WorldWideScience

Sample records for technology andrew blakers

  1. George Andrew Olah

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 22; Issue 12. George Andrew ... Hungarian born American chemist, George Andrew Olah wasa prolific researcher. The central theme ... He leavesbehind a large body of work comprising almost 1500 papersand twenty books for the scientific community.

  2. Obituary: Andrew Stephen Wilson, 1947-2008

    Science.gov (United States)

    Veilleux, Sylvain

    2009-01-01

    papers that are still standard references in the field today. In the last 15 years, Andrew became an avid proponent of two of NASA's Great Observatories, the Hubble Space Telescope and Chandra X-ray Observatory. Since 1985, he was NASA Interdisciplinary Scientist and member of the Science Working Group for the Chandra X-ray Observatory. He was also an adjunct astronomer at the Space Telescope Science Institute in Baltimore since 1994. Taking advantage of this leap in technology, Andrew used these facilities to examine the environment of black holes in unprecedented detail and led a research group that was second to none in this area of research. Over the years, Andrew trained and supervised twelve Ph.D. students and more than fifteen postdoctoral research scientists, all of whom are active members of the astronomical community today. This group's work on nearby radio galaxies (e.g., Cygnus A, M87, and Pictor A) and Seyfert galaxies (e.g., the Circinus galaxy, NGC 1068, NGC 4151, and NGC 4258) is simply outstanding, a monument to Andrew's passion and perseverance to seek a complete physical understanding of the AGN phenomenon. Andrew was at his best in one-on-one discussions. He did not beat around the bush. He was always direct, frank, and honest, all for the sake of better science. He also never did anything halfway. Andrew was fully devoted to his science and held himself and others to the highest intellectual standards. He inspired many by his example, his discipline, and a sense of humor that was equally charming and disarming. The twinkle in his eyes and mischievous smile were sure signs that he was about to say something provocative and witty. Andrew will be dearly missed by the entire astronomical community. I thank Andrew's wife and brother, Kaija and Martin Wilson, for their assistance in writing this obituary.

  3. George Andrews' Game

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 14; Issue 2. George Andrews' Game. Jerold Mathews. General Article Volume 14 Issue 2 February 2009 pp 172-178. Fulltext. Click here to view fulltext PDF. Permanent link: http://www.ias.ac.in/article/fulltext/reso/014/02/0172-0178. Keywords. Fibonacci ...

  4. Millikan, Prof. Robert Andrews

    Indian Academy of Sciences (India)

    Home; Fellowship. Fellow Profile. Elected: 1935 Honorary. Millikan, Prof. Robert Andrews Nobel Laureate (Physics) - 1923. Date of birth: 22 March 1868. Date of death: 19 December 1953. YouTube; Twitter; Facebook; Blog. Academy News. IAS Logo. Theory Of Evolution. Posted on 23 January 2018. Joint Statement by the ...

  5. George Andrews' Game

    Indian Academy of Sciences (India)

    Admin

    helping international students learn English. Keywords. Fibonacci numbers, Zecken- dorf's theorem, Andrew's game, greedy algorithm. T his is an expository article show ing how Zeck- endorf's T heorem (every positive integer can be represented in one and only one w ay as the sum of non-consecutive Fibonacci num bers) ...

  6. Interview with Andrew Dalby

    OpenAIRE

    Mac Con Iomaire, Máirtín

    2016-01-01

    Andrew Dalby (born 1947 in Liverpool) is an English linguist, translator and historian and author of numerous articles and several books on a wide range of topics including food history, language, and Classical texts. Dalby studied Latin, French and Greek at the Bristol Grammar School and University of Cambridge. Here he also studied Romance languages and linguistics, earning a bachelor's degree in 1970. Dalby worked for fifteen years at Cambridge University Library, eventually specialising i...

  7. Mortality from Hurricane Andrew.

    Science.gov (United States)

    Lew, E O; Wetli, C V

    1996-05-01

    Hurricane Andrew, a category 4 storm, made landfall in South Florida on August 24, 1992, and caused extensive structural and environmental damage. The Dade County Medical Examiner Department investigated 15 deaths directly related to the storm and another 15 natural deaths indirectly related to the storm. The aftermath of the hurricane continued to create circumstances that lead to 32 accidental deaths, five suicides, and four homicides over the next six months. Traffic fatalities due to uncontrolled intersections accounted for one-third of the post-storm accidental deaths. Dyadic deaths (homicide-suicide) doubled in rate for the six months following the storm. The limited number of direct hurricane deaths is attributed to advance storm warnings, its occurrence on a weekend, the storm's passage through less populated areas of the county, and the relatively modest amount of accompanying rainfall.

  8. Andrew spares Florida Coast

    Science.gov (United States)

    Bush, Susan

    When geologists heard of the intensity of Hurricane Andrew, which struck the Florida coast on August 25 and then moved on to southern Louisiana, they were expecting the same kinds of coastal damage that Hurricane Hugo brought to the Caribbean and Carolina shores in 1989. Both storms were category 4 hurricanes, having winds of 131-155 mph and surges of 13-18 feet. However, the coastal damage never materialized, leaving geologists to analyze the factors that lessened the impact of the storm. “For minimum coastal damage, you couldn't have designed a better storm,” said Orrin Pilkey, director of the Program for the Study of Developed Shorelines (PSDS) in Durham, N.C. This was due in part to the nature of the storm itself and where it hit land, and in part to the regional geology, said Rob Thieler of PSDS. Despite the huge amounts of damage to buildings, there was virtually no evidence of coastal process destruction, he said.

  9. A History of the Andrew File System

    CERN Multimedia

    CERN. Geneva; Altman, Jeffrey

    2011-01-01

    Derrick Brashear and Jeffrey Altman will present a technical history of the evolution of Andrew File System starting with the early days of the Andrew Project at Carnegie Mellon through the commercialization by Transarc Corporation and IBM and a decade of OpenAFS. The talk will be technical with a focus on the various decisions and implementation trade-offs that were made over the course of AFS versions 1 through 4, the development of the Distributed Computing Environment Distributed File System (DCE DFS), and the course of the OpenAFS development community. The speakers will also discuss the various AFS branches developed at the University of Michigan, Massachusetts Institute of Technology and Carnegie Mellon University.

  10. In Memoriam: George Andrew Olah

    Indian Academy of Sciences (India)

    A Nobel Laureate in chemistry, George Andrew Olah, was a giant who transformed many ideas of fundamental organic chemistry. A kind and generous gentleman, ... cluded investigations into superacids and ways to generate and study long-lived carbocations. These investigations led him to distinguish between classical ...

  11. Andrew A. Benson: personal recollections.

    Science.gov (United States)

    Nonomura, Arthur; Lorimer, George; Holtz, Barry; Vacquier, Victor; Biel, Karl Y; Govindjee

    2016-03-01

    Andrew A. Benson, one of the greatest and much loved scientists of our century, passed away on January 16, 2015; he was born on September 24, 1917. A grand celebration of his life was held on February 6, 2015, in California. Here, we present one of his photographs and key excerpts from what was said then, and soon thereafter.

  12. The Americas and Hurricane Andrew

    Science.gov (United States)

    1992-01-01

    Image taken on August 25, 1992 by NOAA GOES-7 of the Americas and Hurricane Andrew.Photo Credit: Image produced by F. Hasler, M. Jentoft-Nilsen, H. Pierce, K. Palaniappan, and M. Manyin. NASA Goddard Lab for Atmospheres - Data from National Oceanic and Atmospheric Administration (NOAA).

  13. Safety and design impact of hurricane Andrew

    International Nuclear Information System (INIS)

    Guey, Ching N.

    2004-01-01

    Turkey Point completed the IPE in June of 1991. Hurricane Andrew landed at Turkey Point on August 24, 1992. Although the safety related systems, components and structures were not damaged by the Hurricane Andrew, certain nonsafety related components and the neighboring fossil plant sustained noticeable damage. Among the major components that were nonsafety related but would affect the PRA of the plant included the service water pumps and the high tower. This paper discusses the safety and design impact of Hurricane Andrew on Turkey Point Nuclear Power Plant. The risk of hurricanes on the interim and evolving plant configurations are briefly described. The risk of the plant from internal events as a result of damage incurred during Hurricane Andrew are discussed. The design change as the result of Hurricane Andrew and its impact on the PRA are presented. (author)

  14. Psychiatric morbidity following Hurricane Andrew.

    Science.gov (United States)

    David, D; Mellman, T A; Mendoza, L M; Kulick-Bell, R; Ironson, G; Schneiderman, N

    1996-07-01

    The nature of psychiatric morbidity in previously non-ill subjects from the area most affected by Hurricane Andrew was investigated at 6-12 months posthurricane. Preliminary associations of morbidity with personal and event-related risk factors were also determined. Fifty one percent (31/61) met criteria for a new-onset disorder, including posttraumatic stress disorder (PTSD) in 36%, major depression (MD) in 30%, and other anxiety disorders in 20%. Thirty four subjects (56%) had significant symptoms persisting beyond 6 months. Having sustained "severe damage" was the risk factor most strongly associated with outcome. Our data underscore the range of psychiatric morbidity related to a natural disaster, and suggest a relationship to chronic stressors.

  15. Interview with 2018 Hooke medal winner Andrew McAinsh.

    Science.gov (United States)

    2018-03-14

    Andrew McAinsh received his PhD from the University of Cambridge, UK, working in the laboratory of Steve Jackson on DNA damage and repair mechanisms in yeast. He then joined the laboratory of Peter Sorger as a Jane Coffin Childs Fellow to work as a post-doc on kinetochore biology at the Massachusetts Institute of Technology, Boston, USA. In 2005, he returned to the UK to establish his independent laboratory at the Marie Curie Research Institute, Surrey, before moving to the University of Warwick in 2009 to co-found the Centre for Mechanochemical Cell Biology (CMCB). Subsequently, Andrew was appointed Professor of Cell Biology and became a Wellcome Senior Investigator, and was awarded a Royal Society Wolfson Research Merit Award. He co-directs the MRC Doctoral Training Partnership in Interdisciplinary Biomedical Research, and in 2017 became Head of Division of Biomedical Sciences at Warwick Medical School. Andrew is interested in understanding how the chromosomal multi-protein complex, the kinetochore, ensures error-free chromosome segregation. He is the recipient of the 2018 Hooke medal, established to recognize an emerging leader in cell biology. The Hooke medal is awarded at the annual spring meeting of the British Society for Cell Biology (BSCB). © 2018. Published by The Company of Biologists Ltd.

  16. A Reanalysis of Hurricane Andrew's Intensity.

    Science.gov (United States)

    Landsea, Christopher W.; Franklin, James L.; McAdie, Colin J.; Beven, John L., II; Gross, James M.; Jarvinen, Brian R.; Pasch, Richard J.; Rappaport, Edward N.; Dunion, Jason P.; Dodge, Peter P.

    2004-11-01

    Hurricane Andrew of 1992 caused unprecedented economic devastation along its path through the Bahamas, southeastern Florida, and Louisiana. Damage in the United States was estimated to be $26 billion (in 1992 dollars), making Andrew one of the most expensive natural disasters in U.S. history. This hurricane struck southeastern Florida with maximum 1-min surface winds estimated in a 1992 poststorm analysis at 125 kt (64 m s-1). This original assessment was primarily based on an adjustment of aircraft reconnaissance flight-level winds to the surface.Based on recent advancements in the understanding of the eyewall wind structure of major hurricanes, the official intensity of Andrew was adjusted upward for five days during its track across the Atlantic Ocean and Gulf of Mexico by the National Hurricane Center Best Track Change Committee. In particular, Andrew is now assessed by the National Hurricane Center to be a Saffir Simpson Hurricane Scale category-5 hurricane (the highest intensity category possible) at its landfall in southeastern Florida, with maximum 1-min winds of 145 kt (75 m s-1). This makes Andrew only the third category-5 hurricane to strike the United States since at least 1900. Implications for how this change impacts society's planning for such extreme events are discussed.

  17. Andrew A. Benson, 1917-2015.

    Science.gov (United States)

    Lichtenthaler, Hartmut K; Buchanan, Bob B; Douce, Roland; Govindjee

    2015-05-01

    On January 16, 2015, Professor Andrew Alm Benson, one of the leading plant biochemists of the twentieth century, died in La Jolla, California, at the age of 97; he was born on September 24, 1917. Benson was known especially for his pioneering studies on photosynthesis (CO2 assimilation, carbon reduction cycle) and plant lipids (phospholipid phosphatidyl glycerol; and the sulfolipid, sulfoquinovosyl diglyceride). A photograph of Benson is shown in Fig. 1. Fig. 1 Photograph of Andrew A. Benson. Annual Review of Plant Biology, Vol. 53, 2002, published with permission.

  18. Dr. Andrew Foster: A Literature Review

    Science.gov (United States)

    Runnels, Joel

    2017-01-01

    Often compared to Laurent Clerc, Thomas Gallaudet, and Alexander Graham Bell, Dr. Andrew Foster was a deaf African American who founded 32 schools for the deaf in 13 African nations. The 60th anniversary of his arrival in Liberia and Ghana and the 30th anniversary of his tragic death in a Rwanda airplane accident both occur in 2017. Renewed…

  19. George Andrew Olah: Across Conventional Lines

    Indian Academy of Sciences (India)

    Permanent link: https://www.ias.ac.in/article/fulltext/reso/022/12/1111-1153. Keywords. Electron-deficient intermediates, Friedel–Crafts chemistry, carbocations, carbanions, methanol economy, anthropogenic chemical carbon cycle. Abstract. Hungarian born American chemist, George Andrew Olah wasa prolific researcher.

  20. Obituary: Andrew Lange (1957-2010)

    Science.gov (United States)

    Kamionkowski, Marc

    2011-12-01

    The worlds of physics and astrophysics were stunned to learn on 22 January 2010 that Andrew Lange, the Marvin L. Goldberger Professor of Physics at Caltech, had taken his own life the night before. He had succumbed to the severe depression that he had suffered from for many years, unbeknownst to even his closest colleagues. Lange will perhaps be best remembered as the co-leader of Boomerang, the balloon-borne experiment that provided the first high-angular-resolution map of the cosmic microwave background (CMB). And while this was certainly his most notable achievement, Andrew amassed a record of accomplishment as an instrumentalist, leader, mentor, and communicator that extended much further. Andrew was born in Urbana, Illinois on July 23, 1957, the son of an architect and a librarian, and raised primarily in Connecticut. His family and early friends remember him as a serious and extremely intelligent child and young man. Andrew Lange's lifelong interest in the CMB was nurtured as an undergraduate at Princeton University by David Wilkinson, and he recalled fondly a summer spent working with John Mather at Goddard Space Flight Center. Andrew Lange went to graduate school in physics at Berkeley where he worked in Paul Richards' group. Although his thesis project, the Berkeley-Nagoya rocket experiment, showed an anomalous sub-millimeter excess in the CMB spectrum that was shortly thereafter shown by a later flight of the same rocket and COBE-FIRAS to be incorrect, Lange's talents were recognized by the physics department at Berkeley who appointed him shortly after his PhD (1987) to their faculty. While on the Berkeley faculty, Andrew obtained early detections of the Sunyaev-Zeldovich effect, upper limits to small-angle CMB fluctuations, and important infrared constraints to the interstellar medium. He also led a pioneering instrument operating 300 mK detectors for a small infrared satellite experiment. This early work showed high ambition and daring, and it pioneered

  1. Building a "cyber forest" in complex terrain at the Andrews Experimental Forest

    Science.gov (United States)

    Donald L. Henshaw; Fred Bierlmaier; Barbara J. Bond; Kari B. O' Connell

    2008-01-01

    Our vision for a future "cyber forest" at the Andrews Experimental Forest foresees high performance wireless communications enhancing connectivity among remote field research locations, station headquarters, and beyond to the university and outside world. New sensor technologies and collaboration tools foretell exponential increases in data and information...

  2. Andrew shortens lifetime of Louisiana Barrier Islands

    Science.gov (United States)

    Bush, Susan

    Because the Isles Dernieres, a series of four barrier islands off the coast of Louisiana, have one of the most rapidly eroding shorelines in the world, geologists at the U.S. Geological Survey and the Louisiana Geological Survey have been monitoring erosion activity over the last several years, said Jeff Williams of the USGS in Reston, Va. Hurricane Andrew, which struck the state on August 26, caused severe erosional damage to these islands that has shortened their lifetimes.Before Andrew struck, geologists projected that Raccoon Island would disappear below sea level by the year 2001 and that Whiskey Island would disappear by 2016. Now, due to the severe erosion from Hurricane Andrew, the scientists claim that the islands may disappear before the turn of the century, and the other islands in the Dernieres chain are expected to follow suit within 2 decades. Raccoon, Whiskey, Trinity, and East islands make up the Isles Dernieres, which existed as one island, known as the Isle Derniere, before an 1856 hurricane and subsequent erosion.

  3. Children describe life after Hurricane Andrew.

    Science.gov (United States)

    Coffman, S

    1994-01-01

    Hurricane Andrew, which devastated the south Florida coast in August 1992, left over 250,000 people homeless with multiple health and social problems. This nursing study explored the experiences of 17 children, ages 5 through 12, who lived in the geographic area of storm damage. Common experiences described by the children included remembering the storm, dealing with after-effects, and reestablishing a new life. In general, children described a sense of strangeness, articulated as "life is weird" after the hurricane. In addition to stressful responses, many positive reactions were described by children in the study, revealing that the disaster also had a maturing effect.

  4. Shallow water currents during Hurricane Andrew

    Science.gov (United States)

    Keen, Timothy R.; Glenn, Scott M.

    1999-10-01

    Oceanographic measurements are used in combination with a numerical model to examine the influence of stratification on shallow water currents during the directly forced stage of a tropical cyclone (Hurricane Andrew) on the continental shelf. The following stratification-dependent coastal processes are examined: (1) turbulent mixing, (2) coastally trapped waves, (3) near-inertial oscillations, and (4) upwelling and downwelling. Turbulent mixing was strong within 1 Rw (radius of maximum winds) of the storm track, and stratification was nearly destroyed. Turbulent mixing was weak at distances greater than 2 Rw. The dominant coastal wave was a barotropic Kelvin wave generated as the storm surge relaxed after landfall. Baroclinic near-inertial oscillations were dominant at the shelf break and occurred along with a barotropic response on the middle shelf. Downwelling-favorable flow developed east of the track prior to the storm peak, and upwelling-favorable flow evolved west of the track as the eye crossed the shelf. The idealized storm flow was modified by local barotropic and baroclinic pressure gradients on the shelf. Ocean circulation during Hurricane Andrew was hindcast using both stratified and unstratified three-dimensional numerical models. For areas within 1 Rw of the storm track, the unstratified model matched the observed currents better than the stratified model, partly because of errors in the initial stratification. At distances greater than 2 Rw the influence of stratification increases, and the unstratified model does not reproduce the observed upwelling-favorable flow.

  5. Remote sensing for hurricane Andrew impact assessment

    Science.gov (United States)

    Davis, Bruce A.; Schmidt, Nicholas

    1994-01-01

    Stennis Space Center personnel flew a Learjet equipped with instrumentation designed to acquire imagery in many spectral bands into areas most damaged by Hurricane Andrew. The calibrated airborne multispectral scanner (CAMS), a NASA-developed sensor, and a Zeiss camera acquired images of these areas. The information derived from the imagery was used to assist Florida officials in assessing the devastation caused by the hurricane. The imagery provided the relief teams with an assessment of the debris covering roads and highways so cleanup plans could be prioritized. The imagery also mapped the level of damage in residential and commercial areas of southern Florida and provided maps of beaches and land cover for determination of beach loss and vegetation damage, particularly the mangrove population. Stennis Space Center personnel demonstrated the ability to respond quickly and the value of such response in an emergency situation. The digital imagery from the CAMS can be processed, analyzed, and developed into products for field crews faster than conventional photography. The resulting information is versatile and allows for rapid updating and editing. Stennis Space Center and state officials worked diligently to compile information to complete analyses of the hurricane's impact.

  6. Hurricane Andrew and a pediatric emergency department.

    Science.gov (United States)

    Quinn, B; Baker, R; Pratt, J

    1994-04-01

    To determine the effect of Hurricane Andrew on a pediatric emergency department. A retrospective analysis of ED visits through the use of computerized records and chart review. A children's hospital in South Florida. All patients presenting to the ED during the control week and the two study weeks after the hurricane. Census, diagnoses, admission rate, and patient geographic origin and age. During week 1, there was an average daily increase of 40.7% in patient volume (P < .01) and a 3.3% decrease in the admission rate (P < .01). The increased census was due mainly to local patients, rather than those from the most devastated areas. More patients were seen with open wounds, gastroenteritis, and impetigo (all, P < .05); more were more than 18 years old (P < .05). By the second week, both census and admission rate returned to normal; cases of cellulitis (P < .05) and open wounds (P < .001) were increased. Although not statistically significant, a higher percentage of hydrocarbon and/or bleach ingestions was seen for both weeks. Following a hurricane, personnel in a pediatric ED can expect to see an increased census, with more diagnoses of open wounds, gastroenteritis, and skin infections. They may also see hydrocarbon and bleach ingestions. Alerting parents to the potential for injury and accidental poisoning in their children after a hurricane may help prevent the reported morbidity.

  7. Andrew Smith: peame leidma tee majanduskasvuni, mis põhineb säästmisel, investeeringutel ja ekspordil / Andrew Smith

    Index Scriptorium Estoniae

    Smith, Andrew

    2010-01-01

    KPMG (UK) peaökonomist Andrew Smith vastab küsimustele, mis puudutavad majanduskriisi tekkimist, olukorra paranemist, majandusolukorda Suurbritannias, erinevusi Euroopa ja muude maailma piirkondade vahel, sarnasusi Eesti ja Suurbritannia majandusolukorra vahel ning prognoose edaspidiste arengute osas

  8. High Impact Technology Compact Combustion (HITCC) Compact Core Technologies

    Science.gov (United States)

    2016-01-01

    were combusted in a vitiated stream. The molecular weight and hydrogen -to-carbon ratios of these fuels were measured by Princeton University [17...AFRL-RQ-WP-TR-2016-0010 HIGH IMPACT TECHNOLOGY COMPACT COMBUSTION (HITCC) COMPACT CORE TECHNOLOGIES Andrew W. Caswell Combustion ...ANDREW W. CASWELL CHARLES J. CROSS, Branch Chief Program Engineer Combustion Branch Combustion Branch Turbine Engine Division Turbine

  9. Appreciating Unity in Diversity: An Interview with Andrew Solomon

    Science.gov (United States)

    Peters, Dane L.

    2014-01-01

    The theme of the AMS 2014 Annual Conference is "Unity in Diversity," a concept that also describes the work of conference keynote speaker Andrew Solomon. Solomon is a writer and lecturer on psychology and politics; winner of the National Book Award; and an activist for LGBT [lesbian, gay, bisexual, and transgender] rights, mental health,…

  10. Hurricane Andrew in Florida: Dynamics of a Disaster.

    Science.gov (United States)

    Willoughby, H. E.; Black, P. G.

    1996-03-01

    Four meteorological factors aggravated the devastation when Hurricane Andrew struck South Florida: completed replacement of the original eyewall by an outer, concentric eyewall while Andrew was still at sea; storm translation so fast that the eye crossed the populated coastline before the influence of land could weaken it appreciably, extreme wind speed, 82 m s1 winds measured by aircraft flying at 2.5 km; and formation of an intense, but nontornadic, convective vortex in the eyewall at the time of landfall. Although Andrew weakened for 12 h during the eyewall replacement, it contained vigorous convection and was reintensifying rapidly as it passed onshore. The Gulf Stream just offshore was warm enough to support a sea level pressure 20-30 hPa lower than the 922 hPa attained, but Andrew bit land before it could reach this potential. The difficult-to-predict mesoscale and vortex-scale phenomena determined the course of events on that windy morning, not a long-term trend toward worse hurricanes.

  11. Hurricane Andrew: Parent Conflict As a Moderator of Children's Adjustment.

    Science.gov (United States)

    Wasserstein, Shari B.; La Greca, Annette M.

    1998-01-01

    Three months after Hurricane Andrew, 89 children in grades four to six who lived in two-parent families and had experienced the hurricane were tested. Children's symptoms of posttraumatic stress disorder were related to their perceptions of parental conflict; this relationship was stronger for Hispanic children than for other ethnic groups.…

  12. The Mental Health Counselor's Role in Hurricane Andrew.

    Science.gov (United States)

    Dingman, Robert L.

    1995-01-01

    Discusses the effects of Hurricane Andrew on disaster workers, followed by some reported experiences of workers as well as victims. Background on natural disasters in general is given, along with information about crisis intervention. Discusses mental health interventions and various skills needed by disaster mental health counselors. (Author/KW)

  13. Andrew Tracey: Performer, Scholar, Teacher, Mentor | Thram | South ...

    African Journals Online (AJOL)

    A Legacy to Uphold Born to follow in his father Hugh Tracey's footsteps, Andrew Tracey has inspired countless people with his knowledge of African music. This he has done through his publications and films and his teaching and performing from the early days of his career in the 1960s through his Directorship of the ...

  14. Interview with Abel Laureate Sir Andrew J. Wiles

    DEFF Research Database (Denmark)

    Raussen, Martin Hubert; Skau, Christian

    2017-01-01

    Andrew J. Wiles is the recipient of the 2016 Abel Prize of the Norwegian Academy of Science and Letters. The interview was conducted by Martin Raussen And Christian Skau in Oslo on May 23, 2016, in conjunction with the Abel Prize celebration....

  15. Impact of Hurricane Andrew on FPL generation facilities

    International Nuclear Information System (INIS)

    Brannen, W.F.; Adams, R.L.

    1993-01-01

    In the pre-dawn hours of August 25, 1992, Hurricane Andrew made landfall in southern Dade County, Florida. The storm approached directly from the east and moved rapidly across the State and into the Gulf of Mexico. Andrew's intense winds caused unprecedented devastation to structures and facilities in its path. Not surprisingly, Florida Power and Light's (FPL) generation, transmission and distribution facilities in south Florida also suffered extensive damage. Two of FPL's electrical generating sites were located in the direct path of the storm and received its full brunt. This paper presents a review of the damage sustained by those plants, an overview of the unique recovery challenges encountered and a summary of the lessons learned from this experience

  16. Injuries and illnesses related to Hurricane Andrew--Louisiana, 1992.

    Science.gov (United States)

    1993-04-09

    On August 26, 1992, Hurricane Andrew struck Louisiana. On August 24, in anticipation of hurricane-related injuries and illnesses, the Office of Public Health (OPH), Louisiana Department of Health and Hospitals, in cooperation with hospital emergency room (ER) and public utility personnel and coroners, established an active emergency surveillance system in 19 parishes to monitor these events. This report summarizes the findings from this emergency surveillance system.

  17. A pioneer of tropical medicine worldwide: Andrew Balfour, of Khartoum.

    Science.gov (United States)

    Adeel, Ahmed A A

    2013-01-01

    This is an archival account of the career of Sir Andrew Balfour in Khartoum, Sudan during the period 1902 to 1913. As the first director of the Wellcome Tropical Research Laboratories in Khartoum during the period, Andrew Balfour was tasked with establishing the laboratories and at the same time he was engaged in founding the health services in Khartoum. Balfour worked in close collaboration and support from Henry Wellcome and Reginald Wingate, the Governor General of the Sudan. The energetic and meticulous sanitary work of Balfour had a remarkable impact, with Khartoum declared mosquito-free by 1910. Establishing a research base in the laboratories was met with many challenges but eventually Balfour managed to recruit a team of dedicated researchers and to produce well-circulated publications in tropical medicine. Balfour's work in Khartoum later lead him to a distinguished career in tropical medicine. In 1923 he was appointed the first Director of London School of Hygiene and Tropical Medicine. He was also elected President of the Royal Society of Tropical Medicine and Hygiene (1925-27). Sir Andrew Balfour, KCMG, CB, LL D (1873 -1931).

  18. The MacAndrew Scale as a measure of substance of abuse and delinquency among adolescents.

    Science.gov (United States)

    Rathus, S A; Fox, J A; Ortins, J B

    1980-04-01

    Used regression equations to determine the predictive power of the abbreviated MacAndrew Scale of the MMPI-168 on self-reported delinquent behavior of 1,672 suburban high school students. The abbreviated MacAndrew Scale score successfully predicted alcohol abuse, but was also shown to be related to crimes against property and persons and to marijuana usage. It was concluded that the MacAndrew Alcoholism Scale may not be uniquely sensitive to alcohol abuse among the population sampled.

  19. The Center for Adventist Research at Andrews University

    Directory of Open Access Journals (Sweden)

    Terry Dwain Robertson

    2015-01-01

    Full Text Available The Center for Adventist Research (CAR, an Andrews University and General Conference of Seventh-day Adventist organization, seeks to promote an understanding and appreciation of the heritage and mission of the Seventh-day Adventist Church (SDA. It combines the resources of the James White Library’s Adventist Heritage Center and the Ellen G. White Estate Branch Office to provide the most extensive collection of Adventist related resources in the world, both physically and digitally. An introduction to the background, collections, and activities of CAR is presented. Of particular interest are the digitization projects.

  20. Micropropagation and in vitro conservation of vanilla (Vanilla planifolia Andrews).

    Science.gov (United States)

    Divakaran, Minoo; Babu, K Nirmal

    2009-01-01

    Vanilla (Vanilla planifolia Andrews (syn. V. fragrans Salisb.), a source of natural vanillin, plays a major positive role in the economy of several countries. A native to the Central America, its primary gene pool is threatened by deforestation and over collection that has resulted in disappearance of natural habitats and wild species. Therefore, multiplication and conservation of vanilla diversity is of paramount importance because of its narrow genetic base. It plays an important role in the production of disease free planting material for commercial cultivation. Simple protocols for micropropagation, in vitro conservation and synthetic seed production are described in this chapter which could further be applied to other related vanilla species as well.

  1. Prediction of posttraumatic stress symptoms in children after hurricane Andrew.

    Science.gov (United States)

    Vernberg, E M; Silverman, W K; La Greca, A M; Prinstein, M J

    1996-05-01

    The authors used an integrative conceptual model to examine the emergence of posttraumatic stress disorder (PTSD) symptoms in 568 elementary school-age children 3 months after Hurricane Andrew. The model included 4 primary factors: Exposure to Traumatic Events, Child Characteristics, Access to Social Support, and Children's Coping. Overall, 62% of the variance in children's self-reported PTSD symptoms was accounted for by the 4 primary factors, and each factor improved overall prediction of symptoms when entered in the analyses in the order specified by the conceptual model. The findings suggest that the conceptual model may be helpful to organize research and intervention efforts in the wake of natural disasters.

  2. Pharmaceutical services at a medical site after Hurricane Andrew.

    Science.gov (United States)

    Nestor, A; Aviles, A I; Kummerle, D R; Barclay, L P; Rey, J A

    1993-09-01

    The experiences of a group of volunteer clinical pharmacists who provided pharmacy services as part of a disaster relief effort following a hurricane are reported. Hurricane Andrew left many people in southern Florida without shelter and other basic necessities, including health care services. A group of seven pharmacists volunteered to provide services at a temporary medical site set up in a community center. The pharmacy stock consisted of donated drugs. The pharmacists dispensed medications directly to patients and worked closely with other volunteer medical personnel to make sure proper medications were used. Because the pharmacy stock was limited, physicians relied upon the pharmacists for information about therapeutic interchanges, dosage conversions, and new medications. Prescriptions were often ordered and dispensed with only oral instructions. The pharmacists also provided patient counseling, although problems caused by inexperience with certain types of patients, a language barrier, and substandard living conditions after the hurricane made counseling more difficult. The contributions of seven pharmacists who provided services at an emergency medical site after Hurricane Andrew were well received by other health care personnel and by the community.

  3. Posttraumatic stress disorder in adolescents after Hurricane Andrew.

    Science.gov (United States)

    Garrison, C Z; Bryant, E S; Addy, C L; Spurrier, P G; Freedy, J R; Kilpatrick, D G

    1995-09-01

    To examine rates and correlates of posttraumatic stress disorder (PTSD) in adolescents after Hurricane Andrew. A random-digit dialing sample of 158 Hispanic, 116 black, and 104 white adolescent-parent pairs were surveyed in high- and low-impact areas within Dade County, Florida, 6 months after Hurricane Andrew. Subjects completed a structured telephone interview focused on within-disaster experiences and emotional reaction, disaster-related losses, lifetime exposure to violent or traumatic events, recent stressful experiences, and psychiatric symptomatology. Approximately 3% of males (95% confidence interval 0.4 to 5.3) and 9% of females (95% confidence interval 4.6 to 13.7) met the criteria for PTSD. Rates were highest among blacks (8.3%, 95% confidence interval 2.3 to 14.2) and Hispanics (6.1%, 95% confidence interval 2.2 to 9.9) and increased with age (odds ratio of 1.34, 95% confidence interval 1.04 to 1.72) and the number of undesirable events reported (odds ratio of 1.38, 95% confidence interval 1.21 to 1.57). While only a relatively small percentage of adolescents reported symptoms consistent with a diagnosis of PTSD, most reported some posttraumatic symptoms. Postdisaster planning should recognize that common stressful events occurring after disasters may be more strongly associated with PTSD than magnitude of contact with the actual disaster.

  4. Hurricane Andrew-related injuries and illnesses, Louisiana, 1992.

    Science.gov (United States)

    McNabb, S J; Kelso, K Y; Wilson, S A; McFarland, L; Farley, T A

    1995-06-01

    To determine the extent and types of injuries and illnesses in Louisiana associated with or related to Hurricane Andrew, we gathered data from hospital emergency departments and coroner's offices on demographic variables, institution, nature and cause of the injury or illness, body part affected, location, and date and time of the event. A hurricane-related injury or illness was defined as one that occurred from noon on August 24, 1992, through midnight on September 21, 1992, as a direct or indirect result of the preparation for (preimpact), the impact of, or the clean-up after the hurricane (postimpact). Nineteen parishes in south-central Louisiana that were most affected by Hurricane Andrew provided data from patients seen in emergency departments and reports from coroner's offices. Active, advance surveillance of this type promotes and facilitates the reporting of disaster-related health outcomes. Future planning for hurricanes should take into account the high rate of cuts, lacerations, and puncture wounds, particularly during the postimpact phase.

  5. Vroeë Oos-Kaapse tekste: Andrew Geddes Bain (1797-1864) | van ...

    African Journals Online (AJOL)

    Early Eastern Cape Texts: Andrew Geddes Bain (1797-1864) [Afrikaans] Andrew Geddes Bain: fervent letter writer of satirical sketches of contemporary life, transport entrepeneur, military man, farmer, builder of bridges in the dry stone walling technique, autodidact, discoverer of the "Blinkwater Monster" fossil, as well as ...

  6. The Implementation of IAS 16 and IAS 41 at Andrew Peller Limited

    Science.gov (United States)

    Lapointe-Antunes, Pascale; Moore, James

    2013-01-01

    This case asks students to play the role of Doug Grodeckie, Manager of Financial Reporting at Andrew Peller Limited (APL). Doug was asked to prepare a report analyzing Andrew Peller Limited's current tangible long-lived assets disclosures and making recommendations on how best to comply with International Accounting Standard (IAS) 16 Property,…

  7. The MacAndrew Scale as a Measure of Substance Abuse and Delinquency among Adolescents.

    Science.gov (United States)

    Rathus, Spencer A.; And Others

    1980-01-01

    Used regression equations to determine the predictive power of the abbreviated MacAndrew Scale of the MMPI-168 on self-reported delinquent behavior of 1,672 high school students. The abbreviated MacAndrew Scale score successfully predicted alcohol abuse but was also related to crimes against property and persons and to marijuana usage. (Author)

  8. Pamela Ngesa A Review of George Gonaís Andrew Mtagwaba ...

    African Journals Online (AJOL)

    Jimmy Gitonga

    Review of George Gona's Andrew Mtagwaba Kailembo: The Life and Times of an African Trade Unionist 173. Review of ... renowned Tanzanian labour movement leader, Andrew Mtagwaba Kailembo has received little .... hanging rather loosely, without clearly showing their role on the road to Pan-African trade union unity.

  9. The paths of Andrew A. Benson: a radio-autobiography.

    Science.gov (United States)

    Nonomura, Arthur M; Holtz, Barry; Biel, Karl Y; Cooney, Robert; Lorimer, George; Govindjee

    2017-10-01

    Andrew A. Benson, one of the greatest biochemists of our time, is celebrated on his centennial by the authors with whom he interacted performing experiments or contemplating metabolic pathways in a wide range of biological kingdoms. He charted the chemical flow of energy in cells, tissues, organs, plants, animals, and ecosystems. Benson collaborated with hundreds of colleagues to examine the natural history of autotrophy, mixotrophy, and heterotrophy while elucidating metabolic pathways. We present here a biological perspective of his body of studies. Benson lived from September 24, 1917, to January 16, 2015. Out of over 1000 autoradiograms he produced in his life, he left a legacy of 50 labeled autoradiograms to the authors who tell the story of his life's work that resulted in Benson's Protocol (Nonomura et al., Photosynth Res 127:369-378, 2016) that has been applied, over the years, for the elucidation of major metabolic pathways by many scientists.

  10. Measurement of perceived disruption during rebuilding following Hurricane Andrew.

    Science.gov (United States)

    Burnett, K; Ironson, G; Benight, C; Wynings, C; Greenwood, D; Carver, C S; Cruess, D; Baum, A; Schneiderman, N

    1997-10-01

    The purpose of this study was to develop and evaluate a measure of perceived disruption during rebuilding following a disaster. Two eight-item scales, which measured intensity of disruption during the entire repair phase (Intensity-RP) and intensity of disruption during the past month (Intensity-PM) were developed and administered to 135 survivors of Hurricane Andrew. At 9 to 12 months postdisaster, Intensity-RP and Intensity-PM were both significantly associated with scores on the Global Severity Index of the SCL-90-R, and with scores on the Impact of Event-Intrusion Scale; Intensity-PM alone was significantly associated with PTSD scores. Regression analyses indicated that each scale contributed significant unique variance in predicting mental health symptoms, even after controlling for relevant demographic and initial disaster exposure variables.

  11. Food-related coping strategies after Hurricane Andrew.

    Science.gov (United States)

    Magnus, M H

    1994-06-01

    This telephone survey examined food-related coping strategies in Floridian households after Hurricane Andrew. Approximately 137 households of university faculty and staff who lived in hurricane-damaged areas were interviewed. The average respondent was a college-educated woman between 41 and 60 years old. Prevailing food-purchasing problems included food stores that were either closed, without perishable food, distant, or crowded. In the absence of electricity and water, changes in food preparation included preparation of meals without a stove, more frequent use of grills and canned food, simpler meals, and less cooking. Changes in kitchen cleanup included using more disposables, cleaning more often, washing dishes by hand, and cleaning up less often because of damage in the kitchen. Respondents indicated that the hurricane experience taught them that they should have acquired more general supplies (eg, coolers, thermoses, propane stoves, and gas burners), more water and ice, and more nonperishable foods before the hurricane.

  12. Philip Andrew Traynor, DDS, FACD, (1874-1962).

    Science.gov (United States)

    Reed, R V

    1996-11-01

    Philip Andrew Traynor was arguably Delaware's most peerless dentist during his lifetime and even until today. He touched many lives, advanced the prestige of the dental profession, and served his state and country unselfishly as a national legislator. Forceful, no nonsense, take charge, persuasive, athlete, soldier, politico, legislator, canine judge, vocalist, dentist--all words that have been used to identify and describe this remarkable, unwonted, and extraordinary man--truly a dental diamond from the Diamond State. Historically it is important to view Traynor's wide ranging accomplishments in perspective. An Irish Catholic and son of the nation's second smallest state, Dr. Traynor affected the lives of thousands of people the length and breadth of his state and even his nation. Whether at the dental chair or congressional lecturn, Philip A. Traynor, a dual savant, imprinted his hallmark. This paper details the unselfish life of a perspicacious man and exceptional dentist, Philip A. Traynor, DDS.

  13. Deaths related to Hurricane Andrew in Florida and Louisiana, 1992.

    Science.gov (United States)

    Combs, D L; Parrish, R G; McNabb, S J; Davis, J H

    1996-06-01

    Information about circumstances leading to disaster-related deaths helps emergency response coordinators and other public health officials respond to the needs of disaster victims and develop policies for reducing the mortality and morbidity of future disasters. In this paper, we describe the decedent population, circumstances of death, and population-based mortality rates related to Hurricane Andrew, and propose recommendations for evaluating and reducing the public health impact of natural disasters. To ascertain the number and circumstances of deaths attributed to Hurricane Andrew in Florida and Louisiana, we contacted medical examiners in 11 Florida counties and coroners in 36 Louisiana parishes. In Florida medical examiners attributed 44 deaths to the hurricane. The mortality rate for directly-related deaths was 4.4 per 1 000 000 population and that for indirectly-related deaths was 8.5 per 1 000 000 population. In Louisiana, coroners attributed 11 resident deaths to the hurricane. Mortality rates were 0.6 per 1000 000 population for deaths directly related to the storm and 2.8 for deaths indirectly related to the storm. Six additional deaths occurred among non-residents who drowned in international waters in the Gulf of Mexico. In both Florida and Louisiana, mortality rates generally increased with age and were higher among whites and males. In addition to encouraging people to follow existing recommendations, we recommend emphasizing safe driving practices during evacuation and clean-up, equipping shelters with basic medical needs for the population served, and modifying zoning and housing legislation. We also recommend developing and using a standard definition for disaster-related deaths, and using population-based statistics to describe the public health effectiveness of policies intended to reduce disaster-related mortality.

  14. Third-order gas-liquid phase transition and the nature of Andrews critical point

    Directory of Open Access Journals (Sweden)

    Tian Ma

    2011-12-01

    Full Text Available The main objective of this article is to study the nature of the Andrews critical point in the gas-liquid transition in a physical-vapor transport (PVT system. A dynamical model, consistent with the van der Waals equation near the Andrews critical point, is derived. With this model, we deduce two physical parameters, which interact exactly at the Andrews critical point, and which dictate the dynamic transition behavior near the Andrews critical point. In particular, it is shown that 1 the gas-liquid co-existence curve can be extended beyond the Andrews critical point, and 2 the transition is first order before the critical point, second-order at the critical point, and third order beyond the Andrews critical point. This clearly explains why it is hard to observe the gas-liquid phase transition beyond the Andrews critical point. Furthermore, the analysis leads naturally the introduction of a general asymmetry principle of fluctuations and the preferred transition mechanism for a thermodynamic system. The theoretical results derived in this article are in agreement with the experimental results obtained in (K. Nishikawa and T. Morita, Fluid behavior at supercritical states studied by small-angle X-ray scattering, Journal of Supercritical Fluid, 13 (1998, pp. 143-148. Also, the derived second-order transition at the critical point is consistent with the result obtained in (M. Fisher, Specific heat of a gas near the critical point, Physical Review, 136:6A (1964, pp. A1599-A1604.

  15. A transnational conference romance: Elsie Andrews, Hildegarde Kneeland, and the Pan-Pacific Women's Association.

    Science.gov (United States)

    Laurie, Alison J

    2009-01-01

    Elsie Andrews, a feminist activist from New Zealand, met Dr. Hildegarde Kneeland, a progressive economist from the United States, at the 1934 Pan-Pacific Women's Association conference in Honolulu. Andrews wrote diaries of her attendance at conferences, and in these writes openly of her attraction and romantic feelings for Kneeland, despite her own long-term domestic partnership back in New Plymouth with Muriel Kirton. This article considers the role conference romances may have played for Andrews and others in encouraging their interest in women's organizations, in the context of literature on romantic friendships and lesbianism.

  16. Cloud-to-ground lightning in Hurricane Andrew

    Science.gov (United States)

    Molinari, John; Moore, Paul K.; Idone, Vincent P.; Henderson, Ronald W.; Saljoughy, Arsalan B.

    1994-08-01

    The spatial and temporal distribution of cloud-to-ground lightning was examined in Hurricane Andrew of 1992. Lightning locations available from the National Lightning Detection Network were superimposed on infrared satellite images to relate lightning activity to hurricane cloud structure. A distinct radial variation occurred in time-averaged flash density, with a weak maximum in the eye wall, a region of near-zero flash density 40 to 100 km from the center, and a steady increase to a large maximum in the outer rainbands 190 km from the center. This radial distribution is consistent with the convective structure of mature hurricanes. Eye wall lightning tended to be episodic, occurring almost exclusively prior to and during periods of intensification of the storm. During these periods, negative flashes occurred several kilometers inward from the highest eye wall cloud tops, in the region of the largest radar reflectivity. Positive eye wall flashes, while small in number, tended to occur directly under the highest cloud tops. The results are suggestive of a normal dipole in sign but outwardly tilted along the sloping eye wall. In general, hurricane flash characteristics resembled those for a background data set of nonhurricane flashes from the same area. The exception occurred for negative flashes in the eye wall, which had a much smaller mean peak current than the background (25.3 kA versus 44.9 kA).

