WorldWideScience

Sample records for technology patents include

  1. Patent protection for microbial technologies.

    Science.gov (United States)

    Sherkow, Jacob S

    2017-11-01

    Microbial technologies often serve as the basis of fundamental research tools in molecular biology. These present a variety of ethical, legal and social issues concerning their patenting. This commentary presents several case studies of these issues across three major microbiological tools: CRISPR, viral vectors and antimicrobial resistance drugs. It concludes that the development of these technologies-both scientifically and commercially-depend, in part, on the patent regime available for each, and researchers' willingness to enforce those patents against others. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  2. Technology Trends Analysis Using Patent Landscaping

    Directory of Open Access Journals (Sweden)

    Sergey Vsevolodovich Kortov

    2017-09-01

    Full Text Available The article is devoted to the analysis and the choice of the priorities in technology development and, particularly, to the use of patent landscaping as a tool for the study of technology trends. Currently, patent activity indicators are often used for technology foresight and for competitive intelligence as well. Nevertheless, causal relationship between these indicators, on the one hand, and strategic and tactical decisions in the sphere of technological development on meso- and microeconomic level, on the other hand, are not adequately investigated to solve practical tasks. The goal of the work is to systemize the challenges of technology trends analysis, which could be effectively solved on the base of patent landscape analysis. The article analyses the patent landscaping methodology and tools, as well as their use for evaluating the current competitive environment and technology foresight. The authors formulated the generalized classification for the criteria of promising technologies for a selected region. To assess the compliance of a technology with these criteria, we propose a system of corresponding indicators of patenting activity. Using the proposed methodology, we have analysed the patent landscape to select promising technologies for the Sverdlovsk region. The research confirmed the hypothesis of the patent landscapes performance in evaluating such technology indicators as stages of the life cycle stage, universality (applicability in different industries, pace of worldwide development, innovations and science availability in the region and potential possibilities for scientific collaboration with international research institutions and universities. The results of the research may be useful to the wide audience, including representatives small and medium enterprises, large companies and regional authorities for the tasks concerned with the technology trends analysis and technology strategy design

  3. Savannah River Site Patented Technologies Summaries

    Energy Technology Data Exchange (ETDEWEB)

    Rabold, D.E.

    1995-07-18

    This information represents SRS`s contribution of the DOE technology information network, an internet service coordinated out of Los Alamos. The information provided is strictly DOE-SR-titled and-issued patented technologies including environmental remediation, robotics, sensors, materials science, biomedical applications, hydrogen, and consumer products.

  4. Technology Clusters Exploration for Patent Portfolio through Patent Abstract Analysis

    Directory of Open Access Journals (Sweden)

    Gabjo Kim

    2016-12-01

    Full Text Available This study explores technology clusters through patent analysis. The aim of exploring technology clusters is to grasp competitors’ levels of sustainable research and development (R&D and establish a sustainable strategy for entering an industry. To achieve this, we first grouped the patent documents with similar technologies by applying affinity propagation (AP clustering, which is effective while grouping large amounts of data. Next, in order to define the technology clusters, we adopted the term frequency-inverse document frequency (TF-IDF weight, which lists the terms in order of importance. We collected the patent data of Korean electric car companies from the United States Patent and Trademark Office (USPTO to verify our proposed methodology. As a result, our proposed methodology presents more detailed information on the Korean electric car industry than previous studies.

  5. Turning Technology into Business Using University Patents

    NARCIS (Netherlands)

    Hartmann, L.

    2014-01-01

    We present an education paradigm that stimulates innovation and entrepreneurship through a master's-level university course: "Turning Technology into Business". The course was specifically designed to connect technological research with education using patented technologies developed at the research

  6. Patent portfolio structure for single technology companies

    OpenAIRE

    Hartwell, Ian P.

    2004-01-01

    Single technology companies (STCs) are defined in this thesis as companies that (a) have the fundamental rights to a new technology, (b) have development of that technology as their core competence, (c) seek to exploit that technology primarily by licensing the patent rights, and (d) are driven primarily by 'technology push'. These factors often result in much of the value of the STC residing in its patent portfolio. This in turn may place significant - and often conflicting - ...

  7. Are Patents used to Suppress Useful Technology?

    DEFF Research Database (Denmark)

    Howells, John

    2006-01-01

    of innovation, other than in the trivial sense of excluding third parties from the right to develop the technology covered by the patent? There are many references to this possibility in the management, economic and legal literatures, but two highly-cited papers stand out for grounding their claims of corporate......This article examines the evidence behind claims that innovation is hindered or blocked (termed technology suppression) by corporations' use of patents. In other words, are there ways in which the exploitation of the exclusive development right of the patent can be shown to retard the process...... and the difference between economic monopoly and an exclusive right. It is argued here that what is at issue in this work is the proper function of the patent institution. It is shown early in this paper that the understanding of the patent institution as a system of development prospects makes better sense...

  8. Patent Keyword Extraction for Sustainable Technology Management

    Directory of Open Access Journals (Sweden)

    Jongchan Kim

    2018-04-01

    Full Text Available Recently, sustainable growth and development has become an important issue for governments and corporations. However, maintaining sustainable development is very difficult. These difficulties can be attributed to sociocultural and political backgrounds that change over time [1]. Because of these changes, the technologies for sustainability also change, so governments and companies attempt to predict and manage technology using patent analyses, but it is very difficult to predict the rapidly changing technology markets. The best way to achieve insight into technology management in this rapidly changing market is to build a technology management direction and strategy that is flexible and adaptable to the volatile market environment through continuous monitoring and analysis. Quantitative patent analysis using text mining is an effective method for sustainable technology management. There have been many studies that have used text mining and word-based patent analyses to extract keywords and remove noise words. Because the extracted keywords are considered to have a significant effect on the further analysis, researchers need to carefully check out whether they are valid or not. However, most prior studies assume that the extracted keywords are appropriate, without evaluating their validity. Therefore, the criteria used to extract keywords needs to change. Until now, these criteria have focused on how well a patent can be classified according to its technical characteristics in the collected patent data set, typically using term frequency–inverse document frequency weights that are calculated by comparing the words in patents. However, this is not suitable when analyzing a single patent. Therefore, we need keyword selection criteria and an extraction method capable of representing the technical characteristics of a single patent without comparing them with other patents. In this study, we proposed a methodology to extract valid keywords from

  9. A Patent Analysis for Sustainable Technology Management

    Directory of Open Access Journals (Sweden)

    Junhyeog Choi

    2016-07-01

    Full Text Available Technology analysis (TA is an important issue in the management of technology. Most R&D (Research & Development policies have depended on diverse TA results. Traditional TA results have been obtained through qualitative approaches such as the Delphi expert survey, scenario analysis, or technology road mapping. Although they are representative methods for TA, they are not stable because their results are dependent on the experts’ knowledge and subjective experience. To solve this problem, recently many studies on TA have been focused on quantitative approaches, such as patent analysis. A patent document has diverse information of developed technologies, and thus, patent is one form of objective data for TA. In addition, sustainable technology has been a big issue in the TA fields, because most companies have their technological competitiveness through the sustainable technology. Sustainable technology is a technology keeping the technological superiority of a company. So a country as well as a company should consider sustainable technology for technological competition and continuous economic growth. Also it is important to manage sustainable technology in a given technology domain. In this paper, we propose a new patent analysis approach based on statistical analysis for the management of sustainable technology (MOST. Our proposed methodology for the MOST is to extract a technological structure and relationship for knowing the sustainable technology. To do this, we develop a hierarchical diagram of technology for finding the causal relationships among technological keywords of a given domain. The aim of the paper is to select the sustainable technology and to create the hierarchical technology paths to sustainable technology for the MOST. This contributes to planning R&D strategy for the sustainability of a company. To show how the methodology can be applied to real problem, we perform a case study using retrieved patent documents related to

  10. Patent Value: A Business Perspective for Technology Startups

    OpenAIRE

    Angela de Wilton

    2011-01-01

    In the last year, news headlines have highlighted record patent infringement settlements, multibillion dollar auctions of large corporate patent portfolios, and ongoing patent battles between key technology industry players. Despite this acknowledgment of the significant value of patents for large corporations, many small technology companies are understandably more focused on the near-term costs of obtaining a patent rather than future value. Costs may seem prohibitive to an early stage tech...

  11. Preliminary analysis of patent trends for magnetic fusion technology

    International Nuclear Information System (INIS)

    Levine, L.O.; Ashton, W.B.; Campbell, R.S.

    1984-02-01

    This study presents a preliminary analysis of development trends in magnetic fusion technology based on data from US patents. The research is limited to identification and description of general patent activity and ownership characteristics for 373 patents. The results suggest that more detailed studies of fusion patents could provide useful R and D planning information

  12. 48 CFR 27.204 - Patented technology under trade agreements.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Patented technology under trade agreements. 27.204 Section 27.204 Federal Acquisition Regulations System FEDERAL ACQUISITION... Patented technology under trade agreements. ...

  13. 37 CFR 1.18 - Patent post allowance (including issue) fees.

    Science.gov (United States)

    2010-07-01

    ... entity $1,190.00 (d) Publication fee $300.00. (e) For filing an application for patent term adjustment... (including issue) fees. 1.18 Section 1.18 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND TRADEMARK OFFICE, DEPARTMENT OF COMMERCE GENERAL RULES OF PRACTICE IN PATENT CASES General Provisions Fees...

  14. "Environmental Technology Strengths: International Rankings Based on US Patent Data"

    OpenAIRE

    Dora Marinova; Michael McAleer

    2003-01-01

    Patent information has been used by economists and researchers in the field of innovation to analyse current and forecast future technological directions. The recent surge in patenting activities in developed countries reaffirms the strong position of the patent system in a globalised world dominated by market mechanisms. This paper analyses the technological position of the top twelve foreign patenting countries in the USA, namely Australia, Canada, France, Germany, Italy, Japan, Korea, the ...

  15. Research Funding, Patent Search Training and Technology Transfer: a collaboration

    KAUST Repository

    Tyhurst, Janis

    2016-01-01

    This paper will focus on the collaboration efforts of three different university departments to create, teach and evaluate the benefits of a joint patent training series, as well as the future directions this collaboration will take. KAUST has as one of its goals the diversification of the Saudi economy. There is a strong focus at the university on developing entrepreneurial ideas and commercializing research done. The University Library supports this goal through the provision of electronic resources and introductory patent search training skills. However, the patent training class offered by the University Library is only one step in a process that faculty and students need when starting or taking their research to the next level. In the Fall of 2015, I met with representatives of the two major stakeholders in the patent arena, the office of Sponsored Research (OSR) and the Technology Transfer Office (TTO), to develop a patent training program to meet the needs of researchers. The OSR provides funding to researchers who have demonstrated that their ideas have merit with potential applications, the TTO works with researchers who are at the point of needing IP protection. The resulting discussion led us to collaborate on creating a workshop series that benefit the researcher’s information needs and each of our departments as well. In the first of the series of three 2 hour workshops, the Manager of TTO and the Lead Integrative Specialist from the OSR presented a workshop on an overview of Intellectual Property and the patenting process. These presentations focused on when and how to determine whether research is potentially patentable, why a researcher needs to protect his/her research and how to go about protecting it. The second workshop focused on introductory patent search skills and tools, how to expand a literature search to include the information found in patents, and how this kind of research will improve not only the literature search but the research

  16. Patent Value: A Business Perspective for Technology Startups

    Directory of Open Access Journals (Sweden)

    Angela de Wilton

    2011-12-01

    Full Text Available In the last year, news headlines have highlighted record patent infringement settlements, multibillion dollar auctions of large corporate patent portfolios, and ongoing patent battles between key technology industry players. Despite this acknowledgment of the significant value of patents for large corporations, many small technology companies are understandably more focused on the near-term costs of obtaining a patent rather than future value. Costs may seem prohibitive to an early stage technology startup. Some software startups question whether patents are relevant to their business. In practice, effective intellectual property (IP strategy and management is dependent on many factors, such as technology or industry sector, size and maturity of the business, technology lifecycle, and the business and market environment. IP strategy must be aligned to business strategy from the outset. By considering IP in the broader context of the overall business plan and the competitive environment, opportunities for generating increased return on R&D investment and added business value through patents or other forms of IP can be recognized early on. This approach ensures that a decision about whether or not to patent is driven by business reasons rather than budget constraints. This article examines the costs and benefits of patents from the perspective of early-stage technology startups and growing businesses, and it provides some general guidance on best practices for developing an IP and patent activity plan and for building a patent portfolio that appropriately supports business objectives.

  17. Firms’ Negative Perceptions on Patents, Technology Management Strategies, and Subsequent Performance

    Directory of Open Access Journals (Sweden)

    Eun Jin Han

    2017-03-01

    Full Text Available While patents do have many advantages, their disadvantages include requiring disclosure of technical information and imposing the burden of patenting and litigation costs. In this study, we investigate the relationship between a firm’s negative perception on patents, technology management strategies, and subsequent performance. For this purpose, we use a categorical canonical correlation analysis of the top 200, large, R&D-intensive firms in Korea. We find that negative perceptions such as burdensome transaction costs, non-patenting culture, and uncertainty of the outcome of patent litigation are associated with firms’ technology management strategies, such as purchase of licenses, and subsequent performance, such as an increase in the number of inventions from the cross-fertilization of different technologies. The results of this study are expected to contribute to a better understanding of firms’ negative attitudes toward the effects of patents, their subsequent technology management strategies, and resulting performance.

  18. Advances in CO2 capture technology: A patent review

    International Nuclear Information System (INIS)

    Li, Bingyun; Duan, Yuhua; Luebke, David; Morreale, Bryan

    2013-01-01

    Highlights: ► Timely updates on carbon capture technologies: More than 1000 patents on solvent, sorbent, and membrane. ► More patents on solvent and sorbent compared to membrane. ► Environmental and health concerns exist regarding carbon capture technologies. -- Abstract: Carbon dioxide (CO 2 ) emissions are believed to be a major contributor to global warming. As a consequence, large anthropogenic CO 2 sources worldwide will eventually be required to implement CO 2 capture and storage technologies to control CO 2 emissions. In order to guide the establishment of policies for CO 2 removal, we reviewed the current status of CO 2 capture patents and technologies based on the Espacenet patent database and found that more than 1000 patents have been published on sorbent, solvent, and membrane. More than 60% of these patents were published since the year 2000, and a sharp increase in patent numbers was seen in the last several years; ∼25% patents were published in the last 2 years. Substantially more patents on CO 2 removal and separation technologies are expected in the coming years. Meanwhile, the top four major types of patents, which consist of more than 2/3 of these patents, were patents granted by Japan (JP), United States (US), World Intellectual Property Organization (WO), and China (CN), and approximately half of the patents were JP and US patents. Unfortunately, no current technologies for removing CO 2 from large sources like coal-based power plants exist which satisfy the needs of safety, efficiency, and economy; further enhancement and innovation are much needed.

  19. The diffusion of patented oil and gas technology with environmental uses: A forward patent citation analysis

    International Nuclear Information System (INIS)

    Duch-Brown, Néstor; Costa-Campi, María Teresa

    2015-01-01

    Relevant advances in the mitigation of environmental impact could be obtained by the appropriate diffusion of existing environmental technologies. In this paper, we look at the diffusion of knowledge related to environmental technologies developed within the oil and gas industry. To assess knowledge spillovers from oil and gas inventions as a measure of technology diffusion, we rely on forward patent citations methodology. Results show that there is a strong likelihood that the citing patent will be eventually linked to environmental technologies if the original oil and gas invention has already environmental uses. Moreover, both intra and intersectoral spillovers produce a “turnabout” effect, meaning that citing patents show the opposite quality level of the cited patent. Our results support the idea that more sector-specific environmental policies, with an emphasis on diffusion, would significantly improve the use of environmental technologies developed within the oil and gas industry. -- Highlights: •Knowledge spillovers from oil and gas inventions are of an intrasectoral nature. •Environmental uses in original patents diffuse to patents with environmental uses. •The “turnabout” effect converts low quality patents into high quality citing patents. •Diffusion of oil and gas inventions need more ad hoc instruments

  20. Managing the patent thicket and maximizing patent lifetime in vaccine technology.

    Science.gov (United States)

    Mertes, Maria M M; Stötter, Gerd

    2010-10-01

    Patents are exclusive rights for a limited period of time that are granted to provide an incentive for innovation and in exchange for the public disclosure of an invention. Patenting in the medical field, especially in the field of human vaccine technologies, is full of pitfalls, because the products that finally access the market are often covered by a multitude of exclusive IP rights. This commentary gives an overview on obstacles in vaccine patenting and how to overcome them, and intends to provide a patenting guideline for researchers.

  1. Applying patent information to tracking a specific technology

    Directory of Open Access Journals (Sweden)

    Chen-Yuan Liu

    2007-10-01

    Full Text Available Patents in general contain much novel technological information. This paper demonstrates that the usage of patent analysis can facilitate a unique scheme for tracking technology development. In this paper, the walking technique of the Japanese biped robot is tracked as an example. The searching method of the FI (file index and F-term classification system developed by JPO (Japan Patent Office was employed in this study, where all the related patent data were searched from the IPDL (Intellectual Property Digital Library. This study investigated an important technique applied to the humanoid biped robot that imitates the walking behavior of the human beings on two legs. By analyzing the patent information obtained, the relative research capabilities, technical strengths, and patent citation conditions among patent competitors were compared. Furthermore, a formulated technical matrix of patent map is established in this paper to indicate that the ZMP (Zero Moment Point control means is the main technology to achieve stabilized walking control of the humanoid biped robot. This study also incorporates relevant academic journal findings and industrial information. Results presented herein demonstrate that patents can function not only as a map for tracking a technology trajectory, but also as a guide to the main development of a new technology in years to come.

  2. EPA-developed, patented technologies available for licensing

    Data.gov (United States)

    U.S. Environmental Protection Agency — Under the Federal Technology Transfer Act (FTTA), Federal Agencies can patent inventions developed during the course of research. These technologies can then be...

  3. Identification and Analysis of Technology Emergence Using Patent Classification

    Science.gov (United States)

    2014-01-01

    and legal time and capital. The desired payoff for this investment is monopolistic control of a section of the technology space, allowed by present...the claims of their application based on either the prior art cited by the patent examiner or economic reali- ties surrounding the markets for...have been developed, the claims of the patents have been tuned and tested at the respective patent office, and market -driven commercial realities may

  4. Patent Strategy at the Age of High Technology

    Science.gov (United States)

    Aoyama, Hirokazu

    This paper is a summary of the lecture which the author presented at the 5th Hokuriku Workshop for Study of Scientific and Technological Information Activities on the 17th of January in 1986. The author analyzed the present situation and made some suggestions on them ; (1) the role of patent system has shifted from introduction of foreign technologies to independent technological development at the age of high technology, (2) circumstances of rapidly increasing international patent war, particularly patent conflict between U.S. and Japan concerning U.S. ITC, (3) as the service of soft aspects of economy has been closed up, the new business has come to the fore front, and the move to consider technology as a good has been activated, (4) how patent specification should be written, the way of obtaining and protecting patent successfully, (5) basic pattern of patent strategy and what the strategy should be to respond to the enterprises level, (6) present situation of patent information service, effective use of patent maps and information strategy.

  5. Technology Transfer Center to Assume Patenting and Licensing Responsibilities | Poster

    Science.gov (United States)

    The NCI Technology Transfer Center (TTC) is undergoing a reorganization that will bring patenting and licensing responsibilities to the Shady Grove and Frederick offices by October 2015. The reorganization is a result of an effort begun in 2014 by NIH to improve the organizational structure of technology transfer at NIH to meet the rapid rate of change within science, technology, and industry, and to better align the science and laboratory goals with the licensing and patenting process.

  6. Echocardiography for patent ductus arteriosus including closure in adults.

    Science.gov (United States)

    Chugh, Reema; Salem, Morris M

    2015-01-01

    Patent ductus arteriosus (PDA) represents at least 5-10% of all congenital heart defects (CHDs) making it a very important commonly diagnosed lesion. Although spontaneous closure of the PDA occurs within 24 to 48 hours after birth in the majority, those children who do not have natural or surgical closure may have a persistent PDA into adulthood. The diagnosis is most often confirmed by echocardiography that also guides catheter-based interventions and surgeries. Echocardiography continues to be the most important tool in long-term follow-up of residua and sequelae. © 2014, Wiley Periodicals, Inc.

  7. 48 CFR 970.3102-05-30-70 - Patent costs and technology transfer costs.

    Science.gov (United States)

    2010-10-01

    ... technology transfer costs. 970.3102-05-30-70 Section 970.3102-05-30-70 Federal Acquisition Regulations System... Principles and Procedures 970.3102-05-30-70 Patent costs and technology transfer costs. (a) For management and operating contracts that do not include the clause at 970.5227-3, Technology Transfer Mission, the...

  8. The internationalisation of technology analysed with patent data

    OpenAIRE

    Bruno Van Pottelsberghe; Dominique Guellec

    2001-01-01

    This paper presents three new patent-based indicators of internationalisation of technology reflecting international co-operation in research and the location of research facilities of multinational firms. They witness both an increasing trend towards the globalisation of technology in the OECD area and large cross-country differences in the extent of internationalisation. An empirical analysis shows that the degree of technological internationalisation is higher for small countries and for c...

  9. Patent Donations: Making Use of the Gift of Technology

    Science.gov (United States)

    Talnack, G. Marie

    2010-01-01

    The lines between basic and applied research and the sectors of the U.S. economy responsible for each type have begun to blur. No better case for the blurring of these lines and the benefits of technology transfer among research institutions can be provided than the recent phenomenon of corporate patent donations to non-profit research…

  10. A new patented building technology based on ancient Roman knowledge

    DEFF Research Database (Denmark)

    Hertz, Kristian Dahl

    2010-01-01

    Super-light structures with pearl-chains is a new patented building technology by means of which you can build houses, bridges, tunnels, and even ships with longer spans, less material-, and energy consumption, without scaffolding, and making the use of arches, vaults, domes, ribbed shells, and new...

  11. Do Patents Shield Disclosure or Assure Exclusivity When Transacting Technology?

    OpenAIRE

    Gaétan de Rassenfosse; Alfons Palangkaraya; Elizabeth Webster

    2013-01-01

    Patents may assist trade in technology either by protecting buyers against the expropriation of the idea by third parties (the appropriation effect) or by enabling sellers to more frankly disclose the idea during the negotiation phase (the disclosure effect). We test for the presence of both these effects using quasi-experimental matching analysis on a novel dataset of 860 technology transaction negotiations. We identify the appropriation effect by comparing the probability of successful nego...

  12. Lessons from patents. Using patents to measure technological change in environmental models

    International Nuclear Information System (INIS)

    Popp, David

    2005-01-01

    When studying solutions to long-term environmental problems such as climate change, it is important to consider the role that technological change may play. Nonetheless, to date few economic models of environmental policy explicitly model the link between policy and technological change. There is a growing body of evidence that the incentives offered by prices and environmental regulations have a strong influence on both the creation and adoption of new technologies. In several recent papers, I have used patent data to examine the links between environmental policy and technological change. In addition, I have used the results of this research to calibrate the ENTICE model (for ENdogenous Technological change) of climate change, which links energy-related R and D to changes in the price of carbon. Drawing on my experiences from empirical studies on innovation and from modeling the climate change problem, in this paper I review some of the key lessons from recent empirical work using patents to study environmental innovation and diffusion, and discuss its implications for modeling climate change policy. I conclude by offering suggestions for future research

  13. Conditions of the potential for commercialization of the patent: the implementation of a technology public offering system technology at CNEN

    International Nuclear Information System (INIS)

    Archila, Daniela Lima Cerqueira

    2015-01-01

    This dissertation identifies the main factors which represent the conditions for the potential commercialization of patents aiming at the implementation of a system for technology public offering at CNEN as a strategy for creating licensing opportunities to the industrial sector. The method applied refers to an exploratory case study of a patented technology selected from a sample of CNEN's patent portfolio in the biopharmaceutical sector. The case study comprehends a field research of interviews conducted with two specialists in technology and innovation management, one researcher from CNEN and a biopharmaceutical company. The results show that among the nineteen main factors - related to technology, market, business and Science and Technology Organization (STO) - the market dynamics, the potential applications of the technology and an abstract of its main benefits compared to existing technologies are the major relevant information for each technology to be included in the public offering system. Other results indicate that the evaluation of such factors may be conducted by competent professionals to bring less uncertainty and risk to the early-stage of the innovation process, as well as enhance the potential interest of a company in the technology. On the other hand, the latter requires innovation capabilities to move the technology forward – additional R&D, scale-up, manufacturing and marketing - whilst the STO needs a entrepreneurial culture that mitigates its obstacles, creates more positive solutions for its routines and processes and gives sustainability to its Technology Transfer Office (TTO) through valuing its personnel in the long term. Finally, emphasis on technological partnerships with companies can be a motivating feature for directing the STO's patent strategy to the creation of proprietary technological platforms that reflect problems experienced by the commercial environment, as well as the development of this strategic patent

  14. Impact of energy technology patents in China: Evidence from a panel cointegration and error correction model

    International Nuclear Information System (INIS)

    Li, Ke; Lin, Boqiang

    2016-01-01

    Enhancing energy technology innovation performance, which is widely measured by energy technology patents through energy technology research and development (R&D) activities, is a fundamental way to implement energy conservation and emission abatement. This study analyzes the effects of R&D investment activities, economic growth, and energy price on energy technology patents in 30 provinces of China over the period 1999–2013. Several unit root tests indicate that all the above variables are generated by panel unit root processes, and a panel cointegration model is confirmed among the variables. In order to ensure the consistency of the estimators, the Fully-Modified OLS (FMOLS) method is adopted, and the results indicate that R&D investment activities and economic growth have positive effects on energy technology patents while energy price has a negative effect. However, the panel error correction models indicate that the cointegration relationship helps to promote economic growth, but it reduces R&D investment and energy price in the short term. Therefore, market-oriented measures including financial support and technical transformation policies for the development of low-carbon energy technologies, an effective energy price mechanism, especially the targeted fossil-fuel subsidies and their die away mode are vital in promoting China's energy technology innovation. - Highlights: • Energy technology patents in China are analyzed. • Relationship between energy patents and funds for R&D activities are analyzed. • China's energy price system hinders energy technology innovation. • Some important implications for China's energy technology policy are discussed. • A panel cointegration model with FMOLS estimator is used.

  15. Patent Information Use in Engineering Technology Design: An Analysis of Student Work

    Science.gov (United States)

    Phillips, Margaret; Zwicky, Dave

    2017-01-01

    How might engineering technology students make use of patent information in the engineering design process? Librarians analyzed team project reports and personal reflections created by students in an undergraduate mechanical engineering technology design course, revealing that the students used patents to consider the patentability of their ideas,…

  16. Analysis of the BEV Technology Progress of America, Europe, Japan and Korea Based on Patent Map

    Science.gov (United States)

    Yurong, Huang; Yuanyuan, Hou; Jingyan, Zhou; Ru, Liu

    2018-02-01

    The paper analyzed the Battery Electric Vehicle patent application trend, major country distribution, main technology layout and patentee of America, Europe, Japan and Korea based on patent information from 2006 to 2016 by using patent map method, and visualized the Battery Electric Vehicle technology progress conditions of the four countries and regions in the last decade.

  17. Technology and industrialization in Spanish economy from 1950 to 1960: the patents as technological activity indicators

    International Nuclear Information System (INIS)

    Hidalgo Nuchera, A.; Molero Zayas, J.; Granda Gayo, I.

    2007-01-01

    The goal of this research is to study the innovative activity developed in the fifties by the Spanish industry focussing on the foreign technology incorporated in the activity of several industrial sectors. The structure of innovation in each sector has been characterized by using patents as technological activity indicators. The data of patents registered in Spain belonging to the 1950-1960 period have been obtained taking into account the research developed by the Department of Business Administration of the Universidad Politecnica de Madrid through a subsidy granted by the Spanish Patent Office. (Author)

  18. Technological Monitoring Study Based on Invention Patents of Omeprazoleand Derivatives with Pharmaceutical Applications

    Directory of Open Access Journals (Sweden)

    Leandra Guimarães de Oliveira

    2010-11-01

    Full Text Available The current study intends to present the relevance of omeprazole, esomeprazole, rabeprazole, pantoprazole and lansoprazole by means of the technological foresight study, through invention patent documents from Brazilian applicants as indicators of innovation. The European database of patents (Espacenet, Word Patent Index (DERWENT and the Brazilian Patent Base of INPI were used, combining keywords and International Patent Classifications. The major applicants, countries of publication and claims categories were mapped. The 212 patent requests collected are mainly distributed in Chemistry, Pharmacy and Pharmacology areas. The results obtained revealed that the US was the main country with studies directed to this technological area (59 patent applications and the major applicant was the company Astrazeneca AB. Therefore, we can understand that this is a promising technology that may reflect in an increase of R&D activities and patent applications in this area.

  19. Research on Technology Innovation of China's NEV Industry Based on Patent Analysis

    DEFF Research Database (Denmark)

    Wang, Jingyu; Liu, Yingqi; Kokko, Ari

    2016-01-01

    Purpose/Significance: The development of Chinas new energy vehicle(NEV) industry is concerned by both the government and enterprises. Method/Process: Based on the patent data, this paper conducts a deep analysis on the technology innovation of Chinas NEV industry from three perspectives- the year...... distribution of the patent, the distribution of the patent applicants and the distribution of patent technology area. Then, the paper makes further correlation analysis on the NEV industry chain and the patent data. Result/Conclusion: In general,the paper comprehensively reflects the whole picture of Chinas...... NEV industry technology innovation and gives some ideas for its further development....

  20. Pre-empted Patents, Infringed Patents and Firms’ Participation in Markets for Technology

    DEFF Research Database (Denmark)

    Grimpe, Christoph; Hussinger, Katrin

    2014-01-01

    In recent years, firms have increasingly contributed to and been confronted with a patent landscape characterized by numerous but marginal inventions, overlapping claims and patent fences. As a result, firms risk their patent applications to be pre-empted or to be infringed upon by rivals. While...... patents on firms’ engagement in in- and cross-licensing. Based on a sample of more than 1100 German manufacturing firms our results show that firms engage in in-licensing as a reaction to pre-empted patents and in cross-licensing if their protected IP was infringed upon. However, these effects vary...

  1. Google Patents: The global patent search engine

    OpenAIRE

    Noruzi, Alireza; Abdekhoda, Mohammadhiwa

    2014-01-01

    Google Patents (www.google.com/patents) includes over 8 million full-text patents. Google Patents works in the same way as the Google search engine. Google Patents is the global patent search engine that lets users search through patents from the USPTO (United States Patent and Trademark Office), EPO (European Patent Office), etc. This study begins with an overview of how to use Google Patent and identifies advanced search techniques not well-documented by Google Patent. It makes several sug...

  2. Valuing patents on cost-reducing technology: A case study

    NARCIS (Netherlands)

    van Triest, S.P.; van de Vis, Wim

    2007-01-01

    We present an approach for valuing patents on production process improvements. Specifically, we focus on valuing a patent on cost-reducing process improvements from the viewpoint of the patent holding firm. We do this by considering the relevant cash flows that result from owning the patent. The

  3. The European Patent System: Dealing with emerging technologies.

    NARCIS (Netherlands)

    Kica, Evisa; Groenendijk, Nico

    2011-01-01

    In light of recent controversial patent decisions in biotechnology, this article argues that the current European patent examination and opposition procedures do not suffice to balance the patent system These procedures do not provide sufficient guidance for patent examiners to deal effectively with

  4. Measuring patent quality and national technological capacity in cross-country comparison

    OpenAIRE

    Boeing, Philipp; Müller, Elisabeth

    2016-01-01

    China recently surpassed the USA as the greatest global source of patent applications. However, without internationally comparable measures of patent quality it remains questionable whether China's patent expansion constitutes the rise of a new technological superpower. Our novel quality index is based on citations from international search reports and provides internationally comparable, quality-adjusted figures for applications made under the Patent Cooperation Treaty (PCT). We show that Ch...

  5. 14 CFR 1274.906 - Designation of New Technology Representative and Patent Representative.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 5 2010-01-01 2010-01-01 false Designation of New Technology... Conditions § 1274.906 Designation of New Technology Representative and Patent Representative. Designation of New Technology Representative and Patent Representative July 2002 (a) For purposes of administration...

  6. Decoding Patent Information Using Patent Maps

    OpenAIRE

    Liu, Chen-Yuan; Yang, James Chingyu

    2008-01-01

    Patent information is a derivative product from the legal patent system. This information, which includes patent applications, patent descriptions, patent gazettes, patent abstracts, and patent data, is prepared in exact compliance with the regulations and specifications of the patent acts. Patent information, different from other published circulating information, is legally well protected. For convenience, this study classifies patent information into bibliographic and numeric data to creat...

  7. Monitoring innovation in electrochemical energy storage technologies: A patent-based approach

    International Nuclear Information System (INIS)

    Mueller, Simon C.; Sandner, Philipp G.; Welpe, Isabell M.

    2015-01-01

    Highlights: • Grid effects of intermittent sources show increasing need for decentralized storage. • Novel patent classification is applied to monitor competing technologies. • Up-to-date geographical, organizational, and qualitative insight is given. • Redox flow patenting shows strong growth, lithium also strong absolute numbers. • Revealed patents allow the expectation of improved modules in the future. - Abstract: Due to the suitability to balance the intermittency in decentralized systems with renewable sources, electrochemical energy storage possibilities have been analyzed in several studies, all highlighting the need for improvements in relevant techno-economic parameters. Particularly a reduction in the costs per cycle is much needed, which could either come from innovation in more cost-efficient manufacturing methods, a higher endurance of charge/discharge sequences or higher capacities. Looking at patent applications as a metric allows us to determine whether the necessary technological progress is indeed occurring, as the mandatory publication of the underlying inventions provides access to otherwise hidden R and D activities. Our paper contributes to the literature with a compilation of technological classes related to important battery types in the novel Cooperative Patent Classification (CPC), which can be used to identify relevant patent applications of the competing technologies. Using the worldwide patent statistical database (PATSTAT), we find that promising technologies have been showing increasing patent counts in recent years. For example, the number of patent applications related to regenerative fuel cells (e.g. redox flow batteries) doubled from 2009 to 2011. Nevertheless, the volume of patent filings in technologies related to lithium remains unchallenged. Patent applications in this area are still growing, which indicates that the introduction of improved modules will continue. Using citation analysis, we have identified

  8. A Survival Analysis on Fuel Cell Technology Patent Maintenance and Values Exploration between 1976 and 2001

    Directory of Open Access Journals (Sweden)

    Seng-Su Tsang

    2015-01-01

    Full Text Available Fuel cell R&D activities desirably arrive in patents; the costly maintenance fee challenges managers as well as researchers to whether or not renew existing patents. The key is, will the fuel cell patent’s value be worth renewing? Thus assessment of patent value is essential. Our study focus online searching was made available after 1976, as the initial year to conduct the patent search. Up to 2001, there are 2269 patents classified in the H01M 008/00~H01M 008/24 category, which is the category concerning fuel cell under the classification of the International Patent Classification. Effective exploitation of technology values is subject to the complementarities of organizational resources. The present study used the emerging technology of Fuel Cells as an example to show that firms may commercialize the values of technology according to their organizational resources. By aligning firms’ patenting strategies and the imparities between book values and market values this study concludes a technological ambidexterity with respect to firms’ technology development. The exploitative firms tend to file patents to defend their leadership in the product market as a result their technology is constrained within a firm’s boundaries. The results show that patent renewing decisions are consequence of firm’s constraints of complementary resources.

  9. An Interval Estimation Method of Patent Keyword Data for Sustainable Technology Forecasting

    Directory of Open Access Journals (Sweden)

    Daiho Uhm

    2017-11-01

    Full Text Available Technology forecasting (TF is forecasting the future state of a technology. It is exciting to know the future of technologies, because technology changes the way we live and enhances the quality of our lives. In particular, TF is an important area in the management of technology (MOT for R&D strategy and new product development. Consequently, there are many studies on TF. Patent analysis is one method of TF because patents contain substantial information regarding developed technology. The conventional methods of patent analysis are based on quantitative approaches such as statistics and machine learning. The most traditional TF methods based on patent analysis have a common problem. It is the sparsity of patent keyword data structured from collected patent documents. After preprocessing with text mining techniques, most frequencies of technological keywords in patent data have values of zero. This problem creates a disadvantage for the performance of TF, and we have trouble analyzing patent keyword data. To solve this problem, we propose an interval estimation method (IEM. Using an adjusted Wald confidence interval called the Agresti–Coull confidence interval, we construct our IEM for efficient TF. In addition, we apply the proposed method to forecast the technology of an innovative company. To show how our work can be applied in the real domain, we conduct a case study using Apple technology.

  10. The Technology Trend of Japanese Patent for the Nuclear Fuel Assembly Inspection

    International Nuclear Information System (INIS)

    Cho, Jai Wan; Choi, Young Soo; Lee, Nam Ho; Jeong, Kyung Min; Suh, Yong Chil; Kim, Chang Hoi; Shin, Jung Cheol

    2008-06-01

    Japanese technology patents for the nuclear fuel assembly inspection unit, from the year 1993 to the year 2006, were investigated. The fuel rods which contain fissile material are grouped together in a closely-spaced array within the fuel assembly. Various kinds of reactor including the PWR reactor are being operated in Japan. There are many kinds of nuclear fuel assemblies in Japan, and the shape and the size of these nuclear fuel assemblies are various also. As the structure of these various fuel assemblies is a regular square as the same as the Korean one, the inspection method described in Japanese technology patent can be applied to the inspection of the nuclear fuel assembly of the Korea. This report focuses on advances in VIT(visual inspection test) of nuclear fuel assembly using the state-of-the-art CCD camera system

  11. The Technology Trend of Japanese Patent for the Nuclear Fuel Assembly Inspection

    Energy Technology Data Exchange (ETDEWEB)

    Cho, Jai Wan; Choi, Young Soo; Lee, Nam Ho; Jeong, Kyung Min; Suh, Yong Chil; Kim, Chang Hoi; Shin, Jung Cheol

    2008-06-15

    Japanese technology patents for the nuclear fuel assembly inspection unit, from the year 1993 to the year 2006, were investigated. The fuel rods which contain fissile material are grouped together in a closely-spaced array within the fuel assembly. Various kinds of reactor including the PWR reactor are being operated in Japan. There are many kinds of nuclear fuel assemblies in Japan, and the shape and the size of these nuclear fuel assemblies are various also. As the structure of these various fuel assemblies is a regular square as the same as the Korean one, the inspection method described in Japanese technology patent can be applied to the inspection of the nuclear fuel assembly of the Korea. This report focuses on advances in VIT(visual inspection test) of nuclear fuel assembly using the state-of-the-art CCD camera system.

  12. 48 CFR 1852.227-72 - Designation of new technology representative and patent representative.

    Science.gov (United States)

    2010-10-01

    ... CONTRACT CLAUSES Texts of Provisions and Clauses 1852.227-72 Designation of new technology representative... of New Technology Representative and Patent Representative (JUL 1997) (a) For purposes of administration of the clause of this contract entitled “New Technology” or “Patent Rights—Retention by the...

  13. 77 FR 7095 - Transitional Program for Covered Business Method Patents-Definition of Technological Invention

    Science.gov (United States)

    2012-02-10

    ... 0651-AC75 Transitional Program for Covered Business Method Patents-- Definition of Technological... definition of technological invention that the Board will use in conducting transitional covered business... definition for covered business method patent in proposed Sec. 42.301(a). Additionally, the Office in a...

  14. 48 CFR 18.119 - Use of patented technology under the North American Free Trade Agreement.

    Science.gov (United States)

    2010-10-01

    ... under the North American Free Trade Agreement. 18.119 Section 18.119 Federal Acquisition Regulations... Available Acquisition Flexibilities 18.119 Use of patented technology under the North American Free Trade Agreement. Requirement to obtain authorization prior to use of patented technology may be waived in...

  15. Conditions of the potential for commercialization of the patent: the implementation of a technology public offering system technology at CNEN; Condicionantes do potencial de exploracao comercial da patente: a implantacao de um sistema de oferta publica de tecnologia na CNEN

    Energy Technology Data Exchange (ETDEWEB)

    Archila, Daniela Lima Cerqueira

    2015-07-01

    This dissertation identifies the main factors which represent the conditions for the potential commercialization of patents aiming at the implementation of a system for technology public offering at CNEN as a strategy for creating licensing opportunities to the industrial sector. The method applied refers to an exploratory case study of a patented technology selected from a sample of CNEN's patent portfolio in the biopharmaceutical sector. The case study comprehends a field research of interviews conducted with two specialists in technology and innovation management, one researcher from CNEN and a biopharmaceutical company. The results show that among the nineteen main factors - related to technology, market, business and Science and Technology Organization (STO) - the market dynamics, the potential applications of the technology and an abstract of its main benefits compared to existing technologies are the major relevant information for each technology to be included in the public offering system. Other results indicate that the evaluation of such factors may be conducted by competent professionals to bring less uncertainty and risk to the early-stage of the innovation process, as well as enhance the potential interest of a company in the technology. On the other hand, the latter requires innovation capabilities to move the technology forward – additional R&D, scale-up, manufacturing and marketing - whilst the STO needs a entrepreneurial culture that mitigates its obstacles, creates more positive solutions for its routines and processes and gives sustainability to its Technology Transfer Office (TTO) through valuing its personnel in the long term. Finally, emphasis on technological partnerships with companies can be a motivating feature for directing the STO's patent strategy to the creation of proprietary technological platforms that reflect problems experienced by the commercial environment, as well as the development of this strategic patent

  16. EPA-developed, patented technologies related to water monitoring and remediation that are available for licensing

    Data.gov (United States)

    U.S. Environmental Protection Agency — Under the Federal Technology Transfer Act (FTTA), Federal Agencies can patent inventions developed during the course of research. These technologies can then be...

  17. EPA-developed, patented technologies related to vehicles and fuel emissions

    Data.gov (United States)

    U.S. Environmental Protection Agency — Under the Federal Technology Transfer Act (FTTA), Federal Agencies can patent inventions developed during the course of research. These technologies can then be...

  18. EPA-developed, patented technologies related to pollution prevention that are available for licensing.

    Data.gov (United States)

    U.S. Environmental Protection Agency — Under the Federal Technology Transfer Act (FTTA), Federal Agencies can patent inventions developed during the course of research. These technologies can then be...

  19. EPA-developed, patented technologies related to air quality that are available for licensing

    Data.gov (United States)

    U.S. Environmental Protection Agency — Under the Federal Technology Transfer Act (FTTA), Federal Agencies can patent inventions developed during the course of research. These technologies can then be...

  20. EPA-developed, patented technologies related to waste that are available for licensing

    Data.gov (United States)

    U.S. Environmental Protection Agency — Under the Federal Technology Transfer Act (FTTA), Federal Agencies can patent inventions developed during the course of research. These technologies can then be...

  1. A patent survey case: how could technological forecasting help cosmetic chemists with product innovation?

    Science.gov (United States)

    Domicio Da Silva Souza, Ivan; Juliana Pinheiro, Bárbara; Passarini Takahashi, Vania

    2012-01-01

    Patents represent a free and open source of data for studying innovation and forecasting technological trends. Thus, we suggest that new discussions about the role of patent information are needed. To illustrate the relevance of this issue, we performed a survey of patents involving skin care products, which were granted by the United States Patent and Trademark Office (USPTO) between 2006 and 2010, to identify opportunities for innovation and technological trends. We quantified the use of technologies in 333 patents. We plotted a life cycle of technologies related to natural ingredients. We also determined the cross impact of the technologies identified. We observed technologies related to processes applied to cosmetics (2.2%), functional packaging and applicators (2.9%), excipients and active compounds (21.5%), and cosmetic preparations (73.5%). Further, 21.6% of the patents were related to the use of natural ingredients. Several opportunities for innovation were discussed throughout this paper, for example, the use of peptides as active compounds or intracellular carriers (only 3.9% of the technologies in cosmetic preparations). We also observed technological cross impacts that suggested a trend toward multifunctional cosmetics, among others. Patent surveys may help researchers with product innovation because they allow us to identify available and unexplored technologies and turn them into whole new concepts.

  2. Research method of nuclear patent information

    International Nuclear Information System (INIS)

    Mo Dan; Gao An'na; Sun Chenglin; Wang Lei; You Xinfeng

    2010-01-01

    When faced with a huge amount of nuclear patent information, the key to effective research include: (1) Choose convenient way to search, quick access to nuclear technology related patents; (2) To overcome the language barrier, analysis the technical content of patent information; (3) Organize the publication date of retrieved patent documents, analysis the status and trends of nuclear technology development; (4) Research the patented technology of main applicants; (5) Always pay attention to the legal status of patent information, free use the invalid patents, at the same time avoid the patent infringement. Summary, patent information is important to obtain the latest technical information source, and the research work of patent information is a comprehensive understanding and mastery way for advanced nuclear technology. (authors)

  3. Innovation in the U.S. building sector: An assessment of patent citations in building energy control technology

    International Nuclear Information System (INIS)

    Altwies, Joy E.; Nemet, Gregory F.

    2013-01-01

    Buildings are crucial to addressing energy problems because they are large consumers of end-use energy, and potential exists to dramatically improve their efficiencies. However, the pace of innovation in buildings is generally characterized as inadequate, despite the implementation of an array of policy instruments aimed at promoting efficiency. The literature on innovation in the building industry provides several explanations including: fragmented decision-making, principal agent problems, inadequate information, and limited learning across heterogeneous projects. We investigate the innovation process for buildings in the U.S. with a case study of patenting in energy management control systems (EMCS) for commercial buildings and programmable thermostats (PT) for residential buildings. Using U.S. patent data, we find that: (1) patenting activity peaked around 1980, subsequently declined, and then increased considerably in the past decade; (2) commercial, rather than residential, buildings account for the recent increase; and (3) building control technologies have benefitted from inventions originating outside the industry, notably from electronics and computers, with a shift toward the latter in recent years. - Highlights: ► We investigate the innovation process for buildings in the U.S. using patents. ► We use commercial and residential building controls technology as a case study. ► Patenting peaked around 1980, declined, and then increased in the past decade. ► Commercial building control patents account for most of the recent increase. ► Inventions in electronics and computers have led to innovation in building controls.

  4. Patent applications for using DNA technologies to authenticate medicinal herbal material

    Directory of Open Access Journals (Sweden)

    Chan Albert

    2009-11-01

    Full Text Available Abstract Herbal medicines are used in many countries for maintaining health and treating diseases. Their efficacy depends on the use of the correct materials, and life-threatening poisoning may occur if toxic adulterants or substitutes are administered instead. Identification of a medicinal material at the DNA level provides an objective and powerful tool for quality control. Extraction of high-quality DNA is the first crucial step in DNA authentication, followed by a battery of DNA techniques including whole genome fingerprinting, DNA sequencing and DNA microarray to establish the identity of the material. New or improved technologies have been developed and valuable data have been collected and compiled for DNA authentication. Some of these technologies and data are patentable. This article provides an overview of some recent patents that cover the extraction of DNA from medicinal materials, the amplification of DNA using improved reaction conditions, the generation of DNA sequences and fingerprints, and the development of high-throughput authentication methods. It also briefly explains why these patents have been granted.

  5. Technological Foresight Based on Citing and Cited Patents of Cellulose with Pharmaceutical Aplications.

    Directory of Open Access Journals (Sweden)

    Deysimar de Souza Carvalho

    2009-12-01

    Full Text Available The present study intends to present the relevance of cellulose by means of the technological foresight study through citing and cited documents from a patent application (WO 9745131 A1 as indicators of innovation. The European database of patents (espacenet was used, combining keywords and IPC. The major applicants, countries of publication and uses were mapped. The patent requests collected are mainly distributed in the area of polymers to medical devices and therapeutic methods that utilize cellulose. The results obtained revealed that the US were the main country with studies directed to this technological area (18 patent applications and the major applicant was the company Micro Therapeutics Inc. Therefore, we can understand that this is a promising technology that may reflect in an increase of R&D activities and in the patent deposits in this area.

  6. Making Patent Scopes Exceed the Technological Scopes of Scientific Inventions

    DEFF Research Database (Denmark)

    Beukel, Karin

    This paper presents the results of a grounded theory study of the transformation of scientific discoveries into patented inventions. Using an algebraic interpretive approach, the narratives collected during interviews are analyzed as Bayesian inferences and the developed theory is tested. The fin...... for searching in new directions for solutions if challenges of exploitation with regard to the scientific invention arise.......This paper presents the results of a grounded theory study of the transformation of scientific discoveries into patented inventions. Using an algebraic interpretive approach, the narratives collected during interviews are analyzed as Bayesian inferences and the developed theory is tested....... The findings recast the relationship between science and patents as a process in which the way the transformation of the scientific invention is handled has an effect on the breadth of the patent scope. Unleashing patent scope surplus is dependent on processes related to abstraction and cognitive variety...

  7. Delineating the scientific footprint in technology: Identifying scientific publications within non-patent references.

    NARCIS (Netherlands)

    Callaert, J.; Grouwels, J.; van Looy, Bart

    2012-01-01

    Indicators based on non-patent references (NPRs) are increasingly being used for measuring and assessing science–technology interactions. But NPRs in patent documents contain noise, as not all of them can be considered ‘scientific’. In this article, we introduce the results of a machine-learning

  8. A Short Course on Patent Reference for Science and Technology Librarians

    Science.gov (United States)

    Shackle, Linda

    2009-01-01

    Now that the full text of patents as well as patent searching tools are available for free on the Internet, every librarian who is responsible for assisting people with science and technology information should have a basic knowledge of this aspect of intellectual property. Whether a school librarian helping children discover the world of…

  9. Patterns of technological innovation and evolution in the energy sector: A patent-based approach

    International Nuclear Information System (INIS)

    Lee, Kyungpyo; Lee, Sungjoo

    2013-01-01

    Given the ever-increasing pace and complexity of technological innovation in the energy sector, monitoring technological changes has become of strategic importance. One of the most common techniques for technology monitoring is patent analysis, which enables the identification of technological trends over time. However, few previous studies have carried out patent analysis in the energy sector. This study aims to explore patterns of innovation and of evolution in energy technologies, particularly focusing on similarities and differences across technologies. For this purpose, we first defined the relevant energy technologies and extracted the associated patent data from the United States Patents and Trademark Office (USPTO) and then adopted six patent indices and developed six patent maps to analyze their innovation characteristics. We then clustered energy technologies with similar characteristics, so defining innovation categories, and analyzed the changes in these characteristics over time to define their evolution categories. As one of the few attempts to investigate the overall trends in the energy sector's innovation and evolution, this study is expected to help develop an in-depth understanding of the energy industry, which will be useful in establishing technology strategies and policy in this rapidly changing sector. - Highlights: • We examined the patterns of innovation and evolution of energy technologies. • Six types of innovation patterns such as “competitive” or “mature” were identified. • Six types of evolution patterns such as “towards closed innovation” were identified. • The patterns of evolution were related to the patterns of innovation

  10. Technology Resource, Distribution, and Development Characteristics of Global Influenza Virus Vaccine: A Patent Bibliometric Analysis

    OpenAIRE

    Chen, Ning; Liu, Yun; Cheng, Yijie; Liu, Long; Yan, Zhe; Tao, Lixin; Guo, Xiuhua; Luo, Yanxia; Yan, Aoshuang

    2015-01-01

    Influenza virus vaccine (IVV) is a promising research domain that is closely related to global health matters, which has been acknowledged not only by scientists and technology developers, but also by policy-makers. Meanwhile, patents encompass valuable technological information and reflect the latest technological inventions as well as the innovative capability of a nation. However, little research has examined this up-and-coming research field using patent bibliometric method. Thus, this pa...

  11. Current Energy Patents

    International Nuclear Information System (INIS)

    Kelly, R.C.

    1982-01-01

    Current Energy Patents (CEP) provides abstracting and indexing coverage of the international patent literature, including patent applications, that concerns any aspect of energy production, conservation, and utilization

  12. 14 CFR 1260.58 - Designation of new technology representative and patent representative.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 5 2010-01-01 2010-01-01 false Designation of new technology... of new technology representative and patent representative. Designation of New Technology... of this grant entitled “New Technology,” the following named representatives are hereby designated by...

