knowledge of the mechanism of HQ formation is important for understanding the biological function of HQ as well as for manipulating gene expression by targeting HQ. In this work, we studied the mechanism of HQ formation using an in vitro T7 transcription model. We show that RNA synthesis initially produces an R-loop, a DNA:RNA heteroduplex formed by a nascent RNA transcript and the template DNA strand. In the following round of transcription, the RNA in the R-loop is displaced, releasing the RNA in single-stranded form (ssRNA). Then the G-tracts in the RNA can jointly form HQ with those in the nontemplate DNA strand. We demonstrate that the structural cascade R-loop → ssRNA → HQ offers opportunities to intercept HQ formation, which may provide a potential method to manipulate gene expression.

Getting in (and out of the loop: regulating higher order telomere structures

Directory of Open Access Journals (Sweden)

Sarah eLuke-Glaser

2012-11-01

Full Text Available The DNA at the ends of linear chromosomes (the telomere folds back onto itself and forms an intramolecular lariat-like structure. Although the telomere loop has been implicated in the protection of chromosome ends from nuclease-mediated resection and unscheduled DNA repair activities, it potentially poses an obstacle to the DNA replication machinery during S phase. Therefore, the coordinated regulation of telomere loop formation, maintenance and resolution is required in order to establish a balance between protecting the chromosome ends and promoting their duplication prior to cell division. Until recently, the only factor know to influence telomere looping in human cells was TRF2, a component of the shelterin complex. Recent work in yeast and mouse cells has uncovered additional regulatory factors that affect the loop structure at telomeres. In the following perspective we will outline what is known about telomere looping and highlight the latest results regarding the regulation of this chromosome end structure. We will speculate about how the manipulation of the telomere loop may have therapeutic implications in terms of diseases associated with telomere dysfunction and uncontrolled proliferation.

Label-free logic modules and two-layer cascade based on stem-loop probes containing a G-quadruplex domain.

Science.gov (United States)

Guo, Yahui; Cheng, Junjie; Wang, Jine; Zhou, Xiaodong; Hu, Jiming; Pei, Renjun

2014-09-01

A simple, versatile, and label-free DNA computing strategy was designed by using toehold-mediated strand displacement and stem-loop probes. A full set of logic gates (YES, NOT, OR, NAND, AND, INHIBIT, NOR, XOR, XNOR) and a two-layer logic cascade were constructed. The probes contain a G-quadruplex domain, which was blocked or unfolded through inputs initiating strand displacement and the obviously distinguishable light-up fluorescent signal of G-quadruplex/NMM complex was used as the output readout. The inputs are the disease-specific nucleotide sequences with potential for clinic diagnosis. The developed versatile computing system based on our label-free and modular strategy might be adapted in multi-target diagnosis through DNA hybridization and aptamer-target interaction. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Development of an Efficient G-Quadruplex-Stabilised Thrombin-Binding Aptamer Containing a Three-Carbon Spacer Molecule

DEFF Research Database (Denmark)

Aaldering, Lukas J.; Poongavanam, Vasanthanathan; Langkjær, Niels

2017-01-01

The thrombin-binding aptamer (TBA), which shows anticoagulant properties, is one of the most studied G-quadruplex-forming aptamers. In this study, we investigated the impact of different chemical modifications such as a three-carbon spacer (spacer-C3), unlocked nucleic acid (UNA) and 3′-amino-mod...

Duplex/quadruplex oligonucleotides: Role of the duplex domain in the stabilization of a new generation of highly effective anti-thrombin aptamers.

Science.gov (United States)

Russo Krauss, Irene; Napolitano, Valeria; Petraccone, Luigi; Troisi, Romualdo; Spiridonova, Vera; Mattia, Carlo Andrea; Sica, Filomena

2018-02-01

Recently, mixed duplex/quadruplex oligonucleotides have attracted great interest for use as biomedical aptamers. In the case of anti-thrombin aptamers, the addition of duplex-forming sequences to a G-quadruplex module identical or very similar to the best-known G-quadruplex of the Thrombin Binding Aptamer (HD1) results in new or improved biological properties, such as higher activity or different recognition properties with respect to HD1. Remarkably, this bimodular fold was hypothesized, based on its sequence, for the only anti-thrombin aptamer in advanced clinical trial, NU172. Whereas cation modulation of G-quadruplex conformation and stability is well characterized, only few data from similar analysis on duplex/quadruplex oligonucleotides exist. Here we have performed a characterization of structure and stability of four different duplex/quadruplex anti-thrombin aptamers, including NU172, in the presence of different cations and in physiological-mimicking conditions in comparison to HD1, by means of spectroscopic techniques (UV and circular dichroism) and differential scanning calorimetry. Our data show a strong reciprocal influence of each domain on the stability of the other and in particular suggest a stabilizing effect of the duplex region in the presence of solutions mimicking the physiological conditions, strengthening the idea that bimodular aptamers present better therapeutic potentialities than those containing a single G-quadruplex domain. Copyright © 2017 Elsevier B.V. All rights reserved.

The Effect of INA [(R)-1-O-(1-Pyrenylmethyl)Glycerol] Insertions on the Structure and Biological Activity of a G-Quadruplex from a Critical Kras G-Rich Sequence

DEFF Research Database (Denmark)

Cogoi, Susanna; Paramasivan, Manikandan; Xodo, Luigi E.

2007-01-01

Quadruplex-forming oligonucleotides containing INA [(R)-1-O-(1-pyrenylmethyl)glycerol] insertions have been designed and studied for their capacity to inhibit the expression of the KRAS oncogene in pancreatic adenocarcinoma cells. It is found that INA can influence the folding topology of the G-q...

p53 binds human telomeric G-quadruplex in vitro

Czech Academy of Sciences Publication Activity Database

Adámik, Matěj; Kejnovská, Iva; Bažantová, Pavla; Petr, Marek; Renčiuk, Daniel; Vorlíčková, Michaela; Brázdová, Marie

2016-01-01

Roč. 128, SEPT2016 (2016), s. 83-91 ISSN 0300-9084 R&D Projects: GA ČR GA13-36108S; GA ČR(CZ) GP14-33947P Institutional support: RVO:68081707 Keywords : crystal-structure * human-chromosomes * supercoiled dna Subject RIV: BO - Biophysics Impact factor: 3.112, year: 2016

Telomerer og telomerase

DEFF Research Database (Denmark)

Bendix, Laila; Kølvraa, Steen

2010-01-01

In 2009 the Nobel Prize in Medicine was awarded to EH Blackburn, CW Greider and JW Szostak for their work on "How chromosomes are protected by telomeres and the enzyme telomerase". Telomeres are specialized DNA structures localized at the end of linear chromosomes. Telomeres are known as the biol......In 2009 the Nobel Prize in Medicine was awarded to EH Blackburn, CW Greider and JW Szostak for their work on "How chromosomes are protected by telomeres and the enzyme telomerase". Telomeres are specialized DNA structures localized at the end of linear chromosomes. Telomeres are known...

Spectroscopic studies on the interactions of 5-ethyl-6-phenyl-3,8-bis((3-aminoalkyl)propanamido)phenanthridin-5-ium derivatives with G-quadruplex DNA

Science.gov (United States)

Yalçın, Ergin; Duyar, Halil; Ihmels, Heiko; Seferoğlu, Zeynel

2018-05-01

An improved microwave-induced synthesis of five ethidium derivatives (Ethidium derivatives, 2a-d) is presented. As the derivatives 2a-d have been proposed previously to be telomerase inhibitors, the binding interactions of these ethidium derivatives with G-quadruplex DNA were evaluated by means of photometric and fluorimetric titration, thermal DNA denaturation, CD and 1H NMR spectroscopy. In particular, the compound bearing 3,8-bis(pyrrolidin-1-yl)propanamido substituent 2a exhibits high selectivity for G-quadruplex DNA relative to duplex DNA.

A Dual-Specific Targeting Approach Based on the Simultaneous Recognition of Duplex and Quadruplex Motifs.

Science.gov (United States)

Nguyen, Thi Quynh Ngoc; Lim, Kah Wai; Phan, Anh Tuân

2017-09-20

Small-molecule ligands targeting nucleic acids have been explored as potential therapeutic agents. Duplex groove-binding ligands have been shown to recognize DNA in a sequence-specific manner. On the other hand, quadruplex-binding ligands exhibit high selectivity between quadruplex and duplex, but show limited discrimination between different quadruplex structures. Here we propose a dual-specific approach through the simultaneous application of duplex- and quadruplex-binders. We demonstrated that a quadruplex-specific ligand and a duplex-specific ligand can simultaneously interact at two separate binding sites of a quadruplex-duplex hybrid harbouring both quadruplex and duplex structural elements. Such a dual-specific targeting strategy would combine the sequence specificity of duplex-binders and the strong binding affinity of quadruplex-binders, potentially allowing the specific targeting of unique quadruplex structures. Future research can be directed towards the development of conjugated compounds targeting specific genomic quadruplex-duplex sites, for which the linker would be highly context-dependent in terms of length and flexibility, as well as the attachment points onto both ligands.

Exonuclease-assisted multicolor aptasensor for visual detection of ochratoxin A based on G-quadruplex-hemin DNAzyme-mediated etching of gold nanorod.

Science.gov (United States)

Yu, Xinhui; Lin, Yaohui; Wang, Xusheng; Xu, Liangjun; Wang, Zongwen; Fu, FengFu

2018-04-21

An exonuclease-assisted multicolor aptasensor was developed for the visual detection of ochratoxin A (OTA). It is based on the etching of gold nanorods (AuNRs) mediated by a G-quadruplex-hemin DNAzyme. A DNA sequence (AG4-OTA) was designed that comprises a hemin aptamer and an OTA aptamer. OTA binds to AG4-OTA to form an antiparallel G-quadruplex, which halts its digestion by exonuclease I (Exo I) from the 3'-end of AG4-OTA. Thus, the retained hemin aptamer can bind to hemin to form a G-quadruplex-hemin DNAzyme. This DNAzyme has peroxidase-like activity that catalyzes the oxidation of 3,3',5,5'-tetramethylbenzidine (TMB) by H 2 O 2 to produce its diimine derivative (TMB 2+ ) in acidic solution. TMB 2+ can etch the AuNRs by oxidizing Au(0) into Au(I). This results in the generation of rainbow-like colors and provides a multicolor platform for the visual detection of OTA. The assay is based on the use of a single isolated aptamer and possesses obvious advantages such as multi-color visual inspection, relatively high sensitivity and accuracy. It can be used to detect as little as 30 nM concentrations of OTA by visual observation and even 10 nM concentrations by spectrophotometry. The method was successfully applied to the determination of OTA in spiked beer where it gave recoveries of 101-108%, with a relative standard deviation (RSD, n = 5) of <5%. Graphical abstract Schematic of an exonuclease-assisted multicolor bioassay based on the G-quadruplex-hemin DNAzyme-mediated etching of gold nanorods (AuNRs). It enables visual detection of ochratoxin A (OTA) with a detection limit of 30 nM.

Triple Quenching of a Novel Self-Enhanced Ru(II) Complex by Hemin/G-Quadruplex DNAzymes and Its Potential Application to Quantitative Protein Detection.

Science.gov (United States)

Zhao, Min; Liao, Ni; Zhuo, Ying; Chai, Ya-Qin; Wang, Ji-Peng; Yuan, Ruo

2015-08-04

Herein, a novel "on-off" electrochemiluminescence (ECL) aptasensor for highly sensitive determination of thrombin has been constructed based on the triple quenching of the effect of hemin/G-quadruplex DNAzymes upon the Ru(II) complex-based ECL system. First, a strong initial ECL signal was achieved by the dual amplification strategies of (i) intramolecular coreaction of a self-enhanced Ru(II)-based molecule (PTCA-PEI-Ru(II)) and (ii) intermolecular coreaction between PTCA-PEI-Ru(II) and nicotinamide adenine dinucleotide (NADH), which was named the signal-on state. Then, a novel triple quenching of the effect of multifunctional hemin/G-quadruplex DNAzymes upon the Ru(II) complex-based ECL system was designed to realize the desirable signal-off state, which was outlined as follows: (i) the hemin/G-quadruplex DNAzymes mimicked NADH oxidase to oxidize NADH and in situ generate the H2O2, consuming the coreactant of NADH; (ii) its active center of hemin could oxidize the excited state PTCA-PEI-Ru(II)* to PTCA-PEI-Ru(III), making the energy and electron transfer quench; (iii) it also acted as horseradish peroxidase (HRP) to catalyze the H2O2 for in situ producing the quencher of O2. Based on triple quenching of the effect of hemin/G-quadruplex DNAzymes, the highly sensitive "on-off" thrombin aptasensor was developed with a wide linear detection range of 1.0 × 10(-14) M to 1.0 × 10(-10) M and a detection limit down to the femtomolar level.

Modular Assembly of Cell-targeting Devices Based on an Uncommon G-quadruplex Aptamer

Directory of Open Access Journals (Sweden)

Felipe Opazo

2015-01-01

Full Text Available Aptamers are valuable tools that provide great potential to develop cost-effective diagnostics and therapies in the biomedical field. Here, we report a novel DNA aptamer that folds into an unconventional G-quadruplex structure able to recognize and enter specifically into human Burkitt's lymphoma cells. We further optimized this aptamer to a highly versatile and stable minimized version. The minimized aptamer can be easily equipped with different functionalities like quantum dots, organic dyes, or even a second different aptamer domain yielding a bi-paratopic aptamer. Although the target molecule of the aptamer remains unknown, our microscopy and pharmacological studies revealed that the aptamer hijacks the clathrin-mediated endocytosis pathway for its cellular internalization. We conclude that this novel class of aptamers can be used as a modular tool to specifically deliver different cargoes into malignant cells. This work provides a thorough characterization of the aptamer and we expect that our strategy will pave the path for future therapeutic applications.

CTC1-STN1 coordinates G- and C-strand synthesis to regulate telomere length.

Science.gov (United States)

Gu, Peili; Jia, Shuting; Takasugi, Taylor; Smith, Eric; Nandakumar, Jayakrishnan; Hendrickson, Eric; Chang, Sandy

2018-05-17

Coats plus (CP) is a rare autosomal recessive disorder caused by mutations in CTC1, a component of the CST (CTC1, STN1, and TEN1) complex important for telomere length maintenance. The molecular basis of how CP mutations impact upon telomere length remains unclear. The CP CTC1 L1142H mutation has been previously shown to disrupt telomere maintenance. In this study, we used CRISPR/Cas9 to engineer this mutation into both alleles of HCT116 and RPE cells to demonstrate that CTC1:STN1 interaction is required to repress telomerase activity. CTC1 L1142H interacts poorly with STN1, leading to telomerase-mediated telomere elongation. Impaired interaction between CTC1 L1142H :STN1 and DNA Pol-α results in increased telomerase recruitment to telomeres and further telomere elongation, revealing that C:S binding to DNA Pol-α is required to fully repress telomerase activity. CP CTC1 mutants that fail to interact with DNA Pol-α resulted in loss of C-strand maintenance and catastrophic telomere shortening. Our findings place the CST complex as an important regulator of both G-strand extensions by telomerase and C-strand synthesis by DNA Pol-α. © 2018 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.

If the cap fits, wear it: an overview of telomeric structures over evolution.

Science.gov (United States)

Fulcher, Nick; Derboven, Elisa; Valuchova, Sona; Riha, Karel

2014-03-01

Genome organization into linear chromosomes likely represents an important evolutionary innovation that has permitted the development of the sexual life cycle; this process has consequently advanced nuclear expansion and increased complexity of eukaryotic genomes. Chromosome linearity, however, poses a major challenge to the internal cellular machinery. The need to efficiently recognize and repair DNA double-strand breaks that occur as a consequence of DNA damage presents a constant threat to native chromosome ends known as telomeres. In this review, we present a comparative survey of various solutions to the end protection problem, maintaining an emphasis on DNA structure. This begins with telomeric structures derived from a subset of prokaryotes, mitochondria, and viruses, and will progress into the typical telomere structure exhibited by higher organisms containing TTAGG-like tandem sequences. We next examine non-canonical telomeres from Drosophila melanogaster, which comprise arrays of retrotransposons. Finally, we discuss telomeric structures in evolution and possible switches between canonical and non-canonical solutions to chromosome end protection.

Yeast Sub1 and human PC4 are G-quadruplex binding proteins that suppress genome instability at co-transcriptionally formed G4 DNA.

Science.gov (United States)

Lopez, Christopher R; Singh, Shivani; Hambarde, Shashank; Griffin, Wezley C; Gao, Jun; Chib, Shubeena; Yu, Yang; Ira, Grzegorz; Raney, Kevin D; Kim, Nayun

2017-06-02

G-quadruplex or G4 DNA is a non-B secondary DNA structure consisting of a stacked array of guanine-quartets that can disrupt critical cellular functions such as replication and transcription. When sequences that can adopt Non-B structures including G4 DNA are located within actively transcribed genes, the reshaping of DNA topology necessary for transcription process stimulates secondary structure-formation thereby amplifying the potential for genome instability. Using a reporter assay designed to study G4-induced recombination in the context of an actively transcribed locus in Saccharomyces cerevisiae, we tested whether co-transcriptional activator Sub1, recently identified as a G4-binding factor, contributes to genome maintenance at G4-forming sequences. Our data indicate that, upon Sub1-disruption, genome instability linked to co-transcriptionally formed G4 DNA in Top1-deficient cells is significantly augmented and that its highly conserved DNA binding domain or the human homolog PC4 is sufficient to suppress G4-associated genome instability. We also show that Sub1 interacts specifically with co-transcriptionally formed G4 DNA in vivo and that yeast cells become highly sensitivity to G4-stabilizing chemical ligands by the loss of Sub1. Finally, we demonstrate the physical and genetic interaction of Sub1 with the G4-resolving helicase Pif1, suggesting a possible mechanism by which Sub1 suppresses instability at G4 DNA. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Thioflavin T binds dimeric parallel-stranded GA-containing non-G-quadruplex DNAs: a general approach to lighting up double-stranded scaffolds.

Science.gov (United States)

Liu, Shuangna; Peng, Pai; Wang, Huihui; Shi, Lili; Li, Tao

2017-12-01

A molecular rotor thioflavin T (ThT) is usually used as a fluorescent ligand specific for G-quadruplexes. Here, we demonstrate that ThT can tightly bind non-G-quadruplex DNAs with several GA motifs and dimerize them in a parallel double-stranded mode, accompanied by over 100-fold enhancement in the fluorescence emission of ThT. The introduction of reverse Watson-Crick T-A base pairs into these dimeric parallel-stranded DNA systems remarkably favors the binding of ThT into the pocket between G•G and A•A base pairs, where ThT is encapsulated thereby restricting its two rotary aromatic rings in the excited state. A similar mechanism is also demonstrated in antiparallel DNA duplexes where several motifs of two consecutive G•G wobble base pairs are incorporated and serve as the active pockets for ThT binding. The insight into the interactions of ThT with non-G-quadruplex DNAs allows us to introduce a new concept for constructing DNA-based sensors and devices. As proof-of-concept experiments, we design a DNA triplex containing GA motifs in its Hoogsteen hydrogen-bonded two parallel strands as a pH-driven nanoswitch and two GA-containing parallel duplexes as novel metal sensing platforms where C-C and T-T mismatches are included. This work may find further applications in biological systems (e.g. disease gene detection) where parallel duplex or triplex stretches are involved. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Voltammetry and Molecular Assembly of G-quadruplex DNAzyme on Single-crystal Au(111)-electrode Surfaces – Hemin as an Electrochemical Intercalator

DEFF Research Database (Denmark)

Zhang, Ling; Ulstrup, Jens; Zhang, Jingdong

2016-01-01

DNA quadruplexes (qs’s) are a class of “non-canonical” oligonucleotides (OGNs) composed of stacked guanine (G) quartets generally stabilized by monovalent cations. Metal porphyrins selectively bind to G-qs complexes to form DNAzyme, which can exhibit peroxidase and other catalytic activity simila...

Leishmania replication protein A-1 binds in vivo single-stranded telomeric DNA

International Nuclear Information System (INIS)

Neto, J.L. Siqueira; Lira, C.B.B.; Giardini, M.A.; Khater, L.; Perez, A.M.; Peroni, L.A.; Reis, J.R.R. dos; Freitas-Junior, L.H.; Ramos, C.H.I.; Cano, M.I.N.

2007-01-01

Replication protein A (RPA) is a highly conserved heterotrimeric single-stranded DNA-binding protein involved in different events of DNA metabolism. In yeast, subunits 1 (RPA-1) and 2 (RPA-2) work also as telomerase recruiters and, in humans, the complex unfolds G-quartet structures formed by the 3' G-rich telomeric strand. In most eukaryotes, RPA-1 and RPA-2 bind DNA using multiple OB fold domains. In trypanosomatids, including Leishmania, RPA-1 has a canonical OB fold and a truncated RFA-1 structural domain. In Leishmania amazonensis, RPA-1 alone can form a complex in vitro with the telomeric G-rich strand. In this work, we show that LaRPA-1 is a nuclear protein that associates in vivo with Leishmania telomeres. We mapped the boundaries of the OB fold DNA-binding domain using deletion mutants. Since Leishmania and other trypanosomatids lack homologues of known telomere end binding proteins, our results raise questions about the function of RPA-1 in parasite telomeres

Transcription arrest by a G quadruplex forming-trinucleotide repeat sequence from the human c-myb gene.

Science.gov (United States)

Broxson, Christopher; Beckett, Joshua; Tornaletti, Silvia

2011-05-17

Non canonical DNA structures correspond to genomic regions particularly susceptible to genetic instability. The transcription process facilitates formation of these structures and plays a major role in generating the instability associated with these genomic sites. However, little is known about how non canonical structures are processed when encountered by an elongating RNA polymerase. Here we have studied the behavior of T7 RNA polymerase (T7RNAP) when encountering a G quadruplex forming-(GGA)(4) repeat located in the human c-myb proto-oncogene. To make direct correlations between formation of the structure and effects on transcription, we have taken advantage of the ability of the T7 polymerase to transcribe single-stranded substrates and of G4 DNA to form in single-stranded G-rich sequences in the presence of potassium ions. Under physiological KCl concentrations, we found that T7 RNAP transcription was arrested at two sites that mapped to the c-myb (GGA)(4) repeat sequence. The extent of arrest did not change with time, indicating that the c-myb repeat represented an absolute block and not a transient pause to T7 RNAP. Consistent with G4 DNA formation, arrest was not observed in the absence of KCl or in the presence of LiCl. Furthermore, mutations in the c-myb (GGA)(4) repeat, expected to prevent transition to G4, also eliminated the transcription block. We show T7 RNAP arrest at the c-myb repeat in double-stranded DNA under conditions mimicking the cellular concentration of biomolecules and potassium ions, suggesting that the G4 structure formed in the c-myb repeat may represent a transcription roadblock in vivo. Our results support a mechanism of transcription-coupled DNA repair initiated by arrest of transcription at G4 structures.

Long G2 accumulates recombination intermediates and disturbs chromosome segregation at dysfunction telomere in Schizosaccharomyces pombe

Energy Technology Data Exchange (ETDEWEB)

Habib, Ahmed G.K.; Masuda, Kenta; Yukawa, Masashi; Tsuchiya, Eiko [Department of Molecular Biotechnology, Graduate School of Advanced Sciences of Matter, Hiroshima University, 1-3-1 Kagamiyama, Higashi-Hiroshima 739-8530 (Japan); Ueno, Masaru, E-mail: scmueno@hiroshima-u.ac.jp [Department of Molecular Biotechnology, Graduate School of Advanced Sciences of Matter, Hiroshima University, 1-3-1 Kagamiyama, Higashi-Hiroshima 739-8530 (Japan); Research Center for the Mathematics on Chromatin Live Dynamics, Hiroshima University, 1-3-1 Kagamiyama, Higashi-Hiroshima 739-8530 (Japan)

2015-08-14

Protection of telomere (Pot1) is a single-stranded telomere binding protein which is essential for chromosome ends protection. Fission yeast Rqh1 is a member of RecQ helicases family which has essential roles in the maintenance of genomic stability and regulation of homologous recombination. Double mutant between fission yeast pot1Δ and rqh1 helicase dead (rqh1-hd) maintains telomere by homologous recombination. In pot1Δ rqh1-hd double mutant, recombination intermediates accumulate near telomere which disturb chromosome segregation and make cells sensitive to microtubule inhibitors thiabendazole (TBZ). Deletion of chk1{sup +} or mutation of its kinase domain shortens the G2 of pot1Δ rqh1-hd double mutant and suppresses both the accumulation of recombination intermediates and the TBZ sensitivity of that double mutant. In this study, we asked whether the long G2 is the reason for the TBZ sensitivity of pot1Δ rqh1-hd double mutant. We found that shortening the G2 of pot1Δ rqh1-hd double mutant by additional mutations of wee1 and mik1 or gain of function mutation of Cdc2 suppresses both the accumulation of recombination intermediates and the TBZ sensitivity of pot1Δ rqh1-hd double mutant. Our results suggest that long G2 of pot1Δ rqh1-hd double mutant may allow time for the accumulation of recombination intermediates which disturb chromosome segregation and make cells sensitive to TBZ. - Ηighlights: • We show link between long G2 and accumulation of toxic recombination intermediates. • Accumulation of recombination intermediates at telomere results in TBZ sensitivity. • Activation of DNA damage checkpoint worsens cells' viability in presence of TBZ.

Phenolic promiscuity in the cell nucleus--epigallocatechingallate (EGCG) and theaflavin-3,3'-digallate from green and black tea bind to model cell nuclear structures including histone proteins, double stranded DNA and telomeric quadruplex DNA.

Science.gov (United States)

Mikutis, Gediminas; Karaköse, Hande; Jaiswal, Rakesh; LeGresley, Adam; Islam, Tuhidul; Fernandez-Lahore, Marcelo; Kuhnert, Nikolai

2013-02-01

Flavanols from tea have been reported to accumulate in the cell nucleus in considerable concentrations. The nature of this phenomenon, which could provide novel approaches in understanding the well-known beneficial health effects of tea phenols, is investigated in this contribution. The interaction between epigallocatechin gallate (EGCG) from green tea and a selection of theaflavins from black tea with selected cell nuclear structures such as model histone proteins, double stranded DNA and quadruplex DNA was investigated using mass spectrometry, Circular Dichroism spectroscopy and fluorescent assays. The selected polyphenols were shown to display affinity to all of the selected cell nuclear structures, thereby demonstrating a degree of unexpected molecular promiscuity. Most interestingly theaflavin-digallate was shown to display the highest affinity to quadruplex DNA reported for any naturally occurring molecule reported so far. This finding has immediate implications in rationalising the chemopreventive effect of the tea beverage against cancer and possibly the role of tea phenolics as "life span essentials".

Solution structure of telomere binding domain of AtTRB2 derived from Arabidopsis thaliana

International Nuclear Information System (INIS)

Yun, Ji-Hye; Lee, Won Kyung; Kim, Heeyoun; Kim, Eunhee; Cheong, Chaejoon; Cho, Myeon Haeng; Lee, Weontae

2014-01-01

Highlights: • We have determined solution structure of Myb domain of AtTRB2. • The Myb domain of AtTRB2 is located in the N-terminal region. • The Myb domain of AtTRB2 binds to plant telomeric DNA without fourth helix. • Helix 2 and 3 of the Myb domain of AtTRB2 are involved in DNA recognition. • AtTRB2 is a novel protein distinguished from other known plant TBP. - Abstract: Telomere homeostasis is regulated by telomere-associated proteins, and the Myb domain is well conserved for telomere binding. AtTRB2 is a member of the SMH (Single-Myb-Histone)-like family in Arabidopsis thaliana, having an N-terminal Myb domain, which is responsible for DNA binding. The Myb domain of AtTRB2 contains three α-helices and loops for DNA binding, which is unusual given that other plant telomere-binding proteins have an additional fourth helix that is essential for DNA binding. To understand the structural role for telomeric DNA binding of AtTRB2, we determined the solution structure of the Myb domain of AtTRB2 (AtTRB2 1–64 ) using nuclear magnetic resonance (NMR) spectroscopy. In addition, the inter-molecular interaction between AtTRB2 1–64 and telomeric DNA has been characterized by the electrophoretic mobility shift assay (EMSA) and NMR titration analyses for both plant (TTTAGGG)n and human (TTAGGG)n telomere sequences. Data revealed that Trp28, Arg29, and Val47 residues located in Helix 2 and Helix 3 are crucial for DNA binding, which are well conserved among other plant telomere binding proteins. We concluded that although AtTRB2 is devoid of the additional fourth helix in the Myb-extension domain, it is able to bind to plant telomeric repeat sequences as well as human telomeric repeat sequences

G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA.

