Cloning of the human TASK-2 (KCNK5) promoter and its regulation by chronic hypoxia
International Nuclear Information System (INIS)
Brazier, Stephen P.; Mason, Helen S.; Bateson, Alan N.; Kemp, Paul J.
2005-01-01
The tandem P domain potassium channel family includes five members of the acid-sensing subfamily, TASK. TASK channels are active at resting potential and are inhibited by extracellular protons, suggesting they function as acid sensors and control excitability/ion homeostasis. Indeed, TASK-2 (KCNK5) has been shown to control excitability, volume regulation, bicarbonate handling, and apoptosis in a variety of tissues. With such diverse functions being ascribed to TASK-2, it is important to understand long-term as well as short-term regulation of this important channel. Thus, we have cloned the TASK-2 promoter, demonstrated that its transcriptional activity is dependent upon pO 2 , shown that deletion of overlapping consensus binding sites for NF-κB/Elk-1 ablates this O 2 sensitivity, and proved that Elk-1 binds preferentially to this site. Furthermore, the consequences of chronic hypoxia on natively expressed TASK-2 are decreased steady-state mRNA and cell depolarization showing that TASK-2 contributes to the excitability of this important lung cell type
Chen, Yi; Zeng, Xing; Huang, Xuan; Serag, Sara; Woolf, Clifford J; Spiegelman, Bruce M
2017-11-02
Adrenergic stimulation promotes lipid mobilization and oxidation in brown and beige adipocytes, where the harnessed energy is dissipated as heat in a process known as adaptive thermogenesis. The signaling cascades and energy-dissipating pathways that facilitate thermogenesis have been extensively described, yet little is known about the counterbalancing negative regulatory mechanisms. Here, we identify a two-pore-domain potassium channel, KCNK3, as a built-in rheostat negatively regulating thermogenesis. Kcnk3 is transcriptionally wired into the thermogenic program by PRDM16, a master regulator of thermogenesis. KCNK3 antagonizes norepinephrine-induced membrane depolarization by promoting potassium efflux in brown adipocytes. This limits calcium influx through voltage-dependent calcium channels and dampens adrenergic signaling, thereby attenuating lipolysis and thermogenic respiration. Adipose-specific Kcnk3 knockout mice display increased energy expenditure and are resistant to hypothermia and obesity. These findings uncover a critical K + -Ca 2+ -adrenergic signaling axis that acts to dampen thermogenesis, maintain tissue homeostasis, and reveal an electrophysiological regulatory mechanism of adipocyte function. Copyright © 2017 Elsevier Inc. All rights reserved.
Saito, Kosuke; Moore, Rick; Negishi, Masahiko
2013-03-01
KCNK1, a member of the family of two-pore K(+) ion channels, is specifically induced in the livers of male mice after phenobarbital treatment. Here, we have determined the molecular mechanism of this male-specific activation of the Kcnk1 gene and characterized KCNK1 as a phenobarbital-inducible antihyperplasia factor. Upon activation by phenobarbital, nuclear receptor CAR binds the 97-bp response element (-2441/-2345) within the Kcnk1 promoter. This binding is observed in the livers of male mice, but not in the livers of female mice and requires the pituitary gland, because hypophysectomy abrogates it. Hyperplasia further progressed in the livers of Kcnk1 ( -/- ) male mice compared with those of Kcnk1 ( +/+ ) males after phenobarbital treatment. Thus, KCNK1 suppresses phenobarbital-induced hyperplasia. These results indicate that phenobarbital treatment induces KCNK1 to elicit a male-specific and growth-suppressing signal. Thus, KCNK1 and Kcnk1 ( -/- ) mice provide an experimental tool for further investigation into the molecular mechanism of CAR-mediated promotion of the development of hepatocellular carcinoma in mice.
DEFF Research Database (Denmark)
Liang, Bo; Soka, Magdalena; Christensen, Alex Horby
2013-01-01
The two-pore domain potassium channel, K2P3.1 (TASK-1) modulates background conductance in isolated human atrial cardiomyocytes and has been proposed as a potential drug target for atrial fibrillation (AF). TASK-1 knockout mice have a predominantly ventricular phenotype however, and effects of TASK......-1 inactivation on atrial structure and function have yet to be demonstrated in vivo. The extent to which genetic variation in KCNK3, that encodes TASK-1, might be a determinant of susceptibility to AF is also unknown. To address these questions, we first evaluated the effects of transient knockdown...... of the zebrafish kcnk3a and kcnk3b genes and cardiac phenotypes were evaluated using videomicroscopy. Combined kcnk3a and kcnk3b knockdown in 72 hour post fertilization embryos resulted in lower heart rate (p
The role of the potassium channel gene KCNK2 in major depressive disorder.
Congiu, Chiara; Minelli, Alessandra; Bonvicini, Cristian; Bortolomasi, Marco; Sartori, Riccardo; Maj, Carlo; Scassellati, Catia; Maina, Giuseppe; Trabucchi, Luigi; Segala, Matilde; Gennarelli, Massimo
2015-02-28
Six single nucleotide polymorphisms (SNPs) of the KCNK2 gene were investigated for their association with major depressive disorder (MDD) and treatment efficacy in 590 MDD patients and 441 controls. The A homozygotes of rs10779646 were significantly more frequent in patients than controls whereas G allele of rs7549184 was associated with the presence of psychotic symptoms and the severity of disease. Evaluating the Sequenced Treatment Alternatives to Relieve Depression (STAR*D) dataset, we confirmed our findings. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Sánchez Delgado, Marta; Camprubí, Cristina; Tümer, Zeynep; Martínez, Francisco; Milà, Montserrat; Monk, David
2014-09-01
The phenotype overlap between autism spectrum disorders (ASD) & intellectual disabilities (ID) is mirrored at the genetic level, with common genes being reported mutated in variety of developmental disabilities. However despite widespread genetic screening for mutations, in approximately 40-60% of childhood developmental disorders the genetic cause remains unknown. Several genome-wide linkage screens in ASD have identified a locus mapping to distal 8q. We have recently identified a novel brain-specific imprinted cluster at this location, which contains the reciprocally expressed maternal KCNK9 and paternally expressed non-coding PEG13 transcripts, the latter located within an intron of TRAPPC9. Interestingly, mutations of KCNK9 and TRAPPC9 have been reported in Birk-Barel mental retardation and non-syndromic familial forms of ID, respectively. Here, we report a genetic screen for KCNK9 coding mutations and potential epigenetic aberrations that could result in deregulated imprinting in a cohort of 120 ID, 86 ASD and 86 Tourette syndrome patients. Fifteen of the ID patients had clinical characteristics overlapping with Birk-Barel syndrome. Sequencing of the two coding exons of KCNK9 failed to identify pathologic mutations, with only one variant, rs2615374, being present with allele frequencies similar to those described in dbSNP database. DNA methylation profiling of the KCNK9 and TRAPPC9 promoters, the maternally methylated PEG13 DMR and a long-range enhancer region were normal in all patients. Our findings suggest that mutations of KCNK9 or epigenetic disturbances within the PEG13 imprinted cluster do not significantly contribute to the cause of the developmental disabilities tested in this study. © 2014 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Makoto Nishizuka
2014-12-01
Full Text Available KCNK10, a member of tandem pore domain potassium channel family, gives rise to leak K+ currents. It plays important roles in stabilizing the negative resting membrane potential and in counterbalancing depolarization. We previously demonstrated that kcnk10 expression is quickly elevated during the early stage of adipogenesis of 3T3-L1 cells and that reduction of kcnk10 expression inhibits adipocyte differentiation. However, the molecular mechanism of KCNK10 in adipocyte differentiation remains unclear. Here we revealed that kcnk10 is induced by 3-isobutyl-1-methylxanthine, a cyclic nucleotide phosphodiesterase inhibitor and a potent inducer of adipogenesis, during the early stage of adipocyte differentiation. We also demonstrated that KCNK10 functions as a positive regulator of mitotic clonal expansion (MCE, a necessary process for terminal differentiation. The reduction of kcnk10 expression repressed the expression levels of CCAAT/enhancer-binding protein β (C/EBPβ and C/EBPδ as well as the phosphorylation level of Akt during the early phase of adipogenesis. In addition, knockdown of kcnk10 expression suppressed insulin-induced Akt phosphorylation. These results indicate that KCNK10 contributes to the regulation of MCE through the control of C/EBPβ and C/EBPδ expression and insulin signaling.
Directory of Open Access Journals (Sweden)
Stefan Bittner
2015-07-01
Full Text Available Lymphocytes express potassium channels that regulate physiological cell functions, such as activation, proliferation and migration. Expression levels of K2P5.1 (TASK2; KCNK5 channels belonging to the family of two-pore domain potassium channels have previously been correlated to the activity of autoreactive T lymphocytes in patients with multiple sclerosis and rheumatoid arthritis. In humans, K2P5.1 channels are upregulated upon T cell stimulation and influence T cell effector functions. However, a further clinical translation of targeting K2P5.1 is currently hampered by a lack of highly selective inhibitors, making it necessary to evaluate the impact of KCNK5 in established preclinical animal disease models. We here demonstrate that K2P5.1 knockout (K2P5.1−/− mice display no significant alterations concerning T cell cytokine production, proliferation rates, surface marker molecules or signaling pathways. In an experimental model of autoimmune neuroinflammation, K2P5.1−/− mice show a comparable disease course to wild-type animals and no major changes in the peripheral immune system or CNS compartment. A compensatory upregulation of the potassium channels K2P3.1 and KV1.3 seems to counterbalance the deletion of K2P5.1. As an alternative model mimicking autoimmune neuroinflammation, experimental autoimmune encephalomyelitis in the common marmoset has been proposed, especially for testing the efficacy of new potential drugs. Initial experiments show that K2P5.1 is functionally expressed on marmoset T lymphocytes, opening up the possibility for assessing future K2P5.1-targeting drugs.
DEFF Research Database (Denmark)
Delgado, Marta Sánchez; Camprubí, Cristina; Tümer, Zeynep
2014-01-01
The phenotype overlap between autism spectrum disorders (ASD) & intellectual disabilities (ID) is mirrored at the genetic level, with common genes being reported mutated in variety of developmental disabilities. However despite widespread genetic screening for mutations, in approximately 40......-60% of childhood developmental disorders the genetic cause remains unknown. Several genome-wide linkage screens in ASD have identified a locus mapping to distal 8q. We have recently identified a novel brain-specific imprinted cluster at this location, which contains the reciprocally expressed maternal KCNK9...... and paternally expressed non-coding PEG13 transcripts, the latter located within an intron of TRAPPC9. Interestingly, mutations of KCNK9 and TRAPPC9 have been reported in Birk-Barel mental retardation and non-syndromic familial forms of ID, respectively. Here, we report a genetic screen for KCNK9 coding...
A dual phosphorylation switch controls 14-3-3-dependent cell surface expression of TASK-1
Kilisch, Markus; Lytovchenko, Olga; Arakel, Eric C.; Bertinetti, Daniela; Schwappach, Blanche
2016-01-01
ABSTRACT The transport of the K+ channels TASK-1 and TASK-3 (also known as KCNK3 and KCNK9, respectively) to the cell surface is controlled by the binding of 14-3-3 proteins to a trafficking control region at the extreme C-terminus of the channels. The current model proposes that phosphorylation-dependent binding of 14-3-3 sterically masks a COPI-binding motif. However, the direct effects of phosphorylation on COPI binding and on the binding parameters of 14-3-3 isoforms are still unknown. We find that phosphorylation of the trafficking control region prevents COPI binding even in the absence of 14-3-3, and we present a quantitative analysis of the binding of all human 14-3-3 isoforms to the trafficking control regions of TASK-1 and TASK-3. Surprisingly, the affinities of 14-3-3 proteins for TASK-1 are two orders of magnitude lower than for TASK-3. Furthermore, we find that phosphorylation of a second serine residue in the C-terminus of TASK-1 inhibits 14-3-3 binding. Thus, phosphorylation of the trafficking control region can stimulate or inhibit transport of TASK-1 to the cell surface depending on the target serine residue. Our findings indicate that control of TASK-1 trafficking by COPI, kinases, phosphatases and 14-3-3 proteins is highly dynamic. PMID:26743085
pH-dependent inhibition of K2P3.1 prolongs atrial refractoriness in whole hearts
DEFF Research Database (Denmark)
Skarsfeldt, Mark A; Jepps, Thomas A; Bomholtz, Sofia H
2016-01-01
In isolated human atrial cardiomyocytes, inhibition of K2P3.1 K(+) channels results in action potential (action potential duration (APD)) prolongation. It has therefore been postulated that K2P3.1 (KCNK3), together with K2P9.1 (KCNK9), could represent novel drug targets for the treatment of atrial...... fibrillation (AF). However, it is unknown whether these findings in isolated cells translate to the whole heart. The purposes of this study were to investigate the expression levels of KCNK3 and KCNK9 in human hearts and two relevant rodent models and determine the antiarrhythmic potential of K2P3.1 inhibition...... displayed a more uniform expression of KCNK3 between atria and ventricle. In voltage-clamp experiments, ML365 and A293 were found to be potent and selective inhibitors of K2P3.1, but at pH 7.4, they failed to prolong atrial APD and refractory period (effective refractory period (ERP)) in isolated perfused...
Directory of Open Access Journals (Sweden)
Clive J Hoggart
2014-07-01
Full Text Available The phenotypic effect of some single nucleotide polymorphisms (SNPs depends on their parental origin. We present a novel approach to detect parent-of-origin effects (POEs in genome-wide genotype data of unrelated individuals. The method exploits increased phenotypic variance in the heterozygous genotype group relative to the homozygous groups. We applied the method to >56,000 unrelated individuals to search for POEs influencing body mass index (BMI. Six lead SNPs were carried forward for replication in five family-based studies (of ∼4,000 trios. Two SNPs replicated: the paternal rs2471083-C allele (located near the imprinted KCNK9 gene and the paternal rs3091869-T allele (located near the SLC2A10 gene increased BMI equally (beta = 0.11 (SD, P<0.0027 compared to the respective maternal alleles. Real-time PCR experiments of lymphoblastoid cell lines from the CEPH families showed that expression of both genes was dependent on parental origin of the SNPs alleles (P<0.01. Our scheme opens new opportunities to exploit GWAS data of unrelated individuals to identify POEs and demonstrates that they play an important role in adult obesity.
Terbinafine is a novel and selective activator of the two-pore domain potassium channel TASK3.
Wright, Paul D; Veale, Emma L; McCoull, David; Tickle, David C; Large, Jonathan M; Ococks, Emma; Gothard, Gemma; Kettleborough, Catherine; Mathie, Alistair; Jerman, Jeffrey
2017-11-04
Two-pore domain potassium channels (K2Ps) are characterized by their four transmembrane domain and two-pore topology. They carry background (or leak) potassium current in a variety of cell types. Despite a number of important roles there is currently a lack of pharmacological tools with which to further probe K2P function. We have developed a cell-based thallium flux assay, using baculovirus delivered TASK3 (TWIK-related acid-sensitive K + channel 3, KCNK9, K2P9.1) with the aim of identifying novel, selective TASK3 activators. After screening a library of 1000 compounds, including drug-like and FDA approved molecules, we identified Terbinafine as an activator of TASK3. In a thallium flux assay a pEC50 of 6.2 ( ±0.12) was observed. When Terbinafine was screened against TASK2, TREK2, THIK1, TWIK1 and TRESK no activation was observed in thallium flux assays. Several analogues of Terbinafine were also purchased and structure activity relationships examined. To confirm Terbinafine's activation of TASK3 whole cell patch clamp electrophysiology was carried out and clear potentiation observed in both the wild type channel and the pathophysiological, Birk-Barel syndrome associated, G236R TASK3 mutant. No activity at TASK1 was observed in electrophysiology studies. In conclusion, we have identified the first selective activator of the two-pore domain potassium channel TASK3. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
I.R. Siddiqui
2018-02-01
Full Text Available A novel three component one pot methodology for rapid access to pyrido[1,2-c][1,3,5]thiadiazin-4-ones and thiazolo[3,2-c][1,3,5]thiadiazin-4-ones has been developed. A task specific ionic liquid [bmIm]SCN has been used as thiocyanating reagent. The reaction provides high yields of the product and proceeds at ambient reaction conditions in water. The use of water as the reaction medium and easy recyclability of the ionic liquid used as a reagent as well as promoter of the reaction endows the reaction with green aspects.
Directory of Open Access Journals (Sweden)
Dr. Gabriel C. Delariarte
2014-02-01
Full Text Available - This study aimed to determine the taking teacher education to task: exploring the role of teacher education in promoting values and moral education of task-based language teaching in the college of education of West Visayas State University Calinog-Campus for the school year 2012-2013. Descriptive research method was utilized in the study. The findings revealed that the respondents perceived highly observable Teachers’ role in promoting values and moral education of task-based language teaching; the entire group of respondents has perceived highly observable Teachers’ role in promoting values and moral education of task-based language teaching; both male and female respondent have perceived a highly observable Teachers’ role in promoting values and moral education of task-based language teaching; all age brackets have perceived a highly observable Teachers’ role in promoting values and moral education of task-based language teaching except 19 to 20 brackets that perceived very highly observable Teachers’ role in promoting values and moral education of taskbased language teaching. Finally, there is no significant difference in the perceived teacher’s role in promoting values and moral education of task-based language teaching when classified as to sex and age.
Bittner, Stefan; Bobak, Nicole; Feuchtenberger, Martin; Herrmann, Alexander M; Göbel, Kerstin; Kinne, Raimund W; Hansen, Anker J; Budde, Thomas; Kleinschnitz, Christoph; Frey, Oliver; Tony, Hans-Peter; Wiendl, Heinz; Meuth, Sven G
2011-02-11
CD4+ T cells express K(2P)5.1 (TWIK-related acid-sensitive potassium channel 2 (TASK2); KCNK5), a member of the two-pore domain potassium channel family, which has been shown to influence T cell effector functions. Recently, it was shown that K(2P)5.1 is upregulated upon (autoimmune) T cell stimulation. The aim of this study was to correlate expression levels of K(2P)5.1 on T cells from patients with rheumatoid arthritis (RA) to disease activity in these patients. Expression levels of K(2P)5.1 were measured by RT-PCR in the peripheral blood of 58 patients with RA and correlated with disease activity parameters (C-reactive protein levels, erythrocyte sedimentation rates, disease activity score (DAS28) scores). Twenty patients undergoing therapy change were followed-up for six months. Additionally, synovial fluid and synovial biopsies were investigated for T lymphocytes expressing K(2P)5.1. K(2P)5.1 expression levels in CD4+ T cells show a strong correlation to DAS28 scores in RA patients. Similar correlations were found for serological inflammatory parameters (erythrocyte sedimentation rate, C-reactive protein). In addition, K(2P)5.1 expression levels of synovial fluid-derived T cells are higher compared to peripheral blood T cells. Prospective data in individual patients show a parallel behaviour of K(2P)5.1 expression to disease activity parameters during a longitudinal follow-up for six months. Disease activity in RA patients correlates strongly with K(2P)5.1 expression levels in CD4+ T lymphocytes in the peripheral blood in cross-sectional as well as in longitudinal observations. Further studies are needed to investigate the exact pathophysiological mechanisms and to evaluate the possible use of K(2P)5.1 as a potential biomarker for disease activity and differential diagnosis.
Promoting Reasoning through the Magic V Task
Bragg, Leicha A.; Widjaja, Wanty; Loong, Esther Yook-Kin; Vale, Colleen; Herbert, Sandra
2015-01-01
Reasoning in mathematics plays a critical role in developing mathematical understandings. In this article, Bragg, Loong, Widjaja, Vale & Herbert explore an adaptation of the Magic V Task and how it was used in several classrooms to promote and develop reasoning skills.
Energy Technology Data Exchange (ETDEWEB)
Kunz, S.; Schmitz, H.J.; Schrenk, D. [Kaiserslautern Univ. (Germany). Dept. of Food Chemistry and Environmental Toxicology; Buchmann, A.; Schwarz, M. [Tuebingen Univ. (Germany). Inst. of Toxicology; Schilling, B.; Paepke, O. [ERGO Research, Hamburg (Germany); Robertson, L.W.; Lehmler, H.J. [Iowa Univ, Iowa City, IA (United States). Dept. of Occupational and Environmental Health
2004-09-15
Polychlorinated biphenyls (PCBs) are potent persistent environmental pollutants exhibiting neurotoxic, teratogenic and tumor-promoting effects in experimental animal models. PCB congeners can be divided into 'dioxin-like' and 'non-dioxin-like' congeners on the basis of their ability to act as aryl hydrocarbon receptor (AhR) agonists. Like the most toxic dioxin congener 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) 'dioxin-like' PCBs bind to the AhR and show characteristic effects on the expression of AhR-regulated genes including the induction of cytochrome P450 (CYP) 1A1. On the other hand, 'non-dioxin-like' PCB congeners have a lower or no binding affinity to the AhR, but exhibit a 'phenobarbital-type' induction of CYP 2B1/2 activity. The tumor-promoting potency of several PCBs has been demonstrated in two-stage initiation-promotion experiments in rat liver. Preneoplastic cell clones, targets for tumor promotion, can be identified as phenotypically altered foci showing characteristic enzyme patterns including the decreased activity of adenosine triphosphatase (ATPase) or the increased expression of the placental form of gluthatione S-transferase (GSTP). In the present study, the effect of the 'non-dioxin-like' 2,4,4'-trichlorobiphenyl (PCB 28) and 2,2',4,5,5'-pentachlorobiphenyl (PCB 101) on the promotion of enzyme-altered hepatic foci was investigated in female Wistar rats after initiation with diethylnitrosamine (DEN).
Task 4.2.2: Task report prepared for the second CRP meeting 5-8 October 1993, Budapest, Hungary
International Nuclear Information System (INIS)
Fujita, Yushi
1993-01-01
This is a preliminary report on Task 4.2.2. of IAEA Coordinated Research Program on Operator Support Systems in Nuclear Power Plants. The purposes of Task 4.2.2 are defined as follows: evaluate functions assigned to operators, maintenance personnel, or plant management staff; identify where operator support systems (OSS) can support those functions in a productive way. In this report, discussion is made of (i) a framework for evaluating functions assigned to operators, maintenance personnel, or plant management staff, and (ii) where OSS can be most beneficial to support these functions. In addition, recommendations for future efforts are made
Promoted V2O5/TiO2 catalysts for selective catalytic reduction of NO with NH3 at low temperatures
DEFF Research Database (Denmark)
Putluru, Siva Sankar Reddy; Schill, Leonhard; Godiksen, Anita
2016-01-01
characterized by N2 physisorption, XRPD, NH3-TPD, H2-TPR, Raman, FTIR and EPR spectroscopy to investigate the properties of the catalysts. XRPD, Raman and FTIR showed that promotion with 15 wt.% HPA does not cause V2O5 to be present in crystalline form, also at a loading of 5 wt.% V2O5. Hence, use of HPAs does......The influence of varying the V2O5 content (3–6 wt.%) was studied for the selective catalytic reduction (SCR) of nitrogen oxides by ammonia on heteropoly acid (HPA)- and tungsten oxide (WO3)-promoted V2O5/TiO2 catalysts. The SCR activity and alkali deactivation resistance of HPA-promoted V2O5/TiO2...... catalysts was found to be much higher than for WO3-promoted catalysts. By increasing the vanadium content from 3 to 5 wt.% the catalysts displayed a two fold increase in activity at 225 °C and retained their initial activity after alkali doping at a molar K/V ratio of 0.181. Furthermore, the catalysts were...
Promotion of Nb2O5 on the wustite-based iron catalyst for ammonia synthesis
International Nuclear Information System (INIS)
Han, Wenfeng; Huang, Shiliang; Cheng, Tianhong; Tang, Haodong; Li, Ying; Liu, Huazhang
2015-01-01
Highlights: • Niobium enhances the reduction of wustite-based ammonia synthesis catalyst significantly. • Nb 2 O 5 inhibits the segregation or formation of solid solutions on the catalyst surface. • Nb 2 O 5 doping enhances the growth rates of [2 1 1] and [2 0 0] planes rather than their amounts. - Abstract: Niobium was selected and investigated as a potential promoter for wustite-based catalyst (WBC) for ammonia synthesis. Experiments on reduction performance, activity test and H 2 -TGA, in situ XRD as well as XPS were carried out to obtain the promotion effect and mechanism involved. Niobium as a promoter was confirmed to enhance the reduction of WBC significantly. This behavior is highly desired for industry in terms of catalyst regeneration and lesser pretreatment time for fabrication regardless the unimproved catalytic performance for Nb 2 O 5 -doped wustite-based catalyst (Nb-WBC). Possible reasons for these phenomena are discussed. It is suggested that Nb 2 O 5 is not favorable for the segregation or formation of solid solutions on the catalyst surface, which are difficult to be reduced. However, it seems that niobium does not promote the growth of [2 1 1] plane, which is active for ammonia synthesis.
Directory of Open Access Journals (Sweden)
Kristi M Porter
Full Text Available Pulmonary Hypertension (PH is a progressive disorder characterized by endothelial dysfunction and proliferation. Hypoxia induces PH by increasing vascular remodeling. A potential mediator in hypoxia-induced PH development is arachidonate 5-Lipoxygenase (ALOX5. While ALOX5 metabolites have been shown to promote pulmonary vasoconstriction and endothelial cell proliferation, the contribution of ALOX5 to hypoxia-induced proliferation remains unknown. We hypothesize that hypoxia exposure stimulates HPAEC proliferation by increasing ALOX5 expression and activity. To test this, human pulmonary artery endothelial cells (HPAEC were cultured under normoxic (21% O2 or hypoxic (1% O2 conditions for 24-, 48-, or 72 hours. In a subset of cells, the ALOX5 inhibitor, zileuton, or the 5-lipoxygenase activating protein inhibitor, MK-886, was administered during hypoxia exposure. ALOX5 expression was measured by qRT-PCR and western blot and HPAEC proliferation was assessed. Our results demonstrate that 24 and 48 hours of hypoxia exposure have no effect on HPAEC proliferation or ALOX5 expression. Seventy two hours of hypoxia significantly increases HPAEC ALOX5 expression, hydrogen peroxide (H2O2 release, and HPAEC proliferation. We also demonstrate that targeted ALOX5 gene silencing or inhibition of the ALOX5 pathway by pharmacological blockade attenuates hypoxia-induced HPAEC proliferation. Furthermore, our findings indicate that hypoxia-induced increases in cell proliferation and ALOX5 expression are dependent on H2O2 production, as administration of the antioxidant PEG-catalase blocks these effects and addition of H2O2 to HPAEC promotes proliferation. Overall, these studies indicate that hypoxia exposure induces HPAEC proliferation by activating the ALOX5 pathway via the generation of H2O2.
DEFF Research Database (Denmark)
Putluru, Siva Sankar Reddy; Jensen, Anker Degn; Riisager, Anders
2011-01-01
V2O5/TiO2 and heteropoly acid promoted V2O5/TiO2 catalysts were prepared and characterized by N2 physisorption, XRPD and NH3-TPD. The influence of the calcination temperature from 400 to 700 1C on crystallinity and acidic properties was studied and compared with the activity for the selective...... catalytic reduction (SCR) of NO with ammonia. The SCR activity of heteropoly acid promoted catalysts was found to be much higher than for unpromoted catalysts. The stability of heteropoly acid promoted catalysts is dependent on calcination temperature and there is a gradual decrease in SCR activity...... and acidity with increase in calcination temperatures. Furthermore, the heteropoly acid promoted V2O5/TiO2 catalysts showed excellent alkali deactivation resistance and might therefore be alternative deNOx catalysts in biomass fired power plants....
Qin, Xian; Li, Changsheng; Guo, Tao; Chen, Jing; Wang, Hai-Tao; Wang, Yi-Tao; Xiao, Yu-Sha; Li, Jun; Liu, Pengpeng; Liu, Zhi-Su; Liu, Quan-Yan
2017-10-19
Infection with the hepatitis B virus (HBV) is closely associated with the development of hepatocellular carcinoma (HCC). The osmoregulatory transcription factor nuclear factor of activated T-cells 5 (NFAT5) has been shown to play an important role in the development of many types of human cancers. The role of NFAT5 in HBV-associated HCC has never previously been investigated. We compared expression profiles of NFAT5, DARS2 and miR-30e-5p in HCC samples, adjacent nontumor tissues and different hepatoma cell lines by quantitative real-time polymerase chain reaction and /or Western blot. Clinical data of HCC patients for up to 80 months were analyzed. The regulatory mechanisms upstream and convergent downstream pathways of NFAT5 in HBV-associated HCC were investigated by ChIP-seq, MSP, luciferase report assay and bioinformation anaylsis. We first found that higher levels of NFAT5 expression predict a good prognosis, suggesting that NFAT5 is a potential tumor-suppressing gene, and verified that NFAT5 promotes hepatoma cell apoptosis and inhibits cell growth in vitro. Second, our results showed that HBV could suppress NFAT5 expression by inducing hypermethylation of the AP1-binding site in the NFAT5 promoter in hepatoma cells. In addition, HBV also inhibited NFAT5 through miR-30e-5p targeted MAP4K4, and miR-30e-5p in turn inhibited HBV replication. Finally, we demonstrated that NFAT5 suppressed DARS2 by directly binding to its promoter. DARS2 was identified as an HCC oncogene that promotes HCC cell cycle progression and inhibits HCC cell apoptosis. HBV suppresses NFAT5 through the miR-30e-5p/mitogen-activated protein kinase (MAPK) signaling pathway upstream of NFAT5 and inhibits the NFAT5 to enhance HCC tumorigenesis via the downstream target genes of DARS2.
The Use of Conjunctions in Cognitively Simple versus Complex Oral L2 Tasks
Michel, Marije C.
2013-01-01
The present study explores the use of conjunctions in simple versus complex argumentative tasks performed by second language (L2) learners as a specific measure for the amount of reasoning involved in task performance. The Cognition Hypothesis (Robinson, 2005) states that an increase in cognitive task complexity promotes improvements in L2…
The two-pore domain K+ channel TASK-1 is closely associated with brain barriers and meninges.
Kanjhan, Refik; Pow, David V; Noakes, Peter G; Bellingham, Mark C
2010-12-01
Impairment of the blood-brain barrier (BBB), the blood-cerebrospinal fluid (CSF) barrier and brain-CSF barrier has been implicated in neuropathology of several brain disorders, such as amyotrophic lateral sclerosis, cerebral edema, multiple sclerosis, neural inflammation, ischemia and stroke. Two-pore domain weakly inward rectifying K+ channel (TWIK)-related acid-sensitive potassium (TASK)-1 channels (K2p3.1; KCNK3) are among the targets that contribute to the development of these pathologies. For example TASK-1 activity is inhibited by acidification, ischemia, hypoxia and several signaling molecules released under pathologic conditions. We have used immuno-histochemistry to examine the distribution of the TASK-1 protein in structures associated with the BBB, blood-CSF barrier, brain-CSF barrier, and in the meninges of adult rat. Dense TASK-1 immuno-reactivity (TASK-1-IR) was observed in ependymal cells lining the fourth ventricle at the brain-CSF interface, in glial cells that ensheath the walls of blood vessels at the glio-vascular interface, and in the meninges. In these structures, TASK-1-IR often co-localized with glial fibrillary associated protein (GFAP) or vimentin. This study provides anatomical evidence for localization of TASK-1 K+ channels in cells that segregate distinct fluid compartments within and surrounding the brain. We suggest that TASK-1 channels, in coordination with other ion channels (e.g., aquaporins and chloride channels) and transporters (e.g., Na+-K+-ATPase and Na+-K+-2Cl⁻ and by virtue of its heterogeneous distribution, may differentially contribute to the varying levels of K+ vital for cellular function in these compartments. Our findings are likely to be relevant to recently reported roles of TASK-1 in cerebral ischemia, stroke and inflammatory brain disorders.
Directory of Open Access Journals (Sweden)
Jana Winnefeld
2012-01-01
Full Text Available Foreign language learning has been a part of German elementary schools for several years now. Montessori schools focusing on individual learning, i.e. mostly independent from the teacher and based on auto-education, interest, and free choice, are also asked to teach an L2. The original lack of a concept of L2 learning for this environment has brought forth different approaches. Bilingual education seems to be feasible and applicable in Montessori education. The downside to this is that even in a bilingual classroom the Montessori way of learning may not allow for very much oral production of the foreign language. The role of L2 production (cf. Swain 1985, 1995, 2005 for language acquisition has been theoretically claimed and empirically investigated. Output can have a positive influence on L2 learning (cf. e.g. Izumi 2002, Keck et al. 2006. This also applies to interaction (cf. Long 1996, where negotiation of meaning and modified output are factors supporting L2 development (cf. e.g. de la Fuente 2002, McDonough 2005. Task-based Language Learning (TBLL presents itself as one way to promote oral language production and to provide opportunities for meaning-negotiation. Especially tasks with required information exchange and a closed outcome have been shown to be beneficial for the elicitation of negotiation of meaning and modified output. This paper argues that TBLL is a promising approach for the facilitation of L2 production and thus the development of speaking skills in a Montessori context. It also hypothesizes that TBLL can be implemented in a bilingual Montessori environment while still making the Montessori way of learning possible. Different tasks on various topics, examples of which are presented in this article, can lay the foundation for this. Offering such tasks in a bilingual Montessori elementary classroom promises to foster language production and the use of communication strategies like negotiation of meaning, both being
Analysis of Hypoxic and Hypercapnic Ventilatory Response in Healthy Volunteers
Lin, Ling; Sharifi, Husham; Rico, Tom; Andlauer, Olivier; Aran, Adi; Bloomrosen, Efrat; Faraco, Juliette; Fang, Han; Mignot, Emmanuel
2017-01-01
Introduction A previous study has suggested that the Human Leukocyte Antigen (HLA) allele DQB1*06:02 affects hypoxic ventilatory response (HVR) but not hypercapnic ventilatory response (HCVR) in an Asian population. The current study evaluated the relationship in Caucasians and Asians. In addition we assessed whether gender or polymorphisms in genes participating in the control of breathing affect HVR and HCVR. Methods A re-breathing system was used to measure HVR and HCVR in 551 young adults (56.8% Caucasians, 30% Asians). HLA-DQB1*06:02 and tagged polymorphisms and coding variants in genes participating in breathing (PHOX2B, GPR4 and TASK2/KCNK5) were analyzed. The associations between HVR/HCVR and HLA-DQB1*06:02, genetic polymorphisms, and gender were evaluated using ANOVA or frequentist association testing with SNPTEST. Results HVR and gender are strongly correlated. HCVR and gender are not. Mean HVR in women was 0.276±0.168 (liter/minute/%SpO2) compared to 0.429±0.266 (liter/minute/%SpO2) in men, pHVR in men). Women had lower baseline minute ventilation (8.08±2.36 l/m vs. 10.00±3.43l/m, pHVR or HCVR. Genetic analysis revealed point wise, uncorrected significant associations between two TASK2/KCNK5 variants (rs2815118 and rs150380866) and HCVR. Conclusions This is the largest study to date reporting the relationship between gender and HVR/ HCVR and the first study assessing the association between genetic polymorphisms in humans and HVR/HCVR. The data suggest that gender has a large effect on hypoxic breathing response. PMID:28045995
Analysis of Hypoxic and Hypercapnic Ventilatory Response in Healthy Volunteers.
Goldberg, Shmuel; Ollila, Hanna Maria; Lin, Ling; Sharifi, Husham; Rico, Tom; Andlauer, Olivier; Aran, Adi; Bloomrosen, Efrat; Faraco, Juliette; Fang, Han; Mignot, Emmanuel
2017-01-01
A previous study has suggested that the Human Leukocyte Antigen (HLA) allele DQB1*06:02 affects hypoxic ventilatory response (HVR) but not hypercapnic ventilatory response (HCVR) in an Asian population. The current study evaluated the relationship in Caucasians and Asians. In addition we assessed whether gender or polymorphisms in genes participating in the control of breathing affect HVR and HCVR. A re-breathing system was used to measure HVR and HCVR in 551 young adults (56.8% Caucasians, 30% Asians). HLA-DQB1*06:02 and tagged polymorphisms and coding variants in genes participating in breathing (PHOX2B, GPR4 and TASK2/KCNK5) were analyzed. The associations between HVR/HCVR and HLA-DQB1*06:02, genetic polymorphisms, and gender were evaluated using ANOVA or frequentist association testing with SNPTEST. HVR and gender are strongly correlated. HCVR and gender are not. Mean HVR in women was 0.276±0.168 (liter/minute/%SpO2) compared to 0.429±0.266 (liter/minute/%SpO2) in men, pHVR in men). Women had lower baseline minute ventilation (8.08±2.36 l/m vs. 10.00±3.43l/m, pHVR or HCVR. Genetic analysis revealed point wise, uncorrected significant associations between two TASK2/KCNK5 variants (rs2815118 and rs150380866) and HCVR. This is the largest study to date reporting the relationship between gender and HVR/ HCVR and the first study assessing the association between genetic polymorphisms in humans and HVR/HCVR. The data suggest that gender has a large effect on hypoxic breathing response.
TASK-2 Channels Contribute to pH Sensitivity of Retrotrapezoid Nucleus Chemoreceptor Neurons
Wang, Sheng; Benamer, Najate; Zanella, Sébastien; Kumar, Natasha N.; Shi, Yingtang; Bévengut, Michelle; Penton, David; Guyenet, Patrice G.; Lesage, Florian
2013-01-01
Phox2b-expressing glutamatergic neurons of the retrotrapezoid nucleus (RTN) display properties expected of central respiratory chemoreceptors; they are directly activated by CO2/H+ via an unidentified pH-sensitive background K+ channel and, in turn, facilitate brainstem networks that control breathing. Here, we used a knock-out mouse model to examine whether TASK-2 (K2P5), an alkaline-activated background K+ channel, contributes to RTN neuronal pH sensitivity. We made patch-clamp recordings in brainstem slices from RTN neurons that were identified by expression of GFP (directed by the Phox2b promoter) or β-galactosidase (from the gene trap used for TASK-2 knock-out). Whereas nearly all RTN cells from control mice were pH sensitive (95%, n = 58 of 61), only 56% of GFP-expressing RTN neurons from TASK-2−/− mice (n = 49 of 88) could be classified as pH sensitive (>30% reduction in firing rate from pH 7.0 to pH 7.8); the remaining cells were pH insensitive (44%). Moreover, none of the recorded RTN neurons from TASK-2−/− mice selected based on β-galactosidase activity (a subpopulation of GFP-expressing neurons) were pH sensitive. The alkaline-activated background K+ currents were reduced in amplitude in RTN neurons from TASK-2−/− mice that retained some pH sensitivity but were absent from pH-insensitive cells. Finally, using a working heart–brainstem preparation, we found diminished inhibition of phrenic burst amplitude by alkalization in TASK-2−/− mice, with apneic threshold shifted to higher pH levels. In conclusion, alkaline-activated TASK-2 channels contribute to pH sensitivity in RTN neurons, with effects on respiration in situ that are particularly prominent near apneic threshold. PMID:24107938
DECOVALEX II PROJECT Technical Report - Task 2C
International Nuclear Information System (INIS)
Jing, L.; Stephansson, O.; Chijimatzu, M.; Tsang, C.F.
1999-05-01
The DECOVALEX II project is an international co-operative research project supported by a number of national radioactive waste management organizations of different countries. The project studied four tasks: Task 1: numerical simulation of the RCF3 pump test at Sellafield, UK; Task 2: numerical simulation of the in situ T-H-M experiment at Kamaishi Mine, Japan; Task 3: monitoring of current development in rock fracture research; and Task 4: report on treatment of T-H-M processes in Performance Assessment works for nuclear waste repositories. The project started in 1995 and is scheduled to be finalised in March, 1999. This report concerns the Task 2 of the DECOVALEX H project. Task 2 of the DECOVALEX II project is the numerical modelling of the in-situ T-H-M experiment of a fractured rock - buffer - heater system at Kamaishi Mine, Japan. The experiment was carried out inside a test pit drilled in the floor of a 5 x 7 m alcove excavated near an existing drift at the 550 m level. The test pit has a circular cross section of diameter 1.7 m and a depth of 5 m, filled with bentonite which contains an electric heater. Four research teams studied Task 2 with different computational models. The task is divided into three sub-tasks: Task 2A, Task 2B and Task 2C. Task 2A was defined as a blind prediction to the coupled hydro-mechanical behaviour of the fractured rocks due to the excavation of the test pit. The calibration of the numerical models against measured results of pore pressures, flow rates and rock deformation before filling up of the test pit formed Task 2B. These two sub-tasks were performed to establish well calibrated fields of hydraulic conductivity and mechanical deformability of the fractured rocks at the test site. They were necessary for further simulations on interactions between the rock and buffer materials during heating experiments, as required for Task 2C, with a higher level of confidence on rock mass models. Presented in this report is the
DECOVALEX II PROJECT Technical Report - Task 2C
Energy Technology Data Exchange (ETDEWEB)
Jing, L.; Stephansson, O. [Royal Inst. of Tech., Stockholm (Sweden). Dept. of Civil and Environmental Engineering; Boergesson, L. [Clay Technology AB, IDEON Research Center, Lund (Sweden); Chijimatzu, M. [Japan Nuclear Cycle Development Inst., Ibaraki (Japan). Waste Management and Fuel Cycle Research Center; Kautsky, F. [Swedish Nuclear Power Inspectorate (SKI), Stockholm (Sweden); Tsang, C.F. [Lawrence Berkeley National Laboratory, Berkeley, CA (United States). Earth Science Div.