  13. Research and Development Strategy in Biological Technologies: A Patent Data Analysis of Japanese Manufacturing Firms

    Directory of Open Access Journals (Sweden)

    Hidemichi Fujii

    2016-04-01

    Full Text Available Biological technology allows us to invent new medical approaches, create effective food production methods and reserves and develop new materials for industrial production. There is a diversity of biological technology types, and different technologies have different priorities for invention. This study examines the factors that are important for the invention of biology-related technologies in Japan using patent application data and a decomposition analysis framework. As the results show, patent applications related to biochemistry and biotechnology increased until 1995 because of the expanded scale of R&D activities and the high priority assigned to biological technology. However, the number of patent applications stagnated after 1995, because the importance of biochemistry, especially waste-gas treatment technologies, decreased. Additionally, patent applications for medicines and disease-related technologies increased rapidly from 1971 to 1995. The primary determinant of rapid growth is an increase in research priority, especially among firms in the chemical industry whose technologies are related to supplemental foods and foods with health-promoting benefits. Finally, patent applications involving foodstuff- and agriculture-related technologies increased from 1971 to 1995 due to increased R&D and the increased priority of biological technology.

  14. Holding a candle to innovation in concentrating solar power technologies: A study drawing on patent data

    International Nuclear Information System (INIS)

    Braun, Frauke G.; Hooper, Elizabeth; Wand, Robert; Zloczysti, Petra

    2011-01-01

    Improved understanding of the innovative pathways of renewable energy technologies is vital if we are to make the transition to a low carbon economy. This study presents new evidence on innovation and industry dynamics in concentrating solar power (CSP) technologies. Though CSP is undergoing a renaissance, existing innovation studies have explored innovative activity in solar technologies in general, ignoring the major differences between solar photovoltaic and CSP technologies. This study, based on patent data, examines the level and dynamics of innovative activity in CSP between 1978 and 2004. Our unique contribution, based on engineering expertise and detailed datawork, is a classification system mapping CSP technologies to the International Patent Classification (IPC) system. The innovation performance of CSP is found to be surprisingly weak compared to the patent boom in other green technologies. Performance was strong around 1980 before falling dramatically, and has only recently begun to show signs of recovery. Innovation and R and D are concentrated in high-tech countries; the US, Germany and Japan, which do not necessarily have high domestic CSP potential. Large CSP potential is, therefore, not a sufficient condition for innovation. Innovators must possess economic and scientific capabilities. - Research highlights: → We develop a new classification system which allows us to map innovation in CSP technologies to the International Patent Classification System. → Evidence of innovation patterns in concentrating solar power technologies is presented. → Innovation performance in CSP is surprisingly weak compared to patenting in other green technologies, despite its strong potential as a low carbon power generation technology.

  15. DEVELOPING TECHNOLOGICAL INNOVATIONS ON THE BASES OF THE WORLD PATENT INFORMATION

    Directory of Open Access Journals (Sweden)

    N. A. KAMENEVA

    2015-04-01

    Full Text Available To ensure the innovative growth and progressive economic performance in high-technology industries, or at least to keep them at a fixed level it is necessary for the industrial enterprises to conduct scientific research and inventive activities through developing technological innovations and also through supporting, completing, replenishing, updating one of the most important intangible components of the business – patent resources: protective documents on inventions, industrial designs, utility models, trademarks etc. Scientific-and-engineering information, contained in international patent funds, allows determining the world state of the art, registering and securing the company’s exclusive patent rights to the innovations. This work presents the method of obtaining patent information in Russia by means of using various Russian and international databases and abstract journals that can help to investigate the world state of art in a given technological field.

  16. Optimal Selection Method of Process Patents for Technology Transfer Using Fuzzy Linguistic Computing

    Directory of Open Access Journals (Sweden)

    Gangfeng Wang

    2014-01-01

    Full Text Available Under the open innovation paradigm, technology transfer of process patents is one of the most important mechanisms for manufacturing companies to implement process innovation and enhance the competitive edge. To achieve promising technology transfers, we need to evaluate the feasibility of process patents and optimally select the most appropriate patent according to the actual manufacturing situation. Hence, this paper proposes an optimal selection method of process patents using multiple criteria decision-making and 2-tuple fuzzy linguistic computing to avoid information loss during the processes of evaluation integration. An evaluation index system for technology transfer feasibility of process patents is designed initially. Then, fuzzy linguistic computing approach is applied to aggregate the evaluations of criteria weights for each criterion and corresponding subcriteria. Furthermore, performance ratings for subcriteria and fuzzy aggregated ratings of criteria are calculated. Thus, we obtain the overall technology transfer feasibility of patent alternatives. Finally, a case study of aeroengine turbine manufacturing is presented to demonstrate the applicability of the proposed method.

  17. 48 CFR 27.204-1 - Use of patented technology under the North American Free Trade Agreement.

    Science.gov (United States)

    2010-10-01

    ... under the North American Free Trade Agreement. 27.204-1 Section 27.204-1 Federal Acquisition Regulations... Patents and Copyrights 27.204-1 Use of patented technology under the North American Free Trade Agreement... the patent holder is from a country that is a party to the North American Free Trade Agreement (NAFTA...

  18. 48 CFR 970.2770-3 - Technology transfer and patent rights.

    Science.gov (United States)

    2010-10-01

    ... cooperative research and development agreements with public and private entities for purposes of conducting research and development and transferring technology to the private sector. In implementing the NCTTA, DOE....2770-3 Technology transfer and patent rights. The National Competitiveness Technology Transfer Act of...

  19. Innovation in clean coal technologies. Empirical evidence from firm-level patent data

    Energy Technology Data Exchange (ETDEWEB)

    Kruse, Juergen [Koeln Univ. (Germany). Dept. of Economics; Koeln Univ. (Germany). Energiewirtschaftliches Inst.; Wetzel, Heike [Kassel Univ. (Germany). Inst. of Economics

    2016-02-15

    This article empirically analyzes supply-side and demand-side factors expected to a.ect innovation in clean coal technologies. Patent data from 93 national and international patent offices is used to construct new firm-level panel data on 3,648 clean coal innovators over the time period 1978 to 2009. The results indicate that on the supply-side a firm¡¯s history in clean coal patenting and overall propensity to patent positively a.ects clean coal innovation. On the demand-side we find strong evidence that environmental regulation of emissions, that is CO{sub 2}, NO{sub X} and SO{sub 2}, induces innovation in both efficiency improving combustion and after pollution control technologies.

  20. [Data-mining characteristics of adverse drug reactions and pharmacovi-gilance of Chinese patent drugs including Aconitum herbs].

    Science.gov (United States)

    Zhang, Xiao-Meng; Li, Fan; Zhang, Bing; Chen, Xiao-Fen; Piao, Jing-Zhu

    2018-01-01

    The common Aconitum herbs in clinical application mainly include Aconiti Radix(Chuanwu), Aconiti Kusnezoffii Radix(Caowu) and Aconiti Lateralis Radix Praeparaia(Fuzi), all of which have toxicity. Therefore, the safety of using Chinese patent drugs including Aconitum herbs has become an hot topic in clinical controversy. Based on the data-mining methods, this study explored the characteristics and causes of adverse drug reactions/events (ADR/ADE) of the Chinese patent drugs including Aconitum, in order to provide pharmacovigilance and rational drug use suggestions for clinical application. The detailed ADR/ADE reports about the Chinese patent drugs including Aconitum herbs were retrieved in the domestic literature databases since 1984 to now. The information extraction and data-mining were conducted based on the platforms of Microsoft office Excel 2016, Clementine 12.0 and Cytoscape 3.3.0. Finally, 78 detailed ADR/ADE reports involving a total of 30 varieties were included. 92.31% ADR/ADE were surely or likely led by the Chinese patent drugs including Aconitum, mostly involving multiple system/organ damages with good prognosis, and even 1 case of death. The incidence of included ADRs/ADEs was associated with various factors such as the patient idiosyncratic, drug toxicity, as well as clinical medication. The patient age was most closely related to ADR/ADEs, and those aged from 60 to 69 were more easily suffered from the ADRs/ADEs of Chinese patent drugs including Aconitum. The probability of ADR/ADEs for the drugs including Chuanwu or Caowu was greater than that of Fuzi, and the using beyond the instructions dose was the most important potential safety hazard in the clinical medication process. For the regular and characteristics of ADR/ADEs led by Chinese patent drugs including Aconitum, special attention shall be paid to the elder patients or with the patients with allergies; strictly control the dosage and course of treatment, strengthen the safety medication

  1. Patenting Bioprinting Technologies in the US and Europe– The 5th element in the 3rd dimension"

    DEFF Research Database (Denmark)

    Minssen, Timo; Mimler, Marc

    2017-01-01

    of bioprinting- inventions are being patented or would be- protectable under European and US patent laws. Rather than focusing on the highly relevant questions that 3D printing poses for patent infringement doctrines and research exemptions , this paper concentrates on the question of patentable subject matter......, “Patenting Bioprinting Technologies in the US and Europe– The 5th element in the 3rd dimension", Working Paper, forthcoming in: RM Ballardini, M Norrgård & J Partanen (red), 3D printing, Intellectual Property and Innovation – Insights from Law and Technology. Wolters Klu. Available at https...

  2. Research Funding, Patent Search Training and Technology Transfer: a collaboration

    KAUST Repository

    Tyhurst, Janis

    2016-01-01

    The third session builds on the first two by focusing in on how to evaluate a patent’s quality, how to read the patent to find the critical point(s) of the claim(s) being made, and free tools that will assist in evaluating the “intellectual space” around the claim(s) that will help focus and direct current and future research. This session is presented by another member of the TTO.

  3. Comparative analysis between academic and patent publications based on Fenton Technologies among China, Brazil, and the rest of the world.

    Science.gov (United States)

    de Luna, Airton José; Santos, Douglas Alves

    2017-03-01

    Worldwide, year by year, Fenton's Technologies have been highlighted in both academic and patent scopes, in part due to their proven efficiency as environment-friendly technologies destined to the abatement of organic pollutants, and also by their growing interest to produce industrial applications. Thus, aiming to understand the effective dynamic between two worlds, academy vs patents, the present study performs a comparative analysis about publications on Fenton-based Technologies (FbT). Therefore, in this work, technological foresight techniques were adopted focusing on patent and non-patent databases, employing for this, the Web of Science (WoS) database as a prospecting tool. The main results for the last decade point out to a strong increment of the Fenton's Technologies, as much in R&D as in patent applications in the world. Chinese Universities and firms command the scenario. There is an expressive gap between the academic and patent issues.

  4. Clearing the fog of anticancer patents from 1993-2013: through an in-depth technology landscape & target analysis from pioneer research institutes and universities worldwide.

    Directory of Open Access Journals (Sweden)

    Ajay Dara

    Full Text Available BACKGROUND: In a search for an effective anticancer therapy the R&D units from leading universities and institutes reveal numerous technologies in the form of patent documents. The article addressed comparative anticancer patent landscape and technology assessment of Council of Scientific and Industrial Research (CSIR: India's largest R&D organisation with top twenty international public funded universities and institutes from eight different countries. METHODOLOGY/PRINCIPAL FINDINGS: The methodology include quantitative and qualitative assessment based on the bibliometric parameters and manual technology categorisation to understand the changing patent trends and recent novel technologies. The research finding analysed 25,254 patent documents from the year 1993 to 2013 and reported the insights of latest anticancer technologies and targets through categorisation studies at the level of drug discovery, development and treatment & diagnosis. The article has reported the technology correlation matrix of twelve secondary class technologies with 34 tertiary sub-class research area to identify the leading technologies and scope of future research through whitespaces analysis. In addition, the results have also addressed the target analysis, leading inventor, assignee, collaboration network, geographical distribution, patent trend analysis, citation maps and technology assessment with respect to international patent classification systems such as CPC, IPC and CPI codes. CONCLUSIONS/SIGNIFICANCE: The result suggested peptide technology as the dominating research area next to gene therapy, vaccine and medical preparation containing organic compounds. The Indian CSIR has ranked itself at seventh position among the top 20 universities. Globally, the anticancer research was focused in the area of genetics and immunology, whereas Indian CSIR reported more patents related to plant extract and organic preparation. The article provided a glimpse of two decade

  5. Clearing the fog of anticancer patents from 1993-2013: through an in-depth technology landscape & target analysis from pioneer research institutes and universities worldwide.

    Science.gov (United States)

    Dara, Ajay; Sangamwar, Abhay T

    2014-01-01

    In a search for an effective anticancer therapy the R&D units from leading universities and institutes reveal numerous technologies in the form of patent documents. The article addressed comparative anticancer patent landscape and technology assessment of Council of Scientific and Industrial Research (CSIR): India's largest R&D organisation with top twenty international public funded universities and institutes from eight different countries. The methodology include quantitative and qualitative assessment based on the bibliometric parameters and manual technology categorisation to understand the changing patent trends and recent novel technologies. The research finding analysed 25,254 patent documents from the year 1993 to 2013 and reported the insights of latest anticancer technologies and targets through categorisation studies at the level of drug discovery, development and treatment & diagnosis. The article has reported the technology correlation matrix of twelve secondary class technologies with 34 tertiary sub-class research area to identify the leading technologies and scope of future research through whitespaces analysis. In addition, the results have also addressed the target analysis, leading inventor, assignee, collaboration network, geographical distribution, patent trend analysis, citation maps and technology assessment with respect to international patent classification systems such as CPC, IPC and CPI codes. The result suggested peptide technology as the dominating research area next to gene therapy, vaccine and medical preparation containing organic compounds. The Indian CSIR has ranked itself at seventh position among the top 20 universities. Globally, the anticancer research was focused in the area of genetics and immunology, whereas Indian CSIR reported more patents related to plant extract and organic preparation. The article provided a glimpse of two decade anticancer scenario with respect to top public funded universities worldwide.

  6. Clearing the Fog of Anticancer Patents from 1993–2013: Through an In-Depth Technology Landscape & Target Analysis from Pioneer Research Institutes and Universities Worldwide

    Science.gov (United States)

    Dara, Ajay; Sangamwar, Abhay T.

    2014-01-01

    Background In a search for an effective anticancer therapy the R&D units from leading universities and institutes reveal numerous technologies in the form of patent documents. The article addressed comparative anticancer patent landscape and technology assessment of Council of Scientific and Industrial Research (CSIR): India’s largest R&D organisation with top twenty international public funded universities and institutes from eight different countries. Methodology/Principal Findings The methodology include quantitative and qualitative assessment based on the bibliometric parameters and manual technology categorisation to understand the changing patent trends and recent novel technologies. The research finding analysed 25,254 patent documents from the year 1993 to 2013 and reported the insights of latest anticancer technologies and targets through categorisation studies at the level of drug discovery, development and treatment & diagnosis. The article has reported the technology correlation matrix of twelve secondary class technologies with 34 tertiary sub-class research area to identify the leading technologies and scope of future research through whitespaces analysis. In addition, the results have also addressed the target analysis, leading inventor, assignee, collaboration network, geographical distribution, patent trend analysis, citation maps and technology assessment with respect to international patent classification systems such as CPC, IPC and CPI codes. Conclusions/Significance The result suggested peptide technology as the dominating research area next to gene therapy, vaccine and medical preparation containing organic compounds. The Indian CSIR has ranked itself at seventh position among the top 20 universities. Globally, the anticancer research was focused in the area of genetics and immunology, whereas Indian CSIR reported more patents related to plant extract and organic preparation. The article provided a glimpse of two decade anticancer scenario

  7. A Study on Diffusion Pattern of Technology Convergence: Patent Analysis for Korea

    Directory of Open Access Journals (Sweden)

    Jae Young Choi

    2015-08-01

    Full Text Available Technology convergence indicates that technologies of different application areas are converted into a new and common unity of technology. Its range spans from inter-field, whereby technologies are converged between heterogeneous fields in homogeneous sector, to a wider inter-sector, whereby technologies belong to heterogeneous technology sector are converged. This paper determined the definition of technology convergence from previous literature and classified patents into technology category depending on patent information. Furthermore, we empirically measure technology convergence degree based on co-classification analysis and estimate its diffusion trend at the entire technology domain level by using overall 1,476,967 of patents filed to the KIPO (Korean Intellectual Property Office from 1998 to 2010. As a result, potential size and growth rate of technology convergence are varied by both technology and type of technology convergence, i.e., inter-field and inter-sector technology convergence. Diffusion pattern of inter-sector technology convergence appears as the more various form than that of inter-field technology convergence. In a relationship between potential size and growth rate of technology convergence, growth rate of technology convergence is in inverse proportion to potential size of technology convergence in general. That is, the faster the growth rate of technology convergence, the smaller the potential size of technology convergence. In addition, this paper found that technology convergence of the instrument and chemistry sector is actively progressing in both inter-field and inter-sector convergence, while the technologies related to Information and Communication Technology (ICT in electrical engineering sector have relatively mature progress of technology convergence, especially in inter-sector technology convergence.

  8. Knowledge flows, patent citations and the impact of science on technology

    NARCIS (Netherlands)

    Nomaler, Z.O.; Verspagen, B.

    2008-01-01

    Technological innovation depends on knowledge developed by scientific research. The number of citations made in patents to the scientific literature has been suggested as an indicator of this process of transfer of knowledge from science to technology. We provide an intersectoral insight into this

  9. Knowledge flows, patent citations and the impact of science on technology

    NARCIS (Netherlands)

    Nomaler, Z.O.; Verspagen, B.

    2007-01-01

    Technological innovation depends on knowledge developed by scientific research. The num-ber of citations made in patents to the scientific literature has been suggested as an indicator of this process of transfer of knowledge from science to technology. We provide an intersec-toral insight into this

  10. Energy prices, technological knowledge and green energy innovation. A dynamic panel analysis of patent counts

    International Nuclear Information System (INIS)

    Kruse, Juergen; Wetzel, Heike; Koeln Univ.

    2014-01-01

    We examine the effect of energy prices and technological knowledge on innovation in green energy technologies. In doing so, we consider both demand-pull effects, which induce innovative activity by increasing the expected value of innovations, and technology-push effects, which drive innovative activity by extending the technological capability of an economy. Our analysis is conducted using patent data from the European Patent Office on a panel of 26 OECD countries over the period 1978-2009. Utilizing a dynamic count data model for panel data, we analyze 11 distinct green energy technologies. Our results indicate that the existing knowledge stock is a significant driver of green energy innovation for all technologies. Furthermore, the results suggest that energy prices have a positive impact on innovation for some but not all technologies and that the e.ect of energy prices and technological knowledge on green energy innovation becomes more pronounced after the Kyoto protocol agreement in 1997.

  11. Innovation in concentrating solar power technologies: A study drawing on patent data

    OpenAIRE

    Braun, Frauke G.; Hooper, Elizabeth; Wand, Robert; Zloczysti, Petra

    2010-01-01

    Better understanding the innovative process of renewable energy technologies is important for tackling climate change. Though concentrating solar power is receiving growing interest, innovation studies so far have explored innovative activity in solar technologies in general, ignoring the major differences between solar photovoltaic and solar thermal technologies. This study relies on patent data to examine international innovative activity in concentrating solar power technologies. Our uniqu...

  12. Spreadsheet Patents

    DEFF Research Database (Denmark)

    Borum, Holger Stadel; Kirkbro, Malthe Ettrup; Sestoft, Peter

    2018-01-01

    This technical report gives a list of US patents and patent applications related to spreadsheet implementation technology. It is intended as a companion to the monograph Spreadsheet Implementation Technology (Peter Sestoft, MIT Press 2014), and substantially extends and updates an appendix from...

  13. TECHNOLOGICAL INFORMATION REGARDING PREBIOTICS AND PROBIOTICS NUTRITION VERSUS THE PATENT REGISTERS: WHAT IS NEW?

    Science.gov (United States)

    Reis, José Maciel Caldas Dos; Pinheiro, Maurício Fortuna; Oti, André Takashi; Feitosa-Junior, Denilson José Silva; Pantoja, Mauro de Souza; Barros, Rui Sérgio Monteiro

    2016-01-01

    Food is a key factor both in prevention and in promoting human health. Among the functional food are highlighted probiotics and prebiotics. Patent databases are the main source of technological information about innovation worldwide, providing extensive library for research sector. Perform mapping in the main patent databases about pre and probiotics, seeking relevant information regarding the use of biotechnology, nanotechnology and genetic engineering in the production of these foods. Electronic consultation was conducted (online) in the main public databases of patents in Brazil (INPI), United States (USPTO) and the European Patent Bank (EPO). The research involved the period from January 2014 to July 2015, being used in the title fields and summary of patents, the following descriptors in INPI "prebiotic", "prebiotic" "probiotics", "probiotic" and the USPTO and EPO: "prebiotic", "prebiotics", "probiotic", "probiotics". This search haven't found any deposit at the brazilian patents website (INPI) in this period; US Patent &Trademark Office had registered 60 titles in patents and the European Patent Office (EPO) showed 10 documents on the issue. Information technology offered by genetic engineering, biotechnology and nanotechnology deposited in the form of titles and abstracts of patents in relation to early nutritional intervention as functional foods, has increasingly required to decrease the risks and control the progression of health problems. But, the existing summaries, although attractive and promising in this sense, are still incipient to recommend them safely as a therapeutic tool. Therefore, they should be seen more as diet elements and healthy lifestyles. A alimentação é fator primordial tanto na prevenção quanto na promoção para a saúde humana. Dentre os alimentos funcionais destacam-se os probióticos e prebióticos. Os bancos de dados de patentes representam a maior fonte de informação tecnológica acerca de inovação em nível mundial

  14. What Drives the International Transfer of Climate Change Mitigation Technologies? Empirical Evidence from Patent Data

    International Nuclear Information System (INIS)

    Dechezleprete, A.; Glachant, M.; Meniere, Y.

    2010-01-01

    Using patent data from 66 countries for the period 1990-2003, we characterize the factors which promote or hinder the international diffusion of climate-friendly technologies on a global scale. Regression results show that technology-specific capabilities of the recipient countries are determinant factors. In contrast, the general level of education is less important. We also show that restrictions to international trade - e.g., high tariff rates - and to a lesser extent lax intellectual property regimes negatively influence the international diffusion of patented knowledge. A counter-intuitive result is that barriers to foreign direct investments can promote transfers. We discuss different possible interpretations. (authors)

  15. Prospects and trends in the development of terahertz technologies: patent landscape

    Directory of Open Access Journals (Sweden)

    D. А. Usanov

    2017-01-01

    Full Text Available The article is dedicated to the analysis of areas where terahertz radiation is applicable with the hwlp of a patent papers review, as well as to obtaining knowledge about the invention activity changes in this area over the past 35 years.Orbit patent databases’ capabilities were used to complete this analysis. Data search was conducted by keywords “terahertz” or “THz.” The searches were neither limited by submission dates, by priorities, nor by the country. A comprehensive analysis will allow to determine a more than 7389 patent-analog families’ aplications submitted in the period between 1980 and 2017 years. Statistical processing of obtained documents has been completed with the assistance of program software, indicated in the database. It was revealed that terahertz technologies have significant prospects to be applied in various areas; a fact, that is confirmed by an identified range of fields, where electromagnetic radiation of terahertz spectrum is applicable and is constantly growing. The dynamics of patenting is characterized by annual stable positive growth in the number of applications for inventions in the researched area. The highest number of inventions was identified in the field of instrumentation technologies, optics, telecommunications, semiconductor technologies, and medicine. Additionally, there was analyzed the state of patenting over the course of last five years. Examples of inventions were given. There were identified leading countries and companies in the researched area.

  16. Technology Resource, Distribution, and Development Characteristics of Global Influenza Virus Vaccine: A Patent Bibliometric Analysis

    Science.gov (United States)

    Liu, Long; Yan, Zhe; Tao, Lixin; Guo, Xiuhua; Luo, Yanxia; Yan, Aoshuang

    2015-01-01

    Influenza virus vaccine (IVV) is a promising research domain that is closely related to global health matters, which has been acknowledged not only by scientists and technology developers, but also by policy-makers. Meanwhile, patents encompass valuable technological information and reflect the latest technological inventions as well as the innovative capability of a nation. However, little research has examined this up-and-coming research field using patent bibliometric method. Thus, this paper (a) designs the technology classification system and search strategy for the identification of IVV; and (b) presents a longitudinal analysis of the global IVV development based on the European Patent Office (EPO) patents. Bibliometric analysis is used to rank countries, institutions, inventors and technology subfields contributing to IVV technical progress. The results show that the global trends of IVV are a multi-developing feature of variety but an uneven technical resource distribution. Although the synthetic peptide vaccine is a comparatively young field, it already demonstrates the powerful vitality and the enormous development space. With the worldwide competition increasing, all nations especially China should be looking to increase devotion, enhance capability and regard effectiveness of technological innovation. PMID:26372160

  17. Technology Resource, Distribution, and Development Characteristics of Global Influenza Virus Vaccine: A Patent Bibliometric Analysis.

    Science.gov (United States)

    Chen, Ning; Liu, Yun; Cheng, Yijie; Liu, Long; Yan, Zhe; Tao, Lixin; Guo, Xiuhua; Luo, Yanxia; Yan, Aoshuang

    2015-01-01

    Influenza virus vaccine (IVV) is a promising research domain that is closely related to global health matters, which has been acknowledged not only by scientists and technology developers, but also by policy-makers. Meanwhile, patents encompass valuable technological information and reflect the latest technological inventions as well as the innovative capability of a nation. However, little research has examined this up-and-coming research field using patent bibliometric method. Thus, this paper (a) designs the technology classification system and search strategy for the identification of IVV; and (b) presents a longitudinal analysis of the global IVV development based on the European Patent Office (EPO) patents. Bibliometric analysis is used to rank countries, institutions, inventors and technology subfields contributing to IVV technical progress. The results show that the global trends of IVV are a multi-developing feature of variety but an uneven technical resource distribution. Although the synthetic peptide vaccine is a comparatively young field, it already demonstrates the powerful vitality and the enormous development space. With the worldwide competition increasing, all nations especially China should be looking to increase devotion, enhance capability and regard effectiveness of technological innovation.

  18. Technology Resource, Distribution, and Development Characteristics of Global Influenza Virus Vaccine: A Patent Bibliometric Analysis.

    Directory of Open Access Journals (Sweden)

    Ning Chen

    Full Text Available Influenza virus vaccine (IVV is a promising research domain that is closely related to global health matters, which has been acknowledged not only by scientists and technology developers, but also by policy-makers. Meanwhile, patents encompass valuable technological information and reflect the latest technological inventions as well as the innovative capability of a nation. However, little research has examined this up-and-coming research field using patent bibliometric method. Thus, this paper (a designs the technology classification system and search strategy for the identification of IVV; and (b presents a longitudinal analysis of the global IVV development based on the European Patent Office (EPO patents. Bibliometric analysis is used to rank countries, institutions, inventors and technology subfields contributing to IVV technical progress. The results show that the global trends of IVV are a multi-developing feature of variety but an uneven technical resource distribution. Although the synthetic peptide vaccine is a comparatively young field, it already demonstrates the powerful vitality and the enormous development space. With the worldwide competition increasing, all nations especially China should be looking to increase devotion, enhance capability and regard effectiveness of technological innovation.

  19. The Investigation of the European and Eurasian Markets for Technologies: Ukraine in Regional Patent Spaces

    Directory of Open Access Journals (Sweden)

    Grytsulenko Svitlana I.

    2017-05-01

    Full Text Available The exclusive right to intellectual property acts as a universally recognized tool of the modern competitive struggle for the markets for goods and technologies, which actualizes the issue of Ukraine’s participation in this process. For this purpose, based on the data from the European, Eurasian and world patent statistics, the article measures the level of inventive activity of Ukraine in the nearest regional markets for technologies. Among the relevant quantitative and qualitative indicators for the evaluation of the patenting in Ukraine and leading countries of Europe and Eurasia there analyzed: the total volume and dynamics of filing patent applications; the total volume and specific weight of patent portfolios; the high-tech patenting. Based on the results of the study, the corresponding conclusions are drawn. In particular, the huge gap between Ukraine and leaders of inventive activity predetermined the absence of any significant influence of the country on the development of innovative markets in Europe and Eurasia. The decrease in Ukraine’s striving to succeed in the above mentioned ones leads to the loss of both promising markets and entire sectors of the national economy.

  20. 75 FR 34988 - Notice of Intent To Grant Exclusive Patent License; Fiber Optic Sensor Systems Technology...

    Science.gov (United States)

    2010-06-21

    ...; Fiber Optic Sensor Systems Technology Corporation AGENCY: Department of the Navy, DoD. ACTION: Notice. SUMMARY: The Department of the Navy hereby gives notice of its intent to grant to Fiber Optic Sensor... inventions described in U.S. Patent No. 7,149,374: Fiber Optic Pressure Sensor, Navy Case No. 84,557.//U.S...

  1. 77 FR 73456 - Notice of Intent To Grant Exclusive Patent License; Fiber Optic Sensor Systems Technology...

    Science.gov (United States)

    2012-12-10

    ...; Fiber Optic Sensor Systems Technology Corporation AGENCY: Department of the Navy, DoD. ACTION: Notice. SUMMARY: The Department of the Navy hereby gives notice of its intent to grant to Fiber Optic Sensor... Modulated Fiber Optic Pressure Sensor, Navy Case No. 83,816.//U.S. Patent No. 7,149,374: Fiber Optic...

  2. 48 CFR 3027.208 - Use of patented technology under the North American Free Trade Agreements.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 7 2010-10-01 2010-10-01 false Use of patented technology under the North American Free Trade Agreements. 3027.208 Section 3027.208 Federal Acquisition... American Free Trade Agreements. (f) Contracting officers shall ensure compliance. ...

  3. A Hybrid Method of Analyzing Patents for Sustainable Technology Management in Humanoid Robot Industry

    Directory of Open Access Journals (Sweden)

    Jongchan Kim

    2016-05-01

    Full Text Available A humanoid, which refers to a robot that resembles a human body, imitates a human’s intelligence, behavior, sense, and interaction in order to provide various types of services to human beings. Humanoids have been studied and developed constantly in order to improve their performance. Humanoids were previously developed for simple repetitive or hard work that required significant human power. However, intelligent service robots have been developed actively these days to provide necessary information and enjoyment; these include robots manufactured for home, entertainment, and personal use. It has become generally known that artificial intelligence humanoid technology will significantly benefit civilization. On the other hand, Successful Research and Development (R & D on humanoids is possible only if they are developed in a proper direction in accordance with changes in markets and society. Therefore, it is necessary to analyze changes in technology markets and society for developing sustainable Management of Technology (MOT strategies. In this study, patent data related to humanoids are analyzed by various data mining techniques, including topic modeling, cross-impact analysis, association rule mining, and social network analysis, to suggest sustainable strategies and methodologies for MOT.

  4. EPA-developed, patented technologies related to miscellaneous areas of environmental experties and invention that are available for licensing

    Data.gov (United States)

    U.S. Environmental Protection Agency — Under the Federal Technology Transfer Act (FTTA), Federal Agencies can patent inventions developed during the course of research. These technologies can then be...

  5. EPA-developed, patented technologies related to contaminated sites and hazardous substances that are available for licensing

    Data.gov (United States)

    U.S. Environmental Protection Agency — Under the Federal Technology Transfer Act (FTTA), Federal Agencies can patent inventions developed during the course of research. These technologies can then be...

  6. New patent in sight for CERN-made technology

    CERN Multimedia

    Antonella Del Rosso

    2014-01-01

    A portable gamma and beta radiation survey meter capable of operating in a strong magnetic field is the most recent subject of a CERN patent application. Developed by members of the HSE Unit, the new instrument may find applications not only in research laboratories but also in hospitals where radioactivity is managed in the presence of magnetic fields.   The new instrument consists of two parts: an active probe and a counting unit. Inside the probe, a scintillating crystal sends its signal to a photo detection module, which in turn is connected to the electronics. The counting unit is a portable box to be fixed on the operator’s waist. Tested in a magnetic field up to 1 Tesla, this innovative radiation survey meter has an operating range of a fraction of µSv/h to 1 mSv/h for the ambient dose equivalent rate, and 45 keV – 1.3 MeV for photon energy, with a fast response. “The instrument is the result of a collaboration between CERN and the Milan Politecnico ...

  7. Understanding the development trends of low-carbon energy technologies: A patent analysis

    International Nuclear Information System (INIS)

    Albino, Vito; Ardito, Lorenzo; Dangelico, Rosa Maria; Messeni Petruzzelli, Antonio

    2014-01-01

    Highlights: • Governments’ strategies set important frameworks to develop and sustain low-carbon energy technologies. • Commercial activities play a key role in the low-carbon energy technologies’ development. • The number of patents that are based upon basic research is growing. - Abstract: Eco-innovations are being recognized as fundamental means to foster sustainable development, as well as to create new business opportunities. Nowadays, the eco-innovation concept is gaining ground within both academic and practitioner studies with the attempt to better understand the main dynamics underlying its nature and guide policymakers and companies in supporting its development. This paper contributes to the extant literature on eco-innovation by providing a comprehensive overview of the evolution of a specific type of eco-innovations that are playing a crucial role in the current socio-economic agenda, namely low-carbon energy technologies. Accordingly, we focus our attention on the related patenting activity of different countries and organizations over time, as well as on influencing policy initiatives and events. Hence, we collected 131,661 patents granted at the United States Patent and Trademark Office (U.S.PTO.) between 1971 and 2010, and belonging to the “Nuclear power generation”, “Alternative energy production”, and “Energy conservation” technological classes, as indicated by the International Patent Classification (IPC) Green Inventory. Our findings report the development trends of low-carbon energy technologies, as well as identify major related environmental programs, historical events, and private sector initiatives explaining those trends, hence revealing how these different circumstances have significantly influenced their development over time

  8. Longitudinal Patent Analysis for Nanoscale Science and Engineering: Country, Institution and Technology Field

    International Nuclear Information System (INIS)

    Huang Zan; Chen Hsinchun; Yip, Alan; Ng, Gavin; Guo Fei; Chen Zhikai; Roco, Mihail C.

    2003-01-01

    Nanoscale science and engineering (NSE) and related areas have seen rapid growth in recent years. The speed and scope of development in the field have made it essential for researchers to be informed on the progress across different laboratories, companies, industries and countries. In this project, we experimented with several analysis and visualization techniques on NSE-related United States patent documents to support various knowledge tasks. This paper presents results on the basic analysis of nanotechnology patents between 1976 and 2002, content map analysis and citation network analysis. The data have been obtained on individual countries, institutions and technology fields. The top 10 countries with the largest number of nanotechnology patents are the United States, Japan, France, the United Kingdom, Taiwan, Korea, the Netherlands, Switzerland, Italy and Australia. The fastest growth in the last 5 years has been in chemical and pharmaceutical fields, followed by semiconductor devices. The results demonstrate potential of information-based discovery and visualization technologies to capture knowledge regarding nanotechnology performance, transfer of knowledge and trends of development through analyzing the patent documents

  9. Longitudinal Patent Analysis for Nanoscale Science and Engineering: Country, Institution and Technology Field

    Science.gov (United States)

    Huang, Zan; Chen, Hsinchun; Yip, Alan; Ng, Gavin; Guo, Fei; Chen, Zhi-Kai; Roco, Mihail C.

    2003-08-01

    Nanoscale science and engineering (NSE) and related areas have seen rapid growth in recent years. The speed and scope of development in the field have made it essential for researchers to be informed on the progress across different laboratories, companies, industries and countries. In this project, we experimented with several analysis and visualization techniques on NSE-related United States patent documents to support various knowledge tasks. This paper presents results on the basic analysis of nanotechnology patents between 1976 and 2002, content map analysis and citation network analysis. The data have been obtained on individual countries, institutions and technology fields. The top 10 countries with the largest number of nanotechnology patents are the United States, Japan, France, the United Kingdom, Taiwan, Korea, the Netherlands, Switzerland, Italy and Australia. The fastest growth in the last 5 years has been in chemical and pharmaceutical fields, followed by semiconductor devices. The results demonstrate potential of information-based discovery and visualization technologies to capture knowledge regarding nanotechnology performance, transfer of knowledge and trends of development through analyzing the patent documents.

  10. 48 CFR 27.204-2 - Use of patented technology under the General Agreement on Tariffs and Trade (GATT).

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Use of patented technology... Regulations System FEDERAL ACQUISITION REGULATION GENERAL CONTRACTING REQUIREMENTS PATENTS, DATA, AND... and Trade (GATT). Article 31 of Annex 1C, Agreement on Trade-Related Aspects of Intellectual Property...

  11. The Role of Mobile Technology in Tourism: Patents, Articles, News, and Mobile Tour App Reviews

    Directory of Open Access Journals (Sweden)

    Dongwook Kim

    2017-11-01

    Full Text Available The purpose of this research is to identify the status and role of mobile technology in achieving sustainable and smart tourism, and to suggest future research and strategy directions for academia and managers in practice. This research utilized multiple sources, such as patents, academic articles, and news, and selected methodologies optimized for the purpose of each study. Study 1 used Netminer, a social network analysis program, to analyze the relationships between patent’s International Patent Classification (IPC codes. Study 2 used the T-LAB program for content analysis to analyze the texts of patents, journal articles, and news. Study 3 used the Leximancer program, which utilizes relative frequency to analyze mobile app consumer reviews. In study 1, we identified various forms of data related technologies and mobile technologies for smart city systems and maps. In study 2, we found the environment, sustainability, business, and market themes to be related to mobile technology. In study 3, we explored consumers’ attitudes and preferences for mobile travel app using their reviews. Advances in mobile technology are expected to create innovative experiences for consumers, foster a sustainable competitive advantage for tourism destinations and tourism-related suppliers, and create sustainable competencies for smart tourism.

  12. Technological Change in a Small European Country: A Patent- Based Analysis for Greece

    OpenAIRE

    Maria Markatou

    2012-01-01

    The description of the development of the Greek technological change is the main aim of this paper. The analysis is based on the examination and elaboration of patent records and relies on the study of their technological content and their economic direction. Results show that technological change focuses on producing new technologies for the ‘agricultural sector’, ‘food’, ‘pharmaceuticals’, ‘metal shaping-separation’, ‘rubber-plastic products’, ‘building-housing’, ‘instruments’ and ‘electric...

  13. Technology Analysis of Global Smart Light Emitting Diode (LED Development Using Patent Data

    Directory of Open Access Journals (Sweden)

    Sangsung Park

    2017-08-01

    Full Text Available Technological developments related to smart light emitting diode (LED systems have progressed rapidly in recent years. In this paper, patent documents related to smart LED technology are collected and analyzed to understand the technology development of smart LED systems. Most previous studies of the technology were dependent on the knowledge and experience of domain experts, using techniques such as Delphi surveys or technology road-mapping. These approaches may be subjective and lack robustness, because the results can vary according to the selected expert groups. We therefore propose a new technology analysis methodology based on statistical modeling to obtain objective and relatively stable results. The proposed method consists of visualization based on Bayesian networks and a linear count model to analyze patent documents related to smart LED technology. Combining these results, a global hierarchical technology structure is created that can enhance the sustainability in smart LED system technology. In order to show how this methodology could be applied to real-world problems, we carry out a case study on the technology analysis of smart LED systems.

  14. US photovoltaic patents: 1991--1993

    Energy Technology Data Exchange (ETDEWEB)

    Pohle, L

    1995-03-01

    This document contains US patents on terrestrial photovoltaic (PV) power applications, including systems, components, and materials as well as manufacturing and support functions. The patent entries in this document were issued from 1991 to 1993. The entries were located by searching USPA, the database of the US Patent Office. The final search retrieved all patents under the class ``Batteries, Thermoelectric and Photoelectric`` and the subclasses ``Photoelectric,`` ``Testing,`` and ``Applications.`` The search also located patents that contained the words ``photovoltaic(s)`` or ``solar cell(s)`` and their derivatives. After the initial list was compiled, most of the patents on the following subjects were excluded: space photovoltaic technology, use of the photovoltaic effect for detectors, and subjects only peripherally concerned with photovoltaic. Some patents on these three subjects were included when ft appeared that those inventions might be of use in terrestrial PV power technologies.

  15. Nanotechnology and patents in agriculture, food technology, nutrition and medicine - advantages and risks: worldwide patented nano- and absorber particles in food nutrition and agriculture.

    Science.gov (United States)

    Benckiser, Gero

    2012-12-01

    The keywords nanotechnology, super absorber, agriculture, nutrition, and food technology exhibited 28,149 positive matches under more than 68 million patents worldwide. A closer look at the first 500 nanotechnology, agriculture, nutrition and biotechnology related patents, published during 2011-2012, unveiled that 64% are parts of machines and control devices while about 36% comprise metal oxides, fertilizers, pesticides and drugs, which are compounds and often applied in combination with inorganic or organic super absorbing polymeric structures. The latter compounds are in the focus of this special issue.

  16. International Technology Diffusion of Joint and Cross-border Patents

    NARCIS (Netherlands)

    C-L. Chang (Chia-Lin); M.J. McAleer (Michael); J-T. Tang (Ju-Ting)

    2013-01-01

    textabstractWith the advent of globalization, economic and financial interactions among countries have become widespread. Given technological advancements, the factors of production can no longer be considered to be just labor and capital. In the pursuit of economic growth, every country has

  17. International Technology Diffusion of Joint and Cross-border Patents

    NARCIS (Netherlands)

    C-L. Chang (Chia-Lin); M.J. McAleer (Michael); J-T. Tang (Ju-Ting)

    2015-01-01

    markdownabstract__Abstract__ With the advent of globalization, economic and financial interactions among countries have become widespread. Given technological advancements, the factors of production can no longer be considered to be just labor and capital. In the pursuit of economic growth, every

  18. International Technology Diffusion of Joint and Cross-border Patents

    NARCIS (Netherlands)

    C-L. Chang (Chia-Lin); M.J. McAleer (Michael); J-T. Tang (Ju-Ting)

    2015-01-01

    markdownabstract__Abstract__ With the advent of globalization, economic and financial interactions among countries have become widespread. Given technological advancements, the factors of production can no longer be considered to be just labor and capital. In the pursuit of economic growth,

  19. Are Lipases Still Important Biocatalysts? A Study of Scientific Publications and Patents for Technological Forecasting.

    Science.gov (United States)

    Daiha, Karina de Godoy; Angeli, Renata; de Oliveira, Sabrina Dias; Almeida, Rodrigo Volcan

    2015-01-01

    The great potential of lipases is known since 1930 when the work of J. B. S. Haldane was published. After eighty-five years of studies and developments, are lipases still important biocatalysts? For answering this question the present work investigated the technological development of four important industrial sectors where lipases are applied: production of detergent formulations; organic synthesis, focusing on kinetic resolution, production of biodiesel, and production of food and feed products. The analysis was made based on research publications and patent applications, working as scientific and technological indicators, respectively. Their evolution, interaction, the major players of each sector and the main subject matters disclosed in patent documents were discussed. Applying the concept of technology life cycle, S-curves were built by plotting cumulative patent data over time to monitor the attractiveness of each technology for investment. The results lead to a conclusion that the use of lipases as biocatalysts is still a relevant topic for the industrial sector, but developments are still needed for lipase biocatalysis to reach its full potential, which are expected to be achieved within the third, and present, wave of biocatalysis.

  20. Technological Monitoring Applied to Survey-Based on Brazilian Patent Applications about PEMFC

    Directory of Open Access Journals (Sweden)

    Deysimar de Souza Carvalho

    2011-06-01

    Full Text Available The present study aims to show the importance of patents as an instrument of technological innovation and to assess the relevance of technology of PEMFC in Brazil by means of the technological monitoring methodology from 1996 to 2005. This study used different Industrial Property Databases (INPI-BR, ESPACENET and DWPI, in order to retrieve the BR applications in each database. Relevant keywords as “fuel cell” were used in combination with specific IPC (H01M8 in order to assess the main applicants, countries, IPCs and technological innovation over time. In Brazil, the country holding more requests in this area is the United States (US with 53,7% of the patent applications, while Brazil (BR accounts for 4,4% of the total requests. It was also observed that the North-American company, UTC Fuel Cells comes on top of the list and that there were no patent applications of Brazilian origin (BR in other countries.

  1. Technology and industrialization in Spanish economy from 1950 to 1960: the patents as technological activity indicators; Tecnologia e industrializacion en la economia espanola de 1950 a 1960: Nueva evidencia a partir de datos de patentes

    Energy Technology Data Exchange (ETDEWEB)

    Hidalgo Nuchera, A.; Molero Zayas, J.; Granda Gayo, I.

    2007-07-01

    The goal of this research is to study the innovative activity developed in the fifties by the Spanish industry focussing on the foreign technology incorporated in the activity of several industrial sectors. The structure of innovation in each sector has been characterized by using patents as technological activity indicators. The data of patents registered in Spain belonging to the 1950-1960 period have been obtained taking into account the research developed by the Department of Business Administration of the Universidad Politecnica de Madrid through a subsidy granted by the Spanish Patent Office. (Author)

  2. Patent Assessment Quality

    DEFF Research Database (Denmark)

    Burke, Paul F.; Reitzig, Markus

    2006-01-01

    The increasing number of patent applications worldwide and the extension of patenting to the areas of software and business methods have triggered a debate on "patent quality". While patent quality may have various dimensions, this paper argues that consistency in the decision making on the side...... of the patent office is one important dimension, particularly in new patenting areas (emerging technologies). In order to understand whether patent offices appear capable of providing consistent assessments of a patent's technological quality in such novel industries from the beginning, we study the concordance...... of the European Patent Office's (EPO's) granting and opoposition decisions for individual patents. We use the historical example of biotech patens filed between 1978 until 1986, the early stage of the industry. Our results indicate that the EPO shows systematically different assessments of technological quality...

  3. The Population Ecology of Technology: An Empirical Study of US Biotechnology Patents from 1976 to 2003

    Science.gov (United States)

    van den Oord, Ad; van Witteloostuijn, Arjen

    2017-01-01

    A detailed understanding of technological change as an evolutionary process is currently not well understood. To increase our understanding, we build upon theory from organizational ecology to develop a model of endogenous technological growth and determine to what extent the pattern of technological growth can be attributed to the structural or systemic characteristics of the technology itself. Through an empirical investigation of patent data in the biotechnology industry from 1976 to 2003, we find that a technology’s internal (i.e., density and diversity) ecological characteristics have a positive effect on its growth rate. The niche’s external characteristics of crowding and status have a negative effect on its growth rate. Hence, applying theory from organizational ecology increases our understanding of technological change as an evolutionary process. We discuss the implications of our findings for the study of technological growth and evolution, and suggest avenues for further research. PMID:28081570

  4. Measuring science–technology interactions using patent citations and author-inventor links: an exploration analysis from Chinese nanotechnology

    International Nuclear Information System (INIS)

    Wang Gangbo; Guan Jiancheng

    2011-01-01

    This article contributes to the growing study on the interactions between science and technology with China’s evidence in the field of nanotechnology, based on the database of United States Patent and Trademark Office. The analysis is focused during the period of 1991–2008, a rapid increasing period for the development of nanotechnology. Using the non-patent references cited by patents, we first investigate the science–technology connections in the context of Chinese nanotechnology, especially in institutional sectors and its application fields. Those patents, produced by academic researchers and directed towards basic scientific knowledge, generally cite more scientific references with a higher proportion of self-citations. It is interesting to find that patents contributed by collaborations between public organizations and corporations seldom contain scientific references. Following an interesting path on matching the data of publications and patents, we establish the author-inventor links in this emerging field. Author-inventors, who are co-active in publishing and patenting, are at the very top of the most prolific and highly cited researchers. Finally, we employ social network analysis to explore the characteristics of scientific and technological networks generated by co-authorship and co-invention data, to investigate the position and the role of patenting–publishing scientists in these research networks.

  5. Published patent applications and patents from the promoted R + D area

    International Nuclear Information System (INIS)

    Jaeckel, G.; Zierl, I.

    1977-09-01

    The Ministry for Research and Technology of the Federal Republic of Germany has sponsored technological R + D for industrial innovations since 1969. The following compilation includes the published patent applications and patents from all projects which were sponsored up to and including 1973. (orig.) [de

  6. Patents as instruments for exploring innovation dynamics: geographic and technological perspectives on “photovoltaic cells”

    NARCIS (Netherlands)

    Leydesdorff, L.; Alkemade, F.; Heimeriks, G.; Hoekstra, R.J.

    2015-01-01

    The recently developed Cooperative Patent Classifications of the U.S. Patent and Trade Office (USPTO) and the European Patent Office (EPO) provide new options for an informed delineation of samples in both USPTO data and the Worldwide Patent Statistical Database (PatStat) of EPO. Among the

  7. The "Food Polymer Science" approach to the practice of industrial R&D, leading to patent estates based on fundamental starch science and technology.

    Science.gov (United States)

    Slade, Louise; Levine, Harry

    2018-04-13

    This article reviews the application of the "Food Polymer Science" approach to the practice of industrial R&D, leading to patent estates based on fundamental starch science and technology. The areas of patents and patented technologies reviewed here include: (a) soft-from-the-freezer ice creams and freezer-storage-stable frozen bread dough products, based on "cryostabilization technology" of frozen foods, utilizing commercial starch hydrolysis products (SHPs); (b) glassy-matrix encapsulation technology for flavors and other volatiles, based on structure-function relationships for commercial SHPs; (c) production of stabilized whole-grain wheat flours for biscuit products, based on the application of "solvent retention capacity" technology to develop flours with reduced damaged starch; (d) production of improved-quality, low-moisture cookies and crackers, based on pentosanase enzyme technology; (e) production of "baked-not-fried," chip-like, starch-based snack products, based on the use of commercial modified-starch ingredients with selected functionality; (f) accelerated staling of a starch-based food product from baked bread crumb, based on the kinetics of starch retrogradation, treated as a crystallization process for a partially crystalline glassy polymer system; and (g) a process for producing an enzyme-resistant starch, for use as a reduced-calorie flour replacer in a wide range of grain-based food products, including cookies, extruded expanded snacks, and breakfast cereals.

  8. Scientific production and technological production: transforming a scientific paper into patent applications.

    Science.gov (United States)

    Dias, Cleber Gustavo; Almeida, Roberto Barbosa de

    2013-01-01

    Brazil has been presenting in the last years a scientific production well-recognized in the international scenario, in several areas of knowledge, according to the impact of their publications in important events and especially in indexed journals of wide circulation. On the other hand, the country does not seem to be in the same direction regarding to the technological production and wealth creation from the established scientific development, and particularly from the applied research. The present paper covers such issue and discloses the main similarities and differences between a scientific paper and a patent application, in order to contribute to a better understanding of both types of documents and help the researchers to chose and select the results with technological potential, decide what is appropriated for industrial protection, as well as foster new business opportunities for each technology which has been created.

  9. Study the content relationship between science and technology documents: A compression of papers and patent in Autonomous Underwater Vehicle Dominos

    Directory of Open Access Journals (Sweden)

    Soraia Zolfaghari

    2016-08-01

    Full Text Available The current research aims at studying the conceptual relationship between the science and technology documents through the comparison of vocabularies that are used within the patents and the papers in the field of Autonomous Underwater Vehicles (AUV.  The research method is descriptive. To perform the research, the patents were retrieved from Google Patents and Lens websites, and the papers from IEEE Explore database. A hybrid keyword-class method was used to conduct the search. It means that the search query was consisted of "Autonomous Underwater Vehicle" keyword and “H” class. The titles and the abstracts of the patents and the papers were automatically indexed through a semi-automatic method. This resulted in 195 keywords for patents and 114 ones for papers. Co-occurrence matrices of these two sets of keywords were created through RavarMatrix software. The hierarchical maps of keywords were drawn by SPSS. Findings show that 65 percent of papers’ keywords are those that occurred within the patents but 23 percent of patents’ keywords are similar to the papers’.  The structural comparison of patents and papers clustering’s also revealed that the structural proximity between patents and papers vocabularies is equal to zero. The other finding showed that the similarity between the members of ego networks of prominent keywords is for two cases zero and for others fewer than 15 percent except for the keyword “data”. It may be concluded that the science is affected by technology in the field of AUV.