Science.gov (United States)

Stoltenburg, Regina; Krafčiková, Petra; Víglaský, Viktor; Strehlitz, Beate

2016-09-21

Aptamers for whole cell detection are selected mostly by the Cell-SELEX procedure. Alternatively, the use of specific cell surface epitopes as target during aptamer selections allows the development of aptamers with ability to bind whole cells. In this study, we integrated a formerly selected Protein A-binding aptamer PA#2/8 in an assay format called ELONA (Enzyme-Linked OligoNucleotide Assay) and evaluated the ability of the aptamer to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface. The full-length aptamer and one of its truncated variants could be demonstrated to specifically bind to Protein A-expressing intact cells of S. aureus, and thus have the potential to expand the portfolio of aptamers that can act as an analytical agent for the specific recognition and rapid detection of the bacterial pathogen. The functionality of the aptamer was found to be based on a very complex, but also highly variable structure. Two structural key elements were identified. The aptamer sequence contains several G-clusters allowing folding into a G-quadruplex structure with the potential of dimeric and multimeric assembly. An inverted repeat able to form an imperfect stem-loop at the 5'-end also contributes essentially to the aptameric function.

Hairpins participating in folding of human telomeric sequence quadruplexes studied by standard and T-REMD simulations

Czech Academy of Sciences Publication Activity Database

Stadlbauer, Petr; Kuehrova, P.; Banáš, P.; Koča, J.; Bussi, G.; Trantírek, L.; Otyepka, M.; Šponer, Jiří

2016-01-01

Roč. 43, č. 20 (2016), s. 9626-9644 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP208/11/1822 Institutional support: RVO:68081707 Keywords : MOLECULAR-DYNAMICS SIMULATIONS * INTRAMOLECULAR DNA QUADRUPLEXES * PARTICLE MESH EWALD Subject RIV: BO - Biophysics Impact factor: 10.162, year: 2016

Tetrahelical structural family adopted by AGCGA-rich regulatory DNA regions

Science.gov (United States)

Kocman, Vojč; Plavec, Janez

2017-05-01

Here we describe AGCGA-quadruplexes, an unexpected addition to the well-known tetrahelical families, G-quadruplexes and i-motifs, that have been a focus of intense research due to their potential biological impact in G- and C-rich DNA regions, respectively. High-resolution structures determined by solution-state nuclear magnetic resonance (NMR) spectroscopy demonstrate that AGCGA-quadruplexes comprise four 5'-AGCGA-3' tracts and are stabilized by G-A and G-C base pairs forming GAGA- and GCGC-quartets, respectively. Residues in the core of the structure are connected with edge-type loops. Sequences of alternating 5'-AGCGA-3' and 5'-GGG-3' repeats could be expected to form G-quadruplexes, but are shown herein to form AGCGA-quadruplexes instead. Unique structural features of AGCGA-quadruplexes together with lower sensitivity to cation and pH variation imply their potential biological relevance in regulatory regions of genes responsible for basic cellular processes that are related to neurological disorders, cancer and abnormalities in bone and cartilage development.

Fanconi anemia proteins in telomere maintenance.

Science.gov (United States)

Sarkar, Jaya; Liu, Yie

2016-07-01

Mammalian chromosome ends are protected by nucleoprotein structures called telomeres. Telomeres ensure genome stability by preventing chromosome termini from being recognized as DNA damage. Telomere length homeostasis is inevitable for telomere maintenance because critical shortening or over-lengthening of telomeres may lead to DNA damage response or delay in DNA replication, and hence genome instability. Due to their repetitive DNA sequence, unique architecture, bound shelterin proteins, and high propensity to form alternate/secondary DNA structures, telomeres are like common fragile sites and pose an inherent challenge to the progression of DNA replication, repair, and recombination apparatus. It is conceivable that longer the telomeres are, greater is the severity of such challenges. Recent studies have linked excessively long telomeres with increased tumorigenesis. Here we discuss telomere abnormalities in a rare recessive chromosomal instability disorder called Fanconi Anemia and the role of the Fanconi Anemia pathway in telomere biology. Reports suggest that Fanconi Anemia proteins play a role in maintaining long telomeres, including processing telomeric joint molecule intermediates. We speculate that ablation of the Fanconi Anemia pathway would lead to inadequate aberrant structural barrier resolution at excessively long telomeres, thereby causing replicative burden on the cell. Published by Elsevier B.V.

Solution structure of telomere binding domain of AtTRB2 derived from Arabidopsis thaliana

Energy Technology Data Exchange (ETDEWEB)

Yun, Ji-Hye [Department of Biochemistry, College of Life Science and Biotechnology, Yonsei University, Seoul 120-749 (Korea, Republic of); Lee, Won Kyung [Department of Systems Biology, College of Life Science and Biotechnology, Yonsei University, Seoul 120-749 (Korea, Republic of); Kim, Heeyoun [Department of Biochemistry, College of Life Science and Biotechnology, Yonsei University, Seoul 120-749 (Korea, Republic of); Kim, Eunhee; Cheong, Chaejoon [Magnetic Resonance Team, Korea Basic Science Institute (KBSI), Ochang, Chungbuk 363-883 (Korea, Republic of); Cho, Myeon Haeng [Department of Systems Biology, College of Life Science and Biotechnology, Yonsei University, Seoul 120-749 (Korea, Republic of); Lee, Weontae, E-mail: wlee@spin.yonsei.ac.kr [Department of Biochemistry, College of Life Science and Biotechnology, Yonsei University, Seoul 120-749 (Korea, Republic of)

2014-09-26

Highlights: • We have determined solution structure of Myb domain of AtTRB2. • The Myb domain of AtTRB2 is located in the N-terminal region. • The Myb domain of AtTRB2 binds to plant telomeric DNA without fourth helix. • Helix 2 and 3 of the Myb domain of AtTRB2 are involved in DNA recognition. • AtTRB2 is a novel protein distinguished from other known plant TBP. - Abstract: Telomere homeostasis is regulated by telomere-associated proteins, and the Myb domain is well conserved for telomere binding. AtTRB2 is a member of the SMH (Single-Myb-Histone)-like family in Arabidopsis thaliana, having an N-terminal Myb domain, which is responsible for DNA binding. The Myb domain of AtTRB2 contains three α-helices and loops for DNA binding, which is unusual given that other plant telomere-binding proteins have an additional fourth helix that is essential for DNA binding. To understand the structural role for telomeric DNA binding of AtTRB2, we determined the solution structure of the Myb domain of AtTRB2 (AtTRB2{sub 1–64}) using nuclear magnetic resonance (NMR) spectroscopy. In addition, the inter-molecular interaction between AtTRB2{sub 1–64} and telomeric DNA has been characterized by the electrophoretic mobility shift assay (EMSA) and NMR titration analyses for both plant (TTTAGGG)n and human (TTAGGG)n telomere sequences. Data revealed that Trp28, Arg29, and Val47 residues located in Helix 2 and Helix 3 are crucial for DNA binding, which are well conserved among other plant telomere binding proteins. We concluded that although AtTRB2 is devoid of the additional fourth helix in the Myb-extension domain, it is able to bind to plant telomeric repeat sequences as well as human telomeric repeat sequences.

Drosophila cell cycle under arrest: uncapped telomeres plead guilty.

Science.gov (United States)

Cenci, Giovanni

2009-04-01

Telomeres are specialized structures that protect chromosome ends from degradation and fusion events. In most organisms, telomeres consist of short, repetitive G-rich sequences added to chromosome ends by a reverse transcriptase with an internal RNA template, called telomerase. Specific DNA-binding protein complexes associate with telomeric sequences preventing chromosome ends from being recognized as DNA double strand breaks (DSBs). Telomeres that lose their cap activate the DNA damage response (DDR) likewise DSBs and, if inappropriately repaired, generate telomeric fusions, which eventually lead to genome instability. In Drosophila there is not telomerase, and telomere length is maintained by transposition of three specialized retroelements. However, fly telomeres are protected by multi protein complexes like their yeast and vertebrate counterparts; these complexes bind chromosome ends in a sequence-independent fashion and are required to prevent checkpoint activation and end-to-end fusion. Uncapped Drosophila telomeres elicit a DDR just as dysfunctional human telomeres. Most interestingly, uncapped Drosophila telomeres also activate the spindle assembly checkpoint (SAC) by recruiting the SAC kinase BubR1. BubR1 accumulations at chromosome ends trigger the SAC that inhibits the metaphase-to-anaphase transition. These findings, reviewed here, highlight an intriguing and unsuspected connection between telomeres and cell cycle regulation, providing a clue to understand human telomere function.

Interdependence of pyrene interactions and tetramolecular G4-DNA assembly.

Science.gov (United States)

Doluca, Osman; Withers, Jamie M; Loo, Trevor S; Edwards, Patrick J B; González, Carlos; Filichev, Vyacheslav V

2015-03-28

Controlling the arrangement of organic chromophores in supramolecular architectures is of primary importance for the development of novel functional molecules. Insertion of a twisted intercalating nucleic acid (TINA) moiety, containing phenylethynylpyren-1-yl derivatives, into a G-rich DNA sequence alters G-quadruplex folding, resulting in supramolecular structures with defined pyrene arrangements. Based on CD, NMR and ESI-mass-spectra, as well as TINA excited dimer (excimer) fluorescence emission we propose that insertion of the TINA monomer in the middle of a dTG4T sequence (i.e. dTGGXGGT, where X is TINA) converts a parallel tetramolecular G-quadruplex into an assembly composed of two identical antiparallel G-quadruplex subunits stacked via TINA-TINA interface. Kinetic analysis showed that TINA-TINA association controls complex formation in the presence of Na(+) but barely competes with guanine-mediated association in K(+) or in the sequence with the longer G-run (dTGGGXGGGT). These results demonstrate new perspectives in the design of molecular entities that can kinetically control G-quadruplex formation and show how tetramolecular G-quadruplexes can be used as a tuneable scaffold to control the arrangement of organic chromophores.

Peroxiredoxin 1 Protects Telomeres from Oxidative Damage and Preserves Telomeric DNA for Extension by Telomerase

Directory of Open Access Journals (Sweden)

Eric Aeby

2016-12-01

Full Text Available Oxidative damage of telomeres can promote cancer, cardiac failure, and muscular dystrophy. Specific mechanisms protecting telomeres from oxidative damage have not been described. We analyzed telomeric chromatin composition during the cell cycle and show that the antioxidant enzyme peroxiredoxin 1 (PRDX1 is enriched at telomeres during S phase. Deletion of the PRDX1 gene leads to damage of telomeric DNA upon oxidative stress, revealing a protective function of PRDX1 against oxidative damage at telomeres. We also show that the oxidized nucleotide 8-oxo-2′deoxyguanosine-5′-triphosphate (8oxodGTP causes premature chain termination when incorporated by telomerase and that some DNA substrates terminating in 8oxoG prevent extension by telomerase. Thus, PRDX1 safeguards telomeres from oxygen radicals to counteract telomere damage and preserve telomeric DNA for elongation by telomerase.

Label-free and enzyme-free detection of transcription factors with graphene oxide fluorescence switch-based multifunctional G-quadruplex-hairpin probe.

Science.gov (United States)

Zhu, Desong; Wang, Lei; Xu, Xiaowen; Jiang, Wei

2016-01-15

Transcription factors (TFs) play pivotal roles in the regulation of a variety of essential cellular processes and some of them have been recognized as potential diagnostic markers and therapeutic targets of some diseases. Sensitive and accurate detection of TFs is of great importance to better understanding their roles in gene regulation and evaluation of disease state. Here, we developed a simple, label-free and enzyme-free new fluorescent strategy for the detection of TFs by graphene oxide (GO) fluorescence switch-based multifunctional G-quadruplex-hairpin probe (MGHP). The MGHP possessed of three functions simultaneously, adsorbing onto GO with the loop part, binding to target with the stem part and serving as signal carrier with the terminal G-quadruplex. First, the MGHP was adsorbed quickly to GO. Next, the TF bound to the stem part of MGHP to form a huge target-MGHP complex, which led to desorption of the complex from GO. Finally, NMM was inserted into G-quadruplex in the complex to yield an enhanced fluorescence response. The GO used here, as a fluorescence switch, could quickly and efficiently quench the fluorescence of NMM inserted into the MGHP absorbed on the GO, guaranteeing a high signal-to-noise ratio. Sensitive detection of purified NF-κB p50 and HeLa cell nuclear extracts were achieved with detection limits of 0.2nM and 7.8ng/µL, respectively. Moreover, this proposed strategy could be used to screen inhibitors of NF-κB p50 activity. The strategy proposed here might offer a new potential approach for reliable quantification of TFs in clinical diagnostics and treatment research of some diseases. Copyright © 2015 Elsevier B.V. All rights reserved.

Telomere Maintenance Mechanisms in Cancer

OpenAIRE

Tiago Bordeira Gaspar; Ana Sá; José Manuel Lopes; Manuel Sobrinho-Simões; Paula Soares; João Vinagre

2018-01-01

Tumour cells can adopt telomere maintenance mechanisms (TMMs) to avoid telomere shortening, an inevitable process due to successive cell divisions. In most tumour cells, telomere length (TL) is maintained by reactivation of telomerase, while a small part acquires immortality through the telomerase-independent alternative lengthening of telomeres (ALT) mechanism. In the last years, a great amount of data was generated, and different TMMs were reported and explained in detail, benefiting from g...

Thrombin-Binding Aptamer Quadruplex Formation: AFM and Voltammetric Characterization

Directory of Open Access Journals (Sweden)

Victor Constantin Diculescu

2010-01-01

Full Text Available The adsorption and the redox behaviour of thrombin-binding aptamer (TBA and extended TBA (eTBA were studied using atomic force microscopy and voltammetry at highly oriented pyrolytic graphite and glassy carbon. The different adsorption patterns and degree of surface coverage were correlated with the sequence base composition, presence/absence of K+, and voltammetric behaviour of TBA and eTBA. In the presence of K+, only a few single-stranded sequences present adsorption, while the majority of the molecules forms stable and rigid quadruplexes with no adsorption. Both TBA and eTBA are oxidized and the only anodic peak corresponds to guanine oxidation. Upon addition of K+ ions, TBA and eTBA fold into a quadruplex, causing the decrease of guanine oxidation peak and occurrence of a new peak at a higher potential due to the oxidation of G-quartets. The higher oxidation potential of G-quartets is due to the greater difficulty of electron transfer from the inside of the quadruplex to the electrode surface than electron transfer from the more flexible single strands.

Label-free detection of kanamycin based on a G-quadruplex DNA aptamer-based fluorescent intercalator displacement assay

Science.gov (United States)

Xing, Yun-Peng; Liu, Chun; Zhou, Xiao-Hong; Shi, Han-Chang

2015-01-01

This work was the first to report that the kanamycin-binding DNA aptamer (5'-TGG GGG TTG AGG CTA AGC CGA-3') can form stable parallel G-quadruplex DNA (G4-DNA) structures by themselves and that this phenomenon can be verified by nondenaturing polyacrylamide gel electrophoresis and circular dichroism spectroscopy. Based on these findings, we developed a novel label-free strategy for kanamycin detection based on the G4-DNA aptamer-based fluorescent intercalator displacement assay with thiazole orange (TO) as the fluorescence probe. In the proposed strategy, TO became strongly fluorescent upon binding to kanamycin-binding G4-DNA. However, the addition of kanamycin caused the displacement of TO from the G4-DNA-TO conjugate, thereby resulting in decreased fluorescent signal, which was inversely related to the kanamycin concentration. The detection limit of the proposed assay decreased to 59 nM with a linear working range of 0.1 μM to 20 μM for kanamycin. The cross-reactivity against six other antibiotics was negligible compared with the response to kanamycin. A satisfactory recovery of kanamycin in milk samples ranged from 80.1% to 98.0%, confirming the potential of this bioassay in the measurement of kanamycin in various applications. Our results also served as a good reference for developing similar fluorescent G4-DNA-based bioassays in the future.

pH-Modulated Watson-Crick duplex-quadruplex equilibria of guanine-rich and cytosine-rich DNA sequences 140 base pairs upstream of the c-kit transcription initiation site.

Science.gov (United States)

Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo

2009-11-23

Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.

Telomeres: Implications for Cancer Development

Directory of Open Access Journals (Sweden)

Aina Bernal

2018-01-01

Full Text Available Telomeres facilitate the protection of natural ends of chromosomes from constitutive exposure to the DNA damage response (DDR. This is most likely achieved by a lariat structure that hides the linear telomeric DNA through protein-protein and protein-DNA interactions. The telomere shortening associated with DNA replication in the absence of a compensatory mechanism culminates in unmasked telomeres. Then, the subsequent activation of the DDR will define the fate of cells according to the functionality of cell cycle checkpoints. Dysfunctional telomeres can suppress cancer development by engaging replicative senescence or apoptotic pathways, but they can also promote tumour initiation. Studies in telomere dynamics and karyotype analysis underpin telomere crisis as a key event driving genomic instability. Significant attainment of telomerase or alternative lengthening of telomeres (ALT-pathway to maintain telomere length may be permissive and required for clonal evolution of genomically-unstable cells during progression to malignancy. We summarise current knowledge of the role of telomeres in the maintenance of chromosomal stability and carcinogenesis.

Bis-guanylhydrazone diimidazo[1,2-a:1,2-c]pyrimidine as a novel and specific G-quadruplex binding motif.

Science.gov (United States)

Sparapani, Silvia; Bellini, Stefania; Gunaratnam, Mekala; Haider, Shozeb M; Andreani, Aldo; Rambaldi, Mirella; Locatelli, Alessandra; Morigi, Rita; Granaiola, Massimiliano; Varoli, Lucilla; Burnelli, Silvia; Leoni, Alberto; Neidle, Stephen

2010-08-21

A bis-guanylhydrazone derivative of diimidazo[1,2-a:1,2-c]pyrimidine has unexpectedly been found to be a potent stabiliser of several quadruplex DNAs, whereas there is no significant interaction with duplex DNA. Molecular modeling suggests that the guanylhydrazone groups play an active role in quadruplex binding.

Shelterin Protects Chromosome Ends by Compacting Telomeric Chromatin

Science.gov (United States)

Bandaria, Jigar N.; Qin, Peiwu; Berk, Veysel; Chu, Steven; Yildiz, Ahmet

2016-01-01

SUMMARY Telomeres, repetitive DNA sequences at chromosome ends, are shielded against the DNA damage response (DDR) by the shelterin complex. To understand how shelterin protects telomere ends, we investigated the structural organization of telomeric chromatin in human cells using super-resolution microscopy. We found that telomeres form compact globular structures through a complex network of interactions between shelterin subunits and telomeric DNA, and not by DNA methylation, histone deacetylation or histone trimethylation at telomeres and subtelomeric regions. Mutations that abrogate shelterin assembly or removal of individual subunits from telomeres cause up to a 10-fold increase in telomere volume. Decompacted telomeres become more accessible to telomere-associated proteins and accumulate DDR signals. Recompaction of telomeric chromatin using an orthogonal method displaces DDR signals from telomeres. These results reveal the chromatin remodeling activity of shelterin and demonstrate that shelterin-mediated compaction of telomeric chromatin provides robust protection of chromosome ends against the DDR machinery. PMID:26871633

Identification of a New G-Quadruplex Motif in the KRAS Promoter and Design of Pyrene-Modified G4-Decoys with Antiproliferative Activity in Pancreatic Cancer Cells

DEFF Research Database (Denmark)

Cogoi, Susanna; Paramasivam, Manikandan; Filitchev, Vyacheslav Viatcheslav

2009-01-01

A new quadruplex motif located in the promoter of the human KRAS gene, within a nuclease hypersensitive element (NHE), has been characterized. Oligonucleotides mimicking this quadruplex are found to compete with a DNA-protein complex between NHE and a nuclear extract from pancreatic cancer cells........ When modified with (R)-1-O-[4-1-(1-pyrenylethynyl) phenylmethyl]glycerol insertions (TINA), the quadruplex oligonucleotides showed a dramatic increase of the Tm (ΔTm from 22 to 32 °C) and a strong antiproliferative effects in Panc-1 cells....

Quantification of Chemical and Mechanical Effects on the Formation of the G-Quadruplex and i-Motif in Duplex DNA.

Science.gov (United States)

Selvam, Sangeetha; Mandal, Shankar; Mao, Hanbin

2017-09-05

The formation of biologically significant tetraplex DNA species, such as G-quadruplexes and i-motifs, is affected by chemical (ions and pH) and mechanical [superhelicity (σ) and molecular crowding] factors. Because of the extremely challenging experimental conditions, the relative importance of these factors on tetraplex folding is unknown. In this work, we quantitatively evaluated the chemical and mechanical effects on the population dynamics of DNA tetraplexes in the insulin-linked polymorphic region using magneto-optical tweezers. By mechanically unfolding individual tetraplexes, we found that ions and pH have the largest effects on the formation of the G-quadruplex and i-motif, respectively. Interestingly, superhelicity has the second largest effect followed by molecular crowding conditions. While chemical effects are specific to tetraplex species, mechanical factors have generic influences. The predominant effect of chemical factors can be attributed to the fact that they directly change the stability of a specific tetraplex, whereas the mechanical factors, superhelicity in particular, reduce the stability of the competing species by changing the kinetics of the melting and annealing of the duplex DNA template in a nonspecific manner. The substantial dependence of tetraplexes on superhelicity provides strong support that DNA tetraplexes can serve as topological sensors to modulate fundamental cellular processes such as transcription.

Exploring the Interactions of the Dietary Plant Flavonoids Fisetin and Naringenin with G-Quadruplex and Duplex DNA, Showing Contrasting Binding Behavior: Spectroscopic and Molecular Modeling Approaches.

Science.gov (United States)

Bhattacharjee, Snehasish; Chakraborty, Sandipan; Sengupta, Pradeep K; Bhowmik, Sudipta

2016-09-01

Guanine-rich sequences have the propensity to fold into a four-stranded DNA structure known as a G-quadruplex (G4). G4 forming sequences are abundant in the promoter region of several oncogenes and become a key target for anticancer drug binding. Here we have studied the interactions of two structurally similar dietary plant flavonoids fisetin and naringenin with G4 as well as double stranded (duplex) DNA by using different spectroscopic and modeling techniques. Our study demonstrates the differential binding ability of the two flavonoids with G4 and duplex DNA. Fisetin more strongly interacts with parallel G4 structure than duplex DNA, whereas naringenin shows stronger binding affinity to duplex rather than G4 DNA. Molecular docking results also corroborate our spectroscopic results, and it was found that both of the ligands are stacked externally in the G4 DNA structure. C-ring planarity of the flavonoid structure appears to be a crucial factor for preferential G4 DNA recognition of flavonoids. The goal of this study is to explore the critical effects of small differences in the structure of closely similar chemical classes of such small molecules (flavonoids) which lead to the contrasting binding properties with the two different forms of DNA. The resulting insights may be expected to facilitate the designing of the highly selective G4 DNA binders based on flavonoid scaffolds.

Telomere Homeostasis: Interplay with Magnesium

Directory of Open Access Journals (Sweden)

Donogh Maguire

2018-01-01

Full Text Available Telomere biology, a key component of the hallmarks of ageing, offers insight into dysregulation of normative ageing processes that accompany age-related diseases such as cancer. Telomere homeostasis is tightly linked to cellular metabolism, and in particular with mitochondrial physiology, which is also diminished during cellular senescence and normative physiological ageing. Inherent in the biochemistry of these processes is the role of magnesium, one of the main cellular ions and an essential cofactor in all reactions that use ATP. Magnesium plays an important role in many of the processes involved in regulating telomere structure, integrity and function. This review explores the mechanisms that maintain telomere structure and function, their influence on circadian rhythms and their impact on health and age-related disease. The pervasive role of magnesium in telomere homeostasis is also highlighted.

Characterization of oxidative guanine damage and repair in mammalian telomeres.

Directory of Open Access Journals (Sweden)

Zhilong Wang

2010-05-01

Full Text Available 8-oxo-7,8-dihydroguanine (8-oxoG and 2,6-diamino-4-hydroxy-5-formamidopyrimidine (FapyG are among the most common oxidative DNA lesions and are substrates for 8-oxoguanine DNA glycosylase (OGG1-initiated DNA base excision repair (BER. Mammalian telomeres consist of triple guanine repeats and are subject to oxidative guanine damage. Here, we investigated the impact of oxidative guanine damage and its repair by OGG1 on telomere integrity in mice. The mouse cells were analyzed for telomere integrity by telomere quantitative fluorescence in situ hybridization (telomere-FISH, by chromosome orientation-FISH (CO-FISH, and by indirect immunofluorescence in combination with telomere-FISH and for oxidative base lesions by Fpg-incision/Southern blot assay. In comparison to the wild type, telomere lengthening was observed in Ogg1 null (Ogg1(-/- mouse tissues and primary embryonic fibroblasts (MEFs cultivated in hypoxia condition (3% oxygen, whereas telomere shortening was detected in Ogg1(-/- mouse hematopoietic cells and primary MEFs cultivated in normoxia condition (20% oxygen or in the presence of an oxidant. In addition, telomere length abnormalities were accompanied by altered telomere sister chromatid exchanges, increased telomere single- and double-strand breaks, and preferential telomere lagging- or G-strand losses in Ogg1(-/- mouse cells. Oxidative guanine lesions were increased in telomeres in Ogg1(-/- mice with aging and primary MEFs cultivated in 20% oxygen. Furthermore, oxidative guanine lesions persisted at high level in Ogg1(-/- MEFs after acute exposure to hydrogen peroxide, while they rapidly returned to basal level in wild-type MEFs. These findings indicate that oxidative guanine damage can arise in telomeres where it affects length homeostasis, recombination, DNA replication, and DNA breakage repair. Our studies demonstrate that BER pathway is required in repairing oxidative guanine damage in telomeres and maintaining telomere integrity

Extreme telomere length dimorphism in the Tasmanian devil and related marsupials suggests parental control of telomere length.

Directory of Open Access Journals (Sweden)

Hannah S Bender

Full Text Available Telomeres, specialised structures that protect chromosome ends, play a critical role in preserving chromosome integrity. Telomere dynamics in the Tasmanian devil (Sarcophilus harrisii are of particular interest in light of the emergence of devil facial tumour disease (DFTD, a transmissible malignancy that causes rapid mortality and threatens the species with extinction. We used fluorescent in situ hybridisation to investigate telomere length in DFTD cells, in healthy Tasmanian devils and in four closely related marsupial species. Here we report that animals in the Order Dasyuromorphia have chromosomes characterised by striking telomere length dimorphism between homologues. Findings in sex chromosomes suggest that telomere length dimorphism may be regulated by events in the parental germlines. Long telomeres on the Y chromosome imply that telomere lengthening occurs during spermatogenesis, whereas telomere diminution occurs during oogenesis. Although found in several somatic cell tissue types, telomere length dimorphism was not found in DFTD cancer cells, which are characterised by uniformly short telomeres. This is, to our knowledge, the first report of naturally occurring telomere length dimorphism in any species and suggests a novel strategy of telomere length control. Comparative studies in five distantly related marsupials and a monotreme indicate that telomere dimorphism evolved at least 50 million years ago.

Role of arterial telomere dysfunction in hypertension: relative contributions of telomere shortening and telomere uncapping.

Science.gov (United States)

Morgan, R Garrett; Ives, Stephen J; Walker, Ashley E; Cawthon, Richard M; Andtbacka, Robert H I; Noyes, Dirk; Lesniewski, Lisa A; Richardson, Russell S; Donato, Anthony J

2014-06-01

Telomere shortening in arteries could lead to telomere uncapping and cellular senescence, which in turn could promote the development of hypertension. To assess the novel role of arterial telomere dysfunction in hypertension, we compared mean telomere length (qPCR), telomere uncapping (serine 139 phosphorylated histone γ-H2A.X (γ-H2) localized to telomeres: ChIP), and tumor suppressor protein p53 (P53)/cyclin-dependent kinase inhibitor 1A (P21)-induced senescence (P53 bound to P21 gene promoter: ChIP) in arteries from 55 age-matched hypertensive and nonhypertensive individuals. Arterial mean telomere length was not different in hypertensive patients compared with nonhypertensive individuals (P = 0.29). Arterial telomere uncapping and P53/P21-induced senescence were two-fold greater in hypertensive patients compared with nonhypertensive individuals (P = 0.04 and P = 0.02, respectively). Arterial mean telomere length was not associated with telomere uncapping or P53/P21-induced senescence (r = -0.02, P = 0.44 and r = 0.01, P = 0.50, respectively), but telomere uncapping was a highly influential covariate for the hypertension group difference in P53/P21-induced senescence (r = 0.62, P hypertension status (P = 0.03), whereas mean telomere length was not (P = 0.68). Collectively, these findings demonstrate that arterial telomere uncapping and P53/P21-induced senescence are linked to hypertension independently of mean telomere length, and telomere uncapping influences hypertension status more than mean telomere length.