1999-05-01
The DECOVALEX II project is an international co-operative research project supported by a number of national radioactive waste management organizations of different countries. The project studied four tasks: Task 1: numerical simulation of the RCF3 pump test at Sellafield, UK; Task 2: numerical simulation of the in situ T-H-M experiment at Kamaishi Mine, Japan; Task 3: monitoring of current development in rock fracture research; and Task 4: report on treatment ofT-H-M processes in Performance Assessment works for nuclear waste repositories. The project started in 1995 and is scheduled to be finalised in March, 1999. This report concerns the Task 2 of the DECOVALEX H project. Task 2 of the DECOVALEX II project is the numerical modelling of the in-situ T-H-M experiment of a fractured rock - buffer - heater system at Kamaishi Mine, Japan. The experiment was carried out inside a test pit drilled in the floor of a 5 x 7 m alcove excavated near an existing drift at the 550 m level. The test pit has a circular cross section of diameter 1.7 m and a depth of 5 m, filled with bentonite which contains an electric heater. Four research teams studied Task 2 with different computational models. The task is divided into three sub-tasks: Task 2A, Task 2B and Task 2C. Task 2A was defined as a blind prediction to the coupled hydro-mechanical behaviour of the fractured rocks due to the excavation of the test pit. The calibration of the numerical models against measured results of pore pressures, flow rates and rock deformation before filling up of the test pit formed Task 2B. These two sub-tasks were performed to establish well calibrated fields of hydraulic conductivity and mechanical deformability of the fractured rocks at the test site. They were necessary for further simulations on interactions between the rock and buffer materials during heating experiments, as required for Task 2C, with a higher level of confidence on rock mass models. Presented in this report is the definition
KCNK5 in Physiology and Pathophysiology
DEFF Research Database (Denmark)
Kirkegaard, Signe Skyum
the channel itself. Acute cell swelling and its regulatory mechanisms is by far the most studied part of the cells response to hypotonic stress and little is known about the consequences of long-term hypotonic stimuli on cells, thus we induced a long-term hypotonic stimulation on EAT cells and ELA cells...
Pushed by Symptoms, Pulled by Values: Promotion Goals Increase Motivation in Therapeutic Tasks.
Katz, Benjamin A; Catane, Sara; Yovel, Iftah
2016-03-01
While many therapies focus on the reduction of disturbing symptoms, others pursue behavior consistent with personally held values. Based on regulatory focus theory (Higgins, 1997), reducing symptoms is a type of prevention goal while pursuing values is a promotion goal. In the current study, 123 undergraduate students elicited a negative, self-focused emotion-laden cognition. They were then randomly assigned to construe their negative thought as either (a) an impediment to valued behaviors, (b) a cause of unpleasant symptoms, or to one of two control conditions: (c) distraction or (d) no intervention. Then, participants in all groups completed a series of repetitive therapeutic tasks that targeted their elicited negative cognitions. Results showed that participants who construed treatment in terms of valued behavior promotion spent more time on a therapeutic task than all other groups. The group in the unpleasant symptom promotion condition did not differ from either control group. The motivational advantage of value promotion was not accounted for by differences in mood. The present findings suggest that clients may be better motivated through value promotion goals, as opposed to symptom prevention goals. Copyright © 2015. Published by Elsevier Ltd.
Directory of Open Access Journals (Sweden)
David Mauricio Ramirez
2015-03-01
Full Text Available A1899 is a potent and highly selective blocker of the Two-pore domain potassium (K2P channel TASK-1, it acts as an antagonist blocking the K+ flux and binds to TASK-1 in the inner cavity and shows an activity in nanomolar order. This drug travels through the central cavity and finally binds in the bottom of the selectivity filter with some threonines and waters molecules forming a H-bond network and several hydrophobic interactions. Using alanine mutagenesis screens the binding site was identify involving residues in the P1 and P2 pore loops, the M2 and M4 transmembrane segments, and the halothane response element; mutations were introduced in the human TASK-1 (KCNK3, NM_002246 expressed in Oocytes from anesthetized Xenopus laevis frogs. Based in molecular modeling and structural analysis as such as molecular docking and binding free energy calculations a pose was suggested using a TASK-1 homology models. Recently, various K2P crystal structures have been obtained. We want redefined – from a structural point of view – the binding mode of A1899 in TASK-1 homology models using as a template the K2P crystal structures. By computational structural analysis we describe the molecular basis of the A1899 binding mode, how A1899 travel to its binding site and suggest an interacting pose (Figure 1. after 100 ns of molecular dynamics simulation (MDs we found an intra H-Bond (80% of the total MDs, a H-Bond whit Thr93 (42% of the total MDs, a pi-pi stacking interaction between a ring and Phe125 (88% of the total MDs and several water bridges. Our experimental and computational results allow the molecular understanding of the structural binding mechanism of the selective blocker A1899 to TASK-1 channels. We identified the structural common and divergent features of TASK-1 channel through our theoretical and experimental studies of A1899 drug action.
Self-Control of Task Difficulty During Early Practice Promotes Motor Skill Learning.
Andrieux, Mathieu; Boutin, Arnaud; Thon, Bernard
2016-01-01
This study was designed to determine whether the effect of self-control of task difficulty on motor learning is a function of the period of self-control administration. In a complex anticipation-coincidence task that required participants to intercept 3 targets with a virtual racquet, the task difficulty was either self-controlled or imposed to the participants in the two phases of the acquisition session. First, the results confirmed the beneficial effects of self-control over fully prescribed conditions. Second, the authors also demonstrated that a partial self-control of task difficulty better promotes learning than does a complete self-controlled procedure. Overall, the results revealed that these benefits are increased when this choice is allowed during early practice. The findings are discussed in terms of theoretical and applied perspectives.
2010-01-01
... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Promotion. 532.407 Section 532.407... Administration § 532.407 Promotion. (a) An employee who is promoted is entitled to be paid at the lowest.... (c) If the promotion is to a position in a different wage area, the agency shall determine the...
Force control tasks with pure haptic feedback promote short-term focused attention.
Wang, Dangxiao; Zhang, Yuru; Yang, Xiaoxiao; Yang, Gaofeng; Yang, Yi
2014-01-01
Focused attention has great impact on our quality of life. Our learning, social skills and even happiness are closely intertwined with our capacity for focused attention. Attention promotion is replete with examples of training-induced increases in attention capability, most of which rely on visual and auditory stimulation. Pure haptic stimulation to increase attention capability is rarely found. We show that accurate force control tasks with pure haptic feedback enhance short-term focused attention. Participants were trained by a force control task in which information from visual and auditory channels was blocked, and only haptic feedback was provided. The trainees were asked to exert a target force within a pre-defined force tolerance for a specific duration. The tolerance was adaptively modified to different levels of difficulty to elicit full participant engagement. Three attention tests showed significant changes in different aspects of focused attention in participants who had been trained as compared with those who had not, thereby illustrating the role of haptic-based sensory-motor tasks in the promotion of short-term focused attention. The findings highlight the potential value of haptic stimuli in brain plasticity and serve as a new tool to extend existing computer games for cognitive enhancement.
Cognitive tasks promote automatization of postural control in young and older adults.
Potvin-Desrochers, Alexandra; Richer, Natalie; Lajoie, Yves
2017-09-01
Researchers looking at the effects of performing a concurrent cognitive task on postural control in young and older adults using traditional center-of-pressure measures and complexity measures found discordant results. Results of experiments showing improvements of stability have suggested the use of strategies such as automatization of postural control or stiffening strategy. This experiment aimed to confirm in healthy young and older adults that performing a cognitive task while standing leads to improvements that are due to automaticity of sway by using sample entropy. Twenty-one young adults and twenty-five older adults were asked to stand on a force platform while performing a cognitive task. There were four cognitive tasks: simple reaction time, go/no-go reaction time, equation and occurrence of a digit in a number sequence. Results demonstrated decreased sway area and variability as well as increased sample entropy for both groups when performing a cognitive task. Results suggest that performing a concurrent cognitive task promotes the adoption of an automatic postural control in young and older adults as evidenced by an increased postural stability and postural sway complexity. Copyright © 2017 Elsevier B.V. All rights reserved.
The RAB2B-GARIL5 Complex Promotes Cytosolic DNA-Induced Innate Immune Responses.
Takahama, Michihiro; Fukuda, Mitsunori; Ohbayashi, Norihiko; Kozaki, Tatsuya; Misawa, Takuma; Okamoto, Toru; Matsuura, Yoshiharu; Akira, Shizuo; Saitoh, Tatsuya
2017-09-19
Cyclic GMP-AMP synthase (cGAS) is a cytosolic DNA sensor that induces the IFN antiviral response. However, the regulatory mechanisms that mediate cGAS-triggered signaling have not been fully explored. Here, we show the involvement of a small GTPase, RAB2B, and its effector protein, Golgi-associated RAB2B interactor-like 5 (GARIL5), in the cGAS-mediated IFN response. RAB2B-deficiency affects the IFN response induced by cytosolic DNA. Consistent with this, RAB2B deficiency enhances replication of vaccinia virus, a DNA virus. After DNA stimulation, RAB2B colocalizes with stimulator of interferon genes (STING), the downstream signal mediator of cGAS, on the Golgi apparatus. The GTP-binding activity of RAB2B is required for its localization on the Golgi apparatus and for recruitment of GARIL5. GARIL5 deficiency also affects the IFN response induced by cytosolic DNA and enhances replication of vaccinia virus. These findings indicate that the RAB2B-GARIL5 complex promotes IFN responses against DNA viruses by regulating the cGAS-STING signaling axis. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
The RAB2B-GARIL5 Complex Promotes Cytosolic DNA-Induced Innate Immune Responses
Directory of Open Access Journals (Sweden)
Michihiro Takahama
2017-09-01
Full Text Available Cyclic GMP-AMP synthase (cGAS is a cytosolic DNA sensor that induces the IFN antiviral response. However, the regulatory mechanisms that mediate cGAS-triggered signaling have not been fully explored. Here, we show the involvement of a small GTPase, RAB2B, and its effector protein, Golgi-associated RAB2B interactor-like 5 (GARIL5, in the cGAS-mediated IFN response. RAB2B-deficiency affects the IFN response induced by cytosolic DNA. Consistent with this, RAB2B deficiency enhances replication of vaccinia virus, a DNA virus. After DNA stimulation, RAB2B colocalizes with stimulator of interferon genes (STING, the downstream signal mediator of cGAS, on the Golgi apparatus. The GTP-binding activity of RAB2B is required for its localization on the Golgi apparatus and for recruitment of GARIL5. GARIL5 deficiency also affects the IFN response induced by cytosolic DNA and enhances replication of vaccinia virus. These findings indicate that the RAB2B-GARIL5 complex promotes IFN responses against DNA viruses by regulating the cGAS-STING signaling axis.
5D Task Analysis Visualization Tool, Phase I
National Aeronautics and Space Administration — The creation of a five-dimensional task analysis visualization (5D-TAV) software tool for Task Analysis and Workload Planning using multi-dimensional visualization...
Engineering development of selective agglomeration: Task 5, Bench- scale process testing
Energy Technology Data Exchange (ETDEWEB)
1991-09-01
Under the overall objectives of DOE Contract ``Engineering Development of Selective Agglomeration,`` there were a number of specific objectives in the Task 5 program. The prime objectives of Task 5 are highlighted below: (1) Maximize process performance in pyritic sulfur rejection and BTU recovery, (2) Produce a low ash product, (3) Compare the performance of the heavy agglomerant process based on diesel and the light agglomerant process using heptane, (4) Define optimum processing conditions for engineering design, (5) Provide first-level evaluation of product handleability, and (6) Explore and investigate process options/ideas which may enhance process performance and/or product handleability.
Fiorella, Logan; van Gog, T.; Hoogerheide, V.; Mayer, Richard
2017-01-01
The present study tests whether presenting video modeling examples from the learner’s (first-person) perspective promotes learning of an assembly task, compared to presenting video examples from a third-person perspective. Across 2 experiments conducted in different labs, university students viewed
Analysis of Hypoxic and Hypercapnic Ventilatory Response in Healthy Volunteers.
Directory of Open Access Journals (Sweden)
Shmuel Goldberg
Full Text Available A previous study has suggested that the Human Leukocyte Antigen (HLA allele DQB1*06:02 affects hypoxic ventilatory response (HVR but not hypercapnic ventilatory response (HCVR in an Asian population. The current study evaluated the relationship in Caucasians and Asians. In addition we assessed whether gender or polymorphisms in genes participating in the control of breathing affect HVR and HCVR.A re-breathing system was used to measure HVR and HCVR in 551 young adults (56.8% Caucasians, 30% Asians. HLA-DQB1*06:02 and tagged polymorphisms and coding variants in genes participating in breathing (PHOX2B, GPR4 and TASK2/KCNK5 were analyzed. The associations between HVR/HCVR and HLA-DQB1*06:02, genetic polymorphisms, and gender were evaluated using ANOVA or frequentist association testing with SNPTEST.HVR and gender are strongly correlated. HCVR and gender are not. Mean HVR in women was 0.276±0.168 (liter/minute/%SpO2 compared to 0.429±0.266 (liter/minute/%SpO2 in men, p<0.001 (55.4% higher HVR in men. Women had lower baseline minute ventilation (8.08±2.36 l/m vs. 10.00±3.43l/m, p<0.001, higher SpO2 (98.0±1.3% vs. 96.6±1.7%, p<0.001, and lower EtCO2 (4.65±0.68% vs. 4.82±1.02%, p = 0.025. One hundred and two (18.5% of the participants had HLA-DQB1*06:02. No association was seen between HLA-DQB1*06:02 and HVR or HCVR. Genetic analysis revealed point wise, uncorrected significant associations between two TASK2/KCNK5 variants (rs2815118 and rs150380866 and HCVR.This is the largest study to date reporting the relationship between gender and HVR/ HCVR and the first study assessing the association between genetic polymorphisms in humans and HVR/HCVR. The data suggest that gender has a large effect on hypoxic breathing response.
Fiorella, Logan; van Gog, Tamara; Hoogerheide, Vincent; Mayer, Richard E.
2017-01-01
The present study tests whether presenting video modeling examples from the learner's (first-person) perspective promotes learning of an assembly task, compared to presenting video examples from a third-person perspective. Across 2 experiments conducted in different labs, university students viewed a video showing how to assemble an 8-component…
Engineering development of selective agglomeration: Task 5, Bench- scale process testing
Energy Technology Data Exchange (ETDEWEB)
1991-09-01
Under the overall objectives of DOE Contract Engineering Development of Selective Agglomeration,'' there were a number of specific objectives in the Task 5 program. The prime objectives of Task 5 are highlighted below: (1) Maximize process performance in pyritic sulfur rejection and BTU recovery, (2) Produce a low ash product, (3) Compare the performance of the heavy agglomerant process based on diesel and the light agglomerant process using heptane, (4) Define optimum processing conditions for engineering design, (5) Provide first-level evaluation of product handleability, and (6) Explore and investigate process options/ideas which may enhance process performance and/or product handleability.
Wang, Songbo; Wang, Guoqing; Zhang, Mengyuan; Zhuang, Lu; Wan, Xiaojuan; Xu, Jingren; Wang, Lina; Zhu, Xiaotong; Gao, Ping; Xi, Qianyun; Zhang, Yongliang; Shu, Gang; Jiang, Qingyan
2016-11-15
It has been implicated that IGF-1 secretion can be regulated by dietary protein. However, whether the dipeptides, one of digested products of dietary protein, have influence on IGF-1 secretion remain largely unknown. Our study aimed to investigate the effects of the dipeptide Pro-Asp on IGF-1 secretion and expression in hepatocytes and to explore the possible underlying mechanisms. Our findings demonstrated that Pro-Asp promoted the secretion and gene expression of IGF-1 in HepG2 cells and primary porcine hepatocytes. Meanwhile, Pro-Asp activated the ERK and Akt signaling pathways, downstream of IGF-1. In addition, Pro-Asp enhanced GH-mediated JAK2/STAT5 signaling pathway, while inhibition of JAK2/STAT5 blocked the promotive effect of Pro-Asp on IGF-1 secretion and expression. Moreover, acute injection of Pro-Asp stimulated IGF-1 expression and activated JAK2/STAT5 signaling pathway in mice liver. Together, these results suggested that the dipeptide Pro-Asp promoted IGF-1 secretion and expression in hepatocytes by enhancing GH-mediated JAK2/STAT5 signaling pathway. Copyright © 2016. Published by Elsevier Ireland Ltd.
Construction of Tasks in Order to Develop and Promote Classroom Communication in Mathematics
Olteanu, Lucian
2015-01-01
In this article, the focus is on task construction and the importance of this process to develop and promote classroom communication in mathematics. The students' tests, examination of students' mathematical work, the teachers' lesson plans, and reports of the lessons' instructions are the basic data for this article. The analysis indicated that…
5 CFR 302.403 - Qualifications for promotion.
2010-01-01
... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Qualifications for promotion. 302.403... EMPLOYMENT IN THE EXCEPTED SERVICE Selection and Appointment; Reappointment; and Qualifications for Promotion § 302.403 Qualifications for promotion. In determining qualifications for promotion with respect to an...
Geometry task sheets : grades 3-5
Rosenberg, Mary
2009-01-01
For grades 3-5, our Common Core State Standards-based resource meets the geometry concepts addressed by the NCTM standards and encourages the students to learn and review the concepts in unique ways. Each task sheet is organized around a central problem taken from real-life experiences of the students.
5 CFR 531.214 - Setting pay upon promotion.
2010-01-01
... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Setting pay upon promotion. 531.214... Changes § 531.214 Setting pay upon promotion. (a) General. An agency must set an employee's payable rate of basic pay upon promotion following the rules in this section, consistent with 5 U.S.C. 5334(b...
5D Task Analysis Visualization Tool Phase II, Phase II
National Aeronautics and Space Administration — The creation of a five-dimensional task analysis visualization (5D-TAV) software tool for Task Analysis and Workload Planning using multi-dimensional visualization...
TASK-2: a K2P K+ channel with complex regulation and diverse physiological functions
Directory of Open Access Journals (Sweden)
Luis Pablo Cid
2013-07-01
Full Text Available TASK-2 (K2P5.1 is a two-pore domain K+ channel belonging to the TALK subgroup of the K2P family of proteins. TASK-2 has been shown to be activated by extra- and intracellular alkalinisation. Extra- and intracellular pH-sensors reside at arginine 224 and lysine 245 and might affect separate selectivity filter and inner gates respectively. TASK-2 is modulated by changes in cell volume and a regulation by direct G-protein interaction has also been proposed. Activation by extracellular alkalinisation has been associated with a role of TASK-2 in kidney proximal tubule bicarbonate reabsorption, whilst intracellular pH-sensitivity might be the mechanism for its participation in central chemosensitive neurons. In addition to these functions TASK-2 has been proposed to play a part in apoptotic volume decrease in kidney cells and in volume regulation of glial cells and T-lymphocytes. TASK-2 is present in chondrocytes of hyaline cartilage, where it is proposed to play a central role in stabilizing the membrane potential. Additional sites of expression are dorsal root ganglion neurons, endocrine and exocrine pancreas and intestinal smooth muscle cells. TASK-2 has been associated with the regulation of proliferation of breast cancer cells and could become target for breast cancer therapeutics. Further work in native tissues and cells together with genetic modification will no doubt reveal the details of TASK-2 functions that we are only starting to suspect.
Lien, Mei-Ching; Ruthruff, Eric
2004-01-01
This study examined how task switching is affected by hierarchical task organization. Traditional task-switching studies, which use a constant temporal and spatial distance between each task element (defined as a stimulus requiring a response), promote a flat task structure. Using this approach, Experiment 1 revealed a large switch cost of 238 ms.…
Bridge-in-a-Backpack(TM) task 5: guidelines for quality assurance.
2016-03-01
This report includes fulfillment of Task 5 of a multi-task contract to further enhance concrete filled FRP tubes, or : the Bridge in a Backpack. Task 6 provides guidelines for quality assurance. : The Bridge-in-a-Backpack or hybrid composite arch ...
Directory of Open Access Journals (Sweden)
Karly Maree Turner
2016-01-01
Full Text Available Neuropsychiatric research has utilised cognitive testing in rodents to improve our understanding of cognitive deficits and for preclinical drug development. However, more sophisticated cognitive tasks have not been as widely exploited due to low throughput and the extensive training time required. We developed a modified signal detection task (SDT based on the growing body of literature aimed at improving cognitive testing in rodents. This study directly compares performance on the modified SDT with the traditional test for measuring attention, the 5-choice serial reaction time task (5CSRTT. Adult male Sprague-Dawley rats were trained on either the 5CSRTT or the SDT. Briefly, the 5CSRTT required rodents to pay attention to a spatial array of 5 apertures and respond with a nose poke when an aperture was illuminated. The SDT required the rat to attend to a light panel and respond either left or right to indicate the presence of a signal. In addition, modifications were made to the reward delivery, timing, control of body positioning and the self-initiation of trials. It was found that less training time was required for the SDT, with both sessions to criteria and daily session duration significantly reduced. Rats performed with a high level of accuracy (>87% on both tasks, however omissions were far more frequent on the 5CSRTT. The signal duration was reduced on both tasks as a manipulation of task difficulty relevant to attention and a similar pattern of decreasing accuracy was observed on both tasks. These results demonstrate some of the advantages of the SDT over the traditional 5CSRTT as being higher throughput with reduced training time, fewer omission responses and their body position at stimulus onset was controlled. In addition, rats performing the SDT had comparable high levels of accuracy. These results highlight the differences and similarities between the 5CSRTT and a modified SDT as tools for assessing attention in preclinical animal
5 CFR 9901.354 - Setting pay upon promotion.
2010-01-01
... 5 Administrative Personnel 3 2010-01-01 2010-01-01 false Setting pay upon promotion. 9901.354... promotion. (a)(1) Except as otherwise provided in this section, upon an employee's promotion, the employee.... The decision to grant a promotion increase exceeding 12 percent must be reviewed and approved by an...
2.5-Year-Olds Succeed at a Verbal Anticipatory-Looking False-Belief Task
He, Zijing; Bolz, Matthias; Baillargeon, Renee
2012-01-01
Recent research suggests that infants and toddlers succeed at a wide range of non-elicited-response false-belief tasks (i.e., tasks that do not require children to answer a direct question about a mistaken agent's likely behaviour). However, one exception to this generalization comes from verbal anticipatory-looking tasks, which have produced…
TASK 2.5.4 DEVELOPMENT OF AN ENERGY SAVINGS CALCULATOR
Energy Technology Data Exchange (ETDEWEB)
Miller, William A [ORNL; New, Joshua Ryan [ORNL; Desjarlais, Andre Omer [ORNL; Huang, Joe [Lawrence Berkeley National Laboratory (LBNL); Erdem, Ender [Lawrence Berkeley National Laboratory (LBNL); Ronnen, Levinson [Lawrence Berkeley National Laboratory (LBNL)
2010-03-01
California s major energy utilities and the California Energy Commission (CEC) are seeking to allocate capital that yields the greatest return on investment for energy infrastructure that meets any part of the need for reliable supplies of energy. The utilities are keenly interested in knowing the amount of electrical energy savings that would occur if cool roof color materials are adopted in the building market. To meet this need the Oak Ridge National Laboratory and the Lawrence Berkeley National Laboratory (LBNL) have been collaborating on a Public Interest Energy Research (PIER) project to develop an industry-consensus energy-savings calculator. The task was coordinated with an ongoing effort supported by the DOE to develop one calculator to achieve both the DOE and the EPA objectives for deployment of cool roof products. Recent emphasis on domestic building energy use has made the work a top priority by the Department of Energy s (DOE) Building Technologies Program. The Roof Savings Calculator (RSC) tool is designed to help building owners, manufacturers, distributors, contractors and practitioners easily run complex simulations. The latest web technologies and usability design were employed to provide an easy input interface to an annual simulation of hour-by-hour, whole-building performance using the world-class simulation tools DOE-2.1E and AtticSim. Building defaults were assigned based on the best available statistical evidence and can provide energy and cost savings after the user selects nothing more than the building location. A key goal for the tool is to promote the energy benefits of cool color tile, metal and asphalt shingle roof products and other energy saving systems. The RSC tool focuses on applications for the roof and attic; however, the code conducts a whole building simulation that puts the energy and heat flows of the roof and attic into the perspective of the whole house. An annual simulation runs in about 30 sec. In addition to cool
5 CFR 9701.353 - Setting pay upon promotion.
2010-01-01
... 5 Administrative Personnel 3 2010-01-01 2010-01-01 false Setting pay upon promotion. 9701.353... upon promotion. (a) Except as otherwise provided in this section, upon an employee's promotion, DHS... basic pay after promotion may not be less than the minimum rate of the higher band. (b) DHS will issue...
Using the 5 P Relay in Task Groups
Stanley, Paula Helen
2006-01-01
This article describes the 5 P Relay, a group exercise that can increase the effectiveness of task groups. The 5 P Relay is based on the principles and concepts of the Invitational Model, which emphasizes the importance of assessing the effectiveness or health of five aspects of an organization's environment: people, places, programs, processes,…
Number & operations task sheets : grades 3-5
Reed, Nat
2009-01-01
For grades 3-5, our Common Core State Standards-based resource meets the number & operations concepts addressed by the NCTM standards and encourages the students to learn and review the concepts in unique ways. Each task sheet is organized around a central problem taken from real-life experiences of the students.
DEFF Research Database (Denmark)
Cho, Yoon Shin; Chen, Chien-Hsiun; Hu, Cheng
2012-01-01
We conducted a three-stage genetic study to identify susceptibility loci for type 2 diabetes (T2D) in east Asian populations. We followed our stage 1 meta-analysis of eight T2D genome-wide association studies (6,952 cases with T2D and 11,865 controls) with a stage 2 in silico replication analysis...... (5,843 cases and 4,574 controls) and a stage 3 de novo replication analysis (12,284 cases and 13,172 controls). The combined analysis identified eight new T2D loci reaching genome-wide significance, which mapped in or near GLIS3, PEPD, FITM2-R3HDML-HNF4A, KCNK16, MAEA, GCC1-PAX4, PSMD6 and ZFAND3...
Molleman, Eric; Emans, Ben; Turusbekova, Nonna
2012-01-01
Purpose - The purpose of this study is to analyze the relationship between the performance orientation of employees and self-promotion in the form of overstating one's performance. It is hypothesized that this relationship depends on task clarity and personalized responsibility.
Batool, Kanza; Tuz Zahra, Fatima; Rehman, Yasir
2017-01-01
Arsenic (As) is a well-known toxic metalloid found naturally and released by different industries, especially in developing countries. Purple nonsulfur bacteria (PNSB) are known for wastewater treatment and plant growth promoting abilities. As-resistant PNSB were isolated from a fish pond. Based on As-resistance and plant growth promoting attributes, 2 isolates CS2 and SS5 were selected and identified as Rhodopseudomonas palustris and Rhodopseudomonas faecalis , respectively, through 16S rRNA gene sequencing. Maximum As(V) resistance shown by R. faecalis SS5 and R. palustris CS2 was up to 150 and 100 mM, respectively. R . palustris CS2 showed highest As(V) reduction up to 62.9% (6.29 ± 0.24 mM), while R. faecalis SS5 showed maximum As(III) oxidation up to 96% (4.8 ± 0.32 mM), respectively. Highest auxin production was observed by R. palustris CS2 and R. faecalis SS, up to 77.18 ± 3.7 and 76.67 ± 2.8 μ g mL -1 , respectively. Effects of these PNSB were tested on the growth of Vigna mungo plants. A statistically significant increase in growth was observed in plants inoculated with isolates compared to uninoculated plants, both in presence and in absence of As. R. palustris CS2 treated plants showed 17% (28.1 ± 0.87 cm) increase in shoot length and 21.7% (7.07 ± 0.42 cm) increase in root length, whereas R. faecalis SS5 treated plants showed 12.8% (27.09 ± 0.81 cm) increase in shoot length and 18.8% (6.9 ± 0.34 cm) increase in root length as compared to the control plants. In presence of As, R. palustris CS2 increased shoot length up to 26.3% (21.0 ± 1.1 cm), while root length increased up to 31.3% (5.3 ± 0.4 cm), whereas R. faecalis SS5 inoculated plants showed 25% (20.7 ± 1.4 cm) increase in shoot length and 33.3% (5.4 ± 0.65 cm) increase in root length as compared to the control plants. Bacteria with such diverse abilities could be ideal for plant growth promotion in As-contaminated sites.
Kim, Min-Ji; Radhakrishnan, Ramalingam; Kang, Sang-Mo; You, Young-Hyun; Jeong, Eun-Ju; Kim, Jong-Guk; Lee, In-Jung
2017-07-01
This study was aimed to identify plant growth-promoting bacterial isolates from soil samples and to investigate their ability to improve plant growth and salt tolerance by analysing phytohormones production and phosphate solubilisation. Among the four tested bacterial isolates (I-2-1, H-1-4, H-2-3, and H-2-5), H-2-5 was able to enhance the growth of Chinese cabbage, radish, tomato, and mustard plants. The isolated bacterium H-2-5 was identified as Bacillus amyloliquefaciens H-2-5 based on 16S rDNA sequence and phylogenetic analysis. The secretion of gibberellins (GA 4 , GA 8 , GA 9 , GA 19 , and GA 20 ) from B. amyloliquefaciens H-2-5 and their phosphate solubilisation ability may contribute to enhance plant growth. In addition, the H-2-5-mediated mitigation of short term salt stress was tested on soybean plants that were affected by sodium chloride. Abscisic acid (ABA) produced by the H-2-5 bacterium suppressed the NaCl-induced stress effects in soybean by enhancing plant growth and GA 4 content, and by lowering the concentration of ABA, salicylic acid, jasmonic acid, and proline. These results suggest that GAs, ABA production, and the phosphate solubilisation capacity of B. amyloliquefaciens H-2-5 are important stimulators that promote plant growth through their interaction and also to improve plant growth by physiological changes in soybean at saline soil.
5 CFR 335.104 - Eligibility for career ladder promotion.
2010-01-01
... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Eligibility for career ladder promotion... REGULATIONS PROMOTION AND INTERNAL PLACEMENT General Provisions § 335.104 Eligibility for career ladder promotion. No employee shall receive a career ladder promotion unless his or her current rating of record...
Preuss, U W; Koller, G; Bondy, B; Bahlmann, M; Soyka, M
2001-01-01
Impulsive behavior in alcoholics puts them at serious risk of severer course of disease and has been related to the serotonergic neurotransmission dysfunction. The aim of this study is to investigate the association between impulsive aggression in alcohol dependents with regard to the G-1438A polymorphism in the promoter region of the 5-HT2A receptor gene. Furthermore, we investigated the statistical interaction between 5-HT2A alleles, antisocial personality disorder (APD) and impulsive aggression in alcohol dependents. Alcohol dependents were investigated because these personality disorders and impulsive behavior are very frequent in alcohol dependence anf of clinical relevance. One hundred and thirty-five patients of German descent meeting DSM-IV criteria of alcohol dependence were recruited. Blood samples were taken from alcohol dependents to determine 5-HT2A promoter polymorphisms using PCR (polymerase chain reaction) of lymphocyte DNA. Impulsive aggression was assessed using a German version of the Barratt Impulsiveness Scale which was translated and backtranslated. Alcohol dependents were subdivided into low- or high-impulsivity groups using a median split of the Barratt score. APD and borderline personality disorder (BPD) were assessed using the SCID-II interview. The low-impulsivity group was slightly older and showed a later age at alcoholism onset than the highly impulsive group. Alcohol dependents with high impulsive traits showed a significant association with 5-HT2A 1438 A alleles. After excluding alcohol dependents with APD or BPD from the analysis, this association remained significant. Furthermore, no association between APD, BPD and 5-HT2A alleles was noted. Inpatient alcohol dependents showed a significant association between 5-HT2A A alleles and impulsive traits, independent of the presence of APD or BPD. No association was noted between personality disorders and the polymorphism. This is the first report about an association of 5-HT2A promoter
Context-Sensitive Adjustment of Cognitive Control in Dual-Task Performance
Fischer, Rico; Gottschalk, Caroline; Dreisbach, Gesine
2014-01-01
Performing 2 highly similar tasks at the same time requires an adaptive regulation of cognitive control to shield prioritized primary task processing from between-task (cross-talk) interference caused by secondary task processing. In the present study, the authors investigated how implicitly and explicitly delivered information promotes the…
Molecular and functional characterization of the promoter of ETS2, the human c-ets-2 gene
International Nuclear Information System (INIS)
Mavrothalassitis, G.J.; Watson, D.K.; Papas, T.S.
1990-01-01
The 5' end of the human c-ets-2 gene, ETS2, was cloned and characterized. The major transcription initiation start sites were identified, and the pertinent sequences surrounding the ETS2 promoter were determined. The promoter region of ETS2 does not possess typical TATA and CAAT elements. However, this promoter contains several repeat regions, as well as two consensus AP2 binding sites and three putative Sp1 sites. There is also a palindromic region similar to the serum response element of the c-fos gene, located 1,400 base pairs (bp) upstream from the first major transcription initiation site. A G+C-rich sequence (GC element) with dyad symmetry can be seen in the ETS2 promoter, immediately following an unusually long polypurine-polypyrimidine tract. A series of deletion fragments from the putative promoter region were ligated in front of the bacterial chloramphenicol acetyltransferase gene and tested for activity following transfection into HeLa cells. The 5' boundary of the region needed for maximum promoter activity was found to be 159 bp upstream of the major initiation site. The promoter of ETS2 (within the polypyrimidine tract) serves to illustrate an alternative structure that may be present in genes with TATA-less promoters
Sebastian, Soji; Sreenivas, Prethish; Sambasivan, Ramkumar; Cheedipudi, Sirisha; Kandalla, Prashanth; Pavlath, Grace K.; Dhawan, Jyotsna
2009-01-01
Most cells in adult tissues are nondividing. In skeletal muscle, differentiated myofibers have exited the cell cycle permanently, whereas satellite stem cells withdraw transiently, returning to active proliferation to repair damaged myofibers. We have examined the epigenetic mechanisms operating in conditional quiescence by analyzing the function of a predicted chromatin regulator mixed lineage leukemia 5 (MLL5) in a culture model of reversible arrest. MLL5 is induced in quiescent myoblasts and regulates both the cell cycle and differentiation via a hierarchy of chromatin and transcriptional regulators. Knocking down MLL5 delays entry of quiescent myoblasts into S phase, but hastens S-phase completion. Cyclin A2 (CycA) mRNA is no longer restricted to S phase, but is induced throughout G0/G1, with activation of the cell cycle regulated element (CCRE) in the CycA promoter. Overexpressed MLL5 physically associates with the CCRE and impairs its activity. MLL5 also regulates CycA indirectly: Cux, an activator of CycA promoter and S phase is induced in RNAi cells, and Brm/Brg1, CCRE-binding repressors that promote differentiation are repressed. In knockdown cells, H3K4 methylation at the CCRE is reduced, reflecting quantitative global changes in methylation. MLL5 appears to lack intrinsic histone methyl transferase activity, but regulates expression of histone-modifying enzymes LSD1 and SET7/9, suggesting an indirect mechanism. Finally, expression of muscle regulators Pax7, Myf5, and myogenin is impaired in MLL5 knockdown cells, which are profoundly differentiation defective. Collectively, our results suggest that MLL5 plays an integral role in novel chromatin regulatory mechanisms that suppress inappropriate expression of S-phase-promoting genes and maintain expression of determination genes in quiescent cells. PMID:19264965
5 CFR 531.243 - Promotion of a GM employee.
2010-01-01
... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Promotion of a GM employee. 531.243... Promotion of a GM employee. (a) Upon promotion, an employee's status as a GM employee ends, as provided in § 531.241(b). (b) When an employee loses status as a GM employee because of a temporary promotion and is...
Mansoubi, Maedeh; Pearson, Natalie; Clemes, Stacy A; Biddle, Stuart Jh; Bodicoat, Danielle H; Tolfrey, Keith; Edwardson, Charlotte L; Yates, Thomas
2015-05-29
Sedentary behavior is defined as any waking behavior characterized by an energy expenditure of 1.5 METS or less while in a sitting or reclining posture. This study examines this definition by assessing the energy cost (METs) of common sitting, standing and walking tasks. Fifty one adults spent 10 min during each activity in a variety of sitting tasks (watching TV, Playing on the Wii, Playing on the PlayStation Portable (PSP) and typing) and non-sedentary tasks (standing still, walking at 0.2, 0.4, 0.6, 0.8, 1.0, 1.2, 1.4, and 1.6 mph). Activities were completed on the same day in a random order following an assessment of resting metabolic rate (RMR). A portable gas analyzer was used to measure oxygen uptake, and data were converted to units of energy expenditure (METs). Average of standardized MET values for screen-based sitting tasks were: 1.33 (SD: 0.24) METS (TV), 1.41 (SD: 0.28) (PSP), and 1.45 (SD: 0.32) (Typing). The more active, yet still seated, games on the Wii yielded an average of 2.06 (SD: 0.5) METS. Standing still yielded an average of 1.59 (SD: 0.37) METs. Walking MET values increased incrementally with speed from 2.17 to 2.99 (SD: 0.5 - 0.69) METs. The suggested 1.5 MET threshold for sedentary behaviors seems reasonable however some sitting based activities may be classified as non-sedentary. The effect of this on the definition of sedentary behavior and associations with metabolic health needs further investigation.
Lithium modulation of the human inositol monophosphatase 2 (IMPA2) promoter
International Nuclear Information System (INIS)
Seelan, Ratnam S.; Parthasarathy, Latha K.; Parthasarathy, Ranga N.
2004-01-01
The inositol-signaling pathway is a therapeutic target for lithium in the treatment of bipolar disorder. Inositol monophosphatases (IMPases) play a key role in inositol signaling. Lithium's ability to inhibit IMPase 1 is well known, but its effect on IMPase 2 or on the transcriptional regulation of these genes has not been studied. Here, we report the identification and characterization of the minimal promoter of IMPA2 (encoding IMPase 2) in HeLa (epithelial) and SK-N-AS (neuronal) cells. IMPA2 promoter activity appears to be contributed by different elements in the 5' flanking region, suggesting that the gene is differentially regulated in neuronal and non-neuronal cells. Furthermore, IMPA2 promoter activity in both cell lines is downregulated, in a dose-dependent manner, by lithium after treatment for only 24 h. This effect is also observed in vivo. Our results suggest a possible role for IMPA2 in bipolar disorder
Preuss, Ulrich W.; Koller, G.; Bondy, Brigitta; Bahlmann, Miriam; Soyka, Michael
2001-01-01
Objective: Impulsive behavior in alcoholics puts them at serious risk of severer course of disease and has been related to the serotonergic neurotransmission dysfunction. The aim of this study is to investigate the association between impulsive aggression in alcohol dependents with regard to the G-1438A polymorphism in the promoter region of the 5-HT2A receptor gene. Furthermore, we investigated the statistical interaction between 5-HT2A alleles, antisocial personality disorder (APD) and impu...
Task force on modelling of groundwater flow and transport of solutes. Task 5 Summary report
International Nuclear Information System (INIS)
Rhen, Ingvar; Smellie, John
2003-02-01
The Aespoe Hard Rock Laboratory is located in the Simpevarp area, southeast Sweden, some 35 km north of Oskarshamn. Construction of the underground laboratory commenced in 1990 and was completed in 1995, consisting of a 3.6 km. long tunnel excavated in crystalline rock to a depth of approximately 460 m. Prior to, during and subsequent to completion, research concerning the deep geological disposal of nuclear waste in fractured crystalline rock has been carried out. Central to this research has been the characterisation of the groundwater flow system and the chemistry of the groundwaters at Aespoe prior to excavation (Pre-investigation Phase) and subsequently to monitor changes in these parameters during the evolution of laboratory construction (Construction Phase). The principle aim of the Aespoe Task 5 modelling exercise has been to compare and ultimately integrate hydrogeochemistry and hydrogeology using the input data from the pre-investigation and construction phases. The main objectives were: to assess the consistency of groundwater-flow models and hydrogeochemical mixing-reaction models through integration and comparison of hydraulic and hydrogeochemical data obtained before and during tunnel construction, and to develop a procedure for integration of hydrological and hydrogeochemical information which could be used for disposal site assessments. Task 5 commenced in 1998 and was finalised in 2002. Participating modelling teams in the project represented ANDRA (France; three modelling teams - ANTEA, ITASCA, CEA), BMWi/BGR (Germany), ENRESA (Spain), JNC (Japan), CRIEPI (Japan), Posiva (Finland) and SKB (Sweden; two modelling teams - CFE and Intera (now GeoPoint)). Experience from Task 5 has highlighted several important aspects for site investigations facilitating the possibilities for mathematically integrated modelling and consistency checks that should be taken into account for future repository performance assessments. Equally important is that Task 5 has
Task force on modelling of groundwater flow and transport of solutes. Task 5 Summary report
Energy Technology Data Exchange (ETDEWEB)
Rhen, Ingvar [SWECO VIAK AB, Goeteborg (Sweden); Smellie, John [Conterra AB, Uppsala (Sweden)
2003-02-01
The Aespoe Hard Rock Laboratory is located in the Simpevarp area, southeast Sweden, some 35 km north of Oskarshamn. Construction of the underground laboratory commenced in 1990 and was completed in 1995, consisting of a 3.6 km. long tunnel excavated in crystalline rock to a depth of approximately 460 m. Prior to, during and subsequent to completion, research concerning the deep geological disposal of nuclear waste in fractured crystalline rock has been carried out. Central to this research has been the characterisation of the groundwater flow system and the chemistry of the groundwaters at Aespoe prior to excavation (Pre-investigation Phase) and subsequently to monitor changes in these parameters during the evolution of laboratory construction (Construction Phase). The principle aim of the Aespoe Task 5 modelling exercise has been to compare and ultimately integrate hydrogeochemistry and hydrogeology using the input data from the pre-investigation and construction phases. The main objectives were: to assess the consistency of groundwater-flow models and hydrogeochemical mixing-reaction models through integration and comparison of hydraulic and hydrogeochemical data obtained before and during tunnel construction, and to develop a procedure for integration of hydrological and hydrogeochemical information which could be used for disposal site assessments. Task 5 commenced in 1998 and was finalised in 2002. Participating modelling teams in the project represented ANDRA (France; three modelling teams - ANTEA, ITASCA, CEA), BMWi/BGR (Germany), ENRESA (Spain), JNC (Japan), CRIEPI (Japan), Posiva (Finland) and SKB (Sweden; two modelling teams - CFE and Intera (now GeoPoint)). Experience from Task 5 has highlighted several important aspects for site investigations facilitating the possibilities for mathematically integrated modelling and consistency checks that should be taken into account for future repository performance assessments. Equally important is that Task 5 has
A 5-trial adjusting delay discounting task: Accurate discount rates in less than 60 seconds
Koffarnus, Mikhail N.; Bickel, Warren K.