  10. Lovely but dangerous: The impact of patent citations on patent duration

    OpenAIRE

    Maurseth, Per Botolf

    2001-01-01

    - What is the impact of patent citations on patent renewal behaviour? Patent citations are commonly used as an indicator of technology spillovers. For cited patents therefore, patent citations have a potentially ambiguous impact. On the one hand, patent citations may indicate a scientific breakthrough, a high value of the cited patent and therefore a long survival period. On the other hand, patent citations may indicate competing innovations that render the cited patent obsolete. By discri...

  11. Contact lens technology to 2020 and beyond: a review of recent patent literature.

    Science.gov (United States)

    Papas, Eric B

    2017-09-01

    Contact lenses have been a common means of vision correction for more than half a century. Recent developments raise the possibility that the next several years will see the range of applications in which they are used broaden considerably, with an associated expansion in both the number and type of individuals who consider them to be a valuable option. To describe this new landscape, a review of recent patent submissions covering the period 1 January 2014 to 1 February 2017 was undertaken. The results show that in the main, areas where contact lenses will be applied include drug delivery, visual augmentation and biosensing. © 2017 Optometry Australia.

  12. What drives innovation in nuclear reactors technologies? An empirical study based on patent counts

    International Nuclear Information System (INIS)

    Berthelemy, Michel

    2012-01-01

    This paper examines the evolution of innovation in nuclear power reactors between 1974 and 2008 in twelve OECD countries and assesses to what extent nuclear innovation has been driven by economic incentives, political decisions and safety regulation considerations. We use priority patent applications related to Nuclear Power Plants (NPPs) as a proxy for innovating activity. Our results highlight that nuclear innovation is partly driven by the conventional paradigm where both demand-pull, measured by NPPs constructions in the innovating country and in the rest of the world, and technology-push, measured by Research and Development (R and D) expenditures specific to NPPs, have a positive and significant impact on innovation. Our results also evidence that the impact of public R and D expenditures and national NPPs construction on innovation is stronger when the quality of innovation, measured by forward patent citations, is taken into account, and have a long run positive impact on innovation through the stock of knowledge available to innovators. In contrast, we show that political decisions following the Three Miles Island and Chernobyl nuclear accidents, measured by NPPs cancellations, have a negative impact on nuclear innovation. Finally, we find that the nuclear safety authority has an ambivalent effect on innovation. On one hand, regulatory inspections have a positive impact on innovation, one the other hand, regulatory decisions to temporarily close a NPP have an adverse impact on innovation. (author)

  13. What drives innovation in renewable energy technology? Evidence based on patent counts

    Science.gov (United States)

    McCormick, Jesse

    America's future economic growth and international competitiveness depend on our capacity to innovate, particularly in emerging global markets. This paper analyzes the forces that drive innovation in one such market, renewable energy technologies, utilizing the theory of induced technological innovation. Specifically, this paper operationalizes the determinants of innovation to consist of: 1) private market forces, 2) public policy that influences price and market size, and 3) public policy that catalyzes R&D investment. Analysis is conducted using a negative binomial regression to determine which of the three foundational determinants has the greatest impact on renewable energy innovation. In so doing this paper builds off of work conducted by Johnstone et al. (2010). Innovation is measured using European Patent Office data on a panel of 24 countries spanning the period from 1978-2005. The implications of this study are straightforward; policies, not market forces, are responsible for driving innovation in renewable energy technologies. Market-oriented policies are effective for mature technologies, particularly hydro, and to a lesser extent wind and solar power. R&D-oriented policy is effective for a broader technology set. In short, the United States needs a comprehensive policy environment to support renewable energy innovation; market forces alone will not provide the pace and breadth of innovations needed. That environment can and should be strategically targeted, however, to effectively allocate scare resources.

  14. US Photovoltaic Patents, 1988--1990

    Energy Technology Data Exchange (ETDEWEB)

    1991-12-01

    This document contains US patents on terrestrial photovoltaic (PV) power applications, including systems, components, and materials, as well as manufacturing and support functions. The patent entries in this document were issued from 1988 through 1990. The entries were located by searching USPA, the data base of the US Patent Office. The final search retrieved all patents under the class ``Batteries, Thermoelectric and Photoelectric`` and the subclasses ``Photoelectric,`` ``Testing,`` and ``Applications.`` The search also located patents that contained the words ``photovoltaic(s)`` or ``solar cell(s)`` and their derivatives. A manual search of the patents in the Solar Energy Research Institute (SERI) patent file augmented the data base search. After the initial list was compiled, most of the patents on the following subjects were excluded: space photovoltaic technology, use of the photovoltaic effect for detectors and subjects only peripherally concerned with photovoltaics. Some patents on these three subjects were included when it appeared that those inventions might be of use in terrestrial PV power technologies.

  15. US Photovoltaic Patents, 1988--1990

    Energy Technology Data Exchange (ETDEWEB)

    1991-12-01

    This document contains US patents on terrestrial photovoltaic (PV) power applications, including systems, components, and materials, as well as manufacturing and support functions. The patent entries in this document were issued from 1988 through 1990. The entries were located by searching USPA, the data base of the US Patent Office. The final search retrieved all patents under the class Batteries, Thermoelectric and Photoelectric'' and the subclasses Photoelectric,'' Testing,'' and Applications.'' The search also located patents that contained the words photovoltaic(s)'' or solar cell(s)'' and their derivatives. A manual search of the patents in the Solar Energy Research Institute (SERI) patent file augmented the data base search. After the initial list was compiled, most of the patents on the following subjects were excluded: space photovoltaic technology, use of the photovoltaic effect for detectors and subjects only peripherally concerned with photovoltaics. Some patents on these three subjects were included when it appeared that those inventions might be of use in terrestrial PV power technologies.

  16. Modern evaluation of patents

    Science.gov (United States)

    Ignat, V.

    2016-08-01

    The number of patents is not so important as the market value. The market value is especially important for licensing of patents, make-or-buy decisions for technology procurement, corporate finance. Patents can be used as collateral for financing. Patents and credit approvals: without patents only 46% and with patents 54%. The value share of knowledge-based components to industrial products already reached 50% and it is still rising. OECD called these developments under the slogan "knowledge economy”. German Norm-DIN 77100 provides a working method for monetary evaluation of a patent. The value of a patent arises from its use. A patent can be used to protect or to earn licensing revenues. An evaluation expertise is required in areas, such as marketing, finance, R & D and strategic planning. As an indicator of the value of a patent is often used the number of citations. The number of a patent citation refers to its meaning and value. Other indicators would be: size of the patent family, validity of the patent, result of objections against patent application, number and quality of claims. The analysis of 9.000 patents resulted that only 7.2% worth over 10 million euro and 68% below 1 million euro. The cost method: it is considered the cost that would be incurred for the development and patenting of a similar invention. The market method: are used the prices that have been achieved in comparable with recently transactions. The Income method: the potential reward is measured, which can arise from a patent. The evaluation will be in the following areas: legal status, technology, market conditions, finance and strategy. Each question relates to a different parameter of a value.

  17. ChemicalVia: a CERN-patented technology for use in high-density circuits

    CERN Multimedia

    Patrice Loïez

    2003-01-01

    High-density multilayer printed circuits such as those pictured here are found in miniaturized modern equipment from video cameras to mobile phones. Adjacent layers in these circuits are electrically connected by microvias, consisting of a small-diameter hole (usually 50 µm) with a thin metal-deposited surface covering their cylindrical walls to ensure local conductivity between the two layers. ChemicalVia is a new method, patented by CERN, to make microvias on high-density multilayer printed circuits using chemicals rather than complex laser, plasma or photoimaging technology. The process is compatible with all standard printed-circuit assembly lines, and has the advantages of low initial investment and reduced manufacturing costs. http://www.cern.ch/ttdatabase

  18. Patenting Nanomedicine in Europe:

    DEFF Research Database (Denmark)

    Nordberg, Ana

    Patenting Nanomedicine in Europe: Applying the ‘medical methods exception’ to emerging technologies is based on the authors PhD dissertation, defended in March 2014, at the University of Copenhagen. The book debates restrictions on the patentability of medical methods in European Patent Law....... The main question addressed is whether it is viable and advisable the reinterpretation, reformulation or replacement of Article 53 (c) EPC – a provision restricting the patenting of medical methods. The subject is approached by reference to emerging technologies, and using nanomedicine innovation...... as example and point of departure. Nanotechnology inventions blur the lines between patentable subject matter and what may fall under the exception from patentability. It is a good example of how in recent years, emerging technologies have been challenging the patent system and exposing the need for re...

  19. Strategies on Technology Transfer and Patents Commercialization for Nanotechnology at the Spanish National Research Council.

    Science.gov (United States)

    Maira, Javier; Etxabe, Javier; Serena, Pedro A

    2018-02-14

    Nanoscience and nanotechnology made their appearance in the scientific scene at a time when both the economy of Spain and the Spanish Research and Innovation System were experiencing strong growth. This circumstance resulted in a remarkable development of nanoscience and nanotechnology especially in universities and public research institutions such as the Spanish National Research Council (Consejo Superior de Investigaciones Científicas-CSIC). However, this development in academia has not been reflected in a similar increment in the transfer of knowledge to the productive sector despite several efforts and initiatives were launched. The CSIC, the main generator of scientific knowledge in Spain, has designed and implemented a series of actions in order to take advantage of the knowledge generated in nanotechnology by its research groups by mean of an appropriate transfer to both the Spanish and the international industry. Internal methodologies used in CSIC in order to protect and commercialize nanotechnology based intellectual property as well as their effects are reviewed. The evolution of CSIC nanotechnology patents portfolio is also analyzed. There has been a clear increase in the patent license agreements of CSIC in the period 2002- 2015 in the field of nanotechnology. This increase is correlated to these facts: (i) Highly qualified team managing Intellectual Property issues, (ii) The presence of CSIC in international fairs, and (iii) Proactive search of companies and investors. Successful results can be achieved in technology transfer when the appropriate resources are available and properly organized with an adequate combination of efforts in knowledge protection, promotion and commercialization of technologies and support to the scientific entrepreneurs of the institution. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  20. Digital pathology: A systematic evaluation of the patent landscape

    Directory of Open Access Journals (Sweden)

    Ioan C. Cucoranu

    2014-01-01

    Full Text Available Introduction: Digital pathology is a relatively new field. Inventors of technology in this field typically file for patents to protect their intellectual property. An understanding of the patent landscape is crucial for companies wishing to secure patent protection and market dominance for their products. To our knowledge, there has been no prior systematic review of patents related to digital pathology. Therefore, the aim of this study was to systematically identify and evaluate United States patents and patent applications related to digital pathology. Materials and Methods: Issued patents and patent applications related to digital pathology published in the United States Patent and Trademark Office (USPTO database (www.uspto.gov (through January 2014 were searched using the Google Patents search engine (Google Inc., Mountain View, California, USA. Keywords and phrases related to digital pathology, whole-slide imaging (WSI, image analysis, and telepathology were used to query the USPTO database. Data were downloaded and analyzed using the Papers application (Mekentosj BV, Aalsmeer, Netherlands. Results: A total of 588 United States patents that pertain to digital pathology were identified. In addition, 228 patent applications were identified, including 155 that were pending, 65 abandoned, and eight rejected. Of the 588 patents granted, 348 (59.18% were specific to pathology, while 240 (40.82% included more general patents also usable outside of pathology. There were 70 (21.12% patents specific to pathology and 57 (23.75% more general patents that had expired. Over 120 unique entities (individual inventors, academic institutions, and private companies applied for pathology specific patents. Patents dealt largely with telepathology and image analysis. WSI related patents addressed image acquisition (scanning and focus, quality (z-stacks, management (storage, retrieval, and transmission of WSI files, and viewing (graphical user interface (GUI

  1. Digital pathology: A systematic evaluation of the patent landscape.

    Science.gov (United States)

    Cucoranu, Ioan C; Parwani, Anil V; Vepa, Suryanarayana; Weinstein, Ronald S; Pantanowitz, Liron

    2014-01-01

    Digital pathology is a relatively new field. Inventors of technology in this field typically file for patents to protect their intellectual property. An understanding of the patent landscape is crucial for companies wishing to secure patent protection and market dominance for their products. To our knowledge, there has been no prior systematic review of patents related to digital pathology. Therefore, the aim of this study was to systematically identify and evaluate United States patents and patent applications related to digital pathology. Issued patents and patent applications related to digital pathology published in the United States Patent and Trademark Office (USPTO) database (www.uspto.gov) (through January 2014) were searched using the Google Patents search engine (Google Inc., Mountain View, California, USA). Keywords and phrases related to digital pathology, whole-slide imaging (WSI), image analysis, and telepathology were used to query the USPTO database. Data were downloaded and analyzed using the Papers application (Mekentosj BV, Aalsmeer, Netherlands). A total of 588 United States patents that pertain to digital pathology were identified. In addition, 228 patent applications were identified, including 155 that were pending, 65 abandoned, and eight rejected. Of the 588 patents granted, 348 (59.18%) were specific to pathology, while 240 (40.82%) included more general patents also usable outside of pathology. There were 70 (21.12%) patents specific to pathology and 57 (23.75%) more general patents that had expired. Over 120 unique entities (individual inventors, academic institutions, and private companies) applied for pathology specific patents. Patents dealt largely with telepathology and image analysis. WSI related patents addressed image acquisition (scanning and focus), quality (z-stacks), management (storage, retrieval, and transmission of WSI files), and viewing (graphical user interface (GUI), workflow, slide navigation and remote control). An

  2. Argonne National Laboratory patent portfolio

    International Nuclear Information System (INIS)

    Huguelet, B.C.

    1976-01-01

    This booklet contains the abstracts of all active U. S. patents on technology items that originated at ANL, the applicability of which is not limited to nuclear reactors. Also listed are the titles of all ANL-originated nuclear-related U. S. patents that are still in force. Selected technology items for which patent applications have been filed and are available for licensing are included in several categories. Categories included in this booklet are as follows: atmospheric and earth sciences; biological and medical sciences; chemistry and chemical engineering; cryogenics and superconductivity; electronics and electrical engineering; energy conversion; measurements and controls; methods and devices; materials and fabrication; physics, accelerators and fusion; and selected nuclear-related technology

  3. How Important are Noncorporate Patents?

    DEFF Research Database (Denmark)

    Schneider, Cédric

    2011-01-01

    This article analyses the innovative performances of noncorporate inventors using patent citations data from the European Patent Office. The results show that inventions patented outside an established corporate framework are on average less ‘important’ than corporate patents, but with large...... variations across technology classes. Patents applied for by independent inventors, start-ups and corporate firms are of comparable ‘quality’ in emerging technologies. The results also highlight that in these fields noncorporate patents are more ‘radical’ than corporate patents....

  4. A study on technology development strategy and collaborative relationships using patent information

    Science.gov (United States)

    Nakaoka, Iori; Fujino, Hayato; Chen, Yunju; Park, Yousin; Matsuno, Seigo

    2017-10-01

    Japanese economy has fallen into a long downturn called "The Lost Two Decades" after the collapse of bubble economy in early 1990s. Many companies could not gain competitive advantages although they conducted various management reforms to restore their competitiveness. The companies that have played the main role of the Japanese economy growth until then have lost the sustained competitive advantage. Moreover, they have struggled in the global market even now. On the other hand, Japanese automobile companies have high competitiveness and market share due to their advanced technology development. It is considered that personnel groups engaged in research and development of their companies cannot turn into core rigidity and the structure also hinders new core capabilities. In addition, there is a hypothesis that the close relationships with many suppliers contribute to acquisition of competitive advantage. Therefore, this paper focuses on the collaboration relationships with suppliers and core rigidity of human resources related to research and development as the analysis factors. First, we analyze the composition and core rigidity degree of human resources involved in technology development by social network analysis using patent information, which represents the research and development capability. Second, we analyze the degree of collaboration among companies based on the hypothesis that advanced technology development can be executed by joint research and developments with many kinds of suppliers. As a result, features of close collaboration with suppliers and high core rigidity rate in the Japanese automobile industry are clarified.

  5. Interviewing Objects: Including Educational Technologies as Qualitative Research Participants

    Science.gov (United States)

    Adams, Catherine A.; Thompson, Terrie Lynn

    2011-01-01

    This article argues the importance of including significant technologies-in-use as key qualitative research participants when studying today's digitally enhanced learning environments. We gather a set of eight heuristics to assist qualitative researchers in "interviewing" technologies-in-use (or other relevant objects), drawing on concrete…

  6. Examining the patterns of innovation in low carbon energy science and technology: Publications and patents of Asian emerging economies

    International Nuclear Information System (INIS)

    Wong, Chan-Yuan; Fatimah Mohamad, Zeeda; Keng, Zi-Xiang; Ariff Azizan, Suzana

    2014-01-01

    This paper focuses on selected Asian emerging economies. The study employs publications and patents as proxies for science and technology, and its analysis is divided into three main parts: production trends, catching-up trends and patterns of convergence. The findings resulted in four salient points to be considered by policy makers: (1) ASEAN-4 lagged significantly behind the more advanced economies (Korea, Taiwan and China) even though their performance was identical in the early 1990s. China has forged ahead in terms of scientific publications and patents production, but lags behind in patents quality; (2) compared to the world average, the region as a whole has high potential to forge ahead in low carbon energy scientific production. (3) Advanced economies in Asia kicked off their low carbon energy science and technology development more from technological rather than scientific production, with no straightforward co-evolution between the two competencies. This demonstrates the need for a strong science-based technological foundation and a high level of dynamism for low carbon energy technology development; and (4) the economies demonstrated contrasting development trends in their focus between the supply and demand sides of energy technology development. The performance of the advanced economies is higher in ‘demand-side’ low carbon energy innovations

  7. Biotechnological Patents Applications of the Deuterium Oxide in Human Health.

    Science.gov (United States)

    da S Mariano, Reysla M; Bila, Wendell C; Trindade, Maria Jaciara F; Lamounier, Joel A; Galdino, Alexsandro S

    2017-01-01

    Deuterium oxide is a molecule that has been used for decades in several studies related to human health. Currently, studies on D2O have mobilized a "Race for Patenting" worldwide. Several patents have been registered from biomedical and technological studies of D2O showing the potential of this stable isotope in industry and health care ecosystems. Most of the patents related to the applications of the deuterium oxide in human health have been summarized in this review. The following patents databases were consulted: European Patent Office (Espacenet), the United States Patent and Trademark Office (USPTO), the United States Latin America Patents (LATIPAT), Patent scope -Search International and National Patent Collections (WIPO), Google Patents and Free Patents Online. With this review, the information was collected on recent publications including 22 patents related to deuterium oxide and its applications in different areas. This review showed that deuterium oxide is a promising component in different areas, including biotechnology, chemistry and medicine. In addition, the knowledge of this compound was covered, reinforcing its importance in the field of biotechnology and human health. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  8. An Evidence Framework for Off-Patent Pharmaceutical Review (EFOR) for Health Technology Assessment in Emerging Markets.

    Science.gov (United States)

    Brixner, Diana; Kaló, Zoltán; Maniadakis, Nikos; Kim, Kyoo; Wijaya, Kalman

    2018-03-29

    This article introduces an Evidence Framework for Off-Patent Pharmaceutical Review (EFOR), which establishes value-based criteria in a template that manufacturers use to provide evidence showing how their products meet those criteria. Health authorities in emerging markets can then use the evidence presented in the EFOR to evaluate off-patent pharmaceuticals (OPPs) in a consistent, transparent, and evidence-based manner to support policy decisions, including pricing, reimbursement, formulary listing, and drug procurement. A literature search found no multi-criteria evidence framework for evaluating OPPs in emerging markets. An International Outcomes Research Board (IORB) of academia and industry experts conducted extensive research, meetings, and workshops to define high-priority criteria to incorporate into an evidence-based health technology assessment (HTA) tool using the multi-criteria decision analysis (MCDA) technique. The resulting framework was further tailored for country-specific needs in workshops in three emerging countries (Kazakhstan, Vietnam, and Indonesia). The IORB defined nine criteria four categories (Product, Manufacturing, Service, and Value Assessment), which OPP manufacturers can use to provide evidence for reimbursement and health policy decision making. Then the IORB developed the EFOR as a base case document, which can be adapted and used as a template by health authorities in emerging countries. Emerging countries have a significant need for an HTA tool that balances affordability with accurate evidence showing the value differentiation of OPPs. The value attributes in this setting often are different from those in developed markets, which emphasize new products and have high regulation and manufacturing standards. The EFOR is an easy-to-use, adaptable framework that emerging countries can use to increase the consistency, transparency, and effectiveness of drug decision making. The open source EFOR is available as Supplemental Materials

  9. Immersive Technology for Human-Centric Cyberphysical Systems in Complex Manufacturing Processes: A Comprehensive Overview of the Global Patent Profile Using Collective Intelligence

    Directory of Open Access Journals (Sweden)

    Usharani Hareesh Govindarajan

    2018-01-01

    Full Text Available Immersive technology for human-centric cyberphysical systems includes broad concepts that enable users in the physical world to connect with the cyberworld with a sense of immersion. Complex systems such as virtual reality, augmented reality, brain-computer interfaces, and brain-machine interfaces are emerging as immersive technologies that have the potential for improving manufacturing systems. Industry 4.0 includes all technologies, standards, and frameworks for the fourth industrial revolution to facilitate intelligent manufacturing. Industrial immersive technologies will be used for smart manufacturing innovation in the context of Industry 4.0’s human machine interfaces. This research provides a thorough review of the literature, construction of a domain ontology, presentation of patent metatrend statistical analysis, and data mining analysis using a technology function matrix and highlights technical and functional development trends using latent Dirichlet allocation (LDA models. A total of 179 references from the IEEE and IET databases and 2,672 patents are systematically analyzed to identify current trends. The paper establishes an essential foundation for the development of advanced human-centric cyberphysical systems in complex manufacturing processes.

  10. International nanotechnology development in 2003: Country, institution, and technology field analysis based on USPTO patent database

    International Nuclear Information System (INIS)

    Huang Zan; Chen Hsinchun; Chen Zhikai; Roco, Mihail C.

    2004-01-01

    Nanoscale science and engineering (NSE) have seen rapid growth and expansion in new areas in recent years. This paper provides an international patent analysis using the U.S. Patent and Trademark Office (USPTO) data searched by keywords of the entire text: title, abstract, claims, and specifications. A fraction of these patents fully satisfy the National Nanotechnology Initiative definition of nanotechnology (which requires exploiting specific phenomena and direct manipulation at the nanoscale), while others only make use of NSE tools and methods of investigation. In previous work we proposed an integrated patent analysis and visualization framework of patent content mapping for the NSE field and of knowledge flow pattern identification until 2002. In this paper, the results are updated for 2003, and the new trends are presented

  11. International nanotechnology development in 2003: Country, institution, and technology field analysis based on USPTO patent database

    Science.gov (United States)

    Huang, Zan; Chen, Hsinchun; Chen, Zhi-kai; Roco, Mihail C.

    2004-08-01

    Nanoscale science and engineering (NSE) have seen rapid growth and expansion in new areas in recent years. This paper provides an international patent analysis using the U.S. Patent and Trademark Office (USPTO) data searched by keywords of the entire text: title, abstract, claims, and specifications. A fraction of these patents fully satisfy the National Nanotechnology Initiative definition of nanotechnology (which requires exploiting specific phenomena and direct manipulation at the nanoscale), while others only make use of NSE tools and methods of investigation. In previous work we proposed an integrated patent analysis and visualization framework of patent content mapping for the NSE field and of knowledge flow pattern identification until 2002. In this paper, the results are updated for 2003, and the new trends are presented.

  12. [Overview of patents on targeted genome editing technologies and their implications for innovation and entrepreneurship education in universities].

    Science.gov (United States)

    Fan, Xiang-yu; Lin, Yan-ping; Liao, Guo-jian; Xie, Jian-ping

    2015-12-01

    Zinc finger nuclease, transcription activator-like effector nuclease, and clustered regularly interspaced short palindromic repeats/Cas9 nuclease are important targeted genome editing technologies. They have great significance in scientific research and applications on aspects of functional genomics research, species improvement, disease prevention and gene therapy. There are past or ongoing disputes over ownership of the intellectual property behind every technology. In this review, we summarize the patents on these three targeted genome editing technologies in order to provide some reference for developing genome editing technologies with self-owned intellectual property rights and some implications for current innovation and entrepreneurship education in universities.

  13. How ordinary judges and juries decide the seemingly complex technological questions of patentability over the prior art.

    Science.gov (United States)

    Kieff, F Scott

    2003-01-01

    Determinations of patentability over the prior art are often thought to raise questions that are so technologically complex that they require special training and judgment to answer, especially in fast-moving fields like modern biotechnology. This essay explores the somewhat counterintuitive argument that under the U.S. system they do not and should not. According to this view, determinations of patentability over the prior art are based entirely on factual inquiries that are best made by lay judges and juries, just like the factual determinations these people regularly make in any ordinary nonpatent trial. This is good because judges and juries are adept at these determinations, and because appellate courts are adept at reviewing them. It leads to a system that is cheaper overall in allowing private litigants to better predict outcomes that also better approximate the correct answer than would be possible under other regimes premised upon the expert technological knowledge and judgment of a decisionmaker.

  14. Used, Blocking and Sleeping Patents

    DEFF Research Database (Denmark)

    Torrisi, Salvatore; Gambardella, Alfonso; Giuri, Paola

    2016-01-01

    This paper employs data from a large-scale survey (InnoS&T) of inventors in Europe, the USA, and Japan who were listed in patent applications filed at the European Patent Office with priority years between 2003 and 2005. We provide evidence regarding the reasons for patenting and the ways in which...... patents are being utilized. A substantial share of patents is neither used internally nor for market transactions, which confirms the importance of strategic patenting and inefficiency in the management of intellectual property. We investigate different types of unused patents—unused blocking patents...... and sleeping patents. We also examine the association between used and unused patents and their characteristics such as family size, scope, generality and overlapping claims, technology area, type of applicant, and the competitive environment from where these patents originate. We discuss our results...

  15. The Academic Advantage: Gender Disparities in Patenting

    OpenAIRE

    Sugimoto, Cassidy R.; Ni, Chaoqun; West, Jevin D.; Larivi?re, Vincent

    2015-01-01

    We analyzed gender disparities in patenting by country, technological area, and type of assignee using the 4.6 million utility patents issued between 1976 and 2013 by the United States Patent and Trade Office (USPTO). Our analyses of fractionalized inventorships demonstrate that women's rate of patenting has increased from 2.7% of total patenting activity to 10.8% over the nearly 40-year period. Our results show that, in every technological area, female patenting is proportionally more likely...

  16. A patent landscape on application of microorganisms in construction industry.

    Science.gov (United States)

    Dapurkar, Dipti; Telang, Manasi

    2017-07-01

    Construction biotechnology includes research and development of construction materials and processes that make use of various microbes. The present technology landscape gives a perspective on how microbes have been used in construction industry as cement and concrete additives by analyzing patents filed in this technology arena. All patents related to the technology of interest published globally to date have been reviewed. The earliest patent filing in this technology domain was recorded in the year 1958 and the patenting activity reached its peak around mid to late 1990s. The early technology was mainly focused on microbial polysaccharides and other metabolic products as additives. Year 2002 onwards, biomineralization has taken precedence over the other technologies with consistent patent filings indicating a shift in innovation focus. Japan has been the global leader with highest number of patents filed on application of microbes in construction industry. Southeast University, China has topped the patent assignee list with maximum number of filings followed by Kajima Corp. and Shin-Etsu Chemical Co., Ltd. Most patent applications have claimed microbe based bio-products. Construction-related microbial technologies are mainly based on activity of different microorganisms such as urease-producing, acidogenic, halophilic, alkaliphilic, nitrate and iron-reducing bacteria. Sporosarcina pasteurii has been the most widely used microbe for biomineralization.

  17. DOE Patents Available for Licensing

    International Nuclear Information System (INIS)

    Stuber, C.

    1981-01-01

    DOE Patents Available for Licensing (DOE PAL) provides abstracting and indexing coverage of the DOE patent literature, including patent applications, that concerns any apsect of energy production, conservation, and utilization. The citations are arranged by subject category. DOE is prepared to grant exclusive or nonexclusive, revocable licenses under DOE-owned US patents and patent applications in accordance with the provisions of 10CFR781

  18. Performance of Patenting Firms

    DEFF Research Database (Denmark)

    Madsen, Erik Strøjer; Smith, Valdemar; Nielsen, Anders Østergaard

    2000-01-01

    Most countries focus on industries with high technology and the governments grant subsidies to innovating firms. However, there has been remarkable few studies of the performance of innovative firms or industries. This study examines the performance of patent active firms compared to the non-patenting...... firms within the manufacturing sector in Denmark. Performance is measured both by growth in employment as well as in the return on equity and profit share in turnover. The results suggest that differences in performance of patenting and non-patenting firms are very small, which questions the political...

  19. Just-in-time patents and the development of standards

    NARCIS (Netherlands)

    Kang, B.; Bekkers, R.

    2015-01-01

    Modern technical standards often include large numbers of patented technologies that are required to implement those standards. These “standard-essential patents” are very valuable assets, and firms that do not own such patents are prepared to spend billions of dollars purchasing them. Whereas large

  20. 37 CFR 1.710 - Patents subject to extension of the patent term.

    Science.gov (United States)

    2010-07-01

    ... of Patent Term Extension of Patent Term Due to Regulatory Review § 1.710 Patents subject to extension... primarily manufactured using recombinant DNA, recombinant RNA, hybridoma technology, or other processes...

  1. Evaluation of Brazilian biotechnology patent activity from 1975 to 2010.

    Science.gov (United States)

    Dias, F; Delfim, F; Drummond, I; Carmo, A O; Barroca, T M; Horta, C C; Kalapothakis, E

    2012-08-01

    The analysis of patent activity is one methodology used for technological monitoring. In this paper, the activity of biotechnology-related patents in Brazil were analyzed through 30 International Patent Classification (IPC) codes published by the Organization for Economic Cooperation and Development (OECD). We developed a program to analyse the dynamics of the major patent applicants, countries and IPC codes extracted from the Brazilian Patent Office (INPI) database. We also identified Brazilian patent applicants who tried to expand protection abroad via the Patent Cooperation Treaty (PCT). We had access to all patents published online at the INPI from 1975 to July 2010, including 9,791 biotechnology patent applications in Brazil, and 163 PCTs published online at World Intellectual Property Organization (WIPO) from 1997 to December 2010. To our knowledge, there are no other online reports of biotechnology patents previous to the years analyzed here. Most of the biotechnology patents filed in the INPI (10.9%) concerned measuring or testing processes involving nucleic acids. The second and third places belonged to patents involving agro-technologies (recombinant DNA technology for plant cells and new flowering plants, i.e. angiosperms, or processes for obtaining them, and reproduction of flowering plants by tissue culture techniques). The majority of patents (87.2%) were filed by nonresidents, with USA being responsible for 51.7% of all biotechnology patents deposited in Brazil. Analyzing the resident applicants per region, we found a hub in the southeast region of Brazil. Among the resident applicants for biotechnology patents filed in the INPI, 43.5% were from São Paulo, 18.3% were from Rio de Janeiro, and 9.7% were from Minas Gerais. Pfizer, Novartis, and Sanofi were the largest applicants in Brazil, with 339, 288, and 245 biotechnology patents filed, respectively. For residents, the largest applicant was the governmental institution FIOCRUZ (Oswaldo Cruz

  2. Essentials of the successful drafting of invention applications on nuclear technology in the view of patent examination

    International Nuclear Information System (INIS)

    Zhai Chenyang

    2010-01-01

    Up to now, there has been a comparatively low ratio of domestic authorization in terms of invention applications in the field of nuclear technology. In this paper, the main reasons according to my experience in the patent examination are revealed in the following three aspects: (1) there is a lack of novelty or inventive step; (2) the scope of some claims is not clearly defined; (3) the description is improperly drafting. Common problems are shown and analyzed. Suggestion for avoiding the problems and corresponding solutions are given. (author)

  3. Environmentally conscious patent histories

    Science.gov (United States)

    Crouch, Dennis D.; Crouch, Henry L.

    2004-02-01

    There is a need for investigators, legislators, and business leaders to understand the magnitude of innovation and discovery in the field of environmentally conscious technologies (ECTs). Knowledge of the "big picture" is important to providing a national and global account of actual environmental stewardship over the last twenty-five years. A recitation of the Environmental Protection Agency (EPA) supported Acts which have been enacted into law reveals one facet of the multifaceted dynamic of environmental consciousness. The popular discussion and debate, as well as partisan lobbying, which created the political forces leading to environmentally conscious legislation is another facet. A third facet is the corporate response to the threats and opportunities predicted by CEO"s and others through environmental scanning. This paper examines changes in environmentally conscious inventive effort by comparing data from United States Patents issued from 1976 through 2003. Patents are useful tool for measuring technological innovation because they are publicly available records of innovative activity. Although not all inventions result in patent applications, the monopoly rights granted on the invention give the inventor a strong incentive to obtain patents on any viable product or process. Among the results, we found a significant increase in patents relating to environmentally conscious products and processes during the period in question. Specifically, a dramatic increase in patent activity was seen for the decade of the 1990"s. Surprisingly, the patenting rate from 2000 to 2003 seems to have stabilized. Additionally public discussion of ECTs appears to have a positive impact on patent filings.

  4. Using Patent Development, Education Policy and Research and Development Expenditure Policy to Increase Technological Competitiveness of Small European Union Member States

    Directory of Open Access Journals (Sweden)

    Ferraro Simona

    2017-08-01

    Full Text Available The Chinese Belt and Road Initiative will open new trade routes between China and the European Union (EU and increase competition pressures on smaller EU member states. This article ranks where states like Estonia stand internationally in terms of innovativeness (and consequent competitiveness by conducting an econometric study of patent development, education policy and research and development (R&D expenditure policy. The authors claim that small member states such as Estonia should follow the example of countries such as Germany and adopt policies which focus more on increased public spending on R&D and innovation in public universities of science and technology, and raise support for high tech startups with a strong focus on international patenting. Member States must go further and subsidise R&D activities by focusing, inter alia, on filing of foreign patents such as triadic patents.

  5. Patents and nanomedicine.

    Science.gov (United States)

    Bawa, Raj

    2007-06-01

    Big pharma's business model, which relies on a few blockbusters to generate profits, is clearly broken. Patent expiration on numerous blockbusters in recent years is already altering the drug landscape. Drug companies are also facing other challenges that necessitate development and implementation of novel R&D strategies, including those that focus on nanotechnology and miniaturization. Clearly, there is enormous excitement and expectation regarding nanomedicine's potential impact. However, securing valid and defensible patent protection will be critical. Although early forecasts for nanomedicine commercialization are encouraging, there are numerous bottlenecks as well. One of the major hurdles is an emerging thicket of patent claims, resulting primarily from patent proliferation as well as continued issuance of surprisingly broad patents by the US Patent and Trademark Office (PTO). Adding to this confusion is the fact that the US National Nanotechnology Initiative's widely cited definition of nanotechnology is inaccurate and irrelevant from a nanomedicine perspective. It is also the cause of the inadequate patent classification system that was recently unveiled by the PTO. All of this is creating a chaotic, tangled patent landscape in various sectors of nanomedicine where the competing players are unsure of the validity and enforceability of numerous issued patents. If this trend continues, it could stifle competition and limit access to some inventions. Therefore, reforms are urgently needed at the PTO to address problems ranging from poor patent quality and questionable examination practices to inadequate search capabilities, rising attrition, poor employee morale and a skyrocketing patent application backlog. Only a robust patent system will stimulate the development of commercially viable nanomedicine products that can drastically improve a patient's quality of life and reduce healthcare costs.

  6. The academic advantage: gender disparities in patenting.

    Science.gov (United States)

    Sugimoto, Cassidy R; Ni, Chaoqun; West, Jevin D; Larivière, Vincent

    2015-01-01

    We analyzed gender disparities in patenting by country, technological area, and type of assignee using the 4.6 million utility patents issued between 1976 and 2013 by the United States Patent and Trade Office (USPTO). Our analyses of fractionalized inventorships demonstrate that women's rate of patenting has increased from 2.7% of total patenting activity to 10.8% over the nearly 40-year period. Our results show that, in every technological area, female patenting is proportionally more likely to occur in academic institutions than in corporate or government environments. However, women's patents have a lower technological impact than that of men, and that gap is wider in the case of academic patents. We also provide evidence that patents to which women--and in particular academic women--contributed are associated with a higher number of International Patent Classification (IPC) codes and co-inventors than men. The policy implications of these disparities and academic setting advantages are discussed.

  7. The interplay between standardization and technological change : a study on wireless technologies, technological trajectories, and essential patent claims

    NARCIS (Netherlands)

    Bekkers, R.N.A.; Martinelli, A.

    2010-01-01

    In many technology fields, standardization is the primary method of achieving alignment between actors. Especially if strong network effects and increasing returns are present, the market often ends up with a single standard that dominates the technical direction, activities and search heuristics,

  8. Exploration Technology Development including Surface Acoustic Wave RFID chips

    Data.gov (United States)

    National Aeronautics and Space Administration — This project is focused on maturing future surface exploration technologies and instrumentation and working towards flight instrumentation and systems to support...

  9. Patenting human genes: Chinese academic articles' portrayal of gene patents.

    Science.gov (United States)

    Du, Li

    2018-04-24

    The patenting of human genes has been the subject of debate for decades. While China has gradually come to play an important role in the global genomics-based testing and treatment market, little is known about Chinese scholars' perspectives on patent protection for human genes. A content analysis of academic literature was conducted to identify Chinese scholars' concerns regarding gene patents, including benefits and risks of patenting human genes, attitudes that researchers hold towards gene patenting, and any legal and policy recommendations offered for the gene patent regime in China. 57.2% of articles were written by law professors, but scholars from health sciences, liberal arts, and ethics also participated in discussions on gene patent issues. While discussions of benefits and risks were relatively balanced in the articles, 63.5% of the articles favored gene patenting in general and, of the articles (n = 41) that explored gene patents in the Chinese context, 90.2% supported patent protections for human genes in China. The patentability of human genes was discussed in 33 articles, and 75.8% of these articles reached the conclusion that human genes are patentable. Chinese scholars view the patent regime as an important legal tool to protect the interests of inventors and inventions as well as the genetic resources of China. As such, many scholars support a gene patent system in China. These attitudes towards gene patents remain unchanged following the court ruling in the Myriad case in 2013, but arguments have been raised about the scope of gene patents, in particular that the increasing numbers of gene patents may negatively impact public health in China.

  10. Can this kind of idea be a patent?

    International Nuclear Information System (INIS)

    Yu, Jae Bok

    2004-08-01

    This book mentions patent such as application, what is patents, patent law, procedure and patent attorney, which includes business idea is patent. Is internet domain name or name-brand? We can make a big money with others idea, the difference among patent, trademark, utility model rights and registration of design, priority system, new weapon in digital period, patent is a knife and a shield, the cost from application to registration, what is hunting of patent information, writing document for patent, patent examination and patent lawyer.

  11. Can this kind of idea be a patent?

    Energy Technology Data Exchange (ETDEWEB)

    Yu, Jae Bok

    2004-08-15

    This book mentions patent such as application, what is patents, patent law, procedure and patent attorney, which includes business idea is patent. Is internet domain name or name-brand? We can make a big money with others idea, the difference among patent, trademark, utility model rights and registration of design, priority system, new weapon in digital period, patent is a knife and a shield, the cost from application to registration, what is hunting of patent information, writing document for patent, patent examination and patent lawyer.

  12. Use of Patent Applications as a Tool for Technology Development Prospection on the Ethanol Production Chain from Lignocellulosic Biomasses in Brazil

    Directory of Open Access Journals (Sweden)

    Luiz André Felizardo Silva Schlittler

    2012-09-01

    Full Text Available The growing concerns regarding the future of global energy supplies have encouraged R&D in alternative sources to complement the global energy matrix. Brazil has earned notoriety as one of the largest producers of ethanol and biomass. This has aroused other countries’ interest in Brazil’s capabilities. However, the technologies for converting biomass into ethanol are not sufficiently mature, and have been developed in a decentralized manner. The lignocellulosic ethanol technologies can be divided into the following three groups: pretreatment, enzymes and ethanol production. One of the most efficient methods for mapping such technologies is through patent applications because the applications provide important information on trends in long-term technological development. Among all the patent applications deposited in the Brazilian database, pretreatment technologies were the most exploited followed by enzymes and ethanol production. The large number of documents from USA and European countries efforts the importance of Brazil in this technological scenario.

  13. Patenting Nanomedicine in Europe

    DEFF Research Database (Denmark)

    Nordberg, Ana

    This work addresses the question of determining whether reinterpretation, reformulation or replacement of article 53 (c) of the European Patent Convention is viable and advisable. It does so by reference to novel or resurfacing interpretative concerns connected with emerging technologies exemplif......This work addresses the question of determining whether reinterpretation, reformulation or replacement of article 53 (c) of the European Patent Convention is viable and advisable. It does so by reference to novel or resurfacing interpretative concerns connected with emerging technologies...... exemplified by nanomedicine, while considering known interpretative issues and traditional objections to this provision. The debate concerning the patentability of ‘medical methods’ is multi-layered and complex. The ‘medical methods exception’ is a public policy mechanism, intended to introduce flexibility...... in the patent system in order to allow for the protection of core ethical values of society. Nanotechnology inventions blur the lines between patentable subject matter and what may fall under the exception from patentability. It is a good example of how in recent years, emerging technologies have been...

  14. Invention and Transfer of Climate Change Mitigation Technologies on a Global Scale: A Study Drawing on Patent Data

    International Nuclear Information System (INIS)

    Dechezlepretre, A.; Glachant, M.; Hascic, I.; Johnstone, N.; Meniere, Y.

    2010-01-01

    This paper uses the EPO/OECD World Patent Statistical Database (PATSTAT) to provide a quantitative description of the geographic distribution of inventions in thirteen climate mitigation technologies since 1978 and their international diffusion on a global scale. Statistics suggest that innovation has mostly been driven by energy prices until 1990. Since then, environmental policies, and climate policies more recently, have accelerated the pace of innovation. Innovation is highly concentrated in three countries - Japan, Germany and the USA - which account for 60% of total innovations. Surprisingly, the innovation performance of emerging economies is far from being negligible as China and South Korea together represent about 15% of total inventions. However, they export much less inventions than industrialized countries, suggesting their inventions have less value. More generally, international transfers mostly occur between developed countries (73% of exported inventions). Exports from developed countries to emerging economies are still limited (22%) but are growing rapidly, especially to China. (authors)

  15. Patent Keyword Extraction Algorithm Based on Distributed Representation for Patent Classification

    Directory of Open Access Journals (Sweden)

    Jie Hu

    2018-02-01

    Full Text Available Many text mining tasks such as text retrieval, text summarization, and text comparisons depend on the extraction of representative keywords from the main text. Most existing keyword extraction algorithms are based on discrete bag-of-words type of word representation of the text. In this paper, we propose a patent keyword extraction algorithm (PKEA based on the distributed Skip-gram model for patent classification. We also develop a set of quantitative performance measures for keyword extraction evaluation based on information gain and cross-validation, based on Support Vector Machine (SVM classification, which are valuable when human-annotated keywords are not available. We used a standard benchmark dataset and a homemade patent dataset to evaluate the performance of PKEA. Our patent dataset includes 2500 patents from five distinct technological fields related to autonomous cars (GPS systems, lidar systems, object recognition systems, radar systems, and vehicle control systems. We compared our method with Frequency, Term Frequency-Inverse Document Frequency (TF-IDF, TextRank and Rapid Automatic Keyword Extraction (RAKE. The experimental results show that our proposed algorithm provides a promising way to extract keywords from patent texts for patent classification.

  16. Expanding Health Technology Assessments to Include Effects on the Environment

    DEFF Research Database (Denmark)

    Marsh, Kevin; Ganz, Michael Lee; Hsu, John

    2016-01-01

    decision makers. Health care is an important and sizable sector of the economy that could warrant closer policy attention to its impact on the environment. Considerable work is needed to track decision makers' demands, augment the environmental evidence base, and develop robust methods for capturing......There is growing awareness of the impact of human activity on the climate and the need to stem this impact. Public health care decision makers from Sweden and the United Kingdom have started examining environmental impacts when assessing new technologies. This article considers the case...... and objectives extending beyond health care. Two types of challenges hinder this process. First, the nascent evidence base is insufficient to support the accurate comparison of technologies' environmental impacts. Second, cost-utility analysis, which is favored by many HTA agencies, could capture some...

  17. Expanding Health Technology Assessments to Include Effects on the Environment.

    Science.gov (United States)

    Marsh, Kevin; Ganz, Michael L; Hsu, John; Strandberg-Larsen, Martin; Gonzalez, Raquel Palomino; Lund, Niels

    2016-01-01

    There is growing awareness of the impact of human activity on the climate and the need to stem this impact. Public health care decision makers from Sweden and the United Kingdom have started examining environmental impacts when assessing new technologies. This article considers the case for incorporating environmental impacts into the health technology assessment (HTA) process and discusses the associated challenges. Two arguments favor incorporating environmental impacts into HTA: 1) environmental changes could directly affect people's health and 2) policy decision makers have broad mandates and objectives extending beyond health care. Two types of challenges hinder this process. First, the nascent evidence base is insufficient to support the accurate comparison of technologies' environmental impacts. Second, cost-utility analysis, which is favored by many HTA agencies, could capture some of the value of environmental impacts, especially those generating health impacts, but might not be suitable for addressing broader concerns. Both cost-benefit and multicriteria decision analyses are potential methods for evaluating health and environmental outcomes, but are less familiar to health care decision makers. Health care is an important and sizable sector of the economy that could warrant closer policy attention to its impact on the environment. Considerable work is needed to track decision makers' demands, augment the environmental evidence base, and develop robust methods for capturing and incorporating environmental data as part of HTA. Copyright © 2016 International Society for Pharmacoeconomics and Outcomes Research (ISPOR). Published by Elsevier Inc. All rights reserved.

  18. Mapping technological trajectories as patent citation networks : a study on the history of fuel cell research

    NARCIS (Netherlands)

    Verspagen, B.

    2005-01-01

    Technological change is argued to be taking place along ordered and selective patterns, shaped jointly by technological and scientific principles, and economic and other societal factors. Historical, descriptive analysis is often used to analyze these "trajectories". Recently, quantitative methods

  19. Mapping technological trajectories as patent citation networks : a study on the history of fuel cell research

    NARCIS (Netherlands)

    Verspagen, B.

    2007-01-01

    Technological change is argued to be taking place along ordered and selective patterns, shaped jointly by technological and scientific principles, and economic and other societal factors. Historical, descriptive analysis is often used to analyze these "trajectories". Recently, quantitative methods

  20. When patents matter: The impact of competition and patent age on the performance contribution of intellectual property rights protection

    NARCIS (Netherlands)

    Maresch, Daniela; Fink, Matthias; Harms, Rainer

    2016-01-01

    The question whether patenting impacts patenting firms' subsequent financial performance is important for technology-oriented companies. However, relevant research has led to contradictory results. We strive to overcome this impasse by introducing innovation competition and patent age as moderators

  1. 78 FR 17187 - Notice of Intent To Grant Exclusive Patent License; Fiber Optic Sensor Systems Technology...

    Science.gov (United States)

    2013-03-20

    ...; Fiber Optic Sensor Systems Technology Corporation AGENCY: Department of the Navy, DoD. ACTION: Notice..., 2012, announcing an intent to grant to Fiber Optic Sensor Systems Technology Corporation, a revocable... the Navy hereby gives notice of its intent to grant to Fiber Optic Sensor Systems Technology...

  2. High-efficiency photovoltaic technology including thermoelectric generation

    Science.gov (United States)

    Fisac, Miguel; Villasevil, Francesc X.; López, Antonio M.

    2014-04-01

    Nowadays, photovoltaic solar energy is a clean and reliable source for producing electric power. Most photovoltaic systems have been designed and built up for use in applications with low power requirements. The efficiency of solar cells is quite low, obtaining best results in monocrystalline silicon structures, with an efficiency of about 18%. When temperature rises, photovoltaic cell efficiency decreases, given that the short-circuit current is slightly increased, and the open-circuit voltage, fill factor and power output are reduced. To ensure that this does not affect performance, this paper describes how to interconnect photovoltaic and thermoelectric technology into a single structure. The temperature gradient in the solar panel is used to supply thermoelectric cells, which generate electricity, achieving a positive contribution to the total balance of the complete system.

  3. Constructing an Intelligent Patent Network Analysis Method

    Directory of Open Access Journals (Sweden)

    Chao-Chan Wu

    2012-11-01

    Full Text Available Patent network analysis, an advanced method of patent analysis, is a useful tool for technology management. This method visually displays all the relationships among the patents and enables the analysts to intuitively comprehend the overview of a set of patents in the field of the technology being studied. Although patent network analysis possesses relative advantages different from traditional methods of patent analysis, it is subject to several crucial limitations. To overcome the drawbacks of the current method, this study proposes a novel patent analysis method, called the intelligent patent network analysis method, to make a visual network with great precision. Based on artificial intelligence techniques, the proposed method provides an automated procedure for searching patent documents, extracting patent keywords, and determining the weight of each patent keyword in order to generate a sophisticated visualization of the patent network. This study proposes a detailed procedure for generating an intelligent patent network that is helpful for improving the efficiency and quality of patent analysis. Furthermore, patents in the field of Carbon Nanotube Backlight Unit (CNT-BLU were analyzed to verify the utility of the proposed method.

  4. Interactions between science and technology: analysis of the intellectual production of the researchers-inventors of the first letter- patent of the UFRGS

    Directory of Open Access Journals (Sweden)

    Ana Maria Mielniczuk de Moura

    2006-12-01

    Full Text Available The paper discusses intellectual and industrial property and existing differences between scientific and technological knowledge. It aims at incorporating the patent in the context of the scientific and technological communication. It presents preliminary data of a study that aims at analyzing the relationship between scientific and technological information in the intellectual production of the researchers-inventors of the first patent from the Federal University of Rio Grande do Sul (UFRGS. It concludes that, in the case studied, a flow between scientific and technological information occurs, in which the former, after its diffusion and approval in the peer review process, subsidizes the latter. It suggests that other studies should be carried out.

  5. Idea on patent ; It is high time to stress quality

    International Nuclear Information System (INIS)

    2012-03-01

    This book deals with patent stressing on the quality, which includes from idea to technical business, It's simple to register the computer program, why do patent lawyer appoint the patent attorney's office? construction of patent right range, a good patent and a bad patent, strong patent and weak patent. It doesn't allow for Dus to use as we like, each patent has different value, Let's write technical specifications, advice on talking for invention with a patent attorney's office and what kind of task do intellectual property division do?

  6. System failure, innovation policy and patents: Fuel cells and related hydrogen technology in Norway 1990-2002

    International Nuclear Information System (INIS)

    Godoe, Helge; Nygaard, Stian

    2006-01-01

    The empirical focus of this article is technological innovation activities in the emerging field of fuel cells and related hydrogen technology in Norway from 1990 to 2002. In this period, four comparatively large-scale research and development projects and a number of smaller projects aimed at development of fuel cells technology were undertaken, resulting in many inventions that were subsequently patented. Although this creativity may be considered an indication of success, only one of the projects became successful in an innovation perspective. All the large projects were initiated and funded for divergent political and economic reasons. An important reason in the late 1980s was the prospect of using Norway's abundant supply of natural gas in fuel cells for electric power generation. The large R and D projects that attempted to develop fuel cells based on natural gas as energy source failed. In contrast, the successful project was undertaken by military R and D, i.e. in a different system of innovation than the projects that failed. Analysis of these cases points to the importance of a systemic approach to innovations-and to policy making. One challenge for policy makers is to decide how they should promote this development which is crucial for the vision of a future 'Hydrogen Economy', i.e. what kind of policy incentives should be introduced to spur efficiency in technological development and diffusion. Theoretically, many options are available; however, understanding the innovation dynamics in this sector is fundamental for making choices. In this article, focus will be set on policy aspects using an innovation systemic approach to analyze development of fuel cells and related hydrogen technology in Norway

  7. Patenting Human Genes in Europe

    DEFF Research Database (Denmark)

    Minssen, Timo

    2017-01-01

    In accordance with the concept of the book and the assigned scope of the contribution, this chapter describes the European law with respect to the patent-eligibility of isolated DNA sequences. This chapter will further include a brief comparison with recent developments from the US and Australia....... It will, however, not focus on the important debates regarding the patent-eligibility of other biological material, diagnostic methods patents (as data aggregators) or abstract ideas which will be addressed by other contributions. Moreover, the analysis will merely concentrate on patent-eligibility. Other...... patentability requirement will only be briefly touched upon in the discussion part. The paper starts out in section 1.5.2 by discussing the patent-eligibility of isolated human DNA sequences on the European national level and under the Biotechnology Directive. Then the patent-eligibility of isolated human DNA...