Characterizing and controlling intrinsic biases of lambda exonuclease in nascent strand sequencing reveals phasing between nucleosomes and G-quadruplex motifs around a subset of human replication origins

DEFF Research Database (Denmark)

Foulk, M. S.; Urban, J. M.; Casella, Cinzia

2015-01-01

Nascent strand sequencing (NS-seq) is used to discover DNA replication origins genome-wide, allowing identification of features for their specification. NS-seq depends on the ability of lambda exonuclease (lambda-exo) to efficiently digest parental DNA while leaving RNA-primer protected nascent...... strands intact. We used genomics and biochemical approaches to determine if lambda-exo digests all parental DNA sequences equally. We report that lambda-exo does not efficiently digest G-quadruplex (G4) structures in a plasmid. Moreover, lambda-exo digestion of nonreplicating genomic DNA (LexoG0) enriches...... GC-rich DNA and G4 motifs genome-wide. We used LexoG0 data to control for nascent strand-independent lambda-exo biases in NSseq and validated this approach at the rDNA locus. The lambda-exo-controlled NS-seq peaks are not GC-rich, and only 35.5% overlap with 6.8% of all G4s, suggesting that G4s...

Within the genome, long telomeres are more informative than short telomeres with respect to fitness components in a long-lived seabird

NARCIS (Netherlands)

Bauch, Christina; Becker, Peter H.; Verhulst, Simon

Telomeres, DNA-protein structures at chromosome ends, shorten with age, and telomere length has been linked to age-related diseases and survival. In vitro studies revealed that the shortest telomeres trigger cell senescence, but whether the shortest telomeres are also the best biomarker of ageing is

Drosophila atm/telomere fusion is required for telomeric localization of HP1 and telomere position effect.

Science.gov (United States)

Oikemus, Sarah R; McGinnis, Nadine; Queiroz-Machado, Joana; Tukachinsky, Hanna; Takada, Saeko; Sunkel, Claudio E; Brodsky, Michael H

2004-08-01

Terminal deletions of Drosophila chromosomes can be stably protected from end-to-end fusion despite the absence of all telomere-associated sequences. The sequence-independent protection of these telomeres suggests that recognition of chromosome ends might contribute to the epigenetic protection of telomeres. In mammals, Ataxia Telangiectasia Mutated (ATM) is activated by DNA damage and acts through an unknown, telomerase-independent mechanism to regulate telomere length and protection. We demonstrate that the Drosophila homolog of ATM is encoded by the telomere fusion (tefu) gene. In the absence of ATM, telomere fusions occur even though telomere-specific Het-A sequences are still present. High levels of spontaneous apoptosis are observed in ATM-deficient tissues, indicating that telomere dysfunction induces apoptosis in Drosophila. Suppression of this apoptosis by p53 mutations suggests that loss of ATM activates apoptosis through a DNA damage-response mechanism. Loss of ATM reduces the levels of heterochromatin protein 1 (HP1) at telomeres and suppresses telomere position effect. We propose that recognition of chromosome ends by ATM prevents telomere fusion and apoptosis by recruiting chromatin-modifying complexes to telomeres.

Charge splitters and charge transport junctions based on guanine quadruplexes

Science.gov (United States)

Sha, Ruojie; Xiang, Limin; Liu, Chaoren; Balaeff, Alexander; Zhang, Yuqi; Zhang, Peng; Li, Yueqi; Beratan, David N.; Tao, Nongjian; Seeman, Nadrian C.

2018-04-01

Self-assembling circuit elements, such as current splitters or combiners at the molecular scale, require the design of building blocks with three or more terminals. A promising material for such building blocks is DNA, wherein multiple strands can self-assemble into multi-ended junctions, and nucleobase stacks can transport charge over long distances. However, nucleobase stacking is often disrupted at junction points, hindering electric charge transport between the two terminals of the junction. Here, we show that a guanine-quadruplex (G4) motif can be used as a connector element for a multi-ended DNA junction. By attaching specific terminal groups to the motif, we demonstrate that charges can enter the structure from one terminal at one end of a three-way G4 motif, and can exit from one of two terminals at the other end with minimal carrier transport attenuation. Moreover, we study four-way G4 junction structures by performing theoretical calculations to assist in the design and optimization of these connectors.

A Role for the Fifth G-Track in G-Quadruplex Forming Oncogene Promoter Sequences during Oxidative Stress: Do These "Spare Tires" Have an Evolved Function?

Science.gov (United States)

Fleming, Aaron M; Zhou, Jia; Wallace, Susan S; Burrows, Cynthia J

2015-08-26

Uncontrolled inflammation or oxidative stress generates electron-deficient species that oxidize the genome increasing its instability in cancer. The G-quadruplex (G4) sequences regulating the c-MYC , KRAS , VEGF , BCL-2 , HIF-1α , and RET oncogenes, as examples, are targets for oxidation at loop and 5'-core guanines (G) as showcased in this study by CO 3 •- oxidation of the VEGF G4. Products observed include 8-oxo-7,8-dihydroguanine (OG), spiroiminodihydantoin (Sp), and 5-guanidinohydantoin (Gh). Our previous studies found that OG and Gh, when present in the four G-tracks of the solved structure for VEGF and c-MY C, were not substrates for the base excision repair (BER) DNA glycosylases in biologically relevant KCl solutions. We now hypothesize that a fifth G-track found a few nucleotides distant from the G4 tracks involved in folding can act as a "spare tire," facilitating extrusion of a damaged G-run into a large loop that then becomes a substrate for BER. Thermodynamic, spectroscopic, and DMS footprinting studies verified the fifth domain replacing a damaged G-track with OG or Gh at a loop or core position in the VEGF G4. These new "spare tire"-containing strands with Gh in loops are now found to be substrates for initiation of BER with the NEIL1, NEIL2, and NEIL3 DNA glycosylases. The results support a hypothesis in which regulatory G4s carry a "spare-tire" fifth G-track for aiding in the repair process when these sequences are damaged by radical oxygen species, a feature observed in a large number of these sequences. Furthermore, formation and repair of oxidized bases in promoter regions may constitute an additional example of epigenetic modification, in this case of guanine bases, to regulate gene expression in which the G4 sequences act as sensors of oxidative stress.

Mycobacterium tuberculosis DinG is a structure-specific helicase that unwinds G4 DNA: implications for targeting G4 DNA as a novel therapeutic approach.

Science.gov (United States)

Thakur, Roshan Singh; Desingu, Ambika; Basavaraju, Shivakumar; Subramanya, Shreelakshmi; Rao, Desirazu N; Nagaraju, Ganesh

2014-09-05

The significance of G-quadruplexes and the helicases that resolve G4 structures in prokaryotes is poorly understood. The Mycobacterium tuberculosis genome is GC-rich and contains >10,000 sequences that have the potential to form G4 structures. In Escherichia coli, RecQ helicase unwinds G4 structures. However, RecQ is absent in M. tuberculosis, and the helicase that participates in G4 resolution in M. tuberculosis is obscure. Here, we show that M. tuberculosis DinG (MtDinG) exhibits high affinity for ssDNA and ssDNA translocation with a 5' → 3' polarity. Interestingly, MtDinG unwinds overhangs, flap structures, and forked duplexes but fails to unwind linear duplex DNA. Our data with DNase I footprinting provide mechanistic insights and suggest that MtDinG is a 5' → 3' polarity helicase. Notably, in contrast to E. coli DinG, MtDinG catalyzes unwinding of replication fork and Holliday junction structures. Strikingly, we find that MtDinG resolves intermolecular G4 structures. These data suggest that MtDinG is a multifunctional structure-specific helicase that unwinds model structures of DNA replication, repair, and recombination as well as G4 structures. We finally demonstrate that promoter sequences of M. tuberculosis PE_PGRS2, mce1R, and moeB1 genes contain G4 structures, implying that G4 structures may regulate gene expression in M. tuberculosis. We discuss these data and implicate targeting G4 structures and DinG helicase in M. tuberculosis could be a novel therapeutic strategy for culminating the infection with this pathogen. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

Dissecting the telomere-inner nuclear membrane interface formed in meiosis.

Science.gov (United States)

Pendlebury, Devon F; Fujiwara, Yasuhiro; Tesmer, Valerie M; Smith, Eric M; Shibuya, Hiroki; Watanabe, Yoshinori; Nandakumar, Jayakrishnan

2017-12-01

Tethering telomeres to the inner nuclear membrane (INM) allows homologous chromosome pairing during meiosis. The meiosis-specific protein TERB1 binds the telomeric protein TRF1 to establish telomere-INM connectivity and is essential for mouse fertility. Here we solve the structure of the human TRF1-TERB1 interface to reveal the structural basis for telomere-INM linkage. Disruption of this interface abrogates binding and compromises telomere-INM attachment in mice. An embedded CDK-phosphorylation site within the TRF1-binding region of TERB1 provides a mechanism for cap exchange, a late-pachytene phenomenon involving the dissociation of the TRF1-TERB1 complex. Indeed, further strengthening this interaction interferes with cap exchange. Finally, our biochemical analysis implicates distinct complexes for telomere-INM tethering and chromosome-end protection during meiosis. Our studies unravel the structure, stoichiometry, and physiological implications underlying telomere-INM tethering, thereby providing unprecedented insights into the unique function of telomeres in meiosis.

G-quadruplex formation in the Oct4 promoter positively regulates Oct4 expression

Czech Academy of Sciences Publication Activity Database

Renčiuk, Daniel; Ryneš, J.; Kejnovská, Iva; Foldynova-Trantirkova, S.; Andaeng, M.; Trantírek, L.; Vorlíčková, Michaela

2017-01-01

Roč. 1860, č. 2 (2017), s. 175-183 ISSN 1874-9399 R&D Projects: GA ČR(CZ) GP14-33947P; GA ČR GAP205/12/0466; GA ČR(CZ) GA15-06785S Institutional support: RVO:68081707 Keywords : linked polymorphic region * guanine quadruplexes * transcription factor Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 5.018, year: 2016

Alternative Lengthening of Telomeres: Recurrent Cytogenetic Aberrations and Chromosome Stability under Extreme Telomere Dysfunction

Directory of Open Access Journals (Sweden)

Despoina Sakellariou

2013-11-01

Full Text Available Human tumors using the alternative lengthening of telomeres (ALT exert high rates of telomere dysfunction. Numerical chromosomal aberrations are very frequent, and structural rearrangements are widely scattered among the genome. This challenging context allows the study of telomere dysfunction-driven chromosomal instability in neoplasia (CIN in a massive scale. We used molecular cytogenetics to achieve detailed karyotyping in 10 human ALT neoplastic cell lines.We identified 518 clonal recombinant chromosomes affected by 649 structural rearrangements. While all human chromosomes were involved in random or clonal, terminal, or pericentromeric rearrangements and were capable to undergo telomere healing at broken ends, a differential recombinatorial propensity of specific genomic regions was noted.We show that ALT cells undergo epigenetic modifications rendering polycentric chromosomes functionally monocentric, and because of increased terminal recombinogenicity, they generate clonal recombinant chromosomes with interstitial telomeric repeats. Losses of chromosomes 13, X, and 22, gains of 2, 3, 5, and 20, and translocation/deletion events involving several common chromosomal fragile sites (CFSs were recurrent. Long-term reconstitution of telomerase activity in ALT cells reduced significantly the rates of random ongoing telomeric and pericentromeric CIN. However, the contribution of CFS in overall CIN remained unaffected, suggesting that in ALT cells whole-genome replication stress is not suppressed by telomerase activation. Our results provide novel insights into ALT-driven CIN, unveiling in parallel specific genomic sites that may harbor genes critical for ALT cancerous cell growth.

A sensitive electrochemical aptasensor based on the co-catalysis of hemin/G-quadruplex, platinum nanoparticles and flower-like MnO2 nanosphere functionalized multi-walled carbon nanotubes.

Science.gov (United States)

Xu, Wenju; Xue, Shuyan; Yi, Huayu; Jing, Pei; Chai, Yaqin; Yuan, Ruo

2015-01-28

In this work, a sensitive electrochemical aptasensor for the detection of thrombin (TB) is developed and demonstrated based on the co-catalysis of hemin/G-quadruplex, platinum nanoparticles (PtNPs) and flower-like MnO2 nanosphere functionalized multi-walled carbon nanotubes (MWCNT-MnO2).

Short telomeres: from dyskeratosis congenita to sporadic aplastic anemia and malignancy.

Science.gov (United States)

Gramatges, Maria M; Bertuch, Alison A

2013-12-01

Telomeres are DNA-protein structures that form a protective cap on chromosome ends. As such, they prevent the natural ends of linear chromosomes from being subjected to DNA repair activities that would result in telomere fusion, degradation, or recombination. Both the DNA and protein components of the telomere are required for this essential function, because insufficient telomeric DNA length, loss of the terminal telomeric DNA structure, or deficiency of key telomere-associated factors may elicit a DNA damage response and result in cellular senescence or apoptosis. In the setting of failed checkpoint mechanisms, such DNA-protein defects can also lead to genomic instability through telomere fusions or recombination. Thus, as shown in both model systems and in humans, defects in telomere biology are implicated in cellular and organismal aging as well as in tumorigenesis. Bone marrow failure and malignancy are 2 life-threatening disease manifestations in the inherited telomere biology disorder dyskeratosis congenita. We provide an overview of basic telomere structure and maintenance. We outline the telomere biology defects observed in dyskeratosis congenita, focusing on recent discoveries in this field. Last, we review the evidence of how telomere biology may impact sporadic aplastic anemia and the risk for various cancers. Copyright © 2013 Mosby, Inc. All rights reserved.

Telomere structure and maintenance gene variants and risk of five cancer types

Science.gov (United States)

Karami, Sara; Han, Younghun; Pande, Mala; Cheng, Iona; Rudd, James; Pierce, Brandon L.; Nutter, Ellen L.; Schumacher, Fredrick R.; Kote-Jarai, Zsofia; Lindstrom, Sara; Witte, John S.; Fang, Shenying; Han, Jiali; Kraft, Peter; Hunter, David; Song, Fengju; Hung, Rayjean J.; McKay, James; Gruber, Stephen B.; Chanock, Stephen J.; Risch, Angela; Shen, Hongbing; Haiman, Christopher A.; Boardman, Lisa; Ulrich, Cornelia M.; Casey, Graham; Peters, Ulrike; Al Olama, Ali Amin; Berchuck, Andrew; Berndt, Sonja I.; Bezieau, Stephane; Brennan, Paul; Brenner, Hermann; Brinton, Louise; Caporaso, Neil; Chan, Andrew T.; Chang-Claude, Jenny; Christiani, David C.; Cunningham, Julie M.; Easton, Douglas; Eeles, Rosalind A.; Eisen, Timothy; Gala, Manish; Gallinger, Steven J.; Gayther, Simon A.; Goode, Ellen L.; Grönberg, Henrik; Henderson, Brian E.; Houlston, Richard; Joshi, Amit D.; Küry, Sébastien; Landi, Mari T.; Le Marchand, Loic; Muir, Kenneth; Newcomb, Polly A.; Permuth-Wey, Jenny; Pharoah, Paul; Phelan, Catherine; Potter, John D.; Ramus, Susan J.; Risch, Harvey; Schildkraut, Joellen; Slattery, Martha L.; Song, Honglin; Wentzensen, Nicolas; White, Emily; Wiklund, Fredrik; Zanke, Brent W.; Sellers, Thomas A.; Zheng, Wei; Chatterjee, Nilanjan; Amos, Christopher I.; Doherty, Jennifer A.

2016-01-01

Telomeres cap chromosome ends, protecting them from degradation, double-strand breaks, and end-to-end fusions. Telomeres are maintained by telomerase, a reverse transcriptase encoded by TERT, and an RNA template encoded by TERC. Loci in the TERT and adjoining CLPTM1L region are associated with risk of multiple cancers. We therefore investigated associations between variants in 22 telomere structure and maintenance gene regions and colorectal, breast, prostate, ovarian, and lung cancer risk. We performed subset-based meta-analyses of 204,993 directly-measured and imputed SNPs among 61,851 cancer cases and 74,457 controls of European descent. Independent associations for SNP minor alleles were identified using sequential conditional analysis (with gene-level P-value cutoffs ≤3.08×10−5). Of the thirteen independent SNPs observed to be associated with cancer risk, novel findings were observed for seven loci. Across the TERT-CLPTML1 region, rs12655062 was associated positively with prostate cancer, and inversely with colorectal and ovarian cancers, and rs115960372 was associated positively with prostate cancer. Across the TERC region, rs75316749 was positively associated with colorectal, breast, ovarian, and lung cancers. Across the DCLRE1B region, rs974404 and rs12144215 were inversely associated with prostate and lung cancers, and colorectal, breast, and ovarian cancers, respectively. Near POT1, rs116895242 was inversely associated with colorectal, ovarian, and lung cancers, and RTEL1 rs34978822 was inversely associated with prostate and lung cancers. The complex association patterns in telomere-related genes across cancer types may provide insight into mechanisms through which telomere dysfunction in different tissues influences cancer risk. PMID:27459707

Telomere structure and maintenance gene variants and risk of five cancer types.

Science.gov (United States)

Karami, Sara; Han, Younghun; Pande, Mala; Cheng, Iona; Rudd, James; Pierce, Brandon L; Nutter, Ellen L; Schumacher, Fredrick R; Kote-Jarai, Zsofia; Lindstrom, Sara; Witte, John S; Fang, Shenying; Han, Jiali; Kraft, Peter; Hunter, David J; Song, Fengju; Hung, Rayjean J; McKay, James; Gruber, Stephen B; Chanock, Stephen J; Risch, Angela; Shen, Hongbing; Haiman, Christopher A; Boardman, Lisa; Ulrich, Cornelia M; Casey, Graham; Peters, Ulrike; Amin Al Olama, Ali; Berchuck, Andrew; Berndt, Sonja I; Bezieau, Stephane; Brennan, Paul; Brenner, Hermann; Brinton, Louise; Caporaso, Neil; Chan, Andrew T; Chang-Claude, Jenny; Christiani, David C; Cunningham, Julie M; Easton, Douglas; Eeles, Rosalind A; Eisen, Timothy; Gala, Manish; Gallinger, Steven J; Gayther, Simon A; Goode, Ellen L; Grönberg, Henrik; Henderson, Brian E; Houlston, Richard; Joshi, Amit D; Küry, Sébastien; Landi, Mari T; Le Marchand, Loic; Muir, Kenneth; Newcomb, Polly A; Permuth-Wey, Jenny; Pharoah, Paul; Phelan, Catherine; Potter, John D; Ramus, Susan J; Risch, Harvey; Schildkraut, Joellen; Slattery, Martha L; Song, Honglin; Wentzensen, Nicolas; White, Emily; Wiklund, Fredrik; Zanke, Brent W; Sellers, Thomas A; Zheng, Wei; Chatterjee, Nilanjan; Amos, Christopher I; Doherty, Jennifer A

2016-12-15

Telomeres cap chromosome ends, protecting them from degradation, double-strand breaks, and end-to-end fusions. Telomeres are maintained by telomerase, a reverse transcriptase encoded by TERT, and an RNA template encoded by TERC. Loci in the TERT and adjoining CLPTM1L region are associated with risk of multiple cancers. We therefore investigated associations between variants in 22 telomere structure and maintenance gene regions and colorectal, breast, prostate, ovarian, and lung cancer risk. We performed subset-based meta-analyses of 204,993 directly-measured and imputed SNPs among 61,851 cancer cases and 74,457 controls of European descent. Independent associations for SNP minor alleles were identified using sequential conditional analysis (with gene-level p value cutoffs ≤3.08 × 10 -5 ). Of the thirteen independent SNPs observed to be associated with cancer risk, novel findings were observed for seven loci. Across the DCLRE1B region, rs974494 and rs12144215 were inversely associated with prostate and lung cancers, and colorectal, breast, and prostate cancers, respectively. Across the TERC region, rs75316749 was positively associated with colorectal, breast, ovarian, and lung cancers. Across the DCLRE1B region, rs974404 and rs12144215 were inversely associated with prostate and lung cancers, and colorectal, breast, and prostate cancers, respectively. Near POT1, rs116895242 was inversely associated with colorectal, ovarian, and lung cancers, and RTEL1 rs34978822 was inversely associated with prostate and lung cancers. The complex association patterns in telomere-related genes across cancer types may provide insight into mechanisms through which telomere dysfunction in different tissues influences cancer risk. © 2016 UICC.

Thermodynamic characterization of binding Oxytricha nova single strand telomere DNA with the alpha protein N-terminal domain.

Science.gov (United States)

Buczek, Pawel; Horvath, Martin P

2006-06-23

The Oxytricha nova telemere binding protein alpha subunit binds single strand DNA and participates in a nucleoprotein complex that protects the very ends of chromosomes. To understand how the N-terminal, DNA binding domain of alpha interacts with DNA we measured the stoichiometry, enthalpy (DeltaH), entropy (DeltaS), and dissociation constant (K(D-DNA)) for binding telomere DNA fragments at different temperatures and salt concentrations using native gel electrophoresis and isothermal titration calorimetry (ITC). About 85% of the total free energy of binding corresponded with non-electrostatic interactions for all DNAs. Telomere DNA fragments d(T(2)G(4)), d(T(4)G(4)), d(G(3)T(4)G(4)), and d(G(4)T(4)G(4)) each formed monovalent protein complexes. In the case of d(T(4)G(4)T(4)G(4)), which has two tandemly repeated d(TTTTTGGGG) telomere motifs, two binding sites were observed. The high-affinity "A site" has a dissociation constant, K(D-DNA(A)) = 13(+/-4) nM, while the low-affinity "B site" is characterized by K(D-DNA(B)) = 5600(+/-600) nM at 25 degrees C. Nucleotide substitution variants verified that the A site corresponds principally with the 3'-terminal portion of d(T(4)G(4)T(4)G(4)). The relative contributions of entropy (DeltaS) and enthalpy (DeltaH) for binding reactions were DNA length-dependent as was heat capacity (DeltaCp). These trends with respect to DNA length likely reflect structural transitions in the DNA molecule that are coupled with DNA-protein association. Results presented here are important for understanding early intermediates and subsequent stages in the assembly of the full telomere nucleoprotein complex and how binding events can prepare the telomere DNA for extension by telomerase, a critical event in telomere biology.

Telomeres and viruses: common themes of genome maintenance

Science.gov (United States)

Deng, Zhong; Wang, Zhuo; Lieberman, Paul M.

2012-01-01

Genome maintenance mechanisms actively suppress genetic instability associated with cancer and aging. Some viruses provoke genetic instability by subverting the host’s control of genome maintenance. Viruses have their own specialized strategies for genome maintenance, which can mimic and modify host cell processes. Here, we review some of the common features of genome maintenance utilized by viruses and host chromosomes, with a particular focus on terminal repeat (TR) elements. The TRs of cellular chromosomes, better known as telomeres, have well-established roles in cellular chromosome stability. Cellular telomeres are themselves maintained by viral-like mechanisms, including self-propagation by reverse transcription, recombination, and retrotransposition. Viral TR elements, like cellular telomeres, are essential for viral genome stability and propagation. We review the structure and function of viral repeat elements and discuss how they may share telomere-like structures and genome protection functions. We consider how viral infections modulate telomere regulatory factors for viral repurposing and can alter normal host telomere structure and chromosome stability. Understanding the common strategies of viral and cellular genome maintenance may provide new insights into viral–host interactions and the mechanisms driving genetic instability in cancer. PMID:23293769

Microwave-Assisted Synthesis of Arene Ru(II Complexes Induce Tumor Cell Apoptosis Through Selectively Binding and Stabilizing bcl-2 G-Quadruplex DNA

Directory of Open Access Journals (Sweden)

Yanhua Chen

2016-05-01

Full Text Available A series of arene Ru(II complexes coordinated with phenanthroimidazole derivatives, [(η6-C6H6Ru(lCl]Cl(1b L = p-ClPIP = 2-(4-Chlorophenylimidazole[4,5f] 1,10-phenanthroline; 2b L = m-ClPIP = 2-(3-Chlorophenylimidazole[4,5f] 1,10-phenanthroline; 3b L = p-NPIP = 2-(4-Nitrophenylimidazole[4,5f] 1,10-phenanthroline; 4b L = m-NPIP = 2-(3-Nitrophenyl imidazole [4,5f] 1,10-phenanthroline were synthesized in yields of 89.9%–92.7% under conditions of microwave irradiation heating for 30 min to liberate four arene Ru(II complexes (1b, 2b, 3b, 4b. The anti-tumor activity of 1b against various tumor cells was evaluated by MTT assay. The results indicated that this complex blocked the growth of human lung adenocarcinoma A549 cells with an IC50 of 16.59 μM. Flow cytometric analysis showed that apoptosis of A549 cells was observed following treatment with 1b. Furthermore, the in vitro DNA-binding behaviors that were confirmed by spectroscopy indicated that 1b could selectively bind and stabilize bcl-2 G-quadruplex DNA to induce apoptosis of A549 cells. Therefore, the synthesized 1b has impressive bcl-2 G-quadruplex DNA-binding and stabilizing activities with potential applications in cancer chemotherapy.

The role of telomeres in Etoposide induced tumor cell death.

Science.gov (United States)

Jeyapalan, Jessie; Leake, Alan; Ahmed, Shaheda; Saretzki, Gabriele; Tilby, Michael; von Zglinicki, Thomas

2004-09-01

Etoposide, a topoisomerase II poison is used in the treatment of a number of solid tumors. Contradictory data exist on the role of the telomere/telomerase complex in etoposide induced apoptosis. Therefore we examined the effects of etoposide treatment in the neuroblastoma cell line SHSY5Y, with very short telomeres and the acute lymphoblastic T cell line 1301, which displays extremely long telomeres. Both short-term and continuous exposure to the drug were examined. Etoposide induced widespread DNA damage followed by DNA damage foci formation and ultimately growth arrest and apoptosis in a concentration-dependent manner. However, length of telomeres and of single stranded telomeric G rich overhangs did not change significantly under the treatments in any cell line. There was no significant induction of single-strand breaks in the G-rich strand of telomeres. Telomerase activity was transiently upregulated under low concentrations of etoposide, while high concentrations resulted in decreased telomerase activity only after onset of apoptosis. Telomerase overexpression protected against etoposide induced apoptosis in fibroblasts. The data suggest that telomeres are not major signal transducers towards growth arrest or apoptosis after etoposide treatment. However, upregulation of telomerase might be part of an attempted adaptative response, which protects cells by a mechanism that might be independent of telomere length maintenance.

Tiptoeing to chromosome tips: facts, promises and perils of today's human telomere biology.

Science.gov (United States)

Fajkus, J; Simícková, M; Maláska, J

2002-04-29

The past decade has witnessed an explosion of knowledge concerning the structure and function of chromosome terminal structures-telomeres. Today's telomere research has advanced from a pure descriptive approach of DNA and protein components to an elementary understanding of telomere metabolism, and now to promising applications in medicine. These applications include 'passive' ones, among which the use of analysis of telomeres and telomerase (a cellular reverse transcriptase that synthesizes telomeres) for cancer diagnostics is the best known. The 'active' applications involve targeted downregulation or upregulation of telomere synthesis, either to mortalize immortal cancer cells, or to rejuvenate mortal somatic cells and tissues for cellular transplantations, respectively. This article reviews the basic data on structure and function of human telomeres and telomerase, as well as both passive and active applications of human telomere biology.

Isolation of deletion alleles by G4 DNA-induced mutagenesis

NARCIS (Netherlands)

Pontier, Daphne B; Kruisselbrink, Evelien; Guryev, Victor; Tijsterman, Marcel

Metazoan genomes contain thousands of sequence tracts that match the guanine-quadruplex (G4) DNA signature G(3)N(x)G(3)N(x)G(3)N(x)G(3), a motif that is intrinsically mutagenic, probably because it can form secondary structures during DNA replication. Here we show how and to what extent this feature

Telomeres, telomerase and premature ovarian failure

Directory of Open Access Journals (Sweden)

Renata Košir Pogačnik

2011-11-01

Full Text Available Telomeres are specialized structures at the ends of chromosomes, consisting of six repeated nucleotides in TTAGGG sequence. Genome stability is partly maintained by the architecture of telomeres and is gradually lost as telomeres progressively shorten with each cell replication. Critically shortened telomeres are recognized by DNA repair mechanisms as DNA damage and the cell replication cycle stops. The cell eventually dies or undergoes cell apoptosis. Telomere represents a cellular marker of biological age and are therefore also called cell mitotic clock. The enzyme that counteracts telomere shortening by adding nucleotides to the 3’ end of DNA strand is called telomerase. It is composed of the RNA subunit (TR, which is special type of messenger RNA (mRNA, the catalytic protein subunit (TERT, which works as a reverse transcriptase and numerous additional proteins. Telomerase is active in some germline, epithelial and haemopoietic cells, but in most somatic cells the activity is undetectable. In literature, the length of telomeres is closely connected with premature ovarian failure (POF. POF is generally defined as the onset of menopause before the age of 40. The causes of disease are genetical, autoimmune, iatrogenic or if we cannot establish the cause – idiopathic. A lot of studies examined correlation between idiopathic POF, length of telomeres and telomerase activity. The studies mostly show that women with POF have shortened telomeres and decreased activity of telomerase as compared to healthy women.

