Energy Technology Data Exchange (ETDEWEB)
Bullita, S.; Casula, M. F., E-mail: casulaf@unica.it [INSTM and Department of Chemical and Geological Science, University of Cagliari, Monserrato (Canada) (Italy); Piludu, M. [Department of Biomedical Sciences, University of Cagliari, Monserrato (Canada) (Italy); Falqui, A. [INSTM and Department of Chemical and Geological Science, University of Cagliari, Monserrato (Canada) Italy and KAUST-King Abdullah University of Science and Technology, Jeddah (Saudi Arabia); Carta, D. [INSTM and Department of Chemical and Geological Science, University of Cagliari, Monserrato (Canada), Italy and Faculty of Physical Sciences and Engineering, University of Southampton, Southampton (United Kingdom); Corrias, A. [INSTM and Department of Chemical and Geological Science, University of Cagliari, Monserrato (Canada) Italy and School of Physical Sciences, Ingram Building, University of Kent, Canterbury (United Kingdom)
2014-10-21
Nanocomposites made out of FeCo alloy nanocrystals supported onto pre-formed mesoporous ordered silica which features a cubic arrangement of pores (SBA-16) were investigated. Information on the effect of the nanocrystals on the mesostructure (i.e. pore arrangement symmetry, pore size, and shape) were deduced by a multitechnique approach including N2 physisorption, low angle X-ray diffraction, and Transmission electron microscopy. It is shown that advanced transmission electron microscopy techniques are required, however, to gain direct evidence on key compositional and textural features of the nanocomposites. In particular, electron tomography and microtomy techniques make clear that the FeCo nanocrystals are located within the pores of the SBA-16 silica, and that the ordered mesostructure of the nanocomposite is retained throughout the observed specimen.
DEFF Research Database (Denmark)
Rodrigo, Katarzyna Agnieszka; Wang, Hsiang-Jen; Heiroth, Sebastian
2011-01-01
The morphology as well as the spatially resolved elemental and chemical characterization of 10 mol% gadolinia doped ceria (CGO10) structures prepared by pulsed laser deposition (PLD) technique are investigated by scanning transmission electron microscopy accompanied with electron energy loss spec......, indicate apparent variation of the ceria valence state across and along the film. No element segregation to the grain boundaries is detected. These results are discussed in the context of solid oxide fuel cell applications.......The morphology as well as the spatially resolved elemental and chemical characterization of 10 mol% gadolinia doped ceria (CGO10) structures prepared by pulsed laser deposition (PLD) technique are investigated by scanning transmission electron microscopy accompanied with electron energy loss...... spectroscopy and energy dispersive X-ray spectroscopy. A dense, columnar and structurally inhomogeneous CGO10 film, i.e. exhibiting grain size refinement across the film thickness, is obtained in the deposition process. The cerium M4,5 edges, used to monitor the local electronic structure of the grains...
Transmission Electron Microscope Measures Lattice Parameters
Pike, William T.
1996-01-01
Convergent-beam microdiffraction (CBM) in thermionic-emission transmission electron microscope (TEM) is technique for measuring lattice parameters of nanometer-sized specimens of crystalline materials. Lattice parameters determined by use of CBM accurate to within few parts in thousand. Technique developed especially for use in quantifying lattice parameters, and thus strains, in epitaxial mismatched-crystal-lattice multilayer structures in multiple-quantum-well and other advanced semiconductor electronic devices. Ability to determine strains in indivdual layers contributes to understanding of novel electronic behaviors of devices.
International Nuclear Information System (INIS)
Biasi, R.S. de; Rodrigues, R.W.D.; Pascual, R.; Pessoa, C.S.
1983-01-01
The crystallization of the metal glass METGLAS 2826A has been studied with the ferromagnetic resonance and electron transmission microscopy techniques. The first-derivative linewidth of the absorption curve was measured for several times of isothermal treatments at 375 0 C. After an initial decrease, attributed to stress relaxation, the linewidth increases linearly with the transformed fraction of the first crystallization phase. Comparison with the electron microscopy results shows that the ferromagnetic resonance technique is particularly useful for short and medium aging times. (Author) [pt
International Nuclear Information System (INIS)
Shahid, M.; Thomson, G.E.
1997-01-01
Along with improved mechanical properties, metal matrix composites (MMC) have a disadvantage of enhanced corrosion susceptibility in aggressive environments. Recent studies on corrosion behaviour of an Al-alloy 8090/SiC MMC, revealed considerably high corrosion rates of the MMC in near neutral solutions containing chloride ions. Anodizing is one of the potential surface treatment for the MMC to provide protective coating against corrosion. The surface and cross section of the anodized MMC can easily be observed using scanning electron microscope. The anodizing behaviour of the MMC can be understood further if the anodized cross section in examined under transmission electron microscope (TEM). However, it is relatively difficult to prepare small (3 mm diameter) electron transparent specimens of the MMC supporting an anodic film. In the present study a technique has been developed for preparing thin electron transparent specimens of the anodized MMC. This technique employed conventional ion beam thinning process but the preparation of small discs was a problem. A MMMC consisting of Al-alloy 8090 with 20 % (by weight) SiC particulate with an average size of 5 Mu m, was anodized and observed in TEM after preparing the samples using the above mentioned techniques. (author)
DEFF Research Database (Denmark)
Lindbo, Jørgen
1966-01-01
A technique for thinning 1 mm wire samples of aluminium and aluminium-alumina alloys for transmission electron microscopy is described. The essential feature of the technique, which involves spark machining and electropolishing in a polytetrafluoroethylene holder followed by chemical polishing...
Elemental mapping in scanning transmission electron microscopy
International Nuclear Information System (INIS)
Allen, L J; D'Alfonso, A J; Lugg, N R; Findlay, S D; LeBeau, J M; Stemmer, S
2010-01-01
We discuss atomic resolution chemical mapping in scanning transmission electron microscopy (STEM) based on core-loss electron energy loss spectroscopy (EELS) and also on energy dispersive X-ray (EDX) imaging. Chemical mapping using EELS can yield counterintuitive results which, however, can be understood using first principles calculations. Experimental chemical maps based on EDX bear out the thesis that such maps are always likely to be directly interpretable. This can be explained in terms of the local nature of the effective optical potential for ionization under those imaging conditions. This is followed by an excursion into the complementary technique of elemental mapping using energy-filtered transmission electron microscopy (EFTEM) in a conventional transmission electron microscope. We will then consider the widely used technique of Z-contrast or high-angle annular dark field (HAADF) imaging, which is based on phonon excitation, where it has recently been shown that intensity variations can be placed on an absolute scale by normalizing the measured intensities to the incident beam. Results, showing excellent agreement between theory and experiment to within a few percent, are shown for Z-contrast imaging from a sample of PbWO 4 .
Transmission Electron Microscopy of Minerals and Rocks
McLaren, Alex C.
1991-04-01
Of the many techniques that have been applied to the study of crystal defects, none has contributed more to our understanding of their nature and influence on the physical and chemical properties of crystalline materials than transmission electron microscopy (TEM). TEM is now used extensively by an increasing number of earth scientists for direct observation of defect microstructures in minerals and rocks. Transmission Electron Microscopy of Rocks and Minerals is an introduction to the principles of the technique and is the only book to date on the subject written specifically for geologists and mineralogists. The first part of the book deals with the essential physics of the transmission electron microscope and presents the basic theoretical background required for the interpretation of images and electron diffraction patterns. The final chapters are concerned with specific applications of TEM in mineralogy and deal with such topics as planar defects, intergrowths, radiation-induced defects, dislocations and deformation-induced microstructures. The examples cover a wide range of rock-forming minerals from crustal rocks to those in the lower mantle, and also take into account the role of defects in important mineralogical and geological processes.
Three-Dimensional Orientation Mapping in the Transmission Electron Microscope
DEFF Research Database (Denmark)
Liu, Haihua; Schmidt, Søren; Poulsen, Henning Friis
2011-01-01
resolution of 200 nanometers (nm). We describe here a nondestructive technique that enables 3D orientation mapping in the transmission electron microscope of mono- and multiphase nanocrystalline materials with a spatial resolution reaching 1 nm. We demonstrate the technique by an experimental study...
Novel lift-off technique for Transmission Electron Microscopy imaging of block copolymer films
International Nuclear Information System (INIS)
Roache, Fergus J.M.; Radjainia, Mazdak; Williams, David E.; Gerrard, Juliet A.; Travas-Sejdic, Jadranka; Malmström, Jenny
2015-01-01
We have developed a simple technique to allow for the lift-off and subsequent transfer of poly(styrene-block-ethylene glycol) films to Transmission Electron Microscopy (TEM) grids. The block copolymer is spin coated onto carbon coated mica and annealed. After the thin film is produced it can easily be floated onto water and picked up by a TEM grid. This method offers better control over film processing than dip coating the TEM grid and is also a significant improvement over methods using etchants such as hydrofluoric acid. - Highlights: • We have developed a simple method to lift block copolymer films to TEM grids. • Polymer films prepared on carbon coated mica are easily floated on water. • The new method circumvents the use of harsh chemicals
Characterization of Li-rich layered oxides by using transmission electron microscope
Directory of Open Access Journals (Sweden)
Hu Zhao
2017-07-01
Full Text Available Lithium-rich layered oxides (LrLOs deliver extremely high specific capacities and are considered to be promising candidates for electric vehicle and smart grid applications. However, the application of LrLOs needs further understanding of the structural complexity and dynamic evolution of monoclinic and rhombohedral phases, in order to overcome the issues including voltage decay, poor rate capability, initial irreversible capacity loss and etc. The development of aberration correction for the transmission electron microscope and concurrent progress in electron spectroscopy, have fueled rapid progress in the understanding of the mechanism of such issues. New techniques based on the transmission electron microscope are first surveyed, and the applications of these techniques for the study of the structure, migration of transition metal, and the activation of oxygen of LrLOs are then explored in detail, with a particular focus on the mechanism of voltage decay. Keywords: Lithium-ion battery, Transmission electron microscope, Lithium-rich layered oxide, Cathode material
Cellular imaging electron tomography and related techniques
2018-01-01
This book highlights important techniques for cellular imaging and covers the basics and applications of electron tomography and related techniques. In addition, it considers practical aspects and broadens the technological focus by incorporating techniques that are only now becoming accessible (e.g. block face imaging). The first part of the book describes the electron microscopy 3D technique available to scientists around the world, allowing them to characterize organelles, cells and tissues. The major emphasis is on new technologies like scanning transmission electron microscopy (STEM) tomography, though the book also reviews some of the more proven technologies like electron tomography. In turn, the second part is dedicated to the reconstruction of data sets, signal improvement and interpretation.
Transmission electron microscopy of mercury metal
Anjum, Dalaver H.
2016-03-28
Summary: Transmission electron microcopy (TEM) analysis of liquid metals, especially mercury (Hg), is difficult to carry out because their specimen preparation poses a daunting task due to the unique surface properties of these metals. This paper reports a cryoTEM study on Hg using a novel specimen preparation technique. Hg metal is mixed with water using sonication and quenched in liquid ethane cryogen. This technique permits research into the morphological, phase and structural properties of Hg at nanoscale dimensions. © 2016 Royal Microscopical Society.
Transmission electron microscopy in micro-nanoelectronics
Claverie, Alain
2013-01-01
Today, the availability of bright and highly coherent electron sources and sensitive detectors has radically changed the type and quality of the information which can be obtained by transmission electron microscopy (TEM). TEMs are now present in large numbers not only in academia, but also in industrial research centers and fabs.This book presents in a simple and practical way the new quantitative techniques based on TEM which have recently been invented or developed to address most of the main challenging issues scientists and process engineers have to face to develop or optimize sem
New developments in transmission electron microscopy for nanotechnology
International Nuclear Information System (INIS)
Wang, Z.L.
2003-01-01
High-resolution transmission electron microscopy (HRTEM) is one of the most powerful tools used for characterizing nanomaterials, and it is indispensable for nanotechnology. This paper reviews some of the most recent developments in electron microscopy techniques for characterizing nanomaterials. The review covers the following areas: in-situ microscopy for studying dynamic shape transformation of nanocrystals; in-situ nanoscale property measurements on the mechanical, electrical and field emission properties of nanotubes/nanowires; environmental microscopy for direct observation of surface reactions; aberration-free angstrom-resolution imaging of light elements (such as oxygen and lithium); high-angle annular-dark-field scanning transmission electron microscopy (STEM); imaging of atom clusters with atomic resolution chemical information; electron holography of magnetic materials; and high-spatial resolution electron energy-loss spectroscopy (EELS) for nanoscale electronic and chemical analysis. It is demonstrated that the picometer-scale science provided by HRTEM is the foundation of nanometer-scale technology. (Abstract Copyright [2003], Wiley Periodicals, Inc.)
Oxidation mechanism of nickel particles studied in an environmental transmission electron microscope
DEFF Research Database (Denmark)
Jeangros, Q.; Hansen, Thomas Willum; Wagner, Jakob Birkedal
2014-01-01
The oxidation of nickel particles was studied in situ in an environmental transmission electron microscope in 3.2 mbar of O2 between ambient temperature and 600°C. Several different transmission electron microscopy imaging techniques, electron diffraction and electron energy-loss spectroscopy were...... diffusion of Ni2+ along NiO grain boundaries, self-diffusion of Ni2+ ions and vacancies, growth of NiO grains and nucleation of voids at Ni/NiO interfaces. We also observed the formation of transverse cracks in a growing NiO film in situ in the electron microscope....
Transmission Electron Microscopy as Key Technique for the Characterization of Telocytes.
Cantarero, Irene; Luesma, Maria Jose; Alvarez-Dotu, Jose Miguel; Muñoz, Eduardo; Junquera, Concepcion
2016-01-01
It was 50 years ago when the details of cellular structure were first observed with an electron microscope (EM). Today, transmission electron microscopy (TEM) still provides the highest resolution detail of cellular ultrastructure. The existence of telocytes (TCs) has been described by Hinescu and Popescu in 2005 and up to now, many studies have been done in different tissues. EM has been fundamental in identification and recognition of TC and relationship between TC and stem cells (SCs) in recent years. We present a review on the importance of TEM to provide major advances in the knowledge of the biology of these cells.
Structure Identification in High-Resolution Transmission Electron Microscopic Images
DEFF Research Database (Denmark)
Vestergaard, Jacob Schack; Kling, Jens; Dahl, Anders Bjorholm
2014-01-01
A connection between microscopic structure and macroscopic properties is expected for almost all material systems. High-resolution transmission electron microscopy is a technique offering insight into the atomic structure, but the analysis of large image series can be time consuming. The present ...
Gauquelin, N; van den Bos, K H W; Béché, A; Krause, F F; Lobato, I; Lazar, S; Rosenauer, A; Van Aert, S; Verbeeck, J
2017-10-01
Nowadays, aberration corrected transmission electron microscopy (TEM) is a popular method to characterise nanomaterials at the atomic scale. Here, atomically resolved images of nanomaterials are acquired, where the contrast depends on the illumination, imaging and detector conditions of the microscope. Visualization of light elements is possible when using low angle annular dark field (LAADF) STEM, annular bright field (ABF) STEM, integrated differential phase contrast (iDPC) STEM, negative spherical aberration imaging (NCSI) and imaging STEM (ISTEM). In this work, images of a NdGaO 3 -La 0.67 Sr 0.33 MnO 3 (NGO-LSMO) interface are quantitatively evaluated by using statistical parameter estimation theory. For imaging light elements, all techniques are providing reliable results, while the techniques based on interference contrast, NCSI and ISTEM, are less robust in terms of accuracy for extracting heavy column locations. In term of precision, sample drift and scan distortions mainly limits the STEM based techniques as compared to NCSI. Post processing techniques can, however, partially compensate for this. In order to provide an outlook to the future, simulated images of NGO, in which the unavoidable presence of Poisson noise is taken into account, are used to determine the ultimate precision. In this future counting noise limited scenario, NCSI and ISTEM imaging will provide more precise values as compared to the other techniques, which can be related to the mechanisms behind the image recording. Copyright © 2017 Elsevier B.V. All rights reserved.
Electron beam dynamics in an ultrafast transmission electron microscope with Wehnelt electrode.
Bücker, K; Picher, M; Crégut, O; LaGrange, T; Reed, B W; Park, S T; Masiel, D J; Banhart, F
2016-12-01
High temporal resolution transmission electron microscopy techniques have shown significant progress in recent years. Using photoelectron pulses induced by ultrashort laser pulses on the cathode, these methods can probe ultrafast materials processes and have revealed numerous dynamic phenomena at the nanoscale. Most recently, the technique has been implemented in standard thermionic electron microscopes that provide a flexible platform for studying material's dynamics over a wide range of spatial and temporal scales. In this study, the electron pulses in such an ultrafast transmission electron microscope are characterized in detail. The microscope is based on a thermionic gun with a Wehnelt electrode and is operated in a stroboscopic photoelectron mode. It is shown that the Wehnelt bias has a decisive influence on the temporal and energy spread of the picosecond electron pulses. Depending on the shape of the cathode and the cathode-Wehnelt distance, different emission patterns with different pulse parameters are obtained. The energy spread of the pulses is determined by space charge and Boersch effects, given by the number of electrons in a pulse. However, filtering effects due to the chromatic aberrations of the Wehnelt electrode allow the extraction of pulses with narrow energy spreads. The temporal spread is governed by electron trajectories of different length and in different electrostatic potentials. High temporal resolution is obtained by excluding shank emission from the cathode and aberration-induced halos in the emission pattern. By varying the cathode-Wehnelt gap, the Wehnelt bias, and the number of photoelectrons in a pulse, tradeoffs between energy and temporal resolution as well as beam intensity can be made as needed for experiments. Based on the characterization of the electron pulses, the optimal conditions for the operation of ultrafast TEMs with thermionic gun assembly are elaborated. Copyright © 2016 Elsevier B.V. All rights reserved.
Cross-sectional transmission electron microscopy of semiconductors
International Nuclear Information System (INIS)
Sadana, D.K.
1982-10-01
A method to prepare cross-sectional (X) semiconductor specimens for transmission electron microscopy (TEM) has been described. The power and utility of XTEM has been demonstrated. It has been shown that accuracy and interpretation of indirect structural-defects profiling techniques, namely, MeV He + channeling and secondary ion mass spectrometry (SIMS) can be greatly enhanced by comparing their results with those obtained by XTEM from the same set of samples
Investigation of ceramic devices by analytical electron microscopy techniques
International Nuclear Information System (INIS)
Shiojiri, M.; Saijo, H.; Isshiki, T.; Kawasaki, M.; Yoshioka, T.; Sato, S.; Nomura, T.
1999-01-01
Ceramics are widely used as capacitors and varistors. Their electrical properties depend on the structure, which is deeply influenced not only by the composition of raw materials and additives but also by heating treatments in the production process. This paper reviews our investigations of SrTiO 3 ceramic devices, which have been performed using various microscopy techniques such as high-resolution transmission electron microscopy (HRTEM), cathodoluminescence scanning electron microscopy (CLSEM), field emission SEM (FE-SEM), energy dispersive X-ray spectroscopy (EDS), electron energy-loss spectroscopy (EELS) and high angle annular dark field (HAADF) imaging method in a FE-(scanning) transmission electron microscope(FE-(S)TEM). (author)
Viladot, D; Véron, M; Gemmi, M; Peiró, F; Portillo, J; Estradé, S; Mendoza, J; Llorca-Isern, N; Nicolopoulos, S
2013-10-01
A recently developed technique based on the transmission electron microscope, which makes use of electron beam precession together with spot diffraction pattern recognition now offers the possibility to acquire reliable orientation/phase maps with a spatial resolution down to 2 nm on a field emission gun transmission electron microscope. The technique may be described as precession-assisted crystal orientation mapping in the transmission electron microscope, precession-assisted crystal orientation mapping technique-transmission electron microscope, also known by its product name, ASTAR, and consists in scanning the precessed electron beam in nanoprobe mode over the specimen area, thus producing a collection of precession electron diffraction spot patterns, to be thereafter indexed automatically through template matching. We present a review on several application examples relative to the characterization of microstructure/microtexture of nanocrystalline metals, ceramics, nanoparticles, minerals and organics. The strengths and limitations of the technique are also discussed using several application examples. ©2013 The Authors. Journal of Microscopy published by John Wiley & Sons Ltd on behalf of Royal Microscopical Society.
Processing scarce biological samples for light and transmission electron microscopy
Directory of Open Access Journals (Sweden)
P Taupin
2008-06-01
Full Text Available Light microscopy (LM and transmission electron microscopy (TEM aim at understanding the relationship structure-function. With advances in biology, isolation and purification of scarce populations of cells or subcellular structures may not lead to enough biological material, for processing for LM and TEM. A protocol for preparation of scarce biological samples is presented. It is based on pre-embedding the biological samples, suspensions or pellets, in bovine serum albumin (BSA and bis-acrylamide (BA, cross-linked and polymerized. This preparation provides a simple and reproducible technique to process biological materials, present in limited quantities that can not be amplified, for light and transmission electron microscopy.
Directory of Open Access Journals (Sweden)
Filip Čertík
2016-01-01
Full Text Available This paper presents a possible simulation of negative effects in the optical transmission medium and an analysis for the utilization of different signal processing techniques at the optical signal transmission. An attention is focused on the high data rate signal transmission in the optical fiber influenced by linear and nonlinear environmental effects presented by the prepared simulation model. The analysis includes possible utilization of OOK, BPSK, DBPSK, BFSK, QPSK, DQPSK, 8PSK, and 16QAM modulation techniques together with RS, BCH, and LDPC encoding techniques for the signal transmission in the optical fiber. Moreover, the prepared simulation model is compared with real optical transmission systems. In the final part, a comparison of the selected modulation techniques with different encoding techniques and their implementation in real transmission systems is shown.
Electron beam dynamics in an ultrafast transmission electron microscope with Wehnelt electrode
Energy Technology Data Exchange (ETDEWEB)
Bücker, K.; Picher, M.; Crégut, O. [Institut de Physique et Chimie des Matériaux de Strasbourg, UMR 7504 CNRS, Université de Strasbourg, 23 rue du Loess, 67034 Strasbourg (France); LaGrange, T. [Interdisciplinary Centre for Electron Microscopy, École Polytechnique Fédérale de Lausanne, 1015 Lausanne (Switzerland); Reed, B.W.; Park, S.T.; Masiel, D.J. [Integrated Dynamic Electron Solutions, Inc., 5653 Stoneridge Drive 117, Pleasanton, CA 94588 (United States); Banhart, F., E-mail: florian.banhart@ipcms.unistra.fr [Institut de Physique et Chimie des Matériaux de Strasbourg, UMR 7504 CNRS, Université de Strasbourg, 23 rue du Loess, 67034 Strasbourg (France)
2016-12-15
High temporal resolution transmission electron microscopy techniques have shown significant progress in recent years. Using photoelectron pulses induced by ultrashort laser pulses on the cathode, these methods can probe ultrafast materials processes and have revealed numerous dynamic phenomena at the nanoscale. Most recently, the technique has been implemented in standard thermionic electron microscopes that provide a flexible platform for studying material's dynamics over a wide range of spatial and temporal scales. In this study, the electron pulses in such an ultrafast transmission electron microscope are characterized in detail. The microscope is based on a thermionic gun with a Wehnelt electrode and is operated in a stroboscopic photoelectron mode. It is shown that the Wehnelt bias has a decisive influence on the temporal and energy spread of the picosecond electron pulses. Depending on the shape of the cathode and the cathode-Wehnelt distance, different emission patterns with different pulse parameters are obtained. The energy spread of the pulses is determined by space charge and Boersch effects, given by the number of electrons in a pulse. However, filtering effects due to the chromatic aberrations of the Wehnelt electrode allow the extraction of pulses with narrow energy spreads. The temporal spread is governed by electron trajectories of different length and in different electrostatic potentials. High temporal resolution is obtained by excluding shank emission from the cathode and aberration-induced halos in the emission pattern. By varying the cathode-Wehnelt gap, the Wehnelt bias, and the number of photoelectrons in a pulse, tradeoffs between energy and temporal resolution as well as beam intensity can be made as needed for experiments. Based on the characterization of the electron pulses, the optimal conditions for the operation of ultrafast TEMs with thermionic gun assembly are elaborated. - Highlights: • A detailed characterization of electron
Characterization of nanomaterials with transmission electron microscopy
Anjum, Dalaver H.
2016-08-01
The field of nanotechnology is about research and development on materials whose at least one dimension is in the range of 1 to 100 nanometers. In recent years, the research activity for developing nano-materials has grown exponentially owing to the fact that they offer better solutions to the challenges faced by various fields such as energy, food, and environment. In this paper, the importance of transmission electron microscopy (TEM) based techniques is demonstrated for investigating the properties of nano-materials. Specifically the nano-materials that are investigated in this report include gold nano-particles (Au-NPs), silver atom-clusters (Ag-ACs), tantalum single-atoms (Ta-SAs), carbon materials functionalized with iron cobalt (Fe-Co) NPs and titania (TiO2) NPs, and platinum loaded Ceria (Pt-CeO2) Nano composite. TEM techniques that are employed to investigate nano-materials include aberration corrected bright-field TEM (BF-TEM), high-angle dark-field scanning TEM (HAADF-STEM), electron energy-loss spectroscopy (EELS), and BF-TEM electron tomography (ET). With the help presented of results in this report, it is proved herein that as many TEM techniques as available in a given instrument are essential for a comprehensive nano-scale analysis of nanomaterials.
Transmission Electron Microscopy and Diffractometry of Materials
Fultz, Brent
2013-01-01
This book explains concepts of transmission electron microscopy (TEM) and x-ray diffractometry (XRD) that are important for the characterization of materials. The fourth edition adds important new techniques of TEM such as electron tomography, nanobeam diffraction, and geometric phase analysis. A new chapter on neutron scattering completes the trio of x-ray, electron and neutron diffraction. All chapters were updated and revised for clarity. The book explains the fundamentals of how waves and wavefunctions interact with atoms in solids, and the similarities and differences of using x-rays, electrons, or neutrons for diffraction measurements. Diffraction effects of crystalline order, defects, and disorder in materials are explained in detail. Both practical and theoretical issues are covered. The book can be used in an introductory-level or advanced-level course, since sections are identified by difficulty. Each chapter includes a set of problems to illustrate principles, and the extensive Appendix includes la...
Transmission Electron Microscopy Physics of Image Formation
Kohl, Helmut
2008-01-01
Transmission Electron Microscopy: Physics of Image Formation presents the theory of image and contrast formation, and the analytical modes in transmission electron microscopy. The principles of particle and wave optics of electrons are described. Electron-specimen interactions are discussed for evaluating the theory of scattering and phase contrast. Also discussed are the kinematical and dynamical theories of electron diffraction and their applications for crystal-structure analysis and imaging of lattices and their defects. X-ray microanalysis and electron energy-loss spectroscopy are treated as analytical methods. Specimen damage and contamination by electron irradiation limits the resolution for biological and some inorganic specimens. This fifth edition includes discussion of recent progress, especially in the area of aberration correction and energy filtering; moreover, the topics introduced in the fourth edition have been updated. Transmission Electron Microscopy: Physics of Image Formation is written f...
Chrapoński, J; Rodak, K
2006-09-01
The aim of this work was to assess the changes in the microstructure of hot-deformed specimens made of alloys containing 46-50 at.% Al, 2 at.% Cr and 2 at.% Nb (and alloying additions such as carbon and boron) with the aid of scanning electron microscopy and transmission electron microscopy techniques. After homogenization and heat treatment performed in order to make diverse lamellae thickness, the specimens were compressed at 1000 degrees C. Transmission electron microscopy examinations of specimens after the compression test revealed the presence of heavily deformed areas with a high density of dislocation. Deformation twins were also observed. Dynamically recrystallized grains were revealed. For alloys no. 2 and no. 3, the recovery and recrystallization processes were more extensive than for alloy no. 1.
Computer simulation of high resolution transmission electron micrographs: theory and analysis
International Nuclear Information System (INIS)
Kilaas, R.
1985-03-01
Computer simulation of electron micrographs is an invaluable aid in their proper interpretation and in defining optimum conditions for obtaining images experimentally. Since modern instruments are capable of atomic resolution, simulation techniques employing high precision are required. This thesis makes contributions to four specific areas of this field. First, the validity of a new method for simulating high resolution electron microscope images has been critically examined. Second, three different methods for computing scattering amplitudes in High Resolution Transmission Electron Microscopy (HRTEM) have been investigated as to their ability to include upper Laue layer (ULL) interaction. Third, a new method for computing scattering amplitudes in high resolution transmission electron microscopy has been examined. Fourth, the effect of a surface layer of amorphous silicon dioxide on images of crystalline silicon has been investigated for a range of crystal thicknesses varying from zero to 2 1/2 times that of the surface layer
Monochromated scanning transmission electron microscopy
International Nuclear Information System (INIS)
Rechberger, W.; Kothleitner, G.; Hofer, F.
2006-01-01
Full text: Electron energy-loss spectroscopy (EELS) has developed into an established technique for chemical and structural analysis of thin specimens in the (scanning) transmission electron microscope (S)TEM. The energy resolution in EELS is largely limited by the stability of the high voltage supply, by the resolution of the spectrometer and by the energy spread of the source. To overcome this limitation a Wien filter monochromator was recently introduced with commercially available STEMs, offering the advantage to better resolve EELS fine structures, which contain valuable bonding information. The method of atomic resolution Z-contrast imaging within an STEM, utilizing a high-angle annular dark-field (HAADF) detector can perfectly complement the excellent energy resolution, since EELS spectra can be collected simultaneously. In combination with a monochromator microscope not only high spatial resolution images can be recorded but also high energy resolution EELS spectra are attainable. In this work we investigated the STEM performance of a 200 kV monochromated Tecnai F20 with a high resolution Gatan Imaging Filter (HR-GIF). (author)
Cathodoluminescence in the scanning transmission electron microscope
Energy Technology Data Exchange (ETDEWEB)
Kociak, M., E-mail: mathieu.kociak@u-psud.fr [Laboratoire de Physique des Solides, Université Paris-SudParis-Sud, CNRS-UMR 8502, Orsay 91405 (France); Zagonel, L.F. [“Gleb Wataghin” Institute of Physics University of Campinas - UNICAMP, 13083-859 Campinas, São Paulo (Brazil)
2017-05-15
Cathodoluminescence (CL) is a powerful tool for the investigation of optical properties of materials. In recent years, its combination with scanning transmission electron microscopy (STEM) has demonstrated great success in unveiling new physics in the field of plasmonics and quantum emitters. Most of these results were not imaginable even twenty years ago, due to conceptual and technical limitations. The purpose of this review is to present the recent advances that broke these limitations, and the new possibilities offered by the modern STEM-CL technique. We first introduce the different STEM-CL operating modes and the technical specificities in STEM-CL instrumentation. Two main classes of optical excitations, namely the coherent one (typically plasmons) and the incoherent one (typically light emission from quantum emitters) are investigated with STEM-CL. For these two main classes, we describe both the physics of light production under electron beam irradiation and the physical basis for interpreting STEM-CL experiments. We then compare STEM-CL with its better known sister techniques: scanning electron microscope CL, photoluminescence, and electron energy-loss spectroscopy. We finish by comprehensively reviewing recent STEM-CL applications. - Highlights: • Reviews the field of STEM-CL. • Introduces the technical requirements and challenges for STEM-CL. • Introduces the different types of excitations probed by STEM-CL. • Gives comprehensive overview of the last fifteenth years in the field.
Transmission electron microscopy: direct observation of crystal structure in refractory ceramics.
Shaw, T M; Thomas, G
1978-11-10
Using high-resolution multibeam interference techniques in the transmission electron microscope, images have been obtained that make possible a real-space structure analysis of a beryllium-silicon-nitrogen compound. The results illustrate the usefulness of lattice imaging in the analysis of local crystal structure in these technologically promising ceramic materials.
In situ transmission electron microscopy for magnetic nanostructures
DEFF Research Database (Denmark)
Ngo, Duc-The; Kuhn, Luise Theil
2016-01-01
Nanomagnetism is a subject of great interest because of both application and fundamental aspects in which understanding of the physical and electromagnetic structure of magnetic nanostructures is essential to explore the magnetic properties. Transmission electron microscopy (TEM) is a powerful tool...... that allows understanding of both physical structure and micromagnetic structure of the thin samples at nanoscale. Among TEM techniques, in situ TEM is the state-of-the-art approach for imaging such structures in dynamic experiments, reconstructing a real-time nanoscale picture of the properties......-structure correlation. This paper aims at reviewing and discussing in situ TEM magnetic imaging studies, including Lorentz microscopy and electron holography in TEM, applied to the research of magnetic nanostructures....
International Nuclear Information System (INIS)
Wang Peng; Behan, Gavin; Kirkland, Angus I.; Nellist, Peter D.; Takeguchi, Masaki; Hashimoto, Ayako; Mitsuishi, Kazutaka; Shimojo, Masayuki
2010-01-01
We demonstrate that a transmission electron microscope fitted with two spherical-aberration correctors can be operated as an energy-filtered scanning confocal electron microscope. A method for establishing this mode is described and initial results showing 3D chemical mapping with nanoscale sensitivity to height and thickness changes in a carbon film are presented. Importantly, uncorrected chromatic aberration does not limit the depth resolution of this technique and moreover performs an energy-filtering role, which is explained in terms of a combined depth and energy-loss response function.
Addressing preservation of elastic contrast in energy-filtered transmission electron microscopy
Energy Technology Data Exchange (ETDEWEB)
Brown, H.G.; D' Alfonso, A.J.; Forbes, B.D.; Allen, L.J., E-mail: lja@unimelb.edu.au
2016-01-15
Energy-filtered transmission electron microscopy (EFTEM) images with resolutions of the order of an Ångström can be obtained using modern microscopes corrected for chromatic aberration. However, the delocalized nature of the transition potentials for atomic ionization often confounds direct interpretation of EFTEM images, leading to what is known as “preservation of elastic contrast”. In this paper we demonstrate how more interpretable images might be obtained by scanning with a focused coherent probe and incoherently averaging the energy-filtered images over probe position. We dub this new imaging technique energy-filtered imaging scanning transmission electron microscopy (EFISTEM). We develop a theoretical framework for EFISTEM and show that it is in fact equivalent to precession EFTEM, where the plane wave illumination is precessed through a range of tilts spanning the same range of angles as the probe forming aperture in EFISTEM. It is demonstrated that EFISTEM delivers similar results to scanning transmission electron microscopy with an electron energy-loss spectrometer but has the advantage that it is immune to coherent aberrations and spatial incoherence of the probe and is also more resilient to scan distortions. - Highlights: • Interpretation of EFTEM images is complicated by preservation of elastic contrast. • More direct images obtained by scanning with a focused coherent probe and averaging. • This is equivalent to precession EFTEM through the solid angle defined by the probe. • Also yields similar results to energy-loss scanning transmission electron microscopy. • Scanning approach immune to probe aberrations and resilient to scan distortions.
Transmission electron microscope studies of extraterrestrial materials
Keller, Lindsay P.
1995-01-01
Transmission Electron Microscopy, X-Ray spectrometry and electron-energy-loss spectroscopy are used to analyse carbon in interplanetary dust particles. Optical micrographs are shown depicting cross sections of the dust particles embedded in sulphur. Selected-area electron diffraction patterns are shown. Transmission Electron Microscope specimens of lunar soil were prepared using two methods: ion-milling and ultramicrotomy. A combination of high resolution TEM imaging and electron diffraction is used to characterize the opaque assemblages. The opaque assemblages analyzed in this study are dominated by ilmenite with lesser rutile and spinel exsolutions, and traces of Fe metal.
Transmission electron microscopy of InP-based compound semiconductor materials and devices
International Nuclear Information System (INIS)
Chu, S.N.G.
1990-01-01
InP/InGaAsP-based heteroepitaxial structures constitute the major optoelectronic devices for state-of-the-art long wavelength optical fiber communication system.s Future advanced device structures will require thin heteroepitaxial quantum wells and superlattices a few tens of angstrom or less in thickness, and lateral dimensions ranging from a few tens angstrom for quantum dots and wires to a few μm in width for buried heterostructure lasers. Due to the increasing complexity of the device structure required by band-gap engineering, the performance of these devices becomes susceptible to any lattice imperfections present in the structure. Transmission electron microscopy (TEM), therefore, becomes the most important technique in characterizing the structural integrity of these materials. Cross-section transmission electron microscopy (XTEM) not only provides the necessary geometric information on the device structure; a careful study of the materials science behind the observed lattice imperfections provides directions for optimization of both the epitaxial growth parameters and device processing conditions. Furthermore, for device reliability studies, TEM is the only technique that unambiguously identifies the cause of device degradation. In this paper, the authors discuss areas of application of various TEM techniques, describe the TEM sample preparation technique, and review case studies to demonstrate the power of the TEM technique
International Nuclear Information System (INIS)
Moraes, Antonio M.C.; Moreira, Anderson C.; Appoloni, Carlos R.
2007-01-01
This work applies the gamma transmission techniques (GTR) and imaging by scanning electron microscopy (SEM) for determination of porosity in the sparkling wine bottle corks. The gamma transmission experimental apparatus consists of a micrometric table (ZX) of sample movement automated, a Am-241 source (59,53 keV, 100 mCi), lead collimators, sample-holder, Na I(Tl) detector and appropriated electronics. For the microscopic images an FEI (Quanta 200), electronic microscope with associated electronics was used, and the image analysis was performed with IMAGO software. The average porosity for 22 samples analysed by GTR was of φ=58 +- 4.6 percent. By the imaging technique the found average porosity was φ=60.0 +- 6.2 percent. (author)
Sample Preparation and Imaging of Exosomes by Transmission Electron Microscopy.
Jung, Min Kyo; Mun, Ji Young
2018-01-04
Exosomes are nano-sized extracellular vesicles secreted by body fluids and are known to represent the characteristics of cells that secrete them. The contents and morphology of the secreted vesicles reflect cell behavior or physiological status, for example cell growth, migration, cleavage, and death. The exosomes' role may depend highly on size, and the size of exosomes varies from 30 to 300 nm. The most widely used method for exosome imaging is negative staining, while other results are based on Cryo-Transmission Electron Microscopy, Scanning Electron Microscopy, and Atomic Force Microscopy. The typical exosome's morphology assessed through negative staining is a cup-shape, but further details are not yet clear. An exosome well-characterized through structural study is necessary particular in medical and pharmaceutical fields. Therefore, function-dependent morphology should be verified by electron microscopy techniques such as labeling a specific protein in the detailed structure of exosome. To observe detailed structure, ultrathin sectioned images and negative stained images of exosomes were compared. In this protocol, we suggest transmission electron microscopy for the imaging of exosomes including negative staining, whole mount immuno-staining, block preparation, thin section, and immuno-gold labelling.
Current status and future directions for in situ transmission electron microscopy
Energy Technology Data Exchange (ETDEWEB)
Taheri, Mitra L. [Department of Materials Science and Engineering, Drexel University (United States); Stach, Eric A. [Center for Functional Nanomaterials, National Laboratory, Brookhaven (United States); Arslan, Ilke [Pacific Northwest National Laboratory, Physical and Computational Sciences Directorate, 902 Battelle Blvd, Richland, WA (United States); Crozier, P.A. [School for Engineering of Matter, Transport and Energy, Arizona State University, Tempe, AZ 85281 (United States); Kabius, Bernd C. [The Pennsylvania State University, University Park, PA 16802 (United States); LaGrange, Thomas [Lawrence Livermore National Laboratory, Physical and Life Science Directorate, Condensed Matter and Materials Division, 7000 East Avenue, P.O. 808 L-356 (United States); Minor, Andrew M. [Department of Materials Science & Engineering, University of California, Berkeley and National Center for Electron Microscopy, Molecular Foundry, Lawrence Berkeley National Laboratory, One Cyclotron Road, MS 72, Berkeley, CA (United States); Takeda, Seiji [Institute of Scientific and Industrial Research (ISIR), Osaka University, 8-1 Mihogaoka, Ibaraki, Osaka 567-0047 (Japan); Tanase, Mihaela [Center for Nanoscale Science and Technology, National Institute of Standards and Technology, Gaithersburg, MD 20899-6203 (United States); Wagner, Jakob B. [Center for Electron Nanoscopy, Technical University of Denmark, Kgs, Lyngby (Denmark); Sharma, Renu, E-mail: renu.sharma@nist.gov [Center for Nanoscale Science and Technology, National Institute of Standards and Technology, Gaithersburg, MD 20899-6203 (United States)
2016-11-15
This review article discusses the current and future possibilities for the application of in situ transmission electron microscopy to reveal synthesis pathways and functional mechanisms in complex and nanoscale materials. The findings of a group of scientists, representing academia, government labs and private sector entities (predominantly commercial vendors) during a workshop, held at the Center for Nanoscale Science and Technology- National Institute of Science and Technology (CNST-NIST), are discussed. We provide a comprehensive review of the scientific needs and future instrument and technique developments required to meet them. - Highlights: • Evaluation of currently available technology for performing in situ experiments using transmission electron microscope. • Limitations of currently available instrumentation with respect to base TEM, specialty TEM holders, and data acquisition systems. • Guidelines and wish list for the areas of future development.
Current status and future directions for in situ transmission electron microscopy
International Nuclear Information System (INIS)
Taheri, Mitra L.; Stach, Eric A.; Arslan, Ilke; Crozier, P.A.; Kabius, Bernd C.; LaGrange, Thomas; Minor, Andrew M.; Takeda, Seiji; Tanase, Mihaela; Wagner, Jakob B.; Sharma, Renu
2016-01-01
This review article discusses the current and future possibilities for the application of in situ transmission electron microscopy to reveal synthesis pathways and functional mechanisms in complex and nanoscale materials. The findings of a group of scientists, representing academia, government labs and private sector entities (predominantly commercial vendors) during a workshop, held at the Center for Nanoscale Science and Technology- National Institute of Science and Technology (CNST-NIST), are discussed. We provide a comprehensive review of the scientific needs and future instrument and technique developments required to meet them. - Highlights: • Evaluation of currently available technology for performing in situ experiments using transmission electron microscope. • Limitations of currently available instrumentation with respect to base TEM, specialty TEM holders, and data acquisition systems. • Guidelines and wish list for the areas of future development.
Design of a transmission electron positron microscope
International Nuclear Information System (INIS)
Doyama, Masao; Inoue, M.; Kogure, Y.; Hayashi, Y.; Yoshii, T.; Kurihara, T.; Tsuno, K.
2003-01-01
This paper reports the plans and design of positron-electron microscopes being built at KEK (High Energy Accelerator Research Organization), Tsukuba, Japan. A used electron microscope is altered. The kinetic energies of positrons produced by accelerators or by nuclear decays are not a unique value but show a spread over in a wide range. Positron beam is guided to a transmission electron microscope (JEM100SX). Positrons are moderated by a tungsten foil, are accelerated and are focused on a nickel sheet. The monochromatic focused beam is injected into an electron microscope. The focusing and aberration of positrons are the same as electrons in a magnetic system which are used in commercial electron microscopes. Imaging plates are used to record positron images for the transmission electron microscope. (author)
Characterization of catalysts by scanning transmission electron microscopy
International Nuclear Information System (INIS)
Targos, W.M.; Bradley, S.A.
1989-01-01
The dedicated scanning transmission electron microscope (STEM) is an integral tool for characterizing catalysts because of its unique ability to image and analyze nanosized volumes. This information is valuable in optimizing catalyst formulations and determining causes for reduced catalyst performance. For many commercial catalysts direct correlations between structural features of metal crystallites and catalytic performance are not attainable. When these instances occur, determination of elemental distribution may be the only information available. In this paper the authors discuss some of the techniques employed and limitations associated with characterizing commercial catalysts
Structural studies of glasses by transmission electron microscopy and electron diffraction
International Nuclear Information System (INIS)
Kashchieva, E.P.
1997-01-01
The purpose of this work is to present information about the applications of transmission electron microscopy (TEM) and electron diffraction (ED) for structural investigations of glasses. TEM investigations have been carried out on some binary and on a large number of ternary borate-telluride systems where glass-forming oxides, oxides of transitional elements and modified oxides of elements from I, II and III groups in the periodic table, are used as third component. The large experimental data given by TEM method allows the fine classification of the micro-heterogeneities. A special case of micro-heterogeneous structure with technological origin occurs near the boundary between the 2 immiscible liquids obtained at macro-phase separation. TEM was also used for the direct observation of the glass structure and we have studied the nano-scale structure of borate glasses obtained at slow and fast cooling of the melts. The ED possesses advantages for analysis of amorphous thin films or micro-pastilles and it is a very useful technique for study in materials containing simultaneously light and heavy elements. A comparison between the possibilities of the 3 diffraction techniques (X-ray diffraction, neutron diffraction and ED) is presented
eV-TEM: Transmission electron microscopy in a low energy cathode lens instrument
Energy Technology Data Exchange (ETDEWEB)
Geelen, Daniël, E-mail: geelen@physics.leidenuniv.nl [Huygens-Kamerlingh Onnes Laboratory, Leiden Institute of Physics, Leiden University, P.O. Box 9504, 2300 RA Leiden (Netherlands); Thete, Aniket [Huygens-Kamerlingh Onnes Laboratory, Leiden Institute of Physics, Leiden University, P.O. Box 9504, 2300 RA Leiden (Netherlands); Schaff, Oliver; Kaiser, Alexander [SPECS GmbH, Voltastrasse 5, D-13355 Berlin (Germany); Molen, Sense Jan van der [Huygens-Kamerlingh Onnes Laboratory, Leiden Institute of Physics, Leiden University, P.O. Box 9504, 2300 RA Leiden (Netherlands); Tromp, Rudolf [IBM T.J. Watson Research Center, 1101 Kitchawan Road, P.O. Box 218, Yorktown Heights, NY 10598 (United States)
2015-12-15
We are developing a transmission electron microscope that operates at extremely low electron energies, 0–40 eV. We call this technique eV-TEM. Its feasibility is based on the fact that at very low electron energies the number of energy loss pathways decreases. Hence, the electron inelastic mean free path increases dramatically. eV-TEM will enable us to study elastic and inelastic interactions of electrons with thin samples. With the recent development of aberration correction in cathode lens instruments, a spatial resolution of a few nm appears within range, even for these very low electron energies. Such resolution will be highly relevant to study biological samples such as proteins and cell membranes. The low electron energies minimize adverse effects due to radiation damage. - Highlights: • We present a new way of performing low energy transmission electron microscopy in an aberration corrected LEEM/PEEM instrument. • We show a proof of principle where we measure transmitted electrons through a suspended graphene monolayer with a preliminary setup. • We present an improved setup design that provides better control of the incident electron beam.
Su, Chia-Ping; Syu, Wei-Jhe; Hsiao, Chien-Nan; Lai, Ping-Shan; Chen, Chien-Chun
2017-08-01
To investigate dislocations or heterostructures across interfaces is now of great interest to condensed matter and materials scientists. With the advances in aberration-corrected electron optics, the scanning transmission electron microscope has demonstrated its excellent capability of characterizing atomic structures within nanomaterials, and well-resolved atomic-resolution images can be obtained through long-exposure data acquisition. However, the sample drifting, carbon contamination, and radiation damage hinder further analysis, such as deriving three-dimensional (3D) structures from a series of images. In this study, a method for obtaining atomic-resolution images with significantly reduced exposure time was developed, using which an original high-resolution image with approximately one tenth the electron dose can be obtained by combining a fast-scan high-magnification image and a slow-scan low-magnification image. The feasibility of obtaining 3D atomic structures using the proposed approach was demonstrated through multislice simulation. Finally, the feasibility and accuracy of image restoration were experimentally verified. This general method cannot only apply to electron microscopy but also benefit to image radiation-sensitive materials using various light sources.
Single particle analysis based on Zernike phase contrast transmission electron microscopy.
Danev, Radostin; Nagayama, Kuniaki
2008-02-01
We present the first application of Zernike phase-contrast transmission electron microscopy to single-particle 3D reconstruction of a protein, using GroEL chaperonin as the test specimen. We evaluated the performance of the technique by comparing 3D models derived from Zernike phase contrast imaging, with models from conventional underfocus phase contrast imaging. The same resolution, about 12A, was achieved by both imaging methods. The reconstruction based on Zernike phase contrast data required about 30% fewer particles. The advantages and prospects of each technique are discussed.
International Nuclear Information System (INIS)
Chung, H.M.; Chopra, O.K.
1987-06-01
Results are presented of complementary characterization of aged duplex stainless steels by advanced metallographic techniques, including transmission and high-voltage electron microscopies; small-angle neutron scattering; and atom-probe field ion microscopy. On the basis of the characterization, the mechanisms of aging embrittlement have been shown to be associated with the precipitation of Ni- and Si-rich G phase and Cr-rich α' in the ferrite, and M 23 C 6 carbides on the austenite-ferrite phase boundaries. 19 refs., 19 figs., 1 tab
Transmission techniques for emergent multicast and broadcast systems
da Silva, Mario Marques; Dinis, Rui; Souto, Nuno; Silva, Joao Carlos
2010-01-01
Describing efficient transmission schemes for broadband wireless systems, Transmission Techniques for Emergent Multicast and Broadcast Systems examines advances in transmission techniques and receiver designs capable of supporting the emergent wireless needs for multimedia broadcast and multicast service (MBMS) requirements. It summarizes the research and development taking place in wireless communications for multimedia MBMS and addresses the means to improved spectral efficiency to allow for increased user bit rate, as well as increased capacity of the digital cellular radio network.The text
Transmission of electrons through Al2O3 nanocapillaries
DEFF Research Database (Denmark)
Milosavljević, A.R.; Jureta, J.J.; Víkor, Gy.
2012-01-01
We investigate transmission of low-energy electrons (250 eV) through insulating AlO nanocapillaries (270 nm diameter and 15 μm length). Kinetic energy distribution of electrons transmitted through the nanocapillaries in the straightforward direction, time dependence of the transmission rate both...
Quantitative transmission electron microscopy at atomic resolution
International Nuclear Information System (INIS)
Allen, L J; D'Alfonso, A J; Forbes, B D; Findlay, S D; LeBeau, J M; Stemmer, S
2012-01-01
In scanning transmission electron microscopy (STEM) it is possible to operate the microscope in bright-field mode under conditions which, by the quantum mechanical principle of reciprocity, are equivalent to those in conventional transmission electron microscopy (CTEM). The results of such an experiment will be presented which are in excellent quantitative agreement with theory for specimens up to 25 nm thick. This is at variance with the large contrast mismatch (typically between two and five) noted in equivalent CTEM experiments. The implications of this will be discussed.
Transmission electron microscopy of bone
Everts, Vincent; Niehof, Anneke; Tigchelaar-Gutter, Wikky; Beertsen, Wouter
2012-01-01
This chapter describes procedures to process mineralized tissues obtained from different sources for transmission electron microscopy (TEM). Methods for fixation, resin embedding, staining of semi-thin sections and ultrathin sections are presented. In addition, attention will be paid to processing
Transmission electron microscopy physics of image formation and microanalysis
Reimer, Ludwig
1993-01-01
"Transmission Electron Microscopy" presents the theory of image and contrastformation, and the analytical modes in transmission electron microscopy Theprinciples of particle and wave optics of electrons are described Electron-specimen interactions are discussed for evaluating the theory of scattering and phase contrast Also analysed are the kinetical and dynamical theories of electron diffraction and their applications for crystal-structure determination and imaging of lattices and their defects X-ray microanalysis and electron energy-loss spectroscopy are treated as analytical methods The third edition includes a brief discussionof Schottky emission guns, some clarification of minor details, and references to the recent literature
Fabrication and electric measurements of nanostructures inside transmission electron microscope.
Chen, Qing; Peng, Lian-Mao
2011-06-01
Using manipulation holders specially designed for transmission electron microscope (TEM), nanostructures can be characterized, measured, modified and even fabricated in-situ. In-situ TEM techniques not only enable real-time study of structure-property relationships of materials at atomic scale, but also provide the ability to control and manipulate materials and structures at nanoscale. This review highlights in-situ electric measurements and in-situ fabrication and structure modification using manipulation holder inside TEM. Copyright © 2011 Elsevier B.V. All rights reserved.
Imaging and Quantification of Extracellular Vesicles by Transmission Electron Microscopy.
Linares, Romain; Tan, Sisareuth; Gounou, Céline; Brisson, Alain R
2017-01-01
Extracellular vesicles (EVs) are cell-derived vesicles that are present in blood and other body fluids. EVs raise major interest for their diverse physiopathological roles and their potential biomedical applications. However, the characterization and quantification of EVs constitute major challenges, mainly due to their small size and the lack of methods adapted for their study. Electron microscopy has made significant contributions to the EV field since their initial discovery. Here, we describe the use of two transmission electron microscopy (TEM) techniques for imaging and quantifying EVs. Cryo-TEM combined with receptor-specific gold labeling is applied to reveal the morphology, size, and phenotype of EVs, while their enumeration is achieved after high-speed sedimentation on EM grids.
Digital processing optical transmission and coherent receiving techniques
Binh, Le Nguyen
2013-01-01
With coherent mixing in the optical domain and processing in the digital domain, advanced receiving techniques employing ultra-high speed sampling rates have progressed tremendously over the last few years. These advances have brought coherent reception systems for lightwave-carried information to the next stage, resulting in ultra-high capacity global internetworking. Digital Processing: Optical Transmission and Coherent Receiving Techniques describes modern coherent receiving techniques for optical transmission and aspects of modern digital optical communications in the most basic lines. The
Demonstration of relatively new electron dosimetry measurement techniques on the Mevatron 80
International Nuclear Information System (INIS)
Meyer, J.A.; Palta, J.R.; Hogstrom, K.R.
1984-01-01
A comprehensive set of electron dosimetry measurements at 7, 10, 12, 15, and 18 MeV was made on a Mevatron 80. Dosimetry measurements presented include percentage depth dose, dose in the buildup region, field size dependence of output, output at extended distances, lead transmission measurements, and isodose curves. These beam measurements are presented to document the electron beam characteristics of this linear accelerator. Three relatively new dosimetry techniques, which have not been standardly used in the past, are illustrated. One technique determines the depth dose of fields too small to measure. A second technique accurately converts depth dose measured in polystyrene to depth dose in water. A third technique calculates the output at extended distances
International Nuclear Information System (INIS)
Langford, R.M.; Petford-Long, A.K.
2001-01-01
The preparation of transmission electron microscopy cross-section specimens using focused ion beam milling is outlined. The 'liftout' and 'trench' techniques are both described in detail, and their relative advantages and disadvantages are discussed. Artifacts such as ion damage to the top surface and sidewalls of the cross-section specimens, and methods of reducing them, are addressed
Transmission electron microscopy of amyloid fibrils.
Gras, Sally L; Waddington, Lynne J; Goldie, Kenneth N
2011-01-01
Transmission Electron Microscopy of negatively stained and cryo-prepared specimens allows amyloid fibrils to be visualised at high resolution in a dried or a hydrated state, and is an essential method for characterising the morphology of fibrils and pre-fibrillar species. We outline the key steps involved in the preparation and observation of samples using negative staining and cryo-electron preservation. We also discuss methods to measure fibril characteristics, such as fibril width, from electron micrographs.
Correction of bubble size distributions from transmission electron microscopy observations
International Nuclear Information System (INIS)
Kirkegaard, P.; Eldrup, M.; Horsewell, A.; Skov Pedersen, J.
1996-01-01
Observations by transmission electron microscopy of a high density of gas bubbles in a metal matrix yield a distorted size distribution due to bubble overlap and bubble escape from the surface. A model is described that reconstructs 3-dimensional bubble size distributions from 2-dimensional projections on taking these effects into account. Mathematically, the reconstruction is an ill-posed inverse problem, which is solved by regularization technique. Extensive Monte Carlo simulations support the validity of our model. (au) 1 tab., 32 ills., 32 refs
Tailoring of electron flow current in magnetically insulated transmission lines
Directory of Open Access Journals (Sweden)
J. P. Martin
2009-03-01
Full Text Available It is desirable to optimize (minimizing both the inductance and electron flow the magnetically insulated vacuum sections of low impedance pulsed-power drivers. The goal of low inductance is understandable from basic efficiency arguments. The goal of low electron flow results from two observations: (1 flowing electrons generally do not deliver energy to (or even reach most loads, and thus constitute a loss mechanism; (2 energetic electrons deposited in a small area can cause anode damage and anode plasma formation. Low inductance and low electron flow are competing goals; an optimized system requires a balance of the two. While magnetically insulated systems are generally forgiving, there are times when optimization is crucial. For example, in large pulsed-power drivers used to energize high energy density physics loads, the electron flow as a fraction of total current is small, but that flow often reaches the anode in relatively small regions. If the anode temperature becomes high enough to desorb gas, the resulting plasma initiates a gap closure process that can impact system performance. Magnetic-pressure driven (z pinches and material equation of state loads behave like a fixed inductor for much of the drive pulse. It is clear that neither fixed gap nor constant-impedance transmission lines are optimal for driving inductive loads. This work shows a technique for developing the optimal impedance profile for the magnetically insulated section of a high-current driver. Particle-in-cell calculations are used to validate the impedance profiles developed in a radial disk magnetically insulated transmission line geometry. The input parameters are the spacing and location of the minimum gap, the effective load inductance, and the desired electron flow profile. The radial electron flow profiles from these simulations are in good agreement with theoretical predictions when driven at relatively high voltage (i.e., V≥2 MV.
The role of electron irradiation history in liquid cell transmission electron microscopy
Energy Technology Data Exchange (ETDEWEB)
Moser, Trevor H.; Mehta, Hardeep S.; Park, Chiwoo; Kelly, Ryan T.; Shokuhfar, Tolou; Evans, James E.
2018-04-20
In situ liquid cell transmission electron microscopy (LC-TEM) allows dynamic nanoscale characterization of systems in a hydrated state. Although powerful, this technique remains impaired by issues of repeatability that limit experimental fidelity and hinder the identification and control of some variables underlying observed dynamics. We detail new LC- TEM devices that improve experimental reproducibility by expanding available imaging area and providing a platform for investigating electron flux history on the sample. Irradiation history is an important factor influencing LC-TEM results that has, to this point, been largely qualitatively and not quantitatively described. We use these devices to highlight the role of cumulative electron flux history on samples from both nanoparticle growth and biological imaging experiments and demonstrate capture of time zero, low-dose images on beam-sensitive samples. In particular, the ability to capture pristine images of biological samples, where the acquired image is the first time that the cell experiences significant electron flux, allowed us to determine that nanoparticle movement compared to the cell membrane was a function of cell damage and therefore an artifact rather than visualizing cell dynamics in action. These results highlight just a subset of the new science that is accessible with LC-TEM through the new multiwindow devices with patterned focusing aides.
Transmission electron microscopy physics of image formation and microanalysis
Reimer, Ludwig
1997-01-01
Transmission Electron Microscopy presents the theory of image and contrast formation, and the analytical modes in transmission electron microscopy. The principles of particle and wave optics of electrons are described. Electron-specimen interactions are discussed for evaluating the theory of scattering and phase contrast. Also discussed are the kinematical and dynamical theories of electron diffraction and their applications for crystal-structure analysis and imaging of lattices and their defects. X-ray micronanalysis and electron energy-loss spectroscopy are treated as analytical methods. Specimen damage and contamination by electron irradiation limits the resolution for biological and some inorganic specimens. This fourth edition includes discussion of recent progress, especially in the area of Schottky emission guns, convergent-beam electron diffraction, electron tomography, holography and the high resolution of crystal lattices.
Hendriks, Frank C.|info:eu-repo/dai/nl/412642697; Mohammadian, Sajjad|info:eu-repo/dai/nl/374721327; Ristanovic, Zoran|info:eu-repo/dai/nl/328233005; Kalirai, Samanbir; Meirer, Florian; Vogt, Eelco T. C.|info:eu-repo/dai/nl/073717398; Bruijnincx, Pieter C. A.|info:eu-repo/dai/nl/33799529X; Gerritsen, Hans|info:eu-repo/dai/nl/071548777; Weckhuysen, Bert M.|info:eu-repo/dai/nl/285484397
2018-01-01
Establishing structure–activity relationships in complex, hierarchically structured nanomaterials, such as fluid catalytic cracking (FCC) catalysts, requires characterization with complementary, correlated analysis techniques. An integrated setup has been developed to perform transmission electron
Transmission electron microscopy a textbook for materials science
Williams, David B
1996-01-01
Electron microscopy has revolutionized our understanding the extraordinary intellectual demands required of the mi of materials by completing the processing-structure-prop croscopist in order to do the job properly: crystallography, erties links down to atomistic levels. It now is even possible diffraction, image contrast, inelastic scattering events, and to tailor the microstructure (and meso structure ) of materials spectroscopy. Remember, these used to be fields in them to achieve specific sets of properties; the extraordinary abili selves. Today, one has to understand the fundamentals ties of modem transmission electron microscopy-TEM of all of these areas before one can hope to tackle signifi instruments to provide almost all of the structural, phase, cant problems in materials science. TEM is a technique of and crystallographic data allow us to accomplish this feat. characterizing materials down to the atomic limits. It must Therefore, it is obvious that any curriculum in modem mate be use...
