WorldWideScience

Sample records for technology targets peak

  1. A new automatic fixed peak technology of microcontroller

    International Nuclear Information System (INIS)

    Huang Liguo; Wang Dequan; Zhang Damin; Li Jun; Liu Yuwen; Guo Qingxue; Wang Guifeng

    1999-01-01

    The microcontroller automatic fixed peak technology which differs from fashion half channel fixed peak is described. It bases on the principles of selecting double single channel and readjusting the voltage of power source. This technology is suitable to the industrial isotope instruments with various radioactive sources

  2. Impact of Smart Grid Technologies on Peak Load to 2050

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2011-07-01

    The IEA's Smart Grids Technology Roadmap identified five global trends that could be effectively addressed by deploying smart grids. These are: increasing peak load (the maximum power that the grid delivers during peak hours), rising electricity consumption, electrification of transport, deployment of variable generation technologies (e.g. wind and solar PV) and ageing infrastructure. Along with this roadmap, a new working paper -- Impact of Smart Grid Technologies on Peak Load to 2050 -- develops a methodology to estimate the evolution of peak load until 2050. It also analyses the impact of smart grid technologies in reducing peak load for four key regions; OECD North America, OECD Europe, OECD Pacific and China. This working paper is a first IEA effort in an evolving modelling process of smart grids that is considering demand response in residential and commercial sectors as well as the integration of electric vehicles.

  3. An analysis of China's CO2 emission peaking target and pathways

    Directory of Open Access Journals (Sweden)

    Jian-Kun He

    2014-12-01

    Full Text Available China has set the goal for its CO2 emissions to peak around 2030, which is not only a strategic decision coordinating domestic sustainable development and global climate change mitigation but also an overarching target and a key point of action for China's resource conservation, environmental protection, shift in economic development patterns, and CO2 emission reduction to avoid climate change. The development stage where China maps out the CO2 emission peak target is earlier than that of the developed countries. It is a necessity that the non-fossil energy supplies be able to meet all the increased energy demand for achieving CO2 emission peaking. Given that China's potential GDP annual increasing rate will be more than 4%, and China's total energy demand will continue to increase by approximately 1.0%–1.5% annually around 2030, new and renewable energies will need to increase by 6%–8% annually to meet the desired CO2 emission peak. The share of new and renewable energies in China's total primary energy supply will be approximately 20% by 2030. At that time, the energy consumption elasticity will decrease to around 0.3, and the annual decrease in the rate of CO2 intensity will also be higher than 4% to ensure the sustained growth of GDP. To achieve the CO2 emission peaking target and substantially promote the low-carbon development transformation, China needs to actively promote an energy production and consumption revolution, the innovation of advanced energy technologies, the reform of the energy regulatory system and pricing mechanism, and especially the construction of a national carbon emission cap and trade system.

  4. Target Glint Suppression Technology.

    Science.gov (United States)

    1980-09-01

    Rayleigh for either horizontal or vertical polarization). 2.1.2 Spatial Characterization. Before the effects of diversity on target detection can be...ncs) dRCS T If the lower intergration limit is taken as zero for the Rayleigh targct model of interest, then this quantity is unbounded. In...port wing, inner section Trailing edge of starboard .:ing, inner section Leading edge of horizontal stabilizer, inner section, port side TLeal, -g

  5. An analysis of Chinas CO2 emission peaking target and pathways

    OpenAIRE

    He, Jian-Kun

    2017-01-01

    China has set the goal for its CO2 emissions to peak around 2030, which is not only a strategic decision coordinating domestic sustainable development and global climate change mitigation but also an overarching target and a key point of action for Chinas resource conservation, environmental protection, shift in economic development patterns, and CO2 emission reduction to avoid climate change. The development stage where China maps out the CO2 emission peak target is earlier than that of the ...

  6. Substantial reductions of input energy and peak power requirements in targets for heavy ion fusion

    International Nuclear Information System (INIS)

    Mark, J.W.K.; Pan, Y.L.

    1986-01-01

    Two ways of reducing the requirements of the heavy ion driver for inertial confinement fusion (ICF) target implosion are described. Compared to estimates of target gain not using these methods, the target input energy and peak power may be reduced by about a factor of two with the use of the hybrid-implosion concept. Another factor of two reduction in input energy may be obtained with the use of spin-polarized DT fuel in the ICF target

  7. Technology for computer-stabilized peak of NaI(Tl) gamma spectrum

    International Nuclear Information System (INIS)

    Chen Jianzhen; Guo Lanying; Ling Qiu; Qu Guopu; Zhao Lihong; Hu Chuangye

    2005-01-01

    An improved technology for spectrum stabilization of NaI(Tl) gamma spectrum was introduced. This technology is based on the system using a reference peak, which is equivalent gamma peak of 241 Am source. The computer seeks peak's position deviation and computes adjust value of programmable amplifier and controls programmable amplifier to stabilize spectrum by digital PID. This is a technology of spectrum stabilizing with 'hardware + reference-peak + software' and has high stability and fast speed of spectrum stabilizing. (author)

  8. Estimation of peak heat flux onto the targets for CFETR with extended divertor leg

    International Nuclear Information System (INIS)

    Zhang, Chuanjia; Chen, Bin; Xing, Zhe; Wu, Haosheng; Mao, Shifeng; Luo, Zhengping; Peng, Xuebing; Ye, Minyou

    2016-01-01

    Highlights: • A hypothetical geometry is assumed to extend the outer divertor leg in CFETR. • Density scan SOLPS simulation is done to study the peak heat flux onto target. • Attached–detached regime transition in out divertor occurs at lower puffing rate. • Unexpected delay of attached–detached regime transition occurs in inner divertor. - Abstract: China Fusion Engineering Test Reactor (CFETR) is now in conceptual design phase. CFETR is proposed as a good complement to ITER for demonstrating of fusion energy. Divertor is a crucial component which faces the plasmas and handles huge heat power for CFETR and future fusion reactor. To explore an effective way for heat exhaust, various methods to reduce the heat flux to divertor target should be considered for CFETR. In this work, the effect of extended out divertor leg on the peak heat flux is studied. The magnetic configuration of the long leg divertor is obtained by EFIT and Tokamak Simulation Code (TSC), while a hypothetical geometry is assumed to extend the out divertor leg as long as possible inside vacuum vessel. A SOLPS simulation is performed to study peak heat flux of the long leg divertor for CFETR. D 2 gas puffing is used and increasing of the puffing rate means increase of plasma density. Both peak heat flux onto inner and outer targets are below 10 MW/m 2 is achieved. A comparison between the peak heat flux between long leg and conventional divertor shows that an attached–detached regime transition of out divertor occurs at lower gas puffing gas puffing rate for long leg divertor. While for the inner divertor, even the configuration is almost the same, the situation is opposite.

  9. Estimation of peak heat flux onto the targets for CFETR with extended divertor leg

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Chuanjia; Chen, Bin [School of Nuclear Science and Technology, University of Science and Technology of China, 96 Jinzhai Road, Hefei, Anhui 230026 (China); Xing, Zhe [Institute of Plasma Physics, Chinese Academy of Sciences, Hefei, Anhui 230031 (China); Wu, Haosheng [School of Nuclear Science and Technology, University of Science and Technology of China, 96 Jinzhai Road, Hefei, Anhui 230026 (China); Mao, Shifeng, E-mail: sfmao@ustc.edu.cn [School of Nuclear Science and Technology, University of Science and Technology of China, 96 Jinzhai Road, Hefei, Anhui 230026 (China); Luo, Zhengping; Peng, Xuebing [Institute of Plasma Physics, Chinese Academy of Sciences, Hefei, Anhui 230031 (China); Ye, Minyou [School of Nuclear Science and Technology, University of Science and Technology of China, 96 Jinzhai Road, Hefei, Anhui 230026 (China); Institute of Plasma Physics, Chinese Academy of Sciences, Hefei, Anhui 230031 (China)

    2016-11-01

    Highlights: • A hypothetical geometry is assumed to extend the outer divertor leg in CFETR. • Density scan SOLPS simulation is done to study the peak heat flux onto target. • Attached–detached regime transition in out divertor occurs at lower puffing rate. • Unexpected delay of attached–detached regime transition occurs in inner divertor. - Abstract: China Fusion Engineering Test Reactor (CFETR) is now in conceptual design phase. CFETR is proposed as a good complement to ITER for demonstrating of fusion energy. Divertor is a crucial component which faces the plasmas and handles huge heat power for CFETR and future fusion reactor. To explore an effective way for heat exhaust, various methods to reduce the heat flux to divertor target should be considered for CFETR. In this work, the effect of extended out divertor leg on the peak heat flux is studied. The magnetic configuration of the long leg divertor is obtained by EFIT and Tokamak Simulation Code (TSC), while a hypothetical geometry is assumed to extend the out divertor leg as long as possible inside vacuum vessel. A SOLPS simulation is performed to study peak heat flux of the long leg divertor for CFETR. D{sub 2} gas puffing is used and increasing of the puffing rate means increase of plasma density. Both peak heat flux onto inner and outer targets are below 10 MW/m{sup 2} is achieved. A comparison between the peak heat flux between long leg and conventional divertor shows that an attached–detached regime transition of out divertor occurs at lower gas puffing gas puffing rate for long leg divertor. While for the inner divertor, even the configuration is almost the same, the situation is opposite.

  10. Timing at peak force may be the hidden target controlled in continuation and synchronization tapping.

    Science.gov (United States)

    Du, Yue; Clark, Jane E; Whitall, Jill

    2017-05-01

    Timing control, such as producing movements at a given rate or synchronizing movements to an external event, has been studied through a finger-tapping task where timing is measured at the initial contact between finger and tapping surface or the point when a key is pressed. However, the point of peak force is after the time registered at the tapping surface and thus is a less obvious but still an important event during finger tapping. Here, we compared the time at initial contact with the time at peak force as participants tapped their finger on a force sensor at a given rate after the metronome was turned off (continuation task) or in synchrony with the metronome (sensorimotor synchronization task). We found that, in the continuation task, timing was comparably accurate between initial contact and peak force. These two timing events also exhibited similar trial-by-trial statistical dependence (i.e., lag-one autocorrelation). However, the central clock variability was lower at the peak force than the initial contact. In the synchronization task, timing control at peak force appeared to be less variable and more accurate than that at initial contact. In addition to lower central clock variability, the mean SE magnitude at peak force (SEP) was around zero while SE at initial contact (SEC) was negative. Although SEC and SEP demonstrated the same trial-by-trial statistical dependence, we found that participants adjusted the time of tapping to correct SEP, but not SEC, toward zero. These results suggest that timing at peak force is a meaningful target of timing control, particularly in synchronization tapping. This result may explain the fact that SE at initial contact is typically negative as widely observed in the preexisting literature.

  11. Artificial ground motion compatible with specified peak ground displacement and target multi-damping response spectra

    International Nuclear Information System (INIS)

    Zhang Yushan; Zhao Fengxin

    2010-01-01

    With respect to the design ground motion of nuclear power plant (NPP), the Regular Guide 1.60 of the US not only defined the standard multi-damping response spectra, i.e. the RG1.60 spectra, but also definitely prescribed the peak ground displacement (PGD) value corresponding to the standard spectra. However, in the engineering practice of generating multi-damping-spectra-compatible artificial ground motion for the seismic design of NPP, the PGD value had been neglected. Addressing this issue, this paper proposed a synthesizing method which generates the artificial ground motion compatible with not only the target multi-damping response spectra but also the specified PGD value. Firstly, by the transfer formula between the power spectrum and the response spectrum, an initial uniformly modulated acceleration time history is synthesized by multiplying the stationary Gaussian process with the prescribed intensity envelope to simulate the amplitude-non-stationarity of earthquake ground motion. And then by superimposing a series of narrow-band time histories in the time domain, the initial time history is modified in the iterative manner to match the target PGD as well as the target multi-damping spectra with the pre-specified matching precisions. Numerical examples are provided to demonstrate the matching precisions of the proposed method to the target values.

  12. Matrix-mini-tablets of lornoxicam for targeting early morning peak symptoms of rheumatoid arthritis

    Directory of Open Access Journals (Sweden)

    Abdul Hadi Mohd

    2014-05-01

    Full Text Available Objective(s: The aim of present research was to develop matrix-mini-tablets of lornoxicam filled in capsule for targeting early morning peak symptoms of rheumatoid arthritis. Materials and Methods:Matrix-mini-tablets of lornoxicam were prepared by direct compression method using microsomal enzyme dependent and pH-sensitive polymers which were further filled into an empty HPMC capsule. To assess the compatibility, FT-IR and DSC studies for pure drug, polymers and their physical mixture were performed. The formulated batches were subjected to physicochemical studies, estimation of drug content, in vitro drug release, drug release kinetics, and stability studies. Results:  When FTIR and DSC studies were performed it was found that there was no interaction between lornoxicam and polymers which used. All the physicochemical properties of prepared matrix-mini-tablets were found to be in normal limits. The percentage of drug content was found to be 99.60±0.07%. Our optimized matrix mini-tablets-filled-capsule formulation F30 released lornoxicam after a lag time of 5.02±0.92 hr, 95.48±0.65 % at the end of 8 hr and 99.90±0.83 % at the end of 12 hr. Stability was also found for this formulation as per the guidelines of International Conference on Harmonisation of Technical Requirements of Pharmaceuticals for Human Use. Conclusion: A novel colon targeted delivery system of lornoxicam was successfully developed by filling matrix-mini-tablets into an empty HPMC capsule shell for targeting early morning peak symptoms of rheumatoid arthritis.

  13. Modified egg as a nutritional supplement during peak brain development: a new target for fortification.

    Science.gov (United States)

    Shapira, Niva

    2009-01-01

    Though eggs have the unique capacity, like breastmilk, to concentrate essential nutrients required for early growth and brain development of offspring - i.e. n-3 PUFA, increasingly deficient and sources contaminated - cholesterol and allergy concerns often exclude them from perinatal recommendations. Egg's potential contribution of key nutrients required for peak brain development are re-evaluated vis-à-vis fortification, accessibility, and risks. Contributions of standard (USDA) and fortified (selected market-available) egg compositions to perinatal requirements for critical brain-supporting nutrients were compared to human and cow milks, and risks and recommendations evaluated. Standard egg has already higher concentrations/kcal of iron, selenium, zinc, choline, vitamins B12 and E, and essential amino acids (plus taurine) than human milk. Fortified egg could further yield significant n-3 PUFA % recommendations for pregnancy-lactation (total n-3 69.6-75.0% [DRI=1400-1300 mg/day]), including DHA (120.1-129.3%, mostly approximately 80% [calculated DRI=140-130 mg/day]), plus antioxidant vitamins A (9.0-15.2%) and E (51.6-65.3%), and minerals iodine (33.6-44.5%) and selenium (33.7-39.3%); % recommendations for children (1-3 y) even more. Cholesterol, important for nerve membranes and learning, may not be generally contraindicated in childbearing-aged women (approximately 10.5% hypercholesterolemia), and early-life egg exposure may increase tolerance. Egg-inclusive perinatal nutrition programs have shown significant contributions. Eggs, especially target-fortified, may provide a unique nutritional supplement for peak brain development continously during pregnancy, nursing, and infancy (from 6 months), especially vs. insufficiencies. Missing nutritional opportunities by egg exclusion vs. concerns of hypercholesterolemia or allergy could be addressed individually, rather than as general recommendations, warranting further research and targeted egg design.

  14. Development of RI Target Production Technology

    International Nuclear Information System (INIS)

    Jeong, Do Young; Ko, Kwang Hoon; Kim, Cheol Jung; Kim, Taek Soo; Rho, Si Pyo; Park, Hyun Min; Lim, Gwon; Cha, Yong Ho; Han, Jae Min

    2010-04-01

    This project was accomplished with an aim of productive technical development on the 'enriched target' which is used essentially in radioisotope production. The research was advanced systematically with target production pilot system configuration and core technical development. We composed Yb-176 productive pilot system which equip the chemical purification technique of medical treatment level and proved its capability. Possibilities to separate Zn-67 by the method of using the polarizing light in principle and to separate Zn-70 by the method of using the double optical pumping in theory were also proved. RI target production technologies are recognized excessively with monopolistic techniques of part atomic energy advanced nations such as Russia and US and they are come, but we prepared the opportunity will be able to complete a full cycle of like (RI material production -> RI target production -> RI application) with this project accomplishment. When considering only the direct demand of stable isotope which is used in various industrial, we forecast with the fact that RI target markets will become larger with the approximately 5 billion dollars in 2020 and this technology will contribute in the domestic rising industry creation with high value added

  15. Using vehicle-to-grid technology for frequency regulation and peak-load reduction

    Science.gov (United States)

    White, Corey D.; Zhang, K. Max

    This paper explores the potential financial return for using plug-in hybrid electric vehicles as a grid resource. While there is little financial incentive for individuals when the vehicle-to-grid (V2G) service is used exclusively for peak reduction, there is a significant potential for financial return when the V2G service is used for frequency regulation. We propose that these two uses for V2G technology are not mutually exclusive, and that there could exist a "dual-use" program that utilizes V2G for multiple uses simultaneously. In our proposition, V2G could be used for regulation on a daily basis to ensure profits, and be used for peak reduction on days with high electricity demand and poor ambient air quality in order to reap the greatest environmental benefits. The profits for the individual in this type of dual-use program are close to or even higher than the profits experienced in either of the single-use programs. More importantly, we argue that the external benefits of this type of program are much greater as well. At higher V2G participation rates, our analysis shows that the market for regulation capacity could become saturated by V2G-based regulation providers. At the same time, there is plenty of potential for widespread use of V2G technology, especially if the demand for regulation, reserves, and storage grows as more intermittent renewable resources are being incorporated into the power systems.

  16. Analysis of the need for intermediate and peaking technologies in the year 2000

    Energy Technology Data Exchange (ETDEWEB)

    Barrager, S.M.; Campbell, G.L.

    1980-04-01

    This analysis was conducted to assess the impact of load management on the future need for intermediate- and peak-generating technologies (IPTs) such as combustion turbines, pumped storage, and cycling coal plants. There will be a reduced need for IPTs if load-management activities such as time-of-use pricing, together with customer-owned energy-storage devices, hot-water-heater controls, and interruptible service, can economically remove most of the variation from electric-power demands. Therefore, the analysis assesses the need for IPTs in an uncertain future, which will probably include load management and time-differentiated electricity prices. Section 2 provides a condensed description of the models used in the analysis. (Details and data sets are contained in the appendixes.) Results of sensitivities on growth rates, model parameters, and appliance saturations are discussed in Section 3, which also contains the analysis of the potential impacts of customer energy storage, appliance control, and time-of-use pricing. The future need for intermediate and peaking technologies is analyzed in Section 4.

  17. The partitioning of nanoparticles to endothelium or interstitium during ultrasound-microbubble-targeted delivery depends on peak-negative pressure

    International Nuclear Information System (INIS)

    Hsiang, Y.-H.; Song, J.; Price, R. J.

    2015-01-01

    Patients diagnosed with advanced peripheral arterial disease often face poor prognoses and have limited treatment options. For some patient populations, the therapeutic growth of collateral arteries (i.e. arteriogenesis) that bypass regions affected by vascular disease may become a viable treatment option. Our group and others are developing therapeutic approaches centered on the ability of ultrasound-activated microbubbles to permeabilize skeletal muscle capillaries and facilitate the targeted delivery of pro-arteriogenic growth factor-bearing nanoparticles. The development of such approaches would benefit significantly from a better understanding of how nanoparticle diameter and ultrasound peak-negative pressure affect both total nanoparticle delivery and the partitioning of nanoparticles to endothelial or interstitial compartments. Toward this goal, using Balb/C mice that had undergone unilateral femoral artery ligation, we intra-arterially co-injected nanoparticles (50 and 100 nm) with microbubbles, applied 1 MHz ultrasound to the gracilis adductor muscle at peak-negative pressures of 0.7, 0.55, 0.4, and 0.2 MPa, and analyzed nanoparticle delivery and distribution. As expected, total nanoparticle (50 and 100 nm) delivery increased with increasing peak-negative pressure, with 50 nm nanoparticles exhibiting greater tissue coverage than 100 nm nanoparticles. Of particular interest, increasing peak-negative pressure resulted in increased delivery to the interstitium for both nanoparticle sizes, but had little influence on nanoparticle delivery to the endothelium. Thus, we conclude that alterations to peak-negative pressure may be used to adjust the fraction of nanoparticles delivered to the interstitial compartment. This information will be useful when designing ultrasound protocols for delivering pro-arteriogenic nanoparticles to skeletal muscle

  18. The partitioning of nanoparticles to endothelium or interstitium during ultrasound-microbubble-targeted delivery depends on peak-negative pressure

    Energy Technology Data Exchange (ETDEWEB)

    Hsiang, Y.-H.; Song, J.; Price, R. J., E-mail: rprice@virginia.edu [University of Virginia, Department of Biomedical Engineering (United States)

    2015-08-15

    Patients diagnosed with advanced peripheral arterial disease often face poor prognoses and have limited treatment options. For some patient populations, the therapeutic growth of collateral arteries (i.e. arteriogenesis) that bypass regions affected by vascular disease may become a viable treatment option. Our group and others are developing therapeutic approaches centered on the ability of ultrasound-activated microbubbles to permeabilize skeletal muscle capillaries and facilitate the targeted delivery of pro-arteriogenic growth factor-bearing nanoparticles. The development of such approaches would benefit significantly from a better understanding of how nanoparticle diameter and ultrasound peak-negative pressure affect both total nanoparticle delivery and the partitioning of nanoparticles to endothelial or interstitial compartments. Toward this goal, using Balb/C mice that had undergone unilateral femoral artery ligation, we intra-arterially co-injected nanoparticles (50 and 100 nm) with microbubbles, applied 1 MHz ultrasound to the gracilis adductor muscle at peak-negative pressures of 0.7, 0.55, 0.4, and 0.2 MPa, and analyzed nanoparticle delivery and distribution. As expected, total nanoparticle (50 and 100 nm) delivery increased with increasing peak-negative pressure, with 50 nm nanoparticles exhibiting greater tissue coverage than 100 nm nanoparticles. Of particular interest, increasing peak-negative pressure resulted in increased delivery to the interstitium for both nanoparticle sizes, but had little influence on nanoparticle delivery to the endothelium. Thus, we conclude that alterations to peak-negative pressure may be used to adjust the fraction of nanoparticles delivered to the interstitial compartment. This information will be useful when designing ultrasound protocols for delivering pro-arteriogenic nanoparticles to skeletal muscle.

  19. Realizing Technologies for Magnetized Target Fusion

    Energy Technology Data Exchange (ETDEWEB)

    Wurden, Glen A. [Los Alamos National Laboratory

    2012-08-24

    Researchers are making progress with a range of magneto-inertial fusion (MIF) concepts. All of these approaches use the addition of a magnetic field to a target plasma, and then compress the plasma to fusion conditions. The beauty of MIF is that driver power requirements are reduced, compared to classical inertial fusion approaches, and simultaneously the compression timescales can be longer, and required implosion velocities are slower. The presence of a sufficiently large Bfield expands the accessibility to ignition, even at lower values of the density-radius product, and can confine fusion alphas. A key constraint is that the lifetime of the MIF target plasma has to be matched to the timescale of the driver technology (whether liners, heavy ions, or lasers). To achieve sufficient burn-up fraction, scaling suggests that larger yields are more effective. To handle the larger yields (GJ level), thick liquid wall chambers are certainly desired (no plasma/neutron damage materials problem) and probably required. With larger yields, slower repetition rates ({approx}0.1-1 Hz) for this intrinsically pulsed approach to fusion are possible, which means that chamber clearing between pulses can be accomplished on timescales that are compatible with simple clearing techniques (flowing liquid droplet curtains). However, demonstration of the required reliable delivery of hundreds of MJ of energy, for millions of pulses per year, is an ongoing pulsed power technical challenge.

  20. Analysis of the need for intermediate and peaking technologies in the year 2000. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Barrager, S.M.; Campbell, G.L.

    1980-04-01

    This analysis was conducted to assess the impact of load management on the future need for intermediate- and peak-generating technologies (IPTs) such as combustion turbines, pumped storage, and cycling coal plants. There would be a reduced need for IPTs if load-management activities such as time-of-use pricing, together with customer-owned energy-storage devices, hot-water-heater controls, and interruptible service can economically remove most of the variation from electric power demands. The objective of this analysis is to assess the need for IPTs in an uncertain future, which will probably include load management and time-differentiated electricity prices. The analysis is exploratory in nature and broad in scope. It does not attempt to predict the future or to model precisely the technical characteristics or economic desirability of load management. Rather, its purpose is to provide research and development planners with some basic insights into the order of magnitude of possible hourly demand shifts on a regional basis and to determine the impact of load management on daily and seasonal variations in electricity demand.

  1. The air quality and health co-benefits of alternative post-2020 pathways for achieving peak carbon targets in Jiangsu, China

    Science.gov (United States)

    Liu, M.; Bi, J.; Huang, Y.; Kinney, P. L.

    2016-12-01

    Jiangsu, which has three national low-carbon pilot cities, is set to be a model province in China for achieving peak carbon targets before 2030. However, according to local planning of responding to climate change, carbon emissions are projected to keep going up before 2020 even the strictest measures are implemented. In other words, innovative measures must be in action after 2020. This work aimed at assessing the air quality and health co-benefits of alternative post-2020 measures to help remove barriers of policy implementation through tying it to local incentives for air quality improvement. To achieve the aim, we select 2010 as baseline year and develop Bussiness As Usual (BAU) and Traditional Carbon Reduction (TCR) scenarios before 2020. Under BAU, only existing climate and air pollution control policies are considered; under TCR, potential climate policies in local planning and existing air pollution control policies are considered. After 2020, integrated gasification combined cycle (IGCC) plant with carbon capture and storage (CCS) technology and large-scale substitution of renewable energy seem to be two promising pathways for achieving peak carbon targets. Therefore, two additional scenarios (TCR-IGCC and TCR-SRE) are set after 2020. Based on the projections of future energy balances and industrial productions, we estimate the pollutant emissions and simulate PM2.5 and ozone concentrations by 2017, 2020, 2030 and 2050 using CMAQ. Then using health impact assessment approach, the premature deaths are estimated and monetized. Results show that the carbon peak in Jiangsu will be achieved before 2030 only under TCR-IGCC and TCR-SRE scenarios. Under three policy scenarios, Jiangsu's carbon emission control targets would have substantial effects on primary air pollutant emissions far beyond those we estimate would be needed to meet the PM2.5 concentration targets in 2017. Compared with IGCC with CCS, large-scale substitutions of renewable energy bring

  2. Transrectal real-time tissue elastography targeted biopsy coupled with peak strain index improves the detection of clinically important prostate cancer.

    Science.gov (United States)

    Ma, Qi; Yang, Dong-Rong; Xue, Bo-Xin; Wang, Cheng; Chen, Han-Bin; Dong, Yun; Wang, Cai-Shan; Shan, Yu-Xi

    2017-07-01

    The focus of the present study was to evaluate transrectal real-time tissue elastography (RTE)-targeted two-core biopsy coupled with peak strain index for the detection of prostate cancer (PCa) and to compare this method with 10-core systematic biopsy. A total of 141 patients were enrolled for evaluation. The diagnostic value of peak strain index was assessed using a receiver operating characteristic curve. The cancer detection rates of the two approaches and corresponding positive cores and Gleason score were compared. The cancer detection rate per core in the RTE-targeted biopsy (44%) was higher compared with that in systematic biopsy (30%). The peak strain index value of PCa was higher compared with that of the benign lesion. PCa was detected with the highest sensitivity (87.5%) and specificity (85.5%) using the threshold value of a peak strain index of ≥5.97 with an area under the curve value of 0.95. When the Gleason score was ≥7, RTE-targeted biopsy coupled with peak strain index detected 95.6% of PCa cases, but 84.4% were detected using systematic biopsy. Peak strain index as a quantitative parameter may improve the differentiation of PCa from benign lesions in the prostate peripheral zone. Transrectal RTE-targeted biopsy coupled with peak strain index may enhance the detection of clinically significant PCa, particularly when combined with systematic biopsy.

  3. Materials technology applied to nuclear accelerator targets

    International Nuclear Information System (INIS)

    Barthell, B.L.

    1986-01-01

    The continuing requests for both shaped and flat, very low areal density metal foils have led to the development of metallurgical quality, high strength products. Intent of this paper is to show methods of forming structures on various substrates using periodic vapor interruptions, alternating anodes, and mechanical peening to alter otherwise unacceptable grain morphology which both lowers tensile strength and causes high stresses in thin films. The three technologies, physical vapor deposition, electrochemistry, and chemical vapor deposition and their thin film products can benefit from the use of laminate technology and control of grain structure morphology through the use of materials research and technology

  4. Targeted Technology Transfer to US Independents

    Energy Technology Data Exchange (ETDEWEB)

    Donald F. Duttlinger; E. Lance Cole

    2006-09-29

    The Petroleum Technology Transfer Council (PTTC) was established by domestic crude oil and natural gas producers in 1994 as a national not-for-profit organization to address the increasingly urgent need to improve the technology-transfer process in the U.S. upstream petroleum industry. Coordinated from a Headquarters (HQ) office in Houston, PTTC maintains an active grassroots program executed by 10 Regional Lead Organizations (RLOs) and two satellite offices (Figure 1). Regional Directors interact with domestic oil and gas producers through technology workshops, resource centers, websites, newsletters, technical publications and cooperative outreach efforts. HQ facilitates inter-regional technology transfer and implements a comprehensive communications program. Active volunteers on the National Board and in Producer Advisory Groups (PAGs) in each of the 10 regions focus effort in areas that will create the most impact for domestic producers. Focused effort by dedicated individuals across the country has enabled PTTC to achieve the milestones outlined in Appendix A.

  5. TARGETED TECHNOLOGY TRANSFER TO US INDEPENDENTS

    Energy Technology Data Exchange (ETDEWEB)

    Donald F. Duttlinger; E. Lance Cole

    2005-01-01

    The Petroleum Technology Transfer Council (PTTC) continued pursuing its mission of assisting U.S. independent oil and gas producers with timely, informed technology decisions during Fiscal Year 2004 (FY04). PTTC has active grassroots programs through its 10 Regional Lead Organizations (RLOs) and 2 satellite offices. They bring research and academia to the table via their association with geological surveys and engineering departments. The regional directors interact with independent oil and gas producers through technology workshops, resource centers, websites, newsletters, technical publications and other cooperative outreach efforts. PTTC's Headquarters (HQ) staff receives direction from a National Board of Directors predominantly comprised of American natural gas and oil producers to plan and manage the overall technology transfer program. PTTC HQ implements a comprehensive communications program by interconnecting the talents of the National Board, 10 Regional Producer Advisory Groups (PAG) and the RLOs with industry across the U.S. PTTC effectively combines federal funding through the Department of Energy's (DOE) Office of Fossil Energy, namely the Strategic Center for Natural Gas and Oil with state and industry contributions to share application of upstream technologies. Ultimately, these efforts factor in to provide a safe, secure and reliable energy supply for American consumers. This integrated resource base, combined with industry volunteers guiding PTTC's activities and the dedication of national and regional staff, are achieving notable results regarding domestic production figures. PTTC is increasingly recognized as a critical resource for information and access to technologies by providing direct contact with research, development and demonstration (RD&D) results. A key to the program is demonstrating proven technologies that can be applied broadly and rapidly. This technical progress report summarizes PTTC's accomplishments during

  6. 'Peak oil' or 'peak demand'?

    International Nuclear Information System (INIS)

    Chevallier, Bruno; Moncomble, Jean-Eudes; Sigonney, Pierre; Vially, Rolland; Bosseboeuf, Didier; Chateau, Bertrand

    2012-01-01

    This article reports a workshop which addressed several energy issues like the objectives and constraints of energy mix scenarios, the differences between the approaches in different countries, the cost of new technologies implemented for this purposes, how these technologies will be developed and marketed, which will be the environmental and societal acceptability of these technical choices. Different aspects and issues have been more precisely presented and discussed: the peak oil, development of shale gases and their cost (will non conventional hydrocarbons modify the peak oil and be socially accepted?), energy efficiency (its benefits, its reality in France and other countries, its position in front of the challenge of energy transition), and strategies in the transport sector (challenges for mobility, evolution towards a model of sustainable mobility)

  7. Targeted Technology Transfer to US Independents

    Energy Technology Data Exchange (ETDEWEB)

    E. Lance Cole

    2009-09-30

    The Petroleum Technology Transfer Council (PTTC) was established by domestic crude oil and natural gas producers, working in conjunction with the Independent Petroleum Association of America (IPAA), the U.S. Department of Energy (DOE) and selected universities, in 1994 as a national not-for-profit organization. Its goal is to transfer Exploration and Production (E&P) technology to the domestic upstream petroleum industry, in particular to the small independent operators. PTTC connects producers, technology providers and innovators, academia, and university/industry/government research and development (R&D) groups. From inception PTTC has received federal funding through DOE's oil and natural gas program managed by the National Energy Technology Laboratory (NETL). With higher funding available in its early years, PTTC was able to deliver well more than 100 workshops per year, drawing 6,000 or more attendees per year. Facing the reality of little or no federal funding in the 2006-2007 time frame, PTTC and the American Association of Petroleum Geologists (AAPG) worked together for PTTC to become a subsidiary organization of AAPG. This change brings additional organizational and financial resources to bear for PTTC's benefit. PTTC has now been 'powered by AAPG' for two full fiscal years. There is a clear sense that PTTC has stabilized and is strengthening its regional workshop and national technology transfer programs and is becoming more entrepreneurial in exploring technology transfer opportunities beyond its primary DOE contract. Quantitative accomplishments: PTTC has maintained its unique structure of a national organization working through Regional Lead Organizations (RLOs) to deliver local, affordable workshops. During the contract period PTTC consolidated from 10 to six regions efficiency and alignment with AAPG sections. The number of workshops delivered by its RLOs during the contract period is shown below. Combined attendance over the

  8. Verification of maximum radial power peaking factor due to insertion of FPM-LEU target in the core of RSG-GAS reactor

    Energy Technology Data Exchange (ETDEWEB)

    Setyawan, Daddy, E-mail: d.setyawan@bapeten.go.id [Center for Assessment of Regulatory System and Technology for Nuclear Installations and Materials, Indonesian Nuclear Energy Regulatory Agency (BAPETEN), Jl. Gajah Mada No. 8 Jakarta 10120 (Indonesia); Rohman, Budi [Licensing Directorate for Nuclear Installations and Materials, Indonesian Nuclear Energy Regulatory Agency (BAPETEN), Jl. Gajah Mada No. 8 Jakarta 10120 (Indonesia)

    2014-09-30

    Verification of Maximum Radial Power Peaking Factor due to insertion of FPM-LEU target in the core of RSG-GAS Reactor. Radial Power Peaking Factor in RSG-GAS Reactor is a very important parameter for the safety of RSG-GAS reactor during operation. Data of radial power peaking factor due to the insertion of Fission Product Molybdenum with Low Enriched Uranium (FPM-LEU) was reported by PRSG to BAPETEN through the Safety Analysis Report RSG-GAS for FPM-LEU target irradiation. In order to support the evaluation of the Safety Analysis Report incorporated in the submission, the assessment unit of BAPETEN is carrying out independent assessment in order to verify safety related parameters in the SAR including neutronic aspect. The work includes verification to the maximum radial power peaking factor change due to the insertion of FPM-LEU target in RSG-GAS Reactor by computational method using MCNP5and ORIGEN2. From the results of calculations, the new maximum value of the radial power peaking factor due to the insertion of FPM-LEU target is 1.27. The results of calculations in this study showed a smaller value than 1.4 the limit allowed in the SAR.

  9. Technological aspects of cryogenic laser-fusion targets

    International Nuclear Information System (INIS)

    Musinski, D.L.; Henderson, T.M.; Simms, R.J.; Pattinson, T.R.; Jacobs, R.B.

    1980-01-01

    Most current laser-fusion targets consist of hollow spherical glass shells which have been filled with a mixture of gaseous deuterium-tritium fuel. Theoretical considerations suggest that optimum yields can be obtained from these targets if the fuel is condensed as a uniform liquid or solid layer on the inner surface of the glass shell at the time it is irradiated. In principle, this can be accomplished in a straightforward way by cooling the target below the condensation or freezing point of the fuel. In practice, cryogenic targets can appear in routine laser experiments only when the necessary cryogenic technology is reliably integrated into experimental target chambers. Significant progress has been made recently in this field. The authors will discuss the scientific basis and the various technological features of a system which has allowed the successful irradiation of uniform solid-fuel-layer targets

  10. Targeted Technology Transfer to US Independents

    Energy Technology Data Exchange (ETDEWEB)

    Schatzinger, Viola [Petroleum Tech. Transfer Council, Tulsa, OK (United States); Chapman, Kathy [Petroleum Tech. Transfer Council, Tulsa, OK (United States); Lovendahl, Kristi [Petroleum Tech. Transfer Council, Tulsa, OK (United States)

    2014-09-30

    The Petroleum Technology Transfer Council (PTTC) is a unique not-for-profit network that focuses on transferring Exploration and Production (E&P) technology to the domestic oil and natural gas producing industry. PTTC connects producers, technology providers and innovators, academia, research and development (R&D) consortiums and governments. Local affordable workshops delivered by Regional Lead Organizations (RLOs), which are typically a university or geological survey, are a primary tool. PTTC also maintains a website network, issues a national newsletter, provides a column in a major trade publication, and exhibits at major industry events. It also encourages industry to ask technology-related questions, striving to find relevant answers that will save questioners significant time. Working since late 1993, the PTTC network has a proven track record of providing industry with technology insights they can apply. Volunteers at the regional and national level provide key guidance regarding where to focus technical effort and help connect PTTC with industry. At historical funding levels, PTTC had been able to hold well more than 100 workshops per year, drawing 6,000+ attendees. As funding decreased in the early 2000s, the level of activity decreased and PTTC sought a merger with the American Association of Petroleum Geologists (AAPG), becoming an AAPG-managed organization at the start of FY08. This relationship with AAPG was terminated by mutual consent in May 2011 and PTTC once again operates independently. Chris Hall, California continued to serve as Chairman of the Board of Directors until December 2013. At the time PTTC reorganized into a RLO led organization with Mary Carr and Jeremy Viscomi as co-Executive Directors. Jerry Anderson became the Chairman of the PTTC Board of Directors and Chris Hall continues to serve on the Board. Workshop activity stabilized at 55-65 workshops per year averaging 3,100 attendees. FY14 represented the fifth year in a multi

  11. Future technological developments to fulfill AG2020 targets

    DEFF Research Database (Denmark)

    Markussen, Mads Ville; Østergård, Hanne; Borch, Kristian

    2010-01-01

    This report constitute an analysis of selected technologies that are anticipated to underpin the images described in Giaoutzi et al (2008) and it proposes policy measures to promote these technologies. It builds on Borch et al (2008) where a more detailed description of technologies can be found....... as the threats for development of the technology in the respective images. Finally policies for promoting and spreading technologies are proposed.......This report constitute an analysis of selected technologies that are anticipated to underpin the images described in Giaoutzi et al (2008) and it proposes policy measures to promote these technologies. It builds on Borch et al (2008) where a more detailed description of technologies can be found....... Based on the technological narratives and imperatives, we select a set of present available technologies that are able to support the society in reaching the targets set up by AG2020. For each of these technologies, we evaluate the strengths and weaknesses of the technology to reach the target as well...

  12. Electroless plating technology of integral hohlraum Cu target

    International Nuclear Information System (INIS)

    Liu Jiguang; Fu Qu; Wan Xiaobo; Zhou Lan; Xiao Jiang

    2005-01-01

    The electroless plating method of making integral hohlraum Cu target and corrosion-resistant technology of target's surface were researched. The actual process was as follows, choosing plexiglass (PMMA) as arbor, taking cationic activation and electroless plating Cu on the arbor surface, taking arbor surface passivation and chemical etching by C 6 H 5 N 3 solution. The technology is easy to realize and its cost is lower, so it is of great reference value for fabricating other integral hohlraum metal or alloy targets used for inertial confinement fusion study. (author)

  13. Current status of solid state target technologies

    International Nuclear Information System (INIS)

    Schlyer, David J.; Ferrieri, Richard A.

    2000-01-01

    In general radioisotopes fall into two basic groups: those that are neutron rich and those that are neutron deficient. Those that are neutron rich are usually made in a nuclear reactor while those that are neutron deficient are produced by bombarding a suitable target with protons, deuterons or helium particles. Particle accelerators and in particular cyclotrons, were very important in the preparation of radioisotopes during the years of 1935 to the end of World War Two. The amount of radioactive material which could be produced in an accelerator was many times greater than the amount which could be produced using the alpha particles from naturally occurring radioactive elements. After World War Two, reactors were used to produce radioactive elements and the use of accelerators for this purpose became less common. However, as the techniques for using radiotracers became more sophisticated, it became clear that reactor produced radionuclides could not satisfy the growing demands and therefore accelerators were needed to produce new radioisotopes which could be used in new ways. There are three major reasons the accelerator produced radioisotopes are used more widely that reactor produced radionuclides. These are: 1) The radioisotopes produced in a reactor may have unfavorable decay characteristics (particle emission, half-life, gamma rays, etc.) for a particular application. 2) The radioisotope cannot be produced in a reactor with high specific activity. 3) Access to a reactor is limited. The number of reactors available has become many fewer than the number of cyclotrons available to the scientific community, or the radioisotope has too short a half-life to be transported to the site where it is needed. There are a wide variety of nuclear reactions which are used in an accelerator to produce the artificial radioactivity. The bombarding particles are usually protons, deuterons, or helium particles. The energies which are used range from a few MeV to hundreds of Me

  14. Reconfiguring global pharmaceutical value networks through targeted technology interventions

    OpenAIRE

    Harrington, Tomas Seosamh; Phillips, MA; Srai, Jagjit Singh

    2016-01-01

    Targeting a series of advanced manufacturing technology (AMT) ‘interventions’ provides the potential for significant step changes across the pharmaceutical value chain, from early stage ‘system discovery’ and clinical trials, through to novel service supply models. This research explores future value network configurations which, when aligned with disruptive shifts in technology (process and digital), may enable alternative routes to medicines production and the delivery of additional value t...

  15. Technology strategy for gas technologies; Technology Target Areas; TTA8 Gas Technology

    Energy Technology Data Exchange (ETDEWEB)

    2008-07-01

    TTA8 - Gas technologies points out the various routes Norway can follow to capitalise on the vast resources of natural gas that will be produced in the years to come by developing a strong technology and competence platform. A broad view is taken for the value creation having as basis the continued gas export from NCS to Europe, but also a strong focus on development of gas resources in other parts of the world. The latter can also be seen as part of international positioning for upstream resources and does also include involvements in projects, and export of technology and products. The TTA has structured the analysis into 3 main areas: Gas transport and processing (pipeline, LNG, other); Gas conversion to fuels, chemicals and materials; CO{sub 2} management. In this report, for each of these areas, scenarios based on a gap analysis are presented. One of the key goals has been to identify pacing and emerging technologies for the next 20 years. Based on this, technologies have been mapped according to importance for future competitiveness and technology ambitions. This also includes primary funding responsibilities (public and/or industry). The road map below reflects the key issues in the proposed strategy. The base level of the figure explains areas that will have to be pursued to maintain Norway's role as a key gas and gas technology provider. The second layer represents near term options and possibilities with a reasonable risk profile that could further enhance the Norwegian position given the resources and drive to further develop this industry. As the top layer we have selected some of our 'dreams', what we may achieve if a progressive approach is followed with a strongly innovation based policy. It is acknowledged by the TTA that Norway cannot be a leading technology player in all aspects of the gas value chain. For some technologies we should be an active player and developer, whilst for other technologies we should become a competent buyer and user. This

  16. Technology strategy for gas technologies; Technology Target Areas; TTA8 Gas Technology

    Energy Technology Data Exchange (ETDEWEB)

    2008-07-01

    TTA8 - Gas technologies points out the various routes Norway can follow to capitalise on the vast resources of natural gas that will be produced in the years to come by developing a strong technology and competence platform. A broad view is taken for the value creation having as basis the continued gas export from NCS to Europe, but also a strong focus on development of gas resources in other parts of the world. The latter can also be seen as part of international positioning for upstream resources and does also include involvements in projects, and export of technology and products. The TTA has structured the analysis into 3 main areas: Gas transport and processing (pipeline, LNG, other); Gas conversion to fuels, chemicals and materials; CO{sub 2} management. In this report, for each of these areas, scenarios based on a gap analysis are presented. One of the key goals has been to identify pacing and emerging technologies for the next 20 years. Based on this, technologies have been mapped according to importance for future competitiveness and technology ambitions. This also includes primary funding responsibilities (public and/or industry). The road map below reflects the key issues in the proposed strategy. The base level of the figure explains areas that will have to be pursued to maintain Norway's role as a key gas and gas technology provider. The second layer represents near term options and possibilities with a reasonable risk profile that could further enhance the Norwegian position given the resources and drive to further develop this industry. As the top layer we have selected some of our 'dreams', what we may achieve if a progressive approach is followed with a strongly innovation based policy. It is acknowledged by the TTA that Norway cannot be a leading technology player in all aspects of the gas value chain. For some technologies we should be an active player and developer, whilst for other technologies we should become a competent buyer

  17. Technologies using accelerator-driven targets under development at BNL

    International Nuclear Information System (INIS)

    Van Tuyle, G.J.

    1994-01-01

    Recent development work conducted at Brookhaven National Laboratory on technologies which use particle accelerator-driven targets is summarized. These efforts include development of the Spallation-Induced Lithium Conversion (SILC) Target for the Accelerator Production of Tritium (APT), the Accelerator-Driven Assembly for Plutonium Transformation (ADAPT) Target for the Accelerator-Based Conversion (ABC) of excess weapons plutonium. The PHOENIX Concept for the accelerator-driven transmutation of minor actinides and fission products from the waste stream of commercial nuclear power plants, and other potential applications

  18. Gene transfer technology and genetic radioisotope targeting therapy

    International Nuclear Information System (INIS)

    Wang Jiaqiong; Wang Zizheng

    2004-01-01

    With deeper cognition about mechanisms of disease at the cellular and molecular level, gene therapy has become one of the most important research fields in medical molecular biology at present. Gene transfer technology plays an important role during the course of gene therapy, and further improvement should be made about vectors carrying target gene sequences. Also, gene survey is needed during gene therapy, and gene imaging is the most effective method. The combination of gene therapy and targeted radiotherapy, that is, 'Genetic Radioisotope Targeting Therapy', will be a novel approach to tumor gene therapy

  19. Artificial Intelligence In Automatic Target Recognizers: Technology And Timelines

    Science.gov (United States)

    Gilmore, John F.

    1984-12-01

    The recognition of targets in thermal imagery has been a problem exhaustively analyzed in its current localized dimension. This paper discusses the application of artificial intelligence (AI) technology to automatic target recognition, a concept capable of expanding current ATR efforts into a new globalized dimension. Deficiencies of current automatic target recognition systems are reviewed in terms of system shortcomings. Areas of artificial intelligence which show the most promise in improving ATR performance are analyzed, and a timeline is formed in light of how near (as well as far) term artificial intelligence applications may exist. Current research in the area of high level expert vision systems is reviewed and the possible utilization of artificial intelligence architectures to improve low level image processing functions is also discussed. Additional application areas of relevance to solving the problem of automatic target recognition utilizing both high and low level processing are also explored.

  20. Discharge runaway in high power impulse magnetron sputtering of carbon: the effect of gas pressure, composition and target peak voltage

    Science.gov (United States)

    Vitelaru, Catalin; Aijaz, Asim; Constantina Parau, Anca; Kiss, Adrian Emil; Sobetkii, Arcadie; Kubart, Tomas

    2018-04-01

    Pressure and target voltage driven discharge runaway from low to high discharge current density regimes in high power impulse magnetron sputtering of carbon is investigated. The main purpose is to provide a meaningful insight of the discharge dynamics, with the ultimate goal to establish a correlation between discharge properties and process parameters to control the film growth. This is achieved by examining a wide range of pressures (2–20 mTorr) and target voltages (700–850 V) and measuring ion saturation current density at the substrate position. We show that the minimum plasma impedance is an important parameter identifying the discharge transition as well as establishing a stable operating condition. Using the formalism of generalized recycling model, we introduce a new parameter, ‘recycling ratio’, to quantify the process gas recycling for specific process conditions. The model takes into account the ion flux to the target, the amount of gas available, and the amount of gas required for sustaining the discharge. We show that this parameter describes the relation between the gas recycling and the discharge current density. As a test case, we discuss the pressure and voltage driven transitions by changing the gas composition when adding Ne into the discharge. We propose that standard Ar HiPIMS discharges operated with significant gas recycling do not require Ne to increase the carbon ionization.

  1. Screening Technologies for Target Identification in Pancreatic Cancer

    Energy Technology Data Exchange (ETDEWEB)

    Michl, Patrick, E-mail: michlp@med.uni-marburg.de; Ripka, Stefanie; Gress, Thomas; Buchholz, Malte [Department of Gastroenterology and Endocrinology, University Hospital, Philipps-University Marburg, Baldinger Strasse, D-35043 Marburg (Germany)

    2010-12-29

    Pancreatic cancer exhibits an extraordinarily high level of resistance to almost any kind of systemic therapy evaluated in clinical trials so far. Therefore, the identification of novel therapeutic targets is urgently required. High-throughput screens have emerged as an important tool to identify putative targets for diagnosis and therapy in an unbiased manner. More than a decade ago, microarray technology was introduced to identify differentially expressed genes in pancreatic cancer as compared to normal pancreas, chronic pancreatitis and other cancer types located in close proximity to the pancreas. In addition, proteomic screens have facilitated the identification of differentially secreted proteins in body fluids of pancreatic cancer patients, serving as possible biomarkers. Recently, RNA interference-based loss-of-function screens have been used to identify functionally relevant genes, whose knock-down has impact on pancreatic cancer cell viability, thereby representing potential new targets for therapeutic intervention. This review summarizes recent results of transcriptional, proteomic and functional screens in pancreatic cancer and discusses potentials and limitations of the respective technologies as well as their impact on future therapeutic developments.

  2. Screening Technologies for Target Identification in Pancreatic Cancer

    International Nuclear Information System (INIS)

    Michl, Patrick; Ripka, Stefanie; Gress, Thomas; Buchholz, Malte

    2010-01-01

    Pancreatic cancer exhibits an extraordinarily high level of resistance to almost any kind of systemic therapy evaluated in clinical trials so far. Therefore, the identification of novel therapeutic targets is urgently required. High-throughput screens have emerged as an important tool to identify putative targets for diagnosis and therapy in an unbiased manner. More than a decade ago, microarray technology was introduced to identify differentially expressed genes in pancreatic cancer as compared to normal pancreas, chronic pancreatitis and other cancer types located in close proximity to the pancreas. In addition, proteomic screens have facilitated the identification of differentially secreted proteins in body fluids of pancreatic cancer patients, serving as possible biomarkers. Recently, RNA interference-based loss-of-function screens have been used to identify functionally relevant genes, whose knock-down has impact on pancreatic cancer cell viability, thereby representing potential new targets for therapeutic intervention. This review summarizes recent results of transcriptional, proteomic and functional screens in pancreatic cancer and discusses potentials and limitations of the respective technologies as well as their impact on future therapeutic developments

  3. The Advanced Linked Extended Reconnaissance & Targeting Technology Demonstration project

    Science.gov (United States)

    Edwards, Mark

    2008-04-01

    The Advanced Linked Extended Reconnaissance & Targeting (ALERT) Technology Demonstration (TD) project is addressing many operational needs of the future Canadian Army's Surveillance and Reconnaissance forces. Using the surveillance system of the Coyote reconnaissance vehicle as an experimental platform, the ALERT TD project aims to significantly enhance situational awareness by fusing multi-sensor and tactical data, developing automated processes, and integrating beyond line-of-sight sensing. The project is exploiting important advances made in computer processing capability, displays technology, digital communications, and sensor technology since the design of the original surveillance system. As the major research area within the project, concepts are discussed for displaying and fusing multi-sensor and tactical data within an Enhanced Operator Control Station (EOCS). The sensor data can originate from the Coyote's own visible-band and IR cameras, laser rangefinder, and ground-surveillance radar, as well as from beyond line-of-sight systems such as mini-UAVs and unattended ground sensors. Video-rate image processing has been developed to assist the operator to detect poorly visible targets. As a second major area of research, automatic target cueing capabilities have been added to the system. These include scene change detection, automatic target detection and aided target recognition algorithms processing both IR and visible-band images to draw the operator's attention to possible targets. The merits of incorporating scene change detection algorithms are also discussed. In the area of multi-sensor data fusion, up to Joint Defence Labs level 2 has been demonstrated. The human factors engineering aspects of the user interface in this complex environment are presented, drawing upon multiple user group sessions with military surveillance system operators. The paper concludes with Lessons Learned from the project. The ALERT system has been used in a number of C4ISR

  4. The advanced linked extended reconnaissance and targeting technology demonstration project

    Science.gov (United States)

    Cruickshank, James; de Villers, Yves; Maheux, Jean; Edwards, Mark; Gains, David; Rea, Terry; Banbury, Simon; Gauthier, Michelle

    2007-06-01

    The Advanced Linked Extended Reconnaissance & Targeting (ALERT) Technology Demonstration (TD) project is addressing key operational needs of the future Canadian Army's Surveillance and Reconnaissance forces by fusing multi-sensor and tactical data, developing automated processes, and integrating beyond line-of-sight sensing. We discuss concepts for displaying and fusing multi-sensor and tactical data within an Enhanced Operator Control Station (EOCS). The sensor data can originate from the Coyote's own visible-band and IR cameras, laser rangefinder, and ground-surveillance radar, as well as beyond line-of-sight systems such as a mini-UAV and unattended ground sensors. The authors address technical issues associated with the use of fully digital IR and day video cameras and discuss video-rate image processing developed to assist the operator to recognize poorly visible targets. Automatic target detection and recognition algorithms processing both IR and visible-band images have been investigated to draw the operator's attention to possible targets. The machine generated information display requirements are presented with the human factors engineering aspects of the user interface in this complex environment, with a view to establishing user trust in the automation. The paper concludes with a summary of achievements to date and steps to project completion.

  5. Inertial Confinement Fusion Target Component Fabrication and Technology Development report

    International Nuclear Information System (INIS)

    Steinman, D.

    1994-03-01

    On December 30, 1990, the US Department of Energy entered into a contract with General Atomics (GA) to be the Inertial Confinement Fusion Target Component Fabrication and Technology Development Support contractor. This report documents the technical activities which took place under this contract during the period of October 1, 1992 through September 30, 1993. During this period, GA was assigned 18 tasks in support of the Inertial Confinement Fusion program and its laboratories. These tasks included ''Capabilities Activation'' and ''Capabilities Demonstration'' to enable us to begin production of glass and composite polymer capsules. Capsule delivery tasks included ''Small Glass Shell Deliveries'' and ''Composite Polymer Capsules'' for Lawrence Livermore National Laboratory (LLNL) and Los Alamos National Laboratory (LANL). We also were asked to provide direct ''Onsite Support'' at LLNL and LANL. We continued planning for the transfer of ''Micromachining Equipment from Rocky Flats'' and established ''Target Component Micromachining and Electroplating Facilities'' at GA. We fabricated over 1100 films and filters of 11 types for Sandia National Laboratory and provided full-time onsite engineering support for target fabrication and characterization. We initiated development of methods to make targets for the Naval Research Laboratory. We investigated spherical interferometry, built an automated capsule sorter, and developed an apparatus for calorimetric measurement of fuel fill for LLNL. We assisted LANL in the ''Characterization of Opaque b-Layered Targets.'' We developed deuterated and UV-opaque polymers for use by the University of Rochester's Laboratory for Laser Energetics (UR/LLE) and devised a triple-orifice droplet generator to demonstrate the controlled-mass nature of the microencapsulation process

  6. How to trigger low carbon technologies by EU targets for 2030? An assessment of technology needs

    Energy Technology Data Exchange (ETDEWEB)

    Groenenberg, H.; Van Breevoort, P.; Janeiro, L.; Winkel, T.

    2013-04-15

    The current EU framework for energy and climate policies up to 2020 consists of three headline targets: 20% reduction of GHG emissions compared to 2005, a 20% share of renewable energy in final energy consumption, and 20% primary energy savings compared to baseline developments. While progress on these 2020 targets is mixed, discussions in the EU about climate and energy policies and targets for the period after 2020 have started. Given the long cycles associated to energy and climate investments, agreement on a clear longer-term policy framework is critical to improve visibility for investors and avoid lock-in effects in inefficient or polluting technologies. Therefore, the European Commission published a Communication on 6 June 2012 on the need for a long term policy framework for renewable energy, and a Green Paper on the 2030 climate and energy policy framework on 27 March 2013. Against this background, the Dutch Ministries of Infrastructure and Environment and the Ministry of Economic Affairs requested PBL to create input for the European debate on climate targets and policies until and beyond 2030. Ecofys supported PBL by addressing the following two questions: (1) What steps are needed for selected key technology groups to achieve long term GHG emission reductions and what climate and energy policies are likely to trigger these steps?; and (2) What are the pros and cons of a 2030 policy framework with (a) a GHG reduction target only, and (b) targets for GHG reduction, renewable energy, and energy efficiency? The focus of the first question was on four technology groups, namely (1) energy efficiency in the built environment, notably for heat; (2) solar PV and wind energy; (3) advanced biofuels; (4) CO2 carbon capture and storage (CCS). An analysis of the steps needed for the deployment of the full GHG mitigation potential of the discussed technology groups shows that this will largely depend on the adoption of a wide range of policy instruments by EU Member

  7. A Plane Target Detection Algorithm in Remote Sensing Images based on Deep Learning Network Technology

    Science.gov (United States)

    Shuxin, Li; Zhilong, Zhang; Biao, Li

    2018-01-01

    Plane is an important target category in remote sensing targets and it is of great value to detect the plane targets automatically. As remote imaging technology developing continuously, the resolution of the remote sensing image has been very high and we can get more detailed information for detecting the remote sensing targets automatically. Deep learning network technology is the most advanced technology in image target detection and recognition, which provided great performance improvement in the field of target detection and recognition in the everyday scenes. We combined the technology with the application in the remote sensing target detection and proposed an algorithm with end to end deep network, which can learn from the remote sensing images to detect the targets in the new images automatically and robustly. Our experiments shows that the algorithm can capture the feature information of the plane target and has better performance in target detection with the old methods.

  8. Future of brain stimulation: new targets, new indications, new technology.

    Science.gov (United States)

    Hariz, Marwan; Blomstedt, Patric; Zrinzo, Ludvic

    2013-11-01

    In the last quarter of a century, DBS has become an established neurosurgical treatment for Parkinson's disease (PD), dystonia, and tremors. Improved understanding of brain circuitries and their involvement in various neurological and psychiatric illnesses, coupled with the safety of DBS and its exquisite role as a tool for ethical study of the human brain, have unlocked new opportunities for this technology, both for future therapies and in research. Serendipitous discoveries and advances in structural and functional imaging are providing abundant "new" brain targets for an ever-increasing number of pathologies, leading to investigations of DBS in diverse neurological, psychiatric, behavioral, and cognitive conditions. Trials and "proof of concept" studies of DBS are underway in pain, epilepsy, tinnitus, OCD, depression, and Gilles de la Tourette syndrome, as well as in eating disorders, addiction, cognitive decline, consciousness, and autonomic states. In parallel, ongoing technological development will provide pulse generators with longer battery longevity, segmental electrode designs allowing a current steering, and the possibility to deliver "on-demand" stimulation based on closed-loop concepts. The future of brain stimulation is certainly promising, especially for movement disorders-that will remain the main indication for DBS for the foreseeable future-and probably for some psychiatric disorders. However, brain stimulation as a technique may be at risk of gliding down a slippery slope: Some reports indicate a disturbing trend with suggestions that future DBS may be proposed for enhancement of memory in healthy people, or as a tool for "treatment" of "antisocial behavior" and for improving "morality." © 2013 International Parkinson and Movement Disorder Society.

  9. Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines.

    Science.gov (United States)

    Gao, Zitong; Liu, Yang; Wang, Xiaoyue; Song, Jingyuan; Chen, Shilin; Ragupathy, Subramanyam; Han, Jianping; Newmaster, Steven G

    2017-07-19

    Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.

  10. Education, Technology, and Media: A Peak into My Summer Internship at NASA Glenn Research Center in Cleveland, Ohio

    Science.gov (United States)

    Moon, James

    2004-01-01

    My name is James Moon and I am a senor at Tennessee State University where my major is Aeronautical and Industrial Technology with a concentration in industrial electronics. I am currently serving my internship in the Engineering and Technical Services Directorate at the Glenn Research Center (GRC). The Engineering and Technical Service Directorate provides the services and infrastructure for the Glenn Research Center to take research concepts to reality. They provide a full range of integrated services including engineering, advanced prototyping and testing, facility management, and information technology for NASA, industry, and academia. Engineering and Technical Services contains the core knowledge in Information Technology (IT). This includes data systems and analysis, inter and intranet based systems design and data security. Including the design and development of embedded real-time sohare applications for flight and supporting ground systems, Engineering and Technical Services provide a wide range of IT services and products specific to the Glenn Research Center research and engineering community.

  11. Accelerator and spallation target technologies for ADS applications

    International Nuclear Information System (INIS)

    2005-01-01

    The efficient and safe management of spent fuel produced during the operation of commercial nuclear power plants is an important issue. Worldwide, more than 250 000 tons of spent fuel from reactors currently operating will require disposal. These numbers account for only high-level radio-active waste generated by present-day power reactors. Nearly all issues related to risks to future generations arising from the long-term disposal of such spent nuclear fuel is attributable to only about 1% of its content. This 1% is made up primarily of plutonium, neptunium, americium and curium (called transuranic elements) and the long-lived isotopes of iodine and technetium. When transuranics are removed from discharged fuel destined for disposal, the toxic nature of the spent fuel drops below that of natural uranium ore (that which was originally mined for the nuclear fuel) within a period of several hundred years. This significantly reduces the burden on geological repositories and the problem of addressing the remaining long-term residues can thus be done in controlled environments having timescales of centuries rather than millennia. To address the disposal of transuranics, accelerator-driven systems (ADS), i.e. a sub-critical system driven by an accelerator to sustain the chain reaction, seem to have great potential for transuranic transmutation, though much R and D work is still required in order to demonstrate their desired capability as a whole system. This report describes the current status of accelerator and spallation target technologies and suggests technical issues that need to be resolved for ADS applications. It will be of particular interest to nuclear scientists involved in ADS development and in advanced fuel cycles in general. (author)

  12. Effects of peak shaving technologies in the residential and commercial sector; Minsei bumon no fuka heijunka gijutsu no donyu koka

    Energy Technology Data Exchange (ETDEWEB)

    Nagata, Y. [Kyoto University, Kyoto (Japan); Takahashi, M.; Uchiyama, Y. [Central Research Institute of Electric Power Industry, Tokyo (Japan)

    1997-09-01

    This paper analyzes how much of the power demand could be reduced in the future by improving efficiencies of electric power utilizing appliances used in the residential and commercial sector. It discusses whether the reduction would lead to load leveling. Annual load rate in the power demand is continuing to decrease because of power demand increase in the residential and commercial sector, and increase in demand for air conditioning in summer. If a technology to improve electric appliance efficiency is proliferated to its maximum scope, the annual load rate in fiscal 2014 may be improved by 1.1 percent point. Since the improvement allows new power generation facility installation cost to be deferred, the power generation unit cost can be reduced by 0.11 yen per kwh. If a heat storage type air conditioning technology is proliferated to its maximum scope, the annual load rate in fiscal 2014 can be improved by 1.8 percent point, and the power generation cost may also be reduced. If the device efficiency improving technology and the heat storage type air conditioning technology are introduced to their maximum simultaneously, the annual load rate in fiscal 2014 can be improved by 2.5 percent point, and the power generation cost may also be reduced by 0.24 yen per kwh. If a promotion policy is taken on proliferation of a specific device efficiency improving technology having excellent economic performance by providing subsidy, the reduction amount of cumulative power generation expense will be much greater than the required subsidy amount. 10 refs., 9 figs., 22 tabs.

  13. Physics and technology of superthin internal targets in storage rings

    International Nuclear Information System (INIS)

    Popov, S.G.

    1989-01-01

    The new generation of accelerators for coincidence electronuclear investigations is discussed. The luminosity and beam parameters are calculated for an electron storage ring with an internal target operating in the superthin regime. The advantages and disadvantages in comparison with conventional operation using an external beam and target are described. The intermediate results for 2 GeV electron scattering on polarized internal deuterium target are given (joint Novosibirsk-Argonne experiment). 32 refs.; 5 figs

  14. Target technologies for laser inertial confinement fusion: state-of-the-art and future perspective

    International Nuclear Information System (INIS)

    Zhang Lin; Du Kai

    2013-01-01

    Targets are physical base of the laser inertial confinement fusion (ICF) researches. The quality of the targets has extremely important influences on the reliabilities and degree of precision of the ICF experimental results. The characteristics of the ICF targets, such as complexity and microscale, high precision, determine that the target fabrication process must be a system engineering. This paper presents progresses on the fabrication technologies of ICF targets. The existing problem and the future needs of ICF target fabrication technologies are also discussed. (authors)

  15. Technology strategy for subsea processing and transport; Technology Target Areas; TTA6 - Subsea processing and transportation

    Energy Technology Data Exchange (ETDEWEB)

    2008-07-01

    OG21 (www.OG21.org) Norway's official technology strategy for the petroleum sector issued a revised strategy document in November 2005 (new strategy planned in 2009). In this document 'Subsea processing and transport' was identified as one of the eight new technology target areas (TTAs). The overall OG21 strategy document is on an aggregated level, and therefore the Board of OG21 decided that a sub-strategy for each TTA was needed. This document proposes the sub-strategy for the technology target area 'Subsea processing and transport' which covers the technology and competence necessary to effectively transport well stream to a platform or to onshore facilities. This includes multiphase flow modelling, flow assurance challenges to avoid problems with hydrates, asphaltenes and wax, subsea or downhole fluid conditioning including bulk water removal, and optionally complete water removal, and sand handling. It also covers technologies to increase recovery by pressure boosting from subsea pumping and/or subsea compression. Finally it covers technologies to facilitate subsea processing such as control systems and power supply. The vision of the Subsea processing and transport TTA is: Norway is to be the leading international knowledge- and technology cluster in subsea processing and transport: Sustain increased recovery and accelerated production on the NCS by applying subsea processing and efficient transport solutions; Enable >500 km gas/condensate multiphase well stream transport; Enable >200 km oil-dominated multiphase well stream transport; Enable well stream transport of complex fluids; Enable subsea separation, boosting compression, and water injection; Enable deepwater developments; Enable environmentally friendly and energy efficient field development. Increase the export of subsea processing and transport technology: Optimize technology from the NCS for application worldwide; Develop new technology that can meet the challenges found in

  16. Energy technologies for post Kyoto targets in the medium term

    International Nuclear Information System (INIS)

    Soenderberg Petersen, L.; Larsen, H.