Design, synthesis and antimalarial activity of novel bis{N-[(pyrrolo[1,2-a]quinoxalin-4-yl)benzyl]-3-aminopropyl}amine derivatives.

Science.gov (United States)

Guillon, Jean; Cohen, Anita; Gueddouda, Nassima Meriem; Das, Rabindra Nath; Moreau, Stéphane; Ronga, Luisa; Savrimoutou, Solène; Basmaciyan, Louise; Monnier, Alix; Monget, Myriam; Rubio, Sandra; Garnerin, Timothée; Azas, Nadine; Mergny, Jean-Louis; Mullié, Catherine; Sonnet, Pascal

2017-12-01

Novel series of bis- and tris-pyrrolo[1,2-a]quinoxaline derivatives 1 were synthesized and tested for in vitro activity upon the intraerythrocytic stage of W2 and 3D7 Plasmodium falciparum strains. Biological results showed good antimalarial activity with IC 50 in the μM range. In attempting to investigate the large broad-spectrum antiprotozoal activities of these new derivatives, their properties toward Leishmania donovani were also investigated and revealed their selective antiplasmodial profile. In parallel, the in vitro cytotoxicity of these molecules was assessed on the human HepG2 cell line. Structure-activity relationships of these new synthetic compounds are discussed here. The bis-pyrrolo[1,2-a]quinoxalines 1n and 1p were identified as the most potent antimalarial candidates with selectivity index (SI) of 40.6 on W2 strain, and 39.25 on 3D7 strain, respectively. As the telomeres of the parasite could constitute an attractive target, we investigated the possibility of targeting Plasmodium telomeres by stabilizing the Plasmodium telomeric G-quadruplexes through a FRET melting assay by our new compounds.

Molecular recognition in complexes of TRF proteins with telomeric DNA.

Directory of Open Access Journals (Sweden)

Miłosz Wieczór

Full Text Available Telomeres are specialized nucleoprotein assemblies that protect the ends of linear chromosomes. In humans and many other species, telomeres consist of tandem TTAGGG repeats bound by a protein complex known as shelterin that remodels telomeric DNA into a protective loop structure and regulates telomere homeostasis. Shelterin recognizes telomeric repeats through its two major components known as Telomere Repeat-Binding Factors, TRF1 and TRF2. These two homologous proteins are therefore essential for the formation and normal function of telomeres. Indeed, TRF1 and TRF2 are implicated in a plethora of different cellular functions and their depletion leads to telomere dysfunction with chromosomal fusions, followed by apoptotic cell death. More specifically, it was found that TRF1 acts as a negative regulator of telomere length, and TRF2 is involved in stabilizing the loop structure. Consequently, these proteins are of great interest, not only because of their key role in telomere maintenance and stability, but also as potential drug targets. In the current study, we investigated the molecular basis of telomeric sequence recognition by TRF1 and TRF2 and their DNA binding mechanism. We used molecular dynamics (MD to calculate the free energy profiles for binding of TRFs to telomeric DNA. We found that the predicted binding free energies were in good agreement with experimental data. Further, different molecular determinants of binding, such as binding enthalpies and entropies, the hydrogen bonding pattern and changes in surface area, were analyzed to decompose and examine the overall binding free energies at the structural level. With this approach, we were able to draw conclusions regarding the consecutive stages of sequence-specific association, and propose a novel aspartate-dependent mechanism of sequence recognition. Finally, our work demonstrates the applicability of computational MD-based methods to studying protein-DNA interactions.

Telomere length analysis.

Science.gov (United States)

Canela, Andrés; Klatt, Peter; Blasco, María A

2007-01-01

Most somatic cells of long-lived species undergo telomere shortening throughout life. Critically short telomeres trigger loss of cell viability in tissues, which has been related to alteration of tissue function and loss of regenerative capabilities in aging and aging-related diseases. Hence, telomere length is an important biomarker for aging and can be used in the prognosis of aging diseases. These facts highlight the importance of developing methods for telomere length determination that can be employed to evaluate telomere length during the human aging process. Telomere length quantification methods have improved greatly in accuracy and sensitivity since the development of the conventional telomeric Southern blot. Here, we describe the different methodologies recently developed for telomere length quantification, as well as their potential applications for human aging studies.

Effects of G-CSF on telomere lengths in PBMCs from human immunodeficiency virus-infected patients

DEFF Research Database (Denmark)

Aladdin, H; Ullum, H; Schjerling, P

2000-01-01

, and not in CD4+ T cells. In this double-blind placebo-controlled study, we investigated the effect of granulocyte colony stimulating factor (G-CSF) treatment combined with highly active antiretroviral therapy (HAART) on mean telomere length in peripheral blood mononuclear cells (PBMC). The terminal restriction...... fragment (TRF) length showed no changes during G-CSF treatment although the number of lymphocytes increased significantly. The mean TRF length correlated positively (R = 0.552, P = 0.009) and negatively (R = -0.503, P = 0.02) to the proportion of CD4+ memory and naïve cells, respectively. Our data suggest...

The telomere length dynamic and methods of its assessment.

Science.gov (United States)

Lin, Kah-Wai; Yan, Ju

2005-01-01

Human telomeres are composed of long repeating sequences of TTAGGG, associated with a variety of telomere-binding proteins. Its function as an end-protector of chromosomes prevents the chromosome from end-to-end fusion, recombination and degradation. Telomerase acts as reverse transcriptase in the elongation of telomeres, which prevent the loss of telomeres due to the end replication problems. However, telomerase activity is detected at low level in somatic cells and high level in embryonic stem cells and tumor cells. It confers immortality to embryonic stem cells and tumor cells. In most tumor cells, telomeres are extremely short and stable. Telomere length is an important indicator of the telomerase activity in tumor cells and it may be used in the prognosis of malignancy. Thus, the assessment of telomeres length is of great experimental and clinical significance. This review describes the role of telomere and telomerase in cancer pathogenesis and the dynamics of the telomeres length in different cell types. The various methods of measurement of telomeres length, i.e. southern blot, hybridization protection assay, fluorescence in situ hybridization, primed in situ, quantitative PCR and single telomere length analysis are discussed. The principle and comparative evaluation of these methods are reviewed. The detection of G-strand overhang by telomeric-oligonucleotide ligation assay, primer extension/nick translation assay and electron microscopy are briefly discussed.

Mechanistic Studies of Oligonucleotide Aptamers With Potent Antiproliferative and Pro-Apoptotic Activity Against Prostate Cancer Cells

Science.gov (United States)

2007-05-01

Quadruplex structures in nucleic acids. Biopolymers , 2000. 56(3): p. 123-46. 16. Mills, M., et al., Unusual DNA conformations: implications for telomeres...scanning autoradiographic films and using UN-SCAN-IT gel software ( Silk Scientific Corporation, UT, USA). Band intensities were normalized as indicated in

Cation binding to 15-TBA quadruplex DNA is a multiple-pathway cation-dependent process

Science.gov (United States)

Reshetnikov, Roman V.; Sponer, Jiri; Rassokhina, Olga I.; Kopylov, Alexei M.; Tsvetkov, Philipp O.; Makarov, Alexander A.; Golovin, Andrey V.

2011-01-01

A combination of explicit solvent molecular dynamics simulation (30 simulations reaching 4 µs in total), hybrid quantum mechanics/molecular mechanics approach and isothermal titration calorimetry was used to investigate the atomistic picture of ion binding to 15-mer thrombin-binding quadruplex DNA (G-DNA) aptamer. Binding of ions to G-DNA is complex multiple pathway process, which is strongly affected by the type of the cation. The individual ion-binding events are substantially modulated by the connecting loops of the aptamer, which play several roles. They stabilize the molecule during time periods when the bound ions are not present, they modulate the route of the ion into the stem and they also stabilize the internal ions by closing the gates through which the ions enter the quadruplex. Using our extensive simulations, we for the first time observed full spontaneous exchange of internal cation between quadruplex molecule and bulk solvent at atomistic resolution. The simulation suggests that expulsion of the internally bound ion is correlated with initial binding of the incoming ion. The incoming ion then readily replaces the bound ion while minimizing any destabilization of the solute molecule during the exchange. PMID:21893589

Insights into Cdc13 Dependent Telomere Length Regulation

Energy Technology Data Exchange (ETDEWEB)

M Mason; E Skordalakes

2011-12-31

Cdc13 is a single stranded telomere binding protein that specifically localizes to the telomere ends of budding yeasts and is essential for cell viability. It caps the ends of chromosomes thus preventing chromosome end-to-end fusions and exonucleolytic degradation, events that could lead to genomic instability and senescence, the hallmark of aging. Cdc13 is also involved in telomere length regulation by recruiting or preventing access of telomerase to the telomeric overhang. Recruitment of telomerase to the telomeres for G-strand extension is required for continuous cell division, while preventing its access to the telomeres through capping the chromosome ends prevents mitotic events that could lead to cell immortality, the hall mark of carcinogenesis. Cdc13 and its putative homologues human CTC1 and POT1 are therefore key to many biological processes directly associated with life extension and cancer prevention and can be viewed as an ideal target for cancer and age related therapies.

Drosophila atm/telomere fusion is required for telomeric localization of HP1 and telomere position effect

OpenAIRE

Oikemus, Sarah R.; McGinnis, Nadine; Queiroz-Machado, Joana; Tukachinsky, Hanna; Takada, Saeko; Sunkel, Claudio E.; Brodsky, Michael H.

2004-01-01

Terminal deletions of Drosophila chromosomes can be stably protected from end-to-end fusion despite the absence of all telomere-associated sequences. The sequence-independent protection of these telomeres suggests that recognition of chromosome ends might contribute to the epigenetic protection of telomeres. In mammals, Ataxia Telangiectasia Mutated (ATM) is activated by DNA damage and acts through an unknown, telomerase-independent mechanism to regulate telomere length and protection. We dem...

Real-Time Study of the Interaction between G-Rich DNA Oligonucleotides and Lead Ion on DNA Tetrahedron-Functionalized Sensing Platform by Dual Polarization Interferometry.

Science.gov (United States)

Wang, Shuang; Lu, Shasha; Zhao, Jiahui; Huang, Jianshe; Yang, Xiurong

2017-11-29

G-quadruplex plays roles in numerous physiological and pathological processes of organisms. Due to the unique properties of G-quadruplex (e.g., forming G4/hemin complexes with catalytic activity and electron acceptability, binding with metal ions, proteins, fluorescent ligands, and so on), it has been widely applied in biosensing. But the formation process of G-quadruplex is not yet fully understood. Here, a DNA tetrahedron platform with higher reproducibility, regenerative ability, and time-saving building process was coupled with dual polarization interferometry technique for the real-time and label-free investigation of the specific interaction process of guanine-rich singled-stranded DNA (G-rich ssDNA) and Pb 2+ . The oriented immobilization of probes greatly decreased the spatial hindrance effect and improved the accessibility of the probes to the Pb 2+ ions. Through real-time monitoring of the whole formation process of the G-quadruplex, we speculated that the probes on the tetrahedron platform initially stood on the sensing surface with a random coil conformation, then the G-rich ssDNA preliminarily formed unstable G-quartets by H-bonding and cation binding, subsequently forming a completely folded and stable quadruplex structure through relatively slow strand rearrangements. On the basis of these studies, we also developed a novel sensing platform for the specific and sensitive determination of Pb 2+ and its chelating agent ethylenediaminetetraacetic acid. This study not only provides a proof-of-concept for conformational dynamics of G-quadruplex-related drugs and pathogenes, but also enriches the biosensor tools by combining nanomaterial with interfaces technique.

Integration of G-quadruplex and DNA-templated Ag NCs for nonarithmetic information processing.

Science.gov (United States)

Gao, Ru-Ru; Yao, Tian-Ming; Lv, Xiao-Yan; Zhu, Yan-Yan; Zhang, Yi-Wei; Shi, Shuo

2017-06-01

To create sophisticated molecular logic circuits from scratch, you may not believe how common the building blocks can be and how diverse and powerful such circuits can be when scaled up. Using the two simple building blocks of G-quadruplex and silver nanoclusters (Ag NCs), we experimentally construct a series of multifunctional, label-free, and multi-output logic circuits to perform nonarithmetic functions: a 1-to-2 decoder, a 4-to-2 encoder, an 8-to-3 encoder, dual transfer gates, a 2 : 1 multiplexer, and a 1 : 2 demultiplexer. Moreover, a parity checker which is capable of identifying odd and even numbers from natural numbers is constructed conceptually. Finally, a multi-valued logic gate (ternary inhibit gate) is readily achieved by taking this DNA/Ag NC system as a universal platform. All of the above logic circuits share the same building blocks, indicating the great prospects of the assembly of nanomaterials and DNA for biochemical logic devices. Considering its biocompatibility, the novel prototypes developed here may have potential applications in the fields of biological computers and medical diagnosis and serve as a promising proof of principle in the not-too-distant future.

HSV-1 Remodels Host Telomeres to Facilitate Viral Replication

Directory of Open Access Journals (Sweden)

Zhong Deng

2014-12-01

Full Text Available Telomeres protect the ends of cellular chromosomes. We show here that infection with herpes simplex virus 1 (HSV-1 results in chromosomal structural aberrations at telomeres and the accumulation of telomere dysfunction-induced DNA damage foci (TIFs. At the molecular level, HSV-1 induces transcription of telomere repeat-containing RNA (TERRA, followed by the proteolytic degradation of the telomere protein TPP1 and loss of the telomere repeat DNA signal. The HSV-1-encoded E3 ubiquitin ligase ICP0 is required for TERRA transcription and facilitates TPP1 degradation. Small hairpin RNA (shRNA depletion of TPP1 increases viral replication, indicating that TPP1 inhibits viral replication. Viral replication protein ICP8 forms foci that coincide with telomeric proteins, and ICP8-null virus failed to degrade telomere DNA signal. These findings suggest that HSV-1 reorganizes telomeres to form ICP8-associated prereplication foci and to promote viral genomic replication.

New insights into transcription fidelity: thermal stability of non-canonical structures in template DNA regulates transcriptional arrest, pause, and slippage.

Science.gov (United States)

Tateishi-Karimata, Hisae; Isono, Noburu; Sugimoto, Naoki

2014-01-01

The thermal stability and topology of non-canonical structures of G-quadruplexes and hairpins in template DNA were investigated, and the effect of non-canonical structures on transcription fidelity was evaluated quantitatively. We designed ten template DNAs: A linear sequence that does not have significant higher-order structure, three sequences that form hairpin structures, and six sequences that form G-quadruplex structures with different stabilities. Templates with non-canonical structures induced the production of an arrested, a slipped, and a full-length transcript, whereas the linear sequence produced only a full-length transcript. The efficiency of production for run-off transcripts (full-length and slipped transcripts) from templates that formed the non-canonical structures was lower than that from the linear. G-quadruplex structures were more effective inhibitors of full-length product formation than were hairpin structure even when the stability of the G-quadruplex in an aqueous solution was the same as that of the hairpin. We considered that intra-polymerase conditions may differentially affect the stability of non-canonical structures. The values of transcription efficiencies of run-off or arrest transcripts were correlated with stabilities of non-canonical structures in the intra-polymerase condition mimicked by 20 wt% polyethylene glycol (PEG). Transcriptional arrest was induced when the stability of the G-quadruplex structure (-ΔG°37) in the presence of 20 wt% PEG was more than 8.2 kcal mol(-1). Thus, values of stability in the presence of 20 wt% PEG are an important indicator of transcription perturbation. Our results further our understanding of the impact of template structure on the transcription process and may guide logical design of transcription-regulating drugs.

Do Telomeres Adapt to Physiological Stress? Exploring the Effect of Exercise on Telomere Length and Telomere-Related Proteins

Directory of Open Access Journals (Sweden)

Andrew T. Ludlow

2013-01-01

Full Text Available Aging is associated with a tissue degeneration phenotype marked by a loss of tissue regenerative capacity. Regenerative capacity is dictated by environmental and genetic factors that govern the balance between damage and repair. The age-associated changes in the ability of tissues to replace lost or damaged cells is partly the cause of many age-related diseases such as Alzheimer's disease, cardiovascular disease, type II diabetes, and sarcopenia. A well-established marker of the aging process is the length of the protective cap at the ends of chromosomes, called telomeres. Telomeres shorten with each cell division and with increasing chronological age and short telomeres have been associated with a range of age-related diseases. Several studies have shown that chronic exposure to exercise (i.e., exercise training is associated with telomere length maintenance; however, recent evidence points out several controversial issues concerning tissue-specific telomere length responses. The goals of the review are to familiarize the reader with the current telomere dogma, review the literature exploring the interactions of exercise with telomere phenotypes, discuss the mechanistic research relating telomere dynamics to exercise stimuli, and finally propose future directions for work related to telomeres and physiological stress.

Ancestral telomere shortening: a countdown that will increase mean life span?

Science.gov (United States)

Hertzog, Radu G

2006-01-01

Like cells, all mammals have a limited life span. Among cells there are a few exceptions (e.g., immortal cells), among mammals not, even if some of them live longer. Many in vitro and in vivo studies support the consensus that telomere length is strongly correlated with life span. At the somatic cellular level, long telomeres have been associated with longer life span. A different situation can be seen in immortal cells, such as cancer, germ and stem cells, where telomeres are maintained by telomerase, a specialized reverse transcriptase that is involved in synthesis of telomeres. Irrespective of telomere length, if telomerase is active, telomeres can be maintained at a sufficient length to ensure cell survival. To the contrary, telomeres shorten progressively with each cell division and when a critical telomere length (Hayflick limit) is reached, the cells undergo senescence and subsequently apoptosis. In mammals, those with the longest telomeres (e.g., mice) have the shortest life span. Furthermore, the shorter the mean telomere length, the longer the mean life span, as observed in humans (10-14 kpb) and bowhead-whales (undetermined telomere length), which have the longest mean life span among mammals. Over the past centuries, human average life span has increased. The hypothesis presented here suggests that this continual increase in the mean life span could be due to a decrease of mean telomere length over the last hundreds years. Actually, the life span is not directly influenced by length of telomeres, but rather by telomere length - dependent gene expression pattern. According to Greider, "rather than average telomere length, it is the shortest telomere length that makes the biggest difference to a cell". In the context of fast-growing global elderly population due to increase in life expectancy, it also seem to be an age related increase in cancer incidence. Nevertheless, extending healthy life span could depend on how good cells achieve, during the

Sexual differences in telomere selection in the wild.

Science.gov (United States)

Olsson, Mats; Pauliny, Angela; Wapstra, Erik; Uller, Tobias; Schwartz, Tonia; Miller, Emily; Blomqvist, Donald

2011-05-01

Telomere length is restored primarily through the action of the reverse transcriptase telomerase, which may contribute to a prolonged lifespan in some but not all species and may result in longer telomeres in one sex than the other. To what extent this is an effect of proximate mechanisms (e.g. higher stress in males, higher oestradiol/oestrogen levels in females), or is an evolved adaptation (stronger selection for telomere length in one sex), usually remains unknown. Sand lizard (Lacerta agilis) females have longer telomeres than males and better maintain telomere length through life than males do. We also show that telomere length more strongly contributes to life span and lifetime reproductive success in females than males and that telomere length is under sexually diversifying selection in the wild. Finally, we performed a selection analysis with number of recruited offspring into the adult population as a response variable with telomere length, life span and body size as predictor variables. This showed significant differences in selection pressures between the sexes with strong ongoing selection in females, with these three predictors explaining 63% of the variation in recruitment. Thus, the sexually dimorphic telomere dynamics with longer telomeres in females is a result of past and ongoing selection in sand lizards. Finally, we compared the results from our selection analyses based on Telometric-derived data to the results based on data generated by the software ImageJ. ImageJ resulted in shorter average telomere length, but this difference had virtually no qualitative effect on the patterns of ongoing selection. © 2011 Blackwell Publishing Ltd.

Telomeres and replicative senescence: Is it only length that counts?

Science.gov (United States)

von Zglinicki, T

2001-07-26

Telomeres are well established as a major 'replicometer', counting the population doublings in primary human cell cultures and ultimately triggering replicative senescence. However, neither is the pace of this biological clock inert, nor is there a fixed threshold telomere length acting as the universal trigger of replicative senescence. The available data suggest that opening of the telomeric loop and unscheduled exposure of the single-stranded G-rich telomeric overhang might act like a semaphore to signal senescent cell cycle arrest. Short telomere length, telomeric single-strand breaks, low levels of loop-stabilizing proteins, or other factors may trigger this opening of the loop. Thus, both telomere shortening and the ultimate signalling into senescence are able to integrate different environmental and genetic factors, especially oxidative stress-mediated damage, which might otherwise become a thread to genomic stability.

A Role for the Fifth G-Track in G-Quadruplex Forming Oncogene Promoter Sequences during Oxidative Stress: Do These “Spare Tires” Have an Evolved Function?

Science.gov (United States)

2015-01-01

Uncontrolled inflammation or oxidative stress generates electron-deficient species that oxidize the genome increasing its instability in cancer. The G-quadruplex (G4) sequences regulating the c-MYC, KRAS, VEGF, BCL-2, HIF-1α, and RET oncogenes, as examples, are targets for oxidation at loop and 5′-core guanines (G) as showcased in this study by CO3•– oxidation of the VEGF G4. Products observed include 8-oxo-7,8-dihydroguanine (OG), spiroiminodihydantoin (Sp), and 5-guanidinohydantoin (Gh). Our previous studies found that OG and Gh, when present in the four G-tracks of the solved structure for VEGF and c-MYC, were not substrates for the base excision repair (BER) DNA glycosylases in biologically relevant KCl solutions. We now hypothesize that a fifth G-track found a few nucleotides distant from the G4 tracks involved in folding can act as a “spare tire,” facilitating extrusion of a damaged G-run into a large loop that then becomes a substrate for BER. Thermodynamic, spectroscopic, and DMS footprinting studies verified the fifth domain replacing a damaged G-track with OG or Gh at a loop or core position in the VEGF G4. These new “spare tire”-containing strands with Gh in loops are now found to be substrates for initiation of BER with the NEIL1, NEIL2, and NEIL3 DNA glycosylases. The results support a hypothesis in which regulatory G4s carry a “spare-tire” fifth G-track for aiding in the repair process when these sequences are damaged by radical oxygen species, a feature observed in a large number of these sequences. Furthermore, formation and repair of oxidized bases in promoter regions may constitute an additional example of epigenetic modification, in this case of guanine bases, to regulate gene expression in which the G4 sequences act as sensors of oxidative stress. PMID:26405692

Mitosis, double strand break repair, and telomeres: a view from the end: how telomeres and the DNA damage response cooperate during mitosis to maintain genome stability.

Science.gov (United States)

Cesare, Anthony J

2014-11-01

Double strand break (DSB) repair is suppressed during mitosis because RNF8 and downstream DNA damage response (DDR) factors, including 53BP1, do not localize to mitotic chromatin. Discovery of the mitotic kinase-dependent mechanism that inhibits DSB repair during cell division was recently reported. It was shown that restoring mitotic DSB repair was detrimental, resulting in repair dependent genome instability and covalent telomere fusions. The telomere DDR that occurs naturally during cellular aging and in cancer is known to be refractory to G2/M checkpoint activation. Such DDR-positive telomeres, and those that occur as part of the telomere-dependent prolonged mitotic arrest checkpoint, normally pass through mitosis without covalent ligation, but result in cell growth arrest in G1 phase. The discovery that suppressing DSB repair during mitosis may function primarily to protect DDR-positive telomeres from fusing during cell division reinforces the unique cooperation between telomeres and the DDR to mediate tumor suppression. © 2014 The Author. Bioessays published by WILEY Periodicals, Inc.

The estimation of H-bond and metal ion-ligand interaction energies in the G-Quadruplex ⋯ Mn+ complexes

Science.gov (United States)

Mostafavi, Najmeh; Ebrahimi, Ali

2018-06-01

In order to characterize various interactions in the G-quadruplex ⋯ Mn+ (G-Q ⋯ Mn+) complexes, the individual H-bond (EHB) and metal ion-ligand interaction (EMO) energies have been estimated using the electron charge densities (ρs) calculated at the X ⋯ H (X = N and O) and Mn+ ⋯ O (Mn+ is an alkaline, alkaline earth and transition metal ion) bond critical points (BCPs) obtained from the atoms in molecules (AIM) analysis. The estimated values of EMO and EHB were evaluated using the structural parameters, results of natural bond orbital analysis (NBO), aromaticity indexes and atomic charges. The EMO value increase with the ratio of ionic charge to radius, e/r, where a linear correlation is observed between EMO and e/r (R = 0.97). Meaningful relationships are also observed between EMO and indexes used for aromaticity estimation. The ENH value is higher than EOH in the complexes; this is in complete agreement with the trend of N⋯Hsbnd N and O⋯Hsbnd N angles, the E (2) value of nN → σ*NH and nO → σ*NH interactions and the difference between the natural charges on the H-bonded atom and the hydrogen atom of guanine (Δq). In general, the O1MO2 angle becomes closer to 109.5° with the increase in EMO and decrease in EHB in the presence of metal ion.

Elucidate the Mechanism of Telomere Maintenance in STAG2 Mutated Tumor Cells

Science.gov (United States)

2017-12-01

normal human cells.; Cancer Research; 2017. Nothing to report. Tumor and Stem Cell Biology Loss of Tumor Suppressor STAG2 Promotes Telomere...total G- strand telomeric DNA. Themean telomere lengthwas determinedusing Telometric (Fox Chase Cancer Center). C-circle assay The C-circle assay was...bodies (APB; ref. 36) and partially single- stranded telomeric extrachromosomal (CCCTAA) DNA circles (C-circles; ref. 27), and the absence of telomerase

Telomerase and Tel1p Preferentially Associate with Short Telomeres in S. cerevisiae

Science.gov (United States)

Sabourin, Michelle; Tuzon, Creighton T.; Zakian, Virginia A.

2009-01-01

SUMMARY In diverse organisms, telomerase preferentially elongates short telomeres. We generated a single short telomere in otherwise wild-type (WT) S. cerevisiae cells. The binding of the positive regulators Ku and Cdc13p was similar at short and WT-length telomeres. The negative regulators Rif1p and Rif2p were present at the short telomere, although Rif2p levels were reduced. Two telomerase holoenzyme components, Est1p and Est2p, were preferentially enriched at short telomeres in late S/G2 phase, the time of telomerase action. Tel1p, the yeast ATM-like checkpoint kinase, was highly enriched at short telomeres from early S through G2 phase and even into the next cell cycle. Nonetheless, induction of a single short telomere did not elicit a cell-cycle arrest. Tel1p binding was dependent on Xrs2p and required for preferential binding of telomerase to short telomeres. These data suggest that Tel1p targets telomerase to the DNA ends most in need of extension. PMID:17656141

The association of telomere length and genetic variation in telomere biology genes.

Science.gov (United States)

Mirabello, Lisa; Yu, Kai; Kraft, Peter; De Vivo, Immaculata; Hunter, David J; Prescott, Jennifer; Wong, Jason Y Y; Chatterjee, Nilanjan; Hayes, Richard B; Savage, Sharon A

2010-09-01

Telomeres cap chromosome ends and are critical for genomic stability. Many telomere-associated proteins are important for telomere length maintenance. Recent genome-wide association studies (GWAS) have identified single nucleotide polymorphisms (SNPs) in genes encoding telomere-associated proteins (RTEL1 and TERT-CLPTM1) as markers of cancer risk. We conducted an association study of telomere length and 743 SNPs in 43 telomere biology genes. Telomere length in peripheral blood DNA was determined by Q-PCR in 3,646 participants from the Prostate, Lung, Colorectal, and Ovarian Cancer Screening Trial and Nurses' Health Study. We investigated associations by SNP, gene, and pathway (functional group). We found no associations between telomere length and SNPs in TERT-CLPTM1L or RTEL1. Telomere length was not significantly associated with specific functional groups. Thirteen SNPs from four genes (MEN1, MRE11A, RECQL5, and TNKS) were significantly associated with telomere length. The strongest findings were in MEN1 (gene-based P=0.006), menin, which associates with the telomerase promoter and may negatively regulate telomerase. This large association study did not find strong associations with telomere length. The combination of limited diversity and evolutionary conservation suggest that these genes may be under selective pressure. More work is needed to explore the role of genetic variants in telomere length regulation. Published 2010 Wiley-Liss, Inc.

E-type cyclins modulate telomere integrity in mammalian male meiosis.