  17. Psychological effects of Hurricane Andrew on an elementary school population.

    Science.gov (United States)

    Shaw, J A; Applegate, B; Tanner, S; Perez, D; Rothe, E; Campo-Bowen, A E; Lahey, B L

    1995-09-01

    To explore the prevalence and progression of posttraumatic symptomatology (PTS), using emotional and behavioral indices of psychopathology in school-age children in the pathway of Hurricane Andrew (HI-IMPACT) and in a comparison group north of Miami (LO-IMPACT). Pynoos' Posttraumatic Stress Disorder Reaction Index and Achenbach's Teacher's Report Form (TRF) were administered 8 weeks and 32 weeks after the hurricane. In addition, 21 measures of disruptive behavior cataloged by Dade County Public Schools were aggregated and compared by grading period between pre- and posthurricane school years. There were no statistically significant differences between the two schools in PTS at 8 weeks after the hurricane, although the children in the HI-IMPACT school were more likely to have severe PTS. TRF findings at 8 weeks revealed that children in the HI-IMPACT school evidenced lower means on the eight TRF scales and on the broader Internalizing and Externalizing measures. Analysis of the disruptive behavior revealed a drop in the marking period immediately after the hurricane in the HI-IMPACT area, but an opposite effect was observed in the LO-IMPACT area. After the hurricane there was an initial increase in PTS and a concomitant decrease in other measures of behavior and psychopathology. PTS remained relatively high throughout the school year, but there was a rebound and subsequent normalization of the measures of disruptive behavior.

  18. Andrew Liehr and the structure of Jahn-Teller surfaces

    Science.gov (United States)

    Chibotaru, Liviu F.; Iwahara, Naoya

    2017-05-01

    The present article is an attempt to draw attention to a seminal work by Andrew Liehr “Topological aspects of conformational stability problem” [1, 2] issued more than half century ago. The importance of this work stems from two aspects of static Jahn-Teller and pseudo-Jahn-Teller problems fully developed by the author. First, the work of Liehr offers an almost complete overview of adiabatic potential energy surfaces for most known Jahn-Teller problems including linear, quadratic and higher-order vibronic couplings. Second, and most importantly, it identifies the factors defining the structure of Jahn-Teller surfaces. Among them, one should specially mention the minimax principle stating that the distorted Jahn-Teller systems tend to preserve the highest symmetry consistent with the loss of their orbital degeneracy. We believe that the present short reminiscence not only will introduce a key Jahn-Teller scientist to the young members of the community but also will serve as a vivid example of how a complete understanding of a complex problem, which the Jahn-Teller effect certainly was in the beginning of 1960s, can be achieved.

  19. Does Andrews facial analysis predict esthetic sagittal maxillary position?

    Science.gov (United States)

    Resnick, Cory M; Daniels, Kimberly M; Vlahos, Maryann

    2018-04-01

    Cephalometric analyses have limited utility in planning maxillary sagittal position for orthognathic surgery. In Six Elements of Orofacial Harmony, Andrews quantified maxillary position relative to forehead projection and angulation and proposed an ideal relationship. The purpose of this study was to investigate the ability of this technique to predict esthetic sagittal maxillary position. Survey study including a male and female with straight facial profiles, normal maxillary incisor angulations, and Angle's Class I. Maxillary position was modified on lateral photographs to create 5 images for each participant with incisor-goal anterior limit line (GALL) distances of -4, -2, 0, +2, and +4 mm. A series of health care professionals and laypeople were asked to rate each photo in order of attractiveness. A total of 100 complete responses were received. Incisor-GALL distances of +4 mm (41%) and +2 mm (40%) were most commonly considered "most esthetic" for the female volunteer (P < .001). For the male volunteer, there were 2 peak "most esthetic" responses: incisor-GALL distances of 0 mm (37%) and -4 mm (32%) (P < .001). Respondents considered maxillary incisor position 2 to 4 mm anterior to GALL most attractive in a woman and 0 to 4 mm posterior to GALL most esthetic in a man. Using these modified target distances, this analysis may be useful for orthognathic surgery planning. Copyright © 2018 Elsevier Inc. All rights reserved.

  20. Mida mõtleb professor Andrew Mayo? / Anne-Mari Ernesaks

    Index Scriptorium Estoniae

    Ernesaks, Anne-Mari

    2005-01-01

    PARE koordinaator tutvustab tuntud inimkapitali ideoloogi Andrew Mayo raamatut "Ettevõtte inimväärtus". Raamatu autori hinnangul on tänapäeva organisatsioonides juhtimise olulisim ülesanne inimese juhtimine varana. Lisa: Konverents

  1. Active morbidity surveillance after Hurricane Andrew--Florida, 1992.

    Science.gov (United States)

    Lee, L E; Fonseca, V; Brett, K M; Sanchez, J; Mullen, R C; Quenemoen, L E; Groseclose, S L; Hopkins, R S

    1993-08-04

    To describe the health status of and to detect disease outbreaks in the population affected by Hurricane Andrew in south Dade County, Florida. The Florida Department of Health and Rehabilitative Services and the US Army conducted active surveillance for gastrointestinal illness, respiratory illness, injury, and other index conditions by monitoring civilian and service member visits to care sites (civilian and military free care sites and hospital emergency departments) from August 30 (1 week after the hurricane's landfall) through September 30, 1992. South Dade County, Florida. Proportional morbidity: the number of daily visits for each index condition divided by the total number of visits, expressed as a percentage. Morbidity rate: the total number of daily visits by service members divided by the total number of service members, expressed as a percentage. Six index conditions accounted for 41.3% of visits to civilian free care sites: diarrhea (4.7%), cough (4.7%), other infection (9.6%), rash (5.4%), animal bite (1.2%), and injury (15.7%). At military free care sites, five index conditions accounted for 75.7% of civilian visits: injury (23.7%), dermatologic illness (12.4%), respiratory illness (9.9%), gastrointestinal illness (5.3%), and other medical conditions (24.4%). Two index conditions accounted for 54.1% of service member visits: injury (36.2%) and dermatologic illness (17.9%). During the 5 weeks after the hurricane, proportional morbidity from injury decreased; proportional morbidity from respiratory illness increased; and proportional morbidity from diarrhea was stable. No infectious disease outbreaks occurred. Injuries were an important source of morbidity throughout the surveillance period, especially among service members. Enteric and respiratory agents did not cause disease outbreaks, despite alarming rumors to the contrary.

  2. Preliminary report: medical examiner reports of deaths associated with Hurricane Andrew--Florida, August 1992.

    Science.gov (United States)

    1992-09-04

    On August 24, 1992, at 1:40 a.m. eastern daylight time (EDT), rain bands associated with Hurricane Andrew reached the eastern coast of Florida. At 4:45 a.m. EDT, Hurricane Andrew made landfall 35 miles southeast of Miami at Homestead, with sustained winds of 145 miles per hour (mph) and gusts of 164 mph. These winds extended 45 miles outward of the storm center. The storm moved across the state at 18 mph toward the Gulf of Mexico (Figure 1). The tidal surge on the eastern coast was estimated at 7-19 feet. During the storm, approximately 2.5 million Florida residents were left without electrical power, and approximately 56,000 family dwelling units were destroyed or severely damaged. This report presents preliminary data from Florida medical examiner (ME) offices about deaths attributed to Hurricane Andrew.

  3. Analyzing after-action reports from Hurricanes Andrew and Katrina: repeated, modified, and newly created recommendations.

    Science.gov (United States)

    Knox, Claire Connolly

    2013-01-01

    Thirteen years after Hurricane Andrew struck Homestead, FL, Hurricane Katrina devastated the Gulf Coast of Mississippi, Alabama, and southeastern Louisiana. Along with all its destruction, the term "catastrophic" was redefined. This article extends the literature on these hurricanes by providing a macrolevel analysis of The Governor's Disaster Planning and Response Review Committee Final Report from Hurricane Andrew and three federal after-action reports from Hurricane Katrina, as well as a cursory review of relevant literature. Results provide evidence that previous lessons have not been learned or institutionalized with many recommendations being repeated or modified. This article concludes with a discussion of these lessons, as well as new issues arising during Hurricane Katrina.

  4. Capacities of template-type platforms in the Gulf of Mexico during hurricane Andrew

    Energy Technology Data Exchange (ETDEWEB)

    Bea, R.G.; Loch, K.J.; Young, P.L. [Univ. of California, Berkeley, CA (United States)

    1997-02-01

    This paper details results from nonlinear analyses of the ultimate limit state performance characteristics of four Gulf of Mexico (GOM) platforms subjected to intense loadings from hurricane Andrew. These four platforms were located to the east of the track of hurricane Andrew, and were thus in the most intense portion of the storm (Smith, 1993). The nonlinear analyses are able to replicate details of the observed behavior of the four structures. This replication is very dependent on realistic characterization of the performance characteristics of the pile foundations and on accurate information on the as is condition of the platforms before the storm.

  5. The Role of the U.S. Army Medical Department in Domestic Disaster Assistance Operations. Lessons Learned from Hurricane Andrew.

    Science.gov (United States)

    1996-04-15

    Hurricane Andrew , which struck South Dade County, Florida on the morning of 24 August 1992, was the ’worst natural disaster ever to hit the United...and Medical). The study also addresses the Army Medical Department’s role in the Hurricane Andrew operations and closes with a review of the medically

  6. On the Record: with Olly Owen and Andrew Faull | Owen | South ...

    African Journals Online (AJOL)

    ... of International Development at the University of Oxford. In 2012 he completed his doctorate in Social and Cultural Anthropology at Oxford. This involved an ethnographic study of, and fieldwork with, the Nigerian Police Force. Andrew Faull is a doctoral research student at the Centre for Criminology, University of Oxford.

  7. Joshua Rodda: Public Religious Disputations in England 1558–1626, St Andrews Studies in Reformation History

    Directory of Open Access Journals (Sweden)

    Joachim Schwend

    2015-01-01

    Full Text Available This contribution offers a review of Joshua Rodda's Public Religious Disputations in England 1558–1626, St Andrews Studies in Reformation History. Farnham, Surrey: Ashgate, 2014. 252 pages, regular price £ 70, 234 x 156 mm, ISBN 978–1–4724–1555–4.

  8. Commentary on Andrew Coulson's "Comparing Public, Private, and Market Schools: The International Evidence"

    Science.gov (United States)

    Wolfram, Gary; Coulson, Andrew J.

    2009-01-01

    In this article, the authors comment on Andrew Coulson's "Comparing Public, Private, and Market Schools: The International Evidence." The authors believe that Coulson's paper is a very interesting review of the literature on the ability of market-produced education to outperform government-produced education. Coulson's response on this commentary…

  9. Crisis Intervention with Survivors of Natural Disaster: Lessons from Hurricane Andrew.

    Science.gov (United States)

    Shelby, Janine S.; Tredinnick, Michael G.

    1995-01-01

    Crisis intervention has typically been conceptualized as seeking a return of clients to a state of equilibrium. Personal work experience with Hurricane Andrew survivors has led to an appreciation of the importance of several considerations. Develops a proactive approach, attempting to recognize and extend clients' preexisting strengths. Offers…

  10. News of Hurricane Andrew: The Agenda of Sources and the Sources' Agendas.

    Science.gov (United States)

    Salwen, Michael B.

    1995-01-01

    Studies quotations in newspaper coverage of Hurricane Andrew, showing that individuals who were not affiliated with government or business were quoted most often. Shows that most sources were quoted as experts, with individuals represented as suffering victims, providing the news media with human interest quotations. Notes that most sources…

  11. Posttraumatic Stress, Depression, and Social Support among College Students after Hurricane Andrew.

    Science.gov (United States)

    Pickens, Jeffrey; And Others

    1995-01-01

    One month after Hurricane Andrew, surveyed students who reported experiencing the most severe impact damage from the storm also reported experiencing the most stress, anxiety, and depressive symptoms. Regression analyses revealed that material and emotional social support were significant predictors of anxiety and depression scores after the…

  12. Stressing Memory: Long-Term Relations among Children's Stress, Recall and Psychological Outcome following Hurricane Andrew

    Science.gov (United States)

    Sales, Jessica McDermott; Fivush, Robyn; Parker, Janat; Bahrick, Lorraine

    2005-01-01

    We examined relations among stress, children's recall, and psychological functioning following Hurricane Andrew. Thirty-five children from mixed socioeconomic backgrounds were divided into low-, moderate-, and high-stress groups and were interviewed about the hurricane immediately after the storm and 6 years later. Our primary interest, stemming…

  13. Airborne Videography and GPS for Assessment of Forest Damage in Southern Louisiana from Hurricane Andrew

    Science.gov (United States)

    D.M. Jacobs; Susan Eggen-McIntosh

    1993-01-01

    Abstract: One week after Hurricane Andrew made landfall in Louisiana in August 1992, an airborne videography system, with a global positioning system (GPS) receiver, was used to assess timberland damage across a 1.7 million-ha (4.2 million-acre) study area. Ground observations were made to identify different intensities of timber damage and then...

  14. Visions and Vanities: John Andrew Rice of Black Mountain College. Southern Biography Series.

    Science.gov (United States)

    Reynolds, Katherine Chaddock

    This biography presents the life of John Andrew Rice, who founded Black Mountain College (North Carolina) in 1933 to implement his philosophy of education, including the centrality of artistic experience and emotional development to learning in all disciplines and the need for democratic governance shared between faculty and students. Born in…

  15. Impact of an extreme event on the sediment budget: Hurricane Andrew in the Louisiana barrier islands

    Science.gov (United States)

    List, Jeffrey H.; Hansen, Mark E.; Sallenger,, Asbury H.; Jaffe, Bruce E.; Edge, B.L

    1997-01-01

    This paper examines the influence of Hurricane Andrew on the sediment budget of an 80-kilometer section of the Louisiana barrier islands west of the modern Mississippi delta. Because long-term bathymetric change has been extensively studied in this area, excellent baseline data are available for evaluating the impact of Hurricane Andrew. Results show that despite the high intensity of the storm and a storm track optimally positioned to impact the study area, the storm did not have an overwhelming influence on the sediment budget when compared to the changes occurring over the previous 50 years. For the Louisiana barrier islands, a 50-year record appears to be adequate for averaging the long-term contributions of both major and minor storm events to the sediment budget.

  16. Geologic impact of Hurricane Andrew on Everglades coast of southwest Florida

    Science.gov (United States)

    Davis, R. A.

    1995-04-01

    Hurricane Andrew, one of the strongest storms of the century, crossed the southern part of the Florida peninsula on 24 August 1992. Its path crossed the Florida Everglades and exited in the national park across a mangrove-dominated coast onto the shallow, low-energy, inner shelf. The storm caused extensive breakage and defoliation in the mangrove community; full recovery will take decades. It produced no extensive sedimentation unit; only local and ephemeral ebb-surge deposits. The discontinuous shelly storm beach ridge was breached at multiple locations, and it moved landward a few meters. After seven months, there was little geologic indication that the storm had passed. It is likely that the stratigraphic record in this area will not contain any recognizable features of the passage of Hurricane Andrew.

  17. Rapid health needs assessment following hurricane Andrew--Florida and Louisiana, 1992.

    Science.gov (United States)

    1992-09-18

    Following the impact phase of Hurricane Andrew in Florida (August 24) and Louisiana (August 26) (Figure 1), the primary objectives of the public health response have been to address the health and medical needs of residents in the storm-damaged areas and to provide data for relief interventions and decision-making. This report presents the combined findings from rapid health needs assessment surveys conducted by state health departments with CDC assistance 3-10 days postimpact.

  18. Andrew Wyeth and N.C. Wyeth: a psychodynamic perspective on father and son.

    Science.gov (United States)

    Shaw, Jon A

    2013-01-01

    This paper examines the relationship between two extraordinary artists, father and son--N.C. Wyeth (1882-1945) and Andrew Wyeth (1917-2009)--and their art. N.C. Wyeth, the father, the most famous illustrator of his day, painted scenes full of drama and action, often of men engaged in violent life and death struggles. N.C. was unable to separate from his powerful mother and yearned for his iconic father. He thought himself an artistic failure and dedicated himself to raising his children to be geniuses. The youngest son, Andrew Wyeth, who lived a "secret life," painted scenes often characterized by pathos: bleak and barren landscapes, leaden skies, tire tracks, gray framed houses, desiccated fields, and circling buzzards. In the father-son relationship, we often seen three themes perpetuated developmentally: (1) the son's identification with the innermost conflicts of his father; (2) the yearning for the iconic father of his youth; and (3) a continuation and disavowal of his father's life. These themes are played out in the relationship between Andrew Wyeth and his father.

  19. Enrico Fermi Awards Ceremony for Dr. Allen J. Bard and Dr. Andrew Sessler, February 2014 (Presentations, including remarks by Energy Secretary, Dr. Ernest Moniz)

    Energy Technology Data Exchange (ETDEWEB)

    Moniz, Ernest [U.S. Energy Secretary

    2014-02-03

    The Fermi Award is a Presidential award and is one of the oldest and most prestigious science and technology honors bestowed by the U.S. Government. On February 3, 2014 it was conferred upon two exceptional scientists. The first to be recognized is Dr. Allen J. Bard, 'for international leadership in electrochemical science and technology, for advances in photoelectrochemistry and photocatalytic materials, processes, and devices, and for discovery and development of electrochemical methods including electrogenerated chemiluminescence and scanning electrochemical microscopy.' The other honoree is Dr. Andrew Sessler, 'for advancing accelerators as powerful tools of scientific discovery, for visionary direction of the research enterprise focused on challenges in energy and the environment, and for championing outreach and freedom of scientific inquiry worldwide.' Dr. Patricia Dehmer opened the ceremony, and Dr. Ernest Moniz presented the awards.

  20. Raymond Andrews as Griot: Privileging Southern Black Communities through Oral Storytelling and Cultural History

    Directory of Open Access Journals (Sweden)

    Brennan Collins

    2012-01-01

    Full Text Available Raymond Andrews’ novels celebrate rural Black life by focusing on the customs and traditions of Southern African American communities. Critical to this celebration are the rhetorical strategies Andrews uses that privilege oral over literary storytelling. Using Geneva Smitherman’s discussion of the griot and Henry Louis Gates, Jr.’s concept of the speakerly text in the context of John Miles Foley’s work on comparative oral traditions, this essay explores the possibility and implications of describing Andrews’ written work as a form of oral storytelling.

  1. Emergency mosquito control associated with Hurricane Andrew--Florida and Louisiana, 1992.

    Science.gov (United States)

    1993-04-09

    Hurricane Andrew crossed south Florida on August 24, 1992 entered the Gulf of Mexico, and struck the Louisiana coast on August 26. In Florida, an estimated 25,000 housing units were destroyed and 37,000 severely damaged in a 200,000-acre area in the southern portion of Dade County; in Louisiana, an estimated 25,000 housing units were destroyed or severely damaged by the storm, primarily in the coastal sections of the 36-parish disaster area. Initial assessment of the disaster areas indicated a need for vector surveillance and control (1). This report summarizes actions to assess and alleviate mosquito-related problems in Florida and Louisiana.

  2. Cognition About the Creative Process – Interview With Dr Andrew P. Allen

    Directory of Open Access Journals (Sweden)

    Andrew P. Allen

    2016-11-01

    Full Text Available What is the relationship between the creative process and cognition and perception? Lynda Loughnane, a master’s student in Art and Process in Crawford College of Art and Design, Cork, Ireland interviewed Dr Andrew P. Allen about the subject. Areas covered include mindfulness, Type 1 and Type 2 thinking, stage theories of creativity, engagement with the art process and the artwork, phenomenology and consciousness with and without self report. The interview was constructed to cover a wide range of subject matter, so as to gather as much information as possible in layman's language about the cognitive process in relation to creativity and interaction with art.

  3. Sleep disturbance and its relationship to psychiatric morbidity after Hurricane Andrew.

    Science.gov (United States)

    Mellman, T A; David, D; Kulick-Bell, R; Hebding, J; Nolan, B

    1995-11-01

    Sleep disturbance is an important dimension of posttraumatic stress disorder (PTSD), but most of the limited available data were obtained years after the original traumatic event. This study provides information on sleep disturbance and its relationship to posttraumatic morbidity from evaluations done within a year after the trauma. Sleep and psychiatric symptoms of 54 victims (12 men and 42 women) of Hurricane Andrew who had no psychiatric illness in the 6 months before the hurricane were evaluated. A subset of hurricane victims with active psychiatric morbidity (N = 10) and nine comparison subjects who were unaffected by the hurricane were examined in a sleep laboratory. A broad range of sleep-related complaints were rated as being greater after the hurricane, and psychiatric morbidity (which was most commonly PTSD, followed by depression) had a significant effect on most of the subjective sleep measures. In addition, subjects with active morbidity endorsed greater frequencies of "bad dreams" and general sleep disturbances before the hurricane. Polysomnographic results for the hurricane victims revealed a greater number of arousals and entries into stage 1 sleep. REM density correlated positively with both the PTSD symptom of reexperiencing trauma and global distress. Subjects affected by Hurricane Andrew reported sleep disturbances, particularly those subjects with psychiatric morbidity. Tendencies to experience bad dreams and interrupted sleep before a trauma appear to mark vulnerability to posttraumatic morbidity. Results of sleep laboratory evaluations suggested brief shifts toward higher arousal levels during sleep for PTSD subjects and a relationship of REM phasic activity and symptom severity.

  4. Delayed tree mortality in the Atchafalaya Basin of Southern Louisiana following Hurricane Andrew

    Science.gov (United States)

    Keeland, B.D.; Gorham, L.E.

    2009-01-01

    Hurricanes can damage trees in forested wetlands, and the potential for mortality related to these storms exists due to the effects of tree damage over time. In August 1992, Hurricane Andrew passed through the forested wetlands of southern Louisiana with winds in excess of 225 kph. Although more than 78 of the basal area was destroyed in some areas, most trees greater than 2.5 cm dbh were alive and resprouting prolifically the following year (98.8). Survival of most tree species was similarly high two years after the hurricane, but mortality rates of some species increased dramatically. For example, Populus heterophylla (swamp cottonwood) mortality increased from 7.8 to 59.2 (n 76) and Salix interior (sandbar willow) mortality increased from 4.5 to 57.1 (n 21). Stem sprouts on many up-rooted hardwood trees of other species were still alive in 1998, 6 years after the hurricane. Due to the understory tree species composition, regeneration, and high levels of resprouting, there was little change in species composition or perhaps a slight shift toward more shade and flood tolerant species six years following the hurricane event. Triadica sebifera (Chinese tallow) was found on some of the sites heavily disturbed by Hurricane Andrew, and may proliferate at the expense of native tree species. ?? 2009 The Society of Wetland Scientists.

  5. Impacts of Hurricane Andrew on carbonate platform environments, northern Great Bahama Bank

    Science.gov (United States)

    Boss, Stephen K.; Neumann, A. Conrad

    1993-10-01

    The northern (most energetic) quadrant of Hurricane Andrew (August 1992) passed over leeward-margin sand waves, bank-top sand shoals, reefs, and low islands of Great Bahama Bank for which an extensive prestorm data base exists. A reconnaissance survey seven weeks after Hurricane Andrew evaluated storm impacts on these bank-top settings. Resurveyed seismic profiles showed that positions, dimensions, and orientations of platform sand bodies were unchanged relative to fixed bedrock features. Surveys of reef communities indicated only minor storm-related disturbance. Coral bleaching may be due to storm-induced environmental stress. In addition, storm-wave plucking of boulders from emergent rocky cays resulted in localized crushing of reef biota. On low islands, beach erosion and storm surge were insignificant, and storm damage to Casuarina forests was minor and substrate-specific. Observed minimal hurricane impacts on northern Great Bahama Bank environments lying 10-75 km from the hurricane eye are reconciled by analysis of meteorological data, which show significant weakening of the storm (expressed as a rise in central barometric pressure of ˜20 mbar) during passage across the bank-top. This study demonstrates the importance of specific dynamic aspects of hurricanes (e.g., varying intensity, strength, size, forward speed, duration) which influence their geologic potential, even over relatively short distances along the storm track of an individual hurricane.

  6. Demographic effects of natural disasters: a case study of Hurricane Andrew.

    Science.gov (United States)

    Smith, S K; McCarty, C

    1996-05-01

    Many studies have considered the economic, social, and psychological effects of hurricanes, earthquakes, floods, tornadoes, and other natural disasters, but few have considered their demographic effects. In this paper we describe and evaluate a method for measuring the effects of Hurricane Andrew on the housing stock and population distribution in Dade County, Florida. Using information collected through sample surveys and from other data sources, we investigate the extent of housing damages, the number of people forced out of their homes, where they went, how long they stayed, and whether they returned to their prehurricane residences. We conclude that more than half the housing units in Dade County were damaged by Hurricane Andrew; that more than 353,000 people were forced to leave their homes, at least temporarily; and that almost 40,000 people left the county permanently as a direct result of the hurricane. We believe that this study will provide methodological guidance to analysts studying the demographic effects of other large-scale natural disasters.

  7. Development of pile foundation bias factors using observed behavior of platforms during Hurricane Andrew

    Energy Technology Data Exchange (ETDEWEB)

    Aggarwal, R.K.; Litton, R.W.; Cornell, C.A.; Tang, W.H.; Chen, J.H.; Murff, J.D.

    1996-12-31

    The performance of more than 3,000 offshore platforms in the Gulf of Mexico was observed during the passage of Hurricane Andrew in August 1992. This event provided an opportunity to test the procedures used for platform analysis and design. A global bias was inferred for overall platform capacity and loads in the Andrew Joint Industry Project (JIP) Phase 1. It was predicted that the pile foundations of several platforms should have failed, but did not. These results indicated that the biases specific to foundation failure modes may be higher than those of jacket failure modes. The biases in predictions of foundation failure modes were therefore investigated further in this study. The work included capacity analysis and calibration of predictions with the observed behavior for 3 jacket platforms and 3 caissons using Bayesian updating. Bias factors for two foundation failure modes, lateral shear and overturning, were determined for each structure. Foundation capacity estimates using conventional methods were found to be conservatively biased overall.

  8. Specific features of basalts from the western part of Andrew Bain Fault, Southwest Indian Ridge

    Science.gov (United States)

    Peyve, A. A.; Skolotnev, S. G.

    2017-12-01

    This paper reports original data on the composition of volcanic rocks in the western part of the Andrew Bain Fault of the South-West Indian Ridge obtained in the 23rd voyage of R/V Akademik Nikolai Strakhov. In accordance with high La/Th and low Nb/U ratios, the basalt compositions of stations S2317, S2318, and S2330 could result from melting of the DM-type source with HIMU traces. Meanwhile, the enriched samples of station S2326 correspond to a mantle source with a considerable contribution of recycled sediments (EM). Sample S2326/35, which is composed of a melt almost completely depleted in EM material, corresponds to the volcanic rocks of the Marion and Prince Edward islands. The obtained and available data on the SWIR segment from Bouvet Island to Andrew Bain Fault are indicative of small mantle heterogeneities in this region. Two possible variants of their origin are considered: either preservation of the enriched material fragments in the depleted mantle during the split of Gondwana or "contamination" of the mantle with plume material with the formation of vein irregularities before opening of the ocean in this region. In the latter case, the plume material could cover a huge area not constrained by the young plume magmatism regions on Bouvet, Marion, and Prince Edward islands.

  9. Ecological evaluation of proposed dredged material from St. Andrew Bay, Florida

    Energy Technology Data Exchange (ETDEWEB)

    Mayhew, H.L.; Word, J.Q.; Kohn, N.P.; Pinza, M.R.; Karle, L.M.; Ward, J.A. [Battelle/Marine Sciences Lab., Sequim, WA (United States)

    1993-10-01

    The US Army Corps of Engineers (USACE), Mobile District, requested that the Battelle/Marine Sciences Laboratory (MSL) conduct field sampling and chemical and biological testing to determine the suitability of potential dredged material for open ocean disposal. Sediment from St. Andrew Bay was chemically characterized and evaluated for biological toxicity and bioaccumulation of contaminants. The Tier III guidance for ocean disposal testing requires tests of water column effects (following dredged material disposal), deposited sediment toxicity, and bioaccumulation of contaminants from deposited sediment (dredged material). To meet these requirements, the MSL conducted suspended-particulate-phase (SPP) toxicity tests, solid-phase toxicity tests, and bioaccumulation testing on sediment representing potential dredged material from Panama City Harbor. Physical and chemical characterization of sediment to support toxicity and bioaccumulation results was also conducted on both the test and reference sediments. The MSL collected sediment samples from five sites in St. Andrew Bay and one reference site near Lands End Peninsula. The five test sediments and the reference sediment were analyzed for physical and chemical sediment characteristics, SPP chemical contaminants, solid-phase toxicity, SPP toxicity, and bioaccumulation of contaminants.

  10. Discriminative validity of the MacAndrew Alcoholism Scale with Cluster B personality disorders.

    Science.gov (United States)

    Smith, S R; Hilsenroth, M J

    2001-06-01

    This study was designed to assess the ability of the Minnesota Multiphasic Personality Inventory (MMPI-2) MacAndrew Alcoholism Scale (MAC-R) to differentiate between outpatients with personality disorders with Substance-Related Disorders (SRDs) and without SRDs. MMPI-2 validity, clinical, and MAC-R scale scores were compared in an SRD Cluster B group (comprised of Narcissistic, Antisocial, Borderline, and Histrionic; n = 15), a non-SRD Cluster B group (n = 33), and a non-SRD group with personality disorders from Clusters A and C (n = 18). Results revealed that the substance-abusing Cluster B group scored significantly higher on the MAC-R ( p Personality Disorder (r =.60, p Personality Disorders were most related to MAC-R scores (R =.78, R(2) =.60). This indicates that the MAC-R may be more related to the presence of an SRD than has been suggested, and when used in outpatient settings as MacAndrew (1965) intended, the MAC-R may be useful as a screening device for assessing SRD among outpatients with Axis II psychopathology.

  11. 33 CFR 334.680 - Gulf of Mexico, southeast of St. Andrew Bay East Entrance, small-arms firing range, Tyndall Air...

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 3 2010-07-01 2010-07-01 false Gulf of Mexico, southeast of St... AND RESTRICTED AREA REGULATIONS § 334.680 Gulf of Mexico, southeast of St. Andrew Bay East Entrance... the Gulf of Mexico, southeast of St. Andrew Bay East Entrance within a rectangular area beginning at a...

  12. 33 CFR 334.770 - Gulf of Mexico and St. Andrew Sound, south of East Bay, Fla., Tyndall Drone Launch Corridor...

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 3 2010-07-01 2010-07-01 false Gulf of Mexico and St. Andrew... ARMY, DEPARTMENT OF DEFENSE DANGER ZONE AND RESTRICTED AREA REGULATIONS § 334.770 Gulf of Mexico and St....; restricted area. (a) The area. The waters of the Gulf of Mexico and St. Andrew Sound within an area described...

  13. Protocols for Biotechnological Interventions in Improvement of Vanilla (Vanilla planifolia Andrews.).

    Science.gov (United States)

    Divakaran, Minoo; Babu, K Nirmal; Peter, K V

    2016-01-01

    Vanilla (Vanilla planifolia Andrews (syn. V. fragrans Salisb.), a native of Central America, is the primary source of natural vanillin and plays a major role in the global economy. The gene pool of vanilla is threatened by deforestation and overcollection that has resulted in disappearance of natural habitats and wild species. Continuous vegetative propagation and lack of natural seed set and sufficient variations in the gene pool hamper crop improvement programs. In vitro techniques, one of the key tools of plant biotechnology, can be employed for overcoming specific problems, viz. production of disease-free clones, inducing somaclonal variations, developing hybrids, gene pool conservation, incorporating desired traits by distant hybridization, genetic engineering, etc. However, realization of these objectives necessitates standardization of protocols. This chapter describes the various protocols optimized for crop improvement in Vanilla species.

  14. A conversation with Andrew Benson: reflections on the discovery of the Calvin-Benson cycle.

    Science.gov (United States)

    Benson, Andrew

    2013-03-01

    On June 26-27, 2012, one of us (BBB) made a video based on an interview conducted with Andrew A. Benson, Professor Emeritus, Scripps Institution of Oceanography, University of California, San Diego, CA, USA. The video was first shown in a seminar presented by BBB on July 27, 2012 at the Calvin Laboratory, University of California, Berkeley, to mark the departure of the Energy Biosciences Institute to a new building. Here we record the conversation taking place during the interview. The Brancraft Library on the Berkeley campus will house the video's transcript in its oral histories collection, and the video will be housed in its motion picture collection. The video and the transcript have also been posted on You Tube (http://youtu.be/GfQQJ2vR_xE).

  15. Prosthetic rehabilitation of severe Siebert′s Class III defect with modified Andrews bridge system

    Directory of Open Access Journals (Sweden)

    Manu Rathee

    2015-01-01

    Full Text Available Prosthetic dentistry involves the replacement of missing and contiguous tissues with artificial substitutes to restore and maintain the oral functions, appearance, and health of the patient. The treatment of edentulous areas with ridge defects poses a challenging task for the dentist. Management of such cases involves a wide range of treatment options comprising mainly of surgical interventions and non surgical techniques such as use of removable, fixed or fixed- removable partial dentures. But each treatment plan undertaken should be customized according to patient needs. A variety of factors such as quality and quantity of existing contiguous hard and soft tissues, systemic condition and economic status of the patient play an important role in treatment planning, clinical outcome and prognosis. This case report presents the restoration of a Seibert′s Class III ridge defect by an economical modification of Andrews Bridge in a 32 Year old patient.

  16. Symptoms of posttraumatic stress in children after Hurricane Andrew: a prospective study.

    Science.gov (United States)

    La Greca, A; Silverman, W K; Vernberg, E M; Prinstein, M J

    1996-08-01

    The authors examined symptoms of posttraumatic stress in 3rd-5th grade children during the school year after Hurricane Andrew. From a conceptual model of the effects of traumatic events, 442 children were evaluated 3, 7, and 10 months postdisaster with respect to (a) their exposure to traumatic events during and after the disaster, (b) their preexisting demographic characteristics, (c) the occurrence of major life stressors, (d) the availability of social support, and (e) the type of coping strategies used to cope with disaster-related distress. Although symptoms of posttraumatic stress disorder (PTSD) declined over time, a substantial level of symptomatology was observed up to 10 months after the disease. All 5 factors in the conceptual model were predictive of children's PTSD symptoms 7 and 10 months postdisaster. Findings are discussed in terms of the potential utility of the model for organizing thinking about factors that predict the emergence and persistence of PTSD symptoms in children.

  17. Comprehensive assessment of health needs 2 months after Hurricane Andrew--Dade County, Florida, 1992.

    Science.gov (United States)

    1993-06-11

    On August 24, 1992, Hurricane Andrew struck southern Florida. More than 28,000 houses, mobile homes, and apartment buildings were destroyed, and approximately 107,000 additional dwellings sustained major damage. An estimated 180,000 persons were left homeless; insured damages were estimated at $15.5 billion and total damages at more than $30 billion. During the recovery period, many private and public health-care facilities damaged or destroyed in the storm were not functional. During November 3-13, to help prioritize health needs and direct public health resources, the Dade County Public Health Unit of the Florida Department of Health and Rehabilitative Services conducted a survey to assess health needs and the availability of health-care services during the recovery phase with funds provided by the Federal Emergency Management Agency (FEMA). This report summarizes the results of the survey.

  18. Damage Survey of Hurricane Andrew and Its Relationship to the Eyewall.

    Science.gov (United States)

    Wakimoto, Roger M.; Black, Peter G.

    1994-02-01

    A damage map documenting Hurricane Andrew's destructive land fall over southern Florida is presented. Vectors that represent the direction of winds causing damage to trees and structures are shown along with an F-scale rating in order to assess the strength of the near-surface winds. It is hypothesized that increased surface roughness once the hurricane made landfall may have contributed to a surface wind enhancement resulting in the strongest winds ever estimated (F3) for a landfall hurricane. This intense damage occurred primarily during the "second" period of strong winds associated with the east side of the eyewall. For the first time, a well-defined circulation in the damage pattern by the second wind was documented. A superposition of radar data from Miami and Key West on top of the damage map provides the first detailed examination of the relationship between the eyewall and the surface flow field as estimated from the damage vectors.

  19. Children's predisaster functioning as a predictor of posttraumatic stress following Hurricane Andrew.

    Science.gov (United States)

    La Greca, A M; Silverman, W K; Wasserstein, S B

    1998-12-01

    This study examined (a) children's predisaster behavioral and academic functioning as a predictor of posttraumatic stress (PTS) following Hurricane Andrew and (b) whether children who were exposed to the disaster would display a worsening of prior functioning. Fifteen months before the disaster, 92 4th through 6th graders provided self-reports of anxiety; peers and teachers rated behavior problems (anxiety, inattention, and conduct) and academic skills. Measures were repeated 3 months postdisaster; children also reported PTS symptoms and hurricane-related experiences (i.e., exposure). PTS symptoms were again assessed 7 months postdisaster. At 3 months postdisaster, children's exposure to the disaster, as well as predisaster ratings of anxiety, inattention, and academic skills, predicted PTS symptoms. By 7 months, only exposure, African American ethnicity, and predisaster anxiety predicted PTS. Prior anxiety levels also worsened as a result of exposure to the disaster. The findings have implications for identifying and treating children at risk for stress reactions following a catastrophic disaster.

  20. Stability and change in stress, resources, and psychological distress following natural disaster: Findings from hurricane Andrew.

    Science.gov (United States)

    Norris, F H; Perilla, J L; Riad, J K; Kaniasty, K; Lavizzo, E A

    1999-01-01

    Abstract The stress, resource, and symptom levels of 241 residents of southern Dade County, Florida were assessed 6 and 30 months after Hurricane Andrew. Percentages meeting study criteria for depression and PTSD did not change over time. Whereas mean levels of intrusion and arousal decreased, depressive symptoms remained stable, and avoidance/numbing symptoms actually increased. Intrusion and arousal were associated more strongly with pre-disaster factors (gender, ethnicity) and within-disaster factors (injury, property loss) than with post-disaster factors (stress, resources), but the reverse was true for depression and avoidance. Changes over time in symptoms were largely explained by changes over time in stress and resources. The findings indicate that ongoing services are needed to supplement the crisis-oriented assistance typically offered to disaster victims.

  1. Tilting at wave beams: a new perspective on the St Andrew's Cross

    Science.gov (United States)

    Akylas, T. R.; Kataoka, T.; Ghaemsaidi, S. J.; Holzenberger, N.; Peacock, T.

    2017-11-01

    The generation of internal gravity waves by a vertically oscillating cylinder that is tilted to the horizontal in a stratified fluid of constant buoyancy frequency, is investigated theoretically and experimentally. This forcing arrangement leads to a variant of the classical St Andrew's Cross that has certain unique features: (i) radiation of wave beams is limited due to a lower cut-off frequency set by the cylinder tilt angle to the horizontal; (ii) the response is essentially three-dimensional, as end effects eventually come into play when the cut-off frequency is approached, however long a cylinder might be. These results follow from kinematic considerations and are also confirmed by laboratory experiments. The kinematic analysis, moreover, suggests a resonance phenomenon near the cut-off frequency, where viscous and nonlinear effects are likely to play an important part. This scenario is examined by an asymptotic model as well as experimentally. Supported in part by NSF Grant DMS-1512925.

  2. Memorial Camels and Design by Committee: St Andrews Black Saturday Memorials

    Directory of Open Access Journals (Sweden)

    SueAnne Ware

    2015-02-01

    Full Text Available This paper examines a work in progress, the St Andrews Bushfire Memorial, which commemorates victims of the 7 February 2009 bushfires in Victoria, Australia. The paper’s intent is threefold: to describe and reflect on a current and ongoing memorial design project; to frame this project within a larger series of design discourses; and to examine the processes by which this memorial, but also many other grassroots or ‘bottom-up’ memorials, come into being. By examining the design process, I aim to open up various memorialisation and consultation methods for review. More importantly, however, by framing this project in contemporary discussions regarding socially engaged design practices, I offer a critique of the dictator–democrat binaries mentioned above and offer another way forward.

  3. Physical symptoms of chronic fatigue syndrome are exacerbated by the stress of Hurricane Andrew.

    Science.gov (United States)

    Lutgendorf, S K; Antoni, M H; Ironson, G; Fletcher, M A; Penedo, F; Baum, A; Schneiderman, N; Klimas, N

    1995-01-01

    This study examined the effects of Hurricane Andrew on physical symptoms and functional impairments in a sample of chronic fatigue syndrome (CFS) patients residing in South Florida. In the months after Hurricane Andrew (September 15-December 31, 1992), 49 CFS patients were assessed for psychosocial and physical functioning with questionnaires, interviews, and physical examinations. This sample was made up of 25 CFS patients living in Dade county, a high impact area, and 24 patients in Broward and Palm Beach counties, areas less affected by the hurricane. Based on our model for stress-related effects on CFS, we tested the hypothesis that the patients who had the greatest exposure to this natural disaster would show the greatest exacerbation in CFS symptoms and related impairments in activities of daily living (illness burden). In support of this hypothesis, we found that the Dade county patients showed significant increases in physician-rated clinical relapses and exacerbations in frequency of several categories of self-reported CFS physical symptoms as compared to the Broward/Palm Beach county patients. Illness burden, as measured on the Sickness Impact Profile, also showed a significant increase in the Dade county patients. Although extent of disruption due to the storm was a significant factor in predicting relapse, the patient's posthurricane distress response was the single strongest predictor of the likelihood and severity of relapse and functional impairment. Additionally, optimism and social support were significantly associated with lower illness burden after the hurricane, above and beyond storm-related disruption and distress responses. These findings provide information on the impact of environmental stressors and psychosocial factors in the exacerbation of CFS symptoms.

  4. Posttraumatic stress symptoms, intrusive thoughts, loss, and immune function after Hurricane Andrew.

    Science.gov (United States)

    Ironson, G; Wynings, C; Schneiderman, N; Baum, A; Rodriguez, M; Greenwood, D; Benight, C; Antoni, M; LaPerriere, A; Huang, H S; Klimas, N; Fletcher, M A

    1997-01-01

    To examine the impact of and relationship between exposure to Hurricane Andrew, a severe stressor, posttraumatic stress symptoms and immune measures. Blood draws and questionnaires were taken from community volunteer subjects living in the damaged neighborhoods between 1 and 4 months after the Hurricane. The sample exhibited high levels of posttraumatic stress symptoms by questionnaire (33% overall; 76% with at least one symptom cluster), and 44% scored in the high impact range on the Impact of Events (IES) scale. A substantial proportion of variance in posttraumatic stress symptoms could be accounted for by four hurricane experience variables (damage, loss, life threat, and injury), with perceived loss being the highest correlate. Of the five immune measures studied Natural Killer Cell Cytotoxicity (NKCC) was the only measure that was meaningfully related (negatively) to both damage and psychological variables (loss, intrusive thoughts, and posttraumatic stress disorder (PTSD). White blood cell counts (WBCs) were significantly positively related with the degree of loss and PTSD experienced. Both NKCC (lower) and WBC were significantly related to retrospective self-reported increase of somatic symptoms after the hurricane. Overall, the community sample was significantly lower in NKCC, CD4 and CD8 number, and higher in NK cell number compared to laboratory controls. Finally, evidence was found for new onset of sleep problems as a mediator of the posttraumatic symptom-NKCC relationship. Several immune measures differed from controls after Hurricane Andrew. Negative (intrusive) thoughts and PTSD were related to lower NKCC. Loss was a key correlate of both posttraumatic symptoms and immune (NKCC, WBC) measures.

  5. Hurricane Andrew Damage in Relation to Wood Decay Fungi and Insects in Bottomland Hardwoods of the Atchafalaya Basin, Louisiana

    Science.gov (United States)

    Theodor D. Leininger; A. Dan Wilson; Donald G. Lester

    1997-01-01

    Hurricane Andrew caused damage to more than 780 sq.km of bottomland hardwood and cypress-tupelo forests in the Atchafalaya Basin of Louisiana in August 1992. Trees in bottomland hardwood sites were examined, in early May 1994, for signs and symptoms of wood decay fungi, and for insect damage, ostensibly present before the hurricane, which may have predisposed trees to...

  6. The Psychological Effects of Hurricane Andrew on Ethnic Minority and Caucasian Children and Adolescents: A Case Study.

    Science.gov (United States)

    Jones, Russell T.; Frary, Robert; Cunningham, Phillippe; Weddle, J. David; Kaiser, Lisa

    2001-01-01

    Several measures of children's reactions to disasters were employed with 212 elementary and middle school students 6 months after experiencing Hurricane Andrew. Higher levels of intrusive symptomatology were found for girls and for elementary school children. Discusses lack of findings concerning race and implications for future research.…

  7. The role of the U.S. Army Medical Department in domestic disaster assistance operations - lessons learned from hurricane Andrew.

    Science.gov (United States)

    1996-04-01

    Hurricane Andrew, which struck South Dade County, Florida on the morning of 24 August 1992, was the "worst natural disaster ever to hit the United States..." The capabilities of the local and state governments to respond to the disaster were quickly ...

  8. Should Community College Be Free? Forum. "Education Next" Talks with Sara Goldrick-Rab and Andrew P. Kelly

    Science.gov (United States)

    Goldrick-Rab, Sara; Kelly, Andrew P.

    2016-01-01

    In this article, "Education Next" talks with Sara Goldrick-Rab and Andrew Kelly. President Obama's proposal for tuition-free community college, seems to have laid down a marker for the Democratic Party. Vermont senator Bernie Sanders is touting his plan for free four-year public college on the primary trail; Massachusetts senator…

  9. Invertebrates of The H.J. Andrews Experimental Forest, Western Cascades, Oregon: III. The Orthoptera (Grasshoppers and Crickets).