    2003-09-01

    The Risoe International Energy Conference took place 19 - 21 May 2003 and the aim was to present and discuss new developments and trends in energy technologies which may become main contributors to the energy scene in 15 to 20 years. The conference addressed R and D related to the individual technologies as well as system integration. The proceedings are prepared from papers presented at the conference and received with corrections, if any, until the final deadline on 25 June 2003. (au)

  17. Energy technologies for post Kyoto targets in the medium term

    Energy Technology Data Exchange (ETDEWEB)

    Soenderberg Petersen, L; Larsen, H [eds.

    2003-09-01

    The Risoe International Energy Conference took place 19 - 21 May 2003 and the aim was to present and discuss new developments and trends in energy technologies which may become main contributors to the energy scene in 15 to 20 years. The conference addressed R&D related to the individual technologies as well as system integration. The proceedings are prepared from papers presented at the conference and received with corrections, if any, until the final deadline on 25 June 2003. (au)

  18. Development of a Novel Targeted RNAi Delivery Technology inTherapies for Metabolic Diseases

    Science.gov (United States)

    2017-10-01

    report Impact on other disciplines: Nothing to report Impact on technology transfer: Nothing to report Impact on society : Nothing to report 5. CHANGES...AWARD NUMBER: W81XWH-15-1-0569 TITLE: Development of a Novel Targeted RNAi Delivery Technology in Therapies for Metabolic Diseases PRINCIPAL...COVERED 30Sep2016 - 29Sep2017 4. TITLE AND SUBTITLE Development of a Novel Targeted RNAi Delivery Technology in Therapies for Metabolic Diseases 5a

  19. Fabrication of laser-target components by semiconductor technology

    International Nuclear Information System (INIS)

    Tindall, W.E.

    1979-01-01

    This paper describes the design and fabrication of a unique silicon substrate with which laser-target components can be mass produced. Different sizes and shapes of gold foils from 50 to 3000 microns in diameter and up to 25 microns thick have been produced with this process since 1976

  20. Infrared small target detection technology based on OpenCV

    Science.gov (United States)

    Liu, Lei; Huang, Zhijian

    2013-09-01

    Accurate and fast detection of infrared (IR) dim target has very important meaning for infrared precise guidance, early warning, video surveillance, etc. In this paper, some basic principles and the implementing flow charts of a series of algorithms for target detection are described. These algorithms are traditional two-frame difference method, improved three-frame difference method, background estimate and frame difference fusion method, and building background with neighborhood mean method. On the foundation of above works, an infrared target detection software platform which is developed by OpenCV and MFC is introduced. Three kinds of tracking algorithms are integrated in this software. In order to explain the software clearly, the framework and the function are described in this paper. At last, the experiments are performed for some real-life IR images. The whole algorithm implementing processes and results are analyzed, and those algorithms for detection targets are evaluated from the two aspects of subjective and objective. The results prove that the proposed method has satisfying detection effectiveness and robustness. Meanwhile, it has high detection efficiency and can be used for real-time detection.

  1. Targeted killing with drones? Old arguments, new technologies

    Directory of Open Access Journals (Sweden)

    Meisels Tamar

    2018-01-01

    Full Text Available The question of how to contend with terrorism in keeping with our preexisting moral and legal commitments now challenges Europe as well as Israel and the United States: how do we apply Just War Theory and International Law to asymmetrical warfare, specifically to our counter terrorism measures? What can the classic moral argument in Just and Unjust Wars teach us about contemporary targeted killings with drones? I begin with a defense of targeted killing, arguing for the advantages of pin pointed attacks over any alternative measure available for combatting terrorism. Assuming the legitimacy of killing combatants in wartime, I argue, there is nothing wrong, and in fact much that is right, with targeting particular terrorists selected by name, as long as their assassinations can be reasonably expected to reduce terrorist hostilities rather than increase it. Subsequently, I offer some further thoughts and comments on the use of remotely piloted aircrafts to carry out targeted killings, and address the various sources for discomfort with this practice identified by Michael Walzer and others.

  2. Addressing key science and technology issues for IFE chambers, target fabrication and target injection

    International Nuclear Information System (INIS)

    Meier, W.R.; Goodin, D.T.; Nobile, A.

    2003-01-01

    Significant progress has been made in the development of high repetition rate chambers, target fabrication and injection for inertial fusion energy (IFE) for both heavy ion and laser drivers. Research is being conducted in a coordinated manner by national laboratories, universities and industry. This paper provides an overview of U.S. research activities and discusses how interface considerations (such as beam propagation and target survival during injection) impact design choices. (author)

  3. ICF target technology at the Russian Federal Nuclear Center

    International Nuclear Information System (INIS)

    Veselov, A.V.; Drozhin, V.S.; Druzhinin, A.A.; Izgorodin, V.M.; Iiyushechkin, B.N.; Kirillov, G.A.; Komleva, G.V.; Korochkin, A.M.; Medvedev, E.F.; Nikolaev, G.P.; Pikulin, I.V.; Pinegin, A.V.; Punin, V.T.; Romaev, V.N.; Sumatokhin, V.L.; Tarasova, N.N.; Tachaev, G.V.; Cherkesova, I.N.

    1995-01-01

    The main effort of the ICF target fabrication group is support of the experiments performed on the 'ISKRA-4' and 'ISKRA-5' laser systems. The main types of targets used in these experiments are direct drive, inverted corona, and indirect drive. For production of direct drive targets, manufacturing techniques have been developed for both hollow glass and polystyrene microspheres. Hollow glass microspheres are fabricated by free-fall of liquid glass drops or dry gel in a 4 meter vertical kiln. These methods allow us to manufacture glass microspheres with diameters from 50 μm to 1 mm, wall thicknesses from 0.5 to 10 μm, and aspect ratios (radius/ wall) from 20 to 500. The microspheres have a thickness inhomogeneity less than 5% and non-sphericity less than 1%. Polystyrene microspheres are fabricated from polystyrene particles with a blowing agent in a similar vertical kiln. Polystyrene microspheres are fabricated with diameter up to 800 μm and wall thicknesses from 1 to 10 μm. 15 refs., 8 figs

  4. Near-term technology policies for long-term climate targets--economy wide versus technology specific approaches

    International Nuclear Information System (INIS)

    Sanden, B.A.; Azar, Christian

    2005-01-01

    The aim of this paper is to offer suggestions when it comes to near-term technology policies for long-term climate targets based on some insights into the nature of technical change. We make a distinction between economy wide and technology specific policy instruments and put forward two key hypotheses: (i) Near-term carbon targets such as the Kyoto protocol can be met by economy wide price instruments (carbon taxes, or a cap-and-trade system) changing the technologies we pick from the shelf (higher energy efficiency in cars, buildings and industry, wind, biomass for heat and electricity, natural gas instead of coal, solar thermal, etc.). (ii) Technology specific policies are needed to bring new technologies to the shelf. Without these new technologies, stricter emission reduction targets may be considered impossible to meet by the government, industry and the general public, and therefore not adopted. The policies required to bring these more advanced technologies to the shelf are more complex and include increased public research and development, demonstration, niche market creation, support for networks within the new industries, standard settings and infrastructure policies (e.g., when it comes to hydrogen distribution). There is a risk that the society in its quest for cost-efficiency in meeting near-term emissions targets, becomes blindfolded when it comes to the more difficult, but equally important issue of bringing more advanced technologies to the shelf. The paper presents mechanisms that cause technology look in, how these very mechanisms can be used to get out of the current 'carbon lock-in' and the risk with premature lock-ins into new technologies that do not deliver what they currently promise. We then review certain climate policy proposals with regards to their expected technology impact, and finally we present a let-a-hundred-flowers-bloom strategy for the next couple of decades

  5. FY05 Targeted Technology Transfer to US Independents

    Energy Technology Data Exchange (ETDEWEB)

    Donald F. Duttlinger; E. Lance Cole

    2005-11-01

    Petroleum Technology Transfer Council (PTTC) was established by domestic crude oil and natural gas producers in 1994 as a national not-for-profit organization to address the increasingly urgent need to improve the technology-transfer process in the U.S. upstream petroleum industry. PTTC's technology-transfer programs enhance U.S. national security. PTTC administers the only nation-wide, comprehensive program dedicated to maximizing America's supplies of domestic oil and gas. PTTC conducts grassroots programs through 10 Regional Lead Organizations (RLOs) and two satellite offices, leveraging their preexisting connections with industry. This organizational structure helps bring researchers and academia to the table. Nationally and regionally, volunteers within a National Board and Regional Producer Advisory Groups guide efforts. The National Board meets three times per year, an important function being approving the annual plans and budgets developed by the regions and Headquarters (HQ). Between Board meetings, an active Management and Budget Committee guide HQ activity. PTTC itself undergoes a thorough financial audit each year. The PTTC's HQ staff plans and manages all aspects of the PTTC program, conducts nation-wide technology-transfer activities, and implements a comprehensive communications program. Networking, involvement in technical activities, and an active exhibit schedule are increasing PTTC's sphere of influence with both producers and the oilfield service sector. Circulation for ''PTTC Network News'', the quarterly newsletter, has risen to nearly 17,500. About 7,500 people receive an email Technology Alert on an approximate three-week frequency. Case studies in the ''Petroleum Technology Digest in World Oil'' appear monthly, as do ''Tech Connections'' columns in ''The American Oil and Gas Reporter''. As part of its oversight responsibility for the regions

  6. Coping with Atmospheric Turbulence in the Selection of Laser Hardening Technology for FCS Targeting Systems

    National Research Council Canada - National Science Library

    Pritchett, Timothy M

    2004-01-01

    ... by frequency-agile battlefield lasers at both long and short range. Evidently, the selection of sensor protection technologies for incorporation into the final targeting system will be based on their optical limiting performance under field conditions...

  7. Report of the consultants' meeting on target and processing technologies for cyclotron production of radionuclides

    International Nuclear Information System (INIS)

    1999-11-01

    Cyclotron produced radionuclides are used routinely for the diagnosis of a wide variety of diseases. Recently a number of radionuclides available from cyclotrons have been proposed for use in radiotherapy. In fact Pd-103 has become routinely available in some parts of the world for incorporation into brachytherapy seeds for treating prostate cancer. The consultants meeting reviewed the status of target and processing technologies associated with cyclotron production of radionuclides. The main topics of discussion included the basic nuclear data that is crucial to the production of the desired radionuclides, gas and solid target systems, the automated chemical processing units, the Good Manufacturing Practices (GMP) required in order to use these radionuclides in human patients in a safe and efficacious manner and a review of possible candidate nuclides that show promise for use in Nuclear Medicine in the near future. Advances in the preparation of solid targets using electroplating technology has created the possibility of preparing targets capable of operating at very high beam currents which would make the production of large quantities of SPECT agents possible at cyclotron facilities throughout the world. Recognising the needs of the developing countries which have established cyclotron facilities, the consultants focussed on how to provide the technology for preparing solid targets that could be used in the existing facilities. While solid target technology can be used for many radionuclides the report concentrated on several key radionuclides, which are of current importance or show potential for use in the near future. Tl-201 is currently used for cardiac profusion studies throughout the world. New target preparation techniques could potentially make many of the member states self sufficient in the production of this nuclide. I-123 has tremendous potential because of the near ideal photon energy for SPECT cameras and its well-understood chemistry. However, it

  8. Technologies for ITER divertor vertical target plasma facing components

    International Nuclear Information System (INIS)

    Schlosser, J.; Escourbiac, F.; Merola, M.; Fouquet, S.; Bayetti, P.; Cordier, J.J.; Grosman, A.; Missirlian, M.; Tivey, R.; Roedig, M.

    2005-01-01

    The ITER divertor vertical target has to sustain heat fluxes up to 20 MW m -2 . The concept developed for this plasma facing component working at steady state is based on carbon fibre composite armour for the lower straight part and tungsten for the curved upper part. The main challenges involved in the use of such components include the removal of the high heat fluxes deposited and mechanically and thermally joining the armour to the metallic heat sink, despite the mismatch in the thermal expansions. Two solutions based on the use of a CuCrZr hardened copper alloy and an active metal casting (AMC (registered) ) process were investigated during the ITER EDA phase: the first one called 'flat tile geometry' was mainly developed for the Tore Supra pumped limiter, the second one called 'monoblock geometry' was developed by the EU Participating Team for the ITER project. This paper presents a review of these two solutions and analyses their assets and drawbacks: pressure drop, critical heat flux, surface temperature and expected behaviour during operation, risks during the manufacture, control of the armour defects during the manufacture and at the reception, and the possibility of repairing defective tiles

  9. Optimisation of high-performance liquid chromatography with diode array detection using an automatic peak tracking procedure based on augmented iterative target transformation factor analysis

    NARCIS (Netherlands)

    van Zomeren, Paul; Hoogvorst, A.; Coenegracht, P.M J; de Jong, G.J.

    2004-01-01

    An automated method for the optimisation of high-performance liquid chromatography is developed. First of all, the sample of interest is analysed with various eluent compositions. All obtained data are combined into one augmented data matrix. Subsequently, augmented iterative target transformation

  10. Evaluation of a novel ultra small target technology supporting on-product overlay measurements

    Science.gov (United States)

    Smilde, Henk-Jan H.; den Boef, Arie; Kubis, Michael; Jak, Martin; van Schijndel, Mark; Fuchs, Andreas; van der Schaar, Maurits; Meyer, Steffen; Morgan, Stephen; Wu, Jon; Tsai, Vincent; Wang, Cathy; Bhattacharyya, Kaustuve; Chen, Kai-Hsiung; Huang, Guo-Tsai; Ke, Chih-Ming; Huang, Jacky

    2012-03-01

    Reducing the size of metrology targets is essential for in-die overlay metrology in advanced semiconductor manufacturing. In this paper, μ-diffraction-based overlay (μDBO) measurements with a YieldStar metrology tool are presented for target-sizes down to 10 × 10 μm2. The μDBO technology enables selection of only the diffraction efficiency information from the grating by efficiently separating it from product structure reflections. Therefore, μDBO targets -even when located adjacent to product environment- give excellent correlation with 40 × 160 μm2 reference targets. Although significantly smaller than standard scribe-line targets, they can achieve total-measurement-uncertainty values of below 0.5 nm on a wide range of product layers. This shows that the new μDBO technique allows for accurate metrology on ultra small in-die targets, while retaining the excellent TMU performance of diffraction-based overlay metrology.

  11. The value of advanced technology in meeting 2050 greenhouse gas emissions targets in the United States

    International Nuclear Information System (INIS)

    Kyle, Page; Clarke, Leon; Pugh, Graham; Wise, Marshall; Calvin, Kate; Edmonds, James; Kim, Son

    2009-01-01

    This paper, a contribution to the EMF 22 subgroup on Transition Scenarios, examines the relationship between technology evolution over the next 40 years and the cost, energy, and greenhouse gas emissions consequences of possible U.S. mitigation goals. The paper explores these issues within the context of cumulative emissions targets based on linear reductions in CO 2 -e emissions of 50% and 80% below 1990 levels by 2050. Six technology futures were constructed within the MiniCAM integrated assessment model and then applied to the emissions targets. The paper explores the influence of technology availability and expectations of future technology availability on the economic consequences of emissions mitigation, on the time path of emissions mitigation, and on the evolution of the U.S. energy system over time. One of the strongest themes to emerge from the scenarios in this study is that near-term decision-making depends on the availability of technology decades into the future, when deep emissions reductions are required to meet the cumulative emissions goals. In the scenarios in this paper, it is the expectations about future technology that have the most dramatic effect on greenhouse gas emissions prices and emissions reductions in 2020, as opposed to near-term technology availability. Moreover, it is the nature of technology 20, 30, and 40 years out, rather than availability and deployment of technology in the next decade, that will largely determine the character of the mid-century energy system.

  12. Biofuels development in China: Technology options and policies needed to meet the 2020 target

    International Nuclear Information System (INIS)

    Chang, Shiyan; Zhao, Lili; Timilsina, Govinda R.; Zhang, Xiliang

    2012-01-01

    China promulgated the Medium and Long-Term Development Plan for Renewable Energy in 2007, which included sub-targets of 2010 and 2020 for various renewable energy technologies. Almost all the 2010 sub-targets have been met and even surpassed except non-grain fuel ethanol. There is debate surrounding the questions of whether and how the country will be able to meet the 2020 biofuels target. This paper provides the assessment of potential technology pathways to achieve the 2020 target regarding their respective resource potential and supply cost. Barriers and policy options are identified based on broad literatures review. And an overview of biofuels projections is presented to provide insight into the comparison of various policy scenarios. The study shows that China can potentially satisfy non-grain fuel ethanol target by 2020 from technology perspective. But she will probably fall far short of this target if current situations continue. Additional policy efforts are needed. Meanwhile, the target of biodiesel production has high probability to be achieved. However, if given support policies, it will develop better. - Highlights: ► I. Non-grain feedstocks such as cassava, sweet sorghum and sweet potato grown in low productive arable lands or unutilized lands have enough potential to meet ethanol targets in 2020. ► II. If current situations continue, China will fall far short of the 2020 target. ► III. The target of biodiesel production has high probability to be achieved, while, if given support policies, it will develop better. ► IV. Supply cost is one of the major barriers faced by all biofuels pathways. ► V. Various policy measures would be necessary to overcome the costs barriers to biofuels in China.

  13. Integration of multidisciplinary technologies for real time target visualization and verification for radiotherapy

    Directory of Open Access Journals (Sweden)

    Chang WC

    2014-06-01

    Full Text Available Wen-Chung Chang,1,* Chin-Sheng Chen,2,* Hung-Chi Tai,3 Chia-Yuan Liu,4,5 Yu-Jen Chen3 1Department of Electrical Engineering, National Taipei University of Technology, Taipei, Taiwan; 2Graduate Institute of Automation Technology, National Taipei University of Technology, Taipei, Taiwan; 3Department of Radiation Oncology, Mackay Memorial Hospital, Taipei, Taiwan; 4Department of Internal Medicine, Mackay Memorial Hospital, Taipei, Taiwan; 5Department of Medicine, Mackay Medical College, New Taipei City, Taiwan  *These authors contributed equally to this work Abstract: The current practice of radiotherapy examines target coverage solely from digitally reconstructed beam's eye view (BEV in a way that is indirectly accessible and that is not in real time. We aimed to visualize treatment targets in real time from each BEV. The image data of phantom or patients from ultrasound (US and computed tomography (CT scans were captured to perform image registration. We integrated US, CT, US/CT image registration, robotic manipulation of US, a radiation treatment planning system, and a linear accelerator to constitute an innovative target visualization system. The performance of this algorithm segmented the target organ in CT images, transformed and reconstructed US images to match each orientation, and generated image registration in real time mode with acceptable accuracy. This image transformation allowed physicians to visualize the CT image-reconstructed target via a US probe outside the BEV that was non-coplanar to the beam's plane. It allowed the physicians to remotely control the US probe that was equipped on a robotic arm to dynamically trace and real time monitor the coverage of the target within the BEV during a simulated beam-on situation. This target visualization system may provide a direct remotely accessible and real time way to visualize, verify, and ensure tumor targeting during radiotherapy. Keywords: ultrasound, computerized tomography

  14. Elucidating antimalarial drug targets/mode-of-action by application of system biology technologies

    CSIR Research Space (South Africa)

    Becker, J

    2008-11-01

    Full Text Available targets/mode-of-action by application of systems biology technologies J BECKER, L MTWISHA, B CRAMPTON AND D MANCAMA CSIR Biosciences, PO Box 395, Pretoria, 0001, South Africa Email: JBecker@csir.co.za – www.csir.co.za INTRODUCTION Malaria is one... The objective of this study was to use systems biology tools to unravel the drug target/mode-of-action (MoA) of an antimalarial drug (cyclohexylamine) with a known drug target/MoA, by analysing differential expression profiles of drug treated vs untreated...

  15. A novel technology to target adenovirus vectors : application in cells involved in atherosclerosis

    NARCIS (Netherlands)

    Gras, Jan Cornelis Emile

    2007-01-01

    In this thesis a novel technology is described to target adenovirus vectors. Adenovirus vectors are powerful tools to modulate gene expression. The use of these vectors however, is hampered by the fact that many for gene therapy interesting cell types do not, or only at low levels express the CAR

  16. Method for Targeted Therapeutic Delivery of Proteins into Cells | NCI Technology Transfer Center | TTC

    Science.gov (United States)

    The Protein Expression Laboratory at the National Cancer Institute in Frederick, MD is seeking statements of capability or interest from parties interested in collaborative research to further develop a platform technology for the targeted intra-cellular delivery of proteins using virus-like particles (VLPs).

  17. Targeted Research and Technology Within NASA's Living With a Star Program

    Science.gov (United States)

    Antiochos, Spiro; Baker, Kile; Bellaire, Paul; Blake, Bern; Crowley, Geoff; Eddy, Jack; Goodrich, Charles; Gopalswamy, Nat; Gosling, Jack; Hesse, Michael

    2004-01-01

    Targeted Research & Technology (TR&T) NASA's Living With a Star (LWS) initiative is a systematic, goal-oriented research program targeting those aspects of the Sun-Earth system that affect society. The Targeted Research and Technology (TR&T) component of LWS provides the theory, modeling, and data analysis necessary to enable an integrated, system-wide picture of Sun-Earth connection science with societal relevance. Recognizing the central and essential role that TR&T would have for the success of the LWS initiative, the LWS Science Architecture Team (SAT) recommended that a Science Definition Team (SDT), with the same status as a flight mission definition team, be formed to design and coordinate a TR&T program having prioritized goals and objectives that focused on practical societal benefits. This report details the SDT recommendations for the TR&T program.

  18. The development of uranium foil farication technology utilizing twin roll method for Mo-99 irradiation target

    CERN Document Server

    Kim, C K; Park, H D

    2002-01-01

    MDS Nordion in Canada, occupying about 75% of global supply of Mo-99 isotope, has provided the irradiation target of Mo-99 using the rod-type UAl sub x alloys with HEU(High Enrichment Uranium). ANL (Argonne National Laboratory) through co-operation with BATAN in Indonesia, leading RERTR (Reduced Enrichment for Research and Test Reactors) program substantially for nuclear non-proliferation, has designed and fabricated the annular cylinder of uranium targets, and successfully performed irradiation test, in order to develop the fabrication technology of fission Mo-99 using LEU(Low Enrichment Uranium). As the uranium foils could be fabricated in laboratory scale, not in commercialized scale by hot rolling method due to significant problems in foil quality, productivity and economic efficiency, attention has shifted to the development of new technology. Under these circumstances, the invention of uranium foil fabrication technology utilizing twin-roll casting method in KAERI is found to be able to fabricate LEU or...

  19. Target and (Astro-)WISE technologies Data federations and its applications

    Science.gov (United States)

    Valentijn, E. A.; Begeman, K.; Belikov, A.; Boxhoorn, D. R.; Brinchmann, J.; McFarland, J.; Holties, H.; Kuijken, K. H.; Kleijn, G. Verdoes; Vriend, W.-J.; Williams, O. R.; Roerdink, J. B. T. M.; Schomaker, L. R. B.; Swertz, M. A.; Tsyganov, A.; van Dijk, G. J. W.

    2017-06-01

    After its first implementation in 2003 the Astro-WISE technology has been rolled out in several European countries and is used for the production of the KiDS survey data. In the multi-disciplinary Target initiative this technology, nicknamed WISE technology, has been further applied to a large number of projects. Here, we highlight the data handling of other astronomical applications, such as VLT-MUSE and LOFAR, together with some non-astronomical applications such as the medical projects Lifelines and GLIMPS; the MONK handwritten text recognition system; and business applications, by amongst others, the Target Holding. We describe some of the most important lessons learned and describe the application of the data-centric WISE type of approach to the Science Ground Segment of the Euclid satellite.

  20. OPTICAL correlation identification technology applied in underwater laser imaging target identification

    Science.gov (United States)

    Yao, Guang-tao; Zhang, Xiao-hui; Ge, Wei-long

    2012-01-01

    The underwater laser imaging detection is an effective method of detecting short distance target underwater as an important complement of sonar detection. With the development of underwater laser imaging technology and underwater vehicle technology, the underwater automatic target identification has gotten more and more attention, and is a research difficulty in the area of underwater optical imaging information processing. Today, underwater automatic target identification based on optical imaging is usually realized with the method of digital circuit software programming. The algorithm realization and control of this method is very flexible. However, the optical imaging information is 2D image even 3D image, the amount of imaging processing information is abundant, so the electronic hardware with pure digital algorithm will need long identification time and is hard to meet the demands of real-time identification. If adopt computer parallel processing, the identification speed can be improved, but it will increase complexity, size and power consumption. This paper attempts to apply optical correlation identification technology to realize underwater automatic target identification. The optics correlation identification technology utilizes the Fourier transform characteristic of Fourier lens which can accomplish Fourier transform of image information in the level of nanosecond, and optical space interconnection calculation has the features of parallel, high speed, large capacity and high resolution, combines the flexibility of calculation and control of digital circuit method to realize optoelectronic hybrid identification mode. We reduce theoretical formulation of correlation identification and analyze the principle of optical correlation identification, and write MATLAB simulation program. We adopt single frame image obtained in underwater range gating laser imaging to identify, and through identifying and locating the different positions of target, we can improve

  1. Technology Strategy for 'Environmental Technology for the Future'; Technology Target Areas; TTA1 - environmental technology for the future

    Energy Technology Data Exchange (ETDEWEB)

    2007-07-01

    The OG21 Technology Target Area 1 (TTA 1) group has produced a strategy for 'Environmental Technology for the Future'. A key aim of this work is to ensure that the operators on the Norwegian Continental Shelf (NCS) remain in a leading position with respect to environmental performance, while contributing to optimised resource recovery and value creation. This strategy focuses on environmental technology, which includes hardware, methods, software and knowledge. The TTA 1 group has agreed on a common vision: 'Norwegian oil and gas activities shall be leading in environmental performance, and Norway shall have the world leading knowledge and technology cluster within environmental technologies to support the zero harmful impact goals of the oil and gas industry.' Priorities have been made with emphasis on gaps that are considered most important to close and that will benefit from public research and development funding either for initialisation (primarily via the Petromaks and Climit programs) or acceleration (via Petromaks / Climit and particularly Demo 2000 where demonstration or piloting is required). The priorities aim to avoid technology gaps that are expected to be closed adequately through existing projects / programs or which are covered in other TTA strategies. The priority areas as identified are: Environmental impact and risk identification / quantification for new areas: Make quality assured environmental baseline data available on the web. Develop competence necessary to quantify and monitor the risks and risk reductions to the marine environment in new area ecosystems; Carbon capture and storage: Quantify environmental risks and waste management issues associated with bi-products from carbon capture processes and storage solutions. Develop and demonstrate effective carbon storage risk management, monitoring and mitigation technologies. Develop more cost and energy efficient power-from-shore solutions to reduce / eliminate CO{sub 2

  2. Research on infrared small-target tracking technology under complex background

    Science.gov (United States)

    Liu, Lei; Wang, Xin; Chen, Jilu; Pan, Tao

    2012-10-01

    In this paper, some basic principles and the implementing flow charts of a series of algorithms for target tracking are described. On the foundation of above works, a moving target tracking software base on the OpenCV is developed by the software developing platform MFC. Three kinds of tracking algorithms are integrated in this software. These two tracking algorithms are Kalman Filter tracking method and Camshift tracking method. In order to explain the software clearly, the framework and the function are described in this paper. At last, the implementing processes and results are analyzed, and those algorithms for tracking targets are evaluated from the two aspects of subjective and objective. This paper is very significant in the application of the infrared target tracking technology.

  3. Program Design Analysis using BEopt Building Energy Optimization Software: Defining a Technology Pathway Leading to New Homes with Zero Peak Cooling Demand; Preprint

    Energy Technology Data Exchange (ETDEWEB)

    Anderson, R.; Christensen, C.; Horowitz, S.

    2006-08-01

    An optimization method based on the evaluation of a broad range of different combinations of specific energy efficiency and renewable-energy options is used to determine the least-cost pathway to the development of new homes with zero peak cooling demand. The optimization approach conducts a sequential search of a large number of possible option combinations and uses the most cost-effective alternatives to generate a least-cost curve to achieve home-performance levels ranging from a Title 24-compliant home to a home that uses zero net source energy on an annual basis. By evaluating peak cooling load reductions on the least-cost curve, it is then possible to determine the most cost-effective combination of energy efficiency and renewable-energy options that both maximize annual energy savings and minimize peak-cooling demand.

  4. Chemical Genomics and Emerging DNA Technologies in the Identification of Drug Mechanisms and Drug Targets

    DEFF Research Database (Denmark)

    Olsen, Louise Cathrine Braun; Færgeman, Nils J.

    2012-01-01

    and validate therapeutic targets and to discover drug candidates for rapidly and effectively generating new interventions for human diseases. The recent emergence of genomic technologies and their application on genetically tractable model organisms like Drosophila melanogaster,Caenorhabditis elegans...... critical roles in the genomic age of biological research and drug discovery. In the present review we discuss how simple biological model organisms can be used as screening platforms in combination with emerging genomic technologies to advance the identification of potential drugs and their molecular...

  5. Technology strategy for enhanced recovery; Technology Target Areas; TTA3 - enhanced recovery

    Energy Technology Data Exchange (ETDEWEB)

    2007-07-01

    The Norwegian Continental Shelf (NCS) is facing new challenges in reserve replacement and improved recovery in order to maintain the overall oil production rate from the area. A new target for an increase in oil reserves of 800 million Sm3 of oil (5 billion barrels) by year 2015 has been set by NPD. This is an ambitious goal considering several of the large fields are on a steep decline, and most of the recent discoveries are relatively small. A significant part of these increased reserves will have to come from fields currently on production, from reservoir areas that have been partly or fully swept, and it is therefore evident that Enhanced Oil Recovery (EOR) methods have to play a key role in achieving this target. EOR methods can be divided into gas based EOR methods and water based EOR methods. Thermal methods are not considered applicable on the NCS due to the relatively light oils present, and the depth of the reservoirs. Gas Based EOR; Water Based EOR; CO{sub 2} injection; Surfactants; Air injection; Polymer; Nitrogen injection; Alkaline; Flue gas injection; Polymer gels; WAG; MEOR; FAWAG. The former OG21 strategy document gave high priority to Water Alternating Gas (WAG) methods and CO{sub 2} injection for enhanced recovery. A lot of research and development and evaluation projects on CO{sub 2} injection were launched and are on-going, most of these are being CO{sub 2} WAG studies. The main challenge now in order to realize CO{sub 2} injection on the NCS is on CO{sub 2} availability and transport. It is also believed that increasing gas prices will limit the availability of hydrocarbon gas for injection purposes in the future. There is, however, a clear need for developing alternative cost efficient EOR methods that can improve the sweep efficiency significantly. Since a majority of the fields on the NCS are being produced under water flooding (or WAG), methods that can improve the water flooding efficiency by chemical additives are of special interest and

  6. Solar Europe industry initiative: research technology development and demonstration in support of 2020 and long-term targets

    NARCIS (Netherlands)

    Sinke, W.C.; Fraile Montoro, D.; Despotou, E.; Nowak, S.; Perezagua, E.

    2010-01-01

    The European Union has set an ambitious target for the implementation of renewable energy technologies by 2020, i.e. a share of 20% of the total energy consumption. In support of these targets the Strategic Energy Technology (SET) Plan has been initiated by the European Commission. One of the key

  7. Technology strategy for cost-effective drilling and intervention; Technology Target Areas; TTA4 - Cost effective drilling and intervention

    Energy Technology Data Exchange (ETDEWEB)

    2007-07-01

    The main goals of the OG21 initiative are to (1) develop new technology and knowledge to increase the value creation of Norwegian oil and gas resources and (2) enhance the export of Norwegian oil and gas technology. The OG21 Cost-effective Drilling and Intervention (CEDI) Technology Target Area (TTA) has identified some key strategic drilling and well intervention needs to help meet the goals of OG21. These key strategic drilling and well intervention needs are based on a review of present and anticipated future offshore-Norway drilling and well intervention conditions and the Norwegian drilling and well intervention industry. A gap analysis has been performed to assess the extent to which current drilling and well intervention research and development and other activities will meet the key strategic needs. Based on the identified strategic drilling and well intervention needs and the current industry res each and development and other activities, the most important technology areas for meeting the OG21 goals are: environment-friendly and low-cost exploration wells; low-cost methods for well intervention/sidetracks; faster and extended-reach drilling; deep water drilling, completion and intervention; offshore automated drilling; subsea and sub-ice drilling; drilling through basalt and tight carbonates; drilling and completion in salt formation. More specific goals for each area: reduce cost of exploration wells by 50%; reduce cost for well intervention/sidetracks by 50%; increase drilling efficiency by 40%; reduce drilling cost in deep water by 40 %; enable offshore automated drilling before 2012; enable automated drilling from seabed in 2020. Particular focus should be placed on developing new technology for low-cost exploration wells to stem the downward trends in the number of exploration wells drilled and the volume of discovered resources. The CEDI TTA has the following additional recommendations: The perceived gaps in addressing the key strategic drilling and

  8. Decision Analysis and Policy Formulation for Technology-Specific Renewable Energy Targets

    Science.gov (United States)

    Okioga, Irene Teshamulwa

    This study establishes a decision making procedure using Analytic Hierarchy Process (AHP) for a U.S. national renewable portfolio standard, and proposes technology-specific targets for renewable electricity generation for the country. The study prioritizes renewable energy alternatives based on a multi-perspective view: from the public, policy makers, and investors' points-of-view, and uses multiple criteria for ranking the alternatives to generate a unified prioritization scheme. During this process, it considers a 'quadruple bottom-line' approach (4P), i.e. reflecting technical "progress", social "people", economic 'profits", and environmental "planet" factors. The AHP results indicated that electricity generation from solar PV ranked highest, and biomass energy ranked lowest. A "Benefits/Cost Incentives/Mandates" (BCIM) model was developed to identify where mandates are needed, and where incentives would instead be required to bring down costs for technologies that have potential for profitable deployment. The BCIM model balances the development of less mature renewable energy technologies, without the potential for rising near-term electricity rates for consumers. It also ensures that recommended policies do not lead to growth of just one type of technology--the "highest-benefit, least-cost" technology. The model indicated that mandates would be suited for solar PV, and incentives generally for geothermal and concentrated solar power. Development for biomass energy, as a "low-cost, low-benefits" alternative was recommended at a local rather than national level, mainly due to its low resource potential values. Further, biomass energy generated from wastewater treatment plants (WWTPs) had the least resource potential compared to other biomass sources. The research developed methodologies and recommendations for biogas electricity targets at WWTPs, to take advantage of the waste-to-energy opportunities.

  9. The CRISPR-Cas9 technology: Closer to the ultimate toolkit for targeted genome editing.

    Science.gov (United States)

    Quétier, Francis

    2016-01-01

    The first period of plant genome editing was based on Agrobacterium; chemical mutagenesis by EMS (ethyl methanesulfonate) and ionizing radiations; each of these technologies led to randomly distributed genome modifications. The second period is associated with the discoveries of homing and meganuclease enzymes during the 80s and 90s, which were then engineered to provide efficient tools for targeted editing. From 2006 to 2012, a few crop plants were successfully and precisely modified using zinc-finger nucleases. A third wave of improvement in genome editing, which led to a dramatic decrease in off-target events, was achieved in 2009-2011 with the TALEN technology. The latest revolution surfaced in 2013 with the CRISPR-Cas9 system, whose high efficiency and technical ease of use is really impressive; scientists can use in-house kits or commercially available kits; the only two requirements are to carefully choose the location of the DNA double strand breaks to be induced and then to order an oligonucleotide. While this close-to- ultimate toolkit for targeted editing of genomes represents dramatic scientific progress which allows the development of more complex useful agronomic traits through synthetic biology, the social acceptance of genome editing remains regularly questioned by anti-GMO citizens and organizations. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  10. Physics and technology of inertial fusion energy targets chambers and drivers. Proceedings of a technical meeting

    International Nuclear Information System (INIS)

    2005-09-01

    The third IAEA Technical Meeting on Physics and Technology of Inertial Fusion Energy Targets and Chambers took place 11-13 October 2004 in the Yousung Hotel Daejon, Republic of Korea. The first meeting was held in Madrid, Spain, 7-9 June 2000, and the second one in San Diego, California, 17-19 June 2002. Nuclear fusion has the promise of becoming an abundant energy source with good environmental compatibility. Excellent progress has been made in controlled nuclear fusion research on both magnetic and inertial approaches for plasma confinement. The IAEA plays a pro-active role to catalyze innovation and enhance worldwide commitment to fusion. This is done by creating awareness of the different concepts of magnetic as well as inertial confinement. The International Fusion Research Council (IFRC) supports the IAEA in the development of strategies to enhance fusion research in Member States. As part of the recommendations, a technical meeting on the physics and technology of inertial fusion energy (IFE) was proposed in one of the council meetings. The objective of the technical meeting was to contribute to advancing the understanding of targets and chambers for all proposed inertial fusion energy power plant designs. The topics to be covered were: Target design and physics, chamber design and physics, target fabrication injection and Tritium handling, assessment of safety, environment and economy aspect of IFE. It was recognized by the International Advisory Committee that the scope of the meeting should also include fusion drivers. The presentations of the meeting included target and chamber physics and technology for all proposed IFE plant concepts (laser driven, heavy-ion driven, Z-pinches, etc.). The final Research Coordination Meeting of the Coordinated Research Project on Elements of Power Plant Design for Inertial Fusion Energy, including further new results and achievements, followed the technical meeting. Twenty-nine participants from 12 countries participated

  11. Peak Experience Project

    Science.gov (United States)

    Scott, Daniel G.; Evans, Jessica

    2010-01-01

    This paper emerges from the continued analysis of data collected in a series of international studies concerning Childhood Peak Experiences (CPEs) based on developments in understanding peak experiences in Maslow's hierarchy of needs initiated by Dr Edward Hoffman. Bridging from the series of studies, Canadian researchers explore collected…

  12. Target validation for FCV technology development in Japan from energy competition point of view

    International Nuclear Information System (INIS)

    ENDO Eiichi

    2006-01-01

    The objective of this work is to validate the technical targets in the governmental hydrogen energy road-map of Japan by analyzing market penetration of fuel cell vehicle(FCV)s and effects of fuel price and carbon tax on it from technology competition point of view. In this analysis, an energy system model of Japan based on MARKAL is used. The results of the analysis show that hydrogen FCVs could not have cost-competitiveness until 2030 without carbon tax, including the governmental actual plan of carbon tax. However, as the carbon tax rate increases, instead of conventional vehicles including gasoline hybrid electric vehicle, hydrogen FCVs penetrate to the market earlier and more. By assuming higher fuel price and severer carbon tax rate, market share of hydrogen FCVs approaches to the governmental goal. This suggests that cheaper vehicle cost and/or hydrogen price than those targeted in the road-map is required. At the same time, achievement of the technical targets in the road-map also allows to attain the market penetration target of hydrogen FCVs in some possible conditions. (authors)

  13. Targeted Prostate Biopsy: Lessons Learned Midst the Evolution of a Disruptive Technology.

    Science.gov (United States)

    Nassiri, Nima; Natarajan, Shyam; Margolis, Daniel J; Marks, Leonard S

    2015-09-01

    Lessons learned during a 6-year experience with more than 1200 patients undergoing targeted prostate biopsy via MRI/ultrasound fusion are reported: (1) the procedure is safe and efficient, requiring some 15-20 minutes in an office setting; (2) MRI is best performed by a radiologist with specialized training, using a transabdominal multiparametric approach and preferably a 3T magnet; (3) grade of MRI suspicion is the most powerful predictor of biopsy results, eg, Grade 5 usually represents cancer; (4) some potentially important cancers (15%-30%) are MRI-invisible; (5) Targeted biopsies provide >80% concordance with whole-organ pathology. Early enthusiasm notwithstanding, cost-effectiveness is yet to be resolved, and the technologies remain in evolution. Copyright © 2015 Elsevier Inc. All rights reserved.

  14. 2010 national progress report on R and D on LEU fuel and target technology in Argentina

    International Nuclear Information System (INIS)

    Balart, S.; Blaumann, H.; Cristini, P.; Gonzalez, A.G.; Gonzalez, R.; Hermida, J.D.; Lopez, M.; Mirandou, M.; Taboada, H.

    2010-01-01

    Since last RRFM meeting, CNEA has deployed several related tasks. The RA-6 MTR type reactor, converted its core from HEU to a new LEU silicide one is scaling up the power, according to a protocol requested by the national regulatory body, ARN. CNEA is deploying an intense R and D activity to fabricate both dispersed U-Mo (Al-Si matrix and Al cladding) and monolithic (Zry-4 cladding) miniplates to develop possible solutions to VHD dispersed and monolithic fuels technical problems. Some monolithic 58% enrichment U8%Mo and U10%Mo are being delivered to INL-DoE to be irradiated in ATR reactor core. A conscientious study on compound interphase formation in both cases is being carried out. CNEA, a worldwide leader on LEU technology for fission radioisotope production is providing Brazil with these radiopharmaceutical products and Egypt and Australia with the technology through INVAP SE. CNEA is also committed to improve the diffusion of LEU target and radiochemical technology for radioisotope production and target and process optimization. Future plans include: 1) Fabrication of a LEU dispersed U-Mo fuel prototype following the recommendations of the IAEA's Good Practices document, to be irradiated in a high flux reactor in the frame of the ARG/4/092 IAEA's Technical Cooperation project. 2) Development of LEU very high density monolithic and dispersed U-Mo fuel plates with Zry-4 or Al cladding as a part of the RERTR program. 3) Optimization of LEU target and radiochemical techniques for radioisotope production. (author)

  15. Overview of the IFE chamber and target technologies R and D in the U.S

    International Nuclear Information System (INIS)

    Meier, W.R.; Abdou, M.A.; Kulcinski, G.L.; Moir, R.W.; Nobile, A.; Peterson, P.F.; Petti, D.A.; Schultz, K.R.; Tillack, M.; Yoda, M.

    2001-01-01

    The U.S. Department of Energy, Office of Fusion Energy Science (OFES) formed the Virtual Laboratory for Technology (VLT) to develop the technologies needed to support near term fusion experiments and to provide the basis for future magnetic and inertial fusion energy power plants. The scope of the inertial fusion energy (IFE) element of the VLT includes the fusion chamber, driver/chamber interface, target fabrication and injection, and safety and environmental assessment for IFE. Lawrence Livermore National Laboratory, in conjunction with other laboratories, universities and industry, has written an R and D plan to address the critical issues in these areas over the next 5 years in a coordinated manner. This paper provides an overview of the U.S. research activities addressing these critical issues. (author)

  16. [Overview of patents on targeted genome editing technologies and their implications for innovation and entrepreneurship education in universities].

    Science.gov (United States)

    Fan, Xiang-yu; Lin, Yan-ping; Liao, Guo-jian; Xie, Jian-ping

    2015-12-01

    Zinc finger nuclease, transcription activator-like effector nuclease, and clustered regularly interspaced short palindromic repeats/Cas9 nuclease are important targeted genome editing technologies. They have great significance in scientific research and applications on aspects of functional genomics research, species improvement, disease prevention and gene therapy. There are past or ongoing disputes over ownership of the intellectual property behind every technology. In this review, we summarize the patents on these three targeted genome editing technologies in order to provide some reference for developing genome editing technologies with self-owned intellectual property rights and some implications for current innovation and entrepreneurship education in universities.

  17. Peak-interviewet

    DEFF Research Database (Denmark)

    Raalskov, Jesper; Warming-Rasmussen, Bent

    Peak-interviewet er en særlig effektiv metode til at gøre ubevidste menneskelige ressourcer bevidste. Fokuspersonen (den interviewede) interviewes om en selvvalgt, personlig succesoplevelse. Terapeuten/coachen (intervieweren) spørger ind til processen, som ledte hen til denne succes. Herved afdæk...... fokuspersonen ønsker at tage op (nye mål eller nye processer). Nærværende workingpaper beskriver, hvad der menes med et peak-interview, peakinterviwets teoretiske fundament samt metodikken til at foretage et tillidsfuldt og effektiv peak-interview....

  18. Intravenous siRNA of brain cancer with receptor targeting and avidin-biotin technology.

    Science.gov (United States)

    Xia, Chun-Fang; Zhang, Yufeng; Zhang, Yun; Boado, Ruben J; Pardridge, William M

    2007-12-01

    The effective delivery of short interfering RNA (siRNA) to brain following intravenous administration requires the development of a delivery system for transport of the siRNA across the brain capillary endothelial wall, which forms the blood-brain barrier in vivo. siRNA was delivered to brain in vivo with the combined use of a receptor-specific monoclonal antibody delivery system, and avidin-biotin technology. The siRNA was mono-biotinylated on either terminus of the sense strand, in parallel with the production of a conjugate of the targeting MAb and streptavidin. Rat glial cells (C6 or RG-2) were permanently transfected with the luciferase gene, and implanted in the brain of adult rats. Following the formation of intra-cranial tumors, the rats were treated with a single intravenous injection of 270 microg/kg of biotinylated siRNA attached to a transferrin receptor antibody via a biotin-streptavidin linker. The intravenous administration of the siRNA caused a 69-81% decrease in luciferase gene expression in the intracranial brain cancer in vivo. Brain delivery of siRNA following intravenous administration is possible with siRNAs that are targeted to brain with the combined use of receptor specific antibody delivery systems and avidin-biotin technology.

  19. Peak power ratio generator

    Science.gov (United States)

    Moyer, R.D.

    A peak power ratio generator is described for measuring, in combination with a conventional power meter, the peak power level of extremely narrow pulses in the gigahertz radio frequency bands. The present invention in a preferred embodiment utilizes a tunnel diode and a back diode combination in a detector circuit as the only high speed elements. The high speed tunnel diode provides a bistable signal and serves as a memory device of the input pulses for the remaining, slower components. A hybrid digital and analog loop maintains the peak power level of a reference channel at a known amount. Thus, by measuring the average power levels of the reference signal and the source signal, the peak power level of the source signal can be determined.

  20. Peak Oil, Peak Coal and Climate Change

    Science.gov (United States)

    Murray, J. W.

    2009-05-01

    Research on future climate change is driven by the family of scenarios developed for the IPCC assessment reports. These scenarios create projections of future energy demand using different story lines consisting of government policies, population projections, and economic models. None of these scenarios consider resources to be limiting. In many of these scenarios oil production is still increasing to 2100. Resource limitation (in a geological sense) is a real possibility that needs more serious consideration. The concept of 'Peak Oil' has been discussed since M. King Hubbert proposed in 1956 that US oil production would peak in 1970. His prediction was accurate. This concept is about production rate not reserves. For many oil producing countries (and all OPEC countries) reserves are closely guarded state secrets and appear to be overstated. Claims that the reserves are 'proven' cannot be independently verified. Hubbert's Linearization Model can be used to predict when half the ultimate oil will be produced and what the ultimate total cumulative production (Qt) will be. US oil production can be used as an example. This conceptual model shows that 90% of the ultimate US oil production (Qt = 225 billion barrels) will have occurred by 2011. This approach can then be used to suggest that total global production will be about 2200 billion barrels and that the half way point will be reached by about 2010. This amount is about 5 to 7 times less than assumed by the IPCC scenarios. The decline of Non-OPEC oil production appears to have started in 2004. Of the OPEC countries, only Saudi Arabia may have spare capacity, but even that is uncertain, because of lack of data transparency. The concept of 'Peak Coal' is more controversial, but even the US National Academy Report in 2007 concluded only a small fraction of previously estimated reserves in the US are actually minable reserves and that US reserves should be reassessed using modern methods. British coal production can be

  1. Transmutation technology development; thermal hydraulic power analysis and structure analysis of the HYPER target beam window

    Energy Technology Data Exchange (ETDEWEB)

    Choi, J. H.; Ju, E. S.; Song, M. K.; Jeon, Y. Z. [Gyeongsang National University, Jinju (Korea)

    2002-03-01

    A thermal hydraulic power analysis, a structure analysis and optimization computation for some design factor for the design of spallation target suitable for HYPER with 1000 MW thermal power in this study was performed. Heat generation formula was used which was evaluated recently based on the LAHET code, mainly to find the maximum beam current under given computation conditions. Thermal hydraulic power of HYPER target system was calculated using FLUENT code, structure conducted by inputting the data into ANSYS. On the temp of beam windows and the pressure distribution calculated using FLUENT. Data transformation program was composed apply the data calculated using FLUENT being commercial CFD code and ANSYS being FEM code for CFX structure analysis. A basic study was conducted on various singular target to obtain fundamental data on the shape for optimum target design. A thermal hydraulic power analysis and structure analysis were conducted on the shapes of parabolic, uniform, scanning beams to choose the optimum shape of beam current analysis was done according to some turbulent model to simulate the real flow. To evaluate the reliability of numerical analysis result, benchmarking of FLUENT code reformed at SNU and Korea Advanced Institute of Science and Technology and it was compared to CFX in the possession of Korea Atomic Energy Research Institute and evaluated. Reliable deviation was observed in the results calculated using FLUENT code, but temperature deviation of about 200 .deg. C was observed in the result from CFX analysis at optimum design condition. Several benchmarking were performed on the basis of numerical analysis concerning conventional HYPER. It was possible to allow a beam arrests of 17.3 mA in the case of the {phi} 350 mm parabolic beam suggested to the optimum in nuclear transmutation when stress equivalent to VON-MISES was calculated to be 140 MPa. 29 refs., 109 figs. (Author)

  2. Peak regulation right

    International Nuclear Information System (INIS)

    Gao, Z. |; Ren, Z.; Li, Z.; Zhu, R.

    2005-01-01

    A peak regulation right concept and corresponding transaction mechanism for an electricity market was presented. The market was based on a power pool and independent system operator (ISO) model. Peak regulation right (PRR) was defined as a downward regulation capacity purchase option which allowed PRR owners to buy certain quantities of peak regulation capacity (PRC) at a specific price during a specified period from suppliers. The PRR owner also had the right to decide whether or not they would buy PRC from suppliers. It was the power pool's responsibility to provide competitive and fair peak regulation trading markets to participants. The introduction of PRR allowed for unit capacity regulation. The PRR and PRC were rated by the supplier, and transactions proceeded through a bidding process. PRR suppliers obtained profits by selling PRR and PRC, and obtained downward regulation fees regardless of whether purchases are made. It was concluded that the peak regulation mechanism reduced the total cost of the generating system and increased the social surplus. 6 refs., 1 tab., 3 figs

  3. Make peak flow a habit

    Science.gov (United States)

    Asthma - make peak flow a habit; Reactive airway disease - peak flow; Bronchial asthma - peak flow ... 2014:chap 55. National Asthma Education and Prevention Program website. How to use a peak flow meter. ...

  4. Automated asteroseismic peak detections

    DEFF Research Database (Denmark)

    de Montellano, Andres Garcia Saravia Ortiz; Hekker, S.; Themessl, N.

    2018-01-01

    Space observatories such as Kepler have provided data that can potentially revolutionize our understanding of stars. Through detailed asteroseismic analyses we are capable of determining fundamental stellar parameters and reveal the stellar internal structure with unprecedented accuracy. However......, such detailed analyses, known as peak bagging, have so far been obtained for only a small percentage of the observed stars while most of the scientific potential of the available data remains unexplored. One of the major challenges in peak bagging is identifying how many solar-like oscillation modes are visible...... of detected oscillation modes. The algorithm presented here opens the possibility for detailed and automated peak bagging of the thousands of solar-like oscillators observed by Kepler....

  5. Technology of micro- and macroshells and the problem of reactor targets

    International Nuclear Information System (INIS)

    Akunets, A.A.; Dorogotovtsev, V.M.; Merkul'ev, Yu.A.

    1987-01-01

    Technological principles, permitting to produce laser targets of 4.0 - 10 mm diameter are suggested. According to the given technique a particle of initial substance (drop or shell) with additions of a gas-forming agent under conditions similar to free fall, flies in the atmosphere of rarefied heat-exchange gas through a hot area. The process of its heating under conditions of a weak forced convective heat exchange is the main process taking much time. Starting heat treatment of a shell 4.0 mm in diameter with aspect ratio A = 200, i.e. thickness of 10 μm, the treatment can be finished with 10.0 mm diameter at A = 1300, i.e. with wall thickness 1.6 μm. Experimental testing has confirmed the evaluations. Shells of 4.0 mm diameter with A = 2500 are produced

  6. Automated asteroseismic peak detections

    Science.gov (United States)

    García Saravia Ortiz de Montellano, Andrés; Hekker, S.; Themeßl, N.

    2018-05-01

    Space observatories such as Kepler have provided data that can potentially revolutionize our understanding of stars. Through detailed asteroseismic analyses we are capable of determining fundamental stellar parameters and reveal the stellar internal structure with unprecedented accuracy. However, such detailed analyses, known as peak bagging, have so far been obtained for only a small percentage of the observed stars while most of the scientific potential of the available data remains unexplored. One of the major challenges in peak bagging is identifying how many solar-like oscillation modes are visible in a power density spectrum. Identification of oscillation modes is usually done by visual inspection that is time-consuming and has a degree of subjectivity. Here, we present a peak-detection algorithm especially suited for the detection of solar-like oscillations. It reliably characterizes the solar-like oscillations in a power density spectrum and estimates their parameters without human intervention. Furthermore, we provide a metric to characterize the false positive and false negative rates to provide further information about the reliability of a detected oscillation mode or the significance of a lack of detected oscillation modes. The algorithm presented here opens the possibility for detailed and automated peak bagging of the thousands of solar-like oscillators observed by Kepler.

  7. Application of real-time single camera SLAM technology for image-guided targeting in neurosurgery

    Science.gov (United States)

    Chang, Yau-Zen; Hou, Jung-Fu; Tsao, Yi Hsiang; Lee, Shih-Tseng

    2012-10-01

    In this paper, we propose an application of augmented reality technology for targeting tumors or anatomical structures inside the skull. The application is a combination of the technologies of MonoSLAM (Single Camera Simultaneous Localization and Mapping) and computer graphics. A stereo vision system is developed to construct geometric data of human face for registration with CT images. Reliability and accuracy of the application is enhanced by the use of fiduciary markers fixed to the skull. The MonoSLAM keeps track of the current location of the camera with respect to an augmented reality (AR) marker using the extended Kalman filter. The fiduciary markers provide reference when the AR marker is invisible to the camera. Relationship between the markers on the face and the augmented reality marker is obtained by a registration procedure by the stereo vision system and is updated on-line. A commercially available Android based tablet PC equipped with a 320×240 front-facing camera was used for implementation. The system is able to provide a live view of the patient overlaid by the solid models of tumors or anatomical structures, as well as the missing part of the tool inside the skull.

  8. Uncertainties in key low carbon power generation technologies - Implication for UK decarbonisation targets

    International Nuclear Information System (INIS)

    Kannan, R.

    2009-01-01

    The UK government's economy-wide 60% carbon dioxide reduction target by 2050 requires a paradigm shift in the whole energy system. Numerous analytical studies have concluded that the power sector is a critical contributor to a low carbon energy system, and electricity generation has dominated the policy discussion on UK decarbonisation scenarios. However, range of technical, social and market challenges, combined with alternate market investment strategies mean that large scale deployment of key classes of low carbon electricity technologies is fraught with uncertainty. The UK MARKAL energy systems model has been used to investigate these long-term uncertainties in key electricity generation options. A range of power sector specific parametric sensitivities have been performed under a 'what-if' framework to provide a systematic exploration of least-cost energy system configurations under a broad, integrated set of input assumptions. In this paper results of six sensitivities, via restricted investments in key low carbon technologies to reflect their technical and political uncertainties, and an alternate investment strategies from perceived risk and other barriers, have been presented. (author)

  9. Spatial peak-load pricing

    International Nuclear Information System (INIS)

    Arellano, M. Soledad; Serra, Pablo

    2007-01-01

    This article extends the traditional electricity peak-load pricing model to include transmission costs. In the context of a two-node, two-technology electric power system, where suppliers face inelastic demand, we show that when the marginal plant is located at the energy-importing center, generators located away from that center should pay the marginal capacity transmission cost; otherwise, consumers should bear this cost through capacity payments. Since electric power transmission is a natural monopoly, marginal-cost pricing does not fully cover costs. We propose distributing the revenue deficit among users in proportion to the surplus they derive from the service priced at marginal cost. (Author)

  10. Integration of intracellular telomerase monitoring by electrochemiluminescence technology and targeted cancer therapy by reactive oxygen species.

    Science.gov (United States)

    Zhang, Huairong; Li, Binxiao; Sun, Zhaomei; Zhou, Hong; Zhang, Shusheng

    2017-12-01

    Cancer therapies based on reactive oxygen species (ROS) have emerged as promising clinical treatments. Electrochemiluminescence (ECL) technology has also attracted considerable attention in the field of clinical diagnosis. However, studies about the integration of ECL diagnosis and ROS cancer therapy are very rare. Here we introduce a novel strategy that employs ECL technology and ROS to fill the above vacancy. Briefly, an ITO electrode was electrodeposited with polyluminol-Pt NPs composite films and modified with aptamer DNA to capture HL-60 cancer cells with high specificity. After that, mesoporous silica nanoparticles (MSNs) filled with phorbol 12-myristate 13-acetate (PMA) were closed by the telomerase primer DNA (T-primer DNA) and aptamer. After aptamer on MSN@PMA recognized and combined with the HL-60 cancer cells with high specificity, T-primer DNA on MSN@PMA could be moved away from the MSN@PMA surface after extension by telomerase in the HL-60 cancer cells and PMA was released to induce the production of ROS by the HL-60 cancer cells. After that, the polyluminol-Pt NPs composite films could react with hydrogen peroxide (a major ROS) and generate an ECL signal. Thus the intracellular telomerase activity of the HL-60 cancer cells could be detected in situ . Besides, ROS could induce apoptosis in the HL-60 cancer cells with high efficacy by causing oxidative damage to the lipids, protein, and DNA. Above all, the designed platform could not only detect intracellular telomerase activity instead of that of extracted telomerase, but could also kill targeted tumors by ECL technology and ROS.

  11. Technology strategy for integrated operations and real time reservoir management; Technology Target Areas; TTA5 - Integrated operations and RTRM

    Energy Technology Data Exchange (ETDEWEB)

    2007-07-01

    In Norway Integrated Operations (IO) is a concept which in the first phase (G1) has been used to describe how to integrate processes and people onshore and offshore using ICT solutions and facilities that improve onshore's ability to support offshore operationally. The second generation (G2) Integrated Operations aims to help operators utilize vendors' core competencies and services more efficiently. Utilizing digital services and vendor products, operators will be able to update reservoir models, drilling targets and well trajectories as wells are drilled, manage well completions remotely, optimize production from reservoir to export lines, and implement condition-based maintenance concepts. The total impact on production, recovery rates, costs and safety will be profound. When the international petroleum business moves to the Arctic region the setting is very different from what is the case on the Norwegian Continental Shelf (NCS) and new challenges will arise. The Norwegian Ministry of Environment has recently issued an Integrated Management Plan for the Barents Sea where one focus is on 'Monitoring of the Marine Environment in the North'. The Government aims to establish a new and more coordinated system for monitoring the marine ecosystems in the north. A representative group consisting of the major Operators, the Service Industry, Academia and the Authorities have developed the enclosed strategy for the OG21 Integrated Operations and Real Time Reservoir Management (IO and RTRM) Technology Target Area (TTA). Major technology and work process research and development gaps have been identified in several areas: Bandwidth down-hole to surface; Sensor development including Nano-technology; Cross discipline use of Visualisation, Simulation and model development particularly in Drilling and Reservoir management areas; Software development in terms of data handling, model updating and calculation speed; Enabling reliable and robust communications particularly for

  12. Technology strategy for integrated operations and real time reservoir management; Technology Target Areas; TTA5 - Integrated operations and RTRM

    Energy Technology Data Exchange (ETDEWEB)

    2007-07-01

    In Norway Integrated Operations (IO) is a concept which in the first phase (G1) has been used to describe how to integrate processes and people onshore and offshore using ICT solutions and facilities that improve onshore's ability to support offshore operationally. The second generation (G2) Integrated Operations aims to help operators utilize vendors' core competencies and services more efficiently. Utilizing digital services and vendor products, operators will be able to update reservoir models, drilling targets and well trajectories as wells are drilled, manage well completions remotely, optimize production from reservoir to export lines, and implement condition-based maintenance concepts. The total impact on production, recovery rates, costs and safety will be profound. When the international petroleum business moves to the Arctic region the setting is very different from what is the case on the Norwegian Continental Shelf (NCS) and new challenges will arise. The Norwegian Ministry of Environment has recently issued an Integrated Management Plan for the Barents Sea where one focus is on 'Monitoring of the Marine Environment in the North'. The Government aims to establish a new and more coordinated system for monitoring the marine ecosystems in the north. A representative group consisting of the major Operators, the Service Industry, Academia and the Authorities have developed the enclosed strategy for the OG21 Integrated Operations and Real Time Reservoir Management (IO and RTRM) Technology Target Area (TTA). Major technology and work process research and development gaps have been identified in several areas: Bandwidth down-hole to surface; Sensor development including Nano-technology; Cross discipline use of Visualisation, Simulation and model development particularly in Drilling and Reservoir management areas; Software development in terms of data handling, model updating and calculation speed; Enabling reliable and robust communications

  13. Utilizing nanobody technology to target non-immunodominant domains of VAR2CSA.

    Directory of Open Access Journals (Sweden)

    Sisse B Ditlev

    Full Text Available Placental malaria is a major health problem for both pregnant women and their fetuses in malaria endemic regions. It is triggered by the accumulation of Plasmodium falciparum-infected erythrocytes (IE in the intervillous spaces of the placenta and is associated with foetal growth restriction and maternal anemia. IE accumulation is supported by the binding of the parasite-expressed protein VAR2CSA to placental chondroitin sulfate A (CSA. Defining specific CSA-binding epitopes of VAR2CSA, against which to target the immune response, is essential for the development of a vaccine aimed at blocking IE adhesion. However, the development of a VAR2CSA adhesion-blocking vaccine remains challenging due to (i the large size of VAR2CSA and (ii the extensive immune selection for polymorphisms and thereby non-neutralizing B-cell epitopes. Camelid heavy-chain-only antibodies (HcAbs are known to target epitopes that are less immunogenic to classical IgG and, due to their small size and protruding antigen-binding loop, able to reach and recognize cryptic, conformational epitopes which are inaccessible to conventional antibodies. The variable heavy chain (VHH domain is the antigen-binding site of camelid HcAbs, the so called Nanobody, which represents the smallest known (15 kDa intact, native antigen-binding fragment. In this study, we have used the Nanobody technology, an approach new to malaria research, to generate small and functional antibody fragments recognizing unique epitopes broadly distributed on VAR2CSA.

  14. [Optimization study on extraction technology of the seed of Ziziphus jujuba var. spinosa by orthogonal design with multi-targets].

    Science.gov (United States)

    Wang, Xiao-liang; Zhang, Yu-jie; Chen, Ming-xia; Wang, Ze-feng

    2005-05-01

    To optimize extraction technology of the seed of Ziziphus jujuba var. spinosa with the targets of the total saponin, total jujuboside A and B and total flavonoids. In the method of one-way and orthogonal tests, ethanol concentration, amount of ethanol, extraction time and extraction times were the factors in orthogonal test, and each factor with three levels. Ethanol concentration and extraction times had significant effect on all the targets, other factors should be selected in accordance with production practice. The best extraction technology is to extract for three times with 8 fold ethanol solution (60%), and 1.5 h each time.

  15. Research on the development of space target detecting system and three-dimensional reconstruction technology

    Science.gov (United States)

    Li, Dong; Wei, Zhen; Song, Dawei; Sun, Wenfeng; Fan, Xiaoyan

    2016-11-01

    With the development of space technology, the number of spacecrafts and debris are increasing year by year. The demand for detecting and identification of spacecraft is growing strongly, which provides support to the cataloguing, crash warning and protection of aerospace vehicles. The majority of existing approaches for three-dimensional reconstruction is scattering centres correlation, which is based on the radar high resolution range profile (HRRP). This paper proposes a novel method to reconstruct the threedimensional scattering centre structure of target from a sequence of radar ISAR images, which mainly consists of three steps. First is the azimuth scaling of consecutive ISAR images based on fractional Fourier transform (FrFT). The later is the extraction of scattering centres and matching between adjacent ISAR images using grid method. Finally, according to the coordinate matrix of scattering centres, the three-dimensional scattering centre structure is reconstructed using improved factorization method. The three-dimensional structure is featured with stable and intuitive characteristic, which provides a new way to improve the identification probability and reduce the complexity of the model matching library. A satellite model is reconstructed using the proposed method from four consecutive ISAR images. The simulation results prove that the method has gotten a satisfied consistency and accuracy.

  16. Peak reading detector circuit

    International Nuclear Information System (INIS)

    Courtin, E.; Grund, K.; Traub, S.; Zeeb, H.

    1975-01-01

    The peak reading detector circuit serves for picking up the instants during which peaks of a given polarity occur in sequences of signals in which the extreme values, their time intervals, and the curve shape of the signals vary. The signal sequences appear in measuring the foetal heart beat frequence from amplitude-modulated ultrasonic, electrocardiagram, and blood pressure signals. In order to prevent undesired emission of output signals from, e. g., disturbing intermediate extreme values, the circuit consists of the series connections of a circuit to simulate an ideal diode, a strong unit, a discriminator for the direction of charging current, a time-delay circuit, and an electronic switch lying in the decharging circuit of the storage unit. The time-delay circuit thereby causes storing of a preliminary maximum value being used only after a certain time delay for the emission of the output signal. If a larger extreme value occurs during the delay time the preliminary maximum value is cleared and the delay time starts running anew. (DG/PB) [de

  17. Technology strategy for deepwater and subsea production systems 2008 update; Technology Target Areas; TTA7 - Deep water and subsea prodution technology

    Energy Technology Data Exchange (ETDEWEB)

    2008-07-01

    Executive summary 'Deepwater and Subsea Production Systems' has been identified as one of the eight new Technology Target Areas (TTAs) in Norway's technology strategy for the Oil and Gas sector. This TTA covers deepwater floating production systems, subsea systems (except subsea processing technologies which are addressed by TTA6) and arctic development systems (in both shallow and deepwater). The total hydrocarbon reserves worldwide, which are enabled by the technologies under this TTA exceed 400 billion boe which, itself exceeds the proven reserves of Saudi Arabia. For deepwater developments the long term technical challenge is to develop flexible and adaptive systems which are better able to cope with subsurface uncertainties e.g. compartmentalisation and provide required access to the reservoir to enable successful recovery. More specific medium term challenges relate to developing solutions for harsh environmental conditions such as those offshore Norway and to develop cost effective methods of installing subsea hardware in deep and ultra deep water without requiring expensive crane vessels. For subsea systems the challenge is to develop solutions for ultra deepwater without increasing costs, so that Norway's leading export position in this area can be maintained and strengthened. Considering developments in the arctic, Norwegian industry is already well placed through its familiarity with arctic climate, close relationship with Russia and involvement in Sakhalin II. As we move to water depth beyond about 150m use of Gravity Base Structures (GBS) becomes very expensive or non-feasible and we need to consider other solutions. Subsea-to-beach could be an attractive solution but we need to resolve challenges related to long distance tie backs, flow assurance, uneven terrain, etc. There is also a specific need to develop floating systems capable of drilling and production in an arctic environment. To address the above technical challenges the

  18. Inertial confinement fusion target component fabrication and technology development support: Annual report, October 1, 1995--September 30, 1996

    International Nuclear Information System (INIS)

    Hoppe, M.