Science.gov (United States)

Manterola, Marcia; Sicinski, Piotr; Wolgemuth, Debra J

2016-06-01

We have shown that E-type cyclins are key regulators of mammalian male meiosis. Depletion of cyclin E2 reduced fertility in male mice due to meiotic defects, involving abnormal pairing and synapsis, unrepaired DNA, and loss of telomere structure. These defects were exacerbated by additional loss of cyclin E1, and complete absence of both E-type cyclins produces a meiotic catastrophe. Here, we investigated the involvement of E-type cyclins in maintaining telomere integrity in male meiosis. Spermatocytes lacking cyclin E2 and one E1 allele (E1+/-E2-/-) displayed a high rate of telomere abnormalities but can progress to pachytene and diplotene stages. We show that their telomeres exhibited an aberrant DNA damage repair response during pachynema and that the shelterin complex proteins TRF2 and RAP2 were significantly decreased in the proximal telomeres. Moreover, the insufficient level of these proteins correlated with an increase of γ-H2AX foci in the affected telomeres and resulted in telomere associations involving TRF1 and telomere detachment in later prophase-I stages. These results suggest that E-type cyclins are key modulators of telomere integrity during meiosis by, at least in part, maintaining the balance of shelterin complex proteins, and uncover a novel role of E-type cyclins in regulating chromosome structure during male meiosis.

Telomere length modulation in human astroglial brain tumors.

Directory of Open Access Journals (Sweden)

Domenico La Torre

Full Text Available BACKGROUND: Telomeres alteration during carcinogenesis and tumor progression has been described in several cancer types. Telomeres length is stabilized by telomerase (h-TERT and controlled by several proteins that protect telomere integrity, such as the Telomere Repeat-binding Factor (TRF 1 and 2 and the tankyrase-poli-ADP-ribose polymerase (TANKs-PARP complex. OBJECTIVE: To investigate telomere dysfunction in astroglial brain tumors we analyzed telomeres length, telomerase activity and the expression of a panel of genes controlling the length and structure of telomeres in tissue samples obtained in vivo from astroglial brain tumors with different grade of malignancy. MATERIALS AND METHODS: Eight Low Grade Astrocytomas (LGA, 11 Anaplastic Astrocytomas (AA and 11 Glioblastoma Multiforme (GBM samples were analyzed. Three samples of normal brain tissue (NBT were used as controls. Telomeres length was assessed through Southern Blotting. Telomerase activity was evaluated by a telomere repeat amplification protocol (TRAP assay. The expression levels of TRF1, TRF2, h-TERT and TANKs-PARP complex were determined through Immunoblotting and RT-PCR. RESULTS: LGA were featured by an up-regulation of TRF1 and 2 and by shorter telomeres. Conversely, AA and GBM were featured by a down-regulation of TRF1 and 2 and an up-regulation of both telomerase and TANKs-PARP complex. CONCLUSIONS: In human astroglial brain tumours, up-regulation of TRF1 and TRF2 occurs in the early stages of carcinogenesis determining telomeres shortening and genomic instability. In a later stage, up-regulation of PARP-TANKs and telomerase activation may occur together with an ADP-ribosylation of TRF1, causing a reduced ability to bind telomeric DNA, telomeres elongation and tumor malignant progression.

Cation binding to 15-TBA quadruplex DNA is a multiple-pathway cation-dependent process.

Science.gov (United States)

Reshetnikov, Roman V; Sponer, Jiri; Rassokhina, Olga I; Kopylov, Alexei M; Tsvetkov, Philipp O; Makarov, Alexander A; Golovin, Andrey V

2011-12-01

A combination of explicit solvent molecular dynamics simulation (30 simulations reaching 4 µs in total), hybrid quantum mechanics/molecular mechanics approach and isothermal titration calorimetry was used to investigate the atomistic picture of ion binding to 15-mer thrombin-binding quadruplex DNA (G-DNA) aptamer. Binding of ions to G-DNA is complex multiple pathway process, which is strongly affected by the type of the cation. The individual ion-binding events are substantially modulated by the connecting loops of the aptamer, which play several roles. They stabilize the molecule during time periods when the bound ions are not present, they modulate the route of the ion into the stem and they also stabilize the internal ions by closing the gates through which the ions enter the quadruplex. Using our extensive simulations, we for the first time observed full spontaneous exchange of internal cation between quadruplex molecule and bulk solvent at atomistic resolution. The simulation suggests that expulsion of the internally bound ion is correlated with initial binding of the incoming ion. The incoming ion then readily replaces the bound ion while minimizing any destabilization of the solute molecule during the exchange. © The Author(s) 2011. Published by Oxford University Press.

Derivation of Reliable Geometries in QM Calculations of DNA Structures: Explicit Solvent QM/MM and Restrained Implicit Solvent QM Optimizations of G-Quadruplexes.

Science.gov (United States)

Gkionis, Konstantinos; Kruse, Holger; Šponer, Jiří

2016-04-12

Modern dispersion-corrected DFT methods have made it possible to perform reliable QM studies on complete nucleic acid (NA) building blocks having hundreds of atoms. Such calculations, although still limited to investigations of potential energy surfaces, enhance the portfolio of computational methods applicable to NAs and offer considerably more accurate intrinsic descriptions of NAs than standard MM. However, in practice such calculations are hampered by the use of implicit solvent environments and truncation of the systems. Conventional QM optimizations are spoiled by spurious intramolecular interactions and severe structural deformations. Here we compare two approaches designed to suppress such artifacts: partially restrained continuum solvent QM and explicit solvent QM/MM optimizations. We report geometry relaxations of a set of diverse double-quartet guanine quadruplex (GQ) DNA stems. Both methods provide neat structures without major artifacts. However, each one also has distinct weaknesses. In restrained optimizations, all errors in the target geometries (i.e., low-resolution X-ray and NMR structures) are transferred to the optimized geometries. In QM/MM, the initial solvent configuration causes some heterogeneity in the geometries. Nevertheless, both approaches represent a decisive step forward compared to conventional optimizations. We refine earlier computations that revealed sizable differences in the relative energies of GQ stems computed with AMBER MM and QM. We also explore the dependence of the QM/MM results on the applied computational protocol.

Stabilization of Reversed Replication Forks by Telomerase Drives Telomere Catastrophe.

Science.gov (United States)

Margalef, Pol; Kotsantis, Panagiotis; Borel, Valerie; Bellelli, Roberto; Panier, Stephanie; Boulton, Simon J

2018-01-25

Telomere maintenance critically depends on the distinct activities of telomerase, which adds telomeric repeats to solve the end replication problem, and RTEL1, which dismantles DNA secondary structures at telomeres to facilitate replisome progression. Here, we establish that reversed replication forks are a pathological substrate for telomerase and the source of telomere catastrophe in Rtel1 -/- cells. Inhibiting telomerase recruitment to telomeres, but not its activity, or blocking replication fork reversal through PARP1 inhibition or depleting UBC13 or ZRANB3 prevents the rapid accumulation of dysfunctional telomeres in RTEL1-deficient cells. In this context, we establish that telomerase binding to reversed replication forks inhibits telomere replication, which can be mimicked by preventing replication fork restart through depletion of RECQ1 or PARG. Our results lead us to propose that telomerase inappropriately binds to and inhibits restart of reversed replication forks within telomeres, which compromises replication and leads to critically short telomeres. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

TERRA mimicking ssRNAs prevail over the DNA substrate for telomerase in vitro due to interactions with the alternative binding site.

Science.gov (United States)

Azhibek, Dulat; Skvortsov, Dmitry; Andreeva, Anna; Zatsepin, Timofei; Arutyunyan, Alexandr; Zvereva, Maria; Dontsova, Olga

2016-06-01

Telomerase is a key component of the telomere length maintenance system in the majority of eukaryotes. Telomerase displays maximal activity in stem and cancer cells with high proliferative potential. In humans, telomerase activity is regulated by various mechanisms, including the interaction with telomere ssDNA overhangs that contain a repetitive G-rich sequence, and with noncoding RNA, Telomeric repeat-containing RNA (TERRA), that contains the same sequence. So these nucleic acids can compete for telomerase RNA templates in the cell. In this study, we have investigated the ability of different model substrates mimicking telomere DNA overhangs and TERRA RNA to compete for telomerase in vitro through a previously developed telomerase inhibitor assay. We have shown in this study that RNA oligonucleotides are better competitors for telomerase that DNA ones as RNA also use an alternative binding site on telomerase, and the presence of 2'-OH groups is significant in these interactions. In contrast to DNA, the possibility of forming intramolecular G-quadruplex structures has a minor effect for RNA binding to telomerase. Taking together our data, we propose that TERRA RNA binds better to telomerase compared with its native substrate - the 3'-end of telomere DNA overhang. As a result, some specific factor may exist that participates in switching telomerase from TERRA to the 3'-end of DNA for telomere elongation at the distinct period of a cell cycle in vivo. Copyright © 2015 John Wiley & Sons, Ltd. Copyright © 2015 John Wiley & Sons, Ltd.

RecQ-core of BLM unfolds telomeric G-quadruplex in the absence of ATP

Czech Academy of Sciences Publication Activity Database

Budhathoki, J.B.; Ray, S.; Urban, Václav; Janščák, Pavel; Yodh, J.G.; Balci, H.

2014-01-01

Roč. 42, č. 18 (2014), 11528–11545 ISSN 0305-1048 R&D Projects: GA ČR GA204/09/0565 Grant - others:U.S. National Science Foundation(US) 1430124 Institutional support: RVO:68378050 Keywords : Bloom helicase * ATP * Gquadruplex (GQ) structure * GQ destabilization Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 9.112, year: 2014

Telomere lengthening and other functions of telomerase.

Science.gov (United States)

Rubtsova, M P; Vasilkova, D P; Malyavko, A N; Naraikina, Yu V; Zvereva, M I; Dontsova, O A

2012-04-01

Telomerase is an enzyme that maintains the length of the telomere. The telomere length specifies the number of divisions a cell can undergo before it finally dies (i.e. the proliferative potential of cells). For example, telomerase is activated in embryonic cell lines and the telomere length is maintained at a constant level; therefore, these cells have an unlimited fission potential. Stem cells are characterized by a lower telomerase activity, which enables only partial compensation for the shortening of telomeres. Somatic cells are usually characterized by the absence of telomerase activity. Telomere shortening leads to the attainment of the Hayflick limit, the transition of cells to a state of senescence. The cells subsequently enter a state of crisis, accompanied by massive cell death. The surviving cells become cancer cells, which are capable both of dividing indefinitely and maintaining telomere length (usually with the aid of telomerase). Telomerase is a reverse transcriptase. It consists of two major components: telomerase RNA (TER) and reverse transcriptase (TERT). TER is a non-coding RNA, and it contains the region which serves as a template for telomere synthesis. An increasing number of articles focussing on the alternative functions of telomerase components have recently started appearing. The present review summarizes data on the structure, biogenesis, and functions of telomerase.

Evaluation of the Stability of DNA i-Motifs in the Nuclei of Living Mammalian Cells

Czech Academy of Sciences Publication Activity Database

Dzatko, S.; Krafčíková, M.; Haensel-Hertsch, R.; Fessl, T.; Fiala, R.; Loja, T.; Krafčík, D.; Mergny, Jean-Louis; Foldynova-Trantirkova, Silvie; Trantírek, L.

2018-01-01

Roč. 57, č. 8 (2018), s. 2165-2169 ISSN 1433-7851 R&D Projects: GA MŠk EF15_003/0000477 Institutional support: RVO:68081707 Keywords : g-quadruplex * telomeric dna * base-pairs * molecular switch Subject RIV: CG - Electrochemistry OBOR OECD: Electrochemistry (dry cells, batteries, fuel cells, corrosion metals, electrolysis) Impact factor: 11.994, year: 2016

Telomere Q-PNA-FISH--reliable results from stochastic signals.

Directory of Open Access Journals (Sweden)

Andrea Cukusic Kalajzic

Full Text Available Structural and functional analysis of telomeres is very important for understanding basic biological functions such as genome stability, cell growth control, senescence and aging. Recently, serious concerns have been raised regarding the reliability of current telomere measurement methods such as Southern blot and quantitative polymerase chain reaction. Since telomere length is associated with age related pathologies, including cardiovascular disease and cancer, both at the individual and population level, accurate interpretation of measured results is a necessity. The telomere Q-PNA-FISH technique has been widely used in these studies as well as in commercial analysis for the general population. A hallmark of telomere Q-PNA-FISH is the wide variation among telomere signals which has a major impact on obtained results. In the present study we introduce a specific mathematical and statistical analysis of sister telomere signals during cell culture senescence which enabled us to identify high regularity in their variations. This phenomenon explains the reproducibility of results observed in numerous telomere studies when the Q-PNA-FISH technique is used. In addition, we discuss the molecular mechanisms which probably underlie the observed telomere behavior.

NEIL3 Repairs Telomere Damage during S Phase to Secure Chromosome Segregation at Mitosis

Directory of Open Access Journals (Sweden)

Jia Zhou

2017-08-01

Full Text Available Oxidative damage to telomere DNA compromises telomere integrity. We recently reported that the DNA glycosylase NEIL3 preferentially repairs oxidative lesions in telomere sequences in vitro. Here, we show that loss of NEIL3 causes anaphase DNA bridging because of telomere dysfunction. NEIL3 expression increases during S phase and reaches maximal levels in late S/G2. NEIL3 co-localizes with TRF2 and associates with telomeres during S phase, and this association increases upon oxidative stress. Mechanistic studies reveal that NEIL3 binds to single-stranded DNA via its intrinsically disordered C terminus in a telomere-sequence-independent manner. Moreover, NEIL3 is recruited to telomeres through its interaction with TRF1, and this interaction enhances the enzymatic activity of purified NEIL3. Finally, we show that NEIL3 interacts with AP Endonuclease 1 (APE1 and the long-patch base excision repair proteins PCNA and FEN1. Taken together, we propose that NEIL3 protects genome stability through targeted repair of oxidative damage in telomeres during S/G2 phase.

Telomere Length and Mortality

DEFF Research Database (Denmark)

Kimura, Masayuki; Hjelmborg, Jacob V B; Gardner, Jeffrey P

2008-01-01

Leukocyte telomere length, representing the mean length of all telomeres in leukocytes, is ostensibly a bioindicator of human aging. The authors hypothesized that shorter telomeres might forecast imminent mortality in elderly people better than leukocyte telomere length. They performed mortality...

Association of cadmium and arsenic exposure with salivary telomere length in adolescents in Terai, Nepal

Energy Technology Data Exchange (ETDEWEB)

Fillman, Toki, E-mail: tokif@humeco.m.u-tokyo.ac.jp [Department of Human Ecology, School of International Health, Graduate School of Medicine, University of Tokyo, 7-3-1, Hongo, Bunkyo-Ku, Tokyo, 113-0033 (Japan); Shimizu-Furusawa, Hana, E-mail: hana-shimizu@umin.ac.jp [Department of Human Ecology, School of International Health, Graduate School of Medicine, University of Tokyo, 7-3-1, Hongo, Bunkyo-Ku, Tokyo, 113-0033 (Japan); Ng, Chris Fook Sheng, E-mail: chrisng-tky@umin.ac.jp [Department of Pediatric Infectious Diseases, Institute of Tropical Medicine, Nagasaki University, Nagasaki (Japan); Parajuli, Rajendra Prasad, E-mail: rp.parajuli@mcgill.ca [Basu Laboratory, CINE Building, Macdonald Campus, Faculty of Agricultural and Environmental Sciences, McGill University, Montreal, Quebec (Canada); Watanabe, Chiho, E-mail: chiho@humeco.m.u-tokyo.ac.jp [Department of Human Ecology, School of International Health, Graduate School of Medicine, University of Tokyo, 7-3-1, Hongo, Bunkyo-Ku, Tokyo, 113-0033 (Japan)

2016-08-15

Background: Cadmium and arsenic are ubiquitous metals commonly found in the environment which can harm human health. A growing body of research shows telomere length as a potential biomarker of future disease risk. Few studies have examined the effects of metals on telomere length and none have focused on adolescents. Objectives: In this study, the impact of cadmium and arsenic on salivary telomere length was studied in adolescents in Terai, Nepal. Methods: Adolescents aged 12–16 years old (n=351)were recruited where questionnaire interviews and both saliva and urine collection took place. Telomere length was determined by quantitative polymerase chain reaction using DNA extracted from saliva. Urinary cadmium and arsenic concentration were measured by inductively coupled plasma mass spectrometry. Multivariable linear regression was used to examine associations between urinary metals and salivary telomere length. Results: The geometric means and standard deviations of cadmium and arsenic were 0.33±0.33 μg/g creatinine and 196.0±301.1 μg/g creatinine, respectively. Urinary cadmium concentration was negatively associated with salivary telomere length after adjustment for confounders (β=−0.24, 95% CI −0.42,−0.07). Arsenic showed positive associations with telomere length but did not reach statistical significance. Conclusions: This is the first study to demonstrate that cadmium may shorten adolescent telomeres, even at exposure levels that may be considered low. These results agree with prior experimental and adult epidemiological studies, and also help identify the mechanism of DNA damage by cadmium. This study expanded current evidence on the harmful effects of cadmium exposure on telomere length even to adolescents. - Highlights: • This is the first study examining metal exposure on telomere length in adolescents. • Urinary cadmium levels were similar to non-industrially polluted levels in Asia. • Urinary arsenic levels were as high as groundwater

Association of cadmium and arsenic exposure with salivary telomere length in adolescents in Terai, Nepal

International Nuclear Information System (INIS)

Fillman, Toki; Shimizu-Furusawa, Hana; Ng, Chris Fook Sheng; Parajuli, Rajendra Prasad; Watanabe, Chiho

2016-01-01

Background: Cadmium and arsenic are ubiquitous metals commonly found in the environment which can harm human health. A growing body of research shows telomere length as a potential biomarker of future disease risk. Few studies have examined the effects of metals on telomere length and none have focused on adolescents. Objectives: In this study, the impact of cadmium and arsenic on salivary telomere length was studied in adolescents in Terai, Nepal. Methods: Adolescents aged 12–16 years old (n=351)were recruited where questionnaire interviews and both saliva and urine collection took place. Telomere length was determined by quantitative polymerase chain reaction using DNA extracted from saliva. Urinary cadmium and arsenic concentration were measured by inductively coupled plasma mass spectrometry. Multivariable linear regression was used to examine associations between urinary metals and salivary telomere length. Results: The geometric means and standard deviations of cadmium and arsenic were 0.33±0.33 μg/g creatinine and 196.0±301.1 μg/g creatinine, respectively. Urinary cadmium concentration was negatively associated with salivary telomere length after adjustment for confounders (β=−0.24, 95% CI −0.42,−0.07). Arsenic showed positive associations with telomere length but did not reach statistical significance. Conclusions: This is the first study to demonstrate that cadmium may shorten adolescent telomeres, even at exposure levels that may be considered low. These results agree with prior experimental and adult epidemiological studies, and also help identify the mechanism of DNA damage by cadmium. This study expanded current evidence on the harmful effects of cadmium exposure on telomere length even to adolescents. - Highlights: • This is the first study examining metal exposure on telomere length in adolescents. • Urinary cadmium levels were similar to non-industrially polluted levels in Asia. • Urinary arsenic levels were as high as groundwater

Telomerers rolle i cancer

DEFF Research Database (Denmark)

Bendix, Laila; Kølvraa, Steen

2010-01-01

Telomeres are a double-edged sword when it comes to cancer. On one hand, telomeres limit the cells' ability to divide and thereby restrict the uninhibited growth seen in cancer. On the other hand, short telomeres can initiate the chromosome instability that characterizes cancer. Diseases...... with the combination of short telomeres and high cancer risk are seen, but until now the use of telomeres as predictors of cancer has, in general, been unsuccessful. Telomeres and telomerase play an important role in further cancer development. Researchers are trying to exploit this in the development of new cancer...

Telomeres and genomic damage repair. Their implication in human pathology

International Nuclear Information System (INIS)

Perez, Maria del R.; Dubner, Diana; Michelin, Severino; Gisone, Pablo; Carosella, Edgardo D.

2002-01-01

Telomeres, functional complexed that protect eukaryotic chromosome ends, participate in the regulation of cell proliferation and could play a role in the stabilization of genomic regions in response to genotoxic stress. Their significance in human pathology becomes evident in several diseases sharing genomic instability as a common trait, in which alterations of the telomere metabolism have been demonstrated. Many of them are also associated with hypersensitivity to ionizing radiation and cancer susceptibility. Besides the specific proteins belonging to the telomeric complex, other proteins involved in the DNA repair machinery, such as ATM, BRCA1, BRCA2, PARP/tankyrase system, DNA-PK and RAD50-MRE11-NBS1 complexes, are closely related with the telomere. This suggests that the telomere sequesters DNA repair proteins for its own structure maintenance, with could also be released toward damaged sites in the genomic DNA. This communication describes essential aspects of telomere structure and function and their links with homologous recombination, non-homologous end-joining (NHEJ), V(D)J system and mismatch-repair (MMR). Several pathological conditions exhibiting alterations in some of these mechanisms are also considered. The cell response to ionizing radiation and its relationship with the telomeric metabolism is particularly taken into account as a model for studying genotoxicity. (author)

Telomere lengthening early in development.

Science.gov (United States)

Liu, Lin; Bailey, Susan M; Okuka, Maja; Muñoz, Purificación; Li, Chao; Zhou, Lingjun; Wu, Chao; Czerwiec, Eva; Sandler, Laurel; Seyfang, Andreas; Blasco, Maria A; Keefe, David L

2007-12-01

Stem cells and cancer cells maintain telomere length mostly through telomerase. Telomerase activity is high in male germ line and stem cells, but is low or absent in mature oocytes and cleavage stage embryos, and then high again in blastocysts. How early embryos reset telomere length remains poorly understood. Here, we show that oocytes actually have shorter telomeres than somatic cells, but their telomeres lengthen remarkably during early cleavage development. Moreover, parthenogenetically activated oocytes also lengthen their telomeres, thus the capacity to elongate telomeres must reside within oocytes themselves. Notably, telomeres also elongate in the early cleavage embryos of telomerase-null mice, demonstrating that telomerase is unlikely to be responsible for the abrupt lengthening of telomeres in these cells. Coincident with telomere lengthening, extensive telomere sister-chromatid exchange (T-SCE) and colocalization of the DNA recombination proteins Rad50 and TRF1 were observed in early cleavage embryos. Both T-SCE and DNA recombination proteins decrease in blastocyst stage embryos, whereas telomerase activity increases and telomeres elongate only slowly. We suggest that telomeres lengthen during the early cleavage cycles following fertilization through a recombination-based mechanism, and that from the blastocyst stage onwards, telomerase only maintains the telomere length established by this alternative mechanism.

A calmodulin-like protein (LCALA) is a new Leishmania amazonensis candidate for telomere end-binding protein.

Science.gov (United States)

Morea, Edna G O; Viviescas, Maria Alejandra; Fernandes, Carlos A H; Matioli, Fabio F; Lira, Cristina B B; Fernandez, Maribel F; Moraes, Barbara S; da Silva, Marcelo S; Storti, Camila B; Fontes, Marcos R M; Cano, Maria Isabel N

2017-11-01

Leishmania spp. telomeres are composed of 5'-TTAGGG-3' repeats associated with proteins. We have previously identified LaRbp38 and LaRPA-1 as proteins that bind the G-rich telomeric strand. At that time, we had also partially characterized a protein: DNA complex, named LaGT1, but we could not identify its protein component. Using protein-DNA interaction and competition assays, we confirmed that LaGT1 is highly specific to the G-rich telomeric single-stranded DNA. Three protein bands, with LaGT1 activity, were isolated from affinity-purified protein extracts in-gel digested, and sequenced de novo using mass spectrometry analysis. In silico analysis of the digested peptide identified them as a putative calmodulin with sequences identical to the T. cruzi calmodulin. In the Leishmania genome, the calmodulin ortholog is present in three identical copies. We cloned and sequenced one of the gene copies, named it LCalA, and obtained the recombinant protein. Multiple sequence alignment and molecular modeling showed that LCalA shares homology to most eukaryotes calmodulin. In addition, we demonstrated that LCalA is nuclear, partially co-localizes with telomeres and binds in vivo the G-rich telomeric strand. Recombinant LCalA can bind specifically and with relative affinity to the G-rich telomeric single-strand and to a 3'G-overhang, and DNA binding is calcium dependent. We have described a novel candidate component of Leishmania telomeres, LCalA, a nuclear calmodulin that binds the G-rich telomeric strand with high specificity and relative affinity, in a calcium-dependent manner. LCalA is the first reported calmodulin that binds in vivo telomeric DNA. Copyright © 2017 Elsevier B.V. All rights reserved.

Telomere Length in Circulating Lymphocytes: Association with Chromosomal Aberrations

Czech Academy of Sciences Publication Activity Database

Hemminki, K.; Rachakonda, S.; Musak, L.; Vymetálková, Veronika; Halasová, E.; Forsti,, A.; Vodičková, Ludmila; Buchancová, J.; Vodička, Pavel; Kumar, R.

2015-01-01

Roč. 54, č. 3 (2015), s. 194-196 ISSN 1045-2257 Institutional support: RVO:68378041 Keywords : structural chromosome aberrations * healthy subjects * relative telomere length * genotoxicity * telomere biology Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.960, year: 2015

HOT1 is a mammalian direct telomere repeat-binding protein contributing to telomerase recruitment

NARCIS (Netherlands)

Kappei, D.; Butter, F.; Benda, C.; Scheibe, M.; Draskovic, Irena; Stevense, M.; Novo, C.L.; Basquin, C.; Araki, M.; Araki, K.; Krastev, D.B.; Kittler, R.; Jessberger, R.; Londono-Vallejo, J.A.; Mann, M.; Buchholz, F.

2013-01-01

Telomeres are repetitive DNA structures that, together with the shelterin and the CST complex, protect the ends of chromosomes. Telomere shortening is mitigated in stem and cancer cells through the de novo addition of telomeric repeats by telomerase. Telomere elongation requires the delivery of the

Investigation of a Quadruplex-Forming Repeat Sequence Highly Enriched in Xanthomonas and Nostoc sp.

Directory of Open Access Journals (Sweden)

Charlotte Rehm

Full Text Available In prokaryotes simple sequence repeats (SSRs with unit sizes of 1-5 nucleotides (nt are causative for phase and antigenic variation. Although an increased abundance of heptameric repeats was noticed in bacteria, reports about SSRs of 6-9 nt are rare. In particular G-rich repeat sequences with the propensity to fold into G-quadruplex (G4 structures have received little attention. In silico analysis of prokaryotic genomes show putative G4 forming sequences to be abundant. This report focuses on a surprisingly enriched G-rich repeat of the type GGGNATC in Xanthomonas and cyanobacteria such as Nostoc. We studied in detail the genomes of Xanthomonas campestris pv. campestris ATCC 33913 (Xcc, Xanthomonas axonopodis pv. citri str. 306 (Xac, and Nostoc sp. strain PCC7120 (Ana. In all three organisms repeats are spread all over the genome with an over-representation in non-coding regions. Extensive variation of the number of repetitive units was observed with repeat numbers ranging from two up to 26 units. However a clear preference for four units was detected. The strong bias for four units coincides with the requirement of four consecutive G-tracts for G4 formation. Evidence for G4 formation of the consensus repeat sequences was found in biophysical studies utilizing CD spectroscopy. The G-rich repeats are preferably located between aligned open reading frames (ORFs and are under-represented in coding regions or between divergent ORFs. The G-rich repeats are preferentially located within a distance of 50 bp upstream of an ORF on the anti-sense strand or within 50 bp from the stop codon on the sense strand. Analysis of whole transcriptome sequence data showed that the majority of repeat sequences are transcribed. The genetic loci in the vicinity of repeat regions show increased genomic stability. In conclusion, we introduce and characterize a special class of highly abundant and wide-spread quadruplex-forming repeat sequences in bacteria.

Investigation of a Quadruplex-Forming Repeat Sequence Highly Enriched in Xanthomonas and Nostoc sp.

Science.gov (United States)

Rehm, Charlotte; Wurmthaler, Lena A; Li, Yuanhao; Frickey, Tancred; Hartig, Jörg S

2015-01-01

In prokaryotes simple sequence repeats (SSRs) with unit sizes of 1-5 nucleotides (nt) are causative for phase and antigenic variation. Although an increased abundance of heptameric repeats was noticed in bacteria, reports about SSRs of 6-9 nt are rare. In particular G-rich repeat sequences with the propensity to fold into G-quadruplex (G4) structures have received little attention. In silico analysis of prokaryotic genomes show putative G4 forming sequences to be abundant. This report focuses on a surprisingly enriched G-rich repeat of the type GGGNATC in Xanthomonas and cyanobacteria such as Nostoc. We studied in detail the genomes of Xanthomonas campestris pv. campestris ATCC 33913 (Xcc), Xanthomonas axonopodis pv. citri str. 306 (Xac), and Nostoc sp. strain PCC7120 (Ana). In all three organisms repeats are spread all over the genome with an over-representation in non-coding regions. Extensive variation of the number of repetitive units was observed with repeat numbers ranging from two up to 26 units. However a clear preference for four units was detected. The strong bias for four units coincides with the requirement of four consecutive G-tracts for G4 formation. Evidence for G4 formation of the consensus repeat sequences was found in biophysical studies utilizing CD spectroscopy. The G-rich repeats are preferably located between aligned open reading frames (ORFs) and are under-represented in coding regions or between divergent ORFs. The G-rich repeats are preferentially located within a distance of 50 bp upstream of an ORF on the anti-sense strand or within 50 bp from the stop codon on the sense strand. Analysis of whole transcriptome sequence data showed that the majority of repeat sequences are transcribed. The genetic loci in the vicinity of repeat regions show increased genomic stability. In conclusion, we introduce and characterize a special class of highly abundant and wide-spread quadruplex-forming repeat sequences in bacteria.