2014-01-01
Individuals who discount delayed rewards at a high rate are more likely to engage in substance abuse, overeating, or problem gambling. Findings such as these suggest the value of methods to obtain an accurate and fast measurement of discount rate that can be easily deployed in variety of settings. In the present study, we developed and evaluated the 5-trial adjusting delay task, a novel method of obtaining discount rate in less than one minute. We hypothesized that discount rates from the 5-trial adjusting delay task would be similar and correlated with discount rates from a lengthier task we have used previously, and that four known effects relating to delay discounting would be replicable with this novel task. To test these hypotheses, the 5-trial adjusting delay task was administered to 111 college students six times to obtain discount rates for six different commodities, along with a lengthier adjusting amount discounting task. We found that discount rates were similar and correlated between the 5-trial adjusting delay task and the adjusting amount task. Each of the four known effects relating to delay discounting was replicated with the 5-trial adjusting delay task to varying degrees. First, discount rates were inversely correlated with amount. Second, discount rates between past and future outcomes were correlated. Third, discount rates were greater for consumable rewards than with money, although we did not control for amount in this comparison. Fourth, discount rates were lower when zero amounts opposing the chosen time point were explicitly described. Results indicate that the 5-trial adjusting delay task is a viable, rapid method to assess discount rate. PMID:24708144
A 5-trial adjusting delay discounting task: accurate discount rates in less than one minute.
Koffarnus, Mikhail N; Bickel, Warren K
2014-06-01
Individuals who discount delayed rewards at a high rate are more likely to engage in substance abuse, overeating, or problem gambling. Such findings suggest the value of methods to obtain an accurate and fast measurement of discount rate that can be easily deployed in variety of settings. In the present study, we developed and evaluated the 5-trial adjusting delay task, a novel method of obtaining a discount rate in less than 1 min. We hypothesized that discount rates from the 5-trial adjusting delay task would be similar and would correlate with discount rates from a lengthier task we have used previously, and that 4 known effects relating to delay discounting would be replicable with this novel task. To test these hypotheses, the 5-trial adjusting delay task was administered to 111 college students 6 times to obtain discount rates for 6 different commodities, along with a lengthier adjusting amount discounting task. We found that discount rates were similar and correlated between the 5-trial adjusting delay task and the adjusting amount task. Each of the 4 known effects relating to delay discounting was replicated with the 5-trial adjusting delay task to varying degrees. First, discount rates were inversely correlated with amount. Second, discount rates between past and future outcomes were correlated. Third, discount rates were greater for consumable rewards than with money, although we did not control for amount in this comparison. Fourth, discount rates were lower when $0 amounts opposing the chosen time point were explicitly described. Results indicate that the 5-trial adjusting delay task is a viable, rapid method to assess discount rate. PsycINFO Database Record (c) 2014 APA, all rights reserved.
Task and Tool Interface Design for L2 Speaking Interaction Online
Appel, Christine; Robbins, Jackie; Moré, Joaquim; Mullen, Tony
2012-01-01
Learners and teachers of a foreign language in online and blended learning environments are being offered more opportunities for speaking practice from technological developments. However, in order to maximise these learning opportunities, appropriate task-based materials are required which promote and direct student to student interaction in…
Li, Sufang; Zou, Qihong; Li, Jun; Li, Jin; Wang, Deyi; Yan, Chaogan; Dong, Qi; Zang, Yu-Feng
2012-01-01
Prior research has shown that the amygdala of carriers of the short allele (s) of the serotonin transporter (5-HTT) gene (5-HTTLPR) have a larger response to negative emotional stimuli and higher spontaneous activity during the resting state than non-carriers. However, recent studies have suggested that the effects of 5-HTTLPR may be specific to different ethnic groups. Few studies have been conducted to address this issue. Blood oxygenation level dependent (BOLD) functional magnetic resonance imaging (fMRI) was conducted on thirty-eight healthy Han Chinese subjects (l/l group, n = 19; s/s group, n = 19) during the resting state and during an emotional processing task. Compared with the s/s group, the l/l group showed significantly increased regional homogeneity or local synchronization in the right amygdala during the resting state (|t|>2.028, pemotional processing task. 5-HTTLPR can alter the spontaneous activity of the amygdala in Han Chinese. However, the effect of 5-HTTLPR on the amygdala both in task state and resting state in Asian population was no similar with Caucasians. They suggest that the effect of 5-HTTLPR on the amygdala may be modulated by ethnic differences.
Change Best: Task 2.3. Analysis of policy mix and development of Energy Efficiency Services
International Nuclear Information System (INIS)
Boonekamp, P.; Vethman, P.
2010-04-01
The aim of the Change Best project is to promote the development of an energy efficiency service (EES) market and to give good practice examples of changes in energy service business, strategies, and supportive policies and measures in the course of the implementation of Directive 2006/32/EC on Energy End-Use Efficiency and Energy Services. This report addresses task 2.3: Analysis of policy mix and development of Energy Efficiency Services.
Peroxiredoxin 5 promotes the epithelial-mesenchymal transition in colon cancer
International Nuclear Information System (INIS)
Ahn, Hye-Mi; Yoo, Jin-Woo; Lee, Seunghoon; Lee, Hong Jun; Lee, Hyun-Shik; Lee, Dong-Seok
2017-01-01
Globally, colorectal cancer (CRC) is common cause of cancer-related deaths. The high mortality rate of patients with colon cancer is due to cancer cell invasion and metastasis. Initiation of the epithelial-to-mesenchymal transition (EMT) is essential for the tumorigenesis. Peroxiredoinxs (PRX1-6) have been reported to be overexpressed in various tumor tissues, and involved to be responsible for tumor progression. However, the exact role of PRX5 in colon cancer remains to be investigated enhancing proliferation and promoting EMT properties. In this study, we constructed stably overexpressing PRX5 and suppressed PRX5 expression in CRC cells. Our results revealed that PRX5 overexpression significantly enhanced CRC cell proliferation, migration, and invasion. On the other hand, PRX5 suppression markedly inhibited these EMT properties. PRX5 was also demonstrated to regulate the expression of two hallmark EMT proteins, E-cadherin and Vimentin, and the EMT-inducing transcription factors, Snail and Slug. Moreover, in the xenograft mouse model, showed that PRX5 overexpression enhances tumor growth of CRC cells. Thus, our findings first provide evidence in CRC that PRX5 promotes EMT properties by inducing the expression of EMT-inducing transcription factors. Therefore, PRX5 can be used as a predictive biomarker and serves as a putative therapeutic target for the development of clinical treatments for human CRC. - Highlights: • PRX5 promoted colorectal cancer cell proliferation. • PRX5 enhanced EMT properties in colorectal cancer. • PRX5 mediated the EMT by inducing the expression of Snail and Slug. • PRX5 promoted tumor growth of colorectal cancer cells.
Energy Technology Data Exchange (ETDEWEB)
Zhang, Heyu [Central Laboratory, Peking University School of Stomatology, Beijing (China); Nan, Xu [Center for Human Disease Genomics, Department of Immunology, Key Laboratory of Medical Immunology, Ministry of Health, School of Basic Medical Sciences, Peking University, Beijing (China); Li, Xuefen [Central Laboratory, Peking University School of Stomatology, Beijing (China); Chen, Yan; Zhang, Jianyun [Department of Oral Pathology, Peking University School of Stomatology, Beijing (China); Sun, Lisha [Central Laboratory, Peking University School of Stomatology, Beijing (China); Han, Wenlin [Center for Human Disease Genomics, Department of Immunology, Key Laboratory of Medical Immunology, Ministry of Health, School of Basic Medical Sciences, Peking University, Beijing (China); Li, Tiejun, E-mail: litiejun22@vip.sina.com [Department of Oral Pathology, Peking University School of Stomatology, Beijing (China)
2014-05-02
Highlights: • Down-regulation of CMTM5 expression in OSCC tissues was found. • The promoter methylation status of CMTM5 was measured. • CMTM5-v1 inhibited cell proliferation and migration and induced apoptosis. • CMTM5 might act as a putative tumor suppressor gene in OSCC. - Abstract: Oral squamous cell carcinoma (OSCC) is one of the most common types of malignancies in the head and neck region. CKLF-like MARVEL transmembrane domain-containing member 5 (CMTM5) has been recently implicated as a tumor suppressor gene in several cancer types. Herein, we examined the expression and function of CMTM5 in oral squamous cell carcinoma. CMTM5 was down-regulated in oral squamous cell lines and tumor samples from patients with promoter methylation. Treatment with the demethylating agent 5-aza-2′-deoxycytidine restored CMTM5 expression. In the OSCC cell lines CAL27 and GNM, the ectopic expression of CMTM5-v1 strongly inhibited cell proliferation and migration and induced apoptosis. In addition, CMTM5-v1 inhibited tumor formation in vivo. Therefore, CMTM5 might act as a putative tumor suppressor gene through promoter methylation in oral squamous cell carcinoma.
International Nuclear Information System (INIS)
Zhang, Heyu; Nan, Xu; Li, Xuefen; Chen, Yan; Zhang, Jianyun; Sun, Lisha; Han, Wenlin; Li, Tiejun
2014-01-01
Highlights: • Down-regulation of CMTM5 expression in OSCC tissues was found. • The promoter methylation status of CMTM5 was measured. • CMTM5-v1 inhibited cell proliferation and migration and induced apoptosis. • CMTM5 might act as a putative tumor suppressor gene in OSCC. - Abstract: Oral squamous cell carcinoma (OSCC) is one of the most common types of malignancies in the head and neck region. CKLF-like MARVEL transmembrane domain-containing member 5 (CMTM5) has been recently implicated as a tumor suppressor gene in several cancer types. Herein, we examined the expression and function of CMTM5 in oral squamous cell carcinoma. CMTM5 was down-regulated in oral squamous cell lines and tumor samples from patients with promoter methylation. Treatment with the demethylating agent 5-aza-2′-deoxycytidine restored CMTM5 expression. In the OSCC cell lines CAL27 and GNM, the ectopic expression of CMTM5-v1 strongly inhibited cell proliferation and migration and induced apoptosis. In addition, CMTM5-v1 inhibited tumor formation in vivo. Therefore, CMTM5 might act as a putative tumor suppressor gene through promoter methylation in oral squamous cell carcinoma
Directory of Open Access Journals (Sweden)
Wen-Tsung Huang
2017-12-01
Full Text Available Intrinsic or acquired resistance to hormone therapy is frequently reported in estrogen receptor positive (ER+ breast cancer patients. Even though dysregulations of histone deacetylases (HDACs are known to promote cancer cells survival, the role of different HDACs in the induction of hormone therapy resistance in ER+ breast cancer remains unclear. Survivin is a well-known pro-tumor survival molecule and miR-125a-5p is a recently discovered tumor suppressor. In this study, we found that ER+, hormone-independent, tamoxifen-resistant MCF7-TamC3 cells exhibit increased expression of HDAC2, HDAC5, and survivin, but show decreased expression of miR-125a-5p, as compared to the parental tamoxifen-sensitive MCF7 breast cancer cells. Molecular down-regulations of HDAC2, HDAC5, and survivin, and ectopic over-expression of miR-125a-5p, increased the sensitivity of MCF7-TamC3 cells to estrogen deprivation and restored the sensitivity to tamoxifen. The same treatments also further increased the sensitivity to estrogen-deprivation in the ER+ hormone-dependent ZR-75-1 breast cancer cells in vitro. Kaplan–Meier analysis and receiver operating characteristic curve analysis of expression cohorts of breast tumor showed that high HDAC2 and survivin, and low miR-125a-5p, expression levels correlate with poor relapse-free survival in endocrine therapy and tamoxifen-treated ER+ breast cancer patients. Further molecular analysis revealed that HDAC2 and HDAC5 positively modulates the expression of survivin, and negatively regulates the expression miR-125a-5p, in ER+ MCF7, MCF7-TamC3, and ZR-75-1 breast cancer cells. These findings indicate that dysregulations of HDAC2 and HDAC5 promote the development of hormone independency and tamoxifen resistance in ERC breast cancer cells in part through expression regulation of survivin and miR-125a-5p.
Directory of Open Access Journals (Sweden)
Saeideh Ahangari
2012-11-01
Full Text Available Different methods of language teaching have tried to help EFL learners to develop good language skills based on their various perspectives. Research findings have underscored the effect of using task types in promoting language skills in terms of accuracy in written discourse. Therefore, this study set out to investigate whether there is an evidence of correct use of simple past tense (Accuracy based on Task Complexity (Task type :Here-and now & There-and-then,Task Conditions (Gender: Male & Female, and Task Difficulty (Proficiency: Lower-intermediate & Intermediate. Sixty Iranian English learners in a language institute participated in the study and were assigned to four groups of lower-intermediate male, lower-intermediate female, intermediate male and intermediate female. Initial homogeneity of the groups was verified using two general proficiency tests; KET for lower-intermediate and PET for intermediate. All groups in here-and-now task type were asked to write a story using simple past based on a picture strip while for there-and-then task type the participants were supposed to write about their last birthday. The results from paired samples t-test, independent samples t-test and two-way ANOVA analysis of the written data revealed significant differences in performing task types, at different proficiency levels and interaction between them. The findings have significant pedagogical implications for EFL learners to understand the relationship among Task Complexity,Task Conditions, Task Difficulty and L2 written production leading to various degrees of Accuracy.
Energy Technology Data Exchange (ETDEWEB)
Zhang, Yanwei; Xu, Jing, E-mail: xujingdoc@163.com
2016-04-22
miR-140-5p is down-regulated in patients with pulmonary arterial hypertension (PAH) and experimental models of PAH, and inhibits hypoxia-mediated pulmonary artery smooth muscle cell (PASMC) proliferation in vitro. Delivery of synthetic miR-140-5p prevents and treats established, experimental PAH. DNA methyltransferase 1 (Dnmt1) is up-regulated in PAH associated human PASMCs (HPASMCs), which promotes the development of PAH by hypermethylation of CpG islands within the promoter for superoxide dismutase 2 (SOD2) and down-regulating SOD2 expression. We searched for miR-140-5p targets using TargetScan, PicTar and MiRanda tools, and found that Dnmt1 is a potential target of miR-140-5p. Based on these findings, we speculated that miR-140-5p might target Dnmt1 and regulate SOD2 expression to regulate hypoxia-mediated HPASMC proliferation, apoptosis and differentiation. We detected the expression of miR-140-5p, Dnmt1 and SOD2 by quantitative real-time polymerase chain reaction (qRT-PCR) and western blot assays, respectively, and found down-regulation of miR-140-5p and SOD2 and up-regulation of Dnmt1 exist in PAH tissues and hypoxia-mediated HPASMCs. Cell proliferation, apoptosis and differentiation detection showed that miR-140-5p inhibits proliferation and promotes apoptosis and differentiation of HPASMCs in hypoxia, while the effect of Dnmt1 on hypoxia-mediated HPASMCs is reversed. Luciferase assay confirmed that miR-140-5p targets Dnmt1 directly. An inverse correlation is also found between miR-140-5p and Dnmt1 in HPASMCs. In addition, we further investigated whether miR-140-5p and Dnmt1 regulate HPASMC proliferation, apoptosis and differentiation by regulating SOD2 expression, and the results confirmed our speculation. Taken together, these results indicated that miR-140-5p at least partly targets Dnmt1 and regulates SOD2 expression to inhibit proliferation and promote apoptosis and differentiation of HPASMCs in hypoxia. - Highlights: • miR-140-5p and SOD2 are down
Single-task and dual-task tandem gait test performance after concussion.
Howell, David R; Osternig, Louis R; Chou, Li-Shan
2017-07-01
To compare single-task and dual-task tandem gait test performance between athletes after concussion with controls on observer-timed, spatio-temporal, and center-of-mass (COM) balance control measurements. Ten participants (19.0±5.5years) were prospectively identified and completed a tandem gait test protocol within 72h of concussion and again 1 week, 2 weeks, 1 month, and 2 months post-injury. Seven uninjured controls (20.0±4.5years) completed the same protocol in similar time increments. Tandem gait test trials were performed with (dual-task) and without (single-task) concurrently performing a cognitive test as whole-body motion analysis was performed. Outcome variables included test completion time, average tandem gait velocity, cadence, and whole-body COM frontal plane displacement. Concussion participants took significantly longer to complete the dual-task tandem gait test than controls throughout the first 2 weeks post-injury (mean time=16.4 [95% CI: 13.4-19.4] vs. 10.1 [95% CI: 6.4-13.7] seconds; p=0.03). Single-task tandem gait times were significantly lower 72h post-injury (p=0.04). Dual-task cadence was significantly lower for concussion participants than controls (89.5 [95% CI: 68.6-110.4] vs. 127.0 [95% CI: 97.4-156.6] steps/minute; p=0.04). Moderately-high to high correlations between tandem gait test time and whole-body COM medial-lateral displacement were detected at each time point during dual-task gait (r s =0.70-0.93; p=0.03-0.001). Adding a cognitive task during the tandem gait test resulted in longer detectable deficits post-concussion compared to the traditional single-task tandem gait test. As a clinical tool to assess dynamic motor function, tandem gait may assist with return to sport decisions after concussion. Copyright © 2017 Sports Medicine Australia. Published by Elsevier Ltd. All rights reserved.
CHANGE@CERN:Task Force 5 : Restructuring the accelerator sector
2002-01-01
The last of our series on the Task Forces. PS accelerator 'We had a clear mandate, which we could approach in a logical way', explains Steve Myers, Head of SL Division and convenor of Task Force 5, 'To avoid duplication of effort in the accelerator sector through a restructuring that would lead to greater efficiency and flexibility and so release resources for the LHC.' The implementation of all their recommendations is already underway, albeit with different time scales. In 2001 the accelerator sector involved more than 900 staff members in three divisions (LHC, PS and SL) and one unit (AC), working in 141 sections within 34 groups. The first step for the Task Force was to identify major activities within the sector and to set up inter-divisional working groups to review these activities (16 in all), identifying the technologies and the numbers of staff associated with each activity. The working groups were also asked to propose ways of grouping the activities into a new more efficient organizational stru...
MicroRNA-1 promotes apoptosis of hepatocarcinoma cells by targeting apoptosis inhibitor-5 (API-5).
Li, Dong; Liu, Yu; Li, Hua; Peng, Jing-Jing; Tan, Yan; Zou, Qiang; Song, Xiao-Feng; Du, Min; Yang, Zheng-Hui; Tan, Yong; Zhou, Jin-Jun; Xu, Tao; Fu, Zeng-Qiang; Feng, Jian-Qiong; Cheng, Peng; chen, Tao; Wei, Dong; Su, Xiao-Mei; Liu, Huan-Yi; Qi, Zhong-Chun; Tang, Li-Jun; Wang, Tao; Guo, Xin; Hu, Yong-He; Zhang, Tao
2015-01-02
Although microRNA-1 (miR-1) is a known liver cancer suppressor, the role of miR-1 in apoptosis of hepatoma cells has remained largely unknown. Our study shows that ectopic miR-1 overexpression induced apoptosis of liver hepatocellular carcinoma (HepG2) cells. Apoptosis inhibitor 5 (API-5) was found to be a potential regulator of miR-1 induced apoptosis, using a bioinformatics approach. Furthermore, an inverse relationship between miR-1 and API-5 expression was observed in human liver cancer tissues and adjacent normal liver tissues. Negative regulation of API-5 expression by miR-1 was demonstrated to promote apoptosis of HepG2 cells. Our study provides a novel regulatory mechanism of miR-1 in the apoptosis of hepatoma cells. Copyright © 2014 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.
The frequency of CCR5 promoter polymorphisms and CCR5 32 mutation in Iranian populations
Directory of Open Access Journals (Sweden)
Mohammad Zare-Bidaki
2015-04-01
Full Text Available Evidence showed that chemokines serve as pro-migratory factors for immune cells. CCL3, CCL4 and CCL5, as the main CC chemokines subfamily members, activate immune cells through binding to CC chemokine receptor 5 or CCR5. Macrophages, NK cells and T lymphocytes express CCR5 and thus, affected CCR5 expression or functions could be associated with altered immune responses. Deletion of 32 base pairs (D 32 in the exon 1 of the CCR5 gene, which is known as CCR5 D 32 mutation causes down regulation and malfunction of the molecule. Furthermore, it has been evidenced that three polymorphisms in the promoter region of CCR5 modulate its expression. Altered CCR5 expression in microbial infection and immune related diseases have been reported by several researchers but the role of CCR5 promoter polymorphisms and CCR5 D 32 mutation in Iranian patients suffering from these diseases are controversial. Due to the fact that Iranian people have different genetic backgrounds compared to other ethnics, hence, CCR5 promoter polymorphisms and CCR5 D 32 mutation association with the diseases may be different in Iranian patients. Therefore, this review addresses the most recent information regarding the prevalence as well as association of the mutation and polymorphisms in Iranian patients with microbial infection and immune related diseases as along with normal population.
Number & operations task & drill sheets : grades 3-5
Reed, Nat
2011-01-01
For grades 3-5, our Common Core State Standards-based combined resource meets the number & operations concepts addressed by the NCTM standards and encourages the students to review the concepts in unique ways. The task sheets introduce the mathematical concepts to the students around a central problem taken from real-life experiences, while the drill sheets provide warm-up and timed practice questions for the students to strengthen their procedural proficiency skills.
Promoter2.0: for the recognition of PolII promoter sequences
DEFF Research Database (Denmark)
Knudsen, Steen; Knudsen, Steen
1999-01-01
transcription start sites. On standardized test setsconsisting of human genomic DNA, the performance of Promoter2.0 compares well with other softwaredeveloped for the same purpose. Availability : Promoter2.0 is available as a Web server at http://www.cbs.dtu.dk/services/promoter/ Contact : steen@cbs.dtu.dk...
Yang, Weili; Wang, Junpei; Chen, Zhenzhen; Chen, Ji; Meng, Yuhong; Chen, Liming; Chang, Yongsheng; Geng, Bin; Sun, Libo; Dou, Lin; Li, Jian; Guan, Youfei; Cui, Qinghua; Yang, Jichun
2017-07-01
Hepatic FAM3A expression is repressed under obese conditions, but the underlying mechanism remains unknown. This study determined the role and mechanism of miR-423-5p in hepatic glucose and lipid metabolism by repressing FAM3A expression. miR-423-5p expression was increased in the livers of obese diabetic mice and in patients with nonalcoholic fatty liver disease (NAFLD) with decreased FAM3A expression. miR-423-5p directly targeted FAM3A mRNA to repress its expression and the FAM3A-ATP-Akt pathway in cultured hepatocytes. Hepatic miR-423-5p inhibition suppressed gluconeogenesis and improved insulin resistance, hyperglycemia, and fatty liver in obese diabetic mice. In contrast, hepatic miR-423-5p overexpression promoted gluconeogenesis and hyperglycemia and increased lipid deposition in normal mice. miR-423-5p inhibition activated the FAM3A-ATP-Akt pathway and repressed gluconeogenic and lipogenic gene expression in diabetic mouse livers. The miR-423 precursor gene was further shown to be a target gene of NFE2, which induced miR-423-5p expression to repress the FAM3A-ATP-Akt pathway in cultured hepatocytes. Hepatic NFE2 overexpression upregulated miR-423-5p to repress the FAM3A-ATP-Akt pathway, promoting gluconeogenesis and lipid deposition and causing hyperglycemia in normal mice. In conclusion, under the obese condition, activation of the hepatic NFE2/miR-423-5p axis plays important roles in the progression of type 2 diabetes and NAFLD by repressing the FAM3A-ATP-Akt signaling pathway. © 2017 by the American Diabetes Association.
TASK 2.5.5 NATURAL EXPOSURE TESTING IN CALIFORNIA
Energy Technology Data Exchange (ETDEWEB)
Miller, William A [ORNL; Cheng, Mengdawn [ORNL; New, Joshua Ryan [ORNL; Ronnen, Levinson [Lawrence Berkeley National Laboratory (LBNL); Akbari, Hashem [Lawrence Berkeley National Laboratory (LBNL); Berhahl, Paul [Lawrence Berkeley National Laboratory (LBNL)
2010-03-01
Airborne particulate matter that settles on a roof can either reflect or absorb incoming solar radiation, dependent on the chemical content and size of the particles. These light scattering and absorption processes occur within a few microns of the surface, and can affect the solar reflectance of the roof. Wilkes et al. (2000) tested 24 different roof coatings on a low-slope test stand and observed about a 25% decrease in the solar reflectance of white-coated and aluminum-coated surfaces as the time of exposure increased; however, the decrease leveled off after 2 years. SPRI Inc. and its affiliates studied the effect of climatic exposure on the surface properties of white thermoplastic single-ply membranes and determined that membranes lose from 30 to 50% of their reflectance over 3 years (Miller et al. 2002). The CMRC and its affiliates AISI, NamZAC, MBMA, MCA and NCCA exposed unpainted and painted metal roofing on both steep- and low-slope test roofs and found that after 3 years, the painted polyvinylidene fluoride (PVDF) metal roofs lost less than 5% of their original reflectance (Miller et al. 2004). The results of the three different weathering studies are very interesting in terms of their solar reflectance after 3 years of exposure. The white thermoplastic membrane and white ceramic coating with white topcoat had original reflectance measures that were about 20 percentage points higher than the painted metal; however, after 3-years of field exposure the solar reflectance of the painted metal exceeds that of the thermoplastic membrane and equals that of the coating. The long-term loss of reflectance appears driven by the ability of the particulate matter to cling to the roof and resist being washed off by wind and or rain. Miller et al. (2002) discovered that aerosol deposition introduced biomass of complex microbial consortia onto the test roofs and the combination of contaminants and biomass accelerated the loss of solar reflectance for the thermoplastic
Liu, Xiao; Gilmore, Kerry J; Moulton, Simon E; Wallace, Gordon G
2009-12-01
The purpose of this work was to investigate for the first time the potential biomedical applications of novel polypyrrole (PPy) composites incorporating a large polyelectrolyte dopant, poly (2-methoxy-5 aniline sulfonic acid) (PMAS). The physical and electrochemical properties were characterized. The PPy/PMAS composites were found to be smooth and hydrophilic and have low electrical impedance. We demonstrate that PPy/PMAS supports nerve cell (PC12) differentiation, and that clinically relevant 250 Hz biphasic current pulses delivered via PPy/PMAS films significantly promote nerve cell differentiation in the presence of nerve growth factor (NGF). The capacity of PPy/PMAS composites to support and enhance nerve cell differentiation via electrical stimulation renders them valuable for medical implants for neurological applications.
Ultrasound promoted and SiO2/CCl3COOH mediated synthesis of 2 ...
Indian Academy of Sciences (India)
First one-pot synthesis of 2-aryl-1-arylmethyl-1H- benzimidazole derivatives from ... to promote chemical reactions is called sonochemistry .... −1): 1615, 2845, 2980, 3036, 3067; 1H NMR (500MHz,. CDCl3):δ 5.38 (s, 2H, CH2), 6.65 (d, J = 8.0 ...
Energy Technology Data Exchange (ETDEWEB)
Seo, Young-Kyo [Department of Molecular Biology and Biochemistry, 3244 McGaugh Hall, University of California, UC Irvine, Irvine, CA 92697-3900 (United States); Zhu, Bing [Department of Pathology, University of Texas Medical Branch, Galveston, TX 77555-0144 (United States); Jeon, Tae-Il [Department of Molecular Biology and Biochemistry, 3244 McGaugh Hall, University of California, UC Irvine, Irvine, CA 92697-3900 (United States); Osborne, Timothy F., E-mail: tfosborn@uci.edu [Department of Molecular Biology and Biochemistry, 3244 McGaugh Hall, University of California, UC Irvine, Irvine, CA 92697-3900 (United States)
2009-11-01
In this study, we show that sterol regulatory element binding proteins (SREBPs) regulate expression of Srd5a2, an enzyme that catalyzes the irreversible conversion of testosterone to dihydroxytestosterone in the male reproductive tract and is highly expressed in androgen-sensitive tissues such as the prostate and skin. We show that Srd5a2 is induced in livers and prostate from mice fed a chow diet supplemented with lovastatin plus ezitimibe (L/E), which increases the activity of nuclear SREBP-2. The three fold increase in Srd5a2 mRNA mediated by L/E treatment was accompanied by the induction of SREBP-2 binding to the Srd5a2 promoter detected by a ChIP-chip assay in liver. We identified a SREBP-2 responsive region within the first 300 upstream bases of the mouse Srd5a2 promoter by co-transfection assays which contain a site that bound SREBP-2 in vitro by an EMSA. Srd5a2 protein was also induced in cells over-expressing SREBP-2 in culture. The induction of Srd5a2 through SREBP-2 provides a mechanistic explanation for why even though statin therapy is effective in reducing cholesterol levels in treating hypercholesterolemia it does not compromise androgen production in clinical studies.
International Nuclear Information System (INIS)
Seo, Young-Kyo; Zhu, Bing; Jeon, Tae-Il; Osborne, Timothy F.
2009-01-01
In this study, we show that sterol regulatory element binding proteins (SREBPs) regulate expression of Srd5a2, an enzyme that catalyzes the irreversible conversion of testosterone to dihydroxytestosterone in the male reproductive tract and is highly expressed in androgen-sensitive tissues such as the prostate and skin. We show that Srd5a2 is induced in livers and prostate from mice fed a chow diet supplemented with lovastatin plus ezitimibe (L/E), which increases the activity of nuclear SREBP-2. The three fold increase in Srd5a2 mRNA mediated by L/E treatment was accompanied by the induction of SREBP-2 binding to the Srd5a2 promoter detected by a ChIP-chip assay in liver. We identified a SREBP-2 responsive region within the first 300 upstream bases of the mouse Srd5a2 promoter by co-transfection assays which contain a site that bound SREBP-2 in vitro by an EMSA. Srd5a2 protein was also induced in cells over-expressing SREBP-2 in culture. The induction of Srd5a2 through SREBP-2 provides a mechanistic explanation for why even though statin therapy is effective in reducing cholesterol levels in treating hypercholesterolemia it does not compromise androgen production in clinical studies.
Simulation and modeling CO2 absorption in biogas with DEA promoted K2CO3 solution in packed column
Nurkhamidah, Siti; Altway, Ali; Airlangga, Bramantyo; Emilia, Dwi Putri
2017-05-01
Absorption of carbon dioxide (CO2) using potassium carbonate (K2CO3) is one of biogas purification method. However, K2CO3 have slow mass transfer in liquid phase. So it is necessary to eliminate the disadvantage of CO2 absorption using K2CO3 by adding promotor (activator). Diethanol amine (DEA) is one of promotor which can increase its reaction rate. Simulation and modeling research of the CO2 absorption from biogas with DEA promoted K2CO3 solution has not been conducted. Thus, the main goal of this research is create model and simulation for the CO2 absorption from biogas with DEA promoted K2CO3 solution, then observe the influence of promoter concentration. DEA concentration varies between 1-5 %wt. From the simulation, we concluded that the CO2 removal rise with the increasing of promoter concentration. The highest CO2 removal is 54.5318 % at 5 % wt DEA concentration.
Innamaa, A; Jackson, L; Asher, V; van Schalkwyk, G; Warren, A; Keightley, A; Hay, D; Bali, A; Sowter, H; Khan, R
2013-11-01
Aberrant expression of potassium (K(+)) channels contributes to cancer cell proliferation and apoptosis, and K(+) channel blockers can inhibit cell proliferation. TREK-1 and -2 belong to the two-pore domain (K2P) superfamily. We report TREK-1 and -2 expression in ovarian cancer and normal ovaries, and the effects of TREK-1 modulators on cell proliferation and apoptosis. The cellular localisation of TREK-1 and -2 was investigated by immunofluorescence in SKOV-3 and OVCAR-3 cell lines and in cultured ovarian surface epithelium and cancer. Channel expression in normal ovaries and cancer was quantified by western blotting. Immunohistochemical analysis demonstrated the association between channel expression and disease prognosis, stage, and grade. TREK-1 modulation of cell proliferation in the cell lines was investigated with the MTS-assay and the effect on apoptosis determined using flow cytometry. Expression was identified in both cell lines, ovarian cancer (n = 22) and normal ovaries (n = 6). IHC demonstrated positive staining for TREK-1 and -2 in 95.7 % of tumours (n = 69) and 100 % of normal ovaries (n = 9). A reduction in cell proliferation (P ovaries and ovarian cancer. TREK-1 modulators have a significant effect on cell proliferation and apoptosis. We propose investigation of the therapeutic potential of TREK-1 blockers is warranted.
Hall, Bruce M; Plain, Karren M; Tran, Giang T; Verma, Nirupama D; Robinson, Catherine M; Nomura, Masaru; Boyd, Rochelle; Hodgkinson, Suzanne J
2017-08-01
CD4 + T cells mediate antigen-specific allograft tolerance, but die in culture without activated lymphocyte derived cytokines. Supplementation of the media with cytokine rich supernatant, from ConA activated spleen cells, preserves the capacity of tolerant cells to transfer tolerance and suppress rejection. rIL-2 or rIL-4 alone are insufficient to maintain these cells, however. We observed that activation of naïve CD4 + CD25 + FOXP3 + Treg with alloantigen and the Th2 cytokine rIL-4 induces them to express interleukin-5 specific receptor alpha (IL-5Rα) suggesting that IL-5, a Th2 cytokine that is produced later in the immune response may promote tolerance mediating Treg. This study examined if recombinant IL-5(rIL-5) promoted survival of tolerant CD4 + , especially CD4 + CD25 + T cells. CD4 + T cells, from DA rats tolerant to fully allogeneic PVG heart allografts surviving over 100days without on-going immunosuppression, were cultured with PVG alloantigen and rIL-5. The ability of these cells to adoptively transfer tolerance to specific-donor allograft and suppress normal CD4 + T cell mediated rejection in adoptive DA hosts was examined. Tolerant CD4 + CD25 + T cells' response to rIL-5 and expression of IL-5Rα was also assessed. rIL-5 was sufficient to promote transplant tolerance mediating CD4 + T cells' survival in culture with specific-donor alloantigen. Tolerant CD4 + T cells cultured with rIL-5 retained the capacity to transfer alloantigen-specific tolerance and inhibited naïve CD4 + T cells' capacity to effect specific-donor graft rejection. rIL-5 promoted tolerant CD4 + CD25 + T cells' proliferation in vitro when stimulated with specific-donor but not third-party stimulator cells. Tolerant CD4 + CD25 + T cells expressed IL-5Rα. This study demonstrated that IL-5 promoted the survival of alloantigen-specific CD4 + CD25 + T cells that mediate transplant tolerance. Copyright © 2017 Elsevier B.V. All rights reserved.
1985-01-01
The primary objective of Task 2 is the development of an information base that will support the conduct of trade studies and provide sufficient data to make key design/programmatic decisions. This includes: (1) the establishment of option categories that are most likely to influence Space Station Data System (SSDS) definition; (2) the identification of preferred options in each category; and (3) the characterization of these options with respect to performance attributes, constraints, cost and risk. This volume contains the options development for the design category. This category comprises alternative structures, configurations and techniques that can be used to develop designs that are responsive to the SSDS requirements. The specific areas discussed are software, including data base management and distributed operating systems; system architecture, including fault tolerance and system growth/automation/autonomy and system interfaces; time management; and system security/privacy. Also discussed are space communications and local area networking.
Maier, Jonathan G; Piosczyk, Hannah; Holz, Johannes; Landmann, Nina; Deschler, Christoph; Frase, Lukas; Kuhn, Marion; Klöppel, Stefan; Spiegelhalder, Kai; Sterr, Annette; Riemann, Dieter; Feige, Bernd; Voderholzer, Ulrich; Nissen, Christoph
2017-11-01
Sleep modulates motor learning, but its detailed impact on performance curves remains to be fully characterized. This study aimed to further determine the impact of brief daytime periods of NREM sleep on 'offline' (task discontinuation after initial training) and 'on-task' (performance within the test session) changes in motor skill performance (finger tapping task). In a mixed design (combined parallel group and repeated measures) sleep laboratory study (n=17 'active' wake vs. sleep, n=19 'passive' wake vs. sleep), performance curves were assessed prior to and after a 90min period containing either sleep, active or passive wakefulness. We observed a highly significant, but state- (that is, sleep/wake)-independent early offline gain and improved on-task performance after sleep in comparison to wakefulness. Exploratory curve fitting suggested that the observed sleep effect most likely emerged from an interaction of training-induced improvement and detrimental 'time-on-task' processes, such as fatigue. Our results indicate that brief periods of NREM sleep do not promote early offline gains but subsequent on-task performance in motor skill learning. Copyright © 2017 Elsevier Inc. All rights reserved.
Cyclooxygenase 2 Promotes Parathyroid Hyperplasia in ESRD
Zhang, Qian; Qiu, Junsi; Li, Haiming; Lu, Yanwen; Wang, Xiaoyun; Yang, Junwei; Wang, Shaoqing; Zhang, Liyin; Gu, Yong; Hao, Chuan-Ming
2011-01-01
Hyperplasia of the PTG underlies the secondary hyperparathyroidism (SHPT) observed in CKD, but the mechanism underlying this hyperplasia is incompletely understood. Because aberrant cyclooxygenase 2 (COX2) expression promotes epithelial cell proliferation, we examined the effects of COX2 on the parathyroid gland in uremia. In patients with ESRD who underwent parathyroidectomy, clusters of cells within the parathyroid glands had increased COX2 expression. Some COX2-positive cells exhibited two nuclei, consistent with proliferation. Furthermore, nearly 78% of COX2-positive cells expressed proliferating cell nuclear antigen (PCNA). In the 5/6-nephrectomy rat model, rats fed a high-phosphate diet had significantly higher serum PTH levels and larger parathyroid glands than sham-operated rats. Compared with controls, the parathyroid glands of uremic rats exhibited more PCNA-positive cells and greater COX2 expression in the chief cells. Treatment with COX2 inhibitor celecoxib significantly reduced PCNA expression, attenuated serum PTH levels, and reduced the size of the glands. In conclusion, COX2 promotes the pathogenesis of hyperparathyroidism in ESRD, suggesting that inhibiting the COX2 pathway could be a potential therapeutic target. PMID:21335517
DEFF Research Database (Denmark)
Stofega, M R; Herrington, J; Billestrup, Nils
2000-01-01
phosphorylation. Consistent with the effects on STAT5B phosphorylation, tyrosine-to-phenylalanine mutation of tyrosine 595 prolongs the duration of tyrosyl phosphorylation of GHR and JAK2. These data suggest that tyrosine 595 is a major site of interaction of GHR with SHP-2, and that GHR-bound SHP-2 negatively......Binding of GH to GH receptor (GHR) rapidly and transiently activates multiple signal transduction pathways that contribute to the growth-promoting and metabolic effects of GH. While the events that initiate GH signal transduction, such as activation of the Janus tyrosine kinase JAK2, are beginning...
Characterization of the promoter of human CRTh2, a prostaglandin D{sub 2} receptor
Energy Technology Data Exchange (ETDEWEB)
Quapp, Russell; Madsen, Norman [Department of Medicine, Division of Pulmonary Medicine, Pulmonary Research Group, 574B Heritage Medical Research Centre, University of Alberta, Edmonton, AB, T6G 2S2 (Canada); Cameron, Lisa [Department of Medicine, Division of Pulmonary Medicine, Pulmonary Research Group, 574B Heritage Medical Research Centre, University of Alberta, Edmonton, AB, T6G 2S2 (Canada)
2007-11-30
Chemoattractant-receptor homologous molecule expressed on Th2 cells (CRTh2) is a receptor for prostaglandin (PG)D{sub 2}, a lipid mediator involved in allergic inflammation. CRTh2 is expressed by Th2 cells, eosinophils and basophils and PDG{sub 2}-CRTh2 signaling induces calcium mobilization, cell migration and expression of the Th2 cytokines IL-4, IL-5, and IL-13. Despite the role of CRTh2 in allergic inflammation, transcriptional regulation of this gene has not been studied. Here, we demonstrated that a reporter construct of the CRTh2 promoter was induced following T cell stimulation. This activity could be further enhanced by over-expression of GATA-3, but not NFAT2 or STAT6. Electromobility shift assay demonstrated GATA-3 binding to a probe from the CRTh2 promoter. This study provides the first detailed analysis of transcriptional regulation of the human CRTh2 promoter. These findings may help identify strategies to attenuate expression of this gene and influence the maintenance and proliferation of Th2 cells in allergic inflammation.