    1997-02-01

    On December 30, 1990, the U.S. Department of Energy entered into a contract with General Atomics (GA) to be the Inertial Confinement Fusion (ICF) Target Component Fabrication and Technology Development Support contractor. In September 1995 this contract ended and a second contract was issued for us to continue this ICF target support work. This report documents the technical activities of the period October 1, 1995 through September 30, 1996. During this period, GA and our partners WJ Schafer Associates (WJSA) and Soane Technologies, Inc. (STI) were assigned 14 formal tasks in support of the Inertial Confinement Fusion program and its five laboratories. A portion of the effort on these tasks included providing direct open-quotes Onsite Supportclose quotes at Lawrence Livermore National Laboratory (LLNL), Los Alamos National Laboratory (LANL), and Sandia National Laboratory Albuquerque (SNLA). We fabricated and delivered over 800 gold-plated hohlraum mandrels to LLNL, LANL and SNLA. We produced nearly 1,200 glass and plastic target capsules for LLNL, LANL, SNLA and University of Rochester/Laboratory for Laser Energetics (UR/LLE). We also delivered over 100 flat foil targets for Naval Research Lab (NRL) and SNLA in FY96. This report describes these target fabrication activities and the target fabrication and characterization development activities that made the deliveries possible. The ICF program is anticipating experiments at the OMEGA laser and the National Ignition Facility (NIF) which will require capsules containing cryogenic layered D 2 or deuterium-tritium (DT) fuel. We are part of the National Cryogenic Target Program to create and demonstrate viable ways to generate and characterize cryogenic layers. Substantial progress has been made on ways to both create and characterize viable layers. During FY96, significant progress was made in the design of the OMEGA Cryogenic Target System that will field cryogenic targets on OMEGA

  19. New design targets and new automated technology for the production of radionuclides with high specificity radioactivity in nuclear research reactors

    International Nuclear Information System (INIS)

    Gerasimov, A.S.; Kiselev, G.V.

    1997-01-01

    Current demands of industry require the application of radionuclides with high specific radioactivity under low consumption of neutrons. To provide this aim staff of ITEP Reactor Department investigated the different type AEs of start targets for the production of the main radionuclides; Co-60, Ir-192 and others. In first turn the targets of Co and Ir without the block-effect of neutron flux (with low absorption of neutrons) were investigated. The following principal results were received for example for Ir-192: block effect is equal 0.086 for diameter of Ir target mm and is equal 0.615 for diameter Ir target 0.5mm. It means average neutron flux for Ir target diameter 0.5mm and therefore the production of Ir-192 will be at 10 times more than for diameter 6.0mm. To provide the automated technology of the manufacture of radioactive sources with radionuclides with high specific radioactivity it was proposed that the compound targets for the irradiation of ones and for the management with the irradiated targets. Different types of compound targets were analyzed. (authors)

  20. Prediction on the Peak of the CO2 Emissions in China Using the STIRPAT Model

    Directory of Open Access Journals (Sweden)

    Li Li

    2016-01-01

    Full Text Available Climate change has threatened our economic, environmental, and social sustainability seriously. The world has taken active measures in dealing with climate change to mitigate carbon emissions. Predicting the carbon emissions peak has become a global focus, as well as a leading target for China’s low carbon development. China has promised its carbon emissions will have peaked by around 2030, with the intention of peaking earlier. Scholars generally have studied the influencing factors of carbon emissions. However, research on carbon emissions peaks is not extensive. Therefore, by setting a low scenario, a middle scenario, and a high scenario, this paper predicts China’s carbon emissions peak from 2015 to 2035 based on the data from 1998 to 2014 using the Stochastic Impacts by Regression on Population, Affluence, and Technology (STIRPAT model. The results show that in the low, middle, and high scenarios China will reach its carbon emissions peak in 2024, 2027, and 2030, respectively. Thus, this paper puts forward the large-scale application of technology innovation to improve energy efficiency and optimize energy structure and supply and demand. China should use industrial policy and human capital investment to stimulate the rapid development of low carbon industries and modern agriculture and service industries to help China to reach its carbon emissions peak by around 2030 or earlier.

  1. Development and evaluation of a targeted orchard sprayer using machine vision technology

    Directory of Open Access Journals (Sweden)

    H Asaei

    2016-09-01

    Full Text Available Introduction In conventional methods of spraying in orchards, the amount of pesticide sprayed, is not targeted. The pesticide consumption data indicates that the application rate of pesticide in greenhouses and orchards is more than required. Less than 30% of pesticide sprayed actually reaches nursery canopies while the rest are lost and wasted. Nowadays, variable rate spray applicators using intelligent control systems can greatly reduce pesticide use and off-target contamination of environment in nurseries and orchards. In this research a prototype orchard sprayer based on machine vision technology was developed and evaluated. This sprayer performs real-time spraying based on the tree canopy structure and its greenness extent which improves the efficiency of spraying operation in orchards. Materials and Methods The equipment used in this study comprised of three main parts generally: 1- Mechanical Equipment 2- Data collection and image processing system 3- Electronic control system Two booms were designed to support the spray nozzles and to provide flexibility in directing the spray nozzles to the target. The boom comprised two parts, the vertical part and inclined part. The vertical part of the boom was used to spray one side of the trees during forward movement of the tractor and inclined part of the boom was designed to spray the upper half of the tree canopy. Three nozzles were considered on each boom. On the vertical part of the boom, two nozzles were placed, whereas one other nozzle was mounted on the inclined part of the boom. To achieve different tree heights, the vertical part of the boom was able to slide up and down. Labview (version 2011 was used for real time image processing. Images were captured through RGB cameras mounted on a horizontal bar attached on top of the tractor to take images separately for each side of the sprayer. Images were captured from the top of the canopies looking downward. The triggering signal for

  2. Technology of solid-fuel-layer targets for laser-fusion experiments

    International Nuclear Information System (INIS)

    Musinski, D.L.; Henderson, T.M.; Pattinson, T.R.; Tarvin, J.A.

    1979-01-01

    An apparatus which produces uniform solid-fuel layers in glass-shell targets for laser irradiation is described. A low-power cw laser pulse is used to vaporize the fuel within a previously frozen target which is maintained in a cold-helium environment by a cryogenic shroud. The rapid refreezing that follows the pulse forms a uniform fuel layer on the inner surface of the glass shell. This apparatus and technique meet the restrictions imposed by the experimental target chamber. The method does not perturb the target position; nor does it preclude the usual diagnostic experimets since the shroud is retracted before the main laser pulse arrives. Successful laser irradiation and implosion of solid-fuel-layer targets at KMSF have confirmed the effectiveness and reliability of this system and extended the range of laser-target-interaction studies in the cryogenic regime

  3. Advanced research technology for discovery of new effective compounds from Chinese herbal medicine and their molecular targets.

    Science.gov (United States)

    Wong, Vincent Kam-Wai; Law, Betty Yuen-Kwan; Yao, Xiao-Jun; Chen, Xi; Xu, Su Wei; Liu, Liang; Leung, Elaine Lai-Han

    2016-09-01

    Traditional biotechnology has been utilized by human civilization for long in wide aspects of our daily life, such as wine and vinegar production, which can generate new phytochemicals from natural products using micro-organism. Today, with advanced biotechnology, diverse applications and advantages have been exhibited not only in bringing benefits to increase the diversity and composition of herbal phytochemicals, but also helping to elucidate the treatment mechanism and accelerate new drug discovery from Chinese herbal medicine (CHM). Applications on phytochemical biotechnologies and microbial biotechnologies have been promoted to enhance phytochemical diversity. Cell labeling and imaging technology and -omics technology have been utilized to elucidate CHM treatment mechanism. Application of computational methods, such as chemoinformatics and bioinformatics provide new insights on direct target of CHM. Overall, these technologies provide efficient ways to overcome the bottleneck of CHM, such as helping to increase the phytochemical diversity, match their molecular targets and elucidate the treatment mechanism. Potentially, new oriented herbal phytochemicals and their corresponding drug targets can be identified. In perspective, tighter integration of multi-disciplinary biotechnology and computational technology will be the cornerstone to accelerate new arena formation, advancement and revolution in the fields of CHM and world pharmaceutical industry. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. Development of plasma targets for interaction experiments at Tokyo Institute of Technology

    International Nuclear Information System (INIS)

    Hosokai, T.; Miyamoto, S.; Ogawa, M.

    1996-01-01

    A plasma target of z-pinch discharge is developed to obtain a hydrogen plasma of density approaching 10 18 cm -3 . The target plasma has a duration of about 1 μs for an initial gas pressure of 80 Pa. Prior to the gas flow type of target, the z-pinch process of a gas-filled discharge tube was studied by comparison with a computer simulation. The behavior of the z pinch is understood in terms of the dynamics of a shock wave and a current boundary sheet. A laser-induced plasma is also examined as an alternative plasma target free from the plasma lens effect. (orig.)

  5. Continuing investigations for technology assessment of 99Mo production from LEU [low enriched uranium] targets

    International Nuclear Information System (INIS)

    Vandegrift, G.F.; Kwok, J.D.; Marshall, S.L.; Vissers, D.R.; Matos, J.E.

    1987-01-01

    Currently much of the world's supply of 99m Tc for medical purposes is produced from 99 Mo derived from the fissioning of high enriched uranium (HEU). This paper presents the results of our continuing studies on the effects of substituting low enriched uranium (LEU) for HEU in targets for the production of fission product 99 Mo. Improvements in the electrodeposition of thin films of uranium metal continue to increase the appeal for the substitution of LEU metal for HEU oxide films in cylindrical targets. The process is effective for targets fabricated from stainless steel or zircaloy. Included is a cost estimate for setting up the necessary equipment to electrodeposit uranium metal on cylindrical targets. Further investigations on the effect of LEU substitution on processing of these targets are also reported. Substitution of uranium silicides for the uranium-aluminium alloy or uranium aluminide dispersed fuel used in current target designs will allow the substitution of LEU for HEU in these targets with equivalent 99 Mo-yield per target and no change in target geometries. However, this substitution will require modifications in current processing steps due to 1) the insolubility of uranium silicides in alkaline solutions and 2) the presence of significant quantities of silicate in solution. Results to date suggest that substitution of LEU for HEU can be achieved. (Author)

  6. Integration of multidisciplinary technologies for real time target visualization and verification for radiotherapy.

    Science.gov (United States)

    Chang, Wen-Chung; Chen, Chin-Sheng; Tai, Hung-Chi; Liu, Chia-Yuan; Chen, Yu-Jen

    2014-01-01

    The current practice of radiotherapy examines target coverage solely from digitally reconstructed beam's eye view (BEV) in a way that is indirectly accessible and that is not in real time. We aimed to visualize treatment targets in real time from each BEV. The image data of phantom or patients from ultrasound (US) and computed tomography (CT) scans were captured to perform image registration. We integrated US, CT, US/CT image registration, robotic manipulation of US, a radiation treatment planning system, and a linear accelerator to constitute an innovative target visualization system. The performance of this algorithm segmented the target organ in CT images, transformed and reconstructed US images to match each orientation, and generated image registration in real time mode with acceptable accuracy. This image transformation allowed physicians to visualize the CT image-reconstructed target via a US probe outside the BEV that was non-coplanar to the beam's plane. It allowed the physicians to remotely control the US probe that was equipped on a robotic arm to dynamically trace and real time monitor the coverage of the target within the BEV during a simulated beam-on situation. This target visualization system may provide a direct remotely accessible and real time way to visualize, verify, and ensure tumor targeting during radiotherapy.

  7. Fabrication technology for a series of cylindrical thin-wall cavity targets

    CERN Document Server

    Zheng Yong; Sun Zu Oke; Wang Ming Da; Zhou La; Zhou Zhi Yun

    2002-01-01

    Cylindrical thin-wall cavity targets have been fabricated to study the behavior of superthermal electrons and their effects on inertial confinement fusion (ICF). Self-supporting cavity targets having adjustable, uniform wall thickness, and low surface roughness were required. This required production of high-quality mandrels, coating them by sputtering or electroplating, developing techniques for measurement of wall thickness and other cavity parameters, improving the uniformity of rotation of the mandrels, and preventing damage to the targets during removal from the mandrels. Details of the fabrication process are presented. Experimental results from the use of these targets are presented. These results, in good agreement with simulations, indicate that the use of thin-wall cavity targets is an effective method for studying superthermal electrons in ICF.

  8. Stereotactic Bragg peak proton radiosurgery method

    International Nuclear Information System (INIS)

    Kjellberg, R.N.

    1979-01-01

    A brief description of the technical aspects of a stereotactic Bragg peak proton radiosurgical method for the head is presented. The preparatory radiographic studies are outlined and the stereotactic instrument and positioning of the patient are described. The instrument is so calibrated that after corrections for soft tissue and bone thickness, the Bragg peak superimposes upon the intracranial target. The head is rotated at specific intervals to allow predetermined portals of access for the beam path, all of which converge on the intracranial target. Normally, portals are arranged to oppose and overlap from both sides of the head. Using a number of beams (in sequence) on both sides of the head, the target dose is far greater than the path dose. The procedure normally takes 3/2-2 hours, following which the patient can walk away. (Auth./C.F.)

  9. Continuing investigations for technology assessment of 99Mo production from LEU [low enriched Uranium] targets

    International Nuclear Information System (INIS)

    Vandergrift, G.F.; Kwok, J.D.; Marshall, S.L.; Vissers, D.R.; Matos, J.E.

    1987-01-01

    Currently much of the world's supply of /sup 99m/Tc for medical purposes is produced from 99 Mo derived from the fissioning of high enriched uranium (HEU). The need for /sup 99m/Tc is continuing to grow, especially in developing countries, where needs and national priorities call for internal production of 99 Mo. This paper presents the results of our continuing studies on the effects of substituting low enriched Uranium (LEU) for HEU in targets for the production of fission product 99 Mo. Improvements in the electrodeposition of thin films of uranium metal are reported. These improvements continue to increase the appeal for the substitution of LEU metal for HEU oxide films in cylindrical targets. The process is effective for targets fabricated from stainless steel or hastaloy. A cost estimate for setting up the necessary equipment to electrodeposit uranium metal on cylindrical targets is reported. Further investigations on the effect of LEU substitution on processing of these targets are also reported. Substitution of uranium silicides for the uranium-aluminum alloy or uranium aluminide dispersed fuel used in other current target designs will allow the substitution of LEU for HEU in these targets with equivalent 99 Mo-yield per target and no change in target geometries. However, this substitution will require modifications in current processing steps due to (1) the insolubility of uranium silicides in alkaline solutions and (2) the presence of significant quantities of silicate in solution. Results to date suggest that both concerns can be handled and that substitution of LEU for HEU can be achieved

  10. Inertial confinement fusion target component fabrication and technology development support. Annual report, October 1, 1994--September 30, 1995

    International Nuclear Information System (INIS)

    Hoppe, M.

    1996-05-01

    On December 30, 1990, the US Department of Energy entered into a contract with General Atomics (GA) to be the Inertial Confinement Fusion (ICF) Target Component Fabrication and Technology Development Support contractor. This report documents the technical activities of the period October 1, 1994 through September 30, 1995. During this period, GA was assigned 15 tasks in support of the Inertial Confinement Fusion program and its laboratories. A portion of the effort on these tasks included providing direct ''Onsite Support'' at Lawrence Livermore National Laboratory (LLNL), Los Alamos National Laboratory (LANL), and Sandia National Laboratory Albuquerque (SNLA). The ICF program is anticipating experiments at the National Ignition Facility (NIF) and the OMEGA Upgrade. Both facilities will require capsules containing layered D 2 or deuterium-tritium (D-T) fuel. The authors are part of the National Cryogenic Target Program to create and demonstrate viable ways to generate and characterize cryogenic layers. Progress has been made on ways to both create viable layers and to characterize them. They continued engineering, assembly and testing of equipment for a cryogenic target handling system for University of Rochester's Laboratory for Laser Energetics (UR/LLE) that will fill, transport, layer, and characterize targets filled with cryogenic fuel, and insert these cryogenic targets into the OMEGA Upgrade target chamber for laser implosion experiments. This report summarizes and documents the technical progress made on these tasks

  11. Inertial confinement fusion target component fabrication and technology development support. Annual report, October 1, 1994--September 30, 1995

    Energy Technology Data Exchange (ETDEWEB)

    Hoppe, M. [ed.

    1996-05-01

    On December 30, 1990, the US Department of Energy entered into a contract with General Atomics (GA) to be the Inertial Confinement Fusion (ICF) Target Component Fabrication and Technology Development Support contractor. This report documents the technical activities of the period October 1, 1994 through September 30, 1995. During this period, GA was assigned 15 tasks in support of the Inertial Confinement Fusion program and its laboratories. A portion of the effort on these tasks included providing direct ``Onsite Support`` at Lawrence Livermore National Laboratory (LLNL), Los Alamos National Laboratory (LANL), and Sandia National Laboratory Albuquerque (SNLA). The ICF program is anticipating experiments at the National Ignition Facility (NIF) and the OMEGA Upgrade. Both facilities will require capsules containing layered D{sub 2} or deuterium-tritium (D-T) fuel. The authors are part of the National Cryogenic Target Program to create and demonstrate viable ways to generate and characterize cryogenic layers. Progress has been made on ways to both create viable layers and to characterize them. They continued engineering, assembly and testing of equipment for a cryogenic target handling system for University of Rochester`s Laboratory for Laser Energetics (UR/LLE) that will fill, transport, layer, and characterize targets filled with cryogenic fuel, and insert these cryogenic targets into the OMEGA Upgrade target chamber for laser implosion experiments. This report summarizes and documents the technical progress made on these tasks.

  12. Effect of performance of Zr-Y alloy target on thin film deposition technology

    International Nuclear Information System (INIS)

    Pan Qianfu; Liu Chaohong; Jiang Mingzhong; Yin Changgeng

    2011-01-01

    Yttria-stabilized zirconia (YSZ) films are synthesized on corrosion resistant plates by pulsed bias arc ion plating. The arc starting performance and the stability of thin film deposition is explored by improving the uniformity and compactibility of Zr-Y alloy target. The property of Zr-Y alloy target and depositional thin films were measured with the optical microscope, scanning electron microscope, X-ray diffractometer. The result shows that the target with hot rolling and annealing has a good arc starting performance and stability of thin film deposition, and the depositional thin films made of Yttria and amorphous zirconia are homogeneous and compact. (authors)

  13. Technology Issues and Benefits of a Fast Ignition Power Plant with Cone Targets

    International Nuclear Information System (INIS)

    Hogan, W J; Meier, W R

    2003-01-01

    The use of cone focus, fast ignition targets, either for direct or indirect drive, promises to lower the required driver size and relax the symmetry requirements in IFE power plants. It may also allow use of chamber concepts previously thought infeasible with a laser driver. These benefits will lower the COE and make IFE plants more competitive at smaller size. Their use also raises unique issues that will impact the design and development of power plant subsystems. Cone targets have a significant mass of high Z material whether or not they have a hohlraum and they are not spherically symmetric. This has implications for target injection, tracking and chamber background gas allowable

  14. Biosocial Spaces and Neurocomputational Governance: Brain-Based and Brain-Targeted Technologies in Education

    Science.gov (United States)

    Williamson, Ben; Pykett, Jessica; Nemorin, Selena

    2018-01-01

    Recently, technologies based on neuroscientific insights into brain function and structure have been promoted for application in education. The novel practices and environments produced by these technologies require new forms of "biosocial" analysis to unpack their implications for education, learning and governance. This article…

  15. Research on Ground Motion Metal Target Based on Rocket Projectile by Using Millimeter Wave Radiometer Technology

    Directory of Open Access Journals (Sweden)

    Zhang Dongyang

    2014-06-01

    Full Text Available How to detect the ground motion metal target effectively is an important guarantee for precision strike in the process of Rocket Projectile flight. Accordingly and in view of the millimeter- wave radiation characteristic of the ground motion metal target, a mathematical model was established based on Rocket Projectile about millimeter-wave detection to the ground motion metal target. Through changing various parameters in the process of Rocket Projectile flight, the detection model was studied by simulation. The parameters variation and effective range of millimeter wave radiometer were obtained in the process of rotation and horizontal flight. So a certain theoretical basis was formed for the precision strike to the ground motion metal target.

  16. A Very High Uranium Density Fission Mo Target Suitable for LEU Using atomization Technology

    Energy Technology Data Exchange (ETDEWEB)

    Kim, C. K.; Kim, K. H.; Lee, Y. S.; Ryu, H. J.; Woo, Y. M.; Jang, S. J.; Park, J. M.; Choi, S. J. [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2011-05-15

    Currently HEU minimization efforts in fission Mo production are underway in connection with the global threat reduction policy. In order to convert HEU to LEU for the fission Mo target, higher uranium density material could be applied. The uranium aluminide targets used world widely for commercial {sup 99}Mo production are limited to 3.0 g-U/cc in uranium density of the target meat. A consideration of high uranium density using the uranium metal particles dispersion plate target is taken into account. The irradiation burnup of the fission Mo target are as low as 8 at.% and the irradiation period is shorter than 7 days. Pure uranium material has higher thermal conductivity than uranium compounds or alloys. It is considered that the degradation by irradiation would be almost negligible. In this study, using the computer code of the PLATE developed by ANL the irradiation behavior was estimated. Some considerations were taken into account to improve the irradiation performance further. It has been known that some alloying elements of Si, Cr, Fe, and Mo are beneficial for reducing the swelling by grain refinement. In the RERTR program recently the interaction problem could be solved by adding a small amount of Si to the aluminum matrix phase. The fabrication process and the separation process for the proposed atomized uranium particles dispersion target were reviewed

  17. An Effort to Improve U Foil Fabrication Technology of Roll-casting for Fission Mo Target

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Chang Kyu; Woo, Yun Myeong; Kim, Ki Hwan; Oh, Jong Myeong [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of); Sim, Moon Soo [Chungnam University, Green Energy Technology, Daejeon (Korea, Republic of)

    2010-10-15

    Mo-99 isotope has been produced mainly by extracting fission products of {sup 235}U. The targets for irradiating in reactor have used as stainless tube coated with highly enriched UO{sub 2} at the inside surface and highly enriched UAlx plate cladded with aluminum. In connection with non-proliferation policy the RERTR program developed a new process of Mo-99 using low enriched uranium (LEU) instead of highly enriched uranium (HEU). LEU should be put about five times more quantity than HEU because the {sup 235}U contents of LEU and HEU are 20% and higher than 90%, respectively. Accordingly pure uranium metal foil target was adopted as a promising target material due to high uranium density. ANL and BATAN developed a Cintichem process using uranium metal foil target of 130 {mu}m in thickness jointly and the RERTR program is trying to disseminate the new process world-widely. However, uranium foil is made by lots of times rolling work on uranium plate, which is laborious and tedious. In order to avoid this difficulty KAERI developed a new process of making foil directly from uranium melt by roll casting. This process is very much simple, productive, and cost-effective. But the outside surface of foil is generally very rough. A typical transverse cross section had a minimum thickness of 65 {mu}m and a maximum thickness of 205 {mu}m. This roughness could affect (1) target fabrication, where the U foil, or the Ni foil might be damaged during drawing, and (2) irradiation behavior, where gaps between the target walls and the U metal might affect cooling of the target

  18. Elemental Technologies for Lead-Bismuth Spallation Target System in J-PARC

    International Nuclear Information System (INIS)

    Obayashi, H.; Yamaguchi, K.; Saito, S.; Sugawara, T.; Takei, H.; Sasa, T.

    2015-01-01

    Japan Atomic Energy Agency (JAEA) has been researching and developing an Accelerator-Driven System (ADS) as a dedicated system for the transmutation of long-lived radioactive nuclides. The ADS proposed by JAEA uses the lead-bismuth eutectic (LBE) alloy as a spallation target material and a coolant. In the various R and D for ADS, construction of the Transmutation Experimental Facility (TEF) is planned under the framework of the J-PARC project as a preceding step before the construction of demonstrative ADS. In this R and D, TEF is considered for the experimental investigation of the feasibility of the beam window, the structural materials, and to investigate the operation properties of the target system by using 400 MeV-250 kW proton beam. This target system is consisted of various elements and must be able to operate without troubles during an operation period of TEF facility. Furthermore, in the maintenance period after the operation, because the inside of a hot cell storing a target is exposed to strong radiations, all elements must be designed as remote control devices. In this study, the present conditions of the design and the result of performance test of each important elements were confirmed in the realisation of the LBE target system, such as the monitoring system of flow rate by using the ultrasonic method, the heater system with the metallic heat insulator joined to a flow channel of LBE, and the operability of remote handing. (authors)

  19. Design and implement of infrared small target real-time detection system based on pipeline technology

    Science.gov (United States)

    Sun, Lihui; Wang, Yongzhong; He, Yongqiang

    2007-01-01

    The detection for motive small target in infrared image sequence has become a hot topic nowadays. Background suppress algorithm based on minim gradient median filter and temporal recursion target detection algorithm are introduced. On the basis of contents previously mentioned, a four stages pipeline structure infrared small target detection process system, which aims at characters of algorithm complexity, large amounts of data to process, high frame frequency and exigent real-time character in this kind of application, is designed and implemented. The logical structure of the system was introduced and the function and signals flows are programmed. The system is composed of two FPGA chips and two DSP chips of TI. According to the function of each part, the system is divided into image preprocess stage, target detection stage, track relation stage and image output stage. The experiment of running algorithms on the system presented in this paper proved that the system could meet acquisition and process of 50Hz 240x320 digital image and the system could real time detect small target with a signal-noise ratio more than 3 reliably. The system achieves the characters of large amount of memory, high real-time processing, excellent extension and favorable interactive interface.

  20. Preliminary investigations for technology assessment of 99Mo production from LEU [low enriched uranium] targets

    International Nuclear Information System (INIS)

    Vandegrift, G.F.; Chaiko, D.J.; Heinrich, R.R.; Kucera, E.T.; Jensen, K.J.; Poa, D.S.; Varma, R.; Vissers, D.R.

    1986-11-01

    This paper presents the results of preliminary studies on the effects of substituting low enriched uranium (LEU) for highly enriched uranium (HEU) in targets for the production of fission product 99 Mo. Issues that were addressed are: (1) purity and yield of the 99 Mo//sup 99m/Tc product, (2) fabrication of LEU targets and related concerns, and (3) radioactive waste. Laboratory experimentation was part of the efforts for issues (1) and (2); thus far, radioactive waste disposal has only been addressed in a paper study. Although the reported results are still preliminary, there is reason to be optimistic about the feasibility of utilizing LEU targets for 99 Mo production. 37 refs., 1 fig., 5 tabs

  1. Monoclonal Antibody Fragments for Targeting Therapeutics to Growth Plate Cartilage | NCI Technology Transfer Center | TTC

    Science.gov (United States)

    Researchers at The Eunice Kennedy Shriver National Institute on Child Health and Human Development (NICHD) have discovered monoclonal antibodies that bind to matrilin-3, a protein specifically expressed in cartilage tissue, that could be used for treating or inhibiting growth plate disorders, such as a skeletal dysplasia or short stature. The monoclonal antibodies can also be used to target therapeutic agents, such as anti-arthritis agents, to cartilage tissue. NICHD seeks statements of capability or interest from parties interested in collaborative research to co-develop, evaluate, or commercialize treatment of skeletal disorders using targeting antibodies.

  2. Technology of preparation for low density 6Li(H,D) solid micro-target

    International Nuclear Information System (INIS)

    Wang Xisheng; Zeng Jiaquan; Li Qiang

    2002-01-01

    Low density 6 Li(H,D) micro-targets are prepared by loose sintering 6 LiH or 6 LiD powder in a tiny gold cylinder and soaking for 30 min up to 430 degree C at the rate of 10 degree C/h in argon. The dimension of the micro-targets is as tiny as 0.6-1.0 mm for diameter and 1-2 mm for length. Densities of 6 LiH and 6 LiD without Parylene C is (0.283 +- 0.009) g/cm 3 and (0.369 +- 0.009) g/cm 3 , respectively while 6 LiD targets with Parylene C is only (0.301 +- 0.010) g/cm 3 . The Parylene C has no effect on purity, deuterium abundance and 6 Li abundance of the sintered micro-targets. It's effective to keep 6 Li(H,D) purity by strict control of argon atmosphere

  3. Peak MSC—Are We There Yet?

    Directory of Open Access Journals (Sweden)

    Timothy R. Olsen

    2018-06-01

    Full Text Available Human mesenchymal stem cells (hMSCs are a critical raw material for many regenerative medicine products, including cell-based therapies, engineered tissues, or combination products, and are on the brink of radically changing how the world of medicine operates. Their unique characteristics, potential to treat many indications, and established safety profile in more than 800 clinical trials have contributed to their current consumption and will only fuel future demand. Given the large target patient populations with typical dose sizes of 10's to 100's of millions of cells per patient, and engineered tissues being constructed with 100's of millions to billions of cells, an unprecedented demand has been created for hMSCs. The fulfillment of this demand faces an uphill challenge in the limited availability of large quantities of pharmaceutical grade hMSCs for the industry—fueling the need for parallel rapid advancements in the biomanufacturing of this living critical raw material. Simply put, hMSCs are no different than technologies like transistors, as they are a highly technical and modular product that requires stringent control over manufacturing that can allow for high quality and consistent performance. As hMSC manufacturing processes are optimized, it predicts a future time of abundance for hMSCs, where scientists and researchers around the world will have access to a consistent and readily available supply of high quality, standardized, and economical pharmaceutical grade product to buy off the shelf for their applications and drive product development—this is “Peak MSC.”

  4. Inertial confinement fusion target component fabrication and technology development support: Annual report, October 1, 1993--September 30, 1994

    Energy Technology Data Exchange (ETDEWEB)

    Hoppe, M. [ed.

    1995-04-01

    On December 30, 1990, the US Department of Energy entered into a contract with General Atomics (GA) to be the Inertial Confinement Fusion (ICF) Target Component Fabrication and Technology Development Support contractor. During the period, GA was assigned 17 tasks in support of the Inertial Confinement Fusion program and its laboratories. This year they achieved full production capabilities for the micromachining, dimensional characterization and gold plating of hohlraums. They fabricated and delivered 726 gold-plated mandrels of 27 different types to LLNL and 48 gold-plated mandrels of two different types to LANL. They achieved full production capabilities in composite capsule production ad delivered in excess of 240 composite capsules. They continuously work to improve performance and capabilities. They were also directed to dismantle, remove, and disposition all equipment at the previous contractor (KMSF) that had radioactive contamination levels low enough that they could be exposed to the general public without radiological constraints. GA was also directed to receive and store the tritium fill equipment. They assisted LANL in the development of techniques for characterization of opaque targets. They developed deuterated and UV-opaque polymers for use by the University of Rochester`s Laboratory for Laser Energetics (UR/LLE) and devised a triple-orifice droplet generator to demonstrate the controlled-mass nature of the microencapsulation process. The ICF program is anticipating experiments at NIF and the Omega Upgrade. Both facilities will require capsules containing layered D{sub 2} or D-T fuel. They continued engineering and assembly of equipment for a cryogenic target handling system for UR/LLE that will fill, transport, layer, and characterize targets filled with cryogenic deuterium or deuterium-tritium fuel, and insert these cryogenic targets into the OMEGA Upgrade target chamber for laser implosion experiments.

  5. Inertial confinement fusion target component fabrication and technology development support: Annual report, October 1, 1993--September 30, 1994

    International Nuclear Information System (INIS)

    Hoppe, M.

    1995-04-01

    On December 30, 1990, the US Department of Energy entered into a contract with General Atomics (GA) to be the Inertial Confinement Fusion (ICF) Target Component Fabrication and Technology Development Support contractor. During the period, GA was assigned 17 tasks in support of the Inertial Confinement Fusion program and its laboratories. This year they achieved full production capabilities for the micromachining, dimensional characterization and gold plating of hohlraums. They fabricated and delivered 726 gold-plated mandrels of 27 different types to LLNL and 48 gold-plated mandrels of two different types to LANL. They achieved full production capabilities in composite capsule production ad delivered in excess of 240 composite capsules. They continuously work to improve performance and capabilities. They were also directed to dismantle, remove, and disposition all equipment at the previous contractor (KMSF) that had radioactive contamination levels low enough that they could be exposed to the general public without radiological constraints. GA was also directed to receive and store the tritium fill equipment. They assisted LANL in the development of techniques for characterization of opaque targets. They developed deuterated and UV-opaque polymers for use by the University of Rochester's Laboratory for Laser Energetics (UR/LLE) and devised a triple-orifice droplet generator to demonstrate the controlled-mass nature of the microencapsulation process. The ICF program is anticipating experiments at NIF and the Omega Upgrade. Both facilities will require capsules containing layered D 2 or D-T fuel. They continued engineering and assembly of equipment for a cryogenic target handling system for UR/LLE that will fill, transport, layer, and characterize targets filled with cryogenic deuterium or deuterium-tritium fuel, and insert these cryogenic targets into the OMEGA Upgrade target chamber for laser implosion experiments

  6. SWATHtoMRM: Development of High-Coverage Targeted Metabolomics Method Using SWATH Technology for Biomarker Discovery.

    Science.gov (United States)

    Zha, Haihong; Cai, Yuping; Yin, Yandong; Wang, Zhuozhong; Li, Kang; Zhu, Zheng-Jiang

    2018-03-20

    The complexity of metabolome presents a great analytical challenge for quantitative metabolite profiling, and restricts the application of metabolomics in biomarker discovery. Targeted metabolomics using multiple-reaction monitoring (MRM) technique has excellent capability for quantitative analysis, but suffers from the limited metabolite coverage. To address this challenge, we developed a new strategy, namely, SWATHtoMRM, which utilizes the broad coverage of SWATH-MS technology to develop high-coverage targeted metabolomics method. Specifically, SWATH-MS technique was first utilized to untargeted profile one pooled biological sample and to acquire the MS 2 spectra for all metabolites. Then, SWATHtoMRM was used to extract the large-scale MRM transitions for targeted analysis with coverage as high as 1000-2000 metabolites. Then, we demonstrated the advantages of SWATHtoMRM method in quantitative analysis such as coverage, reproducibility, sensitivity, and dynamic range. Finally, we applied our SWATHtoMRM approach to discover potential metabolite biomarkers for colorectal cancer (CRC) diagnosis. A high-coverage targeted metabolomics method with 1303 metabolites in one injection was developed to profile colorectal cancer tissues from CRC patients. A total of 20 potential metabolite biomarkers were discovered and validated for CRC diagnosis. In plasma samples from CRC patients, 17 out of 20 potential biomarkers were further validated to be associated with tumor resection, which may have a great potential in assessing the prognosis of CRC patients after tumor resection. Together, the SWATHtoMRM strategy provides a new way to develop high-coverage targeted metabolomics method, and facilitates the application of targeted metabolomics in disease biomarker discovery. The SWATHtoMRM program is freely available on the Internet ( http://www.zhulab.cn/software.php ).

  7. Precise focusing and diagnosis technology for laser beams in ICF target chamber

    International Nuclear Information System (INIS)

    Zhu Qixiang

    1999-01-01

    The precise focusing and diagnosis experimental system for laser beams in ICF target chamber is introduced. The system is controlled by computer. In process of focusing a series data of displacement in axial direction and relative area of focus spots are acquired. According to the functional curvature the accurate position of focal plane is determined. The construction of the system is simple, the system is controlled conveniently and runs quickly

  8. Technological advances and proteomic applications in drug discovery and target deconvolution: identification of the pleiotropic effects of statins.

    Science.gov (United States)

    Banfi, Cristina; Baetta, Roberta; Gianazza, Erica; Tremoli, Elena

    2017-06-01

    Proteomic-based techniques provide a powerful tool for identifying the full spectrum of protein targets of a drug, elucidating its mechanism(s) of action, and identifying biomarkers of its efficacy and safety. Herein, we outline the technological advancements in the field, and illustrate the contribution of proteomics to the definition of the pharmacological profile of statins, which represent the cornerstone of the prevention and treatment of cardiovascular diseases (CVDs). Statins act by inhibiting 3-hydroxy-3-methyl-glutaryl-coenzyme A (HMG-CoA) reductase, thus reducing cholesterol biosynthesis and consequently enhancing the clearance of low-density lipoproteins from the blood; however, HMG-CoA reductase inhibition can result in a multitude of additional effects beyond lipid lowering, known as 'pleiotropic effects'. The case of statins highlights the unique contribution of proteomics to the target profiling of a drug molecule. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Fabrication of advanced targets for laser driven nuclear fusion reactions through standard microelectronics technology approaches.

    Czech Academy of Sciences Publication Activity Database

    Picciotto, A.; Crivellari, M.; Bellutti, P.; Barozzi, M.; Kucharik, M.; Krása, Josef; Swidlovsky, A.; Malinowska, A.; Velyhan, Andriy; Ullschmied, Jiří; Margarone, Daniele

    2017-01-01

    Roč. 12, October (2017), č. článku P10001. ISSN 1748-0221 Grant - others:OP VK 2 LaserGen(XE) CZ.1.07/2.3.00/20.0087; LaserZdroj (OP VK 3)(XE) CZ.1.07/2.3.00/20.0279 Institutional support: RVO:61389021 ; RVO:68378271 Keywords : Nuclear instruments and methods for hot plasma diagnostics * Plasma generation (laserproduced, RF, x ray-produced) * Plasma diagnostics - charged-particle spectroscopy Subject RIV: BL - Plasma and Gas Discharge Physics; BL - Plasma and Gas Discharge Physics (FZU-D) OBOR OECD: 2.11 Other engineering and technologies; 2.11 Other engineering and technologies (FZU-D) Impact factor: 1.220, year: 2016 http://iopscience.iop.org/article/10.1088/1748-0221/12/10/P10001/meta

  10. Induced mutation and epigenetics modification in plants for crop improvement by targeting CRISPR/Cas9 technology.

    Science.gov (United States)

    Khan, Muhammad Hafeez Ullah; Khan, Shahid U; Muhammad, Ali; Hu, Limin; Yang, Yang; Fan, Chuchuan

    2018-06-01

    Clustered regularly interspaced palindromic repeats associated protein Cas9 (CRISPR-Cas9), originally an adaptive immunity system of prokaryotes, is revolutionizing genome editing technologies with minimal off-targets in the present era. The CRISPR/Cas9 is now highly emergent, advanced, and highly specific tool for genome engineering. The technology is widely used to animal and plant genomes to achieve desirable results. The present review will encompass how CRISPR-Cas9 is revealing its beneficial role in characterizing plant genetic functions, genomic rearrangement, how it advances the site-specific mutagenesis, and epigenetics modification in plants to improve the yield of field crops with minimal side-effects. The possible pitfalls of using and designing CRISPR-Cas9 for plant genome editing are also discussed for its more appropriate applications in plant biology. Therefore, CRISPR/Cas9 system has multiple benefits that mostly scientists select for genome editing in several biological systems. © 2017 Wiley Periodicals, Inc.

  11. The study of metal-alloy targets and excimer laser deposition technology

    International Nuclear Information System (INIS)

    Xu Hua; Wu Weidong; Tang Xiaohong; Zhang Jicheng; Tang Yongjian

    2002-01-01

    Pulsed Laser Deposition (PLD) technology is described. Design and manufacture of the PLD installation is illustrated in detail. The Cu films and Cu/Fe multi-layers are produced by PLD method. The production of the Mg/Si films using magnetron sputtering method is investigated in detail. The percent of Si on Mg/Si film surface is measured by using conductivity method

  12. Polymeric particulate technologies for oral drug delivery and targeting: A pathophysiological perspective

    DEFF Research Database (Denmark)

    Hunter, A. Christy; Elsom, Jacqueline; Wibroe, Peter Popp

    2012-01-01

    Publication year: 2012 Source:Maturitas, Volume 73, Issue 1 A. Christy Hunter, Jacqueline Elsom, Peter P. Wibroe, S. Moein Moghimi The oral route for delivery of pharmaceuticals is the most widely used and accepted. Nanoparticles and microparticles are increasingly being applied within this arena....... It is the purpose of this review to describe these cutting edge technologies and specifically focus on the interaction and fate of these polymers within the gastrointestinal system....

  13. Targeting Non-Coding RNAs in Plants with the CRISPR-Cas Technology is a Challenge yet Worth Accepting.

    Science.gov (United States)

    Basak, Jolly; Nithin, Chandran

    2015-01-01

    Non-coding RNAs (ncRNAs) have emerged as versatile master regulator of biological functions in recent years. MicroRNAs (miRNAs) are small endogenous ncRNAs of 18-24 nucleotides in length that originates from long self-complementary precursors. Besides their direct involvement in developmental processes, plant miRNAs play key roles in gene regulatory networks and varied biological processes. Alternatively, long ncRNAs (lncRNAs) are a large and diverse class of transcribed ncRNAs whose length exceed that of 200 nucleotides. Plant lncRNAs are transcribed by different RNA polymerases, showing diverse structural features. Plant lncRNAs also are important regulators of gene expression in diverse biological processes. There has been a breakthrough in the technology of genome editing, the CRISPR-Cas9 (clustered regulatory interspaced short palindromic repeats/CRISPR-associated protein 9) technology, in the last decade. CRISPR loci are transcribed into ncRNA and eventually form a functional complex with Cas9 and further guide the complex to cleave complementary invading DNA. The CRISPR-Cas technology has been successfully applied in model plants such as Arabidopsis and tobacco and important crops like wheat, maize, and rice. However, all these studies are focused on protein coding genes. Information about targeting non-coding genes is scarce. Hitherto, the CRISPR-Cas technology has been exclusively used in vertebrate systems to engineer miRNA/lncRNAs, but it is still relatively unexplored in plants. While briefing miRNAs, lncRNAs and applications of the CRISPR-Cas technology in human and animals, this review essentially elaborates several strategies to overcome the challenges of applying the CRISPR-Cas technology in editing ncRNAs in plants and the future perspective of this field.

  14. Targeting non-coding RNAs in Plants with the CRISPR-Cas technology is a challenge yet worth accepting

    Directory of Open Access Journals (Sweden)

    Jolly eBasak

    2015-11-01

    Full Text Available Non-coding RNAs (ncRNAs have emerged as versatile master regulator of biological functions in recent years. MicroRNAs (miRNAs are small endogenous ncRNAs of 18-24 nucleotides in length that originates from long self-complementary precursors. Besides their direct involvement in developmental processes, plant miRNAs play key roles in gene regulatory networks and varied biological processes. Alternatively, long ncRNAs (lncRNAs are a large and diverse class of transcribed ncRNAs whose length exceed that of 200 nucleotides. Plant lncRNAs are transcribed by different RNA polymerases, showing diverse structural features. Plant lncRNAs also are important regulators of gene expression in diverse biological processes. There has been a breakthrough in the technology of genome editing, the CRISPR-Cas9 (clustered regulatory interspaced short palindromic repeats/CRISPR-associated protein 9 technology, in the last decade. CRISPR loci are transcribed into ncRNA and eventually form a functional complex with Cas9 and further guide the complex to cleave complementary invading DNA. The CRISPR-Cas technology has been successfully applied in model plants such as Arabidopsis and tobacco and important crops like wheat, maize and rice. However, all these studies are focused on protein coding genes. Information about targeting non-coding genes is scarce. Hitherto, the CRISPR-Cas technology has been exclusively used in vertebrate systems to engineer miRNA/lncRNAs, but it is still relatively unexplored in plants. While briefing miRNAs, lncRNAs and applications of the CRISPR-Cas technology in human and animals, this review essentially elaborates several strategies to overcome the challenges of applying the CRISPR-Cas technology in editing ncRNAs in plants and the future perspective of this field.

  15. Strand Invasion Based Amplification (SIBA®): a novel isothermal DNA amplification technology demonstrating high specificity and sensitivity for a single molecule of target analyte.

    Science.gov (United States)

    Hoser, Mark J; Mansukoski, Hannu K; Morrical, Scott W; Eboigbodin, Kevin E

    2014-01-01

    Isothermal nucleic acid amplification technologies offer significant advantages over polymerase chain reaction (PCR) in that they do not require thermal cycling or sophisticated laboratory equipment. However, non-target-dependent amplification has limited the sensitivity of isothermal technologies and complex probes are usually required to distinguish between non-specific and target-dependent amplification. Here, we report a novel isothermal nucleic acid amplification technology, Strand Invasion Based Amplification (SIBA). SIBA technology is resistant to non-specific amplification, is able to detect a single molecule of target analyte, and does not require target-specific probes. The technology relies on the recombinase-dependent insertion of an invasion oligonucleotide (IO) into the double-stranded target nucleic acid. The duplex regions peripheral to the IO insertion site dissociate, thereby enabling target-specific primers to bind. A polymerase then extends the primers onto the target nucleic acid leading to exponential amplification of the target. The primers are not substrates for the recombinase and are, therefore unable to extend the target template in the absence of the IO. The inclusion of 2'-O-methyl RNA to the IO ensures that it is not extendible and that it does not take part in the extension of the target template. These characteristics ensure that the technology is resistant to non-specific amplification since primer dimers or mis-priming are unable to exponentially amplify. Consequently, SIBA is highly specific and able to distinguish closely-related species with single molecule sensitivity in the absence of complex probes or sophisticated laboratory equipment. Here, we describe this technology in detail and demonstrate its use for the detection of Salmonella.

  16. Strand Invasion Based Amplification (SIBA®: a novel isothermal DNA amplification technology demonstrating high specificity and sensitivity for a single molecule of target analyte.

    Directory of Open Access Journals (Sweden)

    Mark J Hoser

    Full Text Available Isothermal nucleic acid amplification technologies offer significant advantages over polymerase chain reaction (PCR in that they do not require thermal cycling or sophisticated laboratory equipment. However, non-target-dependent amplification has limited the sensitivity of isothermal technologies and complex probes are usually required to distinguish between non-specific and target-dependent amplification. Here, we report a novel isothermal nucleic acid amplification technology, Strand Invasion Based Amplification (SIBA. SIBA technology is resistant to non-specific amplification, is able to detect a single molecule of target analyte, and does not require target-specific probes. The technology relies on the recombinase-dependent insertion of an invasion oligonucleotide (IO into the double-stranded target nucleic acid. The duplex regions peripheral to the IO insertion site dissociate, thereby enabling target-specific primers to bind. A polymerase then extends the primers onto the target nucleic acid leading to exponential amplification of the target. The primers are not substrates for the recombinase and are, therefore unable to extend the target template in the absence of the IO. The inclusion of 2'-O-methyl RNA to the IO ensures that it is not extendible and that it does not take part in the extension of the target template. These characteristics ensure that the technology is resistant to non-specific amplification since primer dimers or mis-priming are unable to exponentially amplify. Consequently, SIBA is highly specific and able to distinguish closely-related species with single molecule sensitivity in the absence of complex probes or sophisticated laboratory equipment. Here, we describe this technology in detail and demonstrate its use for the detection of Salmonella.

  17. Use of CRISPR/Cas Genome Editing Technology for Targeted Mutagenesis in Rice.

    Science.gov (United States)

    Xu, Rongfang; Wei, Pengcheng; Yang, Jianbo

    2017-01-01

    Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/CRISPR-associated protein (Cas) system is a newly emerging mutagenesis (gene-editing) tool in genetic engineering. Among the agriculturally important crops, several genes have been successfully mutated by the system, and some agronomic important traits have been rapidly generated, which indicates the potential applications in both scientific research and plant breeding. In this chapter, we describe a standard gene-editing procedure to effectively target rice genes and to make specific rice mutants using the CRISPR/Cas9 system mediated by Agrobacterium transformation.

  18. Utilizing nanobody technology to target non-immunodominant domains of VAR2CSA

    DEFF Research Database (Denmark)

    Ditlev, Sisse B; Florea, Raluca; Nielsen, Morten A

    2014-01-01

    adhesion. However, the development of a VAR2CSA adhesion-blocking vaccine remains challenging due to (i) the large size of VAR2CSA and (ii) the extensive immune selection for polymorphisms and thereby non-neutralizing B-cell epitopes. Camelid heavy-chain-only antibodies (HcAbs) are known to target epitopes...... that are less immunogenic to classical IgG and, due to their small size and protruding antigen-binding loop, able to reach and recognize cryptic, conformational epitopes which are inaccessible to conventional antibodies. The variable heavy chain (VHH) domain is the antigen-binding site of camelid HcAbs, the so...

  19. Combining multiple ChIP-seq peak detection systems using combinatorial fusion.

    Science.gov (United States)

    Schweikert, Christina; Brown, Stuart; Tang, Zuojian; Smith, Phillip R; Hsu, D Frank

    2012-01-01

    Due to the recent rapid development in ChIP-seq technologies, which uses high-throughput next-generation DNA sequencing to identify the targets of Chromatin Immunoprecipitation, there is an increasing amount of sequencing data being generated that provides us with greater opportunity to analyze genome-wide protein-DNA interactions. In particular, we are interested in evaluating and enhancing computational and statistical techniques for locating protein binding sites. Many peak detection systems have been developed; in this study, we utilize the following six: CisGenome, MACS, PeakSeq, QuEST, SISSRs, and TRLocator. We define two methods to merge and rescore the regions of two peak detection systems and analyze the performance based on average precision and coverage of transcription start sites. The results indicate that ChIP-seq peak detection can be improved by fusion using score or rank combination. Our method of combination and fusion analysis would provide a means for generic assessment of available technologies and systems and assist researchers in choosing an appropriate system (or fusion method) for analyzing ChIP-seq data. This analysis offers an alternate approach for increasing true positive rates, while decreasing false positive rates and hence improving the ChIP-seq peak identification process.

  20. Sci-Thur AM: YIS – 01: New technologies for astatine-211 targeted alpha therapy research

    Energy Technology Data Exchange (ETDEWEB)

    Crawford, Jason; Yang, Hua; Schaffer, Paul; Ruth, Thomas [University of Victoria, Victoria, BC (Canada); TRIUMF, Vancouver, BC (Canada)

    2016-08-15

    Purpose: The short-range, densely ionizing α-particles emitted by {sup 211}At (t{sub 1/2}=7.2h) are well suited for the treatment of diffuse microscopic disease, using cancer targeting biomolecules. {sup 211}At availability is limited by the rarity of α-cyclotrons required for standard production. Image-based dosimetry is also limited for {sup 211}At, which emits low intensity X-rays. Our goal was to leverage state-of-the-art infrastructure at TRIUMF to produce and evaluate two related isotopes, {sup 211}Rn (t{sub 1/2}=14.6h, 73% decay to {sup 211}At) as a generator for {sup 211}At, and {sup 209}At (t{sub 1/2}=5.4h, X-ray/gamma-ray emitter) as a novel 211At surrogate for preclinical imaging studies. Methods: Produced by spallation of uranium with 480 MeV protons, mass separated ion beams of short-lived francium isotopes were implanted into NaCl targets where {sup 211}Rn or {sup 209}At were produced by radioactive decay, in situ. {sup 211}Rn was transferred to dodecane from which {sup 211}At was efficiently extracted and evaluated for clinical applicability. High energy SPECT/CT was evaluated for measuring {sup 209}At activity distributions in mice and phantoms. Results: Our small scale {sup 211}Rn/{sup 211}At generator system provided high purity {sup 211}At samples. The methods are immediately scalable to the level of radioactivity required for in vivo experiments with {sup 211}At. {sup 209}At-based high energy SPECT imaging was determined suitable for pursuing image-based dosimetry in mouse tumour models. In the future, we will utilize quantitative {sup 209}At-SPECT for image-based dose calculations. Conclusion: These early studies provided a foundation for future endeavours with {sup 211}At-based α-therapy. Canada is now significantly closer to clinical targeted α-therapy of cancer.

  1. Highlights from the 2015 WIN Symposium: novel targets, innovative agents, and advanced technologies-a WINning strategy?

    Science.gov (United States)

    Schilsky, Richard L

    2015-01-01

    The worldwide innovative networking (WIN) consortium comprises a global alliance of 28 academic and clinical cancer centres, 11 pharmaceutical and technology companies and five charitable or health payer organisations. Since its inception the consortium has striven to provide a forum for all of its members to network, share information and experience, and perform clinical trials with the overarching goal of advancing the care of patients with cancer through the use of precision medicine. The annual 2-day WIN Symposium is the most visible output of the consortium and provides an opportunity for around 400 experts and other delegates to meet and discuss the latest research and initiatives in personalised cancer medicine. The seventh WIN Symposium, held in Paris, France, 29-30 June 2015, consisted of nine plenary and eight poster sessions that covered the overarching theme of novel targets, innovative agents, and advanced technologies being a winning strategy. Highlights included discussions of immune mechanisms and ways to target the cancer immunome and systems biology approaches to supporting personalised cancer. The latest data from the BATTLE-2 and WINther trials were discussed, and round table discussions were held that focused on how best to design the next generation of clinical trials, which included SPRING, SUMMER, and BOOSTER being initiated by the WIN Consortium.

  2. Development of low enrichment technologies for high density fuels and for isotope production targets

    International Nuclear Information System (INIS)

    Taboada, Horacio; Gonzalez, Alfredo G.

    2005-01-01

    Since more than twenty years ago, CNEA has carried out RERTR activities. Main goals are to convert the RA 6 reactor core from HEU to LEU, to get a comprehensive understanding of U-Mo/Al compounds phase formation in dispersed and monolithic fuels, to develop possible solutions to VHD dispersed and monolithic fuels technical problems, and to optimize techniques to recover U from silicide scrap samples. The future plans include: 1) Completion the RA 6 reactor conversion to LEU; 2) Qualification by irradiation of the promising solutions found for the high density fuels; 3) Irradiation of mini plates and full scale fuel assemblies at the RA 3 reactor and at higher flux and temperature reactors; 4) Optimization of LEU target and radiochemical techniques for radioisotope production. (author) [es

  3. Research on Key Technologies of Network Centric System Distributed Target Track Fusion

    Directory of Open Access Journals (Sweden)

    Yi Mao

    2017-01-01

    Full Text Available To realize common tactical picture in network-centered system, this paper proposes a layered architecture for distributed information processing and a method for distributed track fusion on the basis of analyzing the characteristics of network-centered systems. Basing on the noncorrelation of three-dimensional measurement of surveillance and reconnaissance sensors under polar coordinates, it also puts forward an algorithm for evaluating track quality (TQ using statistical decision theory. According to simulation results, the TQ value is associated with the measurement accuracy of sensors and the motion state of targets, which is well matched with the convergence process of tracking filters. Besides, the proposed algorithm has good reliability and timeliness in track quality evaluation.

  4. Technology-Based Innovations to Foster Personalized Healthy Lifestyles and Well-Being: A Targeted Review

    Science.gov (United States)

    Santana, Silvina; Tsiknakis, Manolis; Marias, Kostas; Sakkalis, Vangelis; Teixeira, António; Janssen, Joris H; de Jong, Henri; Tziraki, Chariklia

    2016-01-01

    Background New community-based arrangements and novel technologies can empower individuals to be active participants in their health maintenance, enabling people to control and self-regulate their health and wellness and make better health- and lifestyle-related decisions. Mobile sensing technology and health systems responsive to individual profiles combined with cloud computing can expand innovation for new types of interoperable services that are consumer-oriented and community-based. This could fuel a paradigm shift in the way health care can be, or should be, provided and received, while lessening the burden on exhausted health and social care systems. Objective Our goal is to identify and discuss the main scientific and engineering challenges that need to be successfully addressed in delivering state-of-the-art, ubiquitous eHealth and mHealth services, including citizen-centered wellness management services, and reposition their role and potential within a broader context of diverse sociotechnical drivers, agents, and stakeholders. Methods We review the state-of-the-art relevant to the development and implementation of eHealth and mHealth services in critical domains. We identify and discuss scientific, engineering, and implementation-related challenges that need to be overcome to move research, development, and the market forward. Results Several important advances have been identified in the fields of systems for personalized health monitoring, such as smartphone platforms and intelligent ubiquitous services. Sensors embedded in smartphones and clothes are making the unobtrusive recognition of physical activity, behavior, and lifestyle possible, and thus the deployment of platforms for health assistance and citizen empowerment. Similarly, significant advances are observed in the domain of infrastructure supporting services. Still, many technical problems remain to be solved, combined with no less challenging issues related to security, privacy, trust, and

  5. Technology-Based Innovations to Foster Personalized Healthy Lifestyles and Well-Being: A Targeted Review.

    Science.gov (United States)

    Spanakis, Emmanouil G; Santana, Silvina; Tsiknakis, Manolis; Marias, Kostas; Sakkalis, Vangelis; Teixeira, António; Janssen, Joris H; de Jong, Henri; Tziraki, Chariklia

    2016-06-24

    New community-based arrangements and novel technologies can empower individuals to be active participants in their health maintenance, enabling people to control and self-regulate their health and wellness and make better health- and lifestyle-related decisions. Mobile sensing technology and health systems responsive to individual profiles combined with cloud computing can expand innovation for new types of interoperable services that are consumer-oriented and community-based. This could fuel a paradigm shift in the way health care can be, or should be, provided and received, while lessening the burden on exhausted health and social care systems. Our goal is to identify and discuss the main scientific and engineering challenges that need to be successfully addressed in delivering state-of-the-art, ubiquitous eHealth and mHealth services, including citizen-centered wellness management services, and reposition their role and potential within a broader context of diverse sociotechnical drivers, agents, and stakeholders. We review the state-of-the-art relevant to the development and implementation of eHealth and mHealth services in critical domains. We identify and discuss scientific, engineering, and implementation-related challenges that need to be overcome to move research, development, and the market forward. Several important advances have been identified in the fields of systems for personalized health monitoring, such as smartphone platforms and intelligent ubiquitous services. Sensors embedded in smartphones and clothes are making the unobtrusive recognition of physical activity, behavior, and lifestyle possible, and thus the deployment of platforms for health assistance and citizen empowerment. Similarly, significant advances are observed in the domain of infrastructure supporting services. Still, many technical problems remain to be solved, combined with no less challenging issues related to security, privacy, trust, and organizational dynamics. Delivering

  6. Avoiding the False Peaks in Correlation Discrimination

    International Nuclear Information System (INIS)

    Awwal, A.S.

    2009-01-01

    Fiducials imprinted on laser beams are used to perform video image based alignment of the 192 laser beams in the National Ignition Facility (NIF) of Lawrence Livermore National Laboratory. In many video images, matched filtering is used to detect the location of these fiducials. Generally, the highest correlation peak is used to determine the position of the fiducials. However, when the signal to-be-detected is very weak compared to the noise, this approach totally breaks down. The highest peaks act as traps for false detection. The active target images used for automatic alignment in the National Ignition Facility are examples of such images. In these images, the fiducials of interest exhibit extremely low intensity and contrast, surrounded by high intensity reflection from metallic objects. Consequently, the highest correlation peaks are caused by these bright objects. In this work, we show how the shape of the correlation is exploited to isolate the valid matches from hundreds of invalid correlation peaks, and therefore identify extremely faint fiducials under very challenging imaging conditions

  7. Upper limit of peak area

    International Nuclear Information System (INIS)

    Helene, O.A.M.

    1982-08-01

    The determination of the upper limit of peak area in a multi-channel spectra, with a known significance level is discussed. This problem is specially important when the peak area is masked by the background statistical fluctuations. The problem is exactly solved and, thus, the results are valid in experiments with small number of events. The results are submitted to a Monte Carlo test and applied to the 92 Nb beta decay. (Author) [pt

  8. MEANING OF TARGET AMBIGUITY FACTOR IN INTELLECTUAL TECHNOLOGIES OF SCIENTIFIC SEARCH

    Directory of Open Access Journals (Sweden)

    V. M. Коleshko

    2008-01-01

    Full Text Available The main peculiar feature of an intellectual system orientated to formulation of original scientific hypothesis, non-trivial technical solutions is an initial target ambiguity of creative search. Process concerning creation of new knowledge in such system presuppose chaotic steps directed on hypothesis synthesis and their improvement, cancellation of non-productive searching methods and advancement of new scientific theories. Formation of new knowledge which generally has random character at the initial stage gradually becomes more ordered, motivated to obtain a concrete result due to development of searching process. Both components of the intellectual medium (a human being and a machine have so to speak an equilibrium in their actions, actively interacting and supplementing each other in the most creative procedures of hypothesis synthesis. Role difference resides in that a computer provides its formal logical and information resource for solution selection, and a researcher is assigned to carry out an additional task that is to take decisions about correctness of scientific hypothesis

  9. An Effort to Improve Uranium Foil Target Fabrication Technology by Single Roll Method

    Energy Technology Data Exchange (ETDEWEB)

    Sim, Moon Soo; Lee, Jong Hyeon [Chungnam National University, Daejeon (Korea, Republic of); Kim, Chang Kyu [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2012-05-15

    Technetium-99({sup 99m}Tc) is the most commonly used radioisotope in nuclear medicine for diagnostic procedures. It is produced from the decay of its parent Mo-99, which is sent to the hospital or clinic in the form of a generator. Recently, all of the major providers of Mo-99 have used high-enrichment uranium (HEU) as a target material in a research and test reactor. As a part of a nonproliferation effort, the RERTR program has investigated the production of the fission isotope Mo-99 using low-enrichment uranium(LEU) instead of HEU since 1993, a parent nuclide of {sup 99m}Tc , which is a major isotope for a medical diagnosis. As uranium foils have been produced by the conventional method on a laboratory scale by a repetitive hot-rolling method with significant problems in foil quality, productivity and economic efficiency, attention has shifted to the planar flow casting(PFC) method. In KAERI, many experiments are performed using depleted uranium(DU).

  10. Role of Bioreactor Technology in Tissue Engineering for Clinical Use and Therapeutic Target Design

    Directory of Open Access Journals (Sweden)

    Clare Selden

    2018-04-01

    Full Text Available Micro and small bioreactors are well described for use in bioprocess development in pre-production manufacture, using ultra-scale down and microfluidic methodology. However, the use of bioreactors to understand normal and pathophysiology by definition must be very different, and the constraints of the physiological environment influence such bioreactor design. This review considers the key elements necessary to enable bioreactors to address three main areas associated with biological systems. All entail recreation of the in vivo cell niche as faithfully as possible, so that they may be used to study molecular and cellular changes in normal physiology, with a view to creating tissue-engineered grafts for clinical use; understanding the pathophysiology of disease at the molecular level; defining possible therapeutic targets; and enabling appropriate pharmaceutical testing on a truly representative organoid, thus enabling better drug design, and simultaneously creating the potential to reduce the numbers of animals in research. The premise explored is that not only cellular signalling cues, but also mechano-transduction from mechanical cues, play an important role.

  11. Solubility of helium in mercury for bubbling technology of the spallation neutron mercury target

    International Nuclear Information System (INIS)

    Hasegawa, S.; Naoe, T.; Futakawa, M.

    2010-01-01

    The pitting damage of mercury target container that originates in the pressure wave excited by the proton beam incidence becomes a large problem to reach the high-power neutron source in JSNS and SNS. The lifetime of mercury container is decreased remarkably by the pitting damage. As one of solutions, the pressure wave is mitigated by injecting the helium micro bubbles in mercury. In order to inject the helium micro bubbles into mercury, it is important to understand the characteristic of micro bubbles in mercury. The solubility of mercury-helium system is a key factor to decide bubbling conditions, because the disappearance behavior, i.e. the lifetime of micro bubbles, depends on the solubility. In addition, the bubble generation method is affected by it. Moreover, the experimental data related to the solubility of helium in mercury hardly exist. In this work, the solubility was obtained experimentally by measuring precisely the pressure drop of the gas that is facing to mercury surface. The pressure drop was attributed to the helium dissolution into mercury. Based on the measured solubility, the lifetime of micro bubbles and the method of the bubble generation is estimated using the solubility data.

  12. Exploration and reservoir characterization; Technology Target Areas; TTA2 - Exploration and reservoir characterisation

    Energy Technology Data Exchange (ETDEWEB)

    2008-07-01

    In future, research within exploration and reservoir characterization will play an even more important role for Norway since resources are decreasing and new challenges like deep sea, harsh environment and last but not least environmental issues have to be considered. There are two major fields which have to be addressed within exploration and reservoir characterization: First, replacement of reserves by new discoveries and ultimate field recoveries in mature basins at the Norwegian Continental shelf, e.g. at the Halten Terrace has to be addressed. A wealth of data exists in the more mature areas. Interdisciplinary integration is a key feature of reservoir characterization, where available data and specialist knowledge need to be combined into a consistent reservoir description. A systematic approach for handling both uncertainties in data sources and uncertainties in basic models is needed. Fast simulation techniques are necessary to generate models spanning the event space, covering both underground based and model-based uncertainties. Second, exploration in frontier areas like the Barents Sea region and the deeper Voering Basin has to be addressed. The scarcity of wells in these frontier areas leads to uncertainties in the geological understanding. Basin- and depositional modelling are essential for predicting where source rocks and reservoir rocks are deposited, and if, when and which hydrocarbons are generated and trapped. Predictive models and improved process understanding is therefore crucial to meet these issues. Especially the challenges related to the salt deposits e.g. sub-salt/sub-basalt reservoir definitions in the Nordkapp Basin demands up-front research and technology developments. TTA2 stresses the need to focus on the development of new talents. We also see a strong need to push cooperation as far as possible in the present competitive environment. Projects that may require a substantial financial commitment have been identified. The following

  13. Improving EEG signal peak detection using feature weight learning ...

    Indian Academy of Sciences (India)

    Asrul Adam

    4 School of Psychology and Counseling, Queensland University of Technology, Brisbane 4000, Australia. 5 QIMR ... The groups of Acir et al .... difference between the peak and the floating mean, which is ..... Thus, the individual features were.

  14. Research on Methods of High Coherent Target Extraction in Urban Area Based on Psinsar Technology

    Science.gov (United States)

    Li, N.; Wu, J.

    2018-04-01

    PSInSAR technology has been widely applied in ground deformation monitoring. Accurate identification of Persistent Scatterers (PS) is key to the success of PSInSAR data processing. In this paper, the theoretic models and specific algorithms of PS point extraction methods are summarized and the characteristics and applicable conditions of each method, such as Coherence Coefficient Threshold method, Amplitude Threshold method, Dispersion of Amplitude method, Dispersion of Intensity method, are analyzed. Based on the merits and demerits of different methods, an improved method for PS point extraction in urban area is proposed, that uses simultaneously backscattering characteristic, amplitude and phase stability to find PS point in all pixels. Shanghai city is chosen as an example area for checking the improvements of the new method. The results show that the PS points extracted by the new method have high quality, high stability and meet the strong scattering characteristics. Based on these high quality PS points, the deformation rate along the line-of-sight (LOS) in the central urban area of Shanghai is obtained by using 35 COSMO-SkyMed X-band SAR images acquired from 2008 to 2010 and it varies from -14.6 mm/year to 4.9 mm/year. There is a large sedimentation funnel in the cross boundary of Hongkou and Yangpu district with a maximum sedimentation rate of more than 14 mm per year. The obtained ground subsidence rates are also compared with the result of spirit leveling and show good consistent. Our new method for PS point extraction is more reasonable, and can improve the accuracy of the obtained deformation results.

  15. Peak Oil and other threatening peaks-Chimeras without substance

    International Nuclear Information System (INIS)

    Radetzki, Marian

    2010-01-01

    The Peak Oil movement has widely spread its message about an impending peak in global oil production, caused by an inadequate resource base. On closer scrutiny, the underlying analysis is inconsistent, void of a theoretical foundation and without support in empirical observations. Global oil resources are huge and expanding, and pose no threat to continuing output growth within an extended time horizon. In contrast, temporary or prolonged supply crunches are indeed plausible, even likely, on account of growing resource nationalism denying access to efficient exploitation of the existing resource wealth.