Ultrasensitive photoelectrochemical aptasensor for lead ion detection based on sensitization effect of CdTe QDs on MoS2-CdS:Mn nanocomposites by the formation of G-quadruplex structure.

Science.gov (United States)

Shi, Jian-Jun; Zhu, Jing-Chun; Zhao, Ming; Wang, Yan; Yang, Ping; He, Jie

2018-06-01

An ultrasensitive photoelectrochemical (PEC) aptasensor for lead ion (Pb 2+ ) detection was fabricated based on MoS 2 -CdS:Mn nanocomposites and sensitization effect of CdTe quantum dots (QDs). MoS 2 -CdS:Mn modified electrode was used as the PEC matrix for the immobilization of probe DNA (pDNA) labeled with CdTe QDs. Target DNA (tDNA) were hybridized with pDNA to made the QDs locate away from the electrode surface by the rod-like double helix. The detection of Pb 2+ was based on the conformational change of the pDNA to G-quadruplex structure in the presence of Pb 2+ , which made the labeled QDs move close to the electrode surface, leading to the generation of sensitization effect and evident increase of the photocurrent intensity. The linear range was 50 fM to 100 nM with a detection limit of 16.7 fM. The recoveries of the determination of Pb 2+ in real samples were in the range of 102.5-108.0%. This proposed PEC aptasensor provides a new sensing strategy for various heavy metal ions at ultralow levels. Copyright © 2018 Elsevier B.V. All rights reserved.

A new signal-on method for the detection of protein based on binding-induced strategy and photoinduced electron transfer between Ag nanoclusters and split G-quadruplex-hemin complexes

Energy Technology Data Exchange (ETDEWEB)

Zhang, Kai, E-mail: zhangkai@jsinm.org; Wang, Ke; Zhu, Xue; Xie, Minhao

2015-08-05

Proteins play important roles in biological and cellular processes. The levels of proteins can be useful biomarkers for cellular events or disease diagnosis, thus the method for sensitive and selective detection of proteins is imperative to proteins express, study, and clinical diagnosis. Herein, we report a “signal-on” platform for the assay of protein based on binding-induced strategy and photoinduced electron transfer between Ag nanoclusters and split G-quadruplex-hemin complexes. By using biotin as the affinity ligand, this simple protocol could sensitively detect streptavidin with a detection limit down to 10 pM. With the use of an antibody as the affinity ligand, a method for homogeneous fluorescence detection of Prostate Specific Antigen (PSA) was also proposed with a detection limit of 10 pM. The one-step and wash-free assay showed good selectivity. Its high sensitivity, acceptable accuracy, and satisfactory versatility of analytes led to various applications in bioanalysis. - Highlights: • AgNCs have great potential for application in biomedicine. • Binding of two affinity ligands can result in binding-induced DNA assemblies. • PET can be happened between DNA/AgNCs and G-quadruplex/hemin complexes. • A platform for the detection of proteins was proposed by using PET and binding-induced strategy.

Telomere Restriction Fragment (TRF) Analysis.

Science.gov (United States)

Mender, Ilgen; Shay, Jerry W

2015-11-20

While telomerase is expressed in ~90% of primary human tumors, most somatic tissue cells except transiently proliferating stem-like cells do not have detectable telomerase activity (Shay and Wright, 1996; Shay and Wright, 2001). Telomeres progressively shorten with each cell division in normal cells, including proliferating stem-like cells, due to the end replication (lagging strand synthesis) problem and other causes such as oxidative damage, therefore all somatic cells have limited cell proliferation capacity (Hayflick limit) (Hayflick and Moorhead, 1961; Olovnikov, 1973). The progressive telomere shortening eventually leads to growth arrest in normal cells, which is known as replicative senescence (Shay et al. , 1991). Once telomerase is activated in cancer cells, telomere length is stabilized by the addition of TTAGGG repeats to the end of chromosomes, thus enabling the limitless continuation of cell division (Shay and Wright, 1996; Shay and Wright, 2001). Therefore, the link between aging and cancer can be partially explained by telomere biology. There are many rapid and convenient methods to study telomere biology such as Telomere Restriction Fragment (TRF), Telomere Repeat Amplification Protocol (TRAP) (Mender and Shay, 2015b) and Telomere dysfunction Induced Foci (TIF) analysis (Mender and Shay, 2015a). In this protocol paper we describe Telomere Restriction Fragment (TRF) analysis to determine average telomeric length of cells. Telomeric length can be indirectly measured by a technique called Telomere Restriction Fragment analysis (TRF). This technique is a modified Southern blot, which measures the heterogeneous range of telomere lengths in a cell population using the length distribution of the terminal restriction fragments (Harley et al. , 1990; Ouellette et al. , 2000). This method can be used in eukaryotic cells. The description below focuses on the measurement of human cancer cells telomere length. The principle of this method relies on the lack of

Caspase-Dependent Apoptosis Induced by Telomere Cleavage and TRF2 Loss

Directory of Open Access Journals (Sweden)

Asha S. Multani

2000-07-01

Full Text Available Chromosomal abnormalities involving telomeric associations (TAs often precede replicative senescence and abnormal chromosome configurations. We report here that telomere cleavage following exposure to proapoptotic agents is an early event in apoptosis. Exposure of human and murine cancer cells to a variety of pro-apoptotic stimuli (staurosporine, thapsigargin, anti-Fas antibody, cancer chemotherapeutic agents resulted in telomere cleavage and aggregation, finally their extrusion from the nuclei. Telomere loss was associated with arrest of cells in G2/M phase and preceded DNA fragmentation. Telomere erosion and subsequent large-scale chromatin cleavage were inhibited by overexpression of the anti -apoptotic protein, bcl-2, two peptide caspase inhibitors (BACMK and zVADfmk, indicating that both events are regulated by caspase activation. The results demonstrate that telomere cleavage is an early chromatin alteration detected in various cancer cell lines leading to drug-induced apoptosis, suggest that this event contributes to mitotic catastrophe and induction of cell death. Results also suggest that the decrease of telomeric-repeat binding factor 2 (TRF2 may be the earliest event in the ara-C-induced telomere shortening, induction of endoreduplication and chromosomal fragmentation leading to cell death.

Telomere dysfunction and chromosome structure modulate the contribution of individual chromosomes in abnormal nuclear morphologies

Energy Technology Data Exchange (ETDEWEB)

Pampalona, J.; Soler, D.; Genesca, A. [Department of Cell Biology, Physiology and Immunology, Universitat Autonoma de Barcelona, Bellaterra E-08193 (Spain); Tusell, L., E-mail: laura.tusell@uab.es [Department of Cell Biology, Physiology and Immunology, Universitat Autonoma de Barcelona, Bellaterra E-08193 (Spain)

2010-01-05

The cytokinesis-block micronucleus assay has emerged as a biomarker of chromosome damage relevant to cancer. Although it was initially developed to measure micronuclei, it is also useful for measuring nucleoplasmic bridges and nuclear buds. Abnormal nuclear morphologies are frequently observed in malignant tissues and short-term tumour cell cultures. Changes in chromosome structure and number resulting from chromosome instability are important factors in oncogenesis. Telomeres have become key players in the initiation of chromosome instability related to carcinogenesis by means of breakage-fusion-bridge cycles. To better understand the connection between telomere dysfunction and the appearance of abnormal nuclear morphologies, we have characterised the presence of micronuclei, nucleoplasmic bridges and nuclear buds in human mammary primary epithelial cells. These cells can proliferate beyond the Hayflick limit by spontaneously losing expression of the p16{sup INK4a} protein. Progressive telomere shortening leads to the loss of the capping function, and the appearance of end-to-end chromosome fusions that can enter into breakage-fusion-bridge cycles generating massive chromosomal instability. In human mammary epithelial cells, different types of abnormal nuclear morphologies were observed, however only nucleoplasmatic bridges and buds increased significantly with population doublings. Fluorescent in situ hybridisation using centromeric and painting specific probes for chromosomes with eroded telomeres has revealed that these chromosomes are preferentially included in the different types of abnormal nuclear morphologies observed, thus reflecting their common origin. Accordingly, real-time imaging of cell divisions enabled us to determine that anaphase bridge resolution was mainly through chromatin breakage and the formation of symmetric buds in daughter nuclei. Few micronuclei emerged in this cell system thus validating the scoring of nucleoplasmic bridges and

Telomere dysfunction and chromosome structure modulate the contribution of individual chromosomes in abnormal nuclear morphologies

International Nuclear Information System (INIS)

Pampalona, J.; Soler, D.; Genesca, A.; Tusell, L.

2010-01-01

The cytokinesis-block micronucleus assay has emerged as a biomarker of chromosome damage relevant to cancer. Although it was initially developed to measure micronuclei, it is also useful for measuring nucleoplasmic bridges and nuclear buds. Abnormal nuclear morphologies are frequently observed in malignant tissues and short-term tumour cell cultures. Changes in chromosome structure and number resulting from chromosome instability are important factors in oncogenesis. Telomeres have become key players in the initiation of chromosome instability related to carcinogenesis by means of breakage-fusion-bridge cycles. To better understand the connection between telomere dysfunction and the appearance of abnormal nuclear morphologies, we have characterised the presence of micronuclei, nucleoplasmic bridges and nuclear buds in human mammary primary epithelial cells. These cells can proliferate beyond the Hayflick limit by spontaneously losing expression of the p16 INK4a protein. Progressive telomere shortening leads to the loss of the capping function, and the appearance of end-to-end chromosome fusions that can enter into breakage-fusion-bridge cycles generating massive chromosomal instability. In human mammary epithelial cells, different types of abnormal nuclear morphologies were observed, however only nucleoplasmatic bridges and buds increased significantly with population doublings. Fluorescent in situ hybridisation using centromeric and painting specific probes for chromosomes with eroded telomeres has revealed that these chromosomes are preferentially included in the different types of abnormal nuclear morphologies observed, thus reflecting their common origin. Accordingly, real-time imaging of cell divisions enabled us to determine that anaphase bridge resolution was mainly through chromatin breakage and the formation of symmetric buds in daughter nuclei. Few micronuclei emerged in this cell system thus validating the scoring of nucleoplasmic bridges and nuclear

Telomere dysfunction and chromosome structure modulate the contribution of individual chromosomes in abnormal nuclear morphologies.

Science.gov (United States)

Pampalona, J; Soler, D; Genescà, A; Tusell, L

2010-01-05

The cytokinesis-block micronucleus assay has emerged as a biomarker of chromosome damage relevant to cancer. Although it was initially developed to measure micronuclei, it is also useful for measuring nucleoplasmic bridges and nuclear buds. Abnormal nuclear morphologies are frequently observed in malignant tissues and short-term tumour cell cultures. Changes in chromosome structure and number resulting from chromosome instability are important factors in oncogenesis. Telomeres have become key players in the initiation of chromosome instability related to carcinogenesis by means of breakage-fusion-bridge cycles. To better understand the connection between telomere dysfunction and the appearance of abnormal nuclear morphologies, we have characterised the presence of micronuclei, nucleoplasmic bridges and nuclear buds in human mammary primary epithelial cells. These cells can proliferate beyond the Hayflick limit by spontaneously losing expression of the p16(INK4a) protein. Progressive telomere shortening leads to the loss of the capping function, and the appearance of end-to-end chromosome fusions that can enter into breakage-fusion-bridge cycles generating massive chromosomal instability. In human mammary epithelial cells, different types of abnormal nuclear morphologies were observed, however only nucleoplasmatic bridges and buds increased significantly with population doublings. Fluorescent in situ hybridisation using centromeric and painting specific probes for chromosomes with eroded telomeres has revealed that these chromosomes are preferentially included in the different types of abnormal nuclear morphologies observed, thus reflecting their common origin. Accordingly, real-time imaging of cell divisions enabled us to determine that anaphase bridge resolution was mainly through chromatin breakage and the formation of symmetric buds in daughter nuclei. Few micronuclei emerged in this cell system thus validating the scoring of nucleoplasmic bridges and nuclear

Telomeres, Nutrition, and Longevity: Can We Really Navigate Our Aging?

Science.gov (United States)

Vidacek, Nikolina Škrobot; Nanic, Lucia; Ravlic, Sanda; Sopta, Mary; Geric, Marko; Gajski, Goran; Garaj-Vrhovac, Vera; Rubelj, Ivica

2017-12-12

Telomeres are dynamic chromosome-end structures that serve as guardians of genome stability. They are known to be one of the major determinants of aging and longevity in higher mammals. Studies have demonstrated a direct correlation between telomere length and life expectancy, stress, DNA damage, and onset of aging-related diseases. This review discusses the most important factors that influence our telomeres. Various genetic and environmental factors such as diet, physical activity, obesity, and stress are known to influence health and longevity as well as telomere dynamics. Individuals currently have the opportunity to modulate the dynamics of their aging and health span, monitor these processes, and even make future projections by following their telomere dynamics. As telomeres react to positive as well as negative health factors, we should be able to directly influence our telomere metabolism, slow their deterioration, and diminish our aging and perhaps extend our life and health span. © The Author(s) 2017. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Mre11 and Blm-Dependent Formation of ALT-Like Telomeres in Ku-Deficient Ustilago maydis.

Directory of Open Access Journals (Sweden)

Eun Young Yu

2015-10-01

Full Text Available A subset of human cancer cells uses a specialized, aberrant recombination pathway known as ALT to maintain telomeres, which in these cells are characterized by complex aberrations including length heterogeneity, high levels of unpaired C-strand, and accumulation of extra-chromosomal telomere repeats (ECTR. These phenotypes have not been recapitulated in any standard budding or fission yeast mutant. We found that eliminating Ku70 or Ku80 in the yeast-like fungus Ustilago maydis results initially in all the characteristic telomere aberrations of ALT cancer cells, including C-circles, a highly specific marker of ALT. Subsequently the ku mutants experience permanent G2 cell cycle arrest, accompanied by loss of telomere repeats from chromosome ends and even more drastic accumulation of very short ECTRs (vsECTRs. The deletion of atr1 or chk1 rescued the lethality of the ku mutant, and "trapped" the telomere aberrations in the early ALT-like stage. Telomere abnormalities are telomerase-independent, but dramatically suppressed by deletion of mre11 or blm, suggesting major roles for these factors in the induction of the ALT pathway. In contrast, removal of other DNA damage response and repair factors such as Rad51 has disparate effects on the ALT phenotypes, suggesting that these factors process ALT intermediates or products. Notably, the antagonism of Ku and Mre11 in the induction of ALT is reminiscent of their roles in DSB resection, in which Blm is also known to play a key role. We suggest that an aberrant resection reaction may constitute an early trigger for ALT telomeres, and that the outcomes of ALT are distinct from DSB because of the unique telomere nucleoprotein structure.

Single-cell telomere-length quantification couples telomere length to meristem activity and stem cell development in Arabidopsis.

Science.gov (United States)

González-García, Mary-Paz; Pavelescu, Irina; Canela, Andrés; Sevillano, Xavier; Leehy, Katherine A; Nelson, Andrew D L; Ibañes, Marta; Shippen, Dorothy E; Blasco, Maria A; Caño-Delgado, Ana I

2015-05-12

Telomeres are specialized nucleoprotein caps that protect chromosome ends assuring cell division. Single-cell telomere quantification in animals established a critical role for telomerase in stem cells, yet, in plants, telomere-length quantification has been reported only at the organ level. Here, a quantitative analysis of telomere length of single cells in Arabidopsis root apex uncovered a heterogeneous telomere-length distribution of different cell lineages showing the longest telomeres at the stem cells. The defects in meristem and stem cell renewal observed in tert mutants demonstrate that telomere lengthening by TERT sets a replicative limit in the root meristem. Conversely, the long telomeres of the columella cells and the premature stem cell differentiation plt1,2 mutants suggest that differentiation can prevent telomere erosion. Overall, our results indicate that telomere dynamics are coupled to meristem activity and continuous growth, disclosing a critical association between telomere length, stem cell function, and the extended lifespan of plants. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

Diet, nutrition and telomere length.

Science.gov (United States)

Paul, Ligi

2011-10-01

The ends of human chromosomes are protected by DNA-protein complexes termed telomeres, which prevent the chromosomes from fusing with each other and from being recognized as a double-strand break by DNA repair proteins. Due to the incomplete replication of linear chromosomes by DNA polymerase, telomeric DNA shortens with repeated cell divisions until the telomeres reach a critical length, at which point the cells enter senescence. Telomere length is an indicator of biological aging, and dysfunction of telomeres is linked to age-related pathologies like cardiovascular disease, Parkinson disease, Alzheimer disease and cancer. Telomere length has been shown to be positively associated with nutritional status in human and animal studies. Various nutrients influence telomere length potentially through mechanisms that reflect their role in cellular functions including inflammation, oxidative stress, DNA integrity, DNA methylation and activity of telomerase, the enzyme that adds the telomeric repeats to the ends of the newly synthesized DNA. Copyright © 2011 Elsevier Inc. All rights reserved.

A Shld1-controlled POT1a provides support for repression of ATR signaling at telomeres through RPA exclusion.

Science.gov (United States)

Gong, Yi; de Lange, Titia

2010-11-12

We previously proposed that POT1 prevents ATR signaling at telomeres by excluding RPA from the single-stranded TTAGGG repeats. Here, we use a Shld1-stabilized degron-POT1a fusion (DD-POT1a) to study the telomeric ATR kinase response. In the absence of Shld1, DD-POT1a degradation resulted in rapid and reversible activation of the ATR pathway in G1 and S/G2. ATR signaling was abrogated by shRNAs to ATR and TopBP1, but shRNAs to the ATM kinase or DNA-PKcs did not affect the telomere damage response. Importantly, ATR signaling in G1 and S/G2 was reduced by shRNAs to RPA. In S/G2, RPA was readily detectable at dysfunctional telomeres, and both POT1a and POT1b were required to exclude RPA and prevent ATR activation. In G1, the accumulation of RPA at dysfunctional telomeres was strikingly less, and POT1a was sufficient to repress ATR signaling. These results support an RPA exclusion model for the repression of ATR signaling at telomeres. Copyright © 2010 Elsevier Inc. All rights reserved.

Telomere biology: Rationale for diagnostics and therapeutics in cancer.

Science.gov (United States)

Rousseau, Philippe; Autexier, Chantal

2015-01-01

The key step of carcinogenesis is the malignant transformation which is fundamentally a telomere biology dysfunction permitting cells to bypass the Hayflick limit and to divide indefinitely and uncontrollably. Thus all partners and structures involved in normal and abnormal telomere maintenance, protection and lengthening can be considered as potential anti-cancer therapeutic targets. In this Point of View we discuss, highlight and provide new perspectives from the current knowledge and understanding to position the different aspects of telomere biology and dysfunction as diagnostic, preventive and curative tools in the field of cancer.

Role of chromatin structure in telomere maintenance

Czech Academy of Sciences Publication Activity Database

Kunická, Zuzana; Muselíková Polanská, Eva; Dvořáčková, Martina; Štros, Michal; Fajkus, Jiří

2008-01-01

Roč. 28, 5C (2008), s. 193 ISSN 0250-7005. [Eighth International Conference of Anticancer Research. 17.10.2008-22.10.2008, Kos] R&D Projects: GA ČR(CZ) GA204/08/1530 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : telomeres * epigenetics * heterochromatin Subject RIV: BO - Biophysics

The functional polymorphism rs73598374:G>A (p.Asp8Asn) of the ADA gene is associated with telomerase activity and leukocyte telomere length.

Science.gov (United States)

Concetti, Fabio; Carpi, Francesco M; Nabissi, Massimo; Picciolini, Matteo; Santoni, Giorgio; Napolioni, Valerio

2015-02-01

Recent evidence demonstrated a relevant role of adenosine deaminase (ADA) in replicative senescence of T cells through its capacity to modulate telomerase activity (TA). Herein, we tested the impact of the functional polymorphism ADA rs73598374:G>A (c.22G>A, p.Asp8Asn) on telomere biology, by measuring TA and leukocyte telomere length (LTL) in healthy subjects selected according to rs73598374 genotype. rs73598374-A carriers showed lower TA (P=0.019) and shorter LTL (P=0.003), respectively, compared to G/G carriers. rs73598374-A carriers showed a stronger cross-sectional age reduction of LTL (r=-0.314, P=0.005) compared to G/G carriers (r=-0.243, P=0.022). The reduced ADA activity associated to rs73598374-A variant predisposes those carriers to display higher levels of adenosine compared to G/G carriers. Consequently, it may lead to an accelerated process of replicative senescence, causing a stronger reduction of TA and in turn shorter LTL. In conclusion, the crucial role played by replicative senescence of the immune system in several human diseases and in the aging process underscores the relevance of the present findings and also spurs interest into the possible involvement of rs73598374 in shaping the susceptibility to several age-related diseases.

A novel, simple and rapid nondenaturing FISH (ND-FISH) technique for the detection of plant telomeres. Potential used and possible target structures detected.

Science.gov (United States)

Cuadrado, Angeles; Golczyk, Hieronim; Jouve, Nicolás

2009-01-01

We report a new technique-nondenaturing FISH (ND-FISH)-for the rapid detection of plant telomeres without the need for prior denaturation of the chromosomes. In its development, two modified, synthetic oligonucleotides, 21 nt in length, fluorescently labelled at their 5' and 3' ends and complementary to either the cytidine-rich (C(3)TA(3)) or guanosine-rich (T(3)AG(3)) telomeric DNA strands, were used as probes. The high binding affinity of these probes and the short hybridization time required allows the visualization of plant telomeres in less than an hour. In tests, both probes gave strong signals visualized as double spots at both chromosome ends; this was true of both the mitotic and meiotic chromosomes of barley, wheat, rye, maize, Brachypodium distachyon and Rhoeo spathacea. They were also able to detect telomere motifs at certain intercalary sites in the chromosomes of R. spathacea. To investigate the nature of the target structures detected, the chromosomes were treated with RNase A and single strand-specific nuclease S1 before ND-FISH experiments. Signal formation was resistant to standard enzymatic treatment, but sensitive when much higher enzyme concentrations were used. The results are discussed in relation to current knowledge of telomere structure.

Telomere dysfunction and chromosome instability

Energy Technology Data Exchange (ETDEWEB)

Murnane, John P., E-mail: jmurnane@radonc.ucsf.edu [Department of Radiation Oncology, University of California San Francisco, 2340 Sutter Street, San Francisco, CA 94143-1331 (United States)

2012-02-01

The ends of chromosomes are composed of a short repeat sequence and associated proteins that together form a cap, called a telomere, that keeps the ends from appearing as double-strand breaks (DSBs) and prevents chromosome fusion. The loss of telomeric repeat sequences or deficiencies in telomeric proteins can result in chromosome fusion and lead to chromosome instability. The similarity between chromosome rearrangements resulting from telomere loss and those found in cancer cells implicates telomere loss as an important mechanism for the chromosome instability contributing to human cancer. Telomere loss in cancer cells can occur through gradual shortening due to insufficient telomerase, the protein that maintains telomeres. However, cancer cells often have a high rate of spontaneous telomere loss despite the expression of telomerase, which has been proposed to result from a combination of oncogene-mediated replication stress and a deficiency in DSB repair in telomeric regions. Chromosome fusion in mammalian cells primarily involves nonhomologous end joining (NHEJ), which is the major form of DSB repair. Chromosome fusion initiates chromosome instability involving breakage-fusion-bridge (B/F/B) cycles, in which dicentric chromosomes form bridges and break as the cell attempts to divide, repeating the process in subsequent cell cycles. Fusion between sister chromatids results in large inverted repeats on the end of the chromosome, which amplify further following additional B/F/B cycles. B/F/B cycles continue until the chromosome acquires a new telomere, most often by translocation of the end of another chromosome. The instability is not confined to a chromosome that loses its telomere, because the instability is transferred to the chromosome donating a translocation. Moreover, the amplified regions are unstable and form extrachromosomal DNA that can reintegrate at new locations. Knowledge concerning the factors promoting telomere loss and its consequences is

Cells bearing chromosome aberrations lacking one telomere are selectively blocked at the G2/M checkpoint

Energy Technology Data Exchange (ETDEWEB)

Rodriguez, Pilar [Unitat de Biologia Cel.lular, Departament de Biologia Cel.lular, Fisiologia i Immunologia, Universitat Autonoma de Barcelona, 08193 Bellaterra (Spain); Barquinero, Joan Francesc [Unitat d' Antropologia Biologica, Departament de Biologia Animal, Biologia Vegetal i Ecologia, Universitat Autonoma de Barcelona, 08193 Bellaterra (Spain); Duran, Assumpta [Unitat de Biologia Cel.lular, Departament de Biologia Cel.lular, Fisiologia i Immunologia, Universitat Autonoma de Barcelona, 08193 Bellaterra (Spain); Caballin, Maria Rosa [Unitat d' Antropologia Biologica, Departament de Biologia Animal, Biologia Vegetal i Ecologia, Universitat Autonoma de Barcelona, 08193 Bellaterra (Spain); Ribas, Montserrat [Servei de Radiofisica i Radioproteccio de l' Hospital de la Santa Creu i Sant Pau, 08025 Barcelona (Spain); Barrios, Leonardo, E-mail: Lleonard.Barrios@uab.cat [Unitat de Biologia Cel.lular, Departament de Biologia Cel.lular, Fisiologia i Immunologia, Universitat Autonoma de Barcelona, 08193 Bellaterra (Spain)

2009-11-02

Cell cycle checkpoints are part of the cellular mechanisms to maintain genomic integrity. After ionizing radiation exposure, the cells can show delay or arrest in their progression through the cell cycle, as well as an activation of the DNA repair machinery in order to reduce the damage. The G2/M checkpoint prevents G2 cells entering mitosis until the DNA damage has been reduced. The present study evaluates which G0 radiation-induced chromosome aberrations are negatively selected in the G2/M checkpoint. For this purpose, peripheral blood samples were irradiated at 1 and 3 Gy of {gamma}-rays, and lymphocytes were cultured for 48 h. Calyculin-A and Colcemid were used to analyze, in the same slide, cells in G2 and M. Chromosome spreads were consecutively analyzed by solid stain, pancentromeric and pantelomeric FISH and mFISH. The results show that the frequency of incomplete chromosome elements, those lacking a telomeric signal at one end, decreases abruptly from G2 to M. This indicates that cells with incomplete chromosome elements can progress from G0 to G2, but at the G2/M checkpoint suffer a strong negative selection.

Cells bearing chromosome aberrations lacking one telomere are selectively blocked at the G2/M checkpoint

International Nuclear Information System (INIS)

Rodriguez, Pilar; Barquinero, Joan Francesc; Duran, Assumpta; Caballin, Maria Rosa; Ribas, Montserrat; Barrios, Leonardo

2009-01-01

Cell cycle checkpoints are part of the cellular mechanisms to maintain genomic integrity. After ionizing radiation exposure, the cells can show delay or arrest in their progression through the cell cycle, as well as an activation of the DNA repair machinery in order to reduce the damage. The G2/M checkpoint prevents G2 cells entering mitosis until the DNA damage has been reduced. The present study evaluates which G0 radiation-induced chromosome aberrations are negatively selected in the G2/M checkpoint. For this purpose, peripheral blood samples were irradiated at 1 and 3 Gy of γ-rays, and lymphocytes were cultured for 48 h. Calyculin-A and Colcemid were used to analyze, in the same slide, cells in G2 and M. Chromosome spreads were consecutively analyzed by solid stain, pancentromeric and pantelomeric FISH and mFISH. The results show that the frequency of incomplete chromosome elements, those lacking a telomeric signal at one end, decreases abruptly from G2 to M. This indicates that cells with incomplete chromosome elements can progress from G0 to G2, but at the G2/M checkpoint suffer a strong negative selection.