DEFF Research Database (Denmark)
Nørgaard, Jørgen Harck; Andersen, Thomas Lykke; Burcharth, Hans F.
2012-01-01
As a consequence of climate changes, coastal defenses are worldwide at higher risk of failure. Climate changes can lead to problems in terms of function, stability, and safety of goods and persons. To overcome the problems, different scenarios can be adopted, such as; 1) no upgrade actions...... and repairing the damages 2) upgrade of existing defences by e.g. changing the structure dimensions 3) perform strategic retreat and decommissioning. Within the THESEUS project, the present work task, WT 2.5, focus on upgrading existing rubble mound breakwater defences. Solutions for upgrading parts of rubble...... mound structures are investigated by means of modifying the structure profile and/or adding structure elements. Results from this study will be incorporated in the THESEUS decision tool (DSS-tool) and in the guidelines in work package 5 (WP.5)....
Change Best.Task 2.1. National Report on the Energy Efficiency Service Business in Italy
International Nuclear Information System (INIS)
Sabbatucci, N.; Labanca, N.
2009-05-01
The aim of the Change Best project is to promote the development of an energy efficiency service (EES) market and to give good practice examples of changes in energy service business, strategies, and supportive policies and measures in the course of the implementation of Directive 2006/32/EC on Energy End-Use Efficiency and Energy Services. This report addresses Task 2.1: National Report on the Energy Efficiency Service Business in Italy. More information can be found on the website of Change Best at www.changebest.eu.
DeWall, C Nathan; Baumeister, Roy F; Mead, Nicole L; Vohs, Kathleen D
2011-01-01
When leaders perform solitary tasks, do they self-regulate to maximize their effort, or do they reduce effort and conserve their resources? Our model suggests that power motivates self-regulation toward effective performance-unless the task is perceived as unworthy of leaders. Our 1st studies showed that power improves self-regulation and performance, even when resources for self-regulation are low (ego depletion). Additional studies showed that leaders sometimes disdain tasks they deem unworthy, by withholding effort (and therefore performing poorly). Ironically, during ego depletion, leaders skip the appraisal and, therefore, work hard regardless of task suitability, so that depleted leaders sometimes outperform nondepleted ones. Our final studies replicated these patterns with different tasks and even with simple manipulation of framing and perception of the same task (Experiment 5). Experiment 4 also showed that the continued high exertion of leaders when depleted takes a heavy toll, resulting in larger impairments later. The judicious expenditure of self-control resources among powerful people may help them prioritize their efforts to pursue their goals effectively. (PsycINFO Database Record (c) 2010 APA, all rights reserved).
Kawaguchi, Koichiro; Kinameri, Ayumi; Suzuki, Shunsuke; Senga, Shogo; Ke, Youqiang; Fujii, Hiroshi
2016-02-15
FABPs (fatty-acid-binding proteins) are a family of low-molecular-mass intracellular lipid-binding proteins consisting of ten isoforms. FABPs are involved in binding and storing hydrophobic ligands such as long-chain fatty acids, as well as transporting these ligands to the appropriate compartments in the cell. FABP5 is overexpressed in multiple types of tumours. Furthermore, up-regulation of FABP5 is strongly associated with poor survival in triple-negative breast cancer. However, the mechanisms underlying the specific up-regulation of the FABP5 gene in these cancers remain poorly characterized. In the present study, we determined that FABP5 has a typical CpG island around its promoter region. The DNA methylation status of the CpG island in the FABP5 promoter of benign prostate cells (PNT2), prostate cancer cells (PC-3, DU-145, 22Rv1 and LNCaP) and human normal or tumour tissue was assessed by bisulfite sequencing analysis, and then confirmed by COBRA (combined bisulfite restriction analysis) and qAMP (quantitative analysis of DNA methylation using real-time PCR). These results demonstrated that overexpression of FABP5 in prostate cancer cells can be attributed to hypomethylation of the CpG island in its promoter region, along with up-regulation of the direct trans-acting factors Sp1 (specificity protein 1) and c-Myc. Together, these mechanisms result in the transcriptional activation of FABP5 expression during human prostate carcinogenesis. Importantly, silencing of Sp1, c-Myc or FABP5 expression led to a significant decrease in cell proliferation, indicating that up-regulation of FABP5 expression by Sp1 and c-Myc is critical for the proliferation of prostate cancer cells. © 2016 Authors; published by Portland Press Limited.
The Effect of Focus on Form and Task Complexity on L2 Learners' Oral Task Performance
Salimi, Asghar
2015-01-01
Second Language learners' oral task performance has been one of interesting and research generating areas of investigations in the field of second language acquisition specially, task-based language teaching and learning. The main purpose of the present study is to investigate the effect of focus on form and task complexity on L2 learners' oral…
COMMIT at SemEval-2017 Task 5: Ontology-based Method for Sentiment Analysis of Financial Headlines
Schouten, Kim; Frasincar, Flavius; de Jong, F.M.G.
2017-01-01
This paper describes our submission to Task 5 of SemEval 2017, Fine-Grained Sentiment Analysis on Financial Microblogs and News, where we limit ourselves to performing sentiment analysis on news headlines only (track 2). The approach presented in this paper uses a Support Vector Machine to do the
Promoter characterization and genomic organization of the human X11β gene APBA2.
LENUS (Irish Health Repository)
Hao, Yan
2012-02-15
Overexpression of neuronal adaptor protein X11β has been shown to decrease the production of amyloid-β, a toxic peptide deposited in Alzheimer\\'s disease brains. Therefore, manipulation of the X11β level may represent a potential therapeutic strategy for Alzheimer\\'s disease. As X11β expression can be regulated at the transcription level, we determined the genomic organization and the promoter of the human X11β gene, amyloid β A4 precursor protein-binding family A member 2 (APBA2). By RNA ligase-mediated rapid amplification of cDNA ends, a single APBA2 transcription start site and the complete sequence of exon 1 were identified. The APBA2 promoter was located upstream of exon 1 and was more active in neurons. The core promoter contains several CpG dinucleotides, and was strongly suppressed by DNA methylation. In addition, mutagenesis analysis revealed a putative Pax5-binding site within the promoter. Together, APBA2 contains a potent neuronal promoter whose activity may be regulated by DNA methylation and Pax5.
Ubiquitin-like protein UBL5 promotes the functional integrity of the Fanconi anemia pathway.
Oka, Yasuyoshi; Bekker-Jensen, Simon; Mailand, Niels
2015-05-12
Ubiquitin and ubiquitin-like proteins (UBLs) function in a wide array of cellular processes. UBL5 is an atypical UBL that does not form covalent conjugates with cellular proteins and which has a known role in modulating pre-mRNA splicing. Here, we report an unexpected involvement of human UBL5 in promoting the function of the Fanconi anemia (FA) pathway for repair of DNA interstrand crosslinks (ICLs), mediated by a specific interaction with the central FA pathway component FANCI. UBL5-deficient cells display spliceosome-independent reduction of FANCI protein stability, defective FANCI function in response to DNA damage and hypersensitivity to ICLs. By mapping the sequence determinants underlying UBL5-FANCI binding, we generated separation-of-function mutants to demonstrate that key aspects of FA pathway function, including FANCI-FANCD2 heterodimerization, FANCD2 and FANCI monoubiquitylation and maintenance of chromosome stability after ICLs, are compromised when the UBL5-FANCI interaction is selectively inhibited by mutations in either protein. Together, our findings establish UBL5 as a factor that promotes the functionality of the FA DNA repair pathway. © 2015 The Authors.
Jelsøe, Erling; Thualagant, Nicole; Holm, Jesper; Kjærgård, Bente; Andersen, Heidi Myglegård; From, Ditte-Marie; Land, Birgit; Pedersen, Kirsten Bransholm
2018-02-01
Based on previous studies and reflections collected from participants in a workshop at the 8th Nordic Health Promotion Research Network conference, we reveal current tendencies and discuss future challenges for health-promotion research regarding integration of sustainable development principles. Despite obvious interfaces and interactions between the two, our contention is that strategies for health promotion are not sufficiently integrated with strategies for sustainable development and that policies aimed at solving health or sustainability problems may therefore cause new, undesired and unforeseen environmental and health problems. As illustrated in previous research and as deliberated in the above-mentioned workshop, a number of barriers are identified. These are believed to be related to historical segregation, the conceptual understandings of health promotion and sustainable development, as well as the politics and implementation of policy goals in both areas. Three focal points are proposed as important challenges to address in future research: (a) the duality of health promotion and sustainability and how it can be handled in order to enhance mutually supportive processes between them; (b) the social dimension of sustainability and how it can be strengthened in the development of strategies for health promotion and sustainable development; and (c) exploring and identifying policy approaches and strategies for integrating health promotion and sustainable development.
IL-5 promotes induction of antigen-specific CD4+CD25+ T regulatory cells that suppress autoimmunity.
Tran, Giang T; Hodgkinson, Suzanne J; Carter, Nicole M; Verma, Nirupama D; Plain, Karren M; Boyd, Rochelle; Robinson, Catherine M; Nomura, Masaru; Killingsworth, Murray; Hall, Bruce M
2012-05-10
Immune responses to foreign and self-Ags can be controlled by regulatory T cells (Tregs) expressing CD4 and IL-2Rα chain (CD25). Defects in Tregs lead to autoimmunity, whereas induction of Ag-specific CD4+CD25+ Tregs restores tolerance. Ag-specific CD4+CD25+ FOXP3+Tregs activated by the T helper type 2 (Th2) cytokine, IL-4, and specific alloantigen promote allograft tolerance. These Tregs expressed the specific IL-5Rα and in the presence of IL-5 proliferate to specific but not third-party Ag. These findings suggest that recombinant IL-5 (rIL-5) therapy may promote Ag-specific Tregs to mediate tolerance. This study showed normal CD4+CD25+ Tregs cultured with IL-4 and an autoantigen expressed Il-5rα. Treatment of experimental autoimmune neuritis with rIL-5 markedly reduced clinical paralysis, weight loss, demyelination, and infiltration of CD4+ (Th1 and Th17) CD8+ T cells and macrophages in nerves. Clinical improvement was associated with expansion of CD4+CD25+FOXP3+ Tregs that expressed Il-5rα and proliferated only to specific autoantigen that was enhanced by rIL-5. Depletion of CD25+ Tregs or blocking of IL-4 abolished the benefits of rIL-5. Thus, rIL-5 promoted Ag-specific Tregs, activated by autoantigen and IL-4, to control autoimmunity. These findings may explain how Th2 responses, especially to parasitic infestation, induce immune tolerance. rIL-5 therapy may be able to induce Ag-specific tolerance in autoimmunity.
Directory of Open Access Journals (Sweden)
B-J Kwon
2018-01-01
Full Text Available Osteoporosis is a disease characterized by low bone mass, most commonly caused by an increase in bone resorption that is not matched by sufficient bone formation. The most common complications of postmenopausal osteoporosis are bone-related defects and fractures. Fracture healing is a multifactorial bone regeneration process, influenced by both biological and mechanical factors related to age, osteoporosis and stability of the osteosynthesis. During the treatment of bone defects in osteoporotic conditions, imbalanced bone remodeling is the leading cause for implant failure. To overcome these problems, ethyl-2,5-dihydroxybenzoate (E-2,5-DHB, a drug that promotes bone formation and inhibits bone resorption, was used. E-2,5-DHB-incorporating titanium (Ti implants using poly(lactic-co-glycolic acid (PLGA coating for local delivery of E-2,5-DHB were developed and the effects on bone healing of femoral defects were evaluated in an osteoporotic model. The release of E-2,5-DHB resulted in decreased bone resorption and increased bone formation around the implant. Thus, it was confirmed that, in the osteoporotic model, bone healing was increased and implant fixation was enhanced. These results suggested that E-2,5-DHB-coated Ti implants have great potential as an ultimate local drug delivery system for bone tissue scaffolds.
Directory of Open Access Journals (Sweden)
Kensuke Sakai
Full Text Available AIMS: East Asian genome-wide association studies (GWAS for type 2 diabetes identified 8 loci with genome-wide significance, and 2 loci with a borderline association. However, the associations of these loci except MAEA locus with type 2 diabetes have not been evaluated in independent East Asian cohorts. We performed a replication study to investigate the association of these susceptibility loci with type 2 diabetes in an independent Japanese population. METHODS: We genotyped 7,379 Japanese participants (5,315 type 2 diabetes and 2,064 controls for each of the 9 single nucleotide polymorphisms (SNPs, rs7041847 in GLIS3, rs6017317 in FITM2-R3HDML-HNF4A, rs6467136 near GCCI-PAX4, rs831571 near PSMD6, rs9470794 in ZFAND3, rs3786897 in PEPD, rs1535500 in KCNK16, rs16955379 in CMIP, and rs17797882 near WWOX. Because the sample size in this study was not sufficient to replicate single SNP associations, we constructed a genetic risk score (GRS by summing a number of risk alleles of the 9 SNPs, and examined the association of the GRS with type 2 diabetes using logistic regression analysis. RESULTS: With the exception of rs1535500 in KCNK16, all SNPs had the same direction of effect (odds ratio [OR]>1.0 as in the original reports. The GRS constructed from the 9 SNPs was significantly associated with type 2 diabetes in the Japanese population (p = 4.0 × 10(-4, OR = 1.05, 95% confidence interval: 1.02-1.09. In quantitative trait analyses, rs16955379 in CMIP was nominally associated with a decreased homeostasis model assessment of β-cell function and with increased fasting plasma glucose, but neither the individual SNPs nor the GRS showed a significant association with the glycemic traits. CONCLUSIONS: These results indicate that 9 loci that were identified in the East Asian GWAS meta-analysis have a significant effect on the susceptibility to type 2 diabetes in the Japanese population.
Pedagogical directions to design and support collaborative knowledge building on-line tasks
Directory of Open Access Journals (Sweden)
Ingrid Noguera Fructuoso
2013-02-01
Full Text Available 0 0 1 187 1034 USAL 8 2 1219 14.0 Normal 0 21 false false false ES JA X-NONE /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Tabla normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin-top:0cm; mso-para-margin-right:0cm; mso-para-margin-bottom:10.0pt; mso-para-margin-left:0cm; line-height:115%; mso-pagination:widow-orphan; font-size:11.0pt; font-family:Calibri; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-ansi-language:ES; mso-fareast-language:EN-US;} Research on Computer-Supported Collaborative Learning (CSCL demonstrates that proposing that students work in groups does not improve their learning or increase their motivation. It is essential to design appropriate learning tasks and suitable pedagogical and technological support. The aim of this research is to identify pedagogical directions to design and support collaborative knowledge building tasks in on-line education. We conducted a case study at the Open University of Catalonia where we carried out two experiments: the first focusing on how teachers design and support collaborative on-line learning tasks and, the second, based on the control exerted over the tasks. As a result of the investigation we characterize the type of tasks that promote collaborative knowledge building, the teachers’ role and functions supporting these types of tasks, and we identify different stages in task regulation. Based on these results, we propose pedagogical directions to design and support collaborative on-line tasks divided into 4 stages: 1 Task design and individual preparation, 2 Task organization and group negotiation, 3 Task performance and collaborative knowledge building, and 4 Critical evaluation.
Odagiri, Haruki; Kadomatsu, Tsuyoshi; Endo, Motoyoshi; Masuda, Tetsuro; Morioka, Masaki Suimye; Fukuhara, Shigetomo; Miyamoto, Takeshi; Kobayashi, Eisuke; Miyata, Keishi; Aoi, Jun; Horiguchi, Haruki; Nishimura, Naotaka; Terada, Kazutoyo; Yakushiji, Toshitake; Manabe, Ichiro; Mochizuki, Naoki; Mizuta, Hiroshi; Oike, Yuichi
2014-01-21
The tumor microenvironment can enhance the invasive capacity of tumor cells. We showed that expression of angiopoietin-like protein 2 (ANGPTL2) in osteosarcoma (OS) cell lines increased and the methylation of its promoter decreased with time when grown as xenografts in mice compared with culture. Compared with cells grown in normal culture conditions, the expression of genes encoding DNA demethylation-related enzymes increased in tumor cells implanted into mice or grown in hypoxic, serum-starved culture conditions. ANGPTL2 expression in OS cell lines correlated with increased tumor metastasis and decreased animal survival by promoting tumor cell intravasation mediated by the integrin α5β1, p38 mitogen-activated protein kinase, and matrix metalloproteinases. The tolloid-like 1 (TLL1) protease cleaved ANGPTL2 into fragments in vitro that did not enhance tumor progression when overexpressed in xenografts. Expression of TLL1 was weak in OS patient tumors, suggesting that ANGPTL2 may not be efficiently cleaved upon secretion from OS cells. These findings demonstrate that preventing ANGPTL2 signaling stimulated by the tumor microenvironment could inhibit tumor cell migration and metastasis.
Lean, Lyn Li; Hong, Ryan Yee Shiun; Ti, Lian Kah
2017-08-01
Communication of feedback during teaching of practical procedures is a fine balance of structure and timing. We investigate if continuous in-task (IT) or end-task feedback (ET) is more effective in teaching spinal anaesthesia to medical students. End-task feedback was hypothesized to improve both short-term and long-term procedural learning retention as experiential learning promotes active learning after encountering errors during practice. Upon exposure to a 5-min instructional video, students randomized to IT or ET feedbacks were trained using a spinal simulator mannequin. A blinded expert tested the students using a spinal anaesthesia checklist in the short term (immediate) and long-term (average 4 months). Sixty-five students completed the training and testing. There were no differences in demographics of age or gender within IT or ET distributions. Both short-term and long-term learning retention of spinal anaesthesia ET feedback proved to be better (P feedback. The time taken for ET students was shorter at long-term testing. End-task feedback improves both short-term and long-term procedural learning retention.
Energy Technology Data Exchange (ETDEWEB)
1992-03-01
The objective of Task 5 (Operation of Pressurized Fluidized-Bed Hydro-Retorting (PFH) on Beneficiated Shale) was to modify the PFH process to facilitate its use for fine-sized, beneficiated Eastern shales. This task was divided into 3 subtasks: Non-Reactive Testing, Reactive Testing, and Data Analysis and Correlations. The potential environment impacts of PFH processing of oil shale must be assessed throughout the development program to ensure that the appropriate technologies are in place to mitigate any adverse effects. The overall objectives of Task 6 (Environmental Data and Mitigation Analyses) were to obtain environmental data relating to PFH and shale beneficiation and to analyze the potential environmental impacts of the integrated PFH process. The task was divided into the following four subtasks. Characterization of Processed Shales (IGT), 6.2. Water Availability and Treatment Studies, 6.3. Heavy Metals Removal and 6.4. PFH Systems Analysis. The objective of Task 7 (Sample Procurement, Preparation, and Characterization) was to procure, prepare, and characterize raw and beneficiated bulk samples of Eastern oil shale for all of the experimental tasks in the program. Accomplishments for these tasks are presented.
Survival Processing and the Stroop Task
Stephanie A. Kazanas; Kendra M. Van Valkenburg; Jeanette Altarriba
2015-01-01
This study was designed to investigate the impact of survival processing with a novel task for this paradigm: the Stroop color-naming task. As the literature is mixed with regard to task generalizability, with survival processing promoting better memory for words, but not better memory for faces or paired associates, these types of task investigations are important to a growing field of research. Using the Stroop task provides a unique contribution, as identifying items by color is an importa...
Vliegenthart, J.F.G.; Vleugel, D.J.M. van der; Zwikker, J.W.; Boeckel, S.A.A. van; Boom, J.H. van
1982-01-01
Silver triflate-promoted condensation of methyl 5-acetamido-4,7,8,9-tetra-O-acetyl-2-chloro-2,3,5-trideoxy-β-D-glycero-D-galacto -2-nonulopyranosonate (9) with benzyl-2-acetamido-2-deoxy-3,4-O-(1,1,3,3-tetraisopropyldisiloxane-1,3-diyl)-α-D-glucopyranoside, followed by removal of the
Guo, Hongming; Zhou, Heng; Zhang, Jing; Guan, Wenxue; Xu, Sheng; Shen, Wenbiao; Xu, Guohua; Xie, Yanjie; Foyer, Christine Helen
2017-09-01
Previous studies revealed that rice heme oxygenase PHOTOPERIOD SENSITIVITY 5 (OsSE5) is involved in the regulation of tolerance to excess ammonium by enhancing antioxidant defence. In this study, the relationship between OsSE5 and hydrogen sulfide (H 2 S), a well-known signalling molecule, was investigated. Results showed that NH 4 Cl triggered the induction of l-cysteine desulfhydrase (l-DES)-related H 2 S production in rice seedling roots. A H 2 S donor not only alleviated the excess ammonium-triggered inhibition of root growth but also reduced endogenous ammonium, both of which were aggravated by hypotaurine (HT, a H 2 S scavenger) or dl-propargylglycine (PAG, a l-DES inhibitor). Nitrogen metabolism-related enzymes were activated by H 2 S, thus resulting in the induction of amino acid synthesis and total nitrogen content. Interestingly, the activity of l-DES, as well as the enzymes involved in nitrogen metabolism, was significantly increased in the OsSE5-overexpression line (35S:OsSE5), whereas it impaired in the OsSE5-knockdown mutant (OsSE5-RNAi). The application of the HT/PAG or H 2 S donor could differentially block or rescue NH 4 Cl-hyposensitivity or hypersensitivity phenotypes in 35S:OsSE5-1 or OsSE5-RNAi-1 plants, with a concomitant modulation of nitrogen assimilation. Taken together, these results illustrated that H 2 S function as an indispensable positive regulator participated in OsSE5-promoted ammonium tolerance, in which nitrogen metabolism was facilitated. © 2017 John Wiley & Sons Ltd.
Change Best.Task 2.1. National Report on the Energy Efficiency Service Business in the Netherlands
International Nuclear Information System (INIS)
Boonekamp, P.; Vethman, P.
2009-11-01
The aim of the Change Best project is to promote the development of an energy efficiency service (EES) market and to give good practice examples of changes in energy service business, strategies, and supportive policies and measures in the course of the implementation of Directive 2006/32/EC on Energy End-Use Efficiency and Energy Services. This report addresses Task 2.1: National Report on the Energy Efficiency Service Business in the Netherlands. More information can be found on the website of Change Best at www.changebest.eu.
Zhu, Frank F; Yeung, Andrew Y; Poolton, Jamie M; Lee, Tatia M C; Leung, Gilberto K K; Masters, Rich S W
2015-01-01
Implicit motor learning is characterized by low dependence on working memory and stable performance despite stress, fatigue, or multi-tasking. However, current paradigms for implicit motor learning are based on behavioral interventions that are often task-specific and limited when applied in practice. To investigate whether cathodal transcranial direct current stimulation (tDCS) over the left dorsolateral prefrontal cortex (DLPFC) area during motor learning suppressed working memory activity and reduced explicit verbal-analytical involvement in movement control, thereby promoting implicit motor learning. Twenty-seven healthy individuals practiced a golf putting task during a Training Phase while receiving either real cathodal tDCS stimulation over the left DLPFC area or sham stimulation. Their performance was assessed during a Test phase on another day. Verbal working memory capacity was assessed before and after the Training Phase, and before the Test Phase. Compared to sham stimulation, real stimulation suppressed verbal working memory activity after the Training Phase, but enhanced golf putting performance during the Training Phase and the Test Phase, especially when participants were required to multi-task. Cathodal tDCS over the left DLPFC may foster implicit motor learning and performance in complex real-life motor tasks that occur during sports, surgery or motor rehabilitation. Copyright © 2015 Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Jelsøe, Erling; Thualagant, Nicole; Holm, Jesper
2018-01-01
Based on previous studies and reflections collected from participants in a workshop at the 8th Nordic Health Promotion Research Network conference, we reveal current tendencies and discuss future challenges for health promotion research regarding integration of sustainable development principles....... Despite obvious interfaces and interactions between the two, our contention is that strategies for health promotion are not sufficiently integrated with strategies for sustainable development and that policies aimed at solving health or sustainability problems may therefore cause new, undesired...... and unforeseen environmental and health problems. As illustrated in previous research and as deliberated in the above-mentioned workshop, a number of barriers are identified: these are believed to be related to historical segregation, the conceptual understandings of health promotion and sustainable development...
Negative effect of the 5'-untranslated leader sequence on Ac transposon promoter expression.
Scortecci, K C; Raina, R; Fedoroff, N V; Van Sluys, M A
1999-08-01
Transposable elements are used in heterologous plant hosts to clone genes by insertional mutagenesis. The Activator (Ac) transposable element has been cloned from maize, and introduced into a variety of plants. However, differences in regulation and transposition frequency have been observed between different host plants. The cause of this variability is still unknown. To better understand the activity of the Ac element, we analyzed the Ac promoter region and its 5'-untranslated leader sequence (5' UTL). Transient assays in tobacco NT1 suspension cells showed that the Ac promoter is a weak promoter and its activity was localized by deletion analyses. The data presented here indicate that the core of the Ac promoter is contained within 153 bp fragment upstream to transcription start sites. An important inhibitory effect (80%) due to the presence of the 5' UTL was found on the expression of LUC reporter gene. Here we demonstrate that the presence of the 5' UTL in the constructs reduces the expression driven by either strong or weak promoters.
Directory of Open Access Journals (Sweden)
Lingyu Zhao
2017-02-01
Full Text Available Methyl-CpG binding protein 2 (MeCP2 has recently been characterized as an oncogene frequently amplified in several types of cancer. However, its precise role in gastric cancer (GC and the molecular mechanism of MeCP2 regulation are still largely unknown. Here we report that MeCP2 is highly expressed in primary GC tissues and the expression level is correlated with the clinicopathologic features of GC. In our experiments, knockdown of MeCP2 inhibited tumor growth. Molecular mechanism of MeCP2 regulation was investigated using an integrated approach with combination of microarray analysis and chromatin immunoprecipitation sequencing (ChIP-Seq. The results suggest that MeCP2 binds to the methylated CpG islands of FOXF1 and MYOD1 promoters and inhibits their expression at the transcription level. Furthermore, we show that MeCP2 promotes GC cell proliferation via FOXF1-mediated Wnt5a/β-Catenin signaling pathway and suppresses apoptosis through MYOD1-mediated Caspase-3 signaling pathway. Due to its high expression level in GC and its critical function in driving GC progression, MeCP2 represents a promising therapeutic target for GC treatment.
International Nuclear Information System (INIS)
Glauert, Howard P.; Tharappel, Job C.; Banerjee, Subhashis; Chan, Nelson L.S.; Kania-Korwel, Izabela; Lehmler, Hans-Joachim; Lee, Eun Y.; Robertson, Larry W.; Spear, Brett T.
2008-01-01
Polychlorinated biphenyls (PCBs) are persistent and ubiquitous environmental chemicals that bioaccumulate and have hepatic tumor promoting activity in rodents. The present study examined the effect of deleting the p50 subunit of NF-κB on the hepatic tumor promoting activity of 2,2',4,4',5,5'-hexachlorobiphenyl (PCB-153) in mice. Both wild-type and p50-/- male mice were injected i.p. with diethylnitrosamine (DEN, 90 mg/kg) and then subsequently injected biweekly with 20 i.p. injections of PCB-153 (300 μmol/kg/injection). p50 deletion decreased the tumor incidence in both PCB- and vehicle-treated mice, whereas PCB-153 slightly (P = 0.09) increased the tumor incidence in wild-type and p50-/- mice. PCB-153 increased the total tumor volume in both wild-type and p50-/- mice, but the total tumor volume was not affected by p50 deletion in either PCB- or vehicle-treated mice. The volume of tumors that were positive for glutamine synthetase (GS), which is indicative of mutations in the beta-catenin gene, was increased in both wild-type and p50-/- mice administered PCB-153 compared to vehicle controls, and inhibited in p50-/- mice compared to wild-type mice (in both PCB- and vehicle-treated mice). The volume of tumors that were negative for GS was increased in p50-/- mice compared to wild-type mice but was not affected by PCB-153. PCB-153 increased cell proliferation in normal hepatocytes in wild-type but not p50-/- mice; this increase was inhibited in p50-/- mice. In hepatic tumors, the rate of cell proliferation was much higher than in normal hepatocytes, but was not affected by PCB treatment or p50 deletion. The rate of apoptosis, as measured by the TUNEL assay, was not affected by PCB-153 or p50 deletion in normal hepatocytes. In hepatic tumors, the rate of apoptosis was lower than in normal hepatocytes; PCB-153 slightly (P = 0.10) increased apoptosis in p50-/- but not wild-type mice; p50 deletion had no effect. Taken together, these data indicate that the absence of
TRESK potassium channel in human T lymphoblasts
International Nuclear Information System (INIS)
Sánchez-Miguel, Dénison Selene; García-Dolores, Fernando; Rosa Flores-Márquez, María; Delgado-Enciso, Iván; Pottosin, Igor; Dobrovinskaya, Oxana
2013-01-01
Highlights: • TRESK (KCNK18) mRNA is present in different T lymphoblastic cell lines. • KCNK18 mRNA was not found in resting peripheral blood lymphocytes. • Clinical samples of T lymphoblastic leukemias and lymphomas were positive for TRESK. • TRESK in T lymphoblasts has dual localization, in plasma membrane and intracellular. -- Abstract: TRESK (TWIK-related spinal cord K + ) channel, encoded by KCNK18 gene, belongs to the double-pore domain K + channel family and in normal conditions is expressed predominantly in the central nervous system. In our previous patch-clamp study on Jurkat T lymphoblasts we have characterized highly selective K + channel with pharmacological profile identical to TRESK. In the present work, the presence of KCNK18 mRNA was confirmed in T lymphoblastic cell lines (Jurkat, JCaM, H9) but not in resting peripheral blood lymphocytes of healthy donors. Positive immunostaining for TRESK was demonstrated in lymphoblastic cell lines, in germinal centers of non-tumoral lymph nodes, and in clinical samples of T acute lymphoblastic leukemias/lymphomas. Besides detection in the plasma membrane, intracellular TRESK localization was also revealed. Possible involvement of TRESK channel in lymphocyte proliferation and tumorigenesis is discussed
TRESK potassium channel in human T lymphoblasts
Energy Technology Data Exchange (ETDEWEB)
Sánchez-Miguel, Dénison Selene, E-mail: amurusk@hotmail.com [Center for Biomedical Research, University of Colima, Av. 25 de Julio 965, Villa San Sebastian, C.P. 28045 Colima (Mexico); García-Dolores, Fernando, E-mail: garciaddf@yahoo.com [Department of Pathology, Institute of Forensic Sciences, Av. Niños Héroes 130, Col. Doctores, C.P. 06720 Mexico, DF (Mexico); Rosa Flores-Márquez, María, E-mail: mariafo31@yahoo.com.mx [National Medical Center of Occident (CMNO) IMSS, Belisario Dominguez 735, Col. Independencia Oriente, C.P. 44340 Guadalajara, Jalisco (Mexico); Delgado-Enciso, Iván [University of Colima, School of Medicine, Av. Universidad 333, Col. Las Viboras, C.P. 28040 Colima (Mexico); Pottosin, Igor, E-mail: pottosin@ucol.mx [Center for Biomedical Research, University of Colima, Av. 25 de Julio 965, Villa San Sebastian, C.P. 28045 Colima (Mexico); Dobrovinskaya, Oxana, E-mail: oxana@ucol.mx [Center for Biomedical Research, University of Colima, Av. 25 de Julio 965, Villa San Sebastian, C.P. 28045 Colima (Mexico)
2013-05-03
Highlights: • TRESK (KCNK18) mRNA is present in different T lymphoblastic cell lines. • KCNK18 mRNA was not found in resting peripheral blood lymphocytes. • Clinical samples of T lymphoblastic leukemias and lymphomas were positive for TRESK. • TRESK in T lymphoblasts has dual localization, in plasma membrane and intracellular. -- Abstract: TRESK (TWIK-related spinal cord K{sup +}) channel, encoded by KCNK18 gene, belongs to the double-pore domain K{sup +} channel family and in normal conditions is expressed predominantly in the central nervous system. In our previous patch-clamp study on Jurkat T lymphoblasts we have characterized highly selective K{sup +} channel with pharmacological profile identical to TRESK. In the present work, the presence of KCNK18 mRNA was confirmed in T lymphoblastic cell lines (Jurkat, JCaM, H9) but not in resting peripheral blood lymphocytes of healthy donors. Positive immunostaining for TRESK was demonstrated in lymphoblastic cell lines, in germinal centers of non-tumoral lymph nodes, and in clinical samples of T acute lymphoblastic leukemias/lymphomas. Besides detection in the plasma membrane, intracellular TRESK localization was also revealed. Possible involvement of TRESK channel in lymphocyte proliferation and tumorigenesis is discussed.
DECOVALEX II PROJECT. Technical report - Task 2A and 2B. (Revised edition)
International Nuclear Information System (INIS)
Lanru Jing; Stephansson, Ove
1998-08-01
DECOVALEX II project started in November 1995 as a continuation of the DECOVALEX I project, which was completed at the end of 1994. The project was initiated by recognizing the fact that a proper evaluation of the current capacities of numerical modelling of the coupled T-H-M processes in fractured media is needed not only for small scale, well controlled laboratory test cases such as those studied in DECOVALEX 1, but also for less characterised, more complex and realistic in-situ experiments. This will contribute to validation and confidence building in the current mathematical models, numerical methods and computer codes. Four tasks were defined in the DECOVALEX II project: TASK 1 - numerical study of the RCF3 pumping test and shaft excavation at Sellafield by Nirex, UK; TASK 2 - numerical study of the in-situ T-H-M experiments at Kamaishi Mine by PNC, Japan; TASK 3 - review of current state-of-the-art of rock joint research and TASK 4 - report on the coupled T-H-M issues related to repository design and performance assessment. This report is one of the technical reports of the DECOVALEX II project, describing the work performed for TASK 2A and 2B - the predictions and model calibration for the hydro-mechanical effect of the excavation of the test pit for the in-situ T-H-M experiments at Kamaishi Mine by PNC, Japan. Presented in this report are the descriptions of the project, definition of Task 2, and approaches, methods and results of numerical modelling work carried out by the research teams. The report is a summary of the research reports written by the research teams and the discussions held during project workshops and task force group meetings. The opinions and conclusions in this report, however, reflect only ideas of the authors, not necessarily a collective representation of the funding organisations of the project
Meneses, Alfredo
2002-05-01
Recent studies using invertebrate and mammal species have revealed that, endogenous serotonin (5-hydroxytryptamine, 5-HT) modulates cognitive processes, particularly learning and memory, though, at present, it is unclear the manner, where, and how long 5-HT systems are involved. Hence in this work, an attempt was made to study the effects of 5-HT endogenous on memory formation, using a 5-HT uptake facilitator (tianeptine) and, selective 5-HT(1-7) receptor antagonists to determine whether 5-HT uptake sites and which 5-HT receptors are involved, respectively. Results showed that post-training tianeptine injection enhanced memory consolidation in an autoshaping Pavlovian/instrumental learning task, which has been useful to detect changes on memory formation elicited by drugs or aging. On interaction experiments, ketanserin (5-HT(1D/2A/2C) antagonist) slightly enhanced tianeptine effects, while WAY 100635 (5-HT(1A) antagonist), SB-224289 (5-HT(1B) inverse agonist), SB-200646 (5-HT(2B/2C) antagonist), ondansetron (5-HT(3) antagonist), GR 127487 (5-HT(4) antagonist), Ro 04-6790 (5-HT(6) antagonist), DR 4004 (5-HT(7) antagonist), or fluoxetine (an inhibitor of 5-HT reuptake) blocked the facilitatory tianeptine effect. Notably, together tianeptine and Ro 04-6790 impaired learning consolidation. Moreover, 5-HT depletion completely reversed the tianeptine effect. Tianeptine also normalized an impaired memory elicited by scopolamine (an antimuscarinic) or dizocilpine (non-competitive glutamatergic antagonist), while partially reversed that induced by TFMPP (5-HT(1B/1D/2A-2C/7) agonist/antagonist). Finally, tianeptine-fluoxetine coadministration had no effect on learning consolidation; nevertheless, administration of an acetylcholinesterase inhibitor, phenserine, potentiated subeffective tianeptine or fluoxetine doses. Collectively, these data confirmed that endogenously 5-HT modulates, via uptake sites and 5-HT(1-7) receptors, memory consolidation, and are consistent with the
International Nuclear Information System (INIS)
Liu, Cheng-Der; Cheng, Chi-Ping; Fang, Jia-Shih; Chen, Ling-Chih; Zhao, Bo; Kieff, Elliott; Peng, Chih-Wen
2013-01-01
Highlights: ► Catalytic active PRMT5 substantially binds to the EBNA2 RG domain. ► PRMT5 augments the EBNA2-dependent transcription. ► PRMT5 triggers the symmetric dimethylation of the EBNA2 RG domain. ► PRMT5 enhances the promoter occupancy of EBNA2 on its target promoters. -- Abstract: Epstein–Barr Virus Nuclear Antigen (EBNA) 2 features an Arginine–Glycine repeat (RG) domain at amino acid positions 335–360, which is a known target for protein arginine methyltransferaser 5 (PRMT5). In this study, we performed protein affinity pull-down assays to demonstrate that endogenous PRMT5 derived from lymphoblastoid cells specifically associated with the protein bait GST-E2 RG. Transfection of a plasmid expressing PRMT5 induced a 2.5- to 3-fold increase in EBNA2-dependent transcription of both the LMP1 promoter in AKATA cells, which contain the EBV genome endogenously, and a Cp-Luc reporter plasmid in BJAB cells, which are EBV negative. Furthermore, we showed that there was a 2-fold enrichment of EBNA2 occupancy in target promoters in the presence of exogenous PRMT5. Taken together, we show that PRMT5 triggers the symmetric dimethylation of EBNA2 RG domain to coordinate with EBNA2-mediated transcription. This modulation suggests that PRMT5 may play a role in latent EBV infection
Energy Technology Data Exchange (ETDEWEB)
Liu, Cheng-Der; Cheng, Chi-Ping; Fang, Jia-Shih; Chen, Ling-Chih [Department of Life Sciences, Tzu-Chi University, 701 Chung-Yang Rd. Sec 3, Hualien 97004, Taiwan (China); Zhao, Bo; Kieff, Elliott [Department of Medicine and Microbiology and Molecular Genetics, Channing Laboratory, Brigham and Women’s Hospital and Harvard Medical School, 181 Longwood Ave., Boston 02115, MA (United States); Peng, Chih-Wen, E-mail: pengcw@mail.tcu.edu.tw [Department of Life Sciences, Tzu-Chi University, 701 Chung-Yang Rd. Sec 3, Hualien 97004, Taiwan (China)
2013-01-18
Highlights: ► Catalytic active PRMT5 substantially binds to the EBNA2 RG domain. ► PRMT5 augments the EBNA2-dependent transcription. ► PRMT5 triggers the symmetric dimethylation of the EBNA2 RG domain. ► PRMT5 enhances the promoter occupancy of EBNA2 on its target promoters. -- Abstract: Epstein–Barr Virus Nuclear Antigen (EBNA) 2 features an Arginine–Glycine repeat (RG) domain at amino acid positions 335–360, which is a known target for protein arginine methyltransferaser 5 (PRMT5). In this study, we performed protein affinity pull-down assays to demonstrate that endogenous PRMT5 derived from lymphoblastoid cells specifically associated with the protein bait GST-E2 RG. Transfection of a plasmid expressing PRMT5 induced a 2.5- to 3-fold increase in EBNA2-dependent transcription of both the LMP1 promoter in AKATA cells, which contain the EBV genome endogenously, and a Cp-Luc reporter plasmid in BJAB cells, which are EBV negative. Furthermore, we showed that there was a 2-fold enrichment of EBNA2 occupancy in target promoters in the presence of exogenous PRMT5. Taken together, we show that PRMT5 triggers the symmetric dimethylation of EBNA2 RG domain to coordinate with EBNA2-mediated transcription. This modulation suggests that PRMT5 may play a role in latent EBV infection.
Directory of Open Access Journals (Sweden)
Pramudji Hastuti
2011-10-01
Full Text Available Background: Obesity among adults has risen significantly in the world-cutting across all ages, racial and ethnic groups and gender. The 5-HT 2A receptor is crucially involved in regulation of body weight and the appetite. Disturbances in the distribution and or gene regulation of the postsynaptic 5-HT2A receptor are implicated in the pathophysiology of conditions such as obesity, coronary heart disease, high blood pressure, diabetes, stroke dan some cancers. Objective: To test the association between obesity with polymorphism of promoter -1438G→A 5-HT2A receptors gene, blood pressure, lipid profiles, levels of blood glucose and malondialdehyde (MDA. Method: This cross-sectional study included thirty six unrelated obese young people (BMI ≥ 30 recruited from populations in Yogyakarta and 36 controls with age matched with BMI ≤ 25. Statistical differences between blood pressure, lipid profiles, glucose and MDA levels were assessed by t-test and genotypes by Chi square test. Results: There were no significant difference in blood pressure lipid profile, level of glucose and MDA in obese group compared with control (p>0,05. Allele A and G frequency in obese group 25% and 75% respectively, and controls 22.2% and 77.8% respectively, and no significant difference in all two groups, but G allele had higher risk to obese than A allele. Conclusion: These data indicated G allele was mild risk factor for obesity.