  16. Electricity Portfolio Management: Optimal Peak / Off-Peak Allocations

    OpenAIRE

    Huisman, Ronald; Mahieu, Ronald; Schlichter, Felix

    2007-01-01

    textabstractElectricity purchasers manage a portfolio of contracts in order to purchase the expected future electricity consumption profile of a company or a pool of clients. This paper proposes a mean-variance framework to address the concept of structuring the portfolio and focuses on how to allocate optimal positions in peak and off-peak forward contracts. It is shown that the optimal allocations are based on the difference in risk premiums per unit of day-ahead risk as a measure of relati...

  17. Ultrasonic Transducer Peak-to-Peak Optical Measurement

    Directory of Open Access Journals (Sweden)

    Pavel Skarvada

    2012-01-01

    Full Text Available Possible optical setups for measurement of the peak-to-peak value of an ultrasonic transducer are described in this work. The Michelson interferometer with the calibrated nanopositioner in reference path and laser Doppler vibrometer were used for the basic measurement of vibration displacement. Langevin type of ultrasonic transducer is used for the purposes of Electro-Ultrasonic Nonlinear Spectroscopy (EUNS. Parameters of produced mechanical vibration have to been well known for EUNS. Moreover, a monitoring of mechanical vibration frequency shift with a mass load and sample-transducer coupling is important for EUNS measurement.

  18. Chinese emissions peak: Not when, but how

    International Nuclear Information System (INIS)

    Spencer, Thomas; Colombier, Michel; Wang, Xin; Sartor, Oliver; Waisman, Henri

    2016-07-01

    It seems highly likely that China will overachieve its 2020 and 2030 targets, and peak its emissions before 2030 and possibly at a lower level than often assumed. This paper argues that the debate on the timing of the peak is misplaced: what matters is not when by why. For the peak to be seen as a harbinger of deep transformation, it needs to be based on significant macro-economic reform and restructuring, with attendant improvement in energy intensity. The Chinese economic model has been extraordinarily investment and resource intensive, and has driven the growth in GHG emissions. That model is no longer economically or environmentally sustainable. Therefore Chinese policy-makers are faced with a trade-off between slower short-term growth and economic reform, versus supporting short-term growth but slowing economic reform. The outcome will be crucial for the transition to a low-carbon economy. Overall, the 13. FYP (2016-2020) gives the impression of a cautious reflection of the new normal paradigm on the economic front, and a somewhat conservative translation of this shift into the energy and climate targets. Nonetheless, the 13. FYP targets set China well on the way to overachieving its 2020 pledge undertaken at COP15 in Copenhagen, and to potentially overachieving its INDC. It thus seems likely that China will achieve its emissions peak before 2030. However, the crucial question is not when China peaks, but whether the underlying transformation of the Chinese economy and energy system lays the basis for deep decarbonization thereafter. Thorough assessments of the implications of the 'new normal' for Chinese emissions and energy system trajectories, taking into account the link with the Chinese macro-economy, are needed. Scenarios provide a useful framework and should focus on a number of short-term uncertainties. Most energy system and emissions scenarios published today assume a continuity of trends between 2010-2015 and 2015-2020, which is at odds with clear

  19. Peaking-factor of PWR

    International Nuclear Information System (INIS)

    Morioka, Noboru; Kato, Yasuji; Yokoi, M.

    1975-01-01

    Output peaking factor often plays an important role in the safety and operation of nuclear reactors. The meaning of the peaking factor of PWRs is categorized into two features or the peaking factor in core (FQ-core) and the peaking factor on the basis of accident analysis (or FQ-limit). FQ-core is the actual peaking factor realized in nuclear core at the time of normal operation, and FQ-limit should be evaluated from loss of coolant accident and other abnormal conditions. If FQ-core is lower than FQ-limit, the reactor may be operated at full load, but if FQ-core is larger than FQ-limit, reactor output should be controlled lower than FQ-limit. FQ-core has two kinds of values, or the one on the basis of nuclear design, and the other actually measured in reactor operation. The first FQ-core should be named as FQ-core-design and the latter as FQ-core-measured. The numerical evaluation of FQ-core-design is as follows; FQ-core-design of three-dimensions is synthesized with FQ-core horizontal value (X-Y) and FQ-core vertical value, the former one is calculated with ASSY-CORE code, and the latter one with one dimensional diffusion code. For the evaluation of FQ-core-measured, on-site data observation from nuclear reactor instrumentation or off-site data observation is used. (Iwase, T.)

  20. How to use your peak flow meter

    Science.gov (United States)

    ... meter - how to use; Asthma - peak flow meter; Reactive airway disease - peak flow meter; Bronchial asthma - peak ... 2014:chap 55. National Asthma Education and Prevention Program website. How to use a peak flow meter. ...

  1. Young drivers' engagement with social interactive technology on their smartphone: Critical beliefs to target in public education messages.

    Science.gov (United States)

    Gauld, Cassandra S; Lewis, Ioni M; White, Katherine M; Watson, Barry

    2016-11-01

    The current study forms part of a larger study based on the Step Approach to Message Design and Testing (SatMDT), a new and innovative framework designed to guide the development and evaluation of health communication messages, including road safety messages. This four step framework is based on several theories, including the Theory of Planned Behaviour. The current study followed steps one and two of the SatMDT framework and utilised a quantitative survey to validate salient beliefs (behavioural, normative, and control) about initiating, monitoring/reading, and responding to social interactive technology on smartphones by N=114 (88F, 26M) young drivers aged 17-25 years. These beliefs had been elicited in a prior in-depth qualitative study. A subsequent critical beliefs analysis identified seven beliefs as potential targets for public education messages, including, 'slow-moving traffic' (control belief - facilitator) for both monitoring/reading and responding behaviours; 'feeling at ease that you had received an expected communication' (behavioural belief -advantage) for monitoring/reading behaviour; and 'friends/peers more likely to approve' (normative belief) for responding behaviour. Potential message content targeting these seven critical beliefs is discussed in accordance with the SatMDT. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. Peak effect in twinned superconductors

    International Nuclear Information System (INIS)

    Larkin, A.I.; Marchetti, M.C.; Vinokur, V.M.

    1995-01-01

    A sharp maximum in the critical current J c as a function of temperature just below the melting point of the Abrikosov flux lattice has recently been observed in both low- and high-temperature superconductors. This peak effect is strongest in twinned crystals for fields aligned with the twin planes. We propose that this peak signals the breakdown of the collective pinning regime and the crossover to strong pinning of single vortices on the twin boundaries. This crossover is very sharp and can account for the steep drop of the differential resistivity observed in experiments. copyright 1995 The American Physical Society

  3. Hubbert's Peak -- A Physicist's View

    Science.gov (United States)

    McDonald, Richard

    2011-04-01

    Oil, as used in agriculture and transportation, is the lifeblood of modern society. It is finite in quantity and will someday be exhausted. In 1956, Hubbert proposed a theory of resource production and applied it successfully to predict peak U.S. oil production in 1970. Bartlett extended this work in publications and lectures on the finite nature of oil and its production peak and depletion. Both Hubbert and Bartlett place peak world oil production at a similar time, essentially now. Central to these analyses are estimates of total ``oil in place'' obtained from engineering studies of oil reservoirs as this quantity determines the area under the Hubbert's Peak. Knowing the production history and the total oil in place allows us to make estimates of reserves, and therefore future oil availability. We will then examine reserves data for various countries, in particular OPEC countries, and see if these data tell us anything about the future availability of oil. Finally, we will comment on synthetic oil and the possibility of carbon-neutral synthetic oil for a sustainable future.

  4. Managing peak loads in energy grids: Comparative economic analysis

    International Nuclear Information System (INIS)

    Zhuk, A.; Zeigarnik, Yu.; Buzoverov, E.; Sheindlin, A.

    2016-01-01

    One of the key issues in modern energy technology is managing the imbalance between the generated power and the load, particularly during times of peak demand. The increasing use of renewable energy sources makes this problem even more acute. Various existing technologies, including stationary battery energy storage systems (BESS), can be employed to provide additional power during peak demand times. In the future, integration of on-board batteries of the growing fleet of electric vehicles (EV) and plug-in hybrid electric vehicles (PHEV) into the grid can provide power during peak demand hours (vehicle-to-grid, or V2G technology). This work provides cost estimates of managing peak energy demands using traditional technologies, such as maneuverable power plants, conventional hydroelectric, pumped storage plants and peaker generators, as well as BESS and V2G technologies. The derived estimates provide both per kWh and kW year of energy supplied to the grid. The analysis demonstrates that the use of battery storage is economically justified for short peak demand periods of <1 h. For longer durations, the most suitable technology remains the use of maneuverable steam gas power plants, gas turbine,reciprocating gas engine peaker generators, conventional hydroelectric, pumped storage plants. - Highlights: • Cost of managing peak energy demand employing different technologies are estimated. • Traditional technologies, stationary battery storage and V2G are compared. • Battery storage is economically justified for peak demand periods of <1 h. • V2G appears to have better efficiency than stationary battery storage in low voltage power grids.

  5. Gamma-Ray Peak Integration: Accuracy and Precision

    International Nuclear Information System (INIS)

    Richard M. Lindstrom

    2000-01-01

    The accuracy of singlet gamma-ray peak areas obtained by a peak analysis program is immaterial. If the same algorithm is used for sample measurement as for calibration and if the peak shapes are similar, then biases in the integration method cancel. Reproducibility is the only important issue. Even the uncertainty of the areas computed by the program is trivial because the true standard uncertainty can be experimentally assessed by repeated measurements of the same source. Reproducible peak integration was important in a recent standard reference material certification task. The primary tool used for spectrum analysis was SUM, a National Institute of Standards and Technology interactive program to sum peaks and subtract a linear background, using the same channels to integrate all 20 spectra. For comparison, this work examines other peak integration programs. Unlike some published comparisons of peak performance in which synthetic spectra were used, this experiment used spectra collected for a real (though exacting) analytical project, analyzed by conventional software used in routine ways. Because both components of the 559- to 564-keV doublet are from 76 As, they were integrated together with SUM. The other programs, however, deconvoluted the peaks. A sensitive test of the fitting algorithm is the ratio of reported peak areas. In almost all the cases, this ratio was much more variable than expected from the reported uncertainties reported by the program. Other comparisons to be reported indicate that peak integration is still an imperfect tool in the analysis of gamma-ray spectra

  6. Tim Peake and Britain's road to space

    CERN Document Server

    Seedhouse, Erik

    2017-01-01

    This book puts the reader in the flight suit of Britain’s first male astronaut, Tim Peake. It chronicles his life, along with the Principia mission and the down-to-the-last-bolt descriptions of life aboard the ISS, by way of the hurdles placed by the British government and the rigors of training at Russia’s Star City military base. In addition, this book discusses the learning curves required in astronaut and mission training and the complexity of the technologies required to launch an astronaut and keep them alive for months on end. This book underscores the fact that technology and training, unlike space, do not exist in a vacuum; complex technical systems, like the ISS, interact with the variables of human personality, and the cultural background of the astronauts. .

  7. SPANISH PEAKS PRIMITIVE AREA, MONTANA.

    Science.gov (United States)

    Calkins, James A.; Pattee, Eldon C.

    1984-01-01

    A mineral survey of the Spanish Peaks Primitive Area, Montana, disclosed a small low-grade deposit of demonstrated chromite and asbestos resources. The chances for discovery of additional chrome resources are uncertain and the area has little promise for the occurrence of other mineral or energy resources. A reevaluation, sampling at depth, and testing for possible extensions of the Table Mountain asbestos and chromium deposit should be undertaken in the light of recent interpretations regarding its geologic setting.

  8. Neurofeedback training for peak performance

    OpenAIRE

    Marek Graczyk; Maria Pąchalska; Artur Ziółkowski; Grzegorz Mańko; Beata Łukaszewska; Kazimierz Kochanowicz; Andrzej Mirski; Iurii D. Kropotov

    2014-01-01

    [b]aim[/b]. One of the applications of the Neurofeedback methodology is peak performance in sport. The protocols of the neurofeedback are usually based on an assessment of the spectral parameters of spontaneous EEG in resting state conditions. The aim of the paper was to study whether the intensive neurofeedback training of a well-functioning Olympic athlete who has lost his performance confidence after injury in sport, could change the brain functioning reflected in changes in spontaneou...

  9. Power peaking nuclear reliability factors

    International Nuclear Information System (INIS)

    Hassan, H.A.; Pegram, J.W.; Mays, C.W.; Romano, J.J.; Woods, J.J.; Warren, H.D.

    1977-11-01

    The Calculational Nuclear Reliability Factor (CNRF) assigned to the limiting power density calculated in reactor design has been determined. The CNRF is presented as a function of the relative power density of the fuel assembly and its radial local. In addition, the Measurement Nuclear Reliability Factor (MNRF) for the measured peak hot pellet power in the core has been evaluated. This MNRF is also presented as a function of the relative power density and radial local within the fuel assembly

  10. Evaluation of concurrent peak responses

    International Nuclear Information System (INIS)

    Wang, P.C.; Curreri, J.; Reich, M.

    1983-01-01

    This report deals with the problem of combining two or more concurrent responses which are induced by dynamic loads acting on nuclear power plant structures. Specifically, the acceptability of using the square root of the sum of the squares (SRSS) value of peak values as the combined response is investigated. Emphasis is placed on the establishment of a simplified criterion that is convenient and relatively easy to use by design engineers

  11. Finding two-dimensional peaks

    International Nuclear Information System (INIS)

    Silagadze, Z.K.

    2007-01-01

    Two-dimensional generalization of the original peak finding algorithm suggested earlier is given. The ideology of the algorithm emerged from the well-known quantum mechanical tunneling property which enables small bodies to penetrate through narrow potential barriers. We merge this 'quantum' ideology with the philosophy of Particle Swarm Optimization to get the global optimization algorithm which can be called Quantum Swarm Optimization. The functionality of the newborn algorithm is tested on some benchmark optimization problems

  12. Drivers of peak sales for pharmaceutical brands

    NARCIS (Netherlands)

    Fischer, Marc; Leeflang, Peter S. H.; Verhoef, Peter C.

    2010-01-01

    Peak sales are an important metric in the pharmaceutical industry. Specifically, managers are focused on the height-of-peak-sales and the time required achieving peak sales. We analyze how order of entry and quality affect the level of peak sales and the time-to-peak-sales of pharmaceutical brands.

  13. The efficacy of the supramolecular complexes of niclosamide obtained by mechanochemical technology and targeted delivery against cestode infection of animals.

    Science.gov (United States)

    Arkhipov, Ivan A; Sadov, Konstantin M; Limova, Yulia V; Sadova, Alexandra K; Varlamova, Anastasiya I; Khalikov, Salavat S; Dushkin, Alexandr V; Chistyachenko, Yulia S

    2017-11-15

    Niclosamide is an anthelmintic that is widely used to treat cestode infection of animals. The efficacy of the supramolecular complexes of niclosamide obtained by mechanochemical technology and targeted delivery was studied in hymenolepiosis of mice and monieziosis of sheep. The efficacy of new substances of niclosamide with polyvinylpyrrolidone polymer in different ratios (1:10; 1:5; 1:2) was determined by the results of helminthological necropsy of the small intestine of sheep and mice. Pre-treatment eggs per gram (EPG) were not significantly different (P>0.1) among groups. The controlled test was used to evaluate the efficacy. A high efficacy (>95% efficacy) of the supramolecular complexes of niclosamide with PVP (SCoNwPVP) was shown in different ratios (1:10; 1:5 and 1:2) at a dose of 20mg/kg of body weight at oral administration against Hymenolepis nana in mice and Moniezia expansa in sheep. Whereas the basic drug - substance of niclosamide was effective at a dose of 100mg/kg of b/w. No adverse effects of the drugs on animal health were detected during the study. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Feeling validated yet? A scoping review of the use of consumer-targeted wearable and mobile technology to measure and improve sleep.

    Science.gov (United States)

    Baron, Kelly Glazer; Duffecy, Jennifer; Berendsen, Mark A; Cheung Mason, Ivy; Lattie, Emily G; Manalo, Natalie C

    2017-12-20

    The objectives of this review were to evaluate the use of consumer-targeted wearable and mobile sleep monitoring technology, identify gaps in the literature and determine the potential for use in behavioral interventions. We undertook a scoping review of studies conducted in adult populations using consumer-targeted wearable technology or mobile devices designed to measure and/or improve sleep. After screening for inclusion/exclusion criteria, data were extracted from the articles by two co-authors. Articles included in the search were using wearable or mobile technology to estimate or evaluate sleep, published in English and conducted in adult populations. Our search returned 3897 articles and 43 met our inclusion criteria. Results indicated that the majority of studies focused on validating technology to measure sleep (n = 23) or were observational studies (n = 10). Few studies were used to identify sleep disorders (n = 2), evaluate response to interventions (n = 3) or deliver interventions (n = 5). In conclusion, the use of consumer-targeted wearable and mobile sleep monitoring technology has largely focused on validation of devices and applications compared with polysomnography (PSG) but opportunities exist for observational research and for delivery of behavioral interventions. Multidisciplinary research is needed to determine the uses of these technologies in interventions as well as the use in more diverse populations including sleep disorders and other patient populations. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. A 900 MHz RF energy harvesting system in 40 nm CMOS technology with efficiency peaking at 47% and higher than 30% over a 22dB wide input power range

    NARCIS (Netherlands)

    Wang, J.; Jiang, Y.; Dijkhuis, J.; Dolmans, G.; Gao, H.; Baltus, P.G.M.

    2017-01-01

    A 900 MHz RF energy harvesting system is proposed for a far-field wireless power transfer application. The topology of a single-stage CMOS rectifier loaded with an integrated boost DC-DC converter is implemented in a 40 nm CMOS technology. The co-design of a cross-coupled CMOS rectifier and an

  16. Improvements to science operations at Kitt Peak National Observatory

    Science.gov (United States)

    Bohannan, Bruce

    1998-07-01

    In recent years Kitt Peak National Observatory has undertaken a number of innovative projects to optimize science operations with the suite of telescopes we operate on Kitt Peak, Arizona. Changing scientific requirements and expectations of our users, evolving technology and declining budgets have motivated the changes. The operations improvements have included telescope performance enhancements--with the focus on the Mayall 4-m--modes of observing and scheduling, telescope control and observing systems, planning and communication, and data archiving.

  17. Economic effects of peak oil

    International Nuclear Information System (INIS)

    Lutz, Christian; Lehr, Ulrike; Wiebe, Kirsten S.

    2012-01-01

    Assuming that global oil production peaked, this paper uses scenario analysis to show the economic effects of a possible supply shortage and corresponding rise in oil prices in the next decade on different sectors in Germany and other major economies such as the US, Japan, China, the OPEC or Russia. Due to the price-inelasticity of oil demand the supply shortage leads to a sharp increase in oil prices in the second scenario, with high effects on GDP comparable to the magnitude of the global financial crises in 2008/09. Oil exporting countries benefit from high oil prices, whereas oil importing countries are negatively affected. Generally, the effects in the third scenario are significantly smaller than in the second, showing that energy efficiency measures and the switch to renewable energy sources decreases the countries' dependence on oil imports and hence reduces their vulnerability to oil price shocks on the world market. - Highlights: ► National and sectoral economic effects of peak oil until 2020 are modelled. ► The price elasticity of oil demand is low resulting in high price fluctuations. ► Oil shortage strongly affects transport and indirectly all other sectors. ► Global macroeconomic effects are comparable to the 2008/2009 crisis. ► Country effects depend on oil imports and productivity, and economic structures.

  18. National energy peak leveling program (NEPLP). Final report

    Energy Technology Data Exchange (ETDEWEB)

    None

    1977-12-01

    This three-volume report is responsive to the requirements of Contract E (04-3)-1152 to provide a detailed methodology, to include management, technology, and socio-economic aspects, of a voluntary community program of computer-assisted peak load leveling and energy conservation in commercial community facilities. The demonstration project established proof-of-concept in reducing the kW-demand peak by the unofficial goal of 10%, with concurrent kWh savings. This section of the three volume report is a final report appendix with information on the National Energy Peak Leveling Program (NEPLP).

  19. Clearing the fog of anticancer patents from 1993-2013: through an in-depth technology landscape & target analysis from pioneer research institutes and universities worldwide.

    Directory of Open Access Journals (Sweden)

    Ajay Dara

    Full Text Available BACKGROUND: In a search for an effective anticancer therapy the R&D units from leading universities and institutes reveal numerous technologies in the form of patent documents. The article addressed comparative anticancer patent landscape and technology assessment of Council of Scientific and Industrial Research (CSIR: India's largest R&D organisation with top twenty international public funded universities and institutes from eight different countries. METHODOLOGY/PRINCIPAL FINDINGS: The methodology include quantitative and qualitative assessment based on the bibliometric parameters and manual technology categorisation to understand the changing patent trends and recent novel technologies. The research finding analysed 25,254 patent documents from the year 1993 to 2013 and reported the insights of latest anticancer technologies and targets through categorisation studies at the level of drug discovery, development and treatment & diagnosis. The article has reported the technology correlation matrix of twelve secondary class technologies with 34 tertiary sub-class research area to identify the leading technologies and scope of future research through whitespaces analysis. In addition, the results have also addressed the target analysis, leading inventor, assignee, collaboration network, geographical distribution, patent trend analysis, citation maps and technology assessment with respect to international patent classification systems such as CPC, IPC and CPI codes. CONCLUSIONS/SIGNIFICANCE: The result suggested peptide technology as the dominating research area next to gene therapy, vaccine and medical preparation containing organic compounds. The Indian CSIR has ranked itself at seventh position among the top 20 universities. Globally, the anticancer research was focused in the area of genetics and immunology, whereas Indian CSIR reported more patents related to plant extract and organic preparation. The article provided a glimpse of two decade

  20. Clearing the fog of anticancer patents from 1993-2013: through an in-depth technology landscape & target analysis from pioneer research institutes and universities worldwide.

    Science.gov (United States)

    Dara, Ajay; Sangamwar, Abhay T

    2014-01-01

    In a search for an effective anticancer therapy the R&D units from leading universities and institutes reveal numerous technologies in the form of patent documents. The article addressed comparative anticancer patent landscape and technology assessment of Council of Scientific and Industrial Research (CSIR): India's largest R&D organisation with top twenty international public funded universities and institutes from eight different countries. The methodology include quantitative and qualitative assessment based on the bibliometric parameters and manual technology categorisation to understand the changing patent trends and recent novel technologies. The research finding analysed 25,254 patent documents from the year 1993 to 2013 and reported the insights of latest anticancer technologies and targets through categorisation studies at the level of drug discovery, development and treatment & diagnosis. The article has reported the technology correlation matrix of twelve secondary class technologies with 34 tertiary sub-class research area to identify the leading technologies and scope of future research through whitespaces analysis. In addition, the results have also addressed the target analysis, leading inventor, assignee, collaboration network, geographical distribution, patent trend analysis, citation maps and technology assessment with respect to international patent classification systems such as CPC, IPC and CPI codes. The result suggested peptide technology as the dominating research area next to gene therapy, vaccine and medical preparation containing organic compounds. The Indian CSIR has ranked itself at seventh position among the top 20 universities. Globally, the anticancer research was focused in the area of genetics and immunology, whereas Indian CSIR reported more patents related to plant extract and organic preparation. The article provided a glimpse of two decade anticancer scenario with respect to top public funded universities worldwide.

  1. Clearing the Fog of Anticancer Patents from 1993–2013: Through an In-Depth Technology Landscape & Target Analysis from Pioneer Research Institutes and Universities Worldwide

    Science.gov (United States)

    Dara, Ajay; Sangamwar, Abhay T.

    2014-01-01

    Background In a search for an effective anticancer therapy the R&D units from leading universities and institutes reveal numerous technologies in the form of patent documents. The article addressed comparative anticancer patent landscape and technology assessment of Council of Scientific and Industrial Research (CSIR): India’s largest R&D organisation with top twenty international public funded universities and institutes from eight different countries. Methodology/Principal Findings The methodology include quantitative and qualitative assessment based on the bibliometric parameters and manual technology categorisation to understand the changing patent trends and recent novel technologies. The research finding analysed 25,254 patent documents from the year 1993 to 2013 and reported the insights of latest anticancer technologies and targets through categorisation studies at the level of drug discovery, development and treatment & diagnosis. The article has reported the technology correlation matrix of twelve secondary class technologies with 34 tertiary sub-class research area to identify the leading technologies and scope of future research through whitespaces analysis. In addition, the results have also addressed the target analysis, leading inventor, assignee, collaboration network, geographical distribution, patent trend analysis, citation maps and technology assessment with respect to international patent classification systems such as CPC, IPC and CPI codes. Conclusions/Significance The result suggested peptide technology as the dominating research area next to gene therapy, vaccine and medical preparation containing organic compounds. The Indian CSIR has ranked itself at seventh position among the top 20 universities. Globally, the anticancer research was focused in the area of genetics and immunology, whereas Indian CSIR reported more patents related to plant extract and organic preparation. The article provided a glimpse of two decade anticancer scenario

  2. National energy peak leveling program (NEPLP). Final report

    Energy Technology Data Exchange (ETDEWEB)

    None

    1977-12-01

    This three-volume report is responsive to the requirements of contract E (04-3)-1152 to provide a detailed methodology, to include management, technology, and socio-economic aspects, of a voluntary community program for computer-assisted peak load leveling and energy conservation in commercial community facilities. The demonstration project established proof-of-concept in reducing the kW-demand peak by the unofficial goal of 10%, with concurrent kWh savings. The report consists of the following three volumes: Volume I: management overview; Volume II: methodology and technology; and Volume III; appendices.

  3. Establishment of peak bone mass.

    Science.gov (United States)

    Mora, Stefano; Gilsanz, Vicente

    2003-03-01

    Among the main areas of progress in osteoporosis research during the last decade or so are the general recognition that this condition, which is the cause of so much pain in the elderly population, has its antecedents in childhood and the identification of the structural basis accounting for much of the differences in bone strength among humans. Nevertheless, current understanding of the bone mineral accrual process is far from complete. The search for genes that regulate bone mass acquisition is ongoing, and current results are not sufficient to identify subjects at risk. However, there is solid evidence that BMD measurements can be helpful for the selection of subjects that presumably would benefit from preventive interventions. The questions regarding the type of preventive interventions, their magnitude, and duration remain unanswered. Carefully designed controlled trials are needed. Nevertheless, previous experience indicates that weight-bearing activity and possibly calcium supplements are beneficial if they are begun during childhood and preferably before the onset of puberty. Modification of unhealthy lifestyles and increments in exercise or calcium assumption are logical interventions that should be implemented to improve bone mass gains in all children and adolescents who are at risk of failing to achieve an optimal peak bone mass.

  4. Neurofeedback training for peak performance

    Directory of Open Access Journals (Sweden)

    Marek Graczyk

    2014-11-01

    Full Text Available [b]aim[/b]. One of the applications of the Neurofeedback methodology is peak performance in sport. The protocols of the neurofeedback are usually based on an assessment of the spectral parameters of spontaneous EEG in resting state conditions. The aim of the paper was to study whether the intensive neurofeedback training of a well-functioning Olympic athlete who has lost his performance confidence after injury in sport, could change the brain functioning reflected in changes in spontaneous EEG and event related potentials (ERPs. [b]case study[/b]. The case is presented of an Olympic athlete who has lost his performance confidence after injury in sport. He wanted to resume his activities by means of neurofeedback training. His QEEG/ERP parameters were assessed before and after 4 intensive sessions of neurotherapy. Dramatic and statistically significant changes that could not be explained by error measurement were observed in the patient. [b]conclusion[/b]. Neurofeedback training in the subject under study increased the amplitude of the monitoring component of ERPs generated in the anterior cingulate cortex, accompanied by an increase in beta activity over the medial prefrontal cortex. Taking these changes together, it can be concluded that that even a few sessions of neurofeedback in a high performance brain can significantly activate the prefrontal cortical areas associated with increasing confidence in sport performance.

  5. Reactor power peaking information display

    International Nuclear Information System (INIS)

    Book, T.L.; Kochendarfer, R.A.

    1986-01-01

    This patent describes a system for monitoring operating conditions within a nuclear reactor. The system consists of a method for measuring the operating parameters within the nuclear reactor, including the position of axial power shaping rods and regulating control rod. It also includes a method for determining from the operating parameters the operating limits before a power peaking condition exists within the nuclear reactor, and a method for displaying the operating limits which consists of a visual display permitting the continuous monitoring of the operating conditions within the nuclear reactor as a graph of the shaping rod position vs the regulating rod position having a permissible area and a restricted area. The permissible area is further divided into a recommended operating area for steady state operation and a cursor located on the graph to indicate the present operating condition of the nuclear reactor to allow an operator to view any need for corrective action based on the movement of the cursor out of the recommended operating area and to take any corrective transient action within the permissible area

  6. Neurofeedback training for peak performance.

    Science.gov (United States)

    Graczyk, Marek; Pąchalska, Maria; Ziółkowski, Artur; Mańko, Grzegorz; Łukaszewska, Beata; Kochanowicz, Kazimierz; Mirski, Andrzej; Kropotov, Iurii D

    2014-01-01

    One of the applications of the Neurofeedback methodology is peak performance in sport. The protocols of the neurofeedback are usually based on an assessment of the spectral parameters of spontaneous EEG in resting state conditions. The aim of the paper was to study whether the intensive neurofeedback training of a well-functioning Olympic athlete who has lost his performance confidence after injury in sport, could change the brain functioning reflected in changes in spontaneous EEG and event related potentials (ERPs). The case is presented of an Olympic athlete who has lost his performance confidence after injury in sport. He wanted to resume his activities by means of neurofeedback training. His QEEG/ERP parameters were assessed before and after 4 intensive sessions of neurotherapy. Dramatic and statistically significant changes that could not be explained by error measurement were observed in the patient. Neurofeedback training in the subject under study increased the amplitude of the monitoring component of ERPs generated in the anterior cingulate cortex, accompanied by an increase in beta activity over the medial prefrontal cortex. Taking these changes together, it can be concluded that that even a few sessions of neurofeedback in a high performance brain can significantly activate the prefrontal cortical areas associated with increasing confidence in sport performance.

  7. Sequence based polymorphic (SBP marker technology for targeted genomic regions: its application in generating a molecular map of the Arabidopsis thaliana genome

    Directory of Open Access Journals (Sweden)

    Sahu Binod B

    2012-01-01

    Full Text Available Abstract Background Molecular markers facilitate both genotype identification, essential for modern animal and plant breeding, and the isolation of genes based on their map positions. Advancements in sequencing technology have made possible the identification of single nucleotide polymorphisms (SNPs for any genomic regions. Here a sequence based polymorphic (SBP marker technology for generating molecular markers for targeted genomic regions in Arabidopsis is described. Results A ~3X genome coverage sequence of the Arabidopsis thaliana ecotype, Niederzenz (Nd-0 was obtained by applying Illumina's sequencing by synthesis (Solexa technology. Comparison of the Nd-0 genome sequence with the assembled Columbia-0 (Col-0 genome sequence identified putative single nucleotide polymorphisms (SNPs throughout the entire genome. Multiple 75 base pair Nd-0 sequence reads containing SNPs and originating from individual genomic DNA molecules were the basis for developing co-dominant SBP markers. SNPs containing Col-0 sequences, supported by transcript sequences or sequences from multiple BAC clones, were compared to the respective Nd-0 sequences to identify possible restriction endonuclease enzyme site variations. Small amplicons, PCR amplified from both ecotypes, were digested with suitable restriction enzymes and resolved on a gel to reveal the sequence based polymorphisms. By applying this technology, 21 SBP markers for the marker poor regions of the Arabidopsis map representing polymorphisms between Col-0 and Nd-0 ecotypes were generated. Conclusions The SBP marker technology described here allowed the development of molecular markers for targeted genomic regions of Arabidopsis. It should facilitate isolation of co-dominant molecular markers for targeted genomic regions of any animal or plant species, whose genomic sequences have been assembled. This technology will particularly facilitate the development of high density molecular marker maps, essential for

  8. A Bioinformatic Pipeline for Monitoring of the Mutational Stability of Viral Drug Targets with Deep-Sequencing Technology.

    Science.gov (United States)

    Kravatsky, Yuri; Chechetkin, Vladimir; Fedoseeva, Daria; Gorbacheva, Maria; Kravatskaya, Galina; Kretova, Olga; Tchurikov, Nickolai

    2017-11-23

    The efficient development of antiviral drugs, including efficient antiviral small interfering RNAs (siRNAs), requires continuous monitoring of the strict correspondence between a drug and the related highly variable viral DNA/RNA target(s). Deep sequencing is able to provide an assessment of both the general target conservation and the frequency of particular mutations in the different target sites. The aim of this study was to develop a reliable bioinformatic pipeline for the analysis of millions of short, deep sequencing reads corresponding to selected highly variable viral sequences that are drug target(s). The suggested bioinformatic pipeline combines the available programs and the ad hoc scripts based on an original algorithm of the search for the conserved targets in the deep sequencing data. We also present the statistical criteria for the threshold of reliable mutation detection and for the assessment of variations between corresponding data sets. These criteria are robust against the possible sequencing errors in the reads. As an example, the bioinformatic pipeline is applied to the study of the conservation of RNA interference (RNAi) targets in human immunodeficiency virus 1 (HIV-1) subtype A. The developed pipeline is freely available to download at the website http://virmut.eimb.ru/. Brief comments and comparisons between VirMut and other pipelines are also presented.

  9. A Bioinformatic Pipeline for Monitoring of the Mutational Stability of Viral Drug Targets with Deep-Sequencing Technology

    Directory of Open Access Journals (Sweden)

    Yuri Kravatsky

    2017-11-01

    Full Text Available The efficient development of antiviral drugs, including efficient antiviral small interfering RNAs (siRNAs, requires continuous monitoring of the strict correspondence between a drug and the related highly variable viral DNA/RNA target(s. Deep sequencing is able to provide an assessment of both the general target conservation and the frequency of particular mutations in the different target sites. The aim of this study was to develop a reliable bioinformatic pipeline for the analysis of millions of short, deep sequencing reads corresponding to selected highly variable viral sequences that are drug target(s. The suggested bioinformatic pipeline combines the available programs and the ad hoc scripts based on an original algorithm of the search for the conserved targets in the deep sequencing data. We also present the statistical criteria for the threshold of reliable mutation detection and for the assessment of variations between corresponding data sets. These criteria are robust against the possible sequencing errors in the reads. As an example, the bioinformatic pipeline is applied to the study of the conservation of RNA interference (RNAi targets in human immunodeficiency virus 1 (HIV-1 subtype A. The developed pipeline is freely available to download at the website http://virmut.eimb.ru/. Brief comments and comparisons between VirMut and other pipelines are also presented.

  10. Inertial confinement fusion target component fabrication and technology development support: Annual report, October 1, 1997 - September 30, 1998

    International Nuclear Information System (INIS)

    Gibson, J.

    1998-12-01

    During this period, General Atomics (GA) and their partner Schafer Corporation were assigned 17 formal tasks in support of the Inertial Confinement Fusion (ICF) program and its five laboratories. A portion of the effort on these tasks included providing direct ''On-site Support'' at Lawrence Livermore National Laboratory (LLNL), Los Alamos National Laboratory (LANL), and Sandia National Laboratory Albuquerque (SNLA). They fabricated and delivered over 1,200 hohlraum mandrels and numerous other micromachined components to LLNL, LANL, and SNLA. They produced more than 1,300 glass and plastic target capsules for LLNL, LANL, SNLA, and the University of Rochester/Laboratory for Laser Energetics (UR/LLE). They also delivered nearly 2,000 various target foils and films for Naval Research Lab (NRL) and UR/LLE in FY98. This report describes these target fabrication activities and the target fabrication and characterization development activities that made the deliveries possible. During FY98, great progress was made by the GA/Schafer-UR/LLE-LANL team in the design, procurement, installation, and testing of the OMEGA Cryogenic Target System (OCTS) that will field cryogenic targets on OMEGA. The design phase was concluded for all components of the OCTS and all major components were procured and nearly all were fabricated. Many of the components were assembled and tested, and some have been shipped to UR/LLE. The ICF program is anticipating experiments at the OMEGA laser and the National Ignition Facility (NIF) which will require targets containing cryogenic layered D 2 or deuterium-tritium (DT) fuel. They are part of the National Cryogenic Target Program and support experiments at LLNL and LANL to generate and characterize cryogenic layers for these targets. They also contributed cryogenic support and developed concepts for NIF cryogenic targets. This report summarizes and documents the technical progress made on these tasks

  11. Inertial confinement fusion target component fabrication and technology development support: Annual report, October 1, 1997--September 30, 1998

    Energy Technology Data Exchange (ETDEWEB)

    Gibson, J. [ed.

    1998-12-01

    During this period, General Atomics (GA) and their partner Schafer Corporation were assigned 17 formal tasks in support of the Inertial Confinement Fusion (ICF) program and its five laboratories. A portion of the effort on these tasks included providing direct ``On-site Support`` at Lawrence Livermore National Laboratory (LLNL), Los Alamos National Laboratory (LANL), and Sandia National Laboratory Albuquerque (SNLA). They fabricated and delivered over 1,200 hohlraum mandrels and numerous other micromachined components to LLNL, LANL, and SNLA. They produced more than 1,300 glass and plastic target capsules for LLNL, LANL, SNLA, and the University of Rochester/Laboratory for Laser Energetics (UR/LLE). They also delivered nearly 2,000 various target foils and films for Naval Research Lab (NRL) and UR/LLE in FY98. This report describes these target fabrication activities and the target fabrication and characterization development activities that made the deliveries possible. During FY98, great progress was made by the GA/Schafer-UR/LLE-LANL team in the design, procurement, installation, and testing of the OMEGA Cryogenic Target System (OCTS) that will field cryogenic targets on OMEGA. The design phase was concluded for all components of the OCTS and all major components were procured and nearly all were fabricated. Many of the components were assembled and tested, and some have been shipped to UR/LLE. The ICF program is anticipating experiments at the OMEGA laser and the National Ignition Facility (NIF) which will require targets containing cryogenic layered D{sub 2} or deuterium-tritium (DT) fuel. They are part of the National Cryogenic Target Program and support experiments at LLNL and LANL to generate and characterize cryogenic layers for these targets. They also contributed cryogenic support and developed concepts for NIF cryogenic targets. This report summarizes and documents the technical progress made on these tasks.

  12. Inertial confinement fusion target component fabrication and technology development support. Annual report, October 1, 1996 - September 30, 1997

    International Nuclear Information System (INIS)

    Gibson, J.

    1998-03-01

    This report documents the technical activities of the period October 1, 1996 through September 30, 1997. During this period, GA and their partner Schafer Corporation were assigned 13 formal tasks in support of the ICF program and its five laboratories. A portion of the effort on these tasks included providing direct open-quotes Onsite Supportclose quotes at Lawrence Livermore National Laboratory (LLNL), Los Alamos National Laboratory (LANL), and Sandia National Laboratory Albuquerque (SNLA). Over 700 gold-plated hohlraum mandrels were fabricated and delivered to LLNL, LANL and SNLA. More than 1600 glass and plastic target capsules were produced for LLNL, LANL, SNLA and University of Rochester/Laboratory for Laser Energetics (UR/LLE). Nearly 2000 various target foils and films were delivered for Naval Research Lab (NRL) and UR/LLE in FY97. This report describes these target fabrication activities and the target fabrication and characterization development activities that made the deliveries possible. The ICF program is anticipating experiments at the OMEGA laser and the National Ignition Facility (NIF) which will require targets containing cryogenic layered D 2 or deuterium-tritium (DT) fuel. This project is part of the National Cryogenic Target Program and support experiments at LLNL and LANL to generate and characterize cryogenic layers for these targets. During FY97, significant progress was made in the design and component testing of the OMEGA Cryogenic Target System that will field cryogenic targets on OMEGA. This included major design changes, reduction in equipment, and process simplifications. This report summarizes and documents the technical progress made on these tasks

  13. Inertial confinement fusion target component fabrication and technology development support. Annual report, October 1, 1996--September 30, 1997

    Energy Technology Data Exchange (ETDEWEB)

    Gibson, J. [ed.

    1998-03-01

    This report documents the technical activities of the period October 1, 1996 through September 30, 1997. During this period, GA and their partner Schafer Corporation were assigned 13 formal tasks in support of the ICF program and its five laboratories. A portion of the effort on these tasks included providing direct {open_quotes}Onsite Support{close_quotes} at Lawrence Livermore National Laboratory (LLNL), Los Alamos National Laboratory (LANL), and Sandia National Laboratory Albuquerque (SNLA). Over 700 gold-plated hohlraum mandrels were fabricated and delivered to LLNL, LANL and SNLA. More than 1600 glass and plastic target capsules were produced for LLNL, LANL, SNLA and University of Rochester/Laboratory for Laser Energetics (UR/LLE). Nearly 2000 various target foils and films were delivered for Naval Research Lab (NRL) and UR/LLE in FY97. This report describes these target fabrication activities and the target fabrication and characterization development activities that made the deliveries possible. The ICF program is anticipating experiments at the OMEGA laser and the National Ignition Facility (NIF) which will require targets containing cryogenic layered D{sub 2} or deuterium-tritium (DT) fuel. This project is part of the National Cryogenic Target Program and support experiments at LLNL and LANL to generate and characterize cryogenic layers for these targets. During FY97, significant progress was made in the design and component testing of the OMEGA Cryogenic Target System that will field cryogenic targets on OMEGA. This included major design changes, reduction in equipment, and process simplifications. This report summarizes and documents the technical progress made on these tasks.

  14. Nuclear cooperation targets global challenges. States back main pillars of the IAEA's work to strengthen nuclear safety, verification and technology transfer

    International Nuclear Information System (INIS)

    2000-01-01

    States meeting at the 44th IAEA General Conference in Vienna have set a challenging agenda for international nuclear cooperation into the 21st century that targets issues of global safety, security, and sustainable development. They adopted resolutions endorsing the Agency's programmes for strengthening activities under its three main pillars of work - nuclear verification, safety, and technology - that are closely linked to major challenges before the world. The document presents the main actions taken during the conference

  15. A 62GHz inductor-peaked rectifier with 7% efficiency

    NARCIS (Netherlands)

    Gao, H.; Matters - Kammerer, M.; Milosevic, D.; Roermund, van A.H.M.; Baltus, P.G.M.

    2013-01-01

    This paper presents the first 62 GHz fully onchip RF-DC rectifier in 65nm CMOS technology. The rectifier is the bottleneck in realizing on-chip wireless power receivers. In this paper, efficiency problems of the mm-wave rectifier are discussed and the inductor-peaked rectifier structure is proposed

  16. PolyaPeak: Detecting Transcription Factor Binding Sites from ChIP-seq Using Peak Shape Information

    Science.gov (United States)

    Wu, Hao; Ji, Hongkai

    2014-01-01

    ChIP-seq is a powerful technology for detecting genomic regions where a protein of interest interacts with DNA. ChIP-seq data for mapping transcription factor binding sites (TFBSs) have a characteristic pattern: around each binding site, sequence reads aligned to the forward and reverse strands of the reference genome form two separate peaks shifted away from each other, and the true binding site is located in between these two peaks. While it has been shown previously that the accuracy and resolution of binding site detection can be improved by modeling the pattern, efficient methods are unavailable to fully utilize that information in TFBS detection procedure. We present PolyaPeak, a new method to improve TFBS detection by incorporating the peak shape information. PolyaPeak describes peak shapes using a flexible Pólya model. The shapes are automatically learnt from the data using Minorization-Maximization (MM) algorithm, then integrated with the read count information via a hierarchical model to distinguish true binding sites from background noises. Extensive real data analyses show that PolyaPeak is capable of robustly improving TFBS detection compared with existing methods. An R package is freely available. PMID:24608116

  17. Inertial confinement fusion target component fabrication and technology development support. Annual report 10/1/98 through 9/30/99

    International Nuclear Information System (INIS)

    Gibson, Jane

    1999-01-01

    General Atomics (GA) has served as the Inertial Confinement Fusion (ICF) Target Component Fabrication and Technology Development Support contractor for the U.S. Department of Energy since December 30, 1990. This report documents the technical activities of the period October 1, 1998 through September 30, 1999. During this period, GA and our partner Schafer Corporation were assigned 17 formal tasks in support of the ICF program and its five laboratories. A portion of the effort on these tasks included providing direct ''Onsite Support'' at Lawrence Livermore National Laboratory (LLNL), Los Alamos National Laboratory (LANL), and Sandia National Laboratory (SNL). We fabricated and delivered over 1790 hohlraum mandrels and numerous other micromachined components to LLNL, LANL, and SNL. We produced more than 1380 glass and plastic target capsules over a wide range of sizes and designs (plus over 300 near target-quality capsules) for LLNL, LANL, SNL, and University of Rochester/Laboratory for Laser Energetic (UR/LLE). We also delivered various target foils and films for Naval Research Lab (NRL) and UWLLE in FY99. We fabricated a device to polish NIF-sized beryllium shells and prepared a laboratory for the safe operation of beryllium polishing activities. This report describes these target fabrication activities and the target fabrication and characterization development activities that made the deliveries possible. During FY99, the GA/Schafer portion of the GA/Schafer-UR/LLE-LANL team effort for design, procurement, installation, and testing of the OMEGA Cryogenic Target System (OCTS) that will field cryogenic targets on OMEGA was completed. All components of the OCTS were procured, fabricated, assembled, tested, and shipped to UR/LLE. Only minor documentation tasks remain to be done in FY00. The ICF program is anticipating experiments at the OMEGA laser and the National Ignition Facility (NIF) which will require targets containing cryogenic layered D2 or deuterium

  18. Targeted Nanoparticles for Image-guided Treatment of Triple Negative Breast Cancer: Clinical Significance and Technological Advances

    Science.gov (United States)

    Miller-Kleinhenz, Jasmine M.; Bozeman, Erica N.

    2015-01-01

    Effective treatment of triple negative breast cancer (TNBC) with its aggressive tumor biology, highly heterogeneous tumor cells, and poor prognosis requires an integrated therapeutic approach that addresses critical issues in cancer therapy. Multifunctional nanoparticles with the abilities of targeted drug delivery and non-invasive imaging for monitoring drug delivery and responses to therapy, such as theranostic nanoparticles, hold great promise towards the development of novel therapeutic approaches for the treatment of TNBC using a single therapeutic platform. The biological and pathological characteristics of TNBC provide insight into several potential molecular targets for current and future nanoparticle based therapeutics. Extensive tumor stroma, highly proliferative cells, and a high rate of drug-resistance are all barriers that must be appropriately addressed in order for these nanotherapeutic platforms to be effective. Utilization of the enhanced permeability and retention (EPR) effect coupled with active targeting of cell surface receptors expressed by TNBC cells, and tumor associated endothelial cells, stromal fibroblasts and macrophages is likely to overcome such barriers to facilitate more effective drug delivery. An in depth summary of current studies investigating targeted nanoparticles in preclinical TNBC mouse and human xenograft models is presented. This review aims to outline the current status of nanotherapeutic options for TNBC patients, identification of promising molecular targets, challenges associated with the development of targeted nanotherapeutics, the research done by our group as well as others and future perspectives on the nanomedicine field and ways to translate current preclinical studies into the clinic. PMID:25966677

  19. Targeted nanoparticles for image-guided treatment of triple-negative breast cancer: clinical significance and technological advances.

    Science.gov (United States)

    Miller-Kleinhenz, Jasmine M; Bozeman, Erica N; Yang, Lily

    2015-01-01

    Effective treatment of triple-negative breast cancer (TNBC) with its aggressive tumor biology, highly heterogeneous tumor cells, and poor prognosis requires an integrated therapeutic approach that addresses critical issues in cancer therapy. Multifunctional nanoparticles with the abilities of targeted drug delivery and noninvasive imaging for monitoring drug delivery and responses to therapy, such as theranostic nanoparticles, hold great promise toward the development of novel therapeutic approaches for the treatment of TNBC using a single therapeutic platform. The biological and pathological characteristics of TNBC provide insight into several potential molecular targets for current and future nanoparticle-based therapeutics. Extensive tumor stroma, highly proliferative cells, and a high rate of drug resistance are all barriers that must be appropriately addressed in order for these nanotherapeutic platforms to be effective. Utilization of the enhanced permeability and retention effect coupled with active targeting of cell surface receptors expressed by TNBC cells, and tumor-associated endothelial cells, stromal fibroblasts, and macrophages is likely to overcome such barriers to facilitate more effective drug delivery. An in-depth summary of current studies investigating targeted nanoparticles in preclinical TNBC mouse and human xenograft models is presented. This review aims to outline the current status of nanotherapeutic options for TNBC patients, identification of promising molecular targets, challenges associated with the development of targeted nanotherapeutics, the research done by our group as well as by others, and future perspectives on the nanomedicine field and ways to translate current preclinical studies into the clinic. © 2015 Wiley Periodicals, Inc.

  20. Development of fission Mo-99 production technology - A nuclear feasibility study on UN target for Mo-99 production in HANARO

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Myung Hyun; Kim, Woo Sik [Kyunghee University, Seoul (Korea)

    2000-03-01

    Nuclear target design satisfying all the constraints for fission moly production in HANARO was proposed in this project. The 'MCNP-ORIGEN' code system which was previously proposed for a design tool, was evaluated by the comparison with through the 'MCNP-Analytic Eq.' system. A characteristics of each chemical processing step were analysed and material balance was set up to evaluate the overall yield ratio of Mo-99 recovery. A parametric study was done for the optimum HEU target design. Tested parameters were target thickness, recoil-loss rate to the fuel thickness, target radius, cladding materials, thickness of irradiation guide tube, and barrier materials. Optimized HEU target design was proposed which satisfying the constraints and having high production yield. For a LEU target design using 19.7 w/o UN powder fuel, a parametric study was also done for the optimization of fuel thickness, powder packing density, mixture material volume ratio. 24 refs., 35 figs., 57 tabs. (Author)

  1. Explanation of the surface peak in charge integrated LEIS spectra

    CERN Document Server

    Draxler, M; Taglauer, E; Schmid, K; Gruber, R; Ermolov, S N; Bauer, P

    2003-01-01

    Low energy ion scattering is very surface sensitive if scattered ions are analyzed. By time-of-flight (TOF) techniques, also neutral and charge integrated spectra (ions plus neutrals) can be obtained, which yield information about deeper layers. In the literature, the observation of a more or less pronounced surface peak was reported for charge integrated spectra, the intensity of the surface peak being higher at low energies and for heavy projectiles. Aiming at a more profound physical understanding of this surface peak, we performed TOF-experiments and computer simulations for He projectiles and a copper target. Experiments were done in the range 1-9 keV for a scattering angle of 129 deg. . The simulation was performed using the MARLOWE code for the given experimental parameters and a polycrystalline target. At low energies, a pronounced surface peak was observed, which fades away at higher energies. This peak is quantitatively reproduced by the simulation, and corresponds to scattering from approx 2 atomic...

  2. Emissions Scenarios and Fossil-fuel Peaking

    Science.gov (United States)

    Brecha, R.

    2008-12-01

    Intergovernmental Panel on Climate Change (IPCC) emissions scenarios are based on detailed energy system models in which demographics, technology and economics are used to generate projections of future world energy consumption, and therefore, of greenhouse gas emissions. Built into the assumptions for these scenarios are estimates for ultimately recoverable resources of various fossil fuels. There is a growing chorus of critics who believe that the true extent of recoverable fossil resources is much smaller than the amounts taken as a baseline for the IPCC scenarios. In a climate optimist camp are those who contend that "peak oil" will lead to a switch to renewable energy sources, while others point out that high prices for oil caused by supply limitations could very well lead to a transition to liquid fuels that actually increase total carbon emissions. We examine a third scenario in which high energy prices, which are correlated with increasing infrastructure, exploration and development costs, conspire to limit the potential for making a switch to coal or natural gas for liquid fuels. In addition, the same increasing costs limit the potential for expansion of tar sand and shale oil recovery. In our qualitative model of the energy system, backed by data from short- and medium-term trends, we have a useful way to gain a sense of potential carbon emission bounds. A bound for 21st century emissions is investigated based on two assumptions: first, that extractable fossil-fuel resources follow the trends assumed by "peak oil" adherents, and second, that little is done in the way of climate mitigation policies. If resources, and perhaps more importantly, extraction rates, of fossil fuels are limited compared to assumptions in the emissions scenarios, a situation can arise in which emissions are supply-driven. However, we show that even in this "peak fossil-fuel" limit, carbon emissions are high enough to surpass 550 ppm or 2°C climate protection guardrails. Some

  3. A potential strategy to treat liver fibrosis : Drug targeting to hepatic stellate cells applying a novel linker technology

    NARCIS (Netherlands)

    Gonzalo Lázaro, Teresa

    2006-01-01

    Liver fibrosis is the 9th leading cause of death in the world. This chronic disease cannot be treated successfully with conventional antifibrotic and anti-inflammatory drugs currently on the market, because they either lack efficacy or cause too many side-effects. Targeting of antifibrotic agents to

  4. National energy peak leveling program (NEPLP). Final report

    Energy Technology Data Exchange (ETDEWEB)

    None

    1977-12-01

    This multisectioned three-Volume report is responsive to the requirements of Contract E (04-3)-1152 to provide a detailed methodology, to include management, technology, and socio-economic aspects, of a voluntary community program of computer-assisted peak load leveling and energy conservation in commercial community facilities. The demonstration project established proof-of-concept in reducing the kW-demand peak by the unofficial goal of 10%, with concurrent kWh savings. This section of volume III contains appendixes of information on load shedding determination, analysis, socio-economic study, contractual cross references, and definitions.

  5. Correlation Filter Learning Toward Peak Strength for Visual Tracking.

    Science.gov (United States)

    Sui, Yao; Wang, Guanghui; Zhang, Li

    2018-04-01

    This paper presents a novel visual tracking approach to correlation filter learning toward peak strength of correlation response. Previous methods leverage all features of the target and the immediate background to learn a correlation filter. Some features, however, may be distractive to tracking, like those from occlusion and local deformation, resulting in unstable tracking performance. This paper aims at solving this issue and proposes a novel algorithm to learn the correlation filter. The proposed approach, by imposing an elastic net constraint on the filter, can adaptively eliminate those distractive features in the correlation filtering. A new peak strength metric is proposed to measure the discriminative capability of the learned correlation filter. It is demonstrated that the proposed approach effectively strengthens the peak of the correlation response, leading to more discriminative performance than previous methods. Extensive experiments on a challenging visual tracking benchmark demonstrate that the proposed tracker outperforms most state-of-the-art methods.

  6. [Effect of image fusion technology of radioactive particles implantation before and after the planning target and dosimetry].

    Science.gov (United States)

    Jiang, Y L; Yu, J P; Sun, H T; Guo, F X; Ji, Z; Fan, J H; Zhang, L J; Li, X; Wang, J J

    2017-08-01

    Objective: To compare the post-implant target volumes and dosimetric evaluation with pre-plan, the gross tumor volume(GTV) by CT image fusion-based and the manual delineation of target volume in CT guided radioactive seeds implantation. Methods: A total of 10 patients treated under CT-guidance (125)I seed implantation during March 2016 to April 2016 were analyzed in Peking University Third Hospital.All patients underwent pre-operative CT simulation, pre-operative planning, implantation seeds, CT scanning after seed implantation and dosimetric evaluation of GTV.In every patient, post-implant target volumes were delineated by both two methods, and were divided into two groups. Group 1: image fusion pre-implantation simulation and post-operative CT image, then the contours of GTV were automatically performed by brachytherapy treatment planning system; Group 2: the contouring of the GTV on post-operative CT image were performed manually by three senior radiation oncologists independently. The average of three data was sets. Statistical analyses were performed using SPSS software, version 3.2.0. The paired t -test was used to compare the target volumes and D(90) parameters in two modality. Results: In Group 1, average volume of GTV in post-operation group was 12-167(73±56) cm(3). D(90) was 101-153 (142±19)Gy. In Group 2, they were 14-186(80±58)cm(3) and 96-146(122±16) Gy respectively. In both target volumes and D(90), there was no statistical difference between pre-operation and post-operation in Group 1.The D(90) was slightly lower than that of pre-plan group, but there was no statistical difference ( P =0.142); in Group 2, between pre-operation and post-operation group, there was a significant statistical difference in the GTV ( P =0.002). The difference of D(90) was similarly ( P manual delineation of target volume by maximum reduce the interference from artificial factor and metal artifacts. Further work and more cases are required in the future.

  7. Tribal Recommendations for Designing Culturally Appropriate Technology-Based Sexual Health Interventions Targeting Native Youth in the Pacific Northwest

    Science.gov (United States)

    Rushing, Stephanie Craig; Stephens, David

    2012-01-01

    Media technologies, including the Internet, cell phones, and video games, offer new avenues to reach Native youth on sensitive health topics. Project Red Talon, a sexually transmitted disease (STD)/HIV prevention project that serves the 43 federally recognized tribes in Oregon, Washington, and Idaho, used community-based participatory research…

  8. Alternative pathways to the 1.5 °C target reduce the need for negative emission technologies

    Science.gov (United States)

    van Vuuren, Detlef P.; Stehfest, Elke; Gernaat, David E. H. J.; van den Berg, Maarten; Bijl, David L.; de Boer, Harmen Sytze; Daioglou, Vassilis; Doelman, Jonathan C.; Edelenbosch, Oreane Y.; Harmsen, Mathijs; Hof, Andries F.; van Sluisveld, Mariësse A. E.

    2018-05-01

    Mitigation scenarios that achieve the ambitious targets included in the Paris Agreement typically rely on greenhouse gas emission reductions combined with net carbon dioxide removal (CDR) from the atmosphere, mostly accomplished through large-scale application of bioenergy with carbon capture and storage, and afforestation. However, CDR strategies face several difficulties such as reliance on underground CO2 storage and competition for land with food production and biodiversity protection. The question arises whether alternative deep mitigation pathways exist. Here, using an integrated assessment model, we explore the impact of alternative pathways that include lifestyle change, additional reduction of non-CO2 greenhouse gases and more rapid electrification of energy demand based on renewable energy. Although these alternatives also face specific difficulties, they are found to significantly reduce the need for CDR, but not fully eliminate it. The alternatives offer a means to diversify transition pathways to meet the Paris Agreement targets, while simultaneously benefiting other sustainability goals.

  9. Technology.

    Science.gov (United States)

    Online-Offline, 1998

    1998-01-01

    Focuses on technology, on advances in such areas as aeronautics, electronics, physics, the space sciences, as well as computers and the attendant progress in medicine, robotics, and artificial intelligence. Describes educational resources for elementary and middle school students, including Web sites, CD-ROMs and software, videotapes, books,…

  10. Design of a novel integration-deficient lentivector technology that incorporates genetic and posttranslational elements to target human dendritic cells.

    Science.gov (United States)

    Tareen, Semih U; Kelley-Clarke, Brenna; Nicolai, Christopher J; Cassiano, Linda A; Nelson, Lisa T; Slough, Megan M; Vin, Chintan D; Odegard, Jared M; Sloan, Derek D; Van Hoeven, Neal; Allen, James M; Dubensky, Thomas W; Robbins, Scott H

    2014-03-01

    As sentinels of the immune system, dendritic cells (DCs) play an essential role in regulating cellular immune responses. One of the main challenges of developing DC-targeted therapies includes the delivery of antigen to DCs in order to promote the activation of antigen-specific effector CD8 T cells. With the goal of creating antigen-directed immunotherapeutics that can be safely administered directly to patients, Immune Design has developed a platform of novel integration-deficient lentiviral vectors that target and deliver antigen-encoding nucleic acids to human DCs. This platform, termed ID-VP02, utilizes a novel genetic variant of a Sindbis virus envelope glycoprotein with posttranslational carbohydrate modifications in combination with Vpx, a SIVmac viral accessory protein, to achieve efficient targeting and transduction of human DCs. In addition, ID-VP02 incorporates safety features in its design that include two redundant mechanisms to render ID-VP02 integration-deficient. Here, we describe the characteristics that allow ID-VP02 to specifically transduce human DCs, and the advances that ID-VP02 brings to conventional third-generation lentiviral vector design as well as demonstrate upstream production yields that will enable manufacturing feasibility studies to be conducted.

  11. A genome-wide analysis of lentivector integration sites using targeted sequence capture and next generation sequencing technology.

    Science.gov (United States)

    Ustek, Duran; Sirma, Sema; Gumus, Ergun; Arikan, Muzaffer; Cakiris, Aris; Abaci, Neslihan; Mathew, Jaicy; Emrence, Zeliha; Azakli, Hulya; Cosan, Fulya; Cakar, Atilla; Parlak, Mahmut; Kursun, Olcay

    2012-10-01

    One application of next-generation sequencing (NGS) is the targeted resequencing of interested genes which has not been used in viral integration site analysis of gene therapy applications. Here, we combined targeted sequence capture array and next generation sequencing to address the whole genome profiling of viral integration sites. Human 293T and K562 cells were transduced with a HIV-1 derived vector. A custom made DNA probe sets targeted pLVTHM vector used to capture lentiviral vector/human genome junctions. The captured DNA was sequenced using GS FLX platform. Seven thousand four hundred and eighty four human genome sequences flanking the long terminal repeats (LTR) of pLVTHM fragment sequences matched with an identity of at least 98% and minimum 50 bp criteria in both cells. In total, 203 unique integration sites were identified. The integrations in both cell lines were totally distant from the CpG islands and from the transcription start sites and preferentially located in introns. A comparison between the two cell lines showed that the lentiviral-transduced DNA does not have the same preferred regions in the two different cell lines. Copyright © 2012 Elsevier B.V. All rights reserved.

  12. Passive radio frequency peak power multiplier

    Science.gov (United States)

    Farkas, Zoltan D.; Wilson, Perry B.

    1977-01-01

    Peak power multiplication of a radio frequency source by simultaneous charging of two high-Q resonant microwave cavities by applying the source output through a directional coupler to the cavities and then reversing the phase of the source power to the coupler, thereby permitting the power in the cavities to simultaneously discharge through the coupler to the load in combination with power from the source to apply a peak power to the load that is a multiplication of the source peak power.

  13. Smart households: Dispatch strategies and economic analysis of distributed energy storage for residential peak shaving

    International Nuclear Information System (INIS)

    Zheng, Menglian; Meinrenken, Christoph J.; Lackner, Klaus S.

    2015-01-01

    Highlights: • Cost-effectiveness of building-based storage for peak shaving has hitherto not been well understood. • Several existing storage technologies are shown to provide cost-effective peak shaving. • Setting grid demand targets rather than hard demand limits improves economics. • Accounting for seasonal demand variations in storage dispatch strategy improves economics further. • Total-energy-throughput approach is used to determine storage lifetimes. - Abstract: Meeting time-varying peak demand poses a key challenge to the U.S. electricity system. Building-based electricity storage – to enable demand response (DR) without curtailing actual appliance usage – offers potential benefits of lower electricity production cost, higher grid reliability, and more flexibility to integrate renewables. DR tariffs are currently available in the U.S. but building-based storage is still underutilized due to insufficiently understood cost-effectiveness and dispatch strategies. Whether DR schemes can yield a profit for building operators (i.e., reduction in electricity bill that exceeds levelized storage cost) and which particular storage technology yields the highest profit is yet to be answered. This study aims to evaluate the economics of providing peak shaving DR under a realistic tariff (Con Edison, New York), using a range of storage technologies (conventional and advanced batteries, flywheel, magnetic storage, pumped hydro, compressed air, and capacitors). An agent-based stochastic model is used to randomly generate appliance-level demand profiles for an average U.S. household. We first introduce a levelized storage cost model which is based on a total-energy-throughput lifetime. We then develop a storage dispatch strategy which optimizes the storage capacity and the demand limit on the grid. We find that (i) several storage technologies provide profitable DR; (ii) annual profit from such DR can range from 1% to 39% of the household’s non-DR electricity

  14. Energy solutions for CO2 emission peak and subsequent decline

    DEFF Research Database (Denmark)

    Risø International Energy Conference 2009 took place 14 – 16 September 2009. The conference focused on: • Future global energy development options Scenario and policy issues • Measures to achieve CO2 emission peak in 2015 – 2020 and subsequent decline • Renewable energy supply technologies...... such as bioenergy, wind and solar • Centralized energy technologies such as clean coal technologies • Energy conversion, energy carriers and energy storage, including fuel cells and hydrogen technologies • Providing renewable energy for the transport sector • Systems aspects for the various regions throughout...... the world • End-use technologies, efficiency improvements in supply and end use • Energy savings The proceedings are prepared from papers presented at the conference and received with corrections, if any, until the final deadline on 3 August 2009....

  15. Practical load management - Peak shaving using photovoltaics

    International Nuclear Information System (INIS)

    Berger, W.

    2009-01-01

    This article takes a look at how photovoltaic (PV) power generation can be used in a practical way to meet peak demands for electricity. Advice is provided on how photovoltaics can provide peak load 'shaving' through the correlation between its production and the peak loads encountered during the day. The situation regarding feed-in tariffs in Italy is discussed, as are further examples of installations in Germany and Austria. Further, an initiative of the American Southern California Edison utility is discussed which foresees the installation of large PV plant on the roofs of commercial premises to provide local generation of peak energy and thus relieve demands on their power transportation network.

  16. The geomorphic structure of the runoff peak

    Directory of Open Access Journals (Sweden)

    R. Rigon

    2011-06-01

    Full Text Available This paper develops a theoretical framework to investigate the core dependence of peak flows on the geomorphic properties of river basins. Based on the theory of transport by travel times, and simple hydrodynamic characterization of floods, this new framework invokes the linearity and invariance of the hydrologic response to provide analytical and semi-analytical expressions for peak flow, time to peak, and area contributing to the peak runoff. These results are obtained for the case of constant-intensity hyetograph using the Intensity-Duration-Frequency (IDF curves to estimate extreme flow values as a function of the rainfall return period. Results show that, with constant-intensity hyetographs, the time-to-peak is greater than rainfall duration and usually shorter than the basin concentration time. Moreover, the critical storm duration is shown to be independent of rainfall return period as well as the area contributing to the flow peak. The same results are found when the effects of hydrodynamic dispersion are accounted for. Further, it is shown that, when the effects of hydrodynamic dispersion are negligible, the basin area contributing to the peak discharge does not depend on the channel velocity, but is a geomorphic propriety of the basin. As an example this framework is applied to three watersheds. In particular, the runoff peak, the critical rainfall durations and the time to peak are calculated for all links within a network to assess how they increase with basin area.

  17. [A peak recognition algorithm designed for chromatographic peaks of transformer oil].

    Science.gov (United States)

    Ou, Linjun; Cao, Jian

    2014-09-01

    In the field of the chromatographic peak identification of the transformer oil, the traditional first-order derivative requires slope threshold to achieve peak identification. In terms of its shortcomings of low automation and easy distortion, the first-order derivative method was improved by applying the moving average iterative method and the normalized analysis techniques to identify the peaks. Accurate identification of the chromatographic peaks was realized through using multiple iterations of the moving average of signal curves and square wave curves to determine the optimal value of the normalized peak identification parameters, combined with the absolute peak retention times and peak window. The experimental results show that this algorithm can accurately identify the peaks and is not sensitive to the noise, the chromatographic peak width or the peak shape changes. It has strong adaptability to meet the on-site requirements of online monitoring devices of dissolved gases in transformer oil.