  8. Patenting Biotechnological Inventions in Europe

    Directory of Open Access Journals (Sweden)

    Peter Raspor

    2002-01-01

    Full Text Available The patent system has been able to provide the protection for the achievements of different technologies and in that way it has supported further development and growth of the industry where those achievements were implemented. Modern technologies like information technology and biotechnology with genetic engineering that appeared in the 70s have overgrown the frames of the existing patent system because of their exponential development during the last thirty years. Industry that invests a huge amount of money in these technologies, especially in the field of biotechnology, where the results are very uncertain, has started to claim changes in the patent system.

  9. The dynamics of technological discontinuities : a patent citation network analysis of telecommunication switches

    NARCIS (Netherlands)

    Martinelli, A.

    2010-01-01

    This work focuses on the long-term structural evolution of the telecommunication switching industry, analyzing both the technology and the firm level. The first contribution of this work is in the empirical representation of technological change. Following the growing field of research about the use

  10. The population ecology of technology : An empirical study of US biotechnology patents from 1976 to 2003

    NARCIS (Netherlands)

    Van Oord, Ad Den; Van Witteloostuijn, Arjen

    2017-01-01

    A detailed understanding of technological change as an evolutionary process is currently not well understood. To increase our understanding, we build upon theory from organizational ecology to develop a model of endogenous technological growth and determine to what extent the pattern of

  11. High-quality patents for emerging science and technology through external actors: Community scientific experts and knowledge societies

    NARCIS (Netherlands)

    Kica, Evisa; Groenendijk, Nico; Rodriguez, V.F.; Bonaccorsi, A.; Borras, S.

    2010-01-01

    This article explores one type of administrative mechanism to achieve high-quality patents: Article 115 of the European Patent Convention, which permits the inclusion of third parties to provide input to the prior art search and to communicate relevant information to the examiner in charge. Our

  12. Foreign patent documentation and information research

    International Nuclear Information System (INIS)

    Wang Tongsheng; Wu Xianfeng; Liu Jia; Cao Jifen; Song Tianbao; Feng Beiyuan; Zhang Baozhu

    2014-01-01

    Patent documentations are important scientific and technical documentations, which gather legal information, technical information and economic information together. According to WIPO forecasts, making full use of patent documentation can save 40% of research funding and 60% of the study period. Foreign patent documentations are the world's most valuable patent documentations, and many original technologies that have significant influence are first disclosed in foreign patent documentation. Studying and making use of foreign patent documentations can improve our starting point of scientific and technological innovation, and reduce the research investment. This paper analyzes foreign patent documentation and, combining with the actual development of nuclear technology in our country, makes specific recommendations for patent documentation research. (authors)

  13. The Bayh-Dole Act: Selected Issues in Patent Policy and the Commercialization of Technology

    National Research Council Canada - National Science Library

    Schacht, Wendy H

    2009-01-01

    ...) to certain types of entities with the expressed purpose of encouraging the commercialization of new technologies through cooperative ventures between and among the research community, small business, and industry...

  14. Patent office governance and patent system quality

    OpenAIRE

    PICARD, Pierre M.; VAN POTTELSBERGHE DE LA POTTERIE, Bruno

    2011-01-01

    The present paper discusses the role of quality in patent systems from the perspective of patent offices' behavior and organization. After documenting original stylized facts, the paper presents a model in which patent offices set patent fees and the quality level of their examination processes. Various objectives of patent offices' governors are considered. We show that the quality of the patent system is maximal for the patent offices that maximises either the social welfare or its own prof...

  15. Technology and the diffusion of renewable energy

    International Nuclear Information System (INIS)

    Popp, David; Hascic, Ivan; Medhi, Neelakshi

    2011-01-01

    We consider investment in wind, solar photovoltaic, geothermal, and electricity from biomass and waste across 26 OECD countries from 1991 to 2004. Using the PATSTAT database, we obtain a comprehensive list of patents for each of these technologies throughout the world, which we use to assess the impact of technological change on investment in renewable energy capacity. We consider four alternative methods for counting patents, using two possible filters: weighting patents by patent family size and including only patent applications filed in multiple countries. For each patent count, we create knowledge stocks representing the global technological frontier. We find that technological advances do lead to greater investment, but the effect is small. Investments in other carbon-free energy sources, such as hydropower and nuclear power, serve as substitutes for renewable energy. Comparing the effectiveness of our four patent counts, we find that both using only patents filed in multiple countries and weighting by family size improve the fit of the model.

  16. Joint and Cross-border Patents as Proxies for International Technology Diffusion

    NARCIS (Netherlands)

    C-L. Chang (Chia-Lin); M.J. McAleer (Michael); J-T. Tang (Ju-Ting)

    2016-01-01

    markdownabstractWith the advent of globalization, economic and financial interactions among countries have become widespread. Given technological advancements, the factors of production can no longer be considered to be just labor and capital. In the pursuit of economic growth, every country has

  17. Patents and Technological Progress in a Globalized World-Liber Amicorum Joseph Straus

    DEFF Research Database (Denmark)

    Minssen, Timo

    2012-01-01

    and Technological Progress in a Globalized Economy". Starting with Rainer Moufang's portrayal of the fascinating life and career of Professor Straus and the leitmotivs of his work (pp.VII–XVII), which is followed by the table of contents and a brief description of the contributors (pp.XIX–XXX), the book sets out...

  18. Inventions shaping technological trajectories: do existing patent indicators provide a comprehensive picture?

    NARCIS (Netherlands)

    Arts, Sam; Appio, Francesco Paolo; van Looy, Bart

    2013-01-01

    Since Schumpeter’s (The theory of economic development, 1934) seminal work on economic development, innovation is considered as one of the main drivers of firm performance and economic growth. At the same time, technological innovations vary considerably in terms of impact with only a minority of

  19. 76 FR 2144 - Quest Diagnostics, Inc. Information Technology Help Desk Services Including On-Site Leased...

    Science.gov (United States)

    2011-01-12

    .... Information Technology Help Desk Services Including On-Site Leased Workers From Modis, West Norriton, PA..., applicable to workers of Quest Diagnostics, Inc., Information Technology Help Desk Services, West Norriton... Quest Diagnostics, Inc., Information Technology Help Desk [[Page 2145

  20. Tendências tecnológicas de polietilenos e polipropileno através da prospecção em documentos de patente nos Estados Unidos e Europa - 1990/1997 Technological trends for polyethylene and polypropylene through the study of patent documents in the United States and Europe - 1990/1997

    Directory of Open Access Journals (Sweden)

    Adelaide M. S. Antunes

    2000-03-01

    Full Text Available O presente artigo fornece uma avaliação estratégica da tecnologia de produção de polímeros à base de etileno, principalmente o polietileno, bem como dos polímeros a base de propileno, principalmente o polipropileno, mostrando a tendência em relação a novos produtos, mercados e de concorrentes, com base em informações extraídas de documentos de patentes publicados a partir de 1990. O termo documento de patente abrange pedidos de patente publicados ou patentes concedidas. Da análise dos documentos de patente recuperados nesta pesquisa resultou uma visualização das tendência tecnológicas na indústria de poliolefinas nos mercados europeu e norte-americano, identificando e quantificando quatro indicadores tecnológicos: catalisadores, características da molécula, tipo de produto e campo de aplicação. Uma conclusão importante diz respeito à concentração de tecnologia, onde se observa que 6% das empresas com atividade em patenteamento detêm cerca de 40% do total de documentos, sendo que somente as quatro maiores depositárias dominam mais de 20% do total. Nota-se uma tendência de as empresas em buscar a inovação nas etapas finais da cadeia produtiva, com uma grande concentração de patentes em produtos e melhoria de aplicação.This article offers a strategic assessment of the technology for the production of polymers based on ethylene and propylene (mainly polyethylene and polypropylene, demonstrating the trends related to new products, markets and competitors, based on information extracted from patent documents published since 1990. The term "patent document" covers published patent applications or granted patents. A vision of the technological trends in the polyolefin industry in Europe and North America has been elucidated based upon the analysis of the patent documents studied during this research, and four technological indicators were identified and quantified: catalysts, molecular attributes, product type and

  1. Patent licensing and selling to China as a strategy of technology transfer in a New Era: A perspective of European firms

    DEFF Research Database (Denmark)

    Li, Ying; Meijer, Elise; Duysters, Geert

    2010-01-01

    International technology transfer enables firms in developed countries to exploit the value of their technological innovations, and provides firms in developing countries with access to technological and organizational knowledge. This study aims to present a timely description of the experience...... and intentions of EU firms with regard to patent licensing and/or selling to China in this new era. Firms from 12 European countries in various industries were surveyed by an online questionnaire. We found that (1) large and small EU firms are very different with regard to the number of non...

  2. Exploring gender differences in patenting in Spain

    OpenAIRE

    Elba Mauleón; Cinzia Daraio; Maria Bordons

    2013-01-01

    The under-representation of women in science and technology is a matter of current great concern. Obtaining patent-based indicators by gender is crucial to analyse the situation of women in innovation, identify potential cases of gender inequalities, and support policy measures to promote gender balance. In this article we analyse men and women involvement in Spanish patents applied to the European Patent Office during 1990--2004. At least one female inventor is present in 18% of the patents;...

  3. NREL Patents Method for Continuous Monitoring of Materials During

    Science.gov (United States)

    Manufacturing | News | NREL NREL Patents Method for Continuous Monitoring of Materials During Manufacturing News Release: NREL Patents Method for Continuous Monitoring of Materials During Manufacturing NREL's Energy Systems Integration Facility (ESIF). More information, including the published patent, can

  4. Do Military Personnel Patent

    Science.gov (United States)

    2016-12-01

    following questions: In what fields are military personnel most likely to patent, and how do demographics, such as age, race, and gender , along with...technologies, which have transformed how the United States wages war. DARPA continues to develop new technologies and capabilities for the U.S. military today...build the European navies so it instead decided to utilize an innovative ship design to exploit a gap specific to the British Royal Navy. The six

  5. Eliminating Postoperative Nausea and Vomiting in Outpatient Surgery with Multimodal Strategies including Low Doses of Nonsedating, Off-Patent Antiemetics: Is “Zero Tolerance“ Achievable?

    Directory of Open Access Journals (Sweden)

    Susan J. Skledar

    2007-01-01

    Full Text Available For ondansetron, dexamethasone, and droperidol (when used for prophylaxis, each is estimated to reduce risk of postoperative nausea and/or vomiting (PONV by approximately 25%. Current consensus guidelines denote that patients with 0–1 risk factors still have a 10–20% risk of encountering PONV, but do not yet advocate routine prophylaxis for all patients with 10–20% risk. In ambulatory surgery, however, multimodal prophylaxis has gained favor, and our previously published experience with routine prophylaxis has yielded PONV rates below 10%. We now propose a “zero-tolerance” antiemetic algorithm for outpatients that involves routine prophylaxis by first avoiding volatile agents and opioids to the extent possible, using locoregional anesthesia, multimodal analgesia, and low doses of three nonsedating off-patent antiemetics. Routine oral administration (immediately on arrival to the ambulatory surgery suite of perphenazine 8 mg (antidopaminergic or cyclizine 50 mg (antihistamine, is followed by dexamethasone 4 mg i.v. after anesthesia induction (dexamethasone is avoided in diabetic patients. At the end of surgery, ondansetron (4 mg i.v., now off-patent is added. Rescue therapy consists of avoiding unnecessary repeat doses of drugs acting by the same mechanism: haloperidol 2 mg i.v. (antidopaminergic is prescribed for patients pretreated with cyclizine or promethazine 6.25 mg i.v. (antihistamine for patients having been pretreated with perphenazine. If available, a consultation for therapeutic acupuncture procedure is ordered. Our approach toward “zero tolerance” of PONV emphasizes liberal identification of and prophylaxis against common risks.

  6. Recent patents and technology transfer for molecular diagnosis of β-thalassemia and other hemoglobinopathies.

    Science.gov (United States)

    Breveglieri, Giulia; Finotti, Alessia; Borgatti, Monica; Gambari, Roberto

    2015-01-01

    Biological tests and genetic analyses for diagnosis and characterization of hematological diseases in health laboratories are designed with the aim of meeting the major medical needs of hospitals and pharmaceutical companies involved in this field of applied biomedicine. Genetic testing approaches to perform diagnosis consist of molecular techniques, which should be absolutely reproducible, fast, sensitive, cheap, and portable. Biological tests analyzed involve adult/newborn subjects, whereas genetic analyses involve adult thalassemia patients, newborns, embryos/fetuses (including non-invasive prenatal diagnosis), pre-implantation embryos, and pre-fertilization oocytes. The most recent findings in the diagnostic approach for β-thalassemias are related to three major fields of investigation: moving towards ultrasensitive methodologies for effective detection of the primary causative mutation of β-thalassemia, including the development of polymerase chain reaction-free approaches and non-invasive prenatal diagnosis; comparing analyses of the genotype of β-thalassemia patients to high-HbF-associated polymorphisms; introducing whole genome association assays and next-generation sequencing. All these issues should be considered and discussed in the context of several aspects, including regulatory, ethical and social issues. DNA sequence data aligned with the identification of genes central to the induction, development, progression, and outcome of β-thalassemia will be a key point for directing personalized therapy.

  7. The role of patent and non-patent databases in patent research in universities

    Science.gov (United States)

    Tolstaya, A. M.; Suslina, I. V.; Tolstaya, P. M.

    2017-01-01

    This studies deal with the description and systematization of the popular patent retrieval resources. The importance of the non-patent information when conducting patent research for the intellectual property created in educational and scientific activity of the university is highlighted. The differences in the patent and non-patent information are found out. Based on the databases` analysis the authors conducted the patent research on "Wireless endoscopic capsules" (development of the NRNU MEPhI). This study can be used to facilitate the university work on the new product development in order to improve the efficiency of the process of the commercialization of the intellectual activity results, including the entering the international market.

  8. Patent citation network in nanotechnology (1976-2004)

    International Nuclear Information System (INIS)

    Li Xin; Chen Hsinchun; Huang Zan; Roco, Mihail C.

    2007-01-01

    The patent citation networks are described using critical node, core network, and network topological analysis. The main objective is understanding of the knowledge transfer processes between technical fields, institutions and countries. This includes identifying key influential players and subfields, the knowledge transfer patterns among them, and the overall knowledge transfer efficiency. The proposed framework is applied to the field of nanoscale science and engineering (NSE), including the citation networks of patent documents, submitting institutions, technology fields, and countries. The NSE patents were identified by keywords 'full-text' searching of patents at the United States Patent and Trademark Office (USPTO). The analysis shows that the United States is the most important citation center in NSE research. The institution citation network illustrates a more efficient knowledge transfer between institutions than a random network. The country citation network displays a knowledge transfer capability as efficient as a random network. The technology field citation network and the patent document citation network exhibit a less efficient knowledge diffusion capability than a random network. All four citation networks show a tendency to form local citation clusters

  9. The Coordination of Independently-Owned Vacuum Tube Patents in the Alleged Early Radio Patent Thicket

    DEFF Research Database (Denmark)

    Howells, John; Ron D, Katznelson

    -examines the legal trajectories and entrepreneurial exploitation of these patents with a focus on vacuum tube technology where Fleming’s diode patent ‘overlapped’ with earlier prior art and, dependent on court decisions, with later commercial implementations of De Forest’s triode patents. We show, by means...... of the relevant historical record, patent claims, litigation records and other relevant law, how the ‘overlapping’ patent rights were resolved by the courts and by the immunity of suppliers to the Government from patent infringement liability. We trace the cross-licensing agreements between the different radio...

  10. 75 FR 43555 - Experian, Global Technology Services, a Subsidiary of Experian, Including a Leased Employee From...

    Science.gov (United States)

    2010-07-26

    ... Technology Services, a Subsidiary of Experian, Including a Leased Employee From Tapfin Working Off-Site in... Experian, Global Technology Services, a subsidiary of Experian, including on-site leased workers from... control of the Schaumburg, Illinois location of Experian, Global Technology Services, a subsidiary of...

  11. 76 FR 175 - Faurecia Emissions Control Technologies Including On-Site Leased Workers From Adecco Employment...

    Science.gov (United States)

    2011-01-03

    ... Technologies Including On-Site Leased Workers From Adecco Employment Servcies and Emcon Technologies, Troy, MI..., applicable to workers of Faurecia Emissions Control Technologies, Troy, Michigan, including on-site leased workers from Adecco Employment Services, Troy, Michigan. The Department's notice of determination was...

  12. Panorama dos pedidos de patente de tecnologias relativas ao setor têxtil brasileiro | A panorama of patent requests for Brazilian textile sector technologies

    Directory of Open Access Journals (Sweden)

    Ricardo C. Rodrigues

    2015-10-01

    sector, deposited and published in Brazil between 1999 and 2009. On this database we analysed results showing countries and firms interested in the Brazilian market; the products, processes and or equipment which may constitute innovations; as well as the present status of the textile sector in terms of reseach and development. Keywords: Industrial Property; Textile Industry; Management; Technology.

  13. Discrimination against foreigners in the patent system : evidence from standard-essential patents

    NARCIS (Netherlands)

    de Rassenfosse, G.; Raiteri, E.; Bekkers, R.N.A.

    This paper tests for traces of discrimination against foreign firms in the patent prosecution process. It focuses on the case of China and looks specifically at patent applications declared as essential to a technological standard. The choice of standard-essential patents (SEPs) is particularly

  14. Discrimination in the patent system: evidence from standard-essential patents

    NARCIS (Netherlands)

    de Rassenfosse, G.; Raiteri, E.; Bekkers, R.N.A.

    2017-01-01

    This paper tests for traces of discrimination against foreigners in the patent prosecution process. It focuses on the case of China and looks specifically at patent applications declared as essential to a technological standard, so called standard-essential patents. The identification strategy

  15. The clinical impact of vehicle technology using a patented formulation of benzoyl peroxide 5%/clindamycin 1% gel: comparative assessments of skin tolerability and evaluation of combination use with a topical retinoid.

    Science.gov (United States)

    Del Rosso, James Q; Tanghetti, Emil

    2006-02-01

    A major challenge encountered in clinical practice in patients with acne vulgaris is irritation related to topical medications used for treatment. Advances in vehicle technology have improved formulations containing active ingredients known to produce irritation in some patients, such as benzoyl peroxide (BP) and topical retinoids. Clinical studies, including combination therapy studies have demonstrated that certain additives, such as silicates and specific humectants, reduce irritation by maintaining barrier integrity. A patented gel formulation of BP 5%/clindamycin phosphate 1% (clindamycin) containing dimethicone and glycerin has been studied both as a monotherapy and in combination with topical retinoid use. This article evaluates specific vehicle additives included in this gel formulation and explains their role in reducing irritation. Data from clinical trials utilizing this technology in acne management are also reviewed.

  16. Imitation, patent protection and welfare

    NARCIS (Netherlands)

    Mukherjee, A.; Pennings, H.P.G.

    2000-01-01

    Once a new technology has been invented it is shown that the innovator has an incentive to postpone technology adoption when the cost of imitation is high and patent protection is strong. With the possibility of licensing it is shown that licensing oftechnology instead of delaying technology

  17. Effect of firm variables on patent price

    Directory of Open Access Journals (Sweden)

    Shyam Sreekumaran Nair

    2012-03-01

    Full Text Available In this study, using singleton patent auction price data from Ocean Tomo, LLC, we analyse the effect of firm variables on patent price. Patents owned by small firms attract higher price than patents owned by large firms, if they engage in multi-country filings. The patents owned by small firms get cited more than the patents owned by large firms. The patents owned by individual inventors attract a higher price than the patents owned by organisations when multi-country filings are not included. We believe that the lack of resources is preventing individual inventors from engaging in multi-country filings and maximising the revenue from their invention. A larger representative data should be used to replicate the results before generalising it.

  18. 75 FR 71464 - Metlife Technology, Operations, and Information Technology Groups Including On-Site Leased...

    Science.gov (United States)

    2010-11-23

    ... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-73,210; TA-W-73,210A] Metlife... negative determination regarding the eligibility of workers and former workers of MetLife, Technology... revised certification, and all workers in the group threatened with total or partial separation from...

  19. Identification of the Key Fields and Their Key Technical Points of Oncology by Patent Analysis.

    Science.gov (United States)

    Zhang, Ting; Chen, Juan; Jia, Xiaofeng

    2015-01-01

    This paper aims to identify the key fields and their key technical points of oncology by patent analysis. Patents of oncology applied from 2006 to 2012 were searched in the Thomson Innovation database. The key fields and their key technical points were determined by analyzing the Derwent Classification (DC) and the International Patent Classification (IPC), respectively. Patent applications in the top ten DC occupied 80% of all the patent applications of oncology, which were the ten fields of oncology to be analyzed. The number of patent applications in these ten fields of oncology was standardized based on patent applications of oncology from 2006 to 2012. For each field, standardization was conducted separately for each of the seven years (2006-2012) and the mean of the seven standardized values was calculated to reflect the relative amount of patent applications in that field; meanwhile, regression analysis using time (year) and the standardized values of patent applications in seven years (2006-2012) was conducted so as to evaluate the trend of patent applications in each field. Two-dimensional quadrant analysis, together with the professional knowledge of oncology, was taken into consideration in determining the key fields of oncology. The fields located in the quadrant with high relative amount or increasing trend of patent applications are identified as key ones. By using the same method, the key technical points in each key field were identified. Altogether 116,820 patents of oncology applied from 2006 to 2012 were retrieved, and four key fields with twenty-nine key technical points were identified, including "natural products and polymers" with nine key technical points, "fermentation industry" with twelve ones, "electrical medical equipment" with four ones, and "diagnosis, surgery" with four ones. The results of this study could provide guidance on the development direction of oncology, and also help researchers broaden innovative ideas and discover new

  20. The Academic Advantage: Gender Disparities in Patenting

    Science.gov (United States)

    Sugimoto, Cassidy R.; Ni, Chaoqun; West, Jevin D.; Larivière, Vincent

    2015-01-01

    We analyzed gender disparities in patenting by country, technological area, and type of assignee using the 4.6 million utility patents issued between 1976 and 2013 by the United States Patent and Trade Office (USPTO). Our analyses of fractionalized inventorships demonstrate that women’s rate of patenting has increased from 2.7% of total patenting activity to 10.8% over the nearly 40-year period. Our results show that, in every technological area, female patenting is proportionally more likely to occur in academic institutions than in corporate or government environments. However, women’s patents have a lower technological impact than that of men, and that gap is wider in the case of academic patents. We also provide evidence that patents to which women—and in particular academic women—contributed are associated with a higher number of International Patent Classification (IPC) codes and co-inventors than men. The policy implications of these disparities and academic setting advantages are discussed. PMID:26017626

  1. The academic advantage: gender disparities in patenting.

    Directory of Open Access Journals (Sweden)

    Cassidy R Sugimoto

    Full Text Available We analyzed gender disparities in patenting by country, technological area, and type of assignee using the 4.6 million utility patents issued between 1976 and 2013 by the United States Patent and Trade Office (USPTO. Our analyses of fractionalized inventorships demonstrate that women's rate of patenting has increased from 2.7% of total patenting activity to 10.8% over the nearly 40-year period. Our results show that, in every technological area, female patenting is proportionally more likely to occur in academic institutions than in corporate or government environments. However, women's patents have a lower technological impact than that of men, and that gap is wider in the case of academic patents. We also provide evidence that patents to which women--and in particular academic women--contributed are associated with a higher number of International Patent Classification (IPC codes and co-inventors than men. The policy implications of these disparities and academic setting advantages are discussed.

  2. Absorptive routines and international patent performance

    Directory of Open Access Journals (Sweden)

    Fernando E. García-Muiña

    2017-04-01

    We enrich the treatment of the absorptive capacity phases including the moderating effects between routines associated to the traditional potential-realized absorptive capacities. Taking into account external knowledge search strategies, the deeper external relationships, the better transference and appropriation of specific external knowledge. Nevertheless, when the moderating role of assimilation is included, cooperation agreements appear as the most efficient source of external knowledge. Finally, we show that technological tools let firms store and structure the information making easier its use for international patenting. This positive effect is reinforced in the presence of exploitation routines, since technological knowledge will better fit to the industry's key factors of success.

  3. Alienation from the Objectives of the Patent System: How to Remedy the Situation of Biotechnology Patent.

    Science.gov (United States)

    Jiang, Li

    2018-03-12

    Some fundamental biotechnologies hold unprecedented potential to eradicate many incurable diseases. However, in absence of regulations, the power of patent makes the future use of some important biotechnology in few institution's hands. The excessive patents restrict researcher access to the fundamental technologies. It generates concerns and complaints of deteriorating the public health and social welfare. Furthermore, intellectual curiosities, funding, respect among colleagues etc., rather than patents, are the real motivations driving a major ground-breaking discoveries in biotechnology. These phenomena reveal that some biotechnology patents are alienated from the purpose of patent system. Therefore, it is necessary to take some approaches to stop over-patenting these fundamental biotechnology inventions. This article proposes a model regulatory framework for controlling biotechnology patent alienating from the purpose of patent system.

  4. Patent challenges for standard-setting in the global economy : lessons from information and communication industry

    NARCIS (Netherlands)

    Maskus, K.; Merrill, S.A.; Bekkers, R.N.A.; Sandy Block, Marc; Contreras, Jorge; Gilbert, Richard; Goodman, David; Marasco, Amy; Simcoe, Tim; Smoot, Oliver; Suttmeier, Richard; Updegrove, Andrew

    2014-01-01

    Patent Challenges for Standard-Setting in the Global Economy: Lessons from Information and Communication Technology examines how leading national and multinational standard-setting organizations (SSOs) address patent disclosures, licensing terms, transfers of patent ownership, and other issues that

  5. Implementation of Research and Development Based on Patent Natural Ingredients and Potential Utilization of Tradition Medicine

    Directory of Open Access Journals (Sweden)

    Tommy Hendrix

    2016-12-01

    Full Text Available The results of research and development based on natural ingredients for traditional medicines become an interesting topic to discuss at this point; it’s shown from increasing number in utilization. The use of traditional medicine especially on natural ingredients at this moment becomes effective solution to increase the level of market acceptance in herbal extracts, including an affordable purchase from potential utilization of natural resources which are owned. By using Matheo Patent XE Ver 10.2 as methodology of searching, we can know potentials useful through strategy, research and development, patent analysis and patent collaboration among users in utilization of Natural Ingredient for Traditional Medicine. From the data result shows majority in the field of chemistry for human necessity related to Health; Amusement; Medical or Veterinary Science; Hygiene sectors with total patent 108, family 65. The use of patent analysis is a way to find how the development of technology and products that have been produced and how commercial processes connecting with technology users, especially in traditional medicine. From the data that exist in particular of patents, it is critical to identify the number of patents that has been registered through the innovation process development including technology dissemination is used.

  6. The Patentability of Stem Cells in Australia.

    Science.gov (United States)

    Petering, Jenny; Cowin, Prue

    2015-07-01

    The potential therapeutic applications of stem cells are unlimited. However, the ongoing political and social debate surrounding the intellectual property and patenting considerations of stem cell research has led to the implementation of strict legislative regulations. In Australia the patent landscape surrounding stem cells has evolved considerably over the past 20 years. The Australian Patents Act 1990 includes a specific exclusion to the patentability of human beings and of biological processes for their generation. However, this exclusion has received no judicial consideration to date, and so its scope and potential impact on stem cell patents is unclear. Copyright © 2015 Cold Spring Harbor Laboratory Press; all rights reserved.

  7. How patent experts create patent breadth

    DEFF Research Database (Denmark)

    Beukel, Karin

    2014-01-01

    Science as an input to patented inventions is a fundamental of economic growth. However, our understanding of how science is transformed into patents is limited. In the present paper I seek to fill this gap by examining the micro-foundations of science-patent transformations. Using an inductive......, grounded theory approach to study the transformation of 12 scientific discoveries into patents I recast the relationship between science and patents: I show it as a particular process that affects patent breadth. Exploiting surplus patent breadth depends on the processes of abstraction and cognitive...... variety, which can be mobilized by patenting experts. The theory is tested using a recently published algebraic interpretive method for examining causal relationships in small-N studies....

  8. How patent experts create patent breadth

    DEFF Research Database (Denmark)

    Beukel, Karin

    2018-01-01

    Science as an input to patented inventions is a fundamental of economic growth. However, our understanding of how science is transformed into patents is limited. In the present paper I seek to fill this gap by examining the micro-foundations of science-patent transformations. Using an inductive......, grounded theory approach to study the transformation of 12 scientific discoveries into patents I recast the relationship between science and patents: I show it as a particular process that affects patent breadth. Exploiting surplus patent breadth depends on the processes of abstraction and cognitive...... variety, which can be mobilized by patenting experts. The theory is tested using a recently published algebraic interpretive method for examining causal relationships in small-N studies....

  9. 76 FR 35474 - UAW-Chrysler Technical Training Center, Technology Training Joint Programs Staff, Including On...

    Science.gov (United States)

    2011-06-17

    ...-Chrysler Technical Training Center, Technology Training Joint Programs Staff, Including On-Site Leased Workers From Cranks, O/E Learning, DBSI, IDEA, and Tonic/MVP, Detroit, MI; UAW-Chrysler Technical Training... workers and former workers of UAW-Chrysler Technical Training Center, Technology Training Joint Programs...

  10. Investigation of Techno-Stress Levels of Teachers Who Were Included in Technology Integration Processes

    Science.gov (United States)

    Çoklar, Ahmet Naci; Efilti, Erkan; Sahin, Yusef Levent; Akçay, Arif

    2016-01-01

    Techno-stress is defined as a modern adaptation disorder resulting from the failure in coping with new technologies in a healthy way. Techno-stress affects many occupational groups, including teachers. FATIH project and many other previous studies conducted in Turkey in recent years have necessitated the use of technology for teachers. The present…

  11. A study of fuel cell patenting activity in Canada

    International Nuclear Information System (INIS)

    Lee, B.Y.; Sajewycz, M.

    2004-01-01

    'Full text:' A patent application is generally filed shortly after completion of research and development; therefore, patent filing statistics provide insight into the state of innovation of a technology. A study has been conducted on fuel cell patenting activity in Canada. This study examines fuel cell patenting trends between 1989-2003 and specific activity in 2001, identifies the major players in the Canadian fuel cell industry, and examines the patent landscape by fuel cell technology. Our results show that historically, Canadians have been leaders at home and abroad in fuel cell innovation. However, Canadians have recently fallen behind in protecting their patent rights at home, and now rank fourth behind German, American and Japanese fuel cell patent filers in the Canadian patent office. However, our data also shows that a significant number of new Canadian entities have emerged and have been very active filing new patent applications. These new entities as well as established Canadian companies are examined in detail. (author)

  12. Patent first, ask questions later: morality and biotechnology in patent law.

    Science.gov (United States)

    Bagley, Margo A

    2003-12-01

    This Article explores the U.S. "patent first, ask questions later" approach to determining what subject matter should receive patent protection. Under this approach, the U.S. Patent and Trademark Office (USPTO or the Agency) issues patents on "anything under the sun made by man," and to the extent a patent's subject matter is sufficiently controversial, Congress acts retrospectively in assessing whether patents should issue on such interventions. This practice has important ramifications for morally controversial biotechnology patents specifically, and for American society generally. For many years a judicially created "moral utility" doctrine served as a type of gatekeeper of patent subject matter eligibility. The doctrine allowed both the USTPO and courts to deny patents on morally controversial subject matter under the fiction that such inventions were not "useful." The gate, however, is currently untended. A combination of the demise of the moral utility doctrine, along with expansive judicial interpretations of the scope of patent-eligible subject matter, has resulted in virtually no basis on which the USTPO or courts can deny patent protection to morally controversial, but otherwise patentable, subject matter. This is so despite position statements by the Agency to the contrary. Biotechnology is an area in which many morally controversial inventions are generated. Congress has been in react-mode following the issuance of a stream of morally controversial biotech patents, including patents on transgenic animals, surgical methods, and methods of cloning humans. With no statutory limits on patent eligibility, and with myriad concerns complicating congressional action following a patent's issuance, it is not Congress, the representative of the people, determining patent eligibility. Instead, it is patent applicants, scientific inventors, who are deciding matters of high public policy through the contents of the applications they file with the USTPO. This Article

  13. Patent business guide in a domestic and foreign countries

    International Nuclear Information System (INIS)

    2009-09-01

    This book explains general things on industrial property right, which includes description of industrial property right, types, qualification for application of patent, application guide, on-line application, useful procedure of application, writing methods and samples for application of patents such as design patent and trademarks patent, writing skill and examples for registration, writing ways and examples related examination and writing tips and samples on international application of patent.

  14. Performance of Patenting Firms in Danish Manufacturing

    DEFF Research Database (Denmark)

    Madsen, Erik Strøjer; Smith, Valdemar; Nielsen, Anders Østergaard

    2000-01-01

    Most countries focus on industries with high technology and the governments grant subsidies to innovating firms. However, there has been remarkable few studies of the performance of innovative firms or industries. This study examines the performance of patent active firms compared to the non-patenting...... firms within the manufacturing sector in Denmark. Performance is measured both by growth in employment as well as in the return on equity and profit share in turnover. The results suggest that differences in performance of patenting and non-patenting firms are very small, which questions the political...

  15. IMPROVEMENT OF LIFE SUPPORT SYSTEMS OF PASSENGER ROLLING STOCK: PATENT REVIEW

    Directory of Open Access Journals (Sweden)

    S. R. Kolesnykov

    2018-02-01

    Full Text Available Purpose. Inventors and researchers of the world are focused on improvements of basic life support systems including provision of quality microclimate parameters in a car of the rolling stock. The research is aimed at reviewing and analyzing patents in the field of climate comfort, heating, ventilation and air conditioning (CCHVAC of railway passenger cars (the chronological framework: 2011-2017 from the date of publication. Мethodology. During the study there were reviewed patents (foreign and domestic ones in the field of CCHVAC in passenger vehicles, in particular railway cars, their optimization and ways of managing them. Patent search was carried out according to certain search criteria: keywords, time frames and in various patent systems of the world. An interdisciplinary approach was used. Findings. Based on the search results, 157 patents were found, 21 documents of which were selected for analysis. Patents are systematized into three groups: "New technical and technological solutions in systems and functioning facilities of HVAC ", "New and improved solutions for HVAC system management in a vehicle", "Air ozonation in passenger cars". It is established that all patents have one of the aspects that have solutions to the issues of more environmentally friendly, energy efficient and safe application of CCHVAC systems in railway transport. Originality. It was proved a high level of link penetration in various technical fields, which include patents with CCHVAC. It is established that it is characteristic for them to designate the majority of patent solutions for use not in the purely railway industry, but in transport in general. Practical value. Confirmation of the high level of link penetration in various technical fields will make it possible to reflect technical problems with CCHVAC and technologies for their solution throughout the world. This will contribute to a more intensive technological upgrade in the improvement of life support

  16. The NBER Patent Citation Data File: Lessons, Insights and Methodological Tools

    OpenAIRE

    Bronwyn H. Hall; Adam B. Jaffe; Manuel Trajtenberg

    2001-01-01

    This paper describes the database on U.S. patents that we have developed over the past decade, with the goal of making it widely accessible for research. We present main trends in U. S. patenting over the last 30 years, including a variety of original measures constructed with citation data, such as backward and forward citation lags, indices of 'originality' and 'generality', self-citations, etc. Many of these measures exhibit interesting differences across the six main technological categor...

  17. 32 CFR 37.875 - Should my TIA include a provision concerning foreign access to technology?

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 1 2010-07-01 2010-07-01 false Should my TIA include a provision concerning... Related to Other Administrative Matters Intellectual Property § 37.875 Should my TIA include a provision... provision in the TIA that addresses foreign access to technology developed under the TIA. (b) The provision...

  18. Using virtual reality technology to include field operators in simulation and training

    International Nuclear Information System (INIS)

    Nystad, E.; Strand, S.

    2006-01-01

    By using virtual reality technology, field operators can be included in simulator training. A study has been performed where field operators could perform their activities in a virtual plant and communicate with a control room operator who was placed in a physical control room simulator. This paper describes the use of VR technology in the study and how the operators experienced interacting with the virtual plant. (author)

  19. Patents in INIS

    International Nuclear Information System (INIS)

    Scheel, H.; Breitfeld, B.

    1983-01-01

    Proceeding from the INIS rules for collecting, characterizing, and making available patent documents, results of an analysis are presented, which concern timeliness, origin, and classification of patents according to the INIS subject categories and the International Patent Classification. GDR's capabilities for SDI services and retrospective searches are outlined taking into account patents. For a selected subject area (IPC G21) the coverage of patents announced by INIS was found to be about 30%

  20. 77 FR 48733 - Transitional Program for Covered Business Method Patents-Definitions of Covered Business Method...

    Science.gov (United States)

    2012-08-14

    ... Office 37 CFR Part 42 Transitional Program for Covered Business Method Patents--Definitions of Covered... Business Method Patents-- Definitions of Covered Business Method Patent and Technological Invention AGENCY... forth in detail the definitions of the terms ``covered business method patent'' and ``technological...

  1. Bibliography of US patents on augmentation of convective heat and mass transfer

    International Nuclear Information System (INIS)

    Webb, R.L.; Junkhan, G.H.; Bergles, A.E.

    1980-09-01

    Granted patents are an important source of information on the potential commercialization of augmented heat transfer technology. This report presents a bibliography of US patents pertinent to that technology. The total number of patents cited is 321. They are presented in three separate lists: by patent number, alphabetically by first inventor, and by augmentation techniques

  2. 75 FR 1591 - Green Technology Pilot Program

    Science.gov (United States)

    2010-01-12

    ... DEPARTMENT OF COMMERCE Patent and Trademark Office Green Technology Pilot Program ACTION: Proposed... methods: E-mail: [email protected] . Include A0651-0062 Green Technology Pilot Program [email protected] in... (USPTO) is implementing a streamlined examination pilot program for patent applications pertaining to...

  3. Annual Technology Baseline (Including Supporting Data); NREL (National Renewable Energy Laboratory)

    Energy Technology Data Exchange (ETDEWEB)

    Blair, Nate; Cory, Karlynn; Hand, Maureen; Parkhill, Linda; Speer, Bethany; Stehly, Tyler; Feldman, David; Lantz, Eric; Augusting, Chad; Turchi, Craig; O' Connor, Patrick

    2015-07-08

    Consistent cost and performance data for various electricity generation technologies can be difficult to find and may change frequently for certain technologies. With the Annual Technology Baseline (ATB), National Renewable Energy Laboratory provides an organized and centralized dataset that was reviewed by internal and external experts. It uses the best information from the Department of Energy laboratory's renewable energy analysts and Energy Information Administration information for conventional technologies. The ATB will be updated annually in order to provide an up-to-date repository of current and future cost and performance data. Going forward, we plan to revise and refine the values using best available information. The ATB includes both a presentation with notes (PDF) and an associated Excel Workbook. The ATB includes the following electricity generation technologies: land-based wind; offshore wind; utility-scale solar PV; concentrating solar power; geothermal power; hydropower plants (upgrades to existing facilities, powering non-powered dams, and new stream-reach development); conventional coal; coal with carbon capture and sequestration; integrated gasification combined cycle coal; natural gas combustion turbines; natural gas combined cycle; conventional biopower. Nuclear laboratory's renewable energy analysts and Energy Information Administration information for conventional technologies. The ATB will be updated annually in order to provide an up-to-date repository of current and future cost and performance data. Going forward, we plan to revise and refine the values using best available information.

  4. Essential patents in industry standards : the case of UMTS

    NARCIS (Netherlands)

    Bekkers, R.N.A.; Bongard, R.; Nuvolari, A.

    2009-01-01

    We study the determinants of essential patents in industry standards. In particular, we assess the role of two main factors: the significance of the technological solution contained in the patent and the involvement of the applicant of the patent in the standardization process. To this end, we

  5. 77 FR 38771 - Prospective Grant of Exclusive Patent License

    Science.gov (United States)

    2012-06-29

    ... Exclusive Patent License AGENCY: National Institute of Standards and Technology, Department of Commerce. ACTION: Notice of prospective grant of exclusive patent license. SUMMARY: This is a notice in accordance... embodied in U.S. Patent Application No. 13/346,999 titled ``Chirped-Pulse Terahertz Spectroscopy for...

  6. 77 FR 65673 - Prospective Grant of Exclusive Patent License

    Science.gov (United States)

    2012-10-30

    ... Exclusive Patent License AGENCY: National Institute of Standards and Technology, Commerce. ACTION: Notice of prospective grant of exclusive patent license. SUMMARY: This is a notice in accordance with 35 U.S.C. 209(e.... Patent Application No. 61/625,511 titled ``UV-Assisted Alcohol Sensing with Zinc Oxide Functionalized...

  7. 77 FR 48130 - Prospective Grant of Exclusive Patent License

    Science.gov (United States)

    2012-08-13

    ... Exclusive Patent License AGENCY: National Institute of Standards and Technology, Commerce. ACTION: Notice of prospective grant of exclusive patent license. SUMMARY: This is a notice in accordance with 35 U.S.C. 209(e... Provisional Application for Patent Application No. 61,638,362 titled ``Flow Cytometer Systems and Associated...

  8. Teaching Chemistry Students How To Use Patent Databases and Glean Patent Information

    Science.gov (United States)

    MacMillan, Margy; Shaw, Lawton

    2008-07-01

    Patent literature is an important source of chemical information that is often neglected by chemical educators. This paper describes an effort to teach chemistry students how to use patent databases to search for information on applied chemical technology related to the manufacture of industrial and specialty chemicals. Students in a second-year-level organic chemistry class were shown how to search patent literature as part of a group research paper assignment that involved determining the feasibility of starting an industrial chemical operation to manufacture a given industrial chemical. Students who were assigned high value or specialty chemicals were most likely to cite patent literature in their final papers. Students who were assigned plastics or bulk commodity chemicals were less likely to cite patents. It is suggested that students made choices about the usefulness of patent literature and that patents were most useful when current patents existed and provided the patent owner a competitive advantage. For plastics or commodity chemicals, manufacturing technologies tend to be mature and are well described by more accessible information sources. Suggestions are made for effective introduction of patent literature instruction into upper-level chemistry courses.

  9. Nanotechnology patents in the automotive industry (a quantitative & qualitative analysis).

    Science.gov (United States)

    Prasad, Raghavendra; Bandyopadhyay, Tapas K

    2014-01-01

    The aim of the article is to present a trend in patent filings for application of nanotechnology to the automobile sector across the world, using the keyword-based patent search. Overviews of the patents related to nano technology in the automobile industry have been provided. The current work has started from the worldwide patent search to find the patents on nanotechnology in the automobile industry and classify the patents according to the various parts of an automobile to which they are related and the solutions which they are providing. In the next step various graphs have been produced to get an insight into various trends. In next step, analysis of patents in various classifications, have been performed. The trends shown in graphs provide the quantitative analysis whereas; the qualitative analysis has been done in another section. The classifications of patents based on the solution they provide have been performed by reading the claims, titles, abstract and full texts separately. Patentability of nano technology inventions have been discussed in a view to give an idea of requirements and statutory bars to the patentability of nanotechnology inventions. Another objective of the current work is to suggest appropriate framework for the companies regarding use of nano technology in the automobile industry and a suggestive strategy for patenting of the inventions related to the same. For example, US Patent, with patent number US2008-019426A1 discusses the invention related to Lubricant composition. This patent has been studied and classified to fall under classification of automobile parts. After studying this patent, it is deduced that, the problem of friction in engine is being solved by this patent. One classification is the "automobile part" based while other is the basis of "problem being solved". Hence, two classifications, namely reduction in friction and engine were created. Similarly, after studying all the patents, a similar matrix has been created.

  10. 78 FR 8587 - Thomson Reuters, Finance Operations & Technology Division, Including On-Site Leased Workers From...

    Science.gov (United States)

    2013-02-06

    ... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-81,755] Thomson Reuters, Finance Operations & Technology Division, Including On-Site Leased Workers From Adecco; Eagan, MN; Amended Certification Regarding Eligibility To Apply for Worker Adjustment Assistance In accordance with Section 223 of the Trade Act of 1974, as amended (`...

  11. Patentability of inventions under the Nigeria's patents and designs act

    African Journals Online (AJOL)

    Patentability of inventions under the Nigeria's patents and designs act: an examination. ... AFRICAN JOURNALS ONLINE (AJOL) · Journals · Advanced Search · USING ... The Nigerian Patent Registry refuses patent applications for Software or ...

  12. Litigation-proof patents: avoiding the most common patent mistakes

    National Research Council Canada - National Science Library

    Goldstein, Larry M

    2014-01-01

    "Litigation-Proof Patents: Avoiding the Most Common Patent Mistakes explains the principles of excellent patents, presents the ten most common errors in patents, and details a step-by-step method for avoiding these common errors...

  13. Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines.

    Science.gov (United States)

    Gao, Zitong; Liu, Yang; Wang, Xiaoyue; Song, Jingyuan; Chen, Shilin; Ragupathy, Subramanyam; Han, Jianping; Newmaster, Steven G

    2017-07-19

    Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.

  14. Script of Healthcare Technology: Do Designs of Robotic Beds Exclude or Include Users?

    DEFF Research Database (Denmark)

    Brodersen, Søsser Grith Kragh; Hansen, Meiken; Lindegaard, Hanne

    2015-01-01

    Many new product designs are currently being implemented in the healthcare sector, and this presents designers with challenges involved in socially innovative design. In this paper, we argue that designing assistive technologies requires focus on multiple users and use practices. We see the design...... of assistive technologies as design of socio-material assemblies , which include an analysis of the products already used in relation to multiple users, their practices and wishes. In the article we focus on the challenges in the implementation of two types of robotic beds used for disability care...

  15. Microwave Technology for Waste Management Applications Including Disposition of Electronic Circuitry

    International Nuclear Information System (INIS)

    Wicks, G.G.; Clark, D.E.; Schulz, R.L.

    1998-01-01

    Advanced microwave technology is being developed nationally and internationally for a variety of waste management and environmental remediation purposes. These efforts include treatment and destruction of a vast array of gaseous, liquid and solid hazardous wastes as well as subsequent immobilization of hazardous components into leach resistant forms. Microwave technology provides an important contribution to an arsenal of existing remediation methods that are designed to protect the public and environment from the undesirable consequences of hazardous materials. One application of special interest is the treatment of discarded electronic circuitry using a new hybrid microwave treatment process and subsequent reclamation of the precious metals within

  16. Microwave technology for waste management applications including disposition of electronic circuitry

    International Nuclear Information System (INIS)

    Wicks, G.G.; Clark, D.E.; Schulz, R.L.; Folz, D.C.

    1995-01-01

    Microwave technology is being developed nationally and internationally for a variety of environmental remediation purposes. These efforts include treatment and destruction of a vast array of gaseous, liquid and solid hazardous wastes as well as subsequent immobilization of selected components. Microwave technology provides an important contribution to an arsenal of existing remediation methods that are designed to protect the public and environment from undesirable consequences of hazardous materials. Applications of microwave energy for environmental remediation will be discussed. Emphasized will be a newly developed microwave process designed to treat discarded electronic circuitry and reclaim the precious metals within for reuse

  17. The revival of Phage Therapy to fight Antimicrobial Resistance – Part II: What about patent protection and alternative incentives?

    DEFF Research Database (Denmark)

    Minssen, Timo

    2014-01-01

    Three days ago I commented on a couple of legal issues raised in the recent Nature report “Phage therapy gets revitalized” by Sara Reardon. One challenge concerns the reluctance of pharma companies to broadly invest in the development of phage therapies. As pointed out in the report, this does....... Like in Europe, the first door to patentability that phage-related technology would need to pass concerns patent eligibility. In the last years the US Supreme Court has rendered an astonishing number of fundamental patent-decisions, including not less than four (!) landmark judgments on patent...... occurring viruses, such as phages, and the processes in which these are used. Myriad and Prometheus could thus have a fundamental impact on many patent portfolios relating to phage therapy and thus business involvement. In that context, it is important to realize that an important component of proper use...

  18. Patents Consulting Use Potential for Determining the State of the Art. Analysis in Microgrids with Renewable Energy Sources

    Directory of Open Access Journals (Sweden)

    Tomás Valencia-Zuluaga

    2017-06-01

    Full Text Available In this document, we aim to show how important patent research is for technological and scientific development. We expose some of the main characteristics of patents, as well as the advantages that these documents have over the most commonly used sources of information in research, such as scientific and professional papers. We also cover the International Patent Classification, which should be known if one hopes to extract any valuable information from patents. Finally, we put everything into practice with a case of study regarding microgrids in power systems, with high penetration of renewable energy sources. With this study case, we invite the reader to include patent consulting into his or her literature research habits.

  19. The ethics of patenting human embryonic stem cells.

    Science.gov (United States)

    Chapman, Audrey R

    2009-09-01

    Just as human embryonic stem cell research has generated controversy about the uses of human embryos for research and therapeutic applications, human embryonic stem cell patents raise fundamental ethical issues. The United States Patent and Trademark Office has granted foundational patents, including a composition of matter (or product) patent to the Wisconsin Alumni Research Foundation (WARF), the University of Wisconsin-Madison's intellectual property office. In contrast, the European Patent Office rejected the same WARF patent application for ethical reasons. This article assesses the appropriateness of these patents placing the discussion in the context of the deontological and consequentialist ethical issues related to human embryonic stem cell patenting. It advocates for a patent system that explicitly takes ethical factors into account and explores options for new types of intellectual property arrangements consistent with ethical concerns.

  20. A guide of patent map

    International Nuclear Information System (INIS)

    1999-12-01

    This book introduces application and characteristic of patent information, types of patent information data and research of patent information, arrangement of patent information and patent map, analysis of patent information, necessity, writing period arrangement way of patent map, cases of patent map on selection of task of research and development, system of research and development and application, examples of PM such as MAP by year, application, technique, Inventor, and claim point map and computerization like data arrangement of PM patent, collection of analysis range and item analysis of patent, cases and written reports on patent analysis.

  1. Interações entre ciência e tecnologia: análise da produção intelectual dos pesquisadores-inventores da primeira carta-patente da UFRGS Interactions between science and technology: analysis of the intellectual production of the researchers-inventors of the first letter- patent of the UFRGS

    Directory of Open Access Journals (Sweden)

    Helen Beatriz Frota Rozados

    2006-01-01

    Full Text Available Discute questões como propriedade intelectual e industrial e diferenças existentes entre conhecimento científico e tecnológico. Busca inserir a patente no contexto da comunicação científica e tecnológica. Apresenta dados de um estudo que objetiva analisar a relação entre a informação científica e a tecnológica na produção intelectual dos pesquisadores-inventores da primeira carta-patente da Universidade Federal do Rio Grande do Sul (UFRGS. O período analisado compreende os anos anteriores à publicação do pedido da patente (1996-2000 e posteriores (2001-2005. Conclui que, no caso analisado, ocorre um fluxo entre a informação científica e tecnológica, na qual a primeira, após sua divulgação e aprovação pelos pares, subsidia a segunda. Da mesma forma, a patente gera um impacto na produção científica dos pesquisadores, ocorrendo uma retroalimentação entre ciência e tecnologia. Sugere que novos estudos sejam realizados.The paper discusses intellectual and industrial property and existing differences between scientific and technological knowledge. It aims at incorporating the patent in the context of the scientific and technological communication. It presents preliminary data of a study that aims at analyzing the relationship between scientific and technological information in the intellectual production of the researchers-inventors of the first patent from the Federal University of Rio Grande do Sul (UFRGS. It concludes that, in the case studied, a flow between scientific and technological information occurs, in which the former, after its diffusion and approval in the peer review process, subsidizes the latter. It suggests that other studies should be carried out.