Secondary Electron Emission Materials for Transmission Dynodes in Novel Photomultipliers: A Review
Directory of Open Access Journals (Sweden)
Shu Xia Tao
2016-12-01
Full Text Available Secondary electron emission materials are reviewed with the aim of providing guidelines for the future development of novel transmission dynodes. Materials with reflection secondary electron yield higher than three and transmission secondary electron yield higher than one are tabulated for easy reference. Generations of transmission dynodes are listed in the order of the invention time with a special focus on the most recent atomic-layer-deposition synthesized transmission dynodes. Based on the knowledge gained from the survey of secondary election emission materials with high secondary electron yield, an outlook of possible improvements upon the state-of-the-art transmission dynodes is provided.
Transmission Electron Microscopy for Wood and Fiber Analysis − A Review
Directory of Open Access Journals (Sweden)
Mehedi Reza
2015-07-01
Full Text Available This review describes use of transmission electron microscopy (TEM in wood and fiber analysis. Analytical techniques and sample preparation methods are used to localize substructures of the cell wall polymers and are discussed in this review. The ultrastructural features of the wood cell walls, the structures formed by microfibrils, and the distribution of cell wall polymers, as revealed by TEM, are covered. Research investigating the distribution of lignin in tension and compression woods using TEM is reviewed. Different kinds of wood biodegrading enzymes localized using TEM are mentioned. Additional features of TEM, i.e., 3D imaging, analytical TEM, and electron diffraction are discussed. Lastly, a comparison between TEM and other imaging techniques used for wood and fiber research are made. Thus, this review provides insight into the contribution of TEM in wood research since its invention and demonstrates how to use it more effectively in the future.
Highlighting material structure with transmission electron diffraction correlation coefficient maps
International Nuclear Information System (INIS)
Kiss, Ákos K.; Rauch, Edgar F.; Lábár, János L.
2016-01-01
Correlation coefficient maps are constructed by computing the differences between neighboring diffraction patterns collected in a transmission electron microscope in scanning mode. The maps are shown to highlight material structural features like grain boundaries, second phase particles or dislocations. The inclination of the inner crystal interfaces are directly deduced from the resulting contrast. - Highlights: • We propose a novel technique to image the structure of polycrystalline TEM-samples. • Correlation coefficients maps highlights the evolution of the diffracting signal. • 3D views of grain boundaries are provided for nano-particles or polycrystals.
Transmission environmental scanning electron microscope with scintillation gaseous detection device
International Nuclear Information System (INIS)
Danilatos, Gerasimos; Kollia, Mary; Dracopoulos, Vassileios
2015-01-01
A transmission environmental scanning electron microscope with use of a scintillation gaseous detection device has been implemented. This corresponds to a transmission scanning electron microscope but with addition of a gaseous environment acting both as environmental and detection medium. A commercial type of low vacuum machine has been employed together with appropriate modifications to the detection configuration. This involves controlled screening of various emitted signals in conjunction with a scintillation gaseous detection device already provided with the machine for regular surface imaging. Dark field and bright field imaging has been obtained along with other detection conditions. With a progressive series of modifications and tests, the theory and practice of a novel type of microscopy is briefly shown now ushering further significant improvements and developments in electron microscopy as a whole. - Highlights: • Novel scanning transmission electron microscopy (STEM) with an environmental scanning electron microscope (ESEM) called TESEM. • Use of the gaseous detection device (GDD) in scintillation mode that allows high resolution bright and dark field imaging in the TESEM. • Novel approach towards a unification of both vacuum and environmental conditions in both bulk/surface and transmission mode of electron microscopy
Four-Dimensional Ultrafast Electron Microscopy: Insights into an Emerging Technique
Adhikari, Aniruddha
2016-12-15
Four-dimensional ultrafast electron microscopy (4D-UEM) is a novel analytical technique that aims to fulfill the long-held dream of researchers to investigate materials at extremely short spatial and temporal resolutions by integrating the excellent spatial resolution of electron microscopes with the temporal resolution of ultrafast femtosecond laser-based spectroscopy. The ingenious use of pulsed photoelectrons to probe surfaces and volumes of materials enables time-resolved snapshots of the dynamics to be captured in a way hitherto impossible by other conventional techniques. The flexibility of 4D-UEM lies in the fact that it can be used in both the scanning (S-UEM) and transmission (UEM) modes depending upon the type of electron microscope involved. While UEM can be employed to monitor elementary structural changes and phase transitions in samples using real-space mapping, diffraction, electron energy-loss spectroscopy, and tomography, S-UEM is well suited to map ultrafast dynamical events on materials surfaces in space and time. This review provides an overview of the unique features that distinguish these techniques and also illustrates the applications of both S-UEM and UEM to a multitude of problems relevant to materials science and chemistry.
Fifty years old, and still going strong: Transmission electron optical studies of materials
International Nuclear Information System (INIS)
Brown, L.M.
2008-01-01
Highlights in the history of transmission electron microscopy and scanning transmission electron microscopy include the introduction of diffraction contrast, resolution of periodic lattices by phase contrast and incoherent imaging via the high-angle annular dark-field detector. Convergent-beam electron diffraction and analytical electron microscopy, especially the application of energy-dispersive X-ray and electron energy-loss spectrometry, have provided structural and chemical information in addition to strain contrast from lattice defects. From the outset, novel specimen stages and improvements to aid the operator enhanced the electron-optical engineering provided by the instrument makers. The spatial resolution achieved was mainly determined by the way the instrument was used, and not by the basic resolution limit set by the electron optics. However, the application of computer controlled correction of spherical (and higher order) aberration has resulted in a new generation of instruments capable of sub-Angstrom point-to-point resolution. This improved performance, combined with electron energy-loss spectrometry, promises genuine three-dimensional determination of atomic and electronic structure: an indispensable weapon in the battle to fabricate and control useful nanostructures. The uncertainty principle now fundamentally restricts some of the observations one can make, but much more technical development over the next decades must occur before one can say that the techniques of electron-optical imaging of material structure have reached their fundamental limitations. One can expect remarkable progress over the next few years
A technique for rocket-borne detection of electron bunching at megahertz frequencies
International Nuclear Information System (INIS)
Gough, M.P.
1980-01-01
Energetic electrons precipitating in the auroral ionosphere may be bunched at frequencies up to several megahertz as a result of local wave-particle interactions. A technique is described whereby this megahertz bunching can be observed using conventional rocket-borne energetic electron detectors counting at rates below 10 5 cps. Electron arrival time information is pre-processed on board the rocket and any bunching present can be realized by subsequent computer processing on the ground using only a modest data transmission rate from the rocket. Results of a pilot rocket experiment prove the value of the technique and lead on to formulating the design of a future experiment where the maximum amount of data processing is performed on the rocket. The technique should perform an important diagnostic role, helping us to understand the complex wave-particle interactions occurring in the auroral ionosphere. (orig.)
Sun, Cheng; Müller, Erich; Meffert, Matthias; Gerthsen, Dagmar
2018-04-01
Transmission electron microscopy (TEM) with low-energy electrons has been recognized as an important addition to the family of electron microscopies as it may avoid knock-on damage and increase the contrast of weakly scattering objects. Scanning electron microscopes (SEMs) are well suited for low-energy electron microscopy with maximum electron energies of 30 keV, but they are mainly used for topography imaging of bulk samples. Implementation of a scanning transmission electron microscopy (STEM) detector and a charge-coupled-device camera for the acquisition of on-axis transmission electron diffraction (TED) patterns, in combination with recent resolution improvements, make SEMs highly interesting for structure analysis of some electron-transparent specimens which are traditionally investigated by TEM. A new aspect is correlative SEM, STEM, and TED imaging from the same specimen region in a SEM which leads to a wealth of information. Simultaneous image acquisition gives information on surface topography, inner structure including crystal defects and qualitative material contrast. Lattice-fringe resolution is obtained in bright-field STEM imaging. The benefits of correlative SEM/STEM/TED imaging in a SEM are exemplified by structure analyses from representative sample classes such as nanoparticulates and bulk materials.
Progress and applications of in situ transmission electron microscopy
International Nuclear Information System (INIS)
Wang Rongming; Liu Jialong; Song Yuanjun
2015-01-01
Recent progress in the application of in situ transmission electron microscopy (TEM) is briefly reviewed. It is emphasized that the development of advanced in situ TEM techniques makes it possible to investigate the evolution of materials under heat, strain, magnetic field, electric field or chemical reaction environments on the atomic scale. The mechanism of the microstructure evolution under various conditions and the relationship between the atomic structures and their properties can be obtained, which is beneficial for the design of new materials with tailored properties. The clarification of the structure-property relationship will help to develop new materials and solve related basic problems in the field of condensed matter physics. (authors)
Angularly-selective transmission imaging in a scanning electron microscope.
Holm, Jason; Keller, Robert R
2016-08-01
This work presents recent advances in transmission scanning electron microscopy (t-SEM) imaging control capabilities. A modular aperture system and a cantilever-style sample holder that enable comprehensive angular selectivity of forward-scattered electrons are described. When combined with a commercially available solid-state transmission detector having only basic bright-field and dark-field imaging capabilities, the advances described here enable numerous transmission imaging modes. Several examples are provided that demonstrate how contrast arising from diffraction to mass-thickness can be obtained. Unanticipated image contrast at some imaging conditions is also observed and addressed. Published by Elsevier B.V.
A Transmission Electron Microscope Investigation of Space Weathering Effects in Hayabusa Samples
Keller, Lindsay P.; Berger, Eve L.
2014-01-01
The Hayabusa mission to asteroid 25143 Itokawa successfully returned the first direct samples of the regolith from the surface of an asteroid. The Hayabusa samples thus present a special opportunity to directly investigate the evolution of asteroidal surfaces, from the development of the regolith to the study of the more complex effects of space weathering. Here we describe the mineralogy, microstructure and composition of three Hayabusa mission particles using transmission electron microscope (TEM) techniques
Transmission electron microscopy of bulk specimens over 10 µm in thickness
Energy Technology Data Exchange (ETDEWEB)
Sadamatsu, Sunao, E-mail: sadamatsu@mech.kagoshima-u.ac.jp [Department of Mechanical Engineering, Kagoshima University, Korimoto, Kagoshima 890-0065 (Japan); Tanaka, Masaki; Higashida, Kenji [Department of Materials Science and Engineering, Kyushu University, Nishi-ku, Fukuoka 819-0395 (Japan); Matsumura, Syo [Department of Applied Quantum Physics and Nuclear Engineering, Kyushu University, Nishi-ku, Fukuoka 819-0395 (Japan); Ultramicroscopy Research Center, Kyushu University, Nishi-ku, Fukuoka 819-0395 (Japan)
2016-03-15
We succeeded the observation of microstructures in bulk-sized specimens of over 10 µm in thickness by employing a technique that combines transmission electron microscopy (TEM) with energy-filtered imaging based on electron energy-loss spectroscopy (EELS). This method is unique in that it incorporates the inelastically scattered electrons into the imaging process. Using this technique, bright and sharp images of dislocations in crystalline silicon specimens as thick as 10 µm were obtained. A calibration curve to determine foil thickness of such a thick specimen was also derived. This method simply extends the observable thickness range in TEM. If combined with tilt series of observation over a significant range of angle, it will disclose three dimensional nanostructures in a µm-order block of a specimen, promoting our understanding of the controlling mechanisms behind various bulky material properties. - Highlights: • We developed a method which enables thick specimens to be observed using EF-TEM. • The effects of energy filter width and position on images were determined. • We suggested a method to determine the thickness of a thick film sample. • We achieved observation of microstructures in specimens with a thickness of 10 µm.
Advances in imaging and electron physics the scanning transmission electron microscope
Hawkes, Peter W
2009-01-01
Advances in Imaging and Electron Physics merges two long-running serials--Advances in Electronics and Electron Physics and Advances in Optical and Electron Microscopy. This series features extended articles on the physics of electron devices (especially semiconductor devices), particle optics at high and low energies, microlithography, image science and digital image processing, electromagnetic wave propagation, electron microscopy, and the computing methods used in all these domains. This particular volume presents several timely articles on the scanning transmission electron microscope. Updated with contributions from leading international scholars and industry experts Discusses hot topic areas and presents current and future research trends Provides an invaluable reference and guide for physicists, engineers and mathematicians.
Low-energy electron transmission through high aspect ratio Al O nanocapillaries
DEFF Research Database (Denmark)
Milosavljević, A.R.; Jureta, J.; Víkor, G.
2009-01-01
Electron transmission through insulating AlO nanocapillaries of different diameters (40 and 270 nm) and 15 μm length has been investigated for low-energy electrons (2-120 V). The total intensity of transmitted current weakly depends on the incident electron energy and tilt angle defined with resp......Electron transmission through insulating AlO nanocapillaries of different diameters (40 and 270 nm) and 15 μm length has been investigated for low-energy electrons (2-120 V). The total intensity of transmitted current weakly depends on the incident electron energy and tilt angle defined...
Isotope analysis in the transmission electron microscope.
Susi, Toma; Hofer, Christoph; Argentero, Giacomo; Leuthner, Gregor T; Pennycook, Timothy J; Mangler, Clemens; Meyer, Jannik C; Kotakoski, Jani
2016-10-10
The Ångström-sized probe of the scanning transmission electron microscope can visualize and collect spectra from single atoms. This can unambiguously resolve the chemical structure of materials, but not their isotopic composition. Here we differentiate between two isotopes of the same element by quantifying how likely the energetic imaging electrons are to eject atoms. First, we measure the displacement probability in graphene grown from either 12 C or 13 C and describe the process using a quantum mechanical model of lattice vibrations coupled with density functional theory simulations. We then test our spatial resolution in a mixed sample by ejecting individual atoms from nanoscale areas spanning an interface region that is far from atomically sharp, mapping the isotope concentration with a precision better than 20%. Although we use a scanning instrument, our method may be applicable to any atomic resolution transmission electron microscope and to other low-dimensional materials.
Blancett, Candace D; Fetterer, David P; Koistinen, Keith A; Morazzani, Elaine M; Monninger, Mitchell K; Piper, Ashley E; Kuehl, Kathleen A; Kearney, Brian J; Norris, Sarah L; Rossi, Cynthia A; Glass, Pamela J; Sun, Mei G
2017-10-01
A method for accurate quantitation of virus particles has long been sought, but a perfect method still eludes the scientific community. Electron Microscopy (EM) quantitation is a valuable technique because it provides direct morphology information and counts of all viral particles, whether or not they are infectious. In the past, EM negative stain quantitation methods have been cited as inaccurate, non-reproducible, and with detection limits that were too high to be useful. To improve accuracy and reproducibility, we have developed a method termed Scanning Transmission Electron Microscopy - Virus Quantitation (STEM-VQ), which simplifies sample preparation and uses a high throughput STEM detector in a Scanning Electron Microscope (SEM) coupled with commercially available software. In this paper, we demonstrate STEM-VQ with an alphavirus stock preparation to present the method's accuracy and reproducibility, including a comparison of STEM-VQ to viral plaque assay and the ViroCyt Virus Counter. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.
Analysis on electronic control unit of continuously variable transmission
Cao, Shuanggui
Continuously variable transmission system can ensure that the engine work along the line of best fuel economy, improve fuel economy, save fuel and reduce harmful gas emissions. At the same time, continuously variable transmission allows the vehicle speed is more smooth and improves the ride comfort. Although the CVT technology has made great development, but there are many shortcomings in the CVT. The CVT system of ordinary vehicles now is still low efficiency, poor starting performance, low transmission power, and is not ideal controlling, high cost and other issues. Therefore, many scholars began to study some new type of continuously variable transmission. The transmission system with electronic systems control can achieve automatic control of power transmission, give full play to the characteristics of the engine to achieve optimal control of powertrain, so the vehicle is always traveling around the best condition. Electronic control unit is composed of the core processor, input and output circuit module and other auxiliary circuit module. Input module collects and process many signals sent by sensor and , such as throttle angle, brake signals, engine speed signal, speed signal of input and output shaft of transmission, manual shift signals, mode selection signals, gear position signal and the speed ratio signal, so as to provide its corresponding processing for the controller core.
International Nuclear Information System (INIS)
Yu, Z.G.; Smith, D.L.; Saxena, A.; Bishop, A.R.
1997-01-01
The electronic transmission across metal/conjugated-oligomer/metal structures in the presence of lattice fluctuations is studied for short oligomer chains. The lattice fluctuations are approximated by static white noise disorder. Resonant transmission occurs when the energy of an incoming electron coincides with a discrete electronic level of the oligomer. The corresponding transmission peak diminishes in intensity with increasing disorder strength. Because of disorder there is an enhancement of the electronic transmission for energies that lie within the electronic gap of the oligomer. If fluctuations are sufficiently strong, a transmission peak within the gap is found at the midgap energy E=0 for degenerate conjugated oligomers (e.g., trans-polyacetylene) and E≠0 for AB-type degenerate oligomers. These results can be interpreted in terms of soliton-antisoliton states created by lattice fluctuations. copyright 1997 The American Physical Society
Simulation of loss electron in vacuum magnetically insulated transmission lines
International Nuclear Information System (INIS)
Zhang Pengfei; Li Yongdong; Liu Chunliang; Wang Hongguang; Guo Fan; Yang Hailiang; Qiu Aici; Su Zhaofeng; Sun Jianfeng; Sun Jiang; Gao Yi
2011-01-01
In the beginning of magnetic insulated period, loss electron in coaxial vacuum magnetically insulated transmission line (MITL) strikes anode and the bremsstrahlung photons are generated in the mean time. Based on the self-limited flow model, velocity in direction of energy transport, energy spectrum and angular distribution of loss electron are simulated by PIC code, energy spectrum of bremsstrahlung photons as well calculated though Monte Carlo method. Computational results show that the velocity of loss electron is less than 2.998 x 108 m/s, the angular excursion of electron is not much in a board extent of energy spectrum. These results show an indirect diagnosis of vacuum insulted transmission line working status based on loss electron bremsstrahlung. (authors)
International Nuclear Information System (INIS)
Tancredi, J.
1983-01-01
Hughes, Electron Dynamics Division is developing gyrotrons for ECRH requirements. In the development program, techniques have been evolved for transmission system components. These techniques include over-moded waveguide tapers, high average power windows, and rf water loads for testing
Ponderomotive phase plate for transmission electron microscopes
Reed, Bryan W [Livermore, CA
2012-07-10
A ponderomotive phase plate system and method for controllably producing highly tunable phase contrast transfer functions in a transmission electron microscope (TEM) for high resolution and biological phase contrast imaging. The system and method includes a laser source and a beam transport system to produce a focused laser crossover as a phase plate, so that a ponderomotive potential of the focused laser crossover produces a scattering-angle-dependent phase shift in the electrons of the post-sample electron beam corresponding to a desired phase contrast transfer function.
International Nuclear Information System (INIS)
Hachtel, J A; Haglund, R F; Pantelides, S T; Marvinney, C; Mayo, D; Mouti, A; Lupini, A R; Chisholm, M F; Mu, R; Pennycook, S J
2016-01-01
The nanoscale optical response of surface plasmons in three-dimensional metallic nanostructures plays an important role in many nanotechnology applications, where precise spatial and spectral characteristics of plasmonic elements control device performance. Electron energy loss spectroscopy (EELS) and cathodoluminescence (CL) within a scanning transmission electron microscope have proven to be valuable tools for studying plasmonics at the nanoscale. Each technique has been used separately, producing three-dimensional reconstructions through tomography, often aided by simulations for complete characterization. Here we demonstrate that the complementary nature of the two techniques, namely that EELS probes beam-induced electronic excitations while CL probes radiative decay, allows us to directly obtain a spatially- and spectrally-resolved picture of the plasmonic characteristics of nanostructures in three dimensions. The approach enables nanoparticle-by-nanoparticle plasmonic analysis in three dimensions to aid in the design of diverse nanoplasmonic applications. (paper)
Transmission electron microscopy analysis of hydroxyapatite nanocrystals from cattle bones
International Nuclear Information System (INIS)
Patel, Sangeeta; Wei, Shanghai; Han, Jie; Gao, Wei
2015-01-01
In this present study, hydroxyapatite which was obtained from cattle bones has been heat treated at temperature 400 °C and 600 °C. The microstructure after the treatment has been studied in detail using Transmission electron microscopy (TEM) and X-ray diffraction techniques. The TEM results indicate that natural bone consists of collagen and hydroxyapatite nano-crystals which are needle shaped. The heat treatment influences the crystallinity and growth of these hydroxyapatite nano-crystals known as ‘crystal maturation’ or ‘crystal ageing’. - Highlights: • Hydroxyapatite is obtained from cattle bones. • Material has been characterised using XRD and TEM. • Crystal growth and orientation has been studied in detail.
Transmission electron microscopy analysis of hydroxyapatite nanocrystals from cattle bones
Energy Technology Data Exchange (ETDEWEB)
Patel, Sangeeta, E-mail: spt658@aucklanduni.ac.nz [Department of Chemical and Materials Engineering, The University of Auckland, 20 Symonds Street, Auckland 1010 (New Zealand); Wei, Shanghai [Department of Chemical and Materials Engineering, The University of Auckland, 20 Symonds Street, Auckland 1010 (New Zealand); Han, Jie [Department of Civil and Environmental Engineering, University of Illinois at Urbana-Champaign, 205 North Mathews Avenue, Urbana, IL (United States); Gao, Wei [Department of Chemical and Materials Engineering, The University of Auckland, 20 Symonds Street, Auckland 1010 (New Zealand)
2015-11-15
In this present study, hydroxyapatite which was obtained from cattle bones has been heat treated at temperature 400 °C and 600 °C. The microstructure after the treatment has been studied in detail using Transmission electron microscopy (TEM) and X-ray diffraction techniques. The TEM results indicate that natural bone consists of collagen and hydroxyapatite nano-crystals which are needle shaped. The heat treatment influences the crystallinity and growth of these hydroxyapatite nano-crystals known as ‘crystal maturation’ or ‘crystal ageing’. - Highlights: • Hydroxyapatite is obtained from cattle bones. • Material has been characterised using XRD and TEM. • Crystal growth and orientation has been studied in detail.
Quantitative Scanning Transmission Electron Microscopy of Electronic and Nanostructured Materials
Yankovich, Andrew B.
Electronic and nanostructured materials have been investigated using advanced scanning transmission electron microscopy (STEM) techniques. The first topic is the microstructure of Ga and Sb-doped ZnO. Ga-doped ZnO is a candidate transparent conducting oxide material. The microstructure of GZO thin films grown by MBE under different growth conditions and different substrates were examined using various electron microscopy (EM) techniques. The microstructure, prevalent defects, and polarity in these films strongly depend on the growth conditions and substrate. Sb-doped ZnO nanowires have been shown to be the first route to stable p-type ZnO. Using Z-contrast STEM, I have showed that an unusual microstructure of Sb-decorated head-to-head inversion domain boundaries and internal voids contain all the Sb in the nanowires and cause the p-type conduction. InGaN thin films and InGaN / GaN quantum wells (QW) for light emitting diodes are the second topic. Low-dose Z-contrast STEM, PACBED, and EDS on InGaN QW LED structures grown by MOCVD show no evidence for nanoscale composition variations, contradicting previous reports. In addition, a new extended defect in GaN and InGaN was discovered. The defect consists of a faceted pyramid-shaped void that produces a threading dislocation along the [0001] growth direction, and is likely caused by carbon contamination during growth. Non-rigid registration (NRR) and high-precision STEM of nanoparticles is the final topic. NRR is a new image processing technique that corrects distortions arising from the serial nature of STEM acquisition that previously limited the precision of locating atomic columns and counting the number of atoms in images. NRR was used to demonstrate sub-picometer precision in STEM images of single crystal Si and GaN, the best achieved in EM. NRR was used to measure the atomic surface structure of Pt nanoacatalysts and Au nanoparticles, which revealed new bond length variation phenomenon of surface atoms. In
International Nuclear Information System (INIS)
Francis, L D; Rivas, J; José-Yacamán, M
2014-01-01
Nanomaterials including nanoparticles, nanowires and nanotubes play an important role in heterogeneous catalysis. Thanks to the rapid improvement of the electron microscopic techniques and with the advent of aberration corrected electron microscopy as well as theoretical methodologies, the potential effects induced by nanocatalysts are better understood than before by unravelling their atomic structure. A brief introduction to advanced electron microscopic techniques namely aberration corrected scanning transmission electron microscopy (Cs-STEM) is presented and subsequently two examples of nanocatalysts are considered in the present review. The first example will focus on the study of bimetallic/core-shell nanoalloys. In heterogeneous catalysis, catalysts containing two or more metals might show significantly different catalytic properties compared to the parent metals and thus are widely utilized in several catalytic reactions. Atom-by-atom insights of the nanoalloy based catalysts ex: Au-Pd will be described in the present review using a combination of advanced electron microscopic and spectroscopic techniques. A related example on the understanding of bimetallic clusters by HAADF-STEM will also be presented in addition to nanoparticles. In the second case understanding the structure of transition metal chalcogenide based nanocatalysts by HRTEM and aberration corrected STEM, for the case of MoS 2 will be discussed. MoS 2 -based catalysts serve as model catalysts and are employed in the hydrodesulphurisations (HDS) reactions in the removal of sulphur from gasoline and related petrochemical products. They have been studied in various forms including nanowires, nanotubes and nanoplates. Their structure, atomic insights and as a consequence elucidation of their corresponding catalytic activity are thus important
International Nuclear Information System (INIS)
Terauchi, Masami; Koike, Masato; Fukushima, Kurio; Kimura, Atsushi
2010-01-01
Two types of wavelength-dispersive soft X-ray spectrometers, a high-dispersion type and a conventional one, for transmission electron microscopes were constructed. Those spectrometers were used to study the electronic states of valence electrons (bonding electrons). Both spectrometers extended the acceptable energy regions to higher than 2000 eV. The best energy resolution of 0.08 eV was obtained for an Al L-emission spectrum by using the high-dispersion type spectrometer. By using the spectrometer, C K-emission of carbon allotropes, Cu L-emission of Cu 1-x Zn x alloys and Pt M-emission spectra were presented. The FWHM value of 12 eV was obtained for the Pt Mα-emission peak. The performance of the conventional one was also presented for ZnS and a section specimen of a multilayer device. W-M and Si-K emissions were clearly resolved. Soft X-ray emission spectroscopy based on transmission electron microscopy (TEM) has an advantage for obtaining spectra from a single crystalline specimen with a defined crystal setting. As an example of anisotropic soft X-ray emission, C K-emission spectra of single crystalline graphite with different crystal settings were presented. From the spectra, density of states of π- and σ-bondings were separately derived. These results demonstrated a method to analyse the electronic states of valence electrons of materials in the nanometre scale based on TEM. (author)
Electronic Biometric Transmission Specification. Version 1.2
2006-11-08
Prescribed by ANSI Std Z39-18 Electronic Biometric Transmission Specification DIN: DOD_BTF_TS_EBTS_ Nov06_01.02.00 i Revision History Revision...contains: • the ORI • a Greenwich Mean (a.k.a. Zulu or UTC) date/time stamp • a code for the software used at the point of collection/transmission...long names and would generally include the tribe name. Subfield 1 Item 1 Character Type AS Characters 1 to 50 Special Characters: Any 7-bit non
Nanoporous metal film: An energy-dependent transmission device for electron waves
International Nuclear Information System (INIS)
Grech, S.; Degiovanni, A.; Lapena, L.; Morin, R.
2011-01-01
We measure electron transmission through free-standing ultrathin nanoporous gold films, using the coherent electron beam emitted by sharp field emission tips in a low energy electron projection microscope setup. Transmission coefficient versus electron wavelength plots show periodic oscillations between 75 and 850 eV. These oscillations result from the energy dependence of interference between paths through the gold and paths through the nanometer-sized pores of the film. We reveal that these films constitute high transmittance quantum devices acting on electron waves through a wavelength-dependent complex transmittance defined by the porosity and the thickness of the film.
Catalysts under Controlled Atmospheres in the Transmission Electron Microscope
DEFF Research Database (Denmark)
Hansen, Thomas Willum; Wagner, Jakob Birkedal
2014-01-01
of resolution. Using suitably clean gases, modified pumping schemes, and short pathways through dense gas regions, these issues are now circumvented. Here we provide an account of best practice using environmental transmission electron microscopy on catalytic systems illustrated using select examples from......Over time, there has been an increasing interest in observing catalysts in their operating environment at high spatial resolution and ultimately to determine the structure of a catalytically active surface. One tool with the potential to do exactly this in direct space is the transmission electron...
International Nuclear Information System (INIS)
Loukya, B.; Zhang, X.; Gupta, A.; Datta, R.
2012-01-01
Electron magnetic chiral dichroism (EMCD) has been studied in CrO 2 thin films (with (100) and (110) growth orientations on TiO 2 substrates) using a gun monochromator in an aberration corrected transmission electron microscope operating at 300 kV. Excellent signal-to-noise ratio is obtained at spatial resolution ∼10 nm using a monochromatic probe as compared to conventional parallel illumination, large area convergent beam electron diffraction and scanning transmission electron microscopy techniques of EMCD. Relatively rapid exposure using mono probe illumination enables collection of EMCD spectra in total of 8–9 min in energy filtered imaging mode for a given Cr L 2,3 energy scan (energy range ∼35 eV). We compared the EMCD signal obtained by extracting the Cr L 2,3 spectra under three beam diffraction geometry of two different reciprocal vectors (namely g=110 and 200) and found that the g=200 vector enables acquisition of excellent EMCD signal from relatively thicker specimen area due to the associated larger extinction distance. Orbital to spin moment ratio has been calculated using EMCD sum rules for 3d elements and dichroic spectral features associated with CrO 2 are compared and discussed with XMCD theoretical spectra. - Highlights: ► Electron magnetic circular dichroism (EMCD) of CrO 2 thin film with two different orientations. ► Improved EMCD signal with Gun monochromator illumination. ► Improved EMCD signal with higher g vector.
Ali, Haider; Yang, Xinbo; Weber, Klaus; Schoenfeld, Winston V.; Davis, Kristopher O.
2017-01-01
In this study, the cross-section of electron-selective titanium oxide (TiO2) contacts for n-type crystalline silicon solar cells were investigated by transmission electron microscopy. It was revealed that the excellent cell efficiency of 21
Okuda, Mitsuhiro; Ogawa, Nobuhiro; Takeguchi, Masaki; Hashimoto, Ayako; Tagaya, Motohiro; Chen, Song; Hanagata, Nobutaka; Ikoma, Toshiyuki
2011-10-01
The mineralized structure of aligned collagen fibrils in a tilapia fish scale was investigated using transmission electron microscopy (TEM) techniques after a thin sample was prepared using aqueous techniques. Electron diffraction and electron energy loss spectroscopy data indicated that a mineralized internal layer consisting of aligned collagen fibrils contains hydroxyapatite crystals. Bright-field imaging, dark-field imaging, and energy-filtered TEM showed that the hydroxyapatite was mainly distributed in the hole zones of the aligned collagen fibrils structure, while needle-like materials composed of calcium compounds including hydroxyapatite existed in the mineralized internal layer. Dark-field imaging and three-dimensional observation using electron tomography revealed that hydroxyapatite and needle-like materials were mainly found in the matrix between the collagen fibrils. It was observed that hydroxyapatite and needle-like materials were preferentially distributed on the surface of the hole zones in the aligned collagen fibrils structure and in the matrix between the collagen fibrils in the mineralized internal layer of the scale.
International Nuclear Information System (INIS)
Giruzzi, G.; Fidone, I.; Marcha, M.J.
1991-01-01
The asymmetric electron distribution generated during lower hybrid current drive has been computed using a 3-D Fokker-Planck code. The superthermal tail and the resulting current are generally a combination of two components streaming in opposite toroidal directions. An appropriate diagnostic method for experimental investigation of the two superthermal populations is wave transmission of two equivalent rays with equal and opposite values of the refractive index. These equivalent rays can be realized by launching the waves from symmetric positions with respect ot the equatorial plane at equal and opposite angles in the toroidal direction. Using an appropriate ray tracing code, the damping of the two rays is computed and it is shown that it results from electrons with opposite parallel velocities. The differential transmission is then a measure of the overall asymmetry of the electron momentum distribution. (author). 12 refs, 8 figs
Advanced electron beam techniques
International Nuclear Information System (INIS)
Hirotsu, Yoshihiko; Yoshida, Yoichi
2007-01-01
After 100 years from the time of discovery of electron, we now have many applications of electron beam in science and technology. In this report, we review two important applications of electron beam: electron microscopy and pulsed-electron beam. Advanced electron microscopy techniques to investigate atomic and electronic structures, and pulsed-electron beam for investigating time-resolved structural change are described. (author)
Total electron content measurements at Gauhati using 140 MHz ATS-6 transmissions
International Nuclear Information System (INIS)
Tyagi, T.R.; Singh, L.; Minakshi Devi; Barbara, A.K.
1977-01-01
The amplitude and phase of 140 MHz transmissions from geostationary satellite ATS-6 (0 0 N, 35 0 E) have been recorded at Gauhati (26.16 0 N; 91.75 0 E) for the period Nov. 1975 to Aug. 1976. The calibration technique for geostationary satellite Faraday rotation measurements suggested by Checcacci and Giorgeo has been improved and generalized. It is then utilized to remove the n ambiguity in Faraday rotation values and also to estimate the correct value of diurnal minimum Faraday rotation angle so that the recorded Faraday rotation values can be converted into electron content values. Typical diurnal variation curves have been obtained for all the months except for equinoxes when the satellite transmission was off very often due to ecliptic conditions and hence no complete diurnal curves could be obtained for these months. It has been found that though December and January behave like typical winter months, the month of November is more like an equinoctial month. Similarly, though June and July behave like typical summer months, the month of May is more or less similar to equinoxes. The characteristic features of the diurnal and seasonal behaviour of the electron content have been discussed. (author)
Development of a secondary electron energy analyzer for a transmission electron microscope.
Magara, Hideyuki; Tomita, Takeshi; Kondo, Yukihito; Sato, Takafumi; Akase, Zentaro; Shindo, Daisuke
2018-04-01
A secondary electron (SE) energy analyzer was developed for a transmission electron microscope. The analyzer comprises a microchannel plate (MCP) for detecting electrons, a coil for collecting SEs emitted from the specimen, a tube for reducing the number of backscattered electrons incident on the MCP, and a retarding mesh for selecting the energy of SEs incident on the MCP. The detection of the SEs associated with charging phenomena around a charged specimen was attempted by performing electron holography and SE spectroscopy using the energy analyzer. The results suggest that it is possible to obtain the energy spectra of SEs using the analyzer and the charging states of a specimen by electron holography simultaneously.
International Nuclear Information System (INIS)
Evora, Maria C.; Goncalez, Odair L.
2002-01-01
A comparative study involving transmission, reflection and photoacoustic FTIR techniques is presented with analysis of polyamide-6. The potential and limitations of these methods are investigated by analyzing structural variations that take place at the surface in the bulk in recycled and irradiated polyamide-6 with a 1.5 MeV electron beam with a 500kGY dose, in the presence of O 2 . FTIR techniques appear to be sensitive in detecting small structural changes that occur in recycled and irradiated polyamide-6. The analysis of samples indicated the formation of OH, HOC=O-, - C=O groups. Also, small structural changes were detected which are characterisitic of NH and CN-C=O groups. Transmission techniques show better the structural changes in the bulk, and microscopy-FTIR appears to be more sensitive in detecting what occurs at the sample surface. (author)
Development of the Atomic-Resolution Environmental Transmission Electron Microscope
DEFF Research Database (Denmark)
Gai, Pratibha L.; Boyes, Edward D.; Yoshida, Kenta
2016-01-01
The development of the novel atomic-resolution environmental transmission electron microscope (atomic-resolution ETEM) for directly probing dynamic gas–solid reactions in situ at the atomic level under controlled reaction conditions consisting of gas environment and elevated temperatures is descr......The development of the novel atomic-resolution environmental transmission electron microscope (atomic-resolution ETEM) for directly probing dynamic gas–solid reactions in situ at the atomic level under controlled reaction conditions consisting of gas environment and elevated temperatures...... is used to study steels, graphene, nanowires, etc. In this chapter, the experimental setup of the microscope column and its peripherals are described....
Application of Boltzmann equation to electron transmission and seconary electron emission
International Nuclear Information System (INIS)
Lanteri, H.; Bindi, R.; Rostaing, P.
1979-01-01
A method is presented for numerical treatment of integro-differential equation, based upon finite difference techniques. This method allows to formulate in a satisfactory manner the Boltzmann's equation applied to backscattering, transmission and secondary emission of metallic targets, avoiding must of the restrictive hypothesis, used until now in these models. For aluminium, the calculated energy spectra, angular distribution, transmission and backscattering coefficients, and secondary emission yield, are found to be in good agreement with experiment [fr
Transmission electron microscopy characterization of photocatalysts for water splitting
DEFF Research Database (Denmark)
Cavalca, Filippo; Laursen, Anders Bo; Dahl, Søren
, it is necessary to understand the fundamentals of their reaction mechanisms, chemical behavior, structure and morphology before, during and after reaction using in situ investigations. Here, we focus on the in situ characterization of photocatalysts [1] in an environmental transmission electron microscope (ETEM......) [2]. Such fundamental insight can be used for further material optimization with respect to performance and stability [3]. In this work, we combine conventional TEM analysis of photocatalysts with environmental TEM (ETEM) and photoactivation using light. A novel type of TEM specimen holder...... that enables in situ illumination is developed to study light-induced phenomena in photoactive materials at the nanoscale under working conditions. Our experiments are aimed at exposing a specimen to light and detecting resulting microstructural and chemical changes using in situ TEM techniques...
A simple way to obtain backscattered electron images in a scanning transmission electron microscope.
Tsuruta, Hiroki; Tanaka, Shigeyasu; Tanji, Takayoshi; Morita, Chiaki
2014-08-01
We have fabricated a simple detector for backscattered electrons (BSEs) and incorporated the detector into a scanning transmission electron microscope (STEM) sample holder. Our detector was made from a 4-mm(2) Si chip. The fabrication procedure was easy, and similar to a standard transmission electron microscopy (TEM) sample thinning process based on ion milling. A TEM grid containing particle objects was fixed to the detector with a silver paste. Observations were carried out using samples of Au and latex particles at 75 and 200 kV. Such a detector provides an easy way to obtain BSE images in an STEM. © The Author 2014. Published by Oxford University Press on behalf of The Japanese Society of Microscopy. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Transmission electron microscopy in molecular structural biology: A historical survey.
Harris, J Robin
2015-09-01
In this personal, historic account of macromolecular transmission electron microscopy (TEM), published data from the 1940s through to recent times is surveyed, within the context of the remarkable progress that has been achieved during this time period. The evolution of present day molecular structural biology is described in relation to the associated biological disciplines. The contribution of numerous electron microscope pioneers to the development of the subject is discussed. The principal techniques for TEM specimen preparation, thin sectioning, metal shadowing, negative staining and plunge-freezing (vitrification) of thin aqueous samples are described, with a selection of published images to emphasise the virtues of each method. The development of digital image analysis and 3D reconstruction is described in detail as applied to electron crystallography and reconstructions from helical structures, 2D membrane crystals as well as single particle 3D reconstruction of icosahedral viruses and macromolecules. The on-going development of new software, algorithms and approaches is highlighted before specific examples of the historical progress of the structural biology of proteins and viruses are presented. Copyright © 2014 Elsevier Inc. All rights reserved.
Preparation of herpes simplex virus-infected primary neurons for transmission electron microscopy.
Miranda-Saksena, Monica; Boadle, Ross; Cunningham, Anthony L
2014-01-01
Transmission electron microscopy (TEM) provides the resolution necessary to identify both viruses and subcellular components of cells infected with many types of viruses, including herpes simplex virus. Recognized as a powerful tool in both diagnostic and research-based virology laboratories, TEM has made possible the identification of new viruses and has contributed to the elucidation of virus life cycle and virus-host cell interaction. Whilst there are many sample preparation techniques for TEM, conventional processing using chemical fixation and resin embedding remains a useful technique, available in virtually all EM laboratories, for studying virus/cell ultrastructure. In this chapter, we describe the preparation of herpes simplex virus-infected primary neurons, grown on plastic cover slips, to allow sectioning of neurons and axons in their growth plane. This technique allows TEM examination of cell bodies, axons, growth cones, and varicosities, providing powerful insights into virus-cell interaction.
National Research Council Canada - National Science Library
Lawson, Joseph M
2006-01-01
... justification for the implementation of a given enhancement technique. The research questions were answered through model and simulation of a satellite transmission system via a Linux-based network topology...
Hendriks, Frank C.; Mohammadian, Sajjad; Ristanović, Zoran; Kalirai, Sam; Meirer, Florian; Vogt, Eelco T. C.; Bruijnincx, Pieter C. A.; Gerritsen, Hans C.; Weckhuysen, Bert M.
2017-01-01
Abstract Establishing structure–activity relationships in complex, hierarchically structured nanomaterials, such as fluid catalytic cracking (FCC) catalysts, requires characterization with complementary, correlated analysis techniques. An integrated setup has been developed to perform transmission electron microscopy (TEM) and single‐molecule fluorescence (SMF) microscopy on such nanostructured samples. Correlated structure–reactivity information was obtained for 100 nm thin, microtomed secti...
Measurement of suprathermal electron confinement by cyclotron transmission
International Nuclear Information System (INIS)
Kirkwood, R.; Hutchinson, I.H.; Luckhardt, S.C.; Porkolab, M.; Squire, J.P.
1990-01-01
The confinement time of suprathermal electrons is determined experimentally from the distribution function determined via wave transmission measurements. Measurements of the lowest moment of the distribution perpendicular to the B field as a function of the parallel electron momentum as well as the global input power allow the suprathermal electron confinement time (τ se ) to be calculated during lower-hybrid and inductive current drive. Finite particle confinement is found to be the dominant energy loss term for the suprathermals and improves with plasma current and density
Fabrication and electric measurements of nanostructures inside transmission electron microscope
International Nuclear Information System (INIS)
Chen, Qing; Peng, Lian-Mao
2011-01-01
Using manipulation holders specially designed for transmission electron microscope (TEM), nanostructures can be characterized, measured, modified and even fabricated in-situ. In-situ TEM techniques not only enable real-time study of structure-property relationships of materials at atomic scale, but also provide the ability to control and manipulate materials and structures at nanoscale. This review highlights in-situ electric measurements and in-situ fabrication and structure modification using manipulation holder inside TEM. -- Research highlights: → We review in-situ works using manipulation holder in TEM. → In-situ electric measurements, fabrication and structure modification are focused. → We discuss important issues that should be considered for reliable results. → In-situ TEM is becoming a very powerful tool for many research fields.
Interaction of electrons with light metal hydrides in the transmission electron microscope.
Wang, Yongming; Wakasugi, Takenobu; Isobe, Shigehito; Hashimoto, Naoyuki; Ohnuki, Somei
2014-12-01
Transmission electron microscope (TEM) observation of light metal hydrides is complicated by the instability of these materials under electron irradiation. In this study, the electron kinetic energy dependences of the interactions of incident electrons with lithium, sodium and magnesium hydrides, as well as the constituting element effect on the interactions, were theoretically discussed, and electron irradiation damage to these hydrides was examined using in situ TEM. The results indicate that high incident electron kinetic energy helps alleviate the irradiation damage resulting from inelastic or elastic scattering of the incident electrons in the TEM. Therefore, observations and characterizations of these materials would benefit from increased, instead decreased, TEM operating voltage. © The Author 2014. Published by Oxford University Press on behalf of The Japanese Society of Microscopy. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
International Nuclear Information System (INIS)
Ueno, N.; Sugita, K.; Seki, K.; Inokuchi, H.
1986-01-01
This paper describes the results of low-energy electron transmission and secondary-electron emission experiments on thin films of long-chain alkanes deposited on metal substrates. The spectral changes due to crystal-melt phase transition were measured in situ in both experiments. The ground-state energy V 0 of the quasifree electron in crystalline state was determined to be 0.5 +- 0.1 eV. The value of V 0 for the molten state was found to be negative. Further, in the crystalline state evidence is found for a direct correspondence between the transmission maxima and the high value of the density of states in the conduction bands
Atomic-resolution transmission electron microscopy of electron beam–sensitive crystalline materials
Zhang, Daliang; Zhu, Yihan; Liu, Lingmei; Ying, Xiangrong; Hsiung, Chia-En; Sougrat, Rachid; Li, Kun; Han, Yu
2018-02-01
High-resolution imaging of electron beam–sensitive materials is one of the most difficult applications of transmission electron microscopy (TEM). The challenges are manifold, including the acquisition of images with extremely low beam doses, the time-constrained search for crystal zone axes, the precise image alignment, and the accurate determination of the defocus value. We develop a suite of methods to fulfill these requirements and acquire atomic-resolution TEM images of several metal organic frameworks that are generally recognized as highly sensitive to electron beams. The high image resolution allows us to identify individual metal atomic columns, various types of surface termination, and benzene rings in the organic linkers. We also apply our methods to other electron beam–sensitive materials, including the organic-inorganic hybrid perovskite CH3NH3PbBr3.
Atomic-resolution transmission electron microscopy of electron beam–sensitive crystalline materials
Zhang, Daliang
2018-01-18
High-resolution imaging of electron beam-sensitive materials is one of the most difficult applications of transmission electron microscopy (TEM). The challenges are manifold, including the acquisition of images with extremely low beam doses, the time-constrained search for crystal zone axes, the precise image alignment, and the accurate determination of the defocus value. We develop a suite of methods to fulfill these requirements and acquire atomic-resolution TEM images of several metal organic frameworks that are generally recognized as highly sensitive to electron beams. The high image resolution allows us to identify individual metal atomic columns, various types of surface termination, and benzene rings in the organic linkers. We also apply our methods to other electron beam–sensitive materials, including the organic-inorganic hybrid perovskite CH3NH3PbBr3.
Two-dimensional electron flow in pulsed power transmission lines and plasma opening switches
International Nuclear Information System (INIS)
Church, B.W.; Longcope, D.W.; Ng, C.K.; Sudan, R.N.
1991-01-01
The operation of magnetically insulated transmission lines (MITL) and the interruption of current in a plasma opening switch (POS) are determined by the physics of the electrons emitted by the cathode surface. A mathematical model describes the self-consistent two-dimensional flow of an electron fluid. A finite element code, FERUS, has been developed to solve the two equations which describe Poisson's and Ampere's law in two dimensions. The solutions from this code are obtained for parameters where the electron orbits are considerably modified by the self-magnetic field of the current. Next, the self-insulated electron flow in a MITL with a step change in cross-section is studied using a conventional two-dimensional fully electromagnetic particle-in-cell code, MASK. The equations governing two-dimensional quasi-static electron flow are solved numerically by a third technique which is suitable for predicting current interruption in a POS. The object of the study is to determine the critical load impedance, Z CL , required for current interruption for a given applied voltage, cathode voltage and plasma length. (author). 9 refs, 5 figs
Path-separated electron interferometry in a scanning transmission electron microscope
Yasin, Fehmi S.; Harvey, Tyler R.; Chess, Jordan J.; Pierce, Jordan S.; McMorran, Benjamin J.
2018-05-01
We report a path-separated electron interferometer within a scanning transmission electron microscope. In this setup, we use a nanofabricated grating as an amplitude-division beamsplitter to prepare multiple spatially separated, coherent electron probe beams. We achieve path separations of 30 nm. We pass the +1 diffraction order probe through amorphous carbon while passing the 0th and ‑1 orders through vacuum. The probes are then made to interfere via imaging optics, and we observe an interference pattern at the CCD detector with up to 39.7% fringe visibility. We show preliminary experimental results in which the interference pattern was recorded during a 1D scan of the diffracted probes across a test phase object. These results qualitatively agree with a modeled interference predicted by an independent measurement of the specimen thickness. This experimental design can potentially be applied to phase contrast imaging and fundamental physics experiments, such as an exploration of electron wave packet coherence length.
Electronic publications, a useful technique for astronomy outreach
Stavinschi, M.; Mosoia, C.
2012-09-01
Thanks to modern technology, astronomy can be communicated to the public through a variety of techniques, from classic conferences (also upgraded to the video projectors, etc.) to TV, print media and social media platforms such as Facebook, Twitter, Linkedin, MySpace, etc. We are going to present advantages of electronic publishing, starting from informing the public with latest astronomy news, to providing a place for public debate. In an era of global crisis e-publishing is a must do, be it seen from the financially perspective, or the desired impact to the public. We are going to present a constant example of year electronic publication dedicated to promoting science and communication; also, the Science Communicators Network Interested in spreading the word of astronomy. The aim is to establish connections with all OEP participants with a view to know each other and try to work in common for the better message transmission to the public. Together, we might build a single platform with multiple educational results.
The use of transmission electron microscopy in the quantification of nanoparticle dose
International Nuclear Information System (INIS)
Hondow, N; Brydson, R; Brown, A
2014-01-01
There are an increasing number of potential applications for nanoparticles in clinical medicine, including targeted drug delivery and contrast agents for biomedical imaging. Current in vitro studies are concerned with the biological impact of nanoparticles, with electron microscopy commonly employed to image their intracellular location. It is critical to quantify the absolute nanoparticle dose internalized by cells in a given exposure, and to understand the factors which affect this. In this work we are aiming to develop a full quantitative description of quantum dot uptake by an in vitro cell line. Transmission electron microscopy of thin cell sections provides the location and number of cellular vesicles per 2-D cell slice plus the number of quantum dots per vesicle. These results can then be correlated to other techniques to quantify the internalized nanoparticle dose distribution for whole cells
Hendriks, Frank C.; Mohammadian, Sajjad; Ristanovic, Zoran; Kalirai, Samanbir; Meirer, Florian; Vogt, Eelco T. C.; Bruijnincx, Pieter C. A.; Gerritsen, Hans; Weckhuysen, Bert M.
2018-01-01
Establishing structure–activity relationships in complex, hierarchically structured nanomaterials, such as fluid catalytic cracking (FCC) catalysts, requires characterization with complementary, correlated analysis techniques. An integrated setup has been developed to perform transmission electron microscopy (TEM) and single-molecule fluorescence (SMF) microscopy on such nanostructured samples. Correlated structure–reactivity information was obtained for 100 nm thin, microtomed sections of a ...
Electronic control of a 4-speed automatic transmission with lock-up clutch
Energy Technology Data Exchange (ETDEWEB)
Schwab, M.
1984-01-01
The paper describes the electronic control of an automatic 4-speed transmission with lock-up clutch. As compared to purely hydraulically controlled transmissions, this control offers a clearly improved quality of shifting and the possibility of achieving improvements in fuel consumption thanks to a special economy program. The electronic control unit is a Bosch MOTRONIC which has been expanded to include the functions of transmission control. A special feature is the engine torque control which is implemented by way of retarding the ignition when shifting. This opens up an additional degree of freedom for optimizing a transmission in terms of shift comfort, life of the friction elements and the power which can be transmitted.
International Nuclear Information System (INIS)
Agudo Jácome, L.; Eggeler, G.; Dlouhý, A.
2012-01-01
Stereo transmission electron microscopy (TEM) provides a 3D impression of the microstructure in a thin TEM foil. It allows to perform depth and TEM foil thickness measurements and to decide whether a microstructural feature lies inside of a thin foil or on its surface. It allows appreciating the true three-dimensional nature of dislocation configurations. In the present study we first review some basic elements of classical stereo TEM. We then show how the method can be extended by working in the scanning transmission electron microscope (STEM) mode of a modern analytical 200 kV TEM equipped with a field emission gun (FEG TEM) and a high angle annular dark field (HAADF) detector. We combine two micrographs of a stereo pair into one anaglyph. When viewed with special colored glasses the anaglyph provides a direct and realistic 3D impression of the microstructure. Three examples are provided which demonstrate the potential of this extended stereo TEM technique: a single crystal Ni-base superalloy, a 9% Chromium tempered martensite ferritic steel and a NiTi shape memory alloy. We consider the effect of camera length, show how foil thicknesses can be measured, and discuss the depth of focus and surface effects. -- Highlights: ► The advanced STEM/HAADF diffraction contrast is extended to 3D stereo-imaging. ► The advantages of the new technique over stereo-imaging in CTEM are demonstrated. ► The new method allows foil thickness measurements in a broad range of conditions. ► We show that features associated with ion milling surface damage can be beneficial for appreciating 3D features of the microstructure.
Energy Technology Data Exchange (ETDEWEB)
Agudo Jacome, L., E-mail: leonardo.agudo@bam.de [Institut fuer Werkstoffe, Ruhr-Universitaet Bochum, D-44780 Bochum (Germany); Eggeler, G., E-mail: gunther.eggeler@ruhr-uni-bochum.de [Institut fuer Werkstoffe, Ruhr-Universitaet Bochum, D-44780 Bochum (Germany); Dlouhy, A., E-mail: dlouhy@ipm.cz [Institute of Physics of Materials, Academy of Sciences of the Czech Republic, Zizkova 22, 616 62 Brno (Czech Republic)
2012-11-15
Stereo transmission electron microscopy (TEM) provides a 3D impression of the microstructure in a thin TEM foil. It allows to perform depth and TEM foil thickness measurements and to decide whether a microstructural feature lies inside of a thin foil or on its surface. It allows appreciating the true three-dimensional nature of dislocation configurations. In the present study we first review some basic elements of classical stereo TEM. We then show how the method can be extended by working in the scanning transmission electron microscope (STEM) mode of a modern analytical 200 kV TEM equipped with a field emission gun (FEG TEM) and a high angle annular dark field (HAADF) detector. We combine two micrographs of a stereo pair into one anaglyph. When viewed with special colored glasses the anaglyph provides a direct and realistic 3D impression of the microstructure. Three examples are provided which demonstrate the potential of this extended stereo TEM technique: a single crystal Ni-base superalloy, a 9% Chromium tempered martensite ferritic steel and a NiTi shape memory alloy. We consider the effect of camera length, show how foil thicknesses can be measured, and discuss the depth of focus and surface effects. -- Highlights: Black-Right-Pointing-Pointer The advanced STEM/HAADF diffraction contrast is extended to 3D stereo-imaging. Black-Right-Pointing-Pointer The advantages of the new technique over stereo-imaging in CTEM are demonstrated. Black-Right-Pointing-Pointer The new method allows foil thickness measurements in a broad range of conditions. Black-Right-Pointing-Pointer We show that features associated with ion milling surface damage can be beneficial for appreciating 3D features of the microstructure.
In situ Electrical measurements in Transmission Electron Microscopy
Rudneva, M.
2013-01-01
In the present thesis the combination of real-time electricalmeasurements on nano-sampleswith simultaneous examination by transmission electron microscope (TEM) is discussed. Application of an electrical current may lead to changes in the samples thus the possibility to correlate such changes with
Pulsed Power for a Dynamic Transmission Electron Microscope
Energy Technology Data Exchange (ETDEWEB)
dehope, w j; browning, n; campbell, g; cook, e; king, w; lagrange, t; reed, b; stuart, b; Shuttlesworth, R; Pyke, B
2009-06-25
Lawrence Livermore National Laboratory (LLNL) has converted a commercial 200kV transmission electron microscope (TEM) into an ultrafast, nanoscale diagnostic tool for material science studies. The resulting Dynamic Transmission Electron Microscope (DTEM) has provided a unique tool for the study of material phase transitions, reaction front analyses, and other studies in the fields of chemistry, materials science, and biology. The TEM's thermionic electron emission source was replaced with a fast photocathode and a laser beam path was provided for ultraviolet surface illumination. The resulting photoelectron beam gives downstream images of 2 and 20 ns exposure times at 100 and 10 nm spatial resolution. A separate laser, used as a pump pulse, is used to heat, ignite, or shock samples while the photocathode electron pulses, carefully time-synchronized with the pump, function as probe in fast transient studies. The device functions in both imaging and diffraction modes. A laser upgrade is underway to make arbitrary cathode pulse trains of variable pulse width of 10-1000 ns. Along with a fast e-beam deflection scheme, a 'movie mode' capability will be added to this unique diagnostic tool. This talk will review conventional electron microscopy and its limitations, discuss the development and capabilities of DTEM, in particularly addressing the prime and pulsed power considerations in the design and fabrication of the DTEM, and conclude with the presentation of a deflector and solid-state pulser design for Movie-Mode DTEM.
Pulsed Power for a Dynamic Transmission Electron Microscope
International Nuclear Information System (INIS)
DeHope, W.J.; Browning, N.; Campbell, G.; Cook, E.; King, W.; Lagrange, T.; Reed, B.; Stuart, B.; Shuttlesworth, R.; Pyke, B.
2009-01-01
Lawrence Livermore National Laboratory (LLNL) has converted a commercial 200kV transmission electron microscope (TEM) into an ultrafast, nanoscale diagnostic tool for material science studies. The resulting Dynamic Transmission Electron Microscope (DTEM) has provided a unique tool for the study of material phase transitions, reaction front analyses, and other studies in the fields of chemistry, materials science, and biology. The TEM's thermionic electron emission source was replaced with a fast photocathode and a laser beam path was provided for ultraviolet surface illumination. The resulting photoelectron beam gives downstream images of 2 and 20 ns exposure times at 100 and 10 nm spatial resolution. A separate laser, used as a pump pulse, is used to heat, ignite, or shock samples while the photocathode electron pulses, carefully time-synchronized with the pump, function as probe in fast transient studies. The device functions in both imaging and diffraction modes. A laser upgrade is underway to make arbitrary cathode pulse trains of variable pulse width of 10-1000 ns. Along with a fast e-beam deflection scheme, a 'movie mode' capability will be added to this unique diagnostic tool. This talk will review conventional electron microscopy and its limitations, discuss the development and capabilities of DTEM, in particularly addressing the prime and pulsed power considerations in the design and fabrication of the DTEM, and conclude with the presentation of a deflector and solid-state pulser design for Movie-Mode DTEM
Structural Fingerprinting of Nanocrystals in the Transmission Electron Microscope
Rouvimov, Sergei; Plachinda, Pavel; Moeck, Peter
2010-03-01
Three novel strategies for the structurally identification of nanocrystals in a transmission electron microscope are presented. Either a single high-resolution transmission electron microscopy image [1] or a single precession electron diffractogram (PED) [2] may be employed. PEDs from fine-grained crystal powders may also be utilized. Automation of the former two strategies is in progress and shall lead to statistically significant results on ensembles of nanocrystals. Open-access databases such as the Crystallography Open Database which provides more than 81,500 crystal structure data sets [3] or its mainly inorganic and educational subsets [4] may be utilized. [1] http://www.scientificjournals.org/journals 2007/j/of/dissertation.htm [2] P. Moeck and S. Rouvimov, in: {Drugs and the Pharmaceutical Sciences}, Vol. 191, 2009, 270-313 [3] http://cod.ibt.lt, http://www.crystallography.net, http://cod.ensicaen.fr, http://nanocrystallography.org, http://nanocrystallography.net, http://journals.iucr.org/j/issues/2009/04/00/kk5039/kk5039.pdf [4] http://nanocrystallography.research.pdx.edu/CIF-searchable
On the optical stability of high-resolution transmission electron microscopes
International Nuclear Information System (INIS)
Barthel, J.; Thust, A.
2013-01-01
In the recent two decades the technique of high-resolution transmission electron microscopy experienced an unprecedented progress through the introduction of hardware aberration correctors and by the improvement of the achievable resolution to the sub-Ångström level. The important aspect that aberration correction at a given resolution requires also a well defined amount of optical stability has received little attention so far. Therefore we investigate the qualification of a variety of high-resolution electron microscopes to maintain an aberration corrected optical state in terms of an optical lifetime. We develop a comprehensive statistical framework for the estimation of the optical lifetime and find remarkably low values between tens of seconds and a couple of minutes. Probability curves are introduced, which inform the operator about the chance to work still in the fully aberration corrected state. - Highlights: • We investigate the temporal stability of optical aberrations in HRTEM. • We develop a statistical framework for the estimation of optical lifetimes. • We introduce plots showing the success probability for aberration-free work. • Optical lifetimes in sub-Ångström electron microscopy are surprisingly low. • The success of aberration correction depends strongly on the optical stability
Characterization of strained semiconductor structures using transmission electron microscopy
Energy Technology Data Exchange (ETDEWEB)
Oezdoel, Vasfi Burak
2011-08-15
Today's state-of-the-art semiconductor electronic devices utilize the charge transport within very small volumes of the active device regions. The structural, chemical and optical material properties in these small dimensions can critically affect the performance of these devices. The present thesis is focused on the nanometer scale characterization of the strain state in semiconductor structures using transmission electron microscopy (TEM). Although high-resolution TEM has shown to provide the required accuracy at the nanometer scale, optimization of imaging conditions is necessary for accurate strain measurements. An alternative HRTEM method based on strain mapping on complex-valued exit face wave functions is developed to reduce the artifacts arising from objective lens aberrations. However, a much larger field of view is crucial for mapping strain in the active regions of complex structures like latest generation metal-oxide-semiconductor field-effect transistors (MOSFETs). To overcome this, a complementary approach based on electron holography is proposed. The technique relies on the reconstruction of the phase shifts in the diffracted electron beams from a focal series of dark-field images using recently developed exit-face wave function reconstruction algorithm. Combining high spatial resolution, better than 1 nm, with a field of view of about 1 {mu}m in each dimension, simultaneous strain measurements on the array of MOSFETs are possible. Owing to the much lower electron doses used in holography experiments when compared to conventional quantitative methods, the proposed approach allows to map compositional distribution in electron beam sensitive materials such as InGaN heterostructures without alteration of the original morphology and chemical composition. Moreover, dark-field holography experiments can be performed on thicker specimens than the ones required for high-resolution TEM, which in turn reduces the thin foil relaxation. (orig.)