The Role of the Telomere End Protection Complex in Telomere Main

Science.gov (United States)

2003-06-01

identification of putative substrates of ATM kinase family members. J Biol Chem, 1999. 274(53): p. 37538-43. 9. Lei, M., E.R. Podell , P. Baumann, and T.R. Cech...DNA self-recognition in the structure of Pot1 bound to telomeric single-stranded DNA. Nature, 2003. 426(6963): p. 198-203. 10. Lei, M., E.R. Podell

Selaginella moellendoffii telomeres: conserved and unique features in an ancient land plant lineage

Directory of Open Access Journals (Sweden)

Eugene V Shakirov

2012-07-01

Full Text Available Telomeres, the essential terminal regions of linear eukaryotic chromosomes, consist of G-rich DNA repeats bound by a plethora of associated proteins. While the general pathways of telomere maintenance are evolutionarily conserved, individual telomere complex components show remarkable variation between eukaryotic lineages and even within closely related species. The recent genome sequencing of the lycophyte Selaginella moellendoffii and the availability of an ever-increasing number of flowering plant genomes provides a unique opportunity to evaluate the molecular and functional evolution of telomere components from the early evolving non-seed plants to the more developmentally advanced angiosperms. Here we analyzed telomere sequence in S. moellendorffii and found it to consist of TTTAGGG repeats, typical of most plants. Telomere tracts in S. moellendorffii range from 1-5.5 kb, closely resembling Arabidopsis thaliana. We identified several S. moellendorffii genes encoding sequence homologues of proteins involved in telomere maintenance in other organisms, including CST complex components and the telomere-binding proteins POT1 and TRFL. Notable sequence similarities and differences were uncovered among the telomere-related genes in some of the plant lineages. Taken together, the data indicate that comparative analysis of the telomere complex in early diverging land plants such as S. moellendorffii and green algae will yield important insights into the evolution of telomeres and their protein constituents.

n-3 Fatty Acid Supplementation and Leukocyte Telomere Length in Patients with Chronic Kidney Disease

Directory of Open Access Journals (Sweden)

Anne Barden

2016-03-01

Full Text Available DNA telomere shortening associates with the age-related increase cardiovascular disease (CVD risk. Reducing oxidative stress, could modify telomere erosion during cell replication, and CVD risk in patients with chronic kidney disease (CKD. The effect of n-3 fatty acids and coenzyme Q10 (CoQ on telomere length was studied in a double-blind placebo-controlled trial in CKD. Eighty-five CKD patients were randomized to: n-3 fatty acids (4 g; CoQ (200 mg; both supplements; or control (4 g olive oil, daily for 8 weeks. Telomere length was measured in neutrophils and peripheral blood mononuclear cells (PBMC at baseline and 8 weeks, with and without correction for cell counts. Main and interactive effects of n-3 fatty acids and CoQ on telomere length were assessed adjusting for baseline values. F2-isoprostanes were measured as markers of oxidative stress. There was no effect of n-3 fatty acids or CoQ on neutrophil or PBMC telomere length. However, telomere length corrected for neutrophil count was increased after n-3 fatty acids (p = 0.015. Post-intervention plasma F2-isoprostanes were negative predictors of post-intervention telomere length corrected for neutrophil count (p = 0.025.The effect of n-3 fatty acids to increased telomere length corrected for neutrophil count may relate to reduced oxidative stress and increased clearance of neutrophils with shorter telomeres from the circulation. This may be a novel mechanism of modifying CVD risk in CKD patients.

G4-DNA formation in the HRAS promoter and rational design of decoy oligonucleotides for cancer therapy.

Directory of Open Access Journals (Sweden)

Alexandro Membrino

Full Text Available HRAS is a proto-oncogene involved in the tumorigenesis of urinary bladder cancer. In the HRAS promoter we identified two G-rich elements, hras-1 and hras-2, that fold, respectively, into an antiparallel and a parallel quadruplex (qhras-1, qhras-2. When we introduced in sequence hras-1 or hras-2 two point mutations that block quadruplex formation, transcription increased 5-fold, but when we stabilized the G-quadruplexes by guanidinium phthalocyanines, transcription decreased to 20% of control. By ChIP we found that sequence hras-1 is bound only by MAZ, while hras-2 is bound by MAZ and Sp1: two transcription factors recognizing guanine boxes. We also discovered by EMSA that recombinant MAZ-GST binds to both HRAS quadruplexes, while Sp1-GST only binds to qhras-1. The over-expression of MAZ and Sp1 synergistically activates HRAS transcription, while silencing each gene by RNAi results in a strong down-regulation of transcription. All these data indicate that the HRAS G-quadruplexes behave as transcription repressors. Finally, we designed decoy oligonucleotides mimicking the HRAS quadruplexes, bearing (R-1-O-[4-(1-Pyrenylethynyl phenylmethyl] glycerol and LNA modifications to increase their stability and nuclease resistance (G4-decoys. The G4-decoys repressed HRAS transcription and caused a strong antiproliferative effect, mediated by apoptosis, in T24 bladder cancer cells where HRAS is mutated.

When Telomerase Causes Telomere Loss.

Science.gov (United States)

Glousker, Galina; Lingner, Joachim

2018-02-05

Telomerase counteracts telomere shortening, preventing cellular senescence. Telomerase deficiency causes telomere syndromes because of premature telomere exhaustion in highly proliferative cells. Paradoxically, in a recent issue of Cell, Margalef et al. (2018) demonstrate that telomerase causes telomere loss in cells lacking the RTEL1 helicase, which is defective in Hoyeraal-Hreidarsson syndrome (HHS). Copyright © 2018 Elsevier Inc. All rights reserved.

Telomere length and depression

DEFF Research Database (Denmark)

Wium-Andersen, Marie Kim; Ørsted, David Dynnes; Rode, Line

2017-01-01

BACKGROUND: Depression has been cross-sectionally associated with short telomeres as a measure of biological age. However, the direction and nature of the association is currently unclear. AIMS: We examined whether short telomere length is associated with depression cross-sectionally as well...... as prospectively and genetically. METHOD: Telomere length and three polymorphisms, TERT, TERC and OBFC1, were measured in 67 306 individuals aged 20-100 years from the Danish general population and associated with register-based attendance at hospital for depression and purchase of antidepressant medication....... RESULTS: Attendance at hospital for depression was associated with short telomere length cross-sectionally, but not prospectively. Further, purchase of antidepressant medication was not associated with short telomere length cross-sectionally or prospectively. Mean follow-up was 7.6 years (range 0...

The heritability of telomere length among the elderly and oldest-old

DEFF Research Database (Denmark)

Bischoff, Claus; Graakjaer, Jesper; Petersen, Hans Christian

2005-01-01

. Structural equation models revealed that a model including additive genetic effects and non-shared environment was the best fitting model and that telomere length was moderately heritable, with an estimate that was sensitive to the telomere length standardization procedure. Sex-specific analyses showed lower...... heritability in males, although not statistically significant, which is in line with our earlier finding of a sex difference in telomere dynamics among the elderly and oldest-old....

Characterizing and controlling intrinsic biases of lambda exonuclease in nascent strand sequencing reveals phasing between nucleosomes and G-quadruplex motifs around a subset of human replication origins.

Science.gov (United States)

Foulk, Michael S; Urban, John M; Casella, Cinzia; Gerbi, Susan A

2015-05-01

Nascent strand sequencing (NS-seq) is used to discover DNA replication origins genome-wide, allowing identification of features for their specification. NS-seq depends on the ability of lambda exonuclease (λ-exo) to efficiently digest parental DNA while leaving RNA-primer protected nascent strands intact. We used genomics and biochemical approaches to determine if λ-exo digests all parental DNA sequences equally. We report that λ-exo does not efficiently digest G-quadruplex (G4) structures in a plasmid. Moreover, λ-exo digestion of nonreplicating genomic DNA (LexoG0) enriches GC-rich DNA and G4 motifs genome-wide. We used LexoG0 data to control for nascent strand-independent λ-exo biases in NS-seq and validated this approach at the rDNA locus. The λ-exo-controlled NS-seq peaks are not GC-rich, and only 35.5% overlap with 6.8% of all G4s, suggesting that G4s are not general determinants for origin specification but may play a role for a subset. Interestingly, we observed a periodic spacing of G4 motifs and nucleosomes around the peak summits, suggesting that G4s may position nucleosomes at this subset of origins. Finally, we demonstrate that use of Na(+) instead of K(+) in the λ-exo digestion buffer reduced the effect of G4s on λ-exo digestion and discuss ways to increase both the sensitivity and specificity of NS-seq. © 2015 Foulk et al.; Published by Cold Spring Harbor Laboratory Press.

Involvement of DNA repair in telomere maintenance and chromosomal instability in human cells

International Nuclear Information System (INIS)

Ayouaz, Ali

2008-01-01

Telomeres are a major actor of cell immortalization, precursor of a carcinogenesis process. Thus, it appears that the maintenance of telomeres is crucial in the implementation of carcinogenesis process. Due to their structures and under some conditions, telomeres can be assimilated in some respects to chromosomal breakages. Within this perspective, this research thesis aims at determining under which circumstances telomeres can be taken as targets by DNA repair mechanisms. More precisely, the author addressed the respective contributions of two repair mechanisms (the Non-Homologous End-Joining or NHEJ, and Homologous Recombination or HR) in the maintenance of telomere integrity. The author first discusses knowledge related to the interaction between chromosomal extremities and repair mechanisms. Then, he defines the behaviour of these mechanisms with respect to telomeres. He shows that, in absence of recombination mechanisms, the integrity of telomeres is not affected. Finally, he reports the attempt to determine their respective contributions in telomeric homeostasis [fr

Telomere length maintenance--an ALTernative mechanism.

Science.gov (United States)

Royle, N J; Foxon, J; Jeyapalan, J N; Mendez-Bermudez, A; Novo, C L; Williams, J; Cotton, V E

2008-01-01

The Alternative Lengthening of Telomeres (ALT) mechanism is utilised by approximately 10% of human tumours and a higher proportion of some types of sarcomas. ALT+ cell lines and tumours show heterogeneous telomere length, extra-chromosomal circular and linear telomeric DNA, ALT associated promyelocytic bodies (APBs), a high frequency of post-replication exchanges in telomeres (designated as telomere-sister chromatid exchanges, T-SCE) and high instability at a GC-rich minisatellite, MS32 (D1S8). It is clear that there is a link between the minisatellite instability and the mechanism that underpins ALT, however currently the nature of this relationship is uncertain. Single molecule analysis of telomeric DNA from ALT+ cell lines and tumours has revealed complex telomere mutations that have not been seen in cell lines or tumours that express telomerase. These complex telomere mutations cannot be explained by T-SCE but must arise by another inter-molecular process. The break-induced replication (BIR) model that may explain the observed high frequency of T-SCE and the presence of complex telomere mutations is reviewed. Copyright 2008 S. Karger AG, Basel.

Drosophila: Retrotransposons Making up Telomeres.

Science.gov (United States)

Casacuberta, Elena

2017-07-19

Drosophila and extant species are the best-studied telomerase exception. In this organism, telomere elongation is coupled with targeted retrotransposition of Healing Transposon (HeT-A) and Telomere Associated Retrotransposon (TART) with sporadic additions of Telomere Associated and HeT-A Related (TAHRE), all three specialized non-Long Terminal Repeat (non-LTR) retrotransposons. These three very special retroelements transpose in head to tail arrays, always in the same orientation at the end of the chromosomes but never in interior locations. Apparently, retrotransposon and telomerase telomeres might seem very different, but a detailed view of their mechanisms reveals similarities explaining how the loss of telomerase in a Drosophila ancestor could successfully have been replaced by the telomere retrotransposons. In this review, we will discover that although HeT-A, TART, and TAHRE are still the only examples to date where their targeted transposition is perfectly tamed into the telomere biology of Drosophila, there are other examples of retrotransposons that manage to successfully integrate inside and at the end of telomeres. Because the aim of this special issue is viral integration at telomeres, understanding the base of the telomerase exceptions will help to obtain clues on similar strategies that mobile elements and viruses could have acquired in order to ensure their survival in the host genome.

TRF2 Recruits RTEL1 to Telomeres in S Phase to Promote T-Loop Unwinding

OpenAIRE

Sarek, Grzegorz; Vannier, Jean-Baptiste; Panier, Stephanie; Petrini, John?H.J.; Boulton, Simon?J.

2015-01-01

Summary The helicase RTEL1 promotes t-loop unwinding and suppresses telomere fragility to maintain the integrity of vertebrate telomeres. An interaction between RTEL1 and PCNA is important to prevent telomere fragility, but how RTEL1 engages with the telomere to promote t-loop unwinding is unclear. Here, we establish that the shelterin protein TRF2 recruits RTEL1 to telomeres in S phase, which is required to?prevent catastrophic t-loop processing by structure-specific nucleases. We show that ...

Accelerated Telomere Shortening in Acromegaly; IGF-I Induces Telomere Shortening and Cellular Senescence.

Science.gov (United States)

Matsumoto, Ryusaku; Fukuoka, Hidenori; Iguchi, Genzo; Odake, Yukiko; Yoshida, Kenichi; Bando, Hironori; Suda, Kentaro; Nishizawa, Hitoshi; Takahashi, Michiko; Yamada, Shozo; Ogawa, Wataru; Takahashi, Yutaka

2015-01-01

Patients with acromegaly exhibit reduced life expectancy and increased prevalence of age-related diseases, such as diabetes, hypertension, and cardiovascular disease. However, the underlying mechanism has not been fully elucidated. Telomere shortening is reportedly associated with reduced life expectancy and increased prevalence of these age-related diseases. We measured telomere length in patients with acromegaly using quantitative PCR method. The effect of GH and IGF-I on telomere length and cellular senescence was examined in human skin fibroblasts. Patients with acromegaly exhibited shorter telomere length than age-, sex-, smoking-, and diabetes-matched control patients with non-functioning pituitary adenoma (0.62 ± 0.23 vs. 0.75 ± 0.35, respectively, P = 0.047). In addition, telomere length in acromegaly was negatively correlated with the disease duration (R2 = 0.210, P = 0.003). In vitro analysis revealed that not GH but IGF-I induced telomere shortening in human skin fibroblasts. Furthermore, IGF-I-treated cells showed increased senescence-associated β-galactosidase activity and expression of p53 and p21 protein. IGF-I-treated cells reached the Hayflick limit earlier than GH- or vehicle-treated cells, indicating that IGF-I induces cellular senescence. Shortened telomeres in acromegaly and cellular senescence induced by IGF-I can explain, in part, the underlying mechanisms by which acromegaly exhibits an increased morbidity and mortality in association with the excess secretion of IGF-I.

Nature vs nurture: interplay between the genetic control of telomere length and environmental factors.

Science.gov (United States)

Harari, Yaniv; Romano, Gal-Hagit; Ungar, Lior; Kupiec, Martin

2013-11-15

Telomeres are nucleoprotein structures that cap the ends of the linear eukaryotic chromosomes, thus protecting their stability and integrity. They play important roles in DNA replication and repair and are central to our understanding of aging and cancer development. In rapidly dividing cells, telomere length is maintained by the activity of telomerase. About 400 TLM (telomere length maintenance) genes have been identified in yeast, as participants of an intricate homeostasis network that keeps telomere length constant. Two papers have recently shown that despite this extremely complex control, telomere length can be manipulated by external stimuli. These results have profound implications for our understanding of cellular homeostatic systems in general and of telomere length maintenance in particular. In addition, they point to the possibility of developing aging and cancer therapies based on telomere length manipulation.

Does oxidative stress shorten telomeres?

NARCIS (Netherlands)

Boonekamp, Jelle J.; Bauch, Christina; Mulder, Ellis; Verhulst, Simon

Oxidative stress shortens telomeres in cell culture, but whether oxidative stress explains variation in telomere shortening in vivo at physiological oxidative stress levels is not well known. We therefore tested for correlations between six oxidative stress markers and telomere attrition in nestling

Accelerated Telomere Shortening in Acromegaly; IGF-I Induces Telomere Shortening and Cellular Senescence.

Directory of Open Access Journals (Sweden)

Ryusaku Matsumoto

Full Text Available Patients with acromegaly exhibit reduced life expectancy and increased prevalence of age-related diseases, such as diabetes, hypertension, and cardiovascular disease. However, the underlying mechanism has not been fully elucidated. Telomere shortening is reportedly associated with reduced life expectancy and increased prevalence of these age-related diseases.We measured telomere length in patients with acromegaly using quantitative PCR method. The effect of GH and IGF-I on telomere length and cellular senescence was examined in human skin fibroblasts.Patients with acromegaly exhibited shorter telomere length than age-, sex-, smoking-, and diabetes-matched control patients with non-functioning pituitary adenoma (0.62 ± 0.23 vs. 0.75 ± 0.35, respectively, P = 0.047. In addition, telomere length in acromegaly was negatively correlated with the disease duration (R2 = 0.210, P = 0.003. In vitro analysis revealed that not GH but IGF-I induced telomere shortening in human skin fibroblasts. Furthermore, IGF-I-treated cells showed increased senescence-associated β-galactosidase activity and expression of p53 and p21 protein. IGF-I-treated cells reached the Hayflick limit earlier than GH- or vehicle-treated cells, indicating that IGF-I induces cellular senescence.Shortened telomeres in acromegaly and cellular senescence induced by IGF-I can explain, in part, the underlying mechanisms by which acromegaly exhibits an increased morbidity and mortality in association with the excess secretion of IGF-I.

Accelerated Telomere Shortening in Acromegaly; IGF-I Induces Telomere Shortening and Cellular Senescence

Science.gov (United States)

Matsumoto, Ryusaku; Fukuoka, Hidenori; Iguchi, Genzo; Odake, Yukiko; Yoshida, Kenichi; Bando, Hironori; Suda, Kentaro; Nishizawa, Hitoshi; Takahashi, Michiko; Yamada, Shozo; Ogawa, Wataru; Takahashi, Yutaka

2015-01-01

Objective Patients with acromegaly exhibit reduced life expectancy and increased prevalence of age-related diseases, such as diabetes, hypertension, and cardiovascular disease. However, the underlying mechanism has not been fully elucidated. Telomere shortening is reportedly associated with reduced life expectancy and increased prevalence of these age-related diseases. Methods We measured telomere length in patients with acromegaly using quantitative PCR method. The effect of GH and IGF-I on telomere length and cellular senescence was examined in human skin fibroblasts. Results Patients with acromegaly exhibited shorter telomere length than age-, sex-, smoking-, and diabetes-matched control patients with non-functioning pituitary adenoma (0.62 ± 0.23 vs. 0.75 ± 0.35, respectively, P = 0.047). In addition, telomere length in acromegaly was negatively correlated with the disease duration (R 2 = 0.210, P = 0.003). In vitro analysis revealed that not GH but IGF-I induced telomere shortening in human skin fibroblasts. Furthermore, IGF-I-treated cells showed increased senescence-associated β-galactosidase activity and expression of p53 and p21 protein. IGF-I-treated cells reached the Hayflick limit earlier than GH- or vehicle-treated cells, indicating that IGF-I induces cellular senescence. Conclusion Shortened telomeres in acromegaly and cellular senescence induced by IGF-I can explain, in part, the underlying mechanisms by which acromegaly exhibits an increased morbidity and mortality in association with the excess secretion of IGF-I. PMID:26448623

Telomere in Aging and Age-Related Diseases

Directory of Open Access Journals (Sweden)

Anna Meiliana

2017-12-01

Full Text Available BACKGROUND: The number of elderly population in the world keep increasing. In their advanced ages, many elderly face years of disability because of multiple chronic diseases, frailty, making them lost their independence. Consequently, this could have impacts on social and economic stability. A huge challenge has been sent for biomedical researchers to compress or at least eliminate this period of disability and increase the health span. CONTENT: Over the past decades, many studies of telomere biology have demonstrated that telomeres and telomere-associated proteins are implicated in human diseases. Accelerated telomere erosion was clearly correlated with a pack of metabolic and inflammatory diseases. Critically short telomeres or the unprotected end, are likely to form telomeric fusion, generating genomic instability, the cornerstone for carcinogenesis. Enlightening how telomeres involved in the mechanisms underlying the diseases’ pathogenesis was expected to uncover new molecular targets for any important diagnosis or therapeutic implications. SUMMARY: Telomere shortening was foreseen as an imporant mechanism to supress tumor by limiting cellular proliferative capacity by regulating senescence check point activation. Many human diseases and carcinogenesis are causally related to defective telomeres, asserting the importance of telomeres sustainment. Thus, telomere length assessment might serve as an important tool for clinical prognostic, diagnostic, monitoring and management. KEYWORDS: telomerase, cellular senescence, aging, cancer

Human RTEL1 stabilizes long G-overhangs allowing telomerase-dependent over-extension.

Science.gov (United States)

Porreca, Rosa M; Glousker, Galina; Awad, Aya; Matilla Fernandez, Maria I; Gibaud, Anne; Naucke, Christian; Cohen, Scott B; Bryan, Tracy M; Tzfati, Yehuda; Draskovic, Irena; Londoño-Vallejo, Arturo

2018-05-18

Telomere maintenance protects the cell against genome instability and senescence. Accelerated telomere attrition is a characteristic of premature aging syndromes including Dyskeratosis congenita (DC). Mutations in hRTEL1 are associated with a severe form of DC called Hoyeraal-Hreidarsson syndrome (HHS). HHS patients carry short telomeres and HHS cells display telomere damage. Here we investigated how hRTEL1 contributes to telomere maintenance in human primary as well as tumor cells. Transient depletion of hRTEL1 resulted in rapid telomere shortening only in the context of telomerase-positive cells with very long telomeres and high levels of telomerase. The effect of hRTEL1 on telomere length is telomerase dependent without impacting telomerase biogenesis or targeting of the enzyme to telomeres. Instead, RTEL1 depletion led to a decrease in both G-overhang content and POT1 association with telomeres with limited telomere uncapping. Strikingly, overexpression of POT1 restored telomere length but not the overhang, demonstrating that G-overhang loss is the primary defect caused by RTEL1 depletion. We propose that hRTEL1 contributes to the maintenance of long telomeres by preserving long G-overhangs, thereby facilitating POT1 binding and elongation by telomerase.

QuadBase2: web server for multiplexed guanine quadruplex mining and visualization

Science.gov (United States)

Dhapola, Parashar; Chowdhury, Shantanu

2016-01-01

DNA guanine quadruplexes or G4s are non-canonical DNA secondary structures which affect genomic processes like replication, transcription and recombination. G4s are computationally identified by specific nucleotide motifs which are also called putative G4 (PG4) motifs. Despite the general relevance of these structures, there is currently no tool available that can allow batch queries and genome-wide analysis of these motifs in a user-friendly interface. QuadBase2 (quadbase.igib.res.in) presents a completely reinvented web server version of previously published QuadBase database. QuadBase2 enables users to mine PG4 motifs in up to 178 eukaryotes through the EuQuad module. This module interfaces with Ensembl Compara database, to allow users mine PG4 motifs in the orthologues of genes of interest across eukaryotes. PG4 motifs can be mined across genes and their promoter sequences in 1719 prokaryotes through ProQuad module. This module includes a feature that allows genome-wide mining of PG4 motifs and their visualization as circular histograms. TetraplexFinder, the module for mining PG4 motifs in user-provided sequences is now capable of handling up to 20 MB of data. QuadBase2 is a comprehensive PG4 motif mining tool that further expands the configurations and algorithms for mining PG4 motifs in a user-friendly way. PMID:27185890

Examination of the effect of the annealing cation on higher order structures containing guanine or isoguanine repeats

Science.gov (United States)

Pierce, Sarah E.; Wang, Junmei; Jayawickramarajah, Janarthanan; Hamilton, Andrew D.; Brodbelt, Jennifer S.

2010-01-01

Isoguanine (2-oxo-6-amino-guanine), a natural but non-standard base, exhibits unique self-association properties compared to its isomer, guanine, and results in formation of different higher order DNA structures. In this work, the higher order structures formed by oligonucleotides containing guanine repeats or isoguanine repeats after annealing in solutions containing various cations are evaluated by electrospray ionization mass spectrometry (ESI-MS) and circular dichroism (CD) spectroscopy. The guanine-containing strand (G9) consistently formed quadruplexes upon annealing, whereas the isoguanine strand (Ig9) formed both pentaplexes and quadruplexes depending on the annealing cation. Quadruplex formation with G9 showed some dependence on the identity of the cation present during annealing with high relative quadruplex formation detected with six of ten cations. Analogous annealing experiments with Ig9 resulted in complex formation with all ten cations, and the majority of the resulting complexes were pentaplexes. CD results indicated most of the original complexes survived the desalting process necessary for ESI-MS analysis. In addition, several complexes, especially the pentaplexes, were found to be capable of cation exchange with ammonium ions. Ab initio calculations were conducted for isoguanine tetrads and pentads coordinated with all ten cations to predict the most energetically stable structures of the complexes in the gas phase. The observed preference of forming quadruplexes versus pentaplexes as a function of the coordinated cation can be interpreted by the calculated reaction energies of both the tetrads and pentads in combination with the distortion energies of tetrads. PMID:19746468

Gender and telomere length

DEFF Research Database (Denmark)

Gardner, Michael; Bann, David; Wiley, Laura

2014-01-01

It is widely believed that females have longer telomeres than males, although results from studies have been contradictory.......It is widely believed that females have longer telomeres than males, although results from studies have been contradictory....

Maternal telomere length inheritance in the king penguin.

Science.gov (United States)

Reichert, S; Rojas, E R; Zahn, S; Robin, J-P; Criscuolo, F; Massemin, S

2015-01-01

Telomeres are emerging as a biomarker for ageing and survival, and are likely important in shaping life-history trade-offs. In particular, telomere length with which one starts in life has been linked to lifelong survival, suggesting that early telomere dynamics are somehow related to life-history trajectories. This result highlights the importance of determining the extent to which telomere length is inherited, as a crucial factor determining early life telomere length. Given the scarcity of species for which telomere length inheritance has been studied, it is pressing to assess the generality of telomere length inheritance patterns. Further, information on how this pattern changes over the course of growth in individuals living under natural conditions should provide some insight on the extent to which environmental constraints also shape telomere dynamics. To fill this gap partly, we followed telomere inheritance in a population of king penguins (Aptenodytes patagonicus). We tested for paternal and maternal influence on chick initial telomere length (10 days old after hatching), and how these relationships changed with chick age (at 70, 200 and 300 days old). Based on a correlative approach, offspring telomere length was positively associated with maternal telomere length early in life (at 10 days old). However, this relationship was not significant at older ages. These data suggest that telomere length in birds is maternally inherited. Nonetheless, the influence of environmental conditions during growth remained an important factor shaping telomere length, as the maternal link disappeared with chicks' age.

Telomere shortening impairs regeneration of the olfactory epithelium in response to injury but not under homeostatic conditions.

Directory of Open Access Journals (Sweden)

Masami Watabe-Rudolph

Full Text Available Atrophy of the olfactory epithelium (OE associated with impaired olfaction and dry nose represents one of the most common phenotypes of human aging. Impairment in regeneration of a functional olfactory epithelium can also occur in response to injury due to infection or nasal surgery. These complications occur more frequently in aged patients. Although age is the most unifying risk factor for atrophic changes and functional decline of the olfactory epithelium, little is known about molecular mechanisms that could influence maintenance and repair of the olfactory epithelium. Here, we analyzed the influence of telomere shortening (a basic mechanism of cellular aging on homeostasis and regenerative reserve in response to chemical induced injury of the OE in late generation telomere knockout mice (G3 mTerc(-/- with short telomeres compared to wild type mice (mTerc(+/+ with long telomeres. The study revealed no significant influence of telomere shortening on homeostatic maintenance of the OE during mouse aging. In contrast, the regenerative response to chemical induced injury of the OE was significantly impaired in G3 mTerc(-/- mice compared to mTerc(+/+ mice. Seven days after chemical induced damage, G3 mTerc(-/- mice exhibited significantly enlarged areas of persisting atrophy compared to mTerc(+/+ mice (p = 0.031. Telomere dysfunction was associated with impairments in cell proliferation in the regenerating epithelium. Deletion of the cell cycle inhibitor, Cdkn1a (p21 rescued defects in OE regeneration in telomere dysfunctional mice. Together, these data indicate that telomere shortening impairs the regenerative capacity of the OE by impairing cell cycle progression in a p21-dependent manner. These findings could be relevant for the impairment in OE function in elderly people.

Short telomeres in hatchling snakes: erythrocyte telomere dynamics and longevity in tropical pythons.

Directory of Open Access Journals (Sweden)

Beata Ujvari

Full Text Available BACKGROUND: Telomere length (TL has been found to be associated with life span in birds and humans. However, other studies have demonstrated that TL does not affect survival among old humans. Furthermore, replicative senescence has been shown to be induced by changes in the protected status of the telomeres rather than the loss of TL. In the present study we explore whether age- and sex-specific telomere dynamics affect life span in a long-lived snake, the water python (Liasis fuscus. METHODOLOGY/PRINCIPAL FINDINGS: Erythrocyte TL was measured using the Telo TAGGG TL Assay Kit (Roche. In contrast to other vertebrates, TL of hatchling pythons was significantly shorter than that of older snakes. However, during their first year of life hatchling TL increased substantially. While TL of older snakes decreased with age, we did not observe any correlation between TL and age in cross-sectional sampling. In older snakes, female TL was longer than that of males. When using recapture as a proxy for survival, our results do not support that longer telomeres resulted in an increased water python survival/longevity. CONCLUSIONS/SIGNIFICANCE: In fish high telomerase activity has been observed in somatic cells exhibiting high proliferation rates. Hatchling pythons show similar high somatic cell proliferation rates. Thus, the increase in TL of this group may have been caused by increased telomerase activity. In older humans female TL is longer than that of males. This has been suggested to be caused by high estrogen levels that stimulate increased telomerase activity. Thus, high estrogen levels may also have caused the longer telomeres in female pythons. The lack of correlation between TL and age among old snakes and the fact that longer telomeres did not appear to affect python survival do not support that erythrocyte telomere dynamics has a major impact on water python longevity.