  2. Patents for Soldiers

    Science.gov (United States)

    2016-06-10

    PATENTS FOR SOLDIERS A thesis presented to the Faculty of the U.S. Army Command and General Staff College in partial fulfillment...COVERED (From - To) AUG 2015 – JUNE 2016 4. TITLE AND SUBTITLE Patents for Soldiers 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM...protection of an innovative idea; that is, a patent . A Soldier’s pursuit of patents provides the Army with tangible and intangible benefits. There are on

  3. Have Chinese firms learned from their prior technology in-licensing? An analysis based on patent citations

    DEFF Research Database (Denmark)

    Li-Ying, Jason; Wang, Yuandi; Salomo, Søren

    2013-01-01

    With the rapid rise of Chinese economy, now ranking as the second largest economy in the world in 2010, many Chinese firms have started taking technological lead in the global market. Nevertheless, whether Chinese firms have learned from their prior inlicensing technologies and accumulated...

  4. Gauging a Firm's Innovative Performance Using an Integrated Structural Index for Patents

    Directory of Open Access Journals (Sweden)

    Xiaojun Hu

    2016-03-01

    Full Text Available Purpose: In this contribution we try to find new indicators to measure characteristics of a firm's patents and their influence on a company's profits. Design/methodology/approach: We realize that patent evaluation and influence on a company's profits is a complicated issue requiring different perspectives. For this reason we design two types of structural h-indices, derived from the International Patent Classification (IPC. In a case study we apply not only basic statistics but also a nested case-control methodology. Findings: The resulting indicator values based on a large dataset (19,080 patents in total from the pharmaceutical industry show that the new structural indices are significantly correlated with a firm's profits. Research limitations: The new structural index and the synthetic structural index have just been applied in one case study in the pharmaceutical industry. Practical implications: Our study suggests useful implications for patentometric studies and leads to suggestions for different sized firms to include a healthy research and development (R&D policy management. The structural h-index can be used to gauge the profits resulting from the innovative performance of a firm's patent portfolio. Originality/value: Traditionally, the breadth and depth of patents of a firm and their citations are considered separately. This approach, however, does not provide an integrated insight in the major characteristics of a firm's patents. The Sh(Y index, proposed in our investigation, can reflect a firm's innovation activities, its technological breadth, and its influence in an integrated way.

  5. Transferability and Commercialization of Patent Rights: Economic and Practical Perspectives

    Directory of Open Access Journals (Sweden)

    Haim V. Levy

    2012-01-01

    Full Text Available The transformation of innovation into commercial value depends primarily on appropriate protection of the intellectual property, usually by patents, and efficient pathway(s of its transferability as well as the transfer of the protected knowledge. The key features of patents, from an economic perspective, are that they encompass new knowledge and confer monopoly rights to the owner. The exclusiveness of patent rights is generally conceived as a necessary mechanism to ensure further innovation, stimulate advanced research and facilitate efficient market transactions with patent rights. The patent holder can transfer the technology embodied by way of granting to others a license to use the patented invention in return for a share of the revenues, usually royalties. Patent rights transferability has been proven to be efficient and profitable to the industry as well as beneficial to the welfare of society. The economic and practical perspectives of the transferability and commercialization of patent rights are discussed.

  6. Science and Technology Output Indicators in the Islamic Republic of Iran: A Case Study on the Relevance between Patents and Scientific Products of Iranian Inventors

    Directory of Open Access Journals (Sweden)

    Mohamad Alaee Arani

    2012-10-01

    Full Text Available The output of scientific products represents the efforts of scientific and industrial communities. The study on this output shows scientific attitudes and approaches of a community towards world of science. Quantitative studies can give a representation of the size and extent of the scientific efforts of researchers in special occasions, or a particular society. Patents are one of these important outputs. In this study, the names of Iranian inventors were extracted by carrying a combined search and the analysis of patent data available through Europe Patent Office (EPO, the United States Patent and Trademark Office (USPTO, Japan Patent Office (JPO, and the World Intellectual Property Organization (WIPO databases. Inventors amount of scientific products were also evaluated by using citation indexes in Thompson Reuters (formerly ISI Web of Science. Content analysis research method was adopted. Results of this study reported no significant correlation was found between scientific output and patent application. Findings also indicated a 6.5 percent contribution of patent researcher in comparison with non-patent researchers of Iranian indexed articles by Web of Science.

  7. On Sharks, Trolls, and Other Patent Animals

    DEFF Research Database (Denmark)

    Reitzig, Markus; Henkel, Joachim; Heath, Christopher

    2007-01-01

    Patent trolls (or sharks) are small patent holding individuals or firms who trap R&D intense manufacturers in patent infringement situations in order to receive damage awards for the illegitimate use of their technology. While of great concern to management, their existence and impact for both...... corporate decision makers and policy makers remains to be fully analyzed from an academic standpoint. In this paper we show why patent sharks can operate profitably, why they are of growing concern, how manufacturers can forearm themselves against them, and which issues policy makers need to address. To do...... so, we map international indemnification rules with strategic rationales of small patent-holding firms within a game-theoretical model. Our central finding is that the courts’ unrealistic consideration of the trade-offs faced by inadvertent infringers is a central condition for sharks to operate...

  8. Concerns and evidence for ex-post hold-up with essential patents

    NARCIS (Netherlands)

    Bekkers, R.N.A.

    2015-01-01

    Patented technologies may add significant value to technical standards. But the owners of patents that are necessary required in order to implement a standard (“essential patents”) obtain a particularly powerful position. One of the widely recognized risks here is patent holdup, where the patent

  9. Contemporary Aspects of Marketing in Clinical Trials Including Segments of IT and Technology Transfer.

    Science.gov (United States)

    Stamenovic, Milorad; Dobraca, Amra; Smajlovic, Mersiha

    2018-01-01

    The aim of this paper is to present the marketing strategy and the application of management (marketing management) and advertising in order to increase the efficiency of innovative approach in clinical trials that include and involve the use of new technologies and transfer of technologies. This paper has a descriptive character and represents a narrative review of the literature and new model implementation. Marketing models are primarily used to improve the inclusion of a larger (and appropriate) number of patients, but they can be credited for the stay and monitoring of patients in the trial. Regulatory mechanisms play an important role in the application of various marketing strategies within clinical trials. The value for the patient as the most important stakeholder is defined in the field of clinical trials according to Kotler's value model for the consumer. In order to achieve the best results it is important to adequately examine all the elements of clinical trials and apply this knowledge in creation of a marketing plan that will be made in accordance with the legal regulations defined globally and locally. In this paper, two challenges have been highlighted for the adequate application of marketing tools in the field of clinical trials, namely: defining business elements in order to provide an adequate marketing approach for clinical trials and technology transfer and ensuring uniformity and regulatory affirmation of marketing attitudes in clinical trials in all regions in which they are carried out in accordance with ICH-GCP and valid regulations.

  10. Inventing around Edison’s Incandescent Lamp Patent

    DEFF Research Database (Denmark)

    Howells, John; Katznelson, Ron D.

    ’s ‘898 patent. Third, by analysis of forward citation to these patents we show that regardless of these inventions’ commercial viability in the incandescent lamp market, some became important prior art for new technological fields and some laid the groundwork for the later successful substitute...... for Edison’s carbon filament. Fourthly, we show that the recent view that Edison’s patent gave the patent holder General Electric (GE) a dominant position in the incandescent lamp market is incorrect: we show that besides commercially-successful invention around the claims of this patent, data for GE...

  11. Inventing around Edison’s incandescent lamp patent

    DEFF Research Database (Denmark)

    Howells, John; Ron D, Katznelson

    ’s ‘898 patent. Third, by analysis of forward citation to these patents we show that regardless of these inventions’ commercial viability in the incandescent lamp market, some became important prior art for new technological fields and some laid the groundwork for the later successful substitute...... for Edison’s carbon filament. Fourthly, we show that the recent view that Edison’s patent gave the patent holder General Electric (GE) a dominant position in the incandescent lamp market is incorrect: we show that besides commercially-successful invention around the claims of this patent, data for GE...

  12. Patent analysis for competitive technical intelligence and innovative thinking

    Directory of Open Access Journals (Sweden)

    H Dou

    2006-01-01

    Full Text Available Patents are a very useful source of technical information. The public availability of patents over the Internet, with for some databases (eg. Espacenet the assurance of a constant format, allows the development of high value added products using this information source and provides an easy way to analyze patent information. This simple and powerful tool facilitates the use of patents in academic research, in SMEs and in developing countries providing a way to use patents as a ideas resource thus improving technological innovation.

  13. Monitoring nanotechnology using patent classifications: an overview and comparison of nanotechnology classification schemes

    Energy Technology Data Exchange (ETDEWEB)

    Jürgens, Björn, E-mail: bjurgens@agenciaidea.es [Agency of Innovation and Development of Andalusia, CITPIA PATLIB Centre (Spain); Herrero-Solana, Victor, E-mail: victorhs@ugr.es [University of Granada, SCImago-UGR (SEJ036) (Spain)

    2017-04-15

    Patents are an essential information source used to monitor, track, and analyze nanotechnology. When it comes to search nanotechnology-related patents, a keyword search is often incomplete and struggles to cover such an interdisciplinary discipline. Patent classification schemes can reveal far better results since they are assigned by experts who classify the patent documents according to their technology. In this paper, we present the most important classifications to search nanotechnology patents and analyze how nanotechnology is covered in the main patent classification systems used in search systems nowadays: the International Patent Classification (IPC), the United States Patent Classification (USPC), and the Cooperative Patent Classification (CPC). We conclude that nanotechnology has a significantly better patent coverage in the CPC since considerable more nanotechnology documents were retrieved than by using other classifications, and thus, recommend its use for all professionals involved in nanotechnology patent searches.

  14. Monitoring nanotechnology using patent classifications: an overview and comparison of nanotechnology classification schemes

    International Nuclear Information System (INIS)

    Jürgens, Björn; Herrero-Solana, Victor

    2017-01-01

    Patents are an essential information source used to monitor, track, and analyze nanotechnology. When it comes to search nanotechnology-related patents, a keyword search is often incomplete and struggles to cover such an interdisciplinary discipline. Patent classification schemes can reveal far better results since they are assigned by experts who classify the patent documents according to their technology. In this paper, we present the most important classifications to search nanotechnology patents and analyze how nanotechnology is covered in the main patent classification systems used in search systems nowadays: the International Patent Classification (IPC), the United States Patent Classification (USPC), and the Cooperative Patent Classification (CPC). We conclude that nanotechnology has a significantly better patent coverage in the CPC since considerable more nanotechnology documents were retrieved than by using other classifications, and thus, recommend its use for all professionals involved in nanotechnology patent searches.

  15. Invention note and patent note

    International Nuclear Information System (INIS)

    Chang, Sung Su

    1997-09-01

    This book deals with origin of invention and term related patent and invention, making idea, brain storming, 10 laws of invention skill, attitude of inventors, invention order, making good inventions, patent system, preparation of application, procedure and method of patent, management of patent, patent and trademark office, patent lawyer, copyright, new intellectual property right, industrial property right, trademark, invasion of industrial property right, patent, Judgment, preparation of items, application of industrial property right and effect of inventor and related people.

  16. Nano-enabled tribological thin film coatings: global patent scenario.

    Science.gov (United States)

    Sivudu, Kurva S; Mahajan, Yashwant R; Joshi, Shrikant V

    2014-01-01

    The aim of this paper is to present current status and future prospects of nano-enabled tribological thin film coatings based on worldwide patent landscape analysis. The study also presents an overview of technological trends by carrying out state-of-the-art literature analysis, including survey of corporate websites. Nanostructured tribological coatings encompass a wide spectrum of nanoscale microstructures, including nanocrystalline, nanolayered, nano-multilayered, nanocomposite, nanogradient structures or their unique combinations, which are composed of single or multi-component phases. The distinct microstructural features of the coatings impart outstanding tribological properties combined with multifunctional attributes to the coated components. Their unique combination of remarkable properties make them ideal candidates for a wide range of applications in diverse fields such as cutting and metalworking tools, biomedical devices, automotive engine components, wear parts, hard disc drives etc. The patent landscape analysis has revealed that nano-enabled tribological thin film coatings have significant potential for commercial applications in view of the lion's share of corporate industry in patenting activity. The largest patent portfolio is held by Japan followed by USA, Germany, Sweden and China. The prominent players involved in this field are Mitsubishi Materials Corp., Sandvik Aktiebolag, Hitachi Ltd., Sumitomo Electric Industries Ltd., OC Oerlikon Corp., and so on. The outstanding potential of nanostructured thin film tribological coatings is yet to be fully unravelled and, therefore, immense opportunities are available in future for microstructurally engineered novel coatings to enhance their performance and functionality by many folds.

  17. 76 FR 40339 - Patent Prosecution Highway (PPH) Program

    Science.gov (United States)

    2011-07-08

    ... any of the following methods: E-mail: [email protected] . Include ``0651- 0058 comment... Singapore (IPOS), German Patent and Trade Mark Office (DPMA), National Board of Patents and Registration of... being planned with the USPTO: CIPO, SIPO, and the Nordic Patent Institute (NPI). II. Method of...

  18. Patent portfolio management: literature review and a proposed model.

    Science.gov (United States)

    Conegundes De Jesus, Camila Kiyomi; Salerno, Mario Sergio

    2018-05-09

    Patents and patent portfolios are gaining attention in the last decades, from the called 'pro-patent era' to the recent billionaire transactions involving patent portfolios. The field is growing in importance, both theoretically and practically and despite having substantial literature on new product development portfolio management, we have not found an article relating this theory to patent portfolios. Areas covered: The paper develops a systematic literature review on patent portfolio management to organize the evolution and tendencies of patent portfolio management, highlighting distinctive features of patent portfolio management. Interview with IP manager of three life sciences companies, including a leading multinational group provided relevant information about patent portfolio management. Expert opinion: Based on the systematic literature review on portfolio management, more specifically, on new product development portfolio theory, and interview the paper proposes the paper proposes a reference model to manage patent portfolios. The model comprises four stages aligned with the three goals of the NPD portfolio management: 1 - Linking strategy of the Company's NPD Portfolio to Patent Portfolio; 2 - Balancing the portfolio in buckets; 3 - Patent Valuation (maximizing valuation); 4 - Regularly reviewing the patent portfolio.

  19. Revising the Complex Economics of Patent Scope

    DEFF Research Database (Denmark)

    Howells, John

    Merges and Nelson claim to have provided an empirically grounded argument that pioneer patents of 'broad' scope are used to block technological development. It is widely understood in both law and economics that they have, as they claim, faulted Kitch's 'prospect theory' of patents, a theory...... that a function of patents is to enable the coordinated development of novel technical ideas. This article is a critical review of Merges and Nelson's historical empirical evidence. I find that, first, 'broad' scope is only implicated in one of the examples cited by Merges and Nelson as supportive evidence...... - the Wright brothers' warped-wing patent; second, that strict development block, defined as the prevention, or retardation of the development of technology understood to be capable of useful development, was not illustrated by any of their examples. Therefore I conclude that their general thesis...

  20. Worldwide nanotechnology development: a comparative study of USPTO, EPO, and JPO patents (1976-2004)

    International Nuclear Information System (INIS)

    Li Xin; Lin Yiling; Chen Hsinchun; Roco, Mihail C.

    2007-01-01

    To assess worldwide development of nanotechnology, this paper compares the numbers and contents of nanotechnology patents in the United States Patent and Trademark Office (USPTO), European Patent Office (EPO), and Japan Patent Office (JPO). It uses the patent databases as indicators of nanotechnology trends via bibliographic analysis, content map analysis, and citation network analysis on nanotechnology patents per country, institution, and technology field. The numbers of nanotechnology patents published in USPTO and EPO have continued to increase quasi-exponentially since 1980, while those published in JPO stabilized after 1993. Institutions and individuals located in the same region as a repository's patent office have a higher contribution to the nanotechnology patent publication in that repository ('home advantage' effect). The USPTO and EPO databases had similar high-productivity contributing countries and technology fields with large number of patents, but quite different high-impact countries and technology fields after the average number of received cites. Bibliographic analysis on USPTO and EPO patents shows that researchers in the United States and Japan published larger numbers of patents than other countries, and that their patents were more frequently cited by other patents. Nanotechnology patents covered physics research topics in all three repositories. In addition, USPTO showed the broadest representation in coverage in biomedical and electronics areas. The analysis of citations by technology field indicates that USPTO had a clear pattern of knowledge diffusion from highly cited fields to less cited fields, while EPO showed knowledge exchange mainly occurred among highly cited fields

  1. Contemporary Aspects of Marketing in Clinical Trials Including Segments of IT and Technology Transfer

    Science.gov (United States)

    Stamenovic, Milorad; Dobraca, Amra; Smajlovic, Mersiha

    2018-01-01

    Introduction: The aim of this paper is to present the marketing strategy and the application of management (marketing management) and advertising in order to increase the efficiency of innovative approach in clinical trials that include and involve the use of new technologies and transfer of technologies. Material and Methods: This paper has a descriptive character and represents a narrative review of the literature and new model implementation. Results: Marketing models are primarily used to improve the inclusion of a larger (and appropriate) number of patients, but they can be credited for the stay and monitoring of patients in the trial. Regulatory mechanisms play an important role in the application of various marketing strategies within clinical trials. The value for the patient as the most important stakeholder is defined in the field of clinical trials according to Kotler’s value model for the consumer. Conclusion: In order to achieve the best results it is important to adequately examine all the elements of clinical trials and apply this knowledge in creation of a marketing plan that will be made in accordance with the legal regulations defined globally and locally. In this paper, two challenges have been highlighted for the adequate application of marketing tools in the field of clinical trials, namely: defining business elements in order to provide an adequate marketing approach for clinical trials and technology transfer and ensuring uniformity and regulatory affirmation of marketing attitudes in clinical trials in all regions in which they are carried out in accordance with ICH-GCP and valid regulations. PMID:29719318

  2. Patent border wars: defining the boundary between scientific discoveries and patentable inventions.

    Science.gov (United States)

    Holman, Christopher M

    2007-12-01

    Drawing an appropriate boundary between unpatentable natural phenomena and patentable inventions is crucial in preventing the patent laws from unduly restricting access to fundamental scientific discoveries. Some would argue that, particularly in the U.S., patents are being issued that purport to claim a novel product or process but that, in effect, encompass any practical application of a fundamental biological principle. Examples include gene patents, which Congress is considering banning, and patents relating to biological correlations and pathways, such as the patents at issue in the headline-grabbing LabCorp v. Metabolite and Ariad v. Eli Lilly litigations. In view of the mounting concern, it seems likely that Congress and/or the courts will address the issue, and perhaps substantially shift the boundary.

  3. What is the Destiny of Patents of Brazilian Universities?

    Directory of Open Access Journals (Sweden)

    André Luiz de Souza Querido

    2011-03-01

    Full Text Available The power of patent is expressed when the innovative product or process goes to market, and the exclusive right that patent ensures generates the market power, and the holder possibility to obtain competitive advantage over competitors. Thus, it becomes compelling the discussions on the universities need for transformation of patent applications efforts into granted patents, which could be negotiated with a higher degree of juridical certainty and, consequently, higher value added. To establish an Index of Patents Granting, and understand the importance of Technological Innovation Nuclei for the increase of this index, it was developed a survey on the number of patents granted to Brazilian universities and evaluated the structure of Technological Innovation Nuclei of these universities. From the survey on the granting cases, it was verified that the universities presenting, among other characteristics, better structured Technological Innovation Nuclei stood out.

  4. Nanotechnology strength indicators: international rankings based on US patents

    Science.gov (United States)

    Marinova, Dora; McAleer, Michael

    2003-01-01

    Technological strength indicators (TSIs) based on patent statistics for 1975-2000 are used to analyse patenting of nanotechnology in the USA, and to compile international rankings for the top 12 foreign patenting countries (namely Australia, Canada, France, Germany, Great Britain, Italy, Japan, Korea, the Netherlands, Sweden, Switzerland and Taiwan). As the indicators are not directly observable, various proxy variables are used, namely the technological specialization index for national priorities, patent shares for international presence, citation rate for the contribution of patents to knowledge development and rate of assigned patents for potential commercial benefits. The best performing country is France, followed by Japan and Canada. It is shown that expertise and strength in nanotechnology are not evenly distributed among the technologically advanced countries, with the TSIs revealing different emphases in the development of nanotechnology.

  5. The impact of effective patents on future innovations in nanomedicine.

    Science.gov (United States)

    Bosetti, Rita; Vereeck, Lode

    2012-03-01

    The success of nanomedicine is dependent upon an effective protection of IP rights. Unfortunately, the US nanomedicine patent system is dysfunctional because long R&D procedures as well as the patent pendency are insufficiently taken into account. This could be solved by changing the patent-protection starting point and increasing the capacity of the US PTO. The nanotechnology industry also suffers from overlapping patents. This could be avoided by improving the expertise of the PTO, using a more accurate definition of nanotechnology and devising a generally accepted nomenclature that enhances prior-art searches. To avoid disputes, inference practices and strategic patenting can be used. In the case of a dispute, parties can fall back on re-examination, cross-licensing and patent litigation. Cross-licensing agreements are recommended since they allows parties to access technology, create synergies and exclude third-party competitors. Solving the patent problems in the nanotechnology industry is a necessary step for future success.

  6. Expedited patent examination for green inventions: Developing countries' policy choices

    International Nuclear Information System (INIS)

    Lu, Bingbin

    2013-01-01

    Innovation in green technology is important. Patent rights can provide incentives for green technology research and development. Expedited patent examination for green inventions has emerged as a policy instrument to provide such incentives. Developing countries were never opposed to patents for green technologies. China and Brazil have led the way by offering expedited examinations for green patent applications. More developing countries are expected to follow. Expedited examination for green technologies is consistent with the intellectual property system objectives and is justified by the clear social benefit from green technologies. Introducing such expedited programs in developing countries has sufficient advantages. Existing models of expedited programs for green technologies are analyzed to generalize key issues and to discern suitable policy choices for developing countries. When introducing such programs, a balanced definition for green technology is preferred; a special classification requirement is premature and is not recommended; a pre-examination search requirement is generally recommended to balance patent office workloads, and a green patent database is recommended. - Highlights: • There is no north–south divide in promoting green technologies. • Earlier issuance of green patents has its great social benefit. • Green patent application should receive expedited examination. • Developing countries should introduce such expedited programs. • A suitable approach for developing countries is searched and recommended

  7. Natural compounds for solar photoprotection: a patent review.

    Science.gov (United States)

    Serafini, Mairim R; Guimarães, Adriana G; Quintans, Jullyana S S; Araújo, Adriano A S; Nunes, Paula S; Quintans-Júnior, Lucindo J

    2015-04-01

    Ultraviolet irradiation has deleterious effects on human skin, including tanning, sunburn, cancer and connective tissue degradation (photoaging). Botanical antioxidants have been shown to be associated with reduced incidence of photocarcinogenesis and photoaging through their photoprotective profile. Here, the authors summarized therapeutic patent applications concerning the employment of medicinal plants on the technological development of a formulation with photoprotective or photoaging application. So, the patent search was conducted in the databases WIPO, Espacenet, USPTO and Derwent, using the keywords - photoaging, photoprotection and the IPC A61K 8/97 (cosmetics or similar cleaning supplies obtained from vegetable origin, for example, plant extracts) and A61K 36/00 (medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, for example, traditional herbal medicines). We found 180 patents, out of which 25 were evaluated using inclusion criteria as application of natural products with photoprotective or photoaging application. We found that some patents related to the cosmetic compositions for improving skin wrinkle and either preventing or reducing the signs of photoaging and sunburn. The cosmetic compositions are manufactured in the form of a lotion, gel, soluble liquid, cream, essence, oil-in-water-type or water-in-oil-type formulation, containing the vegetal extracts as an active ingredient.

  8. Patent landscape of neglected tropical diseases: an analysis of worldwide patent families.

    Science.gov (United States)

    Akinsolu, Folahanmi Tomiwa; de Paiva, Vitor Nobre; Souza, Samuel Santos; Varga, Orsolya

    2017-11-14

    "Neglected Tropical Diseases" (NTDs) affect millions of people in Africa, Asia and South America. The two primary ways of strategic interventions are "preventive chemotherapy and transmission control" (PCT), and "innovative and intensified disease management" (IDM). In the last 5 years, phenomenal progress has been achieved. However, it is crucial to intensify research effort into NTDs, because of the emerging drug resistance. According to the World Health Organization (WHO), the term NTDs covers 17 diseases, namely buruli ulcer, Chagas disease, dengue, dracunculiasis, echinococcosis, trematodiasis, human African trypanosomiasis, leishmaniasis, leprosy, lymphatic filariasis, onchocerciasis, rabies, schistosomiasis, soil-transmitted helminthes, taeniasis, trachoma, and yaws. The aim of this study is to map out research and development (R&D) landscape through patent analysis of these identified NTDs. To achieve this, analysis and evaluation have been conducted on patenting trends, current legal status of patent families, priority countries by earliest priority years and their assignee types, technological fields of patent families over time, and original and current patent assignees. Patent families were extracted from Patseer, an international database of patents from over 100 patent issuing authorities worldwide. Evaluation of the patents was carried out using the combination of different search terms related to each identified NTD. In this paper, a total number of 12,350 patent families were analyzed. The main countries with sources of inventions were identified to be the United States (US) and China. The main technological fields covered by NTDs patent landscape are pharmaceuticals, biotechnology, organic fine chemistry, analysis of biological materials, basic materials chemistry, and medical technology. Governmental institutions and universities are the primary original assignees. Among the NTDs, leishmaniasis, dengue, and rabies received the highest number of

  9. The Seductive-Plausibility of Patent Hold-Up Myths — A Flawed Historiography of Patents

    DEFF Research Database (Denmark)

    Howells, John; Katznelson, Ron D

    In previous work we have shown that a flawed historiography of patents continues to be the basis for patent policy advocacy. We set out objective standards of evidence that allegations of development block due to assertion of patents must meet. We show the extent of the errors in the historical...... record in the aircraft, automobile, radio and incandescent lamp technologies. We then evaluate how they measure against the objective standards. We find many simple errors and that an absence of indicia of development block characterise scholarship alleging that assertion of patents blocked development...... of multiple case studies subjected to such standards justifies the rebuttable presumption that “pioneer patents have never blocked development”....

  10. Herbal drug patenting in India: IP potential.

    Science.gov (United States)

    Sahoo, Niharika; Manchikanti, Padmavati; Dey, Satya Hari

    2011-09-01

    Herbal drugs are gaining worldwide prominence due to their distinct advantages. Developing countries have started exploring the ethnopharmacological approach of drug discovery and have begun to file patents on herbal drugs. The expansion of R&D in Indian herbal research organizations and presence of manufacturing units at non-Indian sites is an indication of the capability to develop new products and processes. The present study attempts to identify innovations in the Indian herbal drug sector by analyzing the patenting trends in India, US and EU. Based on key word and IPC based search at the IPO, USPTO, Esp@cenet and WIPO databases, patent applications and grant in herbal drugs by Indian applicants/assignees was collected for the last ten years (from 1st January 2001 to 31st October 2010). From this collection patents related to human therapeutic use only were selected. Analysis was performed to identify filing trends, major applicants/assignees, disease area and major plant species used for various treatments. There is a gradual increase in patent filing through the years. In India, individual inventors have maximum applications and grants. CSIR, among research organizations and Hindustan Unilever, Avesthagen, Piramal Life Science, Sahajanand Biotech and Indus Biotech among the companies have the maximum granted patents in India, US and EU respectively. Diabetes, cancer and inflammatory disorders are the major areas for patenting in India and abroad. Recent patents are on new herbal formulations for treatment of AIDS, hepatitis, skin disorders and gastrointestinal disorders. A majority of the herbal patents applications and grants in India are with individual inventors. Claim analysis indicates that these patents include novel multi-herb compositions with synergistic action. Indian research organizations are more active than companies in filing for patents. CSIR has maximum numbers of applications not only in India but also in the US and EU. Patents by research

  11. 76 FR 32227 - DST Systems, Inc., Including On-Site Leased Workers From Comsys Information Technology Services...

    Science.gov (United States)

    2011-06-03

    ..., Inc., Including On-Site Leased Workers From Comsys Information Technology Services, Megaforce, and Kelly Services Kansas City, MO; DST Technologies, a Wholly Owned Subsidiary of DST Systems, Inc., Boston... Information Technology Services, Megaforce, and Kelly Services, Kansas City, Missouri (subject firm). The...

  12. Data anonymization patent landscape

    Directory of Open Access Journals (Sweden)

    Mirjana Pejić Bach

    2017-01-01

    Full Text Available The omnipresent, unstoppable increase in digital data has led to a greater understanding of the importance of data privacy. Different approaches are used to implement data privacy. The goal of this paper is to develop a data anonymization patent landscape, by determining the following: (i the trend in data anonymization patenting, (ii the type of technical content protected in data anonymization, (iii the organizations and countries most active in patenting data anonymization know-how; and (iv the topics emerging most often in patent titles. Patents from the PatSeer database relating to data anonymization from 2001 to 2015 were analyzed. We used the longitudinal approach in combination with text mining techniques to develop a data anonymization patent landscape. The results indicated the following. The number of single patent families is growing with a high increase after 2010, thus indicating a positive trend in the area of patenting data anonymization solutions. The majority of patenting activities relate to the G Physics section. Organizations from the USA and Japan assigned the majority of patents related to data anonymization. The results of text mining indicate that the most often used word in titles of data anonymization patents are “anonym*, “method”, “data” and “system”. Several additional words that indicated the most frequent topics related to data anonymization were: “equipment”, “software”, “protection”, “identification”, or “encryption”, and specific topics such as “community”, “medical”, or “service”.

  13. Annotated chemical patent corpus: a gold standard for text mining.

    Directory of Open Access Journals (Sweden)

    Saber A Akhondi

    Full Text Available Exploring the chemical and biological space covered by patent applications is crucial in early-stage medicinal chemistry activities. Patent analysis can provide understanding of compound prior art, novelty checking, validation of biological assays, and identification of new starting points for chemical exploration. Extracting chemical and biological entities from patents through manual extraction by expert curators can take substantial amount of time and resources. Text mining methods can help to ease this process. To validate the performance of such methods, a manually annotated patent corpus is essential. In this study we have produced a large gold standard chemical patent corpus. We developed annotation guidelines and selected 200 full patents from the World Intellectual Property Organization, United States Patent and Trademark Office, and European Patent Office. The patents were pre-annotated automatically and made available to four independent annotator groups each consisting of two to ten annotators. The annotators marked chemicals in different subclasses, diseases, targets, and modes of action. Spelling mistakes and spurious line break due to optical character recognition errors were also annotated. A subset of 47 patents was annotated by at least three annotator groups, from which harmonized annotations and inter-annotator agreement scores were derived. One group annotated the full set. The patent corpus includes 400,125 annotations for the full set and 36,537 annotations for the harmonized set. All patents and annotated entities are publicly available at www.biosemantics.org.

  14. Can patents prohibit research? On the social epistemology of patenting and licensing in science.

    Science.gov (United States)

    Biddle, Justin B

    2014-03-01

    A topic of growing importance within philosophy of science is the epistemic implications of the organization of research. This paper identifies a promising approach to social epistemology--nonideal systems design--and uses it to examine one important aspect of the organization of research, namely the system of patenting and licensing and its role in structuring the production and dissemination of knowledge. The primary justification of patenting in science and technology is consequentialist in nature. Patenting should incentivize research and thereby promote the development of knowledge, which in turn facilitates social progress. Some have disputed this argument, maintaining that patenting actually inhibits knowledge production. In this paper, I make a stronger argument; in some areas of research in the US--in particular, research on GM seeds--patents and patent licenses can be, and are in fact being, used to prohibit some research. I discuss three potential solutions to this problem: voluntary agreements, eliminating patents, and a research exemption. I argue against eliminating patents, and I show that while voluntary agreements and a research exemption could be helpful, they do not sufficiently address the problems of access that are discussed here. More extensive changes in the organization of research are necessary.

  15. Utilities and Power - Sector Report. Malaysia: including electricity, gas, water, sewerage, telecommunications and information technology

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1996-10-01

    This report is one of a series designed to introduce British exporters to the opportunities offered by the Malaysian market. The Seventh Malaysia Plan, covering the five year period, 1996-2000, contains an ambitious menu of infrastructure projects. Total expenditure under the Plan is envisaged at RM450 billion, of which around RM380 billion will be sourced from the private sector. This is an indication of the wealth accumulated within the Malaysian economy. The infrastructure developments identified are designed to take the country towards Vision 2020. These infrastructure developments will continue to make the country highly attractive to foreign investors, who were the catalyst for Malaysia`s explosive growth over the last few years. Malaysian Corporations have also grown rapidly and are becoming international investors and traders in their own right, including in the United Kingdom. As they expand, seeking new markets, they are looking also for partners with whom they can share technology and jointly develop projects. Such companies are often ideal partners for UK companies wishing to enter the Malaysian and Asian market. Malaysia offers opportunities to companies prepared to make the small effort to know and understand the country and its people. This report will assist companies to develop a useful understanding of the market. (author)

  16. To succeed using patent and invention which are brillant idea

    International Nuclear Information System (INIS)

    Yu, Jae Bok

    1999-07-01

    This book deals with what invention is, how we can be a inventor, how we apply inventions to intellectual property office, and other useful advice and lesson on patent. These are the titles of each part : trouble stories on success to invent, everybody can be a inventor, this is a invention. There is a problem when the idea is same or similar, preceding patent, where does it hide? database on patent, patent information, Let's go to Korean intellectual property office, patient application which we misses in our dream, and instructions of patent including various sides.

  17. Truth and falsity of patent

    International Nuclear Information System (INIS)

    Park, Gum Jin

    2006-10-01

    This book describes the process of the effect to build the business of patent strongly in difficult situation. The titles of this contents are finally, lawsuit if formed, the task of patent application introduction of tasks of patent negotiation, negotiation with Fujitsu, Mitsubishi, Oki and NEC, amalgamation between LG semiconductor and Hyundai Electronic Industry, life in incorporated company, current condition of application for a patent, the method to process strategy patent, how to make strong patent and effective negotiation strategy for a patent and strategy of patent application.

  18. 75 FR 60141 - International Business Machines (IBM), Global Technology Services Delivery Division, Including On...

    Science.gov (United States)

    2010-09-29

    ... 25, 2010, applicable to workers of International Business Machines (IBM), Global Technology Services... hereby issued as follows: All workers of International Business Machines (IBM), Global Technology... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-74,164] International Business...

  19. Searching bioremediation patents through Cooperative Patent Classification (CPC).

    Science.gov (United States)

    Prasad, Rajendra

    2016-03-01

    Patent classification systems have traditionally evolved independently at each patent jurisdiction to classify patents handled by their examiners to be able to search previous patents while dealing with new patent applications. As patent databases maintained by them went online for free access to public as also for global search of prior art by examiners, the need arose for a common platform and uniform structure of patent databases. The diversity of different classification, however, posed problems of integrating and searching relevant patents across patent jurisdictions. To address this problem of comparability of data from different sources and searching patents, WIPO in the recent past developed what is known as International Patent Classification (IPC) system which most countries readily adopted to code their patents with IPC codes along with their own codes. The Cooperative Patent Classification (CPC) is the latest patent classification system based on IPC/European Classification (ECLA) system, developed by the European Patent Office (EPO) and the United States Patent and Trademark Office (USPTO) which is likely to become a global standard. This paper discusses this new classification system with reference to patents on bioremediation.

  20. 75 FR 66795 - TTM Technologies, Including On-Site Leased Workers From Kelly Services, Aerotek, and an On-Site...

    Science.gov (United States)

    2010-10-29

    ... follows: ``All workers TTM Technologies, including on-site leased workers from Kelly Services and Aerotek... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-64,993] TTM Technologies, Including On-Site Leased Workers From Kelly Services, Aerotek, and an On-Site Leased Worker From Orbotech...

  1. BioChroma - A New and Patented Technology for Processing Radioactive Wastewater from Nuclear Medicine Therapy Facilities in Hospitals and Clinics.

    Science.gov (United States)

    Rodríguez, José Canga

    2012-01-01

    After undergoing radionuclide therapy, patients generate wastewater with a considerable amount of radioactivity, which can reach levels of as much as 90% of the administered dose. Due to the risk of accumulation after discharge into the sewer, it is advisable to collect this effluent for its treatment prior to final discharge. Delay and decay (natural decomposition of the isotope) is the most commonly used technical method of abating radioactive iodine, but it is frequently criticized as being complex and very expensive. BioChroma is a technology that has been developed as an alternative to these complicated and expensive systems. This paper describes this new technology and presents, as an example, a system that was installed and successfully commissioned in the middle of 2008 in a nuclear medicine ward with 12 beds in Stuttgart (Germany). Based on existing legislation, the responsible authorities and the company that operated the hospital agreed on a maximum activity level of 5 Bq/l. If a typical delay and decay system would have been installed, the 180 m(3) treatment plant that was already available in the hospital cellar would have to be extended by additional 150 m(3). By implementing the patented BioChroma process, the space requirements were reduced by 75%. For instance, since the new system was integrated into the existing installation, tanks accounting for 120 m³ could be used as buffering volume in the new wastewater treatment plant. The operation of the referred plant is currently producing very good results with values below the specified limit of 5 Bq/l for the isotope (131)I. In addition, (90)Y has been reported to be eliminated at the same time. Over the past 2 years of operation, the wastewater treatment plant has been able to achieve a maximum processing capacity of more than 2,000 l/day, which equates to a nuclear medicine ward with approx. 20 beds. The highest level recorded during the test period (of 180 days after start-up) was a peak of

  2. BioChroma – A New and Patented Technology for Processing Radioactive Wastewater from Nuclear Medicine Therapy Facilities in Hospitals and Clinics

    International Nuclear Information System (INIS)

    Rodríguez, José Canga

    2012-01-01

    After undergoing radionuclide therapy, patients generate wastewater with a considerable amount of radioactivity, which can reach levels of as much as 90% of the administered dose. Due to the risk of accumulation after discharge into the sewer, it is advisable to collect this effluent for its treatment prior to final discharge. Delay and decay (natural decomposition of the isotope) is the most commonly used technical method of abating radioactive iodine, but it is frequently criticized as being complex and very expensive. BioChroma is a technology that has been developed as an alternative to these complicated and expensive systems. This paper describes this new technology and presents, as an example, a system that was installed and successfully commissioned in the middle of 2008 in a nuclear medicine ward with 12 beds in Stuttgart (Germany). Based on existing legislation, the responsible authorities and the company that operated the hospital agreed on a maximum activity level of 5 Bq/l. If a typical delay and decay system would have been installed, the 180 m 3 treatment plant that was already available in the hospital cellar would have to be extended by additional 150 m 3 . By implementing the patented BioChroma process, the space requirements were reduced by 75%. For instance, since the new system was integrated into the existing installation, tanks accounting for 120 m³ could be used as buffering volume in the new wastewater treatment plant. The operation of the referred plant is currently producing very good results with values below the specified limit of 5 Bq/l for the isotope 131 I. In addition, 90 Y has been reported to be eliminated at the same time. Over the past 2 years of operation, the wastewater treatment plant has been able to achieve a maximum processing capacity of more than 2,000 l/day, which equates to a nuclear medicine ward with approx. 20 beds. The highest level recorded during the test period (of 180 days after start-up) was a peak of nearly 2

  3. Exploring Contextual Models in Chemical Patent Search

    Science.gov (United States)

    Urbain, Jay; Frieder, Ophir

    We explore the development of probabilistic retrieval models for integrating term statistics with entity search using multiple levels of document context to improve the performance of chemical patent search. A distributed indexing model was developed to enable efficient named entity search and aggregation of term statistics at multiple levels of patent structure including individual words, sentences, claims, descriptions, abstracts, and titles. The system can be scaled to an arbitrary number of compute instances in a cloud computing environment to support concurrent indexing and query processing operations on large patent collections.

  4. Quinoxaline derivatives: a patent review (2006--present).

    Science.gov (United States)

    González, Mercedes; Cerecetto, Hugo

    2012-11-01

    Quinoxaline scaffold is included in a large number of therapeutic agents because of its physicochemical properties that make the difference between them and the carbono analogue, naphthalene. This review of patented products presents the quinoxaline heterocycle as part of the structural patent claims from a medicinal chemistry perspective. We centred our discussion in the various drug patent applications of the quinoxaline and its derivatives. The applications are based firstly in the specific enzyme target with very low development in the disease treatment. Only for cancer and antimicrobial agents they were specifically determined but little is mentioned in order to insight in the last development activities.

  5. Analysis of technological innovation in Danish wind turbine industry - including the Test Station for Windturbines dual roll as research institution and certification authority

    International Nuclear Information System (INIS)

    Dannemand Andersen, P.

    1993-01-01

    The overall aim of this thesis is to examine the interactions between the Danish wind turbine industry and the Test Station for Wind Turbines. Because these interactions are concerning technological innovation, it follows that the innovation processes within the enterprises must be analyzed and modelled. The study is carried out as an iterative model-developing process using case study methods. The findings from some less structured interviews are discussed with literature and forms a basis for models and new interviews. The thesis is based on interviews with 20 R and D engineers in the Danish wind turbine industry, 7 engineers at The Test Station and 7 people involved in wind power abroad (American and British). The theoretical frame for this thesis is sociology/organizational theory and industrial engineering. The thesis consists of five main sections, dealing with technology and knowledge, innovation processes, organizational culture, innovation and interaction between the Test Station's research activities and the companies' innovation processes, and finally interaction through the Test Stations certification activity. First a taxonomy for technology and knowledge is established in order to clarify what kind of technology the interactions are all about, and what kind of knowledge is transferred during the interactions. This part of the thesis also contains an analysis of the patents drawn by the Danish wind turbine industry. The analysis shows that the Danish wind turbine industry do not use patents. Instead the nature of the technology and the speed of innovation are used to protect the industry's knowledge. (EG) (192 refs.)

  6. The patent activity of the Czech R

    Directory of Open Access Journals (Sweden)

    Kučera Zdeněk

    2016-12-01

    Full Text Available An effective knowledge transfer between research institutions and industry is a significant bottleneck in the national innovation system. CR adopted in recent years a series of systemic measures aimed to stimulate the orientation of the R&D organizations towards the generation of knowledge directly applicable in the innovation process and more generally to improve the collaboration of the R&D establishment with the industry. In the majority of programs supporting the applied research patents and industrial designs and utility models are among the anticipated results. The Methodology of the evaluation of R&D organizations implemented in the second half of the last decade brought financial bonuses for the creation of the results in the category of industrial property. Despite of this stimulus CR lags behind the technologically advanced EU countries in the patent activities. The topic of this article is a comparison of the protection of the industrial property rights in the Czech higher education institutions and governmental R&D institutions with selected EU countries. We make use of a couple of quantitative indicators to assess the quality and the technological and the commercial potential of the produced industrial property. Despite a dynamic growth of the patent applications in the CR the number of patent applications relative to the country size is far below the EU-15 average. The Czech research organizations contribute to a higher extent to the number of patent applications then do the analogous institutions in EU-15 countries where the majority of patent applications come from the industrial sphere. The Czech research organizations mainly limit the patent rights to the Czech Republic whereas in the EU-15 countries the opposite is preponderant and only a small fraction of patent applications remains limited to the national environment. Thus the majority of the Czech patents created by research organizations cannot be commercialized on the

  7. AVC/H.264 patent portfolio license

    Science.gov (United States)

    Skandalis, Dean A.

    2006-08-01

    MPEG LA, LLC offers a joint patent license for the AVC (a/k/a H.264) Standard (ISO/IEC IS 14496-10:2004). Like MPEG LA's other licenses, the AVC Patent Portfolio License is offered for the convenience of the marketplace as an alternative enabling users to access essential intellectual property owned by many patent holders under a single license rather than negotiating licenses with each of them individually. The AVC Patent Portfolio License includes essential patents owned by DAEWOO Electronics Corporation; Electronics and Telecommunications Research Institute (ETRI); France Telecom, societe anonyme; Fujitsu Limited; Hitachi, Ltd.; Koninklijke Philips Electronics N.V.; LG Electronics Inc.; Matsushita Electric Industrial Co., Ltd.; Microsoft Corporation; Mitsubishi Electric Corporation; Robert Bosch GmbH; Samsung Electronics Co., Ltd.; Sedna Patent Services, LLC; Sharp Kabushiki Kaisha; Siemens AG; Sony Corporation; The Trustees of Columbia University in the City of New York; Toshiba Corporation; UB Video Inc.; and Victor Company of Japan, Limited. Another is expected also to join as of August 1, 2006. MPEG LA's objective is to provide worldwide access to as much AVC essential intellectual property as possible for the benefit of AVC users. Therefore, any party that believes it has essential patents is welcome to submit them for evaluation of their essentiality and inclusion in the License if found essential.

  8. The practical Einstein experiments, patents, inventions

    CERN Document Server

    Illy, József

    2012-01-01

    Albert Einstein may be best known as the wire-haired whacky physicist who gave us the theory of relativity, but that's just one facet of this genius' contribution to human knowledge and modern science. As Jozsef Illy expertly shows in this book, Einstein had an eminently practical side as well. As a youth, Einstein was an inveterate tinkerer in the electrical supply factory his father and uncle owned and operated. His first paid job was as a patent examiner. Later in life, Einstein contributed to many inventions, including refrigerators, microphones, and instruments for aviation. In published papers, Einstein often provided ways to test his theories and fundamental problems of the scientific community of his times. He delved deeply into a variety of technological innovations, most notably the gyrocompass, and consulted for industry in patent cases and on other legal matters. Einstein also provided explanations for common and mundane phenomena, such as the meandering of rivers. In these and other hands-on exam...

  9. Using assistive technology adaptations to include students with learning disabilities in cooperative learning activities.

    Science.gov (United States)

    Bryant, D P; Bryant, B R

    1998-01-01

    Cooperative learning (CL) is a common instructional arrangement that is used by classroom teachers to foster academic achievement and social acceptance of students with and without learning disabilities. Cooperative learning is appealing to classroom teachers because it can provide an opportunity for more instruction and feedback by peers than can be provided by teachers to individual students who require extra assistance. Recent studies suggest that students with LD may need adaptations during cooperative learning activities. The use of assistive technology adaptations may be necessary to help some students with LD compensate for their specific learning difficulties so that they can engage more readily in cooperative learning activities. A process for integrating technology adaptations into cooperative learning activities is discussed in terms of three components: selecting adaptations, monitoring the use of the adaptations during cooperative learning activities, and evaluating the adaptations' effectiveness. The article concludes with comments regarding barriers to and support systems for technology integration, technology and effective instructional practices, and the need to consider technology adaptations for students who have learning disabilities.

  10. Scientific Prediction and Prophetic Patenting in Drug Discovery.

    Science.gov (United States)

    Curry, Stephen H; Schneiderman, Anne M

    2015-01-01

    Pharmaceutical patenting involves writing claims based on both discoveries already made, and on prophesy of future developments in an ongoing project. This is necessitated by the very different timelines involved in the drug discovery and product development process on the one hand, and successful patenting on the other. If patents are sought too early there is a risk that patent examiners will disallow claims because of lack of enablement. If patenting is delayed, claims are at risk of being denied on the basis of existence of prior art, because the body of relevant known science will have developed significantly while the project was being pursued. This review examines the role of prophetic patenting in relation to the essential predictability of many aspects of drug discovery science, promoting the concepts of discipline-related and project-related prediction. This is especially directed towards patenting activities supporting commercialization of academia-based discoveries, where long project timelines occur, and where experience, and resources to pay for patenting, are limited. The need for improved collaborative understanding among project scientists, technology transfer professionals in, for example, universities, patent attorneys, and patent examiners is emphasized.

  11. Nano/micro-electro mechanical systems: a patent view

    Energy Technology Data Exchange (ETDEWEB)

    Hu, Guangyuan, E-mail: hu.guangyuan@mail.shufe.edu.cn, E-mail: hu.guangyuan@shufe.edu.cn [Shanghai University of Finance and Economics, School of Public Economics and Administration (China); Liu, Weishu [Shanghai Jiao Tong University, Antai College of Economics and Management (China)

    2015-12-15

    Combining both bibliometrics and citation network analysis, this research evaluates the global development of micro-electro mechanical systems (MEMS) research based on the Derwent Innovations Index database. We found that worldwide, the growth trajectory of MEMS patents demonstrates an approximate S shape, with United States, Japan, China, and Korea leading the global MEMS race. Evidenced by Derwent class codes, the technology structure of global MEMS patents remains steady over time. Yet there does exist a national competitiveness component among the top country players. The latecomer China has become the second most prolific country filing MEMS patents, but its patent quality still lags behind the global average.

  12. R&D, patents and innovation: a differential game approach

    OpenAIRE

    Wang, H.-M.

    2016-01-01

    A patent race is a technological competition among firms and the firm making a first-hand innovation takes advantages of patenting. Firms strategically invest in R&D and produce knowledge in order to innovate. Instead of growing model of R&D, I use a differential game approach to investigate firms interaction of R&D behavior in a patent race. In general, knowledge is an intangible good that gives a special feature of a patent race. Whether knowledge is substitutable to the existing knowledge ...

  13. Patents and Downstream Innovation Suppresion - Facts or Fiction?

    DEFF Research Database (Denmark)

    Howells, John

    of development as aircraft, the car, radio and electric lighting. Merges and Nelson quite logically use their work to question the value of Kitch's prospect theory of patents,[2] a theory that emphasises that the social value of patents is that they enable the coordination of technological development...... and R. Nelson, "On the Complex Economics of Patent Scope," Columbia Law Review 90, no. 4 (1990), R. Merges and R. Nelson, "On Limiting or Encouraging Rivalry in Technical Progress: The Effect of Patent Scope Decisions," Journal of Economic Behavior and Organisation 25 (1994). [2] Merges and Nelson, "On...

  14. Nano/micro-electro mechanical systems: a patent view

    International Nuclear Information System (INIS)

    Hu, Guangyuan; Liu, Weishu

    2015-01-01

    Combining both bibliometrics and citation network analysis, this research evaluates the global development of micro-electro mechanical systems (MEMS) research based on the Derwent Innovations Index database. We found that worldwide, the growth trajectory of MEMS patents demonstrates an approximate S shape, with United States, Japan, China, and Korea leading the global MEMS race. Evidenced by Derwent class codes, the technology structure of global MEMS patents remains steady over time. Yet there does exist a national competitiveness component among the top country players. The latecomer China has become the second most prolific country filing MEMS patents, but its patent quality still lags behind the global average

  15. Exploiting abstract possibilities: a critique of the concept and practice of product patenting.

    Science.gov (United States)

    Radder, Hans

    2004-01-01

    Developments in biotechnology and genomics have moved the issue of patenting scientific and technological inventions toward the center of interest. In particular, the patentability of genes of plants, animals, or humans and of genetically modified (parts of) living organisms has been discussed, and questioned, from various normative perspectives. This paper aims to contribute to this debate. For this purpose, it first explains a number of relevant aspects of the theory and practice of patenting. The focus is on a special and increasingly significant type of patents, namely product patents. The paper provides three general arguments against the concept and practice of product patenting. The first argument briefly considers the claim that patents are legitimate because they promote socially useful innovation. Against this claim, it is argued that product patents may hamper rather than promote such innovation. The second and main argument concludes that product patents are not adequately based on actual technological inventions, as they should be according to the usual criteria of patentability. The principal moral issue is that product patents tend to reward patentees for inventions they have not really made available. The final argument proposes a method for patenting the heat of the sun. Assuming that granting this patent will be generally considered absurd, the argument exposes a further, fundamental problem of the concept and practice of product patenting.