Zhu, Yihan; Ciston, Jim; Zheng, Bin; Miao, Xiaohe; Czarnik, Cory; Pan, Yichang; Sougrat, Rachid; Lai, Zhiping; Hsiung, Chia-En; Yao, Kexin; Pinnau, Ingo; Pan, Ming; Han, Yu
2017-05-01
Metal-organic frameworks (MOFs) are crystalline porous materials with designable topology, porosity and functionality, having promising applications in gas storage and separation, ion conduction and catalysis. It is challenging to observe MOFs with transmission electron microscopy (TEM) due to the extreme instability of MOFs upon electron beam irradiation. Here, we use a direct-detection electron-counting camera to acquire TEM images of the MOF ZIF-8 with an ultralow dose of 4.1 electrons per square ångström to retain the structural integrity. The obtained image involves structural information transferred up to 2.1 Å, allowing the resolution of individual atomic columns of Zn and organic linkers in the framework. Furthermore, TEM reveals important local structural features of ZIF-8 crystals that cannot be identified by diffraction techniques, including armchair-type surface terminations and coherent interfaces between assembled crystals. These observations allow us to understand how ZIF-8 crystals self-assemble and the subsequent influence of interfacial cavities on mass transport of guest molecules.
Exploring the environmental transmission electron microscope
DEFF Research Database (Denmark)
Wagner, Jakob B.; Cavalca, Filippo; Damsgaard, Christian D.
2012-01-01
of the opportunities that the environmental TEM (ETEM) offers when combined with other in situ techniques will be explored, directly in the microscope, by combining electron-based and photon-based techniques and phenomena. In addition, application of adjacent setups using sophisticated transfer methods...
Development of spin-polarized transmission electron microscope
International Nuclear Information System (INIS)
Kuwahara, M; Saitoh, K; Tanaka, N; Takeda, Y; Ujihara, T; Asano, H; Nakanishi, T
2011-01-01
In order to study spin related phenomena in nano-size materials, spin-polarized electron source (PES) has been employed for the incident beam in transmission electron microscope (TEM). The PES has been designed and constructed with optimizing for spin-polarized TEM. The illuminating system of TEM is also designed to focus the spin-polarized electron beam emitted from a semiconductor photocathode with a negative electron affinity (NEA) surface. The beam energy is set to below 40 keV which is lower energy type as a TEM, because the spin interaction with condensed matters is very small corresponding with a Coulomb interaction. The polarized electron gun has realized in an extra high vacuum (XHV) condition and high field gradient of 4 MV/m on a surface of photocathode. Furthermore, it demonstrated that 40-keV polarized electron beam was operated with a sub-milli second pulse mode by using the backside excitation type photocathode. This high performance PES will make it possible to observe dynamically a magnetic field images with high contrast and highspeed temporal imaging in TEM.
Energy Technology Data Exchange (ETDEWEB)
Parent, Lucas R. [Department; amp, Biochemistry, University of California, San Diego, La Jolla, California 92093, United States; Bakalis, Evangelos [Dipartimento; Ramírez-Hernández, Abelardo [Materials; Institute; Kammeyer, Jacquelin K. [Department; amp, Biochemistry, University of California, San Diego, La Jolla, California 92093, United States; Park, Chiwoo [Department; de Pablo, Juan [Materials; Institute; Zerbetto, Francesco [Dipartimento; Patterson, Joseph P. [Department; amp, Biochemistry, University of California, San Diego, La Jolla, California 92093, United States; Laboratory; Gianneschi, Nathan C. [Department; amp, Biochemistry, University of California, San Diego, La Jolla, California 92093, United States
2017-11-16
Amphiphilic small molecules and polymers form commonplace nanoscale macromolecular compartments and bilayers, and as such are truly essential components in all cells and in many cellular processes. The nature of these architectures, including their formation, phase changes, and stimuli-response behaviors, is necessary for the most basic functions of life, and over the past half-century, these natural micellar structures have inspired a vast diversity of industrial products, from biomedicines to detergents, lubricants, and coatings. The importance of these materials and their ubiquity have made them the subject of intense investigation regarding their nanoscale dynamics with increasing interest in obtaining sufficient temporal and spatial resolution to directly observe nanoscale processes. However, the vast majority of experimental methods involve either bulk-averaging techniques including light, neutron, and X-ray scattering, or are static in nature including even the most advanced cryogenic transmission electron microscopy techniques. Here, we employ in situ liquid-cell transmission electron microscopy (LCTEM) to directly observe the evolution of individual amphiphilic block copolymer micellar nanoparticles in solution, in real time with nanometer spatial resolution. These observations, made on a proof-of-concept bioconjugate polymer amphiphile, revealed growth and evolution occurring by unimer addition processes and by particle-particle collision-and-fusion events. The experimental approach, combining direct LCTEM observation, quantitative analysis of LCTEM data, and correlated in silico simulations, provides a unique view of solvated soft matter nanoassemblies as they morph and evolve in time and space, enabling us to capture these phenomena in solution.
Energy Technology Data Exchange (ETDEWEB)
Bäcke, Olof, E-mail: obacke@chalmers.se [Department of Applied Physics, Chalmers University of Technology, 41296 Göteborg (Sweden); Lindqvist, Camilla; Diaz de Zerio Mendaza, Amaia [Department of Chemistry and Chemical Engineering, Chalmers University of Technology, 41296 Göteborg (Sweden); Gustafsson, Stefan [Department of Applied Physics, Chalmers University of Technology, 41296 Göteborg (Sweden); Wang, Ergang; Andersson, Mats R.; Müller, Christian [Department of Chemistry and Chemical Engineering, Chalmers University of Technology, 41296 Göteborg (Sweden); Kristiansen, Per Magnus [Institute of Polymer Nanotechnology (INKA), FHNW University of Applied Science and Arts Northwestern Switzerland, 5210 Windisch (Switzerland); Laboratory for Micro- and Nanotechnology, Paul Scherrer Institute, 5232 Villigen (Switzerland); Olsson, Eva, E-mail: eva.olsson@chalmers.se [Department of Applied Physics, Chalmers University of Technology, 41296 Göteborg (Sweden)
2017-05-15
We show by in situ microscopy that the effects of electron beam irradiation during transmission electron microscopy can be used to lock microstructural features and enhance the structural thermal stability of a nanostructured polymer:fullerene blend. Polymer:fullerene bulk-heterojunction thin films show great promise for use as active layers in organic solar cells but their low thermal stability is a hindrance. Lack of thermal stability complicates manufacturing and influences the lifetime of devices. To investigate how electron irradiation affects the thermal stability of polymer:fullerene films, a model bulk-heterojunction film based on a thiophene-quinoxaline copolymer and a fullerene derivative was heat-treated in-situ in a transmission electron microscope. In areas of the film that exposed to the electron beam the nanostructure of the film remained stable, while the nanostructure in areas not exposed to the electron beam underwent large phase separation and nucleation of fullerene crystals. UV–vis spectroscopy shows that the polymer:fullerene films are stable for electron doses up to 2000 kGy. - Highlights: • Thermal stability of a polymer: fullerne blend is increased using electron irradiation. • Using in-situ transmission electron microscopy the nanostructure is studied. • Electron irradiation stops phase separation between the polymer and fullerene. • Electron irradiation quenches the formation and nucleation of fullerene crystals.
Transmission electron microscope studies of crystalline LiNbO3
International Nuclear Information System (INIS)
Pareja, R.; Gonzalez, R.; Chen, Y.
1984-01-01
Transmission electron microscope investigations in both as-grown and hydrogen-reduced LiNbO 3 reveal that niobium oxide precipitates can be produced by in situ irradiations in the electron microscope. The precipitation process is produced by a combined effect of ionizing electrons and the thermal heating of the specimens during irradiation. It is proposed that the composition of the precipitates is primarily Nb 2 O 5
Study of electron transmission through thin metallic films by the electron moessbauer spectroscopy
International Nuclear Information System (INIS)
Babikova, Yu.F.; Vakar, O.M.; Gruzin, O.M.; Petrikin, Yu.V.
1983-01-01
Results of the experimental study of the transmission of conversion electrons through aluminium, iron, tin and gold films are presented. Absorption of resonance electrons of the Moessbauer nuclide 57 Fe, formed during target irradiation with γ-quanta of 57 Co source in chromium matrix has been studied. It is asserted that absorption of conversion electrons in films of different elements is similar; at that, like in the case of β-particles, the law of absorption of resonance electrons, emitted from the flat layer, is exponential For conversion electrons of the Moessbauer nuclide 57 Fe the absorption coefficient is (0.025+-0.002) cm 2 /μg, which in the case of iron absorbing film corresponds to (20.0+-1.0)x10 4 cm -1
Transmission environmental scanning electron microscope with scintillation gaseous detection device.
Danilatos, Gerasimos; Kollia, Mary; Dracopoulos, Vassileios
2015-03-01
A transmission environmental scanning electron microscope with use of a scintillation gaseous detection device has been implemented. This corresponds to a transmission scanning electron microscope but with addition of a gaseous environment acting both as environmental and detection medium. A commercial type of low vacuum machine has been employed together with appropriate modifications to the detection configuration. This involves controlled screening of various emitted signals in conjunction with a scintillation gaseous detection device already provided with the machine for regular surface imaging. Dark field and bright field imaging has been obtained along with other detection conditions. With a progressive series of modifications and tests, the theory and practice of a novel type of microscopy is briefly shown now ushering further significant improvements and developments in electron microscopy as a whole. Copyright © 2014 Elsevier B.V. All rights reserved.
Solid-state nanopores of controlled geometry fabricated in a transmission electron microscope
Qian, Hui; Egerton, Ray F.
2017-11-01
Energy-filtered transmission electron microscopy and electron tomography were applied to in situ studies of the formation, shape, and diameter of nanopores formed in a silicon nitride membrane in a transmission electron microscope. The nanopore geometry was observed in three dimensions by electron tomography. Drilling conditions, such as probe current, beam convergence angle, and probe position, affect the formation rate and the geometry of the pores. With a beam convergence semi-angle of α = 22 mrad, a conical shaped nanopore is formed but at α = 45 mrad, double-cone (hourglass-shaped) nanopores were produced. Nanopores with an effective diameter between 10 nm and 1.8 nm were fabricated by controlling the drilling time.
Three-Dimensional scanning transmission electron microscopy of biological specimens
De Jonge, Niels; Sougrat, Rachid; Northan, Brian M.; Pennycook, Stephen J.
2010-01-01
A three-dimensional (3D) reconstruction of the cytoskeleton and a clathrin-coated pit in mammalian cells has been achieved from a focal-series of images recorded in an aberration-corrected scanning transmission electron microscope (STEM
Multistage linear electron acceleration using pulsed transmission lines
International Nuclear Information System (INIS)
Miller, R.B.; Prestwich, K.R.; Poukey, J.W.; Epstein, B.G.; Freeman, J.R.; Sharpe, A.W.; Tucker, W.K.; Shope, S.L.
1981-01-01
A four-stage linear electron accelerator is described which uses pulsed radial transmission lines as the basic accelerating units. An annular electron beam produced by a foilless diode is guided through the accelerator by a strong axial magnetic field. Synchronous firing of the injector and the acccelerating modules is accomplished with self-breaking oil switches. The device has accelerated beam currents of 25 kA to kinetic energies of 9 MV, with 90% current transport efficiency. The average accelerating gradient is 3 MV/m
International Nuclear Information System (INIS)
Asoro, M.A.; Ferreira, P.J.; Kovar, D.
2014-01-01
Transmission electron microscopy and scanning transmission electron microscopy studies were conducted in situ on 2–5 nm Pt and 10–40 nm Ag nanoparticles to study mechanisms for sintering and to measure relevant sintering kinetics in nanoscale particles. Sintering between two separated particles was observed to initiate by either (1) diffusion of the particles on the sample support or (2) diffusion of atoms or small clusters of atoms to the neck region between the two particles. After particle contact, the rate of sintering was controlled by atomic surface diffusivity. The surface diffusivity was determined as a function of particle size and temperature from experimental measurements of the rate of neck growth of the particles. The surface diffusivities did not show a strong size effect for the range of particle sizes that were studied. The surface diffusivity for Pt nanoparticles exhibited the expected Arrhenius temperature dependence and did not appear to be sensitive to the presence of surface contaminants. In contrast, the surface diffusivity for Ag nanoparticles was affected by the presence of impurities such as carbon. The diffusivities for Ag nanoparticles were consistent with previous measurements of bulk surface diffusivities for Ag in the presence of C, but were significantly slower than those obtained from pristine Ag
Hata, S; Miyazaki, S; Gondo, T; Kawamoto, K; Horii, N; Sato, K; Furukawa, H; Kudo, H; Miyazaki, H; Murayama, M
2017-04-01
This paper reports the preliminary results of a new in-situ three-dimensional (3D) imaging system for observing plastic deformation behavior in a transmission electron microscope (TEM) as a directly relevant development of the recently reported straining-and-tomography holder [Sato K et al. (2015) Development of a novel straining holder for transmission electron microscopy compatible with single tilt-axis electron tomography. Microsc. 64: 369-375]. We designed an integrated system using the holder and newly developed straining and image-acquisition software and then developed an experimental procedure for in-situ straining and time-resolved electron tomography (ET) data acquisition. The software for image acquisition and 3D visualization was developed based on the commercially available ET software TEMographyTM. We achieved time-resolved 3D visualization of nanometer-scale plastic deformation behavior in a Pb-Sn alloy sample, thus demonstrating the capability of this system for potential applications in materials science. © The Author 2016. Published by Oxford University Press on behalf of The Japanese Society of Microscopy. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Börrnert, Felix; Renner, Julian; Kaiser, Ute
2018-05-21
The electron source brightness is an important parameter in an electron microscope. Reliable and easy brightness measurement routes are not easily found. A determination method for the illumination semi-angle distribution in transmission electron microscopy is even less well documented. Herein, we report a simple measurement route for both entities and demonstrate it on a state-of-the-art instrument. The reduced axial brightness of the FEI X-FEG with a monochromator was determined to be larger than 108 A/(m2 sr V).
Hosson, J.Th.M. de; Raedt, H.A. De; Zhong, ZY; Saka, H; Kim, TH; Holm, EA; Han, YF; Xie, XS
2005-01-01
This paper aims at applying advanced transmission electron microscopy (TEM) to functional materials, such as ultra-soft magnetic films for high-frequency inductors, to reveal the structure-property relationship. The ultimate goal is to delineate a more quantitative way to obtain information of the
Transmission electron microscopy of weakly deformed alkali halide crystals
International Nuclear Information System (INIS)
Strunk, H.
1976-01-01
Transmission electron microscopy (TEM) is applied to the investigation of the dislocation arrangement of [001]-orientated alkali halide crystals (orientation four quadruple slip) deformed into stage I of the work-hardenig curve. The investigations pertain mainly to NaCl - (0.1-1) mole-% NaBr crystals, because these exhibit a relatively long stage I. The time available for observing the specimens is limited by the ionization radiation damage occuring in the microscope. An optimum reduction of the damage rate is achieved by a combination of several experimental techniques that are briefly outlined. The crystals deform essentially in single glide. According to the observations, stage I deformation of pure and weakly alloyed NaCl crystals is characterized by the glide of screw dislocations, which bow out between jogs and drag dislocation dipoles behind them. In crystals with >= 0.5 mole-% NaBr this process is not observed to occur. This is attributed to the increased importance of solid solution hardening. (orig.) [de
Origin of spin-dependent asymmetries in electron transmission through ultrathin ferromagnetic films
International Nuclear Information System (INIS)
Gokhale, M.P.; Mills, D.L.
1991-01-01
We present theoretical calculations of exchange asymmetries in the transmission of electrons through ultrathin films of ferromagnetic Fe. The results account nicely for the magnitude of the asymmetries observed by Pappas et al. in photoemission studies of Cu covered by an ultrathin film of Fe. We argue that exchange asymmetry in the transmissivity of the Fe film, rather than the spin dependence of the electron mean free path, is responsible for the effects reported by these authors
International Nuclear Information System (INIS)
Haas, Benedikt; Beyer, Andreas; Witte, Wiebke; Breuer, Tobias; Witte, Gregor; Volz, Kerstin
2011-01-01
The crystalline structure and orientation of perfluoropentacene (C 22 F 14 , PFP) fibers formed upon thin-film deposition onto SiO 2 substrates have been studied by means of transmission electron microscopy (TEM), atomic force microscopy (AFM), and x-ray diffraction. The synopsis of TEM micrographs and diffraction patterns enhances the understanding of local crystal orientation on small length scales. The relationship of the PFP fiber morphology with the crystalline arrangement of PFP molecules within single fibers was established using this technique. Radiation damage, which is a critical problem for TEM investigations of organic materials, is described and the sample morphology after TEM investigations is correlated with AFM measurements of samples previously examined by TEM.
International Nuclear Information System (INIS)
Diociaiuti, Marco
2005-01-01
This paper reports original results obtained in our laboratory over the past few years in the application of both electron energy loss spectroscopy (EELS) and electron spectroscopy imaging (ESI) to biological samples, performed in two transmission electron microscopes (TEM) equipped with high-resolution electron filters and spectrometers: a Gatan model 607 single magnetic sector double focusing EEL serial spectrometer attached to a Philips 430 TEM and a Zeiss EM902 Energy Filtering TEM. The primary interest was on the possibility offered by the combined application of these spectroscopic techniques with those offered by the TEM. In particular, the electron beam focusing available in a TEM allowed us to perform EELS and ESI on very small sample volumes, where high-resolution imaging and electron diffraction techniques can provide important structural information. I show that ESI was able to improve TEM performance, due to the reduced chromatic aberration and the possibility of avoiding the sample staining procedure. Finally, the analysis of the oscillating extended energy loss fine structure (EXELFS) beyond the ionization edges characterizing the EELS spectra allowed me, in a manner very similar to the extended X-ray absorption fine structure (EXAFS) analysis of the X-ray absorption spectra, to obtain short-range structural information for such light elements of biological interest as O or Fe. The Philips EM430 (250-300 keV) TEM was used to perform EELS microanalysis on Ca, P, O, Fe, Al and Si. The assessment of the detection limits of this method was obtained working with well-characterized samples containing Ca and P, and mimicking the actual cellular matrix. I applied EELS microanalysis to Ca detection in bone tissue during the mineralization process and to P detection in the cellular membrane of erythrocytes treated with an anti-tumoral drug, demonstrating that the cellular membrane is a drug target. I applied EELS microanalysis and selected area electron
Self-assembly of silicon nanowires studied by advanced transmission electron microscopy
Directory of Open Access Journals (Sweden)
Marta Agati
2017-02-01
Full Text Available Scanning transmission electron microscopy (STEM was successfully applied to the analysis of silicon nanowires (SiNWs that were self-assembled during an inductively coupled plasma (ICP process. The ICP-synthesized SiNWs were found to present a Si–SiO2 core–shell structure and length varying from ≈100 nm to 2–3 μm. The shorter SiNWs (maximum length ≈300 nm were generally found to possess a nanoparticle at their tip. STEM energy dispersive X-ray (EDX spectroscopy combined with electron tomography performed on these nanostructures revealed that they contain iron, clearly demonstrating that the short ICP-synthesized SiNWs grew via an iron-catalyzed vapor–liquid–solid (VLS mechanism within the plasma reactor. Both the STEM tomography and STEM-EDX analysis contributed to gain further insight into the self-assembly process. In the long-term, this approach might be used to optimize the synthesis of VLS-grown SiNWs via ICP as a competitive technique to the well-established bottom-up approaches used for the production of thin SiNWs.
Robert, Donatien; Douillard, Thierry; Boulineau, Adrien; Brunetti, Guillaume; Nowakowski, Pawel; Venet, Denis; Bayle-Guillemaud, Pascale; Cayron, Cyril
2013-12-23
LiFePO4 and FePO4 phase distributions of entire cross-sectioned electrodes with various Li content are investigated from nanoscale to mesoscale, by transmission electron microscopy and by the new electron forward scattering diffraction technique. The distributions of the fully delithiated (FePO4) or lithiated particles (LiFePO4) are mapped on large fields of view (>100 × 100 μm(2)). Heterogeneities in thin and thick electrodes are highlighted at different scales. At the nanoscale, the statistical analysis of 64 000 particles unambiguously shows that the small particles delithiate first. At the mesoscale, the phase maps reveal a core-shell mechanism at the scale of the agglomerates with a preferential pathway along the electrode porosities. At larger scale, lithiation occurs in thick electrodes "stratum by stratum" from the surface in contact with electrolyte toward the current collector.
Imaging of soft and hard materials using a Boersch phase plate in a transmission electron microscope
Energy Technology Data Exchange (ETDEWEB)
Alloyeau, D., E-mail: alloyeau.damien@gmail.com [National Center for Electron Microscopy, Lawrence Berkeley National Laboratory, One Cyclotron Road, MS/72, Berkeley, CA 94720 (United States); Hsieh, W.K. [National Center for Electron Microscopy, Lawrence Berkeley National Laboratory, One Cyclotron Road, MS/72, Berkeley, CA 94720 (United States); Anderson, E.H.; Hilken, L. [Center for X-ray Optics, Lawrence Berkeley National Laboratory, Berkeley CA 94720 (United States); Benner, G. [Carl Zeiss NTS GmbH, Oberkochen 73447 (Germany); Meng, X. [Electrical Engineering and Computer Sciences, UC Berkeley, Berkeley, CA 94720-1770 (United States); Chen, F.R. [Department of Engineering and System Science, National Tsing Hua University, Hsinchu, Taiwan (China); Kisielowski, C. [National Center for Electron Microscopy, Lawrence Berkeley National Laboratory, One Cyclotron Road, MS/72, Berkeley, CA 94720 (United States)
2010-04-15
Using two levels of electron beam lithography, vapor phase deposition techniques, and FIB etching, we have fabricated an electrostatic Boersch phase plate for contrast enhancement of weak phase objects in a transmission electron microscope. The phase plate has suitable dimensions for the imaging of small biological samples without compromising the high-resolution capabilities of the microscope. A micro-structured electrode allows for phase tuning of the unscattered electron beam, which enables the recording of contrast enhanced in-focus images and in-line holograms. We have demonstrated experimentally that our phase plate improves the contrast of carbon nanotubes while maintaining high-resolution imaging performance, which is demonstrated for the case of an AlGaAs heterostructure. The development opens a new way to study interfaces between soft and hard materials.
Transmission techniques for 4G systems
Da Silva, Mario Marques
2012-01-01
Fourth Generation (4G) wireless communication systems support current and emergent multimedia services such as mobile TV, social networks and gaming, high-definition TV, video teleconferencing, and messaging services. These systems feature the All-over-IP concept and boast improved quality of service. Several important R&D activities are currently under way in the field of wireless communications for 4G systems, but the coverage is widespread in the literature. Transmission Techniques for 4G Systems presents a compilation of the latest developments in the field of wireless communications for 4
Zhu, Yihan
2017-02-21
Metal–organic frameworks (MOFs) are crystalline porous materials with designable topology, porosity and functionality, having promising applications in gas storage and separation, ion conduction and catalysis1, 2, 3. It is challenging to observe MOFs with transmission electron microscopy (TEM) due to the extreme instability of MOFs upon electron beam irradiation4, 5, 6, 7. Here, we use a direct-detection electron-counting camera to acquire TEM images of the MOF ZIF-8 with an ultralow dose of 4.1 electrons per square ångström to retain the structural integrity. The obtained image involves structural information transferred up to 2.1 Å, allowing the resolution of individual atomic columns of Zn and organic linkers in the framework. Furthermore, TEM reveals important local structural features of ZIF-8 crystals that cannot be identified by diffraction techniques, including armchair-type surface terminations and coherent interfaces between assembled crystals. These observations allow us to understand how ZIF-8 crystals self-assemble and the subsequent influence of interfacial cavities on mass transport of guest molecules.
Electron transmission through a periodically driven graphene magnetic barrier
Energy Technology Data Exchange (ETDEWEB)
Biswas, R., E-mail: rbiswas.pkc@gmail.com [Department of Physics, P. K. College, Contai, Purba Medinipur, West Bengal – 721401 (India); Maiti, S. [Ajodhya Hills G.S.A.T High School, Ajodhya, Purulia, West Bengal – 723152 (India); Mukhopadhyay, S. [Purulia Zilla School, Dulmi Nadiha, Purulia, West Bengal – 723102 (India); Sinha, C. [Department of Physics, P. K. College, Contai, Purba Medinipur, West Bengal – 721401 (India); Department of Theoretical Physics, Indian Association for the Cultivation of Science, Jadavpur – 700032 (India)
2017-05-10
Electronic transport through graphene magnetic barriers is studied theoretically in presence of an external time harmonic scalar potential in the framework of non-perturbative Landau–Floquet Formalism. The oscillating field mostly suppresses the transmission for rectangular magnetic barrier structure and exhibits the Fano resonance for multiphoton processes due to the presence of bound state inside the barrier. While, for a pair of delta function barriers of larger separation, the oscillating potential suppresses the usual Fabry–Perot oscillations in the transmission and a new type of asymmetric Fano resonance is noted for smaller separation, occurring due to extended states between the barriers. - Highlights: • Tunnelling of the Dirac Fermions through oscillating pure magnetic barriers is reported for the first time. • The high energy transmission through a graphene magnetic barrier is suppressed by the application of time periodic modulation. • Suppression of the Fabry Perot transmission is noted due to the application of an external time harmonic potential. • Two kinds of the Fano resonances are noted in transmission through a pair of modulated δ-function magnetic barriers.
Multiphoton electronic-spin generation and transmission spectroscopy in n-type GaAs
Energy Technology Data Exchange (ETDEWEB)
Idrish Miah, M., E-mail: m.miah@griffith.edu.a [Department of Physics, University of Chittagong, Chittagong 4331 (Bangladesh)
2011-01-17
Multiphoton electronic-spin generation in semiconductors was investigated using differential transmission spectroscopy. The generation of the electronic spins in the semiconductor samples were achieved by multiphoton pumping with circularly polarized light beam and was probed by the spin-resolved transmission of the samples. The electronic spin-polarization of conduction band was estimated and was found to depend on the delay of the probe beam, temperature as well as on the multiphoton pumping energy. The temperature dependence showed a decrease of the spin-polarization with increasing temperature. The electronic spin-polarization was found to depolarize rapidly for multiphoton pumping energy larger than the energy gap of the split-off band to the conduction band. The results were compared with those obtained in one-photon pumping, which shows that an enhancement of the electronic spin-polarization was achieved in multiphoton pumping. The findings resulting from this investigation might have potential applications in opto-spintronics, where the generation of highly polarized electronic spins is required.
Multiphoton electronic-spin generation and transmission spectroscopy in n-type GaAs
International Nuclear Information System (INIS)
Idrish Miah, M.
2011-01-01
Multiphoton electronic-spin generation in semiconductors was investigated using differential transmission spectroscopy. The generation of the electronic spins in the semiconductor samples were achieved by multiphoton pumping with circularly polarized light beam and was probed by the spin-resolved transmission of the samples. The electronic spin-polarization of conduction band was estimated and was found to depend on the delay of the probe beam, temperature as well as on the multiphoton pumping energy. The temperature dependence showed a decrease of the spin-polarization with increasing temperature. The electronic spin-polarization was found to depolarize rapidly for multiphoton pumping energy larger than the energy gap of the split-off band to the conduction band. The results were compared with those obtained in one-photon pumping, which shows that an enhancement of the electronic spin-polarization was achieved in multiphoton pumping. The findings resulting from this investigation might have potential applications in opto-spintronics, where the generation of highly polarized electronic spins is required.
Directory of Open Access Journals (Sweden)
Annette Meister
2017-10-01
Full Text Available Lipid membranes can incorporate amphiphilic or polyphilic molecules leading to specific functionalities and to adaptable properties of the lipid bilayer host. The insertion of guest molecules into membranes frequently induces changes in the shape of the lipid matrix that can be visualized by transmission electron microscopy (TEM techniques. Here, we review the use of stained and vitrified specimens in (cryoTEM to characterize the morphology of amphiphilic and polyphilic molecules upon insertion into phospholipid model membranes. Special emphasis is placed on the impact of novel synthetic amphiphilic and polyphilic bolalipids and polymers on membrane integrity and shape stability.
Foucault imaging by using non-dedicated transmission electron microscope
International Nuclear Information System (INIS)
Taniguchi, Yoshifumi; Matsumoto, Hiroaki; Harada, Ken
2012-01-01
An electron optical system for observing Foucault images was constructed using a conventional transmission electron microscope without any special equipment for Lorentz microscopy. The objective lens was switched off and an electron beam was converged by a condenser optical system to the crossover on the selected area aperture plane. The selected area aperture was used as an objective aperture to select the deflected beam for Foucault mode, and the successive image-forming lenses were controlled for observation of the specimen images. The irradiation area on the specimen was controlled by selecting the appropriate diameter of the condenser aperture.
Foucault imaging by using non-dedicated transmission electron microscope
Taniguchi, Yoshifumi; Matsumoto, Hiroaki; Harada, Ken
2012-08-01
An electron optical system for observing Foucault images was constructed using a conventional transmission electron microscope without any special equipment for Lorentz microscopy. The objective lens was switched off and an electron beam was converged by a condenser optical system to the crossover on the selected area aperture plane. The selected area aperture was used as an objective aperture to select the deflected beam for Foucault mode, and the successive image-forming lenses were controlled for observation of the specimen images. The irradiation area on the specimen was controlled by selecting the appropriate diameter of the condenser aperture.
Foucault imaging by using non-dedicated transmission electron microscope
Energy Technology Data Exchange (ETDEWEB)
Taniguchi, Yoshifumi [Science and Medical Systems Business Group, Hitachi High-Technologies Corp., Ichige, Hitachinaka, Ibaraki 312-8504 (Japan); Matsumoto, Hiroaki [Corporate Manufacturing Strategy Group, Hitachi High-Technologies Corp., Ishikawa-cho, Hitachinaka, Ibaraki 312-1991 (Japan); Harada, Ken [Central Research Laboratory, Hitachi Ltd., Hatoyama, Saitama 350-0395 (Japan)
2012-08-27
An electron optical system for observing Foucault images was constructed using a conventional transmission electron microscope without any special equipment for Lorentz microscopy. The objective lens was switched off and an electron beam was converged by a condenser optical system to the crossover on the selected area aperture plane. The selected area aperture was used as an objective aperture to select the deflected beam for Foucault mode, and the successive image-forming lenses were controlled for observation of the specimen images. The irradiation area on the specimen was controlled by selecting the appropriate diameter of the condenser aperture.
Kumar, Vineet
2011-12-01
The grain size statistics, commonly derived from the grain map of a material sample, are important microstructure characteristics that greatly influence its properties. The grain map for nanomaterials is usually obtained manually by visual inspection of the transmission electron microscope (TEM) micrographs because automated methods do not perform satisfactorily. While the visual inspection method provides reliable results, it is a labor intensive process and is often prone to human errors. In this article, an automated grain mapping method is developed using TEM diffraction patterns. The presented method uses wide angle convergent beam diffraction in the TEM. The automated technique was applied on a platinum thin film sample to obtain the grain map and subsequently derive grain size statistics from it. The grain size statistics obtained with the automated method were found in good agreement with the visual inspection method.
Energy Technology Data Exchange (ETDEWEB)
Mohebbi, Razie; Seyed-Yazdi, Jamileh, E-mail: j.seyedyazdi@vru.ac.ir
2016-06-01
In this paper we have investigated the electronic transmission of systems electrode–benzene–electrode using the Landauer approach. The effect of different electrodes made of metal (Au) and semiconductors (Si, TiO{sub 2}) is investigated. These three electrodes are compared between them and the results show that the electronic transmission of benzene junctions, when using semiconductor electrodes, is associated to a gap in transmission which is due to the electrodes band gap. As a consequence, a threshold voltage is necessary to obtain conducting channels.
Energy Technology Data Exchange (ETDEWEB)
Johnson, Jared M.; Im, Soohyun; Windl, Wolfgang; Hwang, Jinwoo, E-mail: hwang.458@osu.edu
2017-01-15
We propose a new scanning transmission electron microscopy (STEM) technique that can realize the three-dimensional (3D) characterization of vacancies, lighter and heavier dopants with high precision. Using multislice STEM imaging and diffraction simulations of β-Ga{sub 2}O{sub 3} and SrTiO{sub 3}, we show that selecting a small range of low scattering angles can make the contrast of the defect-containing atomic columns substantially more depth-dependent. The origin of the depth-dependence is the de-channeling of electrons due to the existence of a point defect in the atomic column, which creates extra “ripples” at low scattering angles. The highest contrast of the point defect can be achieved when the de-channeling signal is captured using the 20–40 mrad detection angle range. The effect of sample thickness, crystal orientation, local strain, probe convergence angle, and experimental uncertainty to the depth-dependent contrast of the point defect will also be discussed. The proposed technique therefore opens new possibilities for highly precise 3D structural characterization of individual point defects in functional materials. - Highlights: • A new electron microscopy technique that can visualize 3D position of point defect is proposed. • The technique relies on the electron de-channeling signals at low scattering angles. • The technique enables precise determination of the depth of vacancies and lighter impurity atoms.
Aberration-corrected scanning transmission electron microscopy of semiconductors
International Nuclear Information System (INIS)
Krivanek, O L; Dellby, N; Murfitt, M F
2011-01-01
The scanning transmission electron microscope (STEM) has been able to image individual heavy atoms in a light matrix for some time. It is now able to do much more: it can resolve individual atoms as light as boron in monolayer materials; image atomic columns as light as hydrogen, identify the chemical type of individual isolated atoms from the intensity of their annular dark field (ADF) image and by electron energy loss spectroscopy (EELS); and map elemental composition at atomic resolution by EELS and energy-dispersive X-ray spectroscopy (EDXS). It can even map electronic states, also by EELS, at atomic resolution. The instrumentation developments that have made this level of performance possible are reviewed, and examples of applications to semiconductors and oxides are shown.
Directory of Open Access Journals (Sweden)
Alireza B. Parsa
2016-10-01
Full Text Available In this work, the microstructures of superalloy specimens produced using selective electron beam melting additive manufacturing were characterized. The materials were produced using a CMSX-4 powder. Two selective electron beam melting processing strategies, which result in higher and lower effective cooling rates, are described. Orientation imaging microscopy, scanning transmission electron microscopy and conventional high resolution transmission electron microscopy are used to investigate the microstructures. Our results suggest that selective electron beam melting processing results in near equilibrium microstructures, as far as γ′ volume fractions, the formation of small amounts of TCP phases and the partitioning behavior of the alloy elements are concerned. As expected, higher cooling rates result in smaller dendrite spacings, which are two orders of magnitude smaller than observed during conventional single crystal casting. During processing, columnar grains grow in <100> directions, which are rotated with respect to each other. There are coarse γ/γ′ microstructures in high angle boundary regions. Dislocation networks form low angle boundaries. A striking feature of the as processed selective electron beam melting specimens is their high dislocation density. From a fundamental point of view, this opens new possibilities for the investigation of elementary dislocation processes which accompany solidification.
Ultra-precise measurement of optical aberrations for sub-Aangstroem transmission electron microscopy
Energy Technology Data Exchange (ETDEWEB)
Barthel, J.
2008-06-15
Quantitative investigations of material structures on an atomic scale by means of highresolution transmission electron microscopy (HRTEM) impose not only extreme demands on the mechanic and electromagnetic stability of the applied instruments but require also their precise electron-optical adjustment. Today a physical resolution well below one Aangstroem can be achieved with commercially available microscopes on a daily basis. However, the achieved resolution can often not be reliably exploited for the interpretation of the resulting microscopical data due to the presence of so-called higher-order lens aberrations. At the starting time of this work, a sufficiently accurate procedure to measure higher-order aberrations was urgently missing. Since aberration measurement is a mandatory prerequisite for any technique of aberration control enabling quantitative high-resolution microscopy, the goal of this work is to develop such a measurement procedure for the Sub-Aangstroem regime. The measurement procedures developed in the course of this work are based on the numerical evaluation of a series of images taken from an amorphous object under electron-beam illumination with varying tilt. New techniques have been developed for the evaluation of single images as well as for the optimised evaluation of the whole series. These procedures allow microscope users to perform quantitative HRTEM even at a resolution of 0.5 Aangstroem. The precision reached with the newly developed measurement procedures is unprecedented and surpasses existing solutions by at least one order of magnitude in any respect. All the concepts and procedures for aberration measurement developed in this work have been implemented in a software package which satisfies professional demands with respect to robustness, precision, speed and user-friendliness. The new automatic aberrationmeasurement procedures are suitable to establish HRTEM as a quantitative technique for material science investigations in the
Ultra-precise measurement of optical aberrations for sub-Aangstroem transmission electron microscopy
International Nuclear Information System (INIS)
Barthel, J.
2008-06-01
Quantitative investigations of material structures on an atomic scale by means of highresolution transmission electron microscopy (HRTEM) impose not only extreme demands on the mechanic and electromagnetic stability of the applied instruments but require also their precise electron-optical adjustment. Today a physical resolution well below one Aangstroem can be achieved with commercially available microscopes on a daily basis. However, the achieved resolution can often not be reliably exploited for the interpretation of the resulting microscopical data due to the presence of so-called higher-order lens aberrations. At the starting time of this work, a sufficiently accurate procedure to measure higher-order aberrations was urgently missing. Since aberration measurement is a mandatory prerequisite for any technique of aberration control enabling quantitative high-resolution microscopy, the goal of this work is to develop such a measurement procedure for the Sub-Aangstroem regime. The measurement procedures developed in the course of this work are based on the numerical evaluation of a series of images taken from an amorphous object under electron-beam illumination with varying tilt. New techniques have been developed for the evaluation of single images as well as for the optimised evaluation of the whole series. These procedures allow microscope users to perform quantitative HRTEM even at a resolution of 0.5 Aangstroem. The precision reached with the newly developed measurement procedures is unprecedented and surpasses existing solutions by at least one order of magnitude in any respect. All the concepts and procedures for aberration measurement developed in this work have been implemented in a software package which satisfies professional demands with respect to robustness, precision, speed and user-friendliness. The new automatic aberrationmeasurement procedures are suitable to establish HRTEM as a quantitative technique for material science investigations in the
Directory of Open Access Journals (Sweden)
Mark H Rummeli
2018-05-01
Full Text Available The excitement of graphene (as well as 2D materials in general has generated numerous procedures for the fabrication of graphene. Here we present a mini-review on a rather less known, but attractive, in situ means to fabricate graphene inside a transmission electron microscope (TEM. This is achieved in a conventional TEM (viz. no sophisticated specimen holders or microscopes are required and takes advantage of inherent hydrocarbon contamination as a carbon source. Both catalyst free and single atom catalyst approaches are reviewed. An advantage of this technique is that not only can the growth process be imaged in situ, but this can also be achieved with atomic resolution. Moreover, in the future, one can anticipate such approaches enabling the growth of nano-materials with atomic precision.
Transmission electron microscopy physics of image formation and microanalysis
Reimer, Ludwig
1984-01-01
The aim of this book is to outline the physics of image formation, electron specimen interactions and image interpretation in transmission electron mic roscopy. The book evolved from lectures delivered at the University of Munster and is a revised version of the first part of my earlier book Elek tronenmikroskopische Untersuchungs- und Priiparationsmethoden, omitting the part which describes specimen-preparation methods. In the introductory chapter, the different types of electron microscope are compared, the various electron-specimen interactions and their applications are summarized and the most important aspects of high-resolution, analytical and high-voltage electron microscopy are discussed. The optics of electron lenses is discussed in Chapter 2 in order to bring out electron-lens properties that are important for an understanding of the function of an electron microscope. In Chapter 3, the wave optics of elec trons and the phase shifts by electrostatic and magnetic fields are introduced; Fresne...
Brodusch, Nicolas; Demers, Hendrix; Trudeau, Michel; Gauvin, Raynald
2013-01-01
Transmission electron forward scatter diffraction (t-EFSD) is a new technique providing crystallographic information with high resolution on thin specimens by using a conventional electron backscatter diffraction (EBSD) system in a scanning electron microscope. In this study, the impact of tilt angle, working distance, and detector distance on the Kikuchi pattern quality were investigated in a cold-field emission scanning electron microscope (CFE-SEM). We demonstrated that t-EFSD is applicable for tilt angles ranging from -20° to -40°. Working distance (WD) should be optimized for each material by choosing the WD for which the EBSD camera screen illumination is the highest, as the number of detected electrons on the screen is directly dependent on the scattering angle. To take advantage of the best performances of the CFE-SEM, the EBSD camera should be close to the sample and oriented towards the bottom to increase forward scattered electron collection efficiency. However, specimen chamber cluttering and beam/mechanical drift are important limitations in the CFE-SEM used in this work. Finally, the importance of t-EFSD in materials science characterization was illustrated through three examples of phase identification and orientation mapping. © Wiley Periodicals, Inc.
International Nuclear Information System (INIS)
Liu, Z.Q.; Mitsuishi, K.; Furuya, K.
2005-01-01
Attempts were made to fabricate three-dimensional nanostructures on and out of a substrate by electron-beam-induced deposition in a 200-kV scanning transmission electron microscope. Structures with parallel wires over the substrate surface were difficult to fabricate due to the direct deposition of wires on both top and bottom surfaces of the substrate. Within the penetration depth of the incident electron beam, nanotweezers were fabricated by moving the electron beam beyond different substrate layers. Combining the deposition of self-supporting wires and self-standing tips, complicated three-dimensional doll-like, flag-like, and gate-like nanostructures that extend out of the substrate were successfully fabricated with one-step or multi-step scans of the electron beam. Effects of coarsening, nucleation, and distortion during electron-beam-induced deposition are discussed. (orig.)
International Nuclear Information System (INIS)
Radhakrishnan, A.N.; Prabhakar Rao, P.; Sibi, K.S.; Deepa, M.; Koshy, Peter
2009-01-01
Order-disorder transformations in a quaternary pyrochlore oxide system, Ca-Y-Zr-Ta-O, were studied by powder X-ray diffraction (XRD) method, transmission electron microscope (TEM) and FT-NIR Raman spectroscopic techniques. The solid solutions in different ratios, 4:1, 2:1, 1:1, 1:2, 1:4, 1:6, of CaTaO 3.5 and YZrO 3.5 were prepared by the conventional high temperature ceramic route. The XRD results and Rietveld analysis revealed that the crystal structure changed from an ordered pyrochlore structure to a disordered defect fluorite structure as the ratios of the solid solutions of CaTaO 3.5 and YZrO 3.5 were changed from 4:1 to 1:4. This structural transformation in the present system is attributed to the lowering of the average cation radius ratio, r A /r B as a result of progressive and simultaneous substitution of larger cation Ca 2+ for Y 3+ at A sites and smaller cation Ta 5+ for Zr 4+ at B sites. Raman spectroscopy and TEM analysis corroborated the XRD results. - Graphical abstract: Selected area electron diffraction (SAED) patterns showed highly ordered diffraction maxima with characteristic superlattice weak diffraction spots of the pyrochlore structure for (a) Ca 0.6 7Y 1.33 Zr 1.33 Ta 0.33 O 7 (C2YZT2) and bright diffraction maxima arranged in a ring pattern of the fluorite structure for (b) Ca 0.29 7Y 1.71 Zr 1.71 Ta 0.29 O 7 (CY6Z6T).
Design of electron wave filters in monolayer graphene by tunable transmission gap
Chen, Xi; Tao, Jia-Wei
2009-01-01
We have investigated the transmission in monolayer graphene barrier at nonzero angle of incidence. Taking the influence of parallel wave vector into account, the transmission as the function of incidence energy has a gap due to the evanescent waves in two cases of Klein tunneling and classical motion. The modulation of the transmission gap by the incidence angle, the height, and width of potential barrier may lead to potential applications in graphene-based electronic devices.
A Monte Carlo investigation of contaminant electrons due to a novel in vivo transmission detector
International Nuclear Information System (INIS)
Asuni, G; Jensen, J M; McCurdy, B M C
2011-01-01
A novel transmission detector (IBA Dosimetry, Germany) developed as an IMRT quality assurance tool, intended for in vivo patient dose measurements, is studied here. The goal of this investigation is to use Monte Carlo techniques to characterize treatment beam parameters in the presence of the detector and to compare to those of a plastic block tray (a frequently used clinical device). Particular attention is paid to the impact of the detector on electron contamination model parameters of two commercial dose calculation algorithms. The linac head together with the COMPASS transmission detector (TRD) was modeled using BEAMnrc code. To understand the effect of the TRD on treatment beams, the contaminant electron fluence, energy spectra, and angular distributions at different SSDs were analyzed for open and non-open (i.e. TRD and block tray) fields. Contaminant electrons in the BEAMnrc simulations were separated according to where they were created. Calculation of surface dose and the evaluation of contributions from contaminant electrons were performed using the DOSXYZnrc user code. The effect of the TRD on contaminant electrons model parameters in Eclipse AAA and Pinnacle 3 dose calculation algorithms was investigated. Comparisons of the fluence of contaminant electrons produced in the non-open fields versus open field show that electrons created in the non-open fields increase at shorter SSD, but most of the electrons at shorter SSD are of low energy with large angular spread. These electrons are out-scattered or absorbed in air and contribute less to surface dose at larger SSD. Calculated surface doses with the block tray are higher than those with the TRD. Contribution of contaminant electrons to dose in the buildup region increases with increasing field size. The additional contribution of electrons to surface dose increases with field size for TRD and block tray. The introduction of the TRD results in a 12% and 15% increase in the Gaussian widths used in the
In situ Transmission Electron Microscopy of catalyst sintering
DEFF Research Database (Denmark)
DeLaRiva, Andrew T.; Hansen, Thomas Willum; Challa, Sivakumar R.
2013-01-01
Recent advancements in the field of electron microscopy, such as aberration correctors, have now been integrated into Environmental Transmission Electron Microscopes (TEMs), making it possible to study the behavior of supported metal catalysts under operating conditions at atomic resolution. Here......, we focus on in situ electron microscopy studies of catalysts that shed light on the mechanistic aspects of catalyst sintering. Catalyst sintering is an important mechanism for activity loss, especially for catalysts that operate at elevated temperatures. Literature from the past decade is reviewed...... along with our recent in situ TEM studies on the sintering of Ni/MgAl2O4 catalysts. These results suggest that the rapid loss of catalyst activity in the earliest stages of catalyst sintering could result from Ostwald ripening rather than through particle migration and coalescence. The smallest...
International Nuclear Information System (INIS)
Borsheim, K.Y.; Bratbak, G.; Heldal, M.
1990-01-01
Bacteria and virus particles were harvested from water samples by ultracentrifugation directly onto Formvar-coated electron microscopy grids and counted in a transmission electron microscope. With this technique, we have counted and sized bacteria and viruses in marine water samples and during laboratory incubations. By X-ray microanalysis, we could determine the elemental composition and dry-matter content of individual bacteria. The dry weight/volume ratio for the bacteria was 600 fg of dry weight microns-3. The potassium content of the bacteria was normal compared with previous estimates from other bacterial assemblages; thus, this harvesting procedure did not disrupt the bacterial cells. Virus particles were, by an order of magnitude, more abundant than bacteria in marine coastal waters. During the first 5 to 7 days of incubation, the total number of viruses increased exponentially at a rate of 0.4 day-1 and thereafter declined. The high proliferation rate suggests that viral parasitism may affect mortality of bacteria in aquatic environments
International Nuclear Information System (INIS)
Ullmann, P.
2007-06-01
The primary objective of this work was the first experimental realization of parallel RF transmission for accelerating spatially selective excitation in magnetic resonance imaging. Furthermore, basic aspects regarding the performance of this technique were investigated, potential risks regarding the specific absorption rate (SAR) were considered and feasibility studies under application-oriented conditions as first steps towards a practical utilisation of this technique were undertaken. At first, based on the RF electronics platform of the Bruker Avance MRI systems, the technical foundations were laid to perform simultaneous transmission of individual RF waveforms on different RF channels. Another essential requirement for the realization of Parallel Excitation (PEX) was the design and construction of suitable RF transmit arrays with elements driven by separate transmit channels. In order to image the PEX results two imaging methods were implemented based on a spin-echo and a gradient-echo sequence, in which a parallel spatially selective pulse was included as an excitation pulse. In the course of this work PEX experiments were successfully performed on three different MRI systems, a 4.7 T and a 9.4 T animal system and a 3 T human scanner, using 5 different RF coil setups in total. In the last part of this work investigations regarding possible applications of Parallel Excitation were performed. A first study comprised experiments of slice-selective B1 inhomogeneity correction by using 3D-selective Parallel Excitation. The investigations were performed in a phantom as well as in a rat fixed in paraformaldehyde solution. In conjunction with these experiments a novel method of calculating RF pulses for spatially selective excitation based on a so-called Direct Calibration approach was developed, which is particularly suitable for this type of experiments. In the context of these experiments it was demonstrated how to combine the advantages of parallel transmission
International Nuclear Information System (INIS)
Engel, A.; Christen, F.; Michel, B.
1981-01-01
A digital acquisition system that collects multichannel information from a scanning transmission electron microscope (STEM) and its application are described. The hardware comprises (i) single electron counting detectors, (ii) a digital scan generator, (iii) a digital multi-channel on-line processor, (iv) an interface to a minicomputer, and (v) a display system. Experimental results characterizing these components are presented, and their performance is discussed. The software includes assembler coded programs for dynamic file maintenance and fast acquisition of image data, a display driver, and FORTRAN coded application programs. The usefulness of digitized STEM is illustrated by a variety of biological applications. (orig.)
Applications of transmission electron microscopy in the materials and mineral sciences
International Nuclear Information System (INIS)
Murr, L.E.
1975-01-01
Unique capabilities of transmission electron microscopy in characterizing the structure and properties of metals, minerals, and other crystaline materials are illustrated and compared with observations in the scanning electron and field-ion microscopes. Contrast mechanisms involving both mass-thickness and diffraction processes are illustrated, and examples presented of applications of bright and dark-field techiques. Applications of the electron microscope in the investigation of metallurgical and mineralogical problems are outlined with representative examples [pt
Three-Dimensional scanning transmission electron microscopy of biological specimens
De Jonge, Niels
2010-01-18
A three-dimensional (3D) reconstruction of the cytoskeleton and a clathrin-coated pit in mammalian cells has been achieved from a focal-series of images recorded in an aberration-corrected scanning transmission electron microscope (STEM). The specimen was a metallic replica of the biological structure comprising Pt nanoparticles 2-3 nm in diameter, with a high stability under electron beam radiation. The 3D dataset was processed by an automated deconvolution procedure. The lateral resolution was 1.1 nm, set by pixel size. Particles differing by only 10 nm in vertical position were identified as separate objects with greater than 20% dip in contrast between them. We refer to this value as the axial resolution of the deconvolution or reconstruction, the ability to recognize two objects, which were unresolved in the original dataset. The resolution of the reconstruction is comparable to that achieved by tilt-series transmission electron microscopy. However, the focal-series method does not require mechanical tilting and is therefore much faster. 3D STEM images were also recorded of the Golgi ribbon in conventional thin sections containing 3T3 cells with a comparable axial resolution in the deconvolved dataset. © 2010 Microscopy Society of America.
Bäcke, Olof; Lindqvist, Camilla; de Zerio Mendaza, Amaia Diaz; Gustafsson, Stefan; Wang, Ergang; Andersson, Mats R; Müller, Christian; Kristiansen, Per Magnus; Olsson, Eva
2017-05-01
We show by in situ microscopy that the effects of electron beam irradiation during transmission electron microscopy can be used to lock microstructural features and enhance the structural thermal stability of a nanostructured polymer:fullerene blend. Polymer:fullerene bulk-heterojunction thin films show great promise for use as active layers in organic solar cells but their low thermal stability is a hindrance. Lack of thermal stability complicates manufacturing and influences the lifetime of devices. To investigate how electron irradiation affects the thermal stability of polymer:fullerene films, a model bulk-heterojunction film based on a thiophene-quinoxaline copolymer and a fullerene derivative was heat-treated in-situ in a transmission electron microscope. In areas of the film that exposed to the electron beam the nanostructure of the film remained stable, while the nanostructure in areas not exposed to the electron beam underwent large phase separation and nucleation of fullerene crystals. UV-vis spectroscopy shows that the polymer:fullerene films are stable for electron doses up to 2000kGy. Copyright © 2016 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Łęczycki Krzysztof
2017-08-01
Full Text Available Firing from gun armament generates a wide range of physico-chemical phenomena contributing to the degradation of barrel material, e.g. pressure, high temperature, chemically aggressive character of post-detonation gases and friction of a driving band. In this work the technique of thin foils was used in Transmission Electron Microscopy (TEM to study the influence of physicochemical phenomena on the material microstructure of aircraft gun barrel. A mechanism and reason of premature wear-out of the barrel under consideration was also outlined by utilising light microscopy and hardness measurements.
Optimization of Beam Transmission of PAL-PNF Electron Linac
Energy Technology Data Exchange (ETDEWEB)
Shin, S. G.; Kim, S. K.; Kim, E. A. [Pohang University of Science and Technology, Pohang (Korea, Republic of)
2012-05-15
The PNF (Pohang Neutron Facility) electron Linac is providing converted neutrons and photons from electron beams to users for nuclear physics experiments and high energy gamma-ray exposures. This linac is capable of producing 100 MeV electron beams with a beam current of pulsed 100 mA. The pulse length is 2 {mu}s and the pulse repetition rate is typically 30 Hz. This linac consists of two SLAC-type S-band accelerating columns and the thermionic RF gun. They are powered by one klystron and the matching pulse modulator. The electron beams emitted from the RF gun are bunched as they pass through the alpha magnet and are injected into the accelerating column thereafter. In this paper, we discuss procedures and results of the beam transmission optimization with technical details of the accelerator system. We also briefly discuss the future upgrade plan to obtain short-pulse or electron beams for neutron TOF experiments by adopting a triode type thermionic DC electron gun
International Nuclear Information System (INIS)
Michelot, Y.
1995-10-01
Fast electrons are one of the basic ingredients of plasma operations in many existing thermonuclear fusion research devices. However, the understanding of fast electrons dynamics during creation and sustainment of the superthermal electrons tail is far for being satisfactory. For this reason, the Electron Cyclotron Transmission (ECT) diagnostic was implemented on Tore Supra tokamak. It consists on a microwave transmission system installed on a vertical chord crossing the plasma center and working in the frequency range 77-109 GHz. Variations of the wave amplitude during the propagation across the plasma may be due to refraction and resonant absorption. For the ECT, the most common manifestation of refraction is a reduction of the received power density with respect to the signal detected in vacuum, due to the spreading and deflection of the wave beam. Wave absorption is observed in the vicinity of the electron cyclotron harmonics and may be due both to thermal plasma and to superthermal electron tails. It has a characteristic frequency dependence due to the relativistic mass variation in the wave-electron resonance condition. This thesis presents the first measurements of: the extraordinary mode optical depth at the third harmonics, the electron temperature from the width of a cyclotron absorption line and the relaxation times of the electron distribution during lower hybrid current drive from the ordinary mode spectral superthermal absorption line at the first harmonic. (J.S.). 175 refs., 110 figs., 9 tabs., 3 annexes
Direct observations of the MOF (UiO-66) structure by transmission electron microscopy
Zhu, Liangkui; Zhang, Daliang; Xue, Ming; Li, Huan; Qiu, Shilun
2013-01-01
As a demonstration of ab initio structure characterizations of nano metal organic framework (MOF) crystals by high resolution transmission electron microscopy (HRTEM) and electron diffraction tomography methods, a Zr-MOF (UiO-66) structure
Study of the niobium dehydrogenation process by transmission electron microscopy
International Nuclear Information System (INIS)
Bulhoes, I.A.M.; Akune, K.
1983-01-01
The evolution of the micro-structure of Nb-H, during the dehydrogenation process through thermal treatment, has been studied by Transmission Electron Microscopy. The results are used in order to interpret the variation of the line resolution of Electron Channeling Pattern (ECP) of Nb-H as a function of isochronous annealing temperature. It is concluded that the improvement of the ECP line resolution is enhanced of β hydrate in Nb. (Author) [pt
Hirata, Kei; Ishida, Yoichi; Akashi, Tetsuya; Shindo, Daisuke; Tonomura, Akira
2012-01-01
The magnetic domain structure of the writer poles of perpendicular magnetic recording heads was studied using electron holography. Although the domain structure of a 100-nm-thick writer pole could be observed with a 300 kV transmission electron microscope, that of the 250-nm-thick writer pole could not be analyzed due to the limited transmission capability of the instrument. On the other hand, the detailed domain structure of the 250-nm-thick writer pole was successfully analyzed by a 1 MV electron microscope using its high transmission capability. The thickness and material dependency of the domain structure of a writer pole were discussed.
International Nuclear Information System (INIS)
Dörfel, Ilona; Rooch, Heidemarie; Österle, Werner
2012-01-01
The microstructures of two samples of a Zr(C,N) coating on steel, which unexpectedly differed in their tribological properties, were investigated by analytical transmission electron microscopy. The samples were produced by a cathodic arc evaporation process in two commercial coating devices under similar coating conditions with the exception of the number of Zr targets. The source of the differing tribological properties of the samples was detected by analytical transmission electron microscopy (TEM) methods energy-dispersive X-ray spectroscopy (EDX), energy filtering TEM (EFTEM), electron diffraction, high resolution electron microscopy, and high angel annular dark field. The TEM preparation and the results of the TEM investigations are shown in detail. The origin of the unexpected behavior was determined to be a nano-scale multilayer structure that existed only in the tribologically superior specimen. EDX and EFTEM investigations indicated enrichment in oxygen at the interface between coating and steel substrate in the tribologically inferior sample. Findings of the microstructural configuration were obtained by taking a closer look at the structure and comparing the results of the several analytical TEM techniques. This allows the allocation of the concentration fluctuations in N, C, and Zr to the two thickness fractions of the nano multilayers and a local correlation of the identified minority phase Zr 3 (C,N) 4 to the higher N content in the narrower type of the multilayer fraction of the sample with the excellent tribological properties. The minority phase Zr 3 (C,N) 4 is randomly distributed in the sample with the defective tribological properties. Coating conditions are not topic of this work, but after discussion of the TEM results, the fact that one of the coating devices worked with one Zr target and the other one with two, could be identified as cause for the formation of the nano multilayer structure in the sample with the superior tribological
Electronic Creativity Techniques for Organizational Innovation.
Siau, Keng L.
1996-01-01
Discusses using advanced electronic and communication technology to improve organizational innovation. Group creativity techniques, such as electronic brainstorming, PMI (a brainstorming approach involving plus, minus, and interesting points), synectics, and their verbal counterparts are compared. Electronic PMI and synectics are found to be…
Li, C W; Han, L Z; Luo, X M; Liu, Q D; Gu, J F
2016-11-01
Transmission electron forward scatter diffraction and other characterization techniques were used to investigate the fine structure and the variant relationship of the martensite/austenite (M/A) constituent of the granular bainite in low-carbon low-alloy steel. The results demonstrated that the M/A constituents were distributed in clusters throughout the bainitic ferrite. Lath martensite was the main component of the M/A constituent, where the relationship between the martensite variants was consistent with the Nishiyama-Wassermann orientation relationship and only three variants were found in the M/A constituent, suggesting that the variants had formed in the M/A constituent according to a specific mechanism. Furthermore, the Σ3 boundaries in the M/A constituent were much longer than their counterparts in the bainitic ferrite region. The results indicate that transmission electron forward scatter diffraction is an effective method of crystallographic analysis for nanolaths in M/A constituents. © 2016 The Authors Journal of Microscopy © 2016 Royal Microscopical Society.
Mineralogical applications of electron diffraction. 1. Theory and techniques
Ross, Malcolm; Christ, C.L.
1958-01-01
The small wavelengths used in electron-diffraction experiments and the thinness of the crystals necessary for the transmission of the electron beam combine to require a somewhat different diffraction geometry for the interpretation of electron-diffraction patterns than is used in the interpretation of X-ray diffraction patterns. This geometry, based on the reciprocal lattice concept and geometrical construction of Ewald, needed for the interpretation.