    Science.gov (United States)

    David C. Lightfoot

    1986-01-01

    An inventory of Orthoptera (grasshoppers and crickets) at the H.J. Andrews Experimental Forest, near Blue River, Oregon, was conducted to determine the species present and ecological relationships. A key for identification and an annotated list are presented. From qualitative assessments of successional habitat relationships, generalized species associations of forest...

  10. Invertebrates of The H.J. Andrews Experimental Forest, Western Cascade Mountains, Oregon: IV. The Oribatid Mites (Acari: Cryptostigmata).

    Science.gov (United States)

    Andrew Moldenke; Becky. Fichter

    1988-01-01

    A fully illustrated key is presented for identifying genera of oribatid mites known from or suspected of occurring in the Pacific Northwest. The manual includes an introduction detailing sampling methodology; an illustrated glossary of all terminology used; two color plates of all taxa from the H. J. Andrews Experimental Forest; a diagrammatic key to the 16 major...

  11. Invertebrates of The H.J. Andrews Experimental Forest, Western Cascades, Oregon: I. An annotated checklist of fleas.

    Science.gov (United States)

    Robert E. Lewis; Chris. Maser

    1981-01-01

    During a trapping survey of small mammals (approximately 3,000 individuals), species of fleas (1,632 specimens) were collected in the H.J. Andrews Experimental Forest, Western Cascades, Oregon. Host mammals were represented by 15 species—6 insectivores and 9 rodents captured from June through September. The collections extend our knowledge of the fauna of Oregon.

  12. Invertebrates of the H.J. Andrews Experimental Forest, western Cascades, Oregon II. an annotated checklist of caddisflies (Trichoptera)

    Science.gov (United States)

    N.H. Anderson; G.M. Cooper; D.G Denning

    1982-01-01

    At least 99 species, representing 14 families of Trichoptera, are recorded from the H.J. Andrews Experimental Forest, near Blue River, Oregon. The collecting sites include a wide diversity of environmental conditions in a 6000-hectare watershed of the western Cascade Range (from 400 to 1 630 meters in altitude and from 1st- to 7th-order streams).

  13. 77 FR 15600 - Special Local Regulation; Emerald Coast Super Boat Grand Prix; Saint Andrew Bay; Panama City, FL

    Science.gov (United States)

    2012-03-16

    ...-AA08 Special Local Regulation; Emerald Coast Super Boat Grand Prix; Saint Andrew Bay; Panama City, FL... navigable waters during the Emerald Coast Super Boat Grand Prix high speed boat races. Entry into... needed to safeguard persons and vessels from safety hazards associated with the Emerald Coast Super Boat...

  14. Religious Literacy or Spiritual Awareness? Comparative Critique of Andrew Wright's and David Hay's Approaches to Spiritual Education

    Science.gov (United States)

    Filipsone, Anta

    2009-01-01

    On the basis of a comparison of the educational approaches of Andrew Wright and David Hay this paper illustrates the persisting problem of dichotomising cognitive and trans-cognitive aspects of spiritual development and education. Even though both Wright and Hay speak of the same topic--spirituality and spiritual education--they define these terms…

  15. Climatic summaries and documentation for the primary meteorological station, H.J. Andrews Experimental Forest, 1972 To 1984.

    Science.gov (United States)

    Frederick A. Bierlmaler; Arthur. McKee

    1989-01-01

    This report describes the primary meteorological station at the H.J. Andrews Experimental Forest (elev. 426 m, lat. 44°15' N., long. 122°10' W.) in the Willamette National Forest, the automatic digital data logger, sensors, and data-processing procedures used in measuring air temperature, dewpoint temperature, windspeed, precipitation, and solar radiation....

  16. Book received: Alois Riegl, The Origins of Baroque Art in Rome, edited and translated by Andrew Hopkins and Arnold Witte, with essays by Alina Payne, Arnold Witte, and Andrew Hopkins; Los Angeles: Getty Research Institute including contents, acknowledgments and a note on the translation.

    Directory of Open Access Journals (Sweden)

    Alois Riegl

    2010-12-01

    Full Text Available Alois Riegl, The Origins of Baroque Art in Rome, edited and translated by Andrew Hopkins and Arnold Witte, with essays by Alina Payne, Arnold Witte, and Andrew Hopkins; Los Angeles: Getty Research Institute including contents, acknowledgments and a note on the translation.

  17. Occurrence of Cucumber mosaic virus on vanilla (Vanilla planifolia Andrews) in India.

    Science.gov (United States)

    Madhubala, R; Bhadramurthy, V; Bhat, A I; Hareesh, P S; Retheesh, S T; Bhai, R S

    2005-06-01

    Cucumber mosaic virus (CMV) causing mosaic, leaf distortion and stunting of vanilla (Vanilla planifolia Andrews) in India was characterized on the basis of biological and coat protein (CP) nucleotide sequence properties. In mechanical inoculation tests, the virus was found to infect members of Chenopodiaceae, Cucurbitaceae, Fabaceae and Solanaceae. Nicotiana benthamiana was found to be a suitable host for the propagation of CMV. The virus was purified from inoculated N. benthamiana plants and negatively stained purified preparations contained isometric particles of about 28 nm in diameter. The molecular weight of the viral coat protein subunits was found to be 25.0 kDa. Polyclonal antiserum was produced in New Zealand white rabbit, immunoglobulin G (IgG) was purified and conjugated with alkaline phosphatase enzyme. Double antibody sandwich-enzyme linked immunosorbent assay (DAS-ELISA) method was standardized for the detection of CMV infection in vanilla plants. CP gene of the virus was amplified using reverse transcriptase-polymerase chain reaction (RT-PCR), cloned and sequenced. Sequenced region contained a single open reading frame of 657 nucleotides potentially coding for 218 amino acids. Sequence analyses with other CMV isolates revealed the greatest identity with black pepper isolate of CMV (99%) and the phylogram clearly showed that CMV infecting vanilla belongs to subgroup IB. This is the first report of occurrence of CMV on V. planifolia from India.

  18. Wind damage effects of Hurricane Andrew on mangrove communities along the southwest coast of Florida, USA

    Science.gov (United States)

    Doyle, T.W.; Smith, T. J.; Robblee, M.B.

    1995-01-01

    On August 24, 1992, Hurricane Andrew downed and defoliated an extensive swath of mangrove trees across the lower Florida peninsula. Permanent field sites were established to assess the extent of forest damage and to monitor the rate and process of forest recovery. Canopy trees suffered the highest mortality particularly for sites within and immediately north of the storm's eyewall. The type and extent of site damage, windthrow, branch loss, and defoliation generally decreased exponentially with increasing distance from the storm track. Forest damage was greater for sites in the storm's right quadrant than in the left quadrant tor the same given distance from the storm center. Stand exposure, both horizontally and vertically, increased the susceptibility and probability of forest damage and accounted for much of the local variability. Slight species differences were found. Laguncularia racemosa exceeded Avicennia germinans and Rhizophora mangle in damage tendency under similar wind conditions. Azimuths of downed trees were strongly correlated with maximum wind speed and vector based on a hurricane simulation of the storm. Lateral branch loss and leaf defoliation on sites without windthrow damage indicated a degree of crown thinning and light penetration equivalent to treefall gaps under normally intact forest conditions. Mangrove species and forests are susceptible to catastrophic disturbance by hurricanes; the impacts of which are significant to changes in forest structure and function.

  19. William Horner Andrews (1887–1953 – First Professor of Physiology at Onderstepoort

    Directory of Open Access Journals (Sweden)

    D. W. Verwoerd

    2011-04-01

    Full Text Available WHAndrews qualified as a veterinarian in London in 1908 and was recruited soon after, in 1909, by Sir Arnold Theiler to join the staff of the newly established veterinary laboratory at Onderstepoort. After initial studies on the treatment of trypanosomosis and on snake venoms he was deployed by Theiler in 1911 to start research on lamsiekte (botulismat a field station on the farm Kaffraria near Christiana, where he met and married his wife Doris. After a stint as Captain in the SA Veterinary Corps during World War I he succeeded D T Mitchell as head of the Allerton Laboratory in 1918, where he excelled in research on toxic plants, inter alia identifying Matricaria nigellaefolia as the cause of staggers in cattle.Whenthe Faculty ofVeterinary Science was established in 1920 he was appointed as the first Professor of Physiology. After the graduation of the first class in 1924, and due to health problems, he returned to the UK, first to the Royal Veterinary College and then to the Weybridge Veterinary Laboratories of which he became Director in 1927.After his retirement in 1947 he returned to South Africa as a guest worker at Onderstepoort where he again became involved in teaching physiologywhenProf. Quin unexpectedly died in 1950. Andrews died in Pretoria in 1953 and was buried in the Rebecca Street Cemetery.

  20. Analysis of medical treatment at a field hospital following Hurricane Andrew, 1992.

    Science.gov (United States)

    Alson, R; Alexander, D; Leonard, R B; Stringer, L W

    1993-11-01

    To determine what medical care was required of a special operations response team by a community devastated by a major hurricane. Retrospective analysis of 1,544 patient encounter forms generated at a field hospital set up in Homestead, Florida, after Hurricane Andrew in August 1992 and staffed by the special operations response team from Forsyth County, North Carolina. All persons presenting for treatment. One thousand two hundred three adult patients and 336 pediatric patients were seen by the special operations response team. Only five of the injuries treated were due directly to the hurricane, whereas 285 of the treated injuries were sustained during clean-up activities. Most of the care provided was routine medical care denied the citizens due to the loss of their physicians' offices and clinics. Supplies of tetanus toxoid, antibiotics, and insulin were depleted in 24 hours. Resupplying these items and acquiring other medication to refill prescriptions constituted a pressing problem. The primary function of medical personnel responding to an area hit by a major hurricane will be to provide general medical care. Any trauma encountered will be primarily due to clean-up activities and not due to the hurricane itself. Responding medical personnel should plan on providing their own food and water for the first 72 hours and be well stocked with antibiotics, tetanus toxoid, and insulin.

  1. The generation of internal waves on the continental shelf by Hurricane Andrew

    Science.gov (United States)

    Keen, Timothy R.; Allen, Susan E.

    2000-11-01

    Observed currents, temperature, and salinity from moored instruments on the Louisiana continental slope and shelf reveal multiple baroclinic oscillations during Hurricane Andrew in August 1992. These measurements are supplemented by numerical models in order to identify possible internal wave generation mechanisms. The Princeton Ocean Model is run with realistic topography, stratification, and wind forcing to extend the observations to Mississippi Canyon and other areas on the shelf. A two-layer isopycnal model is used with idealized topography and spatially uniform winds to isolate internal waves generated in and around the canyon. The combination of the observations and the results from the numerical models indicates several possible mechanisms for generating long internal waves: (1) near-inertial internal waves were generated across the slope and shelf by dislocation of the thermocline by the wind stress; (2) interaction of inertial flow with topography generated internal waves along the shelf break, which bifurcated into landward and seaward propagating phases; (3) downwelling along the coast depressed the thermocline; after downwelling relaxes, an internal wave front propagates as a Kelvin wave; and (4) Poincaré waves generated within Mississippi Canyon propagate seaward while being advected westward over the continental slope. These processes interact to produce a three-dimensional internal wave field, which was only partly captured by the observations.

  2. Weathering the storm: children's long-term recall of Hurricane Andrew.

    Science.gov (United States)

    Fivush, Robyn; Sales, Jessica McDermott; Goldberg, Amy; Bahrick, Lorraine; Parker, Janat

    2004-01-01

    Children who experienced a highly stressful natural disaster, Hurricane Andrew, were interviewed within a few months of the event, when they were 3-4 years old, and again 6 years later, when they were 9-10 years old. Children were grouped into low, moderate, or high stress groups depending on the severity of the experienced storm. All children were able to recall this event in vivid detail 6 years later. In fact, children reported over twice as many propositions at the second interview as at the first. At the initial interview, children in the high stress group reported less information than children in the moderate stress group, but 6 years later, children in all three stress groups reported similar amounts of information. However children in the high stress group needed more questions and prompts than children in the other stress groups. Yet children in the high stress group also reported more consistent information between the two interviews, especially about the storm, than children in the other stress groups. Implications for children's developing memory of stressful events are discussed.

  3. Storm-tide elevations produced by Hurricane Andrew along the southern Florida coasts, August 24, 1992

    Science.gov (United States)

    Murray, Mitchell H.

    1994-01-01

    On August 24, 1992, Hurricane Andrew crossed southern peninsular Florida. The combined effects of storm surge from the hurricane and astronomical tide, referred to as storm tide, caused flooding over a large part of southern Florida. Subsequent to the flooding, many high-water marks were identified, described, and surveyed along the south- eastern coast of Florida (Miami to Key Largo) and at selected areas along the southwestern coast of Florida (Flamingo to Goodland). Descriptions of these 336 high-water makrs are presented in tabular form in this report and their locations are plotted on nineteen 7.5-minute topographic quadrangle maps. For the southeastern coast, north-south profiles of the high-water makrs along the outher and inner barrier islands and the western shoreline of Biscayne Bay are presented. Average storm-tide elevations (relative to sea level) ranged from 4 to 6 feet in northern Biscayne Bay, were as much as 17 feet on the western shoreline near the center of the bay and ranged from 3 to 6 feet in southern Biscayne Bay and Barnes Sound. Storm-tide elevations along the southwestern coast ranged from 4 to 5 feet at Flamingo and 5 to 7 feet at Goodland in the Ten Thousand Islands area.

  4. Use of a modified cluster sampling method to perform rapid needs assessment after Hurricane Andrew.

    Science.gov (United States)

    Hlady, W G; Quenemoen, L E; Armenia-Cope, R R; Hurt, K J; Malilay, J; Noji, E K; Wurm, G

    1994-04-01

    To rapidly obtain population-based estimates of needs in the early aftermath of Hurricane Andrew in South Florida. We used a modified cluster-sampling method (the Expanded Programme on Immunization [EPI] method) for three surveys. We selected a systematic sample of 30 quarter-mile square clusters for each survey and, beginning from a random start, interviewed members of seven consecutive occupied households in each cluster. Two surveys were of the most affected area (1990 population, 32,672) at three and ten days after the hurricane struck; one survey was of a less affected area (1990 population, 15,576) seven days after the hurricane struck. Results were available within 24 hours of beginning each survey. Initial findings emphasized the need for restoring utilities and sanitation and helped to focus medical relief on primary care and preventive services. The second survey of the most affected area showed improvement in the availability of food, water, electricity, and sanitation (P < or = .05). There was no evidence of disease outbreaks. For the first time, the EPI method provided population-based information to guide and evaluate relief operations after a sudden-impact natural disaster. An improvement over previous approaches, the EPI method warrants further evaluation as a needs assessment tool in acute disasters.

  5. Business closure and relocation: a comparative analysis of the Loma Prieta earthquake and Hurricane Andrew.

    Science.gov (United States)

    Wasileski, Gabriela; Rodríguez, Havidán; Diaz, Walter

    2011-01-01

    The occurrence of a number of large-scale disasters or catastrophes in recent years, including the Indian Ocean tsunami (2004), the Kashmir earthquake (2005), Hurricane Katrina (2005) and Hurricane Ike (2008), have raised our awareness regarding the devastating effects of disasters on human populations and the importance of developing mitigation and preparedness strategies to limit the consequences of such events. However, there is still a dearth of social science research focusing on the socio-economic impact of disasters on businesses in the United States. This paper contributes to this research literature by focusing on the impact of disasters on business closure and relocation through the use of multivariate logistic regression models, specifically focusing on the Loma Prieta earthquake (1989) and Hurricane Andrew (1992). Using a multivariate model, we examine how physical damage to the infrastructure, lifeline disruption and business characteristics, among others, impact business closure and relocation following major disasters. © 2011 The Author(s). Disasters © Overseas Development Institute, 2011.

  6. Long-term effects of Hurricane Andrew: revisiting mental health indicators.

    Science.gov (United States)

    McDonnell, S; Troiano, R P; Barker, N; Noji, E; Hlady, W G; Hopkins, R

    1995-09-01

    Two population-based surveys of South Dade County, Florida, were conducted after Hurricane Andrew to compare hurricane-related symptoms of mental distress and describe the impact of mental health outreach teams. Households were selected by three-stage cluster sampling and findings from the two surveys, 13 months apart, were compared. Response rates were 75 per cent and 84 per cent. The prevalence of symptoms of mental distress decreased over time. However, in the households contacted by the teams (25 per cent of sample), the prevalence of symptoms (50 per cent) did not differ from households not contacted (43 per cent). Households contacted by teams that reported symptoms were just as likely to have been referred for help by the teams (72 per cent) as those without symptoms (68 per cent). Households reporting symptoms were equally likely to get counselling regardless of whether the teams visited. Mental health teams had no significant impact on mental health symptoms or the use of mental health services. Alternative approaches to mental health outreach teams need to be explored.

  7. The post-disaster negative health legacy: pregnancy outcomes in Louisiana after Hurricane Andrew.

    Science.gov (United States)

    Antipova, Anzhelika; Curtis, Andrew

    2015-10-01

    Disasters and displacement increasingly affect and challenge urban settings. How do pregnant women fare in the aftermath of a major disaster? This paper investigates the effect of pregnancies in disaster situations. The study tests a hypothesis that pregnant women residing in hurricane-prone areas suffer higher health risks. The setting is Louisiana in the Gulf Coast, United States, a state that continually experiences hurricane impacts. The time period for the analysis is three years following the landfall of Hurricane Andrew in 1992. We analysed low birth weight and preterm deliveries before and after landfall, as a whole and by race. Findings support an association between hazards and health of a community and indicate that pregnant women in the affected area, irrespective of race, are more likely to experience preterm deliveries compared to pre-event births. Results suggest there is a negative health legacy impact in Louisiana as a result of hurricane landfall. © 2015 The Author(s). Disasters © Overseas Development Institute, 2015.

  8. Predicting the Path to Recovery from Hurricane Katrina through the Lens of Hurricane Andrew and the Rodney King Riots

    OpenAIRE

    Robert Baade; Robert Baumann; Victor Matheson

    2005-01-01

    Hurricane Katrina caused the greatest damage of any hurricane in American history. We look at the rebuilding effort in New Orleans through the lens of two other disasters that occurred in 1992: Hurricane Andrew in Miami and the Rodney King riots in Los Angeles. The rebuilding effort in New Orleans shares similarities with both events, combining the impact of a hurricane on infrastructure and private businesses, and the prospect of an uneven recovery biased against racial minorities and the ec...

  9. Commentary on "The Perception and Cognition of Time in Balinese Music" by Andrew Clay McGraw

    OpenAIRE

    Ian Cross; Satinder Gill; Sarah Knight; Chris Nash; Tal-Chen Rabinowitch; Lydia Slobodian; Neta Spiro; Ghofur Woodruff; Matthew Woolhouse

    2008-01-01

    We review the paper by Andrew Clay McGraw, noting that it represents an interesting and valuable contribution to the study of music in cognition in its informed exploration of non-western musical perceptions. We raise a number of concerns about the methods used, and make suggestions as to how the issues that were empirically addressed in the paper might have been tackled in ways that would have enhanced the interpretability of its findings.

  10. Final Environmental Assessment for FY07-11 BRAC Construction Requirements at Andrews Air Force Base, Maryland

    Science.gov (United States)

    2007-09-01

    Branch Library of the Prince George’s County Memorial Library System at 14730 Main St. Upper Marlboro, MD 20772 and at the Andrews AFB Library at 1642...latifolia), highbush blueberry (Vaccinium corymbosum), and Christmas fern (Polystichium acrostichoides) (USAF 2001). Approximately 720 acres of...parks; national parks that exceeded 6,000 acres; and national wilderness areas and memorial parks that exceeded 5,000 acres if these areas were in

  11. National Status and Trends: Bioeffects Program - Magnitude and Extent of Sediment Toxicity in Four Bays of the Florida Panhandle: Pensacola, Choctawhatchee, St. Andrew and Apalachicola

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The toxicity of sediments in Pensacola, Choctawhatchee, St. Andrew and Apalachicola Bays was determined as part of bioeffects assessments performed by NOAA's...

  12. Cinema and the Great War - Andrew Kelly, 1997. History by Hollywood. The use and abuse of the American past - Robert Brant Toplin, 1996

    NARCIS (Netherlands)

    Kester, Bernadette

    1998-01-01

    textabstractReview of: Cinema and the Great War. Andrew Kelly, Londen, New York (Routledge), 1997, 219 p.History by Hollywood. The use and abuse of the American past. Robert Brant Toplin, Chicago (Urbana), 1996, 267 p.

  13. Twenty-one-month follow-up study of school-age children exposed to Hurricane Andrew.

    Science.gov (United States)

    Shaw, J A; Applegate, B; Schorr, C

    1996-03-01

    To explore the 21-month course of posttraumatic stress symptomatology (PTSS) and psychological morbidity in 30 school-age children (7 to 13 years) after exposure to Hurricane Andrew. Pynoos' Posttraumatic Stress Disorder Reaction Index and Achenbach's Teacher's Report Form were administered at 8 and 21 months after Hurricane Andrew. At 21 months 70% of the children endorsed moderate-severe PTSS. The reduction in PTSS was greater for boys than girls. Psychopathology as measured by the Teacher's Report Form increased over the 19-month period. Boys demonstrated significant increases in internalizing symptoms and in Withdrawn, Anxious/Depressed, Social Problems, and Attention Problems scales, and girls showed a significant increase in the Anxious/Depressed scale. Twenty-one months after exposure to Hurricane Andrew, there were continuing high levels of PTSS and evidence of increasing emotional and behavioral problems. While girls sustained higher levels of PTSS, boys demonstrated higher indices of other psychopathology. The enduring effects of disaster associated with secondary stressors and "traumatic reminders" continue to be etiologically important for continuing psychological morbidity.

  14. Perpetuating the Technological Ideology: An Ellulian Critique of Feenberg's Democratized Rationalization

    Science.gov (United States)

    Garrison, Kevin

    2010-01-01

    Andrew Feenberg, in his book "Questioning Technology", offers his theory of "democratized rationalization" as a critical alternative to Jacques Ellul's essentialist perspective. Feenberg argues that Ellul has confused the tendency toward efficiency in technological discourse with the essence of technology, thereby disallowing for a "positive…

  15. Damage to unburied flowlines in the Gulf of Mexico during Hurricane Andrew

    Energy Technology Data Exchange (ETDEWEB)

    Collins, J.I.

    1995-12-31

    The US Minerals Management Service reported that 454 sub-sea pipelines were damaged during Hurricane Andrew. Previously, damage to pipelines and flowlines has been reported in a series of papers by Blumberg (1964). In the present paper a formulation of the hydrodynamic loads acting on a flowline which is lying on the seafloor in the presence of waves and currents is summarized. In general, the line dynamics can be represented by a fourth order differential equation with nonlinear forcing but a method is presented which assumes that the complete response can be broken down into distinct phases from ``early motion`` to ``taut line`` to ``yield and breaking``. The selection of appropriate force coefficients and boundary layer interactions is discussed. The initial stages of pipeline migration across the seafloor is shown to be followed by loading of the flowline once all of the ``slack`` is taken up. The loads are shown to be a function of the current orientation and the maximum tension is approximately proportional to the square of the distance between risers. Comparisons of predicted and observed damages confirm that ``effective`` boundary layer thicknesses at the seafloor and typical drag and lift coefficients which were selected based on available literature are consistent with observed flowline damage. The results of sidescan sonar mosaics of pipeline migrations and reported damage are consistent with the loads predicted by relatively simple hydrodynamic/structural models. The material presented in this paper permits the evaluation of the risk of damage to unburied flowlines using relatively simple tools. Guidelines to the assumptions of force coefficients and flowline responses are provided. 20 refs., 11 figs., 2 tabs.

  16. Low-Frequency Response Following the Passage of Hurricane Andrew on the Texas-Louisiana Shelf

    Science.gov (United States)

    Pearce, S. M.; Smith, D. C.; Dimarco, S. F.

    2009-12-01

    During August 24th through 27th in 1992, Hurricane Andrew passed through the Gulf Of Mexico almost directly over several moorings on the easternmost Louisiana shelf portion of the Texas-Louisiana Shelf (LATEX) coastal ocean monitoring program. Examination of the current meter time-series showed the existence of fast moving, long shelf waves over the entire Texas-Louisiana shelf west of the storm passage for up to 12 days after direct forcing ceased. The LATEX program featured 31 moorings each with 3 current meters over the 10, 20, 50, and 200 meter isobaths in 5 cross sectional lines with additional coverage on the 200 meter isobath from the Louisiana-Mississippi River delta, to Corpus Christi, Texas. Additionally, several pressure records from LATEX and several NOAA historical coastal tide gauge data from Sabine Pass to Port Isabella, Texas were incorporated. Raw, 3-hour low pass filtered, and 40-hour low pass filtered versions of the current data were analyzed. The pressure data used were detided using a least squares fit, and the tidal records were detided using the NOAA predicted tides for that location. All data were analyzed using a wavelet analysis to determine the spectra over time. The analyzed data shows that the shelf response was largely dominated in the internal Kelvin wave mode. The wave propagated towards the west on the shelf at approximately 400 km/day. These results are contrasted and compared with wave modes predicted for coastal trapped wave solutions. The output of a coastal ocean model simulation using a forced wind field similar to the storm are also contrasted and compared with the observed data.

  17. Tests of executive functioning predict scores on the MacAndrew Alcoholism Scale.

    Science.gov (United States)

    Deckel, A W

    1999-02-01

    1. Previous work reported that tests of executive functioning (EF) predict the risk of alcoholism in subject populations selected for a "high density" of a family history of alcoholism and/or the presence of sociopathic traits. The current experiment examined the ability of EF tests to predict the risk of alcoholism, as measured by the MacAndrew Alcoholism Scale (MAC), in outpatient subjects referred to a general neuropsychological testing service. 2. Sixty-eight male and female subjects referred for neuropsychological testing were assessed for their past drinking histories and administered the Wisconsin Card Sorting Test, the Wechsler Adult Intelligence Scale-Revised, the Trails (Part B) Test, and the MAC. Principal Components analysis (PCA) reduced the number of EF tests to two measures, including one that loaded on the WCST, and one that loaded on the Similarities, Picture Arrangement, and Trails tests. Multiple hierarchical regression first removed the variance from demographic variables, alcohol consumption, and verbal (i.e., Vocabulary) and non-verbal (i.e., Block Design) IQ, and then entered the executive functioning factors into the prediction of the MAC. 3. Seventy-six percent of the subjects were classified as either light, infrequent, or non-drinkers on the Quantity-Frequency-Variability scale. The factor derived from the WCST on PCA significantly added to the prediction of risk on the MAC (p = .0063), as did scores on Block Design (p = .033). Relatively more impaired scores on the WCST factor and Block Design were predictive of higher scores on the MAC. The other factors were not associated with MAC scores. 4. These results support the hypothesis that decrements in EF are associated with risk factors for alcoholism, even in populations where the density of alcoholic behaviors are not unusually high. When taken in conjunction with other findings, these results implicate EF test scores, and prefrontal brain functioning, in the neurobiology of the risk for

  18. Glass Cathedral: Gay Novel or Liberation Theology? An Interview with Andrew Koh

    Directory of Open Access Journals (Sweden)

    Angus Whitehead

    2013-05-01

    Full Text Available Singaporean Andrew Koh was a founding member of the groundbreaking Necessary Stage theatre company in 1987. In Singapore he is best remembered as the author of Glass Cathedral (1995, Singapore's second gay novel[la], which won the 1994 Singapore Literature Prize Commendation Award and was subsequently shortlisted for the 1996 Commonwealth Writers Prize for the Best First Novel Regional Awards. A collection of poetry, Hybrid from the East, was published in the UK in 1997. A second novel awaits publication. After initially leaving Singapore for London in the mid-1990s he now lives in Sydney as a healthcare worker and qualified Chinese medicine practitioner. Sixteen years after its initial publication, Glass Cathedral the novel is finally receiving attention and reappraisal in the wake of its Glass Cathedral's republication by Epigram Books as a Singapore Classic, alongside works such as Goh Poh Seng's The Immolation, Robert Yeo's The Adventures of Holden Heng and Lloyd Fernando's Scorpion Orchid. The interview took place on 8 November 2011 at a restaurant on the site of Koh's alma mater St Joseph's Institution, Bras Basah Road, Singapore, just days after Koh returned to the city-state and gave a spirited reading from and talk about Glass Cathedral at the Singapore Writers Festival. In this interview Koh discusses his Catholic upbringing, and his employment as a policeman during Singapore's policy of entrapment of homosexual men during the 1990s. Koh goes on to discuss how he came to write Glass Cathedral, his leaving Singapore in response to the nation-state's repressive climate and unsympathetic response to queer writing. In the second half of the interview Koh discusses homophobia in Singapore, the Catholic Church, and elsewhere and its roots in misogyny. Koh also draws attention to other issues explored in Glass Cathedral: the marginalisation of minorities in a supposedly multicultural nation state and the impact of Singapore's secret history

  19. Technology.

    Science.gov (United States)

    Online-Offline, 1998

    1998-01-01

    Focuses on technology, on advances in such areas as aeronautics, electronics, physics, the space sciences, as well as computers and the attendant progress in medicine, robotics, and artificial intelligence. Describes educational resources for elementary and middle school students, including Web sites, CD-ROMs and software, videotapes, books,…

  20. The effect of potassium and mycorrhiza on growth of vanilla (Vanilla planifolia Andrew

    Directory of Open Access Journals (Sweden)

    I GEDE TIRTA

    2006-04-01

    Full Text Available The few and shallow roots caused slow growth of vanilla seedling. Mycorrhiza may increased the absorption of water and nutrients, while potassium may increased the rate of growth and strength of seedlings. This study was conducted at Sambangan Village, Buleleng, Bali in 2003 (April-Agustus 2003. The experiment was done in polybag and was arranged in Randomized Block Design with three replications. The treatments were consisted of two factors. The first factor was the rates of KCl fertilizer ( 0, 100 and 200 kg ha-1 or 0, 0,10 and 0,20 9 plant-1 and the second factor was the rates of mycorrhiza (0, 20 and 30 g plant-1. The aim of the research to study interactions between potassium and mycorrhiza and The optimum dosage the mycorrhiza on growth of vanilla (Vanilla planifolia Andrew. The resultes showed that there were interactions between potassium and mycorrhiza on fresh weight of the new shoot, root length and fresh root weight. The optimum dosage of the mycorrhiza was 20 g plant-1 with new shoot fresh weight was 25.63 g plant-1. The longest root (24.67 cm plant-1 was observed at the treatment without potasium with 20 g plant-1 mycorrhiza and this was 23% longer than control (19.93 cm plant-1. The highest fresh root weight (2.48 g plant-1 was observed at the dosage of 200 kg KCl ha-1 and 20 g mycorrhiza plant-1 and that was 55% heavier than control (1.60 g plant-1. The leaf number of the plant with 20 g plant-1 mycorrhiza was 6.22 and that was 18% more than control with leaf number 5.25. The total fresh weight of the seedling with 20 g plant-1 mycorrhiza was 86.74 g plant-1or 15% higher compared with control (75.18 g plant-1. The dosage of 100 kg KCl ha-1 increased the K content of the plant (2.45%K or 35% higher than control (1.81%K.

  1. Effect of Hurricane Andrew on the Turkey Point Nuclear Generating Station from August 20--30, 1992. [Final report

    Energy Technology Data Exchange (ETDEWEB)

    Hebdon, F.J. [Institute of Nuclear Power Operations, Atlanta, GA (United States)

    1993-03-01

    On August 24, 1992, Hurricane Andrew, a Category 4 hurricane, struck the Turkey Point Electrical Generating Station with sustained winds of 145 mph (233 km/h). This is the report of the team that the US Nuclear Regulatory Commission (NRC) and the Institute of Nuclear Power Operations (INPO) jointly sponsored (1) to review the damage that the hurricane caused the nuclear units and the utility`s actions to prepare for the storm and recover from it, and (2) to compile lessons that might benefit other nuclear reactor facilities.

  2. Effect of Hurricane Andrew on the Turkey Point Nuclear Generating Station from August 20--30, 1992

    International Nuclear Information System (INIS)

    Hebdon, F.J.

    1993-03-01

    On August 24, 1992, Hurricane Andrew, a Category 4 hurricane, struck the Turkey Point Electrical Generating Station with sustained winds of 145 mph (233 km/h). This is the report of the team that the US Nuclear Regulatory Commission (NRC) and the Institute of Nuclear Power Operations (INPO) jointly sponsored (1) to review the damage that the hurricane caused the nuclear units and the utility's actions to prepare for the storm and recover from it, and (2) to compile lessons that might benefit other nuclear reactor facilities

  3. Technology

    Directory of Open Access Journals (Sweden)

    Xu Jing

    2016-01-01

    Full Text Available The traditional answer card reading method using OMR (Optical Mark Reader, most commonly, OMR special card special use, less versatile, high cost, aiming at the existing problems proposed a method based on pattern recognition of the answer card identification method. Using the method based on Line Segment Detector to detect the tilt of the image, the existence of tilt image rotation correction, and eventually achieve positioning and detection of answers to the answer sheet .Pattern recognition technology for automatic reading, high accuracy, detect faster

  4. The Andrews' Principles of Risk, Need, and Responsivity as Applied in Drug Abuse Treatment Programs: Meta-Analysis of Crime and Drug Use Outcomes.

    Science.gov (United States)

    Prendergast, Michael L; Pearson, Frank S; Podus, Deborah; Hamilton, Zachary K; Greenwell, Lisa

    2013-09-01

    The purpose of the present meta-analysis was to answer the question: Can the Andrews principles of risk, needs, and responsivity, originally developed for programs that treat offenders, be extended to programs that treat drug abusers? Drawing from a dataset that included 243 independent comparisons, we conducted random-effects meta-regression and ANOVA-analog meta-analyses to test the Andrews principles by averaging crime and drug use outcomes over a diverse set of programs for drug abuse problems. For crime outcomes, in the meta-regressions the point estimates for each of the principles were substantial, consistent with previous studies of the Andrews principles. There was also a substantial point estimate for programs exhibiting a greater number of the principles. However, almost all of the 95% confidence intervals included the zero point. For drug use outcomes, in the meta-regressions the point estimates for each of the principles was approximately zero; however, the point estimate for programs exhibiting a greater number of the principles was somewhat positive. All of the estimates for the drug use principles had confidence intervals that included the zero point. This study supports previous findings from primary research studies targeting the Andrews principles that those principles are effective in reducing crime outcomes, here in meta-analytic research focused on drug treatment programs. By contrast, programs that follow the principles appear to have very little effect on drug use outcomes. Primary research studies that experimentally test the Andrews principles in drug treatment programs are recommended.

  5. Resistance Is Futile: Toward a Non-Modern Democratization of Technology

    NARCIS (Netherlands)

    Verbeek, Peter P.C.C.

    2013-01-01

    Andrew Feenberg’s political philosophy of technology uniquely connects the neo-Marxist tradition with phenomenological approaches to technology. This paper investigates how this connection shapes Feenberg’s analysis of power. Influenced by De Certeau and by classical positions in philosophy of

  6. Mangroves, hurricanes, and lightning strikes: Assessment of Hurricane Andrew suggests an interaction across two differing scales of disturbance

    Science.gov (United States)

    Smith, Thomas J.; Robblee, Michael B.; Wanless, Harold R.; Doyle, Thomas W.

    1994-01-01

    The track of Hurricane Andrew carried it across one of the most extensive mangrove for ests in the New World. Although it is well known that hurricanes affect mangrove forests, surprisingly little quantitative information exists concerning hurricane impact on forest structure, succession, species composition, and dynamics of mangrove-dependent fauna or on rates of eco-system recovery (see Craighead and Gilbert 1962, Roth 1992, Smith 1992, Smith and Duke 1987, Stoddart 1969).After Hurricane Andrew's passage across south Florida, we assessed the environmental damage to the natural resources of the Everglades and Biscayne National Parks. Quantitative data collected during subsequent field trips (October 1992 to July 1993) are also provided. We present measurements of initial tree mortality by species and size class, estimates of delayed (or continuing) tree mortality, and observations of geomorphological changes along the coast and in the forests that could influence the course of forest recovery. We discuss a potential interaction across two differing scales of disturbance within mangrove forest systems: hurricanes and lightning strikes.

  7. Evaluation of long-term community recovery from Hurricane Andrew: sources of assistance received by population sub-groups.

    Science.gov (United States)

    McDonnell, S; Troiano, R P; Barker, N; Noji, E; Hlady, W G; Hopkins, R

    1995-12-01

    Two three-stage cluster surveys were conducted in South Dade County, Florida, 14 months apart, to assess recovery following Hurricane Andrew. Response rates were 75 per cent and 84 per cent. Sources of assistance used in recovery from Hurricane Andrew differed according to race, per capita income, ethnicity, and education. Reports of improved living situation post-hurricane were not associated with receiving relief assistance, but reports of a worse situation were associated with loss of income, being exploited, or job loss. The number of households reporting problems with crime and community violence doubled between the two surveys. Disaster relief efforts had less impact on subjective long-term recovery than did job or income loss or housing repair difficulties. Existing sources of assistance were used more often than specific post-hurricane relief resources. The demographic make-up of a community may determine which are the most effective means to inform them after a disaster and what sources of assistance may be useful.

  8. The brain and the biology of belief: An interview with Andrew Newberg, MD. Interview by Nancy Nachman-Hunt.

    Science.gov (United States)

    Newberg, Andrew

    2009-01-01

    Andrew Newberg, MD, is an associate professor in the Department of Radiology, Division of Nuclear Medicine, at the Hospital of the University of Pennsylvania, Philadelphia, with secondary appointments in the Departments of Psychiatry and Religious Studies. He is actively involved in neuroimaging research projects, including the study of the neurophysiological correlates of meditation and other types of complementary therapies. Dr Newberg's research now largely focuses on how brain function is associated with various mental states, in particular, the relationship between brain function and mystical or religious experiences. He has authored several books, including Why God Won't Go Away: Brain Science and the Biology of Belief (Ballantine/Random House, 2001) and coauthor with Eugene G. d'Aquili, MD, of The Mystical Mind: Probing the Biology of Religious Experience (Fortress Press, 1999). His most recent book is How God Changes Your Brain, with coauthor Mark Waldman (Ballantine Books, 2009).

  9. Enhancing breast projection in autologous reconstruction using the St Andrew's coning technique and 3D volumetric analysis.

    Science.gov (United States)

    Chae, Michael P; Rozen, Warren Matthew; Patel, Nakul Gamanlal; Hunter-Smith, David J; Ramakrishnan, Venkat

    2017-12-01

    An increasing number of women undergo mastectomy for breast cancer and post-mastectomy autologous breast reconstruction has been shown to significantly improve the psychosexual wellbeing of the patients. A goal of treatment is to achieve symmetry and projection to match the native breast, and/or the contralateral breast in the case of a unilateral reconstruction. Autologous reconstruction, particularly with the deep inferior epigastric artery perforator (DIEP) flap, is particularly advantageous as it can be manipulated to mimic the shape and turgor of the native breast. However, very few techniques of shaping the breast conus when insetting the DIEP flap to enhance aesthetic outcome have been reported to date. With the aide of three-dimension (3D) photography and 3D-printed mirrored image of the contralateral breast as a guide intraoperatively, we describe our St Andrew's coning technique to create a personalized flap projection. We report a prospective case series of 3 delayed unilateral breast reconstructions where symmetrization procedure to the contralateral breast was not indicated. Using a commercial 3D scanner (VECTRA XR, Canfield Scientific), the breast region was imaged. The mirrored image was 3D-printed in-house using a desktop 3D printer. In all cases, projection of the breast mound was able to be safely achieved, with a demonstrated central volume (or 'cone') able to be highlighted on imaging and a 3D printed breast. A 3D print of the contralateral breast was able to be used intraoperatively to guide the operative approach. The St Andrew's coning technique is a useful aesthetic maneuver for achieving breast projection during DIEP flap breast reconstruction, with 3D imaging techniques able to assist in perioperative assessment of breast volume.

  10. 78 FR 76812 - In the Matter of: Andrew Vincent O'Donnell, Inmate Number-62355-019, USP Atlanta, U.S...

    Science.gov (United States)

    2013-12-19

    ... DEPARTMENT OF COMMERCE Bureau of Industry and Security In the Matter of: Andrew Vincent O'Donnell... the Internal Security Act of 1950 (50 U.S.C. 783(b)), or section 38 of the Arms Export Control Act (22... 750.8 of the Regulations states that the Bureau of Industry and Security's Office of Exporter Services...

  11. Invertebrates of The H.J. Andrews Experimental Forest, western Cascade Range, Oregon. V: An annotated list of insects and other arthropods.

    Science.gov (United States)

    Gary L. Parson; Gerasimos Cassis; Andrew R. Moldenke; John D. Lattin; Norman H. Anderson; Jeffrey C Miller; Paul Hammond; Timothy D. Schowalter

    1991-01-01

    An annotated list of species of insects and other arthropods that have been collected and studies on the H.J. Andrews Experimental forest, western Cascade Range, Oregon. The list includes 459 families, 2,096 genera, and 3,402 species. All species have been authoritatively identified by more than 100 specialists. Information is included on habitat type, functional group...

  12. Alavi, Hamid R., Aira Htenas, Ron Kopicki, Andrew W. Sheperd and Ramon Clarete (eds) (2012), Trusting Trade and the Private Sector for Food Security in Southeast Asia

    OpenAIRE

    Chung Ming CHIN; Punggol Secondary School

    2014-01-01

    Book Review of the edited compilation: Alavi, Hamid R., Aira Htenas, Ron Kopicki, Andrew W. Sheperd and Ramon Clarete (eds) (2012), Trusting Trade and the Private Sector for Food Security in Southeast Asia, Washington DC: The World Bank, ISBN: 978-0-8213-8626-2, 264 pages

  13. Segmentation and Accretionary Processes Near the Andrew Bain Mega-Transform Fault: The Southwest Indian Ridge 25°-35°E

    Science.gov (United States)

    Takeuchi, C. S.; Sclater, J. G.; Grindlay, N. R.; Madsen, J. A.; Rommevaux-Jestin, C.

    2008-12-01

    The ultra-slow spreading Southwest Indian Ridge (SWIR) separates the Antarctic and African plates. We present results from two surveys covering the SWIR between 26° and 27°30'E and between 32° and 35°E, lying on either side of the long-offset Andrew Bain transform fault. The objectives of the surveys were to characterize the segmentation of an ultra-slow spreading ridge on either side of a long-offset transform fault and to examine the structure of the individual segments. Four transform faults, the Du Toit, Andrew Bain, Marion, and Prince Edward, and one non-transform discontinuity bound four accretionary segments in the survey areas. Two segments lie northeast of the Andrew Bain (32°-35°E). Large central axial volcanoes, deep, broad mantle Bouguer anomaly (MBA) lows, and high magnetization intensities centered on the spreading axis result from high magmatic activity. Increased magmatism on the ridge axis is likely caused by high mantle temperatures produced by the close proximity of the Marion Plume, which abuts the northern end of the Andrew Bain. Two segments lie southwest of the Andrew Bain (26°-27°30'E). Discrepancies in the locations of the axial rift valley, central magnetization high, and an irregularly-shaped MBA low suggest complex accretionary processes at the western segment (~26°-27° E). The eastern segment (~27°-27°30'E), which abuts the southwest end of the Andrew Bain, shows a deep axial valley, MBA values which increase to the east, and nearly nonexistent magnetization intensity. These features are probably the result of amagmatic accretion caused by the transform edge effect of the Andrew Bain. A transition in the character of topography at 26°45'E suggests that the current segment configuration may not be temporally stable. High-relief (~1 km) ridge-trough structures south of the spreading axis may be the result of an episodic interplay between accretion, both magmatic and amagmatic, and tectonic extension.

  14. Inhibition of the gastric H+,K+ -ATPase by plectrinone A, a diterpenoid isolated from Plectranthus barbatus Andrews.

    Science.gov (United States)

    Schultz, Carla; Bossolani, Myllene P; Torres, Luce M B; Lima-Landman, Maria Teresa R; Lapa, Antonio J; Souccar, Caden

    2007-04-20

    This work assessed the mechanism underlying the antisecretory gastric acid effect of Plectranthus barbatus Andrews (Lamiaceae) and active constituents. Popularly known as "false-boldo", this plant is used in Brazilian folk medicine to treat gastrointestinal and hepatic ailments. The plant aqueous extract (AE) and isolated compounds were assayed in vivo in pylorus-ligated mice, and in vitro on acid secretion measured as [(14)C]-aminopyrine ([(14)C]-AP) accumulation in rabbit gastric glands and gastric H(+),K(+)-ATPase preparations. Injected into the duodenal lumen, the AE of the plant leaves (0.5 and 1.0 g/kg) decreased the volume (62 and 76%) and total acidity (23 and 50%) of gastric acid secretion in pylorus-ligated mice. Bioguided purification of the AE yielded an active fraction (IC(50)=24 microg/ml) that inhibited acid secretion in rabbit gastric glands with a potency 10 to 18 times greater than that of the originating extract, on both the basal and stimulated acid secretion by histamine (His) (1 microM) or bethanechol (100 microM). At the same concentrations the gastric H(+),K(+)-ATPase activity was also inhibited. The active constituent was chemically identified as the abietanoid dienedione plectrinone A which reduced the H(+),K(+)-ATPase activity with IC(50)=171 microM. The results indicate that inhibition of the gastric proton pump by this diterpenoid may account for the antisecretory acid effect and reputed anti ulcer activity of Plectranthus barbatus.

  15. Genetic fidelity of long-term micropropagated shoot cultures of vanilla (Vanilla planifolia Andrews) as assessed by molecular markers.