  16. Japan's patent issues relating to life science therapeutic inventions.

    Science.gov (United States)

    Tessensohn, John A

    2014-09-01

    Japan has made 'innovation in science and technology' as one of its central pillars to ensure high growth in its next stage of economic development and its life sciences market which hosts regenerative medicine was proclaimed to be 'the best market in the world right now.' Although life science therapeutic inventions are patentable subject matter under Japanese patent law, there are nuanced obviousness and enablement challenges under Japanese patent law that can be surmounted in view of some encouraging Japanese court developments in fostering a pro-patent applicant environment in the life sciences therapeutic patent field. Nevertheless, great care must be taken when drafting and prosecuting such patent applications in the world's second most important life sciences therapeutic market.

  17. 77 FR 32642 - Patents and Inventions; Delegation of Authority

    Science.gov (United States)

    2012-06-01

    ... DEPARTMENT OF HEALTH AND HUMAN SERVICES Centers for Disease Control and Prevention Patents and... Prevention (CDC), the Deputy Director, DLPP, LSPPPO, OSELS, CDC, and the Chief, Technology Management Branch... regarding the invention and patent program of CDC and the authority to make determinations of rights in...

  18. Globalization and Growth of US University Patenting (2009-2014)

    Science.gov (United States)

    Leydesdorff, Loet; Etzkowitz, Henry; Kushnir, Duncan

    2016-01-01

    Following a pause, with a relatively flat rate, from 1998 to 2008, the long-term trend of university patenting rising as a share of all patenting has resumed, driven by the internationalization of academic entrepreneurship and the persistence of US university technology transfer. The authors disaggregate this recent growth in university patenting…

  19. Survey of the patents intensity in advanced ceramics

    International Nuclear Information System (INIS)

    Rodrigues, C.S.; Oliveira, E.C. de; Pencinato, M.V.; Bandeira, R.J.; Ribeiro, E.

    1989-01-01

    A survey about a sectorial diagnostic of advanced ceramics, using patents of the Industrial Properties National Institute, as a reference documentation is presented. The mains points for generating technology in 80 decade are identified, by the institutions/company titularies of patents. (C.G.C.) [pt

  20. R&D, patents and innovation: a differential game approach

    NARCIS (Netherlands)

    Wang, H.-M.

    2016-01-01

    A patent race is a technological competition among firms and the firm making a first-hand innovation takes advantages of patenting. Firms strategically invest in R&D and produce knowledge in order to innovate. Instead of growing model of R&D, I use a differential game approach to investigate firms

  1. 75 FR 38543 - Patent, Trademark and Copyright Acts

    Science.gov (United States)

    2010-07-02

    ... DEPARTMENT OF THE INTERIOR Geological Survey Patent, Trademark and Copyright Acts AGENCY: Geological Survey, Interior. ACTION: Notice of prospective intent to award exclusive license. SUMMARY: The... Technologies Group, Inc., 253 Portman Lane, Suite 107, Bridgeville, PA 15017 on U.S. Patent No. 6,485,696 B1...

  2. Patents and Downstream Innovation Suppression - Facts or Fiction?

    DEFF Research Database (Denmark)

    Howells, John

    the value of Kitch's prospect theory of patents, a theory that the social value of patents is that they enable the efficient coordination of technological development.    I re-examine history and legal sources bearing on Merges and Nelson's illustrative cases and find no case to illustrate downstream...

  3. Patent Ductus Arteriosus

    Science.gov (United States)

    ... With Patent Ductus Arteriosus Figure A shows the interior of a normal heart and normal blood flow. ... PDA may shrink and go away. However, some children need treatment to close their PDAs. Some children ...

  4. Patent protection strategies

    Directory of Open Access Journals (Sweden)

    Himanshu Gupta

    2010-01-01

    Full Text Available It is widely recognized that the pharmaceutical industry faces serious financial challenges. Large numbers of blockbuster drugs are losing patent protection and going generic. The pipeline of new drugs is too sparse to fill the gap and generate a platform for future growth. Moreover, many of the new products are biologics with much narrower target patient populations and comparatively higher prices relative to traditional pharmaceuticals. So now the time has come for pharmaceutical scientists to have a better understanding of patent fundamentals. This need is illustrated by analyses of key scientific and legal issues that arose during recent patent infringement cases involving Prozac, Prilosec, and Buspar. Facing this scenario, the pharmaceutical industry has moved to accelerate drug development process and to adopt at the same time different strategies to extend the life time of the patent monopoly to provide the economic incentives and utilizing it for drug discovery and development. This review covers the need of patent protection and various strategies to extend the patent.

  5. 37 CFR 1.5 - Identification of patent, patent application, or patent-related proceeding.

    Science.gov (United States)

    2010-07-01

    ... UNITED STATES PATENT AND TRADEMARK OFFICE, DEPARTMENT OF COMMERCE GENERAL RULES OF PRACTICE IN PATENT CASES General Provisions General Information and Correspondence § 1.5 Identification of patent, patent... benefit of the date of deposit with the United States Postal Service. If the returned correspondence is...

  6. Profile of medicinal plants utilization through patent documents: the andiroba example

    Directory of Open Access Journals (Sweden)

    Luciene F. Gaspar Amaral

    2013-06-01

    Full Text Available Today, one of the trends of the pharmaceutical, cosmetic and food market is the development of products with components of natural origin, rationally exploiting biodiversity. Brazilian population makes secular use of medicinal plants including andiroba, whose oil is used in folk medicine as febrifuge, pain-relieving, anti-parasitic, anti-allergic as well as insect repellant. The present study attempts to evaluate the profile of utilization of andiroba by analyzing the patenting trends based on information collected on the databases of the World Intellectual Property Organization, European Patent Office and Brazilian National Institute of Industrial Property in the period from 1990 to 2011. The following parameters were analyzed: chronological aspect of the applications, countries of priority, international patent classification, technologies and actors in the technological platform. The temporal analysis of the applications shows an evident increase despite a discontinuous evolution of the number of applications. Pharmaceutical, chemical and cosmetic areas were identified as the main areas for commercial application of the plant. Brazil is the country with the largest number of applications even though the majority of the patent technologies are already in public domain, indicating that the technological information contained in these documents could be used for research and investment in several areas.

  7. Confidential patent application with an example of preparation

    Directory of Open Access Journals (Sweden)

    Obrad T. Čabarkapa

    2013-12-01

    ; the rest of the patent application, etc.. Description of the invention The description of the invention aims to provide sufficient technical data and to further clarify and describe all the details of the invention for which protection is sought in the claims. The description should enable the average expert in the specific field of technology to perform  or to conduct a  procedure on the application and determine whether it meets the requirements for patentability. The description contains the following units: title of the invention; technology field; technical problem; state of technology; brief summary of the invention; a brief description of the figures of the draft; detailed invention description and the methods of industrial and other applications of the invention. The claims The claims are the most important part of the patent application and all other elements of the patent application are in a function of patent claims. The claims must define the invention solely by its technical characteristics. They are submitted on a separate sheet after the description of the invention under the title "The claims". Depending  on the protection sought, one or more claims can be placed. Abstract The abstract contains the title of the invention and a brief summary of the invention as shown in the description, the requirements and the draft. A brief review must indicate the technical field to which the invention relates and must allow a clear understanding of the technical problem, the essence of the problem and the basic way (ways of using the invention. The abstract contains a maximum of 150 words. Draft of the invention A draft of the invention is submitted on separate sheets, along with the title of the invention on each side. The reference signs given in the description, requirements and the draft must be the same throughout the application. Other documents with the patent application In addition to the above mentioned sections of the patent application, the following

  8. The lifespan of semiconductor patents by assignee and patent characteristics

    Directory of Open Access Journals (Sweden)

    Chang Shu-Hao

    2017-01-01

    Full Text Available Evaluating the values of patents is critical for both managers and investors. Patent maintenance time is an ideal proxy indicator for evaluating commercial patent value. This study investigated the survival rates of patents in the semiconductor industry by using a survival analysis and incorporated a predictive model for patent maintenance times. The technical characteristics of the patents, the assignee factors, and the statuses of the patents were used as the predictive factors for patent maintenance time. The results revealed a small entity size and the number of assignees are the risk factors that increase the likelihood of the maintenance time of a patent decreasing. The litigation status of a patent and the number of its international patent classifications, claims, forward citations, and assignments were determined to be the protection factors that raise the likelihood of its maintenance time extending. Additionally, substantial differences were noted between small entities and nonsmall entities and between being litigated and not in their effects on the survival rates of patents. This study examined the factors that affect the survival rates of patents and provides a reference for the managers and investors of intellectual property rights to use when assessing technical and commercial patent values.

  9. Technology of surface wastewater purification, including high-rise construction areas

    Science.gov (United States)

    Tsyba, Anna; Skolubovich, Yury

    2018-03-01

    Despite on the improvements in the quality of high-rise construction areas and industrial wastewater treatment, the pollution of water bodies continues to increase. This is due to the organized and unorganized surface untreated sewage entry into the reservoirs. The qualitative analysis of some cities' surface sewage composition is carried out in the work. Based on the published literature review, the characteristic contamination present in surface wastewater was identified. The paper proposes a new technology for the treatment of surface sewage and presents the results of preliminary studies.

  10. Therapeutic and cosmetic applications of mangiferin: a patent review.

    Science.gov (United States)

    Telang, Manasi; Dhulap, Sivakami; Mandhare, Anita; Hirwani, Rajkumar

    2013-12-01

    Mangiferin, a natural C-glucoside xanthone [2-C-β-D-glucopyranosyl-1, 3, 6, 7-tetrahydroxyxanthone], is abundantly present in young leaves and stem bark of the mango tree. The xanthonoid structure of mangiferin with C-glycosyl linkage and polyhydroxy components contributes to its free radical-scavenging ability, leading to a potent antioxidant effect as well as multiple biological activities. An extensive search was carried out to collect patent information on mangiferin and its derivatives using various patent databases spanning all priority years to date. The patents claiming therapeutic and cosmetic applications of mangiferin and its derivatives were analyzed in detail. The technology areas covered in this article include metabolic disorders, cosmeceuticals, multiple uses of the same compound, miscellaneous uses, infectious diseases, inflammation, cancer and autoimmune disorders, and neurological disorders. Mangiferin has the potential to modulate multiple molecular targets including nuclear factor-kappa B (NF-κB) signaling and cyclooxygenase-2 (COX-2) protein expression. Mangiferin exhibits antioxidant, antidiabetic, antihyperuricemic, antiviral, anticancer and antiinflammatory activities. The molecular structure of mangiferin fulfils the four Lipinski's requisites reported to favor high bioavailability by oral administration. There is no evidence of adverse side effects of mangiferin so far. Mangiferin could thus be a promising candidate for development of a multipotent drug.

  11. Test Collections for Patent-to-Patent Retrieval and Patent Map Generation in NTCIR-4 Workshop

    OpenAIRE

    Fujii, Atsushi; Iwayama, Makoto; Kando, Noriko

    2004-01-01

    This paper describes the Patent Retrieval Task in the Fourth NTCIR Workshop, and the test collections produced in this task. We perform the invalidity search task, in which each participant group searches a patent collection for the patents that can invalidate the demand in an existing claim. We also perform the automatic patent map generation task, in which the patents associated with a specific topic are organized in a multi-dimensional matrix.

  12. Strategic management and utilization of patents

    International Nuclear Information System (INIS)

    Kim, Gyeong Go; Yun, Gwon Jun

    1993-11-01

    This book deals with why does management of patents need?, system of management of patents with function and site of management of patents and system and composition, what does management of patents department do?, task like technical development, management regulation, patent information, management of patents in small business with technical development of small business, how does business manage the patents in real, introduction of management of patents in the U.S, Europe, Japan, and Korea, and management of patents as strategic management.

  13. Quantitative Analysis of Technological Innovation in Urology.

    Science.gov (United States)

    Bhatt, Nikita R; Davis, Niall F; Dalton, David M; McDermott, Ted; Flynn, Robert J; Thomas, Arun Z; Manecksha, Rustom P

    2018-01-01

    To assess major areas of technological innovation in urology in the last 20 years using patent and publication data. Patent and MEDLINE databases were searched between 1980 and 2012 electronically using the terms urology OR urological OR urologist AND "surgeon" OR "surgical" OR "surgery". The patent codes obtained were grouped in technology clusters, further analyzed with individual searches, and growth curves were plotted. Growth rates and patterns were analyzed, and patents were correlated with publications as a measure of scientific support and of clinical adoption. The initial search revealed 417 patents and 20,314 publications. The top 5 technology clusters in descending order were surgical instruments including urinary catheters, minimally invasive surgery (MIS), lasers, robotic surgery, and image guidance. MIS and robotic surgery were the most emergent clusters in the last 5 years. Publication and patent growth rates were closely correlated (Pearson coefficient 0.78, P innovation and adoption into clinical practice. Patent metrics identify emergent technological innovations and such trends are valuable to understand progress in the field of urology. New surgical technologies like robotic surgery and MIS showed exponential growth in the last decade with good scientific vigilance. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Comprehension and application of patent information

    International Nuclear Information System (INIS)

    Lee, Sang Nam

    2004-05-01

    This book gives descriptions of conception of patent information such as the meaning, characteristic, function, investigation and map of patent information, pro-patent period and patent strategy of the business. It also deals with comprehension of patent information like publication of nations, patent document, patent procedure in Korea, patent procedure in Japan, the U.S, and Europe, article and function of patent document, patent information survey such as writing of search keyword, procedure of the survey and search site of other countries, patent analysis and patent map.

  15. 77 FR 40638 - Syniverse Technologies, Inc., Including On-Site Leased Workers From Insight Global Stone Staffing...

    Science.gov (United States)

    2012-07-10

    ..., Inc., Including On-Site Leased Workers From Insight Global Stone Staffing, and Randstad Formerly Known..., Massachusetts, including on-site leased workers from Insight Global, Stone Staffing, Randstad formerly known as... Insight Global, Stone Staffing, Randstad, formerly known as Sapphire Technologies, were employed on-site...

  16. Patent Foramen Ovale: Is Stroke Due to Paradoxical Embolism?

    Science.gov (United States)

    Ranoux, D.; Cohen, A.; Cabanes, L.; Amarenco, P.; Bousser, M. G.; Mas, J. L.

    1993-01-01

    Background and Purpose: A patent foramen ovale has been reported to be significantly more frequent in young stroke patients than in matched control subjects, and paradoxical embolism has been suggested as the main mechanism of stroke in-this situation. The present study was designed to test this hypothesis. Methods: Sixty-eight consecutive patients under 55 years of age presenting with an ischemic stroke had an extensive workup, including transesophageal echocardiography with contrast. We compared the prevalence of criteria for the diagnosis of paradoxical embolism in patients with and without a patent foramen ovale. Results: A patent foramen ovale was found in 32 patients (47%). A Valsalva-provoking activity was present at stroke onset in six patients with a patent foramen ovale and in eight patients with no patent foramen ovale (X(sup 2)=0.1, nonsignificant). Clinical/radiological features suggestive of an embolic mechanism were not more frequent in patients with a patent foramen ovale. Clinical evidence of deep vein thrombosis was present in one patient with a patent foramen ovale and in none of the others. No occult venous thrombosis was found in a subgroup of patients with a patent foramen ovale and no definite cause for stroke who underwent venography (n=13). Conclusions. Our results do not support the hypothesis that paradoxical embolism is the primary mechanism of stroke in patients with a patent foramen ovale. (Stroke 1993;24:31-34) KEY WORDS e cerebral ischemia e embolism foramen ovale, patent

  17. Cyclodextrins improving the physicochemical and pharmacological properties of antidepressant drugs: a patent review.

    Science.gov (United States)

    Diniz, Tâmara Coimbra; Pinto, Tiago Coimbra Costa; Menezes, Paula Dos Passos; Silva, Juliane Cabral; Teles, Roxana Braga de Andrade; Ximenes, Rosana Christine Cavalcanti; Guimarães, Adriana Gibara; Serafini, Mairim Russo; Araújo, Adriano Antunes de Souza; Quintans Júnior, Lucindo José; Almeida, Jackson Roberto Guedes da Silva

    2018-01-01

    Depression is a serious mood disorder and is one of the most common mental illnesses. Despite the availability of several classes of antidepressants, a substantial percentage of patients are unresponsive to these drugs, which have a slow onset of action in addition to producing undesirable side effects. Some scientific evidence suggests that cyclodextrins (CDs) can improve the physicochemical and pharmacological profile of antidepressant drugs (ADDs). The purpose of this paper is to disclose current data technology prospects involving antidepressant drugs and cyclodextrins. Areas covered: We conducted a patent review to evaluate the antidepressive activity of the compounds complexed in CDs, and we analyzed whether these complexes improved their physicochemical properties and pharmacological action. The present review used 8 specialized patent databases for patent research, using the term 'cyclodextrin' combined with 'antidepressive agents' and its related terms. We found 608 patents. In the end, considering the inclusion criteria, 27 patents reporting the benefits of complexation of ADDs with CDs were included. Expert opinion: The use of CDs can be considered an important tool for the optimization of physicochemical and pharmacological properties of ADDs, such as stability, solubility and bioavailability.

  18. 從專利與論文產量之觀點探討科學與技術之關係 Relation between Technology and Science: A Perspective of Patent and Paper Production

    Directory of Open Access Journals (Sweden)

    Wen-Yau Cathy Lin

    2011-03-01

    Full Text Available 本研究以電子與電機產業為例,從其發明專利產量與科學論文產量的觀點探討科學與技術之關係。先前的研究多數透過對技術專利與科學文獻之間的引用來探討關於科學與技術的連結,但這樣的角度僅能呈現其相互影響的部分面向。因此本研究選擇以電子與電機產業專利表現極佳的20家世界知名公司為例,從同一個公司之專利產量與科學文獻產量的角度切入,探討科學與技術兩者之間的關連,並分別從其被引用狀況,分析企業產出專利與發表科學論文後所造成的影響程度。此外本研究也分析各公司的技術週期時間(TechnologyCycleTime,TCT,探討TCT與Patent-PaperRatio之間的關連,並改良即時影響指數(ModifiedCurrentImpactIndex,ModifiedCII的計算方法使其同時適用於專利與論文,進而比較各公司的專利與論文之即時影響指數。其中發明專利與科學論文分別檢索自USPTO與WoS資料庫,於1989年至2008年間之資料。研究結果顯示,雖然近20年來電子與電機領域的科學論文成長幅度比技術專利大,但該領域中技術專利表現最優秀的20個公司的科學論文發表狀況與產生的影響力卻與其專利數量與影響力之間關連不顯著。本結果對於電子與電機領域之公司在技術與科學之間的連結關係提供一項新的實務證據。This study investigates the relation between production of utility patents and scientific papers in the electrical and electronic (E&E industry. Unlike most prior researches delving into the link between science and technology through patent citations and paper citations, this article takes top 20 companies in the E&E industry as an example to examine the link between science and technology in terms of the productivity of patents and papers in one company. It also probes into patent citations and paper citations respectively and its consequences. Furthermore, this

  19. Energy technology patents–CO2 emissions nexus: An empirical analysis from China

    International Nuclear Information System (INIS)

    Wang Zhaohua; Yang Zhongmin; Zhang Yixiang; Yin Jianhua

    2012-01-01

    Energy technology innovation plays a crucial role in reducing carbon emissions. This paper investigates whether there is relationship between energy technology patents and CO 2 emissions of 30 provinces in mainland China during 1997–2008. Gross domestic product (GDP) is included in the study due to its impact on CO 2 emissions and energy technology innovation, thus avoiding the problem of omitted variable bias. Furthermore, we investigate three cross-regional groups, namely eastern, central and western China. The results show that domestic patents for fossil-fueled technologies have no significant effect on CO 2 emissions reduction; however, domestic patents for carbon-free energy technologies appear to play an important role in reducing CO 2 emissions, which is significant in eastern China, but is not significant in central, western and national level of China. The results of this study enrich energy technology innovation theories and provide some implications for energy technology policy making. - Highlights: ► We studied the causality between energy technology patents and CO 2 emissions using dynamic panel data approach. ► There is a long-run equilibrium relationship among energy technology patents, CO 2 emissions and GDP. ► Domestic patents for fossil-fueled technologies have no significant effect on CO 2 emissions reduction. ► Domestic patents for carbon-free energy technologies appear to play an important role in reducing CO 2 emissions. ► This study provides some references for the future energy technology policy making.

  20. Are biosimilars patentable?

    Science.gov (United States)

    Rolfe, Damian; Parker, Jayson; Morgan, Max

    2016-08-01

    This paper explores whether, and under what circumstances, a biosimilar approved in the United States under the Biologics Price Competition and Innovation Act (hereafter 'BPCIA') can be patented. The possibility that a biosimilar product could have meaningful patent protection arises from specific requirements for biosimilarity under the BPCIA, which account for the fact that manufacturing processes of biologics are inherently imprecise. The requirements for biosimilar approval may provide sufficient leeway to a biosimilar applicant to patent structural or formulation differences that provide non-clinical but business-relevant advantages over the reference molecule, such as improved shelf-life or ease of manufacture, without compromising clinical biosimilarity. Examination of the BPCIA and related Acts, Food and Drug Administration (FDA) guidance papers, case law, patent database searching, and relevant scholarly articles. Legislative and regulatory requirements for the approval of a biosimilar under the BPCIA are focused on clinical results and allow a degree of leeway for differences to exist between a biosimilar's structure and non-clinical components and those of the biosimilar's reference molecule. This leeway can be exploited to provide the biosimilar with potentially patentable business-relevant advantages over its reference product while maintaining clinical biosimilarity to the reference product.

  1. New Nuclear Materials Including Non Metallic Fuel Elements. Vol. I. Proceedings of the Conference on New Nuclear Materials Technology, Including Non Metallic Fuel Elements

    International Nuclear Information System (INIS)

    1963-01-01

    One of the major aims of the International Atomic Energy Agency in furthering the peaceful uses of atomic energy is to encourage the development of economical nuclear power. Certainly, one of the more obvious methods of producing economical nuclear power is the development of economical fuels that can be used at high temperatures for long periods of time, and which have sufficient strength and integrity to operate under these conditions without permitting the release of fission products. In addition it is desirable that after irradiation these new fuels be economically reprocessed to reduce further the cost of the fuel cycle. As nuclear power becomes more and more competitive with conventional power the interest in new and more efficient higher-temperature fuels naturally increases rapidly. For these reasons, the Agency organized a Conference on New Nuclear Materials Technology, Including Non-Metallic Fuel Elements, which was held from 1 to 5 July 1963 at the International Hotel, Prague, with the assistance and co-operation of the Government of the Czechoslovak Socialist Republic. A total of 151 scientists attended, from 23 countries and 4 international organizations. The participants heard and discussed more than 60 scientific papers

  2. 48 CFR 970.5227-12 - Patent rights-management and operating contracts, for-profit contractor, advance class waiver.

    Science.gov (United States)

    2010-10-01

    ...; (B) Storage and disposal of civilian high-level nuclear waste and spent fuel technology; and (C... (including an English-language version if filed in a language other than English); (ii) An executed and... Contractor shall obtain patent agreements to effectuate the provisions of subparagraph (o)(1) of this clause...

  3. Thermodynamic Modeling and Dispatch of Distributed Energy Technologies including Fuel Cell -- Gas Turbine Hybrids

    Science.gov (United States)

    McLarty, Dustin Fogle

    Distributed energy systems are a promising means by which to reduce both emissions and costs. Continuous generators must be responsive and highly efficiency to support building dynamics and intermittent on-site renewable power. Fuel cell -- gas turbine hybrids (FC/GT) are fuel-flexible generators capable of ultra-high efficiency, ultra-low emissions, and rapid power response. This work undertakes a detailed study of the electrochemistry, chemistry and mechanical dynamics governing the complex interaction between the individual systems in such a highly coupled hybrid arrangement. The mechanisms leading to the compressor stall/surge phenomena are studied for the increased risk posed to particular hybrid configurations. A novel fuel cell modeling method introduced captures various spatial resolutions, flow geometries, stack configurations and novel heat transfer pathways. Several promising hybrid configurations are analyzed throughout the work and a sensitivity analysis of seven design parameters is conducted. A simple estimating method is introduced for the combined system efficiency of a fuel cell and a turbine using component performance specifications. Existing solid oxide fuel cell technology is capable of hybrid efficiencies greater than 75% (LHV) operating on natural gas, and existing molten carbonate systems greater than 70% (LHV). A dynamic model is calibrated to accurately capture the physical coupling of a FC/GT demonstrator tested at UC Irvine. The 2900 hour experiment highlighted the sensitivity to small perturbations and a need for additional control development. Further sensitivity studies outlined the responsiveness and limits of different control approaches. The capability for substantial turn-down and load following through speed control and flow bypass with minimal impact on internal fuel cell thermal distribution is particularly promising to meet local demands or provide dispatchable support for renewable power. Advanced control and dispatch

  4. the possible overlap between plant variety protection and patent

    African Journals Online (AJOL)

    the patentability of inventions in all fields of technology, and specifically .... of different plants; the traits or characteristics associated with the genes will be expressed ... David Kaplan, Intellectual Property Rights and Innovation in South Africa: A.

  5. Patent Races and Market Value

    DEFF Research Database (Denmark)

    Czarnitzki, Dirk; Hussinger, Katrin; Leten, Bart

    Patent races are models of strategic interactions between firms competing to develop an invention. The winning firm secures a patent, protecting the invention from imitation. This paper tests the assumption made about the reward structure in patent races, both in discrete and complex industries. We...... identify patent race winners using detailed information from the patent examination reports at the European Patent Office (EPO). Estimates of a market value equation featuring large, R&D-intensive U.S., European and Japanese firms, show that if firms win patent races, their market value increases...... significantly. We further show that the gain in market value is significantly larger for patent race winners in discrete industries than for firms in complex industries....

  6. New Nuclear Materials Including Non Metallic Fuel Elements. Vol. II. Proceedings of the Conference on New Nuclear Materials Technology, Including Non Metallic Fuel Elements

    International Nuclear Information System (INIS)

    1963-01-01

    One of the major aims of the International Atomic Energy Agency in furthering the peaceful uses of atomic energy is to encourage the development of economical nuclear power. Certainly, one of the more obvious methods of producing economical nuclear power is the development of economical fuels that can be used at high temperatures for long periods of time, and which have sufficient strength and integrity to operate under these conditions without permitting the release of fission products. In addition it is desirable that after irradiation these new fuels be economically reprocessed to reduce further the cost of the fuel cycle. As nuclear power becomes more and more competitive with conventional power the interest in new and more efficient higher-temperature fuels naturally increases rapidly. For these reasons, the Agency organized a Conference on New Nuclear Materials Technology, Including Non-Metallic Fuel Elements, which was held from 1 to 5 July 1963 at the International Hotel, Prague, with the assistance and co-operation of the Government of the Czechoslovak Socialist Republic. A total of 151 scientists attended, from 23 countries and 4 international organizations. The participants heard and discussed more than 60 scientific papers. The Agency wishes to thank the scientists who attended this Conference for their papers and for many spirited discussions that truly mark a successful meeting. The Agency wishes also to record its gratitude for the assistance and generous hospitality accorded the Conference, the participants and the Agency's staff by the Government of the Czechoslovak Socialist Republic and by the people of Prague. The scientific information contained in these Proceedings should help to quicken the pace of progress in the fabrication of new and m ore economical fuels, and it is hoped that these proceedings will be found useful to all workers in this and related fields

  7. El Sistema de patentes en Colombia

    Directory of Open Access Journals (Sweden)

    Rafael Viana Barceló

    2014-01-01

    Full Text Available En este documento se realiza un análisis económico del Sistema de Patentes de Colombia. Para ello, se establece el efecto que tienen las patentes concedidas a los inventores foráneos sobre la Inversión Extranjera Directa y el Producto Interno Bruto Nacional, a través de la técnica de regresión de data panel. De igual manera, se identifican los sectores económicos que registran mayores tasas de innovación por parte de los inventores nacionales y extranjeros. Se muestra que el sistema nacional de propiedad intelectual tiene un grado de fortaleza acorde con el resto de países latinoamericanos; para ello, se construye un índice de grado de fortalecimiento de sistema de patente nacional que luego será comparado con el de otros países latinos.Palabras Clave: Sistema de Patentes; Derechos de Propiedad Intelectual; Inversión Directa extranjera; Producto Interno Bruto e innovación tecnológica. The system of patents in ColombiaAbstractIn this document an economic analysis of the System of Patents of Colombia is made. For it, the effect that has the patents granted to the foreign inventors on the Direct Foreign Investment and the Internal Product Gross National, through the technique of regression of data settles down panel. Of equal way, the economic sectors are identified that register greater rates of innovation on the part of the national and foreign inventors.Sample that the national system of intellectual property has a degree of agreed strength with the rest of Latin American countries; for it, an index of degree of fortification of system of national patent is constructed that soon will be compared with the one of other Latin countries.Keywords: System Patent; Rights of Intellectual Property; Foreign Direct Investment; Gross Domestic Product and Technology Innovation.

  8. The fallacy of Software Patents

    CERN Multimedia

    CERN. Geneva

    2015-01-01

    Software patents are usually used as argument for innovation but do they really promote innovation? Who really benefits from software patents? This talk attempts to show the problems with software patents and how they can actually harm innovation having little value for software users and our society in general.

  9. Analysing patent landscapes in plant biotechnology and new plant breeding techniques.

    Science.gov (United States)

    Parisi, Claudia; Rodríguez-Cerezo, Emilio; Thangaraj, Harry

    2013-02-01

    This article aims to inform the reader of the importance of searching patent landscapes in plant biotechnology and the use of basic tools to perform a patent search. The recommendations for a patent search strategy are illustrated with the specific example of zinc finger nuclease technology for genetic engineering in plants. Within this scope, we provide a general introduction to searching using two online and free-access patent databases esp@cenet and PatentScope. The essential features of the two databases, and their functionality is described, together with short descriptions to enable the reader to understand patents, searching, their content, patent families, and their territorial scope. We mostly stress the value of patent searching for mining scientific, rather than legal information. Search methods through the use of keywords and patent codes are elucidated together with suggestions about how to search with or combine codes with keywords and we also comment on limitations of each method. We stress the importance of patent literature to complement more mainstream scientific literature, and the relative complexities and difficulties in searching patents compared to the latter. A parallel online resource where we describe detailed search exercises is available through reference for those intending further exploration. In essence this is aimed at a novice patent searcher who may want to examine accessory patent literature to complement knowledge gained from mainstream journal resources.

  10. Obstacles to prior art searching by the trilateral patent offices: empirical evidence from International Search Reports.

    Science.gov (United States)

    Wada, Tetsuo

    Despite many empirical studies having been carried out on examiner patent citations, few have scrutinized the obstacles to prior art searching when adding patent citations during patent prosecution at patent offices. This analysis takes advantage of the longitudinal gap between an International Search Report (ISR) as required by the Patent Cooperation Treaty (PCT) and subsequent national examination procedures. We investigate whether several kinds of distance actually affect the probability that prior art is detected at the time of an ISR; this occurs much earlier than in national phase examinations. Based on triadic PCT applications between 2002 and 2005 for the trilateral patent offices (the European Patent Office, the US Patent and Trademark Office, and the Japan Patent Office) and their family-level citations made by the trilateral offices, we find evidence that geographical distance negatively affects the probability of capture of prior patents in an ISR. In addition, the technological complexity of an application negatively affects the probability of capture, whereas the volume of forward citations of prior art affects it positively. These results demonstrate the presence of obstacles to searching at patent offices, and suggest ways to design work sharing by patent offices, such that the duplication of search costs arises only when patent office search horizons overlap.

  11. Patent Searching for Librarians and Inventors.

    Science.gov (United States)

    Wherry, Timothy Lee

    Information on patents is provided for librarians and laypersons requiring an understanding of the system and the processes involved. Chapter 1 discusses successful patents; terms and concepts; patent types; copyright; trademark; requirements; patent examiners; patent pending; expiration; patentee and assignee; and reissued patents. Chapter 2…

  12. Patent pools: Intellectual property rights and competition.

    NARCIS (Netherlands)

    Rodriguez, V.F.

    2010-01-01

    Patent pools do not correct all problems associated with patent thickets. In this respect, patent pools might not stop the outsider problem from striking pools. Moreover, patent pools can be expensive to negotiate, can exclude patent holders with smaller numbers of patents or enable a group of major

  13. Patent urachus repair - slideshow

    Science.gov (United States)

    ... Drugs & Supplements Videos & Tools About MedlinePlus Show Search Search MedlinePlus GO GO About MedlinePlus Site Map FAQs Customer Support Health Topics Drugs & Supplements Videos & Tools Español You Are Here: Home → Medical Encyclopedia → Patent urachus repair - series—Normal anatomy URL of this ...

  14. Patent ductus arteriosus

    Science.gov (United States)

    ... Drugs & Supplements Videos & Tools About MedlinePlus Show Search Search MedlinePlus GO GO About MedlinePlus Site Map FAQs Customer Support Health Topics Drugs & Supplements Videos & Tools Español You Are Here: Home → Medical Encyclopedia → Patent ductus arteriosus URL of this page: //medlineplus.gov/ ...

  15. Patent urachus repair

    Science.gov (United States)

    ... Drugs & Supplements Videos & Tools About MedlinePlus Show Search Search MedlinePlus GO GO About MedlinePlus Site Map FAQs Customer Support Health Topics Drugs & Supplements Videos & Tools Español You Are Here: Home → Medical Encyclopedia → Patent urachus repair URL of this page: //medlineplus.gov/ ...

  16. Biological diversity in the patent system.

    Directory of Open Access Journals (Sweden)

    Paul Oldham

    Full Text Available Biological diversity in the patent system is an enduring focus of controversy but empirical analysis of the presence of biodiversity in the patent system has been limited. To address this problem we text mined 11 million patent documents for 6 million Latin species names from the Global Names Index (GNI established by the Global Biodiversity Information Facility (GBIF and Encyclopedia of Life (EOL. We identified 76,274 full Latin species names from 23,882 genera in 767,955 patent documents. 25,595 species appeared in the claims section of 136,880 patent documents. This reveals that human innovative activity involving biodiversity in the patent system focuses on approximately 4% of taxonomically described species and between 0.8-1% of predicted global species. In this article we identify the major features of the patent landscape for biological diversity by focusing on key areas including pharmaceuticals, neglected diseases, traditional medicines, genetic engineering, foods, biocides, marine genetic resources and Antarctica. We conclude that the narrow focus of human innovative activity and ownership of genetic resources is unlikely to be in the long term interest of humanity. We argue that a broader spectrum of biodiversity needs to be opened up to research and development based on the principles of equitable benefit-sharing, respect for the objectives of the Convention on Biological Diversity, human rights and ethics. Finally, we argue that alternative models of innovation, such as open source and commons models, are required to open up biodiversity for research that addresses actual and neglected areas of human need. The research aims to inform the implementation of the 2010 Nagoya Protocol on Access to Genetic Resources and the Equitable Sharing of Benefits Arising from their Utilization and international debates directed to the governance of genetic resources. Our research also aims to inform debates under the Intergovernmental Committee on

  17. Patent Blocking and Infringement and their Effects on Firms?

    DEFF Research Database (Denmark)

    Grimpe, Christoph; Hussinger, Katrin

    In recent years, firms have increasingly contributed to and been confronted with a patent landscape characterized by numerous but marginal inventions, overlapping claims and patent fences. As a result, firms risk to be blocked in their patent applications or to be infringed upon by rivals. While...... both aspects constitute major challenges for the appropriation of returns to inventive activity, extant literature suggests that participation in the market for technology might actually resolve or at least alleviate these problems. In this paper, we investigate the effect of patent blocking...... and infringement on firms’ engagement in in- and cross-licensing. Based on a sample of more than 1000 German manufacturing firms our results show that firms engage in in-licensing as a reaction to patent blocking and in both in- and cross-licensing if their protected IP was infringed upon. However, these effects...

  18. Patenting and Innovation in China: Incentives, Policy, and Outcomes

    Science.gov (United States)

    2015-01-01

    limited at 30,000 yuan. See: Kriegel,  J. (2012). Strategies to leverage Chinese patent subsidies Intellectual Property  Magazine .   26 A patent claim...2012). Strategies to leverage Chinese patent subsidies Intellectual Property  Magazine .  Kumar, N. (2003). "Intellectual property rights, technology and...innovation in China: the role of patents in  biotechnology  and  pharmaceutical industries, Edward Elgar.  Liang, M. (2011). "Chinese Patent Quality: Running

  19. Patent prosecution strategies for stem cell related applications.

    Science.gov (United States)

    Kumar, Rajeev; Yeh, Jenny J; Fernandez, Dennis; Hansen, Nels

    2007-09-01

    Stem cell research and the intellectual property derived from it, because of its potential to completely transform health care, demand an especially high level of consideration from business and patent prosecution perspectives. As with other revolutionary technologies, ordinary risks are amplified (e.g., litigation), and ordinarily irrelevant considerations may become important (e.g., heightened level of both domestic and foreign legislative risk). In the first part of this article, general strategies for patent prosecutors such as several prosecution considerations and methods for accelerating patent prosecution process are presented. In the second part, patent prosecution challenges of stem cell-related patents and possible solutions are discussed. In the final part, ethical and public policy issues particular to stem cell-related and other biotechnological inventions are summarized.

  20. Do patents impede the provision of genetic tests in Australia?

    Science.gov (United States)

    Nicol, Dianne; Liddicoat, John

    2013-06-01

    Health policy and law reform agencies lack a sound evidence base of the impacts of patents on innovation and access to healthcare to assist them in their deliberations. This paper reports the results of a survey of managers of Australian genetic testing laboratories that asked a series of questions relating to the tests they perform, whether they pay to access patented inventions and whether they have received notifications from patent holders about patents associated with particular tests. Some diagnostics facilities are exposed to patent costs, but they are all located in the private sector. No public hospitals reported paying licence fees or royalties beyond those included in the price of commercial test kits. Some respondents reported having received enforcement notices from patent holders, but almost all related to the widely known breast cancer-associated patents. Respondents were also asked for their views on the most effective mechanisms to protect their ability to provide genetic tests now and in the future. Going to the media, paying licence fees, ignoring patent rights and relying on the government to take action were widely seen as most effective. Litigation and applications for compulsory licences were seen as some of the least effective mechanisms. These results provide an evidence base for development of health policy and law reform. What is known about the topic? The impact of patents on the delivery of genetic testing services remains unclear in Australia. What does this paper add? The survey reported in this paper suggests that, aside from well-known enforcement actions relating to the breast cancer associated patents, there is little evidence that providers of genetic testing services are being exposed to aggressive patent-enforcement practices. What are the implications for practitioners? Although patent-enforcement actions may increase in the future, a range of strategies are available to providers of testing services to protect them against

  1. METRICS DEVELOPMENT FOR PATENTS.

    Science.gov (United States)

    Veiga, Daniela Francescato; Ferreira, Lydia Masako

    2015-01-01

    To develop a proposal for metrics for patents to be applied in assessing the postgraduate programs of Medicine III - Capes. From the reading and analysis of the 2013 area documents of all the 48 areas of Capes, a proposal for metrics for patents was developed to be applied in Medicine III programs. Except for the areas Biotechnology, Food Science, Biological Sciences III, Physical Education, Engineering I, III and IV and Interdisciplinary, most areas do not adopt a scoring system for patents. The proposal developed was based on the criteria of Biotechnology, with adaptations. In general, it will be valued, in ascending order, the deposit, the granting and licensing/production. It will also be assigned higher scores to patents registered abroad and whenever there is a participation of students. This proposal can be applied to the item Intellectual Production of the evaluation form, in subsection Technical Production/Patents. The percentage of 10% for academic programs and 40% for Masters Professionals should be maintained. The program will be scored as Very Good when it reaches 400 points or over; Good, between 200 and 399 points; Regular, between 71 and 199 points; Weak up to 70 points; Insufficient, no punctuation. Desenvolver uma proposta de métricas para patentes a serem aplicadas na avaliação dos Programas de Pós-Graduação da Área Medicina III - Capes. A partir da leitura e análise dos documentos de área de 2013 de todas as 48 Áreas da Capes, desenvolveu-se uma proposta de métricas para patentes, a ser aplicada na avaliação dos programas da área. Constatou-se que, com exceção das áreas Biotecnologia, Ciência de Alimentos, Ciências Biológicas III, Educação Física, Engenharias I, III e IV e Interdisciplinar, a maioria não adota sistema de pontuação para patentes. A proposta desenvolvida baseou-se nos critérios da Biotecnologia, com adaptações. De uma forma geral, foi valorizado, em ordem crescente, o depósito, a concessão e o

  2. Patenting and the gender gap: should women be encouraged to patent more?

    Science.gov (United States)

    de Melo-Martín, Inmaculada

    2013-06-01

    The commercialization of academic science has come to be understood as economically desirable for institutions, individual researchers, and the public. Not surprisingly, commercial activity, particularly that which results from patenting, appears to be producing changes in the standards used to evaluate scientists' performance and contributions. In this context, concerns about a gender gap in patenting activity have arisen and some have argued for the need to encourage women to seek more patents. They believe that because academic advancement is mainly dependent on productivity (Stuart and Ding in American Journal of Sociology 112:97-144, 2006; Azoulay et al. in Journal of Economic Behavior & Organization 63:599-623, 2007), differences in research output have the power to negatively impact women's careers. Moreover, in the case of patenting activity, they claim that the gender gap also has the potential to negatively affect society. This is so because scientific and technological advancement and innovation play a crucial role in contemporary societies. Thus, women's more limited involvement in the commercialization of science and technology can also be detrimental to innovation itself. Nevertheless, calls to encourage women to patent on grounds that such activity is likely to play a significant role in the betterment of both women's careers and society seem to be based on two problematic assumptions: (1) that the methods to determine women's productivity in patenting activities are an appropriate way to measure their research efforts and the impact of their work, and (2) that patenting, particularly in academia, benefits society. The purpose of this paper is to call into question these two assumptions.

  3. Handbook of technology law. General funamentals, environment law, genetic engineering act, energy act, telecommunication act and media act, patent act, computer act. 2. ed.; Handbuch des Technikrechts. Allgemeine Grundlagen Umweltrecht, Gentechnikrecht, Energierecht, Telekommunikations- und Medienrecht, Patentrecht, Computerrecht

    Energy Technology Data Exchange (ETDEWEB)

    Schulte, Martin; Schroeder, Rainer (eds.) [Technische Univ. Dresden (Germany). Juristische Fakultaet

    2011-07-01

    On the boundaries between technology sciences, jurisprudence, social sciences and economic science the technology law proves as a cross-sectional area par excellence. The bases of the technology law are presented: individual, particularly important scopes of the technology law (appliance safety regulations, technology law and environment law, genetic engineering act, energy right, telecommunications law and media law, patent law, computer law, data security, legally binding telecooperation) are analyzed in detail. The manual contacts all lawyers who want to provide a first in-depth insight of this new field of law. [German] Im Grenzbereich von Technik-, Rechts-, Sozial- und Wirtschaftswissenschaften erweist sich das Technikrecht als Querschnittsmaterie par excellence. Die Grundlagen des Technikrechts werden dargestellt; einzelne, besonders wichtige Bereiche des Technikrechts (Geraetesicherheitsrecht, Technik und Umweltrecht, Gentechnikrecht, Energierecht, Telekommunikations- und Medienrecht, Patentrecht, Computerrecht, Datensicherheit, Rechtsverbindliche Telekooperation) werden eingehend analysiert. Das Handbuch wendet sich an alle in Wissenschaft und Praxis mit dem Technikrecht befassten Juristen, die sich einen ersten vertieften Einblick in dieses neue Rechtsgebiet verschaffen wollen. (orig.)

  4. Decoding gene patents in Australia.

    Science.gov (United States)

    Denley, Adam; Cherry, James

    2014-10-03

    Patents directed to naturally occurring genetic material, such as DNA, RNA, chromosomes, and genes, in an isolated or purified form have been granted in Australia for many years. This review provides scientists with a summary of the gene patent debate from an Australian perspective and specifically reviews how the various levels of the legal system as they apply to patents-the Australian Patent Office, Australian courts, and Australian government-have dealt with the issue of whether genetic material is proper subject matter for a patent. Copyright © 2015 Cold Spring Harbor Laboratory Press; all rights reserved.

  5. Electric current activated/assisted sintering (ECAS): a review of patents 1906-2008

    International Nuclear Information System (INIS)

    Grasso, Salvatore; Sakka, Yoshio; Maizza, Giovanni

    2009-01-01

    The electric current activated/assisted sintering (ECAS) is an ever growing class of versatile techniques for sintering particulate materials. Despite the tremendous advances over the last two decades in ECASed materials and products there is a lack of comprehensive reviews on ECAS apparatuses and methods. This paper fills the gap by tracing the progress of ECAS technology from 1906 to 2008 and surveys 642 ECAS patents published over more than a century. It is found that the ECAS technology was pioneered by Bloxam (1906 GB Patent No. 9020) who developed the first resistive sintering apparatus. The patents were searched by keywords or by cross-links and were withdrawn from the Japanese Patent Office (342 patents), the United States Patent and Trademark Office (175 patents), the Chinese State Intellectual Property Office of P.R.C. (69 patents) and the World Intellectual Property Organization (12 patents). A subset of 119 (out of 642) ECAS patents on methods and apparatuses was selected and described in detail with respect to their fundamental concepts, physical principles and importance in either present ECAS apparatuses or future ECAS technologies for enhancing efficiency, reliability, repeatability, controllability and productivity. The paper is divided into two parts, the first deals with the basic concepts, features and definitions of basic ECAS and the second analyzes the auxiliary devices/peripherals. The basic ECAS is classified with reference to discharge time (fast and ultrafast ECAS). The fundamental principles and definitions of ECAS are outlined in accordance with the scientific and patent literature. (topical review)

  6. Impact of R&D expenditures on research publications, patents and high-tech exports among European countries.

    Science.gov (United States)

    Meo, S A; Usmani, A M

    2014-01-01

    This study aimed to compare the impact of Research&Development (R&D) expenditures on research publications, patents and high-tech exports among European countries. In this study, 47 European countries were included. The information regarding European countries, their per capita Gross Domestic Product (GDP), R&D spending, number of universities, indexed scientific journals, high technology exports and number of patents were collected. We recorded the total number of research documents in various science and social sciences subjects during the period 1996-2011. The main source for information was World Bank, Web of Science, Thomson Reuters and SCImago/Scopus. The mean GDP per capita for all the European countries is 23372.64 ± 3588.42 US$, yearly per capita spending on R&D 1.14 ± 0.13 US$, number of universities 48.17 ± 10.26, mean number of Institute of Scientific Information (ISI) indexed journal per country 90.72 ± 38.47, high technology exports 12.86 ± 1.59 and number of patent applications 61504.23 ± 22961.85. The mean of research documents published in various science and social science subjects among all the European countries during the period 1996-2011 is 213405.70 ± 56493.04. Spending on R&D, number of universities, indexed journals, high technology exports and number of patents have a positive correlation with number of published documents in various science and social science subjects. We found a positive correlation between patent application and high-tech exports. However, there was no association between GDP per capita and research outcomes. It is concluded that, the most important contributing factors towards a knowledge based economy are spending on R&D, number of universities, scientific indexed journals and research publications, which in turn give a boast to patents, high technology exports and ultimately GDP.

  7. Survey and research for the enhancement of large-scale technology development 3. Patent researches on new tasks for development under large-scale project; Ogata gijutsu kaihatsu suishin no tame no chosa kenkyu. 3. Ogata project shinki kaihatsu tema ni kansuru tokkyo chosa kenkyu

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1981-03-01

    Regarding 'high-speed computation systems for technological use' and 'manganese nodule mining systems,' researches are conducted into technological trends from the viewpoint of patent. As for applications for patents involving the Josephson effect device, there are 79 patents disclosed in Japan, with applications from Japan recording a peak in 1977-1978 and those from overseas in 1974-1975. As for important applicants, IBM distinguishes itself among those overseas while, in Japan, the Nippon Telegraph and Telephone Public Corporation occupies 47%, and Fujitsu, Ltd., 34%. In the case of GaAs-based transistors, businesses in Japan occupies as much as 90% of the applications overwhelming overseas businesses occupying less than 10%. As for the patents on manganese nodule mining systems, 183 Japanese patents are pending, with 88 already granted in America. While the main concern in Japan has transferred from the continuous elevator bucket system of 1971-1974 to the fluid dredge system, the fluid dredge system has consistently been occupying the overpowering majority in America. (NEDO)

  8. Optimal patent policies: A survey

    DEFF Research Database (Denmark)

    Poulsen, Odile

    2002-01-01

    This paper surveys some of the patent literature, in particular, it focuses on optimal patent policies. We compare two situations. The first where the government only has a single policy tool to design the optimal patent policy, namely the optimal patent length. In the second situation......, the government uses two policy tools, the optimal breadth and length. We show that theoretical models give very different answers to what is the optimal patent policy. In particular, we show that the optimal patent policy depends among othet things on the price elasticity of demand, the intersectoral elasticity...... of research outputs as well as the degree of compettition in the R&D sector. The actual law on intellectual property, which advocates a unique patent length of 20 years is in general not supported by theoretical models....

  9. Labor Mobility and Patenting Activity

    DEFF Research Database (Denmark)

    Kaiser, Ulrich; Kongsted, Hans Christian; Rønde, Thomas

    We measure the quantitative importance of labor mobility as a vehicle for the transmission of knowledge and skills across firms. For this purpose we create a unique data set that matches all applications of Danish firms at the European Patent Office to linked employer-employee register data...... for the years 1999-2002. The Danish workforce is split into "R&D workers", who hold a bachelor's or a master's degree in a technical field, and "non{R&D workers". We find that mobile R&D workers ("R&D joiners"') contribute more to patenting activity than immobile R&D workers. Furthermore, R&D workers who have...... previously been employed by a patenting firm ("patent exposed workers") have a larger effect on patenting activity than R&D workers without this experience. Patent exposed R&D joiners constitute the most productive group of workers: for firms that patented prior to 1999, one additional worker of this type...

  10. Milk Technological Properties as Affected by Including Artichoke By-Products Silages in the Diet of Dairy Goats

    Directory of Open Access Journals (Sweden)

    Raquel Muelas

    2017-12-01

    Full Text Available Traditional farming practices include the use of local agricultural by-products in the diet of ruminants. Artichoke harvesting and transformation yield high amounts of by-products that, if properly used, may reduce farming costs and the environmental impact of farming. The present study tests the inclusion of silages from artichoke by-products (plant and outer bracts in the diet of dairy goats (0%, 12.5% and 25% inclusion on the technological and sensory properties of milk during a five-month study. Milk composition, color, stability, coagulation and fermentation properties remained unaffected by diet changes. Panelists were not able to differentiate among yogurts obtained from those milks by discriminant triangular sensory tests. Silages of artichoke by-products can be included in isoproteic and isoenergetic diets for dairy goats, up to a 25% (feed dry matter, without negatively affecting milk technological and sensory properties whereas reducing feeding costs.

  11. NASA Technology Transfer System

    Science.gov (United States)

    Tran, Peter B.; Okimura, Takeshi

    2017-01-01

    NTTS is the IT infrastructure for the Agency's Technology Transfer (T2) program containing 60,000+ technology portfolio supporting all ten NASA field centers and HQ. It is the enterprise IT system for facilitating the Agency's technology transfer process, which includes reporting of new technologies (e.g., technology invention disclosures NF1679), protecting intellectual properties (e.g., patents), and commercializing technologies through various technology licenses, software releases, spinoffs, and success stories using custom built workflow, reporting, data consolidation, integration, and search engines.