Anatomy-based transmission factors for technique optimization in portable chest x-ray
Liptak, Christopher L.; Tovey, Deborah; Segars, William P.; Dong, Frank D.; Li, Xiang
2015-03-01
Portable x-ray examinations often account for a large percentage of all radiographic examinations. Currently, portable examinations do not employ automatic exposure control (AEC). To aid in the design of a size-specific technique chart, acrylic slabs of various thicknesses are often used to estimate x-ray transmission for patients of various body thicknesses. This approach, while simple, does not account for patient anatomy, tissue heterogeneity, and the attenuation properties of the human body. To better account for these factors, in this work, we determined x-ray transmission factors using computational patient models that are anatomically realistic. A Monte Carlo program was developed to model a portable x-ray system. Detailed modeling was done of the x-ray spectrum, detector positioning, collimation, and source-to-detector distance. Simulations were performed using 18 computational patient models from the extended cardiac-torso (XCAT) family (9 males, 9 females; age range: 2-58 years; weight range: 12-117 kg). The ratio of air kerma at the detector with and without a patient model was calculated as the transmission factor. Our study showed that the transmission factor decreased exponentially with increasing patient thickness. For the range of patient thicknesses examined (12-28 cm), the transmission factor ranged from approximately 21% to 1.9% when the air kerma used in the calculation represented an average over the entire imaging field of view. The transmission factor ranged from approximately 21% to 3.6% when the air kerma used in the calculation represented the average signals from two discrete AEC cells behind the lung fields. These exponential relationships may be used to optimize imaging techniques for patients of various body thicknesses to aid in the design of clinical technique charts.
Ion source for thinning of specimen in transmission electron microscopy
International Nuclear Information System (INIS)
Hammer, K.; Rothe, R.
1983-01-01
Thinning of specimen for transmission electron microscopy is carried out by means of sputtering. Construction, design, and operation parameters of an ion source are presented. Because the plasma is produced by means of hollow cathode glow discharges, no special focusing system is used
International Nuclear Information System (INIS)
Moreira, Anderson Camargo
2006-01-01
This work presents the application of the X-ray microtomography and gamma ray transmission techniques for the microstructure characterization of different kinds of materials. Total porosity, pore size distribution and the two point correlation functions were measured. The two point correlation function, which allows the reconstruction of 3D models, was carried out for two samples. Seven ceramic tablets of Alumina (Al 2 O 3 ), seven tablets of Boron Carbide (B 4 C), three samples of sedimentary rocks and one sample of Titanium foam were analyzed. The experimental set up for the Gamma Ray Transmission technique consisted of: a 2'' x 2'' crystal NaI(Tl) detector, an 241 Am radioactive source (59,53 keV, 100 mCi), an automatic micrometric table for the sample XZ movement and standard gamma spectrometry electronics. Two microtomography systems were used: a Fein Focus system, constituted by an X-ray tube, operated at 160 kV and 0.3 to 1.1 mA, a CCD camera and the movement sample system, and a Skyscan system, model 1072, with a X-ray tube operated at 100 kV and 100μA, and a CCD camera. The ceramic tablets, analyzed by the gamma ray transmission technique presented results for most of the porosities data with smaller confidence intervals and inside the intervals supplied by the tablets manufacturer. The Titanium porous sample was analyzed by the two techniques, its microtomography images achieved a resolution of 17μm, obtained employing the Fein Focus system. For both techniques, this sample showed high porosity, which allows its application for this purpose. The sandstones samples were analyzed by the Skyscan system, achieving resolutions of 19μm, 11μm and 3.8μm for each sample, respectively. The resolutions of 11μm and 3.8μm were the ones that generated better 2D sections for the respective samples and, consequently, more reliable porosities. The 3.8μm resolution was the one that best quantified the pore size distribution data, showing information not shown by
Transmission electron microscopy study of unhydrided,dehydrided and annealed LaNi5
Veirman, de A.E.M.; Staals, A.A.; Notten, P.H.L.
1994-01-01
The influence of hydrogen absorption on the microstructure of LaNi5 powders has been investigated by transmission electron microscopy. At the surface of the unhydrided and dehydrided LaNi5 grains a reaction layer is observed. By means of selected area electron diffraction this layer is found to
Security Techniques for the Electronic Health Records.
Kruse, Clemens Scott; Smith, Brenna; Vanderlinden, Hannah; Nealand, Alexandra
2017-08-01
The privacy of patients and the security of their information is the most imperative barrier to entry when considering the adoption of electronic health records in the healthcare industry. Considering current legal regulations, this review seeks to analyze and discuss prominent security techniques for healthcare organizations seeking to adopt a secure electronic health records system. Additionally, the researchers sought to establish a foundation for further research for security in the healthcare industry. The researchers utilized the Texas State University Library to gain access to three online databases: PubMed (MEDLINE), CINAHL, and ProQuest Nursing and Allied Health Source. These sources were used to conduct searches on literature concerning security of electronic health records containing several inclusion and exclusion criteria. Researchers collected and analyzed 25 journals and reviews discussing security of electronic health records, 20 of which mentioned specific security methods and techniques. The most frequently mentioned security measures and techniques are categorized into three themes: administrative, physical, and technical safeguards. The sensitive nature of the information contained within electronic health records has prompted the need for advanced security techniques that are able to put these worries at ease. It is imperative for security techniques to cover the vast threats that are present across the three pillars of healthcare.
Gignac, Lynne M; Mittal, Surbhi; Bangsaruntip, Sarunya; Cohen, Guy M; Sleight, Jeffrey W
2011-12-01
The ability to prepare multiple cross-section transmission electron microscope (XTEM) samples from one XTEM sample of specific sub-10 nm features was demonstrated. Sub-10 nm diameter Si nanowire (NW) devices were initially cross-sectioned using a dual-beam focused ion beam system in a direction running parallel to the device channel. From this XTEM sample, both low- and high-resolution transmission electron microscope (TEM) images were obtained from six separate, specific site Si NW devices. The XTEM sample was then re-sectioned in four separate locations in a direction perpendicular to the device channel: 90° from the original XTEM sample direction. Three of the four XTEM samples were successfully sectioned in the gate region of the device. From these three samples, low- and high-resolution TEM images of the Si NW were taken and measurements of the NW diameters were obtained. This technique demonstrated the ability to obtain high-resolution TEM images in directions 90° from one another of multiple, specific sub-10 nm features that were spaced 1.1 μm apart.
Achromatic elemental mapping beyond the nanoscale in the transmission electron microscope.
Urban, K W; Mayer, J; Jinschek, J R; Neish, M J; Lugg, N R; Allen, L J
2013-05-03
Newly developed achromatic electron optics allows the use of wide energy windows and makes feasible energy-filtered transmission electron microscopy (EFTEM) at atomic resolution. In this Letter we present EFTEM images formed using electrons that have undergone a silicon L(2,3) core-shell energy loss, exhibiting a resolution in EFTEM of 1.35 Å. This permits elemental mapping beyond the nanoscale provided that quantum mechanical calculations from first principles are done in tandem with the experiment to understand the physical information encoded in the images.
On the optimum resolution of transmission-electron backscattered diffraction (t-EBSD)
Energy Technology Data Exchange (ETDEWEB)
Bremen, R. van; Ribas Gomes, D.; Jeer, L.T.H. de; Ocelík, V., E-mail: v.ocelik@rug.nl; De Hosson, J.Th.M.
2016-01-15
The work presented aims at determining the optimum physical resolution of the transmission-electron backscattered diffraction (t-EBSD) technique. The resolution depends critically on intrinsic factors such as the density, atomic number and thickness of the specimen but also on the extrinsic experimental set-up of the electron beam voltage, specimen tilt and detector position. In the present study, the so-called physical resolution of a typical t-EBSD set-up was determined with the use of Monte Carlo simulations and confronted to experimental findings. In the case of a thin Au film of 20 nm, the best resolution obtained was 9 nm whereas for a 100 nm Au film the best resolution was 66 nm. The precise dependence of resolution on thickness was found to vary differently depending on the specific elements involved. This means that the resolution of each specimen should be determined individually. Experimentally the median probe size of the t-EBSD for a 140 nm thick AuAg specimen was measured to be 87 nm. The first and third quartiles of the probe size measurements were found to be 60 nm and 118 nm. Simulation of this specimen resulted in a resolution of 94 nm which fits between these quartiles. - Highlights: • Intrinsic and extrinsic factors affecting resolution of t-EBSD are determined and characterized. • Distinction between resolutions of transmitted and detected electrons is determined. • The simulated results are confirmed experimentally on 140 nm thick AuAg foil.
Dynamics of soft Nanomaterials captured by transmission electron microscopy in liquid water
Energy Technology Data Exchange (ETDEWEB)
Proetto, Maria T.; Rush, Anthony M.; Chien, Miao-Ping; Abellan Baeza, Patricia; Patterson, Joseph P.; Thompson, Matthew P.; Olson, Norman H.; Moore, Curtis E.; Rheingold, Arnold L.; Andolina, Christopher; Millstone, Jill; Howell, Stephen B.; Browning, Nigel D.; Evans, James E.; Gianneschi, Nathan C.
2014-01-14
In this paper we present in situ transmission electron microscopy (TEM) of soft, synthetic nanoparticles with a comparative analysis using conventional TEM methods. This comparison is made with the simple aim of describing what is an unprecedented example of in situ imaging by TEM. However, we contend the technique will quickly become essential in the characterization of analogous systems, especially where dynamics are of interest in the solvated state. In this case, particles were studied which were obtained from the direct polymerization of an oxaliplatin analog, designed for an ongoing program in novel chemotherapeutic delivery systems. The resulting nanoparticles provided sufficient contrast for facile imaging in situ, and point toward key design parameters that enable this new characterization approach for organic nanomaterials. We describe the preparation of the synthetic micellar nanoparticles to- gether with their characterization in liquid water.
Mori, Kazuo; Naito, Katsuhiro; Kobayashi, Hideo
This paper proposes an asymmetric traffic accommodation scheme using a multihop transmission technique for CDMA/FDD cellular communication systems. The proposed scheme exploits the multihop transmission to downlink packet transmissions, which require the large transmission power at their single-hop transmissions, in order to increase the downlink capacity. In these multihop transmissions, vacant uplink band is used for the transmissions from relay stations to destination mobile stations, and this leads more capacity enhancement in the downlink communications. The relay route selection method and power control method for the multihop transmissions are also investigated in the proposed scheme. The proposed scheme is evaluated by computer simulation and the results show that the proposed scheme can achieve better system performance.
Transmission of high-power electron beams through small apertures
International Nuclear Information System (INIS)
Tschalär, C.; Alarcon, R.; Balascuta, S.; Benson, S.V.; Bertozzi, W.; Boyce, J.R.; Cowan, R.; Douglas, D.; Evtushenko, P.; Fisher, P.; Ihloff, E.; Kalantarians, N.; Kelleher, A.; Legg, R.; Milner, R.G.; Neil, G.R.; Ou, L.; Schmookler, B.; Tennant, C.; Williams, G.P.
2013-01-01
Tests were performed to pass a 100 MeV, 430 kWatt c.w. electron beam from the energy-recovery linac at the Jefferson Laboratory's FEL facility through a set of small apertures in a 127 mm long aluminum block. Beam transmission losses of 3 p.p.m. through a 2 mm diameter aperture were maintained during a 7 h continuous run
Charging of carbon thin films in scanning and phase-plate transmission electron microscopy
DEFF Research Database (Denmark)
Hettler, Simon; Kano, Emi; Dries, Manuel
2018-01-01
A systematic study on charging of carbon thin films under intense electron-beam irradiation was performed in a transmission electron microscope to identify the underlying physics for the functionality of hole-free phase plates. Thin amorphous carbon films fabricated by different deposition techni...
Environmental testing techniques for electronics and materials
Dummer, Geoffrey W A; Fry, D W; Higinbotham, W
2013-01-01
Environmental Testing Techniques for Electronics and Materials reviews environmental testing techniques for evaluating the performance of electronic equipment, components, and materials. Environmental test planning, test methods, and instrumentation are described, along with the general environmental conditions under which equipment must operate. This book is comprised of 15 chapters and begins by explaining why environmental testing is necessary and describing the environment in which electronics must operate. The next chapter considers how an environmental test plan is designed; the methods
The Titan Environmental Transmission Electron Microscope
DEFF Research Database (Denmark)
Hansen, Thomas Willum; Wagner, Jakob Birkedal; Jinschek, Jörg R.
2009-01-01
University of Denmark (DTU) provides a unique combination of techniques for studying materials of interest to the catalytic as well as the electronics and other communities [5]. DTU’s ETEM is based on the FEI Titan platform providing ultrahigh microscope stability pushing the imaging resolution into the sub...
Advantages of a monochromated transmission electron microscope for solid state physics
International Nuclear Information System (INIS)
Grogger, W.; Kothleitner, G.; Hofer, F.
2006-01-01
Full text: The characterization of nanostructured devices and functional materials at a nanometer scale is paramount for the understanding of their physical and chemical properties. Transmission electron microscopy (TEM) plays a central role, especially in terms of structural and chemical analysis on a nearly atomic scale. In particular, electron energy-loss spectrometry (EELS) can obtain information not only about the chemical composition of a thin sample, but also about chemical bonding and electronic structure (ionization edge fine structures) and optical properties (through valence loss EELS). Recent instrumental advances like monochromators for the electron gun in the TEM have made it possible to reduce the energy resolution to 0.15 eV at an acceleration voltage of 200 kV. Another strong point of the method lies in the combination with a fine electron probe (0.2 nm) which allows to record EELS spectra with high energy resolution and spatial resolution in the range of 1 nm. The improved energy resolution opens new possibilities for studying detailed electronic structure and bonding effects in solids such as transmission metal oxides. The experimental results will be compared with x-ray absorption spectroscopy and band structure calculations. A better energy-resolution is particularly important for measurements in the low loss region of the EELS spectrum which provides the information about the band gap and the dielectric function. We will highlight the potential of the method for studying metallic nanoparticles and semiconducting devices. Additionally, the influence of the intrinsic effects like core-hole and excited lifetime broadening and delocalization of the inelastically scattered electrons will be discussed. (author)
Magnetically insulated transmission line used for relativistic electron beam injection into SPAC-VI
International Nuclear Information System (INIS)
Tsuzuki, Tetsuya; Narihara, Kazumichi; Tomita, Yukihiro; Mohri, Akihiro.
1980-10-01
For the purpose to inject the electron beam with energy of about 1.5 MeV and current of about 100 kA into the SPAC-6 (torus device), a magnetically insulated transmission line was designed and constructed. The motion of electrons in the line was theoretically analyzed. The requirements for the design of the transmission line were as follows-: (a) condition of magnetic insulation, (b) suppression against reverse gas flow from the beam source to the torus, (c) care to minimize the influence of strong torus magnetic field, (d) reduction of inductance and (e) safety engineering measures, e.g., separation valve in the MITL between the beam source and the SPAC-6. The transmission line of 2.4 m long was designed and constructed. The wave forms of electric potential and current were measured. The transmission efficiency of current along the axis and the efficiency as a function of current at the end of the line were also measured. The reason of the loss of current is discussed. (J.P.N.)
Yücelen, Emrah; Lazić, Ivan; Bosch, Eric G T
2018-02-08
Using state of the art scanning transmission electron microscopy (STEM) it is nowadays possible to directly image single atomic columns at sub-Å resolution. In standard (high angle) annular dark field STEM ((HA)ADF-STEM), however, light elements are usually invisible when imaged together with heavier elements in one image. Here we demonstrate the capability of the recently introduced Integrated Differential Phase Contrast STEM (iDPC-STEM) technique to image both light and heavy atoms in a thin sample at sub-Å resolution. We use the technique to resolve both the Gallium and Nitrogen dumbbells in a GaN crystal in [[Formula: see text
Transmission dosimetry with a liquid-filled electronic portal imaging device
Energy Technology Data Exchange (ETDEWEB)
Boellaard, R; Van Herk, M; Mijnheer, B J [Nederlands Kanker Inst. ` Antoni van Leeuwenhoekhuis` , Amsterdam (Netherlands)
1995-12-01
The aim of transmission dosimetry is to correlate transmission dose values with patient dose values. A liquid-filled electronic portal imaging device (EPID) has been developed. After determination of the dose response relationship, i.e. the relation between pixel value and dose rate, for clinical situations it was found that the EPID is applicable for two-dimensional dosimetry with an accuracy of about 1%. The aim of this study was to investigate transmission dose distributions at different phantom-detector distances to predict exit dose distributions from transmission dose images. An extensive set of transmission dose measurements below homogeneous phantoms were performed with the EPID. The influence of several parameters such as field size, phantom thickness, phantom-detector distance and phantom-source distance on the transmission dose and its distribution were investigated. The two-dimensional transmission dose images were separated into two components: a primary dose and a scattered dose distribution. It was found that the scattered dose is maximal at a phantom thickness of about 10 cm. The scattered dose distribution below a homogeneous phantom has a Gaussian shape. The width of the Gaussian is small at small phantom-detector distances and increases for larger phantom-detector distances. The dependence of the scattered dose distribution on the field size at various phantom-detector distances has been used to estimate the dose distribution at the exit site of the phantom. More work is underway to determine the exit dose distributions for clinical situations, including the presence of inhomogeneities.
Transmission dosimetry with a liquid-filled electronic portal imaging device
International Nuclear Information System (INIS)
Boellaard, R.; Van Herk, M.; Mijnheer, B.J.
1995-01-01
The aim of transmission dosimetry is to correlate transmission dose values with patient dose values. A liquid-filled electronic portal imaging device (EPID) has been developed. After determination of the dose response relationship, i.e. the relation between pixel value and dose rate, for clinical situations it was found that the EPID is applicable for two-dimensional dosimetry with an accuracy of about 1%. The aim of this study was to investigate transmission dose distributions at different phantom-detector distances to predict exit dose distributions from transmission dose images. An extensive set of transmission dose measurements below homogeneous phantoms were performed with the EPID. The influence of several parameters such as field size, phantom thickness, phantom-detector distance and phantom-source distance on the transmission dose and its distribution were investigated. The two-dimensional transmission dose images were separated into two components: a primary dose and a scattered dose distribution. It was found that the scattered dose is maximal at a phantom thickness of about 10 cm. The scattered dose distribution below a homogeneous phantom has a Gaussian shape. The width of the Gaussian is small at small phantom-detector distances and increases for larger phantom-detector distances. The dependence of the scattered dose distribution on the field size at various phantom-detector distances has been used to estimate the dose distribution at the exit site of the phantom. More work is underway to determine the exit dose distributions for clinical situations, including the presence of inhomogeneities
The Design and Construction of a Simple Transmission Electron Microscope for Educational Purposes.
Hearsey, Paul K.
This document presents a model for a simple transmission electron microscope for educational purposes. This microscope could demonstrate thermonic emission, particle acceleration, electron deflection, and flourescence. It is designed to be used in high school science courses, particularly physics, taking into account the size, weight, complexity…
Current status and future directions for in situ transmission electron microscopy
DEFF Research Database (Denmark)
Taheri, Mitra L.; Stach, Eric A.; Arslan, Ilke
2016-01-01
This review article discusses the current and future possibilities for the application of in situ transmission electron microscopy to reveal synthesis pathways and functional mechanisms in complex and nanoscale materials. The findings of a group of scientists, representing academia, government labs...
Facilities for in situ ion beam studies in transmission electron microscopes
International Nuclear Information System (INIS)
Allen, C.W.; Ohnuki, S.; Takahashi, H.
1993-08-01
Interfacing an ion accelerator to a transmission electron microscope (TEM) allows the analytical functions of TEM imaging and electron diffraction from very small regions to be employed during ion-irradiation effects studies. At present there are ten such installations in Japan, one in France and one in the USA. General specifications of facilities which are operational in 1993 are summarized, and additional facilities which are planned or being proposed are briefly described
Directory of Open Access Journals (Sweden)
Sudheer
2017-07-01
Full Text Available The growth and solid-state dewetting behavior of Au thin films (0.7 to 8.4 nm deposited on the formvar film (substrate by sputtering technique have been studied using transmission electron microscopy. The size and number density of the Au nanoparticles (NPs change with an increase in the film thickness (0.7 to 2.8 nm. Nearly spherical Au NPs are obtained for 6 nm show capability to be used as an irreversible temperature sensor with a sensitivity of ∼0.1 CAF/°C. It is observed that annealing affects the crystallinity of the Au grains in the films. The electron diffraction measurement also shows annealing induced morphological evolution in the percolated Au thin films (≥3 nm during solid-state dewetting and recrystallization of the grains.
International Nuclear Information System (INIS)
De Santis, S.; Byrd, J.M.; Billing, M.; Palmer, M.; Sikora, J.; Carlson, B.
2010-01-01
A relatively new technique for measuring the electron cloud density in storage rings has been developed and successfully demonstrated (S. De Santis, J.M. Byrd, F. Caspers, A. Krasnykh, T. Kroyer, M.T.F. Pivi, and K.G. Sonnad, Phys. Rev. Lett. 100, 094801 (2008).). We present the experimental results of a systematic application of this technique at the Cornell Electron Storage Ring Test Accelerator. The technique is based on the phase modulation of the TE mode transmitted in a synchrotron beam pipe caused by the periodic variation of the density of electron plasma. Because of the relatively simple hardware requirements, this method has become increasingly popular and has been since successfully implemented in several machines. While the principles of this technique are straightforward, quantitative derivation of the electron cloud density from the measurement requires consideration of several effects, which we address in detail.
Electron microscopy of surfaces
International Nuclear Information System (INIS)
Venables, J.A.
1981-01-01
Electron beam techniques used to study clean surfaces and surface processes on a microscopic scale are reviewed. Recent experimental examples and possible future developments are discussed. Special emphasis is given to (i) transmission diffraction and microscopy techniques, including atomic imaging; (ii) Auger microscopy on bulk and thin film samples; (iii) secondary electron microscopy, especially low energy secondaries for work-function imaging and photoelectron imaging; and (iv) reflection electron microscopy and diffraction. (orig.)
Dose-rate-dependent damage of cerium dioxide in the scanning transmission electron microscope.
Johnston-Peck, Aaron C; DuChene, Joseph S; Roberts, Alan D; Wei, Wei David; Herzing, Andrew A
2016-11-01
Beam damage caused by energetic electrons in the transmission electron microscope is a fundamental constraint limiting the collection of artifact-free information. Through understanding the influence of the electron beam, experimental routines may be adjusted to improve the data collection process. Investigations of CeO 2 indicate that there is not a critical dose required for the accumulation of electron beam damage. Instead, measurements using annular dark field scanning transmission electron microscopy and electron energy loss spectroscopy demonstrate that the onset of measurable damage occurs when a critical dose rate is exceeded. The mechanism behind this phenomenon is that oxygen vacancies created by exposure to a 300keV electron beam are actively annihilated as the sample re-oxidizes in the microscope environment. As a result, only when the rate of vacancy creation exceeds the recovery rate will beam damage begin to accumulate. This observation suggests that dose-intensive experiments can be accomplished without disrupting the native structure of the sample when executed using dose rates below the appropriate threshold. Furthermore, the presence of an encapsulating carbonaceous layer inhibits processes that cause beam damage, markedly increasing the dose rate threshold for the accumulation of damage. Published by Elsevier B.V.
Transmission electron microscopy investigation of colloids and particles from landfill leachates
Czech Academy of Sciences Publication Activity Database
Matura, M.; Ettler, V.; Klementová, Mariana
2012-01-01
Roč. 30, č. 5 (2012), s. 530-541 ISSN 0734-242X Institutional research plan: CEZ:AV0Z40320502 Keywords : colloids * landfill leachates * transmission electron microscopy * calcite * contaminant mobility Subject RIV: CA - Inorganic Chemistry Impact factor: 1.047, year: 2012
Zhong, Xiang Li; Schilling, Sibylle; Zaluzec, Nestor J; Burke, M Grace
2016-12-01
In recent years, an increasing number of studies utilizing in situ liquid and/or gaseous cell scanning/transmission electron microscopy (S/TEM) have been reported. Because of the difficulty in the preparation of suitable specimens, these environmental S/TEM studies have been generally limited to studies of nanoscale structured materials such as nanoparticles, nanowires, or sputtered thin films. In this paper, we present two methodologies which have been developed to facilitate the preparation of electron-transparent samples from conventional bulk metals and alloys for in situ liquid/gaseous cell S/TEM experiments. These methods take advantage of combining sequential electrochemical jet polishing followed by focused ion beam extraction techniques to create large electron-transparent areas for site-specific observation. As an example, we illustrate the application of this methodology for the preparation of in situ specimens from a cold-rolled Type 304 austenitic stainless steel sample, which was subsequently examined in both 1 atm of air as well as fully immersed in a H2O environment in the S/TEM followed by hyperspectral imaging. These preparation techniques can be successfully applied as a general procedure for a wide range of metals and alloys, and are suitable for a variety of in situ analytical S/TEM studies in both aqueous and gaseous environments.
Jones, L; Nellist, P D
2014-05-01
In the scanning transmission electron microscope, hardware aberration correctors can now correct for the positive spherical aberration of round electron lenses. These correctors make use of nonround optics such as hexapoles or octupoles, leading to the limiting aberrations often being of a nonround type. Here we explore the effect of a number of potential limiting aberrations on the imaging performance of the scanning transmission electron microscope through their resulting optical transfer functions. In particular, the response of the optical transfer function to changes in defocus are examined, given that this is the final aberration to be tuned just before image acquisition. The resulting three-dimensional optical transfer functions also allow an assessment of the performance of a system for focal-series experiments or optical sectioning applications. © 2014 The Authors Journal of Microscopy © 2014 Royal Microscopical Society.
International Nuclear Information System (INIS)
Wang, L.M.
1998-01-01
This paper summarizes some recent results from the application of several advanced transmission electron microscopy (TEM) techniques to the studies of radiation effects in insulators with the main focus on radiation-induced amorphization. These techniques include in situ TEM during ion-beam irradiation at cryogenic and elevated temperatures, cross-sectional TEM, high-resolution TEM, and image simulation on partially damaged materials, as well as digital TEM with image processing and analysis. The combination of these techniques may often provide very detailed information about the microstructure evolution during energetic particle irradiation, especially at the early stages, which is unobtainable with any other analytical methods. These techniques have been successfully applied to the analysis of a large group of ion-beam-irradiated ceramics, including quartz, silicon carbides, uranium oxide, apatite, spinel and other complex mineral phases. The advantages and limitations of each technique, as well as some important technical details for the analysis of radiation damage in ceramics are presented. (orig.)
Thermal diffuse scattering in transmission electron microscopy
Energy Technology Data Exchange (ETDEWEB)
Forbes, B.D.; D' Alfonso, A.J. [School of Physics, University of Melbourne, Parkville, Victoria 3010 (Australia); Findlay, S.D. [School of Physics, Monash University, Victoria 3800 (Australia); Van Dyck, D. [EMAT, University of Antwerp, Groenenborgerlaan 171, B-2020 Antwerp (Belgium); LeBeau, J.M. [North Carolina State University, Raleigh, NC 27695-7907 (United States); Stemmer, S. [Materials Department, University of California, Santa Barbara, CA 93106-5050 (United States); Allen, L.J., E-mail: lja@unimelb.edu.au [School of Physics, University of Melbourne, Parkville, Victoria 3010 (Australia)
2011-12-15
In conventional transmission electron microscopy, thermal scattering significantly affects the image contrast. It has been suggested that not accounting for this correctly is the main cause of the Stobbs factor, the ubiquitous, large contrast mismatch found between theory and experiment. In the case where a hard aperture is applied, we show that previous conclusions drawn from work using bright field scanning transmission electron microscopy and invoking the principle of reciprocity are reliable in the presence of thermal scattering. In the aperture-free case it has been suggested that even the most sophisticated mathematical models for thermal diffuse scattering lack in their numerical implementation, specifically that there may be issues in sampling, including that of the contrast transfer function of the objective lens. We show that these concerns can be satisfactorily overcome with modest computing resources; thermal scattering can be modelled accurately enough for the purpose of making quantitative comparison between simulation and experiment. Spatial incoherence of the source is also investigated. Neglect or inadequate handling of thermal scattering in simulation can have an appreciable effect on the predicted contrast and can be a significant contribution to the Stobbs factor problem. -- Highlights: Black-Right-Pointing-Pointer We determine the numerical requirements for accurate simulation of TDS in CTEM. Black-Right-Pointing-Pointer TDS can be simulated to high precision using the Born-Oppenheimer model. Black-Right-Pointing-Pointer Such calculations establish the contribution of TDS to the Stobbs factor problem. Black-Right-Pointing-Pointer Treating spatial incoherence using envelope functions increases image contrast. Black-Right-Pointing-Pointer Rigorous treatment of spatial incoherence significantly reduces image contrast.
International Nuclear Information System (INIS)
Souza, A.D.B. de; Saito, H.; Appoloni, C.R.; Coimbra, M.M.; Parreira, P.S.
1991-01-01
The properties of soil water diffusivity and soil hydraulic conductivity of two horizons (0-20 cm and 20-40 cm) from Latossolo Roxo distrofico (LRd) and Latossolo Vermelho escuro (LEa) soil samples, have been measured in laboratory through the vertical infiltration and redistribution of water in soil columns. The moisture profile as a function of time for each position in the soil column were obtained with the gamma-ray transmission technique, using a sup(241)Am gamma-ray source, a Na (I) T1 scintillation detector and gamma spectrometry standard electronic. (author)
International Nuclear Information System (INIS)
Allen, C.W.
1994-01-01
Interfacing an ion accelerator to a transmission electron microscope (TEM) allows the analytical functions of TEM imaging and diffraction to be employed during ion-irradiation effects studies. At present there are twelve such installations in Japan, one in France and one in the US. This paper treats several aspects of in situ studies involving electron and ion beam induced and enhanced phase transformations and presents results of several in situ experiments to illustrate the dynamics of this approach in the materials science of irradiation effects. The paper describes the ion- and electron-induced amorphization of CuTi; the ion-irradiation-enhanced transformation of TiCr 2 ; and the ion- and electron-irradiation-enhanced crystallization of CoSi 2
Aberration-corrected scanning transmission electron microscopy for complex transition metal oxides
Qing-Hua, Zhang; Dong-Dong, Xiao; Lin, Gu
2016-06-01
Lattice, charge, orbital, and spin are the four fundamental degrees of freedom in condensed matter, of which the interactive coupling derives tremendous novel physical phenomena, such as high-temperature superconductivity (high-T c SC) and colossal magnetoresistance (CMR) in strongly correlated electronic system. Direct experimental observation of these freedoms is essential to understanding the structure-property relationship and the physics behind it, and also indispensable for designing new materials and devices. Scanning transmission electron microscopy (STEM) integrating multiple techniques of structure imaging and spectrum analysis, is a comprehensive platform for providing structural, chemical and electronic information of materials with a high spatial resolution. Benefiting from the development of aberration correctors, STEM has taken a big breakthrough towards sub-angstrom resolution in last decade and always steps forward to improve the capability of material characterization; many improvements have been achieved in recent years, thereby giving an in-depth insight into material research. Here, we present a brief review of the recent advances of STEM by some representative examples of perovskite transition metal oxides; atomic-scale mapping of ferroelectric polarization, octahedral distortions and rotations, valence state, coordination and spin ordering are presented. We expect that this brief introduction about the current capability of STEM could facilitate the understanding of the relationship between functional properties and these fundamental degrees of freedom in complex oxides. Project supported by the National Key Basic Research Project, China (Grant No. 2014CB921002), the Strategic Priority Research Program of Chinese Academy of Sciences (Grant No. XDB07030200), and the National Natural Science Foundation of China (Grant Nos. 51522212 and 51421002).
Directory of Open Access Journals (Sweden)
S. De Santis
2010-07-01
Full Text Available A relatively new technique for measuring the electron cloud density in storage rings has been developed and successfully demonstrated [S. De Santis, J. M. Byrd, F. Caspers, A. Krasnykh, T. Kroyer, M. T. F. Pivi, and K. G. Sonnad, Phys. Rev. Lett. 100, 094801 (2008.PRLTAO0031-900710.1103/PhysRevLett.100.094801]. We present the experimental results of a systematic application of this technique at the Cornell Electron Storage Ring Test Accelerator. The technique is based on the phase modulation of the TE mode transmitted in a synchrotron beam pipe caused by the periodic variation of the density of electron plasma. Because of the relatively simple hardware requirements, this method has become increasingly popular and has been since successfully implemented in several machines. While the principles of this technique are straightforward, quantitative derivation of the electron cloud density from the measurement requires consideration of several effects, which we address in detail.
Electronic waste recycling techniques
Bernardes, Andréa
2015-01-01
This book presents an overview of the characterization of electronic waste. In addition, processing techniques for the recovery of metals, polymers and ceramics are described. This book serves as a source of information and as an educational technical reference for practicing scientists and engineers, as well as for students.
Turbo Equalization Techniques Toward Robust PDM 16-QAM Optical Fiber Transmission
DEFF Research Database (Denmark)
Arlunno, Valeria; Caballero Jambrina, Antonio; Borkowski, Robert
2014-01-01
In this paper, we show numerically and experimentally that turbo equalization (TE) is an efficient technique to mitigate performance degradations stemming from optical fiber propagation effects in both optical fiber dispersion managed and unmanaged coherent detection links. The effectiveness....... As TE can be included in the current coherent detection transceiver technologies and complement other equalization techniques, it has prospects for application in next-generation high-capacity and long-reach optical transmission links....
Stukalov, Oleg; Korenevsky, Anton; Beveridge, Terry J; Dutcher, John R
2008-09-01
Bacteria can possess an outermost assembly of polysaccharide molecules, a capsule, which is attached to their cell wall. We have used two complementary, high-resolution microscopy techniques, atomic force microscopy (AFM) and transmission electron microscopy (TEM), to study bacterial capsules of four different gram-negative bacterial strains: Escherichia coli K30, Pseudomonas aeruginosa FRD1, Shewanella oneidensis MR-4, and Geobacter sulfurreducens PCA. TEM analysis of bacterial cells using different preparative techniques (whole-cell mounts, conventional embeddings, and freeze-substitution) revealed capsules for some but not all of the strains. In contrast, the use of AFM allowed the unambiguous identification of the presence of capsules on all strains used in the present study, including those that were shown by TEM to be not encapsulated. In addition, the use of AFM phase imaging allowed the visualization of the bacterial cell within the capsule, with a depth sensitivity that decreased with increasing tapping frequency.
Hosson, Jeff Th.M. De; Raedt, Hans A. De
2003-01-01
This paper aims at applying advanced transmission electron microscopy (TEM) to functional materials, such as ultra-soft magnetic films for high-frequency inductors, to reveal the structure-property relationship. The ultimate goal is to delineate a more quantitative way to obtain information of the
Zecevic, J.; Hermannsdorfer, Justus; Schuh, Tobias; de Jong, Krijn P.; de Jonge, Niels
2017-01-01
Liquid-phase transmission electron microscopy (TEM) is used for in-situ imaging of nanoscale processes taking place in liquid, such as the evolution of nanoparticles during synthesis or structural changes of nanomaterials in liquid environment. Here, it is shown that the focused electron beam of
The Development of a Hibachi Window for Electron Beam Transmission in a KrF Laser
International Nuclear Information System (INIS)
Gentile, C.A.; Parsells, R.; Butler, J.E.; Sethian, J.D.; Ciebiera, L.; Hegeler, F.; Jun, C.; Langish, S.; Myers, M.
2003-01-01
In support of Inertial Fusion Energy (IFE), a 150 (micro)m thick silicon (Si) wafer coated on one side with a 1.2 (micro)m nanocrystalline diamond foil is being fabricated as an electron beam transmission (hibachi) window for use in KrF lasers. The hibachi window separates the lasing medium from the electron beam source while allowing the electron beam to pass through. The hibachi window must be capable of withstanding the challenging environment presented in the lasing chamber, which include: fluorine gas, delta pressure >2 atm at 5 Hz, and a high heat flux due to the transmission of electrons passing through the foil. Tests at NRL/Electra and at PPPL have shown that a device employing these novel components in the stated configuration provide for a robust hibachi window with structural integrity
International Nuclear Information System (INIS)
Ye Gangfeng; Nogami, Jun; Crimp, Martin A.
2006-01-01
The microstructure of self-assembled dysprosium silicide nanostructures on silicon(001) has been studied by scanning tunneling microscopy and transmission electron microscopy. The studies focused on nanostructures that involve multiple atomic layers of the silicide. Cross-sectional high resolution transmission electron microscopy images and fast Fourier transform analysis showed that both hexagonal and orthorhombic/tetragonal silicide phases were present. Both the magnitude and the anisotropy of lattice mismatch between the silicide and the substrate play roles in the morphology and epitaxial growth of the nanostructures formed
DEFF Research Database (Denmark)
Dehghan, Roya; Hansen, Thomas Willum; Wagner, Jakob Birkedal
2011-01-01
the reactivity of the nanoparticles and the importance of controlling the gas composition and specimen temperature during this type of experiment. Similar behaviour was observed for a non-promoted catalyst. Imaging and analysis of the promoted sample before and after reduction indicated a uniform distribution...... resolution transmission electron microscopy and scanning transmission electron microscopy imaging. The cobalt particles were mainly face centred cubic while some hexagonal close packed particles were also found. Reoxidation of the sample upon cooling to room temperature, still under flowing H2, underlines...
Transmission Electron Microscopy of the Gastrointestinal Tract of Nile Perch Lates niloticus
Namulawa, V. T; Kato, C. D; Nyatia, E; Rutaisire, J; Britz, P. J
2015-01-01
The ultrastructure of the gastrointestinal tract of Nile perch was described using Transmission Electron Microscopy standard procedures. Investigations revealed the presence of mucous cells, blood vessels and oil droplets plus several nerve cells and muscle bundles in the oral cavity. Further observations revealed columnar epithelial cells in the oesophagus, with a ragged surface, high electron dense cytoplasm, intercellular spaces, mitochondria and mucus granules. The lamina propria of the o...
Preparation of ZiO2 specimens for transmission electron microscopy
International Nuclear Information System (INIS)
Bressiani, A.H.A.
1987-01-01
The determination of average grain size, of the presence of monoclinic, tetragonal and cubic phases, as well as their relative distributions are necessary for the study of several partially stabilized zirconia properties. However, the phase distributions can be changed during the preparation of specimens for transmission electron microscopy, yielding misleading results. In this work suitable preparation method is reported. (Author) [pt
Highlighting material structure with transmission electron diffraction correlation coefficient maps.
Kiss, Ákos K; Rauch, Edgar F; Lábár, János L
2016-04-01
Correlation coefficient maps are constructed by computing the differences between neighboring diffraction patterns collected in a transmission electron microscope in scanning mode. The maps are shown to highlight material structural features like grain boundaries, second phase particles or dislocations. The inclination of the inner crystal interfaces are directly deduced from the resulting contrast. Copyright © 2016 Elsevier B.V. All rights reserved.
Takamura, Y.; Marshall, A. F.; Mehta, A.; Arthur, J.; Griffin, P. B.; Plummer, J. D.; Patel, J. R.
2004-04-01
Ion implantation followed by laser annealing has been used to create supersaturated and electrically active concentrations of antimony in silicon. Upon subsequent thermal annealing, however, these metastable dopants deactivate towards the equilibrium solubility limit. In this work, the formation of inactive antimony structures has been studied with grazing incidence diffuse x-ray scattering, and transmission electron microscopy, and the results are correlated to previous high-resolution x-ray diffraction data. We find that at a concentration of 6.0×1020 cm-3, small, incoherent clusters of radius 3-4 Å form during annealing at 900 °C. At a higher concentration of 2.2×1021 cm-3, deactivation at 600 °C occurs through the formation of small, antimony aggregates and antimony precipitates. The size of these precipitates from diffuse x-ray scattering is roughly 15 Å in radius for anneal times from 15 to 180 seconds. This value is consistent with the features observed in high-resolution and mass contrast transmission electron microscopy images. The coherent nature of the aggregates and precipitates causes the expansion of the surrounding silicon matrix as the deactivation progresses. In addition, the sensitivity of the diffuse x-ray scattering technique has allowed us to detect the presence of small clusters of radius ˜2 Å in unprocessed Czochralski silicon wafers. These defects are not observed in floating zone silicon wafers, and are tentatively attributed to thermal donors.
VANWACHEM, PB; VANLUYN, MJA; NIEUWENHUIS, P; KOERTEN, HK; DAMINK, LO; TENHOOPEN, H; FEIJEN, J
The in vivo degradation of hexamethylenediisocyanate-tanned dermal sheep collagen was studied with transmission electron microscopy. Discs of hexamethylenediisocyanate-tanned dermal sheep collagen were subcutaneously implanted in rats. Both an intra- and an extracellular route of degradation could
Energy Technology Data Exchange (ETDEWEB)
Girleanu, M., E-mail: maria.girleanu@uha.fr [Mecanique, Materiaux et Procedes de Fabrication, LPMT (EA CNRS 4365), Universite de Haute Alsace, 61 rue Albert Camus, F-68093 Mulhouse (France); Pac, M.-J.; Louis, P. [Mecanique, Materiaux et Procedes de Fabrication, LPMT (EA CNRS 4365), Universite de Haute Alsace, 61 rue Albert Camus, F-68093 Mulhouse (France); Ersen, O.; Werckmann, J. [Departement Structures et Interfaces, IPCMS (UMR CNRS 7504), Universite de Strasbourg, 23 rue du Loess, F-67087 Strasbourg (France); Rousselot, C. [Departement Micro Nano Sciences et Systemes, FEMTO-ST (UMR CNRS 6174), Universite de Franche-Comte, BP 71427, F-25211 Montbeliard (France); Tuilier, M.-H. [Mecanique, Materiaux et Procedes de Fabrication, LPMT (EA CNRS 4365), Universite de Haute Alsace, 61 rue Albert Camus, F-68093 Mulhouse (France)
2011-07-01
Titanium and aluminium nitride Ti{sub 1-x}Al{sub x}N films deposited by radiofrequency magnetron reactive sputtering onto steel substrate are examined by transmission electron microscopy over all the range of composition (x = 0, 0.5, 0.68, 0.86, 1). The deposition parameters are optimised in order to grow nitride films with low stress over all the composition range. Transmission electron microscopy cross-section images of Vickers indentation prints performed on that set of coatings show the evolution of their damage behaviour as increasing x Al content. Cubic Ti-rich nitrides consist of small grains clustered in rather large columns sliding along each other during indentation. Hexagonal Al-rich films grow in thinner columns which can be bent under the Vickers tip. Indentation tests carried out on TiN and AlN films are simulated using finite element modelling. Particular aspects of shear stresses and displacements in the coating/substrate are investigated. The growth mode and the nanostructure of two typical films, TiN and Ti{sub 0.14}Al{sub 0.86}N, are studied in detail by combining transmission electron microscopy cross-sections and plan views. Electron energy loss spectrum taken across Ti{sub 0.14}Al{sub 0.86}N film suggests that a part of nitrogen atoms is in cubic-like local environment though the lattice symmetry of Al-rich coatings is hexagonal. The poorly crystallised domains containing Ti and N atoms in cubic-like environment are obviously located in grain boundaries and afford protection of the coating against cracking.
International Nuclear Information System (INIS)
Girleanu, M.; Pac, M.-J.; Louis, P.; Ersen, O.; Werckmann, J.; Rousselot, C.; Tuilier, M.-H.
2011-01-01
Titanium and aluminium nitride Ti 1-x Al x N films deposited by radiofrequency magnetron reactive sputtering onto steel substrate are examined by transmission electron microscopy over all the range of composition (x = 0, 0.5, 0.68, 0.86, 1). The deposition parameters are optimised in order to grow nitride films with low stress over all the composition range. Transmission electron microscopy cross-section images of Vickers indentation prints performed on that set of coatings show the evolution of their damage behaviour as increasing x Al content. Cubic Ti-rich nitrides consist of small grains clustered in rather large columns sliding along each other during indentation. Hexagonal Al-rich films grow in thinner columns which can be bent under the Vickers tip. Indentation tests carried out on TiN and AlN films are simulated using finite element modelling. Particular aspects of shear stresses and displacements in the coating/substrate are investigated. The growth mode and the nanostructure of two typical films, TiN and Ti 0.14 Al 0.86 N, are studied in detail by combining transmission electron microscopy cross-sections and plan views. Electron energy loss spectrum taken across Ti 0.14 Al 0.86 N film suggests that a part of nitrogen atoms is in cubic-like local environment though the lattice symmetry of Al-rich coatings is hexagonal. The poorly crystallised domains containing Ti and N atoms in cubic-like environment are obviously located in grain boundaries and afford protection of the coating against cracking.
International Nuclear Information System (INIS)
LaGrange, Thomas; Campbell, Geoffrey H.; Reed, B.W.; Taheri, Mitra; Pesavento, J. Bradley; Kim, Judy S.; Browning, Nigel D.
2008-01-01
Most biological processes, chemical reactions and materials dynamics occur at rates much faster than can be captured with standard video rate acquisition methods in transmission electron microscopes (TEM). Thus, there is a need to increase the temporal resolution in order to capture and understand salient features of these rapid materials processes. This paper details the development of a high-time resolution dynamic transmission electron microscope (DTEM) that captures dynamics in materials with nanosecond time resolution. The current DTEM performance, having a spatial resolution <10 nm for single-shot imaging using 15 ns electron pulses, will be discussed in the context of experimental investigations in solid state reactions of NiAl reactive multilayer films, the study of martensitic transformations in nanocrystalline Ti and the catalytic growth of Si nanowires. In addition, this paper will address the technical issues involved with high current, electron pulse operation and the near-term improvements to the electron optics, which will greatly improve the signal and spatial resolutions, and to the laser system, which will allow tailored specimen and photocathode drive conditions
Energy Technology Data Exchange (ETDEWEB)
LaGrange, Thomas [Lawrence Livermore National Laboratory, 7000 East Avenue, Livermore, CA 94550 (United States)], E-mail: lagrange@llnl.gov; Campbell, Geoffrey H.; Reed, B.W.; Taheri, Mitra; Pesavento, J. Bradley [Lawrence Livermore National Laboratory, 7000 East Avenue, Livermore, CA 94550 (United States); Kim, Judy S.; Browning, Nigel D. [Lawrence Livermore National Laboratory, 7000 East Avenue, Livermore, CA 94550 (United States); Department of Chemical Engineering and Materials Science, University of California, One Shields Avenue, Davis, CA 95616 (United States)
2008-10-15
Most biological processes, chemical reactions and materials dynamics occur at rates much faster than can be captured with standard video rate acquisition methods in transmission electron microscopes (TEM). Thus, there is a need to increase the temporal resolution in order to capture and understand salient features of these rapid materials processes. This paper details the development of a high-time resolution dynamic transmission electron microscope (DTEM) that captures dynamics in materials with nanosecond time resolution. The current DTEM performance, having a spatial resolution <10 nm for single-shot imaging using 15 ns electron pulses, will be discussed in the context of experimental investigations in solid state reactions of NiAl reactive multilayer films, the study of martensitic transformations in nanocrystalline Ti and the catalytic growth of Si nanowires. In addition, this paper will address the technical issues involved with high current, electron pulse operation and the near-term improvements to the electron optics, which will greatly improve the signal and spatial resolutions, and to the laser system, which will allow tailored specimen and photocathode drive conditions.
The reactions of loaded carbon nanotubes, studied by novel electron microscope techniques
International Nuclear Information System (INIS)
Rawcliffe, A.
1999-01-01
A novel electron microscope technique, controlled environment transmission electron microscopy (CETEM), has been used to investigate the reaction of materials loaded within the internal cavities of carbon nanotubes. CETEM allows the introduction of up to 20 mbar of gas around an electron microscope sample, while maintaining a high resolution imaging capability. The microscope is stable, flexible and reliable under these conditions and high resolution images of encapsulated transmission metal oxide reduction have been recorded at 460 deg. C. Recently discovered carbon nanotubes have in theory many applications, many of which will require controlled reliable loading of the internal cavity. However, at present, there is little experimental evidence to confirm theoretical descriptions of the fundamental mechanisms which govern both the extent of loading and the state in which it is found. Similarly, reaction within the cavity and the effect of encapsulation on the nano-scale particle distribution must also be understood, and CETEM proves to be an ideal technique for the study of these processes. Nanotubes have been loaded from aqueous solution with (NH 4 ) 2 IrCI 6 and with molten MoO 3 or K 2 WO 4 /WO 3 . Bulk samples of the first salt are known to decompose spontaneously in air at 200 deg. C, and the bulk oxides are partially reduced at temperature under hydrogen to give potentially useful conducting phases. Comparing the reaction of these materials it is thus possible to: investigate the effect of loading on their reaction; compare the reaction of these materials in- and out-side the tube cavity; and assess the result of violent loading processes on the tubes themselves. Fortuitously, a spontaneous decomposition, a solid-gas reduction and a phase rearrangement were all recorded, allowing mechanistic implications of encapsulation to be considered for each of these reactions. Perhaps surprisingly, the results can be largely interpreted using the reported bulk
Voltage dependency of transmission probability of aperiodic DNA molecule
Wiliyanti, V.; Yudiarsah, E.
2017-07-01
Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.
Quantitative biological measurement in Transmission Electron Tomography
International Nuclear Information System (INIS)
Mantell, Judith M; Verkade, Paul; Arkill, Kenton P
2012-01-01
It has been known for some time that biological sections shrink in the transmission electron microscope from exposure to the electron beam. This phenomenon is especially important in Electron Tomography (ET). The effect on shrinkage of parameters such as embedding medium or sample type is less well understood. In addition anisotropic area shrinkage has largely been ignored. The intention of this study is to explore the shrinkage on a number of samples ranging in thickness from 200 nm to 500 nm. A protocol was developed to determine the shrinkage in area and thickness using the gold fiducials used in electron tomography. In brief: Using low dose philosophy on the section, a focus area was used prior to a separate virgin study area for a series of known exposures on a tilted sample. The shrinkage was determined by measurements on the gold beads from both sides of the section as determined by a confirmatory tomogram. It was found that the shrinkage in area (approximately to 90-95% of the original) and the thickness (approximately 65% of the original at most) agreed with pervious authors, but that a lmost all the shrinkage was in the first minute and that although the direction of the in-plane shrinkage (in x and y) was sometimes uneven the end result was consistent. It was observed, in general, that thinner samples showed more percentage shrinkage than thicker ones. In conclusion, if direct quantitative measurements are required then the protocol described should be used for all areas studied.
Quantitative biological measurement in Transmission Electron Tomography
Mantell, Judith M.; Verkade, Paul; Arkill, Kenton P.
2012-07-01
It has been known for some time that biological sections shrink in the transmission electron microscope from exposure to the electron beam. This phenomenon is especially important in Electron Tomography (ET). The effect on shrinkage of parameters such as embedding medium or sample type is less well understood. In addition anisotropic area shrinkage has largely been ignored. The intention of this study is to explore the shrinkage on a number of samples ranging in thickness from 200 nm to 500 nm. A protocol was developed to determine the shrinkage in area and thickness using the gold fiducials used in electron tomography. In brief: Using low dose philosophy on the section, a focus area was used prior to a separate virgin study area for a series of known exposures on a tilted sample. The shrinkage was determined by measurements on the gold beads from both sides of the section as determined by a confirmatory tomogram. It was found that the shrinkage in area (approximately to 90-95% of the original) and the thickness (approximately 65% of the original at most) agreed with pervious authors, but that a lmost all the shrinkage was in the first minute and that although the direction of the in-plane shrinkage (in x and y) was sometimes uneven the end result was consistent. It was observed, in general, that thinner samples showed more percentage shrinkage than thicker ones. In conclusion, if direct quantitative measurements are required then the protocol described should be used for all areas studied.
Inner-shell electron spectroscopy for microanalysis
International Nuclear Information System (INIS)
Joy, D.C.; Maher, D.M.
1979-01-01
The transmission electron energy-loss spectrum shows characteristic edges corresponding to the excitation of inner-shell electrons of atoms in a thin sample. Analysis of these edges provides detailed chemical, structural, and electronic data from the radiated volume. By combining electron spectroscopy and electron microscopy, this microanalytical technique can be performed in conjunction with high-resolution imaging of the sample. It is shown that this approach has advantages of sensitivity, spatial resolution, and convenience over other comparable techniques. 7 figures
Direct observations of the MOF (UiO-66) structure by transmission electron microscopy
Zhu, Liangkui
2013-01-01
As a demonstration of ab initio structure characterizations of nano metal organic framework (MOF) crystals by high resolution transmission electron microscopy (HRTEM) and electron diffraction tomography methods, a Zr-MOF (UiO-66) structure was determined and further confirmed by Rietveld refinements of powder X-ray diffraction. HRTEM gave direct imaging of the channels. © 2013 The Royal Society of Chemistry.
Magnetic imaging with a Zernike-type phase plate in a transmission electron microscope
DEFF Research Database (Denmark)
Pollard, Shawn; Malac, Marek; Beleggia, Marco
2013-01-01
We demonstrate the use of a hole-free phase plate (HFPP) for magnetic imaging in transmission electron microscopy by mapping the domain structure in PrDyFeB samples. The HFPP, a Zernike-like imaging method, allows for detecting magnetic signals in-focus to correlate the sample crystal structure...... the reference wave distortion from long-range fields affecting electron holography....
International Nuclear Information System (INIS)
Bueyuek, B.; Tugrul, B.
2009-01-01
The purpose of this study is an experimental analysis of thickness measurement for various metals with the gamma transmission technique using Cs-137 as the radioisotope source. Lead, steel, brass, and aluminum, which are frequently used metals in industry, were chosen for the experiments. As the radioisotope source Cs-137 was preferred for the study since it has long half-life, it is mono energetic, and it penetrates the metals that were studied. Experiments were observed in the constant experimental geometry. Calibration curves for the four metal samples were plotted using the obtained results. To test the plotted calibration curves, counts for determining thickness measurement were collected for each sample and the obtained relative count values were used in conjunction with the plotted calibration curves for each sample to determine its thickness. The thicknesses of the samples have been measured with a micrometer and the results were comparatively analyzed with the measurement results obtained by the gamma transmission technique. The results of the analyses revealed that the thickness measurement values obtained with the gamma transmission technique and the thickness measurement values obtained with the conventional technique significantly converge to each other and the difference between the two values is at an acceptable level. Therefore the reliability of thickness measurements with the gamma transmission technique and the resulting calibration curves have been demonstrated.
International Nuclear Information System (INIS)
De Backer, A; De Wael, A; Gonnissen, J; Martinez, G T; Béché, A; Van Aert, S; MacArthur, K E; Jones, L; Nellist, P D
2015-01-01
Quantitative atomic resolution annular dark field scanning transmission electron microscopy (ADF STEM) has become a powerful technique for nanoparticle atom-counting. However, a lot of nanoparticles provide a severe characterisation challenge because of their limited size and beam sensitivity. Therefore, quantitative ADF STEM may greatly benefit from statistical detection theory in order to optimise the instrumental microscope settings such that the incoming electron dose can be kept as low as possible whilst still retaining single-atom precision. The principles of detection theory are used to quantify the probability of error for atom-counting. This enables us to decide between different image performance measures and to optimise the experimental detector settings for atom-counting in ADF STEM in an objective manner. To demonstrate this, ADF STEM imaging of an industrial catalyst has been conducted using the near-optimal detector settings. For this experiment, we discussed the limits for atomcounting diagnosed by combining a thorough statistical method and detailed image simulations. (paper)
Electronic transmission through p-n and n-p-n junctions of graphene
Energy Technology Data Exchange (ETDEWEB)
Setare, M R [Department of Science of Bijar, University of Kurdistan, Bijar (Iran, Islamic Republic of); Jahani, D, E-mail: rezakord@ipm.co, E-mail: Dariush110@gmail.co [Department of Physics, Razi University, Kermanshah (Iran, Islamic Republic of)
2010-06-23
In this paper, we first evaluate the electronic transmission of Dirac fermions into a p-n junction of gapped graphene and show that the final result depends on the sign of the refractive index, n. We also, by considering the appropriate wavefunctions in the region of the electrostatic potential, show that both transmission and the reflection probability turn out to be positive and less than unity instead of the negative transmission and higher than unity reflection coefficient commonly referred to as the Klein paradox. We then obtain the transmission probability corresponding to a special p-n junction for which there exists a region in which the low energy excitations of graphene acquire a finite mass and, interestingly, find that in this case the transmission is independent of the index of refraction, in contrast with the corresponding result for gapped graphene. We then discuss the validity of the solutions reported in some of the papers cited in this work which, considering the Buettiker formula, turn out to lead to the wrong results for conductivity.
International Nuclear Information System (INIS)
Lee, Z.; Rose, H.; Lehtinen, O.; Biskupek, J.; Kaiser, U.
2014-01-01
In order to achieve the highest resolution in aberration-corrected (AC) high-resolution transmission electron microscopy (HRTEM) images, high electron doses are required which only a few samples can withstand. In this paper we perform dose-dependent AC-HRTEM image calculations, and study the dependence of the signal-to-noise ratio, atom contrast and resolution on electron dose and sampling. We introduce dose-dependent contrast, which can be used to evaluate the visibility of objects under different dose conditions. Based on our calculations, we determine optimum samplings for high and low electron dose imaging conditions. - Highlights: • The definition of dose-dependent atom contrast is introduced. • The dependence of the signal-to-noise ratio, atom contrast and specimen resolution on electron dose and sampling is explored. • The optimum sampling can be determined according to different dose conditions
Energy Technology Data Exchange (ETDEWEB)
Haas, Oliver Sebastian, E-mail: o.haas@gsi.de [GSI Helmholtzzentrum für Schwerionenforschung GmbH, Planckstraße 1, 64291 Darmstadt (Germany); Boine-Frankenheim, Oliver [GSI Helmholtzzentrum für Schwerionenforschung GmbH, Planckstraße 1, 64291 Darmstadt (Germany); Technische Universität Darmstadt, Institut für Theorie Elektromagnetischer Felder, Schlossgartenstraße 8, 64289 Darmstadt (Germany); Petrov, Fedor [Technische Universität Darmstadt, Institut für Theorie Elektromagnetischer Felder, Schlossgartenstraße 8, 64289 Darmstadt (Germany)
2013-11-21
An electron cloud density in an accelerator can be measured using the Microwave Transmission (MWT) method. The aim of our study is to evaluate the influence of a realistic, nonuniform electron cloud on the MWT. We conduct electron cloud buildup simulations for beam pipe geometries and bunch parameters resembling roughly the conditions in the CERN SPS. For different microwave waveguide modes the phase shift induced by a known electron cloud density is obtained from three different approaches: 3D Particle-In-Cell (PIC) simulation of the electron response, a 2D eigenvalue solver for waveguide modes assuming a dielectric response function for cold electrons, a perturbative method assuming a sufficiently smooth density profile. While several electron cloud parameters, such as temperature, result in minor errors in the determined density, the transversely inhomogeneous density can introduce a large error in the measured electron density. We show that the perturbative approach is sufficient to describe the phase shift under realistic electron cloud conditions. Depending on the geometry of the beam pipe, the external magnetic field configuration and the used waveguide mode, the electron cloud density can be concentrated at the beam pipe or near the beam pipe center, leading to a severe over- or underestimation of the electron density. -- Author-Highlights: •Electron cloud distributions are very inhomogeneous, especially in dipoles. •These inhomogeneities affect the microwave transmission measurement results. •Electron density might be over- or underestimated, depending on setup. •This can be quantified with several models, e.g. a perturbative approach.
Atomistic observations and analyses of lattice defects in transmission electron microscopes
Abe, H
2003-01-01
The transmission electron microscope (TEM) -accelerators was developed. TEM-Accelerator made possible to observe in situ experiments of ion irradiation and implantation. The main results are the experimental proof of new lattice defects by irradiation, the formation process and synthesized conditions of carbon onion by ion implantation, the microstructure and phase transformation conditions of graphite by ion irradiated phase transformation, the irradiation damage formation process by simultaneous irradiation of electron and ion and behavior of fullerene whisker under irradiation. The microstructural evolution of defect clusters in copper irradiated with 240-keV Cu sup + ions and a high resolution electron micrograph of carbon onions synthesized by ion implantation are explained as the examples of recent researches. (S.Y.)
Reciprocity relations in transmission electron microscopy: A rigorous derivation.
Krause, Florian F; Rosenauer, Andreas
2017-01-01
A concise derivation of the principle of reciprocity applied to realistic transmission electron microscopy setups is presented making use of the multislice formalism. The equivalence of images acquired in conventional and scanning mode is thereby rigorously shown. The conditions for the applicability of the found reciprocity relations is discussed. Furthermore the positions of apertures in relation to the corresponding lenses are considered, a subject which scarcely has been addressed in previous publications. Copyright © 2016 Elsevier Ltd. All rights reserved.