    Science.gov (United States)

    Sreedhar, Reddampalli V; Venkatachalam, Lakshmanan; Bhagyalakshmi, Neelwarne

    2007-08-01

    Occurrence of genetic variants during micropropagation is occasionally encountered when the cultures are maintained in vitro for long period. Therefore, the micropropagated multiple shoots of Vanilla planifolia Andrews developed from axillary bud explants established 10 years ago were used to determine somaclonal variation using random amplified polymorphic DNA (RAPD) and intersimple sequence repeats markers (ISSR). One thousand micro-plants were established in soil of which 95 plantlets (consisting of four phenotypes) along with the mother plant were subjected to genetic analyses using RAPD and ISSR markers. Out of the 45 RAPD and 20 ISSR primers screened, 30 RAPD and 7 ISSR primers showed 317 clear, distinct and reproducible band classes resulting in a total of 30 115 bands. However, no difference was observed in banding patterns of any of the samples for a particular primer, indicating the absence of variation among the micropropagated plants. Our results allow us to conclude that the micropropagation protocol that we have used for in vitro proliferation of vanilla plantlets for the last 10 years might be applicable for the production of clonal plants over a considerable period of time.

  16. Lessons learned from Hurricane Andrew: recommendations for care of the elderly in long-term care facilities.

    Science.gov (United States)

    Silverman, M A; Weston, M; Llorente, M; Beber, C; Tam, R

    1995-06-01

    We report on the experience of a 500-bed, long-term care facility in Miami, Fla, which provides housing and nursing care units for patients--ranging from those who are independently ambulatory to those who are acutely ill and feeble--in preparing for, during, and in the immediate aftermath of Hurricane Andrew, which struck on August 24, 1992. The problems encountered included a massive influx of evacuated elderly to the facility, facility isolation, loss of electrical power, loss of running water, special dietary needs, and limited professional staffing due to personal property losses or loss of transportation. Overwhelmed county emergency medical services, limited access to hospitals and patient care, and difficulty in procuring supplies exacerbated the already complicated situation resulting from the storm. As a result of these catastrophic conditions, a number of challenges specific to the care of the elderly were identified. In conjunction with the Florida Department of Elder Affairs, we drafted a comprehensive blueprint that could serve as a disaster plan for other long-term care facilities facing a similar threat during the hurricane season.

  17. Apocalyptic Kingship, Harmony and Political Expediency: the Challenges and Paradoxes of Andrew Marvell’s “First Anniversary”

    Directory of Open Access Journals (Sweden)

    Jajtner Tomáš

    2015-07-01

    Full Text Available The following paper deals with the interpretation of one of the major “Cromwellian” poems of Andrew Marvell (1621-1678, “The First Anniversary of the Government under His Highness the Lord Protector”, 1655. The poem is first set in the context of Marvell’s poetry and his public career in the period between 1637 and 1660. The article then identifies and analyses three main themes of “The First Anniversary”: the notion of a new aeon starting with Cromwell’s rule and the apocalyptical imagery related to his Protectorate, the concept of his power and authority between liberty and tyranny, and the relation between the harmony established by Cromwell and classical Pythagorean harmonious lore. The author argues that the imagery Marvell uses to describe the nature of the regime (especially the concept of Cromwell’s “no-kingship” shows a deeply paradoxical structure, which uncovers the frailty and insecurity of Cromwell’s dictatorship as well as the circular logic of its justification. In that sense, the poem can be read as a vivid manifestation of the dilemmas and tensions of this period.

  18. The Impact of Structural Break(s on the Validity of Purchasing Power Parity in Turkey: Evidence from Zivot-Andrews and Lagrange Multiplier Unit Root Tests

    Directory of Open Access Journals (Sweden)

    Hakan Kum

    2012-01-01

    Full Text Available This study examines the validity of the purchasing power parity (PPP in Turkey for annual data from 1953 to 2009. While results from both the ADF unit root and the DF-GLS unit root test indicate mixed results, PPP holds for Turkey with the presence of structural breaks which are obtained by Zivot and Andrews and Lagrange Multiplier unit root tests.

  19. Hurricane Andrew causes major oil spill at Florida Power ampersand Light Company's Turkey Point Power Plant, Homestead, Florida

    International Nuclear Information System (INIS)

    Jones, M.A.; Butts, R.L.; Lindsay, J.R.; McCully, B.S.; Pickering, T.H.

    1993-01-01

    On August 24, 1992, Hurricane Andrew slammed into South Florida with wind gusts in excess of 160 mph. At 4:00 a.m. that day, the eye of this category four storm passed over Florida Power ampersand Light Company's Turkey Point power plant, south of Miami. Although the plant's two nuclear units escaped any significant damage, the storm caused extensive destruction to buildings and transmission facilities, and damaged two 400 foot tall emission stacks associated with the site's two fossil fuel generating units. In addition, a 90,000 to 110,000 gallon spill of No. 6 fuel oil resulted when a piece of wind-blown debris punctured the steel of the unit One 12,000 barrel fuel oil metering tank approximately 30 feet up from the tank bottom. Despite the presence of a secondary containment structure around the tank, the intense wind blew oil throughout the plant site. The damage to the metering tank apparently occurred during the first half hour of the hurricane. As the tank's oil level fell due to the puncture, transfer pumps from the bulk oil storage tanks received a low level alarm which automatically began transferring oil to the damaged metering tank. To prevent the further discharge of oil, plant personnel entered the power block and secured the pumps during the passage of the hurricane eye. Immediately following the storm, facility personnel deployed booms across the barge canal and the Units 1 and 2 intake canal to contain the oil which had entered the water. The response strategy and implementation is described in detail. The remediation costs were approximately $14/gallon spilled, including 54,000 gallons recovered for electricity generation

  20. Vanilla planifolia Andrews

    Indian Academy of Sciences (India)

    Unknown

    et al 2000). CMV is a multicomponent virus with a single stranded positive sense RNA. .... sense primer 5′ ATGGACAAATCTGAATCAAC 3′ was derived from the beginning of the first 20 bases of the ..... Pappu S S, Brand R, Pappu H R, Rybicki E, Gough K H, Frenkel. M J and Niblett C L 1993 A polymerase chain reaction.

  1. Vanilla planifolia Andrews

    Indian Academy of Sciences (India)

    Unknown

    species including cereals, fruits, vegetables and ornamentals. (Roossinck 1999). CMV is readily transmitted in a non-per- sistent manner by more than 75 species of aphids (Palukaitis et al 1992). Weed hosts function as a reservoir for the virus and serve as sources of inoculum for the development of disease epidemics.

  2. The Effects of Dose Rhizoctonia Binucleat (BNR and Phosphorus to Nitrate Reductase Activity (NRA and Chlorophyll of Vanilla Seedling (Vanilla planifolia Andrews

    Directory of Open Access Journals (Sweden)

    Haryuni Haryuni

    2016-09-01

    Full Text Available Vanilla (Vanilla planifolia Andrews is one of the important exported commodities in Indonesia. Indonesia is one of top five major vanilla exporters in the world, that produce the high quality of Indonesian vanilla with high vanillin content (2.75%. The aims of this research were to determine the effects of dose binukleat Rhizoctonia (BNR and phosphorus as well as the interaction of the nitrate reductase activity (NRA and chlorophyll of the vanilla seedling (Vanilla planifolia Andrew. Method in this research used completely randomized factorial design, by involving two factors (dose of BNR inoculation and Phosphor. The first factor is without inoculation and inoculation BNR (M0, M1, M2, M3 wich consists of (0,5, 10, 15 g/polybag, the second factor is the dose of phosphorus fertilizer (P0, P1, P2, P3 which consists of (0, 3, 6, 9 g/polibag. The results showed that the inoculation dose of BNR and doses of phosphorus not significant and lower levels of NRA and chlorophyll while the interaction dose of BNR and phosphorus significantly and increase levels of NRA and chlorophyll of vanilla seedling. Nitrate Reductase Activity and chlorophyll has important role in metabolism process as a plant growth indicator.How to CiteHaryuni, H., & Dewi, T. S. K. (2016. The Effects of Dose Rhizoctonia Binucleat (BNR and Phosphorus to Nitrate Reductase Activity (NRA and Chlorophyll of Vanilla Seedling (Vanilla planifolia Andrews. Biosaintifika: Journal of Biology & Biology Education, 8(2, 141-147.

  3. Maaleht soovitab : Anu Tali dirigeerib Vanemuises "Toscat". Vivaldi, Casanova ja Veneetsia. "Uinuv kaunitar" Vanemuises. Andrew Lloyd Webberi juubelikontserdid. Pärimusmuusika lõiluspidu

    Index Scriptorium Estoniae

    2008-01-01

    27. sept. juhatab Anu Tali Vanemuise teatris Mikk Mikiveri lavastatud ja Ervin Õunapuu taastatud Puccini ooperilavastust "Tosca". Barokkansambel Corelli Consort ja Raivo Järvi esitavad kava "Vivaldi, Casanova ja Veneetsia" 15. okt. Maardu mõisa muusikasalongis, 18. okt. Pärnus sarjas "Café Grand muusikasalong" ja 19. okt. Eesti Teaduste Akadeemia majas sarjas "Toompea muusikasalong". Vanemuisees esietendub 4. okt. Pjotr Tshaikovski ballett "Uinuv kaunitar". Tallinnas Saku Suurhallis toimuvad 18. okt. briti muusikalihelilooja Andrew Lloyd Webberi 60. sünnipäevale pühendatud juubelikontserdid. Viljandi Pärimusmuusika Aidas peetakse 10.-11. okt. "Pärimusmuusika lõikuspidu"

  4. Fuel to the nuclear debate : [Rezension von:] Nuclear power in crisis, Andrew Blowers and David Pepper (editors), New York, Nichols; London ..., Croom Helm, 1987

    OpenAIRE

    Renn, Ortwin

    1988-01-01

    Nuclear energy is one of the most popular topics of today’s publication market. The literature about the pros and cons of nuclear power may easily fill a whole library. Is there anything new to add to this voluminous body of arguments and contra-arguments that would justify editing another book on nuclear energy? Andrew Blowers and David Pepper obviously felt that way and published a reader on Nuclear Power in Crisis. The book consists of 13 articles covering mainly the political, social and ...

  5. Nomina nova in Platyhelminthes pro Macrorhynchus von Graff, 1882 (non [Gmelin, 1801]; non Dunker, 1843), and Leptocleidus Mueller, 1936 (non Andrews, 1922).

    Science.gov (United States)

    Hornung, Jahn J

    2016-08-19

    Two genus-group names of flat-worms-Leptocleidus Mueller, 1936 and Macrorhynchus von Graff, 1882-are junior homonyms that are preoccupied by fossil diapsid reptile genera-Leptocleidus Andrews, 1922, and Macrorhynchus Dunker, 1843-and an extant teleost fish genus-Macrorhynchus [Gmelin, 1801] ex La Cépède, 1800. These are replaced by nomina nova (Pharyngodytes nom. nov.; Graffiellus nom. nov.). Macrorhynchus [Gmelin, 1801] is an objective senior synonym of Macrorhyncus Dumeríl, 1805 ex La Cépède, 1800 (syn. nov.), and a senior homonym of Macrorhynchus Dunker, 1843, and Macrorhynchus von Graff, 1882.

  6. Utilizing NASA Earth Observations to Assess Impacts of Hurricanes Andrew and Irma on Mangrove Forests in Biscayne Bay National Park, FL

    Science.gov (United States)

    Kumar, A.; Weber, S.; Remillard, C.; Escobar Pardo, M. L.; Hashemi Tonekaboni, N.; Cameron, C.; Linton, S.; Rickless, D.; Rivero, R.; Madden, M.

    2017-12-01

    Extreme weather events, such as hurricanes, pose major threats to coastal communities around the globe. However, mangrove forests along coastlines act as barriers and subdue the impacts associated with these catastrophic events. The Biscayne Bay National Park mangrove forest located near the city of Miami Beach was recently affected by the category four hurricane Irma in September of 2017. This study analyzed the impact of Hurricane Irma on Biscayne Bay National Park mangroves. Several remote sensing datasets including Landsat 8 Operational Land Imager (OLI), Sentinel 2-Multi Spectral Imager (MSI), PlanetScope, and aerial imagery were utilized to assess pre-and post-hurricane conditions. The high-resolution aerial imagery and PlanetScope data were used to map damaged areas within the national park. Additionally, Landsat 8 OLI and Sentinel-2 MSI data were utilized to estimate changes in biophysical parameters, including gross primary productivity (GPP), before and after Hurricane Irma. This project also examined damages associated with Hurricane Andrew (1992) using historical Landsat 5 Thematic Mapper (TM) data. These results were compared to GPP estimates following Hurricane Irma and suggested that Hurricane Andrew's impact was greater than that of Irma in Biscayne Bay National Park. The results of this study will help to enhance the mangrove health monitoring and shoreline management programs led by officials at the City of Miami Beach Public Works Department.

  7. Condition Based Maintenance Technology Impacts Study for the Military Land Environment

    Science.gov (United States)

    2014-08-01

    WO2 Michael O’Sullivan A/Prof Axel Bender WO1 Andrew Perry WO1 George Carruth LTCOL Robert de Rooy Dr Justin Fidock Mr Roger Vodicka LTCOL Scott...International Conference on the Technology Exploitation Process (Factory 2000), Cambridge, UK: 2-4 April 1997, pp. 131-138. 41. del Rosairo, R... manuals , user/repair manuals [1, 6]; cost of implementing training (time, instructors, equipment, facilities, associated support [6]; loss of

  8. Anti-trypanosomal activity of 1,2,3,4,6-penta-O-galloyl-β -D-glucose isolated from Plectranthus barbatus Andrews (Lamiaceae

    Directory of Open Access Journals (Sweden)

    Roberta T. dos Santos

    2012-01-01

    Full Text Available MeOH extract from the leaves of Plectranthus barbatus Andrews (Lamiaceae, showed in vitro anti-trypanosomal activity. The bioassay-guided fractionation resulted in the isolation of a gallic acid derivative, identified as 1,2,3,4,6-penta-O-galloyl-β-D-glucose (PGG, after thorough NMR and MS spectral analysis. Finally, this compound was tested against trypomastigote forms of T. cruzi and displayed an EC50 value of 67 µM, at least 6.6-fold more effective than the standard drug benznidazole. This is the first occurrence of PGG in the Plectranthus genus and the first anti-parasitic activity described for PGG in the literature.

  9. Anti-trypanosomal activity of 1,2,3,4,6-penta-O-galloyl-? -D-glucose isolated from Plectranthus barbatus Andrews (Lamiaceae)

    International Nuclear Information System (INIS)

    Santos, Roberta T. dos; Hiramoto, Liliane L.; Lago, Joao Henrique G.; Sartorelli, Patricia

    2012-01-01

    MeOH extract from the leaves of Plectranthus barbatus Andrews (Lamiaceae), showed in vitro anti-trypanosomal activity. The bioassay-guided fractionation resulted in the isolation of a gallic acid derivative, identified as 1,2,3,4,6-penta-O-galloyl-β-D-glucose (PGG), after thorough NMR and MS spectral analysis. Finally, this compound was tested against trypomastigote forms of T. cruzi and displayed an EC 50 value of 67 μM, at least 6.6-fold more effective than the standard drug benznidazole. This is the first occurrence of PGG in the Plectranthus genus and the first anti-parasitic activity described for PGG in the literature (author)

  10. Anti-trypanosomal activity of 1,2,3,4,6-penta-O-galloyl-? -D-glucose isolated from Plectranthus barbatus Andrews (Lamiaceae)

    Energy Technology Data Exchange (ETDEWEB)

    Santos, Roberta T. dos; Hiramoto, Liliane L.; Lago, Joao Henrique G.; Sartorelli, Patricia [Universidade Federal de Sao Paulo (UNIFESP), Diadema, SP (Brazil). Inst. de Ciencias Ambientais, Quimicas e Farmaceuticas; Tempone, Andre G.; Pinto, Erika G. [Instituto Adolfo Lutz, Sao Paulo, SP (Brazil). Dept. de Parasitologia; Lorenzi, Harri, E-mail: psartorelli@unifesp.br [Instituto Plantarum de Estudos da Flora, Nova Odessa, SP (Brazil)

    2012-07-01

    MeOH extract from the leaves of Plectranthus barbatus Andrews (Lamiaceae), showed in vitro anti-trypanosomal activity. The bioassay-guided fractionation resulted in the isolation of a gallic acid derivative, identified as 1,2,3,4,6-penta-O-galloyl-{beta}-D-glucose (PGG), after thorough NMR and MS spectral analysis. Finally, this compound was tested against trypomastigote forms of T. cruzi and displayed an EC{sub 50} value of 67 {mu}M, at least 6.6-fold more effective than the standard drug benznidazole. This is the first occurrence of PGG in the Plectranthus genus and the first anti-parasitic activity described for PGG in the literature (author)

  11. Public health assessment for Wheeling Disposal Service Company Landfill, Amazonia, Andrew County, Missouri, Region 7, CERCLIS number MOD000830554. Final report

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1999-08-25

    The Wheeling Disposal Service Company, Inc., (Wheeling Disposal) site is a closed municipal and industrial waste landfill, approximately 1 mile southeast of Amazonia, Andrew County, Missouri. On-site shallow groundwater is contaminated with Volatile Organic Compounds (VOCs) (methylene chloride, carbon tetrachloride, trichloroethylene) and metals; however, no one is using that water for potable purposes at present. Isolated farm houses are situated in the vicinity of the site, but the houses that would most likely be affected are connected to the public water system. From the information reviewed, DOH concludes that the Wheeling Disposal site currently poses no apparent public health hazard. No exposures are known to be occurring at this time. Potential exposure pathways have been identified, but remedial actions eliminated them.

  12. The impact of Hurricane Andrew on deviant behavior among a multi-racial/ethnic sample of adolescents in Dade County, Florida: a longitudinal analysis.

    Science.gov (United States)

    Khoury, E L; Warheit, G J; Hargrove, M C; Zimmerman, R S; Vega, W A; Gil, A G

    1997-01-01

    Findings from a longitudinal study are presented on the relationships between the problems and stresses resulting from Hurricane Andrew and posthurricane minor deviant behavior. The sample (N = 4,978) included Hispanic, African-American, and White non-Hispanic middle school students enrolled in Dade County, Florida public schools. Two waves of data were collected prior to the hurricane; a third was obtained approximately 6 months following the storm. Results indicated that females were likely to report higher levels of hurricane-related stress symptoms than males. After controlling for prehurricane levels of minor deviance, family support, and race/ethnicity, hurricane stress symptom level remained a significant predictor of posthurricane minor deviant behavior. The findings lend support to stress theories of social deviance.

  13. Die erediens as fees of die fees as erediens?: �n Andrew Murray pryswenner �n kwarteeu later herlees

    Directory of Open Access Journals (Sweden)

    Cas Wepener

    2014-08-01

    Full Text Available Worship as feast or feast as worship? Re-reading an Andrew Murray prizewinner one quarter of a century later. The aim of this contribution is to bring the book Die erediens as fees into discussion with the surrounding culture almost one quarter of a century after its publication. The surrounding culture, we shall call, following Martin Stringer and his so-called discourse of globalisation and consumerism, �the feast as worship service�. Based on this discussion, our research question pertains to the value of Die erediens as fees for the field of Liturgical Studies today. An answer is attempted by, firstly, sketching the liturgical landscape as well as national and international liturgical-scientific developments in our day and, secondly, providing a liturgical-aesthetical exploration and positioning Die erediens as fees within these developments and exploration.

  14. An Analysis and Comparison of Two Short Writings: "Inaugural Address at the University of St. Andrew's" by J.S. Mill and "The University of Utopia" by R.M. Hutchins, Based on Five Criteria.

    Science.gov (United States)

    Poirier, Jeannine M.

    Focusing on the concept of education for work vs. education for living, the author presents a comparative analysis of two works on liberal education, each of which was originally delivered orally to university students: "The Inaugural Address at the University of St. Andrew" by John Stuart Mill and "The University of Utopia" by…

  15. Book Review: Alavi, Hamid R., Aira Htenas, Ron Kopicki, Andrew W. Sheperd and Ramon Clarete (eds) (2012), Trusting Trade and the Private Sector for Food Security in Southeast Asia

    OpenAIRE

    Chung Ming CHIN

    2014-01-01

    Book Review of the edited compilation: Alavi, Hamid R., Aira Htenas, Ron Kopicki, Andrew W. Sheperd and Ramon Clarete (eds) (2012), Trusting Trade and the Private Sector for Food Security in Southeast Asia, Washington DC: The World Bank, ISBN: 978-0-8213-8626-2, 264 pages

  16. Environmental Assessment for the Construction and Operation of a New Shoppette/Gas Station, Class Six Store, and Name-Brand Fast Food Store at Joint Base Andrews Camp Springs, Prince George’s County, Maryland

    Science.gov (United States)

    2010-02-01

    construction standards to mitigate antiterrorism vulnerabilities and terrorist threats. These requirements are incorporated in the Andrews AFB General...Regulation .03B(7) of this chapter, shall: (1) Use a method approved by the Department to: (a) Test all spill catchment basins and containment sumps in

  17. Evaluation of the use of Ocimum suave Willd. (Lamiaceae), Plectranthus barbatus Andrews (Lamiaceae) and Zanthoxylum chalybeum Engl. (Rutaceae) as antimalarial remedies in Kenyan folk medicine.

    Science.gov (United States)

    Kiraithe, Micheni N; Nguta, Joseph M; Mbaria, James M; Kiama, Stephen G

    2016-02-03

    Crude extracts from the leaves of Ocimum suave Willd (Lamiaceae) and the root barks of Plectranthus barbatus Andrews (Lamiaceae) and Zanthoxylum chalybeum Engl. (Rutaceae) were studied to ascertain the ethnopharmacological standing of their antimalarial usage in Kenyan folk medicine. Aqueous and Chloroform: Methanol (1:1) extracts of the plants were used in this study. Toxicity of the extracts was investigated by using brine shrimp lethality test and acute oral toxicity in mice. The antimalarial activity at a dose of 100 mg/kg was screened in Swiss albino mice against chloroquine sensitive Plasmodium berghei (D6) using Peters 4-day suppressive test. Chloroquine, at a dosage rate of 20 mg/kg was used as a reference drug. The extracts showed some signs of acute toxicity in the brine shrimp lethality test. However, no signs of toxicity were observed in the mice at a dose of 2000 mg/kg of the crude extracts. The results revealed that all the tested crude extracts were safe. Z. chalybeum aqueous extract and P. barbatus organic extract showed chemosuppressive activities of 81.45% and 78.69%, respectively. This antimalarial activity was not significantly different from that of chloroquine (P<0.05). The findings suggest that the Kenyan folkloric medicinal application of these plants has a pharmacological basis. Bioactivity guided fractionation and isolation of bioactive molecules from the two species could lead to new hits against Plasmodium falciparum malaria. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  18. Small-scale variations of climate change in mountainous forested terrain - a regional study from H.J. Andrews Long Term Ecological Research site in Oregon, USA

    Science.gov (United States)

    Honzakova, Katerina; Hoffmann, Peter; Jones, Julia; Thomas, Christoph

    2017-04-01

    There has been conflicting evidence as to whether high elevations are experiencing more pronounced climate warming than lower elevations in mountainous regions. In this study we analyze temperature records from H.J. Andrews Long Term Ecological Research, Oregon, USA and several nearby areas, comprising together 28 stations located in Cascade Mountains. The data, starting in 1958, are first checked for quality and homogenized using the Standard Normal Homogeneity Test. As a reference, composite climate time series based on the Global Historic Climate Network is created and together with cross-referencing against station records used to correct breaks and shifts in the data. In the next step, we investigate temperature patterns of the study site from 1958 to 2016 and compare them for valley and hill stations. In particular, we explore seasonality and inter-annual variability of the records and trends of the last day of frost. Additionally, 'cold' sums (positive and negative) are calculated to obtain a link between temperature and ecosystems' responses (such as budbreaks). So far, valley stations seem to be more prone to climate change than ridge or summit stations, contrary to current thinking. Building on previous knowledge, we attempt to provide physical explanations for the temperature records, focusing on wind patterns and associated phenomena such as cold air drainage and pooling. To aid this we analyze wind speed and direction data available for some of the stations since 1996, including seasonality and inter-annual variability of the observed flows.

  19. Geographic variation in life-history traits: growth season affects age structure, egg size and clutch size in Andrew's toad (Bufo andrewsi).

    Science.gov (United States)

    Liao, Wen Bo; Luo, Yi; Lou, Shang Ling; Lu, Di; Jehle, Robert

    2016-01-01

    Environmental variation associated with season length is likely to promote differentiation in life-history traits, but has been little studied in natural populations of ectotherms. We investigated patterns of variation in egg size, clutch size, age at sexual maturity, maximum age, mean age, growth rate and adult body size in relation to growth season length among 17 populations of Andrew's toad (Bufo andrewsi) at different latitudes and altitudes in the Hengduan Mountains, western China. We found that egg size, age at sexual maturity, and mean age increased with decreasing length of the growth season, whereas clutch size showed a converse cline. Body size did not increase with decreasing length of the growth season, but was tightly linked to lifetime activity (i.e. the estimated number of active days during lifetime). Males and females differed in their patterns of geographic variation in growth rates, which may be the result of forces shaping the trade-off between growth and reproduction in different environments. Our findings suggest that growth season plays an important role in shaping variation in life-history traits in B. andrewsi across geographical gradients.

  20. Molecular analysis of abnormal hemoglobins in beta chain in Aegean region of Turkey and first reports of hemoglobin Andrew-Minneapolis and Hb Hinsdale from Turkey.

    Science.gov (United States)

    Aykut, Ayça; Onay, Hüseyin; Durmaz, Asude; Karaca, Emin; Vergin, Canan; Aydınok, Yeşim; Özkınay, Ferda

    2015-07-01

    The Agean is one of the regions in Turkey where thalassemias and abnormal hemoglobins (Hbs) are prevalent. Combined heterozygosity of thalassemia mutations with a variety of structural Hb variants lead to an extremely wide spectrum of clinical and hematological phenotypes which is of importance for prenatal diagnosis. One hundred and seventeen patients and carriers diagnosed by hemoglobin electrophoresis (HPLC), at risk for abnormal hemoglobinopathies were screened for mutational analysis of the beta-globin gene. The full coding the 5' UTR, and the 3' UTR sequences of beta-globin gene (GenBank accession no. U01317) were amplified and sequenced. In this study, a total of 118 (12.24%) structural Hb variant alleles were identified in 1341 mutated beta-chain alleles in Medical Genetics Department of Ege University between January 2006 and November 2013. Here, we report the mutation spectrum of abnormal Hbs associated with the beta-globin gene in Aegean region of Turkey. In the present study, the Hb Hinsdale and Hb Andrew-Minneapolis variants are demonstrated for the first time in the Turkish population.

  1. Computer Modeling of Hydrology, Weathering, and Isotopic Fractionation in Andrews Creek, Rocky Mountain National Park, Colorado for Water Years 1992 through 2012

    Science.gov (United States)

    Webb, R. M. T.; Parkhurst, D. L.; Mast, A.; Clow, D. W.

    2014-12-01

    The U.S. Geological Survey's (USGS) Water, Energy, and Biogeochemical Model (WEBMOD) was used to simulate hydrology, weathering, and isotopic fractionation in the 1.7 square kilometer Andrews Creek alpine watershed. WEBMOD includes hydrologic modules derived from the USGS Precipitation Runoff Modeling System, the National Weather Service Hydro-17 snow model, and TOPMODEL. PHREEQC, a geochemical reaction model, is coupled with the hydrologic model to simulate the geochemical evolution of waters as they evaporate, mix, and react within the landscape. Major solute concentrations and δ18O were modeled over the period 1992-2012. Variations of chloride and inorganic nitrogen respond almost entirely to variations in atmospheric deposition and preferential elution of snowpack. Both evaporation and melting result in isotopic enrichment of heavy isotopes in the residual snowpack throughout the summer. Magnesium and potassium, derived mostly from weathering with some atmospheric inputs, vary seasonally with uptake during the growing season and release during the fall and winter. The weathering of granitic minerals—oligoclase, biotite, chlorite, pyrite, calcite, and formation of secondary minerals—kaolinite, goethite, gibbsite, and smectite-illite—were selected as primary reactions based on mole-balance modeling of basin outflows. The rates of these reactions were quantified by calibrating WEBMOD to match observed concentrations and loads. Exported annual loads of most weathering products are highly correlated with discharge, whereas silica loads are less correlated with discharge, suggesting a source that is more active during dry years and less active during wet years. Potential sources include net dissolution of kaolinite and smectite-illite or mineralization of colloids with high silica content. WEBMOD is a valuable tool for simulating water quality variations in response to climate change, acid mine drainage, acid rain, biological transformations, and other

  2. Feeding behavior of hummingbirds and perching birds on Erythrina speciosa Andrews (Fabaceae flowers in an urban area, Londrina, Paraná, Brazil Comportamento alimentar de beija-flores e Passeriformes nas flores de Erytrhina speciosa Andrews (Fabaceae em uma área urbana de Londrina, Paraná, Brasil

    Directory of Open Access Journals (Sweden)

    Luciana Baza Mendonça

    2006-03-01

    Full Text Available Nine species of birds - seven hummingbirds (Trochilidae and two Passeriformes - were observed visiting the flowers of Erythrina speciosa Andrews (Fabaceae, a hummingbird-pollinated species present on the campus of Londrina State University, Paraná State, Brazil. Nectar in bagged flowers bore little relationship with nectar in flowers opened to foragers either regarding quantity or diurnal pattern of availability. Birds were more frequent early in the morning and their activity on flowers further declined, apparently following the pattern of nectar availability. The manner to which birds probed the flowers and, in consequence, their role on pollination were greatly determined by morphological traits and approaching behavior of birds. E. speciosa seemed best suited for pollination by long-billed hummingbirds but some short to medium-billed species may play some role on its pollination.Nove espécies de aves - sete beija-flores (Trochilidae e duas aves Passeriformes - foram observados visitando as flores de Erythrina speciosa Andrews (Fabaceae, uma espécie polinizada por beija-flores presente no campus da Universidade Estadual de Londrina, Paraná, Brasil. O néctar em flores ensacadas apresentou pouca relação com aquele em flores expostas aos visitantes, tanto em termos de quantidade como em temos de padrão diurno de disponibilidade. As aves foram mais freqüentes de manhã e sua atividade nas flores diminuiu no transcorrer do dia, coincidindo com o padrão de disponibilidade de néctar. O comportamento de visita das aves e, em conseqüência, sua atuação na polinização da espécie foram em grande parte determinadas por características morfológicas e comportamentais destas. E. speciosa parece ser adaptada para polinização por beija-flores de bicos longos, embora espécies com bicos de comprimento curto a médio possam ter algum papel em sua polinização.

  3. Mesnevî Şârihi Şem’î Şem’ullah’ın Şerh Yöntemi İle Walter G. Andrews'un Sözdizimsel Metin Yorumlama Yöntemi Arasındaki Benzerlik Similarity Between Commentator Şem'î Şem'ullah's Method Of Interpretation For Mesnevî And Walter G. Andrews's Syntactical Text Interpretation

    Directory of Open Access Journals (Sweden)

    Turgut KOÇOĞLU

    2012-12-01

    Full Text Available From the past to present texts, needed to explain, have beeninterpreted by people who think that they have better understandingthan the others. Islamic literature, in order to understand the basics oftexts beginning with the Koran and the hadith also interpretationactivities affect literary works. After acceptance of Islam, particularlyreligious works and the other many works were translated and wereinterpreted from Persian and Arabic to Turkish. In time, these activitieshave caused to appear annotation system. In Turkish literature, literarytexts were interpreted with traditional annotation system until thetwentieth century. On the other hand after this century differentmethods can be considered a modern interpretation, literary textscontinued efforts understanding and expressing. Each method hasconsidered these texts in terms of different perspectives and it hasinterpreted.In recent times, Andrews who has interpreted Ottoman poem witha different point of view emphasized that using a unique feature ofTurkish syntax, the meaning of a sentence refers to both stress andintensity. According to Andrews, Divan poetry has the syntactic freedomand comfort like colloquial Turkish. Thanks to this flexibility, in the textoccurs ambiguity. Therefore, it supplies multiple meanings, differentinterpretation and understanding.From past to present, Andrews says that texts are not taken intoaccount syntactic features and nobody makes efforts to interpret thetexts in such a way. However Şem’i Şem’ullah who, is one of the majorpoets of the sixteenth century, used a method close the mentionedmethod of Andrews. In this article are examined that syntactic methodspoint of view of Şem’i Şem’ullah and Andrews. Geçmişten günümüze, izaha ihtiyaç duyulan eserler o eserleri başkalarından daha iyi anladığını düşünen insanlar tarafından açıklanmış ve yorumlanmıştır. İslam edebiyatında Kur'an ve hadisleri anlama gayretleriyle ba

  4. In Memoriam: George Andrew Olah

    Indian Academy of Sciences (India)

    The curriculum emphasized humanities and included a rigorous study of Latin, French, and. German along with history and literature. Olah remained deeply interested in these subjects throughout his life and was known to devour books in a single sitting. It was only after he graduated from high school, having survived the ...

  5. Spatial and Temporal Trends in the Carbon, Nitrogen, and Sulfur Isotopes of Stream DOM From 10 Watersheds at the HJ Andrews Experimental Forest.

    Science.gov (United States)

    Frentress, J.; Kendall, C.; Lajtha, K.; Jones, J.

    2008-12-01

    In order to better understand sources of dissolved organic matter (DOM) in streams from the small to large watershed scales, we initiated a one-year investigation of the chemical and isotopic characteristics of DOM at the HJ Andrews Experimental Forest (HJA) in Blue River, OR. DOM is a biologically significant loss from these watersheds, but its sources (forest floor, mineral soil, riparian zones, stream biota) are debated. Traditional chemical characterizations of DOM like SUVA and FI have been useful in conceptualizing and modeling streamflow sources, however, an improved method for assessing DOM quality is needed to adequately differentiate DOM from sources within the watershed. The isotopic characterization of inorganic molecules like nitrate has provided insight to the role of subsurface and surface processes governing the production and transport of critical nutrients, and yet to date, little work has been done to examine the usefulness of isotopic characterization of organically bound nutrients. We apply the isotopic characterization approach to DOM in order to better understand DOM production, transformation, and transport to streams in a range of watershed sizes. Major questions addressed in this research are: 1) Where in the watershed does stream DOM come from? 2) How do DOM sources vary temporally? 3) How do physical attributes of the watershed mediate DOM quality? A relatively new solid-phase extraction technique using C-18 resin was used to isolate DOM in water samples from 10 watersheds, ranging in size from 10 to 6200 hectares, on 3-week intervals from May 2007 to June 2008. The modified technique allowed for small (1 Liter) sample sizes and short processing times to reduce the costs of analysis. The capacity of carbon, nitrogen and sulfur isotopic characterizations of DOM, as well as traditional methods like SUVA and C:N, to predict physical watershed attributes (i.e. mean residence time, soil depth, elevation, gradient) and land use history (timber

  6. Deep versus shallow melt stagnation in an ultra-slow / ultra-cold ridge segment: the Andrew Bain southern RTI (SWIR)

    Science.gov (United States)

    Paganelli, E.; Brunelli, D.; Seyler, M.; Bonatti, E.; Cipriani, A.; Ligi, M.

    2011-12-01

    The Andrew Bain Fracture Zone (ABFZ) represents one of the largest transform faults in the ridge system spanning 750 km in length with a characteristic lens-shape structure. The southern Ridge-Transform Intersection represents the deepest sector of the whole South West Indian Ridge system. During the Italian-Russian expedition S23-AB06, the seafloor in the Southern Ridge Transform Intersection (RTI) has been sampled recovering only ultramafic material in the majority of the dredging sites. The sampled spinel and plagioclase peridotites show hybrid textures, characterized either by deep spinel-field impregnation assemblages (sp+cpx±opx±ol) or by plagioclase-field equilibrated patches and mineral trails (pl+cpx±ol) marked by both crystallization of newly formed plagioclase-field equilibrated trails and formation of plagioclase coronas around spinel. The ones collected from ridge axis show also late gabbroic pockets and veins, variably enriched in clinopyroxene. Overall textures account for important melt percolation/stagnation events occurred in the plagioclase and spinel field. Major and trace element distribution in pyroxenes and spinels from spinel-bearing peridotites overall follow a general melting trend accompanied by a progressive re-equilibration to lower P/T facies at all scales. However, only few samples can be linked to near fractional melting, while the majority of them shows REE pattern and trace element concentrations that cannot be reproduced by fractional melting process. Open-system melting (OSM) better reproduces measured REE patterns. Modeling melting in an open system scenario requires high residual porosity to be accounted for along with generally enriched melts to influx the melting parcel at depth. Melting at high residual porosity suggests a near-batch regime in which enriched melts stagnate in the spinel field. Inhibition of melt segregation during melt/rock interaction asks for a permeability barrier to develop in the region where the

  7. Laser Technology.

    Science.gov (United States)

    Gauger, Robert

    1993-01-01

    Describes lasers and indicates that learning about laser technology and creating laser technology activities are among the teacher enhancement processes needed to strengthen technology education. (JOW)

  8. Taming Technology

    Science.gov (United States)

    Branscomb, Lewis M.

    1971-01-01

    Reviews aspects of technology in our society: technology as a force for social change; reasons for the frustration and dissatisfaction with technology; how technology decentralizes power; the individual's influence; resolving conflicts in the ionized" society; regulation of technology; corporate responsibility; and the potential pitfalls for the…

  9. Assistive Technology

    Science.gov (United States)

    ... Page Resize Text Printer Friendly Online Chat Assistive Technology Assistive technology (AT) is any service or tool that helps ... be difficult or impossible. For older adults, such technology may be a walker to improve mobility or ...

  10. Sport Technology

    CSIR Research Space (South Africa)

    Kirkbride, T

    2007-11-01

    Full Text Available Technology is transforming the games themselves and at times with dire consequences. Tony Kirkbride, Head: CSIR Technology Centre said there are a variety of sports technologies and there have been advances in material sciences and advances...

  11. Rover Technologies

    Data.gov (United States)

    National Aeronautics and Space Administration — Develop and mature rover technologies supporting robotic exploration including rover design, controlling rovers over time delay and for exploring . Technology...

  12. Nano technology

    International Nuclear Information System (INIS)

    Lee, In Sik

    2002-03-01

    This book is introduction of nano technology, which describes what nano technology is, alpha and omega of nano technology, the future of Korean nano technology and human being's future and nano technology. The contents of this book are nano period is coming, a engine of creation, what is molecular engineering, a huge nano technology, technique on making small things, nano materials with exorbitant possibility, the key of nano world the most desirable nano technology in bio industry, nano development plan of government, the direction of development for nano technology and children of heart.

  13. Information Technology

    Science.gov (United States)

    2003-01-01

    The first wave delivered a range of services to most areas of the world through a vast, carefully constructed global network. Cellular technology ...Information Technology and Services Alliance. Digital Planet 2002: The Global Information Economy. February 2002. Yegyazarian, Anush. Sales Taxes...Information Technology ABSTRACT: The information technology (IT) industry affects virtually every industry in the n economy. During the late 90

  14. Electronic technology

    International Nuclear Information System (INIS)

    Kim, Jin Su

    2010-07-01

    This book is composed of five chapters, which introduces electronic technology about understanding of electronic, electronic component, radio, electronic application, communication technology, semiconductor on its basic, free electron and hole, intrinsic semiconductor and semiconductor element, Diode such as PN junction diode, characteristic of junction diode, rectifier circuit and smoothing circuit, transistor on structure of transistor, characteristic of transistor and common emitter circuit, electronic application about electronic equipment, communication technology and education, robot technology and high electronic technology.

  15. Sir Henry Solomon Wellcome and Dr Andrew Balfour: an enterprise on the Nile and the early foundation of public health and medical research in the Sudan (1899-1935).

    Science.gov (United States)

    Elhadd, T A

    2015-01-01

    In Sudan, modern medical practice and medical research began soon after the creation of Anglo-Egyptian Sudan at the turn of the 20th century. The benevolent involvement of Sir Henry Solomon Wellcome, and the ingenious feat of his protégé Sir Andrew Balfour, was crucial to the strong foundation of that establishment. Sir Henry Wellcome provided the financial sponsorship plus influential, logistical and moral support. Dr Balfour put great energy into making the enterprise one of the most amazing medical achievements in colonial medicine. Improvement in the public health of the capital Khartoum was emulated by other doctors working in this vast country. Research was not restricted to tropical medicine; it also encompassed agricultural and chemical research. This helped with the establishment of the first modern medical school in the country in 1924 and resulted in the medical service in Sudan being described as one of the best in the world. Many British doctors flocked to Sudan to make a fortune and to set a path for their career back in Britain.

  16. Globalization & technology

    DEFF Research Database (Denmark)

    Narula, Rajneesh

    Technology and globalization are interdependent processes. Globalization has a fundamental influence on the creation and diffusion of technology, which, in turn, affects the interdependence of firms and locations. This volume examines the international aspect of this interdependence at two levels...

  17. Living Technology

    DEFF Research Database (Denmark)

    2010-01-01

    This book is aimed at anyone who is interested in learning more about living technology, whether coming from business, the government, policy centers, academia, or anywhere else. Its purpose is to help people to learn what living technology is, what it might develop into, and how it might impact...... our lives. The phrase 'living technology' was coined to refer to technology that is alive as well as technology that is useful because it shares the fundamental properties of living systems. In particular, the invention of this phrase was called for to describe the trend of our technology becoming...... increasingly life-like or literally alive. Still, the phrase has different interpretations depending on how one views what life is. This book presents nineteen perspectives on living technology. Taken together, the interviews convey the collective wisdom on living technology's power and promise, as well as its...

  18. Earthing Technology

    NARCIS (Netherlands)

    Blok, Vincent

    2017-01-01

    In this article, we reflect on the conditions under which new technologies emerge in the Anthropocene and raise the question of how to conceptualize sustainable technologies therein. To this end, we explore an eco-centric approach to technology development, called biomimicry. We discuss opposing

  19. Technology Tiers

    DEFF Research Database (Denmark)

    Karlsson, Christer

    2015-01-01

    A technology tier is a level in a product system: final product, system, subsystem, component, or part. As a concept, it contrasts traditional “vertical” special technologies (for example, mechanics and electronics) and focuses “horizontal” feature technologies such as product characteristics...

  20. Soulful Technologies

    DEFF Research Database (Denmark)

    Fausing, Bent

    2010-01-01

    or anthropomorphism is important for the branding of new technology. Technology is seen as creating a techno-transcendence towards a more qualified humanity which is in contact with fundamental human values like intuition, vision, and sensing; all the qualities that technology, industrialization, and rationalization......, - in short modernity - have taken away from human existence. What old technology has removed now comes back through new technology promoting a better humanity. The present article investigates how digital technology and affects are presented and combined, with examples from everyday imagery, e.g. TV......Samsung introduced in 2008 a mobile phone called "Soul" made with a human touch and including itself a "magic touch". Through the analysis of a Nokia mobile phone TV-commercials I want to examine the function and form of digital technology in everyday images. The mobile phone and its digital camera...

  1. Technology '90

    International Nuclear Information System (INIS)

    1991-01-01

    The US Department of Energy (DOE) laboratories have a long history of excellence in performing research and development in a number of areas, including the basic sciences, applied-energy technology, and weapons-related technology. Although technology transfer has always been an element of DOE and laboratory activities, it has received increasing emphasis in recent years as US industrial competitiveness has eroded and efforts have increased to better utilize the research and development resources the laboratories provide. This document, Technology '90, is the latest in a series that is intended to communicate some of the many opportunities available for US industry and universities to work with the DOE and its laboratories in the vital activity of improving technology transfer to meet national needs. Technology '90 is divided into three sections: Overview, Technologies, and Laboratories. The Overview section describes the activities and accomplishments of the DOE research and development program offices. The Technologies section provides descriptions of new technologies developed at the DOE laboratories. The Laboratories section presents information on the missions, programs, and facilities of each laboratory, along with a name and telephone number of a technology transfer contact for additional information. Separate papers were prepared for appropriate sections of this report

  2. Sensemaking technologies

    DEFF Research Database (Denmark)

    Madsen, Charlotte Øland

    Research scope: The scope of the project is to study technological implementation processes by using Weick's sensemaking concept (Weick, 1995). The purpose of using a social constructivist approach to investigate technological implementation processes is to find out how new technologies transform...... patterns of social action and interaction in organisations (Barley 1986; 1990, Orlikowski 2000). Current research in the field shows that new technologies affect organisational routines/structures/social relationships/power relations/dependencies and alter organisational roles (Barley 1986; 1990, Burkhardt......, Orlikowski 2000). Viewing the use of technology as a process of enactment opens up for investigating the social processes of interpreting new technology into the organisation (Orlikowski 2000). The scope of the PhD project will therefore be to gain a deeper understanding of how the enactment of new...

  3. Technological risks

    International Nuclear Information System (INIS)

    Klinke, A.; Renn, O.