The Multi-Feature Hypothesis: Connectionist Guidelines for L2 Task Design
Moonen, Machteld; de Graaff, Rick; Westhoff, Gerard; Brekelmans, Mieke
2014-01-01
This study focuses on the effects of task type on the retention and ease of activation of second language (L2) vocabulary, based on the multi-feature hypothesis (Moonen, De Graaff, & Westhoff, 2006). Two tasks were compared: a writing task and a list-learning task. It was hypothesized that performing the writing task would yield higher…
CD5L Promotes M2 Macrophage Polarization through Autophagy-Mediated Upregulation of ID3
Directory of Open Access Journals (Sweden)
Lucía Sanjurjo
2018-03-01
Full Text Available CD5L (CD5 molecule-like is a secreted glycoprotein that controls key mechanisms in inflammatory responses, with involvement in processes such as infection, atherosclerosis, and cancer. In macrophages, CD5L promotes an anti-inflammatory cytokine profile in response to TLR activation. In the present study, we questioned whether CD5L is able to influence human macrophage plasticity, and drive its polarization toward any specific phenotype. We compared CD5L-induced phenotypic and functional changes to those caused by IFN/LPS, IL4, and IL10 in human monocytes. Phenotypic markers were quantified by RT-qPCR and flow cytometry, and a mathematical algorithm was built for their analysis. Moreover, we compared ROS production, phagocytic capacity, and inflammatory responses to LPS. CD5L drove cells toward a polarization similar to that induced by IL10. Furthermore, IL10- and CD5L-treated macrophages showed increased LC3-II content and colocalization with acidic compartments, thereby pointing to the enhancement of autophagy-dependent processes. Accordingly, siRNA targeting ATG7 in THP1 cells blocked CD5L-induced CD163 and Mer tyrosine kinase mRNA and efferocytosis. In these cells, gene expression profiling and validation indicated the upregulation of the transcription factor ID3 by CD5L through ATG7. In agreement, ID3 silencing reversed polarization by CD5L. Our data point to a significant contribution of CD5L-mediated autophagy to the induction of ID3 and provide the first evidence that CD5L drives macrophage polarization.
Directory of Open Access Journals (Sweden)
Simon R O Nilsson
Full Text Available Cognitive flexibility can be assessed in reversal learning tests, which are sensitive to modulation of 5-HT2C receptor (5-HT2CR function. Successful performance in these tests depends on at least two dissociable cognitive mechanisms which may separately dissipate associations of previous positive and negative valence. The first is opposed by perseverance and the second by learned non-reward. The current experiments explored the effect of reducing function of the 5-HT2CR on the cognitive mechanisms underlying egocentric reversal learning in the mouse. Experiment 1 used the 5-HT2CR antagonist SB242084 (0.5 mg/kg in a between-groups serial design and Experiment 2 used 5-HT2CR KO mice in a repeated measures design. Animals initially learned to discriminate between two egocentric turning directions, only one of which was food rewarded (denoted CS+, CS-, in a T- or Y-maze configuration. This was followed by three conditions; (1 Full reversal, where contingencies reversed; (2 Perseverance, where the previous CS+ became CS- and the previous CS- was replaced by a novel CS+; (3 Learned non-reward, where the previous CS- became CS+ and the previous CS+ was replaced by a novel CS-. SB242084 reduced perseverance, observed as a decrease in trials and incorrect responses to criterion, but increased learned non-reward, observed as an increase in trials to criterion. In contrast, 5-HT2CR KO mice showed increased perseverance. 5-HT2CR KO mice also showed retarded egocentric discrimination learning. Neither manipulation of 5-HT2CR function affected performance in the full reversal test. These results are unlikely to be accounted for by increased novelty attraction, as SB242084 failed to affect performance in an unrewarded novelty task. In conclusion, acute 5-HT2CR antagonism and constitutive loss of the 5-HT2CR have opposing effects on perseverance in egocentric reversal learning in mice. It is likely that this difference reflects the broader impact of 5HT2CR loss
Matador: final report of task 2
Hendriksen, P.; Riemersma, I.J.; Rijkeboer, R.C.; Rondel, M.; Schmal, D.; Smokers, R.T.M.
2000-01-01
In Task 2 of the MATADOR-project1 measurement methods have been developed for the evaluation of the energy consumption and emissions of vehicles with advanced propulsion systems, such as battery-electric, hybrid-electric and fuel cell vehicles. Based on an inventory of existing and prospective
TMI-2 [Three Mile Island Unit 2] reactor building dose reduction task force
International Nuclear Information System (INIS)
Daniels, R.S.
1988-01-01
In late October 1982, the director of Three Mile Island Unit 2 (TMI-2) created the dose reduction task force with the objective of identifying the principal radiological sources in the reactor building and recommending actions to minimize the dose to workers on labor-intensive projects. Members of the task force were drawn form various groups at TMI. Findings and recommendations were presented to the US Nuclear Regulatory Commission in a briefing on November 18, 1982. The task force developed a three-step approach toward dose reduction. Step 1 identified the radiological sources. Step 2 modeled the source and estimated its contribution to the general area dose rates. Step 3 recommended actions to achieve dose reductions consistent with general exposure rate goals
Freeze drying synthesis of LiNi0.5Mn0.5O2 cathode materials
International Nuclear Information System (INIS)
Shlyakhtin, O.A.; Yoon, Young Soo; Choi, Sun Hee; Oh, Young-Jei
2004-01-01
The influence of several processing conditions on the phase formation and electrochemical performance of LiNi 0.5 Mn 0.5 O 2 powders, obtained by freeze drying method, is studied. Thermal processing in pellets at maximum heating rate promotes better crystallographic ordering of hexagonal LiNi 0.5 Mn 0.5 O 2 and maximum capacity values irrespectively of chemical composition of the precursor. Instead, intense mechanical processing of precursors exerts considerable negative effect on the electrochemical performance. Cathode materials containing superstoichiometric amount of lithium (Li 1.3 Mn 0.5 Ni 0.5 O 2+δ ) demonstrate reversible capacity values up to 190 mAh/g between 2.5 and 4.6 V
Electrochemical study on the cationic promotion of the catalytic SO2 oxidation in pyrosulfate melts
DEFF Research Database (Denmark)
Petrushina, Irina; Bjerrum, Niels; Cappeln, Frederik Vilhelm
1998-01-01
The electrochemical behavior of the molten V2O5-M2S2O7 (M = K, Cs, or Na) system was studied using a gold working electrode at 440 degrees C in argon and air atmosphere. The aim of the present investigation was to find a possible correlation between the promoting effect of Cs+ and Na+ ions...... on the catalytic oxidation of SO2 in the V2O5-M2S2O7 system and the effect of these alkali cations on the electrochemical behavior of V2O5 in the alkali pyrosulfate melts It has been shown that Na+ ions had a promoting effect on the V(V) reversible arrow V(IV) electrochemical reaction. Sodium ions accelerate both...... in the catalytic SO, oxidation most likely is the oxidation of V(IV) to V(V) and the Na+ and Cs+ promoting effect is based on the acceleration of this stage. It has also been proposed that voltammetric measurements can be used for fast optimization of the composition of the vanadium catalyst (which...
[Inactivation of PMS2 gene by promoter methylation in nasopharyngeal carcinoma].
Ni, H F; Jiang, B; Zhou, Z; Li, Y; Yuan, X Y; Cao, X L; Huang, G W
2016-11-23
Objective: To investigate the inactivation of PMS2 gene mediated by promoter methylation and its regulatory mechanism in nasopharyngeal carcinoma (NPC). Methods: Fifty-four NPC tissues, 16 normal nasopharyngeal epithelia (NNE), 5 NPC cell lines (CNE1, CNE2, TWO3, HNE1 and HONE1) and 1 normal nasopharyngeal epithelial cell line (NP69) were collected.Methylation-specific PCR (MSP) was used to detect the PMS2 promoter methylation, semi-quantitative reverse transcription PCR (qRT-PCR) was applied to determine its mRNA expression, and immunohistochemistry (IHC) was used to detect the protein expression of PMS2. The expressions of PMS2 mRNA in CNE1 and CNE2 cells before and after treated with methyltransferase inhibitor 5-aza-2-deoxycytidine were analyzed by qRT-PCR. The impact of methylation and demethylation on the mRNA expression of PMS2, and the association of mRNA and protein expression of PMS2 with clinicopathological features of nasopharyngeal cancer were analyzed. Results: Methylation of PMS2 gene was detected in all of the five NPC cell lines, but not in normal nasopharyngeal epithelial NP69 cells. The methylation rate of PMS2 gene in NPC tissues was 63% (34/54), significantly higher than that of the normal nasopharyngeal epithelia (0/16, P PMS2 mRNA and protein were significantly down-regulated in the 54 NPC tissues when compared with those in the 16 NNE tissues ( P PMS2 mRNA was restored in the CNE1 and CNE2 cells.However, the expressions of PMS2 mRNA and protein were not significantly correlated with patients' age, gender, TNM stage, histopathologic type or lymph node metastasis ( P >0.05 for all). Conclusions: Promoter methylation-mediated inactivation of PMS2 gene participates in carcinogenesis and development of NPC. PMS2 may be a candidate tumor suppressor in the treatment for patients with inactivation of PMS2 promoter methylation.
Task-specific impairments and enhancements induced by magnetic stimulation of human visual area V5.
Walsh, V; Ellison, A; Battelli, L; Cowey, A
1998-03-22
Transcranial magnetic stimulation (TMS) can be used to simulate the effects of highly circumscribed brain damage permanently present in some neuropsychological patients, by reversibly disrupting the normal functioning of the cortical area to which it is applied. By using TMS we attempted to recreate deficits similar to those reported in a motion-blind patient and to assess the specificity of deficits when TMS is applied over human area V5. We used six visual search tasks and showed that subjects were impaired in a motion but not a form 'pop-out' task when TMS was applied over V5. When motion was present, but irrelevant, or when attention to colour and form were required, TMS applied to V5 enhanced performance. When attention to motion was required in a motion-form conjunction search task, irrespective of whether the target was moving or stationary, TMS disrupted performance. These data suggest that attention to different visual attributes involves mutual inhibition between different extrastriate visual areas.
Task type and incidental L2 vocabulary learning: Repetition versus ...
African Journals Online (AJOL)
This study investigated the effect of task type on incidental L2 vocabulary learning. The different tasks investigated in this study differed in terms of repetition of encounters and task involvement load. In a within-subjects design, 72 Iranian learners of English practised 18 target words in three exercise conditions: three ...
Human factors evaluation of teletherapy: Function and task analysis. Volume 2
Energy Technology Data Exchange (ETDEWEB)
Kaye, R.D.; Henriksen, K.; Jones, R. [Hughes Training, Inc., Falls Church, VA (United States); Morisseau, D.S.; Serig, D.I. [Nuclear Regulatory Commission, Washington, DC (United States). Div. of Systems Technology
1995-07-01
As a treatment methodology, teletherapy selectively destroys cancerous and other tissue by exposure to an external beam of ionizing radiation. Sources of radiation are either a radioactive isotope, typically Cobalt-60 (Co-60), or a linear accelerator. Records maintained by the NRC have identified instances of teletherapy misadministration where the delivered radiation dose has differed from the radiation prescription (e.g., instances where fractions were delivered to the wrong patient, to the wrong body part, or were too great or too little with respect to the defined treatment volume). Both human error and machine malfunction have led to misadministrations. Effective and safe treatment requires a concern for precision and consistency of human-human and human-machine interactions throughout the course of therapy. The present study is the first part of a series of human factors evaluations for identifying the root causes that lead to human error in the teletherapy environment. The human factors evaluations included: (1) a function and task analysis of teletherapy activities, (2) an evaluation of the human-system interfaces, (3) an evaluation of procedures used by teletherapy staff, (4) an evaluation of the training and qualifications of treatment staff (excluding the oncologists), (5) an evaluation of organizational practices and policies, and (6) an identification of problems and alternative approaches for NRC and industry attention. The present report addresses the function and task analysis of teletherapy activities and provides the foundation for the conduct of the subsequent evaluations. The report includes sections on background, methodology, a description of the function and task analysis, and use of the task analysis findings for the subsequent tasks. The function and task analysis data base also is included.
Human factors evaluation of teletherapy: Function and task analysis. Volume 2
International Nuclear Information System (INIS)
Kaye, R.D.; Henriksen, K.; Jones, R.; Morisseau, D.S.; Serig, D.I.
1995-07-01
As a treatment methodology, teletherapy selectively destroys cancerous and other tissue by exposure to an external beam of ionizing radiation. Sources of radiation are either a radioactive isotope, typically Cobalt-60 (Co-60), or a linear accelerator. Records maintained by the NRC have identified instances of teletherapy misadministration where the delivered radiation dose has differed from the radiation prescription (e.g., instances where fractions were delivered to the wrong patient, to the wrong body part, or were too great or too little with respect to the defined treatment volume). Both human error and machine malfunction have led to misadministrations. Effective and safe treatment requires a concern for precision and consistency of human-human and human-machine interactions throughout the course of therapy. The present study is the first part of a series of human factors evaluations for identifying the root causes that lead to human error in the teletherapy environment. The human factors evaluations included: (1) a function and task analysis of teletherapy activities, (2) an evaluation of the human-system interfaces, (3) an evaluation of procedures used by teletherapy staff, (4) an evaluation of the training and qualifications of treatment staff (excluding the oncologists), (5) an evaluation of organizational practices and policies, and (6) an identification of problems and alternative approaches for NRC and industry attention. The present report addresses the function and task analysis of teletherapy activities and provides the foundation for the conduct of the subsequent evaluations. The report includes sections on background, methodology, a description of the function and task analysis, and use of the task analysis findings for the subsequent tasks. The function and task analysis data base also is included
Zalbidea, Janire
2017-01-01
The present study explores the independent and interactive effects of task complexity and task modality on linguistic dimensions of second language (L2) performance and investigates how these effects are modulated by individual differences in working memory capacity. Thirty-two intermediate learners of L2 Spanish completed less and more complex…
Wnt5b-associated exosomes promote cancer cell migration and proliferation.
Harada, Takeshi; Yamamoto, Hideki; Kishida, Shosei; Kishida, Michiko; Awada, Chihiro; Takao, Toshifumi; Kikuchi, Akira
2017-01-01
Wnt5b is a member of the same family of proteins as Wnt5a, the overexpression of which is associated with cancer aggressiveness. Wnt5b is also suggested to be involved in cancer progression, however, details remain unclarified. We analyzed the biochemical properties of purified Wnt5b and the mode of secretion of Wnt5b by cancer cells. Wnt5b was glycosylated at three asparagine residues and lipidated at one serine residue, and these post-translational modifications of Wnt5b were essential for secretion. Purified Wnt5b showed Dvl2 phosphorylation and Rac activation abilities to a similar extent as Wnt5a. In cultured-cell conditioned medium, Wnt5b was detected in supernatant or precipitation fractions that were separated by centrifugation at 100 000 g. In PANC-1 pancreatic cancer cells, 55% of secreted endogenous Wnt5b was associated with exosomes. Exosomes from wild-type PANC-1 cells, but not those from Wnt5b-knockout PANC-1 cells, activated Wnt5b signaling in CHO cells and stimulated migration and proliferation of A549 lung adenocarcinoma cells, suggesting that endogenous, Wnt5b-associated exosomes are active. The exosomes were taken up by CHO cells and immunoelectron microscopy revealed that Wnt5b is indeed associated with exosomes. In Caco-2 colon cancer cells, most Wnt5b was recovered in precipitation fractions when Wnt5b was ectopically expressed (Caco-2/Wnt5b cells). Knockdown of TSG101, an exosome marker, decreased the secretion of Wnt5b-associated exosomes from Caco-2/Wnt5b cells and inhibited Wnt5b-dependent cell proliferation. Exosomes secreted from Caco-2/Wnt5b cells stimulated migration and proliferation of A549 cells. These results suggest that Wnt5b-associated exosomes promote cancer cell migration and proliferation in a paracrine manner. © 2016 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.
Comparison of the Kinetic Promoters Piperazine and Carbonic Anhydrase for CO2 Absorption
DEFF Research Database (Denmark)
Gladis, Arne; Gundersen, Maria T.; Thomsen, Kaj
2017-01-01
Kinetic promoter that enhance the reaction kinetics with CO2 are enabling the use of the low heat of reaction of slow absorbing solvents like MDEA. Mass transfer experiments with 30 wt% MDEA promoted by either by 1.7 and 8.5g/L enzyme carbonic anhydrase (CA) or 5 wt% piperazine (PZ) where conduct...
Uittenbogaard, Martine; Martinka, Debra L.; Johnson, Peter F.; Vinson, Charles; Chiaramello, Anne
2009-01-01
Expression of the bHLH transcription factor Nex1/MATH-2/NeuroD6, a member of the NeuroD subfamily, parallels overt neuronal differentiation and synaptogenesis during brain development. Our previous studies have shown that Nex1 is a critical effector of the NGF pathway and promotes neuronal differentiation and survival of PC12 cells in the absence of growth factors. In this study, we investigated the transcriptional regulation of the Nex1 gene during NGF-induced neuronal differentiation. We found that Nex1 expression is under the control of two conserved promoters, Nex1-P1 and Nex1-P2, located in two distinct non-coding exons. Both promoters are TATA-less with multiple transcription start sites, and are activated on NGF or cAMP exposure. Luciferase-reporter assays showed that the Nex1-P2 promoter activity is stronger than the Nex1-P1 promoter activity, which supports the previously reported differential expression levels of Nex1 transcripts throughout brain development. Using a combination of DNaseI footprinting, EMSA assays, and site-directed mutagenesis, we identified the essential regulatory elements within the first 2 kb of the Nex1 5′UTR. The Nex1-P1 promoter is mainly regulated by a conserved CRE element, whereas the Nex1-P2 promoter is under the control of a conserved C/EBP binding site. Overexpression of wild-type C/EBPβ resulted in increased Nex1-P2 promoter activity in NGF-differentiated PC12 cells. The fact that Nex1 is a target gene of C/EBPβ provides new insight into the C/EBP transcriptional cascade known to promote neurogenesis, while repressing gliogenesis. PMID:17075921
International Nuclear Information System (INIS)
Cao, Lu; Wu, Mengchao; Zhang, Ying; Su, Changqing; Li, Chunguang; Shen, Shuwen; Yan, Yan; Ji, Weidan; Wang, Jinghan; Qian, Haihua; Jiang, Xiaoqing; Li, Zhigang
2013-01-01
OCT4 and BIRC5 are preferentially expressed in human cancer cells and mediate cancer cell survival and tumor maintenance. However, the molecular mechanism that regulates OCT4 and BIRC5 expression is not well characterized. By manipulating OCT4 and BIRC5 expression in hepatocellular carcinoma (HCC) cell lines, the regulatory mechanism of OCT4 on BIRC5 and CCND1 were investigated. Increasing or decreasing OCT4 expression could enhance or suppress BIRC5 expression, respectively, by regulating the activity of BIRC5 promoter. Because there is no binding site for OCT4 within BIRC5 promoter, the effect of OCT4 on BIRC5 promoter is indirect. An octamer motif for OCT4 in the CCND1 promoter has directly and partly participated in the regulation of CCND1 promoter activity, suggesting that OCT4 also could upregulated the expression of CCND1. Co-suppression of OCT4 and BIRC5 induced cancer cell apoptosis and cell cycle arrest, thereby efficiently inhibiting the proliferative activity of cancer cells and suppressing the growth of HCC xenogrfts in nude mice. OCT4 can upregulate BIRC5 and CCND1 expression by increasing their promoter activity. These factors collusively promotes HCC cell proliferation, and co-suppression of OCT4 and BIRC5 is potentially beneficial for HCC treatment
Algebra task sheets : grades pk-2
Reed, Nat
2009-01-01
For grades PK-2, our Common Core State Standards-based resource meets the algebraic concepts addressed by the NCTM standards and encourages the students to learn and review the concepts in unique ways. Each task sheet is organized around a central problem taken from real-life experiences of the students.
Geometry task sheets : grades pk-2
Rosenberg, Mary
2009-01-01
For grades PK-2, our Common Core State Standards-based resource meets the geometry concepts addressed by the NCTM standards and encourages the students to learn and review the concepts in unique ways. Each task sheet is organized around a central problem taken from real-life experiences of the students.
A 5A's communication intervention to promote physical activity in underserved populations
Directory of Open Access Journals (Sweden)
Carroll Jennifer K
2012-10-01
Full Text Available Abstract Background The present study protocol describes the trial design of a clinician training intervention to improve physical activity counseling in underserved primary care settings using the 5As. The 5As (Ask, Advise, Agree, Assist, Arrange are a clinical tool recommended for health behavior counseling in primary care. Methods/Design The study is a two-arm randomized pilot pragmatic trial to examine a primary care clinician communication intervention on use of the 5As in discussion of physical activity in audio-recorded office visits in an ethnically diverse, low-income patient population. The study setting consists of two federally qualified community health centers in Rochester, NY. Eligible clinicians (n=15 are recruited and randomized into two groups. Group 1 clinicians participate in the training intervention first; Group 2 clinicians receive the intervention six months later. The intervention and its outcomes are informed by self-determination theory and principles of patient-centered communication. Assessment of outcomes is blinded. The primary outcome will be the frequency and quality of 5As discussions as judged by evaluating 375 audio-recorded patient visits distributed over baseline and in the post-intervention period (immediately post and at six months. Secondary outcomes will be changes in patients’ perceived competence to increase physical activity (Aim 2 and patients and clinicians beliefs regarding whether pertinent barriers to promoting exercise have been reduced. (Aim 3. Exploratory outcomes (Aim 4 are potential mediators of the intervention’s effect and whether the intervention affects actual enrollment in the community program recommended for exercise. The analysis will use repeated measures (in the form of recorded office visits from each clinician at each time point and aggregate measures of Groups 1 and 2 over time. Discussion Results will help elucidate the role of 5As communication training for clinicians on
Task plan for the US Department of Energy TMI-2 programs
International Nuclear Information System (INIS)
1982-10-01
The Task Plan for the US Department of Energy (DOE) Three Mile Island (TMI) Unit 2 Programs identifies the tasks to be planned and administered by the DOE Technical Integration Office (TIO) in a manner which will maximize the use of available resources, obtain the maximum benefit from the opportunities associated with the TMI-2 cleanup effort, and retrieve generically useful information for addressing some of the key problems and issues facing the nuclear power industry. The Plan identifies tasks in three major program areas where DOE has assumed implementation responsibility. The DOE TMI-2 Programs are: Data Acquisition Program, Waste Immobilization Program, and Reactor Evaluation Program. The plan is intended to serve as a management overview by defining the task objective, benefits, and work scope with respect to prioritization of tasks and utilization of resources
The TLR5 ligand flagellin promotes asthma by priming allergic responses to indoor allergens
Wilson, Rhonda H.; Maruoka, Shuichiro; Whitehead, Gregory S.; Foley, Julie F.; Flake, Gordon P.; Sever, Michelle L.; Zeldin, Darryl C.; Kraft, Monica; Garantziotis, Stavros; Nakano, Hideki; Cook, Donald N.
2012-01-01
Allergic asthma is a complex disease characterized by eosinophilic pulmonary inflammation, mucus production and reversible airway obstruction1. Exposure to indoor allergens is a clear risk factor for asthma, but this disease is also associated with high household levels of total and Gram-negative bacteria2. The ability of bacterial products to act as adjuvants3 suggests they might promote asthma by priming allergic sensitization to inhaled allergens. In support of this idea, house dust extracts (HDEs) can activate antigen presenting dendritic cells (DC) in vitro and promote allergic sensitization to inhaled innocuous proteinsin vivo4. It is unknown which microbial products provide most of the adjuvant activity in HDEs. A screen of microbial products for their adjuvant activity in the airway revealed that the bacterial protein, flagellin (FLA) stimulated strong allergic responses to an innocuous inhaled protein. Moreover, toll-like receptor (TLR)5, the mammalian receptor for FLA5,6, was required for priming strong allergic responses to natural indoor allergens present in HDEs. In addition, the incidence of human asthma was associated with high serum levels of FLA-specific antibodies. Together, these findings suggest that household FLA promotes the development of allergic asthma by TLR5-dependent priming of allergic responses to indoor allergens. PMID:23064463
Temple, Aidan
2013-01-01
Filled with practical, step-by-step instructions and clear explanations for the most important and useful tasks. The step-by-step approach taken by this book will show you how to develop a 2D HTML5 platformer-based game that you will be able to publish to multiple devices.This book is great for anyone who has an interest in HTML5 games development, and who already has a basic to intermediate grasp on both the HTML markup and JavaScript programming languages. Therefore, due to this requirement, the book will not discuss the inner workings of either of these languages but will instead attempt to
Bee Venom Promotes Hair Growth in Association with Inhibiting 5α-Reductase Expression.
Park, Seeun; Erdogan, Sedef; Hwang, Dahyun; Hwang, Seonwook; Han, Eun Hye; Lim, Young-Hee
2016-06-01
Alopecia is an important issue that can occur in people of all ages. Recent studies show that bee venom can be used to treat certain diseases including rheumatoid arthritis, neuralgia, and multiple sclerosis. In this study, we investigated the preventive effect of bee venom on alopecia, which was measured by applying bee venom (0.001, 0.005, 0.01%) or minoxidil (2%) as a positive control to the dorsal skin of female C57BL/6 mice for 19 d. Growth factors responsible for hair growth were analyzed by quantitative real-time PCR and Western blot analysis using mice skins and human dermal papilla cells (hDPCs). Bee venom promoted hair growth and inhibited transition from the anagen to catagen phase. In both anagen phase mice and dexamethasone-induced catagen phase mice, hair growth was increased dose dependently compared with controls. Bee venom inhibited the expression of SRD5A2, which encodes a type II 5α-reductase that plays a major role in the conversion of testosterone into dihydrotestosterone. Moreover, bee venom stimulated proliferation of hDPCs and several growth factors (insulin-like growth factor 1 receptor (IGF-1R), vascular endothelial growth factor (VEGF), fibroblast growth factor (FGF)2 and 7) in bee venom-treated hDPCs dose dependently compared with the control group. In conclusion, bee venom is a potentially potent 5α-reductase inhibitor and hair growth promoter.
Directory of Open Access Journals (Sweden)
Manuel Moñino
2016-12-01
Full Text Available Introduction: This article compiles practices promoting fruits and vegetables consumption launched by eight members of AIAM5 - Global Alliance for Promoting Fruits and Vegetables Consumption “5 a day”, with the aim of identifying best practices in the approaching strategies, programs and activities to encourage fruits and vegetables consumption. Material and Methods: A questionnaire designed to categorize and identify strengths, weaknesses, opportunities, cost-effectiveness, feasibility and practices with the greatest potential to adapt to national health promoting policies, was used. Questionnaires from eight countries from AIAM5 were evaluated: Mexico, Chile, Costa Rica, Venezuela, Colombia, Bolivia, Nicaragua and Spain. Results: One of the greatest strengths of the organizations of AIAM5 is the prestige and the professional, technical and academic knowledge that back up their activities. One evident weakness of their strategies is the lack of measuring practices of the impact of the implemented activities, and the evaluation of their cost-effectiveness. It was also observed that some of the entities that carry out the programs “5 a day” are conceived as social enterprises with diverse types of partners and allies. Conclusions: It is recommended that AIAM5 members should make an effort to measure the impact of their activities and interventions by setting quantifiable goals, and using indicators to assess the degree of achievement of the activities carried out. It is also recommended to exploit the niche of opportunities provided by the Corporate Social Responsibility to help them achieve their objectives of promoting fruits and vegetables consumption.
Petric, Bojana; Harwood, Nigel
2013-01-01
This mixed-method study investigates the citation behaviour of a successful L2 postgraduate management student, Sofie, in two pieces of writing, written in response to two assignment tasks in two management modules. The tasks belonged to the same assignment type, but differed in the level of direction provided: one was a directed task, accompanied…
22 CFR 101.2 - Promotion of American interests.
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Promotion of American interests. 101.2 Section... FUNCTIONS § 101.2 Promotion of American interests. Officers of the Foreign Service shall further the.... (g) By taking appropriate steps to facilitate the promotion of such import trade into the United...
DRD2/CHRNA5 interaction on prefrontal biology and physiology during working memory.
Directory of Open Access Journals (Sweden)
Annabella Di Giorgio
Full Text Available BACKGROUND: Prefrontal behavior and activity in humans are heritable. Studies in animals demonstrate an interaction between dopamine D2 receptors and nicotinic acetylcholine receptors on prefrontal behavior but evidence in humans is weak. Therefore, we hypothesize that genetic variation regulating dopamine D2 and nicotinic acetylcholine receptor signaling impact prefrontal cortex activity and related cognition. To test this hypothesis in humans, we explored the interaction between functional genetic variants in the D2 receptor gene (DRD2, rs1076560 and in the nicotinic receptor α5 gene (CHRNA5, rs16969968 on both dorsolateral prefrontal cortex mediated behavior and physiology during working memory and on prefrontal gray matter volume. METHODS: A large sample of healthy subjects was compared for genotypic differences for DRD2 rs1076560 (G>T and CHNRA5 rs16969968 (G>A on prefrontal phenotypes, including cognitive performance at the N-Back task, prefrontal physiology with BOLD fMRI during performance of the 2-Back working memory task, and prefrontal morphometry with structural MRI. RESULTS: We found that DRD2 rs1076560 and CHNRA5 rs16969968 interact to modulate cognitive function, prefrontal physiology during working memory, and prefrontal gray matter volume. More specifically, CHRNA5-AA/DRD2-GT subjects had greater behavioral performance, more efficient prefrontal cortex activity at 2Back working memory task, and greater prefrontal gray matter volume than the other genotype groups. CONCLUSIONS: The present data extend previous studies in animals and enhance our understanding of dopamine and acetylcholine signaling in the human prefrontal cortex, demonstrating interactions elicited by working memory that are modulated by genetic variants in DRD2 and CHRNA5.
DRD2/CHRNA5 interaction on prefrontal biology and physiology during working memory.
Di Giorgio, Annabella; Smith, Ryan M; Fazio, Leonardo; D'Ambrosio, Enrico; Gelao, Barbara; Tomasicchio, Aldo; Selvaggi, Pierluigi; Taurisano, Paolo; Quarto, Tiziana; Masellis, Rita; Rampino, Antonio; Caforio, Grazia; Popolizio, Teresa; Blasi, Giuseppe; Sadee, Wolfgang; Bertolino, Alessandro
2014-01-01
Prefrontal behavior and activity in humans are heritable. Studies in animals demonstrate an interaction between dopamine D2 receptors and nicotinic acetylcholine receptors on prefrontal behavior but evidence in humans is weak. Therefore, we hypothesize that genetic variation regulating dopamine D2 and nicotinic acetylcholine receptor signaling impact prefrontal cortex activity and related cognition. To test this hypothesis in humans, we explored the interaction between functional genetic variants in the D2 receptor gene (DRD2, rs1076560) and in the nicotinic receptor α5 gene (CHRNA5, rs16969968) on both dorsolateral prefrontal cortex mediated behavior and physiology during working memory and on prefrontal gray matter volume. A large sample of healthy subjects was compared for genotypic differences for DRD2 rs1076560 (G>T) and CHNRA5 rs16969968 (G>A) on prefrontal phenotypes, including cognitive performance at the N-Back task, prefrontal physiology with BOLD fMRI during performance of the 2-Back working memory task, and prefrontal morphometry with structural MRI. We found that DRD2 rs1076560 and CHNRA5 rs16969968 interact to modulate cognitive function, prefrontal physiology during working memory, and prefrontal gray matter volume. More specifically, CHRNA5-AA/DRD2-GT subjects had greater behavioral performance, more efficient prefrontal cortex activity at 2Back working memory task, and greater prefrontal gray matter volume than the other genotype groups. The present data extend previous studies in animals and enhance our understanding of dopamine and acetylcholine signaling in the human prefrontal cortex, demonstrating interactions elicited by working memory that are modulated by genetic variants in DRD2 and CHRNA5.
The quantum Hall effect at 5/2 filling factor
International Nuclear Information System (INIS)
Willett, R L
2013-01-01
Experimental discovery of a quantized Hall state at 5/2 filling factor presented an enigmatic finding in an established field of study that has remained an open issue for more than twenty years. In this review we first examine the experimental requirements for observing this state and outline the initial theoretical implications and predictions. We will then follow the chronology of experimental studies over the years and present the theoretical developments as they pertain to experiments, directed at sets of issues. These topics will include theoretical and experimental examination of the spin properties at 5/2; is the state spin polarized? What properties of the higher Landau levels promote development of the 5/2 state, what other correlation effects are observed there, and what are their interactions with the 5/2 state? The 5/2 state is not a robust example of the fractional quantum Hall effect: what experimental and material developments have allowed enhancement of the effect? Theoretical developments from initial pictures have promoted the possibility that 5/2 excitations are exceptional; do they obey non-abelian statistics? The proposed experiments to determine this and their executions in various forms will be presented: this is the heart of this review. Experimental examination of the 5/2 excitations through interference measurements will be reviewed in some detail, focusing on recent results that demonstrate consistency with the picture of non-abelian charges. The implications of this in the more general physics picture is that the 5/2 excitations, shown to be non-abelian, should exhibit the properties of Majorana operators. This will be the topic of the last review section. (review article)
Gab2 promotes hematopoietic stem cell maintenance and self-renewal synergistically with STAT5.
Directory of Open Access Journals (Sweden)
Geqiang Li
2010-02-01
Full Text Available Grb2-associated binding (Gab adapter proteins play major roles in coordinating signaling downstream of hematopoietic cytokine receptors. In hematopoietic cells, Gab2 can modulate phosphatidylinositol-3 kinase and mitogen associated protein kinase activities and regulate the long-term multilineage competitive repopulating activity of hematopoietic stem cells (HSCs. Gab2 may also act in a linear pathway upstream or downstream of signal transducer and activator of transcription-5 (STAT5, a major positive regulator of HSC function. Therefore, we aimed to determine whether Gab2 and STAT5 function in hematopoiesis in a redundant or non-redundant manner.To do this we generated Gab2 mutant mice with heterozygous and homozygous deletions of STAT5. In heterozygous STAT5 mutant mice, deficiencies in HSC/multipotent progenitors were reflected by decreased long-term repopulating activity. This reduction in repopulation function was mirrored in the reduced growth response to early-acting cytokines from sorted double mutant c-Kit(+Lin(-Sca-1(+ (KLS cells. Importantly, in non-ablated newborn mice, the host steady-state engraftment ability was impaired by loss of Gab2 in heterozygous STAT5 mutant background. Fetal liver cells isolated from homozygous STAT5 mutant mice lacking Gab2 showed significant reduction in HSC number (KLS CD150(+CD48(-, reduced HSC survival, and dramatic loss of self-renewal potential as measured by serial transplantation.These data demonstrate new functions for Gab2 in hematopoiesis in a manner that is non-redundant with STAT5. Furthermore, important synergy between STAT5 and Gab2 was observed in HSC self-renewal, which might be exploited to optimize stem cell-based therapeutics.
Methylation of miR-145a-5p promoter mediates adipocytes differentiation
Energy Technology Data Exchange (ETDEWEB)
Du, Jingjing; Cheng, Xiao; Shen, Linyuan; Tan, Zhendong; Luo, Jia; Wu, Xiaoqian; Liu, Chendong [College of Animal Science and Technology, Sichuan Agricultural University, Chengdu 611130 (China); Yang, Qiong [Department of Animal Husbandry and Veterinary Medicine, Chengdu Agricultural College, Chengdu 611100, Sichuan (China); Jiang, Yanzhi [College of Life and Science, Sichuan Agricultural University, Chengdu 611130 (China); Tang, Guoqing; Li, Xuewei [College of Animal Science and Technology, Sichuan Agricultural University, Chengdu 611130 (China); Zhang, Shunhua, E-mail: zhangsh1919@163.com [College of Animal Science and Technology, Sichuan Agricultural University, Chengdu 611130 (China); Zhu, Li, E-mail: zhuli7508@163.com [College of Animal Science and Technology, Sichuan Agricultural University, Chengdu 611130 (China)
2016-06-17
MicroRNAs (miRNAs, miR) play important roles in adipocyte development. Recent studies showed that the expression of several miRNAs is closely related with promoter methylation. However, it is not known whether miRNA mediates adipocytes differentiation by means of DNA methylation. Here, we showed that miR-145a-5p was poorly expressed in adipose tissue from mice fed a high fat diet (HFD). Overexpression or inhibition of miR-145a-5p was unfavorable or beneficial, respectively, for adipogenesis, and these effects were achieved by regulating adipocyte-specific genes involved in lipogenic transcription, fatty acid synthesis, and fatty acid transportation. Particularly, we first suggested that miR-145a-5p mimics or inhibitors promoted or repressed adipocytes proliferation by regulating p53 and p21, which act as cell cycle regulating factors. Surprisingly, the miR-145a-5p-repressed adipocyte differentiation was enhanced or rescued when cells treated with 5-Aza-dC were transfected with miR-145a-5p mimics or inhibitors, respectively. These data indicated that, as a new mean to positively regulate adipocyte proliferation, the process of miR-145a-5p-inhibited adipogenesis may be regulated by DNA methylation. -- Highlights: •MiR-145a-5p promotes adipocytes proliferation. •MiR-145a-5p is negatively correlated with obesity. •MiR-145a-5p mediates adipocytes differentiation via regulating pathway related adipocytes differentiation. MiR-145a-5p mediating adipocytes differentiation was regulated by DNA methylation.
Targeted deletion of Atg5 in chondrocytes promotes age-related osteoarthritis.
Bouderlique, Thibault; Vuppalapati, Karuna K; Newton, Phillip T; Li, Lei; Barenius, Björn; Chagin, Andrei S
2016-03-01
It has been suggested that the lysosomal recycling process called macro-autophagy plays a role in osteoarthritis development. We thus decided to genetically ablate the autophagy-indispensable Atg5 gene specifically in chondrocytes and analyse the development of osteoarthritis upon aging and in a post-traumatic model. Mice lacking the Atg5 gene in their chondrocytes (Atg5cKO) were generated by crossing Atg5-floxed mice with transgenic mice that expressed cre recombinase driven by the collagen type 2 promoter. Animals were analysed at the age of 2, 6 and 12 months for age-related osteoarthritis or underwent mini-open partial medial meniscectomy at 2 months of age and were analysed 1 or 2 months after surgery. We evaluated osteoarthritis using the Osteoarthritis Research Society International (OARSI) scoring on safranin-O-stained samples. Cell death was evaluated by terminal deoxy-nucleotidyl-transferase-mediated deoxy-UTP nick end labelling (TUNEL) and by immunostaining of cleaved caspases. We observed the development of osteoarthritis in Atg5cKO mice with aging including fibrillation and loss of proteoglycans, which was particularly severe in males. The ablation of Atg5 was associated with an increased cell death as assessed by TUNEL, cleaved caspase 3 and cleaved caspase 9. Surprisingly, no difference in the development of post-traumatic osteoarthritis was observed between Atg5cKO and control mice. Autophagy protects from age-related osteoarthritis by facilitating chondrocyte survival. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/
Performance in complex motor tasks deteriorates in hyperthermic humans
DEFF Research Database (Denmark)
Piil, Jacob Feder; Lundbye-Jensen, Jesper; Trangmar, Steven J
2017-01-01
-motor tracking performance was reduced by 10.7 ± 6.5% following exercise-induced hyperthermia when integrated in the multipart protocol and 4.4 ± 5.7% when tested separately (bothP 1.3% (P math tasks...... of information or decision-making prior to responding. We hypothesized that divergences could relate to task complexity and developed a protocol consisting of 1) simple motor task [TARGET_pinch], 2) complex motor task [Visuo-motor tracking], 3) simple math task [MATH_type], 4) combined motor-math task [MATH...
Clark, Daniel N; Lambert, Jared P; Till, Rodney E; Argueta, Lissenya B; Greenhalgh, Kathryn E; Henrie, Brandon; Bills, Trieste; Hawkley, Tyson F; Roznik, Marinya G; Sloan, Jason M; Mayhew, Vera; Woodland, Loc; Nelson, Eric P; Tsai, Meng-Hsuan; Poole, Brian D
2014-05-01
The rs2004640 single nucleotide polymorphism and the CGGGG copy-number variant (rs77571059) are promoter polymorphisms within interferon regulatory factor 5 (IRF5). They have been implicated as susceptibility factors for several autoimmune diseases. IRF5 uses alternative promoter splicing, where any of 4 first exons begin the mRNA. The CGGGG indel is in exon 1A's promoter; the rs2004640 allele creates a splicing recognition site, enabling usage of exon 1B. This study aimed at characterizing alterations in IRF5 mRNA due to these polymorphisms. Cells with risk polymorphisms exhibited ~2-fold higher levels of IRF5 mRNA and protein, but demonstrated no change in mRNA stability. Quantitative PCR demonstrated decreased usage of exons 1C and 1D in cell lines with the risk polymorphisms. RNA folding analysis revealed a hairpin in exon 1B; mutational analysis showed that the hairpin shape decreased translation 5-fold. Although translation of mRNA that uses exon 1B is low due to a hairpin, increased IRF5 mRNA levels in individuals with the rs2004640 risk allele lead to higher overall protein expression. In addition, several new splice variants of IRF5 were sequenced. IRF5's promoter polymorphisms alter first exon usage and increase transcription levels. High levels of IRF5 may bias the immune system toward autoimmunity.