  18. Measuring the Impact of a Moving Target: Towards a Dynamic Framework for Evaluating Collaborative Adaptive Interactive Technologies

    OpenAIRE

    O?Grady, Laura; Witteman, Holly; Bender, Jacqueline L; Urowitz, Sara; Wiljer, David; Jadad, Alejandro R

    2009-01-01

    Background Website evaluation is a key issue for researchers, organizations, and others responsible for designing, maintaining, endorsing, approving, and/or assessing the use and impact of interventions designed to influence health and health services. Traditionally, these evaluations have included elements such as content credibility, interface usability, and overall design aesthetics. With the emergence of collaborative, adaptive, and interactive ("Web 2.0") technologies such as wikis and o...

  19. Effects of peatland drainage management on peak flows

    Directory of Open Access Journals (Sweden)

    C. E. Ballard

    2012-07-01

    Full Text Available Open ditch drainage has historically been a common land management practice in upland blanket peats, particularly in the UK. However, peatland drainage is now generally considered to have adverse effects on the upland environment, including increased peak flows. As a result, drain blocking has become a common management strategy in the UK over recent years, although there is only anecdotal evidence to suggest that this might decrease peak flows. The change in the hydrological regime associated with the drainage of blanket peat and the subsequent blocking of drains is poorly understood, therefore a new physics-based model has been developed that allows the exploration of the associated hydrological processes. A series of simulations is used to explore the response of intact, drained and blocked drain sites at field scales. While drainage is generally found to increase peak flows, the effect of drain blocking appears to be dependent on local conditions, sometimes decreasing and sometimes increasing peak flows. Based on insights from these simulations we identify steep smooth drains as those that would experience the greatest reduction in field-scale peak flows if blocked and recommend that future targeted field studies should be focused on examining surface runoff characteristics.

  20. Comprehensive two-dimensional gas chromatography/time-of-flight mass spectrometry peak sorting algorithm.

    Science.gov (United States)

    Oh, Cheolhwan; Huang, Xiaodong; Regnier, Fred E; Buck, Charles; Zhang, Xiang

    2008-02-01

    We report a novel peak sorting method for the two-dimensional gas chromatography/time-of-flight mass spectrometry (GC x GC/TOF-MS) system. The objective of peak sorting is to recognize peaks from the same metabolite occurring in different samples from thousands of peaks detected in the analytical procedure. The developed algorithm is based on the fact that the chromatographic peaks for a given analyte have similar retention times in all of the chromatograms. Raw instrument data are first processed by ChromaTOF (Leco) software to provide the peak tables. Our algorithm achieves peak sorting by utilizing the first- and second-dimension retention times in the peak tables and the mass spectra generated during the process of electron impact ionization. The algorithm searches the peak tables for the peaks generated by the same type of metabolite using several search criteria. Our software also includes options to eliminate non-target peaks from the sorting results, e.g., peaks of contaminants. The developed software package has been tested using a mixture of standard metabolites and another mixture of standard metabolites spiked into human serum. Manual validation demonstrates high accuracy of peak sorting with this algorithm.

  1. Revisiting nanoparticle technology for blood-brain barrier transport: Unfolding at the endothelial gate improves the fate of transferrin receptor-targeted liposomes.

    Science.gov (United States)

    Johnsen, Kasper Bendix; Moos, Torben

    2016-01-28

    An unmet need exists for therapeutic compounds to traverse the brain capillary endothelial cells that denote the blood-brain barrier (BBB) to deliver effective treatment to the diseased brain. The use of nanoparticle technology for targeted delivery to the brain implies that targeted liposomes encapsulating a drug of interest will undergo receptor-mediated uptake and transport through the BBB with a subsequent unfolding of the liposomal content inside the brain, hence revealing drug release to adjacent drug-demanding neurons. As transferrin receptors (TfRs) are present on brain capillary endothelial, but not on endothelial cells elsewhere in the body, the use of TfR-targeted liposomes - colloidal particulates with a phospholipid bilayer membrane - remains the most relevant strategy to obtain efficient drug delivery to the brain. However, many studies have failed to provide sufficient quantitative data to proof passage of the BBB and significant appearance of drugs inside the brain parenchyma. Here, we critically evaluate the current evidence on the use of TfR-targeted liposomes for brain drug delivery based on a thorough investigation of all available studies within this research field. We focus on issues with respect to experimental design and data analysis that may provide an explanation to conflicting reports, and we discuss possible explanations for the current lack of sufficient transcytosis across the BBB for implementation in the design of TfR-targeted liposomes. We finally provide a list of suggestions for strategies to obtain substantial uptake and transport of drug carriers at the BBB with a concomitant transport of therapeutics into the brain. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Employer Attitudes towards Peak Hour Avoidance

    NARCIS (Netherlands)

    Vonk Noordegraaf, D.M.; Annema, J.A.

    2012-01-01

    Peak Hour Avoidance is a relatively new Dutch mobility management measure. To reduce congestion frequent car drivers are given a financial reward for reducing the proportion of trips that they make during peak hours on a specific motorway section. Although previous studies show that employers are

  3. Employer attitudes towards peak hour avoidance

    NARCIS (Netherlands)

    Noordegraaf, D.M.V.; Annema, J.A.

    2012-01-01

    Peak Hour Avoidance is a relatively new Dutch mobility management measure. To reduce congestion frequent car drivers are given a financial reward for reducing the proportion of trips that they make during peak hours on a specific motorway section. Although previous studies show that employers are

  4. Peak load pricing lowers generation costs

    International Nuclear Information System (INIS)

    Lande, R.H.

    1980-01-01

    Before a utility implements peak load pricing for different classes of consumers, the costs and the benefits should be compared. The methodology described enables a utility to determine whether peak load pricing should be introduced for specific users. Cost-benefit analyses for domestic consumers and commercial/industrial consumers, showing break-even points are presented. (author)

  5. Peak Shaving Considering Streamflow Uncertainties | Iwuagwu ...

    African Journals Online (AJOL)

    The main thrust of this paper is peak shaving with a Stochastic hydro model. In peak sharing, the amount of hydro energy scheduled may be a minimum but it serves to replace less efficient thermal units. The sample system is die Kainji hydro plant and the thermal units of the National Electric Power Authority. The random ...

  6. The peak in neutron powder diffraction

    International Nuclear Information System (INIS)

    Laar, B. van; Yelon, W.B.

    1984-01-01

    For the application of Rietveld profile analysis to neutron powder diffraction data a precise knowledge of the peak profile, in both shape and position, is required. The method now in use employs a Gaussian shaped profile with a semi-empirical asymmetry correction for low-angle peaks. The integrated intensity is taken to be proportional to the classical Lorentz factor calculated for the X-ray case. In this paper an exact expression is given for the peak profile based upon the geometrical dimensions of the diffractometer. It is shown that the asymmetry of observed peaks is well reproduced by this expression. The angular displacement of the experimental profile with respect to the nominal Bragg angle value is larger than expected. Values for the correction to the classical Lorentz factor for the integrated intensity are given. The exact peak profile expression has been incorporated into a Rietveld profile analysis refinement program. (Auth.)

  7. Peak tree: a new tool for multiscale hierarchical representation and peak detection of mass spectrometry data.

    Science.gov (United States)

    Zhang, Peng; Li, Houqiang; Wang, Honghui; Wong, Stephen T C; Zhou, Xiaobo

    2011-01-01

    Peak detection is one of the most important steps in mass spectrometry (MS) analysis. However, the detection result is greatly affected by severe spectrum variations. Unfortunately, most current peak detection methods are neither flexible enough to revise false detection results nor robust enough to resist spectrum variations. To improve flexibility, we introduce peak tree to represent the peak information in MS spectra. Each tree node is a peak judgment on a range of scales, and each tree decomposition, as a set of nodes, is a candidate peak detection result. To improve robustness, we combine peak detection and common peak alignment into a closed-loop framework, which finds the optimal decomposition via both peak intensity and common peak information. The common peak information is derived and loopily refined from the density clustering of the latest peak detection result. Finally, we present an improved ant colony optimization biomarker selection method to build a whole MS analysis system. Experiment shows that our peak detection method can better resist spectrum variations and provide higher sensitivity and lower false detection rates than conventional methods. The benefits from our peak-tree-based system for MS disease analysis are also proved on real SELDI data.

  8. Targeted technology applications for infield reserve growth: A synopsis of the Secondary Natural Gas Recovery project, Gulf Coast Basin. Topical report, September 1988--April 1993

    Energy Technology Data Exchange (ETDEWEB)

    Levey, R.A.; Finley, R.J.; Hardage, B.A.

    1994-06-01

    The Secondary Natural Gas Recovery (SGR): Targeted Technology Applications for Infield Reserve Growth is a joint venture research project sponsored by the Gas Research Institute (GRI), the US Department of Energy (DOE), the State of Texas through the Bureau of Economic Geology at The University of Texas at Austin, with the cofunding and cooperation of the natural gas industry. The SGR project is a field-based program using an integrated multidisciplinary approach that integrates geology, geophysics, engineering, and petrophysics. A major objective of this research project is to develop, test, and verify those technologies and methodologies that have near- to mid-term potential for maximizing recovery of gas from conventional reservoirs in known fields. Natural gas reservoirs in the Gulf Coast Basin are targeted as data-rich, field-based models for evaluating infield development. The SGR research program focuses on sandstone-dominated reservoirs in fluvial-deltaic plays within the onshore Gulf Coast Basin of Texas. The primary project research objectives are: To establish how depositional and diagenetic heterogeneities cause, even in reservoirs of conventional permeability, reservoir compartmentalization and hence incomplete recovery of natural gas. To document examples of reserve growth occurrence and potential from fluvial and deltaic sandstones of the Texas Gulf Coast Basin as a natural laboratory for developing concepts and testing applications. To demonstrate how the integration of geology, reservoir engineering, geophysics, and well log analysis/petrophysics leads to strategic recompletion and well placement opportunities for reserve growth in mature fields.

  9. Medium Term Economic Effects of Peak Oil Today

    OpenAIRE

    Dr. Ulrike Lehr; Dr. Christian Lutz; Kirsten Wiebe

    2011-01-01

    The paper at hand presents results of a model-based scenario analysis on the economic implications in the next decade of an oil peak today and significantly decreasing oil production in the coming years. For that the extraction paths of oil and other fossil fuels given in LBST (2010) are implemented in the global macroeconomic model GINFORS. Additionally, the scenarios incorporate different technological potentials for energy efficiency and renewable energy, which cannot be forecast using eco...

  10. Multiscale peak detection in wavelet space.

    Science.gov (United States)

    Zhang, Zhi-Min; Tong, Xia; Peng, Ying; Ma, Pan; Zhang, Ming-Jin; Lu, Hong-Mei; Chen, Xiao-Qing; Liang, Yi-Zeng

    2015-12-07

    Accurate peak detection is essential for analyzing high-throughput datasets generated by analytical instruments. Derivatives with noise reduction and matched filtration are frequently used, but they are sensitive to baseline variations, random noise and deviations in the peak shape. A continuous wavelet transform (CWT)-based method is more practical and popular in this situation, which can increase the accuracy and reliability by identifying peaks across scales in wavelet space and implicitly removing noise as well as the baseline. However, its computational load is relatively high and the estimated features of peaks may not be accurate in the case of peaks that are overlapping, dense or weak. In this study, we present multi-scale peak detection (MSPD) by taking full advantage of additional information in wavelet space including ridges, valleys, and zero-crossings. It can achieve a high accuracy by thresholding each detected peak with the maximum of its ridge. It has been comprehensively evaluated with MALDI-TOF spectra in proteomics, the CAMDA 2006 SELDI dataset as well as the Romanian database of Raman spectra, which is particularly suitable for detecting peaks in high-throughput analytical signals. Receiver operating characteristic (ROC) curves show that MSPD can detect more true peaks while keeping the false discovery rate lower than MassSpecWavelet and MALDIquant methods. Superior results in Raman spectra suggest that MSPD seems to be a more universal method for peak detection. MSPD has been designed and implemented efficiently in Python and Cython. It is available as an open source package at .

  11. Technology

    Directory of Open Access Journals (Sweden)

    Xu Jing

    2016-01-01

    Full Text Available The traditional answer card reading method using OMR (Optical Mark Reader, most commonly, OMR special card special use, less versatile, high cost, aiming at the existing problems proposed a method based on pattern recognition of the answer card identification method. Using the method based on Line Segment Detector to detect the tilt of the image, the existence of tilt image rotation correction, and eventually achieve positioning and detection of answers to the answer sheet .Pattern recognition technology for automatic reading, high accuracy, detect faster

  12. RESULTS FROM RECENT SCIENCE AND TECHNOLOGY INVESTIGATIONS TARGETING CHROMIUM IN THE 100D AREA HANFORD SITE WASHINGTON USA

    Energy Technology Data Exchange (ETDEWEB)

    PETERSEN SW; THOMPSON KM; TONKIN MJ

    2009-12-03

    Sodium dichromate was used in Hanford's 100D Area during the reactor operations period of 1950 to 1964 to retard corrosion in the reactor cooling systems. Some of the sodium dichromate was released to the environment by spills and/or leaks from pipelines used to deliver the chemical to water treatment plants in the area. As a result, hexavalent chromium [Cr(VI)] has migrated through the vadose zone to the groundwater and contaminated nearly 1 km{sup 2} of groundwater to above the drinking water standard of 48 {micro}g/L. Three technology tests have recently been completed in this area to characterize the source area of the plumes and evaluate alternative methods to remove Cr(VI) from groundwater. These are (1) refine the source area of the southern plume; (2) test electrocoagulation as an alternative groundwater treatment technology; and (3) test the ability to repair a permeable reactive barrier by injecting micron or nanometer-size zero-valent iron (ZVI). The projects were funded by the US Department of Energy as part of a program to interject new technologies and accelerate active cleanup. Groundwater monitoring over the past 10 years has shown that Cr(VI) concentrations in the southern plume have not significantly diminished, strongly indicating a continuing source. Eleven groundwater wells were installed in 2007 and 2008 near a suspected source area and monitored for Cr(VI) and groundwater levels. Interpretation of these data has led to refinement of the source area location to an area of less than 1 hectare (ha, 2.5 acres). Vadose zone soil samples collected during drilling did not discover significant concentrations of Cr(VI), indicating the source is localized, with a narrow wetted path from the surface to the water table. Electrocoagulation was evaluated through a pilot-scale treatability test. Over 8 million liters of groundwater were treated to Cr(VI) concentrations of {le}20 {micro}g/L. The test determined that this technology has the potential to

  13. Results From Recent Science And Technology Investigations Targeting Chromium In The 100D Area, Hanford Site, Washington, USA

    International Nuclear Information System (INIS)

    Petersen, S.W.; Thompson, K.M.; Tonkin, M.J.

    2009-01-01

    Sodium dichromate was used in Hanford's 100D Area during the reactor operations period of 1950 to 1964 to retard corrosion in the reactor cooling systems. Some of the sodium dichromate was released to the environment by spills and/or leaks from pipelines used to deliver the chemical to water treatment plants in the area. As a result, hexavalent chromium (Cr(VI)) has migrated through the vadose zone to the groundwater and contaminated nearly 1 km 2 of groundwater to above the drinking water standard of 48 (micro)g/L. Three technology tests have recently been completed in this area to characterize the source area of the plumes and evaluate alternative methods to remove Cr(VI) from groundwater. These are (1) refine the source area of the southern plume; (2) test electrocoagulation as an alternative groundwater treatment technology; and (3) test the ability to repair a permeable reactive barrier by injecting micron or nanometer-size zero-valent iron (ZVI). The projects were funded by the US Department of Energy as part of a program to interject new technologies and accelerate active cleanup. Groundwater monitoring over the past 10 years has shown that Cr(VI) concentrations in the southern plume have not significantly diminished, strongly indicating a continuing source. Eleven groundwater wells were installed in 2007 and 2008 near a suspected source area and monitored for Cr(VI) and groundwater levels. Interpretation of these data has led to refinement of the source area location to an area of less than 1 hectare (ha, 2.5 acres). Vadose zone soil samples collected during drilling did not discover significant concentrations of Cr(VI), indicating the source is localized, with a narrow wetted path from the surface to the water table. Electrocoagulation was evaluated through a pilot-scale treatability test. Over 8 million liters of groundwater were treated to Cr(VI) concentrations of (le)20 (micro)g/L. The test determined that this technology has the potential to treat Cr

  14. Advanced scale conditioning agent and consolidated deposit extraction planning, application experience, and results at Comanche Peak Unit 2 and industrial super critical water oxidation waste reduction

    Energy Technology Data Exchange (ETDEWEB)

    Forney, M.; Ramaley, D. [Westinghouse Electric Company, Cranberry Township, PA (United States); Bryant, W. [Luminant Energy, Comanche Peak Nuclear Power Plant, Dallas, TX (United States)

    2015-07-01

    Advance Scale Conditioning Agent (ASCA) technology has been applied more than forty times worldwide since its inception in 2000. This technology has continually grown in popularity since its development due to the combination of several process benefits and minimal outage impacts. Comanche Peak Unit 2 applied a Top of Tubesheet (TTS) ASCA in 2014 for partial dissolution and softening of consolidated TTS collars. In addition to the ASCA application, a Consolidated Deposit Extraction (CODE) step was applied to the TTS. CODE is a chemical treatment technology that effectively targets and dissolves 'binding species' such as those containing aluminum and silicon from steam generator deposits. Since magnetite dissolution technologies are not wholly effective in removing consolidated TTS 'collars' CODE technology was developed to address this need in the industry. This paper will discuss both the Westinghouse and utility perspective on TTS ASCA/CODE application planning, site execution, and process results. (author)

  15. The effect of mood state on visual search times for detecting a target in noise: An application of smartphone technology.

    Science.gov (United States)

    Maekawa, Toru; Anderson, Stephen J; de Brecht, Matthew; Yamagishi, Noriko

    2018-01-01

    The study of visual perception has largely been completed without regard to the influence that an individual's emotional status may have on their performance in visual tasks. However, there is a growing body of evidence to suggest that mood may affect not only creative abilities and interpersonal skills but also the capacity to perform low-level cognitive tasks. Here, we sought to determine whether rudimentary visual search processes are similarly affected by emotion. Specifically, we examined whether an individual's perceived happiness level affects their ability to detect a target in noise. To do so, we employed pop-out and serial visual search paradigms, implemented using a novel smartphone application that allowed search times and self-rated levels of happiness to be recorded throughout each twenty-four-hour period for two weeks. This experience sampling protocol circumvented the need to alter mood artificially with laboratory-based induction methods. Using our smartphone application, we were able to replicate the classic visual search findings, whereby pop-out search times remained largely unaffected by the number of distractors whereas serial search times increased with increasing number of distractors. While pop-out search times were unaffected by happiness level, serial search times with the maximum numbers of distractors (n = 30) were significantly faster for high happiness levels than low happiness levels (p = 0.02). Our results demonstrate the utility of smartphone applications in assessing ecologically valid measures of human visual performance. We discuss the significance of our findings for the assessment of basic visual functions using search time measures, and for our ability to search effectively for targets in real world settings.

  16. Isotope resolution of the iron peak

    International Nuclear Information System (INIS)

    Henke, R.P.; Benton, E.V.

    1977-01-01

    A stack of Lexan detectors from the Apollo 17 mission has been analyzed to obtain Z measurements of sufficient accuracy to resolve the iron peak into its isotopic components. Within this distribution several peaks are present. With the centrally located, most populated peak assumed to be 56 Fe, the measurements imply that the abundances of 54 Fe and 58 Fe are appreciable fractions of the 56 Fe abundance. This result is in agreement with those of Webber et al. and Siegman et al. but in disagreement with the predictions of Tsao et al. (Auth.)

  17. Peak load arrangements : Assessment of Nordel guidelines

    Energy Technology Data Exchange (ETDEWEB)

    2009-07-01

    Two Nordic countries, Sweden and Finland, have legislation that empowers the TSO to acquire designated peak load resources to mitigate the risk for shortage situations during the winter. In Denmark, the system operator procures resources to maintain a satisfactory level of security of supply. In Norway the TSO has set up a Regulation Power Option Market (RKOM) to secure a satisfactory level of operational reserves at all times, also in winter with high load demand. Only the arrangements in Finland and Sweden fall under the heading of Peak Load Arrangements defined in Nordel Guidelines. NordREG has been invited by the Electricity Market Group (EMG) to evaluate Nordel's proposal for 'Guidelines for transitional Peak Load Arrangements'. The EMG has also financed a study made by EC Group to support NordREG in the evaluation of the proposal. The study has been taken into account in NordREG's evaluation. In parallel to the EMG task, the Swedish regulator, the Energy Markets Inspectorate, has been given the task by the Swedish government to investigate a long term solution of the peak load issue. The Swedish and Finnish TSOs have together with Nord Pool Spot worked on finding a harmonized solution for activation of the peak load reserves in the market. An agreement accepted by the relevant authorities was reached in early January 2009, and the arrangement has been implemented since 19th January 2009. NordREG views that the proposed Nordel guidelines have served as a starting point for the presently agreed procedure. However, NordREG does not see any need to further develop the Nordel guidelines for peak load arrangements. NordREG agrees with Nordel that the market should be designed to solve peak load problems through proper incentives to market players. NordREG presumes that the relevant authorities in each country will take decisions on the need for any peak load arrangement to ensure security of supply. NordREG proposes that such decisions should be

  18. Automated Peak Picking and Peak Integration in Macromolecular NMR Spectra Using AUTOPSY

    Science.gov (United States)

    Koradi, Reto; Billeter, Martin; Engeli, Max; Güntert, Peter; Wüthrich, Kurt

    1998-12-01

    A new approach for automated peak picking of multidimensional protein NMR spectra with strong overlap is introduced, which makes use of the program AUTOPSY (automatedpeak picking for NMRspectroscopy). The main elements of this program are a novel function for local noise level calculation, the use of symmetry considerations, and the use of lineshapes extracted from well-separated peaks for resolving groups of strongly overlapping peaks. The algorithm generates peak lists with precise chemical shift and integral intensities, and a reliability measure for the recognition of each peak. The results of automated peak picking of NOESY spectra with AUTOPSY were tested in combination with the combined automated NOESY cross peak assignment and structure calculation routine NOAH implemented in the program DYANA. The quality of the resulting structures was found to be comparable with those from corresponding data obtained with manual peak picking.

  19. Crossing the Resolution Limit in Near-Infrared Imaging of Silicon Chips: Targeting 10-nm Node Technology

    Directory of Open Access Journals (Sweden)

    Krishna Agarwal

    2015-05-01

    Full Text Available The best reported resolution in optical failure analysis of silicon chips is 120-nm half pitch demonstrated by Semicaps Private Limited, whereas the current and future industry requirement for 10-nm node technology is 100-nm half pitch. We show the first experimental evidence for resolution of features with 100-nm half pitch buried in silicon (λ/10.6, thus fulfilling the industry requirement. These results are obtained using near-infrared reflection-mode imaging using a solid immersion lens. The key novel feature of our approach is the choice of an appropriately sized collection pinhole. Although it is usually understood that, in general, resolution is improved by using the smallest pinhole consistent with an adequate signal level, it is found that in practice for silicon chips there is an optimum pinhole size, determined by the generation of induced currents in the sample. In failure analysis of silicon chips, nondestructive imaging is important to avoid disturbing the functionality of integrated circuits. High-resolution imaging techniques like SEM or TEM require the transistors to be exposed destructively. Optical microscopy techniques may be used, but silicon is opaque in the visible spectrum, mandating the use of near-infrared light and thus poor resolution in conventional optical microscopy. We expect our result to change the way semiconductor failure analysis is performed.

  20. Satisfaction Survey on Information Technology-Based Glucose Monitoring System Targeting Diabetes Mellitus in Private Local Clinics in Korea

    Directory of Open Access Journals (Sweden)

    Hun-Sung Kim

    2017-06-01

    Full Text Available BackgroundPrivate local clinics in Korea have little experience with information technology (IT-based glucose monitoring (ITGM. Our aim is to examine user satisfaction and the possibility of using ITGM service practically.MethodsPatients sent their blood glucose levels to physicians in local clinics. The physicians reviewed the blood glucose values online and provided personal consultations through text messaging or phone calls. Thereafter, a satisfaction survey on the ITGM service, the modified Morisky scale, and patient assessment of chronic illness care were administered.ResultsOne hundred and seventy patients from seven private local clinics used the ITGM. Overall satisfaction, including that about the ITGM service, the device, and its usefulness, was rated higher than “mostly satisfied” (score 4.2±0.8 out of 5.0 and even higher among the elderly. Satisfaction was positively associated with age, especially in those older than 60 years. The main reason for intent for future use of the service was the time/place flexibility. Highly motivated patients tended to answer positively regarding information satisfaction (P=0.0377.ConclusionOur study is the first to investigate ITGM satisfaction in private local clinics. The feasibility of users utilizing ITGM should be clarified, and future clinical research on the service's clinical effects and cost-benefit analysis is needed.

  1. Bayesian Peak Picking for NMR Spectra

    KAUST Repository

    Cheng, Yichen

    2014-02-01

    Protein structure determination is a very important topic in structural genomics, which helps people to understand varieties of biological functions such as protein-protein interactions, protein–DNA interactions and so on. Nowadays, nuclear magnetic resonance (NMR) has often been used to determine the three-dimensional structures of protein in vivo. This study aims to automate the peak picking step, the most important and tricky step in NMR structure determination. We propose to model the NMR spectrum by a mixture of bivariate Gaussian densities and use the stochastic approximation Monte Carlo algorithm as the computational tool to solve the problem. Under the Bayesian framework, the peak picking problem is casted as a variable selection problem. The proposed method can automatically distinguish true peaks from false ones without preprocessing the data. To the best of our knowledge, this is the first effort in the literature that tackles the peak picking problem for NMR spectrum data using Bayesian method.

  2. Peak-Seeking Control for Trim Optimization

    Data.gov (United States)

    National Aeronautics and Space Administration — Innovators have developed a peak-seeking algorithm that can reduce drag and improve performance and fuel efficiency by optimizing aircraft trim in real time. The...

  3. Instream flow needs below peaking hydroelectric projects

    International Nuclear Information System (INIS)

    Milhous, R.T.

    1991-01-01

    This paper reports on a method developed to assist in the determination of instream flow needs below hydroelectric projects operated in a peaking mode. Peaking hydroelectric projects significantly change streamflow over a short period of time; consequently, any instream flow methodology must consider the dual flows associated with peaking projects. The dual flows are the lowest flow and the maximum generation flow of a peaking cycle. The methodology is based on elements of the Physical Habitat Simulation System of the U.S. Fish and Wildlife Service and uses habitat, rather than fish numbers or biomas, as at basic response variable. All aquatic animals are subject to the rapid changes in streamflow which cause rapid swings in habitat quality. Some aquatic organisms are relatively fixed in location in the stream while others can move when flows change. The habitat available from a project operated in peaking mode is considered to be the minimum habitat occurring during a cycle of habitat change. The methodology takes in to consideration that some aquatic animals can move and others cannot move during a peaking cycle

  4. Electron beam fusion targets

    International Nuclear Information System (INIS)

    Clauser, M.J.; Sweeney, M.A.

    1975-01-01

    R The behavior of the DT filled gold shells when irradiated by a variety of pulse shapes was studied. In these pulses the power (and beam current) was varied, but the voltage was kept constant at 1 MeV. In general the performance of the target, for a given peak power, was not significantly affected by the pulse shape. Pulses with rise times of up to half the implosion time do not significantly degrade the target performance. The use of the ''optimal pulse'' of laser fusion with a fixed peak power does not appear to improve the performance of these targets. The main function of the ''optimal pulse'' is to produce a large rho r of the target during the thermonuclear burn. In e-beam targets a total rho r of 5--10 g/cm 2 can be obtained without pulse shaping; the problem here is one of achieving high enough temperatures to ignite the DT. (U.S.)

  5. Storage Operation for Peak Shaving of Distributed PV and Wind Generation

    NARCIS (Netherlands)

    Nykamp, Stefan; Molderink, Albert; Hurink, Johann L.; Smit, Gerardus Johannes Maria

    2013-01-01

    The integration of fluctuating power generation based on renewable energy systems (RES-E) in distribution grids require grid reinforcement resulting from high feed-in peaks. Introducing storage assets can decrease these peaks. For this, storage technologies need to be chosen and dimensioned

  6. Peak quantification in surface-enhanced laser desorption/ionization by using mixture models

    NARCIS (Netherlands)

    Dijkstra, Martijn; Roelofsen, Han; Vonk, Roel J.; Jansen, Ritsert C.

    2006-01-01

    Surface-enhanced laser desorption/ionization (SELDI) time of flight (TOF) is a mass spectrometry technology for measuring the composition of a sampled protein mixture. A mass spectrum contains peaks corresponding to proteins in the sample. The peak areas are proportional to the measured

  7. Information Extraction and Interpretation Analysis of Mineral Potential Targets Based on ETM+ Data and GIS technology: A Case Study of Copper and Gold Mineralization in Burma

    International Nuclear Information System (INIS)

    Wenhui, Du; Yongqing, Chen; Nana, Guo; Yinglong, Hao; Pengfei, Zhao; Gongwen, Wang

    2014-01-01

    Mineralization-alteration and structure information extraction plays important roles in mineral resource prospecting and assessment using remote sensing data and the Geographical Information System (GIS) technology. Choosing copper and gold mines in Burma as example, the authors adopt band ratio, threshold segmentation and principal component analysis (PCA) to extract the hydroxyl alteration information using ETM+ remote sensing images. Digital elevation model (DEM) (30m spatial resolution) and ETM+ data was used to extract linear and circular faults that are associated with copper and gold mineralization. Combining geological data and the above information, the weights of evidence method and the C-A fractal model was used to integrate and identify the ore-forming favourable zones in this area. Research results show that the high grade potential targets are located with the known copper and gold deposits, and the integrated information can be used to the next exploration for the mineral resource decision-making

  8. What is the peak stress in ceramic bar impacts?

    International Nuclear Information System (INIS)

    Simha, C. Hari Manoj; Bless, S.J.; Bedford, A.

    2000-01-01

    The bar impact experiment has been extensively used to characterize the high strain rate properties of high strength ceramics. In particular, alumina AD-99.5 has been widely studied; both stress gauge and VISAR bar impact data are available for this material. We have performed plate-on-bar impact experiments using this material in some novel configurations. An interface was introduced in the target bar (by cutting it) in the zone where the material fails by axial splitting. Such experiments resulted in a dramatic drop in the peak stress measured in the experiment, when compared to experiments with no interface. We show that the damage kinetics in tension influence these measurements. Since the peak stress is dependent on the damage kinetics we conclude that the measurement cannot be correlated to some intrinsic strength of the ceramic

  9. Limitation of peak fitting and peak shape methods for determination of activation energy of thermoluminescence glow peaks

    CERN Document Server

    Sunta, C M; Piters, T M; Watanabe, S

    1999-01-01

    This paper shows the limitation of general order peak fitting and peak shape methods for determining the activation energy of the thermoluminescence glow peaks in the cases in which retrapping probability is much higher than the recombination probability and the traps are filled up to near saturation level. Right values can be obtained when the trap occupancy is reduced by using small doses or by post-irradiation partial bleaching. This limitation in the application of these methods has not been indicated earlier. In view of the unknown nature of kinetics in the experimental samples, it is recommended that these methods of activation energy determination should be applied only at doses well below the saturation dose.

  10. Demand Side Management: An approach to peak load smoothing

    Science.gov (United States)

    Gupta, Prachi

    A preliminary national-level analysis was conducted to determine whether Demand Side Management (DSM) programs introduced by electric utilities since 1992 have made any progress towards their stated goal of reducing peak load demand. Estimates implied that DSM has a very small effect on peak load reduction and there is substantial regional and end-user variability. A limited scholarly literature on DSM also provides evidence in support of a positive effect of demand response programs. Yet, none of these studies examine the question of how DSM affects peak load at the micro-level by influencing end-users' response to prices. After nearly three decades of experience with DSM, controversy remains over how effective these programs have been. This dissertation considers regional analyses that explore both demand-side solutions and supply-side interventions. On the demand side, models are estimated to provide in-depth evidence of end-user consumption patterns for each North American Electric Reliability Corporation (NERC) region, helping to identify sectors in regions that have made a substantial contribution to peak load reduction. The empirical evidence supports the initial hypothesis that there is substantial regional and end-user variability of reductions in peak demand. These results are quite robust in rapidly-urbanizing regions, where air conditioning and lighting load is substantially higher, and regions where the summer peak is more pronounced than the winter peak. It is also evident from the regional experiences that active government involvement, as shaped by state regulations in the last few years, has been successful in promoting DSM programs, and perhaps for the same reason we witness an uptick in peak load reductions in the years 2008 and 2009. On the supply side, we estimate the effectiveness of DSM programs by analyzing the growth of capacity margin with the introduction of DSM programs. The results indicate that DSM has been successful in offsetting the

  11. Technology transfer

    International Nuclear Information System (INIS)

    1998-01-01

    On the base of technological opportunities and of the environmental target of the various sectors of energy system this paper intend to conjugate the opportunity/objective with economic and social development through technology transfer and information dissemination [it

  12. Statistics of peaks of Gaussian random fields

    International Nuclear Information System (INIS)

    Bardeen, J.M.; Bond, J.R.; Kaiser, N.; Szalay, A.S.; Stanford Univ., CA; California Univ., Berkeley; Cambridge Univ., England; Fermi National Accelerator Lab., Batavia, IL)

    1986-01-01

    A set of new mathematical results on the theory of Gaussian random fields is presented, and the application of such calculations in cosmology to treat questions of structure formation from small-amplitude initial density fluctuations is addressed. The point process equation is discussed, giving the general formula for the average number density of peaks. The problem of the proper conditional probability constraints appropriate to maxima are examined using a one-dimensional illustration. The average density of maxima of a general three-dimensional Gaussian field is calculated as a function of heights of the maxima, and the average density of upcrossing points on density contour surfaces is computed. The number density of peaks subject to the constraint that the large-scale density field be fixed is determined and used to discuss the segregation of high peaks from the underlying mass distribution. The machinery to calculate n-point peak-peak correlation functions is determined, as are the shapes of the profiles about maxima. 67 references

  13. Peak Oil, threat or energy worlds' phantasm?

    International Nuclear Information System (INIS)

    Favennec, Jean-Pierre

    2011-01-01

    The concept of Peak Oil is based on the work of King Hubbert, a petroleum geologist who worked for Shell in the USA in the 1960's. Based on the fact that discoveries in America reached a maximum in the 1930's, he announced that American production would reach a maximum in 1969, which did actually occur. Geologists members of the Association for the Study of Peak Oil have extrapolated this result to a worldwide scale and, since oil discoveries reached a peak in the 1960's, argued that production will peak in the very near future. It is clear that hydrocarbon reserves are finite and therefore exhaustible. But little is known regarding the level of ultimate (i.e. total existing) reserves. There are probably very large reserves of non conventional oil in addition to the reserves of conventional oil. An increasing number of specialists put maximum production at less than 100 Mb/d more for geopolitical than physical reasons. Attainable peak production will probably vary from year to year and will depend on how crude oil prices develop

  14. Electric peak power forecasting by year 2025

    International Nuclear Information System (INIS)

    Alsayegh, O.A.; Al-Matar, O.A.; Fairouz, F.A.; Al-Mulla Ali, A.

    2005-01-01

    Peak power demand in Kuwait up to the year 2025 was predicted using an artificial neural network (ANN) model. The aim of the study was to investigate the effect of air conditioning (A/C) units on long-term power demand. Five socio-economic factors were selected as inputs for the simulation: (1) gross national product, (2) population, (3) number of buildings, (4) imports of A/C units, and (5) index of industrial production. The study used socio-economic data from 1978 to 2000. Historical data of the first 10 years of the studied time period were used to train the ANN. The electrical network was then simulated to forecast peak power for the following 11 years. The calculated error was then used for years in which power consumption data were not available. The study demonstrated that average peak power rates increased by 4100 MW every 5 years. Various scenarios related to changes in population, the number of buildings, and the quantity of A/C units were then modelled to estimate long-term peak power demand. Results of the study demonstrated that population had the strongest impact on future power demand, while the number of buildings had the smallest impact. It was concluded that peak power growth can be controlled through the use of different immigration policies, increased A/C efficiency, and the use of vertical housing. 7 refs., 2 tabs., 6 figs

  15. Electric peak power forecasting by year 2025

    Energy Technology Data Exchange (ETDEWEB)

    Alsayegh, O.A.; Al-Matar, O.A.; Fairouz, F.A.; Al-Mulla Ali, A. [Kuwait Inst. for Scientific Research, Kuwait City (Kuwait). Div. of Environment and Urban Development

    2005-07-01

    Peak power demand in Kuwait up to the year 2025 was predicted using an artificial neural network (ANN) model. The aim of the study was to investigate the effect of air conditioning (A/C) units on long-term power demand. Five socio-economic factors were selected as inputs for the simulation: (1) gross national product, (2) population, (3) number of buildings, (4) imports of A/C units, and (5) index of industrial production. The study used socio-economic data from 1978 to 2000. Historical data of the first 10 years of the studied time period were used to train the ANN. The electrical network was then simulated to forecast peak power for the following 11 years. The calculated error was then used for years in which power consumption data were not available. The study demonstrated that average peak power rates increased by 4100 MW every 5 years. Various scenarios related to changes in population, the number of buildings, and the quantity of A/C units were then modelled to estimate long-term peak power demand. Results of the study demonstrated that population had the strongest impact on future power demand, while the number of buildings had the smallest impact. It was concluded that peak power growth can be controlled through the use of different immigration policies, increased A/C efficiency, and the use of vertical housing. 7 refs., 2 tabs., 6 figs.

  16. Analysis of the location for peak heating in CHP based combined district heating systems

    International Nuclear Information System (INIS)

    Wang, Haichao; Lahdelma, Risto; Wang, Xin; Jiao, Wenling; Zhu, Chuanzhi; Zou, Pinghua

    2015-01-01

    Combined heat and power (CHP) is the main technology for providing the base load of district heating in China. However, CHP is not efficient for providing the peak load; instead, a peak boiler with high efficiency could be used to compensate the peak load. This paper studies how the location of the peak boiler can affect the energy efficiency and economic performance of such CHP based combined district heating system. Firstly, the connection mode and the control strategy for different peak heating locations are analyzed. Then the effect of the peak boiler's location on the initial investment of the network and the cost for distributing heat is studied. The objective is to place the peak boiler in a location where the overall costs are the smallest. Following this rule, the results indicate that the peak boiler should be located at the CHP plant if that allows using cheaper ‘self-use electricity’ in CHP for distributing the heat. However, if the market electricity price is used everywhere, or if energy efficiency is more emphasized, the location of the peak boiler should be closer to the users with dense heat loads. - Highlights: • Location for peak heating in the CHP based combined DH system is studied. • Regulation or control strategies for combined DH are summarized. • The heat load duration curve for combined DH is demonstrated. • Network design for combined DH with peak boiler outside of the CHP is analyzed

  17. New weather depiction technology for night vision goggle (NVG) training: 3D virtual/augmented reality scene-weather-atmosphere-target simulation

    Science.gov (United States)

    Folaron, Michelle; Deacutis, Martin; Hegarty, Jennifer; Vollmerhausen, Richard; Schroeder, John; Colby, Frank P.

    2007-04-01

    US Navy and Marine Corps pilots receive Night Vision Goggle (NVG) training as part of their overall training to maintain the superiority of our forces. This training must incorporate realistic targets; backgrounds; and representative atmospheric and weather effects they may encounter under operational conditions. An approach for pilot NVG training is to use the Night Imaging and Threat Evaluation Laboratory (NITE Lab) concept. The NITE Labs utilize a 10' by 10' static terrain model equipped with both natural and cultural lighting that are used to demonstrate various illumination conditions, and visual phenomena which might be experienced when utilizing night vision goggles. With this technology, the military can safely, systematically, and reliably expose pilots to the large number of potentially dangerous environmental conditions that will be experienced in their NVG training flights. A previous SPIE presentation described our work for NAVAIR to add realistic atmospheric and weather effects to the NVG NITE Lab training facility using the NVG - WDT(Weather Depiction Technology) system (Colby, et al.). NVG -WDT consist of a high end multiprocessor server with weather simulation software, and several fixed and goggle mounted Heads Up Displays (HUDs). Atmospheric and weather effects are simulated using state-of-the-art computer codes such as the WRF (Weather Research μ Forecasting) model; and the US Air Force Research Laboratory MODTRAN radiative transport model. Imagery for a variety of natural and man-made obscurations (e.g. rain, clouds, snow, dust, smoke, chemical releases) are being calculated and injected into the scene observed through the NVG via the fixed and goggle mounted HUDs. This paper expands on the work described in the previous presentation and will describe the 3D Virtual/Augmented Reality Scene - Weather - Atmosphere - Target Simulation part of the NVG - WDT. The 3D virtual reality software is a complete simulation system to generate realistic

  18. Generation Mix Study Focusing on Nuclear Power by Practical Peak Forecast

    International Nuclear Information System (INIS)

    Shin, Jung Ho; Roh, Myung Sub

    2013-01-01

    The excessive underestimation can lead to a range of problem; expansion of LNG plant requiring short construction period, the following increase of electricity price, low reserve margin and inefficient configuration of power source. With regard to nuclear power, the share of the stable and economic base load plant, nuclear power, can reduce under the optimum level. Amongst varied factors which contribute to the underestimate, immoderate target for demand side management (DSM) including double deduction of the constraint amount by DSM from peak demand forecast is one of the causes. The hypothesis in this study is that the better optimum generation mix including the adequate share of nuclear power can be obtained under the condition of the peak demand forecast without deduction of DSM target because this forecast is closer to the actual peak demand. In this study, the hypothesis is verified with comparison between peak demand forecast before (or after) DSM target application and the actual peak demand in the 3 rd through 5 th BPE from 2006 to 2010. Furthermore, this research compares and analyzes several generation mix in 2027 focusing on the nuclear power by a few conditions using the WASP-IV program on the basis of the 6 th BPE in 2013. According to the comparative analysis on the peak demand forecast and actual peak demand from 2006 to 2010, the peak demand forecasts without the deduction of the DSM target is closer to the actual peak demand than the peak demand forecasts considering the DSM target in the 3 th , 4 th , 5 th entirely. In addition, the generation mix until 2027 is examined by the WASP-IV. As a result of the program run, when considering the peak demand forecast without DSM reflection, since the base load plants including nuclear power take up adequate proportion, stable and economic supply of electricity can be achieved. On the contrary, in case of planning based on the peak demand forecast with DSM reflected and then compensating the shortage by

  19. Generation Mix Study Focusing on Nuclear Power by Practical Peak Forecast

    Energy Technology Data Exchange (ETDEWEB)

    Shin, Jung Ho; Roh, Myung Sub [KEPCO International Nuclear Graduate School, Ulsan (Korea, Republic of)

    2013-10-15

    The excessive underestimation can lead to a range of problem; expansion of LNG plant requiring short construction period, the following increase of electricity price, low reserve margin and inefficient configuration of power source. With regard to nuclear power, the share of the stable and economic base load plant, nuclear power, can reduce under the optimum level. Amongst varied factors which contribute to the underestimate, immoderate target for demand side management (DSM) including double deduction of the constraint amount by DSM from peak demand forecast is one of the causes. The hypothesis in this study is that the better optimum generation mix including the adequate share of nuclear power can be obtained under the condition of the peak demand forecast without deduction of DSM target because this forecast is closer to the actual peak demand. In this study, the hypothesis is verified with comparison between peak demand forecast before (or after) DSM target application and the actual peak demand in the 3{sup rd} through 5{sup th} BPE from 2006 to 2010. Furthermore, this research compares and analyzes several generation mix in 2027 focusing on the nuclear power by a few conditions using the WASP-IV program on the basis of the 6{sup th} BPE in 2013. According to the comparative analysis on the peak demand forecast and actual peak demand from 2006 to 2010, the peak demand forecasts without the deduction of the DSM target is closer to the actual peak demand than the peak demand forecasts considering the DSM target in the 3{sup th}, 4{sup th}, 5{sup th} entirely. In addition, the generation mix until 2027 is examined by the WASP-IV. As a result of the program run, when considering the peak demand forecast without DSM reflection, since the base load plants including nuclear power take up adequate proportion, stable and economic supply of electricity can be achieved. On the contrary, in case of planning based on the peak demand forecast with DSM reflected and then

  20. Can We Distinguish Emotions from Faces? Investigation of Implicit and Explicit Processes of Peak Facial Expressions.

    Science.gov (United States)

    Xiao, Ruiqi; Li, Xianchun; Li, Lin; Wang, Yanmei

    2016-01-01

    Most previous studies on facial expression recognition have focused on the moderate emotions; to date, few studies have been conducted to investigate the explicit and implicit processes of peak emotions. In the current study, we used transiently peak intense expression images of athletes at the winning or losing point in competition as materials, and investigated the diagnosability of peak facial expressions at both implicit and explicit levels. In Experiment 1, participants were instructed to evaluate isolated faces, isolated bodies, and the face-body compounds, and eye-tracking movement was recorded. The results revealed that the isolated body and face-body congruent images were better recognized than isolated face and face-body incongruent images, indicating that the emotional information conveyed by facial cues was ambiguous, and the body cues influenced facial emotion recognition. Furthermore, eye movement records showed that the participants displayed distinct gaze patterns for the congruent and incongruent compounds. In Experiment 2A, the subliminal affective priming task was used, with faces as primes and bodies as targets, to investigate the unconscious emotion perception of peak facial expressions. The results showed that winning face prime facilitated reaction to winning body target, whereas losing face prime inhibited reaction to winning body target, suggesting that peak facial expressions could be perceived at the implicit level. In general, the results indicate that peak facial expressions cannot be consciously recognized but can be perceived at the unconscious level. In Experiment 2B, revised subliminal affective priming task and a strict awareness test were used to examine the validity of unconscious perception of peak facial expressions found in Experiment 2A. Results of Experiment 2B showed that reaction time to both winning body targets and losing body targets was influenced by the invisibly peak facial expression primes, which indicated the

  1. Implementing peak load reduction algorithms for household electrical appliances

    International Nuclear Information System (INIS)

    Dlamini, Ndumiso G.; Cromieres, Fabien

    2012-01-01

    Considering household appliance automation for reduction of household peak power demand, this study explored aspects of the interaction between household automation technology and human behaviour. Given a programmable household appliance switching system, and user-reported appliance use times, we simulated the load reduction effectiveness of three types of algorithms, which were applied at both the single household level and across all 30 households. All three algorithms effected significant load reductions, while the least-to-highest potential user inconvenience ranking was: coordinating the timing of frequent intermittent loads (algorithm 2); moving period-of-day time-flexible loads to off-peak times (algorithm 1); and applying short-term time delays to avoid high peaks (algorithm 3) (least accommodating). Peak reduction was facilitated by load interruptibility, time of use flexibility and the willingness of users to forgo impulsive appliance use. We conclude that a general factor determining the ability to shift the load due to a particular appliance is the time-buffering between the service delivered and the power demand of an appliance. Time-buffering can be ‘technologically inherent’, due to human habits, or realised by managing user expectations. There are implications for the design of appliances and home automation systems. - Highlights: ► We explored the interaction between appliance automation and human behaviour. ► There is potential for considerable load shifting of household appliances. ► Load shifting for load reduction is eased with increased time buffering. ► Design, human habits and user expectations all influence time buffering. ► Certain automation and appliance design features can facilitate load shifting.

  2. SPANISH PEAKS WILDERNESS STUDY AREA, COLORADO.

    Science.gov (United States)

    Budding, Karin E.; Kluender, Steven E.

    1984-01-01

    A geologic and geochemical investigation and a survey of mines and prospects were conducted to evaluate the mineral-resource potential of the Spanish Peaks Wilderness Study Area, Huerfano and Las Animas Counties, in south-central Colorado. Anomalous gold, silver, copper, lead, and zinc concentrations in rocks and in stream sediments from drainage basins in the vicinity of the old mines and prospects on West Spanish Peak indicate a substantiated mineral-resource potential for base and precious metals in the area surrounding this peak; however, the mineralized veins are sparse, small in size, and generally low in grade. There is a possibility that coal may underlie the study area, but it would be at great depth and it is unlikely that it would have survived the intense igneous activity in the area. There is little likelihood for the occurrence of oil and gas because of the lack of structural traps and the igneous activity.

  3. Analysis of fuel end-temperature peaking

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Z.; Jiang, Q.; Lai, L.; Shams, M. [CANDU Energy Inc., Fuel Engineering Dept., Mississauga, Ontario (Canada)

    2013-07-01

    During normal operation and refuelling of CANDU® fuel, fuel temperatures near bundle ends will increase due to a phenomenon called end flux peaking. Similar phenomenon would also be expected to occur during a postulated large break LOCA event. The end flux peaking in a CANDU fuel element is due to the fact that neutron flux is higher near a bundle end, in contact with a neighbouring bundle or close to heavy water coolant, than in the bundle mid-plane, because of less absorption of thermal neutrons by Zircaloy or heavy water than by the UO{sub 2} material. This paper describes Candu Energy experience in analysing behaviour of bundle due to end flux peaking using fuel codes FEAT, ELESTRES and ELOCA. (author)

  4. Forecasting Strategies for Predicting Peak Electric Load Days

    Science.gov (United States)

    Saxena, Harshit

    Academic institutions spend thousands of dollars every month on their electric power consumption. Some of these institutions follow a demand charges pricing structure; here the amount a customer pays to the utility is decided based on the total energy consumed during the month, with an additional charge based on the highest average power load required by the customer over a moving window of time as decided by the utility. Therefore, it is crucial for these institutions to minimize the time periods where a high amount of electric load is demanded over a short duration of time. In order to reduce the peak loads and have more uniform energy consumption, it is imperative to predict when these peaks occur, so that appropriate mitigation strategies can be developed. The research work presented in this thesis has been conducted for Rochester Institute of Technology (RIT), where the demand charges are decided based on a 15 minute sliding window panned over the entire month. This case study makes use of different statistical and machine learning algorithms to develop a forecasting strategy for predicting the peak electric load days of the month. The proposed strategy was tested for a whole year starting May 2015 to April 2016 during which a total of 57 peak days were observed. The model predicted a total of 74 peak days during this period, 40 of these cases were true positives, hence achieving an accuracy level of 70 percent. The results obtained with the proposed forecasting strategy are promising and demonstrate an annual savings potential worth about $80,000 for a single submeter of RIT.

  5. FAST MUSIC SPECTRUM PEAK SEARCH VIA METROPOLIS-HASTINGS SAMPLER

    Institute of Scientific and Technical Information of China (English)

    Guo Qinghua; Liao Guisheng

    2005-01-01

    A fast MUltiple SIgnal Classification (MUSIC) spectrum peak search algorithm is devised, which regards the power of the MUSIC spectrum function as target distribution up to a constant of proportionality, and uses Metropolis-Hastings (MH) sampler, one of the most popular Markov Chain Monte Carlo (MCMC) techniques, to sample from it. The proposed method reduces greatly the tremendous computation and storage costs in conventional MUSIC techniques i.e., about two and four orders of magnitude in computation and storage costs under the conditions of the experiment in the paper respectively.

  6. The Combinational Use of CRISPR/Cas9 and Targeted Toxin Technology Enables Efficient Isolation of Bi-Allelic Knockout Non-Human Mammalian Clones

    Directory of Open Access Journals (Sweden)

    Satoshi Watanabe

    2018-04-01

    targeted to be knocked out. Our results indicate that a combination of the CRISPR/Cas9 system and targeted toxin technology using IB4SAP allows efficient enrichment of genome-edited clones, particularly bi-allelic KO clones.

  7. Effective climate-energy solutions, escape routes and peak oil

    International Nuclear Information System (INIS)

    Bergh, Jeroen C.J.M. van den

    2012-01-01

    Many well-intended climate-energy strategies are ineffective in the absence of serious environmental regulation. This holds, among others, for direct support of clean energy, voluntary energy conservation, technical standards on a limited set of products, unilateral stringent carbon pricing, and awaiting peak oil as a climate strategy. All of these suffer from “escape routes” that indirectly increase CO 2 emissions and thus make the original strategy ineffective. On the other hand, environmental regulation alone may lead to a myopia-bias, stimulating early dominance of cost-effective technologies and a focus on incremental innovations associated with such technologies rather than on radical innovations. Although adopting a partial viewpoint keeps the analysis simple, we urgently need a more inclusive systems perspective on climate solutions. This will allow the formulation of an effective climate policy package that addresses the various escape routes. - Highlights: ► Many well-intended climate-energy strategies are ineffective because of escape routes. ► In this context the relationship between peak oil and climate policy receives attention. ► Environmental regulation alone creates myopia-bias, the resolution of which requires technology-specific policies. ► To formulate an effective climate policy package an inclusive systems perspective is needed.

  8. Ship Analysis and Detection in High-resolution Pol-SAR Imagery Based on Peak Zone

    Directory of Open Access Journals (Sweden)

    Xu Cheng-bin

    2015-06-01

    Full Text Available To deal with the problem of false alarm in the ship detection, a method base on proportion of spiral scattering in the peak zone is proposed. By comparing the proportion of spiral scattering in the peak zone, which is available from Krogager decomposition, the ships and interfering targets are identified and analyzed. The effectiveness of this method is justified with C-band full-polarization data from RADARSAT-2. The result show that this method can discriminate ships from interfering targets such as island, water-break, nautical platforms and bridges, thus reducing the false alarm rate of ship targets detection in SAR images.

  9. Osteoporosis: Peak Bone Mass in Women

    Science.gov (United States)

    ... bone density are seen even during childhood and adolescence. Hormonal factors. The hormone estrogen has an effect on peak bone mass. For example, women who had their first menstrual cycle at an early age and those who use oral contraceptives, which contain estrogen, often have high bone mineral ...

  10. Facility Location with Double-peaked Preferences

    DEFF Research Database (Denmark)

    Filos-Ratsikas, Aris; Li, Minming; Zhang, Jie

    2015-01-01

    ; this makes the problem essentially more challenging. As our main contribution, we present a simple truthful-in-expectation mechanism that achieves an approximation ratio of 1+b=c for both the social and the maximum, cost, where b is the distance of the agent from the peak and c is the minimum cost...

  11. Robust Peak Recognition in Intracranial Pressure Signals

    Directory of Open Access Journals (Sweden)

    Bergsneider Marvin

    2010-10-01

    Full Text Available Abstract Background The waveform morphology of intracranial pressure pulses (ICP is an essential indicator for monitoring, and forecasting critical intracranial and cerebrovascular pathophysiological variations. While current ICP pulse analysis frameworks offer satisfying results on most of the pulses, we observed that the performance of several of them deteriorates significantly on abnormal, or simply more challenging pulses. Methods This paper provides two contributions to this problem. First, it introduces MOCAIP++, a generic ICP pulse processing framework that generalizes MOCAIP (Morphological Clustering and Analysis of ICP Pulse. Its strength is to integrate several peak recognition methods to describe ICP morphology, and to exploit different ICP features to improve peak recognition. Second, it investigates the effect of incorporating, automatically identified, challenging pulses into the training set of peak recognition models. Results Experiments on a large dataset of ICP signals, as well as on a representative collection of sampled challenging ICP pulses, demonstrate that both contributions are complementary and significantly improve peak recognition performance in clinical conditions. Conclusion The proposed framework allows to extract more reliable statistics about the ICP waveform morphology on challenging pulses to investigate the predictive power of these pulses on the condition of the patient.

  12. Liquid waste processing at Comanche Peak

    International Nuclear Information System (INIS)

    Hughes-Edwards, L.M.; Edwards, J.M.

    1996-01-01

    This article describes the radioactive waste processing at Comanche Peak Steam Electric Station. Topics covered are the following: Reduction of liquid radioactive discharges (system leakage, outage planning); reduction of waste resin generation (waste stream segregation, processing methodology); reduction of activity released and off-site dose. 8 figs., 2 tabs

  13. Hubbert's Peak: the Impending World oil Shortage

    Science.gov (United States)

    Deffeyes, K. S.

    2004-12-01

    Global oil production will probably reach a peak sometime during this decade. After the peak, the world's production of crude oil will fall, never to rise again. The world will not run out of energy, but developing alternative energy sources on a large scale will take at least 10 years. The slowdown in oil production may already be beginning; the current price fluctuations for crude oil and natural gas may be the preamble to a major crisis. In 1956, the geologist M. King Hubbert predicted that U.S. oil production would peak in the early 1970s.1 Almost everyone, inside and outside the oil industry, rejected Hubbert's analysis. The controversy raged until 1970, when the U.S. production of crude oil started to fall. Hubbert was right. Around 1995, several analysts began applying Hubbert's method to world oil production, and most of them estimate that the peak year for world oil will be between 2004 and 2008. These analyses were reported in some of the most widely circulated sources: Nature, Science, and Scientific American.2 None of our political leaders seem to be paying attention. If the predictions are correct, there will be enormous effects on the world economy. Even the poorest nations need fuel to run irrigation pumps. The industrialized nations will be bidding against one another for the dwindling oil supply. The good news is that we will put less carbon dioxide into the atmosphere. The bad news is that my pickup truck has a 25-gallon tank.

  14. Martial arts striking hand peak acceleration, accuracy and consistency.

    Science.gov (United States)

    Neto, Osmar Pinto; Marzullo, Ana Carolina De Miranda; Bolander, Richard P; Bir, Cynthia A

    2013-01-01

    The goal of this paper was to investigate the possible trade-off between peak hand acceleration and accuracy and consistency of hand strikes performed by martial artists of different training experiences. Ten male martial artists with training experience ranging from one to nine years volunteered to participate in the experiment. Each participant performed 12 maximum effort goal-directed strikes. Hand acceleration during the strikes was obtained using a tri-axial accelerometer block. A pressure sensor matrix was used to determine the accuracy and consistency of the strikes. Accuracy was estimated by the radial distance between the centroid of each subject's 12 strikes and the target, whereas consistency was estimated by the square root of the 12 strikes mean squared distance from their centroid. We found that training experience was significantly correlated to hand peak acceleration prior to impact (r(2)=0.456, p =0.032) and accuracy (r(2)=0. 621, p=0.012). These correlations suggest that more experienced participants exhibited higher hand peak accelerations and at the same time were more accurate. Training experience, however, was not correlated to consistency (r(2)=0.085, p=0.413). Overall, our results suggest that martial arts training may lead practitioners to achieve higher striking hand accelerations with better accuracy and no change in striking consistency.

  15. Prediction of peak overlap in NMR spectra

    International Nuclear Information System (INIS)

    Hefke, Frederik; Schmucki, Roland; Güntert, Peter

    2013-01-01

    Peak overlap is one of the major factors complicating the analysis of biomolecular NMR spectra. We present a general method for predicting the extent of peak overlap in multidimensional NMR spectra and its validation using both, experimental data sets and Monte Carlo simulation. The method is based on knowledge of the magnetization transfer pathways of the NMR experiments and chemical shift statistics from the Biological Magnetic Resonance Data Bank. Assuming a normal distribution with characteristic mean value and standard deviation for the chemical shift of each observable atom, an analytic expression was derived for the expected overlap probability of the cross peaks. The analytical approach was verified to agree with the average peak overlap in a large number of individual peak lists simulated using the same chemical shift statistics. The method was applied to eight proteins, including an intrinsically disordered one, for which the prediction results could be compared with the actual overlap based on the experimentally measured chemical shifts. The extent of overlap predicted using only statistical chemical shift information was in good agreement with the overlap that was observed when the measured shifts were used in the virtual spectrum, except for the intrinsically disordered protein. Since the spectral complexity of a protein NMR spectrum is a crucial factor for protein structure determination, analytical overlap prediction can be used to identify potentially difficult proteins before conducting NMR experiments. Overlap predictions can be tailored to particular classes of proteins by preparing statistics from corresponding protein databases. The method is also suitable for optimizing recording parameters and labeling schemes for NMR experiments and improving the reliability of automated spectra analysis and protein structure determination.

  16. The peak in anomalous magnetic viscosity

    International Nuclear Information System (INIS)

    Collocott, S.J.; Watterson, P.A.; Tan, X.H.; Xu, H.

    2014-01-01

    Anomalous magnetic viscosity, where the magnetization as a function of time exhibits non-monotonic behaviour, being seen to increase, reach a peak, and then decrease, is observed on recoil lines in bulk amorphous ferromagnets, for certain magnetic prehistories. A simple geometrical approach based on the motion of the state line on the Preisach plane gives a theoretical framework for interpreting non-monotonic behaviour and explains the origin of the peak. This approach gives an expression for the time taken to reach the peak as a function of the applied (or holding) field. The theory is applied to experimental data for bulk amorphous ferromagnet alloys of composition Nd 60−x Fe 30 Al 10 Dy x , x = 0, 1, 2, 3 and 4, and it gives a reasonable description of the observed behaviour. The role played by other key magnetic parameters, such as the intrinsic coercivity and fluctuation field, is also discussed. When the non-monotonic behaviour of the magnetization of a number of alloys is viewed in the context of the model, features of universal behaviour emerge, that are independent of alloy composition. - Highlights: • Development of a simple geometrical model based on the Preisach model which gives a complete explanation of the peak in the magnetic viscosity. • Geometrical approach is extended by considering equations that govern the motion of the state line. • The model is used to deduce the relationship between the holding field and the time it takes to reach the peak. • The model is tested with experimental results for a range of Nd–Fe–Al–Dy bulk amorphous ferromagnets. • There is good agreement between the model and the experimental data

  17. The spatial resolution of epidemic peaks.

    Directory of Open Access Journals (Sweden)

    Harriet L Mills

    2014-04-01

    Full Text Available The emergence of novel respiratory pathogens can challenge the capacity of key health care resources, such as intensive care units, that are constrained to serve only specific geographical populations. An ability to predict the magnitude and timing of peak incidence at the scale of a single large population would help to accurately assess the value of interventions designed to reduce that peak. However, current disease-dynamic theory does not provide a clear understanding of the relationship between: epidemic trajectories at the scale of interest (e.g. city; population mobility; and higher resolution spatial effects (e.g. transmission within small neighbourhoods. Here, we used a spatially-explicit stochastic meta-population model of arbitrary spatial resolution to determine the effect of resolution on model-derived epidemic trajectories. We simulated an influenza-like pathogen spreading across theoretical and actual population densities and varied our assumptions about mobility using Latin-Hypercube sampling. Even though, by design, cumulative attack rates were the same for all resolutions and mobilities, peak incidences were different. Clear thresholds existed for all tested populations, such that models with resolutions lower than the threshold substantially overestimated population-wide peak incidence. The effect of resolution was most important in populations which were of lower density and lower mobility. With the expectation of accurate spatial incidence datasets in the near future, our objective was to provide a framework for how to use these data correctly in a spatial meta-population model. Our results suggest that there is a fundamental spatial resolution for any pathogen-population pair. If underlying interactions between pathogens and spatially heterogeneous populations are represented at this resolution or higher, accurate predictions of peak incidence for city-scale epidemics are feasible.

  18. Science + Technology = Intelligence on Target

    Science.gov (United States)

    2008-03-01

    that now it includes almost all states in the West except for perhaps California. Th is is caused by a prion. Prion is a protein with no nucleic acid...kind of a dinosaur or a pachyderm, kind of lumbering along that blue shallow curve where we may invest ten years and $10 billion to get a ten percent

  19. Mineral Resources: Reserves, Peak Production and the Future

    Directory of Open Access Journals (Sweden)

    Lawrence D. Meinert

    2016-02-01

    Full Text Available The adequacy of mineral resources in light of population growth and rising standards of living has been a concern since the time of Malthus (1798, but many studies erroneously forecast impending peak production or exhaustion because they confuse reserves with “all there is”. Reserves are formally defined as a subset of resources, and even current and potential resources are only a small subset of “all there is”. Peak production or exhaustion cannot be modeled accurately from reserves. Using copper as an example, identified resources are twice as large as the amount projected to be needed through 2050. Estimates of yet-to-be discovered copper resources are up to 40-times more than currently-identified resources, amounts that could last for many centuries. Thus, forecasts of imminent peak production due to resource exhaustion in the next 20–30 years are not valid. Short-term supply problems may arise, however, and supply-chain disruptions are possible at any time due to natural disasters (earthquakes, tsunamis, hurricanes or political complications. Needed to resolve these problems are education and exploration technology development, access to prospective terrain, better recycling and better accounting of externalities associated with production (pollution, loss of ecosystem services and water and energy use.

  20. Degradation of the Bragg peak due to inhomogeneities.

    Science.gov (United States)

    Urie, M; Goitein, M; Holley, W R; Chen, G T

    1986-01-01

    The rapid fall-off of dose at the end of range of heavy charged particle beams has the potential in therapeutic applications of sparing critical structures just distal to the target volume. Here we explored the effects of highly inhomogeneous regions on this desirable depth-dose characteristic. The proton depth-dose distribution behind a lucite-air interface parallel to the beam was bimodal, indicating the presence of two groups of protons with different residual ranges, creating a step-like depth-dose distribution at the end of range. The residual ranges became more spread out as the interface was angled at 3 degrees, and still more at 6 degrees, to the direction of the beam. A second experiment showed little significant effect on the distal depth-dose of protons having passed through a mosaic of teflon and lucite. Anatomic studies demonstrated significant effects of complex fine inhomogeneities on the end of range characteristics. Monoenergetic protons passing through the petrous ridges and mastoid air cells in the base of skull showed a dramatic degradation of the distal Bragg peak. In beams with spread out Bragg peaks passing through regions of the base of skull, the distal fall-off from 90 to 20% dose was increased from its nominal 6 to well over 32 mm. Heavy ions showed a corresponding degradation in their ends of range. In the worst case in the base of skull region, a monoenergetic neon beam showed a broadening of the full width at half maximum of the Bragg peak to over 15 mm (compared with 4 mm in a homogeneous unit density medium). A similar effect was found with carbon ions in the abdomen, where the full width at half maximum of the Bragg peak (nominally 5.5 mm) was found to be greater than 25 mm behind gas-soft-tissue interfaces. We address the implications of these data for dose computation with heavy charged particles.

  1. The cost of electrolytic hydrogen from off-peak power

    International Nuclear Information System (INIS)

    Stucki, S.

    1991-01-01

    The cost of electrolytic hydrogen depends on the capacity factor of the plant and the cost of electricity. Both these parameters are correlated if off-peak power is to be used for hydrogen production. Based on assumptions regarding the correlation between the electricity price and the availability of electric power, optimizations were run using a simple cost model for the electrolysis plant. The current density at which the electrolysis plant would be run is taken as a variable for optimization as well as the annual time of availability of electric power. The results of the optimizations show for a number of hypothetical electrolyser types that the optimum operation time or electricity price do not depend much on the technology used. Production cost of electrolytic hydrogen can, however, be cut by 30% by using advanced electrolysis technology. (author)

  2. Mean and peak wind load reduction on heliostats

    Energy Technology Data Exchange (ETDEWEB)

    Peterka, J.A.; Tan, L.; Bienkiewcz, B.; Cermak, J.E.