    1998-01-01

    The empirical part about the technological risks deals with different technologies: nuclear energy, early warning systems of nuclear weapons and NBC-weapons, and electromagnetic fields. The potential of damage, the contemporary management strategies and the relevant characteristics will be described for each technology: risks of nuclear energy; risks of early warning systems of nuclear weapons and NBC-weapons; risks of electromagnetic fields. (authors)

  4. Technological risks

    Energy Technology Data Exchange (ETDEWEB)

    Klinke, A.; Renn, O. [Center of Technology Assessment in Baden-Wuerttemberg, Stuttgart (Germany)

    1998-07-01

    The empirical part about the technological risks deals with different technologies: nuclear energy, early warning systems of nuclear weapons and NBC-weapons, and electromagnetic fields. The potential of damage, the contemporary management strategies and the relevant characteristics will be described for each technology: risks of nuclear energy; risks of early warning systems of nuclear weapons and NBC-weapons; risks of electromagnetic fields. (authors)

  5. Technology alliances

    International Nuclear Information System (INIS)

    Torgerson, D.F.; Boczar, P.G.; Kugler, G.

    1991-10-01

    In the field of nuclear technology, Canada and Korea developed a highly successful relationship that could serve as a model for other high-technology industries. This is particularly significant when one considers the complexity and technical depth required to design, build and operate a nuclear reactor. This paper will outline the overall framework for technology transfer and cooperation between Canada and Korea, and will focus on cooperation in nuclear R and D between the two countries

  6. Chemistry Technology

    Data.gov (United States)

    Federal Laboratory Consortium — Chemistry technology experts at NCATS engage in a variety of innovative translational research activities, including:Design of bioactive small molecules.Development...

  7. Technology Catalogue

    International Nuclear Information System (INIS)

    1994-02-01

    The Department of Energy's Office of Environmental Restoration and Waste Management (EM) is responsible for remediating its contaminated sites and managing its waste inventory in a safe and efficient manner. EM's Office of Technology Development (OTD) supports applied research and demonstration efforts to develop and transfer innovative, cost-effective technologies to its site clean-up and waste management programs within EM's Office of Environmental Restoration and Office of Waste Management. The purpose of the Technology Catalogue is to provide performance data on OTD-developed technologies to scientists and engineers assessing and recommending technical solutions within the Department's clean-up and waste management programs, as well as to industry, other federal and state agencies, and the academic community. OTD's applied research and demonstration activities are conducted in programs referred to as Integrated Demonstrations (IDs) and Integrated Programs (IPs). The IDs test and evaluate.systems, consisting of coupled technologies, at specific sites to address generic problems, such as the sensing, treatment, and disposal of buried waste containers. The IPs support applied research activities in specific applications areas, such as in situ remediation, efficient separations processes, and site characterization. The Technology Catalogue is a means for communicating the status. of the development of these innovative technologies. The FY93 Technology Catalogue features technologies successfully demonstrated in the field through IDs and sufficiently mature to be used in the near-term. Technologies from the following IDs are featured in the FY93 Technology Catalogue: Buried Waste ID (Idaho National Engineering Laboratory, Idaho); Mixed Waste Landfill ID (Sandia National Laboratories, New Mexico); Underground Storage Tank ID (Hanford, Washington); Volatile organic compound (VOC) Arid ID (Richland, Washington); and VOC Non-Arid ID (Savannah River Site, South Carolina)

  8. Thermally activated technologies: Technology Roadmap

    Energy Technology Data Exchange (ETDEWEB)

    None, None

    2003-05-01

    The purpose of this Technology Roadmap is to outline a set of actions for government and industry to develop thermally activated technologies for converting America’s wasted heat resources into a reservoir of pollution-free energy for electric power, heating, cooling, refrigeration, and humidity control. Fuel flexibility is important. The actions also cover thermally activated technologies that use fossil fuels, biomass, and ultimately hydrogen, along with waste heat.

  9. Technological Advancements

    Science.gov (United States)

    Kennedy, Mike

    2010-01-01

    The influx of technology has brought significant improvements to school facilities. Many of those advancements can be found in classrooms, but when students head down the hall to use the washrooms, they are likely to find a host of technological innovations that have improved conditions in that part of the building. This article describes modern…

  10. Maritime Technology

    DEFF Research Database (Denmark)

    Sørensen, Herman

    1997-01-01

    Elementary introduction to the subject "Maritime Technology".The contents include drawings, sketches and references in English without any supplementary text.......Elementary introduction to the subject "Maritime Technology".The contents include drawings, sketches and references in English without any supplementary text....

  11. Technology collaboration

    Energy Technology Data Exchange (ETDEWEB)

    Thomas, Jacob [Halliburton (Brazil)

    2011-07-01

    The aim of this paper is to present Halliburton's Brazilian technology center. Halliburton has technology centers in the United States, Saudi Arabia, India, Singapore and Brazil, all of which aim at delivering accelerated innovation in the oil sector. The technology centers engage in research and development activities with the help of various universities and in collaboration with the customer or supplier. The Halliburton Brazil technology center provides its customers with timely research and development solutions for enhancing recovery and mitigating reservoir uncertainty; they are specialized in finding solutions for pre- and post-salt carbonate drilling and in the enhancement of production from mature fields. This presentation showcased the work carried out by the Halliburton Brazil technology center to help customers develop their deepwater field activities.

  12. Sensemaking technology

    DEFF Research Database (Denmark)

    Madsen, Charlotte Øland

    Research objective: The object of the LOK research project is to gain a better understanding of the technological strategic processes in organisations by using the concept/metaphor of sensemaking. The project will investigate the technological strategies in organisations in order to gain a deeper...... understanding of the cognitive competencies and barriers towards implementing new technology in organisations. The research will therefore concentrate on researching the development process in the organisation's perception of the external environmental elements of customers, suppliers, competitors, internal...... and external technology and legislation and the internal environmental elements of structure, power relations and political arenas. All of these variables have influence on which/how technologies are implemented thus creating different outcomes all depending on the social dynamics that are triggered by changes...

  13. Ergonomics technology

    Science.gov (United States)

    Jones, W. L.

    1977-01-01

    Major areas of research and development in ergonomics technology for space environments are discussed. Attention is given to possible applications of the technology developed by NASA in industrial settings. A group of mass spectrometers for gas analysis capable of fully automatic operation has been developed for atmosphere control on spacecraft; a version for industrial use has been constructed. Advances have been made in personal cooling technology, remote monitoring of medical information, and aerosol particle control. Experience gained by NASA during the design and development of portable life support units has recently been applied to improve breathing equipment used by fire fighters.

  14. Technology Innovation

    Science.gov (United States)

    EPA produces innovative technologies and facilitates their creation in line with the Agency mission to create products such as the stormwater calculator, remote sensing, innovation clusters, and low-cost air sensors.

  15. Videodisc technology

    Energy Technology Data Exchange (ETDEWEB)

    Marsh, F.E. Jr.

    1981-03-01

    An overview of the technology of videodiscs is given. The emphasis is on systems that use reflection or transmission of laser light. Possible use of videodiscs for storage of bibliographic information is considered. 6 figures, 3 tables. (RWR)

  16. Technology | FNLCR

    Science.gov (United States)

    The Frederick National Laboratory develops and applies advanced, next-generation technologies to solve basic and applied problems in the biomedical sciences, and serves as a national resource of shared high-tech facilities.

  17. Globalization & technology

    DEFF Research Database (Denmark)

    Narula, Rajneesh

    of innovation" understanding of learning. Narula and Smith reconcile an important paradox. On the one hand, locations and firms are increasingly interdependent through supranational organisations, regional integration, strategic alliances, and the flow of investments, technologies, ideas and people......Technology and globalization are interdependent processes. Globalization has a fundamental influence on the creation and diffusion of technology, which, in turn, affects the interdependence of firms and locations. This volume examines the international aspect of this interdependence at two levels....... The boundaries of firms and countries are increasingly porous and imprecise, because firms use alliances and outsourcing, and countries are rarely technologically self-sufficient. On the other hand, locations remain distinct and idiosyncratic, with innovation systems remaining largely nationally bound. Knowledge...

  18. Plasma technology

    International Nuclear Information System (INIS)

    Drouet, M.G.

    1984-03-01

    IREQ was contracted by the Canadian Electrical Association to review plasma technology and assess the potential for application of this technology in Canada. A team of experts in the various aspects of this technology was assembled and each team member was asked to contribute to this report on the applications of plasma pertinent to his or her particular field of expertise. The following areas were examined in detail: iron, steel and strategic-metals production; surface treatment by spraying; welding and cutting; chemical processing; drying; and low-temperature treatment. A large market for the penetration of electricity has been identified. To build up confidence in the technology, support should be provided for selected R and D projects, plasma torch demonstrations at full power, and large-scale plasma process testing

  19. Exploration technology

    Energy Technology Data Exchange (ETDEWEB)

    Roennevik, H.C. [Saga Petroleum A/S, Forus (Norway)

    1996-12-31

    The paper evaluates exploration technology. Topics discussed are: Visions; the subsurface challenge; the creative tension; the exploration process; seismic; geology; organic geochemistry; seismic resolution; integration; drilling; value creation. 4 refs., 22 figs.

  20. Lasers technology

    International Nuclear Information System (INIS)

    2014-01-01

    The Laser Technology Program of IPEN is developed by the Center for Lasers and Applications (CLA) and is committed to the development of new lasers based on the research of new optical materials and new resonator technologies. Laser applications and research occur within several areas such as Nuclear, Medicine, Dentistry, Industry, Environment and Advanced Research. Additional goals of the Program are human resource development and innovation, in association with Brazilian Universities and commercial partners

  1. Cognitive technologies

    CERN Document Server

    Mello, Alan; Figueiredo, Fabrício; Figueiredo, Rafael

    2017-01-01

    This book focuses on the next generation optical networks as well as mobile communication technologies. The reader will find chapters on Cognitive Optical Network, 5G Cognitive Wireless, LTE, Data Analysis and Natural Language Processing. It also presents a comprehensive view of the enhancements and requirements foreseen for Machine Type Communication. Moreover, some data analysis techniques and Brazilian Portuguese natural language processing technologies are also described here. .

  2. Globalisation, transport and HIV | Andrews | Southern African ...

    African Journals Online (AJOL)

    No Abstract Southern African Journal of HIV Medicine Vol. 5 (4) 2004: 41-44. Full Text: EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT · AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about AJOL ...

  3. Globalisation, transport and HIV | Andrews | Southern African ...

    African Journals Online (AJOL)

    Southern African Journal of HIV Medicine. Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue · Archives · Journal Home > Vol 5, No 4 (2004) >. Log in or Register to get access to full text downloads. Username, Password, Remember me, or Register · Download this PDF file. The PDF file you selected ...

  4. 431-IJBCS-Article-Andrew H Siwela

    African Journals Online (AJOL)

    User

    Oxidative stress associated with nematode infections in sheep: ... Keywords: Glutathione peroxidase, malondialdehyde, succinate dehydrogenase, nematode .... Gastrointestinal parasites cause marked production losses in farm animals throughout the world (Sykes, 1994) and their control is difficult because of their ...

  5. The Future of the Andrew File System

    CERN Multimedia

    CERN. Geneva; Altman, Jeffrey

    2011-01-01

    The talk will discuss the ten operational capabilities that have made AFS unique in the distributed file system space and how these capabilities are being expanded upon to meet the needs of the 21st century. Derrick Brashear and Jeffrey Altman will present a technical road map of new features and technical innovations that are under development by the OpenAFS community and Your File System, Inc. funded by a U.S. Department of Energy Small Business Innovative Research grant. The talk will end with a comparison of AFS to its modern days competitors.

  6. 7__51 - 55_Andrew_Isoniazid

    African Journals Online (AJOL)

    pc

    major adverse effects, including hepatitis, periphe neuropathy, neurotoxicity, hypersensitivity reactio. (fever, skin eruptions or hematologic alterations alo with lupus-like syndrome that is reversible discontinuation of INH. The most notable adve effect is hepatitis. The estimated rate of clin hepatitis in patients given INH alone ...

  7. Celebrating Andrew Alm Benson's 93rd birthday.

    Science.gov (United States)

    Govindjee

    2010-09-01

    We celebrate Andy Benson's 93rd birthday on September 24, 2010 through this Editorial. This short account about Andy Benson should serve as a prelude to the short article that Andy has written for the entire photosynthesis community, which gives a glimpse of why he left the field of the "path of carbon in photosynthesis," when he had already discovered, together with Melvin Calvin, James Alan Bassham, and others, most of the major steps in what we now call the Calvin-Benson cycle.

  8. Technology cycles and technology revolutions

    Energy Technology Data Exchange (ETDEWEB)

    Paganetto, Luigi; Scandizzo, Pasquale Lucio

    2010-09-15

    Technological cycles have been characterized as the basis of long and continuous periods economic growth through sustained changes in total factor productivity. While this hypothesis is in part consistent with several theories of growth, the sheer magnitude and length of the economic revolutions experienced by humankind seems to indicate surmise that more attention should be given to the origin of major technological and economic changes, with reference to one crucial question: role of production and use of energy in economic development.

  9. Persuasive Technology

    DEFF Research Database (Denmark)

    This book constitutes the proceedings of the 5th International Conference on Persuasive Technology, PERSUASIVE 2010, held in Copenhagen Denmark in June 2010. The 25 papers presented were carefully reviewed and selected from 80 submissions. In addition three keynote papers are included in this vol......This book constitutes the proceedings of the 5th International Conference on Persuasive Technology, PERSUASIVE 2010, held in Copenhagen Denmark in June 2010. The 25 papers presented were carefully reviewed and selected from 80 submissions. In addition three keynote papers are included...... in this volume. The topics covered are emotions and user experience, ambient persuasive systems, persuasive design, persuasion profiles, designing for health, psychology of persuasion, embodied and conversational agents, economic incentives, and future directions for persuasive technology....

  10. Seafood Technology

    DEFF Research Database (Denmark)

    Børresen, Torger

    This presentation will fill the total picture of this conference between fisheries and aquaculture, blue biotech and bioconservation, by considering the optimal processing technology of marine resources from the raw material until the seafood reaches the plate of the consumer. The situation today...... must be performed such that total traceability and authenticity of the final products can be presented on demand. The most important aspects to be considered within seafood technology today are safety, healthy products and high eating quality. Safety can be divided into microbiological safety...... and not presenting any safety risk per se. Seafood is healthy due to the omega-3 fatty acids and the nutritional value of vitamins, peptides and proteins. The processing technology must however be performed such that these valuable features are not lost during production. The same applies to the eating quality. Any...

  11. Smart technology

    International Nuclear Information System (INIS)

    Bruckner, D.G.

    1991-01-01

    The success of smart technology in the pursuit of the Gulf War has accentuated the awareness of how the Safeguards and Security disciplines are changing in response to new weaponry. Throughout the Department of Energy Integrated Complex (IC) Safeguards and Security efforts such as: Protection Programs Operations; Materials, Controls and Accountability; Information Security; Computer Security; Operational Security; Personnel Security, Safeguards and/or Security (S and S) surveys, and Inspections and Evaluations are undergoing a reassessment and refocusing. Some of this is in response to such things as the DOE initiated Freeze Report and the Drell Report. An important aspect is also technological, adjusting the way business is done in light of the weapons, tools and processes/procedures becoming available. This paper addresses the S and S issues with the promise of using smart technology to develop new approaches and equipment across the IC

  12. Technology Transfer

    Science.gov (United States)

    Smith, Nanette R.

    1995-01-01

    The objective of this summer's work was to attempt to enhance Technology Application Group (TAG) ability to measure the outcomes of its efforts to transfer NASA technology. By reviewing existing literature, by explaining the economic principles involved in evaluating the economic impact of technology transfer, and by investigating the LaRC processes our William & Mary team has been able to lead this important discussion. In reviewing the existing literature, we identified many of the metrics that are currently being used in the area of technology transfer. Learning about the LaRC technology transfer processes and the metrics currently used to track the transfer process enabled us to compare other R&D facilities to LaRC. We discuss and diagram impacts of technology transfer in the short run and the long run. Significantly, it serves as the basis for analysis and provides guidance in thinking about what the measurement objectives ought to be. By focusing on the SBIR Program, valuable information regarding the strengths and weaknesses of this LaRC program are to be gained. A survey was developed to ask probing questions regarding SBIR contractors' experience with the program. Specifically we are interested in finding out whether the SBIR Program is accomplishing its mission, if the SBIR companies are providing the needed innovations specified by NASA and to what extent those innovations have led to commercial success. We also developed a survey to ask COTR's, who are NASA employees acting as technical advisors to the SBIR contractors, the same type of questions, evaluating the successes and problems with the SBIR Program as they see it. This survey was developed to be implemented interactively on computer. It is our hope that the statistical and econometric studies that can be done on the data collected from all of these sources will provide insight regarding the direction to take in developing systematic evaluations of programs like the SBIR Program so that they can

  13. Technology applications

    Science.gov (United States)

    Anuskiewicz, T.; Johnston, J.; Leavitt, W.; Zimmerman, R. R.

    1972-01-01

    A summary of NASA Technology Utilization programs for the period of 1 December 1971 through 31 May 1972 is presented. An abbreviated description of the overall Technology Utilization Applications Program is provided as a background for the specific applications examples. Subjects discussed are in the broad headings of: (1) cancer, (2) cardiovascular disease, (2) medical instrumentation, (4) urinary system disorders, (5) rehabilitation medicine, (6) air and water pollution, (7) housing and urban construction, (8) fire safety, (9) law enforcement and criminalistics, (10) transportation, and (11) mine safety.

  14. Architectural technology

    DEFF Research Database (Denmark)

    2005-01-01

    The booklet offers an overall introduction to the Institute of Architectural Technology and its projects and activities, and an invitation to the reader to contact the institute or the individual researcher for further information. The research, which takes place at the Institute of Architectural...... Technology at the Roayl Danish Academy of Fine Arts, School of Architecture, reflects a spread between strategic, goal-oriented pilot projects, commissioned by a ministry, a fund or a private company, and on the other hand projects which originate from strong personal interests and enthusiasm of individual...

  15. Technology Transfer: Marketing Tomorrow's Technology

    Science.gov (United States)

    Tcheng, Erene

    1995-01-01

    The globalization of the economy and the end of the Cold War have triggered many changes in the traditional practices of U.S. industry. To effectively apply the resources available to the United States, the federal government has firmly advocated a policy of technology transfer between private industry and government labs, in this case the National Aeronautics and Space Administration (NASA). NASA Administrator Daniel Goldin is a strong proponent of this policy and has organized technology transfer or commercialization programs at each of the NASA field centers. Here at Langley Research Center, the Technology Applications Group (TAG) is responsible for facilitating the transfer of Langley developed research and technology to U.S. industry. Entering the program, I had many objectives for my summer research with TAG. Certainly, I wanted to gain a more thorough understanding of the concept of technology transfer and Langley's implementation of a system to promote it to both the Langley community and the community at large. Also, I hoped to become more familiar with Langley's research capabilities and technology inventory available to the public. More specifically, I wanted to learn about the technology transfer process at Langley. Because my mentor is a member of Materials and Manufacturing marketing sector of the Technology Transfer Team, another overriding objective for my research was to take advantage of his work and experience in materials research to learn about the Advanced Materials Research agency wide and help market these developments to private industry. Through the various projects I have been assigned to work on in TAG, I have successfully satisfied the majority of these objectives. Work on the Problem Statement Process for TAG as well as the development of the Advanced Materials Research Brochure have provided me with the opportunity to learn about the technology transfer process from the outside looking in and the inside looking out. Because TAG covers

  16. Blast Technologies

    Science.gov (United States)

    2011-06-27

    Team Leader Risa Scherer Blast Mitigation Interior and Laboratory Team Leader Blast Technologies POC’s Government Point Of Contacts (POCs): To...to yield injury assessments at higher fidelities and with higher confidence UNCLASSIFIED UNCLASSIFIED Risa Scherer Blast Mitigation Interior and

  17. Health technology

    International Nuclear Information System (INIS)

    Nicolas, Delphine; Dangleant, Caroline; Ganier, Aude; Kaczmarek, Delphine

    2008-01-01

    The CEA is an organization with a primarily technological focus, and one of the key areas in which it carries out research is Health Technology. This field of research was recognized and approved by the French Atomic Energy Committee on July 20, 2004. The expectations of both the public and health care professionals relate to demands for the highest standards of health care, at minimum risk. This implies a need to diagnose illness and disease as accurately and as at early a stage as possible, to target surgery precisely to deal only with damaged organs or tissues, to minimize the risk of side effects, allergies and hospital-acquired infections, to follow-up and, as far as possible, tailor the health delivery system to each individual's needs and his or her lifestyle. The health care sector is subject to rapid changes and embraces a vast range of scientific fields. It now requires technological developments that will serve to gather increasing quantities of useful information, analyze and integrate it to obtain a full understanding of highly complex processes and to be able to treat the human body as un-invasively as possible. All the technologies developed require assessment, especially in the hospital environment. (authors)

  18. Technology transfer

    International Nuclear Information System (INIS)

    Boury, C.

    1986-01-01

    This paper emphasizes in the specific areas of design, engineering and component production. This paper presents what Framatome has to offer in these areas and its export oriented philosophy. Then, a typical example of this technology transfer philosophy is the collaboration with the South Korean firm, Korea Heavy Industries Corporation (KHIC) for the supply of KNU 9 and KNU 10 power stations

  19. Technology Transfer

    Science.gov (United States)

    Bullock, Kimberly R.

    1995-01-01

    The development and application of new technologies in the United States has always been important to the economic well being of the country. The National Aeronautics and Space Administration (NASA) has been an important source of these new technologies for almost four decades. Recently, increasing global competition has emphasized the importance of fully utilizing federally funded technologies. Today NASA must meet its mission goals while at the same time, conduct research and development that contributes to securing US economic growth. NASA technologies must be quickly and effectively transferred into commercial products. In order to accomplish this task, NASA has formulated a new way of doing business with the private sector. Emphasis is placed on forming mutually beneficial partnerships between NASA and US industry. New standards have been set in response to the process that increase effectiveness, efficiency, and timely customer response. This summer I have identified potential markets for two NASA inventions: including the Radially Focused Eddy Current Sensor for Characterization of Flaws in Metallic Tubing and the Radiographic Moire. I have also worked to establish a cooperative program with TAG, private industry, and a university known as the TAG/Industry/Academia Program.

  20. Energy Technology.

    Science.gov (United States)

    Eaton, William W.

    Reviewed are technological problems faced in energy production including locating, recovering, developing, storing, and distributing energy in clean, convenient, economical, and environmentally satisfactory manners. The energy resources of coal, oil, natural gas, hydroelectric power, nuclear energy, solar energy, geothermal energy, winds, tides,…

  1. (Environmental technology)

    Energy Technology Data Exchange (ETDEWEB)

    Boston, H.L.

    1990-10-12

    The traveler participated in a conference on environmental technology in Paris, sponsored by the US Embassy-Paris, US Environmental Protection Agency (EPA), the French Environmental Ministry, and others. The traveler sat on a panel for environmental aspects of energy technology and made a presentation on the potential contributions of Oak Ridge National Laboratory (ORNL) to a planned French-American Environmental Technologies Institute in Chattanooga, Tennessee, and Evry, France. This institute would provide opportunities for international cooperation on environmental issues and technology transfer related to environmental protection, monitoring, and restoration at US Department of Energy (DOE) facilities. The traveler also attended the Fourth International Conference on Environmental Contamination in Barcelona. Conference topics included environmental chemistry, land disposal of wastes, treatment of toxic wastes, micropollutants, trace organics, artificial radionuclides in the environment, and the use biomonitoring and biosystems for environmental assessment. The traveler presented a paper on The Fate of Radionuclides in Sewage Sludge Applied to Land.'' Those findings corresponded well with results from studies addressing the fate of fallout radionuclides from the Chernobyl nuclear accident. There was an exchange of new information on a number of topics of interest to DOE waste management and environmental restoration needs.

  2. Geospatial Technology

    Science.gov (United States)

    Reed, Philip A.; Ritz, John

    2004-01-01

    Geospatial technology refers to a system that is used to acquire, store, analyze, and output data in two or three dimensions. This data is referenced to the earth by some type of coordinate system, such as a map projection. Geospatial systems include thematic mapping, the Global Positioning System (GPS), remote sensing (RS), telemetry, and…

  3. Photovoltaic technologies

    International Nuclear Information System (INIS)

    Bagnall, Darren M.; Boreland, Matt

    2008-01-01

    Photovoltaics is already a billion dollar industry. It is experiencing rapid growth as concerns over fuel supplies and carbon emissions mean that governments and individuals are increasingly prepared to ignore its current high costs. It will become truly mainstream when its costs are comparable to other energy sources. At the moment, it is around four times too expensive for competitive commercial production. Three generations of photovoltaics have been envisaged that will take solar power into the mainstream. Currently, photovoltaic production is 90% first-generation and is based on silicon wafers. These devices are reliable and durable, but half of the cost is the silicon wafer and efficiencies are limited to around 20%. A second generation of solar cells would use cheap semiconductor thin films deposited on low-cost substrates to produce devices of slightly lower efficiency. A number of thin-film device technologies account for around 5-6% of the current market. As second-generation technology reduces the cost of active material, the substrate will eventually be the cost limit and higher efficiency will be needed to maintain the cost-reduction trend. Third-generation devices will use new technologies to produce high-efficiency devices. Advances in nanotechnology, photonics, optical metamaterials, plasmonics and semiconducting polymer sciences offer the prospect of cost-competitive photovoltaics. It is reasonable to expect that cost reductions, a move to second-generation technologies and the implementation of new technologies and third-generation concepts can lead to fully cost-competitive solar energy in 10-15 years. (author)

  4. Technology Programme

    International Nuclear Information System (INIS)

    Batistoni, Paola; De Marco, Francesco; Pieroni, Leonardo

    2005-01-01

    The technology activities carried out by the Euratom-ENEA Association in the framework of the European Fusion Development Agreement concern the Next Step (International Thermonuclear Experimental Reactor - ITER), the Long-Term Programme (breeder blanket, materials, International Fusion Materials Irradiation Facility - IFMIF), Power Plant Conceptual Studies and Socio-Economic Studies. The Underlying Technology Programme was set up to complement the fusion activities as well to develop technologies with a wider range of interest. The Technology Programme mainly involves staff from the Frascati laboratories of the Fusion Technical and Scientific Unit and from the Brasimone laboratories of the Advanced Physics Technologies Unit. Other ENEA units also provide valuable contributions to the programme. ENEA is heavily engaged in component development/testing and in design and safety activities for the European Fusion Technology Programme. Although the work documented in the following covers a large range of topics that differ considerably because they concern the development of extremely complex systems, the high level of integration and coordination ensures the capability to cover the fusion system as a whole. In 2004 the most significant testing activities concerned the ITER primary beryllium-coated first wall. In the field of high-heat-flux components, an important achievement was the qualification of the process for depositing a copper liner on carbon fibre composite (CFC) hollow tiles. This new process, pre-brazed casting (PBC), allows the hot radial pressing (HRP) joining procedure to be used also for CFC-based armour monoblock divertor components. The PBC and HRP processes are candidates for the construction of the ITER divertor. In the materials field an important milestone was the commissioning of a new facility for chemical vapour infiltration/deposition, used for optimising silicon carbide composite (SiCf/SiC) components. Eight patents were deposited during 2004

  5. Technology Programme

    Energy Technology Data Exchange (ETDEWEB)

    Batistoni, Paola; De Marco, Francesco; Pieroni, Leonardo (ed.)

    2005-07-01

    The technology activities carried out by the Euratom-ENEA Association in the framework of the European Fusion Development Agreement concern the Next Step (International Thermonuclear Experimental Reactor - ITER), the Long-Term Programme (breeder blanket, materials, International Fusion Materials Irradiation Facility - IFMIF), Power Plant Conceptual Studies and Socio-Economic Studies. The Underlying Technology Programme was set up to complement the fusion activities as well to develop technologies with a wider range of interest. The Technology Programme mainly involves staff from the Frascati laboratories of the Fusion Technical and Scientific Unit and from the Brasimone laboratories of the Advanced Physics Technologies Unit. Other ENEA units also provide valuable contributions to the programme. ENEA is heavily engaged in component development/testing and in design and safety activities for the European Fusion Technology Programme. Although the work documented in the following covers a large range of topics that differ considerably because they concern the development of extremely complex systems, the high level of integration and coordination ensures the capability to cover the fusion system as a whole. In 2004 the most significant testing activities concerned the ITER primary beryllium-coated first wall. In the field of high-heat-flux components, an important achievement was the qualification of the process for depositing a copper liner on carbon fibre composite (CFC) hollow tiles. This new process, pre-brazed casting (PBC), allows the hot radial pressing (HRP) joining procedure to be used also for CFC-based armour monoblock divertor components. The PBC and HRP processes are candidates for the construction of the ITER divertor. In the materials field an important milestone was the commissioning of a new facility for chemical vapour infiltration/deposition, used for optimising silicon carbide composite (SiCf/SiC) components. Eight patents were deposited during 2004

  6. Technological Networks

    Science.gov (United States)

    Mitra, Bivas

    The study of networks in the form of mathematical graph theory is one of the fundamental pillars of discrete mathematics. However, recent years have witnessed a substantial new movement in network research. The focus of the research is shifting away from the analysis of small graphs and the properties of individual vertices or edges to consideration of statistical properties of large scale networks. This new approach has been driven largely by the availability of technological networks like the Internet [12], World Wide Web network [2], etc. that allow us to gather and analyze data on a scale far larger than previously possible. At the same time, technological networks have evolved as a socio-technological system, as the concepts of social systems that are based on self-organization theory have become unified in technological networks [13]. In today’s society, we have a simple and universal access to great amounts of information and services. These information services are based upon the infrastructure of the Internet and the World Wide Web. The Internet is the system composed of ‘computers’ connected by cables or some other form of physical connections. Over this physical network, it is possible to exchange e-mails, transfer files, etc. On the other hand, the World Wide Web (commonly shortened to the Web) is a system of interlinked hypertext documents accessed via the Internet where nodes represent web pages and links represent hyperlinks between the pages. Peer-to-peer (P2P) networks [26] also have recently become a popular medium through which huge amounts of data can be shared. P2P file sharing systems, where files are searched and downloaded among peers without the help of central servers, have emerged as a major component of Internet traffic. An important advantage in P2P networks is that all clients provide resources, including bandwidth, storage space, and computing power. In this chapter, we discuss these technological networks in detail. The review

  7. Innovative Technology in Automotive Technology

    Science.gov (United States)

    Gardner, John

    2007-01-01

    Automotive Technology combines hands-on training along with a fully integrated, interactive, computerized multistationed facility. Our program is a competency based, true open-entry/open-exit program that utilizes flexible self-paced course outlines. It is designed around an industry partnership that promotes community and economic development,…

  8. Playful Technology

    DEFF Research Database (Denmark)

    Johansen, Stine Liv; Eriksson, Eva

    2013-01-01

    In this paper, the design of future services for children in Danish public libraries is discussed, in the light of new challenges and opportunities in relation to new media and technologies. The Danish government has over the last few years initiated and described a range of initiatives regarding...... the future of public libraries, especially in relation to children as a particular user group. This paper explores play culture, and takes a stance especially in the project ‘Families at play in the library’, but also in experiences from related projects. The focus is on families playing together...... in the library, the changing role of the librarians and the library space. We argue that intertwining traditional library services with new media forms and engaging play is the core challenge for future design in physical public libraries, but also that it is through new media and technology that new...

  9. Technology transfer

    International Nuclear Information System (INIS)

    Anon.

    1977-01-01

    Illustrated by the example of the FRG's nuclear energy exports, it is shown that the nuclear technology transfer leads to new dimensions of intergovernmental relations, which hold within themselves on account of multiple state-to-state, scientific, industrial and - last but not least - personal contacts the chance of far-reaching friendships between countries and people. If the chance is taken, this can also be seen as an important contribution towards maintaining the peace. (orig.) [de

  10. Group technology

    International Nuclear Information System (INIS)

    Rome, C.P.

    1976-01-01

    Group Technology has been conceptually applied to the manufacture of batch-lots of 554 machined electromechanical parts which now require 79 different types of metal-removal tools. The products have been grouped into 7 distinct families which require from 8 to 22 machines in each machine-cell. Throughput time can be significantly reduced and savings can be realized from tooling, direct-labor, and indirect-labor costs

  11. Army Technology

    Science.gov (United States)

    2015-02-01

    MUTT ) is a semi-autonomous robotic follower that lightens the load for Soldiers by decreasing the amount of equipment they need to carry when...dismounted in the toughest of terrains. The MUTT uses advanced, proven commercial technology that has been adapted for the rigors of the battlefield...With ultra-quiet electric motors, the MUTT gives Soldiers unmatched internal transportability options and expeditionary power that includes hands- free

  12. ADSL Technology

    Directory of Open Access Journals (Sweden)

    Slavko Šarić

    2002-11-01

    Full Text Available The paper deals with the ADSL (Asymmetric Digital SubscriberLine technology- the asymmetric digital telecommunicationtechnology. It is characterised by high-speed transmissionof data and simultaneous transmission of information regardingthe throughput capacity of the telephone network. Thisresults in better efficiency of transmission, and higher utilisationof the bandwidth. Due to its advantages, the use of ADSLtechnology is increasing daily, especially by ente1prises in Europeand worldwide.

  13. Nuclear technology

    International Nuclear Information System (INIS)

    1983-03-01

    This report examines nuclear technology in Canada, with emphasis on Quebec, as a means of revitilizing industry. The historical, present day, and future states of Atomic Energy of Canada Limited are examined. Future research programs are discussed in greatest detail. These range from disposal of porcine wastes to new applications for electricity to nuclear medical techniques (to cite only a few examples). The executive summary is written in English. (23 fig., 16 tab.)

  14. Emerging technologies

    Energy Technology Data Exchange (ETDEWEB)

    Lu, Shin-yee

    1993-03-01

    The mission of the Emerging Technologies thrust area at Lawrence Livermore National Laboratory is to help individuals establish technology areas that have national and commercial impact, and are outside the scope of the existing thrust areas. We continue to encourage innovative ideas that bring quality results to existing programs. We also take as our mission the encouragement of investment in new technology areas that are important to the economic competitiveness of this nation. In fiscal year 1992, we have focused on nine projects, summarized in this report: (1) Tire, Accident, Handling, and Roadway Safety; (2) EXTRANSYT: An Expert System for Advanced Traffic Management; (3) Odin: A High-Power, Underwater, Acoustic Transmitter for Surveillance Applications; (4) Passive Seismic Reservoir Monitoring: Signal Processing Innovations; (5) Paste Extrudable Explosive Aft Charge for Multi-Stage Munitions; (6) A Continuum Model for Reinforced Concrete at High Pressures and Strain Rates: Interim Report; (7) Benchmarking of the Criticality Evaluation Code COG; (8) Fast Algorithm for Large-Scale Consensus DNA Sequence Assembly; and (9) Using Electrical Heating to Enhance the Extraction of Volatile Organic Compounds from Soil.

  15. Technology Management

    DEFF Research Database (Denmark)

    Pilkington, Alan

    2014-01-01

    This paper reports a bibliometric analysis (co-citation network analysis) of 10 journals in the management of technology (MOT) field. As well as introducing various bibliometric ideas, network analysis tools identify and explore the concepts covered by the field and their inter-relationships. Spe......This paper reports a bibliometric analysis (co-citation network analysis) of 10 journals in the management of technology (MOT) field. As well as introducing various bibliometric ideas, network analysis tools identify and explore the concepts covered by the field and their inter......-relationships. Specific results from different levels of analysis show the different dimensions of technology management: • Co-word terms identify themes • Journal co-citation network: linking to other disciplines • Co-citation network show concentrations of themes The analysis shows that MOT has a bridging role...... in integrating ideas from several distinct disciplines. This suggests that management and strategy are central to MOT which essentially relates to the firm rather than policy. Similarly we have a dual focus on capabilities, but can see subtle differences in how we view these ideas, either through an inwards...

  16. Wearable Technology

    Science.gov (United States)

    Watson, Amanda

    2013-01-01

    Wearable technology projects, to be useful, in the future, must be seamlessly integrated with the Flight Deck of the Future (F.F). The lab contains mockups of space vehicle cockpits, habitat living quarters, and workstations equipped with novel user interfaces. The Flight Deck of the Future is one element of the Integrated Power, Avionics, and Software (IPAS) facility, which, to a large extent, manages the F.F network and data systems. To date, integration with the Flight Deck of the Future has been limited by a lack of tools and understanding of the Flight Deck of the Future data handling systems. To remedy this problem it will be necessary to learn how data is managed in the Flight Deck of the Future and to develop tools or interfaces that enable easy integration of WEAR Lab and EV3 products into the Flight Deck of the Future mockups. This capability is critical to future prototype integration, evaluation, and demonstration. This will provide the ability for WEAR Lab products, EV3 human interface prototypes, and technologies from other JSC organizations to be evaluated and tested while in the Flight Deck of the Future. All WEAR Lab products must be integrated with the interface that will connect them to the Flight Deck of the Future. The WEAR Lab products will primarily be programmed in Arduino. Arduino will be used for the development of wearable controls and a tactile communication garment. Arduino will also be used in creating wearable methane detection and warning system.

  17. Understanding Technology?

    Directory of Open Access Journals (Sweden)

    Erik Bendtsen

    2016-11-01

    Full Text Available We are facing radical changes in our ways of living in the nearest future. Not necessarily of our own choice, but because tchnological development is moving so fast, that it will have still greater impact on many aspects of our lives. We have seen the beginnings of that change within the latest 35 years or so, but according to newest research that change will speed up immensely in the nearest years to come. The impact of that change or these changes will affect our working life immensely as a consequence of automation. How these changes are brought about and which are their consequences in a broad sense is being attempted to be understood and guessed by researchers. No one knows for sure, but specific patterns are visible. This paper will not try to guess, what will come, but will rather try to understand the deepest ”nature” of technology in order to understand the driving factors in this development: the genesis of technology in a broad sense in order to contibute to the understanding of the basis for the expected development.

  18. Photon technology. Hard photon technology; Photon technology. Hard photon gijutsu

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1996-03-01

    Research results of hard photon technology have been summarized as a part of novel technology development highly utilizing the quantum nature of photon. Hard photon technology refers to photon beam technologies which use photon in the 0.1 to 200 nm wavelength region. Hard photon has not been used in industry due to the lack of suitable photon sources and optical devices. However, hard photon in this wavelength region is expected to bring about innovations in such areas as ultrafine processing and material synthesis due to its atom selective reaction, inner shell excitation reaction, and spatially high resolution. Then, technological themes and possibility have been surveyed. Although there are principle proposes and their verification of individual technologies for the technologies of hard photon generation, regulation and utilization, they are still far from the practical applications. For the photon source technology, the laser diode pumped driver laser technology, laser plasma photon source technology, synchrotron radiation photon source technology, and vacuum ultraviolet photon source technology are presented. For the optical device technology, the multi-layer film technology for beam mirrors and the non-spherical lens processing technology are introduced. Also are described the reduction lithography technology, hard photon excitation process, and methods of analysis and measurement. 430 refs., 165 figs., 23 tabs.

  19. Architectural Technology and Technological Planning

    Directory of Open Access Journals (Sweden)

    Giorgio Giallocosta

    2011-11-01

    Full Text Available At least three fundamental aspects of the many singular technological approaches to architectural planning are currently evolving significantly and are ripe for potential development. The first relates to enhanced opportunities for defining the ex-ante characteristics and performance of building products and components, but particularly concerns potential leadership assumptions in planning and the ‘reification’ of architecture through ‘collective’ behaviours. The second relates to the tendency to try and overcome the connotation of architectural projects, inclusive of their entire life cycle. The third relates to current evolutionary developments (either potential or simply implicit in performance approach.

  20. Technology round and management of technology

    International Nuclear Information System (INIS)

    Park, Yong Tae

    1994-04-01

    This book deals with beginning of technology round with background of it, change of scientific technique paradigm with economy, management and policy, change of international political environment globalization of technical and economic environment, formation of strategic alliance, intensifying regionalism, new GATT system, UR and technology round, new international technique regulation and technology round of OECD, feature and meaning of technology round, assignment and scientific technique of Korea, past and present of scientific technology in Korea, correspondence for technology round.

  1. Incineration technologies

    CERN Document Server

    Buekens, Alfons

    2013-01-01

    Waste incineration is the art of completely combusting waste, while maintaining or reducing emission levels below current emission standards. Where possible, objectives include the recovering of energy as well as the  combustion residues.  Successful waste incineration makes it possible to achieve a deep reduction in waste volume, obtain a compact and sterile residue, and eliminate a wide array of pollutants. This book places waste incineration within the wider context of waste management, and demonstrates that, in contrast to landfills and composting, waste incineration can eliminate objectionable and hazardous properties such as flammability and toxicity, result in a significant reduction in volume, and destroy gaseous and liquid waste streams leaving little or no residues beyond those linked to flue gas neutralization and treatment. Moreover, waste incineration sterilizes and destroys putrescible matter, and produces usable heat.  Incineration Technologies first appeared as a peer-reviewed contribution ...

  2. Robot technology

    International Nuclear Information System (INIS)

    Vertut, Jean; Coiffet, Philippe.

    1985-01-01

    Teleoperation is concerned with the exploration and exploitation of of spaces which do not allow, because of their inaccessibility or hostility, direct access to man. This volume (Parts 2, 3 and 4) covers the contribution of computer science and automatic control to this technology. Part 2 includes a description of teleoperation systems followed by chapters on the operator substitution function by computer feedback to the operator. Part 3 has chapters on performance evaluation of teleoperation systems and the human operator in the teleoperation system. Part 4 is about applications of teleoperation in the nuclear industry, underwater, in space, in medicine, in industry and in security and civil protection. The nuclear applications include research and pilot facilities, reactor operation and maintenance, reactor decommissioning and dismantling and in emergencies, for example following a reactor accident. (U.K.)

  3. Lander Technologies

    Science.gov (United States)

    Chavers, Greg

    2015-01-01

    Since 2006 NASA has been formulating robotic missions to the lunar surface through programs and projects like the Robotic Lunar Exploration Program, Lunar Precursor Robotic Program, and International Lunar Network. All of these were led by NASA Marshall Space Flight Center (MSFC). Due to funding shortfalls, the lunar missions associated with these efforts, the designs, were not completed. From 2010 to 2013, the Robotic Lunar Lander Development Activity was funded by the Science Mission Directorate (SMD) to develop technologies that would enable and enhance robotic lunar surface missions at lower costs. In 2013, a requirements-driven, low-cost robotic lunar lander concept was developed for the Resource Prospector Mission. Beginning in 2014, The Advanced Exploration Systems funded the lander team and established the MSFC, Johnson Space Center, Applied Physics Laboratory, and the Jet Propulsion Laboratory team with MSFC leading the project. The lander concept to place a 300-kg rover on the lunar surface has been described in the New Technology Report Case Number MFS-33238-1. A low-cost lander concept for placing a robotic payload on the lunar surface is shown in figures 1 and 2. The NASA lander team has developed several lander concepts using common hardware and software to allow the lander to be configured for a specific mission need. In addition, the team began to transition lander expertise to United States (U.S.) industry to encourage the commercialization of space, specifically the lunar surface. The Lunar Cargo Transportation and Landing by Soft Touchdown (CATALYST) initiative was started and the NASA lander team listed above is partnering with three competitively selected U.S. companies (Astrobotic, Masten Space Systems, and Moon Express) to develop, test, and operate their lunar landers.

  4. Powder technology

    International Nuclear Information System (INIS)

    Agueda, Horacio

    1989-01-01

    Powder technology is experiencing nowadays a great development and has broad application in different fields: nuclear energy, medicine, new energy sources, industrial and home artifacts, etc. Ceramic materials are of daily use as tableware and also in the building industry (bricks, tiles, etc.). However, in machine construction its utilization is not so common. The same happens with metals: powder metallurgy is employed less than traditional metal forming techniques. Both cases deal with powder technology and the forming techniques as far as the final consolidation through sintering processes are very similar. There are many different methods and techniques in the forming stage: cold-pressing, slip casting, injection molding, extrusion molding, isostatic pressing, hot-pressing (which involves also the final consolidation step), etc. This variety allows to obtain almost any desired form no matter how complex it could be. Some applications are very specific as in the case of UO 2 pellets (used as nuclear fuels) but with the same technique and other materials, it is possible to manufacture a great number of different products. This work shows the characteristics and behaviour of two magnetic ceramic materials (ferrites) fabricated in the laboratory of the Applied Research Division of the Bariloche Atomic Center for different purposes. Other materials and products made with the same method are also mentioned. Likewise, densities and shrinkage obtained by different methods of forming (cold-pressing, injection molding, slip casting and extrusion molding) using high-purity alumina (99.5% Al 2 O 3 ). Finally, different applications of such methods are given. (Author) [es

  5. Technology programme

    International Nuclear Information System (INIS)

    2007-01-01

    The technology activities carried out by the EURATOM-ENEA Association concern the continuation of the European Fusion Development Agreement (EFDA) as well as the ITER activities coordinated by the ITER International Office and Fusion for Energy. Also included in the activities are design and RD under the Broader Approach Agreement between the EU and Japan. In order to better contribute to the programme a number of consortium agreements among the Associations are being signed. Collaboration with industries in view of their participation in the construction of ITER was further strengthened, mainly in the field of magnet and divertor components. The new European Test Blanket Facility at ENEA Brasimone was completed; the design of the ITER radial neutron camera was optimised and the performance achievable with the in-vessel viewing system was further assessed by experimental trials. Design activities for the JT-60SA magnet and power supply system as well as the design and experimental activities related to the target of the International Fusion Materials Irradiation Facility were continued. Significant work was done to define quality assurance for neutronics analyses. Mockups of the ITER pre-compression ring made in glass fibre epoxy were tested. The activities and results documented in the following illustrate ENEA's efforts to support fusion development

  6. How Technology Teachers Understand Technological Knowledge

    Science.gov (United States)

    Norström, Per

    2014-01-01

    Swedish technology teachers' views of technological knowledge are examined through a written survey and a series of interviews. The study indicates that technology teachers' understandings of what constitutes technological knowledge and how it is justified vary considerably. The philosophical discussions on the topic are unknown to them. This lack…

  7. International technology transfer

    International Nuclear Information System (INIS)

    Kwon, Won Gi

    1991-11-01

    This book introduces technology progress and economic growth, theoretical consideration of technology transfer, policy and mechanism on technology transfer of a developed country and a developing country, reality of international technology transfer technology transfer and industrial structure in Asia and the pacific region, technology transfer in Russia, China and Eastern Europe, cooperation of science and technology for development of Northeast Asia and strategy of technology transfer of Korea.