Choi, Jung-Woo; Lee, Ju-Han; Park, Hong Seok; Kim, Young-Sik
2011-10-01
To characterise patients with high plasminogen activator inhibitor-1 (PAI-1) expression as oral PAI-1 antagonists are currently in preclinical trials, and to determine whether the PAI-1 promoter 4G/5G polymorphism regulates PAI-1 expression in clear cell renal cell carcinoma (CCRCC). PAI-1 expression was examined by immunohistochemistry in 69 CCRCC specimens. In addition, the promoter 4G/5G polymorphism was investigated by both allele-specific PCR and direct DNA sequencing. PAI-1 was overexpressed in 25/69 (36.2%) patients with CCRCC. PAI-1 staining was intense in tumour cells with a high Fuhrman nuclear grade and in spindle-shaped tumour cells. PAI-1 expression was significantly associated with older age at diagnosis (p=0.027), high nuclear grade (p5G and 31.9% (22/69) 5G/5G. The homozygous 4G/4G or 5G/5G group showed a tendency for a high nuclear grade (p=0.05) but the 4G/5G polymorphism was not related to other prognostic parameters. PAI-1 expression was poorly correlated with its promoter 4G/5G polymorphism (Spearman ρ=0.088). CCRCC with high PAI-1 expression is characterised by older age, high nuclear grade, advanced stage, distant metastasis and/or shortened disease-free survival. PAI-1 expression is not affected by the promoter 4G/5G polymorphism.
Valli, Emanuele; Trazzi, Stefania; Fuchs, Claudia; Erriquez, Daniela; Bartesaghi, Renata; Perini, Giovanni; Ciani, Elisabetta
2012-01-01
Mutations in the CDKL5 (cyclin-dependent kinase-like 5) gene are associated with a severe epileptic encephalopathy (early infantile epileptic encephalopathy type 2, EIEE2) characterized by early-onset intractable seizures, infantile spasms, severe developmental delay, intellectual disability, and Rett syndrome (RTT)-like features. Despite the clear involvement of CDKL5 mutations in intellectual disability, the function of this protein during brain development and the molecular mechanisms involved in its regulation are still unknown. Using human neuroblastoma cells as a model system we found that an increase in CDKL5 expression caused an arrest of the cell cycle in the G(0)/G(1) phases and induced cellular differentiation. Interestingly, CDKL5 expression was inhibited by MYCN, a transcription factor that promotes cell proliferation during brain development and plays a relevant role in neuroblastoma biology. Through a combination of different and complementary molecular and cellular approaches we could show that MYCN acts as a direct repressor of the CDKL5 promoter. Overall our findings unveil a functional axis between MYCN and CDKL5 governing both neuron proliferation rate and differentiation. The fact that CDKL5 is involved in the control of both neuron proliferation and differentiation may help understand the early appearance of neurological symptoms in patients with mutations in CDKL5. Copyright © 2012 Elsevier B.V. All rights reserved.
What do health-promoting schools promote?
DEFF Research Database (Denmark)
Simovska, Venka
2012-01-01
-promotion interventions. Directly or indirectly the articles reiterate the idea that health promotion in schools needs to be linked with the core task of the school – education, and to the values inherent to education, such as inclusion, democracy, participation and influence, critical literacy and action competence......Purpose – The editorial aims to provide a brief overview of the individual contributions to the special issue, and a commentary positioning the contributions within research relating to the health-promoting schools initiative in Europe. Design/methodology/approach – The members of the Schools...... for Health in Europe Research Group were invited to submit their work addressing processes and outcomes in school health promotion to this special issue of Health Education. Additionally, an open call for papers was published on the Health Education web site. Following the traditional double blind peer...
Fan, Julie; Voisin, Julien; Milot, Marie-Hélène; Higgins, Johanne; Boudrias, Marie-Hélène
2017-09-01
Recovery of handgrip is critical after stroke since it is positively related to upper limb function. To boost motor recovery, transcranial direct current stimulation (tDCS) is a promising, non-invasive brain stimulation technique for the rehabilitation of persons with stroke. When applied over the primary motor cortex (M1), tDCS has been shown to modulate neural processes involved in motor learning. However, no studies have looked at the impact of tDCS on the learning of a grip task in both stroke and healthy individuals. To assess the use of tDCS over multiple days to promote motor learning of a grip task using a learning paradigm involving a speed-accuracy tradeoff in healthy individuals. In a double-blinded experiment, 30 right-handed subjects (mean age: 22.1±3.3 years) participated in the study and were randomly assigned to an anodal (n=15) or sham (n=15) stimulation group. First, subjects performed the grip task with their dominant hand while following the pace of a metronome. Afterwards, subjects trained on the task, at their own pace, over 5 consecutive days while receiving sham or anodal tDCS over M1. After training, subjects performed de novo the metronome-assisted task. The change in performance between the pre and post metronome-assisted task was used to assess the impact of the grip task and tDCS on learning. Anodal tDCS over M1 had a significant effect on the speed-accuracy tradeoff function. The anodal tDCS group showed significantly greater improvement in performance (39.28±15.92%) than the sham tDCS group (24.06±16.35%) on the metronome-assisted task, t(28)=2.583, P=0.015 (effect size d=0.94). Anodal tDCS is effective in promoting grip motor learning in healthy individuals. Further studies are warranted to test its potential use for the rehabilitation of fine motor skills in stroke patients. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Arid5b facilitates chondrogenesis by recruiting the histone demethylase Phf2 to Sox9-regulated genes
Hata, Kenji; Takashima, Rikako; Amano, Katsuhiko; Ono, Koichiro; Nakanishi, Masako; Yoshida, Michiko; Wakabayashi, Makoto; Matsuda, Akio; Maeda, Yoshinobu; Suzuki, Yutaka; Sugano, Sumio; Whitson, Robert H.; Nishimura, Riko; Yoneda, Toshiyuki
2013-11-01
Histone modification, a critical step for epigenetic regulation, is an important modulator of biological events. Sox9 is a transcription factor critical for endochondral ossification; however, proof of its epigenetic regulation remains elusive. Here we identify AT-rich interactive domain 5b (Arid5b) as a transcriptional co-regulator of Sox9. Arid5b physically associates with Sox9 and synergistically induces chondrogenesis. Growth of Arid5b-/- mice is retarded with delayed endochondral ossification. Sox9-dependent chondrogenesis is attenuated in Arid5b-deficient cells. Arid5b recruits Phf2, a histone lysine demethylase, to the promoter region of Sox9 target genes and stimulates H3K9me2 demethylation of these genes. In the promoters of chondrogenic marker genes, H3K9me2 levels are increased in Arid5b-/- chondrocytes. Finally, we show that Phf2 knockdown inhibits Sox9-induced chondrocyte differentiation. Our findings establish an epigenomic mechanism of skeletal development, whereby Arid5b promotes chondrogenesis by facilitating Phf2-mediated histone demethylation of Sox9-regulated chondrogenic gene promoters.
Jiang, Shan; Zhang, Dongxin; Huang, Hong; Lei, Yonghong; Han, Yan; Han, Weidong
2017-01-01
Background . The aim of this study was to assess the effects of low concentrations of H 2 O 2 on angiogenesis of human umbilical vein endothelial cells (HUVECs) in vitro and explore the underlying mechanisms. Methods . HUVECs were cultured and stimulated with different concentrations of H 2 O 2 . Flow cytometric analysis was used to select an optimal concentration of H 2 O 2 for the following experiments. Cell proliferation, migration, and tubule formation were evaluated by Cell Counting Kit-8 (CCK-8) assays, scratch wound assays, and Matrigel tubule formation assays, respectively. For gain and loss of function studies, constitutively active MEK5 (CA-MEK5) and ERK5 shRNA lentiviruses were used to activate or knock down extracellular signal-regulated kinase 5 (ERK5). Results . We found that low concentrations of H 2 O 2 promoted HUVECs proliferation, migration, and tubule formation. ERK5 in HUVECs was significantly activated by H 2 O 2 . Enhanced ERK5 activity significantly amplified the proangiogenic effects of H 2 O 2 ; in contrast, ERK5 knock-down abrogated the effects of H 2 O 2 . Conclusions . Our results confirmed that low concentrations of H 2 O 2 promoted HUVECs angiogenesis in vitro, and ERK5 is an essential mediator of this process. Therefore, ERK5 may be a potential therapeutic target for promoting angiogenesis and improving graft survival.
Energy Technology Data Exchange (ETDEWEB)
Guo, Kai, E-mail: gk161@163.com [Department of Respiration, Tangdu Hospital, Fourth Military Medical University, Xi' an 710038 (China); Department of Respiration, 161th Hospital, PLA, Wuhan 430015 (China); Jin, Faguang, E-mail: jinfag@fmmu.edu.cn [Department of Respiration, Tangdu Hospital, Fourth Military Medical University, Xi' an 710038 (China)
2015-09-25
The osmoregulated transcription factor nuclear factor of activated T-cells 5(NFAT5), has been found to play important roles in the development of many kinds of human cancers, including breast cancer, colon carcinoma, renal cell carcinoma and melanoma. The aim of the present study was to determine whether NFAT5 is involved in the proliferation and migration of lung adenocarcinoma cells. We found that NFAT5 was upregulated in lung adenocarcinoma cells and knockdown of NFAT5 decreased proliferation and migration of the cells, accompanied by a significant reduction in the expression of AQP5. AQP5 was upregulated in lung adenocarcinoma cells and knockdown of AQP5 also inhibited proliferation and migration of the cells as knockdown of NFAT5 did. Moreover, overexpression of NFAT5 promoted proliferation and migration of lung adenocarcinoma cells, accompanied by a significant increase in the expression of AQP5. These results indicate that NFAT5 plays important roles in proliferation and migration of human lung adenocarcinoma cells through regulating AQP5 expression, providing a new therapeutic option for lung adenocarcinoma therapy. - Highlights: • NFAT5 expression is higher in lung adenocarcinoma cells compared with normal cells. • NFAT5 knockdown decreases proliferation and migration of lung adenocarcinoma cells. • Knockdown of NFAT5 reduces AQP5 expression in human lung adenocarcinoma cells. • Overexpression of NFAT5 promotes proliferation and migration of lung adenocarcinoma cells. • Overexpression of NFAT5 increases AQP5 expression in human lung adenocarcinoma cells.
International Nuclear Information System (INIS)
Guo, Kai; Jin, Faguang
2015-01-01
The osmoregulated transcription factor nuclear factor of activated T-cells 5(NFAT5), has been found to play important roles in the development of many kinds of human cancers, including breast cancer, colon carcinoma, renal cell carcinoma and melanoma. The aim of the present study was to determine whether NFAT5 is involved in the proliferation and migration of lung adenocarcinoma cells. We found that NFAT5 was upregulated in lung adenocarcinoma cells and knockdown of NFAT5 decreased proliferation and migration of the cells, accompanied by a significant reduction in the expression of AQP5. AQP5 was upregulated in lung adenocarcinoma cells and knockdown of AQP5 also inhibited proliferation and migration of the cells as knockdown of NFAT5 did. Moreover, overexpression of NFAT5 promoted proliferation and migration of lung adenocarcinoma cells, accompanied by a significant increase in the expression of AQP5. These results indicate that NFAT5 plays important roles in proliferation and migration of human lung adenocarcinoma cells through regulating AQP5 expression, providing a new therapeutic option for lung adenocarcinoma therapy. - Highlights: • NFAT5 expression is higher in lung adenocarcinoma cells compared with normal cells. • NFAT5 knockdown decreases proliferation and migration of lung adenocarcinoma cells. • Knockdown of NFAT5 reduces AQP5 expression in human lung adenocarcinoma cells. • Overexpression of NFAT5 promotes proliferation and migration of lung adenocarcinoma cells. • Overexpression of NFAT5 increases AQP5 expression in human lung adenocarcinoma cells
RF model of the distribution system as a communication channel, phase 2. Volume 2: Task reports
Rustay, R. C.; Gajjar, J. T.; Rankin, R. W.; Wentz, R. C.; Wooding, R.
1982-01-01
Based on the established feasibility of predicting, via a model, the propagation of Power Line Frequency on radial type distribution feeders, verification studies comparing model predictions against measurements were undertaken using more complicated feeder circuits and situations. Detailed accounts of the major tasks are presented. These include: (1) verification of model; (2) extension, implementation, and verification of perturbation theory; (3) parameter sensitivity; (4) transformer modeling; and (5) compensation of power distribution systems for enhancement of power line carrier communication reliability.
Wolff, Dennis W; Xie, Yan; Deng, Caishu; Gatalica, Zoran; Yang, Mingjie; Wang, Bo; Wang, Jincheng; Lin, Ming-Fong; Abel, Peter W; Tu, Yaping
2012-04-01
G-protein-coupled receptor (GPCR)-stimulated androgen-independent activation of androgen receptor (AR) contributes to acquisition of a hormone-refractory phenotype by prostate cancer. We previously reported that regulator of G-protein signaling (RGS) 2, an inhibitor of GPCRs, inhibits androgen-independent AR activation (Cao et al., Oncogene 2006;25:3719-34). Here, we show reduced RGS2 protein expression in human prostate cancer specimens compared to adjacent normal or hyperplastic tissue. Methylation-specific PCR analysis and bisulfite sequencing indicated that methylation of the CpG island in the RGS2 gene promoter correlated with RGS2 downregulation in prostate cancer. In vitro methylation of this promoter suppressed reporter gene expression in transient transfection studies, whereas reversal of this promoter methylation with 5-aza-2'-deoxycytidine (5-Aza-dC) induced RGS2 reexpression in androgen-independent prostate cancer cells and inhibited their growth under androgen-deficient conditions. Interestingly, the inhibitory effect of 5-Aza-dC was significantly reduced by an RGS2-targeted short hairpin RNA, indicating that reexpressed RGS2 contributed to this growth inhibition. Restoration of RGS2 levels by ectopic expression in androgen-independent prostate cancer cells suppressed growth of xenografts in castrated mice. Thus, RGS2 promoter hypermethylation represses its expression and unmasks a latent pathway for AR transactivation in prostate cancer cells. Targeting this reversible process may provide a new strategy for suppressing prostate cancer progression by reestablishing its androgen sensitivity. Copyright © 2011 UICC.
Bhandari, Jayant; Daya, Ritesh; Mishra, Ram K
2016-09-01
The 5-choice serial reaction time task (5-CSRTT) is an automated operant conditioning task that measures rodent attention. The task allows the measurement of several parameters such as response accuracy, speed of processing, motivation, and impulsivity. The task has been widely used to investigate attentional processes in rodents for attention deficit and hyperactivity disorder and has expanded to other illnesses such as Alzheimer's disease, depression, and schizophrenia. The 5-CSRTT is accompanied with two significant caveats: a time intensive training period and largely varied individual rat capability to learn and perform the task. Here we provide a regimented acquisition protocol to enhance training for the 5-CSRTT and discuss important considerations for researchers using the 5-CSRTT. We offer guidelines to ensure that inferences on performance in the 5-CSRTT are in fact a result of experimental manipulation rather than training differences, or individual animal capability. According to our findings only rats that have been trained successfully within a limited time frame should be used for the remainder of the study. Currently the 5-CSRTT employs a training period of variable duration and procedure, and its inferences on attention must overcome heterogeneous innate animal differences. The 5-CSRTT offers valuable and valid insights on various rodent attentional processes and their translation to the underpinnings of illnesses such as schizophrenia. The recommendations made here provide important criteria to ensure inferences made from this task are in fact relevant to the attentional processes being measured. Copyright © 2016 Elsevier B.V. All rights reserved.
Physiological Indices of Pilots' Abilities Under Varying Task Demands.
Wang, Zhen; Zheng, Lingxiao; Lu, Yanyu; Fu, Shan
2016-04-01
This study investigated pilots' ability by examining the effects of flight experience and task demand on physiological reactions, and analyzing the diagnostic meanings underlying correlated parameters. A total of 12 experienced pilots and 12 less experienced pilots performed 4 simulated flight tasks, including normal and emergency situations. Fixation duration (FD), saccade rate (SR), blink rate (BR), heart rate (HR), respiration rate (RR), and respiration amplitude (RA) were measured during the tasks. More experienced pilots adapted their SR flexibly to changing task demands and had significantly lower SR than less experienced pilots during emergency tasks (29.6 ± 20.0 vs. 70.1 ± 67.1 saccades/min). BR, HR, and RR were affected by pilot experience but not by task demand. More experienced pilots had lower BR, HR, and RR than less experienced pilots during both normal tasks (BR: 14.3 ± 13.0 vs. 32.9 ± 25.8 blinks/min; HR: 72.7 ± 7.9 vs. 83.2 ± 7.2 bpm; RR: 15.4 ± 2.1 vs. 19.5 ± 5.2 breaths/min) and emergency tasks (BR: 10.2 ± 5.0 vs. 32.3 ± 20.8 blinks/min; HR: 73.3 ± 7.3 vs. 82.2 ± 11.6 bpm; RR: 15.6 ± 1.9 vs. 18.0 ± 3.2 breaths/min). FD and RA were not sensitive to either flight experience or task demand. Physiological reactions have the potential to reflect pilots' ability from different aspects. SR and BR could indicate pilots' differences in information access strategy. HR and RR could reflect a pilot's physical fitness. These findings are useful for understanding a pilot's ability.
A Non-Precious Metal Promoting the Synthesis of 5-Hydroxymethylfurfural
Directory of Open Access Journals (Sweden)
Xinyuan Lu
2017-11-01
Full Text Available In this work, a new kind of catalyst was prepared for synthesis of 5-hydroxymethylfurfural. Copper ions were incorporated into manganese oxide octahedral molecular sieves (K-OMS-2. The catalysts Cu-K-OMS-2 were characterized by measuring FTIR spectra, scanning electron microscope images, X-ray diffraction patterns, and temperature-programmed desorption (TPD and temperature-programmed reduction (TPR profiles. Thermogravimetric analysis (TGA demonstrated that the stability of Cu-K-OMS-2 is almost the same as that of K-OMS-2. XRD patterns showed that introducing copper ions did not change the structure of K-OMS-2, but copper ions had an effect on the morphology of K-OMS-2 as illustrated by SEM images. TPD profiles demonstrated that both K-OMS-2 and Cu-K-OMS-2 possess basic and acidic sites, and Cu-K-OMS-2 has weak acidic sites. One-pot synthesis of 2,5-diformylfuran (DFF from fructose was investigated under the catalysis of Cu-K-OMS-2 together with a commercial catalyst Amberlyst 15. The effect of reaction time and temperature on the DFF yield was investigated, and reaction temperature had an effect on the DFF yield. The effect of atomic ratio of Cu to Mn of Cu-K-OMS-2 on the DFF yield was also investigated. The DFF yield was improved 34.7% by Cu-K-OMS-2 in comparison to K-OMS-2, indicating the promotion effect of copper on the DFF yield. Consecutive use of Cu-K-OMS-2 demonstrated that after 6 cycles, the loss of DFF yield was 6.3%, indicating a good reusability of Cu-K-OMS-2.
Directory of Open Access Journals (Sweden)
Ryan F Overcash
Full Text Available The type I transmembrane protein with epidermal growth factor and two follistatin motifs 2 (TMEFF2, is expressed mainly in brain and prostate. Expression of TMEFF2 is deregulated in prostate cancer, suggesting a role in this disease, but the molecular mechanism(s involved in this effect are not clear. Although androgens promote tmeff2 transcription, androgen delivery to castrated animals carrying CWR22 xenografts increases TMEFF2 protein levels in the absence of mRNA changes, suggesting that TMEFF2 may also be post-transcriptionally regulated. Here we show that translation of TMEFF2 is regulated by androgens. Addition of physiological concentrations of dihydrotestosterone (DHT to prostate cancer cell lines increases translation of endogenous TMEFF2 or transfected TMEFF2-Luciferase fusions, and this effect requires the presence of upstream open reading frames (uORFs in the 5'-untranslated region (5'-UTR of TMEFF2. Using chemical and siRNA inhibition of the androgen receptor (AR, we show that the androgen effect on TMEFF2 translation is mediated by the AR. Importantly, DHT also promotes phosphorylation of the α subunit of the translation initiation factor 2 (eIF2α in an AR-dependent manner, paralleling the effect on TMEFF2 translation. Moreover, endoplasmic reticulum (ER stress conditions, which promote eIF2α phosphorylation, also stimulate TMEFF2 translation. These results indicate that androgen signaling promotes eIF2α phosphorylation and subsequent translation of TMEFF2 via a mechanism that requires uORFs in the 5'-UTR of TMEFF2.
Task-Specific Training and Job Design
Felipe Balmaceda
2006-01-01
This paper provides a simple theoretical framework based on a new type of human capital introduced by Gibbons and Waldman (2004), called task-specific training, to understand job design. Mainly, in the presence of task-specific training, promotions might result ex-post in the underutilization of human capital and thus firms at the time of designing jobs should attempt to diversify this risk.
DEFF Research Database (Denmark)
Hansen, Thomas S.; Sádaba, Irantzu; Garcia, Eduardo
2013-01-01
containing promoters (NCPs) to obtain excellent yields. In acetonitrile a 95% DFF yield was obtained after 24h with ambient pressure of dioxygen at room temperature in the presence of different NCPs, which – to our knowledge – is the best result reported thus far for this reaction. The use of NCPs made...... it further possible to apply various traditional solvents, e.g. acetone, methanol and methyl isobutyl ketone for the reaction. The latter can be used as extraction solvent for HMF synthesis in aqueous media and thus integrate the two processes. Additionally, HMF was oxidized to 2,5-furandicarboxylic acid...
Hirosaki, T; Mizushima, H; Tsubota, Y; Moriyama, K; Miyazaki, K
2000-07-21
The basement membrane protein laminin-5, a heterotrimer of laminin alpha3, beta3, and gamma2 chains, potently promotes cellular adhesion and motility. It has been supposed that the carboxyl-terminal globular region of the alpha3 chain consisting of five distinct domains (G1 to G5) is important for its interaction with integrins. To clarify the function of each G domain, we transfected cDNAs for the full-length (wild type (WT)) and five deletion derivatives (DeltaGs) of the alpha3 chain into human fibrosarcoma cell line HT1080, which expressed and secreted the laminin beta3 and gamma2 chains but not the alpha3 chain. The transfectants with the alpha3 chain cDNAs lacking G5 (DeltaG(5)), G4-5 (DeltaG(4-5)), G3-5 (DeltaG(3-5)), and G2-5 (DeltaG(2-5)) secreted laminin-5 variants at levels comparable to that with WT cDNA. However, the transfectant with the cDNA without any G domains (DeltaG(1-5)) secreted little laminin-5, suggesting that the G domains are essential for the efficient assembly and secretion of the heterotrimer alpha3beta3gamma2. The transfectants with WT, DeltaG(5), and DeltaG(4-5) cDNAs survived in serum-free medium longer than those with DeltaG(3-5), DeltaG(2-5), and DeltaG(1-5) cDNAs. The transfectants with WT, DeltaG(5), and DeltaG(4-5) cDNAs secreted apparently the same size of laminin-5, which lacked G4 and G5 due to proteolytic cleavage between G3 and G4, and these laminin-5 forms potently promoted integrin alpha(3)beta(1)-dependent cell adhesion and migration. However, the laminin-5 forms of DeltaG(3-5) and DeltaG(2-5) hardly promoted the cell adhesion and motility. These findings demonstrate that the G3 domain, but not the G4 and G5 domains, of the alpha3 chain is essential for the potent promotion of cell adhesion and motility by laminin-5.
Yu, Cong; Li, Lifu; Xie, Fei; Guo, Shichao; Liu, Fayuan; Dong, Nianguo; Wang, Yongjun
2018-01-01
Emerging evidence indicates that long non-coding RNAs (lncRNAs) play a vital role in cardiovascular physiology and pathology. Although the lncRNA TUG1 is implicated in atherosclerosis, its function in calcific aortic valve disease (CAVD) remains unknown. In this study, we found that TUG1 was highly expressed in human aortic valves and primary valve interstitial cells (VICs). Moreover, TUG1 knockdown induced inhibition of osteoblast differentiation in CAVD both in vitro and in vivo. Mechanistically, silencing of TUG1 increased the expression of miR-204-5p and subsequently inhibited Runx2 expression at the post-transcriptional level. Importantly, TUG1 directly interacted with miR-204-5p and downregulation of miR-204-5p efficiently reversed the suppression of Runx2 induced by TUG1 short hairpin RNA (shRNA). Thus, TUG1 positively regulated the expression of Runx2, through sponging miR-204-5p, and promoted osteogenic differentiation in CAVD. All together, the evidence generated by our study elucidates the role of lncRNA TUG1 as a miRNA sponge in CAVD, and sheds new light on lncRNA-directed diagnostics and therapeutics in CAVD. Published on behalf of the European Society of Cardiology. All rights reserved. © The Author 2017. For permissions please email: journals.permissions@oup.com.
Adverse effect of the CCR5 promoter -2459A allele on HIV-1 disease progression
DEFF Research Database (Denmark)
Knudsen, T B; Kristiansen, T B; Katzenstein, T L
2001-01-01
/G transition that has been discovered recently, have also been shown to influence HIV progression. Since genetic linkages make these polymorphisms interdependent variables, the aim of the present study was to isolate and evaluate the effect on HIV disease progression for each of these mutations independently......HIV positive individuals heterozygous for a 32 basepair deletion in the CCR5 encoding gene (CCR5 Delta32) have a reduced number of CCR5 receptors on the cell surface and a slower progression towards AIDS and death. Other human polymorphisms, such as the CCR2 64I and the CCR5 promoter -2459 A...
Macnamara, Brooke N; Frank, David J
2018-05-01
For well over a century, scientists have investigated individual differences in performance. The majority of studies have focused on either differences in practice, or differences in cognitive resources. However, the predictive ability of either practice or cognitive resources varies considerably across tasks. We are the first to examine task characteristics' impact on learning and performance in a complex task while controlling for other task characteristics. In 2 experiments we test key theoretical task characteristic thought to moderate the relationship between practice, cognitive resources, and performance. We devised a task where each of several key task characteristics can be manipulated independently. Participants played 5 rounds of a game similar to the popular tower defense videogame Plants vs. Zombies where both cognitive load and game characteristics were manipulated. In Experiment 1, participants either played a consistently mapped version-the stimuli and the associated meaning of their properties were constant across the 5 rounds-or played a variably mapped version-the stimuli and the associated meaning of their properties changed every few minutes. In Experiment 2, participants either played a static version-that is, turn taking with no time pressure-or played a dynamic version-that is, the stimuli moved regardless of participants' response rates. In Experiment 1, participants' accuracy and efficiency were substantially hindered in the variably mapped conditions. In Experiment 2, learning and performance accuracy were hindered in the dynamic conditions, especially when under cognitive load. Our results suggest that task characteristics impact the relative importance of cognitive resources and practice on predicting learning and performance. (PsycINFO Database Record (c) 2018 APA, all rights reserved).
Characterization of the promoter region of the human c-erbB-2 protooncogene
International Nuclear Information System (INIS)
Ishii, S.; Imamoto, F.; Yamanashi, Y.; Toyoshima, K.; Yamamoto, T.
1987-01-01
Three overlapping genomic clones that contain the 5'-terminal portion of the human c-erbB-2 gene (ERBB2) were isolated. The promoter region was identified by nuclease S1 mapping with c-erbB-2 mRNA. Seven transcriptional start sites were identified. DNA sequence analysis showed that the promoter region contains a TATA box and a CAAT box about 30 and 80 base pairs (bp), respectively, upstream of the most downstream RNA initiation site. Two putative binding sites for transcription factor Sp1 were identified about 50 and 110 bp upstream of the CAAT box, and six GGA repeats were found between the CAAT box and the TATA box. This region had strong promoter activity when placed upstream of the bacterial chloramphenicol acetyltransferase gene and transfected into monkey CV-1 cells. These data indicate that the promoter of the human c-erbB-2 protooncogene is different from that of the protooncogene c-erbB-1 (epidermal growth factor receptor gene), which does not contain either a TATA box or a CAAT box. Comparison of the promoter sequences and activities of the two protooncogenes should be helpful in analysis of the regulatory mechanism of expression of their gene products, which are growth-factor receptors
Hatterick, G. R.
1972-01-01
The data sheets presented contain the results of the task analysis portion of the study to identify skill requirements of space shuttle crew personnel. A comprehensive data base is provided of crew functions, operating environments, task dependencies, and task-skills applicable to a representative cross section of earth orbital research experiments.
Directory of Open Access Journals (Sweden)
In Sung Son
2013-03-01
Full Text Available The effects of the SnO2 pore size and metal oxide promoters on the sensing properties of SnO2-based thick film gas sensors were investigated to improve the detection of very low H2S concentrations (<1 ppm. SnO2 sensors and SnO2-based thick-film gas sensors promoted with NiO, ZnO, MoO3, CuO or Fe2O3 were prepared, and their sensing properties were examined in a flow system. The SnO2 materials were prepared by calcining SnO2 at 600, 800, 1,000 and 1,200 °C to give materials identified as SnO2(600, SnO2(800, SnO2(1000, and SnO2(1200, respectively. The Sn(12Mo5Ni3 sensor, which was prepared by physically mixing 5 wt% MoO3 (Mo5, 3 wt% NiO (Ni3 and SnO2(1200 with a large pore size of 312 nm, exhibited a high sensor response of approximately 75% for the detection of 1 ppm H2S at 350 °C with excellent recovery properties. Unlike the SnO2 sensors, its response was maintained during multiple cycles without deactivation. This was attributed to the promoter effect of MoO3. In particular, the Sn(12Mo5Ni3 sensor developed in this study showed twice the response of the Sn(6Mo5Ni3 sensor, which was prepared by SnO2(600 with the smaller pore size than SnO2(1200. The excellent sensor response and recovery properties of Sn(12Mo5Ni3 are believed to be due to the combined promoter effects of MoO3 and NiO and the diffusion effect of H2S as a result of the large pore size of SnO2.
Christov, Nikolai Kirilov; Christova, Petya Koeva; Kato, Hideki; Liu, Yuelin; Sasaki, Kentaro; Imai, Ryozo
2014-11-01
A novel cold-inducible GSK3/shaggy-like kinase, TaSK5, was isolated from winter wheat using a macroarray-based differential screening approach. TaSK5 showed high similarity to Arabidopsis subgroup I GSK3/shaggy-like kinases ASK-alpha, AtSK-gamma and ASK-epsilon. RNA gel blot analyses revealed TaSK5 induction by cold and NaCl treatments and to a lesser extent by drought treatment. TaSK5 functionally complemented the cold- and salt-sensitive phenotypes of a yeast GSK3/shaggy-like kinase mutant, △mck1. Transgenic Arabidopsis plants overexpressing TaSK5 cDNA showed enhanced tolerance to salt and drought stresses. By contrast, the tolerance of the transgenic plants to freezing stress was not altered. Microarray analysis revealed that a number of abiotic stress-inducible genes were constitutively induced in the transgenic Arabidopsis plants, suggesting that TaSK5 may function in a novel signal transduction pathway that appears to be unrelated to DREB1/CBF regulon and may involve crosstalk between abiotic and hormonal signals. Copyright © 2014 Elsevier Masson SAS. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Scott, P.; Olson, R.; Marschall, C.; Rudland, D. [and others
1997-02-01
This report presents the results from Task 1 of the Second International Piping Integrity Research Group (IPIRG-2) program. The IPIRG-2 program is an international group program managed by the US Nuclear Regulatory Commission (US NRC) and funded by a consortium of organizations from 15 nations including: Bulgaria, Canada, Czech Republic, France, Hungary, Italy, Japan, Republic of Korea, Lithuania, Republic of China, Slovak Republic, Sweden, Switzerland, the United Kingdom, and the United States. The objective of the program was to build on the results of the IPIRG-1 and other related programs by extending the state-of-the-art in pipe fracture technology through the development of data needed to verify engineering methods for assessing the integrity of nuclear power plant piping systems that contain defects. The IPIRG-2 program included five main tasks: Task 1 - Pipe System Experiments with Flaws in Straight Pipe and Welds Task 2 - Fracture of Flawed Fittings Task 3 - Cyclic and Dynamic Load Effects on Fracture Toughness Task 4 - Resolution of Issues From IPIRG-1 and Related Programs Task 5 - Information Exchange Seminars and Workshops, and Program Management. The scope of this report is to present the results from the experiments and analyses associated with Task 1 (Pipe System Experiments with Flaws in Straight Pipe and Welds). The rationale and objectives of this task are discussed after a brief review of experimental data which existed after the IPIRG-1 program.
International Nuclear Information System (INIS)
Scott, P.; Olson, R.; Marschall, C.; Rudland, D.
1997-02-01
This report presents the results from Task 1 of the Second International Piping Integrity Research Group (IPIRG-2) program. The IPIRG-2 program is an international group program managed by the US Nuclear Regulatory Commission (US NRC) and funded by a consortium of organizations from 15 nations including: Bulgaria, Canada, Czech Republic, France, Hungary, Italy, Japan, Republic of Korea, Lithuania, Republic of China, Slovak Republic, Sweden, Switzerland, the United Kingdom, and the United States. The objective of the program was to build on the results of the IPIRG-1 and other related programs by extending the state-of-the-art in pipe fracture technology through the development of data needed to verify engineering methods for assessing the integrity of nuclear power plant piping systems that contain defects. The IPIRG-2 program included five main tasks: Task 1 - Pipe System Experiments with Flaws in Straight Pipe and Welds Task 2 - Fracture of Flawed Fittings Task 3 - Cyclic and Dynamic Load Effects on Fracture Toughness Task 4 - Resolution of Issues From IPIRG-1 and Related Programs Task 5 - Information Exchange Seminars and Workshops, and Program Management. The scope of this report is to present the results from the experiments and analyses associated with Task 1 (Pipe System Experiments with Flaws in Straight Pipe and Welds). The rationale and objectives of this task are discussed after a brief review of experimental data which existed after the IPIRG-1 program
Activation of the TASK-2 channel after cell swelling is dependent on tyrosine phosphorylation
DEFF Research Database (Denmark)
Kirkegaard, Signe Skyum; Lambert, Ian Henry; Gammeltoft, Steen
2010-01-01
(K,vol) indicating that inhibition of RVD reflects inhibition of TASK-2. We find that in EATC the tyrosine kinase inhibitor genistein inhibits RVD by 90%, and that the tyrosine phosphatase inhibitor monoperoxo(picolinato)-oxo-vanadate(V) [mpV(pic)] shifted the volume set point for inactivation of the channel...... to a lower cell volume. Swelling-activated K(+) efflux was impaired by genistein and the Src kinase family inhibitor 4-amino-5-(4-chloro-phenyl)-7-(t-butyl)pyrazolo[3,4-d]pyrimidine (PP2) and enhanced by the tyrosine phosphatase inhibitor mpV(pic). With the use of the TASK-2 inhibitor clofilium......, it is demonstrated that mpV(pic) increased the volume-sensitive part of the K(+) efflux 1.3 times. To exclude K(+) efflux via a KCl cotransporter, cellular Cl(-) was substituted with NO(3)(-). Also under these conditions K(+) efflux was completely blocked by genistein. Thus tyrosine kinases seem to be involved...
International Nuclear Information System (INIS)
He, Ying-hua; Li, Ming-fang; Zhang, Xing-yan; Meng, Xiao-ming; Huang, Cheng; Li, Jun
2016-01-01
NLRC5, a newly found member of the NLR family and the largest member of nucleotide-binding, has been reported to regulate immune responses and is associated with hepatocellular carcinoma (HCC). We investigated the mechanisms and signaling pathways of NLRC5 in HCC progression. Increased expression of NLRC5, vascular endothelial growth factor-A (VEGF-A) were found in human HCC tissue. There was a positive correlation between NLRC5 and VEGF-A expression and cell proliferation were enhanced in NLRC5-overexpressing HepG2 cells, but inhibited in cells with NLRC5 silencing treatment. Interestingly, we found that up-regulation of NLRC5 also coordinated the activation of PI3K/AKT signaling pathway. An AKT inhibitor LY294002 blocked VEGF-A expression and AKT phosphorylation in HepG2 cells and NLRC5-overexpressing HepG2 cells. These results demonstrate that NLRC5 promotes HCC progression via the AKT/VEGF-A signaling pathway.
Buchler, Norbou G; Hoyer, William J; Cerella, John
2008-06-01
Task-switching performance was assessed in young and older adults as a function of the number of task sets to be actively maintained in memory (varied from 1 to 4) over the course of extended training (5 days). Each of the four tasks required the execution of a simple computational algorithm, which was instantaneously cued by the color of the two-digit stimulus. Tasks were presented in pure (task set size 1) and mixed blocks (task set sizes 2, 3, 4), and the task sequence was unpredictable. By considering task switching beyond two tasks, we found evidence for a cognitive control system that is not overwhelmed by task set size load manipulations. Extended training eliminated age effects in task-switching performance, even when the participants had to manage the execution of up to four tasks. The results are discussed in terms of current theories of cognitive control, including task set inertia and production system postulates.
From proactive to retroactive dual-task interference: The important role of Task-2 probability
Nieuwenstein, Mark; Scholz, S.; Broers, Nico
2014-01-01
Dual-task studies on the attentional blink (AB) and psychological refractory period (PRP) effect show that the processing of a first target (T1) obstructs the processing of a shortly following target (T2). Recently, Nieuwenstein and Wyble (2014) found an opposite pattern, such that a memory encoding
Effects of dual-task conditions on cervical spine movement variability.
Niederer, Daniel; Vogt, Lutz; Vogel, Johanna; Banzer, Winfried
2017-09-22
The potential to accurately perform cervical movements during more challenging tasks might be of importance to prevent dysfunctional motion characteristics. Although sensorimotor function during dual-task conditions are of increasing interest in biomedical and rehabilitation research, effects of such conditions on movement consistency of the neck have not yet been investigated. In this crossover MiSpEx(Medicine in Spine Exercise)-diagnostic study, we aimed to explore differences between single and dual-task conditions on cervical movement variability. Nineteen healthy participants (9 male; 24.5 ± 3.3 y) performed 10 repetitive maximal cervical movements in (1) flexion/extension and (2) lateral flexion, during one single- and during two dual-task test conditions (cognitive, motor) in a randomised and cross-over sequence. Latter consisted of a working memory n-back task (n= 2) and a repetitive ankle movement task. Range of motion (RoM) was assessed using an external three-dimensional ultrasonic movement analysis system. Coefficient of variation (CV) for repetitive RoM was analysed for differences between conditions and controlled for variances in intra-individual movement characteristics. Friedman and post-hoc Bonferroni-adjusted confidence intervals for differences from single- to dual-task values revealed changes in CV in flexion/extension from single-task to motor dual-task (+0.02 ± 0.02 (97.5%CI: 0.01; 0.03); pdual-task condition (+0.01 ± 0.02 (97.5%CI: 0.003; 0.02)) nor for lateral flexion (p> 0.05). Pearson regression analyses revealed a linear negative (pdual-task (R=2 0.55). Results for lateral flexion are comparable, baseline CV negatively impacts differences to cognitive (R=2 0.2) and motor dual-task performance (R=2 0.76; pdual-task conditions while participants with a higher variability remained almost stable or showed a decrease. The results point toward a complex interrelationship of motion patterns and adaptation processes during challenging tasks
Directory of Open Access Journals (Sweden)
Mallori Burse
Full Text Available The host immunophilin cyclophilin A (CypA binds to the capsid protein (CA of HIV-1 and regulates its infectivity. Depending on the target cell type, CypA can either promote or inhibit HIV-1 infection. The ability of CypA to promote HIV-1 infection has been extensively studied and linked to several steps in early replication including uncoating, reverse transcription and nuclear import. By contrast, the mechanism by which CypA inhibits infection is less well understood. We investigated the mechanism by which CypA potentiates restriction of HIV-1 by the tripartite motif-containing protein 5 (TRIM5α. Depletion of TRIM5α in the African green monkey cell line Vero, resulted in a loss of inhibition of infection by CypA, demonstrating that inhibition by CypA is mediated by TRIM5α. Complementary genetic and biochemical assays failed to demonstrate an ability of CypA to promote binding of TRIM5α to the viral capsid. TRIM5α inhibits HIV-1 reverse transcription in a proteasome-dependent manner; however, we observed that inhibition of proteasome activity did not reduce the ability of CypA to inhibit infection, suggesting that CypA acts at a step after reverse transcription. Accordingly, we observed a CypA-dependent reduction in the accumulation of nuclear HIV-1 DNA, indicating that CypA specifically promotes TRIM5α inhibition of HIV-1 nuclear import. We also observed that the ability of CypA to inhibit HIV-1 infection is abolished by amino acid substitutions within the conserved CPSF6-binding surface in CA. Our results indicate that CypA inhibits HIV-1 infection in Vero cells not by promoting TRIM5α binding to the capsid but by blocking nuclear import of the HIV-1 preintegration complex.