    1987-09-01

    This report presents the results of wind-tunnel tests supported through the Solar Energy Research Institute (SERI) by the Office of Solar Thermal Technology of the US Department of Energy as part of the SERI research effort on innovative concentrators. As gravity loads on drive mechanisms are reduced through stretched-membrane technology, the wind-load contribution of the required drive capacity increases in percentage. Reduction of wind loads can provide economy in support structure and heliostat drive. Wind-tunnel tests have been directed at finding methods to reduce wind loads on heliostats. The tests investigated both mean and peak forces, and moments. A significant increase in ability to predict heliostat wind loads and their reduction within a heliostat field was achieved. In addition, a preliminary review of wind loads on parabolic dish collectors was conducted, resulting in a recommended research program for these type collectors. 42 refs., 38 figs., 1 tab.

  3. Central peaking of magnetized gas discharges

    International Nuclear Information System (INIS)

    Chen, Francis F.; Curreli, Davide

    2013-01-01

    Partially ionized gas discharges used in industry are often driven by radiofrequency (rf) power applied at the periphery of a cylinder. It is found that the plasma density n is usually flat or peaked on axis even if the skin depth of the rf field is thin compared with the chamber radius a. Previous attempts at explaining this did not account for the finite length of the discharge and the boundary conditions at the endplates. A simple 1D model is used to focus on the basic mechanism: the short-circuit effect. It is found that a strong electric field (E-field) scaled to electron temperature T e , drives the ions inward. The resulting density profile is peaked on axis and has a shape independent of pressure or discharge radius. This “universal” profile is not affected by a dc magnetic field (B-field) as long as the ion Larmor radius is larger than a

  4. Peak Oil, Food Systems, and Public Health

    Science.gov (United States)

    Parker, Cindy L.; Kirschenmann, Frederick L.; Tinch, Jennifer; Lawrence, Robert S.

    2011-01-01

    Peak oil is the phenomenon whereby global oil supplies will peak, then decline, with extraction growing increasingly costly. Today's globalized industrial food system depends on oil for fueling farm machinery, producing pesticides, and transporting goods. Biofuels production links oil prices to food prices. We examined food system vulnerability to rising oil prices and the public health consequences. In the short term, high food prices harm food security and equity. Over time, high prices will force the entire food system to adapt. Strong preparation and advance investment may mitigate the extent of dislocation and hunger. Certain social and policy changes could smooth adaptation; public health has an essential role in promoting a proactive, smart, and equitable transition that increases resilience and enables adequate food for all. PMID:21778492

  5. Hanford Site peak gust wind speeds

    International Nuclear Information System (INIS)

    Ramsdell, J.V.

    1998-01-01

    Peak gust wind data collected at the Hanford Site since 1945 are analyzed to estimate maximum wind speeds for use in structural design. The results are compared with design wind speeds proposed for the Hanford Site. These comparisons indicate that design wind speeds contained in a January 1998 advisory changing DOE-STD-1020-94 are excessive for the Hanford Site and that the design wind speeds in effect prior to the changes are still appropriate for the Hanford Site

  6. Commodity hydrogen from off-peak electricity

    Energy Technology Data Exchange (ETDEWEB)

    Darrow, K.; Biederman, N.; Konopka, A.

    1977-01-01

    This paper considers the use of off-peak electrical power as an energy source for the electrolytic production of hydrogen. The present industrial uses for hydrogen are examined to determine if hydrogen produced in this fashion would be competitive with the industry's onsite production or existing hydrogen prices. The paper presents a technical and economic feasibility analysis of the various components required and of the operation of the system as a whole including production, transmission, storage, and markets.

  7. Some practical aspects of peak kilovoltage measurements

    International Nuclear Information System (INIS)

    Irfan, A.Y.; Pugh, V.I.; Jeffery, C.D.

    1985-01-01

    The peak kilovoltage (kVsub(p)) across the X-ray tube electrodes in diagnostic X-ray machines is a most important parameter, affecting both radiation output and beam quality. Four commercially available non-invasive devices used for kVsub(p) measurement were tested using a selection of generator waveforms. The majority of the devices provided satisfactory measurements of the kVsub(p) to within approximately +- kV provided certain operating conditions are observed. (U.K.)

  8. METing SUSY on the Z peak

    Energy Technology Data Exchange (ETDEWEB)

    Barenboim, G.; Bernabeu, J.; Vives, O. [Universitat de Valencia, Departament de Fisica Teorica, Burjassot (Spain); Universitat de Valencia-CSIC, Parc Cientific U.V., IFIC, Paterna (Spain); Mitsou, V.A.; Romero, E. [Universitat de Valencia-CSIC, Parc Cientific U.V., IFIC, Paterna (Spain)

    2016-02-15

    Recently the ATLAS experiment announced a 3 σ excess at the Z-peak consisting of 29 pairs of leptons together with two or more jets, E{sub T}{sup miss} > 225 GeV and HT > 600 GeV, to be compared with 10.6 ± 3.2 expected lepton pairs in the Standard Model. No excess outside the Z-peak was observed. By trying to explain this signal with SUSY we find that only relatively light gluinos, m{sub g} or similar 400 GeV decaying predominantly to Z-boson plus a light gravitino, such that nearly every gluino produces at least one Z-boson in its decay chain, could reproduce the excess. We construct an explicit general gauge mediation model able to reproduce the observed signal overcoming all the experimental limits. Needless to say, more sophisticated models could also reproduce the signal, however, any model would have to exhibit the following features: light gluinos, or heavy particles with a strong production cross section, producing at least one Z-boson in its decay chain. The implications of our findings for the Run II at LHC with the scaling on the Z peak, as well as for the direct search of gluinos and other SUSY particles, are pointed out. (orig.)

  9. Acquisition of peak responding: what is learned?

    Science.gov (United States)

    Balci, Fuat; Gallistel, Charles R; Allen, Brian D; Frank, Krystal M; Gibson, Jacqueline M; Brunner, Daniela

    2009-01-01

    We investigated how the common measures of timing performance behaved in the course of training on the peak procedure in C3H mice. Following fixed interval (FI) pre-training, mice received 16 days of training in the peak procedure. The peak time and spread were derived from the average response rates while the start and stop times and their relative variability were derived from a single-trial analysis. Temporal precision (response spread) appeared to improve in the course of training. This apparent improvement in precision was, however, an averaging artifact; it was mediated by the staggered appearance of timed stops, rather than by the delayed occurrence of start times. Trial-by-trial analysis of the stop times for individual subjects revealed that stops appeared abruptly after three to five sessions and their timing did not change as training was prolonged. Start times and the precision of start and stop times were generally stable throughout training. Our results show that subjects do not gradually learn to time their start or stop of responding. Instead, they learn the duration of the FI, with robust temporal control over the start of the response; the control over the stop of response appears abruptly later.

  10. METing SUSY on the Z peak

    International Nuclear Information System (INIS)

    Barenboim, G.; Bernabeu, J.; Vives, O.; Mitsou, V.A.; Romero, E.

    2016-01-01

    Recently the ATLAS experiment announced a 3 σ excess at the Z-peak consisting of 29 pairs of leptons together with two or more jets, E T miss > 225 GeV and HT > 600 GeV, to be compared with 10.6 ± 3.2 expected lepton pairs in the Standard Model. No excess outside the Z-peak was observed. By trying to explain this signal with SUSY we find that only relatively light gluinos, m g or similar 400 GeV decaying predominantly to Z-boson plus a light gravitino, such that nearly every gluino produces at least one Z-boson in its decay chain, could reproduce the excess. We construct an explicit general gauge mediation model able to reproduce the observed signal overcoming all the experimental limits. Needless to say, more sophisticated models could also reproduce the signal, however, any model would have to exhibit the following features: light gluinos, or heavy particles with a strong production cross section, producing at least one Z-boson in its decay chain. The implications of our findings for the Run II at LHC with the scaling on the Z peak, as well as for the direct search of gluinos and other SUSY particles, are pointed out. (orig.)

  11. Monitoring device for local power peaking coefficients

    International Nuclear Information System (INIS)

    Mihashi, Ishi

    1987-01-01

    Purpose: To determine and monitor the local power peaking coefficients by a method not depending on the combination of fuel types. Constitution: Representative values for the local power distribution can be obtained by determining corresponding burn-up degrees based on the burn-up degree of each of fuel assembly segments obtained in a power distribution monitor and by the interpolation and extrapolation of void coefficients. The typical values are multiplied with compensation coefficients for the control rod effect and coefficients for compensating the effect of adjacent fuel assemblies in a calculation device to obtain typical values for the present local power distribution compensated with all of the effects. Further, the calculation device compares them with typical values of the present local power distribution to obtain an aimed local power peaking coefficient as the maximum value thereof. According to the present invention, since the local power peaking coefficients can be determined not depending on the combination of the kind of fuels, if the combination of fuel assemblies is increased upon fuel change, the amount of operation therefor is not increased. (Kamimura, M.)

  12. Particle creation by peak electric field

    Energy Technology Data Exchange (ETDEWEB)

    Adorno, T.C. [Tomsk State University, Department of Physics, Tomsk (Russian Federation); Gavrilov, S.P. [Tomsk State University, Department of Physics, Tomsk (Russian Federation); Herzen State Pedagogical University of Russia, Department of General and Experimental Physics, St. Petersburg (Russian Federation); Gitman, D.M. [Tomsk State University, Department of Physics, Tomsk (Russian Federation); P. N. Lebedev Physical Institute, Moscow (Russian Federation); University of Sao Paulo, Institute of Physics, CP 66318, Sao Paulo, SP (Brazil)

    2016-08-15

    The particle creation by the so-called peak electric field is considered. The latter field is a combination of two exponential parts, one exponentially increasing and another exponentially decreasing. We find exact solutions of the Dirac equation with the field under consideration with appropriate asymptotic conditions and calculate all the characteristics of particle creation effect, in particular, differential mean numbers of created particle, total number of created particles, and the probability for a vacuum to remain a vacuum. Characteristic asymptotic regimes are discussed in detail and a comparison with the pure asymptotically decaying field is considered. (orig.)

  13. Octant vectorcardiography - the evaluation by peaks.

    Science.gov (United States)

    Laufberger, V

    1982-01-01

    From the Frank lead potentials a computer prints out an elementary table. Therein, the electrical space of left ventricle depolarization is divided into eight spatial parts labelled by numbers 1-8 and called octants. Within these octants six peaks are determined labelled with letters ALPR-IS. Their localization is described by six-digit topograms characteristic for each patient. From 300 cases of patients after myocardial infarction, three data bases were compiled enabling every case to be classified into classes, subclasses and types. The follow up of patients according to these principles gives an objective and detailed image about the progress of coronary artery disease.

  14. Energy peaks: A high energy physics outlook

    Science.gov (United States)

    Franceschini, Roberto

    2017-12-01

    Energy distributions of decay products carry information on the kinematics of the decay in ways that are at the same time straightforward and quite hidden. I will review these properties and discuss their early historical applications, as well as more recent ones in the context of (i) methods for the measurement of masses of new physics particle with semi-invisible decays, (ii) the characterization of Dark Matter particles produced at colliders, (iii) precision mass measurements of Standard Model particles, in particular of the top quark. Finally, I will give an outlook of further developments and applications of energy peak method for high energy physics at colliders and beyond.

  15. A non-parametric peak calling algorithm for DamID-Seq.

    Directory of Open Access Journals (Sweden)

    Renhua Li

    Full Text Available Protein-DNA interactions play a significant role in gene regulation and expression. In order to identify transcription factor binding sites (TFBS of double sex (DSX-an important transcription factor in sex determination, we applied the DNA adenine methylation identification (DamID technology to the fat body tissue of Drosophila, followed by deep sequencing (DamID-Seq. One feature of DamID-Seq data is that induced adenine methylation signals are not assured to be symmetrically distributed at TFBS, which renders the existing peak calling algorithms for ChIP-Seq, including SPP and MACS, inappropriate for DamID-Seq data. This challenged us to develop a new algorithm for peak calling. A challenge in peaking calling based on sequence data is estimating the averaged behavior of background signals. We applied a bootstrap resampling method to short sequence reads in the control (Dam only. After data quality check and mapping reads to a reference genome, the peaking calling procedure compromises the following steps: 1 reads resampling; 2 reads scaling (normalization and computing signal-to-noise fold changes; 3 filtering; 4 Calling peaks based on a statistically significant threshold. This is a non-parametric method for peak calling (NPPC. We also used irreproducible discovery rate (IDR analysis, as well as ChIP-Seq data to compare the peaks called by the NPPC. We identified approximately 6,000 peaks for DSX, which point to 1,225 genes related to the fat body tissue difference between female and male Drosophila. Statistical evidence from IDR analysis indicated that these peaks are reproducible across biological replicates. In addition, these peaks are comparable to those identified by use of ChIP-Seq on S2 cells, in terms of peak number, location, and peaks width.

  16. A non-parametric peak calling algorithm for DamID-Seq.

    Science.gov (United States)

    Li, Renhua; Hempel, Leonie U; Jiang, Tingbo

    2015-01-01

    Protein-DNA interactions play a significant role in gene regulation and expression. In order to identify transcription factor binding sites (TFBS) of double sex (DSX)-an important transcription factor in sex determination, we applied the DNA adenine methylation identification (DamID) technology to the fat body tissue of Drosophila, followed by deep sequencing (DamID-Seq). One feature of DamID-Seq data is that induced adenine methylation signals are not assured to be symmetrically distributed at TFBS, which renders the existing peak calling algorithms for ChIP-Seq, including SPP and MACS, inappropriate for DamID-Seq data. This challenged us to develop a new algorithm for peak calling. A challenge in peaking calling based on sequence data is estimating the averaged behavior of background signals. We applied a bootstrap resampling method to short sequence reads in the control (Dam only). After data quality check and mapping reads to a reference genome, the peaking calling procedure compromises the following steps: 1) reads resampling; 2) reads scaling (normalization) and computing signal-to-noise fold changes; 3) filtering; 4) Calling peaks based on a statistically significant threshold. This is a non-parametric method for peak calling (NPPC). We also used irreproducible discovery rate (IDR) analysis, as well as ChIP-Seq data to compare the peaks called by the NPPC. We identified approximately 6,000 peaks for DSX, which point to 1,225 genes related to the fat body tissue difference between female and male Drosophila. Statistical evidence from IDR analysis indicated that these peaks are reproducible across biological replicates. In addition, these peaks are comparable to those identified by use of ChIP-Seq on S2 cells, in terms of peak number, location, and peaks width.

  17. Method and apparatus for current-output peak detection

    Science.gov (United States)

    De Geronimo, Gianluigi

    2017-01-24

    A method and apparatus for a current-output peak detector. A current-output peak detector circuit is disclosed and works in two phases. The peak detector circuit includes switches to switch the peak detector circuit from the first phase to the second phase upon detection of the peak voltage of an input voltage signal. The peak detector generates a current output with a high degree of accuracy in the second phase.

  18. Computation of peak discharge at culverts

    Science.gov (United States)

    Carter, Rolland William

    1957-01-01

    Methods for computing peak flood flow through culverts on the basis of a field survey of highwater marks and culvert geometry are presented. These methods are derived from investigations of culvert flow as reported in the literature and on extensive laboratory studies of culvert flow. For convenience in computation, culvert flow has been classified into six types, according to the location of the control section and the relative heights of the head-water and tail-water levels. The type of flow which occurred at any site can be determined from the field data and the criteria given in this report. A discharge equation has been developed for each flow type by combining the energy and continuity equations for the distance between an approach section upstream from the culvert and a terminal section within the culvert barrel. The discharge coefficient applicable to each flow type is listed for the more common entrance geometries. Procedures for computing peak discharge through culverts are outlined in detail for each of the six flow types.

  19. Comparison of five portable peak flow meters.

    Science.gov (United States)

    Takara, Glaucia Nency; Ruas, Gualberto; Pessoa, Bruna Varanda; Jamami, Luciana Kawakami; Di Lorenzo, Valéria Amorim Pires; Jamami, Mauricio

    2010-05-01

    To compare the measurements of spirometric peak expiratory flow (PEF) from five different PEF meters and to determine if their values are in agreement. Inaccurate equipment may result in incorrect diagnoses of asthma and inappropriate treatments. Sixty-eight healthy, sedentary and insufficiently active subjects, aged from 19 to 40 years, performed PEF measurements using Air Zone, Assess, Galemed, Personal Best and Vitalograph peak flow meters. The highest value recorded for each subject for each device was compared to the corresponding spirometric values using Friedman's test with Dunn's post-hoc (pmeters were 428 (263-688 L/min), 450 (350-800 L/min), 420 (310-720 L/min), 380 (300-735 L/min), 400 (310-685 L/min) and 415 (335-610 L/min), respectively. Significant differences were found when the spirometric values were compared to those recorded by the Air Zone(R) (pmeters. There was no agreement between the spirometric values and the five PEF meters. The results suggest that the values recorded from Galemed meters may underestimate the actual value, which could lead to unnecessary interventions, and that Air Zone meters overestimate spirometric values, which could obfuscate the need for intervention. These findings must be taken into account when interpreting both devices' results in younger people. These differences should also be considered when directly comparing values from different types of PEF meters.

  20. Monitoring device for local power peaking coefficient

    International Nuclear Information System (INIS)

    Mitsuhashi, Ishi

    1987-01-01

    Purpose: To monitor the local power peaking coefficients obtained by the method not depending on the combination of fuel types. Method: A plurality of representative values for the local power distribution determined by the nuclear constant calculation for one fuel assembly are memorized regarding each of the burn-up degree and the void coefficient on every positions and fuel types in fuel rod assemblies. While on the other hand, the representative values for the local power distribution as described above are compensated by a compensation coefficient considering the effect of adjacent segments and a control rod compensation coefficient considering the effect due to the control rod insertion relative to the just-mentioned compensation coefficient. Then, the maximum value among them is selected to determine the local power peaking coefficient at each of the times and each of the segments, which is monitored. According to this system, the calculation and the working required for the fitting work depending on the combination of fuel types are no more required at all to facilitate the maintenance as well. (Horiuchi, T.)

  1. Peak capacity and peak capacity per unit time in capillary and microchip zone electrophoresis.

    Science.gov (United States)

    Foley, Joe P; Blackney, Donna M; Ennis, Erin J

    2017-11-10

    The origins of the peak capacity concept are described and the important contributions to the development of that concept in chromatography and electrophoresis are reviewed. Whereas numerous quantitative expressions have been reported for one- and two-dimensional separations, most are focused on chromatographic separations and few, if any, quantitative unbiased expressions have been developed for capillary or microchip zone electrophoresis. Making the common assumption that longitudinal diffusion is the predominant source of zone broadening in capillary electrophoresis, analytical expressions for the peak capacity are derived, first in terms of migration time, diffusion coefficient, migration distance, and desired resolution, and then in terms of the remaining underlying fundamental parameters (electric field, electroosmotic and electrophoretic mobilities) that determine the migration time. The latter expressions clearly illustrate the direct square root dependence of peak capacity on electric field and migration distance and the inverse square root dependence on solute diffusion coefficient. Conditions that result in a high peak capacity will result in a low peak capacity per unit time and vice-versa. For a given symmetrical range of relative electrophoretic mobilities for co- and counter-electroosmotic species (cations and anions), the peak capacity increases with the square root of the electric field even as the temporal window narrows considerably, resulting in a significant reduction in analysis time. Over a broad relative electrophoretic mobility interval [-0.9, 0.9], an approximately two-fold greater amount of peak capacity can be generated for counter-electroosmotic species although it takes about five-fold longer to do so, consistent with the well-known bias in migration time and resolving power for co- and counter-electroosmotic species. The optimum lower bound of the relative electrophoretic mobility interval [μ r,Z , μ r,A ] that provides the maximum

  2. Energy solutions for CO2 emission peak and subsequent decline. Proceedings

    Energy Technology Data Exchange (ETDEWEB)

    Soenderberg Petersen, L; Larsen, Hans [eds.

    2009-09-15

    The conference focused on: 1) Future global energy development options Scenario and policy issues. 2) Measures to achieve CO2 emission peak in 2015 - 2020 and subsequent decline. 3) Renewable energy supply technologies such as bioenergy, wind and solar. 4) Centralized energy technologies such as clean coal technologies. 5) Energy conversion, energy carriers and energy storage, including fuel cells and hydrogen technologies. 6) Providing renewable energy for the transport sector. 7) Systems aspects for the various regions throughout the world. 8) End-use technologies, efficiency improvements in supply and end use. 9) Energy savings. (au)

  3. Technical Potential for Peak Load Management Programs in New Jersey

    Energy Technology Data Exchange (ETDEWEB)

    Kirby, B.J.

    2002-12-13

    Restructuring is attempting to bring the economic efficiency of competitive markets to the electric power industry. To at least some extent it is succeeding. New generation is being built in most areas of the country reversing the decades-long trend of declining reserve margins. Competition among generators is typically robust, holding down wholesale energy prices. Generators have shown that they are very responsive to price signals in both the short and long term. But a market that is responsive only on the supply side is only half a market. Demand response (elasticity) is necessary to gain the full economic advantages that restructuring can offer. Electricity is a form of energy that is difficult to store economically in large quantities. However, loads often have some ability to (1) conveniently store thermal energy and (2) defer electricity consumption. These inherent storage and control capabilities can be exploited to help reduce peak electric system consumption. In some cases they can also be used to provide system reliability reserves. Fortunately too, technology is helping. Advances in communications and control technologies are making it possible for loads ranging from residential through commercial and industrial to respond to economic signals. When we buy bananas, we don't simply take a dozen and wait a month to find out what the price was. We always ask about the price before we decide how many bananas we want. Technology is beginning to allow at least some customers to think about their electricity consumption the same way they think about most of their other purchases. And power system operators and regulators are beginning to understand that customers need to remain in control of their own destinies. Many customers (residential through industrial) are willing to respond to price signals. Most customers are not able to commit to specific responses months or years in advance. Electricity is a fluid market commodity with a volatile value to both

  4. Combining automated peak tracking in SAR by NMR with structure-based backbone assignment from 15N-NOESY

    KAUST Repository

    Jang, Richard; Gao, Xin; Li, Ming

    2012-01-01

    Background: Chemical shift mapping is an important technique in NMR-based drug screening for identifying the atoms of a target protein that potentially bind to a drug molecule upon the molecule's introduction in increasing concentrations. The goal is to obtain a mapping of peaks with known residue assignment from the reference spectrum of the unbound protein to peaks with unknown assignment in the target spectrum of the bound protein. Although a series of perturbed spectra help to trace a path from reference peaks to target peaks, a one-to-one mapping generally is not possible, especially for large proteins, due to errors, such as noise peaks, missing peaks, missing but then reappearing, overlapped, and new peaks not associated with any peaks in the reference. Due to these difficulties, the mapping is typically done manually or semi-automatically, which is not efficient for high-throughput drug screening.Results: We present PeakWalker, a novel peak walking algorithm for fast-exchange systems that models the errors explicitly and performs many-to-one mapping. On the proteins: hBclXL, UbcH5B, and histone H1, it achieves an average accuracy of over 95% with less than 1.5 residues predicted per target peak. Given these mappings as input, we present PeakAssigner, a novel combined structure-based backbone resonance and NOE assignment algorithm that uses just 15N-NOESY, while avoiding TOCSY experiments and 13C-labeling, to resolve the ambiguities for a one-to-one mapping. On the three proteins, it achieves an average accuracy of 94% or better.Conclusions: Our mathematical programming approach for modeling chemical shift mapping as a graph problem, while modeling the errors directly, is potentially a time- and cost-effective first step for high-throughput drug screening based on limited NMR data and homologous 3D structures. 2012 Jang et al.; licensee BioMed Central Ltd.

  5. Combining automated peak tracking in SAR by NMR with structure-based backbone assignment from 15N-NOESY

    KAUST Repository

    Jang, Richard

    2012-03-21

    Background: Chemical shift mapping is an important technique in NMR-based drug screening for identifying the atoms of a target protein that potentially bind to a drug molecule upon the molecule\\'s introduction in increasing concentrations. The goal is to obtain a mapping of peaks with known residue assignment from the reference spectrum of the unbound protein to peaks with unknown assignment in the target spectrum of the bound protein. Although a series of perturbed spectra help to trace a path from reference peaks to target peaks, a one-to-one mapping generally is not possible, especially for large proteins, due to errors, such as noise peaks, missing peaks, missing but then reappearing, overlapped, and new peaks not associated with any peaks in the reference. Due to these difficulties, the mapping is typically done manually or semi-automatically, which is not efficient for high-throughput drug screening.Results: We present PeakWalker, a novel peak walking algorithm for fast-exchange systems that models the errors explicitly and performs many-to-one mapping. On the proteins: hBclXL, UbcH5B, and histone H1, it achieves an average accuracy of over 95% with less than 1.5 residues predicted per target peak. Given these mappings as input, we present PeakAssigner, a novel combined structure-based backbone resonance and NOE assignment algorithm that uses just 15N-NOESY, while avoiding TOCSY experiments and 13C-labeling, to resolve the ambiguities for a one-to-one mapping. On the three proteins, it achieves an average accuracy of 94% or better.Conclusions: Our mathematical programming approach for modeling chemical shift mapping as a graph problem, while modeling the errors directly, is potentially a time- and cost-effective first step for high-throughput drug screening based on limited NMR data and homologous 3D structures. 2012 Jang et al.; licensee BioMed Central Ltd.

  6. Peaking for optimal performance: Research limitations and future directions.

    Science.gov (United States)

    Pyne, David B; Mujika, Iñigo; Reilly, Thomas

    2009-02-01

    A key element of the physical preparation of athletes is the taper period in the weeks immediately preceding competition. Existing research has defined the taper, identified various forms used in contemporary sport, and examined the prescription of training volume, load, intensity, duration, and type (progressive or step). Current limitations include: the lack of studies on team, combative, racquet, and precision (target) sports; the relatively small number of randomized controlled trials; the narrow focus on a single competition (single peak) compared with multiple peaking for weekly, multi-day or multiple events; and limited understanding of the physiological, neuromuscular, and biomechanical basis of the taper. Future research should address these limitations, together with the influence of prior training on optimal tapering strategies, and the interactions between the taper and long-haul travel, heat, and altitude. Practitioners seek information on how to prescribe tapers from season to season during an athlete's career, or a team's progression through a domestic league season, or multi-year Olympic or World Cup cycle. Practical guidelines for planning effective tapers for the Vancouver 2010 and London 2012 Olympics will evolve from both experimental investigations and modelling of successful tapers currently employed in a wide range of sports.

  7. Fusion target design

    International Nuclear Information System (INIS)

    Bangerter, R.O.

    1978-01-01

    Most detailed fusion target design is done by numerical simulation using large computers. Although numerical simulation is briefly discussed, this lecture deals primarily with the way in which basic physical arguments, driver technology considerations and economical power production requirements are used to guide and augment the simulations. Physics topics discussed include target energetics, preheat, stability and symmetry. A specific design example is discussed

  8. Peak Wind Tool for General Forecasting

    Science.gov (United States)

    Barrett, Joe H., III

    2010-01-01

    The expected peak wind speed of the day is an important forecast element in the 45th Weather Squadron's (45 WS) daily 24-Hour and Weekly Planning Forecasts. The forecasts are used for ground and space launch operations at the Kennedy Space Center (KSC) and Cape Canaveral Air Force Station (CCAFS). The 45 WS also issues wind advisories for KSC/CCAFS when they expect wind gusts to meet or exceed 25 kt, 35 kt and 50 kt thresholds at any level from the surface to 300 ft. The 45 WS forecasters have indicated peak wind speeds are challenging to forecast, particularly in the cool season months of October - April. In Phase I of this task, the Applied Meteorology Unit (AMU) developed a tool to help the 45 WS forecast non-convective winds at KSC/CCAFS for the 24-hour period of 0800 to 0800 local time. The tool was delivered as a Microsoft Excel graphical user interface (GUI). The GUI displayed the forecast of peak wind speed, 5-minute average wind speed at the time of the peak wind, timing of the peak wind and probability the peak speed would meet or exceed 25 kt, 35 kt and 50 kt. For the current task (Phase II ), the 45 WS requested additional observations be used for the creation of the forecast equations by expanding the period of record (POR). Additional parameters were evaluated as predictors, including wind speeds between 500 ft and 3000 ft, static stability classification, Bulk Richardson Number, mixing depth, vertical wind shear, temperature inversion strength and depth and wind direction. Using a verification data set, the AMU compared the performance of the Phase I and II prediction methods. Just as in Phase I, the tool was delivered as a Microsoft Excel GUI. The 45 WS requested the tool also be available in the Meteorological Interactive Data Display System (MIDDS). The AMU first expanded the POR by two years by adding tower observations, surface observations and CCAFS (XMR) soundings for the cool season months of March 2007 to April 2009. The POR was expanded

  9. Peak clustering in two-dimensional gas chromatography with mass spectrometric detection based on theoretical calculation of two-dimensional peak shapes: the 2DAid approach.

    Science.gov (United States)

    van Stee, Leo L P; Brinkman, Udo A Th

    2011-10-28

    A method is presented to facilitate the non-target analysis of data obtained in temperature-programmed comprehensive two-dimensional (2D) gas chromatography coupled to time-of-flight mass spectrometry (GC×GC-ToF-MS). One main difficulty of GC×GC data analysis is that each peak is usually modulated several times and therefore appears as a series of peaks (or peaklets) in the one-dimensionally recorded data. The proposed method, 2DAid, uses basic chromatographic laws to calculate the theoretical shape of a 2D peak (a cluster of peaklets originating from the same analyte) in order to define the area in which the peaklets of each individual compound can be expected to show up. Based on analyte-identity information obtained by means of mass spectral library searching, the individual peaklets are then combined into a single 2D peak. The method is applied, amongst others, to a complex mixture containing 362 analytes. It is demonstrated that the 2D peak shapes can be accurately predicted and that clustering and further processing can reduce the final peak list to a manageable size. Copyright © 2011 Elsevier B.V. All rights reserved.

  10. Peak Electric Load Relief in Northern Manhattan

    Directory of Open Access Journals (Sweden)

    Hildegaard D. Link

    2014-08-01

    Full Text Available The aphorism “Think globally, act locally,” attributed to René Dubos, reflects the vision that the solution to global environmental problems must begin with efforts within our communities. PlaNYC 2030, the New York City sustainability plan, is the starting point for this study. Results include (a a case study based on the City College of New York (CCNY energy audit, in which we model the impacts of green roofs on campus energy demand and (b a case study of energy use at the neighborhood scale. We find that reducing the urban heat island effect can reduce building cooling requirements, peak electricity loads stress on the local electricity grid and improve urban livability.

  11. Complex behavior of elevators in peak traffic

    Science.gov (United States)

    Nagatani, Takashi

    2003-08-01

    We study the dynamical behavior of elevators in the morning peak traffic. We present a stochastic model of the elevators to take into account the interactions between elevators through passengers. The dynamics of the elevators is expressed in terms of a coupled nonlinear map with noises. The number of passengers carried by an elevator and the time-headway between elevators exhibit the complex behavior with varying elevator trips. It is found that the behavior of elevators exhibits a deterministic chaos even if there are no noises. The chaotic motion depends on the loading parameter, the maximum capacity of an elevator, and the number of elevators. When the loading parameter is superior to the threshold, each elevator carries a full load of passengers throughout its trip. The dependence of the threshold (transition point) on the elevator capacity is clarified.

  12. Equivalence principle and the baryon acoustic peak

    Science.gov (United States)

    Baldauf, Tobias; Mirbabayi, Mehrdad; Simonović, Marko; Zaldarriaga, Matias

    2015-08-01

    We study the dominant effect of a long wavelength density perturbation δ (λL) on short distance physics. In the nonrelativistic limit, the result is a uniform acceleration, fixed by the equivalence principle, and typically has no effect on statistical averages due to translational invariance. This same reasoning has been formalized to obtain a "consistency condition" on the cosmological correlation functions. In the presence of a feature, such as the acoustic peak at ℓBAO, this naive expectation breaks down for λLexplicitly applied to the one-loop calculation of the power spectrum. Finally, the success of baryon acoustic oscillation reconstruction schemes is argued to be another empirical evidence for the validity of the results.

  13. Potential of energy-oriented network optimisation: Switching off over-capacity in off-peak hours

    NARCIS (Netherlands)

    Litjens, R.; Jorguseski, L.

    2010-01-01

    Mobile communication networks are usually planned to provide some minimum service quality level during peak traffic hours. Consequently, in off-peak hours, when traffic loads are lower, the network is characterised by over-capacity, in the sense that same service quality targets can typically be

  14. Comparison of five portable peak flow meters

    Directory of Open Access Journals (Sweden)

    Glaucia Nency Takara

    2010-01-01

    Full Text Available OBJECTIVE: To compare the measurements of spirometric peak expiratory flow (PEF from five different PEF meters and to determine if their values are in agreement. Inaccurate equipment may result in incorrect diagnoses of asthma and inappropriate treatments. METHODS: Sixty-eight healthy, sedentary and insufficiently active subjects, aged from 19 to 40 years, performed PEF measurements using Air Zone®, Assess®, Galemed®, Personal Best® and Vitalograph® peak flow meters. The highest value recorded for each subject for each device was compared to the corresponding spirometric values using Friedman's test with Dunn's post-hoc (p<0.05, Spearman's correlation test and Bland-Altman's agreement test. RESULTS: The median and interquartile ranges for the spirometric values and the Air Zone®, Assess®, Galemed®, Personal Best® and Vitalograph® meters were 428 (263-688 L/min, 450 (350-800 L/min, 420 (310-720 L/min, 380 (300-735 L/min, 400 (310-685 L/min and 415 (335-610 L/min, respectively. Significant differences were found when the spirometric values were compared to those recorded by the Air Zone® (p<0.001 and Galemed ® (p<0.01 meters. There was no agreement between the spirometric values and the five PEF meters. CONCLUSIONS: The results suggest that the values recorded from Galemed® meters may underestimate the actual value, which could lead to unnecessary interventions, and that Air Zone® meters overestimate spirometric values, which could obfuscate the need for intervention. These findings must be taken into account when interpreting both devices' results in younger people. These differences should also be considered when directly comparing values from different types of PEF meters.

  15. Comparative analysis of peak-detection techniques for comprehensive two-dimensional chromatography.

    Science.gov (United States)

    Latha, Indu; Reichenbach, Stephen E; Tao, Qingping

    2011-09-23

    Comprehensive two-dimensional gas chromatography (GC×GC) is a powerful technology for separating complex samples. The typical goal of GC×GC peak detection is to aggregate data points of analyte peaks based on their retention times and intensities. Two techniques commonly used for two-dimensional peak detection are the two-step algorithm and the watershed algorithm. A recent study [4] compared the performance of the two-step and watershed algorithms for GC×GC data with retention-time shifts in the second-column separations. In that analysis, the peak retention-time shifts were corrected while applying the two-step algorithm but the watershed algorithm was applied without shift correction. The results indicated that the watershed algorithm has a higher probability of erroneously splitting a single two-dimensional peak than the two-step approach. This paper reconsiders the analysis by comparing peak-detection performance for resolved peaks after correcting retention-time shifts for both the two-step and watershed algorithms. Simulations with wide-ranging conditions indicate that when shift correction is employed with both algorithms, the watershed algorithm detects resolved peaks with greater accuracy than the two-step method. Copyright © 2011 Elsevier B.V. All rights reserved.

  16. Target support for inertial confinement fusion

    International Nuclear Information System (INIS)

    Schultz, K.R.

    1995-08-01

    General Atomics (GA) plays an important industrial support role for the US Inertial Confinement Fusion (ICF) program in the area of target technology. This includes three major activities: target fabrication support, target handling systems development, and target chamber design. The work includes target fabrication for existing ICF experiments, target and target system development for future experiments, and target research and target chamber design for experiments on future machines, such as the National Ignition Facility (NIF)

  17. Logistic curves, extraction costs and effective peak oil

    International Nuclear Information System (INIS)

    Brecha, Robert J.

    2012-01-01

    Debates about the possibility of a near-term maximum in world oil production have become increasingly prominent over the past decade, with the focus often being on the quantification of geologically available and technologically recoverable amounts of oil in the ground. Economically, the important parameter is not a physical limit to resources in the ground, but whether market price signals and costs of extraction will indicate the efficiency of extracting conventional or nonconventional resources as opposed to making substitutions over time for other fuels and technologies. We present a hybrid approach to the peak-oil question with two models in which the use of logistic curves for cumulative production are supplemented with data on projected extraction costs and historical rates of capacity increase. While not denying the presence of large quantities of oil in the ground, even with foresight, rates of production of new nonconventional resources are unlikely to be sufficient to make up for declines in availability of conventional oil. Furthermore we show how the logistic-curve approach helps to naturally explain high oil prices even when there are significant quantities of low-cost oil yet to be extracted. - Highlights: ► Extraction cost information together with logistic curves to model oil extraction. ► Two models of extraction sequence for different oil resources. ► Importance of time-delay and extraction rate limits for new resources. ► Model results qualitatively reproduce observed extraction cost dynamics. ► Confirmation of “effective” peak oil, even though resources are in ground.

  18. Norwegian hydropower a valuable peak power source

    Energy Technology Data Exchange (ETDEWEB)

    Brekke, Hermod

    2010-07-01

    given on a possible increase of the Norwegian hydropower peak power production to meet the growing the European demand for peak power caused by the growing non stationary production from wind mills and ocean energy from waves and sea current. Also building of reversible pump turbine power plants will be discussed even if approximately 10% power will be consumed by loss in the pumping phase compared to direct use of the water from reservoirs. (Author)

  19. Can You Hear That Peak? Utilization of Auditory and Visual Feedback at Peak Limb Velocity

    Science.gov (United States)

    Loria, Tristan; de Grosbois, John; Tremblay, Luc

    2016-01-01

    Purpose: At rest, the central nervous system combines and integrates multisensory cues to yield an optimal percept. When engaging in action, the relative weighing of sensory modalities has been shown to be altered. Because the timing of peak velocity is the critical moment in some goal-directed movements (e.g., overarm throwing), the current study…

  20. OccuPeak: ChIP-Seq peak calling based on internal background modelling

    NARCIS (Netherlands)

    de Boer, Bouke A.; van Duijvenboden, Karel; van den Boogaard, Malou; Christoffels, Vincent M.; Barnett, Phil; Ruijter, Jan M.

    2014-01-01

    ChIP-seq has become a major tool for the genome-wide identification of transcription factor binding or histone modification sites. Most peak-calling algorithms require input control datasets to model the occurrence of background reads to account for local sequencing and GC bias. However, the

  1. Residential implementation of critical-peak pricing of electricity

    International Nuclear Information System (INIS)

    Herter, Karen

    2007-01-01

    This paper investigates how critical-peak pricing (CPP) affects households with different usage and income levels, with the goal of informing policy makers who are considering the implementation of CPP tariffs in the residential sector. Using a subset of data from the California Statewide Pricing Pilot of 2003-04, average load change during summer events, annual percent bill change, and post-experiment satisfaction ratings are calculated across six customer segments, categorized by historical usage and income levels. Findings show that high-use customers respond significantly more in kW reduction than do low-use customers, while low-use customers save significantly more in percentage reduction of annual electricity bills than do high-use customers-results that challenge the strategy of targeting only high-use customers for CPP tariffs. Across income levels, average load and bill changes were statistically indistinguishable, as were satisfaction rates-results that are compatible with a strategy of full-scale implementation of CPP rates in the residential sector. Finally, the high-use customers earning less than $50,000 annually were the most likely of the groups to see bill increases-about 5% saw bill increases of 10% or more-suggesting that any residential CPP implementation might consider targeting this customer group for increased energy efficiency efforts

  2. Prediction of iodine activity peak during refuelling

    International Nuclear Information System (INIS)

    Hozer, Z.; Vajda, N.

    2001-01-01

    The increase of fission product activities in the primary circuit of a nuclear power plant indicates the existence of defects in some fuel rods. The power change leads to the cooling down of the fuel and results in the fragmentation of the UO 2 pellets, which facilitates the release of fission products from the intergranular regions. Furthermore the injection of boric acid after shutdown will increase the primary activity, due to the solution of deposited fission products from the surface of the core components. The calculation of these phenomena usually is based on the evaluation of activity measurements and power plant data. The estimation of iodine spiking peak during reactor transients is based on correlation with operating parameters, such as reactor power and primary pressure. The approach used in the present method was applied for CANDU reactors. The VVER-440 specific correlations were determined using the activity measurements of the Paks NPP and the data provided by the Russian fuel supplier. The present method is used for the evaluation of the iodine isotopes, as well as the noble gases. A numerical model has been developed for iodine spiking simulation and has been validated against several shutdown transients, measured at Paks NPP. (R.P.)

  3. Fast clustering using adaptive density peak detection.

    Science.gov (United States)

    Wang, Xiao-Feng; Xu, Yifan

    2017-12-01

    Common limitations of clustering methods include the slow algorithm convergence, the instability of the pre-specification on a number of intrinsic parameters, and the lack of robustness to outliers. A recent clustering approach proposed a fast search algorithm of cluster centers based on their local densities. However, the selection of the key intrinsic parameters in the algorithm was not systematically investigated. It is relatively difficult to estimate the "optimal" parameters since the original definition of the local density in the algorithm is based on a truncated counting measure. In this paper, we propose a clustering procedure with adaptive density peak detection, where the local density is estimated through the nonparametric multivariate kernel estimation. The model parameter is then able to be calculated from the equations with statistical theoretical justification. We also develop an automatic cluster centroid selection method through maximizing an average silhouette index. The advantage and flexibility of the proposed method are demonstrated through simulation studies and the analysis of a few benchmark gene expression data sets. The method only needs to perform in one single step without any iteration and thus is fast and has a great potential to apply on big data analysis. A user-friendly R package ADPclust is developed for public use.

  4. ASPeak: an abundance sensitive peak detection algorithm for RIP-Seq.

    Science.gov (United States)

    Kucukural, Alper; Özadam, Hakan; Singh, Guramrit; Moore, Melissa J; Cenik, Can

    2013-10-01

    Unlike DNA, RNA abundances can vary over several orders of magnitude. Thus, identification of RNA-protein binding sites from high-throughput sequencing data presents unique challenges. Although peak identification in ChIP-Seq data has been extensively explored, there are few bioinformatics tools tailored for peak calling on analogous datasets for RNA-binding proteins. Here we describe ASPeak (abundance sensitive peak detection algorithm), an implementation of an algorithm that we previously applied to detect peaks in exon junction complex RNA immunoprecipitation in tandem experiments. Our peak detection algorithm yields stringent and robust target sets enabling sensitive motif finding and downstream functional analyses. ASPeak is implemented in Perl as a complete pipeline that takes bedGraph files as input. ASPeak implementation is freely available at https://sourceforge.net/projects/as-peak under the GNU General Public License. ASPeak can be run on a personal computer, yet is designed to be easily parallelizable. ASPeak can also run on high performance computing clusters providing efficient speedup. The documentation and user manual can be obtained from http://master.dl.sourceforge.net/project/as-peak/manual.pdf.

  5. Film coated tablets (ColoPulse technology) for targeted delivery in the lower intestinal tract : influence of the core composition on release characteristics

    NARCIS (Netherlands)

    Schellekens, Reinout C. A.; Baltink, Jan H.; Woesthuis, Ellen M.; Stellaard, Frans; Kosterink, Jos G. W.; Woerdenbag, Herman J.; Frijlink, Henderik W.

    2010-01-01

    The design of a film coating technology which allows a tablet to deliver the drug in the ileocolonic segment would offer new treatment possibilities. The objective is to develop a platform technology that is suitable for a broad range of drug compounds. We developed a coated tablet with a delayed,

  6. Research Opportunities at Storm Peak Laboratory

    Science.gov (United States)

    Hallar, A. G.; McCubbin, I. B.

    2006-12-01

    The Desert Research Institute (DRI) operates a high elevation facility, Storm Peak Laboratory (SPL), located on the west summit of Mt. Werner in the Park Range near Steamboat Springs, Colorado at an elevation of 3210 m MSL (Borys and Wetzel, 1997). SPL provides an ideal location for long-term research on the interactions of atmospheric aerosol and gas- phase chemistry with cloud and natural radiation environments. The ridge-top location produces almost daily transition from free tropospheric to boundary layer air which occurs near midday in both summer and winter seasons. Long-term observations at SPL document the role of orographically induced mixing and convection on vertical pollutant transport and dispersion. During winter, SPL is above cloud base 25% of the time, providing a unique capability for studying aerosol-cloud interactions (Borys and Wetzel, 1997). A comprehensive set of continuous aerosol measurements was initiated at SPL in 2002. SPL includes an office-type laboratory room for computer and instrumentation setup with outside air ports and cable access to the roof deck, a cold room for precipitation and cloud rime ice sample handling and ice crystal microphotography, a 150 m2 roof deck area for outside sampling equipment, a full kitchen and two bunk rooms with sleeping space for nine persons. The laboratory is currently well equipped for aerosol and cloud measurements. Particles are sampled from an insulated, 15 cm diameter manifold within approximately 1 m of its horizontal entry point through an outside wall. The 4 m high vertical section outside the building is capped with an inverted can to exclude large particles.

  7. Contribution of ICT to Climate Targets of Cities. Exploring the potential of Information and Communication Technologies in reducing emissions and energy use from buildings and travel

    Energy Technology Data Exchange (ETDEWEB)

    Kramers, Anna

    2012-07-01

    This thesis examines how ICT solutions can assist in lowering energy use and greenhouse gas (GHG) emissions from buildings and travel in order to help cities meet their climate targets. It also provides an overview of relevant research intended to furnish new knowledge about the issues involved and to find solutions to social problems. The first part of the thesis provides an analysis and compilation of critical system boundaries that need to be used for cities to set targets for energy use and GHG emissions. The climate targets of cities are dependent on setting system boundaries and establishing methods of calculations for monitoring whether the targets have been achieved. Today, there is no official standard for how the system boundaries must be set or what calculation methodologies to apply to evaluate the climate targets. Four main categories of system boundaries were identified: the temporal scope, the object of target setting, the unit of target setting, and the target range (e.g. consumer-producer and lifecycle perspective). Eight European cities were examined in relation to how they set climate targets. The examination showed that awareness of what is included in the targets is limited and that there is a need for standardised and consistent protocols and methods of setting climate targets for cities. In the second part of the thesis, leading Advanced Traveller Information Systems (ATIS) and their functionalities were investigated. The relationship between individual decisions on different travel modes and functionalities of ATIS was investigated through a systematic investigation of the functionality of nine ATIS, mainly from Sweden, Germany, UK and USA. This allowed decisions that could lead to lower energy use and emissions of GHG to be identified. It also resulted in a proposal on requirements for new and improved functionality that could support a reduction in energy use and GHG emissions and a shift to renewable energy sources if implemented in next

  8. CERN: Fixed target targets

    Energy Technology Data Exchange (ETDEWEB)

    Anon.

    1993-03-15

    Full text: While the immediate priority of CERN's research programme is to exploit to the full the world's largest accelerator, the LEP electron-positron collider and its concomitant LEP200 energy upgrade (January, page 1), CERN is also mindful of its long tradition of diversified research. Away from LEP and preparations for the LHC proton-proton collider to be built above LEP in the same 27-kilometre tunnel, CERN is also preparing for a new generation of heavy ion experiments using a new source, providing heavier ions (April 1992, page 8), with first physics expected next year. CERN's smallest accelerator, the LEAR Low Energy Antiproton Ring continues to cover a wide range of research topics, and saw a record number of hours of operation in 1992. The new ISOLDE on-line isotope separator was inaugurated last year (July, page 5) and physics is already underway. The remaining effort concentrates around fixed target experiments at the SPS synchrotron, which formed the main thrust of CERN's research during the late 1970s. With the SPS and LEAR now approaching middle age, their research future was extensively studied last year. Broadly, a vigorous SPS programme looks assured until at least the end of 1995. Decisions for the longer term future of the West Experimental Area of the SPS will have to take into account the heavy demand for test beams from work towards experiments at big colliders, both at CERN and elsewhere. The North Experimental Area is the scene of larger experiments with longer lead times. Several more years of LEAR exploitation are already in the pipeline, but for the longer term, the ambitious Superlear project for a superconducting ring (January 1992, page 7) did not catch on. Neutrino physics has a long tradition at CERN, and this continues with the preparations for two major projects, the Chorus and Nomad experiments (November 1991, page 7), to start next year in the West Area. Delicate neutrino oscillation effects could become visible for the first

  9. Price, environment and security: Exploring multi-modal motivation in voluntary residential peak demand response

    International Nuclear Information System (INIS)

    Gyamfi, Samuel; Krumdieck, Susan

    2011-01-01

    Peak demand on electricity grids is a growing problem that increases costs and risks to supply security. Residential sector loads often contribute significantly to seasonal and daily peak demand. Demand response projects aim to manage peak demand by applying price signals and automated load shedding technologies. This research investigates voluntary load shedding in response to information about the security of supply, the emission profile and the cost of meeting critical peak demand in the customers' network. Customer willingness to change behaviour in response to this information was explored through mail-back survey. The diversified demand modelling method was used along with energy audit data to estimate the potential peak load reduction resulting from the voluntary demand response. A case study was conducted in a suburb of Christchurch, New Zealand, where electricity is the main source for water and space heating. On this network, all water heating cylinders have ripple-control technology and about 50% of the households subscribe to differential day/night pricing plan. The survey results show that the sensitivity to supply security is on par with price, with the emission sensitivity being slightly weaker. The modelling results show potential 10% reduction in critical peak load for aggregate voluntary demand response. - Highlights: → Multiple-factor behaviour intervention is necessarily for effective residential demand response. → Security signals can achieve result comparable to price. → The modelling results show potential 10% reduction in critical peak load for aggregate voluntary demand response. → New Zealand's energy policy should include innovation and development of VDR programmes and technologies.

  10. Peak-valley-peak pattern of histone modifications delineates active regulatory elements and their directionality

    DEFF Research Database (Denmark)

    Pundhir, Sachin; Bagger, Frederik Otzen; Lauridsen, Felicia Kathrine Bratt

    2016-01-01

    Formation of nucleosome free region (NFR) accompanied by specific histone modifications at flanking nucleosomes is an important prerequisite for enhancer and promoter activity. Due to this process, active regulatory elements often exhibit a distinct shape of histone signal in the form of a peak......-valley-peak (PVP) pattern. However, different features of PVP patterns and their robustness in predicting active regulatory elements have never been systematically analyzed. Here, we present PARE, a novel computational method that systematically analyzes the H3K4me1 or H3K4me3 PVP patterns to predict NFRs. We show...... four ENCODE cell lines and four hematopoietic differentiation stages, we identified several enhancers whose regulatory activity is stage specific and correlates positively with the expression of proximal genes in a particular stage. In conclusion, our results demonstrate that PVP patterns delineate...

  11. The effect of welding speed and molten metal peak temperature on ...

    African Journals Online (AJOL)

    The effect of welding speed and molten metal peak temperature on thermal history of an arch - welded steel plate by numerical methods. SM Adedayo. Abstract. No Abstract. Journal of Applied Science, Engineering and Technology Vol. 1(1) 2001: 1-16. Full Text: EMAIL FULL TEXT EMAIL FULL TEXT · DOWNLOAD FULL ...

  12. Cultural targeting and tailoring of shared decision making technology: a theoretical framework for improving the effectiveness of patient decision aids in culturally diverse groups.

    Science.gov (United States)

    Alden, Dana L; Friend, John; Schapira, Marilyn; Stiggelbout, Anne

    2014-03-01

    Patient decision aids are known to positively impact outcomes critical to shared decision making (SDM), such as gist knowledge and decision preparedness. However, research on the potential improvement of these and other important outcomes through cultural targeting and tailoring of decision aids is very limited. This is the case despite extensive evidence supporting use of cultural targeting and tailoring to improve the effectiveness of health communications. Building on prominent psychological theory, we propose a two-stage framework incorporating cultural concepts into the design process for screening and treatment decision aids. The first phase recommends use of cultural constructs, such as collectivism and individualism, to differentially target patients whose cultures are known to vary on these dimensions. Decision aid targeting is operationalized through use of symbols and values that appeal to members of the given culture. Content dimensions within decision aids that appear particularly appropriate for targeting include surface level visual characteristics, language, beliefs, attitudes and values. The second phase of the framework is based on evidence that individuals vary in terms of how strongly cultural norms influence their approach to problem solving and decision making. In particular, the framework hypothesizes that differences in terms of access to cultural mindsets (e.g., access to interdependent versus independent self) can be measured up front and used to tailor decision aids. Thus, the second phase in the framework emphasizes the importance of not only targeting decision aid content, but also tailoring the information to the individual based on measurement of how strongly he/she is connected to dominant cultural mindsets. Overall, the framework provides a theory-based guide for researchers and practitioners who are interested in using cultural targeting and tailoring to develop and test decision aids that move beyond a "one-size fits all" approach

  13. CERN: Fixed target targets

    International Nuclear Information System (INIS)

    Anon.

    1993-01-01

    Full text: While the immediate priority of CERN's research programme is to exploit to the full the world's largest accelerator, the LEP electron-positron collider and its concomitant LEP200 energy upgrade (January, page 1), CERN is also mindful of its long tradition of diversified research. Away from LEP and preparations for the LHC proton-proton collider to be built above LEP in the same 27-kilometre tunnel, CERN is also preparing for a new generation of heavy ion experiments using a new source, providing heavier ions (April 1992, page 8), with first physics expected next year. CERN's smallest accelerator, the LEAR Low Energy Antiproton Ring continues to cover a wide range of research topics, and saw a record number of hours of operation in 1992. The new ISOLDE on-line isotope separator was inaugurated last year (July, page 5) and physics is already underway. The remaining effort concentrates around fixed target experiments at the SPS synchrotron, which formed the main thrust of CERN's research during the late 1970s. With the SPS and LEAR now approaching middle age, their research future was extensively studied last year. Broadly, a vigorous SPS programme looks assured until at least the end of 1995. Decisions for the longer term future of the West Experimental Area of the SPS will have to take into account the heavy demand for test beams from work towards experiments at big colliders, both at CERN and elsewhere. The North Experimental Area is the scene of larger experiments with longer lead times. Several more years of LEAR exploitation are already in the pipeline, but for the longer term, the ambitious Superlear project for a superconducting ring (January 1992, page 7) did not catch on. Neutrino physics has a long tradition at CERN, and this continues with the preparations for two major projects, the Chorus and Nomad experiments (November 1991, page 7), to start next year in the West Area. Delicate neutrino oscillation effects could become

  14. Peak capacity, peak-capacity production rate, and boiling point resolution for temperature-programmed GC with very high programming rates

    Science.gov (United States)

    Grall; Leonard; Sacks

    2000-02-01

    Recent advances in column heating technology have made possible very fast linear temperature programming for high-speed gas chromatography. A fused-silica capillary column is contained in a tubular metal jacket, which is resistively heated by a precision power supply. With very rapid column heating, the rate of peak-capacity production is significantly enhanced, but the total peak capacity and the boiling-point resolution (minimum boiling-point difference required for the separation of two nonpolar compounds on a nonpolar column) are reduced relative to more conventional heating rates used with convection-oven instruments. As temperature-programming rates increase, elution temperatures also increase with the result that retention may become insignificant prior to elution. This results in inefficient utilization of the down-stream end of the column and causes a loss in the rate of peak-capacity production. The rate of peak-capacity production is increased by the use of shorter columns and higher carrier gas velocities. With high programming rates (100-600 degrees C/min), column lengths of 6-12 m and average linear carrier gas velocities in the 100-150 cm/s range are satisfactory. In this study, the rate of peak-capacity production, the total peak capacity, and the boiling point resolution are determined for C10-C28 n-alkanes using 6-18 m long columns, 50-200 cm/s average carrier gas velocities, and 60-600 degrees C/min programming rates. It was found that with a 6-meter-long, 0.25-mm i.d. column programmed at a rate of 600 degrees C/min, a maximum peak-capacity production rate of 6.1 peaks/s was obtained. A total peak capacity of about 75 peaks was produced in a 37-s long separation spanning a boiling-point range from n-C10 (174 degrees C) to n-C28 (432 degrees C).

  15. Characteristic of 120 degree C thermoluminescence peak of iceland spar

    International Nuclear Information System (INIS)

    Lu Xinwei; Han Jia

    2006-01-01

    The basic characteristic of 120 degree C thermoluminescence peak of iceland spar was studied. The experimental result indicates the longevity of 120 degree C thermoluminescence peak of iceland spar is about 2 h under 30 degree C. The thermoluminescence peak moves to the high temperature when the heating speed increasing. The intensity of 120 degree C thermoluminescence peak of iceland spar is directly proportional to radiation dose under 15 Gy. (authors)

  16. Assessing peak aerobic capacity in Dutch law enforcement officers

    NARCIS (Netherlands)

    Wittink, Harriet; Takken, Tim; de Groot, Janke; Reneman, Michiel; Peters, Roelof; Vanhees, Luc

    2015-01-01

    Objectives: To cross-validate the existing peak rate of oxygen consumption (VO2peak) prediction equations in Dutch law enforcement officers and to determine whether these prediction equations can be used to predict VO2peak for groups and in a single individual. A further objective was to report

  17. Determination of the upper limit of a peak area

    International Nuclear Information System (INIS)

    Helene, O.

    1990-03-01

    This paper reports the procedure to extract an upper limit of a peak area in a multichannel spectrum. This procedure takes into account the finite shape of the peak and the uncertanties in the background and in the expected position of the peak. (author) [pt

  18. PEAK TRACKING WITH A NEURAL NETWORK FOR SPECTRAL RECOGNITION

    NARCIS (Netherlands)

    COENEGRACHT, PMJ; METTING, HJ; VANLOO, EM; SNOEIJER, GJ; DOORNBOS, DA

    1993-01-01

    A peak tracking method based on a simulated feed-forward neural network with back-propagation is presented. The network uses the normalized UV spectra and peak areas measured in one chromatogram for peak recognition. It suffices to train the network with only one set of spectra recorded in one

  19. Assessing peak aerobic capacity in Dutch law enforcement officers.

    NARCIS (Netherlands)

    Wittink, H.; Takken, T.; Groot, J.F. de; Reneman, M.; Peters, R.; Vanhees, L.

    2015-01-01

    Objectives: To cross-validate the existing peak rate of oxygen consumption (VO2peak) prediction equations in Dutch law enforcement officers and to determine whether these prediction equations can be used to predict VO2peak for groups and in a single individual. A further objective was to report

  20. 7 CFR 457.163 - Nursery peak inventory endorsement.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 6 2010-01-01 2010-01-01 false Nursery peak inventory endorsement. 457.163 Section... CORPORATION, DEPARTMENT OF AGRICULTURE COMMON CROP INSURANCE REGULATIONS § 457.163 Nursery peak inventory endorsement. Nursery Crop Insurance Peak Inventory Endorsement This endorsement is not continuous and must be...

  1. Bayesian approach for peak detection in two-dimensional chromatography

    NARCIS (Netherlands)

    Vivó-Truyols, G.

    2012-01-01

    A new method for peak detection in two-dimensional chromatography is presented. In a first step, the method starts with a conventional one-dimensional peak detection algorithm to detect modulated peaks. In a second step, a sophisticated algorithm is constructed to decide which of the individual

  2. Determination of the upper limit of a peak area

    International Nuclear Information System (INIS)

    Helene, O.

    1991-01-01

    This article reports the procedure to extract an upper limit of a peak area in a multichannel spectrum. This procedure takes into account the finite shape of the peak and the uncertainties both in the background and in the expected position of the peak. (orig.)

  3. Has Athletic Performance Reached its Peak?

    Science.gov (United States)

    Berthelot, Geoffroy; Sedeaud, Adrien; Marck, Adrien; Antero-Jacquemin, Juliana; Schipman, Julien; Saulière, Guillaume; Marc, Andy; Desgorces, François-Denis; Toussaint, Jean-François

    2015-09-01

    Limits to athletic performance have long been a topic of myth and debate. However, sport performance appears to have reached a state of stagnation in recent years, suggesting that the physical capabilities of humans and other athletic species, such as greyhounds and thoroughbreds, cannot progress indefinitely. Although the ultimate capabilities may be predictable, the exact path for the absolute maximal performance values remains difficult to assess and relies on technical innovations, sport regulation, and other parameters that depend on current societal and economic conditions. The aim of this literature review was to assess the possible plateau of top physical capabilities in various events and detail the historical backgrounds and sociocultural, anthropometrical, and physiological factors influencing the progress and regression of athletic performance. Time series of performances in Olympic disciplines, such as track and field and swimming events, from 1896 to 2012 reveal a major decrease in performance development. Such a saturation effect is simultaneous in greyhound, thoroughbred, and frog performances. The genetic condition, exhaustion of phenotypic pools, economic context, and the depletion of optimal morphological traits contribute to the observed limitation of physical capabilities. Present conditions prevailing, we approach absolute physical limits and endure a continued period of world record scarcity. Optional scenarios for further improvements will mostly depend on sport technology and modification competition rules.

  4. Peak-by-peak correction of Ge(Li) gamma-ray spectra for photopeaks from background

    International Nuclear Information System (INIS)

    Cutshall, N.H.; Larsen, I.L.

    1980-01-01

    Background photopeaks can interfere with accurate measurement of low levels of radionuclides by gamma-ray spectrometry. A flowchart for peak-by-peak correction of sample spectra to produce accurate results is presented. (orig.)

  5. Peak-by-peak correction of Ge(Li) gamma-ray spectra for photopeaks from background

    Energy Technology Data Exchange (ETDEWEB)

    Cutshall, N H; Larsen, I L [Oak Ridge National Lab., TN (USA)

    1980-12-01

    Background photopeaks can interfere with accurate measurement of low levels of radionuclides by gamma-ray spectrometry. A flowchart for peak-by-peak correction of sample spectra to produce accurate results is presented.

  6. Peak creation in the energy spectrum of laser-produced protons by phase rotation

    International Nuclear Information System (INIS)

    Noda, Akira; Nakamura, Shu; Iwashita, Yoshihisa; Shirai, Toshiyuki; Tongu, Hiromu; Ito, Hiroyuki; Souda, Hikaru; Yamazaki, Atsushi; Tanabe, Mikio; Daido, Hiroyuki; Mori, Michiaki; Kado, Masataka; Sagisaka, Akito; Ogura, Koichi; Nishiuchi, Mamiko; Orimo, Satoshi; Hayashi, Yukio; Yogo, Akifumi; Bulanov, Sergei; Esirkepov, Timur; Nagashima, Akira; Kimura, Toyoaki; Tajima, Toshiki; Fukumi, Atsushi; Li, Zhong

    2007-01-01

    In collaboration between JAEA, Kansai Photon Science Institute and Institute for Chemical Research, Kyoto University, proton generation from a thin foil target (Ti 3 or 5 μm in thickness) with use of 10 TW laser (JLITEX) has been performed. Proton production is optimized by real time proton energy measurement with use of TOF method. Phase rotation with use of an RF electric field phase-synchronized to the pulse laser enabled the creation of peaks with the spread of ∼7% in the energy spectrum of the produced protons, which resulted in the increase of the intensity ∼4 times at peak position. (author)

  7. Fuel and vehicle technology choices for passenger vehicles in achieving stringent CO2 targets: connections between transportation and other energy sectors.

    Science.gov (United States)

    Grahn, M; Azar, C; Williander, M I; Anderson, J E; Mueller, S A; Wallington, T J

    2009-05-01

    The regionalized Global Energy Transition (GET-R 6.0) model has been modified to include a detailed description of light-duty vehicle options and used to investigate the potential impact of carbon capture and storage (CCS) and concentrating solar power (CSP) on cost-effective fuel/vehicle technologies in a carbon-constrained world. Total CO2 emissions were constrained to achieve stabilization at 400-550 ppm, by 2100, at lowesttotal system cost The dominantfuel/vehicle technologies varied significantly depending on CO2 constraint future cost of vehicle technologies, and availability of CCS and CSP. For many cases, no one technology dominated on a global scale. CCS provides relatively inexpensive low-CO2 electricity and heatwhich prolongs the use of traditional ICEVs. CSP displaces fossil fuel derived electricity, prolongs the use of traditional ICEVs, and promotes electrification of passenger vehicles. In all cases considered, CCS and CSP availability had a major impact on the lowest cost fuel/vehicle technologies, and alternative fuels are needed in response to expected dwindling oil and natural gas supply potential by the end of the century.

  8. Target laboratory

    International Nuclear Information System (INIS)

    Ephraim, D.C.; Pednekar, A.R.

    1993-01-01

    A target laboratory to make stripper foils for the accelerator and various targets for use in the experiments is set up in the pelletron accelerator facility. The facilities available in the laboratory are: (1) D.C. glow discharge setup, (2) carbon arc set up, and (3) vacuum evaporation set up (resistance heating), electron beam source, rolling mill - all for target preparation. They are described. Centrifugal deposition technique is used for target preparation. (author). 3 figs

  9. Ice targets

    International Nuclear Information System (INIS)

    Pacheco, C.; Stark, C.; Tanaka, N.; Hodgkins, D.; Barnhart, J.; Kosty, J.

    1979-12-01

    This report presents a description of ice targets that were constructed for research work at the High Resolution Spectrometer (HRS) and at the Energetic Pion Channel and Spectrometer (EPICS). Reasons for using these ice targets and the instructions for their construction are given. Results of research using ice targets will be published at a later date

  10. Residential implementation of critical-peak pricing ofelectricity

    Energy Technology Data Exchange (ETDEWEB)

    Herter, Karen

    2006-06-29

    This paper investigates how critical-peak pricing (CPP)affects households with different usage and income levels, with the goalof informing policy makers who are considering the implementation of CPPtariffs in the residential sector. Using a subset of data from theCalifornia Statewide Pricing Pilot of 2003-2004, average load changeduring summer events, annual percent bill change, and post-experimentsatisfaction ratings are calculated across six customer segments,categorized by historical usage and income levels. Findings show thathigh-use customers respond significantly more in kW reduction than dolow-use customers, while low-use customers save significantly more inpercentage reduction of annual electricity bills than do high-usecustomers results that challenge the strategy of targeting only high-usecustomers for CPP tariffs. Across income levels, average load and billchanges were statistically indistinguishable, as were satisfaction ratesresults that are compatible with a strategy of full-scale implementationof CPP rates in the residential sector. Finally, the high-use customersearning less than $50,000 annually were the most likely of the groups tosee bill increases about 5 percent saw bill increases of 10 percent ormore suggesting that any residential CPP implementation might considertargeting this customer group for increased energy efficiencyefforts.

  11. Peak detection method evaluation for ion mobility spectrometry by using machine learning approaches.

    Science.gov (United States)

    Hauschild, Anne-Christin; Kopczynski, Dominik; D'Addario, Marianna; Baumbach, Jörg Ingo; Rahmann, Sven; Baumbach, Jan

    2013-04-16

    Ion mobility spectrometry with pre-separation by multi-capillary columns (MCC/IMS) has become an established inexpensive, non-invasive bioanalytics technology for detecting volatile organic compounds (VOCs) with various metabolomics applications in medical research. To pave the way for this technology towards daily usage in medical practice, different steps still have to be taken. With respect to modern biomarker research, one of the most important tasks is the automatic classification of patient-specific data sets into different groups, healthy or not, for instance. Although sophisticated machine learning methods exist, an inevitable preprocessing step is reliable and robust peak detection without manual intervention. In this work we evaluate four state-of-the-art approaches for automated IMS-based peak detection: local maxima search, watershed transformation with IPHEx, region-merging with VisualNow, and peak model estimation (PME).We manually generated Metabolites 2013, 3 278 a gold standard with the aid of a domain expert (manual) and compare the performance of the four peak calling methods with respect to two distinct criteria. We first utilize established machine learning methods and systematically study their classification performance based on the four peak detectors' results. Second, we investigate the classification variance and robustness regarding perturbation and overfitting. Our main finding is that the power of the classification accuracy is almost equally good for all methods, the manually created gold standard as well as the four automatic peak finding methods. In addition, we note that all tools, manual and automatic, are similarly robust against perturbations. However, the classification performance is more robust against overfitting when using the PME as peak calling preprocessor. In summary, we conclude that all methods, though small differences exist, are largely reliable and enable a wide spectrum of real-world biomedical applications.