  8. Technological capabilities, technological dynamism and innovation offshoring

    OpenAIRE

    Schubert, Torben; Baier, Elisabeth; Rammer, Christian

    2016-01-01

    In this paper we analyze the conditions under which firms decide to offshore innovation. We consider the role of internal technological capabilities and technological dynamism in the firm environment, distinguishing speed and uncertainty of technological change. Using unique data from the German Innovation Survey we find that while high speed of technological change tends to drive innovation offshoring, high uncertainty about future technology developments results in more innovation offsho...

  9. Flywheel Technology

    Science.gov (United States)

    Ritchie, Lisa M.

    2004-01-01

    Throughout the summer of 2004, I am working on a number of different projects. While located in the Space Power and Propulsion Test Engineering branch, my main area of study is flywheel technology. I have been exposed to flywheels, their components, and their uses in today's society. I have been able to experience numerous flywheels here in the flywheel lab at NASA Glenn. My first main project was to explore the attributes and physical characteristics of a flywheel. Our branch was constructing a flywheel demonstration to be presented at the public open house taking place in June. Our Flywheel Interactive Demo, or FIDO, represents a real life multi-flywheel system here at NASA. I was given the opportunity to learn about how these flywheels store energy and are able to position a satellite. With all of this new knowledge, I was able to create the posters that explained how our demonstration worked. I also composed a step-by-step process made up of four experiments that any visitor could follow and perform on FIDO. By stepping through these experiments, the individual learns how a flywheel works. They not only read the explanation of what is happening, but they are also able to see it happen. Creating these two posters not only taught me, but also helped teach the general public during the open house, how flywheel technology is a very important part of our future. Through my research, I have learned that flywheels are able to store massive amounts of energy. They can be described as an electro-mechanical battery that stores kinetic energy while rotating. The faster it rotates, the more energy it stores. Their lifetime is about triple that of an ordinary battery. Flywheels also have the ability to combine energy storage with attitude control all in a single system. Attitude control is the ability to position a satellite as required. FIDO helps us to understand the rotational force (torque) that is applied upon a turn-table or satellite during wheel acceleration

  10. Marketing technologically advanced products

    OpenAIRE

    Bender, Horst

    1989-01-01

    This paper calls for a merger of technology and marketing under a customer value perspective; for an enhancement of the traditional technological innovation orientation of the technology-based firm with a market thrust. It establishes technology-based products as product-service offerings that are derived from technological innovation. The aim in marketing technology-based products is an improved understanding of how an organization can combine a technology orientation with a customer value t...

  11. Sports and Technology. Resources in Technology.

    Science.gov (United States)

    Hadley, Fred W.

    1993-01-01

    Technology is making a significant impact in all areas of sports and recreation. New equipment and computer training methods in spectator sports have had a major social and economic impact, and individual sports have reaped the benefits of technology. (JOW)

  12. Plasma technology directory

    International Nuclear Information System (INIS)

    Ward, P.P.; Dybwad, G.L.

    1995-01-01

    The Plasma Technology Directory has two main goals: (1) promote, coordinate, and share plasma technology experience and equipment within the Department of Energy; and (2) facilitate technology transfer to the commercial sector where appropriate. Personnel are averaged first by Laboratory and next by technology area. The technology areas are accelerators, cleaning and etching deposition, diagnostics, and modeling

  13. Hydrogen technologies and the technology learning curve

    International Nuclear Information System (INIS)

    Rogner, H.-H.

    1998-01-01

    On their bumpy road to commercialization, hydrogen production, delivery and conversion technologies not only require dedicated research, development and demonstration efforts, but also protected niche markets and early adopters. While niche markets utilize the unique technological properties of hydrogen, adopters exhibit a willingness to pay a premium for hydrogen fueled energy services. The concept of the technology learning curve is applied to estimate the capital requirements associated with the commercialization process of several hydrogen technologies. (author)

  14. Installation Restoration Program Phase 2. Confirmation/Quantification Stage 1 for Otis Air National Guard Base, Massachusetts, Air National Guard Support Center, Andrews Air Force Base, Maryland. Volume 2. Appendices

    Science.gov (United States)

    1985-10-01

    petrochemical, metal plating, food industries and DoD. identify and develop treatment methods/technology for Applied research on a number of advanced... food packaging and transformer Jersey, 19-23 March 1979. manufacturing. Mady, N., D. Smith, J. Smith, and C. Wezwick, "The Analysis of Kepone in...FID, NPD , TCD, search Institute he also supported re- FPD). search in organic synthesis, fuel char- acterization, electronic component

  15. International Technology Transfer.

    Science.gov (United States)

    Morris, Robert G.

    The flow of technology out of the United States is discussed. Methods of technology flow, such as licensing and investing, are identified, and the advantages and disadvantages of technology transfer are discussed, especially in relation to the government's role. (MLH)

  16. Computer technology and evolution

    OpenAIRE

    Mainzer, Klaus

    1998-01-01

    Computer technology and evolution : from artificial intelligence to artificial life. - In: Advances in the philosophy of technology / ed. by Evandro Agazzi ... - Newark, Del. : Soc. for Philosophy and Technology, 1999. - S. 105-119

  17. Excimer Laser Technology

    CERN Document Server

    Basting, Dirk

    2005-01-01

    This comprehensive survey on Excimer Lasers investigates the current range of the technology, applications and devices of this commonly used laser source, as well as the future of new technologies, such as F2 laser technology. Additional chapters on optics, devices and laser systems complete this compact handbook. A must read for laser technology students, process application researchers, engineers or anyone interested in excimer laser technology. An effective and understandable introduction to the current and future status of excimer laser technology.

  18. Technology Transfer Report

    Science.gov (United States)

    2000-01-01

    Since its inception, Goddard has pursued a commitment to technology transfer and commercialization. For every space technology developed, Goddard strives to identify secondary applications. Goddard then provides the technologies, as well as NASA expertise and facilities, to U.S. companies, universities, and government agencies. These efforts are based in Goddard's Technology Commercialization Office. This report presents new technologies, commercialization success stories, and other Technology Commercialization Office activities in 1999.

  19. Technology transfer by multinationals

    OpenAIRE

    Kostyantyn Zuzik

    2003-01-01

    The paper analyses the issue of technology transfer by multinational corporations. The following questions are explored: (a) world market of technologies, the role of MNCs (b) Choice of the technology transfer mode, Dunning's OLI-theory as a factor of the choice of the mode of transfer (c) measurement and profitability of technology transfer (d) transfer of technology through partnerships, JVs, alliances and through M&As (e) aspects of technology transfer by services multinationals. Paper uti...

  20. Morgantown Energy Technology Center, technology summary

    International Nuclear Information System (INIS)

    1994-06-01

    This document has been prepared by the DOE Environmental Management (EM) Office of Technology Development (OTD) to highlight its research, development, demonstration, testing, and evaluation activities funded through the Morgantown Energy Technology Center (METC). Technologies and processes described have the potential to enhance DOE's cleanup and waste management efforts, as well as improve US industry's competitiveness in global environmental markets. METC's R ampersand D programs are focused on commercialization of technologies that will be carried out in the private sector. META has solicited two PRDAs for EM. The first, in the area of groundwater and soil technologies, resulted in twenty-one contact awards to private sector and university technology developers. The second PRDA solicited novel decontamination and decommissioning technologies and resulted in eighteen contract awards. In addition to the PRDAs, METC solicited the first EM ROA in 1993. The ROA solicited research in a broad range of EM-related topics including in situ remediation, characterization, sensors, and monitoring technologies, efficient separation technologies, mixed waste treatment technologies, and robotics. This document describes these technology development activities

  1. Constructive Technology Assessmentand Technology Dynamics. The Case of Clean Technologies

    NARCIS (Netherlands)

    Schot, Johan

    1992-01-01

    A synthesis of neo-Schumpeterian evolutionary, sociological, and historical coevolution ary models could be used for constructive technology assessment, aimed at the active management of the process of technological change. This article proposes a synthetic quasi-evolutionary model, in which

  2. Fundamentals of technology roadmapping

    Energy Technology Data Exchange (ETDEWEB)

    Garcia, M.L.; Bray, O.H.

    1997-04-01

    Technology planning is important for many reasons. Globally, companies are facing many competitive problems. Technology roadmapping, a form of technology planning can help deal with this increasingly competitive environment. While it has been used by some companies and industries, the focus has always been on the technology roadmap as a product, not on the process. This report focuses on formalizing the process so that it can be more broadly and easily used. As a DOE national security laboratory with R&D as a major product, Sandia must do effective technology planning to identify and develop the technologies required to meet its national security mission. Once identified, technology enhancements or new technologies may be developed internally or collaboratively with external partners. For either approach, technology roadmapping, as described in this report, is an effective tool for technology planning and coordination, which fits within a broader set of planning activities. This report, the second in a series on technology roadmapping, develops and documents this technology roadmapping process, which can be used by Sandia, other national labs, universities, and industry. The main benefit of technology roadmapping is that it provides information to make better technology investment decisions by identifying critical technologies and technology gaps and identifying ways to leverage R&D investments. It can also be used as a marketing tool. Technology roadmapping is critical when the technology investment decision is not straight forward. This occurs when it is not clear which alternative to pursue, how quickly the technology is needed, or when there is a need to coordinate the development of multiple technologies. The technology roadmapping process consists of three phases - preliminary activity, development of the technology roadmap, and follow-up activity.

  3. Educational Technology in China

    Science.gov (United States)

    Meifeng, Liu; Jinjiao, Lv; Cui, Kang

    2010-01-01

    This paper elaborates the two different academic views of the identity of educational technology in China at the current time--advanced-technology-oriented cognition, known as Electrifying Education, and problem-solving-oriented cognition, known as Educational Technology. It addresses five main modes of educational technology in China: as a…

  4. EPA'S ENVIRONMENTAL TECHNOLOGIES

    Science.gov (United States)

    The use of innovative technology is impeded by the lack of independent, credible information as to how the technology performs. Such data is needed by technology buyers and regulatory decision makers to make informed decisions on technologies that represent good financial invest...

  5. Emerging technology and ethics

    CERN Document Server

    Wakunuma, Kutoma

    2011-01-01

    This e-book on Emerging Technologies and Ethics includes a collection of essays which explore the future and ethics of emerging information and communication technologies. Articles in the collection include an overview of the legal implications which may be relevant to the ethical aspects of emerging technologies and also ethical issues arising from the mass-take up of mobile technologies.

  6. Student Technology Assistant Programs.

    Science.gov (United States)

    Van Eck, Rick; Marvin, Eric; Burr-McNeal, Blake; Jones, Marshall; Lowther, Deborah

    Schools face significant challenges in implementing computing technology within their curriculum. When technology support falters, the integrity of a school district's entire technology program is at risk. Teachers who have invested time to develop lesson plans using technology, especially those who are still newcomers, are less likely to continue…

  7. Marketing technology in macroeconomics.

    Science.gov (United States)

    Tamegawa, Kenichi

    2012-01-01

    In this paper, we incorporate a marketing technology into a dynamic stochastic general equilibrium model by assuming a matching friction for consumption. An improvement in matching can be interpreted as an increase in matching technology, which we call marketing technology because of similar properties. Using a simulation analysis, we confirm that a positive matching technology shock can increase output and consumption.

  8. Marketing technologically advanced products

    NARCIS (Netherlands)

    Bender, Horst

    1989-01-01

    This paper calls for a merger of technology and marketing under a customer value perspective; for an enhancement of the traditional technological innovation orientation of the technology-based firm with a market thrust. It establishes technology-based products as product-service offerings that are

  9. Soil washing technology evaluation

    International Nuclear Information System (INIS)

    Suer, A.

    1995-04-01

    Environmental Restoration Engineering (ERE) continues to review innovative, efficient, and cost effective technologies for SRS soil and/or groundwater remediation. As part of this effort, this technical evaluation provides review and the latest information on the technology for SRS soil remediation. Additional technology evaluation reports will be issued periodically to update these reports. The purpose of this report is to review the soil washing technology and its potential application to SRS soil remediation. To assess whether the Soil Washing technology is a viable option for SRS soil remediation, it is necessary to review the technology/process, technology advantages/limitations, performance, applications, and cost analysis

  10. NASA Technology Transfer System

    Science.gov (United States)

    Tran, Peter B.; Okimura, Takeshi

    2017-01-01

    NTTS is the IT infrastructure for the Agency's Technology Transfer (T2) program containing 60,000+ technology portfolio supporting all ten NASA field centers and HQ. It is the enterprise IT system for facilitating the Agency's technology transfer process, which includes reporting of new technologies (e.g., technology invention disclosures NF1679), protecting intellectual properties (e.g., patents), and commercializing technologies through various technology licenses, software releases, spinoffs, and success stories using custom built workflow, reporting, data consolidation, integration, and search engines.

  11. Physics and high technology

    International Nuclear Information System (INIS)

    Shao Liqin; Ma Junru.

    1992-01-01

    At present, the development of high technology has opened a new chapter in world's history of science and technology. This review describes the great impact of physics on high technology in six different fields (energy technology, new materials, information technology, biotechnology, space technology, and Ocean technology). It is shown that the new concepts and new methods created in physics and the special conditions and measurements established for physics researches not only deepen human's knowledge about nature but also point out new directions for engineering and technology. The achievements in physics have been more and more applied to high technology, while the development of high technology has explored some new research areas and raised many novel, important projects for physics. Therefore, it is important for us to strengthen the research on these major problems in physics

  12. Advancement in Engineering Technology

    DEFF Research Database (Denmark)

    Kalia, Kartik; Rehman, M. Atiqur; Hussain, Dil muhammed Akbar

    2016-01-01

    but to harvest those ideas, technology is a must. With the huge requirement of engineering equipment's, the industry needs specialists who can manage and operate these technologies. Detailed information about the merits and demerits of technology is also mentioned in this paper. Findings: Technology has affected...... the environment on a great scale; in some cases, technology is even replacing human being or use of manpower. So proper counter measures have been mentioned, which can be used to control and limit harmful effect....

  13. Newnes communications technology handbook

    CERN Document Server

    Lewis, Geoff

    1994-01-01

    Newnes Communications Technology Handbook provides a discussion on different topics relevant to communications technology. The book is comprised of 39 chapters that tackle a wide variety of concern in communications technology. The coverage of the text includes technologies, such as analog digital communications systems, radio frequency receiver, and satellite systems. The book also discusses some methods and techniques used in communications technology, including mixer signal processing, modulation and demodulation, and spread spectrum techniques. The text will be of great use to engineers, t

  14. EV Charging Through Wireless Power Transfer: Analysis of Efficiency Optimization and Technology Trends

    Energy Technology Data Exchange (ETDEWEB)

    Miller, John M [ORNL; Rakouth, Heri [Delphi Automotive Systems, USA; Suh, In-Soo [Korea Advanced Institute of Science and Technology

    2012-01-01

    program geared toward a safer, greener and more connected driving. Moreover, it draws from and adds to Dr. Andrew Brown Jr.'s SAE books 'Active Safety and the Mobility Industry', 'Connectivity and Mobility Industry', and 'Green Technologies and the Mobility Industry'. Magnetic resonant coupling is the foundation of modern wireless power transfer. Its efficiency can be controlled through impedance matching and magnetic field shaping. Current implementations use one or both of these control methods and enable both stationary and mobile charging with typical efficiency within the 80% and 90% range for an air gap up to 25 cm.

  15. Emerging Technologies Integrating Technology into Study Abroad

    Science.gov (United States)

    Godwin-Jones, Robert

    2016-01-01

    "Ready access to travel and to technology-enhanced social networking (e.g., Facebook or Skype) has changed the nature of study abroad to the point where today's experiences are fundamentally different from those of earlier eras" (Kinginger, 2013a, p. 345). In addition to more travel options and greater technology availability, study…

  16. Educational technology and the new technologies

    NARCIS (Netherlands)

    Verhagen, Pleunes Willem; Plomp, T.

    1989-01-01

    Like everywhere in our culture, new technologies gradually penetrate the field of education. This may be seen as a problem area, which asks for appropriate, actions by teachers, curriculum experts, instructional designers and others. As "technology" seems to be the main issue,one may quation whether

  17. Search Technologies | NCI Technology Transfer Center | TTC

    Science.gov (United States)

    Our team of technology transfer specialists has specialized training in invention reporting, patenting, patent strategy, executing technology transfer agreements and marketing. TTC is comprised of professionals with diverse legal, scientific, and business/marketing expertise. Most of our staff hold doctorate-level technical and/or legal training.

  18. Available Technologies | NCI Technology Transfer Center | TTC

    Science.gov (United States)

    Our team of technology transfer specialists has specialized training in invention reporting, patenting, patent strategy, executing technology transfer agreements and marketing. TTC is comprised of professionals with diverse legal, scientific, and business/marketing expertise. Most of our staff hold doctorate-level technical and/or legal training.

  19. African Journal of Environmental Science and Technology - Vol 9 ...

    African Journals Online (AJOL)

    Scrap metals' role in circular economy in Ghana, using Sunyani as a case study · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Andrews Nkansah, Francis Attiogbe, Engelbert Kumi, 793-799. http://dx.doi.org/10.5897/AJEST2015.2000 ...

  20. SHARED TECHNOLOGY TRANSFER PROGRAM

    Energy Technology Data Exchange (ETDEWEB)

    GRIFFIN, JOHN M. HAUT, RICHARD C.

    2008-03-07

    The program established a collaborative process with domestic industries for the purpose of sharing Navy-developed technology. Private sector businesses were educated so as to increase their awareness of the vast amount of technologies that are available, with an initial focus on technology applications that are related to the Hydrogen, Fuel Cells and Infrastructure Technologies (Hydrogen) Program of the U.S. Department of Energy. Specifically, the project worked to increase industry awareness of the vast technology resources available to them that have been developed with taxpayer funding. NAVSEA-Carderock and the Houston Advanced Research Center teamed with Nicholls State University to catalog NAVSEA-Carderock unclassified technologies, rated the level of readiness of the technologies and established a web based catalog of the technologies. In particular, the catalog contains technology descriptions, including testing summaries and overviews of related presentations.

  1. ACR-700 advanced technologies

    International Nuclear Information System (INIS)

    Tapping, R.L.; Turner, C.W.; Yu, S.K.W.; Olmstead, R.; Speranzini, R.A.

    2004-01-01

    A successful advanced reactor plant will have optimized economics including reduced operating and maintenance costs, improved performance, and enhanced safety. Incorporating improvements based on advanced technologies ensures cost, safety and operational competitiveness of the ACR-700. These advanced technologies include modern configuration management; construction technologies; operational technology for the control centre and information systems for plant monitoring and analysis. This paper summarizes the advanced technologies used to achieve construction and operational improvements to enhance plant economic competitiveness, advances in the operational technology used for reactor control, and presents the development of the Smart CANDU suite of tools and its application to existing operating reactors and to the ACR-700. (author)

  2. Avionics systems integration technology

    Science.gov (United States)

    Stech, George; Williams, James R.

    1988-01-01

    A very dramatic and continuing explosion in digital electronics technology has been taking place in the last decade. The prudent and timely application of this technology will provide Army aviation the capability to prevail against a numerically superior enemy threat. The Army and NASA have exploited this technology explosion in the development and application of avionics systems integration technology for new and future aviation systems. A few selected Army avionics integration technology base efforts are discussed. Also discussed is the Avionics Integration Research Laboratory (AIRLAB) that NASA has established at Langley for research into the integration and validation of avionics systems, and evaluation of advanced technology in a total systems context.

  3. The Human Technology

    DEFF Research Database (Denmark)

    Fausing, Bent

    towards this very special and lost humanity. Without the technology, no special humanity is the prophecy. This personification or anthropomorphism is important for the branding of new technology. The technology is seen as creating a technotranscendens towards a more qualified humanity, which is in contact...... with fundamental human values like intuition, vision and sensing; all the qualities the technology, the industrialisation and rationalisation, or in short modernity, has been criticized for having taken away from human existence. What technology has taken away now comes back through new technology as an aid...

  4. [Health technology in Mexico].

    Science.gov (United States)

    Cruz, C; Faba, G; Martuscelli, J

    1992-01-01

    The features of the health technology cycle are presented, and the effects of the demographic, epidemiologic and economic transition on the health technology demand in Mexico are discussed. The main problems of science and technology in the context of a decreasing scientific and technological activity due to the economic crisis and the adjustment policies are also analyzed: administrative and planning problems, low impact of scientific production, limitations of the Mexican private sector, and the obstacles for technology assessment. Finally, this paper also discusses the main support strategies for science and technology implemented by the Mexican government during the 1980s and the challenges and opportunities that lie ahead.

  5. Bringing Real World Underwater Science, Engineering and Technology in Tomorrow's Classroom

    Science.gov (United States)

    Livingston, C.

    2012-04-01

    What do Remotely Operated Vehicles (ROVs), Ocean Science, Engineering and Technology have in common with science education in today's classroom? They all meet the growing demand for science, technology, engineering, and mathematics (STEM) professionals in tomorrow's U.S. workforce. Engaging students in real world science experiences will help them develop skills such as critical thinking, problem solving, collaboration, communication, innovation, and creativity. These skills are crucial to building a strong, competitive workforce in an integrated global economy. Fifth grade students from St. Andrew's School of Math and Science in Charleston, SC, USA science classes were introduced to engineering and robotics by using a combination of two underwater ROVs programs from the Office of Naval Research (SeaPerch) and Marine Advanced Technology Education (MATE). Students were grouped in teams as "real scientists" to design and construct a ROV. Students selected their role from a list of engineering positions, and researched how to construct the best ROV. Students created blueprints and models of their ROV design. Scientists/engineers from various local agencies were scheduled to come and share their expertise with the students. On World Ocean Day, a presentation was planned for fifth grade students to work closely with kindergarten through fourth grade students. The purpose of the day was two-fold; it provided students the opportunity to peer teach and the opportunity to present their experiences to a wide audience. All students presented their designs and demonstrated their ROV's movement capabilities in child size pools. They also modeled how submersible pilots communicate with scientists and other researchers while operating their newly designed ROV. As a culminating event, students visited a local marine science high school class with similar ROVs and evaluated their engineering designs in a fresh water pond.

  6. Focus on Technologies: Worry or Technology?

    Directory of Open Access Journals (Sweden)

    Saulius Kanišauskas

    2015-10-01

    Full Text Available The paper analyses different attitudes towards technologies in contemporary philosophical discourses. It points out that classical notion of technology formulated by Martin Heidegger seems to be more and more often questioned and even forgotten. As a result, it is being replaced by the theory of determinism, according to which the change of technologies determines the changes in social systems, the human being including. This happens this way and not vice versa. Nowadays technē, or “technika” (in English: technology is mostly understood in the instrumental meaning or in the meaning of power. It is considered to be a powerful means, tool or mechanism to influence, change, control and manipulate human consciousness and human feelings. Despite the fact that technologies have already been tamed, the problem of huge responsibility for using and developing them arises. It is questioned whether the increasing society’s attention to modern technologies is not a particular “technology” of the postmodern capitalism to manipulate social consciousness. In parallel with “yes” answer to this question, Albert Borgmann’s idea that the causes of technological development have an ontological dimension, i.e. the causes are rooted in the nature of human beings themselves and their desire to adore own creativity, is discussed. Thus, it becomes necessary to probe deeper into the nature of creativity.

  7. General survey of technology management

    Energy Technology Data Exchange (ETDEWEB)

    Shin, Yong Ha; Jang Dong Hun; Lee, In Woo

    1999-02-15

    The content of this book are technology and management, conception of technology management, feature and model of technology management system, elements of technology management, performance measurement of technology management, connectivity between technology and business function, system management of technology, manpower management, readership and technology management, motivation and technology management, management of technical investment evaluation, new item development and marketing, product liability management, intellectual property rights and transfer of technology.

  8. General survey of technology management

    International Nuclear Information System (INIS)

    Shin, Yong Ha; Jang Dong Hun; Lee, In Woo

    1999-02-01

    The content of this book are technology and management, conception of technology management, feature and model of technology management system, elements of technology management, performance measurement of technology management, connectivity between technology and business function, system management of technology, manpower management, readership and technology management, motivation and technology management, management of technical investment evaluation, new item development and marketing, product liability management, intellectual property rights and transfer of technology.

  9. Photon technology. Laser processing technology; Photon technology. Laser process gijutsu

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1996-03-01

    Survey has been conducted to develop laser processing technology utilizing the interaction between substance and photon. This is a part of the leading research on photon technology development. The photon technology development is aimed at novel technology development highly utilizing the quantum nature of photons. In the field of laser processing, high quality photons are used as tools, special functions of atoms and molecules will be discovered, and processing for functional fabrication (photon machining) will be established. A role of laser processing in industries has become significant, which is currently spreading not only into cutting and welding of materials and scalpels but also into such a special field as ultrafine processing of materials. The spreading is sometimes obstructed due to the difficulty of procurement of suitable machines and materials, and the increase of cost. The purpose of this study is to develop the optimal laser technology, to elucidate the interaction between substance and photon, and to develop the laser system and the transmission and regulation systems which realize the optimal conditions. 387 refs., 115 figs., 25 tabs.

  10. CSIR Technology Impact 1996

    CSIR Research Space (South Africa)

    CSIR

    1996-01-01

    Full Text Available This issue of Technology Impact offers a brief snapshot of CSIR activities during the year under review by highlighting a number of innovative projects and initiatives in these areas. It presents a rich canvas portrays technology solutions...

  11. Resources, Technology, and Strategy

    DEFF Research Database (Denmark)

    Resources, Technology and Strategy brings together contributors from Europe, North America and Asia to consider the strategic relationship between technology and other resources, such as production capabilities, marketing prowess, finance and organisational culture. Throughout the book...

  12. Solar Thermal Energy Technology

    Energy Technology Data Exchange (ETDEWEB)

    Cason, D.L.; Pitsenbarger, J. [eds.

    1996-02-01

    Solar Thermal Energy Technology (PST) announces on a bimonthly basis the current worldwide research and development information that would expand the technology base required for the advancement of solar thermal systems as a significant energy resource.

  13. INFORMATION TECHNOLOGIES IN TOURISM

    OpenAIRE

    Radka Tosheva; Aleksandrina Gancheva

    2016-01-01

    In this article the focus is on the role of information technology in tourism, tourism business, electronic payments, software used by tourist companies, new technologies for online advertising and shopping, software for mobile devices.

  14. Technology in Residence.

    Science.gov (United States)

    Fox, Jordan

    1999-01-01

    Discusses the necessity for incorporating current technology in today's college residence halls to meet the more diverse and continued activities of its students. Technology addressed covers data networking and telecommunications, heating and cooling systems, and fire-safety systems. (GR)

  15. Technology Readiness Level Guidebook

    Science.gov (United States)

    2017-09-01

    This guidebook provides the necessary information for conducting a Technology Readiness Level (TRL) Assessment. TRL Assessments are a tool for determining the maturity of technologies and identifying next steps in the research process. This guidebook...

  16. Assisted Reproductive Technology (ART)

    Science.gov (United States)

    ... Share Facebook Twitter Pinterest Email Print Assisted Reproductive Technology (ART) ART refers to treatments and procedures that ... American Society for Reproductive Medicine. (2015). Assisted reproductive technologies: A guide for patients . Retrieved May 31, 2016, ...

  17. Genealogies of Modern Technology

    DEFF Research Database (Denmark)

    Riis, Søren

    2008-01-01

    Does modern technology differ from ancient technology and does it have a unique essence? This twofold question opens one of Martin Heidegger's most influential philosophical inquiries, The Question Concerning Technology. The answer Heidegger offers has inspired various critiques and appraisals from...... a vast number of contemporary scholars of technology.1 Heidegger's answer is traditionally thought to suggest a great difference between ancient and modern technology. However, by re-examining Heidegger's text, it is possible to discover previously ignored or misunderstood lines of thoughts that affirm...... a multi-stable interpretation of the origin of modern technology. In what follows, we shall see how The Question Concerning Technology in fact supports three different genealogies of modern technology...

  18. Technology Implementation Plan

    DEFF Research Database (Denmark)

    Jensen, Karsten Ingerslev; Schultz, Jørgen Munthe

    The Technology Implementation Plan (TIP) describes the main project results and the intended future use. The TIP is confidential.......The Technology Implementation Plan (TIP) describes the main project results and the intended future use. The TIP is confidential....

  19. Crystal-Clear Technology.

    Science.gov (United States)

    Ondris-Crawford, Renate J.; And Others

    1993-01-01

    Provides diagrams to aid in discussing polymer dispersed liquid crystal (PDLC) technology. Equipped with a knowledge of PDLC, teachers can provide students with insight on how the gap between basic science and technology is bridged. (ZWH)

  20. Technology licensing in China

    DEFF Research Database (Denmark)

    Wang, Yuandi; Li-Ying, Jason; Chen, Jin

    2015-01-01

    We explore the landscape of technology licensing among Chinese entities in the period 2000–12, using a unique database on technological licensing from the State Intellectual Property Office of China. We find that: first, among Chinese licensee organizations, firms have dominated in terms of the n......We explore the landscape of technology licensing among Chinese entities in the period 2000–12, using a unique database on technological licensing from the State Intellectual Property Office of China. We find that: first, among Chinese licensee organizations, firms have dominated in terms...... of the number of licensed technologies; second, the geographical distribution of licensed technologies among the provinces has gradually reached a new quantitative balance; third, utility models are the most popular technologies to be licensed and the majority of technology licensing in China has been between...

  1. Environmental technology verification methods

    CSIR Research Space (South Africa)

    Szewczuk, S

    2016-03-01

    Full Text Available Environmental Technology Verification (ETV) is a tool that has been developed in the United States of America, Europe and many other countries around the world to help innovative environmental technologies reach the market. Claims about...

  2. Clean Air Technology Center

    Science.gov (United States)

    The Clean Air Technology Center provides resources for emerging and existing air pollution prevention and control technologies and provides public access to data and information on their use, effectiveness and cost.

  3. CSIR Technology Impact 1994

    CSIR Research Space (South Africa)

    CSIR

    1994-01-01

    Full Text Available This issue of Technology Impact offers a brief snapshot of CSIR activities during the year under review by highlighting a number of innovative projects and initiatives in these areas. It presents a rich canvas portrays technology solutions...

  4. INFORMATION TECHNOLOGIES IN TOURISM

    Directory of Open Access Journals (Sweden)

    Radka Tosheva

    2016-12-01

    Full Text Available In this article the focus is on the role of information technology in tourism, tourism business, electronic payments, software used by tourist companies, new technologies for online advertising and shopping, software for mobile devices.

  5. Ship propulsion reactors technology

    International Nuclear Information System (INIS)

    Fribourg, Ch.

    2002-01-01

    This paper takes the state of the art on ship propulsion reactors technology. The french research programs with the corresponding technological stakes, the reactors specifications and advantages are detailed. (A.L.B.)

  6. Dismantling technologies trends

    International Nuclear Information System (INIS)

    Devaux, P.

    2009-01-01

    In this work dismantling technologies trends realized by the CEA are reviewed. There following technologies are presented: Data acquisition from facilities; Scenario studies; Remote handling and carriers; Dismantling techniques; Decontamination.

  7. TECHNOLOGICAL IMPLEMENTATION PLAN

    DEFF Research Database (Denmark)

    Bellini, Anna

    2004-01-01

    This document has the purpose to describe the technological implementation plan in the IDEAL project.......This document has the purpose to describe the technological implementation plan in the IDEAL project....

  8. CSIR Technology Impact 1993

    CSIR Research Space (South Africa)

    CSIR

    1993-01-01

    Full Text Available This issue of Technology Impact offers a brief snapshot of CSIR activities during the year under review by highlighting a number of innovative projects and initiatives in these areas. It presents a rich canvas portrays technology solutions...

  9. CSIR Technology Impact 2000

    CSIR Research Space (South Africa)

    CSIR

    2000-01-01

    Full Text Available This millennium issue of Technology Impact celebrates the CSIR's contributions during the transitional 1999/2000 year. It presents a rich canvas portrays technology solutions and information which have touched the lives of people both within...

  10. CSIR Technology Impact 1999

    CSIR Research Space (South Africa)

    CSIR

    1999-01-01

    Full Text Available This issue of Technology Impact offers a brief snapshot of CSIR activities during the year under review by highlighting a number of innovative projects and initiatives in these areas. It presents a rich canvas portrays technology solutions...

  11. Fusion technology (FT)

    International Nuclear Information System (INIS)

    1978-01-01

    The annual report of tha fusion technology (FT) working group discusses the projects carried out by the participating institutes in the fields of 1) fuel injection and plasma heating, 2) magnetic field technology, and 3) systems investigations. (HK) [de

  12. ADVANTAGES OF GREEN TECHNOLOGY

    OpenAIRE

    Ghanshyam Das Soni

    2017-01-01

    Technology is application of knowledge to practical requirements. Green technologies encompass various aspects of technology which help us reduce the human impact on the environment and create ways of sustainable development. Social equitability, economic feasibility and sustainability are the key parameters for green technologies. Today the environment is racing towards the tipping point at which we would have done permanent irreversible damage to the planet earth. Our current actions are pu...

  13. New Mobile Technologies

    DEFF Research Database (Denmark)

    Tan, Su-En; Henten, Anders

    2006-01-01

    This paper takes a look at Clayton Christensen 's theory of disruptive technologies and how Christensen's theory relates to other innovation theories. It also proposes a new layer of analysis to this theory to better link the technology analysis to the market analysis of any given technology...... product. This layer suggests that complementarity and substitutability are important criteria for technologies to be market disruptions or sustaining changes....

  14. Emerging Technologies for Telemedicine

    Science.gov (United States)

    Minh, Cao Duc; Antoku, Yasuaki; Torata, Nobuhiro; Kudo, Kuriko; Okamura, Koji; Nakashima, Naoki; Tanaka, Masao

    2012-01-01

    This paper focuses on new technologies that are practically useful for telemedicine. Three representative systems are introduced: a Digital Video Transport System (DVTS), an H.323 compatible videoconferencing system, and Vidyo. Based on some of our experiences, we highlight the advantages and disadvantages of each technology, and point out technologies that are especially targeted at doctors and technicians, so that those interested in using similar technologies can make appropriate choices and achieve their own goals depending on their specific conditions. PMID:22563284

  15. Developments in lubricant technology

    CERN Document Server

    Srivastava, S P

    2014-01-01

    Provides a fundamental understanding of lubricants and lubricant technology including emerging lubricants such as synthetic and environmentally friendly lubricants Teaches the reader to understand the role of technology involved in the manufacture of lubricants Details both major industrial oils and automotive oils for various engines Covers emerging lubricant technology such as synthetic and environmentally friendly lubricants Discusses lubricant blending technology, storage, re-refining and condition monitoring of lubricant in equipment

  16. Rationalizing social technologies

    OpenAIRE

    V V Scherbina

    2016-01-01

    The article considers the problem of defining the specifics and types of social technologies (hereinafter ST). The author pursues the following objectives: first, to clarify the specific features of social technologies; second, to identify the grounds for classifying the existing types of social technologies; third, to describe the basic characteristics (functions, tasks, tools, the scope and limits of application, and ideological bases) of social technologies; fourth, to identify the basic f...

  17. NASA Astrophysics Technology Needs

    Science.gov (United States)

    Stahl, H. Philip

    2012-01-01

    July 2010, NASA Office of Chief Technologist (OCT) initiated an activity to create and maintain a NASA integrated roadmap for 15 key technology areas which recommend an overall technology investment strategy and prioritize NASA?s technology programs to meet NASA?s strategic goals. Science Instruments, Observatories and Sensor Systems(SIOSS) roadmap addresses technology needs to achieve NASA?s highest priority objectives -- not only for the Science Mission Directorate (SMD), but for all of NASA.

  18. Consuming technologies - developing routines

    DEFF Research Database (Denmark)

    Gram-Hanssen, Kirsten

    2008-01-01

    technologies and in this article these processes will be investigated from three different perspectives: an historical perspective of how new technologies have entered homes, a consumer perspective of how both houses and new technologies are purchased and finally, as the primary part of the article, a user...... perspective of how routines develop while these technologies are being used. In the conclusion these insights are discussed in relation to possible ways of influencing routines....

  19. Magnetic fusion technology

    CERN Document Server

    Dolan, Thomas J

    2014-01-01

    Magnetic Fusion Technology describes the technologies that are required for successful development of nuclear fusion power plants using strong magnetic fields. These technologies include: ? magnet systems, ? plasma heating systems, ? control systems, ? energy conversion systems, ? advanced materials development, ? vacuum systems, ? cryogenic systems, ? plasma diagnostics, ? safety systems, and ? power plant design studies. Magnetic Fusion Technology will be useful to students and to specialists working in energy research.

  20. Frontiers in biochip technology

    National Research Council Canada - National Science Library

    Xing, Wan-Li; Cheng, Jing

    2006-01-01

    ... . . . . . . . . . . . . . . . . . . . . . . . . . . . . Haiching Ma, Yuan Wang, Amy S. Pomaybo, and Connie Tsai 2. Improvement of Microarray Technologies for Detecting Single Nucleotide Mismatch...

  1. Conducting a Technology Audit

    Science.gov (United States)

    Flaherty, William

    2011-01-01

    Technology is a critical component in the success of any high-functioning school district, thus it is important that education leaders should examine it closely. Simply put, the purpose of a technology audit is to assess the effectiveness of the technology for administrative or instructional use. Rogers Public Schools in Rogers, Arkansas, recently…

  2. Selecting Security Technology Providers

    Science.gov (United States)

    Schneider, Tod

    2009-01-01

    The world of security technology holds great promise, but it is fraught with opportunities for expensive missteps and misapplications. The quality of the security technology consultants and system integrators one uses will have a direct bearing on how well his school masters this complex subject. Security technology consultants help determine…

  3. Sex, Technology and Morality.

    Science.gov (United States)

    Case, Verna; And Others

    1986-01-01

    Provides an overview of the course "Sex, Technology, and Morality" which focuses on the human reproductive process and examines the advances in reproductive technology. The course emphasizes the social, political, and ethical implications of actual and possible technologies associated with human reproduction. (ML)

  4. Technological Style is History

    DEFF Research Database (Denmark)

    Blond, Lasse

    The effort to comprehend innovation across cultures and time highlights the importance of the explicating factors external to technology. It becomes relevant to nuance or differentiate the understanding of social and cultural responses to adopted technologies by recognizing that technology shapes...

  5. JAPAN'S TECHNOLOGY TRADE

    OpenAIRE

    Hagiwara, Taiji

    1994-01-01

    Japan's technology balance of trade has improved over the last twenty years. The position of Japan is examined through (1) comparison with other OECD countries, (2) the historical change in Japan's technology trade at the industry level, (3) Toshiba's technology trade as a typical case. The conclusion is that Japan is still behind the frontier of innovation.

  6. Power Technologies Data Book

    Energy Technology Data Exchange (ETDEWEB)

    Goldstein, L.

    2002-09-01

    This report, prepared by NREL's Energy Analysis Office, includes up-to-date information on power technologies, including complete technology profiles. The data book also contains charts on electricity restructuring, power technology forecasts and comparisons, electricity supply, electricity capability, electricity generation, electricity demand, prices, economic indicators, environmental indicators, conversion factors, and selected congressional questions and answers.

  7. Exploring Technology Education.

    Science.gov (United States)

    Van Duzer, Eric

    Modular middle school technology programs, generically called Exploring Technology Education (ETE) courses, are described and analyzed to determine their strengths and weaknesses and their appropriate role in middle school curricula. Interviews were conducted with teachers, officers of the Exploring Technology Educators Association, vendors and…

  8. Advanced manufacturing: Technology diffusion

    Energy Technology Data Exchange (ETDEWEB)

    Tesar, A.

    1995-12-01

    In this paper we examine how manufacturing technology diffuses rom the developers of technology across national borders to those who do not have the capability or resources to develop advanced technology on their own. None of the wide variety of technology diffusion mechanisms discussed in this paper are new, yet the opportunities to apply these mechanisms are growing. A dramatic increase in technology diffusion occurred over the last decade. The two major trends which probably drive this increase are a worldwide inclination towards ``freer`` markets and diminishing isolation. Technology is most rapidly diffusing from the US In fact, the US is supplying technology for the rest of the world. The value of the technology supplied by the US more than doubled from 1985 to 1992 (see the Introduction for details). History shows us that technology diffusion is inevitable. It is the rates at which technologies diffuse to other countries which can vary considerably. Manufacturers in these countries are increasingly able to absorb technology. Their manufacturing efficiency is expected to progress as technology becomes increasingly available and utilized.

  9. Optimizing Computer Technology Integration

    Science.gov (United States)

    Dillon-Marable, Elizabeth; Valentine, Thomas

    2006-01-01

    The purpose of this study was to better understand what optimal computer technology integration looks like in adult basic skills education (ABSE). One question guided the research: How is computer technology integration best conceptualized and measured? The study used the Delphi method to map the construct of computer technology integration and…

  10. Creative Technology and Rap

    Science.gov (United States)

    Ch'ien, Evelyn

    2011-01-01

    This paper describes how a linguistic form, rap, can evolve in tandem with technological advances and manifest human-machine creativity. Rather than assuming that the interplay between machines and technology makes humans robotic or machine-like, the paper explores how the pressure of executing artistic visions using technology can drive…

  11. Technology in Education

    Science.gov (United States)

    Roden, Kasi

    2011-01-01

    This paper was written to support a position on using technology in education. The purpose of this study was to support the use of technology in education by synthesizing previous research. A variety of sources including books and journal articles were studied in order to compile an overview of the benefits of using technology in elementary,…

  12. Connecting Technology and Learning.

    Science.gov (United States)

    Woolley, Ginny

    1998-01-01

    Teacher training programs must go beyond "how-to" workshops to facilitate understanding about technology's relationship to learning. An International School of Bangkok training program transforms teachers into learners immersed in technology-rich environments. The process involves seven phases: getting ready, learning about technology,…

  13. Materials and technology

    International Nuclear Information System (INIS)

    Gockel, E.; Simon, J.

    1998-01-01

    New materials and the processes for their economical fabrication and use are the factors which drive innovation in totally different fields of technology, such as energy engineering, transport, and information. But they also open up new fields of technology such as micro systems or medicine technology. Five out of a total of twelve articles are separately listed in the ENERGY database [de

  14. Lucas Heights technology park

    International Nuclear Information System (INIS)

    1987-01-01

    The proposed Lucas Heights Technology Park will pound together the applied research programs of Government, tertiary and industry sectors, aiming to foster technology transfer particularly to the high-technology manufacturing industry. A description of the site is given along with an outline of the envisaged development, existing facilities and expertise. ills

  15. Teaching Information Technology Law

    Science.gov (United States)

    Taylor, M. J.; Jones, R. P.; Haggerty, J.; Gresty, D.

    2009-01-01

    In this paper we discuss an approach to the teaching of information technology law to higher education computing students that attempts to prepare them for professional computing practice. As information technology has become ubiquitous its interactions with the law have become more numerous. Information technology practitioners, and in particular…

  16. E-Business Technologies

    OpenAIRE

    Carmen TIMOFTE

    2007-01-01

    Internet technologies have revolutionized the business world by creating a global online marketplace. Appropriate understanding for the technologies and the impact of different design choices of technologies (including the Internet and open systems) dramatically affects both functional and non-functional aspects of the e-business solution.

  17. Education Technology Success Stories

    Science.gov (United States)

    West, Darrell M.; Bleiberg, Joshua

    2013-01-01

    Advances in technology are enabling dramatic changes in education content, delivery, and accessibility. Throughout history, new technologies have facilitated the exponential growth of human knowledge. In the early twentieth century, the focus was on the use of radios in education. But since then, innovators have seen technology as a way to improve…

  18. Education Technology Transformation

    Science.gov (United States)

    Kennedy, Mike

    2012-01-01

    Years ago, as personal computers and other technological advancements began to find their way into classrooms and other educational settings, teachers and administrators sought ways to use new technology to benefit students. The potential for improving education was clear, but the limitations of the available education technology made it difficult…

  19. Moralizing Food Technology

    DEFF Research Database (Denmark)

    Coff, Christian Eyde

    2015-01-01

    Food technologies are common on many levels in society and used by both food professionals and consumers. Food technologies are not neutral. They inform and shape the behaviour of people. This paper presents a theoretical framework for analysing the mediating role of food technology and its influ...

  20. Green technology in Taiwan

    International Nuclear Information System (INIS)

    Runderkamp, D.