  12. Recent patents on the extraction of carotenoids.

    Science.gov (United States)

    Riggi, Ezio

    2010-01-01

    This article reviews the patents that have been presented during the last decade related to the extraction of carotenoids from various forms of organic matter (fruit, vegetables, animals), with an emphasis on the methods and mechanisms exploited by these technologies, and on technical solutions for the practical problems related to these technologies. I present and classify 29 methods related to the extraction processes (physical, mechanical, chemical, and enzymatic). The large number of processes for extraction by means of supercritical fluids and the growing number of large-scale industrial plants suggest a positive trend towards using this technique that is currently slowed by its cost. This trend should be reinforced by growing restrictions imposed on the use of most organic solvents for extraction of food products and by increasingly strict waste management regulations that are indirectly promoting the use of extraction processes that leave the residual (post-extraction) matrix substantially free from solvents and compounds that must subsequently be removed or treated. None of the reviewed approaches is the best answer for every extractable compound and source, so each should be considered as one of several alternatives, including the use of a combination of extraction approaches.

  13. Patent Analysis for Pyroprocessing of Spent Nuclear Fuels

    International Nuclear Information System (INIS)

    Yoo, Jae Hyung; Kim, Jung Kuk; Lee, Han Soo; Seo, In Seok; Kim, Eun Ka

    2011-01-01

    Analysis of foreign and domestic patents for pyroprocessing technology of spent nuclear fuels was carried out in this study. The current status of pyroprocessing technology development in such countries as Korea, USA, Japan and EU was analyzed by classifying the patents for 1975 through 2009 according to registration country, assignee, calendar year and technology area. The major assignees' activity indices were compared in order to find out whether there is any concentrated area of technical details. Technology competitiveness of the countries was also investigated from the information of patent citation number and family size. Furthermore, some essential unit technologies required for the commercialization of pyroprocessing were derived and examined in the aspect of the state of art as well as the trend of technology development.

  14. Quality and quantity: Can we have both within the European patent system?

    DEFF Research Database (Denmark)

    Elsmore, Matthew J.

    2009-01-01

    Scrutiny of patent systems is never far away. The European Patent Office has long faced rising levels of 'inventive activity'. Fast, fluid technologies and strategic firm behavior add to the difficulties faced in trying to reward inventions with commensurate rights. Analysis suggests stronger...... patent protection does not necessarily equate with more innovation and greater diffusion of knowledge; nor do more patents lead to or reflect more innovation. This article focuses on improving the fundamental workings of the European system as is stands, and proposes a focus on quality and patent...

  15. Patents, antibiotics, and autarky in Spain.

    Science.gov (United States)

    Romero De Pablos, Ana

    2014-01-01

    Patents on antibiotics were introduced in Spain in 1949. Preliminary research reveals diversification in the types of antibiotics: patents relating to penicillin were followed by those relating to streptomycin, erythromycin and tetracycline. There was also diversification in the firms that applied for patents: while Merck & Co. Incorporated and Schenley Industries Inc. were the main partners with Spanish antibiotics manufacturers in the late 1940s, this industrial space also included many others, such as Eli Lilly & Company, Abbott Laboratories, Chas. Pfizer & Co. Incorporated, and American Cyanamid Company in the mid-1970s. The introduction of these drugs in Spain adds new elements to a re-evaluation of the autarkic politics of the early years of the Franco dictatorship.

  16. Recent patents on flavonoids.

    Science.gov (United States)

    Mamta, Gokhale; Bansal, Y K; Sandhu, S S

    2013-12-01

    Flavonoids are substances which are widely distributed in the plant kingdom. They occur in considerable quantities in common food products, spices and beverages. Interest of researchers has been greatly enhanced towards therapeutic potential of flavonoids in last some years. This review summarizes important patents pertaining to recent biotechnological techniques applied for the production, analysis of biosynthetic pathways, effects and applications of different flavonoids. For systematic studies investigations which have been published in the form of patents, are classified in different sectors like biosynthesis, medical application, antimicrobial activity, alteration of flower color, industrial application, cosmetics, food and plant tissue culture. A number of activities have been observed in each sector with vast area of research on flavonoids.

  17. How Patent Function Integration with R&D Influence the Value of Patents

    DEFF Research Database (Denmark)

    Beukel, Karin; Valentin, Finn

    Patent strategies are endogenous to firm appropriability. However, to what extent does firm’s R&D teams’ engagement with patent experts influence the value of patents? We estimate the relationship between firm’s R&D use of patent functions on patent value in Biotech firms. Controlling...... for characteristics of scientific team, firm effects, and other patent value indicators, we find that having a firm specific (in-house) internal patent function is a driver of patent value. In addition, we find that the way in which patent functions create patent value differs dependent on whether the firm has...... internal patent function or not. In-house patent functions create value through narrow patents, whereas, firms with no in-house patent function create valuable patents by the use of broader scoped patents. Our results point to a strong effect of firm specific patent functions, but also explain how firms...

  18. Science of invention patent

    International Nuclear Information System (INIS)

    Park, Yeong Taek; Park, Su Dong

    1999-02-01

    This book tells science of invention patent about new way of invention and creative solution for problems, basic conception of TRIZ, resolution of physical contradictory and technical contradictory, development of system and types of evolution, change of thinking for solving the problems, analysis of structure for problem solution, problem solution using scientific phenomenon and effect, use of standard solution and algorithm of creative problem solution.

  19. A Research on Enterprise Patent Protection and Innovation Strategy

    Institute of Scientific and Technical Information of China (English)

    Zeng Sumei

    2017-01-01

    In the 21st century, high-tech serves as the foundation of competitiveness for the whole world, at the same time, intellectual property, especially the patent has become an effective means for an enterprise to participate in the international competition, and intellectual property is also the key strategic resource to gain competitive advantage. In effect, the competition amongst enterprises is mainly concerning the competition of patent technology. Those enterprises with a large number of high level professional powers gain the initiative edge of survival. Therefore, it is vital for the enterprise to adopt the patent protection and innovation strategy, so as to elevate the survival ability and competitiveness of an enterprise.

  20. Natural products against cancer: A comprehensive bibliometric study of the research projects, publications, patents and drugs

    Directory of Open Access Journals (Sweden)

    Jian Du

    2014-01-01

    Full Text Available Objectives: To analyze multi-source data including awards, publications, patents and drugs, and try to draw the whole landscape of the research and development community in the area of natural products (NPs against cancer. Materials and Methods: Awards, publications, patents and drugs data from National Institute of Health/Natural Science Foundation of China (NIH/NSFC, PubMed, Derwent Innovation Index and Cortellis were collected. Bibliometric methodologies and technology are used to investigate publications/patents/drugs, their contents and relationships. Results: NIH and NSFC respectively demonstrated a stable and sustained expenditure growth in this area. The number of publications is continuously increasing. Yet the annual patent applications worldwide and FDA drug approvals were little changed or not obviously fluctuated in 2003-2013. USA and several Asia-pacific countries/territories are important contributing powers. We described the evolution of major research topics by those MeSH Major Topics indexed in PubMed with the largest growth range in three intervals, and analyzed hot research topics in the recent 10 years which include NPs or NPs derivatives, cell line/animal model, laboratory technologies and activation mechanisms. Conclusions: China published the most publications and received the most patent applications, but drug discovery performance is no better than USA and Japan. Research on anti-neoplastic structures and compounds originated from Chinese traditional medicine (TCM, medicinal plants, herbal medicine and marine NPs are major research topics in the recent 10 years. There still exits translational gap between basic research and drug discovery. Translational research should be undertaken to strengthen the applicability of NPs.

  1. Searching U.S. Patents: Core Collection and Suggestions for Service.

    Science.gov (United States)

    Harwell, Kevin R.

    1993-01-01

    Provides fundamental information about patents, describes effective and affordable reference resources, and discusses specific issues in providing patent information services to inventors and other patrons. Basic resources, including CD-ROM products, patent classification and searching resources, and other search tools are described in an…

  2. 48 CFR 952.227-84 - Notice of right to request patent waiver.

    Science.gov (United States)

    2010-10-01

    ... patent waiver. 952.227-84 Section 952.227-84 Federal Acquisition Regulations System DEPARTMENT OF ENERGY... Notice of right to request patent waiver. Include this provision in all appropriate solicitations in accordance with 48 CFR 927.409(t). Right To Request Patent Waiver (FEB 1998) Offerors have the right to...

  3. 48 CFR 970.2702-6 - Notice of right to request patent waiver.

    Science.gov (United States)

    2010-10-01

    ... patent waiver. 970.2702-6 Section 970.2702-6 Federal Acquisition Regulations System DEPARTMENT OF ENERGY AGENCY SUPPLEMENTARY REGULATIONS DOE MANAGEMENT AND OPERATING CONTRACTS Patents, Data, and Copyrights 970.2702-6 Notice of right to request patent waiver. Contracting officers must include the provision at 970...

  4. Are the Brookhill-Wilk patents impediments to market growth in cybersurgery?

    Science.gov (United States)

    McLean, T R; Torrance, A W

    2008-03-01

    In the past, many surgeons could practise their craft with little or no knowledge of patent law. But in the world of robotic and computerized surgery, this is increasingly a myopic approach, because the principle means of protecting high-tech surgical instruments is through the application of patent law. The issue is: does the Brookhill-Wilk patent, which covers the performance of remote robotic surgery, impede the growth of cybersurgery? Review of the Brookhill-Wilk patent and relevant law. Patent law, which first took its form in the Middle Ages, attempts to balance the rewarding of innovation with the stifling of market growth. Using US patent law as a model, it would appear that the Brookhill-Wilk patent, a particular example of a medical process patent, could inhibit the growth of cybersurgery, as potential sums of money could be demanded by the patent holder from anyone who practises cybersurgery. However, two recent US Supreme Court cases appear to have seriously undermined the validity of a number of medical process patents, including the Brookhill-Wilk patent. Based on recent changes in patent law, it is not expected that Brookhill-Wilk patent will hinder the growth of cybersurgery.

  5. Enforcing patents in the era of 3D printing

    DEFF Research Database (Denmark)

    Ballardini, Rosa Maria; Norrgård, Marcus; Minssen, Timo

    2015-01-01

    This article explores relevant laws and doctrines of patent infringement in Europe with a special emphasis on 3D printing (3DP) technologies. Considering the difficulties that patent owners might face in pursuing direct patent infringement actions in the rapidly evolving era of 3DP, we suggest...... of IP law. Enforcing patents in the era of 3D printing Rosa Maria Ballardini, Marcus Norrgård, and Timo Minssen Journal of Intellectual Property Law & Practice 2015 10: 850-866......, although the internet platforms and CAD files repositories will play a major role in the development and spreading of the 3DP technology, they will likely to be at the center of major law disputes unless they carefully consider the scope of their activities (host and/or customize and/or print) in light...

  6. Eastern European patenting activities in the USA

    Energy Technology Data Exchange (ETDEWEB)

    Marinova, D. [Murdoch University, Perth, WA (Australia). Inst. of Sustainability & Technological Policy

    2001-09-01

    The patenting activities of the former centrally planned economies in the US between 1976 and 1999 are examined. The technological performance of Eastern Europe is assessed and compared with that of the OECD countries. A sharp decline is observed as a consequence of the economic changes undergone by these countries in recent years. The study reveals some common technological strengths, such as in the areas of petroleum, coal, chemicals and other related products, and country-specific advantages, such as in mining in the former USSR, Poland and Bulgaria, textiles, clothing, footwear and leather in the former Czechoslovakia, printing, publishing and recorded media in the former East Germany, health in the former Yugoslavia, energy in Romania and design in Slovenia. Recommendations are made for the future use of foreign patents.

  7. PATENT ANALYSIS: A LOOK AT THE INNOVATIVE NATURE OF PLANT-BASED COSMETICS

    Directory of Open Access Journals (Sweden)

    Francine C. S. César

    Full Text Available The use of plants have become a important trend in cosmetic market, with a crescent number of patent applications. Despite various herbal-based ingredients have been described in scientific literature, most of them are restricted to patent databases. In this work we analyze the innovative use of plants and its derivatives in cosmetic technologies, based on patent analysis. The investigation was conducted using Derwent World Patents Index (Thomson Reuters Scientific, USA from 1995 to 2015. The search was carried out to evaluate the number of patent deposits, the patent depositors profiles, the countries with most patent applications, the International Patent Classification (IPC and the main plant families using in cosmetics. Patent analysis revealed an increase number of applications involving cosmetic containing plants components, with a higher number of deposits related to anti-ageing and whitening skin treatment. Fabaceae, Asteraceae, Rosaceae, Lamiaceae, Poaceae, Rutaceae, Lilliacae and Apiaceae were the key plant families used in cosmetic formulations for skin care treatment. Comparison between scientific and technological data pointed out divergences between patents deposits and aid-based scientific reports. The use of patent analysis in combination with scientific data opens up wider aspects of knowledge and enables a better rationalization of innovative works.

  8. Section for Standard and Patents - Standardization and Patents

    International Nuclear Information System (INIS)

    Wojtowicz, S.; Trechcinski, R.; Rybka, M.; Ryszkowska, A.; Wardaszko, J.

    1997-01-01

    Full text: The most important tasks of the Section in 1996 were: preparation of national standards and program of future work on standards for nuclear instrumentation and electronic equipment in nuclear engineering; organization of activities and participation in the meetings of the Commissions for Standardization No 173 Microprocessor Systems, No 266 Nuclear Instrumentation; giving opinions and expertises on national and international standards for equipment in nuclear engineering; cooperation with the Commission for Standardization No 246 Radiological Protection; control of inventiveness activity; The quality of the technical products is being improved by: a) selection of the proper types of interface systems, technical coordination and quality control; b) creation of standards at a high technical level; The Section works mainly for the Polish Committee for Standardization, the National Atomic Energy Agency, Association of Polish Electrical Engineers and Research Institutes in Poland. The activity of the Section is useful for all national institutions where backplane busses and nuclear electronic equipment is produced or used. The Section participates in the following international organizations: IEC (International Electrotechnical Commission) TC 45 (Nuclear Instrumentation); ISO/IEC Joint Technical Committee ISO/IEC JTCl SC26 (Microprocessor systems); ESONE (European Studies on Norms for Electronics); The section takes part in popularization of nuclear technology and instrumentation in the following ways: distribution of standards and technical documentation to national institutions dealing with nuclear apparatus; collecting and distributing technical information from international organizations (e.g. ESONE); organization of technical and scientific, national and international conferences (New Generation Nuclear Power Plants - September 96, QNX in Real World - January 96); participation in the technical conference organized by the Polish Committee for

  9. Strategies for stem cell patent applications in the light of recent court cases.

    Science.gov (United States)

    Eyre, David E; Schlich, George W

    2015-01-01

    Stem cells offer the prospect of treatments for diseases and injuries that are currently beyond medical science. Although development of these potential medical marvels has been dogged by their controversial origin, technological developments and guidance from recent judicial decisions have answered and overcome many of these difficulties. In particular, the European Patent Office, United States Patent and Trademark Office, Japan Patent Office and State Intellectual Property Office of China have published guidelines covering patenting of stem cell technologies in the light of recent decisions. We now see a patent landscape where stem cell technologies and related therapies can, with very few exceptions, be protected via patents, provided the appropriate form of claim wording is used.

  10. Patentes domésticas de universidades españolas: análisis bibliométrico

    Directory of Open Access Journals (Sweden)

    González-Albo Manglano, Borja

    2007-03-01

    Full Text Available The importance of patents as source of information and base for theelaboration of indicators of the technological production is increasinglyrecognized. The university is one of the main generating centres of researchin any R&D system. Thus, the analysis of the academic patents sheds lighton one of the aspects less studied of university research. This articlestudies the production of Spanish universities as patent applications at theSpanish Office of Patents and Marks between 1980 and 2000 included inthe Oepmpat database. Their institutional, geographical and temporarydistributions are analyzed from a bibliometric perspective, as well as theinventors. The results show that the participation of the university in thenational patent system is very limited; an institutional dispersion of theapplications and an important contribution to the final amount of a smallnumber of authors is observed.

    Cada día se reconoce más la importancia de las patentes comofuente de información y base para la elaboración de indicadores de la produccióntecnológica. La universidad es uno de los principales centrosgeneradores de investigación en cualquier sistema de I+D. El análisis delas patentes académicas permite conocer uno de los aspectos menos tratadosde la investigación universitaria. En este artículo se estudia la producciónde patentes solicitadas por las universidades españolas ante la OficinaEspañola de Patentes y Marcas entre 1980 y 2000 que están incluidasen la base de datos Oepmpat. Se analiza, desde una perspectiva bibliométrica,su distribución institucional, geográfica y temporal, así como losactores intervinientes en su elaboración. Los resultados muestran una escasaparticipación de la universidad en el sistema de patentes nacional, unadispersión institucional de las solicitudes y una alta relevancia de un reducidonúmero de autores en el conjunto final de documentos.

  11. Tracking U.S. biofuel innovation through patents

    International Nuclear Information System (INIS)

    Kessler, Jeff; Sperling, Daniel

    2016-01-01

    We use biofuel patents as a proxy for biofuel innovation. Through use of natural language processing and machine-learning algorithms, we expand patent classification capabilities to better explain the history of biofuels innovation. Results indicate that after the initial establishment of the U.S. biofuel industry, there were two surges in biofuel innovation: 1995–2000, characterized by heavy patenting by 1st generation (food-based) biofuel firms; and 2005–2010, characterized by a second surge of innovation by those same large firms, complemented by a large number of biotechnology firms producing a relatively small number of 2nd generation biofuel patents. Our analysis corroborates the widespread understanding that the first surge in biofuel innovation was linked to innovations in agriculture, and that the second surge of biofuel innovation was driven by demand-pull policies mandating and incentivizing biofuels. But the slow emergence of a 2nd generation cellulose-based biofuels industry, far slower than called for by policy, suggests that technology-push policies more focused on R&D and investment may be needed to accelerate the commercialization of 2nd generation biofuels. - Highlights: • Patenting activity closely corresponds to sociotechnical shifts in biofuel innovation. • The Renewable Fuel Standard likely contributed to the rise in biofuel patenting activity after 2005. • 2nd generation biofuel technology innovation appears lacking compared to 1st generation technologies.

  12. Decoding Gene Patents in Australia

    OpenAIRE

    Denley, Adam; Cherry, James

    2015-01-01

    Patents directed to naturally occurring genetic material, such as DNA, RNA, chromosomes, and genes, in an isolated or purified form have been granted in Australia for many years. This review provides scientists with a summary of the gene patent debate from an Australian perspective and specifically reviews how the various levels of the legal system as they apply to patents—the Australian Patent Office, Australian courts, and Australian government—have dealt with the issue of whether genetic m...

  13. Patents: Recent Trends and Puzzles

    OpenAIRE

    Zvi Griliches

    1989-01-01

    This paper reviews the historical data on patenting in the United States with special reference to the last 20 years and their potential relation, if any, to the recent productivity slowdown. Two Points are made: Patents are not a "constant-yardstick" indicator of either inventive input or output. Moreover, they are "produced" by a governmental agency which goes through its own budgetary and inefficiency cycles. The paper shows that the appearance of an absolute decline in patenting in the 19...

  14. Clearing a path through the CRISPR patent jungle - Part I: User generated licensing models

    DEFF Research Database (Denmark)

    Minssen, Timo; Van Zimmeren, Esther; Wested, Jakob

    2018-01-01

    The revocation of Broad Institute’s patent EP2771468, marks the latest major development in a series of patent battles over the revolutionary and highly lucrative CRISPR- Cas 9 technology (and other gene editing technologies) in the US and Europe. While this is the first EPO decision......, researchers and companies looking to commercialize CRISPR–Cas9 gene editing and comparable techniques will probably continue to face a very complex, highly fragmented patent landscape for the next decades. Typically, patent claims will become narrower and may be harder to enforce. This may trigger some...

  15. Analysis of Taiwan patents for the medicinal mushroom "Niu-Chang- Chih".

    Science.gov (United States)

    Chen, Yu-Fen; Lu, Wen-Ling; Wu, Ming-Der; Yuan, Gwo-Fang

    2013-04-01

    "Niu-Chang-Chih" (Antrodia cinnanomea) is a medicinal mushroom that has only been collected from the aromatic tree, Cinnamomum kanehirai, which is native to Taiwan. A total of 105 Taiwan patent applications and patents for "Niu-Chang-Chih" were collected and analyzed. Patent applications and granted patents claiming newly identified functional components from "Niu-Chang-Chih," biologically pure cultures of the mushroom strain, and cultivation of "Niu-Chang-Chih" were examined. Several applications and patents claim identified active compounds from "Niu-Chang- Chih," which provide better patent protection. These newly identified functional compounds include cyclohexanones, maleic and succinic acid derivatives, labdane diterpenoids, and benzenoids. Newly identified functional proteins include a glutathione-dependent formaldehyde dehydrogenase (GFD), a glycoprotein named ACA1, and a laccase. Newly identified functional polysaccharides include ACP1, ACP2, and ACP3. The number of patents for newly identified compounds and their uses are expected to continue growing.

  16. Biocompatible Synthetic and Semi-synthetic Polymers - A Patent Analysis.

    Science.gov (United States)

    Ranganathan, Balu; Miller, Charles; Sinskey, Anthony

    2018-01-01

    Bioengineering has come of ages by setting up spare parts manufacturing units to be used in human body such as invasive implants and interventional controlled drug delivery in vivo systems. As a matter of fact patients on basis of their fiscal strength have the option to undergo prophylactic tactical manoeuvre for longer life spans. In this sphere of invasive implants, biocompatible polymer implants are a state of the art cutting edge technology with outstanding innovations leading to number of very successful start-up companies with a plethora of patent portfolios. From 2000 onwards, patent filings and grants for biocompatible polymers are expanding. Currently definition of biocompatibility is quite ambiguous with respect to the use of FDA approved polymeric materials. This article analysed patent portfolios for the trend patterns of prolific biocompatible polymers for capitalization and commercialization in the forthcoming years. Pair Bulk Data (PBD) portal was used to mine patent portfolios. In this patent preliminary analysis report, patents from 2000 to 2015 were evaluated using 317(c) filings, grants and classifications data for poly(vinyl alcohol) (PVA), poly(glycolic acid) (PGA), poly(hydroxyalkanoates) (PHAs) and poly(lactic acid) (PLA). This patent portfolio preliminary analysis embarks into patent analysis for New Product Development (NPD) for corporate R&D investment managerial decisions and on government advocacy for federal funding which is decisive for developmental advances. An in-depth patent portfolio investigation with return of investment (RoI) is in the pipeline. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  17. Collaborative networks and patent production in Andean Community of Nations universities (UCANS, 2005-2015

    Directory of Open Access Journals (Sweden)

    Carlos Enrique Agüero Aguilar

    2017-06-01

    Full Text Available The competitiveness and technological development of a region are measured by the degree of innovation supporting them. The quantity and quality of patents generated and applied in production dynamics serve as an element for evaluation. In this sense, universities play a role as generators and transmitters of knowledge. So it is important to identify the level of their collaboration and the trends in terms of technology application in order to establish future policies for development in this sector. This article identifies the degree of collaboration, types of patents, actors (primary and secondary and dynamics of patents produced at the Andean Community of Nations universities during the period 2005-2015 and present in the European Patent Office database. In conclusion, there is a great disparity between CAN universities regarding patent production, so it is necessary to strengthen the collaborative level among universities in this community. Nevertheless, an increase is seen in the production of patents.

  18. Wacky Patents Meet Economic Indicators

    DEFF Research Database (Denmark)

    Czarnitzki, Dirk; Hussinger, Katrin; Schneider, Cédric

    2011-01-01

    We investigate whether standard indicators can distinguish between “wacky” patents and a control group. Forward citations are good predictors of importance. However, “wacky” patents have higher originality, generality and citation lags, suggesting that these indicators should be interpreted...

  19. Online Patent Searching: The Realities.

    Science.gov (United States)

    Kaback, Stuart M.

    1983-01-01

    Considers patent subject searching capabilities of major online databases, noting patent claims, "deep-indexed" files, test searches, retrieval of related references, multi-database searching, improvements needed in indexing of chemical structures, full text searching, improvements needed in handling numerical data, and augmenting a…

  20. Pesticides and the Patent Bargain

    NARCIS (Netherlands)

    Timmermann, C.A.

    2015-01-01

    In order to enlarge the pool of knowledge available in the public domain, temporary exclusive rights (i.e. patents) are granted to innovators who are willing to fully disclose the information needed to reproduce their invention. After the 20-year patent protection period elapses, society should be

  1. Sources of inspiration? Making sense of scientific references in patents

    NARCIS (Netherlands)

    Callaert, Julie; Pellens, Maikel; van Looy, Bart

    2013-01-01

    Scientific references in patent documents can be used as indicators signaling science-technology interactions. Whether they reflect a direct ‘knowledge flow’ from science to technology is subject of debate. Based on 33 interviews with inventors at Belgian firms and knowledge-generating institutes

  2. Patent based innovation and development: issues, challenges and future

    International Nuclear Information System (INIS)

    Noraini Ibrahim

    2001-01-01

    The main purpose of this paper is to analyse the extent to which science and technology (S and T) policy has been integrated to patent based innovation within the context of national development objective. Could the institutionalisation of patent based innovation in Malaysia be effectively implemented ? The main argument is that patent based innovation must be integrated into the national S and T policy as a dynamic and proactive system. This paper argued that the dependency has an effect to the consequent of relationship imbalance between Malaysia and advanced nations as the main technology supplier within the international business economy. This paper adopts the interdisciplinary of social sciences using system-oriented analysis. The objective of the S and T is to enhance the capacity of national S and T resources as well as to develop the capacity of the local to select, negotiate, adopt, modify, and improve imported technology. Nevertheless, even though the S and T policy was launched in 1986, the impetus of government commitment towards the realisation of S and T policy became more pronounced only in the middle of the 90s. The Ministry of Sciences, Technology and Environment recognises the importance of creating a climate of science and technology as a critical prerequisite for national development. Various activities at the state and national levels have been organised to promote awareness and adoption of technology to the community. The Ministry that acts as the secretariat to the National Science and Development Council aims to reinforce the foundation based on S and T activities. Malaysia also should encourage activities that general technical innovations that would be integrated into patent based innovation as one of the component in the national innovation system. While this is so, an effective assimilation of technical innovation that is developed within the framework of the national innovation system is yet to be realised. Patent based innovation as a

  3. Getting patent policy right: an introduction to a special issue on the European Patent System

    DEFF Research Database (Denmark)

    Elsmore, Matthew J.

    2009-01-01

    An editorial on the Special Issue: Dealing with the major questions confronting the basics of the European patent system; plus a look at the possible solutions; includes an overview of the article contributions....

  4. Patent data mining: a tool for accelerating HIV vaccine innovation.

    Science.gov (United States)

    Clark, K; Cavicchi, J; Jensen, K; Fitzgerald, R; Bennett, A; Kowalski, S P

    2011-05-31

    Global access to advanced vaccine technologies is challenged by the interrelated components of intellectual property (IP) management strategies, technology transfer (legal and technical) capabilities and the capacity necessary for accelerating R&D, commercialization and delivery of vaccines. Due to a negative association with the management of IP, patents are often overlooked as a vast resource of freely available, information akin to scientific journals as well as business and technological information and trends fundamental for formulating policies and IP management strategies. Therefore, a fundamental step towards facilitating global vaccine access will be the assembly, organization and analysis of patent landscapes, to identify the amount of patenting, ownership (assignees) and fields of technology covered. This is critical for making informed decisions (e.g., identifying licensees, building research and product development collaborations, and ascertaining freedom to operate). Such information is of particular interest to the HIV vaccine community where the HIV Vaccine Enterprise, have voiced concern that IP rights (particularly patents and trade secrets) may prevent data and materials sharing, delaying progress in research and development of a HIV vaccine. We have compiled and analyzed a representative HIV vaccine patent landscape for a prime-boost, DNA/adenoviral vaccine platform, as an example for identifying obstacles, maximizing opportunities and making informed IP management strategy decisions towards the development and deployment of an efficacious HIV vaccine. Copyright © 2011 Elsevier Ltd. All rights reserved.

  5. Traditional Knowledge and Patent Protection: Conflicting Views On International Patent Standards

    Directory of Open Access Journals (Sweden)

    A Andrzejewski

    2010-12-01

    Full Text Available As diseases continue to spread around the globe, pharmaceutical and biotech companies continue to search for new and better drugs to treat them. Most of these companies have realised that useful compounds for these purposes may be found in the natural resources that indigenous and local communities use. And yet, even though the importance of these biological resources to global health and economic livelihood is well recognised, the legal ownership and control of this traditional knowledge is still very controversial. This article undertakes a comparative analysis of American and European, as well as international legal regulations on patent law and traditional knowledge. Key questions include: What is traditional knowledge? How have the national patent laws of these countries treated the protection of plant variety and plant genetic resources? What are the existing international standards for patents, and what implications do they have for protecting traditional knowledge? And finally, what protection systems are emerging for the future?

  6. Patent arterial duct

    Directory of Open Access Journals (Sweden)

    Martin Robin P

    2009-07-01

    Full Text Available Abstract Patent arterial duct (PAD is a congenital heart abnormality defined as persistent patency in term infants older than three months. Isolated PAD is found in around 1 in 2000 full term infants. A higher prevalence is found in preterm infants, especially those with low birth weight. The female to male ratio is 2:1. Most patients are asymptomatic when the duct is small. With a moderate-to-large duct, a characteristic continuous heart murmur (loudest in the left upper chest or infraclavicular area is typical. The precordium may be hyperactive and peripheral pulses are bounding with a wide pulse pressure. Tachycardia, exertional dyspnoea, laboured breathing, fatigue or poor growth are common. Large shunts may lead to failure to thrive, recurrent infection of the upper respiratory tract and congestive heart failure. In the majority of cases of PAD there is no identifiable cause. Persistence of the duct is associated with chromosomal aberrations, asphyxia at birth, birth at high altitude and congenital rubella. Occasional cases are associated with specific genetic defects (trisomy 21 and 18, and the Rubinstein-Taybi and CHARGE syndromes. Familial occurrence of PAD is uncommon and the usual mechanism of inheritance is considered to be polygenic with a recurrence risk of 3%. Rare families with isolated PAD have been described in which the mode of inheritance appears to be dominant or recessive. Familial incidence of PAD has also been linked to Char syndrome, familial thoracic aortic aneurysm/dissection associated with patent arterial duct, and familial patent arterial duct and bicuspid aortic valve associated with hand abnormalities. Diagnosis is based on clinical examination and confirmed with transthoracic echocardiography. Assessment of ductal blood flow can be made using colour flow mapping and pulsed wave Doppler. Antenatal diagnosis is not possible, as PAD is a normal structure during antenatal life. Conditions with signs and symptoms of

  7. Patent landscape of countermeasures against smallpox and estimation of grant attraction capability through patent landscape data.

    Science.gov (United States)

    Mayburd, Anatoly L; Kedia, Govind; Evans, Haydn W; Kaslival, Pritesh C

    2010-11-01

    The study was concerned with countermeasures against a possible smallpox outbreak. In the process of assessment 18 landscaping sectors were defined and described, the advantages and drawbacks of the corresponding countermeasures being reviewed. The data of the previously published influenza landscape were revisited. The current economic climate of deficit cutting (austerity) also puts emphasis on the optimization of capital investment. We used the materials of the landscape to define and analyze metrics of capital placement optimization. Value score was obtained by fitting patent landscape internals to the sale price of individual patents. Success score was obtained as a product of a-priori parameters that measure likelihood of emergence of a marketable product in a technological sector. Both scores were combined in a qualitative metric. Our methodology defined weight as a product of the sector size by the success score. We hypothesized - based on the material of two landscapes- that a life cycle of a technology begins in IP space with a high patent quality low volume "bud" of low weight, reaches maximum weight and then weight falls again when the technology becomes outdated. The weight and the annual dynamic of weight can serve a measure of investment risk and return. In this report we modeled investment by issue of government grants or purchase of patents by government. In the smallpox landscape the number of patents purchased by government agencies was the highest in the sectors with the highest weight and the trend was confirmed by the count of NIH grants issued in support of the technological sectors. In the influenza landscape only grant issue count was statistically meaningful and the trend was also confirmed. To better fit the grant support levels, the weight expression was optimized by using training coefficients. We propose to use value scores for evaluation of individual patent publications/company portfolios and to use weights for assessment of

  8. Recent Patents in Agricultural Biotechnology; Focus on Health.

    Science.gov (United States)

    Makhzoum, Abdullah; Venkataraman, Srividhya; Tremouillaux-Guiller, Jocelyne; Hefferon, Kathleen

    2016-01-01

    Agricultural biotechnology, including the generation of genetically modified food crops, has been the subject of much controversy over the last few years. Initially serving the basic needs of farmers, Ag Biotech has more recently gained much appeal for its opportunities with respect to both the nutritional and pharmaceutical sciences. The following review describes a number of recently approved patents that could have direct implications for the field of medicine. Topics range from the development of pharmaceuticals in plants using hairy roots or virus expression vectors, to the role of epigenetics for improving the nutritional value of food crops. Many of these patents were developed by smaller companies or publically funded research institutes, disproving the perception that intellectual property in Ag Biotech is restricted to only large multinational corporations. The review concludes with a discussion of the future of these technologies in the face of the current negative political climate. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  9. Global nanotechnology development from 1991 to 2012: patents, scientific publications, and effect of NSF funding

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Hsinchun [The University of Arizona, Department of Management Information Systems (United States); Roco, Mihail C. [National Science Foundation (United States); Son, Jaebong; Jiang, Shan, E-mail: jiangs@email.arizona.edu; Larson, Catherine A.; Gao, Qiang [The University of Arizona, Department of Management Information Systems (United States)

    2013-09-15

    In a relatively short interval for an emerging technology, nanotechnology has made a significant economic impact in numerous sectors including semiconductor manufacturing, catalysts, medicine, agriculture, and energy production. A part of the United States (US) government investment in basic research has been realized in the last two decades through the National Science Foundation (NSF), beginning with the nanoparticle research initiative in 1991 and continuing with support from the National Nanotechnology Initiative after fiscal year 2001. This paper has two main goals: (a) present a longitudinal analysis of the global nanotechnology development as reflected in the United States Patent and Trade Office (USPTO) patents and Web of Science (WoS) publications in nanoscale science and engineering (NSE) for the interval 1991-2012; and (b) identify the effect of basic research funded by NSF on both indicators. The interval has been separated into three parts for comparison purposes: 1991-2000, 2001-2010, and 2011-2012. The global trends of patents and scientific publications are presented. Bibliometric analysis, topic analysis, and citation network analysis methods are used to rank countries, institutions, technology subfields, and inventors contributing to nanotechnology development. We then, examined how these entities were affected by NSF funding and how they evolved over the past two decades. Results show that dedicated NSF funding used to support nanotechnology R and D was followed by an increased number of relevant patents and scientific publications, a greater diversity of technology topics, and a significant increase of citations. The NSF played important roles in the inventor community and served as a major contributor to numerous nanotechnology subfields.

  10. Global nanotechnology development from 1991 to 2012: patents, scientific publications, and effect of NSF funding

    International Nuclear Information System (INIS)

    Chen, Hsinchun; Roco, Mihail C.; Son, Jaebong; Jiang, Shan; Larson, Catherine A.; Gao, Qiang

    2013-01-01

    In a relatively short interval for an emerging technology, nanotechnology has made a significant economic impact in numerous sectors including semiconductor manufacturing, catalysts, medicine, agriculture, and energy production. A part of the United States (US) government investment in basic research has been realized in the last two decades through the National Science Foundation (NSF), beginning with the nanoparticle research initiative in 1991 and continuing with support from the National Nanotechnology Initiative after fiscal year 2001. This paper has two main goals: (a) present a longitudinal analysis of the global nanotechnology development as reflected in the United States Patent and Trade Office (USPTO) patents and Web of Science (WoS) publications in nanoscale science and engineering (NSE) for the interval 1991–2012; and (b) identify the effect of basic research funded by NSF on both indicators. The interval has been separated into three parts for comparison purposes: 1991–2000, 2001–2010, and 2011–2012. The global trends of patents and scientific publications are presented. Bibliometric analysis, topic analysis, and citation network analysis methods are used to rank countries, institutions, technology subfields, and inventors contributing to nanotechnology development. We then, examined how these entities were affected by NSF funding and how they evolved over the past two decades. Results show that dedicated NSF funding used to support nanotechnology R and D was followed by an increased number of relevant patents and scientific publications, a greater diversity of technology topics, and a significant increase of citations. The NSF played important roles in the inventor community and served as a major contributor to numerous nanotechnology subfields

  11. A contribuição de patentes para a inovação sustentável: o caso de um trocador de calor

    Directory of Open Access Journals (Sweden)

    Carlos Mamori Kono

    2014-01-01

    Full Text Available Patents are useful indicators of innovation, although still of a very limited use. In patenting, the need for the precise registration of a method, process, or system facilitates understanding it and eventually motivates the scientific community to carry out research in a given area, thus accelerating technological progress. Patent data are not static; patents cite other connected patents, providing a dynamic view of technological antecedents and descendants leading to state-of-the-art knowledge. This article is an exercise on the usefulness of patents as a source of technological innovation. To do this, we searched patent databases considered as sources of technological innovation in order to introduce improvements in a heat-exchanging device coupled to an electric shower. The results enabled finding the state-of-the-art of the technology and led to suggestions of possible innovations for the product. This allowed us to improve the sustainability potential of this technology.

  12. Global Perspective for Protecting Intellectual Property - Patenting in USA and Poland

    Science.gov (United States)

    Grebski, Michalene Eva; Wolniak, Radosław

    2018-06-01

    Paper addresses the different methods for protecting intellectual property in modern knowledge-based economies. The focus of the paper is a comparison between the procedures for applying for patents in Poland and the United States. The comparison has been made from the perspective of the cost of obtaining and maintaining a patent in Poland, the United States and some other countries. The comparison has also been made from the perspective of the procedures for applying for a patent in different countries based on the Patent Cooperation Treaty. The paper also includes a comparison of the time needed for processing the patent application. Low cost provisional twelve-month patent pending protection available in the United States is also being discussed. The paper also provides some guidance and recommendations for conducting a patent search in order to validate the originality of the invention.

  13. Patents Assessed through Sectoral Operational Programs

    Directory of Open Access Journals (Sweden)

    Paula – Angela VIDRAȘCU

    2014-06-01

    Full Text Available According to the International Accounting Standards – IAS 38 „Intangible assets”; these assets are identifiable non-monetary assets under construction were considered without physical substance. Lack actual physical form must not be understood that an intangible asset would have no material support, because the presence of any intangible asset can be demonstrated only by a support material form. Exmple: frequently encounter compact-disc (in case a software, legal documentation (in the case of licences, trade marks and patents of invention, contracts, permits and licences, technical documentation or films. Nowadays we are constantly subjected to the changing flow of information that is found in a perpetual technological change which started the emergence of a new stage in the society development that which carries the name of knowledge. The object of my research is the patent for the structural funds reimbursable project submitted in the "Operational Program, Economic Competitiveness" Operation 2.3.1. "Support for start-ups and innovative spin-offs. Patent is an official document certifying the inventor, the exclusive right to produce a certain good or product or use a particular process. Remember that evaluation of intangible assets is the most complex and systematic procedure.

  14. Economic Justification of Patents and Exceptions to Patentability

    DEFF Research Database (Denmark)

    Nordberg, Ana

    2012-01-01

    The present article is the conclusion of a review of economic justifications for patent rights conducted with the objective of determining whether such arguments are per se capable of sustaining the existence of a different patentability regime for inventions of methods for treatment and diagnostic...... methods (art.53 (c) European Patent Convention). It starts by exploring the normative background and summarily describes the different types of claims allowed under the current legal framework and their differences. The following sections will describe and apply the main economic arguments sustaining...... patent rights inventions of methods for treatment and diagnostic methods. These reasoning will be later confronted with contra-arguments. This piece will finalize with the formulation of conclusions extracted from the previous debate, inter-alia that economic reasoning does not per se sustain...

  15. Patenting Nanomedicines Legal Aspects, Intellectual Property and Grant Opportunities

    CERN Document Server

    Souto, Eliana B

    2012-01-01

    "Patenting Nanomedicines: Legal Aspects, Intellectual Property and Grant Opportunities" focuses on the fundamental aspects of Patenting Nanomedicines applied in different "Drug Delivery and Targeting Systems". The promoters of new findings in this field of research are numerous and spread worldwide; therefore, managing intellectual property portfolios, and the acquisition and exploitation of new knowledge face several contingency factors. Today, the scientific community is discussing issues of economic outcomes in the field of Nanomedicines. Major concerns include questions

  16. Developing a Systematic Patent Search Training Program

    Science.gov (United States)

    Zhang, Li

    2009-01-01

    This study aims to develop a systematic patent training program using patent analysis and citation analysis techniques applied to patents held by the University of Saskatchewan. The results indicate that the target audience will be researchers in life sciences, and aggregated patent database searching and advanced search techniques should be…

  17. 78 FR 31885 - Patent Term Extension

    Science.gov (United States)

    2013-05-28

    ... DEPARTMENT OF COMMERCE Patent and Trademark Office Patent Term Extension ACTION: Proposed collection; comment request. SUMMARY: The United States Patent and Trademark Office (USPTO), as part of its... States Patent and Trademark Office, P.O. Box 1450, Alexandria, VA 22313-1450. Federal Rulemaking Portal...

  18. 78 FR 7759 - Patent Cooperation Treaty

    Science.gov (United States)

    2013-02-04

    ... DEPARTMENT OF COMMERCE Patent and Trademark Office Patent Cooperation Treaty ACTION: Proposed collection; comment request. SUMMARY: The United States Patent and Trademark Office (USPTO), as part of its... States Patent and Trademark Office, P.O. Box 1450, Alexandria, VA 22313-1450. Federal Rulemaking Portal...

  19. 75 FR 20561 - Patent Term Extension

    Science.gov (United States)

    2010-04-20

    ... DEPARTMENT OF COMMERCE Patent and Trademark Office Patent Term Extension ACTION: Proposed collection; comment request. SUMMARY: The United States Patent and Trademark Office (USPTO), as part of its... Officer, Office of the Chief Information Officer, United States Patent and Trademark Office, P.O. Box 1450...

  20. 76 FR 72000 - Patent, Trademark & Copyright Acts

    Science.gov (United States)

    2011-11-21

    ... DEPARTMENT OF THE INTERIOR Geological Survey Patent, Trademark & Copyright Acts AGENCY: U.S... Consultants, 1255 Roberts Boulevard NW., Suite 200, Kennesaw, GA 30144, on U.S. Patent Application Serial No. 12/133,666, and a divisional patent application to be filed shortly at the Patent and Trademark...

  1. Development of Lab-to-Fab Production Equipment Across Several Length Scales for Printed Energy Technologies, Including Solar Cells

    DEFF Research Database (Denmark)

    Hösel, Markus; Dam, Henrik Friis; Krebs, Frederik C

    2015-01-01

    We describe and review how the scaling of printed energy technologies not only requires scaling of the input materials but also the machinery used in the processes. The general consensus that ultrafast processing of technologies with large energy capacity can only be realized using roll-to-roll m...

  2. 78 FR 22911 - HCL America, Inc., a Subsidiary of HCL Technologies Limited, Including On-Site Leased Workers...

    Science.gov (United States)

    2013-04-17

    ... America Inc., a subsidiary of HCL Technologies Limited, Webster, New York (subject firm). Workers are... infrastructure services (hardware/software testing) for clients. The Department's Notice of determination was... subject firm whose unemployment insurance (UI) wages are reported through Segula Technologies The intent...

  3. Workplace Demographics and Technology: Challenges and Opportunities to the Campus Mission Including the Top Facilities Issues. APPA Thought Leaders 2011

    Science.gov (United States)

    APPA: Association of Higher Education Facilities Officers, 2011

    2011-01-01

    It is not unusual in higher education circles to talk about issues affecting the campus. Experts might write about how shifting demographics are changing the campus, or say technology is becoming more pervasive on campus. The campus itself evolves alongside pedagogical practices, technological innovations, student needs, and the mission of the…

  4. Patents and Publics: Engaging Museum Audiences with Issues of Ownership and Invention

    Directory of Open Access Journals (Sweden)

    James F. Stark

    2015-04-01

    Full Text Available It is all very well to note the hyperbole about patents and ‘intellectual property’ in the recent battles between technology companies such as Apple, Samsung and HTC. But how can museums productively use collection items marked with a patent beyond workaday tasks of identification and cataloguing? We argue that information on patents can enhance visitors’ critical engagement with museum displays; complex ownership claims and counter-claims in patent disputes can underpin lively narratives based around museum objects. Asking why some objects and not others were patented, and how historical consumers responded to that status of ‘patented’ enables us to look at these objects afresh. In particular we analyse the responses of public consultation groups to patenting in the medical trade, as well as the engagement of museum staff with these issues. Such consultation processes offer information that can be used to enhance museum displays with engaging narratives of ownership and invention.

  5. Religious coalition opposes gene patents.

    Science.gov (United States)

    James, J S

    1995-05-19

    The biotechnology industry is concerned about a coalition of mainstream religious leaders, working with Jeremy Rifkin of the Foundation of Economic Trends, who oppose the patenting of human and animal life forms, body parts, and genes. The coalition called a press conference on May 18 to ask the government to prohibit the current patenting practices for genetic engineering. The biotechnology industry argues that patents indicate that a company's research tool has significant value, and encourages capitalists to invest their dollars in the development of new treatments for diseases. They also argue that the 29 biotech drugs that are on the market have been developed as a result of patents on genes. Although most business leaders are united in opposing restrictions, many scientists are divided, citing both religious and scientific reasons.

  6. Universities’ Intellectual Property: Path for Innovation or Patent Competition?

    Directory of Open Access Journals (Sweden)

    Gustavo Dalmarco

    2011-09-01

    Full Text Available Technological innovation is represented by the conversion of knowledge into new products and processes which, when commercialized, generate wealth. In relations with companies, universities’ role is to develop scientific knowledge, fostering industry’s R&D activities. This article proposes an analysis of the technology transfer process performed by public universities in Brazil. Results demonstrate that universities are facing difficulties in requesting and licensing patents based on scientific results, due to lack of commercial contact with companies and their limitations in adapting available technologies. The increase in scientific output is not being effectively transformed into new technologies for products and services, exposing the necessity for new policies to approach university-industry relations. For universities, this may mean rethinking the role of patents in the technology transfer process, such as increasing co-authorship with companies and have companies support technological research within the university, instead of investing in legal protection, distant from market needs.

  7. INDEX OF SPECIALISATION ACCORDING TO TECHNOLOGICAL FIELDS AND THE PERSPECTIVES OF TECHNOLOGICAL LEADERSHIP OF RUSSIA

    Directory of Open Access Journals (Sweden)

    V. G. Zinov

    2016-01-01

    Full Text Available The article presents a completed analysis of patent documents collections, distributed outside ofRussian Federationand its organisation according to classes introduced by International Patent Classification. There are identified areas in engineering, where an increased activity of Russian residents is detected in the global space of intellectual property (IP. There are recognised competitive scientific-technological capacities ofRussian Federationfor conquering the world market. These include technologies for creating and producing new medical drugs, informational communication and digital technologies. There has been identified a significant number of patent technical solutions in certain areas of chemical and biotechnologies. It is emphasised that Russian global technological leadership is impossible without the presence in the global space of the intellectual property.

  8. 78 FR 16474 - Extension of the Period for Comments on the Enhancement of Quality of Software-Related Patents

    Science.gov (United States)

    2013-03-15

    ...] Extension of the Period for Comments on the Enhancement of Quality of Software-Related Patents AGENCY... announcing the formation of a partnership with the software community to enhance the quality of software... quality of software-related patents and the preparation of software-related patent applications including...

  9. Patent Law for Computer Scientists

    Science.gov (United States)

    Closa, Daniel; Gardiner, Alex; Giemsa, Falk; Machek, Jörg

    More than five centuries ago the first patent statute was passed by the Venetian senate. It already had most of the features of modern patent law, recognizing the public interest in innovation and granting exclusive right in exchange for a full disclosure. Some 350 years later the industrial revolution led to globalisation. The wish to protect intellectual property on a more international level evolved and supranational treaties were negotiated. Patent laws are still different in many countries, however, and inventors are sometimes at a loss to understand which basic requirements should be satisfied if an invention is to be granted a patent. This is particularly true for inventions implemented on a computer. While roughly a third of all applications (and granted patents) relate, in one way or another, to a computer, applications where the innovation mainly resides in software or in a business method are treated differently by the major patent offices. The procedures at the USPTO, JPO and EPO and, in particular, the differences in the treatment of applications centring on software are briefly explained. In later sections of this book, a wealth of examples will be presented. The methodology behind the treatment of these examples is explained.

  10. Text mining factor analysis (TFA) in green tea patent data

    Science.gov (United States)

    Rahmawati, Sela; Suprijadi, Jadi; Zulhanif

    2017-03-01

    Factor analysis has become one of the most widely used multivariate statistical procedures in applied research endeavors across a multitude of domains. There are two main types of analyses based on factor analysis: Exploratory Factor Analysis (EFA) and Confirmatory Factor Analysis (CFA). Both EFA and CFA aim to observed relationships among a group of indicators with a latent variable, but they differ fundamentally, a priori and restrictions made to the factor model. This method will be applied to patent data technology sector green tea to determine the development technology of green tea in the world. Patent analysis is useful in identifying the future technological trends in a specific field of technology. Database patent are obtained from agency European Patent Organization (EPO). In this paper, CFA model will be applied to the nominal data, which obtain from the presence absence matrix. While doing processing, analysis CFA for nominal data analysis was based on Tetrachoric matrix. Meanwhile, EFA model will be applied on a title from sector technology dominant. Title will be pre-processing first using text mining analysis.

  11. Gas-cooled reactor technology: a bibliography

    International Nuclear Information System (INIS)

    Raleigh, H.D.

    1981-09-01

    Included are 3358 citations on gas-cooled reactor technology contained in the DOE Energy Data Base for the period January 1978 through June 1981. The citations include reports, journal articles, books, conference papers, patents, and monographs. Corporate, Personal Author, Subject, Contract Number, and Report Number Indexes are provided

  12. Achievement report for fiscal 1982 on Sunshine Program-entrusted research and development. Survey on patent and information (Hydrogen energy); 1982 nendo tokkyo joho chosa kenkyu seika hokokokusho. Suiso energy

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1983-03-01

    Patents related to the research under the Sunshine Program are surveyed so as to ensure that the program be promoted smoothly and efficiently. Since the scope of the hydrogen energy technology is extensive, branches supposed to be relatively important only are surveyed, which include the production of hydrogen (thermochemical process, photochemical process, and electrolysis), storage and transportation of hydrogen, safety of hydrogen, hydrogen fuel cells, hydrogen-fueled engines, and hydrogen combustion devices. The basic policy to follow in the extraction of necessary patents is that all related to the hydrogen energy technology be collected from as many fields as possible. However, it is impossible to read all the laid-open patents. Under such circumstances, out of the items in IPC (International Patent Classification) used by the Patent Agency, those deemed to be closely related to the hydrogen energy technology are designated and, when the classification item attached to the official gazette matches one of the IPC classification items, it is extracted as a desired item after deliberation of its relationship with the hydrogen energy technology. (NEDO)

  13. Patterns of Creation and Discovery: An Analysis of Defense Laboratory Patenting and Innovation

    Science.gov (United States)

    2013-01-01

    or by tracking the accumulation of patents within technology classes as demonstrated in Eusebi & Silberglitt (N.d.), Chen et al. (2010), Andersen ...In 2012, Aggarwal and Sanghera received the Dr. Arthur E. Bisson Prize for Naval Technology Achievement which recognizes "individuals who have...emerging market conditions ( Andersen , 1999; Ernst, 1997). These suggestions are based on the theory that the rate of patent filings within a technology

  14. Scientometric and patentometric analyses to determine the knowledge landscape in innovative technologies: The case of 3D bioprinting.