  12. Automatic Peak Selection by a Benjamini-Hochberg-Based Algorithm

    KAUST Repository

    Abbas, Ahmed; Kong, Xin-Bing; Liu, Zhi; Jing, Bing-Yi; Gao, Xin

    2013-01-01

    A common issue in bioinformatics is that computational methods often generate a large number of predictions sorted according to certain confidence scores. A key problem is then determining how many predictions must be selected to include most of the true predictions while maintaining reasonably high precision. In nuclear magnetic resonance (NMR)-based protein structure determination, for instance, computational peak picking methods are becoming more and more common, although expert-knowledge remains the method of choice to determine how many peaks among thousands of candidate peaks should be taken into consideration to capture the true peaks. Here, we propose a Benjamini-Hochberg (B-H)-based approach that automatically selects the number of peaks. We formulate the peak selection problem as a multiple testing problem. Given a candidate peak list sorted by either volumes or intensities, we first convert the peaks into p-values and then apply the B-H-based algorithm to automatically select the number of peaks. The proposed approach is tested on the state-of-the-art peak picking methods, including WaVPeak [1] and PICKY [2]. Compared with the traditional fixed number-based approach, our approach returns significantly more true peaks. For instance, by combining WaVPeak or PICKY with the proposed method, the missing peak rates are on average reduced by 20% and 26%, respectively, in a benchmark set of 32 spectra extracted from eight proteins. The consensus of the B-H-selected peaks from both WaVPeak and PICKY achieves 88% recall and 83% precision, which significantly outperforms each individual method and the consensus method without using the B-H algorithm. The proposed method can be used as a standard procedure for any peak picking method and straightforwardly applied to some other prediction selection problems in bioinformatics. The source code, documentation and example data of the proposed method is available at http://sfb.kaust.edu.sa/pages/software.aspx. © 2013

  13. Automatic Peak Selection by a Benjamini-Hochberg-Based Algorithm

    KAUST Repository

    Abbas, Ahmed

    2013-01-07

    A common issue in bioinformatics is that computational methods often generate a large number of predictions sorted according to certain confidence scores. A key problem is then determining how many predictions must be selected to include most of the true predictions while maintaining reasonably high precision. In nuclear magnetic resonance (NMR)-based protein structure determination, for instance, computational peak picking methods are becoming more and more common, although expert-knowledge remains the method of choice to determine how many peaks among thousands of candidate peaks should be taken into consideration to capture the true peaks. Here, we propose a Benjamini-Hochberg (B-H)-based approach that automatically selects the number of peaks. We formulate the peak selection problem as a multiple testing problem. Given a candidate peak list sorted by either volumes or intensities, we first convert the peaks into p-values and then apply the B-H-based algorithm to automatically select the number of peaks. The proposed approach is tested on the state-of-the-art peak picking methods, including WaVPeak [1] and PICKY [2]. Compared with the traditional fixed number-based approach, our approach returns significantly more true peaks. For instance, by combining WaVPeak or PICKY with the proposed method, the missing peak rates are on average reduced by 20% and 26%, respectively, in a benchmark set of 32 spectra extracted from eight proteins. The consensus of the B-H-selected peaks from both WaVPeak and PICKY achieves 88% recall and 83% precision, which significantly outperforms each individual method and the consensus method without using the B-H algorithm. The proposed method can be used as a standard procedure for any peak picking method and straightforwardly applied to some other prediction selection problems in bioinformatics. The source code, documentation and example data of the proposed method is available at http://sfb.kaust.edu.sa/pages/software.aspx. © 2013

  14. The Technology Acceptance Model for Resource-Limited Settings (TAM-RLS): A Novel Framework for Mobile Health Interventions Targeted to Low-Literacy End-Users in Resource-Limited Settings.

    Science.gov (United States)

    Campbell, Jeffrey I; Aturinda, Isaac; Mwesigwa, Evans; Burns, Bridget; Santorino, Data; Haberer, Jessica E; Bangsberg, David R; Holden, Richard J; Ware, Norma C; Siedner, Mark J

    2017-11-01

    Although mobile health (mHealth) technologies have shown promise in improving clinical care in resource-limited settings (RLS), they are infrequently brought to scale. One limitation to the success of many mHealth interventions is inattention to end-user acceptability, which is an important predictor of technology adoption. We conducted in-depth interviews with 43 people living with HIV in rural Uganda who had participated in a clinical trial of a short messaging system (SMS)-based intervention designed to prompt return to clinic after an abnormal laboratory test. Interviews focused on established features of technology acceptance models, including perceived ease of use and perceived usefulness, and included open-ended questions to gain insight into unexplored issues related to the intervention's acceptability. We used conventional (inductive) and direct content analysis to derive categories describing use behaviors and acceptability. Interviews guided development of a proposed conceptual framework, the technology acceptance model for resource-limited settings (TAM-RLS). This framework incorporates both classic technology acceptance model categories as well as novel factors affecting use in this setting. Participants described how SMS message language, phone characteristics, and experience with similar technologies contributed to the system's ease of use. Perceived usefulness was shaped by the perception that the system led to augmented HIV care services and improved access to social support from family and colleagues. Emergent themes specifically related to mHealth acceptance among PLWH in Uganda included (1) the importance of confidentiality, disclosure, and stigma, and (2) the barriers and facilitators downstream from the intervention that impacted achievement of the system's target outcome. The TAM-RLS is a proposed model of mHealth technology acceptance based upon end-user experiences in rural Uganda. Although the proposed model requires validation, the TAM

  15. Solar photochemical production of HBr for off-peak electrolytic hydrogen production

    Energy Technology Data Exchange (ETDEWEB)

    Heaton, H. [Solar Reactor Technologies Inc., Miami, FL (United States)

    1996-10-01

    Progress is reported on the development of a unique and innovative hydrogen production concept utilizing renewable (Solar) energy and incorporating energy storage. The concept is based on a solar-electrolytic system for production of hydrogen and oxygen. It employs water, bromine, solar energy, and supplemental electrical power. The process consumes only water, sunlight and off-peak electricity, and produces only hydrogen, oxygen, and peaking electrical power. No pollutants are emitted, and fossil fuels are not consumed. The concept is being developed by Solar Reactor Technologies, Inc., (SRT) under the auspices of a Cooperative Agreement with the U.S. Department of Energy (DOE).

  16. Chemometric Strategies for Peak Detection and Profiling from Multidimensional Chromatography.

    Science.gov (United States)

    Navarro-Reig, Meritxell; Bedia, Carmen; Tauler, Romà; Jaumot, Joaquim

    2018-04-03

    The increasing complexity of omics research has encouraged the development of new instrumental technologies able to deal with these challenging samples. In this way, the rise of multidimensional separations should be highlighted due to the massive amounts of information that provide with an enhanced analyte determination. Both proteomics and metabolomics benefit from this higher separation capacity achieved when different chromatographic dimensions are combined, either in LC or GC. However, this vast quantity of experimental information requires the application of chemometric data analysis strategies to retrieve this hidden knowledge, especially in the case of nontargeted studies. In this work, the most common chemometric tools and approaches for the analysis of this multidimensional chromatographic data are reviewed. First, different options for data preprocessing and enhancement of the instrumental signal are introduced. Next, the most used chemometric methods for the detection of chromatographic peaks and the resolution of chromatographic and spectral contributions (profiling) are presented. The description of these data analysis approaches is complemented with enlightening examples from omics fields that demonstrate the exceptional potential of the combination of multidimensional separation techniques and chemometric tools of data analysis. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Application of encoded library technology (ELT) to a protein-protein interaction target: discovery of a potent class of integrin lymphocyte function-associated antigen 1 (LFA-1) antagonists.

    Science.gov (United States)

    Kollmann, Christopher S; Bai, Xiaopeng; Tsai, Ching-Hsuan; Yang, Hongfang; Lind, Kenneth E; Skinner, Steven R; Zhu, Zhengrong; Israel, David I; Cuozzo, John W; Morgan, Barry A; Yuki, Koichi; Xie, Can; Springer, Timothy A; Shimaoka, Motomu; Evindar, Ghotas

    2014-04-01

    The inhibition of protein-protein interactions remains a challenge for traditional small molecule drug discovery. Here we describe the use of DNA-encoded library technology for the discovery of small molecules that are potent inhibitors of the interaction between lymphocyte function-associated antigen 1 and its ligand intercellular adhesion molecule 1. A DNA-encoded library with a potential complexity of 4.1 billion compounds was exposed to the I-domain of the target protein and the bound ligands were affinity selected, yielding an enriched small-molecule hit family. Compounds representing this family were synthesized without their DNA encoding moiety and found to inhibit the lymphocyte function-associated antigen 1/intercellular adhesion molecule-1 interaction with submicromolar potency in both ELISA and cell adhesion assays. Re-synthesized compounds conjugated to DNA or a fluorophore were demonstrated to bind to cells expressing the target protein. Copyright © 2014 Elsevier Ltd. All rights reserved.

  18. Relationships between electroencephalographic spectral peaks across frequency bands

    Directory of Open Access Journals (Sweden)

    Sacha Jennifer Van Albada

    2013-03-01

    Full Text Available The degree to which electroenencephalographic (EEG spectral peaks are independent, and the relationships between their frequencies have been debated. A novel fitting method was used to determine peak parameters in the range 2–35 Hz from a large sample of eyes-closed spectra, and their interrelationships were investigated. Findings were compared with a mean-field model of thalamocortical activity, which predicts near-harmonic relationships between peaks. The subject set consisted of 1424 healthy subjects from the Brain Resource International Database. Peaks in the theta range occurred on average near half the alpha peak frequency, while peaks in the beta range tended to occur near twice and three times the alpha peak frequency on an individual-subject basis. Moreover, for the majority of subjects, alpha peak frequencies were significantly positively correlated with frequencies of peaks in the theta and low and high beta ranges. Such a harmonic progression agrees semiquantitatively with theoretical predictions from the mean-field model. These findings indicate a common or analogous source for different rhythms, and help to define appropriate individual frequency bands for peak identification.

  19. Relationships between Electroencephalographic Spectral Peaks Across Frequency Bands

    Science.gov (United States)

    van Albada, S. J.; Robinson, P. A.

    2013-01-01

    The degree to which electroencephalographic spectral peaks are independent, and the relationships between their frequencies have been debated. A novel fitting method was used to determine peak parameters in the range 2–35 Hz from a large sample of eyes-closed spectra, and their interrelationships were investigated. Findings were compared with a mean-field model of thalamocortical activity, which predicts near-harmonic relationships between peaks. The subject set consisted of 1424 healthy subjects from the Brain Resource International Database. Peaks in the theta range occurred on average near half the alpha peak frequency, while peaks in the beta range tended to occur near twice and three times the alpha peak frequency on an individual-subject basis. Moreover, for the majority of subjects, alpha peak frequencies were significantly positively correlated with frequencies of peaks in the theta and low and high beta ranges. Such a harmonic progression agrees semiquantitatively with theoretical predictions from the mean-field model. These findings indicate a common or analogous source for different rhythms, and help to define appropriate individual frequency bands for peak identification. PMID:23483663

  20. Particle in cell simulation of peaking switch for breakdown evaluation

    Energy Technology Data Exchange (ETDEWEB)

    Umbarkar, Sachin B.; Bindu, S.; Mangalvedekar, H.A.; Saxena, A.; Singh, N.M., E-mail: sachin.b.umbarkar@gmail.com [Department of Electric Engineering, Veermata Jijabai Technological Institute, Mumbai (India); Sharma, Archana; Saroj, P.C.; Mittal, K.C. [Accelerator Pulse Power Division, Bhabha Atomic Research Centre, Mumbai (India)

    2014-07-01

    Marx generator connected to peaking capacitor and peaking switch can generate Ultra-Wideband (UWB) radiation. A new peaking switch is designed for converting the existing nanosecond Marx generator to a UWB source. The paper explains the particle in cell (PIC) simulation for this peaking switch, using MAGIC 3D software. This peaking switch electrode is made up of copper tungsten material and is fixed inside the hermitically sealed derlin material. The switch can withstand a gas pressure up to 13.5 kg/cm{sup 2}. The lower electrode of the switch is connected to the last stage of the Marx generator. Initially Marx generator (without peaking stage) in air; gives the output pulse with peak amplitude of 113.75 kV and pulse rise time of 25 ns. Thus, we design a new peaking switch to improve the rise time of output pulse and to pressurize this peaking switch separately (i.e. Marx and peaking switch is at different pressure). The PIC simulation gives the particle charge density, current density, E counter plot, emitted electron current, and particle energy along the axis of gap between electrodes. The charge injection and electric field dependence on ionic dissociation phenomenon are briefly analyzed using this simulation. The model is simulated with different gases (N{sub 2}, H{sub 2}, and Air) under different pressure (2 kg/cm{sup 2}, 5 kg/cm{sup 2}, 10 kg/cm{sup 2}). (author)

  1. QRS peak detection for heart rate monitoring on Android smartphone

    Science.gov (United States)

    Pambudi Utomo, Trio; Nuryani, Nuryani; Darmanto

    2017-11-01

    In this study, Android smartphone is used for heart rate monitoring and displaying electrocardiogram (ECG) graph. Heart rate determination is based on QRS peak detection. Two methods are studied to detect the QRS complex peak; they are Peak Threshold and Peak Filter. The acquisition of ECG data is utilized by AD8232 module from Analog Devices, three electrodes, and Microcontroller Arduino UNO R3. To record the ECG data from a patient, three electrodes are attached to particular body’s surface of a patient. Patient’s heart activity which is recorded by AD8232 module is decoded by Arduino UNO R3 into analog data. Then, the analog data is converted into a voltage value (mV) and is processed to get the QRS complex peak. Heart rate value is calculated by Microcontroller Arduino UNO R3 uses the QRS complex peak. Voltage, heart rate, and the QRS complex peak are sent to Android smartphone by Bluetooth HC-05. ECG data is displayed as the graph by Android smartphone. To evaluate the performance of QRS complex peak detection method, three parameters are used; they are positive predictive, accuracy and sensitivity. Positive predictive, accuracy, and sensitivity of Peak Threshold method is 92.39%, 70.30%, 74.62% and for Peak Filter method are 98.38%, 82.47%, 83.61%, respectively.

  2. Standoff Sensing Technology Based on Laser-Induced Breakdown Spectroscopy: Advanced Targeting, Surveillance and Reconnaissance in Security and Architectural Heritage Applications

    OpenAIRE

    Gaona Fernández, María Inmaculada

    2014-01-01

    Due to the ability to perform simultaneous, multi-element and real-time analysis without pretreatment and doing from a distance, laser induced breakdown spectroscopy (LIBS) in standoff mode is now considered a cutting-edge analytical technology. All these features have allowed its application in various fields such as security, environment, cultural heritage protection and space exploration, among the more outstanding. Nonetheless, the fact of working to long distances involves greater dif...

  3. Estimation of the peak factor based on watershed characteristics

    Energy Technology Data Exchange (ETDEWEB)

    Gauthier, Jean; Nolin, Simon; Ruest, Benoit [BPR Inc., Quebec, (Canada)

    2010-07-01

    Hydraulic modeling and dam structure design require the river flood flow as a primary input. For a given flood event, the ratio of peak flow over mean daily flow defines the peak factor. The peak factor value is dependent on the watershed and location along the river. The main goal of this study consisted in finding a relationship between watershed characteristics and this peak factor. Regression analyses were carried out on 53 natural watersheds located in the southern part of the province of Quebec using data from the Centre d'expertise hydrique du Quebec (CEHQ). The watershed characteristics included in the analyses were the watershed area, the maximum flow length, the mean slope, the lake proportion and the mean elevation. The results showed that watershed area and length are the major parameters influencing the peak factor. Nine natural watersheds were also used to test the use of a multivariable model in order to determine the peak factor for ungauged watersheds.

  4. Evaluation of peak power prediction equations in male basketball players.

    Science.gov (United States)

    Duncan, Michael J; Lyons, Mark; Nevill, Alan M

    2008-07-01

    This study compared peak power estimated using 4 commonly used regression equations with actual peak power derived from force platform data in a group of adolescent basketball players. Twenty-five elite junior male basketball players (age, 16.5 +/- 0.5 years; mass, 74.2 +/- 11.8 kg; height, 181.8 +/- 8.1 cm) volunteered to participate in the study. Actual peak power was determined using a countermovement vertical jump on a force platform. Estimated peak power was determined using countermovement jump height and body mass. All 4 prediction equations were significantly related to actual peak power (all p jump prediction equations, 12% for the Canavan and Vescovi equation, and 6% for the Sayers countermovement jump equation. In all cases peak power was underestimated.

  5. Precise determination of the Bragg peak position of proton beams in liquid water

    International Nuclear Information System (INIS)

    Marouane, Abdelhak; Ouaskit, Said; Inchaouh, Jamal

    2011-01-01

    The influence of water molecules on the surrounding biological molecules during irradiation with protons is currently a major subject in radiation science. Proton collisions with the water molecules are estimated around the Bragg peak region, taking into account ionization, excitation, charge-changing processes, and energetic secondary electron behavior. The Bragg peak profile and position was determined by adopting a new approach involving discretization, incrementation, and dividing the target into layers, the thickness of each layer being selected randomly from a distribution weighted by the values of the total interaction cross section, from excitation up to ionization of the target and the incident projectile charge exchange. The calculation was carried out by a Monte-Carlo simulation in the energy range 20 ≤ E ≤ 10 8 eV, including the relativistic corrections.

  6. Peak experiences of psilocybin users and non-users.

    Science.gov (United States)

    Cummins, Christina; Lyke, Jennifer

    2013-01-01

    Maslow (1970) defined peak experiences as the most wonderful experiences of a person's life, which may include a sense of awe, well-being, or transcendence. Furthermore, recent research has suggested that psilocybin can produce experiences subjectively rated as uniquely meaningful and significant (Griffiths et al. 2006). It is therefore possible that psilocybin may facilitate or change the nature of peak experiences in users compared to non-users. This study was designed to compare the peak experiences of psilocybin users and non-users, to evaluate the frequency of peak experiences while under the influence of psilocybin, and to assess the perceived degree of alteration of consciousness during these experiences. Participants were recruited through convenience and snowball sampling from undergraduate classes and at a musical event. Participants were divided into three groups, those who reported a peak experience while under the influence of psilocybin (psilocybin peak experience: PPE), participants who had used psilocybin but reported their peak experiences did not occur while they were under the influence of psilocybin (non-psilocybin peak experience: NPPE), and participants who had never used psilocybin (non-user: NU). A total of 101 participants were asked to think about their peak experiences and complete a measure evaluating the degree of alteration of consciousness during that experience. Results indicated that 47% of psilocybin users reported their peak experience occurred while using psilocybin. In addition, there were significant differences among the three groups on all dimensions of alteration of consciousness. Future research is necessary to identify factors that influence the peak experiences of psilocybin users in naturalistic settings and contribute to the different characteristics of peak experiences of psilocybin users and non-users.

  7. Extragalactic Peaked-spectrum Radio Sources at Low Frequencies

    Energy Technology Data Exchange (ETDEWEB)

    Callingham, J. R.; Gaensler, B. M.; Sadler, E. M.; Lenc, E. [Sydney Institute for Astronomy (SIfA), School of Physics, The University of Sydney, NSW 2006 (Australia); Ekers, R. D.; Bell, M. E. [CSIRO Astronomy and Space Science (CASS), Marsfield, NSW 2122 (Australia); Line, J. L. B.; Hancock, P. J.; Kapińska, A. D.; McKinley, B.; Procopio, P. [ARC Centre of Excellence for All-Sky Astrophysics (CAASTRO) (Australia); Hurley-Walker, N.; Tingay, S. J.; Franzen, T. M. O.; Morgan, J. [International Centre for Radio Astronomy Research (ICRAR), Curtin University, Bentley, WA 6102 (Australia); Dwarakanath, K. S. [Raman Research Institute (RRI), Bangalore 560080 (India); For, B.-Q. [International Centre for Radio Astronomy Research (ICRAR), The University of Western Australia, Crawley, WA 6009 (Australia); Hindson, L.; Johnston-Hollitt, M. [School of Chemical and Physical Sciences, Victoria University of Wellington, Wellington 6140 (New Zealand); Offringa, A. R., E-mail: joseph.callingham@sydney.edu.au [Netherlands Institute for Radio Astronomy (ASTRON), Dwingeloo (Netherlands); and others

    2017-02-20

    We present a sample of 1483 sources that display spectral peaks between 72 MHz and 1.4 GHz, selected from the GaLactic and Extragalactic All-sky Murchison Widefield Array (GLEAM) survey. The GLEAM survey is the widest fractional bandwidth all-sky survey to date, ideal for identifying peaked-spectrum sources at low radio frequencies. Our peaked-spectrum sources are the low-frequency analogs of gigahertz-peaked spectrum (GPS) and compact-steep spectrum (CSS) sources, which have been hypothesized to be the precursors to massive radio galaxies. Our sample more than doubles the number of known peaked-spectrum candidates, and 95% of our sample have a newly characterized spectral peak. We highlight that some GPS sources peaking above 5 GHz have had multiple epochs of nuclear activity, and we demonstrate the possibility of identifying high-redshift ( z > 2) galaxies via steep optically thin spectral indices and low observed peak frequencies. The distribution of the optically thick spectral indices of our sample is consistent with past GPS/CSS samples but with a large dispersion, suggesting that the spectral peak is a product of an inhomogeneous environment that is individualistic. We find no dependence of observed peak frequency with redshift, consistent with the peaked-spectrum sample comprising both local CSS sources and high-redshift GPS sources. The 5 GHz luminosity distribution lacks the brightest GPS and CSS sources of previous samples, implying that a convolution of source evolution and redshift influences the type of peaked-spectrum sources identified below 1 GHz. Finally, we discuss sources with optically thick spectral indices that exceed the synchrotron self-absorption limit.

  8. The sharp peak-flat trough pattern and critical speculation

    OpenAIRE

    Roehner, B. M.; Sornette, D.

    1998-01-01

    We find empirically a characteristic sharp peak-flat trough pattern in a large set of commodity prices. We argue that the sharp peak structure reflects an endogenous inter-market organization, and that peaks may be seen as local ``singularities'' resulting from imitation and herding. These findings impose a novel stringent constraint on the construction of models. Intermittent amplification is not sufficient and nonlinear effects seem necessary to account for the observations.

  9. Gamma-ray peak shapes from cadmium zinc telluride detectors

    Energy Technology Data Exchange (ETDEWEB)

    Namboodiri, M.N.; Lavietes, A.D.; McQuaid, J.H.

    1996-09-01

    We report the results of a study of the peak shapes in the gamma spectra measured using several 5 x 5 x 5 mm{sup 3} cadmium zinc telluride (CZT) detectors. A simple parameterization involving a Gaussian and an exponential low energy tail describes the peak shapes sell. We present the variation of the parameters with gamma energy. This type of information is very useful in the analysis of complex gamma spectra consisting of many peaks.

  10. Statistics of peaks in cosmological nonlinear density fields

    International Nuclear Information System (INIS)

    Suginohara, Tatsushi; Suto, Yasushi.

    1990-06-01

    Distribution of the high-density peaks in the universe is examined using N-body simulations. Nonlinear evolution of the underlying density field significantly changes the statistical properties of the peaks, compared with the analytic results valid for the random Gaussian field. In particular, the abundances and correlations of the initial density peaks are discussed in the context of biased galaxy formation theory. (author)

  11. Environmental impacts of public transport. Why peak-period travellers cause a greater environmental burden than off-peak travellers

    International Nuclear Information System (INIS)

    Rietveld, P.

    2002-01-01

    Given the difference between peak and off-peak occupancy rates in public transport, emissions per traveller kilometre are lower in the peak than in the off-peak period, whereas the opposite pattern is observed for cars. It is argued that it is much more fruitful to analyse environmental effects in marginal terms. This calls for a careful analysis of capacity management policies of public transport suppliers that are facing increased demand during both peak and off-peak periods. A detailed analysis of capacity management by the Netherlands Railways (NS) revealed that off-peak capacity supply is mainly dictated by the demand levels during the peak period. The analysis included the effects of increased frequency and increased vehicle size on environmental impacts, while environmental economies of vehicle size were also taken into account. The main conclusion is that the marginal environmental burden during the peak hours is much higher than is usually thought, whereas it is almost zero during the off-peak period. This implies a pattern that is the precise opposite of the average environmental burden. Thus, an analysis of environmental effects of public transport based on average performance would yield misleading conclusions [nl

  12. Neuroscience imaging enabled by new highly tunable and high peak power femtosecond lasers

    Science.gov (United States)

    Hakulinen, T.; Klein, J.

    2017-02-01

    Neuroscience applications benefit from recent developments in industrial femtosecond laser technology. New laser sources provide several megawatts of peak power at wavelength of 1040 nm, which enables simultaneous optogenetics photoactivation of tens or even hundreds of neurons using red shifted opsins. Another recent imaging trend is to move towards longer wavelengths, which would enable access to deeper layers of tissue due to lower scattering and lower absorption in the tissue. Femtosecond lasers pumping a non-collinear optical parametric amplifier (NOPA) enable the access to longer wavelengths with high peak powers. High peak powers of >10 MW at 1300 nm and 1700 nm allow effective 3-photon excitation of green and red shifted calcium indicators respectively and access to deeper, sub-cortex layers of the brain. Early results include in vivo detection of spontaneous activity in hippocampus within an intact mouse brain, where neurons express GCaMP6 activated in a 3-photon process at 1320 nm.

  13. The dislocation-internal friction peak γ in tantalum

    International Nuclear Information System (INIS)

    Baur, J.; Benoit, W.; Schultz, H.

    1989-01-01

    Torsion-pendulum measurements were carried out on high-purity single crystal specimens of tantalum, having extremely low oxygen contents ( 2 peak, which appears close to γ is small traces of oxygen are presents. The γ 2 peak was formerly explained as a ''dislocation-enhanced Snoek peak''. The γ peak recovers at the peak temperature, whereas the γ 2 peak is more stable. On the basis of their results, and making use of earlier investigations of Rodrian and Schultz, the authors suggest that γ 2 is modified γ relaxation, related to screw-dislocation segments, stabilized by oxygen-decorated kinks. The stability of the γ 2 peak allows an accurate determination of the activation energy, found to be 1.00 +- 0.03 eV. This value is distinctly lower than the activation energy of the oxygen Snoek effect (1.10 eV) and is related here to the mechanism of ''kink-pair formation'' in screw dislocations, as the original γ peak. The numerical value is compatible with recent values derived from flow-stress measurements. The peak γ 2 shows increasing stability with increasing oxygen content. This is explained by single- and multi-decorated kinks

  14. Evaluation of peak-fitting software for gamma spectrum analysis

    International Nuclear Information System (INIS)

    Zahn, Guilherme S.; Genezini, Frederico A.; Moralles, Mauricio

    2009-01-01

    In all applications of gamma-ray spectroscopy, one of the most important and delicate parts of the data analysis is the fitting of the gamma-ray spectra, where information as the number of counts, the position of the centroid and the width, for instance, are associated with each peak of each spectrum. There's a huge choice of computer programs that perform this type of analysis, and the most commonly used in routine work are the ones that automatically locate and fit the peaks; this fit can be made in several different ways - the most common ways are to fit a Gaussian function to each peak or simply to integrate the area under the peak, but some software go far beyond and include several small corrections to the simple Gaussian peak function, in order to compensate for secondary effects. In this work several gamma-ray spectroscopy software are compared in the task of finding and fitting the gamma-ray peaks in spectra taken with standard sources of 137 Cs, 60 Co, 133 Ba and 152 Eu. The results show that all of the automatic software can be properly used in the task of finding and fitting peaks, with the exception of GammaVision; also, it was possible to verify that the automatic peak-fitting software did perform as well as - and sometimes even better than - a manual peak-fitting software. (author)

  15. Individual vision and peak distribution in collective actions

    Science.gov (United States)

    Lu, Peng

    2017-06-01

    People make decisions on whether they should participate as participants or not as free riders in collective actions with heterogeneous visions. Besides of the utility heterogeneity and cost heterogeneity, this work includes and investigates the effect of vision heterogeneity by constructing a decision model, i.e. the revised peak model of participants. In this model, potential participants make decisions under the joint influence of utility, cost, and vision heterogeneities. The outcomes of simulations indicate that vision heterogeneity reduces the values of peaks, and the relative variance of peaks is stable. Under normal distributions of vision heterogeneity and other factors, the peaks of participants are normally distributed as well. Therefore, it is necessary to predict distribution traits of peaks based on distribution traits of related factors such as vision heterogeneity and so on. We predict the distribution of peaks with parameters of both mean and standard deviation, which provides the confident intervals and robust predictions of peaks. Besides, we validate the peak model of via the Yuyuan Incident, a real case in China (2014), and the model works well in explaining the dynamics and predicting the peak of real case.

  16. Bayesian approach for peak detection in two-dimensional chromatography.

    Science.gov (United States)

    Vivó-Truyols, Gabriel

    2012-03-20

    A new method for peak detection in two-dimensional chromatography is presented. In a first step, the method starts with a conventional one-dimensional peak detection algorithm to detect modulated peaks. In a second step, a sophisticated algorithm is constructed to decide which of the individual one-dimensional peaks have been originated from the same compound and should then be arranged in a two-dimensional peak. The merging algorithm is based on Bayesian inference. The user sets prior information about certain parameters (e.g., second-dimension retention time variability, first-dimension band broadening, chromatographic noise). On the basis of these priors, the algorithm calculates the probability of myriads of peak arrangements (i.e., ways of merging one-dimensional peaks), finding which of them holds the highest value. Uncertainty in each parameter can be accounted by adapting conveniently its probability distribution function, which in turn may change the final decision of the most probable peak arrangement. It has been demonstrated that the Bayesian approach presented in this paper follows the chromatographers' intuition. The algorithm has been applied and tested with LC × LC and GC × GC data and takes around 1 min to process chromatograms with several thousands of peaks.

  17. A Cryogenic Infrared Calibration Target

    Science.gov (United States)

    Wollack, E. J.; Kinzer, R. E., Jr.; Rinehart, S. A.

    2014-01-01

    A compact cryogenic calibration target is presented that has a peak diffuse reflectance, R target. The resulting target assembly is lightweight, has a low-geometric profile, and has survived repeated thermal cycling from room temperature to approx.4 K. Basic design considerations, governing equations, and test data for realizing the structure described are provided. The optical properties of selected absorptive materials-Acktar Fractal Black, Aeroglaze Z306, and Stycast 2850 FT epoxy loaded with stainless steel powder-are characterized and presented

  18. Assessing peak aerobic capacity in Dutch law enforcement officers

    Directory of Open Access Journals (Sweden)

    Harriet Wittink

    2015-06-01

    Full Text Available Objectives: To cross-validate the existing peak rate of oxygen consumption (VO2peak prediction equations in Dutch law enforcement officers and to determine whether these prediction equations can be used to predict VO2peak for groups and in a single individual. A further objective was to report normative absolute and relative VO2peak values of a sample of law enforcement officers in the Netherlands. Material and Methods: The peak rate of oxygen consumption (ml×kg–1×min–1 was measured using a maximal incremental bicycle test in 1530 subjects, including 1068 male and 461 female police officers. Validity of the prediction equations for groups was assessed by comparing predicted VO2peak with measured VO2peak using paired t-tests. For individual differences limits of agreement (LoA were calculated. Equations were considered valid for individuals when the difference between measured and predicted VO2peak did not exceed ±1 metabolic equivalent (MET in 95% of individuals. Results: None of the equations met the validity criterion of 95% of individuals having ±1 MET difference or less than the measured value. Limits of agreement (LoAs were large in all predictions. At the individual level, none of the equations were valid predictors of VO2peak (ml×kg–1×min–1. Normative values for Dutch law enforcement officers were presented. Conclusions: Substantial differences between measured and predicted VO2peak (ml×kg–1×min–1 were found. Most tested equations were invalid predictors of VO2peak at group level and all were invalid at individual levels.

  19. An exploratory analysis of California residential customer response to critical peak pricing of electricity

    International Nuclear Information System (INIS)

    Herter, Karen; McAuliffe, Patrick; Rosenfeld, Arthur

    2007-01-01

    This paper summarizes the results from an exploratory analysis of residential customer response to a critical peak pricing (CPP) experiment in California, in which 15 times per year participating customers received high price signals dispatched by a local electricity distribution company. The high prices were about three times the on-peak price for the otherwise applicable time-of-use rate. Using hourly load data collected during the 15-month experiment, we find statistically significant load reduction for participants both with and without automated end-use control technologies. During 5-h critical peak periods, participants without control technology used up to 13% less energy than they did during normal peak periods. Participants equipped with programmable communicating thermostats used 25% and 41% less for 5 and 2h critical events, respectively. Thus, this paper offers convincing evidence that the residential sector can provide substantial contributions to retail demand response, which is considered a potential tool for mitigating market power, stabilizing wholesale market prices, managing system reliability, and maintaining system resource adequacy. (author)

  20. Extreme daily increases in peak electricity demand: Tail-quantile estimation

    International Nuclear Information System (INIS)

    Sigauke, Caston; Verster, Andréhette; Chikobvu, Delson

    2013-01-01

    A Generalized Pareto Distribution (GPD) is used to model extreme daily increases in peak electricity demand. The model is fitted to years 2000–2011 recorded data for South Africa to make a comparative analysis with the Generalized Pareto-type (GP-type) distribution. Peak electricity demand is influenced by the tails of probability distributions as well as by means or averages. At times there is a need to depart from the average thinking and exploit information provided by the extremes (tails). Empirical results show that both the GP-type and the GPD are a good fit to the data. One of the main advantages of the GP-type is the estimation of only one parameter. Modelling of extreme daily increases in peak electricity demand helps in quantifying the amount of electricity which can be shifted from the grid to off peak periods. One of the policy implications derived from this study is the need for day-time use of electricity billing system similar to the one used in the cellular telephone/and fixed line-billing technology. This will result in the shifting of electricity demand on the grid to off peak time slots as users try to avoid high peak hour charges. - Highlights: ► Policy makers should design demand response strategies to save electricity. ► Peak electricity demand is influenced by tails of probability distributions. ► Both the GSP and the GPD are a good fit to the data. ► Accurate assessment of level and frequency of extreme load forecasts is important.

  1. The end of Peak Oil? Why this topic is still relevant despite recent denials

    International Nuclear Information System (INIS)

    Chapman, Ian

    2014-01-01

    Up until recently Peak Oil was a major discussion point crossing from academic research into mainstream journalism, yet it now attracts far less interest. This paper evaluates the reasons for this and on-going relevance of Peak Oil, considering variations in predictive dates for the phenomenon supported by technological, economic and political issues. Using data from agencies, the validity of each position is assessed looking at reserves, industrial developments and alternative fuels. The complicating issue of demand is also considered. The conclusions are that, supported by commercial interests, an unsubstantiated belief in market and technical solutions, and a narrow paradigmatic focus, critics of Peak Oil theory have used unreliable reserve data, optimistic assumptions about utilisation of unconventional supplies and unrealistic predictions for alternative energy production to discredit the evidence that the resource-limited peak in the world's production of conventional oil has arrived, diverting discussion from what should be a serious topic for energy policy: how we respond to decreasing supplies of one of our most important energy sources. - Highlights: • Key advocates/opponents of Peak Oil reveal their biases. • Reserve calculation methods are considered, showing flaws. • Non-conventional oils’ viability is critiqued and found wanting. • Alternative fuels are found to be unsuitable substitutes for oil. • Demand increases add to the potential for fuel shortages

  2. Constraining the shape of the CMB: A peak-by-peak analysis

    International Nuclear Information System (INIS)

    Oedman, Carolina J.; Hobson, Michael P.; Lasenby, Anthony N.; Melchiorri, Alessandro

    2003-01-01

    The recent measurements of the power spectrum of cosmic microwave background anisotropies are consistent with the simplest inflationary scenario and big bang nucleosynthesis constraints. However, these results rely on the assumption of a class of models based on primordial adiabatic perturbations, cold dark matter and a cosmological constant. In this paper we investigate the need for deviations from the Λ-CDM scenario by first characterizing the spectrum using a phenomenological function in a 15 dimensional parameter space. Using a Monte Carlo Markov chain approach to Bayesian inference and a low curvature model template we then check for the presence of new physics and/or systematics in the CMB data. We find an almost perfect consistency between the phenomenological fits and the standard Λ-CDM models. The curvature of the secondary peaks is weakly constrained by the present data, but they are well located. The improved spectral resolution expected from future satellite experiments is warranted for a definitive test of the scenario

  3. Limitations of middle cerebral artery peak systolic velocity in the ...

    African Journals Online (AJOL)

    We present a case of a mother with severe pre-eclampsia at 32 weeks' gestation and non-immune fetal hydrops without obvious cause. Since the. MCA peak systolic velocity (PSV) was ... Limitations of middle cerebral artery peak systolic velocity .... [7] found MCA PSV of value in 9 women with chronic abruption, but in 5.

  4. Daily Nigerian peak load forecasting using artificial neural network ...

    African Journals Online (AJOL)

    A daily peak load forecasting technique that uses artificial neural network with seasonal indices is presented in this paper. A neural network of relatively smaller size than the main prediction network is used to predict the daily peak load for a period of one year over which the actual daily load data are available using one ...

  5. Diffraction peaks in x-ray spectroscopy: Friend or foe?

    International Nuclear Information System (INIS)

    Tissot, R.G.; Goehner, R.P.

    1992-01-01

    Diffraction peaks can occur as unidentifiable peaks in the energy spectrum of an x-ray spectrometric analysis. Recently, there has been increased interest in oriented polycrystalline films and epitaxial films on single crystal substrates for electronic applications. Since these materials diffract x-rays more efficiently than randomly oriented polycrystalline materials, diffraction peaks are being observed more frequently in x-ray fluorescent spectra. In addition, micro x-ray spectrometric analysis utilizes a small, intense, collimated x-ray beam that can yield well defined diffraction peaks. In some cases these diffraction peaks can occur at the same position as elemental peaks. These diffraction peaks, although a possible problem in qualitative and quantitative elemental analysis, can give very useful information about the crystallographic structure and orientation of the material being analyzed. The observed diffraction peaks are dependent on the geometry of the x-ray spectrometer, the degree of collimation and the distribution of wavelengths (energies) originating from the x-ray tube and striking the sample

  6. Quality Assurance in the Determination of Overlapping Peak Areas

    DEFF Research Database (Denmark)

    Christensen, L.H.; Heydorn, K.

    1987-01-01

    The ability of different computer programs to yield accurate peak areas in statistical control in the case of partially overlapping photopeaks has been tested by the Analysis of Precision. A modified Covell method, two commercially available peak-fitting programs from Nuclear Data and Ortec, and ...

  7. Peak effect in surface resistance at microwave frequencies in Dy ...

    Indian Academy of Sciences (India)

    In the measurements at both frequencies the induced microwave current was always less than the critical current of the films. The reason for observation of this peak effect in these films has been explained in our earlier publication [5]. Comparing figures 1 and 2, it is observed that the peaks in sample S1 are broader and.

  8. Peak heart rate decreases with increasing severity of acute hypoxia

    DEFF Research Database (Denmark)

    Lundby, C; Araoz, M; Van Hall, Gerrit

    2001-01-01

    , 459, and 404 mmHg) in a hypobaric chamber and while breathing 9% O(2) in N(2). These conditions were equivalent to altitudes of 3300, 4300, 5300, and 6300 m above sea level, respectively. At 4300 m, maximal exercise was also repeated after 4 and 8 h. Peak heart rate (HR) decreased from 191 (182......-202) (mean and range) at sea level to 189 (179-200), 182 (172-189), 175 (166-183), and 165 (162-169) in the acute hypoxic conditions. Peak HR did not decrease further after 4 and 8 h at 4300 m compared to the acute exposure at this altitude. Between barometric pressures of 518 and 355 mmHg (approximately...... 3300 and 6300 m), peak HR decreased linearly: peak HR(hypobaria) = peak HR(sea level) - 0.135 x [hypobaria(3100) - hypobaria (mmHg)]; or peak HR(altitude) = peak HR(sea level) - 0.15 x (altitude - 3100 m). This corresponds to approximately 1-beat x min(-1) reduction in peak HR for every 7-mmHg decrease...

  9. Determination of gaussian peaks in gamma spectra by iterative regression

    International Nuclear Information System (INIS)

    Nordemann, D.J.R.

    1987-05-01

    The parameters of the peaks in gamma-ray spectra are determined by a simple iterative regression method. For each peak, the parameters are associated with a gaussian curve (3 parameters) located above a linear continuum (2 parameters). This method may produces the complete result of the calculation of statistical uncertainties and an accuracy higher than others methods. (author) [pt

  10. Peak Expiratory Flow Rate In Cigarette Smokers | Ukoli | Highland ...

    African Journals Online (AJOL)

    Objective: To compare lung function between smokers and non-smokers using Peak Expiratory Flow Rate (PEFR). Methods: This study examines the peak expiratory flow rate (PEFR) of three hundred and forty cigarette smokers, age and sex-matched with PEFR of equal number of non-smokers. Results: The mean PEFR of ...

  11. Online junction temperature measurement using peak gate current

    DEFF Research Database (Denmark)

    Baker, Nick; Munk-Nielsen, Stig; Iannuzzo, Francesco

    2015-01-01

    A new method for junction temperature measurement of MOS-gated power semiconductor switches is presented. The measurement method involves detecting the peak voltage over the external gate resistor of an IGBT or MOSFET during turn-on. This voltage is directly proportional to the peak gate current...

  12. Psychological Preparation for Peak Performance in Sports Competition

    Science.gov (United States)

    Ohuruogu, Ben; Jonathan, Ugwuanyi I.; Ikechukwu, Ugwu Jude

    2016-01-01

    This paper attempts to make an overview of various techniques, sport psychologist adopt in psychological preparation of athletes for peak performance. To attain peak performance in sports competitions, coaches and athletes should not base their prospect on physical training on sport skills alone rather should integrate both the mental and physical…

  13. Identification of peaks in multidimensional coincidence {gamma}-ray spectra

    Energy Technology Data Exchange (ETDEWEB)

    Morhac, Miroslav E-mail: fyzimiro@savba.sk; Kliman, Jan; Matousek, Vladislav; Veselsky, Martin; Turzo, Ivan

    2000-03-21

    In the paper a new algorithm to find peaks in two, three and multidimensional spectra, measured in large multidetector {gamma}-ray arrays, is derived. Given the dimension m, the algorithm is selective to m-fold coincidence peaks. It is insensitive to intersections of lower-fold coincidences, hereinafter called ridges.

  14. Identification of peaks in multidimensional coincidence γ-ray spectra

    International Nuclear Information System (INIS)

    Morhac, Miroslav; Kliman, Jan; Matousek, Vladislav; Veselsky, Martin; Turzo, Ivan

    2000-01-01

    In the paper a new algorithm to find peaks in two, three and multidimensional spectra, measured in large multidetector γ-ray arrays, is derived. Given the dimension m, the algorithm is selective to m-fold coincidence peaks. It is insensitive to intersections of lower-fold coincidences, hereinafter called ridges

  15. Probabilistic peak detection for first-order chromatographic data

    NARCIS (Netherlands)

    Lopatka, M.; Vivó-Truyols, G.; Sjerps, M.J.

    2014-01-01

    We present a novel algorithm for probabilistic peak detection in first-order chromatographic data. Unlike conventional methods that deliver a binary answer pertaining to the expected presence or absence of a chromatographic peak, our method calculates the probability of a point being affected by

  16. Antiproton Target

    CERN Multimedia

    1980-01-01

    Antiproton target used for the AA (antiproton accumulator). The first type of antiproton production target used from 1980 to 1982 comprised a rod of copper 3mm diameter and 120mm long embedded in a graphite cylinder that was itself pressed into a finned aluminium container. This assembly was air-cooled and it was used in conjunction with the Van der Meer magnetic horn. In 1983 Fermilab provided us with lithium lenses to replace the horn with a view to increasing the antiproton yield by about 30%. These lenses needed a much shorter target made of heavy metal - iridium was chosen for this purpose. The 50 mm iridium rod was housed in an extension to the original finned target container so that it could be brought very close to the entrance to the lithium lens. Picture 1 shows this target assembly and Picture 2 shows it mounted together with the lithium lens. These target containers had a short lifetime due to a combination of beam heating and radiation damage. This led to the design of the water-cooled target in...

  17. Adherence to self-monitoring via interactive voice response technology in an eHealth intervention targeting weight gain prevention among Black women: randomized controlled trial.

    Science.gov (United States)

    Steinberg, Dori M; Levine, Erica L; Lane, Ilana; Askew, Sandy; Foley, Perry B; Puleo, Elaine; Bennett, Gary G

    2014-04-29

    eHealth interventions are effective for weight control and have the potential for broad reach. Little is known about the use of interactive voice response (IVR) technology for self-monitoring in weight control interventions, particularly among populations disproportionately affected by obesity. This analysis sought to examine patterns and predictors of IVR self-monitoring adherence and the association between adherence and weight change among low-income black women enrolled in a weight gain prevention intervention. The Shape Program was a randomized controlled trial comparing a 12-month eHealth behavioral weight gain prevention intervention to usual care among overweight and obese black women in the primary care setting. Intervention participants (n=91) used IVR technology to self-monitor behavior change goals (eg, no sugary drinks, 10,000 steps per day) via weekly IVR calls. Weight data were collected in clinic at baseline, 6, and 12 months. Self-monitoring data was stored in a study database and adherence was operationalized as the percent of weeks with a successful IVR call. Over 12 months, the average IVR completion rate was 71.6% (SD 28.1) and 52% (47/91) had an IVR completion rate ≥80%. At 12 months, IVR call completion was significantly correlated with weight loss (r =-.22; P=.04) and participants with an IVR completion rate ≥80% had significantly greater weight loss compared to those with an IVR completion rate self-monitoring. Adherence to IVR self-monitoring was high among socioeconomically disadvantaged black women enrolled in a weight gain prevention intervention. Higher adherence to IVR self-monitoring was also associated with greater weight change. IVR is an effective and useful tool to promote self-monitoring and has the potential for widespread use and long-term sustainability. Clinicaltrials.gov NCT00938535; http://www.clinicaltrials.gov/ct2/show/NCT00938535.

  18. Targeted intraoperative radiotherapy in oncology

    CERN Document Server

    Keshtgar, Mohammed; Wenz, Frederik

    2014-01-01

    Targeted intraoperative radiotherapy is a major advance in the management of cancer patients. With an emphasis on practical aspects, this book offers an ideal introduction to this innovative  technology for clinicians.

  19. The effect of utility time-varying pricing and load control strategies on residential summer peak electricity use. A review

    International Nuclear Information System (INIS)

    Newsham, Guy R.; Bowker, Brent G.

    2010-01-01

    Peak demand for electricity in North America is expected to grow, challenging electrical utilities to supply this demand in a cost-effective, reliable manner. Therefore, there is growing interest in strategies to reduce peak demand by eliminating electricity use, or shifting it to non-peak times. This strategy is commonly called 'demand response'. In households, common strategies are time-varying pricing, which charge more for energy use on peak, or direct load control, which allows utilities to curtail certain loads during high demand periods. We reviewed recent North American studies of these strategies. The data suggest that the most effective strategy is a critical peak price (CPP) program with enabling technology to automatically curtail loads on event days. There is little evidence that this causes substantial hardship for occupants, particularly if they have input into which loads are controlled and how, and have an override option. In such cases, a peak load reduction of at least 30% is a reasonable expectation. It might be possible to attain such load reductions without enabling technology by focusing on household types more likely to respond, and providing them with excellent support. A simple time-of-use (TOU) program can only expect to realise on-peak reductions of 5%. (author)

  20. Experiences of Vulnerable Residential Customer Subpopulations with Critical Peak Pricing

    Energy Technology Data Exchange (ETDEWEB)

    Cappers, Peter [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Spurlock, C. Anna [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Todd, Annika [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Jin, Ling [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States)

    2017-04-13

    DOE decided to co-fund ten utilities to undertake eleven experimentally-designed Consumer Behavior Studies (CBS) that proposed to examine a wide range of the topics of interest to the electric utility industry. Each chosen utility was to design, implement and evaluate their own study in order to address questions of interest both to itself and to its applicable regulatory authority, whose approval was generally necessary for the study to proceed. The DOE Office of Energy Delivery and Electricity Reliability (OE), however, did set guidelines, both in the FOA and subsequently during the contracting period, for what would constitute an acceptable study under the Grant. To assist in ensuring these guidelines were adhered to, OE requested that LBNL act as project manager for these Consumer Behavior Studies to achieve consistency of experimental design and adherence to data collection and reporting protocols across the ten utilities. As part of its role, LBNL formed technical advisory groups (TAG) to separately assist each of the utilities by providing technical assistance in all aspects of the design, implementation and evaluation of their studies. LBNL was also given a unique opportunity to perform a comprehensive, cross-study analysis that uses the customer-level interval meter and demographic data made available by these utilities due to SGIG-imposed reporting requirements, in order to analyze critical policy issues associated with AMI-enabled rates and control/information technology. LBNL will publish the results of these analyses in a series of research reports, of which this is one, that attempt to address critical policy issues relating to a variety of topics including customer acceptance, retention and load response to time-based rates and various forms of enabling control and information technologies. This report extends the existing empirical literature on the experiences of low-income customers exposed to critical peak pricing, and provides the first glimpses

  1. Target raster system at CEBAF

    International Nuclear Information System (INIS)

    Yan, C.; Adderley, P.; Carlini, R.; Cuevas, C.; Vulcan, W.; Wines, R.

    1995-01-01

    A fast raster (FR) system consisting of two Litz cable air-core magnets (x, y) has been installed and tested in the Hall C beam line tunnel, 21 m from the cryogenic target. The system provides a maximum deflection of 0.06 mrad at a frequency range of 15-45 kHz for a 6 GeV electron beam. The FR magnets are driven by a MOSFET bipolar switching power source with a triangle current waveform, the peak-to-peak current is 40 A. (orig.)

  2. Direct observation of the hydrogen peak in the energy distribution of electrons backscattered elastically from polyethylene

    International Nuclear Information System (INIS)

    Varga, D.; Toekesi, K.; Berenyi, Z.; Toth, J.; Koever, L.

    2004-01-01

    Complete text of publication follows. Observation of the hydrogen peak is either challenging or impossible task for the conventional electron spectroscopy. Hydrogen was observed earlier in electron scattering experiments using transmission geometry and formvar film. In this work we show an alternative way for the detection of hydrogen peak analyzing the spectra of elastically backscattered electrons from polyethylene ((CH 2 ) n ). We take advantage of the fact that the elastic peak from polyethylene split into carbon and hydrogen components. The energy of the elastically scattered electrons is shifted from the nominal values due to the energy transfer between the primary electron and the target atoms (recoil effect). Due to the motion of the scattering atoms, a broadering of the energy width of the spectra takes place. We performed Monte Carlo simulation for 2 keV electrons penetrated and elastically backscattered from polyethylene sample. In our calculations both the elastic and inelastic scattering events were taken into account. We further assume that the thermal motion of the target atoms follows the Maxwell-Boltzmann energy distribution. After each elastic scattering the recoil energy was calculated according to ref Fig. 1 shows the geometric configuration used in the calculation. The initial angle of incident beam (θ) was 50 deg. Fig. 2 shows the gray scale plot of the intensity of electrons backscattered elastically from polyethylene. The separation between the carbon and hydrogen peaks is clearly seen. Our results show that the multiple electron scattering causes only minor changes in the energy shifts and broadenings of elastic peaks. Moreover, our simulations are in good agreement with our experimental observations. (author)

  3. Target chamber studies for the inertial confinement fusion technology test bed, FIRST STEP. Final report, April 30, 1985-June 30, 1986

    International Nuclear Information System (INIS)

    Peterson, R.R.

    1986-06-01

    Two issues have been examined that are important to heavy ion beam cavity design: vaporization and condensation of wall material and active pumping of noncondensable cavity gases. These issues have been studied in the context of a particular target chamber design where the first wall is covered with flowing liquid lithium. A computer code, CONRAD, has been written to simulate the vaporization and condensation. Scaling laws have been devised from basic laws of physics and results of computer simulations for the case of liquid lithium protected cavities. These scaling laws can be used to calculate the allowable repetition rate for the cavity based on the dimensions and conditions of the cavity and the allowed gas density. Standard gas pumping formulas are used to estimate the pumping power needed to clear the cavity of noncondensable gases. The area of cryopanels has been determined for a given design of the tube through which the pumping occurs. The contamination of the cryopanels by lithium vapor has been studied and is found to be a potentially serious problem

  4. Study Protocol of MINI SALTEN: a technology-based multi-component intervention in the school environment targeting healthy habits of first grade children and their parents.

    Science.gov (United States)

    Kovalskys, Irina; Rausch Herscovici, Cecile; Indart Rougier, Paula; De Gregorio, María José; Zonis, Luciana; Orellana, Liliana

    2017-05-06

    MINI SALTEN is a program developed to increase moderate to vigorous physical activity (PA) and improve eating habits at home and school in first grade children. It aims to assess the effects of a technology family-based and PA school-based intervention. The purpose of this manuscript is to describe the protocol design and the MINISALTEN intervention. This is cluster-randomized controlled trial designed to run from July 2015 to November 2016 in 12 public schools of the city of Buenos Aires, matched for socio-demographic characteristics. The intervention is based on two main components: (a) "active breaks" (AB): implemented during school breaks by a PA instructor; (b) "virtual" (V): web-based contents delivered to the families via a multiplatform application. Using a computer generated random sequence participants are allocated to one of four intervention conditions: (AB), (V), (AB + V), and control (C). Outcomes are measured at baseline and 12 months post intervention, and will include data collected from the child and her/his mother/father or guardian. Primary outcome measures are: PA and sedentary behaviour (measured with accelerometers). Secondary outcome measures related are: percentage of kilocalories (kcal) from added sugars, and from total and saturated fats; grams of fruits and vegetables; and number of snacks and kcal coming from their added sugars and total and saturated fats. Family socio-economic level, home environment, and school environment will also be assessed. Statistical analysis is on an intention-to-treat principle. Baseline characteristics are described using summary measures and mixed models (with school as random effect). The effect of the two interventions will be estimated using a generalized mixed linear model with link and distribution selected according to the type of outcome. Included random effects are: child (or mother/father or guardian) accounting for repeated measures; school accounting for cluster induced by school. The most

  5. Peak broadening in paper chromatography and related techniques : III. Peak broadening in thin-layer chromatography on cellulose powder

    NARCIS (Netherlands)

    Ligny, C.L. de; Remijnse, A.G.

    1968-01-01

    The mechanism of peak broadening in thin-layer chromatography on cellulose powder was investigated by comparing the peak widths obtained in chromatography with those caused only by diffusion in the cellulose powder, for a set of amino acids of widely differing RF values and six kinds of cellulose

  6. Evaluation of different time domain peak models using extreme learning machine-based peak detection for EEG signal.

    Science.gov (United States)

    Adam, Asrul; Ibrahim, Zuwairie; Mokhtar, Norrima; Shapiai, Mohd Ibrahim; Cumming, Paul; Mubin, Marizan

    2016-01-01

    Various peak models have been introduced to detect and analyze peaks in the time domain analysis of electroencephalogram (EEG) signals. In general, peak model in the time domain analysis consists of a set of signal parameters, such as amplitude, width, and slope. Models including those proposed by Dumpala, Acir, Liu, and Dingle are routinely used to detect peaks in EEG signals acquired in clinical studies of epilepsy or eye blink. The optimal peak model is the most reliable peak detection performance in a particular application. A fair measure of performance of different models requires a common and unbiased platform. In this study, we evaluate the performance of the four different peak models using the extreme learning machine (ELM)-based peak detection algorithm. We found that the Dingle model gave the best performance, with 72 % accuracy in the analysis of real EEG data. Statistical analysis conferred that the Dingle model afforded significantly better mean testing accuracy than did the Acir and Liu models, which were in the range 37-52 %. Meanwhile, the Dingle model has no significant difference compared to Dumpala model.

  7. The Mechanics of Peak-Ring Impact Crater Formation from the IODP-ICDP Expedition 364

    Science.gov (United States)

    Melosh, H.; Collins, G. S.; Morgan, J. V.; Gulick, S. P. S.

    2017-12-01

    The Chicxulub impact crater is one of very few peak-ring impact craters on Earth. While small (less than 3 km on Earth) impact craters are typically bowl-shaped, larger craters exhibit central peaks, which in still larger (more than about 100 km on Earth) craters expand into mountainous rings with diameters close to half that of the crater rim. The origin of these peak rings has been contentious: Such craters are far too large to create in laboratory experiments and remote sensing of extraterrestrial examples has not clarified the mechanics of their formation. Two principal models of peak ring formation are currently in vogue, the "nested crater" model, in which the peak ring originates at shallow depths in the target, and the "dynamic collapse" model in which the peak ring is uplifted at the base of a collapsing, over-steepened central peak and its rocks originate at mid-crustal depths. IODP-ICDP Expedition 364 sought to elucidate, among other important goals, the mechanics of peak ring formation in the young (66 Myr), fresh, but completely buried Chicxulub impact crater. The cores from this borehole now show unambiguously that the rocks in the Chicxulub peak ring originated at mid-crustal depths, apparently ruling out the nested crater model. These rocks were shocked to pressures on the order of 10-35 GPa and were so shattered that their densities and seismic velocities now resemble those of sedimentary rocks. The morphology of the final crater, its structure as revealed in previous seismic imaging, and the results from the cores are completely consistent with modern numerical models of impact crater excavation and collapse that incorporate a model for post-impact weakening. Subsequent to the opening of a ca. 100 km diameter and 30 km deep transient crater, this enormous hole in the crust collapsed over a period of about 10 minutes. Collapse was enabled by movement of the underlying rocks, which briefly behaved in the manner of a high-viscosity fluid, a brittle

  8. Neutron capture therapy (NCT) and in-hospital neutron irradiator (IHNI) a new technology on binary targeting radiation therapy of cancer

    International Nuclear Information System (INIS)

    Zhou Yongmao

    2009-01-01

    BNCT is finally becoming 'a new option against cancer'. The difficulties for its development progress of that firstly is to improve the performance of boron compounds,secondly, it is the requirements of quantification and accuracy upon radiation dosimetry evaluation in clinical trials. Furthermore, that is long anticipation on hospital base neutron sources. It includes dedicated new NCT reactor, accelerator based neutron sources, and isotope source facilities. In addition to reactors, so far, the technology of other types of sources for clinical trials is not yet completely proven. The In-Hospital Neutron Irradiator specially designed for NCT, based on the MNSR successfully developed by China, can be installed inside or near the hospital and operated directly by doctors. The Irradiator has two neutron beams for respective treatment of the shallow and deep tumors. It is expected to initiate operation in the end of this year. It would provide a safe, low cost, and effective treatment tool for the NCT routine application in near future. (authors)

  9. System dynamics model of Hubbert Peak for China's oil

    International Nuclear Information System (INIS)

    Tao Zaipu; Li Mingyu

    2007-01-01

    American geophysicist M. King Hubbert in 1956 first introduced a logistic equation to estimate the peak and lifetime production for oil of USA. Since then, a fierce debate ensued on the so-called Hubbert Peak, including also its methodology. This paper proposes to use the generic STELLA model to simulate Hubbert Peak, particularly for the Chinese oil production. This model is demonstrated as being robust. We used three scenarios to estimate the Chinese oil peak: according to scenario 1 of this model, the Hubbert Peak for China's crude oil production appears to be in 2019 with a value of 199.5 million tonnes, which is about 1.1 times the 2005 output. Before the peak comes, Chinese oil output will grow by about 1-2% annually, after the peak, however, the output will fall. By 2040, the annual production of Chinese crude oil would be equivalent to the level of 1990. During the coming 20 years, the crude oil demand of China will probably grow at the rate of 2-3% annually, and the gap between domestic supply and total demand may be more than half of this demand

  10. Core fueling to produce peaked density profiles in large tokamaks

    International Nuclear Information System (INIS)

    Mikkelsen, D.R.; McGuire, K.M.; Schmidt, G.L.; Zweben, S.J.

    1994-06-01

    Peaking the density profile increases the usable bootstrap current and the average fusion power density; this could reduce the current drive power and increase the net output of power producing tokamaks. The use of neutral beams and pellet injection to produce peaked density profiles is assessed. We show that with radially ''hollow'' diffusivity profiles (and no particle pinch) moderately peaked density profiles can be produced by particle source profiles which are peaked off-axis. The fueling penetration requirements can therefore be relaxed and this greatly improves the feasibility of generating peaked density profiles in large tokamaks. In particular, neutral beam fueling does not require MeV particle energy. Even with beam voltages of ∼200 keV, however, exceptionally good particle confinement, τ p much-gt τ E is required to achieve net electrical power generation. In system with no power production requirement (e.g., neutron sources) neutral beam fueling should be capable of producing peaked density profiles in devices as large as ITER. Fueling systems with low energy cost per particle (such as cryogenic pellet injection) must be used in power producing tokamaks when τ p ∼ τ E . Simulations with pellet injection speeds of 7 km/sec show the peaking factor, n eo /left-angle n e right-angle, approaching 2

  11. Probabilistic peak detection for first-order chromatographic data.

    Science.gov (United States)

    Lopatka, M; Vivó-Truyols, G; Sjerps, M J

    2014-03-19

    We present a novel algorithm for probabilistic peak detection in first-order chromatographic data. Unlike conventional methods that deliver a binary answer pertaining to the expected presence or absence of a chromatographic peak, our method calculates the probability of a point being affected by such a peak. The algorithm makes use of chromatographic information (i.e. the expected width of a single peak and the standard deviation of baseline noise). As prior information of the existence of a peak in a chromatographic run, we make use of the statistical overlap theory. We formulate an exhaustive set of mutually exclusive hypotheses concerning presence or absence of different peak configurations. These models are evaluated by fitting a segment of chromatographic data by least-squares. The evaluation of these competing hypotheses can be performed as a Bayesian inferential task. We outline the potential advantages of adopting this approach for peak detection and provide several examples of both improved performance and increased flexibility afforded by our approach. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Core fuelling to produce peaked density profiles in large tokamaks

    International Nuclear Information System (INIS)

    Mikkelsen, D.R.; McGuire, K.M.; Schmidt, G.L.; Zweben, S.J.

    1995-01-01

    Peaking the density profile increases the usable bootstrap current and the average fusion power density; this could reduce the current drive power and increase the net output of power producing tokamaks. The use of neutral beams and pellet injection to produce peaked density profiles is assessed. It is shown that with radially 'hollow' diffusivity profiles (and no particle pinch) moderately peaked density profiles can be produced by particle source profiles that are peaked off-axis. The fuelling penetration requirements can therefore be relaxed and this greatly improves the feasibility of generating peaked density profiles in large tokamaks. In particular, neutral beam fuelling does not require Megavolt particle energies. Even with beam voltages of ∼ 200 keV, however, exceptionally good particle confinement is needed to achieve net electrical power generation. The required ratio of particle to thermal diffusivities is an order of magnitude outside the range reported for tokamaks. In a system with no power production requirement (e.g., neutron sources) neutral beam fuelling should be capable of producing peaked density profiles in devices as large as ITER. Fuelling systems with low energy cost per particle - such as cryogenic pellet injection - must be used in power producing tokamaks when τ P ∼ τ E . Simulations with pellet injection speeds of 7 km/s show that the peaking factor, n e0 / e >, approaches 2. (author). 65 refs, 8 figs

  13. Depending on scientific and technological progress to prospect for superlarge uranium deposits. Across-century target for uranium resources exploration work in China

    International Nuclear Information System (INIS)

    Shen Feng

    1995-01-01

    After over 30 years' development, uranium resources exploration work in China has resulted in the discovery of more than 10 economic types of uranium deposits in 23 provinces (regions) of the whole country and large quantities of uranium reserves have been submitted which guarantee the development of nuclear industry in China. However, characteristics such as smaller size of deposits and ore bodies, and lower ore grade of discovered China's uranium deposits have brought about a series of problems on how to economically exploit and utilize these uranium resources. To prospect for superlarge uranium deposits is a guarantee of making uranium resources essentially meet the demand for the long-term development of nuclear industry in China, and is an important way of improving economic benefits in mining China's uranium resources. It is an important mark for uranium geological exploration work to go up a new step as well. China exhibits the geological environment in which various types of superlarge uranium deposits can be formed. Having the financial support from the state to uranium resources exploration work, having professional uranium exploration teams well-experienced in ore prospecting, having modernized uranium exploration techniques and equipment and also having foreign experience in prospecting for superlarge uranium deposits as reference, it is entirely possible to find out superlarge uranium deposits in China at the end of this century and at the beginning of next century. In order to realize the objective, the most important prerequisite is that research work on metallogenetic geological theory and exploration techniques and prospecting methodology for superlarge uranium deposits must be strengthened, and technical quality of the geological teams must be improved. Within this century, prospect targets should be selected and located accurately to carry out the emphatic breakthrough in exploration strategy

  14. Peak loads and network investments in sustainable energy transitions

    Energy Technology Data Exchange (ETDEWEB)

    Blokhuis, Erik, E-mail: e.g.j.blokhuis@tue.nl [Eindhoven University of Technology, Department of Architecture, Building and Planning, Vertigo 8.11, P.O. Box 513, 5600MB Eindhoven (Netherlands); Brouwers, Bart [Eindhoven University of Technology, Department of Architecture, Building and Planning, Vertigo 8.11, P.O. Box 513, 5600MB Eindhoven (Netherlands); Putten, Eric van der [Endinet, Gas and Electricity Network Operations, P.O. Box 2005, 5600CA Eindhoven (Netherlands); Schaefer, Wim [Eindhoven University of Technology, Department of Architecture, Building and Planning, Vertigo 8.11, P.O. Box 513, 5600MB Eindhoven (Netherlands)

    2011-10-15

    Current energy distribution networks are often not equipped for facilitating expected sustainable transitions. Major concerns for future electricity networks are the possibility of peak load increases and the expected growth of decentralized energy generation. In this article, we focus on peak load increases; the effects of possible future developments on peak loads are studied, together with the consequences for the network. The city of Eindhoven (the Netherlands) is used as reference city, for which a scenario is developed in which the assumed future developments adversely influence the maximum peak loads on the network. In this scenario, the total electricity peak load in Eindhoven is expected to increase from 198 MVA in 2009 to 591-633 MVA in 2040. The necessary investments for facilitating the expected increased peak loads are estimated at 305-375 million Euros. Based upon these projections, it is advocated that - contrary to current Dutch policy - choices regarding sustainable transitions should be made from the viewpoint of integral energy systems, evaluating economic implications of changes to generation, grid development, and consumption. Recently applied and finished policies on energy demand reduction showed to be effective; however, additional and connecting policies on energy generation and distribution should be considered on short term. - Highlights: > Sustainable energy transitions can result in major electricity peak load increases. > Introduction of heat pumps and electrical vehicles requires network expansion. > Under worst case assumptions, peak loads in Eindhoven increase with 200% until 2040. > The necessary investment for facilitating this 2040 peak demand is Euro 305-375 million. > Future policy choices should be made from the viewpoint of the integral energy system.