    2010-01-01

    Taiwan is striving for leadership in the field of green Technologies. Solar cells and Light Emitting Diodes (LED) are the best examples of successful Taiwanese green technologies. Electronic vehicles and smart grids are giving new impetus to the Taiwanese export of high-quality technology. [nl

  1. From Information Technologies to Knowledge Technologies?

    OpenAIRE

    Auzelle, Jean-Philippe; Mayer, Frédérique; Lhoste, Pascal

    2006-01-01

    In spite of the large variety of technological means available today to obtain and share knowledge needed by the progress of our Society, the relation between the knowledge produced and the knowledge required is not sufficiently facilitated. This paper aims to provide a partial answer to this issue. It proposes a NIAM/ORM formalization of exchanges between producers and users of knowledge. The resulting model is used to analyse and to discuss the deficiencies of the current technologies as we...

  2. Brief: Managing computing technology

    International Nuclear Information System (INIS)

    Startzman, R.A.

    1994-01-01

    While computing is applied widely in the production segment of the petroleum industry, its effective application is the primary goal of computing management. Computing technology has changed significantly since the 1950's, when computers first began to influence petroleum technology. The ability to accomplish traditional tasks faster and more economically probably is the most important effect that computing has had on the industry. While speed and lower cost are important, are they enough? Can computing change the basic functions of the industry? When new computing technology is introduced improperly, it can clash with traditional petroleum technology. This paper examines the role of management in merging these technologies

  3. Applied Semantic Web Technologies

    CERN Document Server

    Sugumaran, Vijayan

    2011-01-01

    The rapid advancement of semantic web technologies, along with the fact that they are at various levels of maturity, has left many practitioners confused about the current state of these technologies. Focusing on the most mature technologies, Applied Semantic Web Technologies integrates theory with case studies to illustrate the history, current state, and future direction of the semantic web. It maintains an emphasis on real-world applications and examines the technical and practical issues related to the use of semantic technologies in intelligent information management. The book starts with

  4. Transferring Technology to Industry

    Science.gov (United States)

    Wolfenbarger, J. Ken

    2006-01-01

    This slide presentation reviews the technology transfer processes in which JPL has been involved to assist in transferring the technology derived from aerospace research and development to industry. California Institute of Technology (CalTech), the organization that runs JPL, is the leading institute in patents for all U.S. universities. There are several mechanisms that are available to JPL to inform industry of these technological advances: (1) a dedicated organization at JPL, National Space Technology Applications (NSTA), (2) Tech Brief Magazine, (3) Spinoff magazine, and (4) JPL publications. There have also been many start-up organizations and businesses from CalTech.

  5. Incubation of NASA technology

    Science.gov (United States)

    Olson, Richard

    1996-03-01

    Traditionally, government agencies have sought to transfer technology by licensing to large corporations. An alternative route to commercialization is through the entrepreneurial process: using government technology to assist new businesses in the environment of a business incubator. The NASA Ames Technology Commercialization Center, in Sunnyvale, California, is a business incubator used to commercialize NASA technology. In operation almost two years, it has helped twenty new, high technology ventures. Ice Management Systems is one of these. The Center is funded by NASA and operated by IC2, a think-tank associated with the University of Texas at Austin.

  6. Encouraging environmentally strategic technologies

    International Nuclear Information System (INIS)

    Heaton, G.R.

    1994-01-01

    Having moved beyond its initial absorption with controlling new technology, environmental policy today must focus more strongly on promoting the development and adoption of new technologies. World Resource Institute's (WRI) ongoing study of 'environmentally strategic technology' is addressed to this fundamental policy issue. The study proposes criteria for identifying such technology, offers a specific list, suggests the kinds of public policy changes necessary to encourage their development and finally presents a comparison of critical technology lists (from the White House, the European Community, Japan and the US Department of Defense). (TEC)

  7. Better Learning Through Technology

    Science.gov (United States)

    Mathieu, R. D.; National InstituteScience Education, College Level-One Team

    2000-12-01

    The Learning Through Technology (LT2) resource is designed to help college Science, Mathematics, Engineering and Technology (SMET) instructors: - understand why and how they should use technology-enhanced learning strategies; - shape the powerful emerging technologies into learning tools that better prepare college students for the 21st century; and - provide all their students more experience with, and a better appreciation for, SMET as a living enterprise. The LT2 website includes case studies of learning technology innovations at a variety of post-secondary institutions. Personal narratives of faculty and students cover virtually every logistical, technological, inter-personal, and political issue involved in adapting learning technologies into courses or curricula. The site also includes a wide array of lively first-person vignettes about learning technology experiences from around the country. Frequently Asked Questions is a quick stop for opinions, advice, and bits of wisdom from experienced learning technology users. Finally, the Team is developing user-friendly evaluation resources to help faculty assess the success of learning technologies in improving student learning. The LT2 site is an element of the NISE website "Innovations in SMET Education". This site is intended to help college faculty meet multiple challenging goals including: educating all students to be scientifically literate in a technological society, developing the ranks of future scientists and skilled technicians, and preparing K-12 science and math teachers. The "Innovations in SMET Education" website can be found at www.wcer.wisc.edu/nise/cl1 .

  8. Technology in geriatrics.

    Science.gov (United States)

    Pilotto, Alberto; Boi, Raffaella; Petermans, Jean

    2018-03-13

    Recently, the interest of industry, government agencies and healthcare professionals in technology for aging people has increased. The challenge is whether technology may play a role in enhancing independence and quality of life and in reducing individual and societal costs of caring. Information and communication technologies, i.e. tools aimed at communicating and informing, assistive technologies designed to maintain older peoples' independence and increasing safety, and human-computer interaction technologies for supporting older people with motility and cognitive impairments as humanoid robots, exoskeletons, rehabilitation robots, service robots and companion-type are interdisciplinary topics both in research and in clinical practice. The most promising clinical applications of technologies are housing and safety to guarantee older people remaining in their own homes and communities, mobility and rehabilitation to improve mobility and gait and communication and quality of life by reducing isolation, improve management of medications and transportation. Many factors impair a broad use of technology in older age, including psychosocial and ethical issues, costs and fear of losing human interaction. A substantial lack of appropriate clinical trials to establish the clinical role of technologies to improve physical or cognitive performances and/or quality of life of subjects and their caregivers may suggest that the classical biomedical research model may not be the optimal choice to evaluate technologies in older people. In conclusion, successful technology development requires a great effort in interdisciplinary collaboration to integrate technologies into the existing health and social service systems with the aim to fit into the older adults' everyday life.

  9. Technology Museums in Denmark

    DEFF Research Database (Denmark)

    Søndergaard, Morten Karnøe

    2012-01-01

    within wind power technology. Finally special attention is devoted to the Danish Technological Museum. A museum which is the oldest and most elaborate of all the technology museums. The museum covers virtually every technological breakthrough with any relevance in a Danish section, with a special focus......This article presents an exhibit review of some of the major technology museums in Denmark. First comes an introduction to the Danish museum ”landscape”. Second a total of six museums and their technology focused exhibits are presented. Among the museums are the Fisheries and Maritime Museum...... in Esbjerg, housing one of the most impressive and representative exhibitions on the technology behind the strong Danish maritime sector. Another museum being mentioned is the Energy Museum, which covers the background for some of the major breakthroughs performed in Denmark within this area; particularly...

  10. Technology and Global Change

    Science.gov (United States)

    Grübler, Arnulf

    2003-10-01

    Technology and Global Change describes how technology has shaped society and the environment over the last 200 years. Technology has led us from the farm to the factory to the internet, and its impacts are now global. Technology has eliminated many problems, but has added many others (ranging from urban smog to the ozone hole to global warming). This book is the first to give a comprehensive description of the causes and impacts of technological change and how they relate to global environmental change. Written for specialists and nonspecialists alike, it will be useful for researchers and professors, as a textbook for graduate students, for people engaged in long-term policy planning in industry (strategic planning departments) and government (R & D and technology ministries, environment ministries), for environmental activists (NGOs), and for the wider public interested in history, technology, or environmental issues.

  11. Sensor technology foresight

    DEFF Research Database (Denmark)

    Andersen, Per Dannemand; Jørgensen, Birte Holst; Rasmussen, Birgitte

    2001-01-01

    , robustness, dispensability, and the abilityto be self-calibrating. Future sensors are expected to be integrated systems with multiple applications. The market sectors most influenced by new sensor technology change from topic to topic. But a general conclusion is that health care is the marketsector most......The Sensor Technology Center A/S (STC) in co-operation with Risoe National Laboratory has carried out a sensor technology foresight in order to strengthen a strategic outlook on sensor technology. The technology foresight (with a timeframe of 2000 to2015) has been performed in the period October...... 2000 - September 2001. The conclusions of the sensor technology report are based on 1) a scanning of existing forward looking literature on sensor technology, 2) a number of workshops with Danish andinternational participants and 3) an international survey with 174 respondents. Half of the respondents...

  12. Promoting renewable energy technologies

    International Nuclear Information System (INIS)

    Grenaa Jensen, S.

    2004-06-01

    Technologies using renewable energy sources are receiving increasing interest from both public authorities and power producing companies, mainly because of the environmental advantages they procure in comparison with conventional energy sources. These technologies can be substitution for conventional energy sources and limit damage to the environment. Furthermore, several of the renewable energy technologies satisfy an increasing political goal of self-sufficiency within energy production. The subject of this thesis is promotion of renewable technologies. The primary goal is to increase understanding on how technological development takes place, and establish a theoretical framework that can assist in the construction of policy strategies including instruments for promotion of renewable energy technologies. Technological development is analysed by through quantitative and qualitative methods. (BA)

  13. The Human Technology

    DEFF Research Database (Denmark)

    Fausing, Bent

     Bent Fausing  "The Humane Technology", abstract (for The Two Cultures: Balancing Choices and Effects Oxford University July 20-26, 2008). The paper will investigate the use of technology in everyday aesthetics such as TV-commercials for mobile phones for Nokia, which slogan is, as it is well known......, "Nokia - connecting people". Which function does this technology get in narratives, images, interactions and affects here?      The mobile phone and its digital camera are depicted as being able to make a unique human presence and interaction. The medium, the technology is a necessary helper to get...... towards this very special and lost humanity. Without the technology, no special humanity is the prophecy. This personification or anthropomorphism is important for the branding of new technology. The technology is seen as creating a technotranscendens towards a more qualified humanity, which is in contact...

  14. Technology Empowerment: Security Challenges.

    Energy Technology Data Exchange (ETDEWEB)

    Warren, Drake Edward [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Backus, George A. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Jones, Wendell [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Nelson, Thomas R. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Skocypec, Russell D. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2017-03-01

    Technology empowerment” means that innovation is increasingly accessible to ordinary people of limited means. As powerful technologies become more affordable and accessible, and as people are increasingly connected around the world, ordinary people are empowered to participate in the process of innovation and share the fruits of collaborative innovation. This annotated briefing describes technology empowerment and focuses on how empowerment may create challenges to U.S. national security. U.S. defense research as a share of global innovation has dwindled in recent years. With technology empowerment, the role of U.S. defense research is likely to shrink even further while technology empowerment will continue to increase the speed of innovation. To avoid falling too far behind potential technology threats to U.S. national security, U.S. national security institutions will need to adopt many of the tools of technology empowerment.

  15. JPRS Report, Science & Technology, Japan

    Science.gov (United States)

    1988-10-05

    This is Japan Report with Science and Technology. It contains the issues with different topics on biotecnology , defense industry, nuclear engineering, Marine technology, science and technology policy.

  16. Technology transfer 1994

    Energy Technology Data Exchange (ETDEWEB)

    1994-01-01

    This document, Technology Transfer 94, is intended to communicate that there are many opportunities available to US industry and academic institutions to work with DOE and its laboratories and facilities in the vital activity of improving technology transfer to meet national needs. It has seven major sections: Introduction, Technology Transfer Activities, Access to Laboratories and Facilities, Laboratories and Facilities, DOE Office, Technologies, and an Index. Technology Transfer Activities highlights DOE`s recent developments in technology transfer and describes plans for the future. Access to Laboratories and Facilities describes the many avenues for cooperative interaction between DOE laboratories or facilities and industry, academia, and other government agencies. Laboratories and Facilities profiles the DOE laboratories and facilities involved in technology transfer and presents information on their missions, programs, expertise, facilities, and equipment, along with data on whom to contact for additional information on technology transfer. DOE Offices summarizes the major research and development programs within DOE. It also contains information on how to access DOE scientific and technical information. Technologies provides descriptions of some of the new technologies developed at DOE laboratories and facilities.

  17. Technology '90

    Energy Technology Data Exchange (ETDEWEB)

    1991-01-01

    The US Department of Energy (DOE) laboratories have a long history of excellence in performing research and development in a number of areas, including the basic sciences, applied-energy technology, and weapons-related technology. Although technology transfer has always been an element of DOE and laboratory activities, it has received increasing emphasis in recent years as US industrial competitiveness has eroded and efforts have increased to better utilize the research and development resources the laboratories provide. This document, Technology '90, is the latest in a series that is intended to communicate some of the many opportunities available for US industry and universities to work with the DOE and its laboratories in the vital activity of improving technology transfer to meet national needs. Technology '90 is divided into three sections: Overview, Technologies, and Laboratories. The Overview section describes the activities and accomplishments of the DOE research and development program offices. The Technologies section provides descriptions of new technologies developed at the DOE laboratories. The Laboratories section presents information on the missions, programs, and facilities of each laboratory, along with a name and telephone number of a technology transfer contact for additional information. Separate papers were prepared for appropriate sections of this report.

  18. The Ultimate Technology

    DEFF Research Database (Denmark)

    Riis, Søren

    2013-01-01

    One of the most influential philosophers of the 20th century, Martin Heidegger (1889-1976), died prior to the remarkable cloning of the sheep Dolly and before Dr. Venter started his experiments on creating synthetic life, and he never explicitly discussed living technologies. However, by reinterp......One of the most influential philosophers of the 20th century, Martin Heidegger (1889-1976), died prior to the remarkable cloning of the sheep Dolly and before Dr. Venter started his experiments on creating synthetic life, and he never explicitly discussed living technologies. However......, by reinterpreting his notion of "modern technology," this article shows how it is possible to philosophically assess living technologies and to recognize ways in which Heidegger anticipated this phenomenon with his notion of cybernetics. The interpretation elucidates the fundamental process of technology becoming...... living and simultaneously presents living technology as the ultimate technology. The thesis of this article is that living technology is not just one more technology; rather, it is the perfection of technology as understood by Aristotle. Aristotle's thinking is in this way a key example of a profound...

  19. Technology and teen drivers.

    Science.gov (United States)

    Lee, John D

    2007-01-01

    The rapid evolution of computing, communication, and sensor technology is likely to affect young drivers more than others. The distraction potential of infotainment technology stresses the same vulnerabilities that already lead young drivers to crash more frequently than other drivers. Cell phones, text messaging, MP3 players, and other nomadic devices all present a threat because young drivers may lack the spare attentional capacity for vehicle control and the ability to anticipate and manage hazards. Moreover, young drivers are likely to be the first and most aggressive users of new technology. Fortunately, emerging technology can also support safe driving. Electronic stability control, collision avoidance systems, intelligent speed adaptation, and vehicle tracking systems can all help mitigate the threats to young drivers. However, technology alone is unlikely to make young drivers safer. One promising approach to tailoring technology to teen drivers is to extend proven methods for enhancing young driver safety. The success of graduated drivers license programs (GDL) and the impressive safety benefit of supervised driving suggest ways of tailoring technology to the needs of young drivers. To anticipate the effects of technology on teen driving it may be useful to draw an analogy between the effects of passengers and the effects of technology. Technology can act as a teen passenger and undermine safety or it can act as an adult passenger and enhance safety. Rapidly developing technology may have particularly large effects on teen drivers. To maximize the positive effects and minimize the negative effects will require a broad range of industries to work together. Ideally, vehicle manufacturers would work with infotainment providers, insurance companies, and policy makers to craft new technologies so that they accommodate the needs of young drivers. Without such collaboration young drivers will face even greater challenges to their safety as new technologies emerge.

  20. [Earth Science Technology Office's Computational Technologies Project

    Science.gov (United States)

    Fischer, James (Technical Monitor); Merkey, Phillip

    2005-01-01

    This grant supported the effort to characterize the problem domain of the Earth Science Technology Office's Computational Technologies Project, to engage the Beowulf Cluster Computing Community as well as the High Performance Computing Research Community so that we can predict the applicability of said technologies to the scientific community represented by the CT project and formulate long term strategies to provide the computational resources necessary to attain the anticipated scientific objectives of the CT project. Specifically, the goal of the evaluation effort is to use the information gathered over the course of the Round-3 investigations to quantify the trends in scientific expectations, the algorithmic requirements and capabilities of high-performance computers to satisfy this anticipated need.

  1. Technology transfer - the role of AEA Technology

    International Nuclear Information System (INIS)

    Hughes, A.E.; Bullough, R.; Mason, J.P.

    1989-01-01

    This paper concentrates mostly on examples of spin offs which have arisen from the more basic research carried out by the AEA. However, it should not be inferred from this that the only examples of successful technology transfer by the AEA are of a similar, often unforeseen nature. The most outstanding example of technology transfer by the AEA must surely be that achieved through the applied research which has enabled the establishment of a successful civil nuclear power programme in the UK. The natural transfer of technology here, achieved by virtue of the unique bridging position of the AEA with respect to universities and the nuclear industry, means that its success can easily be overlooked; to do so would be a mistake. However, by including spin off examples, we hope to illustrate how the AEA has also succeeded in bridging to more difficult areas where the special relationship which it shares with the nuclear industry is absent. (author)

  2. Water Technology Lecture 1: Introducing Water Technology

    OpenAIRE

    Gray, Nicholas Frederick

    2017-01-01

    This is a full set of PowerPoint lectures for a course in Water Technology currently given at Trinity College, University of Dublin by professor N.F. Gray. The lectures cover all aspects of water and wastewater treatment and are available for use to lecturers or those interested in the subject. The lecture series is to be used in conjunction with the new textbook ?Water Science and Technology? (4th edition) published by CRC Press in 2017. Lecture 1 is an introduction to the water indust...

  3. Technology Matters - When new technology reshape innovation

    DEFF Research Database (Denmark)

    Edwards, Kasper; Pedersen, Jørgen Lindgaard

    2004-01-01

    not to be managed in the sense that aims, instruments and resources are unclear. It is observed that new technology is adopted with a limited scope and fo-cus – often to solve a particular technical problem e.g. the quality of specifica-tion are too low. For a single reason a new technology is introduced within...... observed through these interviews that product configuration systems are being implemented to solve a particular problem only later to become a significant part of business processes. Product configuration systems over time become a central element when innovating new products....

  4. Responsible technology acceptance

    DEFF Research Database (Denmark)

    Toft, Madeleine Broman; Schuitema, Geertje; Thøgersen, John

    2014-01-01

    on private consumers’ acceptance of having Smart Grid technology installed in their home. We analyse acceptance in a combined framework of the Technology Acceptance Model and the Norm Activation Model. We propose that individuals are only likely to accept Smart Grid technology if they assess usefulness......As a response to climate change and the desire to gain independence from imported fossil fuels, there is a pressure to increase the proportion of electricity from renewable sources which is one of the reasons why electricity grids are currently being turned into Smart Grids. In this paper, we focus...... in terms of a positive impact for society and the environment. Therefore, we expect that Smart Grid technology acceptance can be better explained when the well-known technology acceptance parameters included in the Technology Acceptance Model are supplemented by moral norms as suggested by the Norm...

  5. Use of Payment Technology

    DEFF Research Database (Denmark)

    Xiao, Xiao; Hedman, Jonas; Runnemark, Emma

    2015-01-01

    Drawing on the theory of consumption value, this research-in-progress strives to provide a theoretical explanation of payment technology use by investigating the relationship between consumers’ perceptions of different consumption values associated with a certain payment technology and their choice...... to use the technology. We conducted the study in the context of Denmark, a Northern European country, with three well established payment technologies: cash, payment cards, and Internet banking. Following a focus group of identifying and defining four types of consumption values associated with each...... payment technology, a survey was then conducted by a national statistics agency in the country. Preliminary results have shown that different consumption values matter for the use of different payment technologies. The findings will potentially contribute to a better understanding of consumer payment...

  6. Buildings Energy Technology; (USA)

    Energy Technology Data Exchange (ETDEWEB)

    Cason, D.L.; Hicks, S.C. (eds.)

    1991-01-01

    Buildings Energy Technology (BET) announces on a monthly basis the current worldwide information available on the technology required for economic energy conservation in buildings and communities. Each issue of BET also will include an article presenting a program overview or highlighting a current energy conservation technology project of DOE's Office of Building Technologies (OBT) plus a listing of scheduled meetings of interest. This publication contains the abstracts of DOE reports, journal articles, conference papers, patents, theses, and monographs added to the Energy Science and Technology Database (EDB) during the past month. Also included are US information obtained through acquisition programs or interagency agreements and international information obtained through the International Energy Agency's Energy Technology Data Exchange or government-to-government agreements.

  7. Nuclear technology and beyond

    International Nuclear Information System (INIS)

    Akiyama, Mamoru

    1997-01-01

    After the confrontation of East and West, and the problem of North and South, we are now facing the era of Globalization in the presence of twenty-first century. Tracing the history of civilization, human being has progressed along with the accumulation of experience, and the development of science and technology. Science and technology bloomed in modern ages, especially, energy technology showed the giant leap in this century. Nuclear science and technology has been developed for peaceful purposes, and for the benefit of humanity. As a result, today, its progress led nuclear science and technology to have the great applicability to the development of the society. Toward the twenty-first century and Globalization, the science and technology developed in nuclear field is hoped to play a great contribution in various area of the society. (author)

  8. Everyday Struggels with Technology

    DEFF Research Database (Denmark)

    Mahnke, Martina; Schwartz, Sander Andreas

    2017-01-01

    Technology has not only become an integral part of people’s lives but also of people’s everyday struggles. Struggles with technology are complex in nature; we tend to not only struggle with their basic functions but also with how they make us feel. During the course of our life we tend to master...... and struggle with technology in different ways. This struggle has been studied in relation to media literacy (Livingstone, 2004), to domestication theory (Silverstone et al. 1992), or in everyday life (Bakardjieva, 2005). This work enhances these lines of studies by exploring everyday struggles with technology...... from a life stage (Erikson, 1959) point of view. In particular, we explore what are common struggles people have with technology and what are distinct struggles in relation to life stages. In conclusion, we will present our findings by outlining what we call ‘technological biographies’. Those...

  9. Emerging and Disruptive Technologies.

    Science.gov (United States)

    Kricka, Larry J

    2016-08-01

    Several emerging or disruptive technologies can be identified that might, at some point in the future, displace established laboratory medicine technologies and practices. These include increased automation in the form of robots, 3-D printing, technology convergence (e.g., plug-in glucose meters for smart phones), new point-of-care technologies (e.g., contact lenses with sensors, digital and wireless enabled pregnancy tests) and testing locations (e.g., Retail Health Clinics, new at-home testing formats), new types of specimens (e.g., cell free DNA), big biology/data (e.g., million genome projects), and new regulations (e.g., for laboratory developed tests). In addition, there are many emerging technologies (e.g., planar arrays, mass spectrometry) that might find even broader application in the future and therefore also disrupt current practice. One interesting source of disruptive technology may prove to be the Qualcomm Tricorder XPrize, currently in its final stages.

  10. NAND flash memory technologies

    CERN Document Server

    Aritome, Seiichi

    2016-01-01

    This book discusses basic and advanced NAND flash memory technologies, including the principle of NAND flash, memory cell technologies, multi-bits cell technologies, scaling challenges of memory cell, reliability, and 3-dimensional cell as the future technology. Chapter 1 describes the background and early history of NAND flash. The basic device structures and operations are described in Chapter 2. Next, the author discusses the memory cell technologies focused on scaling in Chapter 3, and introduces the advanced operations for multi-level cells in Chapter 4. The physical limitations for scaling are examined in Chapter 5, and Chapter 6 describes the reliability of NAND flash memory. Chapter 7 examines 3-dimensional (3D) NAND flash memory cells and discusses the pros and cons in structure, process, operations, scalability, and performance. In Chapter 8, challenges of 3D NAND flash memory are dis ussed. Finally, in Chapter 9, the author summarizes and describes the prospect of technologies and market for the fu...

  11. Technological Capability's Predictor Variables

    Directory of Open Access Journals (Sweden)

    Fernanda Maciel Reichert

    2011-03-01

    Full Text Available The aim of this study was to identify the factors that influence in configuration of the technological capability of companies in sectors with medium-low technological intensity. To achieve the goal proposed in this article a survey was carried out. Based on the framework developed by Lall (1992 which classifies firms in basic, intermediate and advanced level of technological capability; it was found that the predominant technological capability is intermediate, with 83.7% of respondent companies (plastics companies in Brazil. It is believed that the main contribution of this study is the finding that the dependent variable named “Technological Capability” can be explained at a rate of 65% by six variables: development of new processes; selection of the best equipment supplier; sales of internally developed new technology to third parties; design and manufacture of equipment; study of the work methods and perform inventory control; and improvement of product quality.

  12. Technology Transfer and Commercialization

    Science.gov (United States)

    Martin, Katherine; Chapman, Diane; Giffith, Melanie; Molnar, Darwin

    2001-01-01

    During concurrent sessions for Materials and Structures for High Performance and Emissions Reduction, the UEET Intellectual Property Officer and the Technology Commercialization Specialist will discuss the UEET Technology Transfer and Commercialization goals and efforts. This will include a review of the Technology Commercialization Plan for UEET and what UEET personnel are asked to do to further the goals of the Plan. The major goal of the Plan is to define methods for how UEET assets can best be infused into industry. The National Technology Transfer Center will conduct a summary of its efforts in assessing UEET technologies in the areas of materials and emissions reduction for commercial potential. NTTC is assisting us in completing an inventory and prioritization by commercialization potential. This will result in increased exposure of UEET capabilities to the private sector. The session will include audience solicitation of additional commercializable technologies.

  13. Technology transfer packages

    International Nuclear Information System (INIS)

    Mizon, G.A.; Bleasdale, P.A.

    1994-01-01

    Nuclear power is firmly established in many developed countries'energy policies and is being adopted by emerging nations as an attractive way of gaining energy self sufficiency. The early users of nuclear power had to develop the technology that they needed, which now, through increasing world wide experience, has been rationalised to meet demanding economic and environmental pressures. These justifiable pressures, can lead to existing suppliers of nuclear services to consider changing to more appropriate technologies and for new suppliers to consider licensing proven technology rather then incurring the cost of developing new alternatives. The transfer of technology, under license, is made more straight forward if the owner conveniently groups appropriate technology into packages. This paper gives examples of 'Technology Packages' and suggests criteria for the specification, selection and contractual requirements to ensure successful licensing

  14. Promoting renewable energy technologies

    DEFF Research Database (Denmark)

    Olsen, O.J.; Skytte, K.

    2004-01-01

    % of its annual electricity production. In this paper, we present and discuss the Danish experience as a case of promoting renewable energy technologies. The development path of the two technologies has been very different. Wind power is considered an outright success with fast deployment to decreasing...... technology and its particular context, it is possible to formulate some general principles that can help to create an effective and efficient policy for promoting new renewable energy technologies.......Wind power and combined heat and power (CHP) using biomass (for combustion, gasification or fermentation) are two of the most promising renewable technologies for generation of electricity. Denmark has a long and well-established tradition for these technologies that now account for approx. 25...

  15. Information Technology Resources Assessment

    Energy Technology Data Exchange (ETDEWEB)

    1993-04-01

    The Information Technology Resources Assessment (ITRA) is being published as a companion document to the Department of Energy (DOE) FY 1994--FY 1998 Information Resources Management Long-Range Plan. This document represents a collaborative effort between the Office of Information Resources Management and the Office of Energy Research that was undertaken to achieve, in part, the Technology Strategic Objective of IRM Vision 21. An integral part of this objective, technology forecasting provides an understanding of the information technology horizon and presents a perspective and focus on technologies of particular interest to DOE program activities. Specifically, this document provides site planners with an overview of the status and use of new information technology for their planning consideration.

  16. Trends in Technology Use

    OpenAIRE

    Florin Frant

    2009-01-01

    This study aims to investigate the relationship between the use of technology, working conditions and the health and well-being of workers in Europe. As it is known that characteristics of work organisation may reinforce or impair both positive and negative effects of technology use, the role of these characteristics is also considered in this study. The research will provide an insight into the trends and changes in technology use and working conditions in European count...

  17. Digital Sensor Technology

    Energy Technology Data Exchange (ETDEWEB)

    Ted Quinn; Jerry Mauck; Richard Bockhorst; Ken Thomas

    2013-07-01

    The nuclear industry has been slow to incorporate digital sensor technology into nuclear plant designs due to concerns with digital qualification issues. However, the benefits of digital sensor technology for nuclear plant instrumentation are substantial in terms of accuracy, reliability, availability, and maintainability. This report demonstrates these benefits in direct comparisons of digital and analog sensor applications. It also addresses the qualification issues that must be addressed in the application of digital sensor technology.

  18. Semiotic technology and practice

    DEFF Research Database (Denmark)

    Zhao, Sumin; Djonov, Emilia; van Leeuwen, Theo

    2014-01-01

    for discourse analysis and social semiotic research, focusing especially on the need to step away from the notion of text and to develop a holistic, non-logocentric, and adaptive multimodal approach to researching semiotic technologies. Using PowerPoint as a case study, this article takes a step toward...... developing a social semiotic multimodal theory of the relation between semiotic technologies, or technologies for making meaning, and semiotic practices....

  19. RFID TECHNOLOGY: AN OVERVIEW

    OpenAIRE

    Amit Kumar Pal; Akanksha Tripathi; Anupam Saigal

    2017-01-01

    The information technology has changed the way library professional to interact, communicate, share and acquire knowledge. However, when the computer was created it did not have features and facilities for users to interact. With the evaluation of Internet and Communication Technology, manual library has evolved into a dynamic, interactive and collaborative platform that facilitates exchange of knowledge and information among its users. RFID is the latest technology to be used in libraries an...

  20. Health care technology assessment

    Science.gov (United States)

    Goodman, Clifford

    1994-12-01

    The role of technology in the cost of health care is a primary issue in current debates concerning national health care reform. The broad scope of studies for understanding technological impacts is known as technology assessment. Technology policy makers can improve their decision making by becoming more aware, and taking greater advantage, of key trends in health care technology assessment (HCTA). HCTA is the systematic evaluation of the properties, impacts, and other attributes of health care technologies, including: technical performance; clinical safety and efficacy/effectiveness; cost-effectiveness and other economic attributes; appropriate circumstances/indications for use; and social, legal, ethical, and political impacts. The main purpose of HCTA is to inform technology-related policy making in health care. Among the important trends in HCTA are: (1) proliferation of HCTA groups in the public and private sectors; (2) higher standards for scientific evidence concerning technologies; (3) methodological development in cost analyses, health-related quality of life measurement, and consolidation of available scientific evidence (e.g., meta-analysis); (4) emphasis on improved data on how well technologies work in routine practice and for traditionally under-represented patient groups; (5) development of priority-setting methods; (6) greater reliance on medical informatics to support and disseminate HCTA findings.

  1. Technology Roadmaps: Cement

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2009-07-01

    To support its roadmap work focusing on key technologies for emissions reductions, the International Energy Agency (IEA) also investigated one particular industry: cement. Cement production includes technologies that are both specific to this industry and those that are shared with other industries (e.g., grinding, fuel preparation, combustion, crushing, transport). An industry specific roadmap provides an effective mechanism to bring together several technology options. It outlines the potential for technological advancement for emissions reductions in one industry, as well as potential cross-industry collaboration.

  2. Explosive Technology Group

    Data.gov (United States)

    Federal Laboratory Consortium — The Explosive Technology Group (ETG) provides diverse technical expertise and an agile, integrated approach to solve complex challenges for all classes of energetic...

  3. Mixed plastics recycling technology

    CERN Document Server

    Hegberg, Bruce

    1995-01-01

    Presents an overview of mixed plastics recycling technology. In addition, it characterizes mixed plastics wastes and describes collection methods, costs, and markets for reprocessed plastics products.

  4. Technology Education in Japan.

    Science.gov (United States)

    Murata, Shoji; Stern, Sam

    1993-01-01

    Describes the history, current status, and future direction of technology education in Japan, including the process of curriculum transition, secondary and postsecondary structure, and lack of resources. (SK)

  5. Distributed Energy Technology Laboratory

    Data.gov (United States)

    Federal Laboratory Consortium — The Distributed Energy Technologies Laboratory (DETL) is an extension of the power electronics testing capabilities of the Photovoltaic System Evaluation Laboratory...

  6. Extending Database Integration Technology

    National Research Council Canada - National Science Library

    Buneman, Peter

    1999-01-01

    Formal approaches to the semantics of databases and database languages can have immediate and practical consequences in extending database integration technologies to include a vastly greater range...

  7. Advanced Surface Technology

    DEFF Research Database (Denmark)

    Møller, Per; Nielsen, Lars Pleht

    , nitriding, carbonitriding, and many other lesser-known thermochemical processes used for solving technological problems. The book is richly illustrated with pictures and figures showing how the technology creates new innovative solutions for industry and how surfaces are becoming integral to the function......This new significant book on advanced modern surface technology in all its variations, is aimed at both teaching at engineering schools and practical application in industry. The work covers all the significant aspects of modern surface technology and also describes how new advanced techniques make...

  8. Networked Constellation Communications Technologies

    Data.gov (United States)

    National Aeronautics and Space Administration — Develop communications architectures and enabling technologies for mission concepts relying on multiple spatially distributed spacecraft to perform coordinated...

  9. Irradiation technology - industrial use

    International Nuclear Information System (INIS)

    Zyball, A.

    1995-01-01

    The most important applications of the radiation technology are the crosslinking of polymers and sterilisation. Although extensive experience about the use of this technology is available and powerful and dependable radiation facilities can be obtained, as yet the radiation technology has not found the acceptance it deserves in the industry. The main reason therefore has to do with how the question of radiation or the term radiation is presented to the industry and among the population. This paper will deal with considerations and ways in which the industrial use of the radiation technology can be expanded. (author)

  10. Acoustic Technology Laboratory

    Data.gov (United States)

    Federal Laboratory Consortium — This laboratory contains an electro-magnetic worldwide data collection and field measurement capability in the area of acoustic technology. Outfitted by NASA Langley...

  11. Solar Cooker Technological Change

    DEFF Research Database (Denmark)

    Ahmad, Bashir

    1997-01-01

    The challenges which solar cooking technology is facing right now is discussed. Based on a field study in Madras and Gujarat, it is asserted that there is an important incompatibility between the technology and the every day real-life conditions of the "users" of solar cooker. An evaluation report...... on a solar cooker technology in Burkina Faso supports the findings of the study. It is concluded that the users and other important actors have to be incorporated in the technological development process of solar cookers in the future....

  12. Future Information Technology

    CERN Document Server

    Stojmenovic, Ivan; Choi, Min; Xhafa, Fatos; FutureTech 2013

    2014-01-01

    Future technology information technology stands for all of continuously evolving and converging information technologies, including digital convergence, multimedia convergence, intelligent applications, embedded systems, mobile and wireless communications, bio-inspired computing, grid and cloud computing, semantic web, user experience and HCI, security and trust computing and so on, for satisfying our ever-changing needs. In past twenty five years or so, Information Technology (IT) influenced and changed every aspect of our lives and our cultures. These proceedings foster the dissemination of state-of-the-art research in all future IT areas, including their models, services, and novel applications associated with their utilization.

  13. Advanced Optical Fuzing Technology

    National Research Council Canada - National Science Library

    Lippe, Christian M. von der; Liu, J. J; Aliberti, Keith; Dang, Gerard; Chang, Wayne; Shen, Paul; Simonis, George

    2004-01-01

    .... The photonic component development exploits pioneering work and unique expertise at ARDEC, ARL, and Sandia National Laboratories by combining key optoelectronic technologies to design and demonstrate...

  14. Moralizing Food Technology

    DEFF Research Database (Denmark)

    Coff, Christian Eyde

    2015-01-01

    Food technologies are common on many levels in society and used by both food professionals and consumers. Food technologies are not neutral. They inform and shape the behaviour of people. This paper presents a theoretical framework for analysing the mediating role of food technology and its...... influence on food ethics. Post-phenomenology and the idea of a technologically mediated morality are central theoretical approaches. Four elements are included in the analytical framework: perception, interpretation, intentionality, and mediated morality. The framework is applied to two cases; food safety...

  15. Application Technology Research Unit

    Data.gov (United States)

    Federal Laboratory Consortium — To conduct fundamental and developmental research on new and improved application technologies to protect floricultural, nursery, landscape, turf, horticultural, and...

  16. Advanced Surface Technology

    DEFF Research Database (Denmark)

    Møller, Per; Nielsen, Lars Pleht

    This new significant book on advanced modern surface technology in all its variations, is aimed at both teaching at engineering schools and practical application in industry. The work covers all the significant aspects of modern surface technology and also describes how new advanced techniques make......, nitriding, carbonitriding, and many other lesser-known thermochemical processes used for solving technological problems. The book is richly illustrated with pictures and figures showing how the technology creates new innovative solutions for industry and how surfaces are becoming integral to the function...

  17. Traditions of technology

    Energy Technology Data Exchange (ETDEWEB)

    Nandy, A.

    1979-01-01

    Modern technology, with about 300 years of history behind it, has become the dominant tradition by marginalizing the other traditions of technology in the West and in the rest of the world. Important roles have been played in this marginalization by the ideology of Englightenment, by the Industrial Revolution, and nineteenth and twentieth century colonialism. They have blurred the difference between science and technology, underwritten the mechanomorphic world-image and promoted the concept of a value-free, ethically unrestrained technology. However, the present crises of technological consciousness has brought to the fore alternative traditions of technology, not as ethnotechnologies from which a universal, secular, modern technology can draw lessons, but as a competing philosophies of universality which can provide correctives to the alienating, exploitative, and dehumanizing role of modern science and technology. An alternative ideology of science is needed for this as well as a new legitimacy for the traditional technosystems and their cultural environments. Such a legitimacy will have to be based on a different set of values relating to the man--nature and man--man relationships and a deeper understanding of the politics of technology in its cross-national and cross-cultural contexts.

  18. Robotics Technology Crosscutting Program. Technology summary

    International Nuclear Information System (INIS)

    1995-06-01

    The Robotics Technology Development Program (RTDP) is a needs-driven effort. A length series of presentations and discussions at DOE sites considered critical to DOE's Environmental Restoration and Waste Management (EM) Programs resulted in a clear understanding of needed robotics applications toward resolving definitive problems at the sites. A detailed analysis of the resulting robotics needs assessment revealed several common threads running through the sites: Tank Waste Retrieval (TWR), Contaminant Analysis Automation (CAA), Mixed Waste Operations (MWO), and Decontamination and Dismantlement (D and D). The RTDP Group also realized that some of the technology development in these four areas had common (Cross Cutting-CC) needs, for example, computer control and sensor interface protocols. Further, the OTD approach to the Research, Development, Demonstration, Testing, and Evaluation (RDDT and E) process urged an additional organizational breakdown between short-term (1--3 years) and long-term (3--5 years) efforts (Advanced Technology-AT). These factors lead to the formation of the fifth application area for Crosscutting and Advanced Technology (CC and AT) development. The RTDP is thus organized around these application areas -- TWR, CAA, MWO, D and D, and CC and AT -- with the first four developing short-term applied robotics. An RTDP Five-Year Plan was developed for organizing the Program to meet the needs in these application areas

  19. Testing Technology: A Sandia technology bulletin

    Energy Technology Data Exchange (ETDEWEB)

    Goetsch, B.; Floyd, H.L.; Doran, L. [eds.

    1994-08-01

    Inside this issue is a farewell to Testing Technology message from technical advisor, Ruth David. Also included are articles on: Testing the I-40 bridge over the Rio Grande, simulated reactor meltdown studies, an inexpensive monitor for testing integrated circuits, testing of antihelicoptor mines, and quality assurance on aircraft inspection.

  20. The Next Technology Revolution - Nano Electronic Technology

    Science.gov (United States)

    Turlik, Iwona

    2004-03-01

    Nanotechnology is a revolutionary engine that will engender enormous changes in a vast majority of today's industries and markets, while potentially creating whole new industries. The impact of nanotechnology is particularly significant in the electronics industry, which is constantly driven by the need for higher performance, increased functionality, smaller size and lower cost. Nanotechnology can influence many of the hundreds of components that are typically assembled to manufacture modern electronic devices. Motorola manufactures electronics for a wide range of industries and communication products. In this presentation, the typical components of a cellular phone are outlined and technology requirements for future products, the customer benefits, and the potential impact of nanotechnology on many of the components are discussed. Technology needs include reliable materials supply, processes for high volume production, experimental and simulation tools, etc. For example, even routine procedures such as failure characterization may require the development of new tools for investigating nano-scale phenomena. Business needs include the development of an effective, high volume supply chain for nano-materials and devices, disruptive product platforms, and visible performance impact on the end consumer. An equally significant long-term industry need is the availability of science and engineering graduates with a multidisciplinary focus and a deep understanding of the fundamentals of nano-technology, that can harness the technology to create revolutionary products.

  1. Technology Transfer and Technology Transfer Intermediaries

    Science.gov (United States)

    Bauer, Stephen M.; Flagg, Jennifer L.

    2010-01-01

    A standard and comprehensive model is needed to evaluate and compare technology transfer systems and the stakeholders within these systems. The principle systems considered include federal laboratories, U.S. universities, the rehabilitation engineering research centers (RERCs), and large small business innovation research programs. An earlier…

  2. Technology Applications Team: Applications of aerospace technology

    Science.gov (United States)

    1993-01-01

    Highlights of the Research Triangle Institute (RTI) Applications Team activities over the past quarter are presented in Section 1.0. The Team's progress in fulfilling the requirements of the contract is summarized in Section 2.0. In addition to our market-driven approach to applications project development, RTI has placed increased effort on activities to commercialize technologies developed at NASA Centers. These Technology Commercialization efforts are summarized in Section 3.0. New problem statements prepared by the Team in the reporting period are presented in Section 4.0. The Team's transfer activities for ongoing projects with the NASA Centers are presented in Section 5.0. Section 6.0 summarizes the status of four add-on tasks. Travel for the reporting period is described in Section 7.0. The RTI Team staff and consultants and their project responsibilities are listed in Appendix A. The authors gratefully acknowledge the contributions of many individuals to the RTI Technology Applications Team program. The time and effort contributed by managers, engineers, and scientists throughout NASA were essential to program success. Most important to the program has been a productive working relationship with the NASA Field Center Technology Utilization (TU) Offices. The RTI Team continues to strive for improved effectiveness as a resource to these offices. Industry managers, technical staff, medical researchers, and clinicians have been cooperative and open in their participation. The RTI Team looks forward to continuing expansion of its interaction with U.S. industry to facilitate the transfer of aerospace technology to the private sector.

  3. Digital Actuator Technology

    Energy Technology Data Exchange (ETDEWEB)

    Ken Thomas; Ted Quinn; Jerry Mauck; Richard Bockhorst

    2014-09-01

    There are significant developments underway in new types of actuators for power plant active components. Many of these make use of digital technology to provide a wide array of benefits in performance of the actuators and in reduced burden to maintain them. These new product offerings have gained considerable acceptance in use in process plants. In addition, they have been used in conventional power generation very successfully. This technology has been proven to deliver the benefits promised and substantiate the claims of improved performance. The nuclear industry has been reluctant to incorporate digital actuator technology into nuclear plant designs due to concerns due to a number of concerns. These could be summarized as cost, regulatory uncertainty, and a certain comfort factor with legacy analog technology. The replacement opportunity for these types of components represents a decision point for whether to invest in more modern technology that would provide superior operational and maintenance benefits. Yet, the application of digital technology has been problematic for the nuclear industry, due to qualification and regulatory issues. With some notable exceptions, the result has been a continuing reluctance to undertake the risks and uncertainties of implementing digital actuator technology when replacement opportunities present themselves. Rather, utilities would typically prefer to accept the performance limitations of the legacy analog actuator technologies to avoid impacts to project costs and schedules. The purpose of this report is to demonstrate that the benefits of digital actuator technology can be significant in terms of plant performance and that it is worthwhile to address the barriers currently holding back the widespread development and use of this technology. It addresses two important objectives in pursuit of the beneficial use of digital actuator technology for nuclear power plants: 1. To demonstrate the benefits of digital actuator

  4. Technology Catalogue. First edition

    Energy Technology Data Exchange (ETDEWEB)

    1994-02-01

    The Department of Energy`s Office of Environmental Restoration and Waste Management (EM) is responsible for remediating its contaminated sites and managing its waste inventory in a safe and efficient manner. EM`s Office of Technology Development (OTD) supports applied research and demonstration efforts to develop and transfer innovative, cost-effective technologies to its site clean-up and waste management programs within EM`s Office of Environmental Restoration and Office of Waste Management. The purpose of the Technology Catalogue is to provide performance data on OTD-developed technologies to scientists and engineers assessing and recommending technical solutions within the Department`s clean-up and waste management programs, as well as to industry, other federal and state agencies, and the academic community. OTD`s applied research and demonstration activities are conducted in programs referred to as Integrated Demonstrations (IDs) and Integrated Programs (IPs). The IDs test and evaluate.systems, consisting of coupled technologies, at specific sites to address generic problems, such as the sensing, treatment, and disposal of buried waste containers. The IPs support applied research activities in specific applications areas, such as in situ remediation, efficient separations processes, and site characterization. The Technology Catalogue is a means for communicating the status. of the development of these innovative technologies. The FY93 Technology Catalogue features technologies successfully demonstrated in the field through IDs and sufficiently mature to be used in the near-term. Technologies from the following IDs are featured in the FY93 Technology Catalogue: Buried Waste ID (Idaho National Engineering Laboratory, Idaho); Mixed Waste Landfill ID (Sandia National Laboratories, New Mexico); Underground Storage Tank ID (Hanford, Washington); Volatile organic compound (VOC) Arid ID (Richland, Washington); and VOC Non-Arid ID (Savannah River Site, South Carolina).