LaCrosse, Amber L.; Burrows, Brian T.; Angulo, Rachel M.; Conrad, Phoebe R.; Himes, Sarah M.; Mathews, Nordia; Wegner, Scott A.; Taylor, Sara B.; Olive, M. Foster
2014-01-01
Rationale Positive allosteric modulators (PAMs) of type 5 metabotropic glutamate receptors (mGluR5) exert pro-cognitive effects in animal models of various neuropsychiatric diseases. However, few studies to date have examined ability of mGluR5 PAMs to reverse cognitive deficits in operant delayed matching/non-matching-to-sample (DMS/DNMS) tasks. Objectives To determine the ability of the mGluR5 PAM 3-cyano-N-1,3-diphenyl-1H-pyrazol-5-yl)benzamide (CDPPB) to reverse set-shifting deficits induced by the NMDA receptor antagonist MK-801. Methods Male Sprague-Dawley rats were initially trained to lever press for sucrose reinforcement under either DMS or DNMS conditions. Following successful acquisition of the task, reinforcement conditions were reversed (DNMS→DMS or DMS→DNMS). In Experiment 1, rats were treated daily prior to each session with either vehicle/vehicle, vehicle/MK-801 (0.06 mg/kg) simultaneously, CDPPB (20 mg/kg)/MK-801 simultaneously, or CDPPB 30 min prior to MK-801. In Experiment 2, rats were treated with either vehicle/vehicle, vehicle/MK-801, or CDPPB 30 min prior to MK-801 only prior to sessions that followed task reversal. Results In Experiment 1, no group differences in initial task acquisition were observed. Rats treated with vehicle+MK−801 showed significant set-shifting impairments following task reversal, which were partially attenuated by simultaneous administration of CDPPB/MK-801, and completely precluded by administration of CDPPB 30 min prior to MK-801. In Experiment 2, MK-801 did not impair reversal learning and no other group differences were observed. Conclusions MK-801 induced deficits in operant set-shifting ability were prevented by pretreatment with CDPPB. MK-801 did not produce deficits in initial task learning or when treatment was initiated following task reversal. PMID:24973895
AAHD's Health Promotion and Wellness, Part 2: Health Promotion Programs
Exceptional Parent, 2011
2011-01-01
This article is part 2 of a 4-part series on "Health Promotion and Wellness" from the American Association on Health and Disability (AAHD). According to the U.S. Census Bureau, more than 54 million people--one in five Americans--have a disability, and these Americans are more likely to report: (1) Being in poorer overall health; (2) Having less…
International Nuclear Information System (INIS)
Hodgkinson, David; Black, John
2005-03-01
This report forms part of an independent review of the specifications, execution and results of Task 6 of the Aespoe Task Force on Modelling of Groundwater Flow and Transport of Solutes, which is seeking to provide a bridge between site characterization and performance assessment approaches to solute transport in fractured rock. The present report is concerned solely with Tasks 6b, 6b and 6b which relate to the transport of tracers on a 5-metre scale in Feature A at the TRUE-1 site. The task objectives, specifications and individual modelling team results are summarised and reviewed, and an evaluation of the overall exercise is presented. The report concludes with assessments of what has been learnt, the implications for the Task 6 objectives, and some possible future directions
Yuan, Y; Zhang, G Q; Chai, W; Ni, M; Xu, C; Chen, J Y
2016-10-01
Osteoarthritis (OA) is characterised by articular cartilage degradation. MicroRNAs (miRNAs) have been identified in the development of OA. The purpose of our study was to explore the functional role and underlying mechanism of miR-138-5p in interleukin-1 beta (IL-1β)-induced extracellular matrix (ECM) degradation of OA cartilage. Human articular cartilage was obtained from patients with and without OA, and chondrocytes were isolated and stimulated by IL-1β. The expression levels of miR-138-5p in cartilage and chondrocytes were both determined. After transfection with miR-138-5p mimics, allele-specific oligonucleotide (ASO)-miR-138-5p, or their negative controls, the messenger RNA (mRNA) levels of aggrecan (ACAN), collagen type II and alpha 1 (COL2A1), the protein levels of glycosaminoglycans (GAGs), and both the mRNA and protein levels of matrix metalloproteinase (MMP)-13 were evaluated. Luciferase reporter assay, quantitative real-time polymerase chain reaction (qRT-PCR), and Western blot were performed to explore whether Forkhead Box C1 (FOCX1) was a target of miR-138-5p. Further, we co-transfected OA chondrocytes with miR-138-5p mimics and pcDNA3.1 (+)-FOXC1 and then stimulated with IL-1β to determine whether miR-138-5p-mediated IL-1β-induced cartilage matrix degradation resulted from targeting FOXC1. MiR-138-5p was significantly increased in OA cartilage and in chondrocytes in response to IL-1β-stimulation. Overexpression of miR-138-5p significantly increased the IL-1β-induced downregulation of COL2A1, ACAN, and GAGs, and increased the IL-1β-induced over expression of MMP-13.We found that FOXC1 is directly regulated by miR-138-5p. Additionally, co-transfection with miR-138-5p mimics and pcDNA3.1 (+)-FOXC1 resulted in higher levels of COL2A1, ACAN, and GAGs, but lower levels of MMP-13. miR-138-5p promotes IL-1β-induced cartilage degradation in human chondrocytes, possibly by targeting FOXC1.Cite this article: Y. Yuan, G. Q. Zhang, W. Chai,M. Ni, C. Xu, J
Kim, Hyungsae
2010-10-05
Dof proteins are transcription factors that have a conserved single zinc finger DNA-binding domain. In this study, we isolated an activation tagging mutant Dof5.1-D exhibiting an upward-curling leaf phenotype due to enhanced expression of the REV gene that is required for establishing adaxialabaxial polarity. Dof5.1-D plants also had reduced transcript levels for IAA6 and IAA19 genes, indicating an altered auxin biosynthesis in Dof5.1-D. An electrophoretic mobility shift assay using the Dof5.1 DNA-binding motif and the REV promoter region indicated that the DNA-binding domain of Dof5.1 binds to a TAAAGT motif located in the 5′-distal promoter region of the REV promoter. Further, transient and chromatin immunoprecipitation assays verified binding activity of the Dof5.1 DNA-binding motif with the REV promoter. Consistent with binding assays, constitutive over-expression of the Dof5.1 DNA-binding domain in wild-type plants caused a downward-curling phenotype, whereas crossing Dof5.1-D to a rev mutant reverted the upward-curling phenotype of the Dof5.1-D mutant leaf to the wild-type. These results suggest that the Dof5.1 protein directly binds to the REV promoter and thereby regulates adaxialabaxial polarity. © 2010 Blackwell Publishing Ltd.
Kim, Hyungsae; Kim, Sungjin; Abbasi, Nazia; Bressan, Ray Anthony; Yun, Daejin; Yoo, Sangdong; Kwon, SukYun; Choi, Sangbong
2010-01-01
Dof proteins are transcription factors that have a conserved single zinc finger DNA-binding domain. In this study, we isolated an activation tagging mutant Dof5.1-D exhibiting an upward-curling leaf phenotype due to enhanced expression of the REV gene that is required for establishing adaxialabaxial polarity. Dof5.1-D plants also had reduced transcript levels for IAA6 and IAA19 genes, indicating an altered auxin biosynthesis in Dof5.1-D. An electrophoretic mobility shift assay using the Dof5.1 DNA-binding motif and the REV promoter region indicated that the DNA-binding domain of Dof5.1 binds to a TAAAGT motif located in the 5′-distal promoter region of the REV promoter. Further, transient and chromatin immunoprecipitation assays verified binding activity of the Dof5.1 DNA-binding motif with the REV promoter. Consistent with binding assays, constitutive over-expression of the Dof5.1 DNA-binding domain in wild-type plants caused a downward-curling phenotype, whereas crossing Dof5.1-D to a rev mutant reverted the upward-curling phenotype of the Dof5.1-D mutant leaf to the wild-type. These results suggest that the Dof5.1 protein directly binds to the REV promoter and thereby regulates adaxialabaxial polarity. © 2010 Blackwell Publishing Ltd.
International Nuclear Information System (INIS)
Cui Wei; Yin Lingling; Dong Lingyue
2012-01-01
Objective: To clarify the mechanism of immediate early response gene 5 (Ier5) transcription induced by radiation. Methods: Deletant construction, site-specific mutagenesis,electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP) were used to forecast the promoter region, binding sites and transcription factors of Ier5 gene in HeLa cells. Results: The promoter region of Ier5 gene might be in the region of Ier5 -8 deletant (-408 - -238 bp). The Ier5 gene had two transcription factors of GCF and NFI, and GCF had two binding sites located in the region of -388 - -382 bp and -274 - -270 bp of Ier5 promoter. The binding site of NFI was located in -362 - -357 bp of Ier5 promoter. GCF could inhibit the expression of Ier5 gene and this inhibition was diminished when the radiation dose increased. In contrast, NFI increased the expression of Ier5. Conclusions: The most possible region of Ier5 promoter is from -408 to -238 bp which has two binding sites for the radiosensitivity transcription factors of GCF and NFI that could negatively and positively regulate the expression of Ier5 respectively. (authors)
Stahl, Christiane Ellen; Necheles, Jonathan Wolf; Mayefsky, Jay Hirsh; Wright, Lydia Katherine; Rankin, Kristin Michele
2011-03-01
This study investigated the feasibility and effectiveness of training pediatric residents to conduct a brief clinic-based behavioral intervention in coordination with community dissemination of a health promotion message developed by the Consortium for Lowering Obesity in Chicago Children. A total of 113 residents completed a short (obesity rates: increased intake of fruits and vegetables (28% vs 16%, P < .01), increased intake of water (30% vs 19%, P < .01), increased physical activity (40% vs 29%, P < .03), and decreased television time (36% vs 24%, P < .01). Brief training using the 5-4-3-2-1-Go! message seems to be feasible and effective.
Dissection of a locus on mouse chromosome 5 reveals arthritis promoting and inhibitory genes
DEFF Research Database (Denmark)
Lindvall, Therese; Karlsson, Jenny; Holmdahl, Rikard
2009-01-01
with Eae39 congenic- and sub-interval congenic mice, carrying RIIIS/J genes on the B10.RIII genetic background, revealed three loci within Eae39 that control disease and anti-collagen antibody titers. Two of the loci promoted disease and the third locus was protecting from collagen induced arthritis...... development. By further breeding of mice with small congenic fragments, we identified a 3.2 Megabasepair (Mbp) interval that regulates disease. CONCLUSIONS: Disease promoting- and protecting genes within the Eae39 locus on mouse chromosome 5, control susceptibility to collagen induced arthritis. A disease......-protecting locus in the telomeric part of Eae39 results in lower anti-collagen antibody responses. The study shows the importance of breeding sub-congenic mouse strains to reveal genetic effects on complex diseases....
Nagarajan, Raman P; Hogart, Amber R; Gwye, Ynnez; Martin, Michelle R; LaSalle, Janine M
2006-01-01
Mutations in MECP2, encoding methyl CpG binding protein 2 (MeCP2), cause most cases of Rett syndrome (RTT), an X-linked neurodevelopmental disorder. Both RTT and autism are "pervasive developmental disorders" and share a loss of social, cognitive and language skills and a gain in repetitive stereotyped behavior, following apparently normal perinatal development. Although MECP2 coding mutations are a rare cause of autism, MeCP2 expression defects were previously found in autism brain. To further study the role of MeCP2 in autism spectrum disorders (ASDs), we determined the frequency of MeCP2 expression defects in brain samples from autism and other ASDs. We also tested the hypotheses that MECP2 promoter mutations or aberrant promoter methylation correlate with reduced expression in cases of idiopathic autism. MeCP2 immunofluorescence in autism and other neurodevelopmental disorders was quantified by laser scanning cytometry and compared with control postmortem cerebral cortex samples on a large tissue microarray. A significant reduction in MeCP2 expression compared to age-matched controls was found in 11/14 autism (79%), 9/9 RTT (100%), 4/4 Angelman syndrome (100%), 3/4 Prader-Willi syndrome (75%), 3/5 Down syndrome (60%), and 2/2 attention deficit hyperactivity disorder (100%) frontal cortex samples. One autism female was heterozygous for a rare MECP2 promoter variant that correlated with reduced MeCP2 expression. A more frequent occurrence was significantly increased MECP2 promoter methylation in autism male frontal cortex compared to controls. Furthermore, percent promoter methylation of MECP2 significantly correlated with reduced MeCP2 protein expression. These results suggest that both genetic and epigenetic defects lead to reduced MeCP2 expression and may be important in the complex etiology of autism.
CO_2 capture from flue gas using clathrate formation in the presence of thermodynamic promoters
International Nuclear Information System (INIS)
Kim, Soyoung; Choi, Sung-Deuk; Seo, Yongwon
2017-01-01
Tetrahydrofuran (THF) as a water-soluble sII clathrate former, cyclopentane (CP) as a water-insoluble sII clathrate former, and tetra n-butyl ammonium chloride (TBAC) as a water-soluble semiclathrate former were used to investigate their thermodynamic promotion effects on clathrate-based CO_2 capture from simulated flue gas. The phase equilibria of CO_2 (20%) + N_2 (80%) + promoter clathrates at different promoter concentrations revealed that the presence of THF, CP, and TBAC could significantly reduce the clathrate formation pressure. THF solutions provided the highest gas uptake and steepest CO_2 concentration changes in the vapor phase, whereas TBAC solutions showed the highest CO_2 selectivity (∼61%) in the clathrate phase. CP solutions exhibited a slower formation rate, but their final gas uptake and CO_2 selectivity in the clathrate phase were comparable to the THF solutions. Raman spectroscopy confirmed the enclathration of both CO_2 and N_2 in the clathrate cages and a structural transition due to the inclusion of promoters in the clathrate phase. The overall experimental results indicate that TBAC is a viable thermodynamic promoter for clathrate-based CO_2 capture from simulated flue gas, considering the lower pressure requirement for clathrate formation, higher CO_2 enrichment in the clathrate phase, non-toxicity, and non-volatility. - Highlights: • Clathrate-based CO_2 capture was investigated in the presence of thermodynamic promoters. • THF, CP, and TBAC demonstrated a significant thermodynamic promotion for CO_2 (20%) + N_2 (80%) clathrates. • The highest gas uptake was observed for the THF (5.6 mol%) solution. • TBAC solutions showed the highest CO_2 selectivity in the clathrate phase (∼61%). • Raman spectroscopy confirmed the guest gas enclathration and clathrate structure.
Micropore Formation of [Zn2(Oxac) (Taz)2]·(H2O)2.5 via CO2 Adsorption.
Zubir, Moondra; Hamasaki, Atom; Iiyama, Taku; Ohta, Akira; Ohki, Hiroshi; Ozeki, Sumio
2017-01-24
As-synthesized [Zn 2 (Oxac) (Taz) 2 ]·(H 2 O) 2.5 , referred to as ZOTW 2.5 , was prepared from aqueous methanol solutions of Zn 5 (CO 3 ) 2 (OH) 6 and two kinds of ligands of 1,2,4-triazole (Taz) and oxalic acid (Oxac) at 453 K for 12 h. The crystal structure was determined by the Rietveld method. As-synthesized ZOTW 2.5 was pretreated at 383 K and 1 mPa for t pt h, ZOTW x (t pt h). ZOTW x (≥3h) showed a type I adsorption isotherm for N 2 at 77 K having a saturation amount (V s ) of 180 mg/g, but that pretreated shortly showed only 1/10 in V s . CO 2 was adsorbed at 303 K in sigmoid on nonporous ZOTW x (≤2h) and in Langmuir-type on ZOTW x (≥3h) to reach the adsorption amount of 120 mg/g at 700 Torr. N 2 adsorption on ZOTW x (≤2h)deCO 2 , degassed after CO 2 adsorption on ZOTW x (≤2h), was promoted 5-fold from 180 mg/g on ZOTW x (t pt h) and ZOTW x (≥3h)deCO 2 up to ca. 1000 mg/g. The interaction of CO 2 and H 2 O molecules in micropores may lead to a new route for micropore formation.
Adler, Corey; Chung-Do, Jane; Ongalibang, Ophelia
2008-01-01
The Asian/Pacific Islander Youth Violence Prevention Center (APIYVPC) focuses its youth violence prevention efforts on community mobilization by partnering with Kailua High School and other local community groups. This paper describes the development and activities of the Safe School Task Force (SSTF) and the lessons learned. In response to concerns of school, community members, and students, the SSTF was organized to promote student leadership in raising awareness about problems related to violence. Collaboration among the school, community, and the university places students in leadership roles to reduce school violence and enhances their self-efficacy to improve their school environment. To increase SSTF effectiveness, more attention must be paid to student recruitment, consistent community partnerships, and gaining teacher buy-in. This partnership may be useful in multicultural communities to provide students the opportunities to learn about violence prevention strategies, community mobilization, and leadership skills.
Lin, Grace; LaPensee, Christopher R; Qin, Zhaohui S; Schwartz, Jessica
2014-09-01
Expression of the Growth Hormone (GH)-stimulated gene Socs2 (Suppressor of Cytokine Signaling 2) is mediated by the transcription activator STAT5 (Signal Transducer and Activator of Transcription 5) and the transcription repressor BCL6 (B-Cell Lymphoma 6). ChIP-Sequencing identified Cish (Cytokine-Inducible SH2-containing protein) and Bcl6 as having similar patterns of reciprocal occupancy by BCL6 and STAT5 in response to GH, though GH stimulates Cish and inhibits Bcl6 expression. The co-activator p300 occupied Socs2, Cish and Bcl6 promoters, and enhanced STAT5-mediated activation of Socs2 and Cish. In contrast, on Bcl6, p300 functioned as a repressor and inhibited in conjunction with STAT5 or BCL6. The co-repressor HDAC3 (Histone deacetylase 3) inhibited the Socs2, Cish and Bcl6 promoters in the presence of STAT5. Thus transcriptional outcomes on GH-regulated genes occupied by BCL6 and STAT5 are determined in a promoter-specific fashion by co-regulatory proteins which mediate the distinction between activating and repressive transcription factors. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Developing Intentionality and L2 Classroom Task-Engagement
Stelma, Juup
2014-01-01
This paper extends work on "intentionality", from philosophy, psychology and education to an exploration of learners' meaning-making in L2 classroom task-engagement. The paper draws on both phenomenological and folk-psychological perspectives on intentionality, and employs John R. Searle's intrinsic (mental) and derived (observable)…
Carnosol promotes endothelial differentiation under H2O2-induced oxidative stress
Directory of Open Access Journals (Sweden)
Ou Shulin
2017-01-01
Full Text Available Oxidative stress causes deregulation of endothelial cell differentiation. Carnosol is a potent antioxidant and antiinflammatory compound. In the present study, we examined whether the antioxidant effect of carnosol might protect bone marrow stem cells against H2O2-induced oxidative stress and promote endothelial differentiation. We examined cell viability by the MTT assay; oxidative stress and apoptosis were analyzed through changes in ROS levels, apoptotic ratio and caspase-3 activity; changes in protein expression of OCT-4, Flk-1, CD31 and Nrf-2 were assessed by Western blot analysis. H2O2 treatment increased oxidative stress and reduced cell viability, while the stem cell marker OCT-4 and endothelial markers Flk-1, CD31 were significantly downregulated as a result of the treatment with H2O2. Treatment with carnosol improved the antioxidant status, increased OCT-4 expression and promoted endothelial differentiation. This study provides evidence that carnosol could increase the antioxidant defense mechanism and promote endothelial differentiation.
mTORC2 Promotes Tumorigenesis via Lipid Synthesis.
Guri, Yakir; Colombi, Marco; Dazert, Eva; Hindupur, Sravanth K; Roszik, Jason; Moes, Suzette; Jenoe, Paul; Heim, Markus H; Riezman, Isabelle; Riezman, Howard; Hall, Michael N
2017-12-11
Dysregulated mammalian target of rapamycin (mTOR) promotes cancer, but underlying mechanisms are poorly understood. We describe an mTOR-driven mouse model that displays hepatosteatosis progressing to hepatocellular carcinoma (HCC). Longitudinal proteomic, lipidomics, and metabolomic analyses revealed that hepatic mTORC2 promotes de novo fatty acid and lipid synthesis, leading to steatosis and tumor development. In particular, mTORC2 stimulated sphingolipid (glucosylceramide) and glycerophospholipid (cardiolipin) synthesis. Inhibition of fatty acid or sphingolipid synthesis prevented tumor development, indicating a causal effect in tumorigenesis. Increased levels of cardiolipin were associated with tubular mitochondria and enhanced oxidative phosphorylation. Furthermore, increased lipogenesis correlated with elevated mTORC2 activity and HCC in human patients. Thus, mTORC2 promotes cancer via formation of lipids essential for growth and energy production. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Moon Hyeon Kim
2018-03-01
Full Text Available Promotion of 2.73% Fe2O3 in an in-house-made V2O5-WO3/TiO2 (VWT and a commercial V2O5-WO3/TiO2 (c-VWT has been investigated as a cost effective approach to the suppression of N2O formation in the selective catalytic reduction of NO by NH3 (NH3-SCR. The promoted VWT and c-VWT catalysts all gave a significantly decreased N2O production at temperatures >400 °C compared to the unpromoted samples. However, such a promotion led to the loss in high temperature NO conversion, mainly due to the oxidation of NH3 to N-containing gases, particularly NO. Characterization of the unpromoted and promoted catalysts using X-ray diffraction (XRD, NH3 adsorption-desorption, and Raman spectroscopy techniques could explain the reason why the promotion showed much lower N2O formation levels at high temperatures. The addition of Fe2O3 to c-VWT resulted in redispersion of the V2O5 species, although this was not visible for 2.73% Fe2O3/VWT. The iron oxides exist as a highly-dispersed noncrystalline α-Fe2O3 in the promoted catalysts. These Raman spectra had a new Raman signal that could be tentatively assigned to Fe2O3-induced tetrahedrally coordinated polymeric vanadates and/or surface V-O-Fe species with significant electronic interactions between the both metal oxides. Calculations of the monolayer coverage of each metal oxide and the surface total coverage are reasonably consistent with Raman measurements. The proposed vanadia-based surface polymeric entities may play a key role for the substantial reduction of N2O formed at high temperatures by NH3 species adsorbed strongly on the promoted catalysts. This reaction is a main pathway to greatly suppress the extent of N2O formation in NH3-SCR reaction over the promoted catalysts.
Kiuru, Noona; Pakarinen, Eija; Vasalampi, Kati; Silinskas, Gintautas; Aunola, Kaisa; Poikkeus, Anna-Maija; Metsäpelto, Riitta-Leena; Lerkkanen, Marja-Kristiina; Nurmi, Jari-Erik
2014-04-01
In the longitudinal study presented here, we tested the theoretical assumption that children's task-focused behavior in learning situations mediates the associations between supportive interpersonal environments and academic performance. The sample consisted of 2,137 Finnish-speaking children. Data on supportive interpersonal environments (characterized by authoritative parenting, positive teacher affect toward the child, and peer acceptance) were gathered in Grade 1. The children's task-focused behavior was measured in Grades 2 and 3, and academic performance was measured in Grades 1 and 4. The results supported our assumption by showing that all three supportive environments were positively associated with children's subsequent academic performance via increased task-focused behavior in learning situations. These findings suggest that students' academic performance can be promoted by increasing the support they receive from peers, parents, and teachers because such increased support leads to better task focus in learning tasks.
International Nuclear Information System (INIS)
Hodgkinson, David
2007-09-01
This report forms part of an independent review of the specifications, execution and results of Task 6 of the Aespoe Task Force on Modelling of Groundwater Flow and Transport of Solutes, which is seeking to provide a bridge between site characterization and performance assessment approaches to modelling solute transport in fractured rock. The objectives of Task 6 are: To assess simplifications used in Performance Assessment (PA) models. To determine how, and to what extent, experimental tracer and flow experiments can constrain the range of parameters used in PA models. To support the design of Site Characterisation (SC) programmes to ensure that the results have optimal value for performance assessment calculations. To improve the understanding of site-specific flow and transport behaviour at different scales using site characterisation models. The present report is concerned with Tasks 6D, 6E, 6F and 6F2. It follows on from two previous reviews of Tasks 6A, 6B and 6B2, and Task 6C. In Task 6D the transport of tracers through a fracture network is modelled using the conditions of the C2 TRUE-Block Scale tracer test, based on the synthetic structural model developed in Task 6C. Task 6E extends the Task 6D transport calculations to a reference set of PA time scales and boundary conditions. Task 6F consists of a series of 'benchmark' studies on single features from the Task 6C hydrostructural model in order to improve the understanding of differences between the participating models. Task 6F2 utilises models set up for Tasks 6E and 6F to perform additional sensitivity studies with the aim of increasing the understanding of how models behave, the reason for differences in modelling results, and the sensitivity of models to various assumptions and parameter values. Eight modelling teams representing five organisations participated in this exercise using Discrete Fracture Network (DFN), continuum and channel network concepts implemented in a range of different codes and
Energy Technology Data Exchange (ETDEWEB)
Hodgkinson, David (Quintessa, Henley-on-Thames (GB))
2007-09-15
This report forms part of an independent review of the specifications, execution and results of Task 6 of the Aespoe Task Force on Modelling of Groundwater Flow and Transport of Solutes, which is seeking to provide a bridge between site characterization and performance assessment approaches to modelling solute transport in fractured rock. The objectives of Task 6 are: To assess simplifications used in Performance Assessment (PA) models. To determine how, and to what extent, experimental tracer and flow experiments can constrain the range of parameters used in PA models. To support the design of Site Characterisation (SC) programmes to ensure that the results have optimal value for performance assessment calculations. To improve the understanding of site-specific flow and transport behaviour at different scales using site characterisation models. The present report is concerned with Tasks 6D, 6E, 6F and 6F2. It follows on from two previous reviews of Tasks 6A, 6B and 6B2, and Task 6C. In Task 6D the transport of tracers through a fracture network is modelled using the conditions of the C2 TRUE-Block Scale tracer test, based on the synthetic structural model developed in Task 6C. Task 6E extends the Task 6D transport calculations to a reference set of PA time scales and boundary conditions. Task 6F consists of a series of 'benchmark' studies on single features from the Task 6C hydrostructural model in order to improve the understanding of differences between the participating models. Task 6F2 utilises models set up for Tasks 6E and 6F to perform additional sensitivity studies with the aim of increasing the understanding of how models behave, the reason for differences in modelling results, and the sensitivity of models to various assumptions and parameter values. Eight modelling teams representing five organisations participated in this exercise using Discrete Fracture Network (DFN), continuum and channel network concepts implemented in a range of different
GSTT2 promoter polymorphisms and colorectal cancer risk
Directory of Open Access Journals (Sweden)
Ahn Sun-A
2007-01-01
Full Text Available Abstract Background Glutathione S-transferases are a group of enzymes that participate in detoxification and defense mechanisms against toxic carcinogens and other compounds. These enzymes play an important role in human carcinogenesis. In the present study, we sought to determine whether GSTT2 promoter single nucleotide polymorphisms (SNPs are associated with colorectal cancer risk. Methods A total of 436 colorectal cancer patients and 568 healthy controls were genotyped for three GSTT2 promoter SNPs (-537G>A, -277T>C and -158G>A, using real-time TaqMan assay and direct sequencing. An electrophoretic mobility shift assay (EMSA was performed to determine the effects of polymorphisms on protein binding to the GSTT2 promoter. Results The -537A allele (-537G/A or A/A was significantly associated with colorectal cancer risk (OR = 1.373, p = 0.025, while the -158A allele (-158G/A or A/A was involved in protection against colorectal cancer (OR = 0.539, p = 0.032. Haplotype 2 (-537A, -277T, -158G was significantly associated with colorectal cancer risk (OR = 1.386, p = 0.021, while haplotype 4 (-537G, -277C, -158A protected against colorectal cancer (OR = 0.539, p = 0.032. EMSA data revealed lower promoter binding activity in the -537A allele than its -537G counterpart. Conclusion Our results collectively suggest that SNPs and haplotypes of the GSTT2 promoter region are associated with colorectal cancer risk in the Korean population.
Highlighting relatedness promotes prosocial motives and behavior.
Pavey, Louisa; Greitemeyer, Tobias; Sparks, Paul
2011-07-01
According to self-determination theory, people have three basic psychological needs: relatedness, competence, and autonomy. Of these, the authors reasoned that relatedness need satisfaction is particularly important for promoting prosocial behavior because of the increased sense of connectedness to others that this engenders. In Experiment 1, the authors manipulated relatedness, autonomy, competence, or gave participants a neutral task, and found that highlighting relatedness led to higher interest in volunteering and intentions to volunteer relative to the other conditions. Experiment 2 found that writing about relatedness experiences promoted feelings of connectedness to others, which in turn predicted greater prosocial intentions. Experiment 3 found that relatedness manipulation participants donated significantly more money to charity than did participants given a neutral task. The results suggest that highlighting relatedness increases engagement in prosocial activities and are discussed in relation to the conflict and compatibility between individual and social outcomes. © 2011 by the Society for Personality and Social Psychology, Inc
Cantoro, Renata; Crocco, Carlos Daniel; Benech-Arnold, Roberto Luis; Rodríguez, María Verónica
2013-12-01
The precise adjustment of the timing of dormancy release according to final grain usage is still a challenge for many cereal crops. Grain sorghum [Sorghum bicolor (L.) Moench] shows wide intraspecific variability in dormancy level and susceptibility to pre-harvest sprouting (PHS). Both embryo sensitivity to abscisic acid (ABA) and gibberellin (GA) metabolism play an important role in the expression of dormancy of the developing sorghum grain. In previous works, it was shown that, simultaneously with a greater embryo sensitivity to ABA and higher expression of SbABA-INSENSITIVE 4 (SbABI4) and SbABA-INSENSITIVE 5 (SbABI5), dormant grains accumulate less active GA4 due to a more active GA catabolism. In this work, it is demonstrated that the ABA signalling components SbABI4 and SbABI5 interact in vitro with a fragment of the SbGA 2-OXIDASE 3 (SbGA2ox3) promoter containing an ABA-responsive complex (ABRC). Both transcription factors were able to bind the promoter, although not simultaneously, suggesting that they might compete for the same cis-acting regulatory sequences. A biological role for these interactions in the expression of dormancy of sorghum grains is proposed: either SbABI4 and/or SbABI5 activate transcription of the SbGA2ox3 gene in vivo and promote SbGA2ox3 protein accumulation; this would result in active degradation of GA4, thus preventing germination of dormant grains. A comparative analysis of the 5'-regulatory region of GA2oxs from both monocots and dicots is also presented; conservation of the ABRC in closely related GA2oxs from Brachypodium distachyon and rice suggest that these species might share the same regulatory mechanism as proposed for grain sorghum.
A Brief Introduction of Task-based Approach
Institute of Scientific and Technical Information of China (English)
王丹
2012-01-01
The task-based language teaching approach is one of the syllabus models that have been proposed in the last twenty years or so. Task-based syllabus represent a particular realization of communicative language teaching. Task-based teaching/learning helps develop students’ communicative competence, enabling them to communicate effectively in real communicating world and engage in interaction. The most active element in the process of the task-based teaching is the learner’ creativity. By exploiting this kind of creativity, learning can be made significantly more efficient and more interesting. It is well-known that the task-based teaching/learning have a rich potential for promoting successful second language learning than the traditional teaching/learning. Task-based approach is reflected not only in China but also in some other countries, such as America, Canada, Singapore, Hong Kong and son on.
Directory of Open Access Journals (Sweden)
Bettina eGathmann
2015-02-01
Full Text Available Performing two cognitively demanding tasks at the same time is known to decrease performance. The current study investigates the underlying executive functions of a dual-tasking situation involving the simultaneous performance of decision making under explicit risk and a working memory task. It is suggested that making a decision and performing a working memory task at the same time should particularly require monitoring - an executive control process supervising behavior and the state of processing on two tasks. To test the role of a supervisory/monitoring function in such a dual-tasking situation we investigated 122 participants with the Game of Dice Task plus 2-back task (GDT plus 2-back task. This dual task requires participants to make decisions under risk and to perform a 2-back working memory task at the same time. Furthermore, a task measuring a set of several executive functions gathered in the term concept formation (Modified Card Sorting Test, MCST and the newly developed Balanced Switching Task (BST, measuring monitoring in particular, were used. The results demonstrate that concept formation and monitoring are involved in the simultaneous performance of decision making under risk and a working memory task. In particular, the mediation analysis revealed that BST performance partially mediates the influence of MCST performance on the GDT plus 2-back task. These findings suggest that monitoring is one important subfunction for superior performance in a dual-tasking situation including decision making under risk and a working memory task.
Gathmann, Bettina; Schiebener, Johannes; Wolf, Oliver T.; Brand, Matthias
2015-01-01
Performing two cognitively demanding tasks at the same time is known to decrease performance. The current study investigates the underlying executive functions of a dual-tasking situation involving the simultaneous performance of decision making under explicit risk and a working memory task. It is suggested that making a decision and performing a working memory task at the same time should particularly require monitoring—an executive control process supervising behavior and the state of processing on two tasks. To test the role of a supervisory/monitoring function in such a dual-tasking situation we investigated 122 participants with the Game of Dice Task plus 2-back task (GDT plus 2-back task). This dual task requires participants to make decisions under risk and to perform a 2-back working memory task at the same time. Furthermore, a task measuring a set of several executive functions gathered in the term concept formation (Modified Card Sorting Test, MCST) and the newly developed Balanced Switching Task (BST), measuring monitoring in particular, were used. The results demonstrate that concept formation and monitoring are involved in the simultaneous performance of decision making under risk and a working memory task. In particular, the mediation analysis revealed that BST performance partially mediates the influence of MCST performance on the GDT plus 2-back task. These findings suggest that monitoring is one important subfunction for superior performance in a dual-tasking situation including decision making under risk and a working memory task. PMID:25741308
Remote dismantlement tasks for the CP5 reactor: Implementation, operations, and lessons learned
International Nuclear Information System (INIS)
Noakes, M.W.
1998-01-01
This paper presents a developer's perspective on lessons learned from one example of the integration of new prototype technology into a traditional operations environment. The dual arm work module was developed by the Robotics Technology Development Program as a research and development activity to examine manipulator controller modes and deployment options. It was later reconfigured for the dismantlement of the Argonne National Laboratory Chicago Pile number-sign 5 reactor vessel as the crane-deployed dual arm work platform. Development staff worked along side operations staff during a significant part of the deployment to provide training, maintenance, and tooling support. Operations staff completed all actual remote dismantlement tasks. At the end of available development support funding, the Dual Arm Work Platform was turned over to the operations staff, who is still using it to complete their dismantlement tasks
Directory of Open Access Journals (Sweden)
Yumeng Shi
2018-04-01
Full Text Available ObjectivesFibroblast-like synoviocytes (FLS exhibit a unique aggressive phenotype in rheumatoid arthritis (RA. Increased FLS migration and subsequent invasion of the extracellular matrix are essential to joint destruction in RA. Our previous research reported that transcription factor SOX5 was highly expressed in RA-FLS. Here, the effects of SOX5 in RA-FLS migration and invasion will be investigated.MethodsThe migration and invasion of RA-FLS were evaluated using a transwell chamber assay. The expression of several potential SOX5-targeted genes, including matrix metalloproteinases (MMP-1, 2, 3 and 9, chemokines (CCL4, CCL2, CCR5 and CCR2, and pro-inflammatory cytokines (TNF-α and IL-6, were examined in RA-FLS using SOX5 gain- and loss-of-function study. The molecular mechanisms of SOX5-mediated MMP-9 expressions were assayed by luciferase reporter gene and chromatin immunoprecipitation (ChIP studies. The in vivo effect of SOX5 on FLS migration and invasion was examined using collagen-induced arthritis (CIA in DBA/1J mice.ResultsKnockdown SOX5 decreased lamellipodium formation, migration, and invasion of RA-FLS. The expression of MMP-9 was the only gene tested to be concomitantly affected by silencing or overexpressing SOX5. ChIP assay revealed that SOX5 was bound to the MMP-9 promoter in RA-FLS. The overexpression of SOX5 markedly enhanced the MMP-9 promoter activity, and specific deletion of a putative SOX5-binding site in MMP-9 promoter diminished this promoter-driven transcription in FLS. Locally knocked down SOX5 inhibited MMP-9 expression in the joint tissue and reduced pannus migration and invasion into the cartilage in CIA mice.ConclusionSOX5 plays a novel role in mediating migration and invasion of FLS in part by regulating MMP-9 expression in RA.
Shi, Yumeng; Wu, Qin; Xuan, Wenhua; Feng, Xiaoke; Wang, Fang; Tsao, Betty P; Zhang, Miaojia; Tan, Wenfeng
2018-01-01
Fibroblast-like synoviocytes (FLS) exhibit a unique aggressive phenotype in rheumatoid arthritis (RA). Increased FLS migration and subsequent invasion of the extracellular matrix are essential to joint destruction in RA. Our previous research reported that transcription factor SOX5 was highly expressed in RA-FLS. Here, the effects of SOX5 in RA-FLS migration and invasion will be investigated. The migration and invasion of RA-FLS were evaluated using a transwell chamber assay. The expression of several potential SOX5-targeted genes, including matrix metalloproteinases (MMP-1, 2, 3 and 9), chemokines (CCL4, CCL2, CCR5 and CCR2), and pro-inflammatory cytokines (TNF-α and IL-6), were examined in RA-FLS using SOX5 gain- and loss-of-function study. The molecular mechanisms of SOX5-mediated MMP-9 expressions were assayed by luciferase reporter gene and chromatin immunoprecipitation (ChIP) studies. The in vivo effect of SOX5 on FLS migration and invasion was examined using collagen-induced arthritis (CIA) in DBA/1J mice. Knockdown SOX5 decreased lamellipodium formation, migration, and invasion of RA-FLS. The expression of MMP-9 was the only gene tested to be concomitantly affected by silencing or overexpressing SOX5. ChIP assay revealed that SOX5 was bound to the MMP-9 promoter in RA-FLS. The overexpression of SOX5 markedly enhanced the MMP-9 promoter activity, and specific deletion of a putative SOX5-binding site in MMP-9 promoter diminished this promoter-driven transcription in FLS. Locally knocked down SOX5 inhibited MMP-9 expression in the joint tissue and reduced pannus migration and invasion into the cartilage in CIA mice. SOX5 plays a novel role in mediating migration and invasion of FLS in part by regulating MMP-9 expression in RA.
Data analysis & probability task sheets : grades pk-2
Cook, Tanya
2009-01-01
For grades PK-2, our Common Core State Standards-based resource meets the data analysis & probability concepts addressed by the NCTM standards and encourages your students to learn and review the concepts in unique ways. Each task sheet is organized around a central problem taken from real-life experiences of the students.
Niu, Jihong; Li, Henan; Zhang, Yao; Li, Jinlan; Xie, Min; Li, Lingdi; Qin, Xiaoying; Qin, Yazhen; Guo, Xiaohuan; Jiang, Qian; Liu, Yanrong; Chen, Shanshan; Huang, Xiaojun; Han, Wenling; Ruan, Guorui
2011-06-01
CMTM5 has been shown to exhibit tumor suppressor activities, however, its role in leukemia is unclear. Herein we firstly reported the expression and function of CMTM5 in myeloid leukemia. CMTM5 was down-regulated, or undetectable, in leukemia cell lines and bone marrow cells from leukemia patients with promoter methylation. Ectopic expression of CMTM5-v1 strongly inhibited the proliferation of K562 and MEG-01 cells. In addition, significant negative correlations were observed between CMTM5 and three leukemia-specific fusion genes (AML1-ETO, PML-RARα and BCR/ABL1). CMTM5 expression was up-regulated in patients who had undergone treatment. Therefore, CMTM5 may be involved in the pathomechanism of myeloid leukemias. Copyright © 2010 Elsevier Ltd. All rights reserved.
Eissa, Sanaa; Zohny, Samir F; Shehata, Hanan Hussien; Hegazy, Marwa G A; Salem, Ahmed M; Esmat, Mohamed
2012-04-01
We evaluated the significance of urinary retinoic acid receptor-β2 (RAR-β2) gene promoter methylation and hyaluronidase activity in comparison with voided urine cytology (VUC) in diagnosis of bladder cancer. This study included 100 patients diagnosed with bladder cancer, 65 patients with benign urological disorders and 51 healthy volunteers. Urine supernatant was used for determining hyaluronidase activity by zymography while urine sediment was used for cytology and detection of methylated RAR-β2 gene promoter by methylation specific nested PCR. The sensitivity and specificity were 53% and 90.5% for VUC, 65% and 89.7% for percent methylation fraction of RAR-β2 gene promoter, and 89% and 90.5% for hyaluronidase activity; combination of the three parameters increased sensitivity to 95%. A significant association was observed between investigated markers and advanced grade tumor. Combined use of RAR-β2 gene promoter methylation, hyaluronidase activity and VUC is promising non-invasive tool for bladder cancer detection. Copyright © 2012. Published by Elsevier Inc.