  15. Peak loads and network investments in sustainable energy transitions

    International Nuclear Information System (INIS)

    Blokhuis, Erik; Brouwers, Bart; Putten, Eric van der; Schaefer, Wim

    2011-01-01

    Current energy distribution networks are often not equipped for facilitating expected sustainable transitions. Major concerns for future electricity networks are the possibility of peak load increases and the expected growth of decentralized energy generation. In this article, we focus on peak load increases; the effects of possible future developments on peak loads are studied, together with the consequences for the network. The city of Eindhoven (the Netherlands) is used as reference city, for which a scenario is developed in which the assumed future developments adversely influence the maximum peak loads on the network. In this scenario, the total electricity peak load in Eindhoven is expected to increase from 198 MVA in 2009 to 591-633 MVA in 2040. The necessary investments for facilitating the expected increased peak loads are estimated at 305-375 million Euros. Based upon these projections, it is advocated that - contrary to current Dutch policy - choices regarding sustainable transitions should be made from the viewpoint of integral energy systems, evaluating economic implications of changes to generation, grid development, and consumption. Recently applied and finished policies on energy demand reduction showed to be effective; however, additional and connecting policies on energy generation and distribution should be considered on short term. - Highlights: → Sustainable energy transitions can result in major electricity peak load increases. → Introduction of heat pumps and electrical vehicles requires network expansion. → Under worst case assumptions, peak loads in Eindhoven increase with 200% until 2040. → The necessary investment for facilitating this 2040 peak demand is Euro 305-375 million. → Future policy choices should be made from the viewpoint of the integral energy system.

  16. Relaxation peak near 200 K in NiTi alloy

    Science.gov (United States)

    Zhu, J. S.; Schaller, R.; Benoit, W.

    1989-10-01

    Internal friction (IF), frequency ( f), electrical resistance ( R) and zero point movement of the torsion pendulum (ɛ) have been measured in near equi-atomic NiTi alloy in order to clarify the mechanism for the relaxation peak near 200 K. The height of the relaxation peak decreases successively with thermal cycling and settles down to a lower stable value in running 15 cycles. However, the electrical resistance of the sample shows a variation in contrast with the internal friction. Both of them will return to the initial state after a single annealing at 773 K for 1 h. The probable mechanism of this relaxation peak was discussed.

  17. The environmental impacts of peaking at hydropower plants

    International Nuclear Information System (INIS)

    Halleraker, Jo Halvard

    2001-01-01

    A recent energy act in Norway allows hydropower plants to be operated so that hydro peaking is permitted. However, it is uncertain how fish react to the variations in discharge and depth that follow hydro peaking. SINTEF Energy Research is cooperating with other research institutions to investigate the consequences of these variations on the biota. Among the research tools is an aqua channel which is an indoor laboratory flume where fish behaviour can be studied in detail. It has been constructed to provide the hydropower industry and public authorities with means of better determining the effects of hydro peaking. (author)

  18. The peak of oil production-Timings and market recognition

    International Nuclear Information System (INIS)

    Almeida, Pedro de; Silva, Pedro D.

    2009-01-01

    Energy is essential for present societies. In particular, transportation systems depend on petroleum-based fuels. That world oil production is set to pass a peak is now a reasonably accepted concept, although its date is far from consensual. In this work, we analyze the true expectations of the oil market participants about the future availability of this fundamental energy source. We study the evolution through time of the curves of crude oil futures prices, and we conclude that the market participants, among them the crude oil producers, already expect a near-term peak of oil production. This agrees with many technical predictions for the date of peak production, including our own, that point to peak dates around the end of the present decade. If this scenario is confirmed, it can cause serious social and economical problems because societies will have little time to perform the necessary adjustments

  19. Reducing Electricity Demand Peaks by Scheduling Home Appliances Usage

    DEFF Research Database (Denmark)

    Rossello Busquet, Ana; Kardaras, Georgios; Iversen, Villy Bæk

    2011-01-01

    Nowadays there is a tendency to consume electricity during the same period of the day leading to demand peaks. Regular energy consumption habits lead to demand peaks at specific temporal intervals, because users consume power at the same time. In order to avoid demand peaks, users’ appliances...... should consume electricity in a more temporarily distributed way. A new methodology to schedule the usage of home appliances is proposed and analyzed in this paper. The main concept behind this approach is the aggregation of home appliances into priority classes and the definition of a maximum power...... consumption limit, which is not allowed to be exceeded during peak hours. The scenario simulated describes a modern household, where the electrical devices are classified in low and high priority groups. The high priority devices are always granted power in order to operate without temporal restrictions...

  20. Advancements of ultra-high peak power laser diode arrays

    Science.gov (United States)

    Crawford, D.; Thiagarajan, P.; Goings, J.; Caliva, B.; Smith, S.; Walker, R.

    2018-02-01

    Enhancements of laser diode epitaxy in conjunction with process and packaging improvements have led to the availability of 1cm bars capable of over 500W peak power at near-infrared wavelengths (770nm to 1100nm). Advances in cooler design allow for multi-bar stacks with bar-to-bar pitches as low as 350μm and a scalable package architecture enabled a single diode assembly with total peak powers of over 1MegaWatt of peak power. With the addition of micro-optics, overall array brightness greater than 10kW/cm2 was achieved. Performance metrics of barbased diode lasers specifically engineered for high peak power and high brightness at wavelengths and pulse conditions commonly used to pump a variety of fiber and solid-state materials are presented.

  1. Energy and public health: the challenge of peak petroleum.

    Science.gov (United States)

    Frumkin, Howard; Hess, Jeremy; Vindigni, Stephen

    2009-01-01

    Petroleum is a unique and essential energy source, used as the principal fuel for transportation, in producing many chemicals, and for numerous other purposes. Global petroleum production is expected to reach a maximum in the near future and to decline thereafter, a phenomenon known as "peak petroleum." This article reviews petroleum geology and uses, describes the phenomenon of peak petroleum, and reviews the scientific literature on the timing of this transition. It then discusses how peak petroleum may affect public health and health care, by reference to four areas: medical supplies and equipment, transportation, energy generation, and food production. Finally, it suggests strategies for anticipating and preparing for peak petroleum, both general public health preparedness strategies and actions specific to the four expected health system impacts.

  2. OECD : Euroopa peaks laenuraha odava hoidma / Sirje Rank

    Index Scriptorium Estoniae

    Rank, Sirje, 1966-

    2002-01-01

    USA majanduse kiire toibumine võib varsti tuua laenuintresside tõusu, Euroopa Keskpank peaks vähemalt aasta lõpuni ootama ja laskma kasvul juurduda. Diagramm: OECD tõstis majanduskasvu prognoosi. Maksukoormus

  3. Hubbert's Oil Peak Revisited by a Simulation Model

    International Nuclear Information System (INIS)

    Giraud, P.N.; Sutter, A.; Denis, T.; Leonard, C.

    2010-01-01

    As conventional oil reserves are declining, the debate on the oil production peak has become a burning issue. An increasing number of papers refer to Hubbert's peak oil theory to forecast the date of the production peak, both at regional and world levels. However, in our views, this theory lacks micro-economic foundations. Notably, it does not assume that exploration and production decisions in the oil industry depend on market prices. In an attempt to overcome these shortcomings, we have built an adaptative model, accounting for the behavior of one agent, standing for the competitive exploration-production industry, subjected to incomplete but improving information on the remaining reserves. Our work yields challenging results on the reasons for an Hubbert type peak oil, lying mainly 'above the ground', both at regional and world levels, and on the shape of the production and marginal cost trajectories. (authors)

  4. Peak globalization. Climate change, oil depletion and global trade

    Energy Technology Data Exchange (ETDEWEB)

    Curtis, Fred [Department of Economics, Drew University, Madison, NJ 07940 (United States)

    2009-12-15

    The global trade in goods depends upon reliable, inexpensive transportation of freight along complex and long-distance supply chains. Global warming and peak oil undermine globalization by their effects on both transportation costs and the reliable movement of freight. Countering the current geographic pattern of comparative advantage with higher transportation costs, climate change and peak oil will thus result in peak globalization, after which the volume of exports will decline as measured by ton-miles of freight. Policies designed to mitigate climate change and peak oil are very unlikely to change this result due to their late implementation, contradictory effects and insufficient magnitude. The implication is that supply chains will become shorter for most products and that production of goods will be located closer to where they are consumed. (author)

  5. Peak thrust operation of linear induction machines from parameter identification

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Z.; Eastham, T.R.; Dawson, G.E. [Queen`s Univ., Kingston, Ontario (Canada). Dept. of Electrical and Computer Engineering

    1995-12-31

    Various control strategies are being used to achieve high performance operation of linear drives. To maintain minimum volume and weight of the power supply unit on board the transportation vehicle, peak thrust per unit current operation is a desirable objective. True peak thrust per unit current through slip control is difficult to achieve because the parameters of linear induction machines vary during normal operation. This paper first develops a peak thrust per unit current control law based on the per-phase equivalent circuit for linear induction machines. The algorithm for identification of the variable parameters in induction machines is then presented. Application to an operational linear induction machine (LIM) demonstrates the utility of this algorithm. The control strategy is then simulated, based on an operational transit LIM, to show the capability of achieving true peak thrust operation for linear induction machines.

  6. Brian Eno Hollandi Festivali peakülaliseks

    Index Scriptorium Estoniae

    1999-01-01

    Inglise helilooja, videokunstnik ja muusikaprodutsent Brian Eno on 5.-26. juunini Amsterdamis toimuva avangardse Hollandi Festivali peakülaline, kelle videoinstallatsioon seatakse üles Stedelijki Muuseumis. Festivali programmist

  7. FHWA operations support : port peak pricing program evaluation

    Science.gov (United States)

    2009-01-01

    This report evaluates the applicability, Federal policy implications, and possible public and private sector roles related to peak pricing strategies at ports and intermodal facilities in the U.S. A number of ports and intermodal terminals are consid...

  8. Peak globalization. Climate change, oil depletion and global trade

    International Nuclear Information System (INIS)

    Curtis, Fred

    2009-01-01

    The global trade in goods depends upon reliable, inexpensive transportation of freight along complex and long-distance supply chains. Global warming and peak oil undermine globalization by their effects on both transportation costs and the reliable movement of freight. Countering the current geographic pattern of comparative advantage with higher transportation costs, climate change and peak oil will thus result in peak globalization, after which the volume of exports will decline as measured by ton-miles of freight. Policies designed to mitigate climate change and peak oil are very unlikely to change this result due to their late implementation, contradictory effects and insufficient magnitude. The implication is that supply chains will become shorter for most products and that production of goods will be located closer to where they are consumed. (author)

  9. The simple method of determination peaks areas in multiplets

    International Nuclear Information System (INIS)

    Loska, L.; Ptasinski, J.

    1991-01-01

    Semiconductor germanium detectors used in γ-spectrometry give spectra with well-separated peaks. However, in some cases, energies of γ-lines are too near, to produce resolved and undisturbed peaks. Then, there is a necessity to perform a mathematical separation. The method proposed here is based on the assumption, that areas of peaks composing the analysed multiplet are proportional to their heights. The method can be applied for any number of interfering peaks, providing, that the function of the background under the multiplet is accurately determined. The results of testing calculations performed on a simulated spectrum are given. The method works successfully in a computer program used for neutron activation analysis data processing. (author). 9 refs, 1 fig, 1 tab

  10. Heavy Ion Testing at the Galactic Cosmic Ray Energy Peak

    Science.gov (United States)

    Pellish, Jonathan A.; Xapsos, M. A.; LaBel, K. A.; Marshall, P. W.; Heidel, D. F.; Rodbell, K. P.; Hakey, M. C.; Dodd, P. E.; Shaneyfelt, M. R.; Schwank, J. R.; hide

    2009-01-01

    A 1 GeV/u Fe-56 Ion beam allows for true 90 deg. tilt irradiations of various microelectronic components and reveals relevant upset trends for an abundant element at the galactic cosmic ray (GCR) flux-energy peak.

  11. Bedrock Geologic Map of the Jay Peak, VT Quadrangle

    Data.gov (United States)

    Vermont Center for Geographic Information — Digital data from VG99-1 Compilation bedrock geologic map of the Jay Peak quadrangle, Compiled by B. Doolan, 1999: VGS Open-File Report VG99-1, 1 plate, scale...

  12. Neutron-induced peaks in Ge detectors from evaporation neutrons

    International Nuclear Information System (INIS)

    Gete, E.; Measday, D.F.; Moftah, B.A.; Saliba, M.A.; Stocki, T.J.

    1997-01-01

    We have studied the peak shapes at 596 and 691 keV resulting from fast neutron interactions inside germanium detectors. We have used neutrons from a 252 Cf source, as well as from the 28 Si(μ - , nν), and 209 Bi(π - , xn) reactions to compare the peaks and to check for a dependence of peak shape on the incoming neutron energy. In our investigation, no difference between these three measurements has been observed. In a comparison of these peak shapes with other studies, we found similar results to ours except for those measurements using monoenergetic neutrons in which a significant variation with neutron energy has been observed. (orig.)

  13. Desert Peak East Enhanced Geothermal Systems (EGS) Project

    Energy Technology Data Exchange (ETDEWEB)

    Zemach, Ezra [Ormat Technologies Inc., Reno, NV (United States); Drakos, Peter [Ormat Technologies Inc., Reno, NV (United States); Spielman, Paul [Ormat Technologies Inc., Reno, NV (United States); Akerley, John [Ormat Technologies Inc., Reno, NV (United States)

    2013-09-30

    This manuscript is a draft to replaced with a final version at a later date TBD. A summary of activities pertaining to the Desert Peak EGS project including the planning and resulting stimulation activities.

  14. Effects of equipment and technique on peak flow measurements

    Directory of Open Access Journals (Sweden)

    O'Driscoll B Ronan

    2006-06-01

    Full Text Available Abstract Background Different lung function equipment and different respiratory manoeuvres may produce different Peak Expiratory Flow (PEF results. Although the PEF is the most common lung function test, there have been few studies of these effects and no previous study has evaluated both factors in a single group of patients. Methods We studied 36 subjects (PEF range 80–570 l/min. All patients recorded PEF measurements using a short rapid expiration following maximal inspiration (PEF technique or a forced maximal expiration to residual volume (FVC technique. Measurements were made using a Wright's peak flow meter, a turbine spirometer and a Fleisch pneumotachograph spirometer. Results The mean PEF was 8.7% higher when the PEF technique was used (compared with FVC technique, p Conclusion Peak flow measurements are affected by the instruction given and by the device and Peak Flow scale used. Patient management decisions should not be based on PEF measurement made on different instruments.

  15. Periodic transmission peak splitting in one dimensional disordered photonic structures

    Science.gov (United States)

    Kriegel, Ilka; Scotognella, Francesco

    2016-08-01

    In the present paper we present ways to modulate the periodic transmission peaks arising in disordered one dimensional photonic structures with hundreds of layers. Disordered structures in which the optical length nd (n is the refractive index and d the layer thickness) is the same for each layer show regular peaks in their transmission spectra. A proper variation of the optical length of the layers leads to a splitting of the transmission peaks. Notably, the variation of the occurrence of high and low refractive index layers, gives a tool to tune also the width of the peaks. These results are of highest interest for optical application, such as light filtering, where the manifold of parameters allows a precise design of the spectral transmission ranges.

  16. The economic impact of emission peaking control policies and China's sustainable development

    Directory of Open Access Journals (Sweden)

    Yi Wang

    2014-12-01

    Full Text Available To achieve the goals of national sustainable development, the peaking control of CO2 emissions is pivotal, as well as other pollutants. In this paper, we build a Chinese inter-regional CGE model and simulate 13 policies and their combinations. By analyzing the energy consumptions, coal consumptions, relating emissions and their impacts on GDP, we found that with the structure adjustment policy, the proportion of coal in primary fossil fuels in 2030 will decrease from 53% to 48% and CO2 emissions will decrease by 11.3%–22.8% compared to the baseline scenario. With the energy intensity reduction policy, CO2 emissions will decrease by 33.3% in 2030 and 47.8% in 2050 than baseline scenario. Other pollutants will also be controlled as synergetic effects. In this study we also find that although the earlier the peaking time the better for emission amounts control, the economic costs can not be ignored. The GDP will decrease by 2.96%–8.23% under different scenarios. Therefore, integrated policy solutions are needed for realizing the peaks package and more targeted measures are required to achieve the peaks of other pollutants earlier.

  17. Effects of peatland drainage management on peak flows

    OpenAIRE

    C. E. Ballard; N. McIntyre; H. S. Wheater

    2011-01-01

    Open ditch drainage has historically been a common land management practice in upland blanket peats, particularly in the UK. However, peatland drainage is now generally considered to have adverse effects on the upland environment, including increased peak flows. As a result, drain blocking has become a common management strategy in the UK over recent years, although there is only anecdotal evidence to suggest that this might decrease peak flows. The change in the hydrologica...

  18. Peak-load management, the security of supply warranty

    International Nuclear Information System (INIS)

    2010-01-01

    Even if France owns an efficient power generation park, largely exporting and clean (90% with no CO 2 emission), it encounters some difficulties during peak-load periods. The successive peak power demand records which are recorded each year represent as many alerts about a possible collapse of the power system. In order to warrant the electricity supply, the present day regulatory framework must be changed to allow the industrial players to carry out the necessary investments

  19. Several peaks of total current in Trichel pulse

    International Nuclear Information System (INIS)

    Bolotov, O.; Golota, V.; Kadolin, B.; Mankovskyi, S.; Ostroushko, V.; Pashchenko, I.; Taran, G.; Zavada, L.

    2015-01-01

    The numerical simulations of negative corona at constant voltage in Trichel pulse mode are carried out in assumptions of presence and absence of photoemission from cathode. In absence of photoemission two peaks of total current or the step before the main peak were obtained for very small values of ion-electron emission coefficient. In presence of photoemission there were observed several maximums, connected with instability development of the process based on radiation of photons, photoemission, and avalanche multiplication

  20. Converter for Measurement of non-sinusoidal current peak value

    DEFF Research Database (Denmark)

    Butvin, P.; Nielsen, Otto V; Brauer, Peter

    1997-01-01

    A linear-response toroid with core wound of rapidly quenched soft magnetic metallic ribbon and fitted with two windings is used to enable correct measurement of mean peak value of non-sinusoidal and not noise-free alternating current.......A linear-response toroid with core wound of rapidly quenched soft magnetic metallic ribbon and fitted with two windings is used to enable correct measurement of mean peak value of non-sinusoidal and not noise-free alternating current....

  1. Generation of narrow peaks in spectroscopy of charged particles

    Energy Technology Data Exchange (ETDEWEB)

    Dubbers, Dirk, E-mail: dubbers@physi.uni-heidelberg.de; Schmidt, Ulrich, E-mail: ulrich.schmidt@physi.uni-heidelberg.de

    2016-11-21

    In spectroscopy of charged particles, narrow peaks may appear in continuous spectra if magnetic transport of the particles is involved. These artefacts, which so far have escaped the attention of investigators, can develop whenever geometric detection efficiency is less than 100%. As such peaks may be misinterpreted as new physics, their generation is investigated, both analytically and experimentally, for various detector configurations, including those used in searches for the spontaneous decay of the vacuum in heavy-ion collisions.

  2. Targeted Learning

    CERN Document Server

    van der Laan, Mark J

    2011-01-01

    The statistics profession is at a unique point in history. The need for valid statistical tools is greater than ever; data sets are massive, often measuring hundreds of thousands of measurements for a single subject. The field is ready to move towards clear objective benchmarks under which tools can be evaluated. Targeted learning allows (1) the full generalization and utilization of cross-validation as an estimator selection tool so that the subjective choices made by humans are now made by the machine, and (2) targeting the fitting of the probability distribution of the data toward the targe

  3. Target preparation

    International Nuclear Information System (INIS)

    Hinn, G.M.

    1984-01-01

    A few of the more interesting of the 210 targets prepared in the Laboratory last year are listed. In addition the author continues to use powdered silver mixed with /sup 9,10/BeO to produce sources for accelerator radio dating of Alaskan and South Polar snow. Currently, he is trying to increase production by multiple sample processing. Also the author routinely makes 3 μg/cm 2 cracked slacked carbon stripper foils and is continuing research with some degree of success in making enriched 28 Si targets starting with the oxide

  4. Modeling the probability distribution of peak discharge for infiltrating hillslopes

    Science.gov (United States)

    Baiamonte, Giorgio; Singh, Vijay P.

    2017-07-01

    Hillslope response plays a fundamental role in the prediction of peak discharge at the basin outlet. The peak discharge for the critical duration of rainfall and its probability distribution are needed for designing urban infrastructure facilities. This study derives the probability distribution, denoted as GABS model, by coupling three models: (1) the Green-Ampt model for computing infiltration, (2) the kinematic wave model for computing discharge hydrograph from the hillslope, and (3) the intensity-duration-frequency (IDF) model for computing design rainfall intensity. The Hortonian mechanism for runoff generation is employed for computing the surface runoff hydrograph. Since the antecedent soil moisture condition (ASMC) significantly affects the rate of infiltration, its effect on the probability distribution of peak discharge is investigated. Application to a watershed in Sicily, Italy, shows that with the increase of probability, the expected effect of ASMC to increase the maximum discharge diminishes. Only for low values of probability, the critical duration of rainfall is influenced by ASMC, whereas its effect on the peak discharge seems to be less for any probability. For a set of parameters, the derived probability distribution of peak discharge seems to be fitted by the gamma distribution well. Finally, an application to a small watershed, with the aim to test the possibility to arrange in advance the rational runoff coefficient tables to be used for the rational method, and a comparison between peak discharges obtained by the GABS model with those measured in an experimental flume for a loamy-sand soil were carried out.

  5. Peak oil: The four stages of a new idea

    Energy Technology Data Exchange (ETDEWEB)

    Bardi, Ugo [Dipartimento di Chimica, Universita di Firenze, Association for the Study of Peak Oil and Gas (ASPO), Polo Scientifico di Sesto Fiorentino, Via della Lastruccia 3, 50019 Sesto Fiorentino (Fi) (Italy)

    2009-03-15

    The present paper reviews the reactions and the path of acceptance of the theory known as ''peak oil''. The theory was proposed for the first time by M.K. Hubbert in the 1950s as a way to describe the production pattern of crude oil. According to Hubbert, the production curve is ''bell shaped'' and approximately symmetric. Hubbert's theory was verified with good approximation for the case of oil production in the United States that peaked in 1971, and is now being applied to the worldwide oil production. It is generally believed that the global peak of oil production (''peak oil'') will take place during the first decade of the 21st century, and some analysts believe that it has already occurred in 2005 or 2006. The theory and its consequences have unpleasant social and economical implications. The present paper is not aimed at assessing the peak date but offers a discussion on the factors that affect the acceptance and the diffusion of the concept of ''peak oil'' with experts and with the general public. The discussion is based on a subdivision of ''four stages of acceptance'', loosely patterned after a sentence by Thomas Huxley. (author)

  6. Peaking of world oil production: Impacts, mitigation, & risk management

    Energy Technology Data Exchange (ETDEWEB)

    Hirsch, R.L. (SAIC); Bezdek, Roger (MISI); Wendling, Robert (MISI)

    2005-02-01

    The peaking of world oil production presents the U.S. and the world with an unprecedented risk management problem. As peaking is approached, liquid fuel prices and price volatility will increase dramatically, and, without timely mitigation, the economic, social, and political costs will be unprecedented. Viable mitigation options exist on both the supply and demand sides, but to have substantial impact, they must be initiated more than a decade in advance of peaking.... The purpose of this analysis was to identify the critical issues surrounding the occurrence and mitigation of world oil production peaking. We simplified many of the complexities in an effort to provide a transparent analysis. Nevertheless, our study is neither simple nor brief. We recognize that when oil prices escalate dramatically, there will be demand and economic impacts that will alter our simplified assumptions. Consideration of those feedbacks will be a daunting task but one that should be undertaken. Our aim in this study is to-- • Summarize the difficulties of oil production forecasting; • Identify the fundamentals that show why world oil production peaking is such a unique challenge; • Show why mitigation will take a decade or more of intense effort; • Examine the potential economic effects of oil peaking; • Describe what might be accomplished under three example mitigation scenarios. • Stimulate serious discussion of the problem, suggest more definitive studies, and engender interest in timely action to mitigate its impacts.

  7. Peak energy consumption and CO2 emissions in China

    International Nuclear Information System (INIS)

    Yuan, Jiahai; Xu, Yan; Hu, Zheng; Zhao, Changhong; Xiong, Minpeng; Guo, Jingsheng

    2014-01-01

    China is in the processes of rapid industrialization and urbanization. Based on the Kaya identity, this paper proposes an analytical framework for various energy scenarios that explicitly simulates China's economic development, with a prospective consideration on the impacts of urbanization and income distribution. With the framework, China's 2050 energy consumption and associated CO 2 reduction scenarios are constructed. Main findings are: (1) energy consumption will peak at 5200–5400 million tons coal equivalent (Mtce) in 2035–2040; (2) CO 2 emissions will peak at 9200–9400 million tons (Mt) in 2030–2035, whilst it can be potentially reduced by 200–300 Mt; (3) China's per capita energy consumption and per capita CO 2 emission are projected to peak at 4 tce and 6.8 t respectively in 2020–2030, soon after China steps into the high income group. - Highlights: • A framework for modeling China's energy and CO 2 emissions is proposed. • Scenarios are constructed based on various assumptions on the driving forces. • Energy consumption will peak in 2035–2040 at 5200–5400 Mtce. • CO 2 emissions will peak in 2030–2035 at about 9300 Mt and be cut by 300 Mt in a cleaner energy path. • Energy consumption and CO 2 emissions per capita will peak soon after China steps into the high income group

  8. From chemical graphs in computer-aided drug design to general Markov-Galvez indices of drug-target, proteome, drug-parasitic disease, technological, and social-legal networks.

    Science.gov (United States)

    Riera-Fernández, Pablo; Munteanu, Cristian R; Dorado, Julian; Martin-Romalde, Raquel; Duardo-Sanchez, Aliuska; González-Diaz, Humberto

    2011-12-01

    Complex Networks are useful in solving problems in drug research and industry, developing mathematical representations of different systems. These systems move in a wide range from relatively simple graph representations of drug molecular structures to large systems. We can cite for instance, drug-target protein interaction networks, drug policy legislation networks, or drug treatment in large geographical disease spreading networks. In any case, all these networks have essentially the same components: nodes (atoms, drugs, proteins, microorganisms and/or parasites, geographical areas, drug policy legislations, etc.) and edges (chemical bonds, drug-target interactions, drug-parasite treatment, drug use, etc.). Consequently, we can use the same type of numeric parameters called Topological Indices (TIs) to describe the connectivity patterns in all these kinds of Complex Networks despite the nature of the object they represent. The main reason for this success of TIs is the high flexibility of this theory to solve in a fast but rigorous way many apparently unrelated problems in all these disciplines. Another important reason for the success of TIs is that using these parameters as inputs we can find Quantitative Structure-Property Relationships (QSPR) models for different kind of problems in Computer-Aided Drug Design (CADD). Taking into account all the above-mentioned aspects, the present work is aimed at offering a common background to all the manuscripts presented in this special issue. In so doing, we make a review of the most common types of complex networks involving drugs or their targets. In addition, we review both classic TIs that have been used to describe the molecular structure of drugs and/or larger complex networks. Next, we use for the first time a Markov chain model to generalize Galvez TIs to higher order analogues coined here as the Markov-Galvez TIs of order k (MGk). Lastly, we illustrate the calculation of MGk values for different classes of

  9. Optimizing deep hyperthermia treatments: are locations of patient pain complaints correlated with modelled SAR peak locations?

    Energy Technology Data Exchange (ETDEWEB)

    Canters, R A M; Franckena, M; Van der Zee, J; Van Rhoon, G C, E-mail: r.canters@erasmusmc.nl [Department of Radiation Oncology, Erasmus MC Daniel den Hoed Cancer Centre, Rotterdam, PO Box 5201, 3008 AE Rotterdam (Netherlands)

    2011-01-21

    During deep hyperthermia treatment, patient pain complaints due to heating are common when maximizing power. Hence, there exists a good rationale to investigate whether the locations of predicted SAR peaks by hyperthermia treatment planning (HTP) are correlated with the locations of patient pain during treatment. A retrospective analysis was performed, using the treatment reports of 35 patients treated with deep hyperthermia controlled by extensive treatment planning. For various SAR indicators, the average distance from a SAR peak to a patient discomfort location was calculated, for each complaint. The investigated V{sub 0.1closest} (i.e. the part of the 0.1th SAR percentile closest to the patient complaint) performed the best, and leads to an average distance between the SAR peak and the complaint location of 3.9 cm. Other SAR indicators produced average distances that were all above 10 cm. Further, the predicted SAR peak location with V{sub 0.1} provides a 77% match with the region of complaint. The current study demonstrates that HTP is able to provide a global indication of the regions where hotspots during treatment will most likely occur. Further development of this technology is necessary in order to use HTP as a valuable toll for objective and advanced SAR steering. The latter is especially valid for applications that enable 3D SAR steering.

  10. Optimizing deep hyperthermia treatments: are locations of patient pain complaints correlated with modelled SAR peak locations?

    International Nuclear Information System (INIS)

    Canters, R A M; Franckena, M; Van der Zee, J; Van Rhoon, G C

    2011-01-01

    During deep hyperthermia treatment, patient pain complaints due to heating are common when maximizing power. Hence, there exists a good rationale to investigate whether the locations of predicted SAR peaks by hyperthermia treatment planning (HTP) are correlated with the locations of patient pain during treatment. A retrospective analysis was performed, using the treatment reports of 35 patients treated with deep hyperthermia controlled by extensive treatment planning. For various SAR indicators, the average distance from a SAR peak to a patient discomfort location was calculated, for each complaint. The investigated V 0.1closest (i.e. the part of the 0.1th SAR percentile closest to the patient complaint) performed the best, and leads to an average distance between the SAR peak and the complaint location of 3.9 cm. Other SAR indicators produced average distances that were all above 10 cm. Further, the predicted SAR peak location with V 0.1 provides a 77% match with the region of complaint. The current study demonstrates that HTP is able to provide a global indication of the regions where hotspots during treatment will most likely occur. Further development of this technology is necessary in order to use HTP as a valuable toll for objective and advanced SAR steering. The latter is especially valid for applications that enable 3D SAR steering.

  11. Low-complexity R-peak detection for ambulatory fetal monitoring

    International Nuclear Information System (INIS)

    Rooijakkers, Michael J; Rabotti, Chiara; Mischi, Massimo; Oei, S Guid

    2012-01-01

    Non-invasive fetal health monitoring during pregnancy is becoming increasingly important because of the increasing number of high-risk pregnancies. Despite recent advances in signal-processing technology, which have enabled fetal monitoring during pregnancy using abdominal electrocardiogram (ECG) recordings, ubiquitous fetal health monitoring is still unfeasible due to the computational complexity of noise-robust solutions. In this paper, an ECG R-peak detection algorithm for ambulatory R-peak detection is proposed, as part of a fetal ECG detection algorithm. The proposed algorithm is optimized to reduce computational complexity, without reducing the R-peak detection performance compared to the existing R-peak detection schemes. Validation of the algorithm is performed on three manually annotated datasets. With a detection error rate of 0.23%, 1.32% and 9.42% on the MIT/BIH Arrhythmia and in-house maternal and fetal databases, respectively, the detection rate of the proposed algorithm is comparable to the best state-of-the-art algorithms, at a reduced computational complexity. (paper)

  12. Low-complexity R-peak detection for ambulatory fetal monitoring.

    Science.gov (United States)

    Rooijakkers, Michael J; Rabotti, Chiara; Oei, S Guid; Mischi, Massimo

    2012-07-01

    Non-invasive fetal health monitoring during pregnancy is becoming increasingly important because of the increasing number of high-risk pregnancies. Despite recent advances in signal-processing technology, which have enabled fetal monitoring during pregnancy using abdominal electrocardiogram (ECG) recordings, ubiquitous fetal health monitoring is still unfeasible due to the computational complexity of noise-robust solutions. In this paper, an ECG R-peak detection algorithm for ambulatory R-peak detection is proposed, as part of a fetal ECG detection algorithm. The proposed algorithm is optimized to reduce computational complexity, without reducing the R-peak detection performance compared to the existing R-peak detection schemes. Validation of the algorithm is performed on three manually annotated datasets. With a detection error rate of 0.23%, 1.32% and 9.42% on the MIT/BIH Arrhythmia and in-house maternal and fetal databases, respectively, the detection rate of the proposed algorithm is comparable to the best state-of-the-art algorithms, at a reduced computational complexity.

  13. Modelling Recycling Targets

    DEFF Research Database (Denmark)

    Hill, Amanda Louise; Leinikka Dall, Ole; Andersen, Frits M.

    2014-01-01

    Within the European Union (EU) a paradigm shift is currently occurring in the waste sector, where EU waste directives and national waste strategies are placing emphasis on resource efficiency and recycling targets. The most recent Danish resource strategy calculates a national recycling rate of 22......% for household waste, and sets an ambitious goal of a 50% recycling rate by 2020. This study integrates the recycling target into the FRIDA model to project how much waste and from which streams should be diverted from incineration to recycling in order to achieve the target. Furthermore, it discusses how...... the existing technological, organizational and legislative frameworks may affect recycling activities. The results of the analysis show that with current best practice recycling rates, the 50% recycling rate cannot be reached without recycling of household biowaste. It also shows that all Danish municipalities...

  14. Impact of roof integrated PV orientation on the residential electricity peak demand

    International Nuclear Information System (INIS)

    Sadineni, Suresh B.; Atallah, Fady; Boehm, Robert F.

    2012-01-01

    Highlights: ► A study to demonstrate peak load reductions at the substation. ► A new residential energy efficient community named Villa Trieste is being developed. ► The peak demand from the homes has decreased by 38% through energy efficiency. ► Orientation of roof integrated PV has less influence on the summer peak demand. ► Increasing thermostat temperature during peak by 1 °C can significantly reduce peaks. -- Abstract: Peak electricity demand has been an issue in the Desert Southwest region of the US, due to extreme summer temperatures. To address this issue, a consortium was formed between the University of Nevada, Las Vegas, Pulte Homes, and NV Energy. An energy efficient residential community was developed by the team in Las Vegas with approximately 200 homes to study substation-level peak reduction strategies. A summer peak reduction of more than 65%, between 1:00 PM and 7:00 PM, compared to code standard housing developments is the targeted goal of the project. Approximately 50 homes are already built and some are occupied. The energy performances of the homes have been monitored and are presented in this paper. Several peak electric load reduction strategies such as energy efficiency in buildings, roof integrated photovoltaics (PV) and direct load control have been applied. Though all the homes in the developed community are installed with 1.8 kW p PV systems, the orientation of the PV system depends on the building orientation. Focus of this paper is to find the impact of PV orientation on the peak load from a building. In addition, different time-of-use (TOU) energy pricing options are offered by the local electrical utility company. Hence it is important to find an optimal pricing option for each building. A computer model has been developed for one of the homes in the new development using building energy simulation code, ENERGY-10. Calculations on the PV orientations have shown that a south and 220° (i.e. 40° west of due south

  15. Simultaneous collection method of on-peak window image and off-peak window image in Tl-201 imaging

    International Nuclear Information System (INIS)

    Murakami, Tomonori; Noguchi, Yasushi; Kojima, Akihiro; Takagi, Akihiro; Matsumoto, Masanori

    2007-01-01

    Tl-201 imaging detects the photopeak (71 keV, in on-peak window) of characteristic X-rays of Hg-201 formed from Tl-201 decay. The peak is derived from 4 rays of different energy and emission intensity and does not follow in Gaussian distribution. In the present study, authors made an idea for the method in the title to attain the more effective single imaging, which was examined for its accuracy and reliability with phantoms and applied clinically to Tl-201 scintigraphy in a patient. The authors applied the triple energy window method for data acquisition: the energy window setting was made on Hg-201 X-rays photopeak in three of the lower (3%, L), main (72 keV, M) and upper (14%, U) windows with the gamma camera with 2-gated detector (Toshiba E. CAM/ICON). L, M and U images obtained simultaneously were then constructed to images of on-peak (L+M, Mock on-peak) and off-peak (M+U) window settings for evaluation. Phantoms for line source with Tl-201-containing swab and for multi-defect with acrylic plate containing Tl-201 solution were imaged in water. The female patient with thyroid cancer was subjected to preoperative scintigraphy under the defined conditions. Mock on-, off-peak images were found to be equivalent to the true (ordinary, clinical) on-, off-peak ones, and the present method was thought usable for evaluation of usefulness of off-peak window data. (R.T.)

  16. The Nature of Double-peaked [O III] Active Galactic Nuclei

    Science.gov (United States)

    Fu, Hai; Yan, Lin; Myers, Adam D.; Stockton, Alan; Djorgovski, S. G.; Aldering, G.; Rich, Jeffrey A.

    2012-01-01

    Active galactic nuclei (AGNs) with double-peaked [O III] lines are suspected to be sub-kpc or kpc-scale binary AGNs. However, pure gas kinematics can produce the same double-peaked line profile in spatially integrated spectra. Here we combine integral-field spectroscopy and high-resolution imaging of 42 double-peaked [O III] AGNs from the Sloan Digital Sky Survey to investigate the constituents of the population. We find two binary AGNs where the line splitting is driven by the orbital motion of the merging nuclei. Such objects account for only ~2% of the double-peaked AGNs. Almost all (~98%) of the double-peaked AGNs were selected because of gas kinematics; and half of those show spatially resolved narrow-line regions that extend 4-20 kpc from the nuclei. Serendipitously, we find two spectrally unresolved binary AGNs where gas kinematics produced the double-peaked [O III] lines. The relatively frequent serendipitous discoveries indicate that only ~1% of binary AGNs would appear double-peaked in Sloan spectra and 2.2+2.5 -0.8% of all Sloan AGNs are binary AGNs. Therefore, the double-peaked sample does not offer much advantage over any other AGN samples in finding binary AGNs. The binary AGN fraction implies an elevated AGN duty cycle (8+8 -3%), suggesting galaxy interactions enhance nuclear accretion. We illustrate that integral-field spectroscopy is crucial for identifying binary AGNs: several objects previously classified as "binary AGNs" with long-slit spectra are most likely single AGNs with extended narrow-line regions (ENLRs). The formation of ENLRs driven by radiation pressure is also discussed. Some of the data presented herein were obtained at the W.M. Keck Observatory, which is operated as a scientific partnership among the California Institute of Technology, the University of California, and the National Aeronautics and Space Administration. The Observatory was made possible by the generous financial support of the W. M. Keck Foundation.

  17. Automatic fitting of Gaussian peaks using abductive machine learning

    Science.gov (United States)

    Abdel-Aal, R. E.

    1998-02-01

    Analytical techniques have been used for many years for fitting Gaussian peaks in nuclear spectroscopy. However, the complexity of the approach warrants looking for machine-learning alternatives where intensive computations are required only once (during training), while actual analysis on individual spectra is greatly simplified and quickened. This should allow the use of simple portable systems for fast and automated analysis of large numbers of spectra, particularly in situations where accuracy may be traded for speed and simplicity. This paper proposes the use of abductive networks machine learning for this purpose. The Abductory Induction Mechanism (AIM) tool was used to build models for analyzing both single and double Gaussian peaks in the presence of noise depicting statistical uncertainties in collected spectra. AIM networks were synthesized by training on 1000 representative simulated spectra and evaluated on 500 new spectra. A classifier network determines the multiplicity of single/double peaks with an accuracy of 5.8%. With statistical uncertainties corresponding to a peak count of 100, average percentage absolute errors for the height, position, and width of single peaks are 4.9, 2.9, and 4.2%, respectively. For double peaks, these average errors are within 7.0, 3.1, and 5.9%, respectively. Models have been developed which account for the effect of a linear background on a single peak. Performance is compared with a neural network application and with an analytical curve-fitting routine, and the new technique is applied to actual data of an alpha spectrum.

  18. The duration of pubertal growth peak among three skeletal classes

    Directory of Open Access Journals (Sweden)

    Waqar Jeelani

    Full Text Available ABSTRACT Introduction: Pubertal growth peak is closely associated with a rapid increase in mandibular length and offers a wide range of therapeutic modifiability. Objective: The aim of the present study was to determine and compare the mean ages of onset and duration of pubertal growth peak among three skeletal classes. Methods: A retrospective cross-sectional study was conducted using lateral cephalograms of 230 subjects with growth potential (110 males, 120 females. Subjects were categorized into three classes (Class I = 81, Class II = 82, Class III = 67, according to the sagittal relationship established between the maxilla and the mandible. The cervical vertebral maturation stage was recorded by means of Baccetti's method. The mean ages at CS3 and CS4 and the CS3-CS4 age interval were compared between boys and girls and among three skeletal classes. Results: Pubertal growth peak occurred on average four months earlier in girls than boys (p = 0.050. The average duration of pubertal growth peak was 11 months in Class I, seven months in Class II and 17 months in Class III subjects. Interclass differences were highly significant (Cohen's d > 0.08. However, no significant difference was found in the timing of pubertal growth peak onset among three skeletal classes (p = 0.126 in boys, p = 0.262 in girls. Conclusions: Girls enter pubertal growth peak on average four months earlier than boys. Moreover, the duration of pubertal growth peak is on average four months shorter in Class II and six months longer in Class III subjects as compared to Class I subjects.

  19. Peak Operation of Cascaded Hydropower Plants Serving Multiple Provinces

    Directory of Open Access Journals (Sweden)

    Jianjian Shen

    2015-10-01

    Full Text Available The bulk hydropower transmission via trans-provincial and trans-regional power networks in China provides great operational flexibility to dispatch power resources between multiple power grids. This is very beneficial to alleviate the tremendous peak load pressure of most provincial power grids. This study places the focus on peak operations of cascaded hydropower plants serving multiple provinces under a regional connected AC/DC network. The objective is to respond to peak loads of multiple provincial power grids simultaneously. A two-stage search method is developed for this problem. In the first stage, a load reconstruction strategy is proposed to combine multiple load curves of power grids into a total load curve. The purpose is to deal with different load features in load magnitudes, peaks and valleys. A mutative-scale optimization method is then used to determine the generation schedules of hydropower plants. In the second stage, an exterior point search method is established to allocate the generation among multiple receiving power grids. This method produces an initial solution using the load shedding algorithm, and further improves it by iteratively coordinating the generation among different power grids. The proposed method was implemented to the operations of cascaded hydropower plants on Xin-Fu River and another on Hongshui River. The optimization results in two cases satisfied the peak demands of receiving provincial power grids. Moreover, the maximum load difference between peak and valley decreased 12.67% and 11.32% in Shanghai Power Grid (SHPG and Zhejiang Power Grid (ZJPG, exceeding by 4.85% and 6.72% those of the current operational method, respectively. The advantage of the proposed method in alleviating peak-shaving pressure is demonstrated.

  20. Superoxide dismutase levels and peak expiratory flow in asthmatic children

    Directory of Open Access Journals (Sweden)

    Arie Kurniasih

    2016-11-01

    Full Text Available Background Asthma is a chronic inflammatory process which involve variety of cells such as inflammatory mediators, reactive oxygen species (ROS, and cytokines. The inflammatory process would be exacerbated in the presence of oxidative stress. Superoxide dismutase (SOD is the first important enzyme to protect the respiratory tract against oxidative stress. The decreased of SOD has a correlation with increased of airway obstruction and bronchospasm. Objective To assess for a correlation between superoxide dismutase (SOD levels and peak expiratory flow, as well as to determine the impact of SOD levels for predicting asthma attacks. Methods We conducted a prospective cohort study at Dr. Sardjito Hospital, Yogyakarta, between February and April 2011 involving asthmatic children aged 5-18 years. Subjects’ serum SOD levels and peak expiratory flow were measured at the same time point. We then performed a prospective study following up on the same subjects to find out if they had a recurrent asthma attack within one month of the tests. We also reassessed their peak expiratory flow one month after blood specimens were obtained. Results Thirty-nine patients were enrolled in this study. There was no significant correlation between SOD level and peak expiratory flow [r=0.289; 95%CI -0.025 to 0.47; P=0.074]. However, older age was significantly associated with higher peak expiratory flow (=0.5; 95%CI 3.10 to 11.57; P=0.01. Lower levels of SOD increased the risk of asthma attacks in a month following the initial measurements (RR=5.5; 95%CI 1.6 to 18.9; P=0.009. Conclusion Superoxide dismutase (SOD level is not significantly associated with peak expiratory flow. However, we find a relationship between older age and higher peak expiratory flow and a relationship between lower SOD levels and risk of asthma attacks within one month following the tests.

  1. Automatic fitting of Gaussian peaks using abductive machine learning

    International Nuclear Information System (INIS)

    Abdel-Aal, R.E.

    1998-01-01

    Analytical techniques have been used for many years for fitting Gaussian peaks in nuclear spectroscopy. However, the complexity of the approach warrants looking for machine-learning alternatives where intensive computations are required only once (during training), while actual analysis on individual spectra is greatly simplified and quickened. This should allow the use of simple portable systems for fast and automated analysis of large numbers of spectra, particularly in situations where accuracy may be traded for speed and simplicity. This paper proposes the use of abductive networks machine learning for this purpose. The Abductory Induction Mechanism (AIM) tool was used to build models for analyzing both single and double Gaussian peaks in the presence of noise depicting statistical uncertainties in collected spectra. AIM networks were synthesized by training on 1,000 representative simulated spectra and evaluated on 500 new spectra. A classifier network determines the multiplicity of single/double peaks with an accuracy of 98%. With statistical uncertainties corresponding to a peak count of 100, average percentage absolute errors for the height, position, and width of single peaks are 4.9, 2.9, and 4.2%, respectively. For double peaks, these average errors are within 7.0, 3.1, and 5.9%, respectively. Models have been developed which account for the effect of a linear background on a single peak. Performance is compared with a neural network application and with an analytical curve-fitting routine, and the new technique is applied to actual data of an alpha spectrum

  2. flowPeaks: a fast unsupervised clustering for flow cytometry data via K-means and density peak finding.

    Science.gov (United States)

    Ge, Yongchao; Sealfon, Stuart C

    2012-08-01

    For flow cytometry data, there are two common approaches to the unsupervised clustering problem: one is based on the finite mixture model and the other on spatial exploration of the histograms. The former is computationally slow and has difficulty to identify clusters of irregular shapes. The latter approach cannot be applied directly to high-dimensional data as the computational time and memory become unmanageable and the estimated histogram is unreliable. An algorithm without these two problems would be very useful. In this article, we combine ideas from the finite mixture model and histogram spatial exploration. This new algorithm, which we call flowPeaks, can be applied directly to high-dimensional data and identify irregular shape clusters. The algorithm first uses K-means algorithm with a large K to partition the cell population into many small clusters. These partitioned data allow the generation of a smoothed density function using the finite mixture model. All local peaks are exhaustively searched by exploring the density function and the cells are clustered by the associated local peak. The algorithm flowPeaks is automatic, fast and reliable and robust to cluster shape and outliers. This algorithm has been applied to flow cytometry data and it has been compared with state of the art algorithms, including Misty Mountain, FLOCK, flowMeans, flowMerge and FLAME. The R package flowPeaks is available at https://github.com/yongchao/flowPeaks. yongchao.ge@mssm.edu Supplementary data are available at Bioinformatics online.

  3. Analysis of Peak-to-Peak Current Ripple Amplitude in Seven-Phase PWM Voltage Source Inverters

    Directory of Open Access Journals (Sweden)

    Gabriele Grandi

    2013-08-01

    Full Text Available Multiphase systems are nowadays considered for various industrial applications. Numerous pulse width modulation (PWM schemes for multiphase voltage source inverters with sinusoidal outputs have been developed, but no detailed analysis of the impact of these modulation schemes on the output peak-to-peak current ripple amplitude has been reported. Determination of current ripple in multiphase PWM voltage source inverters is important for both design and control purposes. This paper gives the complete analysis of the peak-to-peak current ripple distribution over a fundamental period for multiphase inverters, with particular reference to seven-phase VSIs. In particular, peak-to-peak current ripple amplitude is analytically determined as a function of the modulation index, and a simplified expression to get its maximum value is carried out. Although reference is made to the centered symmetrical PWM, being the most simple and effective solution to maximize the DC bus utilization, leading to a nearly-optimal modulation to minimize the RMS of the current ripple, the analysis can be readily extended to either discontinuous or asymmetrical modulations, both carrier-based and space vector PWM. A similar approach can be usefully applied to any phase number. The analytical developments for all different sub-cases are verified by numerical simulations.

  4. PEAK SHIFTS PRODUCED BY CORRELATED RESPONSE TO SELECTION.

    Science.gov (United States)

    Price, Trevor; Turelli, Michael; Slatkin, Montgomery

    1993-02-01

    Traits may evolve both as a consequence of direct selection and also as a correlated response to selection on other traits. While correlated response may be important for both the production of evolutionary novelty and in the build-up of complex characters, its potential role in peak shifts has been neglected empirically and theoretically. We use a quantitative genetic model to investigate the conditions under which a character, Y, which has two alternative optima, can be dragged from one optimum to the other as a correlated response to selection on a second character, X. High genetic correlations between the two characters make the transition, or peak shift, easier, as does weak selection tending to restore Y to the optimum from which it is being dragged. When selection on Y is very weak, the conditions for a peak shift depend only on the location of the new optimum for X and are independent of the strength of selection moving it there. Thus, if the "adaptive valley" for Y is very shallow, little reduction in mean fitness is needed to produce a shift. If the selection acts strongly to keep Y at its current optimum, very intense directional selection on X, associated with a dramatic drop in mean fitness, is required for a peak shift. When strong selection is required, the conditions for peak shifts driven by correlated response might occur rarely, but still with sufficient frequency on a geological timescale to be evolutionarily important. © 1993 The Society for the Study of Evolution.

  5. Pediatric Exercise Testing: Value and Implications of Peak Oxygen Uptake

    Directory of Open Access Journals (Sweden)

    Paolo T. Pianosi

    2017-01-01

    Full Text Available Peak oxygen uptake (peak V ˙ O 2 measured by clinical exercise testing is the benchmark for aerobic fitness. Aerobic fitness, estimated from maximal treadmill exercise, is a predictor of mortality in adults. Peak V ˙ O 2 was shown to predict longevity in patients aged 7–35 years with cystic fibrosis over 25 years ago. A surge of exercise studies in young adults with congenital heart disease over the past decade has revealed significant prognostic information. Three years ago, the first clinical trial in children with pulmonary arterial hypertension used peak V ˙ O 2 as an endpoint that likewise delivered clinically relevant data. Cardiopulmonary exercise testing provides clinicians with biomarkers and clinical outcomes, and researchers with novel insights into fundamental biological mechanisms reflecting an integrated physiological response hidden at rest. Momentum from these pioneering observations in multiple disease states should impel clinicians to employ similar methods in other patient populations; e.g., sickle cell disease. Advances in pediatric exercise science will elucidate new pathways that may identify novel biomarkers. Our initial aim of this essay is to highlight the clinical relevance of exercise testing to determine peak V ˙ O 2 , and thereby convince clinicians of its merit, stimulating future clinical investigators to broaden the application of exercise testing in pediatrics.

  6. Group Elevator Peak Scheduling Based on Robust Optimization Model

    Directory of Open Access Journals (Sweden)

    ZHANG, J.

    2013-08-01

    Full Text Available Scheduling of Elevator Group Control System (EGCS is a typical combinatorial optimization problem. Uncertain group scheduling under peak traffic flows has become a research focus and difficulty recently. RO (Robust Optimization method is a novel and effective way to deal with uncertain scheduling problem. In this paper, a peak scheduling method based on RO model for multi-elevator system is proposed. The method is immune to the uncertainty of peak traffic flows, optimal scheduling is realized without getting exact numbers of each calling floor's waiting passengers. Specifically, energy-saving oriented multi-objective scheduling price is proposed, RO uncertain peak scheduling model is built to minimize the price. Because RO uncertain model could not be solved directly, RO uncertain model is transformed to RO certain model by elevator scheduling robust counterparts. Because solution space of elevator scheduling is enormous, to solve RO certain model in short time, ant colony solving algorithm for elevator scheduling is proposed. Based on the algorithm, optimal scheduling solutions are found quickly, and group elevators are scheduled according to the solutions. Simulation results show the method could improve scheduling performances effectively in peak pattern. Group elevators' efficient operation is realized by the RO scheduling method.

  7. Energy Saving by Chopping off Peak Demand Using Day Light

    Directory of Open Access Journals (Sweden)

    Ashok Kumar Maitra

    2011-08-01

    Full Text Available An artificial intelligent technique has been implemented in this research using real time datas to calculate how much energy can be chopped from peak load demand. The results are based on real time data that are taken from power delivering centers. These datas do reflect the present condition of power and a solution to those critical conditions during the peak period. These are done in such a way such that helps in judicious scheduling of load. The time based load scheduling has been done so as to understand the basic criteria for solving power crisis during morning peak and early evening peak. The sunray availability and percentage of load that will use day light saving (DLS technique has been taken into account in this work. The results shows that about 0.5% to 1% of load can be shedded off from the peak load period which otherwise is reduction of power. Thus it otherwise also means that an equivalent amount of energy is saved which amounts to a large saving of national money. This result is obtained on monthly and even daily basis. Thus this paper justifies DLS gives a new renewable technique to save energy.

  8. Enhanced vegetation growth peak and its key mechanisms

    Science.gov (United States)

    Huang, K.; Xia, J.; Wang, Y.; Ahlström, A.; Schwalm, C.; Huntzinger, D. N.; Chen, J.; Cook, R. B.; Fang, Y.; Fisher, J. B.; Jacobson, A. R.; Michalak, A.; Schaefer, K. M.; Wei, Y.; Yan, L.; Luo, Y.

    2017-12-01

    It remains unclear that whether and how the vegetation growth peak has been shifted globally during the past three decades. Here we used two global datasets of gross primary productivity (GPP) and a satellite-derived Normalized Difference Vegetation Index (NDVI) to characterize recent changes in seasonal peak vegetation growth. The attribution of changes in peak growth to their driving factors was examined with several datasets. We demonstrated that the growth peak of global vegetation has been linearly increasing during the past three decades. About 65% of this trend is evenly explained by the expanding croplands (21%), rising atmospheric [CO2] (22%), and intensifying nitrogen deposition (22%). The contribution of expanding croplands to the peak growth trend was substantiated by measurements from eddy-flux towers, sun-induced chlorophyll fluorescence and a global database of plant traits, all of which demonstrated that croplands have a higher photosynthetic capacity than other vegetation types. The contribution of rising atmospheric [CO2] and nitrogen deposition are consistent with the positive response of leaf growth to elevated [CO2] (25%) and nitrogen addition (8%) from 346 manipulated experiments. The positive effect of rising atmospheric [CO2] was also well captured by 15 terrestrial biosphere models. However, most models underestimated the contributions of land-cover change and nitrogen deposition, but overestimated the positive effect of climate change.

  9. Non-Gaussian bias: insights from discrete density peaks

    CERN Document Server

    Desjacques, Vincent; Riotto, Antonio

    2013-01-01

    Corrections induced by primordial non-Gaussianity to the linear halo bias can be computed from a peak-background split or the widespread local bias model. However, numerical simulations clearly support the prediction of the former, in which the non-Gaussian amplitude is proportional to the linear halo bias. To understand better the reasons behind the failure of standard Lagrangian local bias, in which the halo overdensity is a function of the local mass overdensity only, we explore the effect of a primordial bispectrum on the 2-point correlation of discrete density peaks. We show that the effective local bias expansion to peak clustering vastly simplifies the calculation. We generalize this approach to excursion set peaks and demonstrate that the resulting non-Gaussian amplitude, which is a weighted sum of quadratic bias factors, precisely agrees with the peak-background split expectation, which is a logarithmic derivative of the halo mass function with respect to the normalisation amplitude. We point out tha...

  10. Rotational and peak torque stiffness of rugby shoes.

    Science.gov (United States)

    Ballal, Moez S; Usuelli, Federico Giuseppe; Montrasio, Umberto Alfieri; Molloy, Andy; La Barbera, Luigi; Villa, Tomaso; Banfi, Giuseppe

    2014-09-01

    Sports people always strive to avoid injury. Sports shoe designs in many sports have been shown to affect traction and injury rates. The aim of this study is to demonstrate the differing stiffness and torque in rugby boots that are designed for the same effect. Five different types of rugby shoes commonly worn by scrum forwards were laboratory tested for rotational stiffness and peak torque on a natural playing surface generating force patterns that would be consistent with a rugby scrum. The overall internal rotation peak torque was 57.75±6.26 Nm while that of external rotation was 56.55±4.36 Nm. The Peak internal and external rotational stiffness were 0.696±0.1 and 0.708±0.06 Nm/deg respectively. Our results, when compared to rotational stiffness and peak torques of football shoes published in the literature, show that shoes worn by rugby players exert higher rotational and peak torque stiffness compared to football shoes when tested on the same natural surfaces. There was significant difference between the tested rugby shoes brands. In our opinion, to maximize potential performance and lower the potential of non-contact injury, care should be taken in choosing boots with stiffness appropriate to the players main playing role. Copyright © 2014 Elsevier Ltd. All rights reserved.

  11. Accuracy of portable devices in measuring peak cough flow

    International Nuclear Information System (INIS)

    Kulnik, Stefan Tino; Kalra, Lalit; MacBean, Victoria; Birring, Surinder Singh; Moxham, John; Rafferty, Gerrard Francis

    2015-01-01

    Peak cough flow (PCF) measurements can be used as indicators of cough effectiveness. Portable peak flow meters and spirometers have been used to measure PCF, but little is known about their accuracy compared to pneumotachograph systems. The aim of this study was to compare the accuracy of four portable devices (Mini–Wright and Assess peak flow meters, SpiroUSB and Microlab spirometers) in measuring PCF with a calibrated laboratory based pneumotachograph system. Twenty healthy volunteers (mean (SD) age 45 (16) years) coughed through a pneumotachograph connected in series with each portable device in turn, and the differences in PCF readings were analysed. In addition, mechanically generated flow waves of constant peak flow were delivered through each device both independently and when connected in series with the pneumotachograph. Agreement between PCF readings obtained with the pneumotachograph and the portable devices was poor. Peak flow readings were on average lower by approximately 50 L min −1 when measured using the portable devices; 95% limits of agreement spanned approximately 150 L min −1 . The findings highlight the potential for inaccuracy when using portable devices for the measurement of PCF. Depending on the measurement instrument used, absolute values of PCF reported in the literature may not be directly comparable. (paper)

  12. [A new peak detection algorithm of Raman spectra].

    Science.gov (United States)

    Jiang, Cheng-Zhi; Sun, Qiang; Liu, Ying; Liang, Jing-Qiu; An, Yan; Liu, Bing

    2014-01-01

    The authors proposed a new Raman peak recognition method named bi-scale correlation algorithm. The algorithm uses the combination of the correlation coefficient and the local signal-to-noise ratio under two scales to achieve Raman peak identification. We compared the performance of the proposed algorithm with that of the traditional continuous wavelet transform method through MATLAB, and then tested the algorithm with real Raman spectra. The results show that the average time for identifying a Raman spectrum is 0.51 s with the algorithm, while it is 0.71 s with the continuous wavelet transform. When the signal-to-noise ratio of Raman peak is greater than or equal to 6 (modern Raman spectrometers feature an excellent signal-to-noise ratio), the recognition accuracy with the algorithm is higher than 99%, while it is less than 84% with the continuous wavelet transform method. The mean and the standard deviations of the peak position identification error of the algorithm are both less than that of the continuous wavelet transform method. Simulation analysis and experimental verification prove that the new algorithm possesses the following advantages: no needs of human intervention, no needs of de-noising and background removal operation, higher recognition speed and higher recognition accuracy. The proposed algorithm is operable in Raman peak identification.

  13. Variable threshold method for ECG R-peak detection.

    Science.gov (United States)

    Kew, Hsein-Ping; Jeong, Do-Un

    2011-10-01

    In this paper, a wearable belt-type ECG electrode worn around the chest by measuring the real-time ECG is produced in order to minimize the inconvenient in wearing. ECG signal is detected using a potential instrument system. The measured ECG signal is transmits via an ultra low power consumption wireless data communications unit to personal computer using Zigbee-compatible wireless sensor node. ECG signals carry a lot of clinical information for a cardiologist especially the R-peak detection in ECG. R-peak detection generally uses the threshold value which is fixed. There will be errors in peak detection when the baseline changes due to motion artifacts and signal size changes. Preprocessing process which includes differentiation process and Hilbert transform is used as signal preprocessing algorithm. Thereafter, variable threshold method is used to detect the R-peak which is more accurate and efficient than fixed threshold value method. R-peak detection using MIT-BIH databases and Long Term Real-Time ECG is performed in this research in order to evaluate the performance analysis.

  14. Thermal Peak Management Using Organic Phase Change Materials for Latent Heat Storage in Electronic Applications

    Science.gov (United States)

    Maxa, Jacob; Novikov, Andrej; Nowottnick, Mathias

    2017-01-01

    Modern high power electronics devices consists of a large amount of integrated circuits for switching and supply applications. Beside the benefits, the technology exhibits the problem of an ever increasing power density. Nowadays, heat sinks that are directly mounted on a device, are used to reduce the on-chip temperature and dissipate the thermal energy to the environment. This paper presents a concept of a composite coating for electronic components on printed circuit boards or electronic assemblies that is able to buffer a certain amount of thermal energy, dissipated from a device. The idea is to suppress temperature peaks in electronic components during load peaks or electronic shorts, which otherwise could damage or destroy the device, by using a phase change material to buffer the thermal energy. The phase change material coating could be directly applied on the chip package or the PCB using different mechanical retaining jigs.

  15. Thermal Peak Management Using Organic Phase Change Materials for Latent Heat Storage in Electronic Applications

    Directory of Open Access Journals (Sweden)

    Jacob Maxa

    2017-12-01

    Full Text Available Modern high power electronics devices consists of a large amount of integrated circuits for switching and supply applications. Beside the benefits, the technology exhibits the problem of an ever increasing power density. Nowadays, heat sinks that are directly mounted on a device, are used to reduce the on-chip temperature and dissipate the thermal energy to the environment. This paper presents a concept of a composite coating for electronic components on printed circuit boards or electronic assemblies that is able to buffer a certain amount of thermal energy, dissipated from a device. The idea is to suppress temperature peaks in electronic components during load peaks or electronic shorts, which otherwise could damage or destroy the device, by using a phase change material to buffer the thermal energy. The phase change material coating could be directly applied on the chip package or the PCB using different mechanical retaining jigs.

  16. Statistical analysis of the low-temperature dislocation peak of internal friction (Bordoni peak) in nanostructured copper

    International Nuclear Information System (INIS)

    Vatazhuk, E.N.; Natsik, V.D.

    2011-01-01

    The temperature-frequency dependence of internal friction in the nanostructured samples of Cu and fibred composite C-32 vol.%Nb with the sizes of structure fragments approx 200 nm is analyzed. Experiments are used as initial information for such analysis. The characteristic for the heavily deformed copper Bordoni peak, located nearby a temperature 90 K, was recorded on temperature dependence of vibration decrement (frequencies 73-350 kHz) in previous experiments. The peak is due to the resonance interaction of sound with the system of thermal activated relaxators, and its width considerably greater in comparison with the width of standard internal friction peak with the single relaxation time. Statistical analysis of the peak is made in terms of assumption that the reason of broadening is random activation energy dispersion of relaxators as a result of intense distortion of copper crystal structure. Good agreement of experimental data and Seeger theory considers thermal activated paired kinks at linear segments of dislocation lines, placed in potential Peierls relief valley, as relaxators of Bordoni peak, was established. It is shown that the registered peak height in experiment correspond to presence at the average one dislocation segment in the interior of crystalline grain with size of 200 nm. Empirical estimates for the critical Peierls stress σp ∼ 2x10 7 Pa and integrated density of the interior grain dislocations ρ d ∼ 10 13 m -2 are made. Nb fibers in the composite Cu-Nb facilitate to formation of nanostructured copper, but do not influence evidently on the Bordoni peak.

  17. Maximizing the peak production rate in off-line comprehensive two-dimensional liquid chromatography with mass spectrometry detection

    NARCIS (Netherlands)

    Eeltink, S.; Dolman, S.; Ursem, M.; Swart, R.; McLeod, F.; Schoenmakers, P.J.

    2009-01-01

    This article describes an optimization strategy to obtain the best possible performance in the shortest analysis time—called the peak production rate—for comprehensive off-line two-dimensional liquid chromatography. The demands on column technology (particle size and column length) and LC conditions

  18. An internal friction peak caused by hydrogen in maraging steel

    International Nuclear Information System (INIS)

    Usui, Makoto; Asano, Shigeru

    1996-01-01

    Internal friction in hydrogen-charged iron and steel has so far been studied by a large number of investigators. For pure iron, a well-defined peak of internal friction has been observed under the cold-worked and hydrogen-charged conditions. This is called the hydrogen cold-work peak, or the Snoek-Koester relaxation, which originates from the hydrogen-dislocation interaction. In the present study, a high-strength maraging steel (Fe-18Ni-9Co-5Mo) was chosen as another high-alloy steel which is known to be very susceptible to hydrogen embrittlement. The purpose of this paper is to show a new internal friction peak caused by hydrogen in the maraging steel and to compare it with those found in stainless steels which have so far been studied as typical engineering high-alloy materials

  19. Electron-electron Thomas peak in fast transfer ionization

    International Nuclear Information System (INIS)

    Tolmanov, S. G.; McGuire, J. H.

    2000-01-01

    ''Thomas process'' is a name used for a family of singular two-step processes that can lead to electron transfer. The Thomas process of the ''second kind,'' occurring in reactions with both transfer and ionization, utilizes the e-e scattering in the second step, so this Thomas process requires the dynamics of the electron-electron interaction. We calculate numerically the second order element of an S matrix and corresponding cross sections for the transfer ionization process. We find that the position and shape of the Thomas peak depend on both electron-electron and the electron-nucleus interaction. Also the direct and exchange amplitudes are equal at the peak position. We test the peaking approximation used for transfer ionization. Our results can be compared to experimental results for p + +He→H+He 2+ +e - . (c) 2000 The American Physical Society

  20. Distribution network planning method considering distributed generation for peak cutting

    International Nuclear Information System (INIS)

    Ouyang Wu; Cheng Haozhong; Zhang Xiubin; Yao Liangzhong

    2010-01-01

    Conventional distribution planning method based on peak load brings about large investment, high risk and low utilization efficiency. A distribution network planning method considering distributed generation (DG) for peak cutting is proposed in this paper. The new integrated distribution network planning method with DG implementation aims to minimize the sum of feeder investments, DG investments, energy loss cost and the additional cost of DG for peak cutting. Using the solution techniques combining genetic algorithm (GA) with the heuristic approach, the proposed model determines the optimal planning scheme including the feeder network and the siting and sizing of DG. The strategy for the site and size of DG, which is based on the radial structure characteristics of distribution network, reduces the complexity degree of solving the optimization model and eases the computational burden substantially. Furthermore, the operation schedule of DG at the different load level is also provided.