Kim, Byung Gon; Bae, Sung Hyun; Kim, Hoon; Chung, Yun C
2017-05-29
We propose and demonstrate a simple composite second-order (CSO) cancellation technique based on the digital signal processing (DSP) for the radio-over-fiber (RoF) transmission system implemented by using directly modulated lasers (DMLs). When the RoF transmission system is implemented by using DMLs, its performance could be limited by the CSO distortions caused by the interplay between the DML's chirp and fiber's chromatic dispersion. We present the theoretical analysis of these nonlinear distortions and show that they can be suppressed at the receiver by using a simple DSP. To verify the effectiveness of the proposed technique, we demonstrate the transmission of twenty-four 100-MHz filtered orthogonal frequency-division multiplexing (f-OFDM) signals in 64 quadrature amplitude modulation (QAM) format over 20 km of the standard single-mode fiber (SSMF). The results show that, by using the proposed technique, we can suppress the CSO distortion components by >10 dB and achieve the error-vector magnitude performance better than 6% even after the 20-km long SSMF transmission.
Czech Academy of Sciences Publication Activity Database
Klinger, Miloslav; Polívka, Leoš; Jäger, Aleš; Tyunina, Marina
2016-01-01
Roč. 49, Jun (2016), 762-770 ISSN 1600-5767 R&D Projects: GA ČR GBP108/12/G043; GA ČR GA15-15123S Institutional support: RVO:68378271 Keywords : transmission electron microscopy * structural inhomogeneity * lattice parameters * image processing Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 2.495, year: 2016
A transmission electron microscopy procedure for in-situ straining of miniature
Czech Academy of Sciences Publication Activity Database
Olbricht, J.; Wagner, M. F- X.; Condó, A.; Dlouhý, Antonín; Grossman, Ch.; Kröger, A.; Somsen, Ch.; Eggeler, G.
2008-01-01
Roč. 99, č. 10 (2008), s. 1150-1156 ISSN 1862-5282 R&D Projects: GA ČR(CZ) GA106/05/0918 Institutional research plan: CEZ:AV0Z20410507 Keywords : transmission electron microscopy * in-situ straining * nano-crystalline NiTi Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 0.819, year: 2008
Energy Technology Data Exchange (ETDEWEB)
Wang, Peng; Behan, Gavin; Kirkland, Angus I. [Department of Materials, University of Oxford, Parks Road, Oxford OX1 3PH (United Kingdom); Nellist, Peter D., E-mail: peter.nellist@materials.ox.ac.uk [Department of Materials, University of Oxford, Parks Road, Oxford OX1 3PH (United Kingdom); Cosgriff, Eireann C.; D' Alfonso, Adrian J.; Morgan, Andrew J.; Allen, Leslie J. [School of Physics, University of Melbourne, Parkville, Victoria 3010 (Australia); Hashimoto, Ayako [Advanced Nano-characterization Center, National Institute for Materials Science (NIMS), 3-13 Sakura, Tsukuba 305-0003 (Japan); Takeguchi, Masaki [Advanced Nano-characterization Center, National Institute for Materials Science (NIMS), 3-13 Sakura, Tsukuba 305-0003 (Japan); High Voltage Electron Microscopy Station, NIMS, 3-13 Sakura, Tsukuba 305-0003 (Japan); Mitsuishi, Kazutaka [Advanced Nano-characterization Center, National Institute for Materials Science (NIMS), 3-13 Sakura, Tsukuba 305-0003 (Japan); Quantum Dot Research Center, NIMS, 3-13 Sakura, Tsukuba 305-0003 (Japan); Shimojo, Masayuki [High Voltage Electron Microscopy Station, NIMS, 3-13 Sakura, Tsukuba 305-0003 (Japan); Advanced Science Research Laboratory, Saitama Institute of Technology, 1690 Fusaiji, Fukaya 369-0293 (Japan)
2011-06-15
Scanning confocal electron microscopy (SCEM) offers a mechanism for three-dimensional imaging of materials, which makes use of the reduced depth of field in an aberration-corrected transmission electron microscope. The simplest configuration of SCEM is the bright-field mode. In this paper we present experimental data and simulations showing the form of bright-field SCEM images. We show that the depth dependence of the three-dimensional image can be explained in terms of two-dimensional images formed in the detector plane. For a crystalline sample, this so-called probe image is shown to be similar to a conventional diffraction pattern. Experimental results and simulations show how the diffracted probes in this image are elongated in thicker crystals and the use of this elongation to estimate sample thickness is explored. -- Research Highlights: {yields} The confocal probe image in a scanning confocal electron microscopy image reveals information about the thickness and height of the crystalline layer. {yields} The form of the contrast in a three-dimensional bright-field scanning confocal electron microscopy image can be explained in terms of the confocal probe image. {yields} Despite the complicated form of the contrast in bright-field scanning confocal electron microscopy, we see that depth information is transferred on a 10 nm scale.
3D simulation of electron and ion transmission of GEM-based detectors
Bhattacharya, Purba; Mohanty, Bedangadas; Mukhopadhyay, Supratik; Majumdar, Nayana; da Luz, Hugo Natal
2017-10-01
Time Projection Chamber (TPC) has been chosen as the main tracking system in several high-flux and high repetition rate experiments. These include on-going experiments such as ALICE and future experiments such as PANDA at FAIR and ILC. Different R&D activities were carried out on the adoption of Gas Electron Multiplier (GEM) as the gas amplification stage of the ALICE-TPC upgrade version. The requirement of low ion feedback has been established through these activities. Low ion feedback minimizes distortions due to space charge and maintains the necessary values of detector gain and energy resolution. In the present work, Garfield simulation framework has been used to study the related physical processes occurring within single, triple and quadruple GEM detectors. Ion backflow and electron transmission of quadruple GEMs, made up of foils with different hole pitch under different electromagnetic field configurations (the projected solutions for the ALICE TPC) have been studied. Finally a new triple GEM detector configuration with low ion backflow fraction and good electron transmission properties has been proposed as a simpler GEM-based alternative suitable for TPCs for future collider experiments.
On-line nuclear ash gauge for coal based on gamma-ray transmission techniques
International Nuclear Information System (INIS)
Rizk, R.A.M.; El-Kateb, A.H.; Abdul-Kader, A.M.
1999-01-01
Developments and applications of on-line nuclear gauges in the coal industry are highly requested. A nuclear ash gauge for coal, based on γ-ray transmission techniques is developed. Single and dual energy γ-ray beams are used to determine the ash content of coal. The percentage ash content as a function of the γ-ray intensities transmitted through coal samples is measured and sensitivity curves are obtained. An empirical formulation relating the ash content values to the γ-ray intensities is derived. Preliminary results show that both single and dual energy γ-ray transmission techniques can be used to give a rapid on-line estimation of the ash concentration values in coal with low cost and reasonable accuracy, but the dual one is much preferable. (author)
International Nuclear Information System (INIS)
Zhang Lina; Zhang Haoxu; Zhou Ruifeng; Chen Zhuo; Li Qunqing; Fan Shoushan; Jiang Kaili; Ge Guanglu; Liu Renxiao
2011-01-01
A novel grid for use in transmission electron microscopy is developed. The supporting film of the grid is composed of thin graphene oxide films overlying a super-aligned carbon nanotube network. The composite film combines the advantages of graphene oxide and carbon nanotube networks and has the following properties: it is ultra-thin, it has a large flat and smooth effective supporting area with a homogeneous amorphous appearance, high stability, and good conductivity. The graphene oxide-carbon nanotube grid has a distinct advantage when characterizing the fine structure of a mass of nanomaterials over conventional amorphous carbon grids. Clear high-resolution transmission electron microscopy images of various nanomaterials are obtained easily using the new grids.
Modeling microwave/electron-cloud interaction
International Nuclear Information System (INIS)
Mattes, M; Sorolla, E; Zimmermann, F
2013-01-01
Starting from the separate codes BI-RME and ECLOUD or PyECLOUD, we are developing a novel joint simulation tool, which models the combined effect of a charged particle beam and of microwaves on an electron cloud. Possible applications include the degradation of microwave transmission in telecommunication satellites by electron clouds; the microwave-transmission techniques being used in particle accelerators for the purpose of electroncloud diagnostics; the microwave emission by the electron cloud itself in the presence of a magnetic field; and the possible suppression of electron-cloud formation in an accelerator by injecting microwaves of suitable amplitude and frequency. A few early simulation results are presented. (author)
International Nuclear Information System (INIS)
Tsai, Wen-Shing; Lu, Hai-Han; Li, Chung-Yi; Chen, Bo-Rui; Lin, Hung-Hsien; Lin, Dai-Hua
2016-01-01
A hybrid lightwave transmission system based on light injection/optoelectronic feedback techniques and fiber-visible laser light communication (VLLC) integration is proposed and experimentally demonstrated. To be the first one of its kind in employing light injection and optoelectronic feedback techniques in a fiber-VLLC integration lightwave transmission system, the light is successfully directly modulated with Community Access Television (CATV), 16-QAM, and 16-QAM-OFDM signals. Over a 40 km SMF and a 10 m free-space VLLC transport, good performances of carrier-to-noise ratio (CNR)/composite second-order (CSO)/composite triple-beat (CTB)/bit error rate (BER) are achieved for CATV/16-QAM/16-QAM-OFDM signals transmission. Such a hybrid lightwave transmission system would be very useful since it can provide broadband integrated services including CATV, Internet, and telecommunication services over both distribute fiber and in-building networks. (letter)
Energy Technology Data Exchange (ETDEWEB)
Schoen, Wolfgang [ZF Friedrichshafen AG, Friedrichshafen (DE). Hybridantriebe (F und E); Lutz, Steffen [BMW AG, Muenchen (Germany); Hensler, Alexander [Technische Univ. Chemnitz (Germany); Munding, Andreas [Liebherr Elektronik GmbH, Lindau (Germany); Thoben, Markus [Infineon Technologies AG, Warstein (Germany); Zeidler, Dietmar [Kemet Electronics GmbH, Landsberg am Lech (Germany)
2011-06-15
The power electronics components in today's hybrid vehicles are situated at different places in the vehicle - till now far away from harsh and hot surroundings. In order to develop an integrated solution near the transmission, ZF and BMW launched the research project 'Electric components for active power transmissions' (EfA). On the basis of an eight-speed full hybrid transmission and together with Infineon, Kemet, Liebherr, and the University of Technology of Chemnitz, they are developing a power electronics unit, which facilitates doubling the power density while increasing the operating temperature. The project EfA will be concluded in June 2011. (orig.)
International Nuclear Information System (INIS)
Dey, G. K.
2011-01-01
Transmission Electron Microscopy (TEM), because of its ability to image atomic arrangements directly and its ability to give spectroscopic information at similar resolution has emerged as a very powerful tool for understanding the structure of materials at atomic level. TEM has been particularly useful in resolving the interface structures in materials. This form of microscopy is very suitable for resolving the structure and defects in ultrafine microstructures such as those of the nanocrystalline phases. After a brief description of the different characterization abilities of the aberration corrected transmission electron microscope, this presentation describes the results of TEM investigations on nanocrystalline microstructures generated by laser materials interaction and due to interaction of electrons and ions with materials. Excimer laser has become an attractive choice for new and precision application for ablation and deposition in recent times. In this work, a KrF excimer laser having 30 ns pulse width and 600 mJ energy at source has been used to deposit zirconia on Zr-base alloy in order to explore the ability of the thin oxide film to act as a diffusion barrier to hydrogen ingress into the alloy. It has been found that the variation in pressure by an order of three has resulted in maximum influence on the roughness of the laser deposited oxide film that has not been possible to achieve by other parameters within the range of the instrument. Present study has also indicated an interrelation among the roughness, adherence and the film-thickness, where the last one is indicated by the XPS study. Transmission electron microscopy was carried out to study the size, size distribution and defects in the deposited film. Nanocrystalline phases generated by interaction of electron and ion irradiation of Zr based alloys; Ni based alloys and Fe based alloys have been examined in detail by conventional and high resolution transmission electron microscopy. Results of
International Nuclear Information System (INIS)
Sayre, D.; Feder, R.; Spiller, E.; Kirz, J.; Kim, D.M.
1977-01-01
The minimum radiation dosage in a specimen consistent with transmission microscopy at resolution d and specimen thickness t is calculated for model specimens resembling biological materials in their natural state. The calculations cover 10 4 -10 7 eV electrons and 1.3-90 A photons in a number of microscopy modes. The results indicate that over a considerable part of the (t,d)-plane transmission microscopy on such specimens can be carried out at lower dosage with photons than with electrons. Estimates of the maximum resolutions obtainable with electrons and photons, consistent with structural survival of the specimen, are obtained, as are data on optimal operating conditions for microscopy with the two particles
Electron scattering resonances and dissociative attachment in polyatomic molecules
International Nuclear Information System (INIS)
Olthoff, J.K.
1985-01-01
A relatively new technique, electron transmission spectroscopic, is now being used to investigate the unoccupied valence molecular orbitals of many chemical compounds. Electron-transmission spectroscopy measures the energy of negative ion states that arise from electron capture into unoccupied molecular orbitals. Additional information about the unoccupied orbitals may be obtained if the negative ion decays by way of dissociation. Determination of the identity, kinetic energy, and production rates of stable ion fragments supplies information about the shape and position of the potential energy curves which describe the electronic states of the molecule and the anion. Used together, photoelectron, electron transmission, and dissociation data can produce a complete picture of a molecule's valence electronic structure. For this work, a time-of-flight mass spectrometer was attached to an electron transmission spectrometer to observe negative ion fragments due to dissociative attachment. The mass spectrometer measures the identify and kinetic energy of stable negative ions as a function of incident electron energy. Electron transmission spectra and ion production data were acquired for many compounds in four chemical categories
Cryo-transmission electron microscopy of Ag nanoparticles grown on an ionic liquid substrate
Anjum, Dalaver H.; Stiger, Rebecca M.; Finley, James J.; Conway, James F.
2010-01-01
We report a novel method of growing silver nanostructures by cathodic sputtering onto an ionic liquid (IL) and our visualization by transmission cryo-electron microscopy to avoid beam-induced motion of the nanoparticles. By freezing the IL
Energy Technology Data Exchange (ETDEWEB)
Abe, Hiroaki; Naramoto, Hiroshi [Japan Atomic Energy Research Inst., Takasaki, Gunma (Japan). Takasaki Radiation Chemistry Research Establishment; Hojou, Kiichi; Furuno, Shigemi; Tsukamoto, Tetsuo
1997-03-01
We have developed the transmission/analytical electron microscope interfaced with two sets of ion accelerators (TEM-Accelerators Facility) at JAERI-Takasaki. The facility is expected to provide quantitative insights into radiation effects, such as damage evolution, irradiation-induced phase transformation and their stability, through in-situ observation and analysis under ion and/or electron irradiation. The TEM-Accelerators Facility and its application to materials research are reviewed. (author)
International Nuclear Information System (INIS)
Yang, H.; Chi, Z. H.; Yao, L. D.; Zhang, W.; Li, F. Y.; Jin, C. Q.; Yu, R. C.
2006-01-01
The multiferroic material BiMnO 3 synthesized under high pressure has been systematically studied by transmission electron microscopy and electron energy-loss spectroscopy, and some important structural defects are revealed in this multiferroic material. The frequently observed defects are characterized to be Σ3(111) twin boundaries, Ruddlesden-Popper [Acta Crystallogr. 11, 54 (1958)] antiphase boundaries, and a p p superdislocations connected with a small segment of Ruddlesden-Popper defect. These defects are present initially in the as-synthesized sample. In addition, we find that ordered voids (oxygen vacancies) are easily introduced into the multiferroic BiMnO 3 by electron-beam irradiation
Dutta, Aniruddha; Yuan, Biao; Clukay, Christopher J.; Grabill, Christopher N.; Heinrich, Helge; Bhattacharya, Aniket; Kuebler, Stephen M.
2012-02-01
We report on the quantitative analysis of electrolessly deposited Au and Ag nanoparticles (NPs) on SU8 polymer with the help of High-Angle Annular Dark-Field Scanning Transmission Electron Microscopy (HAADF-STEM) in tilt series. Au NPs act as nucleating agents for the electroless deposition of silver. Au NPs were prepared by attachingAu^3+cations to amine functionalized SU8 polymeric surfaces and then reducing it with aqueous NaBH4. The nanoscale morphology of the deposited NPs on the surface of polymer has been studied from the dark field TEM cross sectional images. Ag NPs were deposited on the cross-linked polymeric surface from a silver citrate solution reduced by hydroquinone. HAADF-STEM enables us to determine the distances between the NPs and their exact locations at and near the surface. The particle distribution, sizes and densities provide us with the data necessary to control the parameters for the development of the electroless deposition technique for emerging nanoscale technologies.
Locci, E.; Dehos, C.; De Lurgio, P.; Djurcic, Z.; Drake, G.; Gimenez, J. L. Gonzalez; Gustafsson, L.; Kim, D.W.; Roehrich, D.; Schoening, A.; Siligaris, A.; Soltveit, H.K.; Ullaland, K.; Vincent, P.; Wiednert, D.; Yang, S.; Brenner, R.
2015-01-01
Wireless techniques have developed extremely fast over the last decade and using them for data and power transmission in particle physics detectors is not science- fiction any more. During the last years several research groups have independently thought of making it a reality. Wireless techniques became a mature field for research and new developments might have impact on future particle physics experiments. The Instrumentation Frontier was set up as a part of the SnowMass 2013 Community Summer Study [1] to examine the instrumentation R&D for the particle physics research over the coming decades: {\\guillemotleft} To succeed we need to make technical and scientific innovation a priority in the field {\\guillemotright}. Wireless data transmission was identified as one of the innovations that could revolutionize the transmission of data out of the detector. Power delivery was another challenge mentioned in the same report. We propose a collaboration to identify the specific needs of different projects that m...
Principle of energy-filtering transmission electron microscopy and its applications
International Nuclear Information System (INIS)
Kurata, Hiroki
1997-01-01
Energy-filtering transmission electron microscopy (EFTEM) is widely used to make images and diffraction patterns more quantitative by removing the inelastic background, and to perform elemental and chemical mapping at high spatial resolution. The principal factors restricting the spatial resolution in elemental maps are discussed. The relativistic effect on inelastic scattering cross-section, which becomes significant for high-voltage EFTEM analysis, is also discussed in relation to the detection efficiency of core-loss signals. (author)
International Nuclear Information System (INIS)
Yurdakul, Hilmi; Idrobo, Juan C.; Pennycook, Stephen J.; Turan, Servet
2011-01-01
Direct visualization of rare earths in α- and β-SiAlON unit-cells is performed through Z-contrast imaging technique in an aberration-corrected scanning transmission electron microscope. The preferential occupation of Yb and Ce atoms in different interstitial locations of β-SiAlON lattice is demonstrated, yielding higher solubility for Yb than Ce. The triangular-like host sites in α-SiAlON unit cell accommodate more Ce atoms than hexagonal sites in β-SiAlON. We think that our results will be applicable as guidelines for many kinds of rare-earth-doped materials.
van Wachem, P.B.; van Luyn, M.J.A.; Nieuwenhuis, P.; Koerten, H.K.; Olde damink, L.H.H.; Olde-Damink, L.; ten Hoopen, Hermina W.M.; Feijen, Jan
1991-01-01
The in vivo degradation of hexamethylenediisocyanate-tanned dermal sheep collagen was studied with transmission electron microscopy. Discs of hexamethylenediisocyanate-tanned dermal sheep collagen were subcutaneously implanted in rats. Both an intra- and an extracellular route of degradation could
H. Jinnai (Hiroshi); T. Higuchi (Takeshi); X. Zhuge (Jason); A. Kumamoto (Akihito); K.J. Batenburg (Joost); Y. Ikuhara (Yuichi)
2017-01-01
textabstractSelf-assembling structures and their dynamical processes in polymeric systems have been investigated using three-dimensional transmission electron microscopy (3D-TEM). Block copolymers (BCPs) self-assemble into nanoscale periodic structures called microphase-separated structures, a deep
Reconstruction and visualization of nanoparticle composites by transmission electron tomography
Energy Technology Data Exchange (ETDEWEB)
Wang, X.Y. [National Institute for Nanotechnology, 11421 Saskatchewan Drive, Edmonton, Canada T6H 2M9 (Canada); Department of Physics, University of Alberta, Edmonton, Canada T6G 2G7 (Canada); Lockwood, R. [National Institute for Nanotechnology, 11421 Saskatchewan Drive, Edmonton, Canada T6H 2M9 (Canada); Malac, M., E-mail: marek.malac@nrc-cnrc.gc.ca [National Institute for Nanotechnology, 11421 Saskatchewan Drive, Edmonton, Canada T6H 2M9 (Canada); Department of Physics, University of Alberta, Edmonton, Canada T6G 2G7 (Canada); Furukawa, H. [SYSTEM IN FRONTIER INC., 2-8-3, Shinsuzuharu bldg. 4F, Akebono-cho, Tachikawa-shi, Tokyo 190-0012 (Japan); Li, P.; Meldrum, A. [National Institute for Nanotechnology, 11421 Saskatchewan Drive, Edmonton, Canada T6H 2M9 (Canada)
2012-02-15
This paper examines the limits of transmission electron tomography reconstruction methods for a nanocomposite object composed of many closely packed nanoparticles. Two commonly used reconstruction methods in TEM tomography were examined and compared, and the sources of various artefacts were explored. Common visualization methods were investigated, and the resulting 'interpretation artefacts' ( i.e., deviations from 'actual' particle sizes and shapes arising from the visualization) were determined. Setting a known or estimated nanoparticle volume fraction as a criterion for thresholding does not in fact give a good visualization. Unexpected effects associated with common built-in image filtering methods were also found. Ultimately, this work set out to establish the common problems and pitfalls associated with electron beam tomographic reconstruction and visualization of samples consisting of closely spaced nanoparticles. -- Highlights: Black-Right-Pointing-Pointer Electron tomography limits were explored by both experiment and simulation. Black-Right-Pointing-Pointer Reliable quantitative volumetry using electron tomography is not presently feasible. Black-Right-Pointing-Pointer Volume rendering appears to be better choice for visualization of composite samples.
Wang, Peng; Behan, Gavin; Kirkland, Angus I; Nellist, Peter D; Cosgriff, Eireann C; D'Alfonso, Adrian J; Morgan, Andrew J; Allen, Leslie J; Hashimoto, Ayako; Takeguchi, Masaki; Mitsuishi, Kazutaka; Shimojo, Masayuki
2011-06-01
Scanning confocal electron microscopy (SCEM) offers a mechanism for three-dimensional imaging of materials, which makes use of the reduced depth of field in an aberration-corrected transmission electron microscope. The simplest configuration of SCEM is the bright-field mode. In this paper we present experimental data and simulations showing the form of bright-field SCEM images. We show that the depth dependence of the three-dimensional image can be explained in terms of two-dimensional images formed in the detector plane. For a crystalline sample, this so-called probe image is shown to be similar to a conventional diffraction pattern. Experimental results and simulations show how the diffracted probes in this image are elongated in thicker crystals and the use of this elongation to estimate sample thickness is explored. Copyright © 2010 Elsevier B.V. All rights reserved.
Investigating the use of in situ liquid cell scanning transmission electron microscopy
Energy Technology Data Exchange (ETDEWEB)
Nguy, Amanda [Iowa State Univ., Ames, IA (United States)
2016-02-19
Engineering nanoparticles with desired shape-dependent properties is the key to many applications in nanotechnology. Although many synthetic procedures exist to produce anisotropic gold nanoparticles, the dynamics of growth are typically unknown or hypothetical. In the case of seed-mediated growth in the presence of DNA into anisotropic nanoparticles, it is not known exactly how DNA directs growth into specific morphologies. A series of preliminary experiments were carried out to contribute to the investigation of the possible mechanism of DNA-mediated growth of gold nanoprisms into gold nanostars using liquid cell scanning transmission electron microscopy (STEM). Imaging in the liquid phase was achieved through the use of a liquid cell platform and liquid cell holder that allow the sample to be contained within a “chip sandwich” between two electron transparent windows. Ex situ growth experiments were performed using Au-T30 NPrisms (30-base thymine oligonucleotide-coated gold nanoprisms) that are expected to grow into gold nanostars. Growth to form these nanostars were imaged using TEM (transmission electron microscopy) and liquid cell STEM (scanning transmission electron microscopy). An attempt to perform in situ growth experiments with the same Au-T30 nanoprisms revealed challenges in obtaining desired morphology results due to the environmental differences within the liquid cell compared to the ex situ environment. Different parameters in the experimental method were explored including fluid line set up, simultaneous and alternating reagent addition, and the effect of different liquid cell volumes to ensure adequate flow of reagents into the liquid cell. Lastly, the binding affinities were compared for T30 and A30 DNA incubated with gold nanoparticles using zeta potential measurements, absorption spectroscopy, and isothermal titration calorimetry (ITC). It was previously reported thymine bases have a lower binding affinity to gold surfaces than adenine
Czech Academy of Sciences Publication Activity Database
Němec, Martin; Gärtnerová, Viera; Klementová, Mariana; Jäger, Aleš
2015-01-01
Roč. 106, Aug (2015), s. 428-436 ISSN 1044-5803 R&D Projects: GA ČR GBP108/12/G043 Institutional support: RVO:68378271 Keywords : biomedical alloy s * heat treatment * microstructure * transmission electron microscopy * electron diffraction Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 2.383, year: 2015
International Nuclear Information System (INIS)
Paske, W.C.; Shadfar, S.; Lorentz, S.R.; Steph, N.C.; Golden, D.E.
1981-01-01
A digital technique has been developed which allows the study of narrow structure in total electron-atom and electron-molecule scattering cross sections without requiring a highly monoenergetic electron beam, modulation of the electron gun, or phase sensitive detection. The electron current transmitted through a gas cell is digitized as the electron energy is stepped by ΔE through the energy range of interest. A transmitted electron difference signal is then obtained using a computer. As examples of this technique, the difference spectra are presented for He near 19.35 eV and for N 2 for the energy range from 10.3 to 15.0 eV. In the present case an instrumental resolution of 30 meV FWHM has been obtained
Photocathode Optimization for a Dynamic Transmission Electron Microscope: Final Report
Energy Technology Data Exchange (ETDEWEB)
Ellis, P; Flom, Z; Heinselman, K; Nguyen, T; Tung, S; Haskell, R; Reed, B W; LaGrange, T
2011-08-04
The Dynamic Transmission Electron Microscope (DTEM) team at Harvey Mudd College has been sponsored by LLNL to design and build a test setup for optimizing the performance of the DTEM's electron source. Unlike a traditional TEM, the DTEM achieves much faster exposure times by using photoemission from a photocathode to produce electrons for imaging. The DTEM team's work is motivated by the need to improve the coherence and current density of the electron cloud produced by the electron gun in order to increase the image resolution and contrast achievable by DTEM. The photoemission test setup is nearly complete and the team will soon complete baseline tests of electron gun performance. The photoemission laser and high voltage power supply have been repaired; the optics path for relaying the laser to the photocathode has been finalized, assembled, and aligned; the internal setup of the vacuum chamber has been finalized and mostly implemented; and system control, synchronization, and data acquisition has been implemented in LabVIEW. Immediate future work includes determining a consistent alignment procedure to place the laser waist on the photocathode, and taking baseline performance measurements of the tantalum photocathode. Future research will examine the performance of the electron gun as a function of the photoemission laser profile, the photocathode material, and the geometry and voltages of the accelerating and focusing components in the electron gun. This report presents the team's progress and outlines the work that remains.
International Nuclear Information System (INIS)
Beleggia, M.; Pozzi, G.
2001-01-01
An approach is presented for the calculation of the electron optical phase shift experienced by high-energy electrons in a transmission electron microscope, when they interact with the magnetic field associated with superconducting fluxons in a thin specimen tilted with respect to the beam. It is shown that by decomposing the vector potential in its Fourier components and by calculating the phase shift of each component separately, it is possible to obtain the Fourier transform of the electron optical phase shift, which can be inverted either analytically or numerically. It will be shown how this method can be used to recover the result, previously obtained by the real-space approach, relative to the case of a straight flux tube perpendicular to the specimen surfaces. Then the method is applied to the case of a London fluxon in a thin film, where the bending and the broadening of the magnetic-field lines due to the finite specimen thickness are now correctly taken into account and not treated approximately by means of a parabolic fit. Finally, it will be shown how simple models for the pancake structure of the fluxon can be analyzed within this framework and the main features of electron transmission images predicted
de Jonge, Niels [Oak Ridge, TN
2010-08-17
A confocal scanning transmission electron microscope which includes an electron illumination device providing an incident electron beam propagating in a direction defining a propagation axis, and a precision specimen scanning stage positioned along the propagation axis and movable in at least one direction transverse to the propagation axis. The precision specimen scanning stage is configured for positioning a specimen relative to the incident electron beam. A projector lens receives a transmitted electron beam transmitted through at least part of the specimen and focuses this transmitted beam onto an image plane, where the transmitted beam results from the specimen being illuminated by the incident electron beam. A detection system is placed approximately in the image plane.
Comparison of three techniques for skin total irradiation with electrons
International Nuclear Information System (INIS)
Batista, Delano V.S.; Bardella, Lucia H.; Rosa, Luiz A.R. da
2011-01-01
This paper compared three techniques of skin total irradiation with electrons: 1) horizontal positioning, 2) vertical positioning - rotatory technique and 3) vertical positioning - six fields technique. For that, a anthropomorphic phantom was positioned according to the recommendation for each technique and was i radiated at the linear accelerator by using the 6 MeV electrons. Radiochromic films were positioned on the surface in various regions of the phantom for measurement of absorbed dose. A ionization chamber was positioned inside of equivalent issue plates for dose evaluation due to the photons produced by electron stopping. The technique 2 and 3 have shown too similar in the results and number or discrepant points (8 and 10 respectively) of prescription lower than the technique 1 (22 points). The total body dose of photons of the 1, 2 and 3 techniques was 2.2%, 5.3% and 5.2% respectively
Transmission electron microscope sample holder with optical features
Milas, Mirko [Port Jefferson, NY; Zhu, Yimei [Stony Brook, NY; Rameau, Jonathan David [Coram, NY
2012-03-27
A sample holder for holding a sample to be observed for research purposes, particularly in a transmission electron microscope (TEM), generally includes an external alignment part for directing a light beam in a predetermined beam direction, a sample holder body in optical communication with the external alignment part and a sample support member disposed at a distal end of the sample holder body opposite the external alignment part for holding a sample to be analyzed. The sample holder body defines an internal conduit for the light beam and the sample support member includes a light beam positioner for directing the light beam between the sample holder body and the sample held by the sample support member.
Energy Technology Data Exchange (ETDEWEB)
Feng, Zhenbao; Yang, Bing; Lin, Yangming; Su, Dangsheng, E-mail: dssu@imr.ac.cn [Shenyang National Laboratory of Materials Science, Institute of Metal Research, Chinese Academy of Sciences, Wenhua Road 72, Shenyang 110016 (China)
2015-12-07
The electron momentum distribution of detonation nanodiamonds (DND) was investigated by recording electron energy-loss spectra at large momentum transfer in the transmission electron microscope (TEM), which is known as electron Compton scattering from solid (ECOSS). Compton profile of diamond film obtained by ECOSS was found in good agreement with prior photon experimental measurement and theoretical calculation that for bulk diamond. Compared to the diamond film, the valence Compton profile of DND was found to be narrower, which indicates a more delocalization of the ground-state charge density for the latter. Combining with other TEM characterizations such as high-resolution transmission electron spectroscopy, diffraction, and energy dispersive X-ray spectroscopy measurements, ECOSS was shown to be a great potential technique to study ground-state electronic properties of nanomaterials.
International Nuclear Information System (INIS)
Goulet, T.; Jay-Gerin, J.-P.
1986-01-01
A theoretical study of the transmission of low-energy (0 to 10 eV) electrons incident from vacuum through thin-film organic molecular solids deposited on a cold metal substrate is presented and developed for the specific case of solid benzene. In essence, using a semiclassical description of electron transport in solids with an energy-independent scattering mean free path and assuming an isotropic electron scattering, the behavior of a penetrating electron in the film is simulated when a large number of scattering events are present. The good agreement between the calculated electron transmission spectra and those obtained experimentally indicates that our study provides a realistic description of the electron transport in the film, and accounts for the influence of the various electron-molecule scattering processes upon the energy dependence of the transmitted current. In particular, we show that the excitonic subionization energy losses are at the origin of the main structures of the observed electron transmission spectra. It is also shown that our study can successfully be used to estimate the probabilities of the various electron scattering processes which occur in the film, as well as the electron mean free path (l). For solid benzene, l is about 8 A in the considered electron energy range. (author)
Ali, Haider
2017-08-15
In this study, the cross-section of electron-selective titanium oxide (TiO2) contacts for n-type crystalline silicon solar cells were investigated by transmission electron microscopy. It was revealed that the excellent cell efficiency of 21.6% obtained on n-type cells, featuring SiO2/TiO2/Al rear contacts and after forming gas annealing (FGA) at 350°C, is due to strong surface passivation of SiO2/TiO2 stack as well as low contact resistivity at the Si/SiO2/TiO2 heterojunction. This can be attributed to the transformation of amorphous TiO2 to a conducting TiO2-x phase. Conversely, the low efficiency (9.8%) obtained on cells featuring an a-Si:H/TiO2/Al rear contact is due to severe degradation of passivation of the a-Si:H upon FGA.
Directory of Open Access Journals (Sweden)
Tsutomu Uchida
2018-03-01
Full Text Available Water containing ultra-fine bubbles (UFB may promote plant growth. But, as UFBs are too small to distinguish from other impurities in a nutrient solution, it is not known if UFBs survive transport from the water source to the rhizosphere. Here we use the freeze-fracture replica method and a transmission electron microscope (TEM to observe UFBs in the nutrient solutions used in a crop-growing system known as a plant factory. In this factory, TEM images taken from various points in the supply line indicate that the concentration of UFBs in the nutrient solution is conserved, starting from their addition to the nutrient solution in the buffer tank, through the peat-moss layer, all the way to the rhizosphere. Measurements also show that a thin film formed on the surface of UFBs in the nutrient solution, with greater film thickness at the rhizosphere. This film is considered to be made from the accumulation of impurities coming from solute and the peat-moss layer.
The electron transport problem sampling by Monte Carlo individual collision technique
International Nuclear Information System (INIS)
Androsenko, P.A.; Belousov, V.I.
2005-01-01
The problem of electron transport is of most interest in all fields of the modern science. To solve this problem the Monte Carlo sampling has to be used. The electron transport is characterized by a large number of individual interactions. To simulate electron transport the 'condensed history' technique may be used where a large number of collisions are grouped into a single step to be sampled randomly. Another kind of Monte Carlo sampling is the individual collision technique. In comparison with condensed history technique researcher has the incontestable advantages. For example one does not need to give parameters altered by condensed history technique like upper limit for electron energy, resolution, number of sub-steps etc. Also the condensed history technique may lose some very important tracks of electrons because of its limited nature by step parameters of particle movement and due to weakness of algorithms for example energy indexing algorithm. There are no these disadvantages in the individual collision technique. This report presents some sampling algorithms of new version BRAND code where above mentioned technique is used. All information on electrons was taken from Endf-6 files. They are the important part of BRAND. These files have not been processed but directly taken from electron information source. Four kinds of interaction like the elastic interaction, the Bremsstrahlung, the atomic excitation and the atomic electro-ionization were considered. In this report some results of sampling are presented after comparison with analogs. For example the endovascular radiotherapy problem (P2) of QUADOS2002 was presented in comparison with another techniques that are usually used. (authors)
Transmission electron microscopy investigation of Bi-2223/Ag tapes
DEFF Research Database (Denmark)
Andersen, L.G.; Bals, S.; Tendeloo, G. Van
2001-01-01
during the tape processing, (3) a study of the grain boundaries on an atomic scale, including intergrowth investigations. Tapes with different process parameters have been compared with respect to the microstructure. A fully processed tape has on the average 50% thicker Bi-2223 grains than a tape after......The microstructure of (Bi,Pb)(2)Sr2Ca2CuOx (Bi-2223) tapes has been investigated by means of transmission electron microscopy (TEM) and high-resolution TEM. The emphasis has been placed on: (1) an examination of the grain morphology and size, (2) grain and colony boundary angles, which are formed...
Comparative study of low-energy neutral atom imaging techniques
International Nuclear Information System (INIS)
Funsten, H.O.; McComas, D.J.; Scime, E.E.
1994-01-01
Low-energy neutral atom (LENA) imaging promise to be a revolutionary tool for global imaging of space plasmas. The technical challenges of LENA detection include separating them from the intense ambient UV without losing information about their incident trajectories, quantifying their trajectories, and obtaining high-sensitivity measurements. Two techniques that have been proposed for this purpose are based on fundamentally different atomic interaction mechanisms between LENAs and a solid; LENA transmission through an ultra thin foil and LENA reflection from a solid surface. Both of these methods provide LENA ionization (for subsequent removal from the UV by electrostatic deflection) and secondary electron emission (for time-of-flight start pulse generation and/or coincidence). They present a comparative study of the transmission and reflection techniques based on differences in atomic interactions with solids and surfaces. Transmission methods are shown to be superior for secondary electron emission rather than reflection methods. Furthermore, transmission methods are shown to be a sufficient for LENA imaging at LENA energies of approximately 1 keV to greater than 30 keV. A hybrid instrument using reflection from a low work function surface for LENA ionization and transmission for secondary electron emission is optimal for imaging of LENAs with energies less than approximately 1 keV
Armigliato, A.
2008-07-01
In the present and future CMOS technology, due to the ever shrinking geometries of the electronic devices, the availability of techniques capable of performing quantitative analyses of the relevant parameters (structural, chemical, mechanical) at a nanoscale is of a paramount importance. The influence of these features on the electrical performances of the nanodevices is a key issue for the nanoelectronics industry. In the recent years, a significant progress has been made in this field by a number of techniques, such as X-ray diffraction, in particular with the advent of synchrotron sources, ion-microbeam based Rutherford backscattering and channeling spectrometry, and micro Raman spectrometry. In addition, secondary ion mass spectrometry (SIMS) has achieved an important role in the determination of the dopant depth profile in ultra-shallow junctions (USJs) in silicon. However, the technique which features the ultimate spatial resolution (at the nanometer scale) is scanning transmission electron microscopy (STEM). In this presentation it will be reported on the nanoanalysis by STEM of two very important physical quantities which need to be controlled in the fabrication processes of nanodevices: the dopant profile in the USJs and the lattice strain that is generated in the Si electrically active regions of isolation structures by the different technological steps. The former quantity is investigated by the so-called Z-contrast high-angle annular dark field (HAADF-STEM) method, whereas the mechanical strain can be two-dimensionally mapped by the convergent beam electron diffraction (CBED-STEM) method. A spatial resolution lower than one nanometer and of a few nanometers can be achieved in the two cases, respectively. To keep the pace with the scientific and technological progress an increasingly wide array of analytical techniques is necessary; their complementary role in the solution of present and future characterization problems must be exploited. Presently
Czech Academy of Sciences Publication Activity Database
Agudo Jácome, L.; Eggeler, G.; Dlouhý, Antonín
2012-01-01
Roč. 122, NOV (2012), s. 48-59 ISSN 0304-3991 R&D Projects: GA ČR GA202/09/2073 Institutional research plan: CEZ:AV0Z20410507 Keywords : stereoscopy * scanning transmission electron microscopy * single crystal Ni-base superalloys * Dislocation substructures * Foil thickness measurement Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 2.470, year: 2012
Microstructure of NiTi orthodontic wires observations using transmission electron microscopy
Ferčec, J.; Jenko, D.; Buchmeister, B.; Rojko, F.; Budič, B.; Kosec, B.; Rudolf, R.
2014-01-01
This work presents the results of the microstructure observation of six different types of NiTi orthodontic wires by using Transmission Electron Microscopy (TEM). Within these analyses the chemical compositions of each wire were observed in different places by applying the EDS detector. Namely, the chemical composition in the orthodontic wires is very important because it shows the dependence between the phase temperatures and mechanical properties. Microstructure observations showed that ort...
DEFF Research Database (Denmark)
Hansen, Thomas Willum; Wagner, Jakob Birkedal; Dunin-Borkowski, Rafal E.
2010-01-01
The latest generation of environmental transmission electron microscopes incorporates aberration correctors and monochromators, allowing studies of chemical reactions and growth processes with improved spatial resolution and spectral sensitivity. Here, we describe the performance of such an instr...
Araújo, Iván Gómez; Sánchez, Jesús Antonio García; Andersen, Palle
2018-05-01
Transmissibility-based operational modal analysis is a recent and alternative approach used to identify the modal parameters of structures under operational conditions. This approach is advantageous compared with traditional operational modal analysis because it does not make any assumptions about the excitation spectrum (i.e., white noise with a flat spectrum). However, common methodologies do not include a procedure to extract closely spaced modes with low signal-to-noise ratios. This issue is relevant when considering that engineering structures generally have closely spaced modes and that their measured responses present high levels of noise. Therefore, to overcome these problems, a new combined method for modal parameter identification is proposed in this work. The proposed method combines blind source separation (BSS) techniques and transmissibility-based methods. Here, BSS techniques were used to recover source signals, and transmissibility-based methods were applied to estimate modal information from the recovered source signals. To achieve this combination, a new method to define a transmissibility function was proposed. The suggested transmissibility function is based on the relationship between the power spectral density (PSD) of mixed signals and the PSD of signals from a single source. The numerical responses of a truss structure with high levels of added noise and very closely spaced modes were processed using the proposed combined method to evaluate its ability to identify modal parameters in these conditions. Colored and white noise excitations were used for the numerical example. The proposed combined method was also used to evaluate the modal parameters of an experimental test on a structure containing closely spaced modes. The results showed that the proposed combined method is capable of identifying very closely spaced modes in the presence of noise and, thus, may be potentially applied to improve the identification of damping ratios.
Scanning transmission electron microscopy: Albert Crewe's vision and beyond
International Nuclear Information System (INIS)
Krivanek, Ondrej L.; Chisholm, Matthew F.; Murfitt, Matthew F.; Dellby, Niklas
2012-01-01
Some four decades were needed to catch up with the vision that Albert Crewe and his group had for the scanning transmission electron microscope (STEM) in the nineteen sixties and seventies: attaining 0.5 Å resolution, and identifying single atoms spectroscopically. With these goals now attained, STEM developments are turning toward new directions, such as rapid atomic resolution imaging and exploring atomic bonding and electronic properties of samples at atomic resolution. The accomplishments and the future challenges are reviewed and illustrated with practical examples. -- Highlights: ► TV-rate STEM imaging of heavy atoms is demonstrated. ► DNA sequencing by STEM dark field imaging should be possible at a rate of 10 6 bases/s. ► Individual silicon atom impurities in graphene are imaged atom-by-atom. ► Single atoms of nitrogen and boron incorporated in graphene are imaged spectroscopically. ► Bonding of individual atoms can be probed by analyzing the fine structures of their EEL spectra.
International Nuclear Information System (INIS)
Laak, Jeroen A.W.M. van der; Dijkman, Henry B.P.M.; Pahlplatz, Martin M.M.
2006-01-01
The magnification factor in transmission electron microscopy is not very precise, hampering for instance quantitative analysis of specimens. Calibration of the magnification is usually performed interactively using replica specimens, containing line or grating patterns with known spacing. In the present study, a procedure is described for automated magnification calibration using digital images of a line replica. This procedure is based on analysis of the power spectrum of Fourier transformed replica images, and is compared to interactive measurement in the same images. Images were used with magnification ranging from 1,000x to 200,000x. The automated procedure deviated on average 0.10% from interactive measurements. Especially for catalase replicas, the coefficient of variation of automated measurement was considerably smaller (average 0.28%) compared to that of interactive measurement (average 3.5%). In conclusion, calibration of the magnification in digital images from transmission electron microscopy may be performed automatically, using the procedure presented here, with high precision and accuracy
International Nuclear Information System (INIS)
Liu, X.; Nuhfer, N.T.; Rollett, A.D.; Sinha, S.; Lee, S.-B.; Carpenter, J.S.; LeDonne, J.E.; Darbal, A.; Barmak, K.
2014-01-01
A transmission-electron-microscope-based orientation mapping technique that makes use of beam precession to achieve near-kinematical conditions was used to map the phase and crystal orientations in nanolamellar Cu/Nb composites with average layer thicknesses of 86, 30 and 18 nm. Maps of high quality and reliability were obtained by comparing the recorded diffraction patterns with pre-calculated templates. Particular care was taken in optimizing the dewarping parameters and in calibrating the frames of reference. Layers with thicknesses as low as 4 nm were successfully mapped. Heterophase interface plane and character distributions (HIPD and HICD, respectively) of Cu and Nb phases from the samples were determined from the orientation maps. In addition, local orientation relation stereograms of the Cu/Nb interfaces were calculated, and these revealed the detailed layer-to-layer texture information. The results are in agreement with previously reported neutron-diffraction-based and precession-electron-diffraction-based measurements on an accumulated roll bonding (ARB)-fabricated Cu/Nb sample with an average layer thickness of 30 nm as well as scanning-electron-microscope-based electron backscattered diffraction HIPD/HICD plots of ARB-fabricated Cu/Nb samples with layer thicknesses between 200 and 600 nm
International Nuclear Information System (INIS)
Baba-Kishi, K.Z.; Barber, D.J.
1990-01-01
An account is given of transmission electron microscope investigations of the phase transitions in single crystals and ceramics of the complex perovskite-structured ferroelectric 'relaxor' compound Pb(Sc 1/2 Ta 1/2 )O 3 . The crystal symmetries pertaining to both the non-polar paraelectric (PE) and polar ferroelectric (FE) states have been studied by the technique of convergent-beam electron diffraction. A new phase transition has been discovered in the temperature range for which the FE and PE states coexist. The new phase transition is interpreted as the creation of a modulated antiferroelectric state, and this is viewed as marking a departure from relaxor behaviour towards more 'normal' ferroelectric behaviour. (orig.)
The electron transport problem sampling by Monte Carlo individual collision technique
Energy Technology Data Exchange (ETDEWEB)
Androsenko, P.A.; Belousov, V.I. [Obninsk State Technical Univ. of Nuclear Power Engineering, Kaluga region (Russian Federation)
2005-07-01
The problem of electron transport is of most interest in all fields of the modern science. To solve this problem the Monte Carlo sampling has to be used. The electron transport is characterized by a large number of individual interactions. To simulate electron transport the 'condensed history' technique may be used where a large number of collisions are grouped into a single step to be sampled randomly. Another kind of Monte Carlo sampling is the individual collision technique. In comparison with condensed history technique researcher has the incontestable advantages. For example one does not need to give parameters altered by condensed history technique like upper limit for electron energy, resolution, number of sub-steps etc. Also the condensed history technique may lose some very important tracks of electrons because of its limited nature by step parameters of particle movement and due to weakness of algorithms for example energy indexing algorithm. There are no these disadvantages in the individual collision technique. This report presents some sampling algorithms of new version BRAND code where above mentioned technique is used. All information on electrons was taken from Endf-6 files. They are the important part of BRAND. These files have not been processed but directly taken from electron information source. Four kinds of interaction like the elastic interaction, the Bremsstrahlung, the atomic excitation and the atomic electro-ionization were considered. In this report some results of sampling are presented after comparison with analogs. For example the endovascular radiotherapy problem (P2) of QUADOS2002 was presented in comparison with another techniques that are usually used. (authors)
Observations of silicon carbide by high resolution transmission electron microscopy
International Nuclear Information System (INIS)
Smith, D.J.; Jepps, N.W.; Page, T.F.
1978-01-01
High resolution transmission electron microscopy techniques, principally involving direct lattice imaging, have been used as part of a study of the crystallography and phase transformation mechanics of silicon carbide polytypes. In particular, the 3C (cubic) and 6H (hexagonal) polytypes have been examined together with partially transformed structural mixtures. Although direct observation of two-dimensional atomic structures was not possible at an operating voltage of 100 kV, considerable microstructural information has been obtained by careful choice of the experimental conditions. In particular, tilted beam observations of the 0.25 nm lattice fringes have been made in the 3C polytype for two different brace 111 brace plane arrays in order to study the dimensions and coherency of finely-twinned regions together with brace 0006 brace and brace 1 0 bar1 2 brace lattice images in the 6H polytype which allow the detailed stacking operations to be resolved. Lower resolution lattice images formed with axial illumination have also been used to study the nature of the 3C → 6H transformation and results are presented showing that the transformation interface may originate with fine twinning of the 3C structure followed by growth of the resultant 6H regions. Observations have been made of the detailed stepped structure of this interface together with the stacking fault distribution in the resultant 6H material. (author)
Characterization of a direct detection device imaging camera for transmission electron microscopy
Energy Technology Data Exchange (ETDEWEB)
Milazzo, Anna-Clare, E-mail: amilazzo@ncmir.ucsd.edu [University of California at San Diego, 9500 Gilman Dr., La Jolla, CA 92093 (United States); Moldovan, Grigore [Department of Materials, University of Oxford, Parks Road, Oxford OX1 3PH (United Kingdom); Lanman, Jason [Department of Molecular Biology, The Scripps Research Institute, La Jolla, CA 92037 (United States); Jin, Liang; Bouwer, James C. [University of California at San Diego, 9500 Gilman Dr., La Jolla, CA 92093 (United States); Klienfelder, Stuart [University of California at Irvine, Irvine, CA 92697 (United States); Peltier, Steven T.; Ellisman, Mark H. [University of California at San Diego, 9500 Gilman Dr., La Jolla, CA 92093 (United States); Kirkland, Angus I. [Department of Materials, University of Oxford, Parks Road, Oxford OX1 3PH (United Kingdom); Xuong, Nguyen-Huu [University of California at San Diego, 9500 Gilman Dr., La Jolla, CA 92093 (United States)
2010-06-15
The complete characterization of a novel direct detection device (DDD) camera for transmission electron microscopy is reported, for the first time at primary electron energies of 120 and 200 keV. Unlike a standard charge coupled device (CCD) camera, this device does not require a scintillator. The DDD transfers signal up to 65 lines/mm providing the basis for a high-performance platform for a new generation of wide field-of-view high-resolution cameras. An image of a thin section of virus particles is presented to illustrate the substantially improved performance of this sensor over current indirectly coupled CCD cameras.
Characterization of a direct detection device imaging camera for transmission electron microscopy
International Nuclear Information System (INIS)
Milazzo, Anna-Clare; Moldovan, Grigore; Lanman, Jason; Jin, Liang; Bouwer, James C.; Klienfelder, Stuart; Peltier, Steven T.; Ellisman, Mark H.; Kirkland, Angus I.; Xuong, Nguyen-Huu
2010-01-01
The complete characterization of a novel direct detection device (DDD) camera for transmission electron microscopy is reported, for the first time at primary electron energies of 120 and 200 keV. Unlike a standard charge coupled device (CCD) camera, this device does not require a scintillator. The DDD transfers signal up to 65 lines/mm providing the basis for a high-performance platform for a new generation of wide field-of-view high-resolution cameras. An image of a thin section of virus particles is presented to illustrate the substantially improved performance of this sensor over current indirectly coupled CCD cameras.
Numerical study of electron-leakage power loss in a tri-plate transmission line
International Nuclear Information System (INIS)
Barker, R.J.; Goldstein, S.A.
1982-01-01
Numerical simulations have been conducted using NRL's DIODE2D computer code to model the steady-state behavior of electron flow in a radial diode and in its adjacent tri-plate transmission line (TTL). Particular attention was paid to the magnitude of the electron current flowing from the cathode to the anode surface in the TTL. A quantitative value for this effective power loss is given. The electron current is restricted mainly to the transition region in the TTL into which there is seepage of the B/sub z/ that is imposed in the diode gap. This finding highlights the importance of that region to diode designers
Berger, Eve L.; Keller, Lindsay P.
2015-01-01
Mineral grains in lunar and asteroidal regolith samples provide a unique record of their interaction with the space environment. Space weathering effects result from multiple processes including: exposure to the solar wind, which results in ion damage and implantation effects that are preserved in the rims of grains (typically the outermost 100 nm); cosmic ray and solar flare activity, which result in track formation; and impact processes that result in the accumulation of vapor-deposited elements, impact melts and adhering grains on particle surfaces. Determining the rate at which these effects accumulate in the grains during their space exposure is critical to studies of the surface evolution of airless bodies. Solar flare energetic particles (mainly Fe-group nuclei) have a penetration depth of a few millimeters and leave a trail of ionization damage in insulating materials that is readily observable by transmission electron microscope (TEM) imaging. The density of solar flare particle tracks is used to infer the length of time an object was at or near the regolith surface (i.e., its exposure age). Track measurements by TEM methods are routine, yet track production rate calibrations have only been determined using chemical etching techniques [e.g., 1, and references therein]. We used focused ion beam-scanning electron microscope (FIB-SEM) sample preparation techniques combined with TEM imaging to determine the track density/exposure age relations for lunar rock 64455. The 64455 sample was used earlier by [2] to determine a track production rate by chemical etching of tracks in anorthite. Here, we show that combined FIB/TEM techniques provide a more accurate determination of a track production rate and also allow us to extend the calibration to solar flare tracks in olivine.
Kooi, B.J.; Palasantzas, G.; de Hosson, J.T.M.
2006-01-01
Magnesium nanoparticles with size above 10 nm, prepared by gas-phase syntheses, were investigated by high-resolution transmission electron microscopy. The dominant particle shape is a hexagonal prism terminated by Mg(0002) and Mg{1010} facets. Oxidation of Mg yields a MgO shell (similar to 3 nm
Recent advances in electronic nose techniques for monitoring of fermentation process.
Jiang, Hui; Zhang, Hang; Chen, Quansheng; Mei, Congli; Liu, Guohai
2015-12-01
Microbial fermentation process is often sensitive to even slight changes of conditions that may result in unacceptable end-product quality. Thus, the monitoring of the process is critical for discovering unfavorable deviations as early as possible and taking the appropriate measures. However, the use of traditional analytical techniques is often time-consuming and labor-intensive. In this sense, the most effective way of developing rapid, accurate and relatively economical method for quality assurance in microbial fermentation process is the use of novel chemical sensor systems. Electronic nose techniques have particular advantages in non-invasive monitoring of microbial fermentation process. Therefore, in this review, we present an overview of the most important contributions dealing with the quality control in microbial fermentation process using the electronic nose techniques. After a brief description of the fundamentals of the sensor techniques, some examples of potential applications of electronic nose techniques monitoring are provided, including the implementation of control strategies and the combination with other monitoring tools (i.e. sensor fusion). Finally, on the basis of the review, the electronic nose techniques are critically commented, and its strengths and weaknesses being highlighted. In addition, on the basis of the observed trends, we also propose the technical challenges and future outlook for the electronic nose techniques.
In-situ transmission electron microscopy growth of nanoparticles under extreme conditions
International Nuclear Information System (INIS)
Luce, F. P.; Azevedo, G. de M.; Baptista, D. L.; Zawislak, F. C.; Oliviero, E.; Fichtner, P. F. P.
2016-01-01
The formation and time resolved behavior of individual Pb nanoparticles embedded in silica have been studied by in-situ transmission electron microscopy observations at high temperatures (400–1100 °C) and under 200 keV electron irradiation. It is shown that under such extreme conditions, nanoparticles can migrate at long distances presenting a Brownian-like behavior and eventually coalesce. The particle migration phenomenon is discussed considering the influence of the thermal energy and the electron irradiation effects on the atomic diffusion process which is shown to control particle migration. These results and comparison with ex-situ experiments tackle the stability and the microstructure evolution of nanoparticles systems under extreme conditions. It elucidates on the effects of energetic particle irradiation-annealing treatments either as a tool or as a detrimental issue that could hamper their long-term applications in radiation-harsh environments such as in space or nuclear sectors
DEFF Research Database (Denmark)
Ek, Martin; Jespersen, Sebastian Pirel Fredsgaard; Damsgaard, Christian Danvad
2016-01-01
on the electron-dose-rate. In this article, we demonstrate that both the total and areal electron-dose-rates work as descriptors for the dose-rate-dependent resolution and are related through the illumination area. Furthermore, the resolution degradation was observed to occur gradually over time after......The introduction of gaseous atmospheres in transmission electron microscopy offers the possibility of studying materials in situ under chemically relevant environments. The presence of a gas environment can degrade the resolution. Surprisingly, this phenomenon has been shown to depend...... initializing the illumination of the sample and gas by the electron beam. The resolution was also observed to be sensitive to the electrical conductivity of the sample. These observations can be explained by a charge buildup over the electron-illuminated sample area, caused by the beam–gas–sample interaction...
National Research Council Canada - National Science Library
Mahalingam, Krishnamurthy
2006-01-01
.... Transmission electron microscope (TEM) characterization studies were performed on a variety of novel III-V semiconductor heterostructures being developed for advanced optoelectronic device applications...
DEFF Research Database (Denmark)
Das, Bhagwan; Abdullah, M.F.L.; Pandey, Bishwajeet
2017-01-01
Differential Phase Shift Keying (DPSK) techniques are widely used in designing the high-speed communication systems. However, these techniques still need improvement for long haul communication system design. In this paper, high-speed optical signal transmission and reception system is achieved f...
Hunter, Ryan C; Beveridge, Terry J
2005-11-01
High-pressure freeze-substitution and transmission electron microscopy have been used for high-resolution imaging of the natural structure of a gram-negative biofilm. Unlike more conventional embedding techniques, this method confirms many of the observations seen by confocal microscopy but with finer structural detail. It further reveals that there is a structural complexity to biofilms at both the cellular and extracellular matrix levels that has not been seen before. Different domains of healthy and lysed cells exist randomly dispersed within a single biofilm as well as different structural organizations of exopolymers. Particulate matter is suspended within this network of fibers and appears to be an integral part of the exopolymeric substance (EPS). O-side chains extending from the outer membrane are integrated into EPS polymers so as to form a continuum. Together, the results support the concept of physical microenvironments within biofilms and show a complexity that was hitherto unknown.
International Nuclear Information System (INIS)
Wang, Chong M.; Xu, Wu; Liu, Jun; Choi, Daiwon; Arey, Bruce W.; Saraf, Laxmikant V.; Zhang, Jiguang; Yang, Zhenguo; Thevuthasan, Suntharampillai; Baer, Donald R.; Salmon, Norman
2010-01-01
The critical challenge facing the lithium ion battery development is the basic understanding of the structural evolution during the cyclic operation of the battery and the consequence of the structural evolution on the properties of the battery. Although transmission electron microscopy (TEM) and spectroscopy have been evolved to a stage such that it can be routinely used to probe into both the structural and chemical composition of the materials with a spatial resolution of a single atomic column, a direct in-situ TEM observation of structural evolution of the materials in lithium ion battery during the dynamic operation of the battery has never been reported. This is related to three factors: high vacuum operation of a TEM; electron transparency requirement of the region to be observed, and the difficulties dealing with the liquid electrolyte of lithium ion battery. In this paper, we report the results of exploring the in-situ TEM techniques for observation of the interface in lithium ion battery during the operation of the battery. A miniature battery was fabricated using a nanowire and an ionic liquid electrolyte. The structure and chemical composition of the interface across the anode and the electrolyte was studied using TEM imaging, electron diffraction, and electron energy loss spectroscopy. In addition, we also explored the possibilities of carrying out in-situ TEM studies of lithium ion batteries with a solid state electrolyte.
Characterization techniques for graphene-based materials in catalysis
Directory of Open Access Journals (Sweden)
Maocong Hu
2017-06-01
Full Text Available Graphene-based materials have been studied in a wide range of applications including catalysis due to the outstanding electronic, thermal, and mechanical properties. The unprecedented features of graphene-based catalysts, which are believed to be responsible for their superior performance, have been characterized by many techniques. In this article, we comprehensively summarized the characterization methods covering bulk and surface structure analysis, chemisorption ability determination, and reaction mechanism investigation. We reviewed the advantages/disadvantages of different techniques including Raman spectroscopy, X-ray photoelectron spectroscopy (XPS, Fourier transform infrared spectroscopy (FTIR and Diffuse Reflectance Fourier Transform Infrared Spectroscopy (DRIFTS, X-Ray diffraction (XRD, X-ray absorption near edge structure (XANES and X-ray absorption fine structure (XAFS, atomic force microscopy (AFM, scanning electron microscopy (SEM, transmission electron microscopy (TEM, high-resolution transmission electron microscopy (HRTEM, ultraviolet-visible spectroscopy (UV-vis, X-ray fluorescence (XRF, inductively coupled plasma mass spectrometry (ICP, thermogravimetric analysis (TGA, Brunauer–Emmett–Teller (BET, and scanning tunneling microscopy (STM. The application of temperature-programmed reduction (TPR, CO chemisorption, and NH3/CO2-temperature-programmed desorption (TPD was also briefly introduced. Finally, we discussed the challenges and provided possible suggestions on choosing characterization techniques. This review provides key information to catalysis community to adopt suitable characterization techniques for their research.
Transmission electron microscopic study of reduced Ca2UO5
International Nuclear Information System (INIS)
Krasevec, V.; Prodan, A.; Holc, J.; Kolar, D.