  5. Assessing Teacher Technology Skills.

    Science.gov (United States)

    Anderson, Mary Alice

    2000-01-01

    Advocates the assessment of teachers' technology skills by school media and technology specialists who are involved in staff training. Discusses what should be assessed, including level of curricular integration and attitudes; assessment objectives; informal assessments; formal assessments; assessment tools; and administrators as role models for…

  6. Managing Technology Projects

    Science.gov (United States)

    Booth, Char

    2009-01-01

    This will be my first time authoring this column, and I'm delighted to have the opportunity it presents to explore the intersection of library technology and public services. As the recent title of the 2008 Internet Librarian conference indicates, "Beyond Library 2.0: User-Focused Tools and Technologies," the tide of what for several years has…

  7. Computers: Educational Technology Paradox?

    Science.gov (United States)

    Hashim, Hajah Rugayah Hj.; Mustapha, Wan Narita

    2005-01-01

    As we move further into the new millennium, the need to involve and adapt learners with new technology have been the main aim of many institutions of higher learning in Malaysia. The involvement of the government in huge technology-based projects like the Multimedia Super Corridor Highway (MSC) and one of its flagships, the Smart Schools have…

  8. New technologies in contraception

    OpenAIRE

    Rowlands, Sam

    2009-01-01

    New technologies in both reversible contraception and sterilisation are described. The review includes recent advances in the development of oral contraception, emergency contraception, injectable contraception, vaginal rings, subdermal implants, transdermal contraception, intrauterine devices, spermicides and barrier methods. It also covers methods of transcervical female sterilisation and more easily reversible male sterilisation. The emphasis is on the technology and its safety and effecti...

  9. Resources in Technology 7.

    Science.gov (United States)

    International Technology Education Association, Reston, VA.

    This volume of Resources in Technology contains the following eight instructional modules: (1) "Processing Technology"; (2) "Water--A Magic Resource"; (3) "Hazardous Waste Disposal--The NIMBY (Not in My Backyard) Syndrome"; (4) "Processing Fibers and Fabrics"; (5) "Robotics--An Emerging…

  10. School Security Technologies

    Science.gov (United States)

    Schneider, Tod

    2010-01-01

    Over the past decade electronic security technology has evolved from an exotic possibility into an essential safety consideration. Before resorting to high-tech security solutions, school officials should think carefully about the potential for unintended consequences. Technological fixes may be mismatched to the problems being addressed. They can…

  11. Botswana Journal of Technology

    African Journals Online (AJOL)

    Botswana Journal of Technology describes original developments or research in the field of Engineering and Technology. It is published twice a year. Vol 22, No 1 (2013). DOWNLOAD FULL TEXT Open Access DOWNLOAD FULL TEXT Subscription or Fee Access. Table of Contents. Articles. Urbanisation, infrastructure ...

  12. Educational Technology: Integration?

    Science.gov (United States)

    Christensen, Dean L.; Tennyson, Robert D.

    This paper presents a perspective of the current state of technology-assisted instruction integrating computer language, artificial intelligence (AI), and a review of cognitive science applied to instruction. The following topics are briefly discussed: (1) the language of instructional technology, i.e., programming languages, including authoring…

  13. Technology and Teaching Philosophy

    Science.gov (United States)

    King, Paul C.

    2012-01-01

    This article discusses the challenges faced when integrating new technologies into the classroom. Viewing the experiences of teaching a first year learning community through the lens of the principles of the Reflective Teaching Portfolio, the author looks to answer the question: "How should Technology relate to our Teaching Philosophy?"…

  14. CSIR Technology Impact 1998

    CSIR Research Space (South Africa)

    CSIR

    1998-01-01

    Full Text Available stream_source_info CSIR Technology Impact 1998.pdf.txt stream_content_type text/plain stream_size 23 Content-Encoding ISO-8859-1 stream_name CSIR Technology Impact 1998.pdf.txt Content-Type text/plain; charset=ISO-8859-1 ...

  15. Technology and Educational Structure

    Science.gov (United States)

    Boocock, Sarane S.

    2012-01-01

    Most current debate on instructional technology is characterized either by grandiose speculation on the salvation of education through automation (without specification of "what" and "how" technological innovations will actually be introduced in specific classroom situations, and how the changes will be financed), or by jargon-filled hairsplitting…

  16. US blanket technology programs

    International Nuclear Information System (INIS)

    Nygren, R.E.

    1985-01-01

    Experimental research in US programs related to blanket technology is described through brief summaries of the objectives, facilities, recent experimental results and principal investigators for the Blanket Technology Program, TRIO-1 Experiment, TSTA, Fusion Hybrid Program and selected activities in the Fusion Materials and Fusion Safety Programs in neutronics research

  17. Advanced Mirror Technology Development

    Science.gov (United States)

    Stahl, H. Philip

    2017-01-01

    The Advanced Mirror Technology Development (AMTD) project matures critical technologies required to enable ultra-stable 4-m-or-larger monolithic or segmented ultraviolet, optical, and infrared (UVOIR) space telescope primary-mirror assemblies for general astrophysics and ultra-high-contrast observations of exoplanets.

  18. Learning Languages through Technology

    Science.gov (United States)

    Hanson-Smith, Elizabeth, Ed.; Rilling, Sarah, Ed.

    2007-01-01

    While posing important questions about how learning proceeds with new technologies, this volume demonstrates how teachers captivate the imagination of learners, from schoolchildren to postgraduates, by providing real-world purposes for language. The authors are from educational institutions in many regions of the world, and describe technology use…

  19. JOURNAL OF LANGUAGE, TECHNOLOGY ...

    African Journals Online (AJOL)

    Frederick Iraki

    It is also claimed that with modern technology, the tendency toward enjoying computer systems in education has also increased and it has affected the way of learning. EFL points in EFL classes. It is believed that the computer and also information technology was introduced in language laboratories to improve the learners' ...

  20. More Technology, Less Learning?

    Science.gov (United States)

    Kulesza, Justin; DeHondt, Gerald, II.; Nezlek, George

    2011-01-01

    Modern information technologies (presentation software, wireless laptop computers, cell phones, etc.) are purported to enhance student learning. Research to date provides an ambivalent and often conflicting set of outcomes about the effectiveness of such technologies in the context of the college classroom. Anecdotal evidence further complicates…

  1. IT Department Technology Transfer

    CERN Multimedia

    Birker, D

    2004-01-01

    The objective of Technology Transfer (TT) at CERN is “to make known and available to third parties under agreed conditions, technical developments achieved in fulfi lling the laboratory’s mission in fundamental research”. The IT Department contributes to this objective by the transfer of technology, expertise and know-how to industry, universities, public institutions and the society at large.

  2. Science and Technology Policy

    DEFF Research Database (Denmark)

    Baark, Erik

    1996-01-01

    This paper examines the status of science and technology in Mongolia, and discusses the policy issues which have emerged with the transition to market economy in recent years.......This paper examines the status of science and technology in Mongolia, and discusses the policy issues which have emerged with the transition to market economy in recent years....

  3. Riding the Technology Wave.

    Science.gov (United States)

    Malan, Pierre

    This paper presents an overview of information technology development. The first section sets the scene, comparing the first WAN (Wide Area Network) and Intel processor to current technology. The birth of the microcomputer is described in the second section, including historical background on semiconductors, microprocessors, and the microcomputer.…

  4. Graphite technology development plan

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1986-07-01

    This document presents the plan for the graphite technology development required to support the design of the 350 MW(t) Modular HTGR within the US National Gas-Cooled Reactor Program. Besides descriptions of the required technology development, cost estimates, and schedules, the plan also includes the associated design functions and design requirements.

  5. Technologies for life

    International Nuclear Information System (INIS)

    Kerner, J.

    2006-01-01

    In this video-film technologies applied in the BIONT, a. s. are presented. Production of radionuclides and radiopharmaceuticals as well as principles of positron emission tomography and diagnostic using is explained. Other technologies implemented and planned in the Cyclotron Center of the Slovak Republic are presented.

  6. Church - Technology - Nuclear Power

    International Nuclear Information System (INIS)

    May, H.

    1982-01-01

    In order to cope with the problems causing a great deal of trouble today, i.e. with fear and with the ethical substantiation of technology, the author considers an integration model necessary which is to link science and technology and religion and philosophy. (RW) [de

  7. Assistive Technologies for Reading

    Science.gov (United States)

    Ruffin, Tiece M.

    2012-01-01

    Twenty-first century teachers working with diverse readers are often faced with the question of how to integrate technology in reading instruction that meets the needs of the techno-generation. Are today's teachers equipped with the knowledge of how to effectively use Assistive Technologies (AT) for reading? This position paper discusses AT for…

  8. VENTILATION TECHNOLOGY SYSTEMS ANALYSIS

    Science.gov (United States)

    The report gives results of a project to develop a systems analysis of ventilation technology and provide a state-of-the-art assessment of ventilation and indoor air quality (IAQ) research needs. (NOTE: Ventilation technology is defined as the hardware necessary to bring outdoor ...

  9. A Technology Enabled Journey

    Science.gov (United States)

    Devine, Pamela Albert

    2012-01-01

    This article features Point Road School, a pre-K-4 school in New Jersey that enhances student learning by integrating new and emerging technologies into the curriculum. Point Road School's technology story began in 1996 with a grant for a classroom modem so students could email their university literacy buddies. The New Jersey school has moved…

  10. TECHNOLOGICAL INNOVATIONS AND SOCIETY.

    Science.gov (United States)

    MORSE, DEAN; WARNER, AARON W.

    THE PAPERS AND DISCUSSIONS IN THIS BOOK REPRESENT THE DELIBERATIONS OF THE 1964-65 COLUMBIA SEMINAR OF TECHNOLOGY AND SOCIAL CHANGE IN WHICH, DURING REGULAR MONTHLY MEETINGS THROUGHOUT THE ACADEMIC YEAR, A DIVERSE GROUP OF PHYSICAL SCIENTISTS, SOCIAL SCIENTISTS, BUSINESS LEADERS, AND PUBLIC OFFICIALS ATTEMPED TO RELATE TECHNOLOGY TO INNOVATION AND…

  11. Danish SDHW Technology

    DEFF Research Database (Denmark)

    Furbo, Simon

    1996-01-01

    The status of Danish technology for solar heating systems for hot water supply as well as R&D work in the field is presented.......The status of Danish technology for solar heating systems for hot water supply as well as R&D work in the field is presented....

  12. Mechatronics and hybrid technologies

    DEFF Research Database (Denmark)

    2008-01-01

    R&D international contributions to control and design of novel intelligent mechatronic products and solutions with sensor- and actuator technology.......R&D international contributions to control and design of novel intelligent mechatronic products and solutions with sensor- and actuator technology....

  13. Emerging wind energy technologies

    DEFF Research Database (Denmark)

    Rasmussen, Flemming; Grivel, Jean-Claude; Faber, Michael Havbro

    2014-01-01

    This chapter will discuss emerging technologies that are expected to continue the development of the wind sector to embrace new markets and to become even more competitive.......This chapter will discuss emerging technologies that are expected to continue the development of the wind sector to embrace new markets and to become even more competitive....

  14. Rehabilitation Technology Review.

    Science.gov (United States)

    Hatherleigh Co., Ltd., New York, NY.

    Designed as a special continuing education program for rehabilitation professionals, this document is divided into five lessons. Lesson 1, "Technology Assessment: Determining the Needs" (Ricardo G. Cerna), includes discussion on technology assessment and determining the needs of the clients as well as different types of assistive…

  15. Nuclear safeguards technology handbook

    International Nuclear Information System (INIS)

    1977-12-01

    The purpose of this handbook is to present to United States industrial organizations the Department of Energy's (DOE) Safeguards Technology Program. The roles and missions for safeguards in the U.S. government and application of the DOE technology program to industry safeguards planning are discussed. A guide to sources and products is included

  16. Environmental science and technology

    Energy Technology Data Exchange (ETDEWEB)

    Manahan, S.E. [Univ. of Missouri, Columbia, MO (United States)

    1998-12-31

    This complete survey of modern environmental science covers the four traditional spheres of the environment: water, air, earth, and life, and introduces a fifth sphere -- the anthrosphere -- which the author defines as the sphere of human activities, especially technology, that affect the earth. The book discusses how technology can be used in a manner that minimizes environmental disruption.

  17. What Is Educational Technology?

    Science.gov (United States)

    Ingle, Henry T.

    1975-01-01

    Featured in this issue are the English translations of two speeches delivered to graduate students in educational technology at Pontificia Universidade, Porto Alegre, Brazil. Henry Ingle defines educational technology in the traditional as well as modern sense, describes its essential elements, and discusses situations in which the use of…

  18. Information technology ethics

    DEFF Research Database (Denmark)

    Hongladarom, Soraj; Ess, Charles

    This book was the first publication to take a genuinely global approach to the diverse ethical issues evoked by Information and Communication Technologies and their possible resolutions. Readers will gain a greater appreciation for the problems and possibilities of genuinely global information...... ethics, which are urgently needed as information and communication technologies continue their exponential growth...

  19. Discourses of Technology

    DEFF Research Database (Denmark)

    Sommer, Jannek K.; Knudsen, Gry Høngsmark

    technology products to explore the negotiation of the familiar and alien that makes consumers reject or embrace a new technology. Thus, this particular project sets out to analyze consumer discourses surrounding the Google Glass video “How it Feels [through Google Glass]” on YouTube, because we want...

  20. Assistive Technology (Moldinclud)

    OpenAIRE

    Luján Mora, Sergio

    2011-01-01

    Slides of the seminar "Assistive Technology" taught at the Institul de Stat de Instruire Continua (Chisinau, Moldova) in november 2011. Transparencias del seminario "Assistive Technology" impartido en el Institul de Stat de Instruire Continua (Chisinau, Moldavia) en noviembre 2011. Tempus project: MOLDINCLUD, Teaching Training Centre for Inclusive Education (TEMPUS 158980-2009).

  1. Educational Technology in Japan.

    Science.gov (United States)

    Sakamoto, Takashi

    1987-01-01

    This overview of the current state of educational technology in Japan includes discussions of professional associations; academic and popular journals; diffusion of media and the budget in elementary and secondary schools; recent trends in government policies; educational technology research; a literature review; and suggestions of future trends.…

  2. Arts and Technology

    DEFF Research Database (Denmark)

    This book constitutes the thoroughly refereed post-conference proceedings of the Second International Conference on Arts and Technology, ArtsIT 2011, which was held in December 2011 in Esbjerg, Denmark. The 19 revised full papers and the two poster papers cover various topics such as Interaction...... and Art, Music and Performance, and Digital Technology....

  3. Brain Activation in Response to Personalized Behavioral and Physiological Feedback From Self-Monitoring Technology: Pilot Study.

    Science.gov (United States)

    Whelan, Maxine E; Morgan, Paul S; Sherar, Lauren B; Kingsnorth, Andrew P; Magistro, Daniele; Esliger, Dale W

    2017-11-08

    The recent surge in commercially available wearable technology has allowed real-time self-monitoring of behavior (eg, physical activity) and physiology (eg, glucose levels). However, there is limited neuroimaging work (ie, functional magnetic resonance imaging [fMRI]) to identify how people's brains respond to receiving this personalized health feedback and how this impacts subsequent behavior. Identify regions of the brain activated and examine associations between activation and behavior. This was a pilot study to assess physical activity, sedentary time, and glucose levels over 14 days in 33 adults (aged 30 to 60 years). Extracted accelerometry, inclinometry, and interstitial glucose data informed the construction of personalized feedback messages (eg, average number of steps per day). These messages were subsequently presented visually to participants during fMRI. Participant physical activity levels and sedentary time were assessed again for 8 days following exposure to this personalized feedback. Independent tests identified significant activations within the prefrontal cortex in response to glucose feedback compared with behavioral feedback (Pbrain activation when compared with behavior. Participants reduced time spent sedentary at follow-up. Research on deploying behavioral and physiological feedback warrants further investigation. ©Maxine E Whelan, Paul S Morgan, Lauren B Sherar, Andrew P Kingsnorth, Daniele Magistro, Dale W Esliger. Originally published in the Journal of Medical Internet Research (http://www.jmir.org), 08.11.2017.

  4. Implementation of Emerging Technologies

    DEFF Research Database (Denmark)

    Barba, F. J.; Orlien, Vibeke; Mota, Maria J.

    2016-01-01

    resources. Lastly, studies with specific examples of the implementation of these novel processing technologies in food industry are described, focusing on the application of high-pressure processing and pulsed electric fields to orange juice, milk, and oysters. Higher implementation costs were observed...... electric fields, ohmic heating, microwave, and ultrasound) emerging technologies are briefly reviewed. Most of these technologies have found niche applications in the food industry, replacing or complementing conventional preservation technologies. Thereby, data on commercialization, energy, and microbial......Novel processing technologies have been gaining interest among food researchers due to their lower impact on nutritional and sensory properties of the products compared to the conventional thermal techniques. In this chapter some of the most well-studied (eg, high-pressure processing, pulsed...

  5. Technology research and development

    International Nuclear Information System (INIS)

    Haas, G.M.; Abdov, M.A.; Baker, C.C.; Beuligmann, R.F.

    1985-01-01

    The U.S. Dept. of Energy discusses the new program plan, the parameters of which are a broad scientific and technology knowledge base, an attractive plasma configuration to be determined, and other issues concerning uncertainty as to what constitutes attractive fusion options to be determined in the future, and increased collaboration. Tables show changing directions in magnetic fusion energy, two examples of boundary condition impacts on long-term technology development, and priority classes of the latter. The Argonne National Laboratory comments on the relationship between science, technology and the engineering aspects of the fusion program. UCLA remarks on the role of fusion technology in the fusion program plan, particularly on results from the recent studies of FINESSE. General Dynamics offers commentary on the issues of a reduced budget, and new emphasis on science which creates an image of the program. A table illustrates technology research and development in the program plan from an industrial perspective

  6. Technology in L1

    DEFF Research Database (Denmark)

    Elf, Nikolaj Frydensbjerg; Hanghøj, Thorkild; Skaar, Håvard

    2015-01-01

    -of-school literacy practices. A final finding is the emphasis on teacher uncertainty regarding how and why to integrate technology within existing paradigms of the subject. This calls for further research on how technology may be justified in L1 practice, including various forms of teacher education.......In recent decades, several Scandinavian research projects have had an explicit focus on how technology intervenes in L1 (or so-called Mother Tongue Education) practices in Swedish, Norwegian and Danish educational contexts, and how this may impact on understanding of the subject. There is currently...... no systematic overview of the documented possibilities and challenges related to the use of technology in L1. At the same time, there is terminological confusion in use of ‘technology’ and related concepts in L1. Finally, there is a general lack of critical reflection on the relation between technological...

  7. Industrial technology transfer

    International Nuclear Information System (INIS)

    Bulger, W.

    1982-06-01

    The transfer of industrial technology is an essential part of the CANDU export marketing program. Potential customers require the opportunity to become self-sufficient in the supply of nuclear plant and equipment in the long term and they require local participation to the maximum extent possible. The Organization of CANDU Industries is working closely with Atomic Energy of Canada Ltd. in developing comprehensive programs for the transfer of manufacturing technology. The objectives of this program are: 1) to make available to the purchasing country all nuclear component manufacturing technology that exists in Canada; and 2) to assure that the transfer of technology takes place in an efficient and effective way. Technology transfer agreements may be in the form of joint ventures or license agreements, depending upon the requirements of the recipient

  8. Designing Human Technologies

    DEFF Research Database (Denmark)

    Simonsen, Jesper

    Research Initiative supporting Roskilde University’s new Humanities and Technology bachelor programme (‘HumTek’), and its three dimensions: Design, Humanities, and Technology. The research initiative involves 70 researchers from different departments and research groups at Roskilde University through...... a shared interdisciplinary research and educational collaboration. As a creative research initiative it focuses on change and innovative thinking. The innovativeness is a result of the strongly interdisciplinary perspective which is at the heart of Designing Human Technologies. Designing Human Technologies......Design is increasingly becoming a part of the university curriculum and research agenda. The keynote present and discuss Designing Human Technologies – an initiative aiming at establishing a design oriented main subject area alongside traditional main subject areas such as Natural Science...

  9. Art, Technology and Nature

    DEFF Research Database (Denmark)

    Since 1900, the connections between art and technology with nature have become increasingly inextricable. Through a selection of innovative readings by international scholars, this book presents the first investigation of the intersections between art, technology and nature in post-medieval times....... Transdisciplinary in approach, this volume’s 14 essays explore art, technology and nature’s shifting constellations that are discernible at the micro level and as part of a larger chronological pattern. Included are subjects ranging from Renaissance wooden dolls, science in the Italian art academies, and artisanal...... Camilla Skovbjerg Paldam and Jacob Wamberg trace the Kantian heritage of radically separating art and technology, and inserting both at a distance to nature, suggesting this was a transient chapter in history. Thus, they argue, the present renegotiation between art, technology and nature is reminiscent...

  10. Fusion technology programme

    International Nuclear Information System (INIS)

    Finken, D.

    1984-04-01

    KfK participates to the Fusion Technology Programme of the European Community. Most of the work in progress addresses the Next European Torus (NET) and the long term technology aspects as defined in the 82/86 programme. A minor part serves to preparation of future contributions and to design studies on fusion concepts in a wider perspective. The Fusion Technology Programme of Euratom covers mainly aspects of nuclear engineering. Plasma engineering, heating, refueling and vacuum technology are at present part of the Physics Programme. In view of NET, integration of the different areas of work will be mandatory. KfK is therefore prepared to address technical aspects beyond the actual scope of the physics experiments. The technology tasks are reported project wise under title and code of the Euratom programme. Most of the projects described here are shared with other European fusion laboratories as indicated in the table annexed to this report. (orig./GG)

  11. Energy and technology review

    International Nuclear Information System (INIS)

    Quirk, W.J.; Bookless, W.A.

    1994-05-01

    The Lawrence Livermore National Laboratory, operated by the University of California for the United States Department of Energy, was established in 1952 to do research on nuclear weapons and magnetic fusion energy. Since then, in response to new national needs, we have added other major programs, including technology transfer, laser science (fusion, isotope separation, materials processing), biology and biotechnology, environmental research and remediation, arms control and nonproliferation, advanced defense technology, and applied energy technology. These programs, in turn, require research in basic scientific disciplines, including chemistry and materials science, computing science and technology, engineering, and physics. The Laboratory also carries out a variety of projects for other federal agencies. Energy and Technology Review is published monthly to report on unclassified work in all our programs. This issue reviews work performed in the areas of modified retoring for waste treatment and underground stripping to remove contamination

  12. Globalization and Technology

    Directory of Open Access Journals (Sweden)

    Traian-Alexandru Miu

    2016-01-01

    Full Text Available Globalization, very complex phenomenon, involves overcoming the barriers between different states, which allowed the rapid transfer of capital, technology, information, and the "toxins" from one country to another. First, the technology formed the basis of rapid expansion of great ideas promoted by globalization. Undeniable progress in the field of technology and science, has conferred to the man extraordinary powers that have been used most often to the detriment of his spiritual progress. We must not deny that science and technology have brought many benefits to human, and he could expand the knowledge horizon upon the world in which he lives, exploiting information acquired and share them with others. Science and technology must become for postmodern man ways of talk and communion between human and divinity, all to the praise of God and the perfection of the creature.

  13. Working around technologies

    DEFF Research Database (Denmark)

    Dupret, Katia

    2017-01-01

    expressions of professionals’ active encounter with the complexity of work situations, and can therefore be important signs of professional ethical judgement. Drawing on science and technology studies and the concept of invisible work, the study discusses workaround situations that arise in health care work......This study discusses how professionalism and work ethics influence how health care professionals work around new technologies. When people avoid using technologies, they are not necessarily ceasing to engage in their work activities. The workaround strategies presented here are rather practical...... in Denmark. The aim and contribution of the study is twofold. First, it attempts to revitalise the discussion on technology workaround strategies as responsible professionalism. Second, it will direct attention to and contribute to an understanding of how the normativity embedded in technological development...

  14. Interpretation of Internet technology

    DEFF Research Database (Denmark)

    Madsen, Charlotte Øland

    2001-01-01

    Research scope: The topic of the research project is to investigate how new internet technologies such as e-trade and customer relation marketing and management are implemented in Danish food processing companies. The aim is to use Weick's (1995) sensemaking concept to analyse the strategic...... processes leading to the use of internet marketing technologies and to investigate how these new technologies are interpreted into the organisation. Investigating the organisational socio-cognitive processes underlying the decision making processes will give further insight into the socio......-cognitive competencies of organisations (Rindova & Fombrunn, 1999). The aim is to contribute to the existing technological implementation theory complex by studying the relationships between the elements of the socio-cognitive processes and the resulting interpretations and actions when new technologies are implemented...

  15. 2017 Annual Technology Baseline

    Energy Technology Data Exchange (ETDEWEB)

    Cole, Wesley J [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Hand, M. M [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Eberle, Annika [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Beiter, Philipp C [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Kurup, Parthiv [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Turchi, Craig S [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Feldman, David J [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Margolis, Robert M [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Augustine, Chad R [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Maness, Michael [Formerly NREL; O' Connor, Patrick [Oak Ridge National Laboratory

    2018-03-26

    Consistent cost and performance data for various electricity generation technologies can be difficult to find and may change frequently for certain technologies. With the Annual Technology Baseline (ATB), the National Renewable Energy Laboratory annually provides an organized and centralized set of such cost and performance data. The ATB uses the best information from the Department of Energy national laboratories' renewable energy analysts as well as information from the Energy Information Administration for fuel-based technologies. The ATB has been reviewed by experts and it includes the following electricity generation technologies: land-based wind, offshore wind, utility-scale solar photovoltaics (PV), commercial-scale solar PV, residential-scale solar PV, concentrating solar power, geothermal power, hydropower, coal, natural gas, nuclear, and conventional biopower. This webinar presentation introduces the 2017 ATB.

  16. Technology and Sport

    DEFF Research Database (Denmark)

    Møller, Rasmus Bysted; Møller, Verner

    2015-01-01

    The relationship between sport and technology is close and can be both fruitful and destructive. Technology has a constitutive function in sport as it makes the activity possible and it can enhance performance as well as the sporting experience. The use of football boots is clearly more comfortable...... and effective than playing in bare feet in a game of football. However, sport challenges its athletes by demanding the employment of less efficient means rather than more efficient means in pursuit of sport specific goals. Therefore technology can potentially subtract from the sporting experience and even...... has long been a heated topic and with gene technology waiting around the corner the relationship between sport and technology has become strained and is more and more often viewed as problematic rather than benign. In this chapter we follow up on this trend by exposing what we consider a tendency...

  17. Accelerator technology in tokamaks

    International Nuclear Information System (INIS)

    Kustom, R.L.

    1977-01-01

    This article presents the similarities in the technology required for high energy accelerators and tokamak fusion devices. The tokamak devices and R and D programs described in the text represent only a fraction of the total fusion program. The technological barriers to producing successful, economical tokamak fusion power plants are as many as the plasma physics problems to be overcome. With the present emphasis on energy problems in this country and elsewhere, it is very likely that fusion technology related R and D programs will vigorously continue; and since high energy accelerator technology has so much in common with fusion technology, more scientists from the accelerator community are likely to be attracted to fusion problems

  18. Technology for Peacebuilding

    Directory of Open Access Journals (Sweden)

    Helena Puig Larrauri

    2013-11-01

    Full Text Available New technologies are changing how and when we learn about events and choose to respond to them. Mobile phones and the internet have altered how we engage with the world. With technology usage expanding rapidly in the developing world, new avenues of participation, engagement, and accountability are emerging. Globally, more people now have the opportunity to actively make use of these tools to participate in processes that impact their societies. This opportunity for participation is also an opportunity for engaging in new ways with peacebuilding processes. As the field of technology for peacebuilding grows, most attention has been paid to the potential of new technologies for bridging the gap between warning and response. Whilst the focus on the use of technology for early warning and response is important, there is more to this growing field. The empowerment of people to participate in localized conflict management efforts is one of the most significant innovations and opportunities created by new technologies. Technology can contribute to peacebuilding processes by offering tools that foster collaboration, transform attitudes, and give a stronger voice to communities. This article aims to give practitioners two related frameworks to understand how new technologies can enhance peacebuilding. The first section looks at the functions that technology can have in a peacebuilding program as a tool for data processing, communication, engagement, and gaming. We then examine the program areas that new technologies can best contribute to, covering early warning/early response systems, programs that allow citizens to voice their opinions and experiences, collaboration efforts, and programs aimed at transforming attitudes.

  19. Excursions in technology policy

    Science.gov (United States)

    Archibald, Robert B.

    1995-01-01

    This technical report presents a summary of three distinct projects: (1) Measuring economic benefits; (2) Evaluating the SBIR program; and (3) A model for evaluating changes in support for science and technology. the first project deals with the Technology Applications Group (TAG) at NASA Langley Research Center. The mission of TAG is to assist firms interested in commercializing technologies. TAG is a relatively new group as is the emphasis on technology commercialization for NASA. One problem faced by TAG and similar groups at other centers is measuring their effectiveness. The first project this summer, a paper entitled, 'Measuring the Economic Benefits of Technology Transfer from a National Laboratory: A Primer,' focused on this measurement problem. We found that the existing studies of the impact of technology transfer on the economy were conceptually flawed. The 'primer' outlines the appropriate theoretical framework for measuring the economic benefits of technology transfer. The second project discusses, one of the programs of TAG, the Small Business Innovation Research (SBIR) program. This program has led to over 400 contracts with Small Business since its inception in 1985. The program has never been evaluated. Crucial questions such as those about the extent of commercial successes from the contracts need to be answered. This summer we designed and implemented a performance evaluation survey instrument. The analysis of the data will take place in the fall. The discussion of the third project focuses on a model for evaluating changes in support for science and technology. At present several powerful forces are combining to change the environment for science and technology policy. The end of the cold war eliminated the rationale for federal support for many projects. The new- found Congressional conviction to balance the budget without tax increases combined with demographic changes which automatically increase spending for some politically popular programs

  20. Tensions at EU-Russia Summit / Andrew Rettman

    Index Scriptorium Estoniae

    Rettman, Andrew

    2009-01-01

    Enne Euroopa Liidu-Venemaa tippkohtumist Kaug-Idas ütles Tšehhi president Vaclav Klaus päevalehes Lidove Noviny, et ta ei näe Venemaas ohtu, vaid suurt, tugevat ja ambitsioonikat riiki, millele tuleb rohkem tähelepanu pöörata kui riikidele nagu Eesti ja Leedu. President Toomas Hendrik Ilves väljendas üllatust, et selliste kahetsusväärsete sõnadega - mis jagavad Euroopa riigid olulisteks ja ebaolulisteks - esines just tšehh

  1. Frederic Andrews Gibbs and the Assassination of John Fitzgerald Kennedy.

    Science.gov (United States)

    Bhattacharyya, Kalyan B

    2017-01-01

    Frederic Gibbs, the peerless expert on electroencephalogrphy was summoned to provide opinion on the EEG tracing of Jack Ruby, who murdered Lee Harvey Oswald, the assassin of John Fitzgerald Kennedy, the American President, in 1963. Gibbs pleaded that the tracing suggested features indicative of psychomotor epilepsy and Ruby killed Oswald in a state of fugue. His view was not agreed upon but Gibbs stood his ground unflinchingly. Subsequent appeals to the higher court spared Ruby from imminent execution and finally he died a natural death from metastatic complications of carcinoma of the lung in 1967.

  2. Correspondence REFERENCES Response to N.B. Andrews

    African Journals Online (AJOL)

    The above article contains no reference to any peer- reviewed paper published on the clinical presentation of brain tumours in Ghana, but at least one such paper is available.1 The article, however, quotes a reference to research done on Brain Tumours in Ghana from an in- ternet article from a newsite intended for ...

  3. Parents' struggles to rebuild family life after Hurricane Andrew.

    Science.gov (United States)

    Coffman, S

    1996-01-01

    The purpose of this phenomenological study was to gain a deeper understanding of the meaning of parents' everyday experiences after a major natural disaster. In-depth interviews were conducted with 13 parents who lived in the hurricane-damaged area. The essence of being a parent emerged as "struggling to rebuild family life." The struggles were superimposed on top of ongoing issues such as divorce and job responsibilities. Parents described feelings of being thankful to be alive, being overwhelmed, being limited by environmental aftereffects, being responsible for children, balancing needs and roles, constantly changing amidst uncertainty, and finding meaning in the disaster. Study findings support the need for nursing interventions that address family needs, support strengths, and involve parents as active decision makers.

  4. Andrew Hoberek, ed. The Cambridge Companion to John F. Kennedy

    OpenAIRE

    Gratale, Joseph Michael

    2016-01-01

    John. F. Kennedy served as president of the United States of America for about one thousand days.  Despite the brief duration of his administration, President Kennedy’s impact and legacy continues to attract discussion and debate amongst scholars and laypersons alike over half a century after he entered the oval office in 1961.  What is it about him and his presidency that sustains public curiosity and appeal? Is it his relatively young age, and youthful appearance? Perhaps it is his optimism...

  5. 76 FR 48168 - Andrew K. Choi: Debarment Order

    Science.gov (United States)

    2011-08-08

    .... Choi was convicted of a misdemeanor under Federal law for conduct relating to the regulation of a drug... misdemeanor under Federal law for conduct relating to the regulation of drug products under the FD&C Act, and... of drug products under the FD&C Act, and that the conduct that served as a basis for the conviction...

  6. q -Engel Series Expansions and Slaters Identities | Andrews ...

    African Journals Online (AJOL)

    We describe the q-Engel series expansion for Laurent series discovered by. John Knopfmacher and use this algorithm to shed new light on partition identities related to two entries from Slater's list. In our study Al-Salam/Ismail and. Santos polynomials play a crucial role. Mathematics Subject Classification (1991): Primary: ...

  7. Public participation and the politics of environmentalism | Andrew ...

    African Journals Online (AJOL)

    As a result, in recent years a discourse of global ecology has developed that is largely devoid of any consideration of power relations, cultural authenticity and moral choice; instead, it rather promotes the aspirations of a rising eco-cracy to manage nature and regulate people worldwide. Ironically, a movement which once ...

  8. USA hiiglane GE Healthcare korraldab meditsiinis revolutsiooni / Andrew Jack

    Index Scriptorium Estoniae

    Jack, Andrew

    2006-01-01

    General Electricu tütarettevõte GE Healthcare võttis üle Briti diagnostika- ja bioteaduse uurimisfirma Amersham, firma strateegia tuum on võimsa skaneerimistehnoloogia ja meditsiinilise diagnostika üksteisele lähendamine. Lisa: Aeg sorteerida andmeid infotehnoloogia abil

  9. Surviving Sepsis in High HIV Prevalence Settings | Andrews ...

    African Journals Online (AJOL)

    No Abstract. Keywords: minimally invasive surgery, sclerotherapy, transfusion, HIV, occupational exposure. Full Text: EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT · AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors ...

  10. General Andrew Wauchope of Niddrie Marischal. A character sketch ...

    African Journals Online (AJOL)

    am too old at the business not to realise how uncertain war is, especially in South Africa .... " (Douglas, 1904:369) Perhaps he was mindful also of the British disaster .... and with courtesy and respect offered help where they could. The week of defeats, Black Week, led to the replacement of Buller by Roberts who embarked.

  11. Bovine Related Head Trauma in Tema- A Case Report. | Andrews ...

    African Journals Online (AJOL)

    ... scan revealed a left temporal bone non-depressed skull fracture, pneumocephalus, an intraaxial temporal lobe hematoma and subarachnoid hemorrhage. Intervention: The patient was treated non-operatively with antibiotics and Nimodopine. He became symptom free with radiographic resolution of the intracranial lesion.

  12. Application of Andrew's Plots to Visualization of Multidimensional Data

    Science.gov (United States)

    Grinshpun, Vadim

    2016-01-01

    Importance: The article raises a point of visual representation of big data, recently considered to be demanded for many scientific and real-life applications, and analyzes particulars for visualization of multi-dimensional data, giving examples of the visual analytics-related problems. Objectives: The purpose of this paper is to study application…

  13. Communication technology update and fundamentals

    CERN Document Server

    Grant, August E

    2010-01-01

    New communication technologies are being introduced at an astonishing rate. Making sense of these technologies is increasingly difficult. Communication Technology Update and Fundamentals is the single best source for the latest developments, trends, and issues in communication technology. Featuring the fundamental framework along with the history and background of communication technologies, Communication Technology Update and Fundamentals, 12th edition helps you stay ahead of these ever-changing and emerging technologies.As always, every chapter ha

  14. United States advanced technologies

    International Nuclear Information System (INIS)

    Longenecker, J.R.

    1985-01-01

    In the United States, the advanced technologies have been applied to uranium enrichment as a means by which it can be assured that nuclear fuel cost will remain competitive in the future. The United States is strongly committed to the development of advanced enrichment technology, and has brought both advanced gas centrifuge (AGC) and atomic vapor laser isotope separation (AVLIS) programs to a point of significant technical refinement. The ability to deploy advanced technologies is the basis for the confidence in competitive future price. Unfortunately, the development of advanced technologies is capital intensive. The year 1985 is the key year for advanced technology development in the United States, since the decision on the primary enrichment technology for the future, AGC or AVLIS, will be made shortly. The background on the technology selection process, the highlights of AGC and AVLIS programs and the way to proceed after the process selection are described. The key objective is to maximize the sales volume and minimize the operating cost. This will help the utilities in other countries supply low cost energy on a reliable, long term basis. (Kako, I.)

  15. Technology and medicine.

    Science.gov (United States)

    Booth, C

    1985-05-22

    Technology, which is older than science, has been of vital importance in the development of modern medicine. Even so, there are voices of dissent to be heard. The disenchantment with technology expressed by Aldous Huxley in Brave new world has been echoed by contemporary writers on the technology of modern medicine. Medicine is seen by some to have been dehumanized by technology, and techniques that are expensive are thought to be consuming a greater proportion of health resources than they deserve. The practice of medicine has, nevertheless, been transformed by modern technology and diagnostic techniques and therapeutic measures undreamed of a few short decades ago are now commonplace. There is no reason why these developments should be any more dehumanizing than the use of similar techniques in modern transportation or communication, nor is their expense out of proportion when compared with other demands on the nation's purse. British workers have been at the forefront of many recent advances. Yet, even though the National Health Service provides a ready market for the products of British medical technology, the nation depends to an inordinate degree on imported products. In the development of appropriate medical technology there is an urgent need for better communication between inventors, scientists, industrialists and the National Health Service. At the same time there is an equal need for improved evaluation of untried techniques. The pressure for a central integrating body to coordinate resources could well be supported by the establishment of evaluation units in the different health authorities in this country.

  16. SINK OR SWIM? DEBT REVIEW'S AMBIVALENT "LIFELINE" ---- A SECOND SEQUEL TO "… A TALE OF TWO JUDGMENTS" NEDBANK V ANDREWS (240/2011 2011 ZAECPEHC 29 (10 May 2011; FIRSTRAND BANK LTD V EVANS 2011 4 SA 597 (KZD AND FIRSTRAND BANK LTD V JANSE VAN RENSBURG 2012 2 All SA 186 (ECP

    Directory of Open Access Journals (Sweden)

    L Steyn

    2012-11-01

    Full Text Available The interface between the National Credit Act 34 of 2005 and the Insolvency Act 24 of 1936 has been the object of our courts' attention in a number of recent cases including Ex parte Ford and Two Similar Cases 2009 3 SA 376 (WCC, Investec Bank Ltd v Mutemeri 2010 1 SA 265 (GSJ, Naidoo v ABSA Bank Ltd 2010 4 SA 597 (SCA and, more recently, Nedbank v Andrews (240/2011 2011 ZAECPEHC 29 (10 May 2011, FirstRand Bank Ltd v Evans 2011 4 597 (KZD and FirstRand Bank Ltd v Janse van Rensburg 2012 2 All SA 186 (ECP. The question raised in all of the three most recent cases was whether or not a debtor's application for debt review in terms of the National Credit Act constitutes an "act of insolvency" in terms of section 8 of the Insolvency Act, upon which a creditor may rely in an application for the compulsory sequestration of the debtor's estate. If it does, it would mean that by resorting to the debt relief measures provided by the National Credit Act a debtor commits the very act on which a creditor may base an application for a sequestration order which, if granted, will render the debtor's estate insolvent and bring about the liquidation of his assets. From the debtor's perspective, this is probably precisely the situation that he seeks to avert by applying for debt review. Further, sequestration would frustrate the stated purpose of the National Credit Act, which is that debtors should take responsibility for their debts by satisfying them in full. Concurrent creditors might also ultimately receive a dividend which falls far short of what is due to them. The question of whether a debtor's resorting to debt review may or should be the very act that triggers his estate's sequestration and its attendant consequences is an important issue, the treatment of which impacts significantly on the efficacy of the South African consumer debt relief system. This article analyses the most recent judgments and considers whether or not statutory regulation of the

  17. The technology vicinity: a location based view on technology

    NARCIS (Netherlands)

    Steenhuis, H.J.; de Bruijn, E.J.; Kocaoglu, D.F.; Anderson, T.R.

    2001-01-01

    The issue of technology transfer has been viewed from many different perspectives. In this case the focus is on the process of (production) technology transfer. One of the difficulties in studying international technology transfer is the definition of technology. The many technology definitions that

  18. COPPER CABLE RECYCLING TECHNOLOGY

    International Nuclear Information System (INIS)

    Chelsea Hubbard

    2001-01-01

    The United States Department of Energy (DOE) continually seeks safer and more cost-effective technologies for use in deactivation and decommissioning (D and D) of nuclear facilities. The Deactivation and Decommissioning Focus Area (DDFA) of the DOE's Office of Science and Technology (OST) sponsors large-scale demonstration and deployment projects (LSDDPs). At these LSDDPs, developers and vendors of improved or innovative technologies showcase products that are potentially beneficial to the DOE's projects and to others in the D and D community. Benefits sought include decreased health and safety risks to personnel and the environment, increased productivity, and decreased costs of operation. The Idaho National Engineering and Environmental Laboratory (INEEL) generated a list of statements defining specific needs and problems where improved technology could be incorporated into ongoing D and D tasks. One such need is to reduce the volume of waste copper wire and cable generated by D and D. Deactivation and decommissioning activities of nuclear facilities generates hundreds of tons of contaminated copper cable, which are sent to radioactive waste disposal sites. The Copper Cable Recycling Technology separates the clean copper from contaminated insulation and dust materials in these cables. The recovered copper can then be reclaimed and, more importantly, landfill disposal volumes can be reduced. The existing baseline technology for disposing radioactively contaminated cables is to package the cables in wooden storage boxes and dispose of the cables in radioactive waste disposal sites. The Copper Cable Recycling Technology is applicable to facility decommissioning projects at many Department of Energy (DOE) nuclear facilities and commercial nuclear power plants undergoing decommissioning activities. The INEEL Copper Cable Recycling Technology Demonstration investigated the effectiveness and efficiency to recycle 13.5 tons of copper cable. To determine the effectiveness

  19. Emergent technologies: 25 years

    Science.gov (United States)

    Rising, Hawley K.

    2013-03-01

    This paper will talk about the technologies that have been emerging over the 25 years since the Human Vision and Electronic Imaging conference began that the conference has been a part of, and that have been a part of the conference, and will look at those technologies that are emerging today, such as social networks, haptic technologies, and still emerging imaging technologies, and what we might look at for the future.Twenty-five years is a long time, and it is not without difficulty that we remember what was emerging in the late 1980s. Yet to be developed: The first commercial digital still camera was not yet on the market, although there were hand held electronic cameras. Personal computers were not displaying standardized images, and image quality was not something that could be talked about in a standardized fashion, if only because image compression algorithms were not standardized yet for several years hence. Even further away were any standards for movie compression standards, there was no personal computer even on the horizon which could display them. What became an emergent technology and filled many sessions later, image comparison and search, was not possible, nor the current emerging technology of social networks- the world wide web was still several years away. Printer technology was still devising dithers and image size manipulations which would consume many years, as would scanning technology, and image quality for both was a major issue for dithers and Fourier noise.From these humble beginnings to the current moves that are changing computing and the meaning of both electronic devices and human interaction with them, we will see a course through the changing technology that holds some features constant for many years, while others come and go.

  20. Digital security technology simplified.

    Science.gov (United States)

    Scaglione, Bernard J

    2007-01-01

    Digital security technology is making great strides in replacing analog and other traditional security systems including CCTV card access, personal identification and alarm monitoring applications. Like any new technology, the author says, it is important to understand its benefits and limitations before purchasing and installing, to ensure its proper operation and effectiveness. This article is a primer for security directors on how digital technology works. It provides an understanding of the key components which make up the foundation for digital security systems, focusing on three key aspects of the digital security world: the security network, IP cameras and IP recorders.