    Science.gov (United States)

    Rodríguez-Salvador, Marisela; Rio-Belver, Rosa María; Garechana-Anacabe, Gaizka

    2017-01-01

    This research proposes an innovative data model to determine the landscape of emerging technologies. It is based on a competitive technology intelligence methodology that incorporates the assessment of scientific publications and patent analysis production, and is further supported by experts' feedback. It enables the definition of the growth rate of scientific and technological output in terms of the top countries, institutions and journals producing knowledge within the field as well as the identification of main areas of research and development by analyzing the International Patent Classification codes including keyword clusterization and co-occurrence of patent assignees and patent codes. This model was applied to the evolving domain of 3D bioprinting. Scientific documents from the Scopus and Web of Science databases, along with patents from 27 authorities and 140 countries, were retrieved. In total, 4782 scientific publications and 706 patents were identified from 2000 to mid-2016. The number of scientific documents published and patents in the last five years showed an annual average growth of 20% and 40%, respectively. Results indicate that the most prolific nations and institutions publishing on 3D bioprinting are the USA and China, including the Massachusetts Institute of Technology (USA), Nanyang Technological University (Singapore) and Tsinghua University (China), respectively. Biomaterials and Biofabrication are the predominant journals. The most prolific patenting countries are China and the USA; while Organovo Holdings Inc. (USA) and Tsinghua University (China) are the institutions leading. International Patent Classification codes reveal that most 3D bioprinting inventions intended for medical purposes apply porous or cellular materials or biologically active materials. Knowledge clusters and expert drivers indicate that there is a research focus on tissue engineering including the fabrication of organs, bioinks and new 3D bioprinting systems. Our

  15. 48 CFR 970.5227-11 - Patent rights-management and operating contracts, for-profit contractor, non-technology transfer.

    Science.gov (United States)

    2010-10-01

    ... affiliates, if any, within the corporate structure of which the Contractor is a party and includes the right... benefits are, to the extent permitted by law or Government regulations, available to the public on... rights—(1) Assignment to the Government. Except to the extent that rights are retained by the Contractor...

  16. Patents, Inducement Prizes, and Contestant Strategy

    DEFF Research Database (Denmark)

    Davis, Jerome; Davis, Lee N.

    2006-01-01

    Debate over the merits of patents versus inducement prizes has tended to ignore the signaling roles of patents, and totally ignores the impact of patent signaling on prize contests. This paper asks: How does patent signaling affect the strategic choices of firms considering entering prize contests......? First, we consider contests that do not allow patenting, then contests that do. If patenting is not allowed, we argue, patent-holders, both internal and external to the contest, can adversely impact prize contests by claiming prize winner violation of their patents, and suing for damages. The likelihood...... of such challenges being made can deter entry, particularly in contests requiring large sunk costs. Furthermore, the firm's decisionmaking process will discriminate against entering prize contests and favor R&D projects with patentable outcomes. Together, these problems may circumscribe any future wider role...

  17. Osteoclast differentiation inhibitors: a patent review (2008 - 2012).

    Science.gov (United States)

    Kim, Seong Hwan; Moon, Seong-Hee

    2013-12-01

    Mononuclear macrophage/monocyte-lineage hematopoietic precursors differentiate into multinucleated osteoclasts. Abnormally increased numbers and/or overactivation of osteoclasts can lead to bone loss. Therefore, pharmaceutical inhibition of osteoclast differentiation is one therapeutic strategy for mitigating the occurrence of bone loss-associated disorders and related fractures. This review surveys the patents and patent applications from 2008 to 2012 that are related to inventions of therapeutics and/or methods for inhibiting osteoclast differentiation. Over the past 20 years, the identification and validation of signaling molecules involved in osteoclast differentiation has led to a better understanding of the molecular mechanism, and to the development of new therapeutic agents for treating bone loss-associated disorders. Since 2008, 34 WO patents or patent applications have been filed that relate to inventions of therapeutics and/or methods for chemical-based, natural product-based, or biological-based inhibitors of osteoclast differentiation. Here, analysis of these patents and patent applications is presented, and summarize the disclosed osteoclast differentiation-inhibiting target molecules. This report can support further advances in the development of anti-osteoclastogenic therapeutics for bone loss-associated disorders, including osteoporosis, rheumatoid arthritis, Paget's disease, periodontal disease, osteosarcoma, and cancer bone metastasis.

  18. How Much are Flexibility and Uncertainty Worth in Patent Licensing?

    DEFF Research Database (Denmark)

    Leone, Maria Isabella; Oriani, Raffaele; Reichstein, Toke

    2015-01-01

    As patent licensing has become the prime driver of technology trade, understanding the rationales behind a properly-defined payment structure of the agreements is essential. Specifically, among the other remuneration components, upfront fees are critical in license negotiations since they imply a...

  19. A State-of-the-Art Report on Technologies of Volume Reduction and Self-Disposal for Large Metal Wastes including the Steam Generator of Nuclear Power Plants

    International Nuclear Information System (INIS)

    Lee, Kune Woo; Choi, W. K.; Kim, G. Y.

    2009-06-01

    This report focuses on technologies of volume reduction and self-disposal for large metal wastes including the steam generator of nuclear power plants. This report consists of the cases of treatments and foreign and domestic technologies for steam generator replacement

  20. Ethics in scientific results application: Gene and life forms patenting

    Directory of Open Access Journals (Sweden)

    Konstantinov Kosana

    2010-01-01

    Full Text Available The remarkable development and application of new genetic technologies over the past decades has been accompanied by profound changes in the way in which research is commercialized in the life sciences. As results, new varieties of commercially grown crops with improved or new traits are developed. Many thousands of patents which assert rights over DNA sequences have been granted to researchers across the public and private sector. The effects of many of these patents are extensive, because inventors who assert rights over DNA sequences obtain protection on all uses of the sequences. Extremely valuable to breeders in the national agricultural research system is the ability to genotype their collections to get a clear picture of their diversity and how diversity could be enhanced through sharing and access to global collections. The issue of the eligibility for patenting of DNA sequences needs to be reopened. Patents that assert rights over DNA sequences and their uses are, in some cases, supportable, but in others, should be treated with great caution. Rights over DNA sequences as research tools should be discouraged. That the best way to discourage the award of such patents is by stringent application of the criteria for patenting, particularly utility. A more equitable, ethically - based food and agricultural system must incorporate concern for three accepted global goals: improved well being, protection of the environment and improved public health (particular point food from GMO. To mitigate conflict one of the approach to solve problem is ethical and truthful label of GM food, because consumers have a right to choose whether to eat genetically modified foods or not. Interesting examples and risks as consequences of free availability of genetic resources utilization, its transformation, patenting of 'new' organism and selling it back to the genetic resource owner are presented. Society has obligations to raise levels of nutrition and

  1. Polymorphs and prodrugs and salts (oh my!: an empirical analysis of "secondary" pharmaceutical patents.

    Directory of Open Access Journals (Sweden)

    Amy Kapczynski

    Full Text Available BACKGROUND: While there has been much discussion by policymakers and stakeholders about the effects of "secondary patents" on the pharmaceutical industry, there is no empirical evidence on their prevalence or determinants. Characterizing the landscape of secondary patents is important in light of recent court decisions in the U.S. that may make them more difficult to obtain, and for developing countries considering restrictions on secondary patents. METHODOLOGY/PRINCIPAL FINDINGS: We read the claims of the 1304 Orange Book listed patents on all new molecular entities approved in the U.S. between 1988 and 2005, and coded the patents as including chemical compound claims (claims covering the active molecule itself and/or one of several types of secondary claims. We distinguish between patents with any secondary claims, and those with only secondary claims and no chemical compound claims ("independent" secondary patents. We find that secondary claims are common in the pharmaceutical industry. We also show that independent secondary patents tend to be filed and issued later than chemical compound patents, and are also more likely to be filed after the drug is approved. When present, independent formulation patents add an average of 6.5 years of patent life (95% C.I.: 5.9 to 7.3 years, independent method of use patents add 7.4 years (95% C.I.: 6.4 to 8.4 years, and independent patents on polymorphs, isomers, prodrug, ester, and/or salt claims add 6.3 years (95% C.I.: 5.3 to 7.3 years. We also provide evidence that late-filed independent secondary patents are more common for higher sales drugs. CONCLUSIONS/SIGNIFICANCE: Policies and court decisions affecting secondary patenting are likely to have a significant impact on the pharmaceutical industry. Secondary patents provide substantial additional patent life in the pharmaceutical industry, at least nominally. Evidence that they are also more common for best-selling drugs is consistent with accounts of

  2. 'Patents and Downstream Innovation Suppression - Fact or Fiction?'

    DEFF Research Database (Denmark)

    Howells, John

    Merges and Nelson have provided an empirically grounded argument that firms use pioneer patents of 'broad' scope to block downstream technological development (Merges and Nelson 1990). If this is a regular occurrence then, as they claim, they have faulted Kitch's 'prospect theory' of patents (Kitch...... 1977), a theory that is a version of the classic justification for the award of the exclusive right - that it should protect the incentive to develop property. Merges and Nelson insist that their thesis should be supported by empirical evidence and they turn to historical accounts as an important form...

  3. Development of the preparation technology of macroporous sorbent for industrial off-gas treatment including 14C

    International Nuclear Information System (INIS)

    Cho, Il Hoon; Cho, Young Hyun; Park, Guen Il; Kim, In Tae; Kim, June Hyung; Ahn, Byung Kil

    2001-01-01

    For environmental and health effects due to increasing levels of pollution in the atmosphere, it is necessary to develop environmentally sound technologies for the treatment of greenhouse gases (CO 2 , CH 4 , CFC, etc.) and acid gases (SOx, NOx, etc.). Specifically, advanced technology for CO 2 capturing is currently one of the most important environmental issues in worldwide. 14 CO 2 , specially which has been gradually emerging issue in the nuclear facilities, is generated about 330 ppm from the CANDU (Canadian Deuterium Uranium Reactor) nuclear power plant and the DUPIC (Direct Use of spent PWR fuel in CANDU reactors) process which is the process of spent fuel treatment. For this purpose, it is necessary to develop the most efficient treatment technology of CO 2 capture by various lime materials in semi- or dry process, it should be also considering a removal performance, waste recycling and safety of disposal. In order to develop a highly active slaked lime as a sorbent for CO 2 and high temperature desulfurization, macroporous slaked lime is necessarily prepared by modified swelling process and equipment, which was developed under carrying out this project. And also for the optimal removal process of off-gases the removal performance tests of various sorbents and the effects of relative humidity and bed depth on the removal capacity must be considered

  4. Development of the preparation technology of macroporous sorbent for industrial off-gas treatment including {sup 14}C

    Energy Technology Data Exchange (ETDEWEB)

    Cho, Il Hoon; Cho, Young Hyun; Park, Guen Il; Kim, In Tae; Kim, June Hyung; Ahn, Byung Kil

    2001-01-01

    For environmental and health effects due to increasing levels of pollution in the atmosphere, it is necessary to develop environmentally sound technologies for the treatment of greenhouse gases (CO{sub 2}, CH{sub 4}, CFC, etc.) and acid gases (SOx, NOx, etc.). Specifically, advanced technology for CO{sub 2} capturing is currently one of the most important environmental issues in worldwide. {sup 14}CO{sub 2}, specially which has been gradually emerging issue in the nuclear facilities, is generated about 330 ppm from the CANDU (Canadian Deuterium Uranium Reactor) nuclear power plant and the DUPIC (Direct Use of spent PWR fuel in CANDU reactors) process which is the process of spent fuel treatment. For this purpose, it is necessary to develop the most efficient treatment technology of CO{sub 2} capture by various lime materials in semi- or dry process, it should be also considering a removal performance, waste recycling and safety of disposal. In order to develop a highly active slaked lime as a sorbent for CO{sub 2} and high temperature desulfurization, macroporous slaked lime is necessarily prepared by modified swelling process and equipment, which was developed under carrying out this project. And also for the optimal removal process of off-gases the removal performance tests of various sorbents and the effects of relative humidity and bed depth on the removal capacity must be considered.

  5. Development of an information retrieval tool for biomedical patents.

    Science.gov (United States)

    Alves, Tiago; Rodrigues, Rúben; Costa, Hugo; Rocha, Miguel

    2018-06-01

    The volume of biomedical literature has been increasing in the last years. Patent documents have also followed this trend, being important sources of biomedical knowledge, technical details and curated data, which are put together along the granting process. The field of Biomedical text mining (BioTM) has been creating solutions for the problems posed by the unstructured nature of natural language, which makes the search of information a challenging task. Several BioTM techniques can be applied to patents. From those, Information Retrieval (IR) includes processes where relevant data are obtained from collections of documents. In this work, the main goal was to build a patent pipeline addressing IR tasks over patent repositories to make these documents amenable to BioTM tasks. The pipeline was developed within @Note2, an open-source computational framework for BioTM, adding a number of modules to the core libraries, including patent metadata and full text retrieval, PDF to text conversion and optical character recognition. Also, user interfaces were developed for the main operations materialized in a new @Note2 plug-in. The integration of these tools in @Note2 opens opportunities to run BioTM tools over patent texts, including tasks from Information Extraction, such as Named Entity Recognition or Relation Extraction. We demonstrated the pipeline's main functions with a case study, using an available benchmark dataset from BioCreative challenges. Also, we show the use of the plug-in with a user query related to the production of vanillin. This work makes available all the relevant content from patents to the scientific community, decreasing drastically the time required for this task, and provides graphical interfaces to ease the use of these tools. Copyright © 2018 Elsevier B.V. All rights reserved.

  6. IMPROVING (SOFTWARE) PATENT QUALITY THROUGH THE ADMINISTRATIVE PROCESS.

    Science.gov (United States)

    Rai, Arti K

    2013-11-24

    The available evidence indicates that patent quality, particularly in the area of software, needs improvement. This Article argues that even an agency as institutionally constrained as the U.S. Patent and Trademark Office ("PTO") could implement a portfolio of pragmatic, cost-effective quality improvement strategies. The argument in favor of these strategies draws upon not only legal theory and doctrine but also new data from a PTO software examination unit with relatively strict practices. Strategies that resolve around Section 112 of the patent statute could usefully be deployed at the initial examination stage. Other strategies could be deployed within the new post-issuance procedures available to the agency under the America Invents Act. Notably, although the strategies the Article discusses have the virtue of being neutral as to technology, they are likely to have a very significant practical impact in the area of software.

  7. The patent, object of research in Information Science and Communication

    Directory of Open Access Journals (Sweden)

    Luc Quoniam

    2014-04-01

    Full Text Available In this study are addressed some dimensions of intellectual property, especially patents and their way of making some tangible outcomes of research and development, playing a key role in the field of strategy, involving the returns on investments and exploration rights to certain inventions. However, the general objective of this study is to present aspects of the information available in patent applications and the possibility of using them to transfer technology between countries, organizations, contribute to the research of social responsibility, valuing natural resources and provide access to medicines, once these are aspects little attention in the literature. Considering the patent as an object of study in the humanities and social sciences, is evidenced by the cases cited, the potential contribution to innovation, research and development organizations, regions and countries.

  8. Search Technologies | NCI Technology Transfer Center | TTC

    Science.gov (United States)

    Our team of technology transfer specialists has specialized training in invention reporting, patenting, patent strategy, executing technology transfer agreements and marketing. TTC is comprised of professionals with diverse legal, scientific, and business/marketing expertise. Most of our staff hold doctorate-level technical and/or legal training.

  9. Available Technologies | NCI Technology Transfer Center | TTC

    Science.gov (United States)

    Our team of technology transfer specialists has specialized training in invention reporting, patenting, patent strategy, executing technology transfer agreements and marketing. TTC is comprised of professionals with diverse legal, scientific, and business/marketing expertise. Most of our staff hold doctorate-level technical and/or legal training.

  10. The Unified Patent Court (UPC) in Action - How Will the Design of the UPC Affect Patent Law?

    DEFF Research Database (Denmark)

    Petersen, Clement Salung; Riis, Thomas; Schovsbo, Jens Hemmingsen

    2014-01-01

    . The article points out that the UPC because of this design will be biased towards technology based values and uniformity at the expense of other values and interests e.g. non-economic public interests, and values associated with diversity. The practical effects of these biases are analysed regarding cases......The new common judiciary for European patents (UPC) will play a crucial role in the future European patent system. The UPC will be a very specialised court that i.a. recruits judges from specialists’ circles and has as part of its mission to develop a coherent and autonomous body of case law...

  11. Study on a Preliminary Survey and Analysis of HLW Management Technology Suitable for Nuclear Industrial Environment in Korea

    International Nuclear Information System (INIS)

    Kim, Eun Ka; Suh, In Suk; Ro, Seong Gy; Yoo, Kun Joong; Yoo, Jae Hyung; Cho, Sung Soo

    2010-12-01

    The purpose of this study is to suggest development direction of related technologies to analyze patented technology filed as a leading technology and to identify the technology trend for developing HLW management technology suitable for atomic industrial environment in Korea. For patent analysis of HLW management technology, international patent data were collected. And international application number, patent share of applicant and nationality, annual number of applications, application trends of assignees and detail technology, and frequency of patent citations / citations-to were analyzed by statistical analysis. Technical level and competitiveness through quantitative analysis by indicators of patent analysis were confirmed. And technology developments of blank technology, similarity analysis, the point of the main patent and a range of patent rights were analyzed through in-depth analysis. Trends of the patented technology of our country and world patent technology in such results have been identified, and statistical data on patents were secured. Especially in HLW management technology, patent application in Korea compared ti United States, Japan and European Union was began much later for the '90s, and are showing the annual increase on trend of patent application. Patent trend in Korea corresponds to development generation, while declining in foreign patent. The result of this study will be usefully applied to setting a development direction and blank technology of patent technology to pursue future in Korea

  12. Economic development evaluation based on science and patents

    Science.gov (United States)

    Jokanović, Bojana; Lalic, Bojan; Milovančević, Miloš; Simeunović, Nenad; Marković, Dusan

    2017-09-01

    Economic development could be achieved through many factors. Science and technology factors could influence economic development drastically. Therefore the main aim in this study was to apply computational intelligence methodology, artificial neural network approach, for economic development estimation based on different science and technology factors. Since economic analyzing could be very challenging task because of high nonlinearity, in this study was applied computational intelligence methodology, artificial neural network approach, to estimate the economic development based on different science and technology factors. As economic development measure, gross domestic product (GDP) was used. As the science and technology factors, patents in different field were used. It was found that the patents in electrical engineering field have the highest influence on the economic development or the GDP.

  13. Patent quality and incentives at the patent office

    NARCIS (Netherlands)

    Schuett, F.

    2013-01-01

    Patent examination is a problem of moral hazard followed by adverse selection: examiners must have incentives to exert effort, but also to truthfully reveal the evidence they find. I develop a theoretical model to study the design of incentives for examiners. The model can explain the puzzling

  14. 48 CFR 1427.201 - Patent and copyright infringement liability.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Patent and copyright... INTERIOR GENERAL CONTRACTING REQUIREMENTS PATENTS, DATA, AND COPYRIGHTS Patents and Copyrights 1427.201 Patent and copyright infringement liability. ...

  15. 48 CFR 27.201 - Patent and copyright infringement liability.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Patent and copyright... REGULATION GENERAL CONTRACTING REQUIREMENTS PATENTS, DATA, AND COPYRIGHTS Patents and Copyrights 27.201 Patent and copyright infringement liability. ...

  16. Fundamentals of patenting and licensing for scientists and engineers

    National Research Council Canada - National Science Library

    Ma, M. Y. (Matthew Y.)

    2009-01-01

    ... ...28 3.2 Types of Patents...28 3.3 Patent Dates ...29 viiviii Fundamentals of Patenting and Licensing for Scientists and Engineers 3.4 Eligibility of Priority Date ...30 3.5 Patentability ...32...

  17. The Applicability of Patented Technologies to Sonobuoys

    Science.gov (United States)

    1988-06-30

    Ave, Boulder, CO 80301 2. Compagnie Generale de Geophysique 6 Rue Galvani Paris, France 3. EIC Laboratories, Incorporated Newton, MA 02146 4. Edo...Co. 2 Compagnie de Geophysique , France 3 Cooper, Charles E. 2 M Crown Controls Corporation 1 ,6 Cyr, Reginald J. 1 DeltaLab Research, Incorporated 1...Int’l App ....... 7,5 [73) Assignees: Institut Francais du Petrole. OTHER PUBLICATIONS -" Rueil-Malmaison; Compagnie Generale de Geophysique , Massy

  18. Increasing the Discovery and Use of Non-Patent Literature (NPL): Scientific Publications in Patent Examination

    OpenAIRE

    F. Loizides; B. Diallo; A. Pollard; A. Mavri

    2017-01-01

    In this work we present findings on non-patent literature use, and specifically scientific publications such as academic articles. We interview patent examiners and observe their prior art searching in order to provide insights into the perceived usage of non-patent literature and produce high level requirements for advancing non-patent literature search tools.

  19. 77 FR 4509 - Patent Public Advisory Committee Public Hearings on the Proposed Patent Fee Schedule

    Science.gov (United States)

    2012-01-30

    ... patent fees. The publication of that Notice will open a comment window through which the public may...-P-2012-0002] Patent Public Advisory Committee Public Hearings on the Proposed Patent Fee Schedule... Trademark Office (USPTO) may set or adjust by rule any patent or trademark fee established, authorized, or...

  20. Beyond Invention: Patent as Knowledge Law

    OpenAIRE

    Madison, Michael

    2017-01-01

    The decision of the Supreme Court of the United States in Bilski v. Kappos, concerning the legal standard for determining patentable subject matter under the American Patent Act, is used as a starting point for a brief review of historical, philosophical, and cultural influences on subject matter questions in both patent and copyright law. The article suggests that patent and copyright law jurisprudence was constructed initially by the Court with explicit attention to the relationship between...

  1. 14 CFR 1260.28 - Patent rights.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 5 2010-01-01 2010-01-01 false Patent rights. 1260.28 Section 1260.28... Provisions § 1260.28 Patent rights. Patent Rights May 2006 As stated at § 1260.136, this award is subject to... “Patent Rights (Small Business Firms and Nonprofit Organizations)” and the following: (a) Where the term...

  2. MSTD 2007 Publications and Patents

    International Nuclear Information System (INIS)

    King, W.E.

    2008-01-01

    The Materials Science and Technology Division (MSTD) supports the central scientific and technological missions of the Laboratory, and at the same time, executes world-class, fundamental research and novel technological development over a wide range of disciplines. Our organization is driven by the institutional needs in nuclear weapons stockpile science, high-energy-density science, nuclear reactor science, and energy and environment science and technology. We maintain expertise and capabilities in many diverse areas, including actinide science, electron microscopy, laser-materials interactions, materials theory, simulation and modeling, materials synthesis and processing, materials science under extreme conditions, ultrafast materials science, metallurgy, nanoscience and technology, nuclear fuels and energy security, optical materials science, and surface science. MSTD scientists play leadership roles in the scientific community in these key and emerging areas

  3. MSTD 2007 Publications and Patents

    Energy Technology Data Exchange (ETDEWEB)

    King, W E

    2008-04-01

    The Materials Science and Technology Division (MSTD) supports the central scientific and technological missions of the Laboratory, and at the same time, executes world-class, fundamental research and novel technological development over a wide range of disciplines. Our organization is driven by the institutional needs in nuclear weapons stockpile science, high-energy-density science, nuclear reactor science, and energy and environment science and technology. We maintain expertise and capabilities in many diverse areas, including actinide science, electron microscopy, laser-materials interactions, materials theory, simulation and modeling, materials synthesis and processing, materials science under extreme conditions, ultrafast materials science, metallurgy, nanoscience and technology, nuclear fuels and energy security, optical materials science, and surface science. MSTD scientists play leadership roles in the scientific community in these key and emerging areas.

  4. Patentability aspects of computational cancer models

    Science.gov (United States)

    Lishchuk, Iryna

    2017-07-01

    Multiscale cancer models, implemented in silico, simulate tumor progression at various spatial and temporal scales. Having the innovative substance and possessing the potential of being applied as decision support tools in clinical practice, patenting and obtaining patent rights in cancer models seems prima facie possible. What legal hurdles the cancer models need to overcome for being patented we inquire from this paper.

  5. 43 CFR 402.10 - Patent.

    Science.gov (United States)

    2010-10-01

    ... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Patent. 402.10 Section 402.10 Public Lands... LANDS IN FEDERAL RECLAMATION PROJECTS Public Lands § 402.10 Patent. When a purchaser has complied fully... and patent and shall state the statutory authority for such liens. The receipt shall be submitted to...

  6. 48 CFR 970.2703 - Patent rights.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Patent rights. 970.2703 Section 970.2703 Federal Acquisition Regulations System DEPARTMENT OF ENERGY AGENCY SUPPLEMENTARY REGULATIONS DOE MANAGEMENT AND OPERATING CONTRACTS Patents, Data, and Copyrights 970.2703 Patent rights. ...

  7. 48 CFR 35.012 - Patent rights.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Patent rights. 35.012 Section 35.012 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION SPECIAL CATEGORIES OF CONTRACTING RESEARCH AND DEVELOPMENT CONTRACTING 35.012 Patent rights. For a discussion of patent rights, see...

  8. Patent analysis to identify shale gas development in China and the United States

    International Nuclear Information System (INIS)

    Lee, Woo Jin; Sohn, So Young

    2014-01-01

    Shale gas has become an increasingly important form of hydrocarbon energy, and related technologies reflect the geographical characteristics of the countries where the gas is extracted and stored. The United States (U.S.) produces most of the world’s shale gas, while China has the world’s largest shale gas reserves. In this research, we focused on identifying the trends in shale-gas related technologies registered to the United States Patent and Trademark Office (USPTO) and to the State Intellectual Property Office of the People’s Republic of China (SIPO) respectively. To cluster shale-gas related technologies, we text-mined the abstracts of patent specifications. It was found that in the U.S., the key advanced technologies were related to hydraulic fracturing, horizontal drilling, and slick water areas, whereas China had a focus on proppants. The results of our study are expected to assist energy experts in designing energy policies related to technology importation. - Highlights: • We analyzed shale gas-related patent applications in the USPTO and SIPO. • We clustered shale gas patents by text mining patent abstract. • Differences were observed in shale gas technologies developed in the U.S. and China. • We proposed the policies of shale gas exploration and development based on patent analysis

  9. The Transaction Cost Benefits of Electronic Patent Licensing Platforms: A Discussion at the Example of the PatentBooks Model

    OpenAIRE

    Ghafele, Roya; Gibert, Benjamin

    2011-01-01

    Current mechanisms to compensate inventors and improve legal access to their inventions remain ineffective. Manufacturers encounter significant transaction costs in the process of licensing the multitude of patent rights implicated in their products. High-technology product manufacturing requires access to a diverse pool of technologies that are owned by different organizations all over the world. The transaction costs of licensing these disparate rights are inhibiting unlicensed manufacturer...

  10. 37 CFR 1.705 - Patent term adjustment determination.

    Science.gov (United States)

    2010-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Patent term adjustment determination. 1.705 Section 1.705 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND TRADEMARK OFFICE, DEPARTMENT OF COMMERCE GENERAL RULES OF PRACTICE IN PATENT CASES Adjustment and Extension of Patent Term...

  11. CLASSICS UNITED STATES PATENT OFFICE

    Indian Academy of Sciences (India)

    IAS Admin

    From the profits, he became a very rich man and was able ... The Schedule referred to in these Letters Patent and making part of the same. TO ALL ... This is the real character and purpose of my invention; and in order to enable others ... kneading, it is rubbed through a hair, silk, or brass-wire sieve, (iron corrodes) and any.

  12. Patents - Overlooked Source of Information

    Czech Academy of Sciences Publication Activity Database

    Matějíček, Jiří; Ilavský, J.

    2004-01-01

    Roč. 13, č. 4 (2004), s. 473-476 ISSN 1059-9630 Institutional research plan: CEZ:AV0Z2043910 Keywords : patent * database * thermal spraying Subject RIV: JK - Corrosion ; Surface Treatment of Materials Impact factor: 1.068, year: 2004

  13. 75 FR 11920 - Agilent Technologies, Eesof Division, Including On-Site Leased Workers From Volt and Managed...

    Science.gov (United States)

    2010-03-12

    ... workers of the subject firm. The workers are engaged in the production of electronic design automation software and related services including quality assurance and learning products, marketing, product development, marketing and administration. The company reports that on-site leased workers from Managed...

  14. 78 FR 52974 - Gamesa Technology Corporation, Including On-Site Leased Workers From A & A Wind Pros Inc., ABB...

    Science.gov (United States)

    2013-08-27

    ... Access, Avanti Wind Systems, Inc., Broadwind Services LLC, Electric Power Systems International... facility on Spain and ``increased blade outsourcing of 65%.'' The attachment to the request included a... Services LLC, Electric Power Systems International, Evolution Energy Group LLC, Global Energy Services USA...

  15. International patent analysis of water source heat pump based on orbit database

    Science.gov (United States)

    Li, Na

    2018-02-01

    Using orbit database, this paper analysed the international patents of water source heat pump (WSHP) industry with patent analysis methods such as analysis of publication tendency, geographical distribution, technology leaders and top assignees. It is found that the beginning of the 21st century is a period of rapid growth of the patent application of WSHP. Germany and the United States had done researches and development of WSHP in an early time, but now Japan and China have become important countries of patent applications. China has been developing faster and faster in recent years, but the patents are concentrated in universities and urgent to be transferred. Through an objective analysis, this paper aims to provide appropriate decision references for the development of domestic WSHP industry.

  16. Studies of world carbon fiber industry from a perspective of patent analysis

    Institute of Scientific and Technical Information of China (English)

    郑佳

    2016-01-01

    Patents are the manifestation of the industry R&D endeavor;therefore, World carbon fiber in-dustry from the perspective of patent analysis is studied .Findings from the analysis show a continual increase of carbon fibers patents since 1969 , and the growth rate began even faster after the year of 2005.Five countries (Japan, China, US, Germany and Korea) took dominant positions in global carbon fibers R&D , and the sum of patents applied in these five countries accounted for 80%of the total patents in the world .Corporations do play an active role in global carbon fibers R&D , and over 60%of patents were applied by corporations .Among them , the top 3 corporations were all from Ja-pan, which had much more patents than the other patent assignees .Furthermore, most corporations were not active in cooperation with others , except Toyota Motor Corp .Global carbon fibers R&D fo-cused on sheet manufacture cloth , core wire layer , heat connect provide and filter activated draw . And there is big difference between Japan and China in the R&D focus .China ’ s corporations have exhibited rapid growth in the number of patent applications in recent years , but there is still a large gap between China and foreign countries in view of global patent layout and influence .By providing the insight into the evolution of global carbon fibers industrial and technological development through the perspective of patent analysis , this study hopes to provide an objective statistic reference for fu-ture policy directions and academic researches .

  17. Survey of the situation of technology succession. Databases of articles including in industrial technology museums; Gijutsu keisho jokyo chosa. Sangyo gijutsu hakubutsukan shuzohin D.B. hen

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1997-03-01

    To promote the succession of history of and the creative use of industrial science technologies, the paper made lists and databases of the articles of industrial technology museums and material halls in Japan. Record/preservation and collection/systematization of history of the industrial technology is useful for forming bases necessary for promotion of future research/development and international contribution. Museums and material halls are the fields for making comprehensive and practical activities. The data were made as one of the basic databases as the first step for promoting activities for examining the technical succession situation in a long term range continuously and systematically. In the classification of the data, the energy relation was divided into electric power, nuclear power, oil, coal, gas and energy in general. Others were classified into metal/mine, electricity/electronics/communication, chemistry/food, ship building/heavy machinery, printing/precision instrument, and textile/spinning. Moreover, the traffic relation was classified into railroad, automobiles/two-wheeled vehicles, airline/space, and ships. Items were also set of life relation, civil engineering/architecture, and general. The total number of the museums for the survey reached 208.

  18. People, Plants, and Patents

    International Development Research Centre (IDRC) Digital Library (Canada)

    In addition, the Group is including a number of other boxes titled "Different Viewpoints. ... Intellectual property policies could set the framework for how we approach ...... Community germplasm maintenance, including "community genebanks," ...

  19. Cross-Border Patent Disputes: Unified Patent Court or International Commercial Arbitration?

    OpenAIRE

    Alba Betancourt, Ana

    2016-01-01

    Currently, the enforcement of a patent that is registered in several countries involves the risk of getting different and conflicting decisions from the national courts. In 2013, 25 European countries entered in an agreement that aims to homogenise the patent system by creating the European patent with unitary effect and a Unified Patent Court (UPC). This article focuses on the UPC, which aims to have a single court proceeding for cross-border patent conflicts. Does the UPC system represent a...

  20. Astronautics and aeronautics, 1973: Chronology of science, technology and policy. [including artificial satellites, space probes, and manned space flights

    Science.gov (United States)

    1975-01-01

    A brief chronological account is presented of key events of the year in aerospace sciences. Dates, actions, hardware, persons, scientific discoveries are recorded along with plans, decisions, achievements and preliminary evaluations of results. Samples of public reaction and social impact are included. Sources are identified and an index is provided to aid in tracing related events through the year. The index also serves as a glossary of acronyms and abbreviations.

  1. 75 FR 30773 - United States Patent Applicant Survey

    Science.gov (United States)

    2010-06-02

    ... comments by any of the following methods: E-mail: [email protected] . Include ``0651- 0052... several years the USPTO has supported an ongoing forecasting program for patent application filings that includes the use of quantitative and qualitative methodologies. Given the importance of accurate...

  2. An Overview on Indian Patents on Biotechnology.

    Science.gov (United States)

    Mallick, Anusaya; Chandra Santra, Subhas; Samal, Alok Chandra

    2015-01-01

    The application of biotechnology is a potential tool for mitigating the present and future fooding and clothing demands in developing countries like India. The commercialization of biotechnological products might benefiting the poor`s in developing countries are unlikely to be developed. Biotechnology has the potential to provide a wide range of products and the existing production skills in the industrial, pharmaceuticals and the agricultural sector. Ownership of the intellectual property rights is the key factors in determining the success of any technological invention, which was introduced in the market. It provides the means for technological progress to continue of the industry of the country. The new plans, animal varieties, new methods of treatments, new crops producing food articles as such are the inventions of biotechnology. Biotechnology is the result of the application of human intelligence and knowledge to the biological processes. Most of the tools of biotechnology have been developed, by companies, governments, research in- stitutes and universities in developed nations. These human intellectual efforts deserve protection. India is a developing country with advance biotechnology based segments of pharmaceutical and agricultural industries. The Trade Related Intellectual Property Rights (TRIPS) is not likely to have a significant impact on incentives for innovation creation in the biotechnology sectors. In the recent years, the world has seen the biotechnology sector as one of greatest investment area through the Patent Law and will giving huge profit in future. The Research and Development in the field of biotechnology should be encouraged for explor- ing new tools and improve the biological systems for interest of the common people. Priority should be given to generation, evaluation, protection and effective commercial utilization of tangible products of intellectual property in agriculture and pharmaceuticals. To support the future growth and

  3. End-User Searching in a Large Library Network: A Case Study of Patent Attorneys.

    Science.gov (United States)

    Vollaro, Alice J.; Hawkins, Donald T.

    1986-01-01

    Reports results of study of a group of end users (patent attorneys) doing their own online searching at AT&T Bell Laboratories. Highlights include DIALOG databases used by the attorneys, locations and searching modes, characteristics of patent attorney searchers, and problem areas. Questionnaire is appended. (5 references) (EJS)

  4. The IEEE-SA patent policy update under the lens of EU competition law

    NARCIS (Netherlands)

    Kanevskaia, Olia; Zingales, Nicolo

    2016-01-01

    In 2015, the Institute of Electrical and Electronics Engineers (IEEE) Standardization Association made some controversial changes to its patent policy. The changes include a recommended method of calculation of FRAND royalty rates, and a request to members holding a standard essential patent (SEP)

  5. Inventory of the patents and publications of FP7 projects in the field of ICT

    NARCIS (Netherlands)

    Jacob, J.; Sanditov, Bulat; Smirnov, Evgueni; Wintjes, Rene; Surpatean, A.; Notten, Ad; Sasso, Simone

    2015-01-01

    The inventory includes data on 295 patents and 18,158 publications resulting from FP7 funded projects in the field of ICT (ICT theme within Cooperation Programme and eInfrastructures within Capacities Programme). The period covered is 2007 - 2013. Patents and publications have been reported by

  6. 77 FR 21086 - Patents External Quality Survey (formerly Customer Panel Quality Survey)

    Science.gov (United States)

    2012-04-09

    ... corporations (including those with 500+ employees), small and medium-size businesses, and universities and... DEPARTMENT OF COMMERCE United States Patent and Trademark Office Patents External Quality Survey... their name, address, or Social Security Number. In order to access and complete the online survey...

  7. Connecting NSF funding to patent innovation in nanotechnology (2001-2004)

    International Nuclear Information System (INIS)

    Huang Zan; Chen Hsinchun; Li Xin; Roco, Mihail C.

    2006-01-01

    Nanotechnology research has experienced growth rapid in knowledge and innovations; it also attracted significant public funding in recent years. Several countries have recognized nanotechnology as a critical research domain that promises to revolutionize a wide range of fields of applications. In this paper, we present an analysis of the funding for nanoscale science and engineering (NSE) at the National Science Foundation (NSF) and its implications on technological innovation (number of patents) in this field from 2001 to 2004. Using a combination of basic bibliometric analysis and content visualization tools, we identify growth trends, research topic distribution, and the evolution in NSF funding and commercial patenting activities recorded at the United States Patent Office (USPTO). The patent citations are used to compare the impact of the NSF-funded research on nanotechnology development with research supported by other sources in the United States and abroad. The analysis shows that the NSF-funded researchers and patents authored by them have significantly higher impact based on patent citation measures in the four-year period than other comparison groups. The NSF-authored patent impact is growing faster with the lifetime of a patent, indicating the long-term importance of fundamental research

  8. Entrepreneurial patent management in pharmaceutical startups.

    Science.gov (United States)

    Holgersson, Marcus; Phan, Tai; Hedner, Thomas

    2016-07-01

    Startups fill an increasingly important role as innovators in the pharmaceutical industry, and patenting is typically central to their success. This article aims to explore patent management in pharmaceutical startups. The results show that startups need to deal with several challenges related to patenting and an 'entrepreneurial' approach to patent management is called for. Resource constraints, venture capital provision, exits and other conditions and events must be readily considered in the patent management process to build a successful pharmaceutical venture, something that could benefit the pharmaceutical industry as a whole. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. Patent data mining method and apparatus

    Science.gov (United States)

    Boyack, Kevin W.; Grafe, V. Gerald; Johnson, David K.; Wylie, Brian N.

    2002-01-01

    A method of data mining represents related patents in a multidimensional space. Distance between patents in the multidimensional space corresponds to the extent of relationship between the patents. The relationship between pairings of patents can be expressed based on weighted combinations of several predicates. The user can select portions of the space to perceive. The user also can interact with and control the communication of the space, focusing attention on aspects of the space of most interest. The multidimensional spatial representation allows more ready comprehension of the structure of the relationships among the patents.

  10. Technology forum Berlin '82. Technologieforum Berlin '82

    Energy Technology Data Exchange (ETDEWEB)

    1982-01-01

    36 articles are represented concerning mechanical engineering, materials, chemicals, communications and telecommunications technology, metal working, precision engineering and optics, microelectronics, plastics, information supplying, patent realization and technology transfer.

  11. Environmental assessment of bioenergy technologies application in Russia, including their impact on the balance of greenhouse gases

    Science.gov (United States)

    Andreeva, Irina; Vasenev, Ivan

    2017-04-01

    In recent years, Russia adopted a policy towards increasing of the share of renewable energy in total amount of used energy, albeit with some delay comparing to the EU countries and the USA. It was expected that the use of biofuels over time will reduce significantly the dependency of Russian economy on fossil fuels, increase its competitiveness, and increase Russian contribution to the prevention of global climate changes. Russia has significant bio-energy potential and resources which are characterized by great diversity due to the large extent of the territory, which require systematic studies and environmental assessment of used bio-energy technologies. Results of research carried at the Laboratory of agroecological monitoring, modeling and prediction of ecosystems RSAU-MTAA demonstrated significant differences in the assessment of the environmental, economic and social effects of biofuel production and use, depending on the species of bio-energy crops, regional soil-ecological and agro-climatic characteristics, applied farming systems and production processes. The total area of temporarily unused and fallow land, which could be allocated to the active agricultural use in Russia, according to various estimates, ranges from 20 to 33 million hectares, which removes the problem, typical of most European countries, of adverse agro-ecological changes in land use connected with the expansion of bio-energy crops cultivation. However, the expansion of biofuel production through the use of fallow land and conversion of natural lands has as a consequence the problem of greenhouse gas emissions due to land use changes, which, according to FAO, could be even higher than CO2 emission from fossil fuels for some of bio-energy raw materials and production systems. Assessment of the total impacts of biofuels on greenhouse gas emissions in the Russian conditions should be based on regionally adapted calculations of flows throughout the entire life cycle of production, taking

  12. Analysis of US patents on spacer grids

    International Nuclear Information System (INIS)

    Kim, Hyung Kyu; Song, Kee Nam; Yoon, Kyung Ho; Kang, Hong Seok; Kim, Hyung Kyu; Jeon, Tae Hyun; Oh, Dong Seok; In, Wang Ki; Bang, Jae Keun; Oh, Seung Eun; Seo, Jeong Min; Lee, Jin Seok; Park, Seong Keun

    1997-06-01

    The total of 137 US patents on spacer grids patented from 1968 through 1993 are analyzed and summarized. Database is constituted with designing the appropriate fields by which each patent can be identified. The fields consist of patent number, inventor, assignee, date of patent, title and major foci of the patent. The major foci are again classified by detailed subjects such as the fretting failure and fuel rod support-related, the strength-related, the fabrication-related as for mechanical subjects, while the cooling performance-related and the pressure drop-related as for thermal-hydraulic one. The 92% of the patents analyzed were issued form nuclear companies of USA, France and Germany. Among the patents dealing with mechanical subjects, the fretting failure and fuel rod support-related is more than the pressure drop-related among the patents of thermal-hydraulic subjects. The number of patents issued from Japan ranks just after Germany i.e., the 4th country. It is thought that much concern as well as investment should be increased in this field, the patent of nuclear components. (author). 2 tabs., 5 figs

  13. Analysis of US patents on spacer grids

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Hyung Kyu; Song, Kee Nam; Yoon, Kyung Ho; Kang, Hong Seok; Kim, Hyung Kyu; Jeon, Tae Hyun; Oh, Dong Seok; In, Wang Ki; Bang, Jae Keun [Korea Atomic Energy Research Institute, Taejon (Korea, Republic of); Oh, Seung Eun; Seo, Jeong Min; Lee, Jin Seok; Park, Seong Keun [Korea Nuclear Fuel Company, Taejon (Korea, Republic of)

    1997-06-01

    The total of 137 US patents on spacer grids patented from 1968 through 1993 are analyzed and summarized. Database is constituted with designing the appropriate fields by which each patent can be identified. The fields consist of patent number, inventor, assignee, date of patent, title and major foci of the patent. The major foci are again classified by detailed subjects such as the fretting failure and fuel rod support-related, the strength-related, the fabrication-related as for mechanical subjects, while the cooling performance-related and the pressure drop-related as for thermal-hydraulic one. The 92% of the patents analyzed were issued form nuclear companies of USA, France and Germany. Among the patents dealing with mechanical subjects, the fretting failure and fuel rod support-related is more than the pressure drop-related among the patents of thermal-hydraulic subjects. The number of patents issued from Japan ranks just after Germany i.e., the 4th country. It is thought that much concern as well as investment should be increased in this field, the patent of nuclear components. (author). 2 tabs., 5 figs.

  14. A review of the health and economic implications of patent protection, with a specific focus on Thailand.

    Science.gov (United States)

    Yamabhai, Inthira; Smith, Richard D

    2012-08-01

    Although it has been two decades since the Thai Patent Act was amended to comply with the Agreement on Trade-Related Aspects of Intellectual Property Rights (TRIPS), there has been little emphasis given to assessing the implications of this amendment. The purpose of this review is to summarize the health and economic impact of patent protection, with a focus on the experience of Thailand. A review of national and international empirical evidence on the health and economic implications of patents from 1980 to 2009 was undertaken. The findings illustrate the role of patent protection in four areas: price, present access, future access, and international trade and investment. Forty-three empirical studies were found, three of which were from Thai databases. Patenting does increase price, although the size of effect differs according to the methodology and country. Although weakening patent rights could increase present access, evidence suggests that strengthening patenting may benefit future access; although this is based on complex assumptions and estimations. Moreover, while patent protection appears to have a positive impact on trade flow, the implication for foreign direct investment (FDI) is equivocal. Empirical studies in Thailand, and other similar countries, are rare, compromising the robustness and generalizability of conclusions. However, evidence does suggest that patenting presents a significant inter-temporal challenge in balancing aspects of current versus future access to technologies. This underlines the urgent need to prioritize health research resources to assess the wider implications of patent protection.

  15. Technological study about a disposal measures of low-level radioactive waste including uranium and long-half-life radionuclides

    International Nuclear Information System (INIS)

    Sugaya, Toshikatsu; Nakatani, Takayoshi; Sakai, Akihiro; Sakamoto, Yoshiaki; Sasaki, Toshihisa; Nakamura, Yasuo

    2017-02-01

    Japan Atomic Energy Agency (JAEA) performed the technical studies contributed for the disposal measures of uranium-bearing waste with low concentration and intermediate depth disposal-based waste occurring from the process of the nuclear fuel cycle. (1) Study of the trench disposal of uranium-bearing waste. As a part of the study of disposal measures of the uranium-bearing waste, we carried out the safety assessment (exposure dose assessment) and derived the upper limit of radioactivity concentration of uranium which was allowed to be included in radioactive waste for trench disposal. (2) Preliminary study for the expansion of material applied to clearance in uranium-bearing waste. Currently, the clearance level of uranium handling facilities was derived from the radioactivity concentration of uranium corresponding to dose criterion about the exposure pathways of the reuse and recycle of metal. Therefore, we preliminarily evaluated whether metal and concrete were able to be applied to clearance by the method of the undergrounding disposal. (3) Study of the concentration limitation scenarios for the intermediate depth disposal-based waste. We carried out dose assessment of intermediate depth disposal of radioactive waste generated from JAEA about radioactive concentration limitation scenarios of which the concept was shown by the study team in Nuclear Regulation Authority. Based on the results, we discussed whether the waste was applied to radioactive waste conforming to concept of intermediate depth disposal. (author)

  16. SUSTAINABLE ENVIRONMENTAL TECHNOLOGIES INCLUDING WATER RECOVERY FOR REUSE FROM TANNERY AND INDUSTRIAL WASTEWATER – INDIAN AND ASIAN SCENARIO

    Directory of Open Access Journals (Sweden)

    Dr. S. RAJAMANI

    2017-05-01

    Full Text Available World leather sector generates 600million m3 of wastewater per annum. The Asian tanneries contributes more than 350 million m3 of wastewater from the process of 8 to 10 millions tons of hides and skins. Environmental challenges due to depletion of quality water resources and increase in salinity, it has become necessary to control Total Dissolved Solids (TDS in the treated effluent with water recovery wherever feasible. Adoption of special membrane system has been engineered in many individual and Common Effluent Treatment Plants (CETPs in India, China and other leather producing countries. The sustainability of saline reject management is one of the major challenges. Conventional tannery wastewater treatment systems include physiochemical and biological treatment to reduce Chromium, BOD, COD and Suspended Solids. To tackle treated effluent with TDS in the rage of 10000 to 30000mg/l, multiple stage high pressure membrane units have been designed and implemented for recovery of water. To reduce the chemical usage and sludge generation in the tertiary treatment, Membrane Bio-Reactor (MBR has been adopted which replace secondary clarifier and sophisticated tertiary treatment units such as Reactive Clarifier, Ultra-filtration (UF, etc. Commercial scale high-tech membrane systems have been implemented in many locations for the capacities ranging from 500 to 10000m3/day. Recent applied R&D on the environmental protection techniques with focus on water-recovery for reuse, salt recovery, marine disposal of saline reject with proper bio-control system, etc. are dealt in this novel technical paper.

  17. The Agile Rapid Global Combat Support (ARGCS) System: A Cost and Benefit Analysis of Including the ARGCS Technologies in the Acquisition of the Enhanced Consolidated Support System (ECASS)

    National Research Council Canada - National Science Library

    Lund, John N

    2007-01-01

    ...). The ultimate goal of this project is to assist in the analysis of the ARGCS technologies and what benefit they would provide if included in the proposed next generation of Naval Aviation test equipment, currently called the Enhanced Consolidated Automated Support System (ECASS).

  18. The Unified Patent Court (UPC), Compulsory Licensing and Competition Law

    DEFF Research Database (Denmark)

    Petersen, Clement Salung; Riis, Thomas; Schovsbo, Jens Hemmingsen

    2014-01-01

    Competition law and rules on compulsory licensing are considered as indispensable instruments to balance patent rights. In this article, we examine the room for using such balancing instruments in the context of the UPC. We analyse whether the balancing instruments will remain applicable...... that the UPC is likely to be less inclined to use them. To redress that problem we suggest that the UPC acknowledges the institutional biases of the court and looks for ways to include other values and interests than the proprietary values and interests of patent law....

  19. The Neglected Patent Controversies in the Twenty First Century

    Directory of Open Access Journals (Sweden)

    Birgitte Andersen

    2003-01-01

    Full Text Available Na virada do século, assistimos a um reforço do sistema de patentes. No entanto, os gestores de políticas deixam sistematicamente de lado as controvérsias sobre patentes. Este artigo examina criticamente as complexas relações entre, por um lado, as razões para os direitos de patente e, por outro lado, seus efeitos sociais e econômicos. Só quando entendermos essa relação, seremos capazes de projetar regimes adequados de Direitos de Propriedade Intelectual (DPI para o novo paradigma tecnoeconômico de microeletrônica baseada em conhecimento e invenções de amplo alcance implementadas por computador. O foco se concentra nas razões morais, nas razões de incentivo econômico, e nas razões de aumento da concorrência e "proteção do talento empresarial no mercado", e nas razões econômicas para organizar ciência, tecnologia e criatividade. Afirma-se aqui que os sistemas de patentes não são neutros, eles estabelecem as regras do jogo em que indivíduos e organizações são os jogadores.At the turn of the century we have seen a tightening of the patent system. However, policy makers systematically neglect the patent controversies. This article critically reviews the complex relationships between the rationales for patent rights on the one hand, and the social and economic effects of such on the other hand. Only when we understand this relationship, will we be able to design appropriate Intellectual Property Right (IPR regimes for the new technoeconomic paradigm of knowledge-based micro-electronics and computer implemented pervasive inventions. Focus is on moral rationales, economic incentive rationales, increased competition and "market protection of entrepreneurial talent" rationales, and the economic rationales for organizing science, technology and creativity. It is argued that patent systems are not neutral, but set the rules of the game in which individuals and organizations are the players.

  20. 1998 Annual Study Report. Surveys on seeds for global environmental technologies, including those for energy saving; 1998 nendo chosa hokokusho. Sho energy nado chikyu kankyo taisaku gijutsu no seeds ni kansuru chosa

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1999-03-01

    The energy-saving and other global environmental technologies are surveyed by collecting relevant information from various institutes, both abroad and domestic, to contribute to development of ceramic gas turbines. USA has announced a climate change plan, based on the five principles, to promote utilization of high-efficiency technologies and development of new clean technologies. UK is promoting to improve energy efficiency, along with liberalization of its energy markets. Germany concentrates its efforts in the 'Program for Energy Research and Energy Technologies.' France places emphasis on prevention of air pollution and rational use of energy. The R and D trends at public institutes, e.g., universities, for global environmental technologies are surveyed, from which a total of 14 themes are extracted as the seed technologies. At the same time, a total of 9 techniques potentially applicable to the seeds are extracted by mainly reviewing JICST and patent information, and assessed. The R&D trends of the IPCC-related researchers are also surveyed, but provide no theme directly applicable to the seeds. Most of the related themes at the private and public institutes surveyed, both domestic and abroad, are concentrated on carbon dioxide. (NEDO)