1983-01-01
Structural changes of Ca 2 UO 5 during reduction in hydrogen were studied by transmission electron microscopy. It was shown that monoclinic Ca 2 UO 5 changes into triclinic Ca 4 U 2 O 9 . They are related, respectively, to the fluorite and the bixbyite (C-M 2 O 3 ) structures, so that the product is a superstructure of the latter. Reduction occurs along the (100)/sub t/ planes originating from the (006)/sub m/ planes of the parent structure by diminishing the coordination number of the Ca cation from 7 to 6. 5 figures
Han, Chang Wan; Ortalan, Volkan
2015-09-01
We have demonstrated a new electron tomography technique utilizing the secondary signals (secondary electrons and backscattered electrons) for ultra thick (a few μm) specimens. The Monte Carlo electron scattering simulations reveal that the amount of backscattered electrons generated by 200 and 300keV incident electrons is a monotonic function of the sample thickness and this causes the thickness contrast satisfying the projection requirement for the tomographic reconstruction. Additional contribution of the secondary electrons emitted from the edges of the specimens enhances the visibility of the surface features. The acquired SSI tilt series of the specimen having mesoscopic dimensions are successfully reconstructed verifying that this new technique, so called the secondary signal imaging electron tomography (SSI-ET), can directly be utilized for 3D structural analysis of mesoscale structures. Published by Elsevier Ltd.
International Nuclear Information System (INIS)
Kim, Taekyung; Kim, Seongwon; Olson, Eric; Zuo Jianmin
2008-01-01
We present the design and operation of a transmission electron microscopy (TEM)-compatible carbon nanotube (CNT) field-effect transistor (FET). The device is configured with microfabricated slits, which allows direct observation of CNTs in a FET using TEM and measurement of electrical transport while inside the TEM. As demonstrations of the device architecture, two examples are presented. The first example is an in situ electrical transport measurement of a bundle of carbon nanotubes. The second example is a study of electron beam radiation effect on CNT bundles using a 200 keV electron beam. In situ electrical transport measurement during the beam irradiation shows a signature of wall- or tube-breakdown. Stepwise current drops were observed when a high intensity electron beam was used to cut individual CNT bundles in a device with multiple bundles
Matteini, Paolo; Sbrana, Francesca; Tiribilli, Bruno; Pini, Roberto
2009-07-01
Low-temperature laser welding of the cornea is a technique used to facilitate the closure of corneal cuts. The procedure consists of staining the wound with a chromophore (indocyanine green), followed by continuous wave irradiation with an 810 nm diode laser operated at low power densities (12-16 W/cm(2)), which induces local heating in the 55-65 degrees C range. In this study, we aimed to investigate the ultrastructural modifications in the extracellular matrix following laser welding of corneal wounds by means of atomic force microscopy and transmission electron microscopy. The results evidenced marked disorganization of the normal fibrillar assembly, although collagen appeared not to be denatured under the operating conditions we employed. The mechanism of low-temperature laser welding may be related to some structural modifications of the nonfibrillar extracellular components of the corneal stroma.
Introduction to electronic relaxation in solids: mechanisms and measuring techniques
International Nuclear Information System (INIS)
Bonville, P.
1983-01-01
The fluctuations of electronic magnetic moments in solids may be investigated by several techniques, either electronic or nuclear. This paper is an introduction of the most frequently encountered paramagnetic relaxation mechanisms (phonons, conduction electrons, exchange or dipolar interactions) in condensed matter, and to the different techniques used for measuring relaxation frequencies: electronic paramagnetic resonance, nuclear magnetic resonance, Moessbauer spectroscopy, inelastic neutron scattering, measurement of longitudinal ac susceptibility and γ-γ perturbed angular correlations. We mainly focus our attention on individual ionic fluctuation spectra, the majority of the experimental work refered to concerning rare earth systems [fr
Simulation and Analysis of Microwave Transmission through an Electron Cloud, a Comparison of Results
International Nuclear Information System (INIS)
Sonnad, Kiran; Sonnad, Kiran; Furman, Miguel; Veitzer, Seth; Stoltz, Peter; Cary, John
2007-01-01
Simulation studies for transmission of microwaves through electron clouds show good agreement with analytic results. The electron cloud produces a shift in phase of the microwave. Experimental observation of this phenomena would lead to a useful diagnostic tool for accessing the local density of electron clouds in an accelerator. These experiments are being carried out at the CERN SPS and the PEP-II LER at SLAC and is proposed to be done at the Fermilab main injector. In this study, a brief analysis of the phase shift is provided and the results are compared with that obtained from simulations
Nucleation of diamond by pure carbon ion bombardment--a transmission electron microscopy study
International Nuclear Information System (INIS)
Yao, Y.; Liao, M.Y.; Wang, Z.G.; Lifshitz, Y.; Lee, S.
2005-01-01
A cross-sectional high-resolution transmission electron microscopy (HRTEM) study of a film deposited by a 1 keV mass-selected carbon ion beam onto silicon held at 800 deg. C is presented. Initially, a graphitic film with its basal planes perpendicular to the substrate is evolving. The precipitation of nanodiamond crystallites in upper layers is confirmed by HRTEM, selected area electron diffraction, and electron energy loss spectroscopy. The nucleation of diamond on graphitic edges as predicted by Lambrecht et al. [W. R. L. Lambrecht, C. H. Lee, B. Segall, J. C. Angus, Z. Li, and M. Sunkara, Nature, 364 607 (1993)] is experimentally confirmed. The results are discussed in terms of our recent subplantation-based diamond nucleation model
Electronic excitation in transmission of relativistic H- ions through thin foils
International Nuclear Information System (INIS)
Reinhold, C.O.; Kuerpick, P.; Burgdoerfer, J.; Yoshida, S.
1998-01-01
The authors describe a theoretical model to study the transmission of relativistic H - ions through thin carbon foils. The approach is based on a Monte Carlo solution of the Langevin equation describing electronic excitations of the atoms during the transport through the foil. Calculations for the subshell populations of outgoing hydrogen atoms are found to be in good agreement with recent experimental data on an absolute scale and show that there exists a propensity for populating extreme Stark states
The Physical Characterization of Liposome Salicylic Acid Using Transmission Electron Microscope
International Nuclear Information System (INIS)
Elman Panjaitan
2008-01-01
The physical characterization of liposome, formulated from salicylic acid using thin film hydration methods with cholesterol and soybean lecithin, has been done. The formula was characterized by optical microscopes and Transmission Electron Microscope (TEM). The observation result shows that the salicylic acid can be formulated to liposomes. Soybean lecithin combined with cholesterol (600 mg : 20 mg) was the best formula and the liposome was spherical vesicle like with dimension about 70 nm unit 800 nm. (author)
Energy Technology Data Exchange (ETDEWEB)
Feist, Armin; Bach, Nora; Rubiano da Silva, Nara; Danz, Thomas; Möller, Marcel; Priebe, Katharina E.; Domröse, Till; Gatzmann, J. Gregor; Rost, Stefan; Schauss, Jakob; Strauch, Stefanie; Bormann, Reiner; Sivis, Murat; Schäfer, Sascha, E-mail: sascha.schaefer@phys.uni-goettingen.de; Ropers, Claus, E-mail: claus.ropers@uni-goettingen.de
2017-05-15
We present the development of the first ultrafast transmission electron microscope (UTEM) driven by localized photoemission from a field emitter cathode. We describe the implementation of the instrument, the photoemitter concept and the quantitative electron beam parameters achieved. Establishing a new source for ultrafast TEM, the Göttingen UTEM employs nano-localized linear photoemission from a Schottky emitter, which enables operation with freely tunable temporal structure, from continuous wave to femtosecond pulsed mode. Using this emission mechanism, we achieve record pulse properties in ultrafast electron microscopy of 9 Å focused beam diameter, 200 fs pulse duration and 0.6 eV energy width. We illustrate the possibility to conduct ultrafast imaging, diffraction, holography and spectroscopy with this instrument and also discuss opportunities to harness quantum coherent interactions between intense laser fields and free-electron beams. - Highlights: • First implementation of an ultrafast TEM employing a nanoscale photocathode. • Localized single photon-photoemission from nanoscopic field emitter yields low emittance ultrashort electron pulses. • Electron pulses focused down to ~9 Å, with a duration of 200 fs and an energy width of 0.6 eV are demonstrated. • Quantitative characterization of ultrafast electron gun emittance and brightness. • A range of applications of high coherence ultrashort electron pulses is shown.
Number transmission of 0.6 and 0.8MeV electrons in elemental materials
International Nuclear Information System (INIS)
Harami, Taikan; Takagaki, Torao; Matsuda, Koji; Nakai, Yohta.
1975-01-01
The number transmissions of electrons in Be, Al, Cu and Ag were obtained experimentally for well collimated electron beams of 0.6 and 0.8 MeV. Experimental results of the present work join smoothly to the previous ones of 1.0 MeV to 2.0 MeV electrons. The ratios of extrapolated range Rsub(ex) to true range R 0 give generally minimum values near 1 MeV (approximately 2mc 2 ) as well as the stopping power. An investigation was done for empirical equation of the form eta=exp(-xP/CEsup(m)), where E is the incident electron energy, x, penetration depth, and p, C and m are the parameters determined from experimental data. (author)
Grogan, Joseph M.
There are many scientifically interesting and technologically relevant nanoscale phenomena that take place in liquid media. Examples include aggregation and assembly of nanoparticles; colloidal crystal formation; liquid phase growth of structures such as nanowires; electrochemical deposition and etching for fabrication processes and battery applications; interfacial phenomena; boiling and cavitation; and biological interactions. Understanding of these fields would benefit greatly from real-time, in situ transmission electron microscope (TEM) imaging with nanoscale resolution. Most liquids cannot be imaged by traditional TEM due to evaporation in the high vacuum environment and the requirement that samples be very thin. Liquid-cell in situ TEM has emerged as an exciting new experimental technique that hermetically seals a thin slice of liquid between two electron transparent membranes to enable TEM imaging of liquid-based processes. This work presents details of the fabrication of a custom-made liquid-cell in situ TEM device, dubbed the nanoaquarium. The nanoaquarium's highlights include an exceptionally thin sample cross section (10s to 100s of nm); wafer scale processing that enables high-yield mass production; robust hermetic sealing that provides leak-free operation without use of glue, epoxy, or any polymers; compatibility with lab-on-chip technology; and on-chip integrated electrodes for sensing and actuation. The fabrication process is described, with an emphasis on direct wafer bonding. Experimental results involving direct observation of colloid aggregation using an aqueous solution of gold nanoparticles are presented. Quantitative analysis of the growth process agrees with prior results and theory, indicating that the experimental technique does not radically alter the observed phenomenon. For the first time, in situ observations of nanoparticles at a contact line and in an evaporating thin film of liquid are reported, with applications for techniques such
Energy Technology Data Exchange (ETDEWEB)
Ming, W.Q.; Chen, J.H., E-mail: jhchen123@hnu.edu.cn
2013-11-15
Three different types of multislice algorithms, namely the conventional multislice (CMS) algorithm, the propagator-corrected multislice (PCMS) algorithm and the fully-corrected multislice (FCMS) algorithm, have been evaluated in comparison with respect to the accelerating voltages in transmission electron microscopy. Detailed numerical calculations have been performed to test their validities. The results show that the three algorithms are equivalent for accelerating voltage above 100 kV. However, below 100 kV, the CMS algorithm will introduce significant errors, not only for higher-order Laue zone (HOLZ) reflections but also for zero-order Laue zone (ZOLZ) reflections. The differences between the PCMS and FCMS algorithms are negligible and mainly appear in HOLZ reflections. Nonetheless, when the accelerating voltage is further lowered to 20 kV or below, the PCMS algorithm will also yield results deviating from the FCMS results. The present study demonstrates that the propagation of the electron wave from one slice to the next slice is actually cross-correlated with the crystal potential in a complex manner, such that when the accelerating voltage is lowered to 10 kV, the accuracy of the algorithms is dependent of the scattering power of the specimen. - Highlights: • Three multislice algorithms for low-energy transmission electron microscopy are evaluated. • The propagator-corrected algorithm is a good alternative for voltages down to 20 kV. • Below 20 kV, a fully-corrected algorithm has to be employed for quantitative simulations.
International Nuclear Information System (INIS)
Ming, W.Q.; Chen, J.H.
2013-01-01
Three different types of multislice algorithms, namely the conventional multislice (CMS) algorithm, the propagator-corrected multislice (PCMS) algorithm and the fully-corrected multislice (FCMS) algorithm, have been evaluated in comparison with respect to the accelerating voltages in transmission electron microscopy. Detailed numerical calculations have been performed to test their validities. The results show that the three algorithms are equivalent for accelerating voltage above 100 kV. However, below 100 kV, the CMS algorithm will introduce significant errors, not only for higher-order Laue zone (HOLZ) reflections but also for zero-order Laue zone (ZOLZ) reflections. The differences between the PCMS and FCMS algorithms are negligible and mainly appear in HOLZ reflections. Nonetheless, when the accelerating voltage is further lowered to 20 kV or below, the PCMS algorithm will also yield results deviating from the FCMS results. The present study demonstrates that the propagation of the electron wave from one slice to the next slice is actually cross-correlated with the crystal potential in a complex manner, such that when the accelerating voltage is lowered to 10 kV, the accuracy of the algorithms is dependent of the scattering power of the specimen. - Highlights: • Three multislice algorithms for low-energy transmission electron microscopy are evaluated. • The propagator-corrected algorithm is a good alternative for voltages down to 20 kV. • Below 20 kV, a fully-corrected algorithm has to be employed for quantitative simulations
DEFF Research Database (Denmark)
Ambrosini, S.; Wagner, Jakob Birkedal; Booth, Tim
2011-01-01
Self catalyzed GaAs nanowires grown on Si-treated GaAs substrates were studied with a transmission electron microscope before and after annealing at 600◦C. At room temperature the nanowires have a zincblende structure and are locally characterized by a high density of rotational twins and stacking...... faults. Selected area diffraction patterns and high-resolution transmission electron microscopy images show that nanowires undergo structural modifications upon annealing, suggesting a decrease of defect density following the thermal treatment....
Porosity measurement of solid pharmaceutical dosage forms by gamma-ray transmission
International Nuclear Information System (INIS)
Martins de Oliveira, Jose; Andreo Filho, Newton; Vinicius Chaud, Marco; Angiolucci, Tatiana; Aranha, Norberto; Germano Martins, Antonio Cesar
2010-01-01
The aim of the present work is the determination of porosity in tablets by using the gamma-ray transmission technique. Tablet dissolution depends on some inherent characteristics of the manufacturing process, such as compression force, tablet volume, density and porosity, nature of excipients, preparation methods and its physical-chemical properties. Porosity is a measure of empty spaces in a material and can be determined by various techniques. In this paper, we propose the use of a gamma-ray transmission technique to obtain the porosity of experimental formulation of tablets. The results of porosity were compared with those obtained by using conventional methodology (density and mercury intrusion). The experimental setup for gamma-ray transmission consists of a gamma-ray source of 241 Am (photons of 59.6 keV and an activity of 3.7x10 9 Bq), an NaI(Tl) scintillation detector, collimators and a standard gamma-ray spectrometry electronics. Our results suggest that the gamma-ray transmission technique is a powerful tool for non-destructive porosity quantification of solid pharmaceutical forms and presents smaller errors than those obtained with conventional methodologies.
DEFF Research Database (Denmark)
Mølhave, Kristian; Gudnason, S.B.; Pedersen, Anders Tegtmeier
2006-01-01
We present repeated structural and electrical measurements on individual multiwalled carbon nanotubes, alternating between electrical measurements under ambient conditions and transmission electron microscopy (TEM). The multiwalled carbon nanotubes made by chemical vapor deposition were manipulated...
Energy Technology Data Exchange (ETDEWEB)
Han, Myung-Geun, E-mail: mghan@bnl.gov [Condensed Matter Physics & Materials Science, Brookhaven National Laboratory, Upton, NY 11973 (United States); Garlow, Joseph A. [Condensed Matter Physics & Materials Science, Brookhaven National Laboratory, Upton, NY 11973 (United States); Materials Science and Engineering Department, Stony Brook University, Stony Brook, NY 11794 (United States); Marshall, Matthew S.J.; Tiano, Amanda L. [Department of Chemistry, Stony Brook University, Stony Brook, NY 11974 (United States); Wong, Stanislaus S. [Condensed Matter Physics & Materials Science, Brookhaven National Laboratory, Upton, NY 11973 (United States); Department of Chemistry, Stony Brook University, Stony Brook, NY 11974 (United States); Cheong, Sang-Wook [Department of Physics and Astronomy, Rutgers Center for Emergent Materials, Rutgers University, Piscataway, NJ 08854 (United States); Walker, Frederick J.; Ahn, Charles H. [Department of Applied Physics and Center for Research on Interface Structures and Phenomena, Yale University, New Haven, CT 06520 (United States); Department of Mechanical Engineering and Materials Science, Yale University, New Haven, CT 06520 (United States); Zhu, Yimei [Condensed Matter Physics & Materials Science, Brookhaven National Laboratory, Upton, NY 11973 (United States)
2017-05-15
Highlights: • Electron-beam-induced-current (EBIC) and active secondary-electron voltage-contrast (SE-VC) are demonstrated in STEM mode combined with in situ electrical biasing in a TEM. • Electrostatic potential maps in ferroelectric thin films, multiferroic nanowires, and single crystals obtained by off-axis electron holography were compared with EBIC and SE-VC data. • Simultaneous EBIC and active SE-VC performed with atomic resolution STEM are demonstrated. - Abstract: The ability to map out electrostatic potentials in materials is critical for the development and the design of nanoscale electronic and spintronic devices in modern industry. Electron holography has been an important tool for revealing electric and magnetic field distributions in microelectronics and magnetic-based memory devices, however, its utility is hindered by several practical constraints, such as charging artifacts and limitations in sensitivity and in field of view. In this article, we report electron-beam-induced-current (EBIC) and secondary-electron voltage-contrast (SE-VC) with an aberration-corrected electron probe in a transmission electron microscope (TEM), as complementary techniques to electron holography, to measure electric fields and surface potentials, respectively. These two techniques were applied to ferroelectric thin films, multiferroic nanowires, and single crystals. Electrostatic potential maps obtained by off-axis electron holography were compared with EBIC and SE-VC to show that these techniques can be used as a complementary approach to validate quantitative results obtained from electron holography analysis.
International Nuclear Information System (INIS)
Nishikawa, H; Yoshimi, A; Takemura, K; Tanaka, A; Douseki, T
2015-01-01
A batteryless self-powered wireless transmission system has been developed that sends a signal from a drum pad to a synthesizer. The power generated by a piezoelectric generator functions both as the “Play” signal for the synthesizer and as the power source for the transmitter. An FM transmitter, which theoretically operates with zero latency, and a receiver with quick-response squelch of the received signal were developed for wireless transmission with a minimum system delay. Experimental results for an electronic drum without any connecting wires fully demonstrated the feasibility of self-powered wireless transmission with a latency of 900 μs. (paper)
Energy Technology Data Exchange (ETDEWEB)
Trewyn, Brian G. [Iowa State Univ., Ames, IA (United States)
2006-01-01
The research presented and discussed within involves the development of novel biological applications of mesoporous silica nanoparticles (MSN) and an investigation of mesoporous material by transmission electron microscopy (TEM). Mesoporous silica nanoparticles organically functionalized shown to undergo endocytosis in cancer cells and drug release from the pores was controlled intracellularly and intercellularly. Transmission electron microscopy investigations demonstrated the variety of morphologies produced in this field of mesoporous silica nanomaterial synthesis. A series of room-temperature ionic liquid (RTIL) containing mesoporous silica nanoparticle (MSN) materials with various particle morphologies, including spheres, ellipsoids, rods, and tubes, were synthesized. By changing the RTIL template, the pore morphology was tuned from the MCM-41 type of hexagonal mesopores to rotational moire type of helical channels, and to wormhole-like porous structures. These materials were used as controlled release delivery nanodevices to deliver antibacterial ionic liquids against Escherichia coli K12. The involvement of a specific organosiloxane function group, covalently attached to the exterior of fluorescein doped mesoporous silica nanoparticles (FITC-MSN), on the degree and kinetics of endocytosis in cancer and plant cells was investigated. The kinetics of endocystosis of TEG coated FITC-MSN is significantly quicker than FITC-MSN as determined by flow cytometry experiments. The fluorescence confocal microscopy investigation showed the endocytosis of TEG coated-FITC MSN triethylene glycol grafted fluorescein doped MSN (TEG coated-FITC MSN) into both KeLa cells and Tobacco root protoplasts. Once the synthesis of a controlled-release delivery system based on MCM-41-type mesoporous silica nanorods capped by disulfide bonds with superparamagnetic iron oxide nanoparticles was completed. The material was characterized by general methods and the dosage and kinetics of the
Electron Beam Polarization Measurement Using Touschek Lifetime Technique
Energy Technology Data Exchange (ETDEWEB)
Sun, Changchun; /Duke U., DFELL; Li, Jingyi; /Duke U., DFELL; Mikhailov, Stepan; /Duke U., DFELL; Popov, Victor; /Duke U., DFELL; Wu, Wenzhong; /Duke U., DFELL; Wu, Ying; /Duke U., DFELL; Chao, Alex; /SLAC; Xu, Hong-liang; /Hefei, NSRL; Zhang, Jian-feng; /Hefei, NSRL
2012-08-24
Electron beam loss due to intra-beam scattering, the Touschek effect, in a storage ring depends on the electron beam polarization. The polarization of an electron beam can be determined from the difference in the Touschek lifetime compared with an unpolarized beam. In this paper, we report on a systematic experimental procedure recently developed at Duke FEL laboratory to study the radiative polarization of a stored electron beam. Using this technique, we have successfully observed the radiative polarization build-up of an electron beam in the Duke storage ring, and determined the equilibrium degree of polarization and the time constant of the polarization build-up process.
New electronic filtering technique in digital subtraction angiography
Energy Technology Data Exchange (ETDEWEB)
Stacul, F; Pozzi-Mucelli, R; Predonzan, F; Magnaldi, S; Godina, G
1986-01-01
The authors report their experience with a new electronic filtering technique in digital subtraction angiography (DSA). The principles of the technique are reported and the advantages in comparison with conventional filters are stressed (accurate and fast placement without fluoroscopic exposure). The system provided excellent results in about 900 DSA examinations.
Inada, H; Su, D; Egerton, R F; Konno, M; Wu, L; Ciston, J; Wall, J; Zhu, Y
2011-06-01
We report detailed investigation of high-resolution imaging using secondary electrons (SE) with a sub-nanometer probe in an aberration-corrected transmission electron microscope, Hitachi HD2700C. This instrument also allows us to acquire the corresponding annular dark-field (ADF) images both simultaneously and separately. We demonstrate that atomic SE imaging is achievable for a wide range of elements, from uranium to carbon. Using the ADF images as a reference, we studied the SE image intensity and contrast as functions of applied bias, atomic number, crystal tilt, and thickness to shed light on the origin of the unexpected ultrahigh resolution in SE imaging. We have also demonstrated that the SE signal is sensitive to the terminating species at a crystal surface. A possible mechanism for atomic-scale SE imaging is proposed. The ability to image both the surface and bulk of a sample at atomic-scale is unprecedented, and can have important applications in the field of electron microscopy and materials characterization. Copyright © 2010 Elsevier B.V. All rights reserved.
Lin, Margaret; Krawitz, Denise; Callahan, Matthew D.; Deperalta, Galahad; Wecksler, Aaron T.
2018-05-01
We describe epitope mapping data using multiple covalent labeling footprinting-mass spectrometry (MS) techniques coupled with negative stain transmission electron microscopy (TEM) data to analyze the antibody-antigen interactions in a sandwich enzyme-linked immunosorbant assay (ELISA). Our hydroxyl radical footprinting-MS data using fast photochemical oxidation of proteins (FPOP) indicates suppression of labeling across the antigen upon binding either of the monoclonal antibodies (mAbs) utilized in the ELISA. Combining these data with Western blot analysis enabled the identification of the putative epitopes that appeared to span regions containing N-linked glycans. An additional structural mapping technique, carboxyl group footprinting-mass spectrometry using glycine ethyl ester (GEE) labeling, was used to confirm the epitopes. Deglycosylation of the antigen resulted in loss of potency in the ELISA, supporting the FPOP and GEE labeling data by indicating N-linked glycans are necessary for antigen binding. Finally, mapping of the epitopes onto the antigen crystal structure revealed an approximate 90° relative spatial orientation, optimal for a noncompetitive binding ELISA. TEM data shows both linear and diamond antibody-antigen complexes with a similar binding orientation as predicted from the two footprinting-MS techniques. This study is the first of its kind to utilize multiple bottom-up footprinting-MS techniques and TEM visualization to characterize the monoclonal antibody-antigen binding interactions of critical reagents used in a quality control (QC) lot-release ELISA. [Figure not available: see fulltext.
Lin, Margaret; Krawitz, Denise; Callahan, Matthew D.; Deperalta, Galahad; Wecksler, Aaron T.
2018-03-01
We describe epitope mapping data using multiple covalent labeling footprinting-mass spectrometry (MS) techniques coupled with negative stain transmission electron microscopy (TEM) data to analyze the antibody-antigen interactions in a sandwich enzyme-linked immunosorbant assay (ELISA). Our hydroxyl radical footprinting-MS data using fast photochemical oxidation of proteins (FPOP) indicates suppression of labeling across the antigen upon binding either of the monoclonal antibodies (mAbs) utilized in the ELISA. Combining these data with Western blot analysis enabled the identification of the putative epitopes that appeared to span regions containing N-linked glycans. An additional structural mapping technique, carboxyl group footprinting-mass spectrometry using glycine ethyl ester (GEE) labeling, was used to confirm the epitopes. Deglycosylation of the antigen resulted in loss of potency in the ELISA, supporting the FPOP and GEE labeling data by indicating N-linked glycans are necessary for antigen binding. Finally, mapping of the epitopes onto the antigen crystal structure revealed an approximate 90° relative spatial orientation, optimal for a noncompetitive binding ELISA. TEM data shows both linear and diamond antibody-antigen complexes with a similar binding orientation as predicted from the two footprinting-MS techniques. This study is the first of its kind to utilize multiple bottom-up footprinting-MS techniques and TEM visualization to characterize the monoclonal antibody-antigen binding interactions of critical reagents used in a quality control (QC) lot-release ELISA. [Figure not available: see fulltext.
Transmission electron microscope study of neutron irradiation-induced defects in silicon
International Nuclear Information System (INIS)
Oshima, Ryuichiro; Kawano, Tetsuya; Fujimoto, Ryoji
1994-01-01
Commercial Czochralski-grown silicon (Cz-Si) and float-zone silicon (Fz-Si) wafers were irradiated with fission neutrons at various fluences from 10 19 to 10 22 n/cm 2 at temperatures ranging from 473 K to 1043 K. The irradiation induced defect structures were examined by transmission electron microscopy and ultra high voltage electron microscopy, which were compared with Marlowe code computer simulation results. It was concluded that the vacancy-type damage structure formed at 473 K were initiated from collapse of vacancy-rich regions of cascades, while interstitial type defect clusters formed by irradiation above 673 K were associated with interstitial oxygen atoms and free interstitials which diffused out of the cascades. Complex defect structures were identified to consist of {113} and {111} planar faults by the parallel beam illumination diffraction analysis. (author)
Study of the nanostructure of Gum Metal using energy-filtered transmission electron microscopy
International Nuclear Information System (INIS)
Yano, T.; Murakami, Y.; Shindo, D.; Kuramoto, S.
2009-01-01
The nanostructure of Gum Metal, which has many anomalous mechanical properties, was investigated using transmission electron microscopy with energy filtering. A precise analysis of the weak diffuse electron scattering that was observed in the electron diffraction patterns of the Gum Metal specimen revealed that Gum Metal contains a substantial amount of the nanometer-sized ω phase. The morphology of the ω phase appeared to have a correlation with the faulting in the {2 1 1} planes, which are one of the characteristic lattice imperfections of the Gum Metal specimen. It is likely that the nanometer-sized ω phase may be a type of obstacle related to the restriction of the dislocation movement, which has been a significant problem in research on Gum Metal
International Nuclear Information System (INIS)
Rooyen, I.J. van; Lillo, T.M.; Trowbridge, T.L.; Madden, J.M.; Wu, Y.Q.; Goran, D.
2013-01-01
Preliminary electron microscopy of coated fuel particles from the AGR-1 experiment was conducted using characterization techniques such as scanning electron microscopy (SEM), transmission electron microscopy (TEM), energy dispersive spectroscopy (EDS), and wavelength dispersive spectroscopy (WDS). Microscopic quantification of fission-product precipitates was performed. Although numerous micro- and nano-sized precipitates observed in the coating layers during initial SEM characterization of the cross-sections, and in subsequent TEM diffraction patterns, were indexed as UPd 2 Si 2 , no Ag was conclusively found. Additionally, characterization of these precipitates highlighted the difficulty of measuring low concentrations of Ag in precipitates in the presence of significantly higher concentrations of Pd and U. The electron microscopy team followed a multi-directional and phased approach in the identification of fission products in irradiated TRISO fuel. The advanced electron microscopy techniques discussed in this paper, not only demonstrate the usefulness of the equipment (methods) as relevant research tools, but also provide relevant scientific results which increase the knowledge about TRISO fuel particles microstructure and fission products transport
Energy Technology Data Exchange (ETDEWEB)
Lu, Ping
2014-10-01
Controlling metallic nanoparticle (NP) interactions plays a vital role in the development of new joining techniques (nanosolder) that bond at lower processing temperatures but remain viable at higher temperatures. The pr imary objective of this project is t o develop a fundamental understanding of the actual reaction processes, associated atomic mechanisms, and the resulting microstructure that occur during thermally - driven bond formation concerning metal - metal nano - scale (%3C50nm) interfaces. In this LDRD pr oject, we have studied metallic NPs interaction at the elevated temperatures by combining in - situ transmission electron microscopy (TEM ) using an aberration - corrected scanning transmission electron microscope (AC - STEM) and atomic - scale modeling such as m olecular dynamic (MD) simulations. Various metallic NPs such as Ag, Cu and Au are synthesized by chemical routines. Numerous in - situ e xperiments were carried out with focus of the research on study of Ag - Cu system. For the first time, using in - situ STEM he ating experiments , we directly observed t he formation of a 3 - dimensional (3 - D) epitaxial Cu - Ag core - shell nanoparticle during the thermal interaction of Cu and Ag NPs at elevated temperatures (150 - 300 o C). The reaction takes place at temperatures as low as 150 o C and was only observed when care was taken to circumvent the effects of electron beam irradiation during STEM imaging. Atomic - scale modeling verified that the Cu - Ag core - shell structure is energetically favored, and indicated that this phenomenon is a nano - scale effect related to the large surface - to - volume ratio of the NPs. The observation potentially can be used for developing new nanosolder technology that uses Ag shell as the "glue" that stic ks the particles of Cu together. The LDRD has led to several journal publications and numerous conference presentations, and a TA. In addition, we have developed new TEM characterization techniques and phase
Energy Technology Data Exchange (ETDEWEB)
Michelot, Y
1995-10-01
Fast electrons are one of the basic ingredients of plasma operations in many existing thermonuclear fusion research devices. However, the understanding of fast electrons dynamics during creation and sustainment of the superthermal electrons tail is far for being satisfactory. For this reason, the Electron Cyclotron Transmission (ECT) diagnostic was implemented on Tore Supra tokamak. It consists on a microwave transmission system installed on a vertical chord crossing the plasma center and working in the frequency range 77-109 GHz. Variations of the wave amplitude during the propagation across the plasma may be due to refraction and resonant absorption. For the ECT, the most common manifestation of refraction is a reduction of the received power density with respect to the signal detected in vacuum, due to the spreading and deflection of the wave beam. Wave absorption is observed in the vicinity of the electron cyclotron harmonics and may be due both to thermal plasma and to superthermal electron tails. It has a characteristic frequency dependence due to the relativistic mass variation in the wave-electron resonance condition. This thesis presents the first measurements of: the extraordinary mode optical depth at the third harmonics, the electron temperature from the width of a cyclotron absorption line and the relaxation times of the electron distribution during lower hybrid current drive from the ordinary mode spectral superthermal absorption line at the first harmonic. (J.S.). 175 refs., 110 figs., 9 tabs., 3 annexes.
International Nuclear Information System (INIS)
Yang Hailiang; Qiu Aici; Zhang Jiasheng; Huang Jianjun; Sun Jianfeng
2002-01-01
The incident angles have a heavy effect on the intense pulsed electron beam energy deposition profile, energy deposition fraction and beam current transmission fraction in material. The author presents electron beam energy deposition profile and energy deposition fraction versus electron energy (0.5-2.0 MeV), at various incident angles for three aluminum targets of various thickness via theoretical calculation. The intense pulsed electron beam current transmission fractions versus electron energy (0.4-1.4 MeV) at various incident angles for three thickness of carbon targets were also theoretically calculated. The calculation results indicate that the deposition energy in unit mass of material surface layer increase with the rise of electron beam incident angle, and electron beam with low incident angle (closer to normal incident angle) penetrates deeper into the target material. The electron beams deposit more energy in unit mass of material surface layer at 60 degree-70 degree incident angle
Fast neutron and gamma-ray transmission technique in mixed samples. MCNP calculations
International Nuclear Information System (INIS)
Perez, N.; Padron, I.
2001-01-01
In this paper the moisture in sand and also the sulfur content in toluene have been described by using the simultaneous fast neutron/gamma transmission technique (FNGT). Monte Carlo calculations show that it is possible to apply this technique with accelerator-based and isotopic neutron sources in the on-line analysis to perform the product quality control, specifically in the building materials industry and the petroleum one. It has been used particles from a 14MeV neutron generator and also from an Am-Be neutron source. The estimation of optimal system parameters like the efficiency, detection time, hazards and costs were performed in order to compare both neutron sources
International Nuclear Information System (INIS)
Kooi, B. J.; Palasantzas, G.; De Hosson, J. Th. M.
2006-01-01
Magnesium nanoparticles with size above 10 nm, prepared by gas-phase syntheses, were investigated by high-resolution transmission electron microscopy. The dominant particle shape is a hexagonal prism terminated by Mg(0002) and Mg(1010) facets. Oxidation of Mg yields a MgO shell (∼3 nm thick), which has an orientation relation with the Mg. Inhomogeneous facet oxidation influences their growth kinetics resulting in a relatively broad size and shape distribution. Faceted voids between Mg and MgO shells indicate a fast outward diffusion of Mg and vacancy rearrangement into voids. The faceting of polar (220) planes is assisted by electron irradiation
International Nuclear Information System (INIS)
Ruault, M.O.; Bernas, H.; Chaumont, J.
1978-01-01
Nine different atomic species, from K to Yb, were implanted into gold at energies ranging from 20 to 150 keV. The nature and depth-distribution of the resultant defect clusters were studied by transmission electron microscopy techniques as well as a modification of the '2 1/2-D' stereo technique developed by Mitchell and Bell. The effect of implanted ion dose and sample purity were determined. The cluster depth distributions are in overall agreement with the damage distributions deduced from the energy deposition calculations of Winterbon, Sigmund, and Sanders. The nature of the defect clusters is found to depend on the mass and energy of the incoming ion, in agreement with our previously reported work. These results are suggested to provide evidence for the decisive influence of the deposited energy density on the nature of visible damage. We conclude that it is possible to distinguish between cascade and 'spike' effects, the latter setting in when the average energy per atom in the cascade is approximately 2 eV/atom. All results (obtained -at low doses on pure samples- for a variety of ion species in Au, Al, Cu, W, Mo and Ni) may be related to each other in this way
The Fresnel mode of Lorentz microscopy using a scanning transmission electron microscope
International Nuclear Information System (INIS)
Chapman, J.N.; Waddell, E.M.; Batson, P.E.; Ferrier, R.P.
1979-01-01
The most widely used method of investigating ferromagnetic films in the transmission electron microscope is the Fresnel or defocus mode of Lorentz microscopy. This may be implemented either in a fixed beam or a scanning instrument. Despite a rather inefficient utilization of electrons, several advantages accrue if the latter is used, and provided it is equipped with a field emission gun, low noise images may be obtained in acceptable recording times. To extract quantitative estimates of domain wall widths from such images it is necessary to measure accurately both instrumental and specimen parameters. Methods for this are discussed and an example of an analysis using a polycrystalline permalloy film is given. (Auth.)
International Nuclear Information System (INIS)
Markwitz, Andreas
2000-01-01
Rutherford backscattering spectrometry (RBS) is known to be one of the techniques ideal for analysis of thin films. Elemental concentrations of matrix components and impurities can be investigated as well as depth profiles of almost each element of the periodic table. Best of all, RBS has both a high sensitivity and a high depth resolution, and is a non-destructive analysis technique that does not require specific sample preparation. Solid-state samples are mounted without preparation inside a high-vacuum analysis chamber. However, depth-related interpretation of elemental depth profiles requires the material density of the specimen and stopping power values to be taken into consideration. In many cases, these parameters can be estimated with sufficient precision. However, the assumed density can be inaccurate for depth scales in the nanometer range. For example, in the case of Ge nanoclusters in 500 nm thick SiO 2 layers, uncertainty is related to the actual position of a very thin Ge nanocluster band. Energy-dispersive X-ray emission (EDX) spectroscopy, using a high-resolution scanning transmission electron microscope (STEM) can assist in removing this uncertainty. By preparing a thin section of the specimen, EDX can be used to identify the position of the Ge nanocluster band very precisely, by correlating the Ge profile with the depth profiles of silicon and oxygen. However, extraction of the concentration profiles from STEM-EDX spectra is in general not straightforward. Therefore, a combination of the two very different analysis techniques is often the best and only successful way to extract high-resolution concentration profiles
Wu, Madeline; Davidson, Norman
1981-01-01
A transmission electron microscope method for gene mapping by in situ hybridization to Drosophila polytene chromosomes has been developed. As electron-opaque labels, we use colloidal gold spheres having a diameter of 25 nm. The spheres are coated with a layer of protein to which Escherichia coli single-stranded DNA is photochemically crosslinked. Poly(dT) tails are added to the 3' OH ends of these DNA strands, and poly(dA) tails are added to the 3' OH ends of a fragmented cloned Drosophila DN...
How to determine the morphology of plasmonic nanocrystals without transmission electron microscopy?
Energy Technology Data Exchange (ETDEWEB)
Battie, Yann, E-mail: yann.battie@univ-lorraine.fr [Université de Lorraine, LCP-A2MC, Institut Jean Barriol (France); Izquierdo-Lorenzo, Irene [Université de Technologie de Troyes, LNIO (CNRS UMR 6279) (France); Resano-Garcia, Amandine; Naciri, Aotmane En; Akil, Suzanna [Université de Lorraine, LCP-A2MC, Institut Jean Barriol (France); Adam, Pierre Michel; Jradi, Safi [Université de Technologie de Troyes, LNIO (CNRS UMR 6279) (France)
2016-08-15
This paper reports the complete ellipsometric characterization of gold nanoparticles (NPs) embedded in a photoresist films. The effective dielectric function of nanocomposite films as well as the shape distribution and the volume fraction of NPs are extracted from ellipsometric measurements by introducing an effective medium theory which takes into account the NP shape distribution and the intrinsic confinement effect. This theory remains valid as long as the nanoparticle interaction is negligible. We show that the magnitude of the confinement depends on the nanoparticle shape and the environment through chemical damping. This suggests that the NP shape distribution can be directly estimated by ellipsometry, while the determination of absolute radius distribution requires transmission electron microscopy measurements. The imaginary part of the effective dielectric function exhibits a strong asymmetric surface plasmon band, while a large variation of the real part occurs close to the resonance. The redshift and the broadening of the plasmon band as the gold volume fraction increases are correlated to the evolution of NP shape distribution. This evolution is attributed to a competition between the nucleation and the coalescence of NPs. This unambiguously demonstrates that ellipsometry combined with a shape-distributed effective medium theory is a powerful alternative tool to transmission electron microscopy for the NP shape analysis.
Morishita, Shigeyuki; Ishikawa, Ryo; Kohno, Yuji; Sawada, Hidetaka; Shibata, Naoya; Ikuhara, Yuichi
2018-02-01
The achievement of a fine electron probe for high-resolution imaging in scanning transmission electron microscopy requires technological developments, especially in electron optics. For this purpose, we developed a microscope with a fifth-order aberration corrector that operates at 300 kV. The contrast flat region in an experimental Ronchigram, which indicates the aberration-free angle, was expanded to 70 mrad. By using a probe with convergence angle of 40 mrad in the scanning transmission electron microscope at 300 kV, we attained the spatial resolution of 40.5 pm, which is the projected interatomic distance between Ga-Ga atomic columns of GaN observed along [212] direction.
Transmission electron microscopy and diffractometry of materials
Fultz, Brent
2001-01-01
This book teaches graduate students the concepts of trans- mission electron microscopy (TEM) and x-ray diffractometry (XRD) that are important for the characterization of materi- als. It emphasizes themes common to both techniques, such as scattering from atoms and the formation and analysis of dif- fraction patterns. It also describes unique aspects of each technique, especially imaging and spectroscopy in the TEM. The textbook thoroughly develops both introductory and ad- vanced-level material, using over 400 accompanying illustra- tions. Problems are provided at the end of each chapter to reinforce key concepts. Simple citatioins of rules are avoi- ded as much as possible, and both practical and theoretical issues are explained in detail. The book can be used as both an introductory and advanced-level graduate text since sec- tions/chapters are sorted according to difficulty and grou- ped for use in quarter and semester courses on TEM and XRD.
International Nuclear Information System (INIS)
Eberhart, J.-P.
1976-01-01
The following topics are discussed: theoretical aspects of radiation-matter interactions; production and measurement of radiations (X rays, electrons, neutrons); applications of radiation interactions to the study of crystalline materials. The following techniques are presented: X-ray and neutron diffraction, electron microscopy, electron diffraction, X-ray fluorescence analysis, electron probe microanalysis, surface analysis by electron emission spectrometry (ESCA and Auger electrons), scanning electron microscopy, secondary ion emission analysis [fr
A review of transmission electron microscopes with in situ ion irradiation
Hinks, J. A.
2009-12-01
Transmission electron microscopy (TEM) with in situ ion irradiation is unique amongst experimental techniques in allowing the direct observation of the internal microstructure of materials on the nanoscale whilst they are being subjected to bombardment with energetic particles. Invaluable insights into the underlying atomistic processes at work can be gained through direct investigation of radiation induced and enhanced effects such as: phase changes and segregation; mechanical and structural changes; atomic/layer mixing and chemical disorder; compositional changes; chemical reactions; grain growth and shrinkage; precipitation and dissolution; defect/bubble formation, growth, motion, coalescence, removal and destruction; ionisation; diffusion; and collision cascades. The experimental results obtained can be used to validate the predictions of computational models which in turn can elucidate the mechanisms behind the phenomena seen in the microscope. It is 50 years since the first TEM observations of in situ ion irradiation were made by D.W. Pashley, A.E.B. Presland and J.W. Menter at the Tube Investment Laboratories in Cambridge, United Kingdom and 40 years since the first interfacing of an ion beam system with a TEM by P.A. Thackery, R.S. Nelson and H.C. Sansom at the Atomic Energy Research Establishment at Harwell, United Kingdom. In that time the field has grown with references in the literature to around thirty examples of such facilities. This paper gives an overview of the importance of the technique, especially with regard to the current challenges faced in understanding radiation damage in nuclear environments; a description of some of the important construction elements and design considerations of TEMs with in situ ion irradiation; a brief history of the development of this type of instrument; a summary of the facilities built around the world over the last half century; and finally a focus on the instruments in operation today.
Naden, A. B.; O'Shea, K. J.; MacLaren, D. A.
2018-04-01
Moiré patterns in scanning transmission electron microscopy (STEM) images of epitaxial perovskite oxides are used to assess strain and defect densities over fields of view extending over several hundred nanometers. The patterns arise from the geometric overlap of the rastered STEM electron beam and the samples’ crystal periodicities and we explore the emergence and application of these moiré fringes for rapid strain analysis. Using the epitaxial functional oxide perovskites BiFeO3 and Pr1-x Ca x MnO3, we discuss the impact of large degrees of strain on the quantification of STEM moiré patterns, identify defects in the fringe patterns and quantify strain and lattice rotation. Such a wide-area analysis of crystallographic strain and defects is crucial for developing structure-function relations of functional oxides and we find the STEM moiré technique to be an attractive means of structural assessment that can be readily applied to low dose studies of damage sensitive crystalline materials.
Visualization of bacterial polysaccharides by scanning transmission electron microscopy.
Wolanski, B S; McAleer, W J; Hilleman, M R
1983-04-01
Highly purified capsular polysaccharides of Neisseria meningitidis groups A, B, and C have been visualized by high resolution Scanning Transmission Electron Microscopy (STEM). Spheroidal macromolecules approximately 200 A in diameter are characteristic of the Meningococcus A and C polysaccharides whereas filaments that are 400-600 A in length are found in Meningococcus B polysaccharide preparations. Filaments are occasionally found associated with the spheroidal Meningococcus A and C polysaccharides and it is proposed that these structures are composed of a long (1-4 microns) filament or filaments that are arranged in spheroidal molecules or micelles of high molecular weight. The Meningococcus B polysaccharide, by contrast, is a short flexuous filament or strand of relatively low molecular weight. A relationship between morphology and antigenicity is proposed.
Ab initio transmission electron microscopy image simulations of coherent Ag-MgO interfaces
International Nuclear Information System (INIS)
Mogck, S.; Kooi, B.J.; Hosson, J.Th.M. de; Finnis, M.W.
2004-01-01
Density-functional theory calculations, within the plane-wave-ultrasoft pseudopotential framework, were performed in the projection for MgO and for the coherent (111) Ag-MgO polar interface. First-principles calculations were incorporated in high-resolution transmission electron microscopy (HRTEM) simulations by converting the charge density into electron scattering factors to examine the influence of charge transfer, charge redistribution at the interface, and ionicity on the dynamical electron scattering and on calculated HRTEM images. It is concluded that the ionicity of oxides and the charge redistribution at interfaces play a significant role in HRTEM image simulations. In particular, the calculations show that at oxygen-terminated (111) Ag-MgO interfaces the first oxygen layer at the interface is much brighter than that in calculations with neutral atoms, in agreement with experimental observations
International Nuclear Information System (INIS)
Elboussiri, Khalid
1991-01-01
The main part of this thesis is devoted to an experimental study by transmission electron microscopy of the different phases of the superconducting bismuth cuprates Bi_2Sr_2Ca_n_-_1Cu_nO_2_n_+_4. In high resolution electron microscopy, the two types of incommensurate modulation realized in these compounds have been observed. A model of structure has been proposed from which the simulated images obtained are consistent with observations. The medium resolution images correlated with the electron diffraction data have revealed existence of a multi-soliton regime with latent lock in phases of commensurate periods between 4b and 10b. At last, a description of different phases of these compounds as a result of superstructures from a disordered perovskite type structure is proposed (author) [fr
A video-amplifier device for the transmission-type electron microscope ELMISCOP I of Siemens
International Nuclear Information System (INIS)
Groboth, G.; Hoerl, E.M.
1975-01-01
In order to get a visual image of the sample at the final screen of a transmission-type electron microscope and to keep at the same time the sample at low temperature a video-amplifier device has been developed by the authors. Details about its design and the necessary reconstruction of the electron microscope equipment are given. The beam current density at the transparent screen is reduced to 10 -12 -10 -13 A.cm -2 . Moreover the costs of this video-amplifier device are lower than those available. (CR)
International Nuclear Information System (INIS)
Platonov, P.A.; Gurovich, B.A.; Shtrombakh, Ya.I.; Karpukhin, V.I.
1985-01-01
Transmission electron-microscopic investigation of polycrystalline graphite before and after irradiation is carried out. The direct use of graphite samples after ion thinning, as an inquiry subject is the basic peculiarity of the work. Main structural components of MPG-6 graphite before and after irradiation are revealed, the structural mechanism of the reactor graphite destruction under irradiation is demonstrated. The mean values of L αm and L cm crystallite dimensions are determined. Radiation defects, occuring in some crystallites after irradiation are revealed by the dark-field electron microscopy method
Transmission positron microscopes
International Nuclear Information System (INIS)
Doyama, Masao; Kogure, Yoshiaki; Inoue, Miyoshi; Kurihara, Toshikazu; Yoshiie, Toshimasa; Oshima, Ryuichiro; Matsuya, Miyuki
2006-01-01
Immediate and near-future plans for transmission positron microscopes being built at KEK, Tsukuba, Japan, are described. The characteristic feature of this project is remolding a commercial electron microscope to a positron microscope. A point source of electrons kept at a negative high voltage is changed to a point source of positrons kept at a high positive voltage. Positional resolution of transmission microscopes should be theoretically the same as electron microscopes. Positron microscopes utilizing trapping of positrons have always positional ambiguity due to the diffusion of positrons
Directory of Open Access Journals (Sweden)
Julien Burlaud-Gaillard
Full Text Available The intracellular morphogenesis of flaviviruses has been well described, but flavivirus release from the host cell remains poorly documented. We took advantage of the optimized production of an attenuated chimeric yellow fever/dengue virus for vaccine purposes to study this phenomenon by microscopic approaches. Scanning electron microscopy (SEM showed the release of numerous viral particles at the cell surface through a short-lived process. For transmission electron microscopy (TEM studies of the intracellular ultrastructure of the small number of cells releasing viral particles at a given time, we developed a new correlative microscopy method: CSEMTEM (for correlative scanning electron microscopy - transmission electron microscopy. CSEMTEM analysis suggested that chimeric flavivirus particles were released as individual particles, in small exocytosis vesicles, via a regulated secretory pathway. Our morphological findings provide new insight into interactions between flaviviruses and cells and demonstrate that CSEMTEM is a useful new method, complementary to SEM observations of biological events by intracellular TEM investigations.
Development techniques and electron optical studies of high voltage, high current electron guns
International Nuclear Information System (INIS)
Rangarajan, L.M.; Mahadevan, S.; Ramamurthi, S.S.
1992-01-01
The progress of the electron gun design, limiting to axially symmetric geometries is discussed here with a view to utilise such guns for electron accelerators. The mechanical design features leading to the physical configuration of the gun with stringent tolerances are outlined. Vacuum processing is done at pressures of 1.3x10 -5 Pa. The gun employs W-filament emitter or a cathode pellet with bombarder service. A water cooled compact faraday cup is used to measure the electron current. Electron gun geometries have been studied using the computer programme. The preveance of the gun is 0.7x10 -7 A/Vsup(1.5) at 80 kV. Developmental techniques of such pulsed electron guns are described. (author). 7 refs., 5 figs
DEFF Research Database (Denmark)
Zhang, Wei; Kuhn, Luise Theil; Jørgensen, Peter Stanley
2013-01-01
An optimum method is proposed to prepare thin foil transmission electron microscopy (TEM) lamellae of multiphase porous functional ceramics: prefilling the pore space of these materials with an epoxy resin prior to focused ion beam milling. Several advantages of epoxy impregnation are demonstrated...... by successful preparation of TEM specimens that maintain the structural integrity of the entire lamella. Feasibility of the TEM alignment procedure is demonstrated, and ideal TEM analyses are illustrated on solid oxide fuel cell and solid oxide electrolysis cell materials. Some potential drawbacks of the TEM...
Energy Technology Data Exchange (ETDEWEB)
Koh, Ai Leen, E-mail: alkoh@stanford.edu [Stanford Nano Shared Facilities, Stanford University, Stanford, CA 94305 (United States); Sinclair, Robert [Department of Materials Science and Engineering, Stanford University, Stanford, CA 94305 (United States)
2017-05-15
In this work, we examine how the imaging electron beam can induce damage in carbon nanotubes (CNTs) at varying oxygen gas pressures and electron dose rates using environmental transmission electron microscopy (ETEM). Our studies show that there is a threshold cumulative electron dose which brings about damage in CNTs in oxygen – through removal of their graphitic walls – which is dependent on O{sub 2} pressure, with a 4–5 fold decrease in total electron dose per decade increase at a lower pressure range (10{sup −6} to 10{sup −5} mbar) and approximately 1.3 –fold decrease per decade increase at a higher pressure range (10{sup −3} to 10{sup 0} mbar). However, at a given pressure, damage in CNTs was found to occur even at the lowest dose rate utilized, suggesting the absence of a lower limit for the latter parameter. This study provides guidelines on the cumulative dose required to damage nanotubes in the 10{sup −7} mbar to 10{sup 0} mbar pressure regimes, and discusses the role of electron dose rate and total electron dose on beam-induced CNT degradation experiments. - Highlights: • The electron beam ionizes gas molecules in ETEM and affects experimental outcomes. • Beam-induced damage in CNTs occurs at varying O{sub 2} pressures and electron dose rates. • There is a threshold cumulative dose to damage CNTs which depends on O{sub 2} pressure. • At a given pressure, CNT damage occurs even at the electron dose rate utilized.
International Nuclear Information System (INIS)
Koh, Ai Leen; Sinclair, Robert
2017-01-01
In this work, we examine how the imaging electron beam can induce damage in carbon nanotubes (CNTs) at varying oxygen gas pressures and electron dose rates using environmental transmission electron microscopy (ETEM). Our studies show that there is a threshold cumulative electron dose which brings about damage in CNTs in oxygen – through removal of their graphitic walls – which is dependent on O_2 pressure, with a 4–5 fold decrease in total electron dose per decade increase at a lower pressure range (10"−"6 to 10"−"5 mbar) and approximately 1.3 –fold decrease per decade increase at a higher pressure range (10"−"3 to 10"0 mbar). However, at a given pressure, damage in CNTs was found to occur even at the lowest dose rate utilized, suggesting the absence of a lower limit for the latter parameter. This study provides guidelines on the cumulative dose required to damage nanotubes in the 10"−"7 mbar to 10"0 mbar pressure regimes, and discusses the role of electron dose rate and total electron dose on beam-induced CNT degradation experiments. - Highlights: • The electron beam ionizes gas molecules in ETEM and affects experimental outcomes. • Beam-induced damage in CNTs occurs at varying O_2 pressures and electron dose rates. • There is a threshold cumulative dose to damage CNTs which depends on O_2 pressure. • At a given pressure, CNT damage occurs even at the electron dose rate utilized.
High-resolution imaging in the scanning transmission electron microscope
International Nuclear Information System (INIS)
Pennycook, S.J.; Jesson, D.E.
1992-03-01
The high-resolution imaging of crystalline materials in the scanning transmission electron microscopy (STEM) is reviewed with particular emphasis on the conditions under which an incoherent image can be obtained. It is shown that a high-angle annular detector can be used to break the coherence of the imaging process, in the transverse plane through the geometry of the detector, or in three dimensions if multiphonon diffuse scattering is detected. In the latter case, each atom can be treated as a highly independent source of high-angle scattering. The most effective fast electron states are therefore tightly bound s-type Bloch states. Furthermore, they add constructively for each incident angle in the coherent STEM probe, so that s states are responsible for practically the entire image contrast. Dynamical effects are largely removed, and almost perfect incoherent imaging is achieved. s states are relatively insensitive to neighboring strings, so that incoherent imaging is maintained for superlattice and interfaces, and supercell calculations are unnecessary. With an optimum probe profile, the incoherent image represents a direct image of the crystal projection, with compositional sensitivity built in through the strong dependence of the scattering cross sections on atomic number Z
Rubino, Stefano; Akhtar, Sultan; Leifer, Klaus
2016-02-01
We present a simple, fast method for thickness characterization of suspended graphene/graphite flakes that is based on transmission electron microscopy (TEM). We derive an analytical expression for the intensity of the transmitted electron beam I 0(t), as a function of the specimen thickness t (tgraphite). We show that in thin graphite crystals the transmitted intensity is a linear function of t. Furthermore, high-resolution (HR) TEM simulations are performed to obtain λ for a 001 zone axis orientation, in a two-beam case and in a low symmetry orientation. Subsequently, HR (used to determine t) and bright-field (to measure I 0(0) and I 0(t)) images were acquired to experimentally determine λ. The experimental value measured in low symmetry orientation matches the calculated value (i.e., λ=225±9 nm). The simulations also show that the linear approximation is valid up to a sample thickness of 3-4 nm regardless of the orientation and up to several ten nanometers for a low symmetry orientation. When compared with standard techniques for thickness determination of graphene/graphite, the method we propose has the advantage of being simple and fast, requiring only the acquisition of bright-field images.
International Nuclear Information System (INIS)
Ahn, Tae-Young; Kim, Sung Woo; Hwang, Seong Sik
2016-01-01
Service failure of alloy 690 in NPP has not been reported. However, some research groups reported that primary water stress corrosion cracking (PWSCC) occurred in severely cold-rolled alloy 690. Transgranular craking was also reported in coll-rolled alloy 690 with a banded structure. In order to understand the effect of cold rolling on the cracking of alloy 690, many research groups have focused on the local strain and the cracked carbide induced by cold-rolling, by using electron backscatter diffraction (EBSD). Transmission electron microscopy (TEM) has been widely used to characterize structural materials because this technique has superior spatial resolution and allows for the analysis of crystallographic and chemical information. The aim of the present study is to understand the mechanism of the abnormally high crack growth rate (CGR) in cold-rolled alloy 690 with a banded structure. The local dislocation density was measured by TEM to confirm the effects of local strain on the stress corrosion cracking (SCC) of alloy 690 with a banded structure. The effects of intragranular carbides on the SCC were also evaluated in this study. The local dislocation densities were directly measured using TEM to understand the effect of local strain on the SCC of Ni-based alloy 690 with a banded structure. The dislocation densities in the interior of the grains sharply increased in highly cold-rolled specimens due to intragranular carbide, which acted as a dislocation source
Cremons, Daniel R.; Schliep, Karl B.; Flannigan, David J.
2013-09-01
With ultrafast transmission electron microscopy (UTEM), access can be gained to the spatiotemporal scales required to directly visualize rapid, non-equilibrium structural dynamics of materials. This is achieved by operating a transmission electron microscope (TEM) in a stroboscopic pump-probe fashion by photoelectrically generating coherent, well-timed electron packets in the gun region of the TEM. These probe photoelectrons are accelerated down the TEM column where they travel through the specimen before reaching a standard, commercially-available CCD detector. A second laser pulse is used to excite (pump) the specimen in situ. Structural changes are visualized by varying the arrival time of the pump laser pulse relative to the probe electron packet at the specimen. Here, we discuss how ultrafast nanoscale motions of crystalline materials can be visualized and precisely quantified using diffraction contrast in UTEM. Because diffraction contrast sensitively depends upon both crystal lattice orientation as well as incoming electron wavevector, minor spatial/directional variations in either will produce dynamic and often complex patterns in real-space images. This is because sections of the crystalline material that satisfy the Laue conditions may be heterogeneously distributed such that electron scattering vectors vary over nanoscale regions. Thus, minor changes in either crystal grain orientation, as occurs during specimen tilting, warping, or anisotropic expansion, or in the electron wavevector result in dramatic changes in the observed diffraction contrast. In this way, dynamic contrast patterns observed in UTEM images can be used as sensitive indicators of ultrafast specimen motion. Further, these motions can be spatiotemporally mapped such that direction and amplitude can be determined.
International Nuclear Information System (INIS)
He Yong; Zou Wen-Kang; Song Sheng-Yi
2011-01-01
In modern pulsed power systems, magnetically insulated transmission lines (MITLs) are used to couple power between the driver and the load. The circuit parameters of MITLs are well understood by employing the concept of flow impedance derived from Maxwell's equations and pressure balance across the flow. However, the electron density in an MITL is always taken as constant in the application of flow impedance. Thus effects of electron flow current density (product of electron density and drift velocity) in an MITL are neglected. We calculate the flow impedances of an MITL and compare them under three classical MITL theories, in which the electron density profile and electron flow current density are different from each other. It is found that the assumption of constant electron density profile in the calculation of the flow impedance is not always valid. The electron density profile and the electron flow current density have significant effects on flow impedance of the MITL. The details of the electron flow current density and its effects on the operation impedance of the MITL should be addressed more explicitly by experiments and theories in the future. (nuclear physics)
Characterization of nanocrystalline zirconia powders by electron optical techniques
International Nuclear Information System (INIS)
Bursill, L.A.