Short telomeres in hatchling snakes: erythrocyte telomere dynamics and longevity in tropical pythons.

Science.gov (United States)

Ujvari, Beata; Madsen, Thomas

2009-10-16

Telomere length (TL) has been found to be associated with life span in birds and humans. However, other studies have demonstrated that TL does not affect survival among old humans. Furthermore, replicative senescence has been shown to be induced by changes in the protected status of the telomeres rather than the loss of TL. In the present study we explore whether age- and sex-specific telomere dynamics affect life span in a long-lived snake, the water python (Liasis fuscus). Erythrocyte TL was measured using the Telo TAGGG TL Assay Kit (Roche). In contrast to other vertebrates, TL of hatchling pythons was significantly shorter than that of older snakes. However, during their first year of life hatchling TL increased substantially. While TL of older snakes decreased with age, we did not observe any correlation between TL and age in cross-sectional sampling. In older snakes, female TL was longer than that of males. When using recapture as a proxy for survival, our results do not support that longer telomeres resulted in an increased water python survival/longevity. In fish high telomerase activity has been observed in somatic cells exhibiting high proliferation rates. Hatchling pythons show similar high somatic cell proliferation rates. Thus, the increase in TL of this group may have been caused by increased telomerase activity. In older humans female TL is longer than that of males. This has been suggested to be caused by high estrogen levels that stimulate increased telomerase activity. Thus, high estrogen levels may also have caused the longer telomeres in female pythons. The lack of correlation between TL and age among old snakes and the fact that longer telomeres did not appear to affect python survival do not support that erythrocyte telomere dynamics has a major impact on water python longevity.

Leucocyte Telomere Shortening in relation to Newly Diagnosed Type 2 Diabetic Patients with Depression

Directory of Open Access Journals (Sweden)

Zhelong Liu

2014-01-01

Full Text Available The goal of this study is to investigate the association between oxidative stress and telomere length shortening in the comorbid depression and diabetes. Therefore, 71 patients with newly diagnosed type 2 diabetes (T2D and 52 subjects with normal glycemic level (control, Ctrl were enrolled. Depressive status was identified with the Depression Subscale of Hospital Anxiety and Depression Scale (HADS-D. Leukocyte telomere length ratio (T/S ratio was determined with quantitative PCR. Oxidative stress status was evaluated with 8-hydroxy-desoxyguanosine (8-OHdG assay kit. Some other biochemical blood testing was also performed. The data showed that T2D patients had higher proportion of depression evaluated by the HADS-D (x2=4.196, P=0.041. T/S ratio was significantly negatively correlated with 8-OHdG, HADS-D, age, HbA1c, FPG, and HOMA-IR. In addition, HADS-D was significantly positively correlated with HbA1c, FPG, HOMA-IR, and 8-OHdG. Both HADS-D and 8-OHdG were the major independent predictors for T/S ratio. This study indicates that oxidative stress contributes to both telomere length shortening and depression development in newly diagnosed type 2 diabetic patients, while in depression status, some other mechanisms besides oxidative stress may also affect the telomere length.

Ku must load directly onto the chromosome end in order to mediate its telomeric functions.

Directory of Open Access Journals (Sweden)

Christopher R Lopez

2011-08-01

Full Text Available The Ku heterodimer associates with the Saccharomyces cerevisiae telomere, where it impacts several aspects of telomere structure and function. Although Ku avidly binds DNA ends via a preformed channel, its ability to associate with telomeres via this mechanism could be challenged by factors known to bind directly to the chromosome terminus. This has led to uncertainty as to whether Ku itself binds directly to telomeric ends and whether end association is crucial for Ku's telomeric functions. To address these questions, we constructed DNA end binding-defective Ku heterodimers by altering amino acid residues in Ku70 and Ku80 that were predicted to contact DNA. These mutants continued to associate with their known telomere-related partners, such as Sir4, a factor required for telomeric silencing, and TLC1, the RNA component of telomerase. Despite these interactions, we found that the Ku mutants had markedly reduced association with telomeric chromatin and null-like deficiencies for telomere end protection, length regulation, and silencing functions. In contrast to Ku null strains, the DNA end binding defective Ku mutants resulted in increased, rather than markedly decreased, imprecise end-joining proficiency at an induced double-strand break. This result further supports that it was the specific loss of Ku's telomere end binding that resulted in telomeric defects rather than global loss of Ku's functions. The extensive telomere defects observed in these mutants lead us to propose that Ku is an integral component of the terminal telomeric cap, where it promotes a specific architecture that is central to telomere function and maintenance.

Ku must load directly onto the chromosome end in order to mediate its telomeric functions.

Science.gov (United States)

Lopez, Christopher R; Ribes-Zamora, Albert; Indiviglio, Sandra M; Williams, Christopher L; Haricharan, Svasti; Bertuch, Alison A

2011-08-01

The Ku heterodimer associates with the Saccharomyces cerevisiae telomere, where it impacts several aspects of telomere structure and function. Although Ku avidly binds DNA ends via a preformed channel, its ability to associate with telomeres via this mechanism could be challenged by factors known to bind directly to the chromosome terminus. This has led to uncertainty as to whether Ku itself binds directly to telomeric ends and whether end association is crucial for Ku's telomeric functions. To address these questions, we constructed DNA end binding-defective Ku heterodimers by altering amino acid residues in Ku70 and Ku80 that were predicted to contact DNA. These mutants continued to associate with their known telomere-related partners, such as Sir4, a factor required for telomeric silencing, and TLC1, the RNA component of telomerase. Despite these interactions, we found that the Ku mutants had markedly reduced association with telomeric chromatin and null-like deficiencies for telomere end protection, length regulation, and silencing functions. In contrast to Ku null strains, the DNA end binding defective Ku mutants resulted in increased, rather than markedly decreased, imprecise end-joining proficiency at an induced double-strand break. This result further supports that it was the specific loss of Ku's telomere end binding that resulted in telomeric defects rather than global loss of Ku's functions. The extensive telomere defects observed in these mutants lead us to propose that Ku is an integral component of the terminal telomeric cap, where it promotes a specific architecture that is central to telomere function and maintenance.

Flap Endonuclease 1 Limits Telomere Fragility on the Leading Strand*

Science.gov (United States)

Teasley, Daniel C.; Parajuli, Shankar; Nguyen, Mai; Moore, Hayley R.; Alspach, Elise; Lock, Ying Jie; Honaker, Yuchi; Saharia, Abhishek; Piwnica-Worms, Helen; Stewart, Sheila A.

2015-01-01

The existence of redundant replication and repair systems that ensure genome stability underscores the importance of faithful DNA replication. Nowhere is this complexity more evident than in challenging DNA templates, including highly repetitive or transcribed sequences. Here, we demonstrate that flap endonuclease 1 (FEN1), a canonical lagging strand DNA replication protein, is required for normal, complete leading strand replication at telomeres. We find that the loss of FEN1 nuclease activity, but not DNA repair activities, results in leading strand-specific telomere fragility. Furthermore, we show that FEN1 depletion-induced telomere fragility is increased by RNA polymerase II inhibition and is rescued by ectopic RNase H1 expression. These data suggest that FEN1 limits leading strand-specific telomere fragility by processing RNA:DNA hybrid/flap intermediates that arise from co-directional collisions occurring between the replisome and RNA polymerase. Our data reveal the first molecular mechanism for leading strand-specific telomere fragility and the first known role for FEN1 in leading strand DNA replication. Because FEN1 mutations have been identified in human cancers, our findings raise the possibility that unresolved RNA:DNA hybrid structures contribute to the genomic instability associated with cancer. PMID:25922071

Telomere Length Reprogramming in Embryos and Stem Cells

Directory of Open Access Journals (Sweden)

Keri Kalmbach

2014-01-01

Full Text Available Telomeres protect and cap linear chromosome ends, yet these genomic buffers erode over an organism’s lifespan. Short telomeres have been associated with many age-related conditions in humans, and genetic mutations resulting in short telomeres in humans manifest as syndromes of precocious aging. In women, telomere length limits a fertilized egg’s capacity to develop into a healthy embryo. Thus, telomere length must be reset with each subsequent generation. Although telomerase is purportedly responsible for restoring telomere DNA, recent studies have elucidated the role of alternative telomeres lengthening mechanisms in the reprogramming of early embryos and stem cells, which we review here.

Assessing Telomere Length Using Surface Enhanced Raman Scattering

Science.gov (United States)

Zong, Shenfei; Wang, Zhuyuan; Chen, Hui; Cui, Yiping

2014-11-01

Telomere length can provide valuable insight into telomeres and telomerase related diseases, including cancer. Here, we present a brand-new optical telomere length measurement protocol using surface enhanced Raman scattering (SERS). In this protocol, two single strand DNA are used as SERS probes. They are labeled with two different Raman molecules and can specifically hybridize with telomeres and centromere, respectively. First, genome DNA is extracted from cells. Then the telomere and centromere SERS probes are added into the genome DNA. After hybridization with genome DNA, excess SERS probes are removed by magnetic capturing nanoparticles. Finally, the genome DNA with SERS probes attached is dropped onto a SERS substrate and subjected to SERS measurement. Longer telomeres result in more attached telomere probes, thus a stronger SERS signal. Consequently, SERS signal can be used as an indicator of telomere length. Centromere is used as the inner control. By calibrating the SERS intensity of telomere probe with that of the centromere probe, SERS based telomere measurement is realized. This protocol does not require polymerase chain reaction (PCR) or electrophoresis procedures, which greatly simplifies the detection process. We anticipate that this easy-operation and cost-effective protocol is a fine alternative for the assessment of telomere length.

Convergence of The Nobel Fields of Telomere Biology and DNA Repair.

Science.gov (United States)

Fouquerel, Elise; Opresko, Patricia L

2017-01-01

The fields of telomere biology and DNA repair have enjoyed a great deal of cross-fertilization and convergence in recent years. Telomeres function at chromosome ends to prevent them from being falsely recognized as chromosome breaks by the DNA damage response and repair machineries. Conversely, both canonical and nonconical functions of numerous DNA repair proteins have been found to be critical for preserving telomere structure and function. In 2009, Elizabeth Blackburn, Carol Greider and Jack Szostak were awarded the Nobel prize in Physiology or Medicine for the discovery of telomeres and telomerase. Four years later, pioneers in the field of DNA repair, Aziz Sancar, Tomas Lindahl and Paul Modrich were recognized for their seminal contributions by being awarded the Nobel Prize in Chemistry. This review is part of a special issue meant to celebrate this amazing achievement, and will focus in particular on the convergence of nucleotide excision repair and telomere biology, and will discuss the profound implications for human health. © 2016 The American Society of Photobiology.

Epigenetic telomere protection by Drosophila DNA damage response pathways.

Science.gov (United States)

Oikemus, Sarah R; Queiroz-Machado, Joana; Lai, KuanJu; McGinnis, Nadine; Sunkel, Claudio; Brodsky, Michael H

2006-05-01

Analysis of terminal deletion chromosomes indicates that a sequence-independent mechanism regulates protection of Drosophila telomeres. Mutations in Drosophila DNA damage response genes such as atm/tefu, mre11, or rad50 disrupt telomere protection and localization of the telomere-associated proteins HP1 and HOAP, suggesting that recognition of chromosome ends contributes to telomere protection. However, the partial telomere protection phenotype of these mutations limits the ability to test if they act in the epigenetic telomere protection mechanism. We examined the roles of the Drosophila atm and atr-atrip DNA damage response pathways and the nbs homolog in DNA damage responses and telomere protection. As in other organisms, the atm and atr-atrip pathways act in parallel to promote telomere protection. Cells lacking both pathways exhibit severe defects in telomere protection and fail to localize the protection protein HOAP to telomeres. Drosophila nbs is required for both atm- and atr-dependent DNA damage responses and acts in these pathways during DNA repair. The telomere fusion phenotype of nbs is consistent with defects in each of these activities. Cells defective in both the atm and atr pathways were used to examine if DNA damage response pathways regulate telomere protection without affecting telomere specific sequences. In these cells, chromosome fusion sites retain telomere-specific sequences, demonstrating that loss of these sequences is not responsible for loss of protection. Furthermore, terminally deleted chromosomes also fuse in these cells, directly implicating DNA damage response pathways in the epigenetic protection of telomeres. We propose that recognition of chromosome ends and recruitment of HP1 and HOAP by DNA damage response proteins is essential for the epigenetic protection of Drosophila telomeres. Given the conserved roles of DNA damage response proteins in telomere function, related mechanisms may act at the telomeres of other organisms.

Cardiac telomere length in heart development, function, and disease.

Science.gov (United States)

Booth, S A; Charchar, F J

2017-07-01

Telomeres are repetitive nucleoprotein structures at chromosome ends, and a decrease in the number of these repeats, known as a reduction in telomere length (TL), triggers cellular senescence and apoptosis. Heart disease, the worldwide leading cause of death, often results from the loss of cardiac cells, which could be explained by decreases in TL. Due to the cell-specific regulation of TL, this review focuses on studies that have measured telomeres in heart cells and critically assesses the relationship between cardiac TL and heart function. There are several lines of evidence that have identified rapid changes in cardiac TL during the onset and progression of heart disease as well as at critical stages of development. There are also many factors, such as the loss of telomeric proteins, oxidative stress, and hypoxia, that decrease cardiac TL and heart function. In contrast, antioxidants, calorie restriction, and exercise can prevent both cardiac telomere attrition and the progression of heart disease. TL in the heart is also indicative of proliferative potential and could facilitate the identification of cells suitable for cardiac rejuvenation. Although these findings highlight the involvement of TL in heart function, there are important questions regarding the validity of animal models, as well as several confounding factors, that need to be considered when interpreting results and planning future research. With these in mind, elucidating the telomeric mechanisms involved in heart development and the transition to disease holds promise to prevent cardiac dysfunction and potentiate regeneration after injury. Copyright © 2017 the American Physiological Society.

Telomeres and human health

DEFF Research Database (Denmark)

Bojesen, S E

2013-01-01

will be reviewed. In addition, technical difficulties and the reasons why measurement of telomeres has still not been introduced into routine clinical practice will be discussed. Findings from recent studies conducted in many thousands of individuals indicate that telomere length is not-or at best only marginally...

Telomere stability and telomerase in mesenchymal stem cells

DEFF Research Database (Denmark)

Serakinci, Nedime; Graakjaer, Jesper; Kølvrå, Steen

2008-01-01

Telomeres are repetitive genetic material that cap and thereby protect the ends of chromosomes. Each time a cell divides, telomeres get shorter. Telomere length is mainly maintained by telomerase. This enzyme is present in high concentrations in the embryonic stem cells and in fast growing...... embryonic cells, and declines with age. It is still unclear to what extent there is telomerase in adult stem cells, but since these are the founder cells of cells of all the tissues in the body, understanding the telomere dynamics and expression of telomerase in adult stem cells is very important....... In the present communication we focus on telomere expression and telomere length in stem cells, with a special focus on mesenchymal stem cells. We consider different mechanisms by which stem cells can maintain telomeres and also focus on the dynamics of telomere length in mesenchymal stem cells, both the overall...

High plasma folate is negatively associated with leukocyte telomere length in Framingham Offspring cohort.

Science.gov (United States)

Paul, Ligi; Jacques, Paul F; Aviv, Abraham; Vasan, Ramachandran S; D'Agostino, Ralph B; Levy, Daniel; Selhub, Jacob

2015-03-01

Shortening of telomeres, the protective structures at the ends of eukaryotic chromosomes, is associated with age-related pathologies. Telomere length is influenced by DNA integrity and DNA and histone methylation. Folate plays a role in providing precursors for nucleotides and methyl groups for methylation reactions and has the potential to influence telomere length. We determined the association between leukocyte telomere length and long-term plasma folate status (mean of 4 years) in Framingham Offspring Study (n = 1,044, females = 52.1 %, mean age 59 years) using data from samples collected before and after folic acid fortification. Leukocyte telomere length was determined by Southern analysis and fasting plasma folate concentration using microbiological assay. There was no significant positive association between long-term plasma folate and leukocyte telomere length among the Framingham Offspring Study participants perhaps due to their adequate folate status. While the leukocyte telomere length in the second quintile of plasma folate was longer than that in the first quintile, the difference was not statistically significant. The leukocyte telomere length of the individuals in the fifth quintile of plasma folate was shorter than that of those in the second quintile by 180 bp (P folate concentrations in the upper four quintiles of plasma folate (P for trend = 0.001). Multivitamin use was associated with shorter telomeres in this cohort (P = 0.015). High plasma folate status possibly resulting from high folic acid intake may interfere with the role of folate in maintaining telomere integrity.

Silica inhalation altered telomere length and gene expression of telomere regulatory proteins in lung tissue of rats.

Science.gov (United States)

Shoeb, Mohammad; Joseph, Pius; Kodali, Vamsi; Mustafa, Gul; Farris, Breanne Y; Umbright, Christina; Roberts, Jenny R; Erdely, Aaron; Antonini, James M

2017-12-11

Exposure to silica can cause lung fibrosis and cancer. Identification of molecular targets is important for the intervention and/or prevention of silica-induced lung diseases. Telomeres consist of tandem repeats of DNA sequences at the end of chromosomes, preventing chromosomal fusion and degradation. Regulator of telomere length-1 (RTEL1) and telomerase reverse transcriptase (TERT), genes involved in telomere regulation and function, play important roles in maintaining telomere integrity and length. The goal of this study was to assess the effect of silica inhalation on telomere length and the regulation of RTEL1 and TERT. Lung tissues and blood samples were collected from rats at 4, 32, and 44 wk after exposure to 15 mg/m 3 of silica × 6 h/d × 5 d. Controls were exposed to air. At all-time points, RTEL1 expression was significantly decreased in lung tissue of the silica-exposed animals compared to controls. Also, significant increases in telomere length and TERT were observed in the silica group at 4 and 32 wk. Telomere length, RTEL1 and TERT expression may serve as potential biomarkers related to silica exposure and may offer insight into the molecular mechanism of silica-induced lung disease and tumorigeneses.

Telomere shortening in hematopoietic stem cell transplantation: a potential mechanism for late graft failure?

Science.gov (United States)

Awaya, Norihiro; Baerlocher, Gabriela M; Manley, Thomas J; Sanders, Jean E; Mielcarek, Marco; Torok-Storb, Beverly; Lansdorp, Peter M

2002-01-01

Telomeres serve to maintain the structural integrity of chromosomes, yet each somatic cell division is associated with a decrease in telomere length. The cumulative decrease in telomere length can impose an upper limit for the number of cell divisions that can occur before a cell senesces. When studied in vitro with fibroblasts, this limit is referred to as the Hayflick limit and usually occurs after 40 to 80 cell doublings. In theory, a similar replicative potential in a hematopoietic stem cell could support hematopoiesis in a person for more than 100 years. However, stem cells differentiate, and the telomere length differs among chromosomes within a single cell, among cell types, and among age-matched individuals. This variation in telomere length raises the possibility that long-term hematopoiesis by transplanted stem cells could, depending on the telomere length of the engrafted stem cell and the proliferative demand to which it is subjected, reach a Hayflick limit during the life span of the patient. Although significant shortening of telomeres is reported to occur within the first year posttransplantation, as yet no evidence has indicated that this shortening is associated with marrow function. In this review, we summarize reports on telomere shortening in stem cell transplantation recipients and report 2 cases in which graft failure is associated with significant telomere shortening.

Mice with Pulmonary Fibrosis Driven by Telomere Dysfunction

Directory of Open Access Journals (Sweden)

Juan M. Povedano

2015-07-01

Full Text Available Idiopathic pulmonary fibrosis (IPF is a degenerative disease of the lungs with an average survival post-diagnosis of 2–3 years. New therapeutic targets and treatments are necessary. Mutations in components of the telomere-maintenance enzyme telomerase or in proteins important for telomere protection are found in both familial and sporadic IPF cases. However, the lack of mouse models that faithfully recapitulate the human disease has hampered new advances. Here, we generate two independent mouse models that develop IPF owing to either critically short telomeres (telomerase-deficient mice or severe telomere dysfunction in the absence of telomere shortening (mice with Trf1 deletion in type II alveolar cells. We show that both mouse models develop pulmonary fibrosis through induction of telomere damage, thus providing proof of principle of the causal role of DNA damage stemming from dysfunctional telomeres in IPF development and identifying telomeres as promising targets for new treatments.

Tocotrienol-Rich Fraction Prevents Cell Cycle Arrest and Elongates Telomere Length in Senescent Human Diploid Fibroblasts

Directory of Open Access Journals (Sweden)

Suzana Makpol

2011-01-01

Full Text Available This study determined the molecular mechanisms of tocotrienol-rich fraction (TRF in preventing cellular senescence of human diploid fibroblasts (HDFs. Primary culture of HDFs at various passages were incubated with 0.5 mg/mL TRF for 24 h. Telomere shortening with decreased telomerase activity was observed in senescent HDFs while the levels of damaged DNA and number of cells in G0/G1 phase were increased and S phase cells were decreased. Incubation with TRF reversed the morphology of senescent HDFs to resemble that of young cells with decreased activity of SA-β-gal, damaged DNA, and cells in G0/G1 phase while cells in the S phase were increased. Elongated telomere length and restoration of telomerase activity were observed in TRF-treated senescent HDFs. These findings confirmed the ability of tocotrienol-rich fraction in preventing HDFs cellular ageing by restoring telomere length and telomerase activity, reducing damaged DNA, and reversing cell cycle arrest associated with senescence.

Telomere-Centromere-Driven Genomic Instability Contributes to Karyotype Evolution in a Mouse Model of Melanoma

Directory of Open Access Journals (Sweden)

Amanda Gonçalves dos Santos Silva

2010-01-01

Full Text Available Aneuploidy and chromosomal instability (CIN are hallmarks of most solid tumors. These alterations may result from inaccurate chromosomal segregation during mitosis, which can occur through several mechanisms including defective telomere metabolism, centrosome amplification, dysfunctional centromeres, and/or defective spindle checkpoint control. In this work, we used an in vitro murine melanoma model that uses a cellular adhesion blockade as a transforming factor to characterize telomeric and centromeric alterations that accompany melanocyte transformation. To study the timing of the occurrence of telomere shortening in this transformation model, we analyzed the profile of telomere length by quantitative fluorescent in situ hybridization and found that telomere length significantly decreased as additional rounds of cell adhesion blockages were performed. Together with it, an increase in telomere-free ends and complex karyotypic aberrations were also found, which include Robertsonian fusions in 100% of metaphases of the metastatic melanoma cells. These findings are in agreement with the idea that telomere length abnormalities seem to be one of the earliest genetic alterations acquired in the multistep process of malignant transformation and that telomere abnormalities result in telomere aggregation, breakage-bridge-fusion cycles, and CIN. Another remarkable feature of this model is the abundance of centromeric instability manifested as centromere fragments and centromeric fusions. Taken together, our results illustrate for this melanoma model CIN with a structural signature of centromere breakage and telomeric loss.

DNA-PKcs is critical for telomere capping

Energy Technology Data Exchange (ETDEWEB)

Gilley, David; Tanaka, Hiromi; Hande, M. Prakash; Kurimasa,Akihiro; Li, Gloria C.; Chen, David J.

2001-04-10

The DNA-dependent protein kinase catalytic subunit (DNA-PKcs) is critical for DNA repair via the non-homologous end joining (NHEJ) pathway. Previously, it was reported that bone marrow cells and spontaneously transformed fibroblasts from SCID (severe combined immunodeficiency) mice have defects in telomere maintenance. The genetically defective SCID mouse arose spontaneously from its parental strain CB17. One known genomic alteration in SCID mice is a truncation of the extreme carboxyl-terminus of DNA-PKcs, but other as yet unidentified alterations may also exist. We have used a defined system, the DNA-PKcs knockout mouse, to investigate specifically the role DNA-PKcs specifically plays in telomere maintenance. We report that primary mouse embryonic fibroblasts (MEFs) and primary cultured kidney cells from 6-8 month old DNA-PKcs deficient mice accumulate a large number of telomere fusions, yet still retain wildtype telomere length. Thus, the phenotype of this defect separates the two-telomere related phenotypes, capping and length maintenance. DNA-PKcs deficient MEFs also exhibit elevated levels of chromosome fragments and breaks, which correlate with increased telomere fusions. Based on the high levels of telomere fusions observed in DNA-PKcs deficient cells, we conclude that DNA-PKcs plays an important capping role at the mammalian telomere.

Flap Endonuclease 1 Limits Telomere Fragility on the Leading Strand.

Science.gov (United States)

Teasley, Daniel C; Parajuli, Shankar; Nguyen, Mai; Moore, Hayley R; Alspach, Elise; Lock, Ying Jie; Honaker, Yuchi; Saharia, Abhishek; Piwnica-Worms, Helen; Stewart, Sheila A

2015-06-12

The existence of redundant replication and repair systems that ensure genome stability underscores the importance of faithful DNA replication. Nowhere is this complexity more evident than in challenging DNA templates, including highly repetitive or transcribed sequences. Here, we demonstrate that flap endonuclease 1 (FEN1), a canonical lagging strand DNA replication protein, is required for normal, complete leading strand replication at telomeres. We find that the loss of FEN1 nuclease activity, but not DNA repair activities, results in leading strand-specific telomere fragility. Furthermore, we show that FEN1 depletion-induced telomere fragility is increased by RNA polymerase II inhibition and is rescued by ectopic RNase H1 expression. These data suggest that FEN1 limits leading strand-specific telomere fragility by processing RNA:DNA hybrid/flap intermediates that arise from co-directional collisions occurring between the replisome and RNA polymerase. Our data reveal the first molecular mechanism for leading strand-specific telomere fragility and the first known role for FEN1 in leading strand DNA replication. Because FEN1 mutations have been identified in human cancers, our findings raise the possibility that unresolved RNA:DNA hybrid structures contribute to the genomic instability associated with cancer. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Interstitial telomere-like repeats in the Arabidopsis thaliana genome.

Science.gov (United States)

Uchida, Wakana; Matsunaga, Sachihiro; Sugiyama, Ryuji; Kawano, Shigeyuki

2002-02-01

Eukaryotic chromosomal ends are protected by telomeres, which are thought to play an important role in ensuring the complete replication of chromosomes. On the other hand, non-functional telomere-like repeats in the interchromosomal regions (interstitial telomeric repeats; ITRs) have been reported in several eukaryotes. In this study, we identified eight ITRs in the Arabidopsis thaliana genome, each consisting of complete and degenerate 300- to 1200-bp sequences. The ITRs were grouped into three classes (class IA-B, class II, and class IIIA-E) based on the degeneracy of the telomeric repeats in ITRs. The telomeric repeats of the two ITRs in class I were conserved for the most part, whereas the single ITR in class II, and the five ITRs in class III were relatively degenerated. In addition, degenerate ITRs were surrounded by common sequences that shared 70-100% homology to each other; these are named ITR-adjacent sequences (IAS). Although the genomic regions around ITRs in class I lacked IAS, those around ITRs in class II contained IAS (IASa), and those around five ITRs in class III had nine types of IAS (IASb, c, d, e, f, g, h, i, and j). Ten IAS types in classes II and III showed no significant homology to each other. The chromosomal locations of ITRs and IAS were not category-related, but most of them were adjacent to, or part of, a centromere. These results show that the A. thaliana genome has undergone chromosomal rearrangements, such as end-fusions and segmental duplications.

TRF2 recruits RTEL1 to telomeres in S phase to promote t-loop unwinding.

Science.gov (United States)

Sarek, Grzegorz; Vannier, Jean-Baptiste; Panier, Stephanie; Petrini, John H J; Boulton, Simon J

2015-02-19

The helicase RTEL1 promotes t-loop unwinding and suppresses telomere fragility to maintain the integrity of vertebrate telomeres. An interaction between RTEL1 and PCNA is important to prevent telomere fragility, but how RTEL1 engages with the telomere to promote t-loop unwinding is unclear. Here, we establish that the shelterin protein TRF2 recruits RTEL1 to telomeres in S phase, which is required to prevent catastrophic t-loop processing by structure-specific nucleases. We show that the TRF2-RTEL1 interaction is mediated by a metal-coordinating C4C4 motif in RTEL1, which is compromised by the Hoyeraal-Hreidarsson syndrome (HHS) mutation, RTEL1(R1264H). Conversely, we define a TRF2(I124D) substitution mutation within the TRFH domain of TRF2, which eliminates RTEL1 binding and phenocopies the RTEL1(R1264H) mutation, giving rise to aberrant t-loop excision, telomere length heterogeneity, and loss of the telomere as a circle. These results implicate TRF2 in the recruitment of RTEL1 to facilitate t-loop disassembly at telomeres in S phase. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.