1989-01-01
Electron optical techniques are described for the characterization of the size distribution of agglomerates, aggregates and primary micro- and nanocrystallites of as-processed zirconia powders. These techniques allow for direct identification of individual crystallites as tetragonal or monoclinic, by optical transform of high-resolution electron micrographs. The latter also permit surface morphology to be examined with atomic resolution. Applications to a range of pure and doped zirconia powders, of recent commercial interest, are presented, which enable the results of concurrent studies by sedimentation, surface specific area measurements, porosity and sinterability to be correctly interpreted. 18 figs
Study on superstructure in ion co-doped BiFeO3 by using transmission electron microscopy
Pu, Shi-Zhou; Guo, Chao; Li, Mei-Ya; Chen, Zhen-Lian; Zou, Hua-Min
2015-04-01
La3+ and V5+ co-doped BiFeO3 ceramics are synthesized by rapid liquid sintering technique. The modulated structure in Bi0.85La0.15Fe0.97V0.03O3 is investigated by using transmission electron microscopy (TEM). Two kinds of superstructures are observed in the samples. One is the component modulated superstructure and twin-domain, which is generated by La3+ ordered substitution for Bi3+ and frequently appears. The chemical composition of the superstructure is explored by x-ray energy dispersive spectroscopy (EDS). The model of the ordered structure is proposed. Simulation based on the model is conducted. The second is the fluorite-type δ-Bi2O3 related superstructure. The relation between the ferroelectric property and the microstructure of the sample is also discussed. Project supported by the National Natural Science Foundation of China (Grant Nos. 51372174, 11074193, and 51132001) and the Fundamental Research Funds for the Central Universities.
International Nuclear Information System (INIS)
Angeles C, C.; Rosas, G.; Perez C, R.
1997-01-01
In this work preliminary studies about the TiAl 3 characterization are reported which is obtained starting from the Fast solidification technique in an arc furnace using Scanning electron microscopy, X-ray diffraction and Transmission electron microscopy. (Author)
Novel in-situ lamella fabrication technique for in-situ TEM.
Canavan, Megan; Daly, Dermot; Rummel, Andreas; McCarthy, Eoin K; McAuley, Cathal; Nicolosi, Valeria
2018-03-29
In-situ transmission electron microscopy is rapidly emerging as the premier technique for characterising materials in a dynamic state on the atomic scale. The most important aspect of in-situ studies is specimen preparation. Specimens must be electron transparent and representative of the material in its operational state, amongst others. Here, a novel fabrication technique for the facile preparation of lamellae for in-situ transmission electron microscopy experimentation using focused ion beam milling is developed. This method involves the use of rotating microgrippers during the lift-out procedure, as opposed to the traditional micromanipulator needle and platinum weld. Using rotating grippers, and a unique adhesive substance, lamellae are mounted onto a MEMS device for in-situ TEM annealing experiments. We demonstrate how this technique can be used to avoid platinum deposition as well as minimising damage to the MEMS device during the thinning process. Our technique is both a cost effective and readily implementable alternative to the current generation of preparation methods for in-situ liquid, electrical, mechanical and thermal experimentation within the TEM as well as traditional cross-sectional lamella preparation. Copyright © 2018 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Chadderton, L.T.; Johnson, E.
1977-01-01
Despite continuing improvements in applications of the analytical method of Rutherford backscattering (RBS) to solid state physics it is recognized that more complete information can be obtained if other techniques - for example transmission electron microscopy (TEM) - are employed simultaneously. Experiments are described in which a combined RBS and TEM study of the annealing of nickel, rendered amorphous by implantation of 20 keV dysprosium ions is supplemented with a completely new technique - total current spectroscopy (TCS). In TCS low energy electrons (0-15 eV) are used to probe the damaged nickel. Observations have been made during annealing of both the reappearance of the bulk band structure of the metal and of a 'surface peak' which is highly sensitive to the recovery process. Changes in the height of the surface peak reveal three sharp annealing stages, the first two being preceded by reverse annealing which correlates well with RBS and TEM results. The first annealing stage - following the amorphous to crystalline transition - may be associated with electronic effects in the vicinity of the Curie point. Changes in the position of the surface peak allow one to trace the diffusion of dysprosium to the surface. Quantum mechanical resonances at the damage/crystal interface have also been followed throughout annealing. The initially amorphous layer (approximately 2.2nm) increases in thickness slightly during recovery. (Auth.)
In situ investigation of bismuth nanoparticles formation by transmission electron microscope.
Liu, Liming; Wang, Honghang; Yi, Zichuan; Deng, Quanrong; Lin, Zhidong; Zhang, Xiaowen
2018-02-01
Bismuth (Bi) nanoparticles are prepared by using NaBi(MoO 4 ) 2 nanosheets in the beam of electrons emitted by transmission electron microscope. The formation and growth of Bi nanoparticles are investigated in situ. The sizes of Bi nanoparticles are confined within the range of 6-10nm by controlling irradiation time. It is also observed that once the diameter of nanoparticles is larger than 10nm, the Bi particles are stable as a result of the immobility of large nanoparticles. In addition, some nanoparticles on the edges form nanorods, which are explained as the result of a coalescence process, if the irradiation period is longer than 10min. The in situ research on Bi nanoparticles facilitates in-depth investigations of the physicochemical behavior and provides more potential applications in various fields such as sensors, catalysts and optical devices. Copyright © 2017 Elsevier Ltd. All rights reserved.
Martin, Joannie; Beauparlant, Martin; Sauvé, Sébastien; L'Espérance, Gilles
2016-12-01
Asbestos amosite fibers were investigated to evaluate the damage caused by a transmission electron microscope (TEM) electron beam. Since elemental x-ray intensity ratios obtained by energy dispersive x-ray spectroscopy (EDS) are commonly used for asbestos identification, the impact of beam damage on these ratios was evaluated. It was determined that the magnesium/silicon ratio best represented the damage caused to the fiber. Various tests showed that most fibers have a current density threshold above which the chemical composition of the fiber is modified. The value of this threshold current density varied depending on the fiber, regardless of fiber diameter, and in some cases could not be determined. The existence of a threshold electron dose was also demonstrated. This value was dependent on the current density used and can be increased by providing a recovery period between exposures to the electron beam. This study also established that the electron beam current is directly related to the damage rate above a current density of 165 A/cm 2 . The large number of different results obtained suggest, that in order to ensure that the amosite fibers are not damaged, analysis should be conducted below a current density of 100 A/cm 2 .
Shiloh, Roy; Remez, Roei; Lu, Peng-Han; Jin, Lei; Lereah, Yossi; Tavabi, Amir H; Dunin-Borkowski, Rafal E; Arie, Ady
2018-06-01
Nearly eighty years ago, Scherzer showed that rotationally symmetric, charge-free, static electron lenses are limited by an unavoidable, positive spherical aberration. Following a long struggle, a major breakthrough in the spatial resolution of electron microscopes was reached two decades ago by abandoning the first of these conditions, with the successful development of multipole aberration correctors. Here, we use a refractive silicon nitride thin film to tackle the second of Scherzer's constraints and demonstrate an alternative method for correcting spherical aberration in a scanning transmission electron microscope. We reveal features in Si and Cu samples that cannot be resolved in an uncorrected microscope. Our thin film corrector can be implemented as an immediate low cost upgrade to existing electron microscopes without re-engineering of the electron column or complicated operation protocols and can be extended to the correction of additional aberrations. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Armstrong, Michael R. [Materials Science and Technology Division, Chemistry and Materials Science Directorate, Lawrence Livermore National Laboratory, P.O. Box 808, L-356, Livermore, CA 94550 (United States)], E-mail: armstrong30@llnl.gov; Boyden, Ken [Materials Science and Technology Division, Chemistry and Materials Science Directorate, Lawrence Livermore National Laboratory, P.O. Box 808, L-356, Livermore, CA 94550 (United States); Browning, Nigel D. [Materials Science and Technology Division, Chemistry and Materials Science Directorate, Lawrence Livermore National Laboratory, P.O. Box 808, L-356, Livermore, CA 94550 (United States); Department of Chemical Engineering and Materials Science, University of California-Davis, One Shields Avenue, Davis, CA 95616 (United States); Campbell, Geoffrey H.; Colvin, Jeffrey D.; De Hope, William J.; Frank, Alan M. [Materials Science and Technology Division, Chemistry and Materials Science Directorate, Lawrence Livermore National Laboratory, P.O. Box 808, L-356, Livermore, CA 94550 (United States); Gibson, David J.; Hartemann, Fred [N Division, Physics and Advanced Technologies Directorate, Lawrence Livermore National Laboratory, P.O. Box 808, L-280, Livermore, CA 94550 (United States); Kim, Judy S. [Materials Science and Technology Division, Chemistry and Materials Science Directorate, Lawrence Livermore National Laboratory, P.O. Box 808, L-356, Livermore, CA 94550 (United States); Department of Chemical Engineering and Materials Science, University of California-Davis, One Shields Avenue, Davis, CA 95616 (United States); King, Wayne E.; La Grange, Thomas B.; Pyke, Ben J.; Reed, Bryan W.; Shuttlesworth, Richard M.; Stuart, Brent C.; Torralva, Ben R. [Materials Science and Technology Division, Chemistry and Materials Science Directorate, Lawrence Livermore National Laboratory, P.O. Box 808, L-356, Livermore, CA 94550 (United States)
2007-04-15
Although recent years have seen significant advances in the spatial resolution possible in the transmission electron microscope (TEM), the temporal resolution of most microscopes is limited to video rate at best. This lack of temporal resolution means that our understanding of dynamic processes in materials is extremely limited. High temporal resolution in the TEM can be achieved, however, by replacing the normal thermionic or field emission source with a photoemission source. In this case the temporal resolution is limited only by the ability to create a short pulse of photoexcited electrons in the source, and this can be as short as a few femtoseconds. The operation of the photo-emission source and the control of the subsequent pulse of electrons (containing as many as 5x10{sup 7} electrons) create significant challenges for a standard microscope column that is designed to operate with a single electron in the column at any one time. In this paper, the generation and control of electron pulses in the TEM to obtain a temporal resolution <10{sup -6} s will be described and the effect of the pulse duration and current density on the spatial resolution of the instrument will be examined. The potential of these levels of temporal and spatial resolution for the study of dynamic materials processes will also be discussed.
International Nuclear Information System (INIS)
Armstrong, Michael R.; Boyden, Ken; Browning, Nigel D.; Campbell, Geoffrey H.; Colvin, Jeffrey D.; De Hope, William J.; Frank, Alan M.; Gibson, David J.; Hartemann, Fred; Kim, Judy S.; King, Wayne E.; La Grange, Thomas B.; Pyke, Ben J.; Reed, Bryan W.; Shuttlesworth, Richard M.; Stuart, Brent C.; Torralva, Ben R.
2007-01-01
Although recent years have seen significant advances in the spatial resolution possible in the transmission electron microscope (TEM), the temporal resolution of most microscopes is limited to video rate at best. This lack of temporal resolution means that our understanding of dynamic processes in materials is extremely limited. High temporal resolution in the TEM can be achieved, however, by replacing the normal thermionic or field emission source with a photoemission source. In this case the temporal resolution is limited only by the ability to create a short pulse of photoexcited electrons in the source, and this can be as short as a few femtoseconds. The operation of the photo-emission source and the control of the subsequent pulse of electrons (containing as many as 5x10 7 electrons) create significant challenges for a standard microscope column that is designed to operate with a single electron in the column at any one time. In this paper, the generation and control of electron pulses in the TEM to obtain a temporal resolution -6 s will be described and the effect of the pulse duration and current density on the spatial resolution of the instrument will be examined. The potential of these levels of temporal and spatial resolution for the study of dynamic materials processes will also be discussed
Light-Induced Reduction of Cuprous Oxide in an Environmental Transmission Electron Microscope
DEFF Research Database (Denmark)
Cavalca, Filippo Carlo; Laursen, Anders Bo; Wagner, Jakob Birkedal
2013-01-01
Photocatalysts for solar fuel production are subject to intensive investigation as they constitute one viable route for solar energy harvesting. Cuprous oxide (Cu2O) is a working photocatalyst for hydrogen evolution but it photocorrodes upon light illumination in an aqueous environment....... Environmental transmission electron microscopy (ETEM) makes it possible to obtain insight into the local structure, composition and reactivity of catalysts in their working environment, which is of fundamental interest for sustainable energy research and is essential for further material optimization. Herein...
International Nuclear Information System (INIS)
Ludwig, Frank; Heim, Erik; Schilling, Meinhard
2009-01-01
We have compared the structure parameters of magnetic core-shell nanoparticles determined from fluxgate magnetorelaxometry measurements applying the moment superposition model with the results from other methods. For the characterization of the magnetic cores, the nanoparticles are immobilized by freeze-drying. The core size distribution estimated for superparamagnetic Fe 3 O 4 magnetic nanoparticles (MNPs) with polyacrylic acid shell agrees well with that from transmission electron microscopy measurements. The distribution of hydrodynamic diameters of nanoparticle suspensions estimated from magnetorelaxometry measurements is in good agreement with that obtained from ac susceptibility and photon correlation spectroscopy measurements. Advantages of magnetorelaxometry compared to the other two integral techniques are that it is fast and the signal is less dominated by larger particles.
Xiang, D.; Fu, F.; Zhang, J.; Huang, X.; Wang, L.; Wang, X.; Wan, W.
2014-01-01
We present feasibility study of an accelerator-based ultrafast transmission electron microscope (u-TEM) capable of producing a full field image in a single-shot with simultaneous picosecond temporal resolution and nanometer spatial resolution. We study key physics related to performance of u-TEMs, and discuss major challenges as well as possible solutions for practical realization of u-TEMs. The feasibility of u-TEMs is confirmed through simulations using realistic electron beam parameters. W...
DEFF Research Database (Denmark)
Duchamp, Martial; Söderström, K.; Jeangros, Q.
2011-01-01
The study of light trapping in amorphous, microcrystalline and micromorph thin-film Si solar cells is an important and active field of investigation. It has been demonstrated that the use of a rough Ag back-reflector lead to an increase of short circuit current but also to losses through...... the creation of surface plasmon polaritons. Here, we use transmission electron microscopy (TEM) techniques to study the grain structure of a Ag thin-film that was sputtered on top of 2-μm-thick rough ZnO layer - defects, such as twin-boundaries have been observed. A smoothing of the top Ag surface was also...... observed after ex-situ annealing. Electron energy-loss spectroscopy with a monochromatic beam was used to measure the surface plasmon resonance with nm spatial resolution. 1 eV and 3 eV Ag surface plasmon resonances have been observed on as-grown layers. Such measurements provide valuable information about...
Directory of Open Access Journals (Sweden)
Wu Qing
2015-10-01
Full Text Available Three sample preparation techniques, focused ion beam (FIB, ion beam (IB etching, and ultramicrotomy (UM were used in comparison to analyze the interphase of carbon fiber/epoxy composites using transmission electron microscopy. An intact interphase with a relatively uniform thickness was obtained by FIB, and detailed chemical analysis of the interphase was investigated by electron energy loss spectroscopy. It shows that the interphase region is 200 nm wide with an increasing oxygen-to-carbon ratio from 10% to 19% and an almost constant nitrogen-to-carbon ratio of about 3%. However, gallium implantation of FIB tends to hinder fine structure analysis of the interphase. For IB etching, the interphase region is observed with transition morphology from amorphous resin to nano-crystalline carbon fiber, but the uneven sample thickness brings difficulty for quantitative chemical analysis. Moreover, UM tends to cause damage and/or deformation on the interphase. These results are meaningful for in-depth understanding on the interphase characteristic of carbon fiber composites.
A dual energy gamma-ray transmission technique for gold alloy identification
International Nuclear Information System (INIS)
Sumi, Tetsuo; Shingu, Hiroyasu; Iwase, Hirotoshi
1991-01-01
An application of the dual energy gamma-ray transmission techniques to gold alloy identification is presented. The measurement by dual energy gamma-ray transmission is independent of thickness and density of a sample. Due to this advantage, golden accessories such as necklaces, earrings and rings can be assayed in spite of their various thicknesses and irregular sectional shapes. Choice of a gamma-ray energy pair suitable for the object is important. The authors chose 511 keV and 1275 keV gamma-rays from 22 Na. With this energy pair, R value (a ratio of mass attenuation coefficients for low and high energy gamma-rays) is predominantly related to the weight fraction of gold of the sample. Using a 370 kBq 22 Na small source and a 50 mm dia.x 50 mm thick NaI(Tl) scintillator for 1200 seconds, a resolution of 2% for the R value was obtained. This corresponds to approximately 5% of the weight fraction of gold. A better resolution can be obtained by increasing the source activity or measurement time. (author)
Energy Technology Data Exchange (ETDEWEB)
Grapes, Michael D., E-mail: mgrapes1@jhu.edu [Department of Materials Science and Engineering, Johns Hopkins University, Baltimore, Maryland 21218 (United States); Materials Measurement Science Division, Material Measurement Laboratory, National Institute of Standards and Technology, Gaithersburg, Maryland 20899 (United States); LaGrange, Thomas; Reed, Bryan W.; Campbell, Geoffrey H. [Condensed Matter and Materials Division, Lawrence Livermore National Laboratory, Livermore, California 94550 (United States); Friedman, Lawrence H.; LaVan, David A., E-mail: david.lavan@nist.gov [Materials Measurement Science Division, Material Measurement Laboratory, National Institute of Standards and Technology, Gaithersburg, Maryland 20899 (United States); Weihs, Timothy P., E-mail: weihs@jhu.edu [Department of Materials Science and Engineering, Johns Hopkins University, Baltimore, Maryland 21218 (United States)
2014-08-15
Nanocalorimetry is a chip-based thermal analysis technique capable of analyzing endothermic and exothermic reactions at very high heating and cooling rates. Here, we couple a nanocalorimeter with an extremely fast in situ microstructural characterization tool to identify the physical origin of rapid enthalpic signals. More specifically, we describe the development of a system to enable in situ nanocalorimetry experiments in the dynamic transmission electron microscope (DTEM), a time-resolved TEM capable of generating images and electron diffraction patterns with exposure times of 30 ns–500 ns. The full experimental system consists of a modified nanocalorimeter sensor, a custom-built in situ nanocalorimetry holder, a data acquisition system, and the DTEM itself, and is capable of thermodynamic and microstructural characterization of reactions over a range of heating rates (10{sup 2} K/s–10{sup 5} K/s) accessible by conventional (DC) nanocalorimetry. To establish its ability to capture synchronized calorimetric and microstructural data during rapid transformations, this work describes measurements on the melting of an aluminum thin film. We were able to identify the phase transformation in both the nanocalorimetry traces and in electron diffraction patterns taken by the DTEM. Potential applications for the newly developed system are described and future system improvements are discussed.
Energy Technology Data Exchange (ETDEWEB)
García-Cervantes, H.; Madrigal-Melchor, J.; Martínez-Orozco, J.C.; Rodríguez-Vargas, I., E-mail: isaac@fisica.uaz.edu.mx
2015-12-01
We study the transmission, transport and electronic structure properties of aperiodic Fibonacci monolayer graphene-based structures (AFGBSs). The transfer matrix method has been implemented to obtain the transmittance, linear-regime conductance and electronic structure. In particular, we have studied two types of aperiodic graphene-based structures: (1) electrostatic AFGBSs (EAFGBSs), structures formed with electrostatic potentials, and (2) substrate AFGBSs (SAFGBSs), obtained alternating substrates that can open and non-open, such as SiC and SiO{sub 2}, an energy bandgap on graphene. We have found that the transmission properties can be modulated readily by changing the main parameters of the systems: well and barrier widths, energy and angle of incident electrons and the degree of aperiodicity. In the case of the linear-regime conductance turns out that it diminishes various orders of magnitude increasing the barrier width for SAFGBSs. On the contrary, Klein tunneling sustains the conductance in EAFGBSs. Calculating the electronic structure or miniband-structure formation and its fragmentation we establish a direct connection between the conductance peaks and the opening, closure and degeneration of energy minibands for both EAFGSLs and SAFGSLs.
Transmission electron and optical microscopy of the domain structure of Ni3B7O13Br ferroic boracite
International Nuclear Information System (INIS)
Castellanos-Guzman, A.G.; Trujillo-Torrez, M.; Czank, M.
2005-01-01
The study investigated the domain structure of nickel bromine boracite single crystals, by means of polarised-light in conjunction with transmission electron microscopy. Single crystals of Ni 3 B 7 O 13 Br were grown by chemical transport reactions in closed quartz ampoules, in the temperature range of 1130 K and were examined by polarising optical microscopy (PLM), and transmission electron microscopy (TEM). PLM was also used in order to study the behaviour of birefringence as a function of temperature. For TEM the single crystals were crushed and mounted on holey carbon films. Comparative electron microscope images were useful for revealing the domain structure of this fully ferroelectric/fully ferroelastic material previously observed between the crossed polars of an optical microscope. X-ray diffraction analysis of the crystal under study was performed at room temperature
Cross-section transmission electron microscopy of the ion implantation damage in annealed diamond
Energy Technology Data Exchange (ETDEWEB)
Derry, T.E. [DST/NRF Centre of Excellence in Strong Materials and School of Physics, University of the Witwatersrand, Wits 2050, Johannesburg (South Africa)], E-mail: Trevor.Derry@wits.ac.za; Nshingabigwi, E.K. [DST/NRF Centre of Excellence in Strong Materials and School of Physics, University of the Witwatersrand, Wits 2050, Johannesburg (South Africa); Department of Physics, National University of Rwanda, P.O. Box 117, Huye (Rwanda); Levitt, M. [DST/NRF Centre of Excellence in Strong Materials and School of Physics, University of the Witwatersrand, Wits 2050, Johannesburg (South Africa); Neethling, J. [DST/NRF CoE-SM and Physics Department, Nelson Mandela Metropolitan University, Port Elizabeth (South Africa); Naidoo, S.R. [DST/NRF Centre of Excellence in Strong Materials and School of Physics, University of the Witwatersrand, Wits 2050, Johannesburg (South Africa)
2009-08-15
It has formerly been shown that low-damage levels, produced during the implantation doping of diamond as a semiconductor, anneal easily while high levels 'graphitize' (above about 5.2 x 10{sup 15} ions/cm{sup 2}). The difference in the defect types and their profiles, in the two cases, has never been directly observed. We have succeeded in using cross-section transmission electron microscopy to do so. The experiments were difficult because the specimens must be polished to {approx}40 {mu}m thickness, then implanted on edge and annealed, before final ion beam thinning to electron transparency. The low-damage micrographs reveal some deeply penetrating dislocations, whose existence had been predicted in earlier work.
Cross-section transmission electron microscopy of the ion implantation damage in annealed diamond
International Nuclear Information System (INIS)
Derry, T.E.; Nshingabigwi, E.K.; Levitt, M.; Neethling, J.; Naidoo, S.R.
2009-01-01
It has formerly been shown that low-damage levels, produced during the implantation doping of diamond as a semiconductor, anneal easily while high levels 'graphitize' (above about 5.2 x 10 15 ions/cm 2 ). The difference in the defect types and their profiles, in the two cases, has never been directly observed. We have succeeded in using cross-section transmission electron microscopy to do so. The experiments were difficult because the specimens must be polished to ∼40 μm thickness, then implanted on edge and annealed, before final ion beam thinning to electron transparency. The low-damage micrographs reveal some deeply penetrating dislocations, whose existence had been predicted in earlier work.
Dynamics of annular bright field imaging in scanning transmission electron microscopy
International Nuclear Information System (INIS)
Findlay, S.D.; Shibata, N.; Sawada, H.; Okunishi, E.; Kondo, Y.; Ikuhara, Y.
2010-01-01
We explore the dynamics of image formation in the so-called annular bright field mode in scanning transmission electron microscopy, whereby an annular detector is used with detector collection range lying within the cone of illumination, i.e. the bright field region. We show that this imaging mode allows us to reliably image both light and heavy columns over a range of thickness and defocus values, and we explain the contrast mechanisms involved. The role of probe and detector aperture sizes is considered, as is the sensitivity of the method to intercolumn spacing and local disorder.
Brenner, R; Dehos, C; De Lurgio, P; Djurcic, Z; Drake, G; Gonzales Gimenez, JL; Gustafsson, L; Kim, DW; Locci, E; Pfeiffer, U; Röhrich, D; Rydberg, D; Schöning, A; Siligaris, A; Soltveit, HK; Ullaland, K; Vincent, P; Vasquez, PR; Wiedner, D; Yang, S
2017-01-01
In the WADAPT project described in this Letter of Intent, we propose to develop wireless techniques for data and power transmission in particle-physics detectors. Wireless techniques have developed extremely fast over the last decade and are now mature for being considered as a promising alternative to cables and optical links that would revolutionize the detector design. The WADAPT consortium has been formed to identify the specific needs of different projects that might benefit from wireless techniques with the objective of providing a common platform for research and development in order to optimize effectiveness and cost. The proposed R&D will aim at designing and testing wireless demonstrators for large instrumentation systems.
Craniospinal radiotherapy in children: Electron- or photon-based technique of spinal irradiation
International Nuclear Information System (INIS)
Chojnacka, M.; Skowronska-Gardas, A.; Pedziwiatr, K.; Morawska-Kaczynska, M.; Zygmuntowicz-Pietka, A.; Semaniak, A.
2010-01-01
Background: The prone position and electron-based technique for craniospinal irradiation (CSI) have been standard in our department for many years. But this immobilization is difficult for the anaesthesiologist to gain airway access. The increasing number of children treated under anaesthesia led us to reconsider our technique. Aim: The purpose of this study is to report our new photon-based technique for CSI which could be applied in both the supine and the prone position and to compare this technique with our electron-based technique. Materials and methods: Between November 2007 and May 2008, 11 children with brain tumours were treated in the prone position with CSI. For 9 patients two treatment plans were created: the first one using photons and the second one using electron beams for spinal irradiation. We prepared seven 3D-conformal photon plans and four forward planned segmented field plans. We compared 20 treatment plans in terms of target dose homogeneity and sparing of organs at risk. Results: In segmented field plans better dose homogeneity in the thecal sac volume was achieved than in electron-based plans. Regarding doses in organs at risk, in photon-based plans we obtained a lower dose in the thyroid but a higher one in the heart and liver. Conclusions: Our technique can be applied in both the supine and prone position and it seems to be more feasible and precise than the electron technique. However, more homogeneous target coverage and higher precision of dose delivery for photons are obtained at the cost of slightly higher doses to the heart and liver. (authors)
Analytical electron microscope study of the omega phase transformation in a zirconium--niobium alloy
Energy Technology Data Exchange (ETDEWEB)
Zaluzec, N.J.
1979-06-01
An in-situ study of the as-quenched omega phase transformation in Zr--15% Nb was conducted between the temperatures of 77 and 300/sup 0/K using analytical electron microscopy. The domain size of the omega regions observed in this investigation was on the order of 30 A, consistent with previous observations in this system. No alignment of omega domains along <222> directions of the bcc lattice was observed and in-situ thermal cycling experiments failed to produce a long period structure of alternating ..beta.. and ..omega.. phase regions as predicted by one theory of this transformation. Several techniques of microstructural analysis were developed, refined, and standardized. Grouped under the general classification of Analytical Electron Microscopy (AEM) they provide the experimentalist with a unique tool for the microcharacterization of solids, allowing semiquantitative to quantitative analysis of the morphology, crystallography, elemental composition, and electronic structure of regions as small as 20 A in diameter. These techniques have complications, and it was necessary to study the AEM system used in this work so that instrumental artifacts which invalidate the information produced in the microscope environment might be eliminated. Once these factors had been corrected, it was possible to obtain a wealth of information about the microvolume of material under investigation. The microanalytical techniques employed during this research include: energy dispersive x-ray spectroscopy (EDS) using both conventional and scanning transmission electron microscopy (CTEM, STEM), transmission scanning electron diffraction (TSED), the stationary diffraction pattern technique, and electron energy loss spectroscopy (ELS) using a dedicated scanning transmission electron microscope (DSTEM).
Analytical electron microscope study of the omega phase transformation in a zirconium--niobium alloy
International Nuclear Information System (INIS)
Zaluzec, N.J.
1979-06-01
An in-situ study of the as-quenched omega phase transformation in Zr--15% Nb was conducted between the temperatures of 77 and 300 0 K using analytical electron microscopy. The domain size of the omega regions observed in this investigation was on the order of 30 A, consistent with previous observations in this system. No alignment of omega domains along directions of the bcc lattice was observed and in-situ thermal cycling experiments failed to produce a long period structure of alternating β and ω phase regions as predicted by one theory of this transformation. Several techniques of microstructural analysis were developed, refined, and standardized. Grouped under the general classification of Analytical Electron Microscopy (AEM) they provide the experimentalist with a unique tool for the microcharacterization of solids, allowing semiquantitative to quantitative analysis of the morphology, crystallography, elemental composition, and electronic structure of regions as small as 20 A in diameter. These techniques have complications, and it was necessary to study the AEM system used in this work so that instrumental artifacts which invalidate the information produced in the microscope environment might be eliminated. Once these factors had been corrected, it was possible to obtain a wealth of information about the microvolume of material under investigation. The microanalytical techniques employed during this research include: energy dispersive x-ray spectroscopy (EDS) using both conventional and scanning transmission electron microscopy (CTEM, STEM), transmission scanning electron diffraction (TSED), the stationary diffraction pattern technique, and electron energy loss spectroscopy (ELS) using a dedicated scanning transmission electron microscope
De Hosson, Jeff Th. M.
In the field of transmission electron microscopy (TEM), fundamental and practical reasons still remain that hamper a straightforward correlation between microscopic structural information and deformation mechanisms in materials. In this article, it is argued that one should focus in particular on in
Electron transport measurements in methane using an improved pulsed Townsend technique
International Nuclear Information System (INIS)
Hunter, S.R.; Carter, J.G.; Christophorou, L.G.
1986-01-01
An improved pulsed Townsend technique for the measurement of electron transport parameters in gases is described. The accuracy and sensitivity of the technique have been investigated by performing, respectively, electron attachment coefficient measurements in pure O 2 over a wide range of E/N at selected O 2 pressures and by determining the electron attachment and ionization coefficients and electron drift velocity in CH 4 over a wide E/N range. Good agreement has been obtained between the present and the previously published electron attachment coefficients in O 2 and for the drift velocity measurements in CH 4 . The data on the electron attachment coefficient in CH 4 (measured for the first time) showed that with the present improved pulsed Townsend method, electron attachment coefficients up to 10 times smaller than the ionization coefficients at a given E/N value can be accurately measured. Our measurements of the electron attachment and ionization coefficients in CH 4 are in good agreement with a Boltzmann equation analysis of the electron gain and loss processes in CH 4 using published electron scattering cross sections for this molecule
Electron sterilization validation techniques using the controlled depth of sterilization process
International Nuclear Information System (INIS)
Cleghorn, D.A.; Nablo, S.V.
1990-01-01
Many pharmaceutical products, especially parenteral drugs, cannot be sterilized with gamma rays or high energy electrons due to the concomitant product degradation. In view of the well-controlled electron energy spectrum available in modern electron processors, it is practical to deliver sterilizing doses over depths considerably less than those defining the thickness of blister-pack constructions or pharmaceutical containers. Because bremsstrahlung and X-ray production are minimized at these low electron energies and in these low Z materials, very high electron: penetrating X-ray dose ratios are possible for the application of the technique. Thin film dosimetric techniques have been developed utilizing radiochromic film in the 10-60 g/m 2 range for determining the surface dose distribution in occluded surface areas where direct electron illumination is not possible. Procedures for validation of the process using dried spore inoculum on the product as well as in good geometry are employed to determine the process lethality and its dependence on product surface geometry. Applications of the process to labile pharmaceuticals in glass and polystyrene syringes are reviewed. It has been applied to the sterilization of commercial sterile products since 1987, and the advantages and the natural limitations of the technique are discussed. (author)
Testing aspects of advanced coherent electron cooling technique
Energy Technology Data Exchange (ETDEWEB)
Litvinenko, V.; Jing, Y.; Pinayev, I.; Wang, G.; Samulyak, R.; Ratner, D.
2015-05-03
An advanced version of the Coherent-electron Cooling (CeC) based on the micro-bunching instability was proposed. This approach promises significant increase in the bandwidth of the CeC system and, therefore, significant shortening of cooling time in high-energy hadron colliders. In this paper we present our plans of simulating and testing the key aspects of this proposed technique using the set-up of the coherent-electron-cooling proof-of-principle experiment at BNL.
Iterative reconstruction of magnetic induction using Lorentz transmission electron tomography
International Nuclear Information System (INIS)
Phatak, C.; Gürsoy, D.
2015-01-01
Intense ongoing research on complex nanomagnetic structures requires a fundamental understanding of the 3D magnetization and the stray fields around the nano-objects. 3D visualization of such fields offers the best way to achieve this. Lorentz transmission electron microscopy provides a suitable combination of high resolution and ability to quantitatively visualize the magnetization vectors using phase retrieval methods. In this paper, we present a formalism to represent the magnetic phase shift of electrons as a Radon transform of the magnetic induction of the sample. Using this formalism, we then present the application of common tomographic methods particularly the iterative methods, to reconstruct the 3D components of the vector field. We present an analysis of the effect of missing wedge and the limited angular sampling as well as reconstruction of complex 3D magnetization in a nanowire using simulations. - Highlights: • We present a formalism to represent electron-optical magnetic phase shift as a Radon transform of the 3D magnetic induction of the nano-object. • We have analyzed four different tomographic reconstruction methods for vectorial data reconstruction. • Reconstruction methods were tested for varying experimental limitations such as limited tilt range and limited angular sampling. • The analysis showed that Gridrec and SIRT methods performed better with lower errors than other reconstruction methods
Energy Technology Data Exchange (ETDEWEB)
Häussler, Dietrich [Institute for Materials Science, Christian-Albrechts-University Kiel, Kaiserstraße 2, 24143 Kiel (Germany); Houben, Lothar [Ernst Ruska-Centre for Microscopy and Spectroscopy with Electrons, Research Centre Juelich GmbH, 52425 Juelich (Germany); Essig, Stephanie [Fraunhofer Institute for Solar Energy Systems ISE, Heidenhofstraße 2, 79110 Freiburg (Germany); Kurttepeli, Mert [Institute for Materials Science, Christian-Albrechts-University Kiel, Kaiserstraße 2, 24143 Kiel (Germany); Dimroth, Frank [Fraunhofer Institute for Solar Energy Systems ISE, Heidenhofstraße 2, 79110 Freiburg (Germany); Dunin-Borkowski, Rafal E. [Ernst Ruska-Centre for Microscopy and Spectroscopy with Electrons, Research Centre Juelich GmbH, 52425 Juelich (Germany); Jäger, Wolfgang, E-mail: wolfgang.jaeger@tf.uni-kiel.de [Institute for Materials Science, Christian-Albrechts-University Kiel, Kaiserstraße 2, 24143 Kiel (Germany)
2013-11-15
Aberration-corrected scanning transmission electron microscopy (STEM) and electron energy loss spectroscopy (EELS) investigations have been applied to investigate the structure and composition fluctuations near interfaces in wafer-bonded multi-junction solar cells. Multi-junction solar cells are of particular interest since efficiencies well above 40% have been obtained for concentrator solar cells which are based on III-V compound semiconductors. In this methodologically oriented investigation, we explore the potential of combining aberration-corrected high-angle annular dark-field STEM imaging (HAADF-STEM) with spectroscopic techniques, such as EELS and energy-dispersive X-ray spectroscopy (EDXS), and with high-resolution transmission electron microscopy (HR-TEM), in order to analyze the effects of fast atom beam (FAB) and ion beam bombardment (IB) activation treatments on the structure and composition of bonding interfaces of wafer-bonded solar cells on Si substrates. Investigations using STEM/EELS are able to measure quantitatively and with high precision the widths and the fluctuations in element distributions within amorphous interface layers of nanometer extensions, including those of light elements. Such measurements allow the control of the activation treatments and thus support assessing electrical conductivity phenomena connected with impurity and dopant distributions near interfaces for optimized performance of the solar cells. - Highlights: • Aberration-corrected TEM and EELS reveal structural and elemental profiles across GaAs/Si bond interfaces in wafer-bonded GaInP/GaAs/Si - multi-junction solar cells. • Fluctuations in elemental concentration in nanometer-thick amorphous interface layers, including the disrubutions of light elements, are measured using EELS. • The projected widths of the interface layers are determined on the atomic scale from STEM-HAADF measurements. • The effects of atom and ion beam activation treatment on the bonding
Cryo-transmission electron tomography of native casein micelles from bovine milk
Trejo, R.; Dokland, T.; Jurat-Fuentes, J.; Harte, F.
2013-01-01
Caseins are the principal protein components in milk and an important ingredient in the food industry. In liquid milk, caseins are found as micelles of casein proteins and colloidal calcium nanoclusters. Casein micelles were isolated from raw skim milk by size exclusion chromatography and suspended in milk protein-free serum produced by ultrafiltration (molecular weight cut-off of 3 kDa) of raw skim milk. The micelles were imaged by cryo-electron microscopy and subjected to tomographic reconstruction methods to visualize the 3-dimensional and internal organization of native casein micelles. This provided new insights into the internal architecture of the casein micelle that had not been apparent from prior cryo-transmission electron microscopy studies. This analysis demonstrated the presence of water-filled cavities (~20 to 30 nm in diameter), channels (diameter greater than ~5 nm), and several hundred high-density nanoclusters (6 to 12 nm in diameter) within the interior of the micelles. No spherical protein submicellar structures were observed. PMID:22118067
Tunable electronic transmission gaps in a graphene superlattice
International Nuclear Information System (INIS)
Lu Weitao; Wang Shunjin; Li Wen; Wang Yonglong; Jiang Hua
2012-01-01
The transmission in graphene superlattices with adjustable barrier height is investigated using transfer-matrix method. It is found that one could control the angular range of transmission by changing the ratio of incidence energy and barrier height. The transmission as a function of incidence energy has more than one gaps, due to the appearance of evanescent waves in different barriers. Accordingly, more than one conductivity minimums are induced. The transmission gaps could be controlled by adjusting the incidence angle, the barrier height, and the barrier number, which gives the possibility to construct an energy-dependent wavevector filter.
Ferreira, Cassio Porto; Oliveira de Almeida, Ana Cristina; Corte-Real, Suzana
2015-02-01
Transmission electron microscopy can yield useful information in a range of scientific fields; it is capable of imaging at a significantly higher resolution than light microscopes and has been a very useful tool in the identification of morphological changes of the dermis as well as assessment of changes in the extracellular matrix. Our aim is to characterize by electron microscopy the cellular profile of lesions caused by Sporothrix schenckii from the sporotrichosis epidemic in its zoonotic form that occurs in Rio de Janeiro, Brazil. © The American Society of Tropical Medicine and Hygiene.
Electron/photon matched field technique for treatment of orbital disease
International Nuclear Information System (INIS)
Arthur, Douglas W.; Zwicker, Robert D.; Garmon, Pamela W.; Huang, David T.; Schmidt-Ullrich, Rupert K.
1997-01-01
Purpose: A number of approaches have been described in the literature for irradiation of malignant and benign diseases of the orbit. Techniques described to date do not deliver a homogeneous dose to the orbital contents while sparing the cornea and lens of excessive dose. This is a result of the geometry encountered in this region and the fact that the target volume, which includes the periorbital and retroorbital tissues but excludes the cornea, anterior chamber, and lens, cannot be readily accommodated by photon beams alone. To improve the dose distribution for these treatments, we have developed a technique that combines a low-energy electron field carefully matched with modified photon fields to achieve acceptable dose coverage and uniformity. Methods and Materials: An anterior electron field and a lateral photon field setup is used to encompass the target volume. Modification of these fields permits accurate matching as well as conformation of the dose distribution to the orbit. A flat-surfaced wax compensator assures uniform electron penetration across the field, and a sunken lead alloy eye block prevents excessive dose to the central structures of the anterior segment. The anterior edge of the photon field is modified by broadening the penumbra using a form of pseudodynamic collimation. Direct measurements using film and ion chamber dosimetry were used to study the characteristics of the fall-off region of the electron field and the penumbra of the photon fields. >From the data collected, the technique for accurate field matching and dose uniformity was generated. Results: The isodose curves produced with this treatment technique demonstrate homogeneous dose coverage of the orbit, including the paralenticular region, and sufficient dose sparing of the anterior segment. The posterior lens accumulates less than 40% of the prescribed dose, and the lateral aspect of the lens receives less than 30%. A dose variation in the match region of ±12% is confronted when
International Nuclear Information System (INIS)
Schroeder, Thomas J.; Rosca-Bocancea, Ecaterina; Hart, Jaap
2015-01-01
When the in-situ monitoring in a geological disposal facility is continued during the post-closure phase, monitoring data need to be transmitted wirelessly from the repository to the surface. Wireless data transmission is used today in many applications, but the large attenuation by the geologic medium between the disposal facility and the surface makes the application of high-frequency based techniques impractical. As part of the EURATOM FP-7 project MoDeRn (Monitoring Developments for safe Repository operation and staged closure), NRG has investigated the feasibility of wireless data transmission through an argillaceous host rock (Boom Clay), making use of low frequency magnetic fields. The main focus of the contribution was to analyze and optimize the energy efficiency of this technique. Therefore, a mathematical model description has been developed that allows to estimate the expected signal strength on the earth's surface on basis of the most relevant characteristics of transmitter, receiver and transmission path. The model is used to analyze the complex interactions of different system parameters, and is applied to design an optimized set-up for through-the-earth data transmission and to estimate minimum energy demands for signal transmission. To demonstrate the potentials of this technique, experiments were performed in the 225 m deep underground research facility HADES in Mol, Belgium. Signal propagation and attenuation by the geologic medium between the HADES and the surface has been measured, and the site-specific magnetic background noise at the surface in Mol has been characterized. Based on the results, optimum conditions for signal transmission have been derived and data transmission experiments have been performed. Results show that despite large local interferences on the surface in Mol, wireless data transmission through 225 m of a geological medium is possible. Data transmission rates up to 100 bit/s has been successfully tested. The
Energy Technology Data Exchange (ETDEWEB)
Schroeder, Thomas J.; Rosca-Bocancea, Ecaterina; Hart, Jaap [Nuclear Research and Consultancy Group (NRG), Petten (Netherlands)
2015-07-01
When the in-situ monitoring in a geological disposal facility is continued during the post-closure phase, monitoring data need to be transmitted wirelessly from the repository to the surface. Wireless data transmission is used today in many applications, but the large attenuation by the geologic medium between the disposal facility and the surface makes the application of high-frequency based techniques impractical. As part of the EURATOM FP-7 project MoDeRn (Monitoring Developments for safe Repository operation and staged closure), NRG has investigated the feasibility of wireless data transmission through an argillaceous host rock (Boom Clay), making use of low frequency magnetic fields. The main focus of the contribution was to analyze and optimize the energy efficiency of this technique. Therefore, a mathematical model description has been developed that allows to estimate the expected signal strength on the earth's surface on basis of the most relevant characteristics of transmitter, receiver and transmission path. The model is used to analyze the complex interactions of different system parameters, and is applied to design an optimized set-up for through-the-earth data transmission and to estimate minimum energy demands for signal transmission. To demonstrate the potentials of this technique, experiments were performed in the 225 m deep underground research facility HADES in Mol, Belgium. Signal propagation and attenuation by the geologic medium between the HADES and the surface has been measured, and the site-specific magnetic background noise at the surface in Mol has been characterized. Based on the results, optimum conditions for signal transmission have been derived and data transmission experiments have been performed. Results show that despite large local interferences on the surface in Mol, wireless data transmission through 225 m of a geological medium is possible. Data transmission rates up to 100 bit/s has been successfully tested. The
Transmission electron microscope cells for use with liquid samples
Khalid, Waqas; Alivisatos, Paul A.; Zettl, Alexander K.
2016-08-09
This disclosure provides systems, methods, and devices related to transmission electron microscopy cells for use with liquids. In one aspect a device includes a substrate, a first graphene layer, and a second graphene layer. The substrate has a first surface and a second surface. The first surface defines a first channel, a second channel, and an outlet channel. The first channel and the second channel are joined to the outlet channel. The outlet channel defines a viewport region forming a though hole in the substrate. The first graphene layer overlays the first surface of the substrate, including an interior area of the first channel, the second channel, and the outlet channel. The second graphene layer overlays the first surface of the substrate, including open regions defined by the first channel, the second channel, and the outlet channel.
International Nuclear Information System (INIS)
Wang Wenzhong; Tu Ya; Wang Lijuan; Liang Yujie; Shi Honglong
2013-01-01
Highlights: ► Raman spectroscopy of copper (I) oxide microspheres were investigated. ► Infrared active mode is greatly activated in Raman scattering spectrum. ► Infrared active mode shows up in Raman spectrum of copper (I) oxide microspheres. ► The defects existed in spheres could be responsible for the observed Raman property. - Abstract: The high-resolution transmission electron microscope and Raman spectroscopy were used to investigate the microstructures and Raman scattering property of copper (I) oxide microspheres composed of nanoparticles. High-resolution transmission electron microscope images indicate that the copper (I) oxide microspheres are composed of nanoparticles with random growth direction, indicating that there are many defects in microspheres. The Raman spectrum shows that infrared active mode, which must be odd parity and is Raman forbidden for bulk crystal due to its inversion symmetry, is activated and shows up in Raman scattering spectrum. On the basis of investigations of the microstructure features of copper (I) oxide microspheres, we attribute the appearance of IR active mode in Raman scattering spectrum to the breakdown of the symmetry of the lattice due to the presence of defects in the prepared copper (I) oxide microspheres as observed in HRTEM images.
Energy Technology Data Exchange (ETDEWEB)
Loyer-Prost, M., E-mail: marie.loyer-prost@cea.fr [DEN-Service de Recherches de Métallurgie Physique, CEA, Université Paris-Saclay, F-91191, Gif-sur-Yvette (France); Merot, J.-S. [Laboratoire d’Etudes des Microstructures – UMR 104, CNRS/ONERA, BP72-29, Avenue de la Division Leclerc, 92 322, Châtillon (France); Ribis, J. [DEN-Service de Recherches de Métallurgie Appliquée, CEA, Université Paris-Saclay, F-91191, Gif-sur-Yvette (France); Le Bouar, Y. [Laboratoire d’Etudes des Microstructures – UMR 104, CNRS/ONERA, BP72-29, Avenue de la Division Leclerc, 92 322, Châtillon (France); Chaffron, L. [DEN-Service de Recherches de Métallurgie Appliquée, CEA, Université Paris-Saclay, F-91191, Gif-sur-Yvette (France); Legendre, F. [DEN-Service de la Corrosion et du Comportement des Matériaux dans leur Environnement, CEA, Université Paris-Saclay, F-91191, Gif-sur-Yvette (France)
2016-10-15
Oxide Dispersion Strengthened (ODS) steels are promising materials for generation IV fuel claddings as their dense nano-oxide dispersion provides good creep and irradiation resistance. Even if they have been studied for years, the formation mechanism of these nano-oxides is still unclear. Here we report for the first time a High Resolution Transmission Electron Microscopy and Energy Filtered Transmission Electron Microscopy characterization of an ODS milled powder. It provides clear evidence of the presence of small crystalline nanoclusters (NCs) enriched in titanium directly after milling. Small NCs (<5 nm) have a crystalline structure and seem partly coherent with the matrix. They have an interplanar spacing close to the (011) {sub bcc} iron structure. They coexist with larger crystalline spherical precipitates of 15–20 nm in size. Their crystalline structure may be metastable as they are not consistent with any Y-Ti-O or Ti-O structure. Such detailed observations in the as-milled grain powder confirm a mechanism of Y, Ti, O dissolution in the ferritic matrix followed by a NC precipitation during the mechanical alloying process of ODS materials. - Highlights: • We observed an ODS ball-milled powder by high resolution transmission microscopy. • The ODS ball-milled powder exhibits a lamellar microstructure. • Small crystalline nanoclusters were detected in the milled ODS powder. • The nanoclusters in the ODS milled powder are enriched in titanium. • Larger NCs of 15–20 nm in size are, at least, partly coherent with the matrix.
Differential phase-contrast dark-field electron holography for strain mapping
Energy Technology Data Exchange (ETDEWEB)
Denneulin, Thibaud, E-mail: thibaud.denneulin@cemes.fr; Houdellier, Florent, E-mail: florent.houdellier@cemes.fr; Hÿtch, Martin, E-mail: martin.hytch@cemes.fr
2016-01-15
Strain mapping is an active area of research in transmission electron microscopy. Here we introduce a dark-field electron holographic technique that shares several aspects in common with both off-axis and in-line holography. Two incident and convergent plane waves are produced in front of the specimen thanks to an electrostatic biprism in the condenser system of a transmission electron microscope. The interference of electron beams diffracted by the illuminated crystal is then recorded in a defocused plane. The differential phase recovered from the hologram is directly proportional to the strain in the sample. The strain can be quantified if the separation of the images due to the defocus is precisely determined. The present technique has the advantage that the derivative of the phase is measured directly which allows us to avoid numerical differentiation. The distribution of the noise in the reconstructed strain maps is isotropic and more homogeneous. This technique was used to investigate different samples: a Si/SiGe superlattice, transistors with SiGe source/drain and epitaxial PZT thin films. - Highlights: • DPC dark-field electron holography is set up with a condenser biprism. • The DPC phase is directly proportional to the lattice deformation. • The technique is illustrated with epitaxial SiGe and Pb(Zr,Ti)O{sub 3} samples. • The defocus allows us to control the strain sensitivity and the spatial resolution. • A solution is proposed to setup this technique with a post-specimen biprism.
Schliep, Karl B.
State-of-the-art technology drives scientific progress, pushing the boundaries of our current understanding of fundamental processes and mechanisms. Our continual scientific advancement is hindered only by what we can observe and experimentally verify; thus, it is reasonable to assert that instrument development and improvement is the cornerstone for technological and intellectual growth. For example, the invention of transmission electron microscopy (TEM) allowed us to observe nanoscale phenomena for the first time in the 1930s and even now it is invaluable in the development of smaller, faster electronics. As we uncover more about the fundamentals of nanoscale phenomena, we have realized that images alone reveal only a snapshot of the story; to continue progressing we need a way to observe the entire scene unfold (e.g. how defects affect the flow of current across a transistor or how thermal energy propagates in nanoscale systems like graphene). Recently, by combining the spatial resolution of a TEM with the temporal resolution of ultrafast lasers, ultrafast electron microscopy ? or microscope ? (UEM) has allowed us to simultaneously observe transient nanoscale phenomena at ultrafast timescales. Ultrafast characterization techniques allow for the investigation of a new realm of previously unseen phenomenon inherent to the transient electronic, magnetic, and structural properties of materials. However, despite the progress made in ultrafast techniques, capturing the nanoscale spatial sub-ns temporal mechanisms and phenomenon at play in magnetic materials (especially during the operation of magnetic devices) has only recently become possible using UEM. With only a handful of instruments available, magnetic characterization using UEM is far from commonplace and any advances made are sparsely reported, and further, specific to the individual instrument. In this dissertation, I outline the development of novel magnetic materials and the establishment of a UEM lab at
320 Gb/s Single polarization OTDM Transmission over 80 km Standard Transmission Fiber
DEFF Research Database (Denmark)
Siahlo, Andrei; Seoane, Jorge; Clausen, Anders
2005-01-01
Optical time-division multiplexing (OTDM) is an attractive technique for increasing the capacity of optical transmission systems. 320 Gbit/s single-channel and single-polarization error-free transmission over continuous spans of either 80 km SMF or 77 km NZDSF are realized.......Optical time-division multiplexing (OTDM) is an attractive technique for increasing the capacity of optical transmission systems. 320 Gbit/s single-channel and single-polarization error-free transmission over continuous spans of either 80 km SMF or 77 km NZDSF are realized....
International Nuclear Information System (INIS)
Levy, V.
1964-01-01
Metallic samples containing rare gas bubbles have been examined by transmission electron microscopy. The different features of the contrast patterns of the bubbles have been explained by the dynamical theory of contrast, assuming that the bubble behaves as a hole in the metal. Experimental results are in good agreement with the theory. (author) [fr
Directory of Open Access Journals (Sweden)
Francisco Michel
2011-05-01
Full Text Available Abstract Background Transmission electron microscopy (TEM remains an important technique to investigate the size, shape and surface characteristics of particles at the nanometer scale. Resulting micrographs are two dimensional projections of objects and their interpretation can be difficult. Recently, electron tomography (ET is increasingly used to reveal the morphology of nanomaterials (NM in 3D. In this study, we examined the feasibility to visualize and measure silica and gold NM in suspension using conventional bright field electron tomography. Results The general morphology of gold and silica NM was visualized in 3D by conventional TEM in bright field mode. In orthoslices of the examined NM the surface features of a NM could be seen and measured without interference of higher or lower lying structures inherent to conventional TEM. Segmentation by isosurface rendering allowed visualizing the 3D information of an electron tomographic reconstruction in greater detail than digital slicing. From the 3D reconstructions, the surface area and the volume of the examined NM could be estimated directly and the volume-specific surface area (VSSA was calculated. The mean VSSA of all examined NM was significantly larger than the threshold of 60 m2/cm3. The high correlation between the measured values of area and volume gold nanoparticles with a known spherical morphology and the areas and volumes calculated from the equivalent circle diameter (ECD of projected nanoparticles (NP indicates that the values measured from electron tomographic reconstructions are valid for these gold particles. Conclusion The characterization and definition of the examined gold and silica NM can benefit from application of conventional bright field electron tomography: the NM can be visualized in 3D, while surface features and the VSSA can be measured.
Sliceable transponders for metro-access transmission links
Wagner, C.; Madsen, P.; Spolitis, S.; Vegas Olmos, J. J.; Tafur Monroy, I.
2015-01-01
This paper presents a solution for upgrading optical access networks by reusing existing electronics or optical equipment: sliceable transponders using signal spectrum slicing and stitching back method after direct detection. This technique allows transmission of wide bandwidth signals from the service provider (OLT - optical line terminal) to the end user (ONU - optical network unit) over an optical distribution network (ODN) via low bandwidth equipment. We show simulation and experimental results for duobinary signaling of 1 Gbit/s and 10 Gbit/s waveforms. The number of slices is adjusted to match the lowest analog bandwidth of used electrical devices and scale from 2 slices to 10 slices. Results of experimental transmission show error free signal recovery by using post forward error correction with 7% overhead.
Proceedings of 10. Conference on Electron Microscopy of Solids
International Nuclear Information System (INIS)
1999-01-01
The new technical solutions and methodical variants of electron microscopy i. e. transmission electron microscopy and scanning electron microscopy have been presented. Development of new methods and microscope constructions which became more and more sophisticated causes the progress in possible applications. The broad spectrum of such applications in metallurgy, materials science, chemical engineering, electronics, physical chemistry, solid state physics, mineralogy and other branches of science and technique have been performed and discussed at the conference
Cryo-transmission electron microscopy of Ag nanoparticles grown on an ionic liquid substrate
Anjum, Dalaver H.
2010-07-01
We report a novel method of growing silver nanostructures by cathodic sputtering onto an ionic liquid (IL) and our visualization by transmission cryo-electron microscopy to avoid beam-induced motion of the nanoparticles. By freezing the IL suspension and controlling electron dose, we can assess properties of particle size, morphology, crystallinity, and aggregation in situ and at high detail. We observed round silver nanoparticles with a well-defined diameter of 7.0 ± 1.5 nm that are faceted with crystalline cubic structures and ∼80% of the particles have multiply twinned faults. We also applied cryo-electron tomography to investigate the structure of the nanoparticles and to directly visualize the IL wetting around them. In addition to particles, we observed nanorods that appear to have assembled from individual nanoparticles. Reexamination of the samples after 4-5 days from initial preparation showed significant changes in morphology, and potential mechanisms for this are discussed. © 2010 Materials Research Society.
High-resolution transmission electron microscopy and energetics of flattened carbon nonoshells
International Nuclear Information System (INIS)
Bourgeois, L.N.; Bursill, L.A.
1998-01-01
When examined under a high-resolution transmission electron microscope, carbon soot produced alongside buckytubes in an arc-discharge is found to contain a small percentage of flattened carbon shells. These objects are shown to be small graphite flakes which eliminated their dangling bonds by terminating their edges with highly curved junctions. Ideal models for these structures are presented, and their energy estimated. The calculations show that the establishment of highly curved junctions is energetically favourable for a graphite flake in an inert atmosphere. Flattened shells also appear more stable than their 'inflated' counterparts (fullerene 'onions' and buckytubes) when the shell dimensions obey specific criteria.(authors)
Kooi, B.J.; de Hosson, J.T.M.
2002-01-01
The crystal structures of GeSb2Te4, Ge2Sb2Te5, and Ge3Sb2Te6 were determined using electron diffraction and high-resolution transmission electron microscopy. The structure determined for the former two crystals deviates from the ones proposed in the literature. These crystal structures were
Amyloid Structure and Assembly: Insights from Scanning Transmission Electron Microscopy
Energy Technology Data Exchange (ETDEWEB)
Goldsbury, C.; Wall, J.; Baxa, U.; Simon, M. N.; Steven, A. C.; Engel, A.; Aebi, U.; Muller, S. A.
2011-01-01
Amyloid fibrils are filamentous protein aggregates implicated in several common diseases such as Alzheimer's disease and type II diabetes. Similar structures are also the molecular principle of the infectious spongiform encephalopathies such as Creutzfeldt-Jakob disease in humans, scrapie in sheep, and of the so-called yeast prions, inherited non-chromosomal elements found in yeast and fungi. Scanning transmission electron microscopy (STEM) is often used to delineate the assembly mechanism and structural properties of amyloid aggregates. In this review we consider specifically contributions and limitations of STEM for the investigation of amyloid assembly pathways, fibril polymorphisms and structural models of amyloid fibrils. This type of microscopy provides the only method to directly measure the mass-per-length (MPL) of individual filaments. Made on both in vitro assembled and ex vivo samples, STEM mass measurements have illuminated the hierarchical relationships between amyloid fibrils and revealed that polymorphic fibrils and various globular oligomers can assemble simultaneously from a single polypeptide. The MPLs also impose strong constraints on possible packing schemes, assisting in molecular model building when combined with high-resolution methods like solid-state nuclear magnetic resonance (NMR) and electron paramagnetic resonance (EPR).
Directory of Open Access Journals (Sweden)
M. Malatesta
2012-04-01
Full Text Available Chitosan-based nanoparticles (NPs deserve particular attention as suitable drug carriers in the field of pharmaceutics, since they are able to protect the encapsulated drugs and/or improve their efficacy by making them able to cross biological barriers (such as the blood-brain barrier and reach their intracellular target sites. Understanding the intracellular location of NPs is crucial for designing drug delivery strategies. In this study, fluorescently-labelled chitosan NPs were administered in vitro to a neuronal cell line, and diaminobenzidine (DAB photoconversion was applied to correlate fluorescence and transmission electron microscopy to precisely describe the NPs intracellular fate. This technique allowed to demonstrate that chitosan NPs easily enter neuronal cells, predominantly by endocytosis; they were found both inside membrane-bounded vesicles and free in the cytosol, and were observed to accumulate around the cell nucleus.
Compton scattering of photons from electrons in magnetically insulated transmission lines
International Nuclear Information System (INIS)
Brower, K.L.; VanDevender, J.P.
1979-01-01
Self-magnetically insulated transmission lines are used for power transport between the vacuum insulator and the diode in high current particle accelerators. Since the efficiency of the power transport depends on the details of the initial line geometry, i.e., the injector, the dependence of the electron canonical momentum distribution on the injector geometry should reveal the loss mechanism. We propose to study that dependence experimentally through a Compton scattering diagnostic. The spectrum of scattered light reveals the electron velocity distribution perpendicular to the direction of flow. The design of the diagnostic is in progress. Our preliminary analysis is based on the conservation of energy and canonical momentum for a single electron in the anti E and anti B fields determined from 2-D calculations. For the Mite accelerator with power flow along Z, the normalized canonical momentum, μ, is in the range - 0.7 < μ less than or equal to 0. For anti k/sub i/ parallel to circumflex Y, and anti k/sub s/ circumflex X, our analysis indicates that the scattered photons have 1.1 eV less than or equal to h nu/sub s/ < 5.6 eV for ruby laser scattering and can be detected with PM tubes
Transmission electron microscope CCD camera
Downing, Kenneth H.
1999-01-01
In order to improve the performance of a CCD camera on a high voltage electron microscope, an electron decelerator is inserted between the microscope column and the CCD. This arrangement optimizes the interaction of the electron beam with the scintillator of the CCD camera while retaining optimization of the microscope optics and of the interaction of the beam with the specimen. Changing the electron beam energy between the specimen and camera allows both to be optimized.
International Nuclear Information System (INIS)
Paredes, Yolanda A.; Campos, Andrea P.C.; Achete, Carlos A.; Cremona, Marco
2015-01-01
Organic light-emitting diodes using phosphorescent dyes (PHOLEDs) have excellent performance, with internal quantum efficiencies approaching 100%. To maximize their performance, PHOLED devices use a conductive organic host material with a sufficiently dispersed phosphorescent guest to avoid concentration quenching. Fac-tris(2-phenylpyridine) iridium, [Ir(ppy)_3] is one of the most widely used green phosphorescent organic compounds. In this work, we used scanning transmission electron microscopy (STEM) equipped with HAADF (high-angle annular dark-field) and EDS (energy dispersive X-ray spectroscopy) detectors to analyze the distribution of the [Ir(ppy)_3] concentration in the host material. This analysis technique, employed for the first time in co-deposited organic thin films, can simultaneously obtain an image and its respective chemical information, allowing for definitive characterization of the distribution and morphology of [Ir(ppy)_3]. The technique was also used to analyze the effect of the vibration of the substrate during thermal co-deposition of the [Ir(ppy)_3] molecules into an organic matrix. - Highlights: • We present a methodology to analyze the dopant distribution in organic thin films. • The method combines HAADF-STEM imaging and EDS X-ray spectroscopy. • Ir(ppy)_3 dopant was co-deposited into Spiro2-CBP organic matrix. • The dopant was co-deposited with and without substrate vibration. • Images and chemical information of the dopant were simultaneously obtained.
Energy Technology Data Exchange (ETDEWEB)
Piazza, L., E-mail: luca.piazza@epfl.ch [Laboratory for Ultrafast Microscopy and Electron Scattering (LUMES), ICMP, Ecole Polytechnique Fédérale de Lausanne, CH-1015 Lausanne (Switzerland); Masiel, D.J. [Integrated Dynamic Electron Solutions, Inc., 455 Bolero Drive, Danville, CA 94526 (United States); LaGrange, T.; Reed, B.W. [Condensed Matter and Materials Division Physical and Life Sciences Directorate, Lawrence Livermore National Laboratory, P.O. Box 808, L-356, Livermore, CA 94550 (United States); Barwick, B. [Department of Physics, Trinity College, 300 Summit St., Hartford, CT 06106 (United States); Carbone, Fabrizio [Laboratory for Ultrafast Microscopy and Electron Scattering (LUMES), ICMP, Ecole Polytechnique Fédérale de Lausanne, CH-1015 Lausanne (Switzerland)
2013-09-23
Highlights: • We present the implementation of a femtosecond-resolved ultrafast TEM. • This is the first ultrafast TEM based on a thermionic gun geometry. • An additional condenser lens has been used to maximize the electron count. • We achieved a time resolution of about 300 fs and an energy resolution of 1 eV. - Abstract: In this paper, the design and implementation of a femtosecond-resolved ultrafast transmission electron microscope is presented, based on a thermionic gun geometry. Utilizing an additional magnetic lens between the electron acceleration and the nominal condenser lens system, a larger percentage of the electrons created at the cathode are delivered to the specimen without degrading temporal, spatial and energy resolution significantly, while at the same time maintaining the femtosecond temporal resolution. Using the photon-induced near field electron microscopy effect (PINEM) on silver nanowires the cross-correlation between the light and electron pulses was measured, showing the impact of the gun settings and initiating laser pulse duration on the electron bunch properties. Tuneable electron pulses between 300 fs and several ps can be obtained, and an overall energy resolution around 1 eV was achieved.
International Nuclear Information System (INIS)
Nair, R. R.; Anissimova, S.; Novoselov, K. S.; Blake, P.; Blake, J. R.; Geim, A. K.; Zan, R.; Bangert, U.; Golovanov, A. P.; Morozov, S. V.; Latychevskaia, T.
2010-01-01
We demonstrate the application of graphene as a support for imaging individual biological molecules in transmission electron microscope (TEM). A simple procedure to produce free-standing graphene membranes has been designed. Such membranes are extremely robust and can support practically any submicrometer object. Tobacco mosaic virus has been deposited on graphene samples and observed in a TEM. High contrast has been achieved even though no staining has been applied.
International Nuclear Information System (INIS)
Kurata, Hiroki
1996-01-01
EFTEM is new microscopy with the object of visualizing high resolution quantitative elemental distribution. The measurement principles and the present state of EFTEM studies are explained by the examples of measurement of the elemental distributions. EFTEM is a combination of the transmission electron microscope with the electron energy loss spectroscopy (EFLS). EFTEM method sets the slit in the specific energy field and put the electron passing the slit back in the microscopic image. The qualitative elemental analysis is obtained by observing the position of the absorption end of core electronic excitation spectrum and the quantitative one by determining the core electronic excitation strength of the specific atom depend on filtering with energy selector slit. The binding state and the local structure in the neighborhood of excited atom is determined by the fine structure of absorption end. By the chemical mapping method, the distribution image of chemical binding state is visualized by the imaging chemical map obtained by filtering the specific peak strength of fine structure with the narrow energy selector slit. The fine powder of lead chromate (PbCrO 4 ) covered with silica glass was shown as a typical example of the elemental distribution image of core electronic excitation spectrum. The quantitative analysis method of elemental distribution image is explained. The possibility of single atom analysis at nanometer was shown by the example of nanotube observed by EFTEM. (S.Y.)
Nano-tomography of porous geological materials using focused ion beam-scanning electron microscopy
Liu, Yang; King, Helen E.; van Huis, Marijn A.; Drury, Martyn R.; Plümper, Oliver
2016-01-01
Tomographic analysis using focused ion beam-scanning electron microscopy (FIB-SEM) provides three-dimensional information about solid materials with a resolution of a few nanometres and thus bridges the gap between X-ray and transmission electron microscopic tomography techniques. This contribution
International Nuclear Information System (INIS)
Smith, G.C.; Seah, M.P.
1991-01-01
For the use of published general or theoretical sensitivity factors in quantitative AES and XPS the energy dependence of both the spectrometer transmission function and the detector sensitivity must be known. Here we develop simple procedures which allow these dependencies to be determined experimentally. Detailed measurements for a modified VG Scientific ESCALAB II, the metrology spectrometer, operated in both the constant ΔE/E and constant ΔE modes, are presented and compared with theoretical estimates. It is shown that an exceptionally detailed electron-optical calculation, involving proprietary information, would be required to match the accuracy of the experimental procedures developed. Removal of the spectrometer transmission function and the detector sensitivity terms allows the measured spectrum to be converted to the true electron emission spectrum irrespective of the mode of operation. This provides the first step to the provision of reference samples to calibrate the transmission functions and detector sensitivities of all instruments so that they, in turn, may produce true electron emission spectra. This is vital if (i) all instruments are to give consistent results, (ii) theoretical terms are to be used in quantifying either AES or XPS and (iii) reference data banks are to be established for AES or XPS
International Nuclear Information System (INIS)
Abe, Shinji; Nishino, Masanari; Yamashita, Masato; Yamaguchi, Hiroshi
2003-01-01
To achieve quantitative accuracy of simultaneous emission/transmission (SET) acquisition using the mask technique, we determined the factor of expression that derives the true transmission data from the measured transmission and emission data. We then evaluated the standardized uptake value (SUV) of the regional activity concentration derived respectively from the SET scans and conventional scans. First, to determine the attenuation factor for the transmission source when the photons of the cylindrical phantom filled with 18 F solution reached emission memory, SET scans were performed with a dummy transmission source and under the blank status of the transmission source. Second, to evaluate the SUV, we used a hollow-sphere phantom filled with 18 F solution whose activity concentrations were approximately 3 and 5 times that of the background. Then we performed conventional and SET scans of the phantom for solutions ranging from the higher concentration to the lower concentration. All of the data were reconstructed with the decay correction, and the SUV of each sphere was derived. The results demonstrated that, when the conventional factor was used, SUV was underestimated according to the increasing activity concentration of the solution. However, when a new factor that took into account the attenuation of the transmission source was used, there was no significant difference in the SUV. We estimated the SUV derived from the SET scans was within 3% for the large spheres and within 16% for the small spheres. (author)
Transmission Electron Microscopy of Magnetite Plaquettes in Orgueil
Chan, Q. H. S.; Han, J.; Zolensky, M.
2016-01-01
Magnetite sometimes takes the form of a plaquette - barrel-shaped stack of magnetite disks - in carbonaceous chondrites (CC) that show evidence of aqueous alteration. The asymmetric nature of the plaquettes caused Pizzarello and Groy to propose magnetite plaquettes as a naturally asymmetric mineral that can indroduce symmetry-breaking in organic molecules. Our previous synchrotron X-ray computed microtomography (SXRCT) and electron backscatter diffraction (EBSD) analyses of the magnetite plaquettes in fifteen CCs indicate that magnetite plaquettes are composed of nearly parallel discs, and the crystallographic orientations of the discs change around a rotational axis normal to the discs surfaces. In order to further investigate the nanostructures of magnetite plaquettes, we made two focused ion beam (FIB) sections of nine magnetite plaquettes from a thin section of CI Orgueil for transmission electron microscope (TEM) analysis. The X-ray spectrum imaging shows that the magnetite discs are purely iron oxide Fe3O4 (42.9 at% Fe and 57.1 at% O), which suggest that the plaquettes are of aqueous origin as it is difficult to form pure magnetite as a nebular condensate. The selected area electron diffraction (SAED) patterns acquired across the plaquettes show that the magnetite discs are single crystals. SEM and EBSD analyses suggest that the planar surfaces of the magnetite discs belong to the {100} planes of the cubic inverse spinel structure, which are supported by our TEM observations. Kerridge et al. suggested that the epitaxial relationship between magnetite plaquette and carbonate determines the magnetite face. However, according to our TEM observation, the association of magnetite with porous networks of phyllosilicate indicates that the epitaxial relationship with carbonate is not essential to the formation of magnetite plaquettes. It was difficult to determine the preferred rotational orientation of the plaquettes due to the symmetry of the cubic structure
Development of a transmission positron microscope
Energy Technology Data Exchange (ETDEWEB)
Matsuya, M., E-mail: matsuya@jeol.co.jp [JEOL Ltd., 1-2 Musashino, 3-Chome, Akishima, Tokyo 196-8558 (Japan); Jinno, S. [Department of Applied Chemistry, Chiba University, Yayoi, Inage, Chiba, Chiba 263-8552 (Japan); Ootsuka, T.; Inoue, M. [JEOL Ltd., 1-2 Musashino, 3-Chome, Akishima, Tokyo 196-8558 (Japan); Kurihara, T. [High Energy Accelerator Research Organization, Oho, Tsukuba, Ibaraki 305-0801 (Japan); Doyama, M.; Inoue, M. [Teikyo University of Science and Technology, Uenohara, Yamanashi 409-0913 (Japan); Fujinami, M. [Department of Applied Chemistry, Chiba University, Yayoi, Inage, Chiba, Chiba 263-8552 (Japan)
2011-07-21
A practical transmission positron microscope (TPM) JEM-1011B has been developed to survey differences in the interaction of positron and electron beams with materials, and is installed in the Slow Positron Facility of High Energy Accelerator Research Organization (KEK). The TPM can share positron and electron beams, and can also be used as a transmission electron microscope (TEM). Positron transmission images up to magnification 10,000x (resolution: 50 nm) and positron diffraction patterns up to 044 family were successfully obtained by the TPM comparing them with those of electrons. The differences in material transmittances for both beams have been measured, and can be explained by the calculated results of the Monte Carlo simulation code PENELOPE-2008.
Quantum coherent optical phase modulation in an ultrafast transmission electron microscope.
Feist, Armin; Echternkamp, Katharina E; Schauss, Jakob; Yalunin, Sergey V; Schäfer, Sascha; Ropers, Claus
2015-05-14
Coherent manipulation of quantum systems with light is expected to be a cornerstone of future information and communication technology, including quantum computation and cryptography. The transfer of an optical phase onto a quantum wavefunction is a defining aspect of coherent interactions and forms the basis of quantum state preparation, synchronization and metrology. Light-phase-modulated electron states near atoms and molecules are essential for the techniques of attosecond science, including the generation of extreme-ultraviolet pulses and orbital tomography. In contrast, the quantum-coherent phase-modulation of energetic free-electron beams has not been demonstrated, although it promises direct access to ultrafast imaging and spectroscopy with tailored electron pulses on the attosecond scale. Here we demonstrate the coherent quantum state manipulation of free-electron populations in an electron microscope beam. We employ the interaction of ultrashort electron pulses with optical near-fields to induce Rabi oscillations in the populations of electron momentum states, observed as a function of the optical driving field. Excellent agreement with the scaling of an equal-Rabi multilevel quantum ladder is obtained, representing the observation of a light-driven 'quantum walk' coherently reshaping electron density in momentum space. We note that, after the interaction, the optically generated superposition of momentum states evolves into a train of attosecond electron pulses. Our results reveal the potential of quantum control for the precision structuring of electron densities, with possible applications ranging from ultrafast electron spectroscopy and microscopy to accelerator science and free-electron lasers.
Electron and bremsstrahlung penetration and dose calculation
Watts, J. W., Jr.; Burrell, M. O.
1972-01-01
Various techniques for the calculation of electron and bremsstrahlung dose deposition are described. Energy deposition, transmission, and reflection coefficients for electrons incident on plane slabs are presented, and methods for their use in electron dose calculations were developed. A method using the straight-ahead approximation was also developed, and the various methods were compared and found to be in good agreement. Both accurate and approximate methods of calculating bremsstrahlung dose were derived and compared. Approximation is found to give a good estimate of dose where the electron spectrum falls off exponentially with energy.
Wang, Hongtao
2012-01-01
Interaction between single noble metal atoms and graphene edges has been investigated via aberration-corrected and monochromated transmission electron microscopy. A collective motion of the Au atom and the nearby carbon atoms is observed in transition between energy-favorable configurations. Most trapping and detrapping processes are assisted by the dangling carbon atoms, which are more susceptible to knock-on displacements by electron irradiation. Thermal energy is lower than the activation barriers in transition among different energy-favorable configurations, which suggests electron-beam irradiation can be an efficient way of engineering the graphene edge with metal atoms. © 2012 The Royal Society of Chemistry.
International Nuclear Information System (INIS)
Tidwell, V.C.; Glass, R.J.
1992-01-01
Two independent high-resolution moisture-sensing techniques, x-ray absorption and light transmission, have been developed for use in two-dimensional, thin-slab experimental systems. The techniques yield full-field measurement capabilities with exceptional resolution of moisture content in time and space. These techniques represent powerful tools for the experimentalist to investigate processes governing unsaturated flow and transport through fractured and nonfractured porous media. Evaluation of these techniques has been accomplished by direct comparison of data obtained by means of the x-ray and light techniques as well as comparison with data collected by gravimetric and gamma-ray densitometry techniques. Results show excellent agreement between data collected by the four moisture-content measurement techniques. This program was established to support the Yucca Mountain Site Characterization Project
Overview of Alternative Bunching and Current-shaping Techniques for Low-Energy Electron Beams
Energy Technology Data Exchange (ETDEWEB)
Piot, Philippe [Northern Illinois U.
2015-12-01
Techniques to bunch or shape an electron beam at low energies (E <15 MeV) have important implications toward the realization of table-top radiation sources [1] or to the design of compact multi-user free-electron lasers[2]. This paper provides an overview of alternative methods recently developed including techniques such as wakefield-based bunching, space-charge-driven microbunching via wave-breaking [3], ab-initio shaping of the electron-emission process [4], and phase space exchangers. Practical applications of some of these methods to foreseen free-electron-laser configurations are also briefly discussed [5].
A Systematic Review Regarding Tonometry and the Transmission of Infectious Diseases
Atkins, Nicole; Hodge, William; Li, Bruce
2018-01-01
Tonometry has been identified as a common method for measuring the intraocular pressure in patients. The direct contact between the tonometer and the eye may contribute to the risk of cross infection, especially of viral particles, from one patient to another. A systematic review was undertaken to address the likelihood of human immunodeficiency virus (HIV), hepatitis B virus, hepatitis C virus, and prion diseases transmission through the use of tonometers. Additionally, a comparison of the current tonometer disinfection methods is provided to assist with identifying which technique effectively reduces the risk of disease transmission. An electronic literature search was conducted using the following databases: Web of Science, EMBASE, CINAHL, SCOPUS, Biosis Previews, Cochrane Library, PubMed, and Google Scholar. Dissertation indexes were also searched, and these included: Dissertations and Abstracts, and Dissertations and Abstracts - UK/Ireland. Additionally, the Clinicaltrials.gov trial registry was searched to identify any other relevant literature. Two independent reviewers critically appraised the articles retrieved through the literature search. In total, 11 unique studies were deemed relevant for this systematic review. The available evidence demonstrated that the use of tonometers contributes to the transmission of these infectious diseases in vitro. The results also demonstrated variability in determining the most effective tonometer sterilization technique against these infectious diseases in vitro. There was limited evidence available regarding the transmission of HIV, hepatitis B, hepatitis C, and prion diseases through the use of tonometers. Additionally, due to the variability regarding the most effective sterilization techniques, it is difficult to identify which sterilization technique is most effective or adequately effective against these infectious diseases. Future research studies regarding infectious disease transmission through tonometry and
A Systematic Review Regarding Tonometry and the Transmission of Infectious Diseases.
Atkins, Nicole; Hodge, William; Li, Bruce
2018-03-01
Tonometry has been identified as a common method for measuring the intraocular pressure in patients. The direct contact between the tonometer and the eye may contribute to the risk of cross infection, especially of viral particles, from one patient to another. A systematic review was undertaken to address the likelihood of human immunodeficiency virus (HIV), hepatitis B virus, hepatitis C virus, and prion diseases transmission through the use of tonometers. Additionally, a comparison of the current tonometer disinfection methods is provided to assist with identifying which technique effectively reduces the risk of disease transmission. An electronic literature search was conducted using the following databases: Web of Science, EMBASE, CINAHL, SCOPUS, Biosis Previews, Cochrane Library, PubMed, and Google Scholar. Dissertation indexes were also searched, and these included: Dissertations and Abstracts, and Dissertations and Abstracts - UK/Ireland. Additionally, the Clinicaltrials.gov trial registry was searched to identify any other relevant literature. Two independent reviewers critically appraised the articles retrieved through the literature search. In total, 11 unique studies were deemed relevant for this systematic review. The available evidence demonstrated that the use of tonometers contributes to the transmission of these infectious diseases in vitro . The results also demonstrated variability in determining the most effective tonometer sterilization technique against these infectious diseases in vitro . There was limited evidence available regarding the transmission of HIV, hepatitis B, hepatitis C, and prion diseases through the use of tonometers. Additionally, due to the variability regarding the most effective sterilization techniques, it is difficult to identify which sterilization technique is most effective or adequately effective against these infectious diseases. Future research studies regarding infectious disease transmission through tonometry and
International Nuclear Information System (INIS)
Chimoye, T.; Fuangfoong, M.
1998-01-01
The study aimed at development of a neutron reflection and transmission technique to determine moisture content in Durian fruit as a function of time after harvesting. A system of a 3 mCi Am-Be neutron source with a BF 3 detector as a neutron probe was developed. The results obtained were validated using weighting method
Influence of time-periodic potentials on electronic transport in double-well structure
International Nuclear Information System (INIS)
Chun-Lei, Li; Yan, Xu
2010-01-01
Within the framework of the Floquet theorem, we have investigated single-electron photon-assisted tunneling in a double-well system using the transfer matrix technique. The transmission probability displays satellite peaks on both sides of the main resonance peaks and these satellite peaks originate from emission or absorption photons. The single-electron resonance tunneling can be controlled through changing the applied harmonically potential positions, such as driven potential in wells, in barriers, or in whole double-well systems. This advantage should be useful in the optimization of the parameters of a transmission device. (condensed matter: electronic structure, electrical, magnetic, and optical properties)
International Nuclear Information System (INIS)
Li, J.G.; Williams, S.S.; Goffinet, D.R.; Boer, A.L.; Xing, L.
2000-01-01
An electron beam with appropriate energy was combined with four intensity modulated photon beams. The direction of the electron beam was chosen to be tilted 10-20 laterally from the anteroposterior direction. Two of the intensity-modulated photon beams had the same gantry angles as the conventional tangential fields, whereas the other two beams were rotated 15-25' toward the anteroposterior directions from the first two photon beams. An iterative algorithm was developed which optimizes the weight of the electron beam as well as the fluence profiles of the photon beams for a given patient. Two breast cancer patients with early-stage breast tumors were planned with the new technique and the results were compared with those from 3D planning using tangential fields as well as 9-field intensity-modulated radiotherapy (IMRT) techniques. The combined electron and IMRT plans showed better dose conformity to the target with significantly reduced dose to the ipsilateral lung and, in the case of the left-breast patient, reduced dose to the heart, than the tangential field plans. In both the right-sided and left-sided breast plans, the dose to other normal structures was similar to that from conventional plans and was much smaller than that from the 9-field IMRT plans. The optimized electron beam provided between 70 to 80% of the prescribed dose at the depth of maximum dose of the electron beam. The combined electron and IMRT technique showed improvement over the conventional treatment technique using tangential fields with reduced dose to the ipsilateral lung and the heart. The customized beam directions of the four IMRT fields also kept the dose to other critical structures to a minimum. (author)
Avalos-Borja, M.; Larson, L. A.; Pizzo, P. P.
1984-01-01
A transmission electron microscopy (TEM) examination of aluminum-lithium-copper alloys was conducted. The principal purpose is to characterize the nature, size, and distribution of stringer particles which result from the powder metallurgy (P/M) processing of these alloys. Microstructural features associated with the stringer particles are reported that help explain the stress corrosion susceptibility of the powder metallurgy-processed Al-Li-Cu alloys. In addition, matrix precipitaton events are documented for a variety of heat treatments and process variations. Hot rolling is observed to significantly alter the nature of matrix precipitation, and the observations are correlated with concomitant mechanical property variations.
Transmission electron microscopy study of dislocation motion in icosahedral Al-Pd-Mn
International Nuclear Information System (INIS)
Mompiou, F.; Caillard, D.
2005-01-01
Perfect and imperfect dislocations trailing phason faults in quasi-crystals are introduced using a simplified two-dimensional aperiodic structure. Then, on the basis of observations of deformed specimens as well as in situ experiments in a transmission electron microscope, the motion of dislocations in icosahedral Al-Pd-Mn is shown to take place exclusively by climb. Under such conditions, the very high brittleness of Al-Pd-Mn at low and medium temperatures is proposed to be a consequence of the difficulty of glide, which itself appears to be an intrinsic property of the quasi-crystalline structure
Houdellier, F; Caruso, G M; Weber, S; Kociak, M; Arbouet, A
2018-03-01
We report on the development of an ultrafast Transmission Electron Microscope based on a cold field emission source which can operate in either DC or ultrafast mode. Electron emission from a tungsten nanotip is triggered by femtosecond laser pulses which are tightly focused by optical components integrated inside a cold field emission source close to the cathode. The properties of the electron probe (brightness, angular current density, stability) are quantitatively determined. The measured brightness is the largest reported so far for UTEMs. Examples of imaging, diffraction and spectroscopy using ultrashort electron pulses are given. Finally, the potential of this instrument is illustrated by performing electron holography in the off-axis configuration using ultrashort electron pulses. Copyright © 2017 Elsevier B.V. All rights reserved.
Optical Axis Identification Technique for Free Space Optics Transmission
Directory of Open Access Journals (Sweden)
Yuki Tashiro
2017-07-01
Full Text Available This paper describes optical axis adjustment technique for an active free space optics transmission system. This system precisely controls the direction of a collimated thin laser beam using a motor driven laser emitting mechanism and positioning photodiodes. Before beginning laser beam feedback control, it is required to guide the laser beam within the range of the positioning photodiodes for initial laser beam alignment. This paper proposes an arrival position presumption method of laser beam traveling along the long distance from transmitter. A positioning sensor containing several photodiodes measures laser luminescence distribution, and analytically calculates the optical axis of laser beam according to the modified Gaussian beam optics based on four or five distributed local intensity of laser luminescence. Experiments are conducted to evaluate the accuracy of the presumption, and results reveal that the method is effective in leading the laser beam onto a distant receiver.
Transmission electron microscopy studies of C3N4H4 treated at high pressure and high temperature
International Nuclear Information System (INIS)
Yu, R C; Chen, L C; Zhu, J L; Li, F Y; Liu, Z X; Qin, Z C; Yu, T N; Jin, C Q; Duan, X F; Zhang, Z
2002-01-01
C 3 N 4 H 4 was treated at 6.0 GPa and 1500 deg C for 2.5 min. Powder x-ray measurement shows that the sample is decomposed and a hexagonal graphite phase forms. Transmission electron microscopy studies show that small amounts of diamond and amorphous carbon phase coexist with the graphite phase. Parallel electron energy-loss spectroscopy analysis was also carried out for these phases
Spin polarized electron source technology transferred from HE accelerators to electron microscopes
International Nuclear Information System (INIS)
Nakanishi, Tsutomu
2009-01-01
For many years, we have developed a technology of spin-polarized-electron-source (PES) for a future linear collider project (ILC). Various new techniques for achieving high polarization, high quantum efficiency, high current density, sub-nanosecond multi-bunch generation etc. were developed. Two fundamental technologies; reduction of dark current and preparation of extremely high vacuum environment to protect the Negative Electron Affinity (NEA) surface have been also developed. Using these PES technologies and a new transmission type photocathode, we recently succeeded in producing the high brightness and high polarization electron beam for the low energy electron microscope (LEEM). Our Spin-LEEM system enables the world-first dynamic observation of surface magnetic domain formed by evaporation on the metal substrate with ∼ 20 nm space resolutions. (author)
Transmission electron microscopy studies on nanometer-sized ω phase produced in Gum Metal
International Nuclear Information System (INIS)
Yano, Takaaki; Murakami, Yasukazu; Shindo, Daisuke; Hayasaka, Yuichiro; Kuramoto, Shigeru
2010-01-01
The morphology, numerical density and average spacing of the ω phase formed in Gum Metal, a Ti-based alloy showing unique mechanical properties, were studied by transmission electron microscopy. Based on dark-field image observations and precise thickness measurements using a thin-foil specimen, the average spacing of the nanometer-sized ω phase was determined to be 6 nm. This spacing appeared to be sufficiently small for trapping dislocations. The results are discussed in conjunction with the dislocation-free deformation mechanism proposed for Gum Metal.
International Nuclear Information System (INIS)
Sauerwald, Andres
2008-01-01
Aim of this thesis was to apply the analytical methods of the scanning transmission electron microscopy to the study of self-organized In(Ga)As quantum structures. With the imaging methods Z contrast and bright field (position resolutions in the subnanometer range) and especially with the possibilities of the quantitative chemical EELS analysis of the scanning transmission electron microscope (STEM) fundamental questions concerning morphology and chemical properties of self-organized quantum structures should be answered. By the high position resolution of the STEM among others essentail morphological and structural parameters in the growth behaviour of ''dot in a well'' (DWell) structures and of vertically correlated quantum dots (QDs) could be analyzed. For the optimization of DWell structures samples were studied, the nominal InAs-QD growth position was directedly varied within the embedding InGaAs quantum wells. The STEM offers in connection with the EELS method a large potential for the chemical analysis of quantum structures. Studied was a sample series of self-organized InGaAs/GaAs structures on GaAs substrate, the stress of which was changed by varying the Ga content of the INGaAs material between 2.4 % and 4.3 % [de
Energy Technology Data Exchange (ETDEWEB)
Lunt, Alexander J.G., E-mail: alexander.lunt@chch.ox.ac.uk [Department of Engineering Science, University of Oxford, Parks Road, Oxford, Oxfordshire OX1 3PJ (United Kingdom); Mohanty, Gaurav, E-mail: gaurav.mohanty@empa.ch [EMPA Materials Science & Technology, Feuerwerkerstrasse 39, CH-3602 Thun (Switzerland); Ying, Siqi, E-mail: siqi.ying@eng.ox.ac.uk [Department of Engineering Science, University of Oxford, Parks Road, Oxford, Oxfordshire OX1 3PJ (United Kingdom); Dluhoš, Jiří, E-mail: jiri.dluhos@tescan.cz [TESCAN Brno, s.r.o., Libušina tř. 1, 623 00 Brno-Kohoutovice (Czech Republic); Sui, Tan, E-mail: tan.sui@eng.ox.ac.uk [Department of Engineering Science, University of Oxford, Parks Road, Oxford, Oxfordshire OX1 3PJ (United Kingdom); Neo, Tee K., E-mail: neophyte@singnet.com.sg [Specialist Dental Group, Mount Elizabeth Orchard, 3 Mount Elizabeth, #08-03/08-08/08-10, 228510 (Singapore); Michler, Johann, E-mail: johann.michler@empa.ch [EMPA Materials Science & Technology, Feuerwerkerstrasse 39, CH-3602 Thun (Switzerland); Korsunsky, Alexander M., E-mail: alexander.korsunsky@eng.ox.ac.uk [Department of Engineering Science, University of Oxford, Parks Road, Oxford, Oxfordshire OX1 3PJ (United Kingdom)
2015-12-01
Recent studies into the origins of failure of yttria partially stabilised zirconia–porcelain veneered prosthesis have revealed the importance of micro-to-nano scale characterisation of this interface zone. Current understanding suggests that the heat treatment, residual stresses and varying microstructure at this location may contribute to near-interface porcelain chipping. In this study the chemical, microstructural and mechanical property variation across the interfacial zone has been characterised at two differing length scales and using three independent techniques; energy dispersive X-ray spectroscopy, transmission electron microscopy and micropillar compression. Energy dispersive X-ray spectroscopy mapping of the near-interface region revealed, for the first time, that the diffusional lengths of twelve principal elements are limited to within 2–6 μm of the interface. This study also revealed that 0.2–2 μm diameter zirconia grains had become detached from the bulk and were embedded in the near-interface porcelain. Transmission electron microscopy analysis demonstrated the presence of nanoscale spherical features, indicative of tensile creep induced voiding, within the first 0.4–1.5 μm from the interface. Within zirconia, variations in grain size and atomistic structure were also observed within the 3 μm closest to the interface. Micropillar compression was performed over a 100 μm range on either side of the interface at the spatial resolution of 5 μm. This revealed an increase in zirconia and porcelain loading modulus at close proximities (< 5 μm) to the interface and a decrease in zirconia modulus at distances between 6 and 41 μm from this location. The combination of the three experimental techniques has revealed intricate details of the microstructural, chemical and consequently mechanical heterogeneities in the YPSZ–porcelain interface, and demonstrated that the length scales typically associated with this behaviour are approximately ± 5
Advanced high-speed protection for transmission lines with different configurations
Energy Technology Data Exchange (ETDEWEB)
Tholomier, D.; Naisani, P. [Areva T and D Automation Canada Inc., Monteal, PQ (Canada); Apostolov, A. [Omicron Electronics, Houston, TX (United States)
2008-07-01
Power substations and transmission lines require intelligent (microprocessor-based) electronic devices (IED) for data acquisition, protection, metering, and control. This paper presented a universal transmission line protection relay with segregated phase differential protection as the main function and multiple backup protection functions, including 3 zone distance protection. It described features allowing the application of the IED to multi-terminal lines, mutual coupled lines, charging current compensation, transformer inrush current detection, breaker and a half and ring bus substation configurations. GPS synchronized current differential protection offers reliable protection for transmission and distribution circuits. The security of the protection relay can be improved significantly by combining it with fallback techniques to cover loss of GPS synchronizing, and by including non-differential elements as back-up during route switching and channel failures. 7 figs.
Structural investigations on nanocrystalline Ni-W alloy films by transmission electron microscopy
Energy Technology Data Exchange (ETDEWEB)
Klimenkov, M. [Institut fuer Materialforschung, Forschungszentrum Karlsruhe, 76021 Karlsruhe (Germany); Haseeb, A.S.M.A. [Department of Mechanical Engineering, University of Malaya, 50603 Kuala Lumpur (Malaysia); Bade, K., E-mail: klaus.bade@imt.fzk.d [Institut fuer Mikrostrukturtechnik, Forschungszentrum Karlsruhe, 76021 Karlsruhe (Germany)
2009-10-30
Electrodeposited Ni-W alloys have been investigated in the as-deposited state by transmission electron microscopy in order to investigate the microstructural features in dependence of the tungsten content. Within the tungsten content range from 7 at.% up to 12 at.%, the microstructure is nanocrystalline characterized by a bimodal grain size distribution, consisting out of 20 to 200 nm sized grains and also larger grains with several 100 nm characteristic dimension. No clear trend in microstructure formation is visible with W content or deposition conditions in the investigated W content range. Only solid solution phase characteristics were observed. The lattice constant is 0.360 nm for 12 at.% W as derived from electron diffraction for the solid solution face centered cubic structure. Larger grains show twinning and stacking faults. Voids with diameter of a few nm were detected along with some multiple twinned particles, indicating high stress level during growth. About 2 at.% difference in the alloy composition from grain to grain was measured.
Energy Technology Data Exchange (ETDEWEB)
Hode, Tomas [Department of Geology, Portland State University, Portland, P.O. Box 751, OR 97201 (United States)], E-mail: hode@pdx.edu; Kristiansson, Per; Elfman, Mikael [Division of Nuclear Physics, Department of Physics, Lund Institute of Technology, Lund University, P.O. Box 118, SE-221 00 Lund (Sweden); Hugo, Richard C.; Cady, Sherry L. [Department of Geology, Portland State University, Portland, P.O. Box 751, OR 97201 (United States)
2009-10-01
The biogenicity of ancient morphological microfossil-like objects can be established by linking morphological (e.g. cell remnants and extracellular polymeric matrix) and chemical (e.g. isotopes, biomarkers and biominerals) evidence indicative of microorganisms or microbial activity. We have developed a non-destructive micro-analytical ion beam system capable of measuring with high spatial resolution the stable carbon isotope ratios of thin samples used for transmission electron microscopy. The technique is based on elastic scattering of alpha particles with an energy of 2.751 MeV. At this energy the {sup 13}C cross section is enhanced relative to the pure Rutherford cross section for {sup 13}C, whereas the {sup 12}C cross section is reduced relative to its pure Rutherford cross section. Here we report the initial results of this experimental approach used to characterize ultramicrotomed sections of sulfur-embedded graphite and microbial cells.
DEFF Research Database (Denmark)
Zhang, Lili; He, Maoshuai; Hansen, Thomas Willum
2017-01-01
and successive growth of additional SWCNTs on Co catalyst particles supported on MgO by means of environmental transmission electron microscopy. Such in situ observations reveal the plethora of solid carbon formations at the local scale while it is happening and thereby elucidate the multitude of configurations...
Czech Academy of Sciences Publication Activity Database
Delville, R.; Malard, B.; Pilch, Jan; Šittner, Petr; Schryvers, D.
172-174, č. 6 (2011), s. 682-687 ISSN 1012-0394 R&D Projects: GA MŠk(CZ) LA10010 Institutional research plan: CEZ:AV0Z10100520 Keywords : transmission electron microscopy * shape memory alloy * martensitic transformation * dislocation slip * nanograins Subject RIV: BM - Solid Matter Physics ; Magnetism
Energy Technology Data Exchange (ETDEWEB)
Mucci, J
1980-05-01
This program was established to determine the feasibility of laser beam welding as a fabrication method for hydrogen transmission and is a precursor in the effort to systematically provide the technological base necessary for large-scale, economic pipeline transmission of fuel for a hydrogen energy system. The study contributes to the technology base by establishing the effect of conventional weld processes and laser beam welding on the mechanical properties of two classes of steels in an air and high pressure gaseous hydrogen environment. Screening evaluation of the tensile, low-cycle fatigue and fracture toughness properties and metallurgical analyses provide the basis for concluding that laser beam welding of AISI 304L stainless steel and ASTM A106B carbon steel can produce weldments of comparable quality to those produced by gas-tungsten arc and electron beam welding and is at least equally compatible with 13.8 MPa (2000 psig) gaseous hydrogen environment.
International Nuclear Information System (INIS)
Shukla, A.K.; Baeslack, W.A.
2007-01-01
Microstructure evolution in friction-stir welded thin-sheet Al-Cu-Li alloy was studied using transmission-electron microscopy (TEM) and the dissolution and coarsening of T 1 and θ' precipitates were related to the microhardness profile of the weld
International Nuclear Information System (INIS)
Lacava, L.M.; Lacava, B.M.; Azevedo, R.B.; Lacava, Z.G.M.; Buske, N.; Tronconi, A.L.; Morais, P.C.
2001-01-01
Atomic force microscopy (AFM), transmission electron microscopy (TEM), and ferromagnetic resonance (FMR) were used to unfold the nanoparticle size of a ferrofluid sample. Compared to TEM, the AFM method showed a nanoparticle diameter (D m ) reduction of 20% and standard deviation (σ) increase of 15%. The differences in D m and σ were associated with the AFM tip and the nanoparticle concentration on the substrate
Transmission spectra of electrons through the Thue-Morse graphene superlattice
International Nuclear Information System (INIS)
Korol', A.M.
2014-01-01
The transmission spectra of the Thue-Morse superlattice (SL) based on a monolayer gapped graphene are investigated. The SL consists of rectangular barriers located along the Ox axis. The Thue-Morse aperiodic modulation is proposed to be realized due to the difference in values of the gap width in different SL elements. It is shown that the effective splitting of the allowed bands (and thereby the arising of a series of gaps) is observed under the influence of the aperiodic factor in the case of normal incidence of the electron wave on the SL as well as in the case of oblique incidence. The spectra are periodical with potential barrier height. In some regions of the spectra, the splitting of bands is subjected to the Fibonacci inflation rule in every new Thue-Morse generation. As in the periodical graphene-based SL, in every Thue-Morse sequence a superlattice Dirac point is created. The width of the gap associated with this point depends on SL parameters substantially; at the same time the energy location of this gap depends weakly on mass term in the Hamiltonian and it does not depend on SL period. The spectra dependence on the angle of electron wave incidence is not substantial
International Nuclear Information System (INIS)
Hunt, E.M.; Hampikian, J.M.
1997-01-01
Ion implantation can be used to alter in the optical response of insulators through the formation of embedded nano-sized particles. Single crystal alumina has been implanted at ambient temperature with 50 keV Ca + to a fluence of 5 x 10 16 ions/cm 2 . Ion channeling, Knoop microhardness measurements, and transmission electron microscopy (TEM) indicate that the alumina surface layer was amorphized by the implant. TEM also revealed nano-sized crystals ∼7--8 nm in diameter. These nanocrystals are randomly oriented, and exhibit a face-centered cubic structure (FCC) with a lattice parameter of 0.409 nm ± 0.002 nm. The similarity between this crystallography and that of pure aluminum suggests that they are metallic aluminum nanocrystals with a slightly dilated lattice parameter, possibly due to the incorporation of a small amount of calcium. Energy-filtered transmission electron microscopy (EFTEM) provides an avenue by which to confirm the metallic nature of the aluminum involved in the nanocrystals. EFTEM has confirmed that the aluminum present in the particles is metallic in nature, that the particles are oxygen deficient in comparison with the matrix material and that the particles are deficient in calcium, and therefore not likely to be calcia. The particles thus appear to be FCC Al (possibly alloyed with a few percent Ca) with a lattice parameter of 0.409nm. A similar result was obtained for yttrium ion implantation into alumina
Dimmable electronic ballasts by variable power density modulation technique
Borekci, Selim; Kesler, Selami
2014-11-01
Dimming can be accomplished commonly by switching frequency and pulse density modulation techniques and a variable inductor. In this study, a variable power density modulation (VPDM) control technique is proposed for dimming applications. A fluorescent lamp is operated in several states to meet the desired lamp power in a modulation period. The proposed technique has the same advantages of magnetic dimming topologies have. In addition, a unique and flexible control technique can be achieved. A prototype dimmable electronic ballast is built and experiments related to it have been conducted. As a result, a 36WT8 fluorescent lamp can be driven for a desired lamp power from several alternatives without modulating the switching frequency.
Energy Technology Data Exchange (ETDEWEB)
Magdalena, Th [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires
1961-07-01
The conventional replica techniques for the examination of surfaces or fractures with the electron microscope are unsuitable for refractories or microporous bodies. The method of cutting ultrafine sections with a diamond cutter, the sample being impregnated with methyl methacrylate, has the advantage of making possible the direct examination by transmission of the sample. (author) [French] Les techniques classiques de repliques pour l'examen de surfaces ou de fractures au microscope electronique sont difficilement applicables aux refractaires et aux microporeux. Les coupes ultraminces au couteau de diamant d'echantillons enrobes dans le methyl-methacrylate ont l'avantage de permettre l'examen direct par transmission des corps etudies. (auteur)
Christoffersen, R.; Keller, L. P.; Rahman, Z.; Baragiola, R.
2010-01-01
Energetic ions mostly from the solar wind play a major role in lunar space weathering because they contribute structural and chemical changes to the space-exposed surfaces of lunar regolith grains. In mature mare soils, ilmenite (FeTiO3) grains in the finest size fraction have been shown in transmission electron microscope (TEM) studies to exhibit key differences in their response to space radiation processing relative to silicates [1,2,3]. In ilmenite, solar ion radiation alters host grain outer margins to produce 10-100 nm thick layers that are microstructurally complex, but dominantly crystalline compared to the amorphous radiation-processed rims on silicates [1,2,3]. Spatially well-resolved analytical TEM measurements also show nm-scale compositional and chemical state changes in these layers [1,3]. These include shifts in Fe/Ti ratio from strong surface Fe-enrichment (Fe/Ti >> 1), to Fe depletion (Fe/Ti < 1) at 40-50 nm below the grain surface [1,3]. These compositional changes are not observed in the radiation-processed rims on silicates [4]. Several mechanism(s) to explain the overall relations in the ilmenite grain rims by radiation processing and/or additional space weathering processes were proposed by [1], and remain under current consideration [3]. A key issue has concerned the ability of ion radiation processing alone to produce some of the deeper- penetrating compositional changes. In order to provide some experimental constraints on these questions, we have performed a combined X-ray photoelectron spectroscopy (XPS) and field-emission scanning transmission electron (FE-STEM) study of experimentally ion-irradiated ilmenite. A key feature of this work is the combination of analytical techniques sensitive to changes in the irradiated samples at depth scales going from the immediate surface (approx.5 nm; XPS), to deeper in the grain interior (5-100 nm; FE-STEM).
McDowell, Matthew T.; Ryu, Ill; Lee, Seok Woo; Wang, Chongmin; Nix, William D.; Cui, Yi
2012-01-01
In situ transmission electron microscopy (TEM) is used to study the electrochemical lithiation of high-capacity crystalline Si nanoparticles for use in Li-ion battery anodes. The lithiation reaction slows down as it progresses into the particle interior, and analysis suggests that this behavior is due not to diffusion limitation but instead to the influence of mechanical stress on the driving force for reaction. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
McDowell, Matthew T.
2012-09-04
In situ transmission electron microscopy (TEM) is used to study the electrochemical lithiation of high-capacity crystalline Si nanoparticles for use in Li-ion battery anodes. The lithiation reaction slows down as it progresses into the particle interior, and analysis suggests that this behavior is due not to diffusion limitation but instead to the influence of mechanical stress on the driving force for reaction. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
DEFF Research Database (Denmark)
Faes, Antonin; Jeangros, Quentin; Wagner, Jakob Birkedal
2009-01-01
Environmental transmission electron microscopy was used to characterize in situ the reduction and oxidation of nickel from a Ni/YSZ solid oxide fuel cell anode support between 300-500{degree sign}C. The reduction is done under low hydrogen pressure. The reduction initiates at the NiO/YSZ interface...
International Nuclear Information System (INIS)
Guillen Giron, Teodolito; Leon Salazar, Jose Luis
2015-01-01
TEM (Transmission Electron Microscopy) probes are analyzed in aeronautical applications. Intercrystalline defects present in the Nimonic 80A superalloy are studied after being thermally treated and then subjecting the specimens to cyclic stresses. The TEM test specimens are pre-tested under high frequency (1 000 Hz and 20 000 Hz) fatigue at the University of Siegen in Germany simulating the working conditions of this alloy in aircraft turbines or other types of aeronautical applications. The mechanical stress has generated many deformations and nanometric defects in this material, evidenced in the dislocations. Defects are observed using very powerful microscopy techniques such as TEM. The results are obtained from the TEM analysis and have revealed characteristic precipitates in the Nimonic 80A sample when subjected to thermal treatments. The alloy has evidenced the formation of dislocations resulting from the mechanical stresses of the specimens. The influence of rainfall is evidenced in the mechanism of formation, grouping and movement of the dislocations in the microstructure of the samples used. (author) [es
International Nuclear Information System (INIS)
Svensson, K.; Jompol, Y.; Olin, H.; Olsson, E.
2003-01-01
A scanning tunneling microscope (STM) with a compact, three-dimensional, inertial slider design is presented. Inertial sliding of the STM tip, in three dimensions, enables coarse motion and scanning using only one piezoelectric tube. Using the same electronics both for scanning and inertial sliding, step lengths of less than 5% of the piezo range were achieved. The compact design, less than 1 cm3 in volume, ensures a low mechanical noise level and enables us to fit the STM into the sample holder of a transmission electron microscope (TEM), while maintaining atomic scale resolution in both STM and TEM imaging
Energy Technology Data Exchange (ETDEWEB)
Paredes, Yolanda A. [Center of Nanotechnology and Nanoscience, Universidad de las Fuerzas Armadas ESPE, Sangolqui 171-5-31B (Ecuador); Campos, Andrea P.C.; Achete, Carlos A. [DIMAT—INMETRO, Xerém, Duque de Caxias, RJ 25250-020 (Brazil); Cremona, Marco [DIMAT—INMETRO, Xerém, Duque de Caxias, RJ 25250-020 (Brazil); Department of Physics, Pontifícia Universidade Católica do Rio de Janeiro, PUC-Rio, Rio de Janeiro, RJ 22453-970 (Brazil)
2015-12-01
Organic light-emitting diodes using phosphorescent dyes (PHOLEDs) have excellent performance, with internal quantum efficiencies approaching 100%. To maximize their performance, PHOLED devices use a conductive organic host material with a sufficiently dispersed phosphorescent guest to avoid concentration quenching. Fac-tris(2-phenylpyridine) iridium, [Ir(ppy){sub 3}] is one of the most widely used green phosphorescent organic compounds. In this work, we used scanning transmission electron microscopy (STEM) equipped with HAADF (high-angle annular dark-field) and EDS (energy dispersive X-ray spectroscopy) detectors to analyze the distribution of the [Ir(ppy){sub 3}] concentration in the host material. This analysis technique, employed for the first time in co-deposited organic thin films, can simultaneously obtain an image and its respective chemical information, allowing for definitive characterization of the distribution and morphology of [Ir(ppy){sub 3}]. The technique was also used to analyze the effect of the vibration of the substrate during thermal co-deposition of the [Ir(ppy){sub 3}] molecules into an organic matrix. - Highlights: • We present a methodology to analyze the dopant distribution in organic thin films. • The method combines HAADF-STEM imaging and EDS X-ray spectroscopy. • Ir(ppy){sub 3} dopant was co-deposited into Spiro2-CBP organic matrix. • The dopant was co-deposited with and without substrate vibration. • Images and chemical information of the dopant were simultaneously obtained.
International Nuclear Information System (INIS)
Sudheer,; Tiwari, P.; Rai, V. N.; Srivastava, A. K.; Mukharjee, C.
2015-01-01
Plasmonic nanoparticle grating (PNG) structure of different periods has been fabricated by electron beam lithography using silver halide based transmission electron microscope film as a substrate. Conventional scanning electron microscope is used as a fabrication tool for electron beam lithography. Optical microscope and energy dispersive spectroscopy (EDS) have been used for its morphological and elemental characterization. Optical characterization is performed by UV-Vis absorption spectroscopic technique
Recent advances in FIB-TEM specimen preparation techniques
International Nuclear Information System (INIS)
Li Jian; Malis, T.; Dionne, S.
2006-01-01
Preparing high-quality transmission electron microscopy (TEM) specimens is of paramount importance in TEM studies. The development of the focused ion beam (FIB) microscope has greatly enhanced TEM specimen preparation capabilities. In recent years, various FIB-TEM foil preparation techniques have been developed. However, the currently available techniques fail to produce TEM specimens from fragile and ultra-fine specimens such as fine fibers. In this paper, the conventional FIB-TEM specimen preparation techniques are reviewed, and their advantages and shortcomings are compared. In addition, a new technique suitable to prepare TEM samples from ultra-fine specimens is demonstrated
Analog data transmission via fiber optics
International Nuclear Information System (INIS)
Cisneros, E.L.; Burgueno, G.F.
1987-01-01
In the SLAC Linear Collider Detector (SLD), as in most high-energy particle detectors, the electromagnetic noise environment is the limiting factor in electronic readout performance. Front-end electronics are particularly susceptible to electromagnetic interference (EMI), and great care has been taken to minimize its effects. The transfer of preprocessed analog signals from the detector environs, to the remote digital processing electronics, by conventional means (via metal conductors), may ultimately limit the performance of the system. Because it is highly impervious to EMI and ground loops, a fiber-optic medium has been chosen for the transmission of these signals. This paper describes several fiber-optic transmission schemes which satisfy the requirements of the SLD analog data transmission
Analog data transmission via fiber optics
International Nuclear Information System (INIS)
Cisneros, E.L.; Burgueno, G.F.
1986-10-01
In the SLAC Linear Collider Detector (SLD), as in most high-energy particle detectors, the electromagnetic noise environment is the limiting factor in electronic readout performance. Front-end electronics are particulary susceptible to electromagnetic interference (EMI), and great care has been taken to minimize its effects. The transfer of preprocessed analog signals from the detector environs, to the remote digital processing electronics, by conventional means (via metal conductors), may ultimately limit the performance of the system. Because it is highly impervious to EMI and ground loops, a fiber-optic medium has been chosen for the transmission of these signals. This paper describes several fiber-optic transmission schemes which satisfy the requirements of the SLD analog data transmission
International Nuclear Information System (INIS)
Koguchi, Masanari; Tsuneta, Ruriko; Anan, Yoshihiro; Nakamae, Koji
2017-01-01
An analytical electron microscope based on the scanning transmission electron microscope with wavelength dispersive x-ray spectroscopy (STEM-WDX) to realize highly sensitive elemental imaging especially for light elements has been developed. In this study, a large-solid-angle multi-capillary x-rays lens with a focal length of 5 mm, long-time data acquisition (e.g. longer than 26 h), and a drift-free system made it possible to visualize boron-dopant images in a Si substrate at a detection limit of 0.2 atomic percent. (paper)
Energy Technology Data Exchange (ETDEWEB)
Ullmann, P.
2007-06-15
The primary objective of this work was the first experimental realization of parallel RF transmission for accelerating spatially selective excitation in magnetic resonance imaging. Furthermore, basic aspects regarding the performance of this technique were investigated, potential risks regarding the specific absorption rate (SAR) were considered and feasibility studies under application-oriented conditions as first steps towards a practical utilisation of this technique were undertaken. At first, based on the RF electronics platform of the Bruker Avance MRI systems, the technical foundations were laid to perform simultaneous transmission of individual RF waveforms on different RF channels. Another essential requirement for the realization of Parallel Excitation (PEX) was the design and construction of suitable RF transmit arrays with elements driven by separate transmit channels. In order to image the PEX results two imaging methods were implemented based on a spin-echo and a gradient-echo sequence, in which a parallel spatially selective pulse was included as an excitation pulse. In the course of this work PEX experiments were successfully performed on three different MRI systems, a 4.7 T and a 9.4 T animal system and a 3 T human scanner, using 5 different RF coil setups in total. In the last part of this work investigations regarding possible applications of Parallel Excitation were performed. A first study comprised experiments of slice-selective B1 inhomogeneity correction by using 3D-selective Parallel Excitation. The investigations were performed in a phantom as well as in a rat fixed in paraformaldehyde solution. In conjunction with these experiments a novel method of calculating RF pulses for spatially selective excitation based on a so-called Direct Calibration approach was developed, which is particularly suitable for this type of experiments. In the context of these experiments it was demonstrated how to combine the advantages of parallel transmission
MFTF-B quasi-optical ECRH transmission system
International Nuclear Information System (INIS)
Yugo, J.J.; Shearer, J.W.; Ziolkowski, R.W.
1983-01-01
The microwave transmission system for ERCH on MFTF-B will utilize quasi-optical transmission techniques. The system consists of ten gyrotron oscillators: two gyrotrons at 28 GHz, two at 35 GHz, and six at 56 GHz. The 28 and 35 GHz gyrotrons both heat the electrons in the end plug (potential peak) while the 56 GHz sources heat the minimum-B anchor region (potential minimum). Microwaves are launched into a pair of cylindrical mirrors that form a pseudo-cavity which directs the microwaves through the plasma numerous times before they are lost out of the cavity. The cavity allows the microwave beam to reach the resonance zone over a wide range of plasma densities and temperatures. The fundamental electron cyclotron resonance moves to higher axial positions as a result of beta-depression of the magnetic field, doppler shifting of the resonance, and relativistic mass corrections for the electrons. With this system the microwave beam will reach the resonance surface at the correct angle of incidence for any density or temperature without active aiming of the antennas. The cavity also allows the beam to make multiple passes through the plasma to increase the heating efficiency at low temperatures and densities when the single pass absorption is low. In addition, neutral beams and diagnostics have an unobstructed view of the plasma
Ran, Ke; Rösner, Benedikt; Butz, Benjamin; Fink, Rainer H.; Spiecker, Erdmann
2016-10-01
The organic semiconductor silver-tetracyanoquinodimethane (Ag-TCNQ) exhibits electrical switching and memory characteristics. Employing a scanning tunnelling microscopy setup inside a transmission electron microscope, the switching behaviour of individual Ag-TCNQ nanowires (NWs) is investigated in detail. For a large number of NWs, the switching between a high (OFF) and a low (ON) resistance state was successfully stimulated by negative bias sweeps. Fitting the experimental I-V curves with a Schottky emission function makes the switching features prominent and thus enables a direct evaluation of the switching process. A memory cycle including writing, reading and erasing features is demonstrated at an individual NW. Moreover, electronic failure mechanisms due to Joule heating are discussed. These findings have a significant impact on our understanding of the switching behaviour of Ag-TCNQ.
International Nuclear Information System (INIS)
Behan, G; Nellist, P D
2008-01-01
The use of spherical aberration correctors in the scanning transmission electron microscope (STEM) has the effect of reducing the depth of field of the microscope, making three-dimensional imaging of a specimen possible by optical sectioning. Depth resolution can be improved further by placing aberration correctors and lenses pre and post specimen to achieve an imaging mode known as scanning confocal electron microscopy (SCEM). We present the calculated incoherent point spread functions (PSF) and optical transfer functions (OTF) of a STEM and SCEM. The OTF for a STEM is shown to have a missing cone region which results in severe blurring along the optic axis, which can be especially severe for extended objects. We also present strategies for reconstruction of experimental data, such as three-dimensional deconvolution of the point spread function.
International Nuclear Information System (INIS)
Hollander, R.W.; Bom, V.R.; Van Eijk, C.W.E.; Faber, J.S.; Hoevers, H.; Kruit, P.
1994-01-01
The elemental composition of a sample at nanometer scale is determined by measurement of the characteristic energy of Auger electrons, emitted in coincidence with incoming primary electrons from a microbeam in a scanning transmission electron microscope (STEM). Single electrons are detected with position sensitive detectors, consisting of MicroChannel Plates (MCP) and MultiStrip Anodes (MSA), one for the energy of the Auger electrons (Auger-detector) and one for the energy loss of primary electrons (EELS-detector). The MSAs are sensed with LeCroy 2735DC preamplifiers. The fast readout is based on LeCroy's PCOS III system. On the detection of a coincidence (Event) energy data of Auger and EELS are combined with timing data to an Event word. Event words are stored in list mode in a VME memory module. Blocks of Event words are scanned by transputers in VME and two-dimensional energy histograms are filled using the timing information to obtain a maximal true/accidental ratio. The resulting histograms are stored on disk of a PC-386, which also controls data taking. The system is designed to handle 10 5 Events per second, 90% of which are accidental. In the histograms the ''true'' to ''accidental'' ratio will be 5. The dead time is 15%. ((orig.))
Transport of electrons in lead oxide studied by CELIV technique
International Nuclear Information System (INIS)
Semeniuk, O; Juska, G; Oelerich, J O; Jandieri, K; Baranovskii, S D; Reznik, A
2017-01-01
Although polycrystalline lead oxide (PbO) has a long history of application in optoelectronics and imaging, the transport mechanism for electrons in this material has not yet been clarified. Using the photo-generated charge extraction by linear increasing voltage (photo-CELIV) technique, we provide the temperature- and field-dependences of electron mobility in poly-PbO. It is found that electrons undergo dispersive transport, i.e. their mobility decreases in the course of time. Multiple trapping of electrons from the conduction band into the developed band tail is revealed as the dominant transport mechanism. This differs dramatically from the dispersive transport of holes in the same material, dominated by topological factors and not by energy disorder. (paper)
International Nuclear Information System (INIS)
Lilen, H.
1976-01-01
Neutron and electron bombardment techniques for materials doping, newly introduced in the fabrication of power semiconductor components: diodes, transistors, thyristors, and triacs are briefly outlined. A neutron bombardment of high purity silicon results in a short-lived 31 Si isotope (from 30 Si) decaying into 31 P. The phosphorus with its five peripheral electrons induces a negative doping (N), and the neutron technique gives a homogeneous doping. Furthermore, silicon bombardment with 1 to 2MeV electrons induces micro-ruptures in the lattice, that act as recombination traps reducing carrier lifetimes. Consequently, gold diffusion techniques can be replaced by electron bombardment with a gain in controlling carrier lifetimes [fr
2017-01-01
An increasing number of studies have recently reported the rapid degradation of hybrid and all-inorganic lead halide perovskite nanocrystals under electron beam irradiation in the transmission electron microscope, with the formation of nanometer size, high contrast particles. The nature of these nanoparticles and the involved transformations in the perovskite nanocrystals are still a matter of debate. Herein, we have studied the effects of high energy (80/200 keV) electron irradiation on colloidal cesium lead bromide (CsPbBr3) nanocrystals with different shapes and sizes, especially 3 nm thick nanosheets, a morphology that facilitated the analysis of the various ongoing processes. Our results show that the CsPbBr3 nanocrystals undergo a radiolysis process, with electron stimulated desorption of a fraction of bromine atoms and the reduction of a fraction of Pb2+ ions to Pb0. Subsequently Pb0 atoms diffuse and aggregate, giving rise to the high contrast particles, as previously reported by various groups. The diffusion is facilitated by both high temperature and electron beam irradiation. The early stage Pb nanoparticles are epitaxially bound to the parent CsPbBr3 lattice, and evolve into nonepitaxially bound Pb crystals upon further irradiation, leading to local amorphization and consequent dismantling of the CsPbBr3 lattice. The comparison among CsPbBr3 nanocrystals with various shapes and sizes evidences that the damage is particularly pronounced at the corners and edges of the surface, due to a lower diffusion barrier for Pb0 on the surface than inside the crystal and the presence of a larger fraction of under-coordinated atoms. PMID:28122188
Thin dielectric film thickness determination by advanced transmission electron microscopy
Energy Technology Data Exchange (ETDEWEB)
Diebold, A.C.; Foran, B.; Kisielowski, C.; Muller, D.; Pennycook, S.; Principe, E.; Stemmer, S.
2003-09-01
High Resolution Transmission Electron Microscopy (HR-TEM) has been used as the ultimate method of thickness measurement for thin films. The appearance of phase contrast interference patterns in HR-TEM images has long been confused as the appearance of a crystal lattice by non-specialists. Relatively easy to interpret crystal lattice images are now directly observed with the introduction of annular dark field detectors for scanning TEM (STEM). With the recent development of reliable lattice image processing software that creates crystal structure images from phase contrast data, HR-TEM can also provide crystal lattice images. The resolution of both methods was steadily improved reaching now into the sub Angstrom region. Improvements in electron lens and image analysis software are increasing the spatial resolution of both methods. Optimum resolution for STEM requires that the probe beam be highly localized. In STEM, beam localization is enhanced by selection of the correct aperture. When STEM measurement is done using a highly localized probe beam, HR-TEM and STEM measurement of the thickness of silicon oxynitride films agree within experimental error. In this paper, the optimum conditions for HR-TEM and STEM measurement are discussed along with a method for repeatable film thickness determination. The impact of sample thickness is also discussed. The key result in this paper is the proposal of a reproducible method for film thickness determination.
Reference nano-dimensional metrology by scanning transmission electron microscopy
International Nuclear Information System (INIS)
Dai, Gaoliang; Fluegge, Jens; Bosse, Harald; Heidelmann, Markus; Kübel, Christian; Prang, Robby
2013-01-01
Traceable and accurate reference dimensional metrology of nano-structures by scanning transmission electron microscopy (STEM) is introduced in the paper. Two methods, one based on the crystal lattice constant and the other based on the pitch of a feature pair, were applied to calibrate the TEM magnification. The threshold value, which was defined as the half-intensity of boundary materials, is suggested to extract the boundary position of features from the TEM image. Experimental investigations have demonstrated the high potential of the proposed methods. For instance, the standard deviation from ten repeated measurements of a line structure with a nominal 100 nm critical dimension (CD) reaches 1σ = 0.023 nm, about 0.02%. By intentionally introduced defocus and larger sample alignment errors, the investigation shows that these influences may reach 0.20 and 1.3 nm, respectively, indicating the importance of high-quality TEM measurements. Finally, a strategy for disseminating the destructive TEM results is introduced. Using this strategy, the CD of a reference material has been accurately determined. Its agreement over five independent TEM measurements is below 1.2 nm. (paper)