Hydrocracking of Cerbera manghas Oil with Co-Ni/HZSM-5 as Double Promoted Catalyst
Directory of Open Access Journals (Sweden)
Lenny Marlinda
2017-05-01
Full Text Available The effect of various reaction temperature on the hydrocracking of Cerbera manghas oil to produce a paraffin-rich mixture of hydrocarbons with Co-Ni/HZSM-5 as doubled promoted catalyst were studied. The Co-Ni/HZSM-5 catalyst with various metal loading and metal ratio was prepared by incipient wetness impregnation. The catalysts were characterized by XRD, AAS, and N2 adsorption-desorption. Surface area, pore diameter, and pore volume of catalysts decreased with the increasing of metals loading. The hydrocracking process was conducted under hydrogen initial pressure in batch reactor equipped with a mechanical stirrer. The reaction was carried out at a temperature of 300-375 oC for 2 h. Depending on the experimental condition, the reaction pressure changed between 10 bar and 15 bar. Several parameters were used to evaluate biofuel produced, including oxygen removal, hydrocarbon composition and gasoline/kerosene/diesel yields. Biofuel was analyzed by Fourier Transform Infrared Spectroscopic (FTIR and gas chromatography-mass spectrometry (GC-MS. The composition of hydrocarbon compounds in liquid products was similar to the compounds in the gasoil sold in unit of Pertamina Gas Stations, namely pentadecane, hexadecane, heptadecane, octadecane, and nonadecane with different amounts for each biofuel produced at different reaction temperatures. However, isoparaffin compounds were not formed at all operating conditions. Pentadecane (n-C15 and heptadecane (n-C17 were the most abundant composition in gasoil when Co-Ni/HZSM-5 catalyst was used. Cerbera Manghas oil can be recommended as the source of non-edible vegetable oil to produce gasoil as an environmentally friendly transportation fuel. Copyright © 2017 BCREC Group. All rights reserved Received: 20th May 2016; Revised: 30th January 2017; Accepted: 10th February 2017 How to Cite: Marlinda, L., Al-Muttaqii, M., Gunardi, I., Roesyadi, A., Prajitno, D.H. (2017. Hydrocracking of Cerbera manghas Oil
Ye, Xiuqin; Hong, Wei; Hao, Binwei; Peng, Gongyong; Huang, Lingmei; Zhao, Zhuxiang; Zhou, Yumin; Zheng, Mengning; Li, Chenglong; Liang, Chunxiao; Yi, Erkang; Pu, Jinding; Li, Bing; Ran, Pixin
2018-03-02
The contribution of airway remodeling in chronic obstructive pulmonary disease (COPD) has been well documented, with airway smooth muscle cell proliferation and migration playing a role in the remodeling process. Here, we aimed to verify the effects of fine particulate matter (PM2.5) on human bronchial smooth muscle cell (HBSMC) migration and to explore the underlying signaling pathways. HBSMC apoptosis, proliferation and migration were measured using flow cytometry, cell counting and transwell migration assays, respectively. The role of the hedgehog pathway in cell migration was assessed by western blotting to measure the expression of Sonic hedgehog (Shh), Gli1 and Snail. Furthermore, siRNA was used to knock down Gli1 or Snail expression. PM2.5 induced HBSMC apoptosis in a dose-dependent manner, although certain concentrations of PM2.5 did not induce HBSMC proliferation or apoptosis. Interestingly, cell migration was stimulated by PM2.5 doses far below those that induced apoptosis. Additional experiments revealed that these PM2.5 doses enhanced the expression of Shh, Gli1 and Snail in HBSMCs. Furthermore, PM2.5-induced cell migration and protein expression were enhanced by recombinant Shh and attenuated by cyclopamine. Similar results were obtained by knocking down Gli1 or Snail. These findings suggest that PM2.5, which may exert its effects through the Shh signaling pathway, is necessary for the migration of HBSMCs. These data define a novel role for PM2.5 in airway remodeling in COPD.
Deng, X; Shao, G; Zhang, H-T; Li, C; Zhang, D; Cheng, L; Elzey, B D; Pili, R; Ratliff, T L; Huang, J; Hu, C-D
2017-03-02
Protein arginine methyltransferase 5 (PRMT5) is an emerging epigenetic enzyme that mainly represses transcription of target genes via symmetric dimethylation of arginine residues on histones H4R3, H3R8 and H2AR3. Accumulating evidence suggests that PRMT5 may function as an oncogene to drive cancer cell growth by epigenetic inactivation of several tumor suppressors. Here, we provide evidence that PRMT5 promotes prostate cancer cell growth by epigenetically activating transcription of the androgen receptor (AR) in prostate cancer cells. Knockdown of PRMT5 or inhibition of PRMT5 by a specific inhibitor reduces the expression of AR and suppresses the growth of multiple AR-positive, but not AR-negative, prostate cancer cells. Significantly, knockdown of PRMT5 in AR-positive LNCaP cells completely suppresses the growth of xenograft tumors in mice. Molecular analysis reveals that PRMT5 binds to the proximal promoter region of the AR gene and contributes mainly to the enriched symmetric dimethylation of H4R3 in the same region. Mechanistically, PRMT5 is recruited to the AR promoter by its interaction with Sp1, the major transcription factor responsible for AR transcription, and forms a complex with Brg1, an ATP-dependent chromatin remodeler, on the proximal promoter region of the AR gene. Furthermore, PRMT5 expression in prostate cancer tissues is significantly higher than that in benign prostatic hyperplasia tissues, and PRMT5 expression correlates positively with AR expression at both the protein and mRNA levels. Taken together, our results identify PRMT5 as a novel epigenetic activator of AR in prostate cancer. Given that inhibiting AR transcriptional activity or androgen synthesis remains the major mechanism of action for most existing anti-androgen agents, our findings also raise an interesting possibility that targeting PRMT5 may represent a novel approach for prostate cancer treatment by eliminating AR expression.
Directory of Open Access Journals (Sweden)
Maximiliano Rapanelli
Full Text Available Circuit modification associated with learning and memory involves multiple events, including the addition and remotion of newborn cells trough adulthood. Adult neurogenesis and gliogenesis were mainly described in models of voluntary exercise, enriched environments, spatial learning and memory task; nevertheless, it is unknown whether it is a common mechanism among different learning paradigms, like reward dependent tasks. Therefore, we evaluated cell proliferation, neurogenesis, astrogliogenesis, survival and neuronal maturation in the medial prefrontal cortex (mPFC and the hippocampus (HIPP during learning an operant conditioning task. This was performed by using endogenous markers of cell proliferation, and a bromodeoxiuridine (BrdU injection schedule in two different phases of learning. Learning an operant conditioning is divided in two phases: a first phase when animals were considered incompletely trained (IT, animals that were learning the task when they performed between 50% and 65% of the responses, and a second phase when animals were considered trained (Tr, animals that completely learned the task when they reached 100% of the responses with a latency time lower than 5 seconds. We found that learning an operant conditioning task promoted cell proliferation in both phases of learning in the mPFC and HIPP. Additionally, the results presented showed that astrogliogenesis was induced in the medial prefrontal cortex (mPFC in both phases, however, the first phase promoted survival of these new born astrocytes. On the other hand, an increased number of new born immature neurons was observed in the HIPP only in the first phase of learning, whereas, decreased values were observed in the second phase. Finally, we found that neuronal maturation was induced only during the first phase. This study shows for the first time that learning a reward-dependent task, like the operant conditioning, promotes neurogenesis, astrogliogenesis, survival and
Energy Technology Data Exchange (ETDEWEB)
Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk
2014-04-25
Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.
Task-Oriented Spoken Dialog System for Second-Language Learning
Kwon, Oh-Woog; Kim, Young-Kil; Lee, Yunkeun
2016-01-01
This paper introduces a Dialog-Based Computer Assisted second-Language Learning (DB-CALL) system using task-oriented dialogue processing technology. The system promotes dialogue with a second-language learner for a specific task, such as purchasing tour tickets, ordering food, passing through immigration, etc. The dialog system plays a role of a…
Age-related effects on postural control under multi-task conditions.
Granacher, Urs; Bridenbaugh, Stephanie A; Muehlbauer, Thomas; Wehrle, Anja; Kressig, Reto W
2011-01-01
Changes in postural sway and gait patterns due to simultaneously performed cognitive (CI) and/or motor interference (MI) tasks have previously been reported and are associated with an increased risk of falling in older adults. The objectives of this study were to investigate the effects of a CI and/or MI task on static and dynamic postural control in young and elderly subjects, and to find out whether there is an association between measures of static and dynamic postural control while concurrently performing the CI and/or MI task. A total of 36 healthy young (n = 18; age: 22.3 ± 3.0 years; BMI: 21.0 ± 1.6 kg/m(2)) and elderly adults (n = 18; age: 73.5 ± 5.5 years; BMI: 24.2 ± 2.9 kg/m(2)) participated in this study. Static postural control was measured during bipedal stance, and dynamic postural control was obtained while walking on an instrumented walkway. Irrespective of the task condition, i.e. single-task or multiple tasks, elderly participants showed larger center-of-pressure displacements and greater stride-to-stride variability than younger participants. Associations between measures of static and dynamic postural control were found only under the single-task condition in the elderly. Age-related deficits in the postural control system seem to be primarily responsible for the observed results. The weak correlations detected between static and dynamic measures could indicate that fall-risk assessment should incorporate dynamic measures under multi-task conditions, and that skills like erect standing and walking are independent of each other and may have to be trained complementarily. Copyright © 2010 S. Karger AG, Basel.
Characterization of P1 promoter activity of the β-galactoside α2,6 ...
Indian Academy of Sciences (India)
2012-04-05
Apr 5, 2012 ... The level of β-galactoside α2,6-sialyltransferase I (ST6Gal I) mRNA, encoded by the gene siat1, is increased in malignant tissues. Expression is regulated by different promoters – P1, P2 and P3 – generating three mRNA isoforms. H, X and YZ. In cervical cancer tissue the mRNA isoform H, which results ...
CCR2-64I polymorphism is not associated with altered CCR5 expression or coreceptor function.
Mariani, R; Wong, S; Mulder, L C; Wilkinson, D A; Reinhart, A L; LaRosa, G; Nibbs, R; O'Brien, T R; Michael, N L; Connor, R I; Macdonald, M; Busch, M; Koup, R A; Landau, N R
1999-03-01
A polymorphism in the gene encoding CCR2 is associated with a delay in progression to AIDS in human immunodeficiency virus (HIV)-infected individuals. The polymorphism, CCR2-64I, changes valine 64 of CCR2 to isoleucine. However, it is not clear whether the effect on AIDS progression results from the amino acid change or whether the polymorphism marks a genetically linked, yet unidentified mutation that mediates the effect. Because the gene encoding CCR5, the major coreceptor for HIV type 1 primary isolates, lies 15 kb 3' to CCR2, linked mutations in the CCR5 promoter or other regulatory sequences could explain the association of CCR2-64I with slowed AIDS pathogenesis. Here, we show that CCR2-64I is efficiently expressed on the cell surface but does not have dominant negative activity on CCR5 coreceptor function. A panel of peripheral blood mononuclear cells (PBMC) from uninfected donors representing the various CCR5/CCR2 genotypes was assembled. Activated primary CD4(+) T cells of CCR2 64I/64I donors expressed cell surface CCR5 at levels comparable to those of CCR2 +/+ donors. A slight reduction in CCR5 expression was noted, although this was not statistically significant. CCR5 and CCR2 mRNA levels were nearly identical for each of the donor PBMC, regardless of genotype. Cell surface CCR5 and CCR2 levels were more variable than mRNA transcript levels, suggesting that an alternative mechanism may influence CCR5 cell surface levels. CCR2-64I is linked to the CCR5 promoter polymorphisms 208G, 303A, 627C, and 676A; however, in transfected promoter reporter constructs, these did not affect transcriptional activity. Taken together, these findings suggest that CCR2-64I does not act by influencing CCR5 transcription or mRNA levels.
Task 5: role of simulators in operator training
International Nuclear Information System (INIS)
1998-01-01
The purpose of the report is to present an analysis of the role of simulators in the training of nuclear power plant operators, from a human factors point of view. Task 5, and this report, consist of the following main parts: 'Current practices in operator training with simulators' (its objective was to identify the role of simulators in the operator training programs, from a human factors point of view, in OECD countries; the information requested was oriented towards the techniques and criteria used for establishing and evaluating that role in the different countries). 'Experiences or studies on specific issues' (its objective was to discuss in-depth some of the issues more difficult or not completely solved yet, with the aim to draw lessons learned and current practices which are used to avoid incidents originated by operator errors due to inadequate training; the selected issues were: Teamwork, Diagnosis and Decision-Making, Stress, and Simulator Fidelity, Issues and Concerns). 'Conclusions and recommendations' (its objective was to gather, present and sum up the conclusions and recommendations reached all over the contributions reported by the ETF-HF members and during the discussions held at the ETF-HF meetings)
Structure of the gene for human β2-adrenergic receptor: expression and promoter characterization
International Nuclear Information System (INIS)
Emorine, L.J.; Marullo, S.; Delavier-Klutchko, C.; Kaveri, S.V.; Durieu-Trautmann, O.; Strosberg, A.D.
1987-01-01
The genomic gene coding for the human β 2 -adrenergic receptor (β 2 AR) from A431 epidermoid cells has been isolated. Transfection of the gene into eukaryotic cells restores a fully active receptor/GTP-binding protein/adenylate cyclase complex with β 2 AR properties. Southern blot analyses with β 2 AR-specific probes show that a single β 2 AR gene is common to various human tissues and that its flanking sequences are highly conserved among humans and between man and rabbit, mouse, and hamster. Functional significance of these regions is supported by the presence of a promoter region (including mRNA cap sites, two TATA boxes, a CAAT box, and three G + C-rich regions that resemble binding sites for transcription factor Sp1) 200-300 base pairs 5' to the translation initiation codon. In the 3' flanking region, sequences homologous to glucocorticoid-response elements might be responsible for the increased expression of the β 2 AR gene observed after treatment of the transfected cells with hydrocortisone. In addition, 5' to the promoter region, an open reading frame encodes a 251-residue polypeptide that displays striking homologies with protein kinases and other nucleotide-binding proteins
Directory of Open Access Journals (Sweden)
Cristina Irimia
Full Text Available Impaired cognitive processing is a hallmark of addiction. In particular, deficits in inhibitory control can propel continued drug use despite adverse consequences. Clinical evidence shows that detoxified alcoholics exhibit poor inhibitory control in the Continuous Performance Task (CPT and related tests of motor impulsivity. Animal models may provide important insight into the neural mechanisms underlying this consequence of chronic alcohol exposure though pre-clinical investigations of behavioral inhibition during alcohol abstinence are sparse. The present study employed the rat 5 Choice-Continuous Performance Task (5C-CPT, a novel pre-clinical variant of the CPT, to evaluate attentional capacity and impulse control over the course of protracted abstinence from chronic intermittent alcohol consumption. In tests conducted with familiar 5C-CPT conditions EtOH-exposed rats exhibited impaired attentional capacity during the first hours of abstinence and impaired behavioral restraint (increased false alarms during the first 5d of abstinence that dissipated thereafter. Subsequent tests employing visual distractors that increase the cognitive load of the task revealed significant increases in impulsive action (premature responses at 3 and 5 weeks of abstinence, and the emergence of impaired behavioral restraint (increased false alarms at 7 weeks of abstinence. Collectively, these findings demonstrate the emergence of increased impulsive action in alcohol-dependent rats during protracted alcohol abstinence and suggest the 5C-CPT with visual distractors may provide a viable behavioral platform for characterizing the neurobiological substrates underlying impaired behavioral inhibition resulting from chronic intermittent alcohol exposure.
MiR-9-5p promotes MSC migration by activating β-catenin signaling pathway.
Li, Xianyang; He, Lihong; Yue, Qing; Lu, Junhou; Kang, Naixin; Xu, Xiaojing; Wang, Huihui; Zhang, Huanxiang
2017-07-01
Mesenchymal stem cells (MSCs) have the potential to treat various tissue damages, but the very limited number of cells that migrate to the damaged region strongly restricts their therapeutic applications. Full understanding of mechanisms regulating MSC migration will help to improve their migration ability and therapeutic effects. Increasing evidence shows that microRNAs play important roles in the regulation of MSC migration. In the present study, we reported that miR-9-5p was upregulated in hepatocyte growth factor -treated MSCs and in MSCs with high migration ability. Overexpression of miR-9-5p promoted MSC migration, whereas inhibition of endogenous miR-9-5p decreased MSC migration. To elucidate the underlying mechanism, we screened the target genes of miR-9-5p and report for the first time that CK1α and GSK3β, two inhibitors of β-catenin signaling pathway, were direct targets of miR-9-5p in MSCs and that overexpression of miR-9-5p upregulated β-catenin signaling pathway. In line with these data, inhibition of β-catenin signaling pathway by FH535 decreased the miR-9-5p-promoted migration of MSCs, while activation of β-catenin signaling pathway by LiCl rescued the impaired migration of MSCs triggered by miR-9-5p inhibitor. Furthermore, the formation and distribution of focal adhesions as well as the reorganization of F-actin were affected by the expression of miR-9-5p. Collectively, these results demonstrate that miR-9-5p promotes MSC migration by upregulating β-catenin signaling pathway, shedding light on the optimization of MSCs for cell replacement therapy through manipulating the expression level of miR-9-5p. Copyright © 2017 the American Physiological Society.
DEFF Research Database (Denmark)
Boyd, Mette; Coskun, Mehmet; Lilje, Berit
2014-01-01
The Caco-2 cell line is one of the most important in vitro models for enterocytes, and is used to study drug absorption and disease, including inflammatory bowel disease and cancer. In order to use the model optimally, it is necessary to map its functional entities. In this study, we have generated...... genome-wide maps of active transcription start sites (TSSs), and active enhancers in Caco-2 cells with or without tumour necrosis factor (TNF)-α stimulation to mimic an inflammatory state. We found 520 promoters that significantly changed their usage level upon TNF-α stimulation; of these, 52...... promoters. As a case example, we characterize an enhancer regulating the laminin-5 γ2-chain (LAMC2) gene by nuclear factor (NF)-κB binding. This report is the first to present comprehensive TSS and enhancer maps over Caco-2 cells, and highlights many novel inflammation-specific promoters and enhancers....
International Nuclear Information System (INIS)
Roychoudhury, Paromita; Ghosh, Utpal; Bhattacharyya, Nitai P.; Chaudhuri, Keya
2006-01-01
The cellular response to ionizing radiation is mediated by a complex interaction of number of proteins involving different pathways. Previously, we have shown that up regulation of mitochondrial genes ND1, ND4, and COX1 transcribed from the heavy strand promoter (P H ) has been increased in a radio-resistant cell strain designated as M5 in comparison with the parental Chinese hamster V79 cells. These genes are also up regulated in Chinese hamster V79 cells VB13 that express exogenous human Bcl2. In the present study, the expression of the gene ND6 that is expressed from the light strand promoter (P L ) was found to be similar in both the cell lines, as determined by RT-PCR. To test the possibility that this differential expression of mitochondrial genes under these two promoters was mediated by differences in proteins' affinity to interact with these promoters, we have carried out electrophoretic mobility shift assay (EMSA) using mitochondrial cell extracts from these two cell lines. Our result of these experiments revealed that two different proteins formed complex with the synthetic promoters and higher amount of protein from M5 cell extracts interacted with the P H promoter in comparison to that observed with cell extracts from Chinese hamster V79 cells. The promoter-specific differential binding of proteins was also observed in VB13. These results showed that differential mitochondrial gene expression observed earlier in the radio-resistant M5 cells was due to enhanced interaction proteins with the promoters P H and mediated by the expression of Bcl2
TMI-2 Lessons Learned Task Force. Final report
International Nuclear Information System (INIS)
1979-10-01
In its final report reviewing the Three Mile Island accident, the TMI-2 Lessons Learned Task Force has suggested change in several fundamental aspects of basic safety policy for nuclear power plants. Changes in nuclear power plant design and operations and in the regulatory process are discussed in terms of general goals. The appendix sets forth specific recommendations for reaching these goals
Resolving task rule incongruence during task switching by competitor rule suppression.
Meiran, Nachshon; Hsieh, Shulan; Dimov, Eduard
2010-07-01
Task switching requires maintaining readiness to execute any task of a given set of tasks. However, when tasks switch, the readiness to execute the now-irrelevant task generates interference, as seen in the task rule incongruence effect. Overcoming such interference requires fine-tuned inhibition that impairs task readiness only minimally. In an experiment involving 2 object classification tasks and 2 location classification tasks, the authors show that irrelevant task rules that generate response conflicts are inhibited. This competitor rule suppression (CRS) is seen in response slowing in subsequent trials, when the competing rules become relevant. CRS is shown to operate on specific rules without affecting similar rules. CRS and backward inhibition, which is another inhibitory phenomenon, produced additive effects on reaction time, suggesting their mutual independence. Implications for current formal theories of task switching as well as for conflict monitoring theories are discussed. (c) 2010 APA, all rights reserved
Ionizing radiation in tumor promotion and progression
International Nuclear Information System (INIS)
Mitchel, R.E.J.
1990-08-01
Chronic exposure to beta radiation has been tested as a tumor promoting or progressing agent. The dorsal skins of groups of 25 female SENCAR mice were chemically initiated with a single exposure to DMBA, and chronic exposure to strontium-90/yttrium-90 beta radiation was tested as a stage 1, stage 2 or complete skin tumor promoter. Exposure of initiated mice to 0.5 gray twice a week for 13 weeks produced no papillomas, indicating no action as a complete promoter. Another similar group of animals was chemically promoted through stage 1 (with TPA) followed by 0.5 gray of beta radiation twice a week for 13 weeks. Again no papillomas developed indicating no action of chronic radiation as a stage 2 tumor promoter. The same radiation exposure protocol in another DMBA initiated group receiving both stage 1 and 2 chemical promotion resulted in a decrease in papilloma frequency, compared to the control group receiving no beta irradiation, indicating a tumor preventing effect of radiation at stage 2 promotion, probably by killing initiated cells. Chronic beta radiation was tested three different ways as a stage 1 tumor promoter. When compared to the appropriate control, beta radiation given after initiation as a stage 1 promoter (0.5 gray twice a week for 13 weeks), after initiation and along with a known stage 1 chemical promoter (1.0 gray twice a week for 2 weeks), or prior to initiation as a stage 1 promoter (0.5 gray twice a week for 4 weeks), each time showed a weak (∼ 15% stimulation) but statistically significant (p<0.01) ability to act as a stage 1 promoter. When tested as a tumor progressing agent delivered to pre-existing papillomas, beta radiation (0.5 gray twice a week for 13 weeks) increased carcinoma frequency from 0.52 to 0.68 carcinoma/animal, but this increase was not statistically significant at the 95% confidence level. We conclude that in the addition to the known initiating, progressing and complete carcinogenic action of acute exposures to ionizing
CED-10/Rac1 regulates endocytic recycling through the RAB-5 GAP TBC-2.
Directory of Open Access Journals (Sweden)
Lin Sun
Full Text Available Rac1 is a founding member of the Rho-GTPase family and a key regulator of membrane remodeling. In the context of apoptotic cell corpse engulfment, CED-10/Rac1 acts with its bipartite guanine nucleotide exchange factor, CED-5/Dock180-CED-12/ELMO, in an evolutionarily conserved pathway to promote phagocytosis. Here we show that in the context of the Caenorhabditis elegans intestinal epithelium CED-10/Rac1, CED-5/Dock180, and CED-12/ELMO promote basolateral recycling. Furthermore, we show that CED-10 binds to the RAB-5 GTPase activating protein TBC-2, that CED-10 contributes to recruitment of TBC-2 to endosomes, and that recycling cargo is trapped in recycling endosomes in ced-12, ced-10, and tbc-2 mutants. Expression of GTPase defective RAB-5(Q78L also traps recycling cargo. Our results indicate that down-regulation of early endosome regulator RAB-5/Rab5 by a CED-5, CED-12, CED-10, TBC-2 cascade is an important step in the transport of cargo through the basolateral recycling endosome for delivery to the plasma membrane.
JV Task 120 - Coal Ash Resources Research Consortium Research
Energy Technology Data Exchange (ETDEWEB)
Debra Pflughoeft-Hassett; Loreal Heebink; David Hassett; Bruce Dockter; Kurt Eylands; Tera Buckley; Erick Zacher
2009-03-28
The Coal Ash Resources Research Consortium{reg_sign} (CARRC{reg_sign}, pronounced 'cars') is the core coal combustion product (CCP) research group at the Energy & Environmental Research Center (EERC). CARRC focuses on performing fundamental and applied scientific and engineering research emphasizing the environmentally safe, economical use of CCPs. CARRC member organizations, which include utilities and marketers, are key to developing industry-driven research in the area of CCP utilization and ensuring its successful application. The U.S. Department of Energy is a partner in CARRC through the EERC Jointly Sponsored Research Program, which provides matching funds for industrial member contributions and facilitates an increased level of effort in CARRC. CARRC tasks were designed to provide information on CCP performance, including environmental performance, engineering performance, favorable economics, and improved life cycle of products and projects. CARRC technical research tasks are developed based on member input and prioritization. CARRC special projects are developed with members and nonmembers to provide similar information and to support activities, including the assembly and interpretation of data, support for standards development and technology transfer, and facilitating product development and testing. CARRC activities from 2007 to 2009 included a range of research tasks, with primary work performed in laboratory tasks developed to answer specific questions or evaluate important fundamental properties of CCPs. The tasks were included in four categories: (1) Environmental Evaluations of CCPs; (2) Evaluation of Impacts on CCPs from Emission Controls; (3) Construction and Product-Related Activities; and (4) Technology Transfer and Maintenance Tasks. All tasks are designed to work toward achieving the CARRC overall goal and supporting objectives. The various tasks are coordinated in order to provide broad and useful technical data for CARRC members
DEFF Research Database (Denmark)
Møller, A M; Jensen, N M; Pildal, J
2001-01-01
This study was performed to test the hypothesis that genetic variation in the promoter of the glucose transporter 2 (GLUT2) might predispose to prediabetic phenotypes or type 2 diabetes. A total of 1611 bp comprising the minimal promoter region of the GLUT2 gene were examined by combined single-s......-tolerant subjects. In conclusion, we found no evidence supporting the hypothesis that genetic variability in the minimal promoter of the GLUT2 is associated with type 2 diabetes or prediabetic phenotypes in the Danish population.......This study was performed to test the hypothesis that genetic variation in the promoter of the glucose transporter 2 (GLUT2) might predispose to prediabetic phenotypes or type 2 diabetes. A total of 1611 bp comprising the minimal promoter region of the GLUT2 gene were examined by combined single...
Isolation and characterization of a plant growth-promoting rhizobacterium, Serratia sp. SY5.
Koo, So-Yeon; Cho, Kyung-Suk
2009-11-01
The role of plant growth-promoting rhizobacteria (PGPR) in the phytoremediation of heavy-metal-contaminated soils is important in overcoming its limitations for field application. A plant growth-promoting rhizobacterium, Serratia sp. SY5, was isolated from the rhizoplane of barnyard grass (Echinochloa crus-galli) grown in petroleum and heavy-metal-contaminated soil. This isolate has shown capacities for indole acetic acid production and siderophores synthesis. Compared with a non-inoculated control, the radicular root growth of Zea mays seedlings inoculated with SY5 can be increased by 27- or 15.4-fold in the presence of 15 mg-Cd/l or 15 mg-Cu/l, respectively. The results from hydroponic cultures showed that inoculation of Serratia sp. SY5 had a favorable influence on the initial shoot growth and biomass of Zea mays under noncontaminated conditions. However, under Cd-contaminated conditions, the inoculation of SY5 significantly increased the root biomass of Zea mays. These results indicate that Serratia sp. SY5 can serve as a promising microbial inoculant for increased plant growth in heavy-metal-contaminated soils to improve the phytoremediation efficiency.
The Role of L2 Learner Goal Differences in Task-Generated Oral Production
Ben Maad, Mohamed Ridha
2016-01-01
In light of the growing interest in the cognitive approach to task in second language (L2) research, comparatively little has been done to examine such effect over time and the role of individual differences (IDs). The present study was designed to verify some longitudinal evidence for the role of tasks in L2 production and whether IDs, in the…
Pinaire, J; Hasanadka, R; Fang, M; Chou, WY; Stewart, MJ; Kruijer, W; Crabb, D
2000-01-01
Two tandem sites in the aldehyde dehydrogenase 2 promoter (designated FP330-5' and FP330-3') that bind members of the nuclear receptor superfamily mere recently identified. Antibodies against apolipoprotein regulatory protein (ARP-1) altered DNA-protein interactions in electrophoretic mobility shift
International Nuclear Information System (INIS)
Anon.
1987-01-01
The International Task Force on Prevention of Nuclear Terrorism was formed in 1985 under the auspices of the Nuclear Control Institute. This report is a consensus report of the 26 task force members - all members not necessarily agreeing on every point and all wordings, but in each case a substantial majority did agree. First, the report defines the threat, then establishes the priorities. Short-term recommendations are presented on: (1) protecting nuclear weapons; (2) protecting nuclear materials; (3) protecting nuclear facilities; (4) intelligence programs; (5) civil liberties concerns; (6) controlling nuclear transfers; (7) US - Soviet cooperation; (8) arms control initiatives; (9) convention of physical protection of nuclear material; (10) role of emergency management programs; and (11) role of the media. Brief long-term recommendations are included on (1) international measures, and (2) emerging nuclear technologies. An Appendix, Production of Nuclear Materials Usable in Weapons is presented for further consideration (without recommendations)
Schauwecker, Suzanne M; Kim, J Julie; Licht, Jonathan D; Clevenger, Charles V
2017-02-10
The hormone prolactin (PRL) contributes to breast cancer pathogenesis through various signaling pathways, one of the most notable being the JAK2/signal transducer and activator of transcription 5 (STAT5) pathway. PRL-induced activation of the transcription factor STAT5 results in the up-regulation of numerous genes implicated in breast cancer pathogenesis. However, the molecular mechanisms that enable STAT5 to access the promoters of these genes are not well understood. Here, we show that PRL signaling induces chromatin decompaction at promoter DNA, corresponding with STAT5 binding. The chromatin-modifying protein high mobility group nucleosomal binding domain 2 (HMGN2) specifically promotes STAT5 accessibility at promoter DNA by facilitating the dissociation of the linker histone H1 in response to PRL. Knockdown of H1 rescues the decrease in PRL-induced transcription following HMGN2 knockdown, and it does so by allowing increased STAT5 recruitment. Moreover, H1 and STAT5 are shown to function antagonistically in regulating PRL-induced transcription as well as breast cancer cell biology. While reduced STAT5 activation results in decreased PRL-induced transcription and cell proliferation, knockdown of H1 rescues both of these effects. Taken together, we elucidate a novel mechanism whereby the linker histone H1 prevents STAT5 binding at promoter DNA, and the PRL-induced dissociation of H1 mediated by HMGN2 is necessary to allow full STAT5 recruitment and promote the biological effects of PRL signaling. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Eustache, Eddy; Gerbasi, Margaret E; Severe, Jennifer; Fils-Aimé, J Reginald; Smith Fawzi, Mary C; Raviola, Giuseppe J; Darghouth, Sarah; Boyd, Kate; Thérosmé, Tatiana; Legha, Rupinder; Pierre, Ermaze L; Affricot, Emmeline; Alcindor, Yoldie; Grelotti, David J; Becker, Anne E
2017-06-01
Task-sharing with teachers to promote youth mental health is a promising but underdeveloped strategy in improving care access in low-income countries. To assess feasibility, acceptability and utility of the teacher accompaniment phase of a school-based Teacher- Accompagnateur Pilot Study (TAPS) in Haiti. We assigned student participants, aged 18-22 years ( n = 120), to teacher participants ( n = 22) within four Haitian schools; we instructed participants to arrange meetings with their assigned counterparts to discuss mental health treatment, academic skills, and/or well-being. We measured student and teacher perceived feasibility, acceptability and utility of meetings with self-report Likert-style questions. We examined overall program feasibility by the percentage of students with a documented meeting, acceptability by a composite measure of student satisfaction and utility by the percentage with identified mental health need who discussed treatment with a teacher. Favorable ratings support feasibility, acceptability and utility of teacher- accompagnateur meetings with students. The majority of students (54%) met with a teacher. Among students with an identified mental disorder, 43.2% discussed treatment during a meeting. This accompaniment approach to mental health task-sharing with teachers provided a school-based opportunity for students with mental health need to discuss treatment and has potential relevance to other low-income settings.
Liy-Salmeron, Gustavo; Meneses, Alfredo
2007-05-25
It was previously reported that brain areas containing serotonin (5-hydroxytryptamine, 5-HT) receptors mediate memory consolidation as well as short (STM)- and long-term memory (LTM). Here the effects of systemic and intrahippocampal administration of 5-HT agonists and antagonists on an autoshaping learning task were explored, which requires hippocampal translation and transduction as well as 5-HT receptors expression. As previously reported ketamine (glutamatergic antagonist) and two well-known amnesic drugs, scopolamine (cholinergic antagonist) and dizocilpine (NMDA antagonist) impaired STM but not LTM; dizocilpine even improved the latter. Since ketamine produces hallucinations and impairs memory in humans, we address the question if well-known antipsychotic haloperidol and clozapine might affect STM deficit. Indeed, systemic administration of clozapine
Lee, Ju-Han; Kim, Younghye; Choi, Jung-Woo; Kim, Young-Sik
2013-01-01
Plasminogen activator inhibitor type 1 (PAI-1) is associated with poor prognosis in breast cancer. Transcriptional expression of the PAI-1 can be controlled by PAI-1 promoter 4G/5G polymorphism. However, the significance of PAI-1 promoter 4G/5G polymorphism in breast cancer patients is contentious. To address this controversy, we conducted a meta-analysis for the relationships between PAI-1 promoter polymorphism and clinicopathological characteristics of breast cancer. Relevant published studies were identified using a search of PubMed, Embase, and the ISI Web of Science. The effect sizes of PAI-1 promoter 4G/5G polymorphism on breast cancer risk, lymph node metastasis, histologic grade, and overall survival were calculated by odds ratio (OR) or hazard ratio. The effect sizes were combined using a random-effects model. Individuals with 4G/4G genotype had a higher risk of breast cancer than those with the combined 4G/5G and 5G/5G genotypes (OR = 1.388; p = 0.031). Breast cancer patients with the 5G/5G genotype displayed lymph node metastasis more than patients with either the combined other genotypes (OR = 1.495; p = 0.027) or with the 4G/4G genotype (OR = 1.623; p = 0.018). However, the PAI-1 promoter 4G/5G polymorphism was not associated with histological grade or overall survival. PAI-1 promoter 4G/5G polymorphism is associated with a relatively increased risk of breast cancer development and lymph node metastasis. Copyright © 2013 IMSS. Published by Elsevier Inc. All rights reserved.
Task-based incidental vocabulary learning in L2 Arabic: The role of proficiency and task performance
Directory of Open Access Journals (Sweden)
Ayman A. Mohamed
2016-03-01
Full Text Available This study tests the claim that word learning in a second language are contingent upon a task’s involvement load (i.e. the amount of need, search, and evaluation it imposes, as proposed by Laufer and Hulstijn (2001. Fifty-three English-speaking learners of Arabic were assigned to one of three vocabulary learning tasks that varied in the degree of involvement: reading comprehension with glosses (low, fill-in-the-gap task (medium, and sentence writing (high. Ten words, selected based on a pretest, were targeted in the tasks. Results showed a main effect of task, with the sentence writing task yielding the highest rates of vocabulary learning, followed by the gap-fill task, and finally the reading comprehension task. A significant correlation was found between accuracy of performance across participants and their subsequent vocabulary acquisition in the immediate posttest. Within groups, only the performance of the writing group correlated significantly with their posttest scores. Results of the present study validate the hypothesis and point to multiple factors at play in incidental vocabulary acquisition. The study provides further arguments to refine the hypothesis and implement pedagogical practices that accommodate incidental learning in foreign language settings.
International Nuclear Information System (INIS)
Müller, Imke; Wischnewski, Frank; Pantel, Klaus; Schwarzenbach, Heidi
2010-01-01
The aim of the current study was to analyze the involvement of methyl-CpG binding proteins (MBDs) and histone modifications on the regulation of CD44, Cyclin D2, GLIPR1 and PTEN in different cellular contexts such as the prostate cancer cells DU145 and LNCaP, and the breast cancer cells MCF-7. Since global chromatin changes have been shown to occur in tumours and regions of tumour-associated genes are affected by epigenetic modifications, these may constitute important regulatory mechanisms for the pathogenesis of malignant transformation. In DU145, LNCaP and MCF-7 cells mRNA expression levels of CD44, Cyclin D2, GLIPR1 and PTEN were determined by quantitative RT-PCR at the basal status as well as after treatment with demethylating agent 5-aza-2'-deoxycytidine and/or histone deacetylase inhibitor Trichostatin A. Furthermore, genomic DNA was bisulfite-converted and sequenced. Chromatin immunoprecipitation was performed with the stimulated and unstimulated cells using antibodies for MBD1, MBD2 and MeCP2 as well as 17 different histone antibodies. Comparison of the different promoters showed that MeCP2 and MBD2a repressed promoter-specifically Cyclin D2 in all cell lines, whereas in MCF-7 cells MeCP2 repressed cell-specifically all methylated promoters. Chromatin immunoprecipitation showed that all methylated promoters associated with at least one MBD. Treatment of the cells by the demethylating agent 5-aza-2'-deoxycytidine (5-aza-CdR) caused dissociation of the MBDs from the promoters. Only MBD1v1 bound and repressed methylation-independently all promoters. Real-time amplification of DNA immunoprecipitated by 17 different antibodies showed a preferential enrichment for methylated lysine of histone H3 (H3K4me1, H3K4me2 and H3K4me3) at the particular promoters. Notably, the silent promoters were associated with unmodified histones which were acetylated following treatment by 5-aza-CdR. This study is one of the first to reveal the histone code and MBD profile
Steer, Andrew M; Bia, Nicolas; Smith, David K; Clarke, Paul A
2017-09-25
Understanding the prebiotic genesis of 2-deoxy-d-ribose, which forms the backbone of DNA, is of crucial importance to unravelling the origins of life, yet remains open to debate. Here we demonstrate that 20 mol% of proteinogenic amino esters promote the selective formation of 2-deoxy-d-ribose over 2-deoxy-d-threopentose in combined yields of ≥4%. We also demonstrate the first aldol reaction promoted by prebiotically-relevant proteinogenic amino nitriles (20 mol%) for the enantioselective synthesis of d-glyceraldehyde with 6% ee, and its subsequent conversion into 2-deoxy-d-ribose in yields of ≥ 5%. Finally, we explore the combination of these two steps in a one-pot process using 20 mol% of an amino ester or amino nitrile promoter. It is hence demonstrated that three interstellar starting materials, when mixed together with an appropriate promoter, can directly lead to the formation of a mixture of higher carbohydrates, including 2-deoxy-d-ribose.
Working Memory Training Improves Dual-Task Performance on Motor Tasks.
Kimura, Takehide; Kaneko, Fuminari; Nagahata, Keita; Shibata, Eriko; Aoki, Nobuhiro
2017-01-01
The authors investigated whether working memory training improves motor-motor dual-task performance consisted of upper and lower limb tasks. The upper limb task was a simple reaction task and the lower limb task was an isometric knee extension task. 45 participants (age = 21.8 ± 1.6 years) were classified into a working memory training group (WM-TRG), dual-task training group, or control group. The training duration was 2 weeks (15 min, 4 times/week). Our results indicated that working memory capacity increased significantly only in the WM-TRG. Dual-task performance improved in the WM-TRG and dual-task training group. Our study provides the novel insight that working memory training improves dual-task performance without specific training on the target motor task.
Cold hypersensitivity increases with age in mice with sickle cell disease
Zappia, Katherine J.; Garrison, Sheldon R.; Hillery, Cheryl A.; Stucky, Cheryl L.
2014-01-01
Sickle cell disease (SCD) is associated with acute vaso-occlusive crises that trigger painful episodes and frequently involves ongoing, chronic pain. Additionally, both humans and mice with SCD experience heighted cold sensitivity. However, studies have not addressed the mechanism(s) underlying the cold sensitization, nor its progression with age. Here we measured thermotaxis behavior in young and aged mice with severe SCD. Sickle mice had a marked increase in cold sensitivity measured by a cold preference test. Further, cold hypersensitivity worsened with advanced age. We assessed whether enhanced peripheral input contributes to the chronic cold pain behavior by recording from C fibers, many of which are cold-sensitive, in skin-nerve preparations. We observed that C fibers from sickle mice displayed a shift to warmer (more sensitive) cold-detection thresholds. To address mechanisms underlying the cold sensitization in primary afferent neurons, we quantified mRNA expression levels for ion channels thought to be involved in cold detection. These included the Transient Receptor Potential Melastatin 8 (Trpm8) and TRP Ankyrin 1 (Trpa1) channels, as well as the two-pore domain potassium channels, TREK-1 (Kcnk2), TREK-2 (Kcnk4), and TRAAK (Kcnk10). Surprisingly, transcript expression levels of all of these channels were comparable between sickle and control mice. We further examined transcript expression of 83 additional pain-related genes and found increased mRNA levels for endothelin 1 and tachykinin receptor 1. These factors may contribute to hypersensitivity in sickle mice at both the afferent and behavioral levels. Sensory neurons from sickle cell disease mice are sensitized to cold, mirroring behavioral observations, and have increased expression of endothelin 1 and tachykinin receptor 1. PMID:24953902
Identification of functional DNA variants in the constitutive promoter region of MDM2
Directory of Open Access Journals (Sweden)
Lalonde Marie-Eve
2012-09-01
Full Text Available Abstract Although mutations in the oncoprotein murine double minute 2 (MDM2 are rare, MDM2 gene overexpression has been observed in several human tumors. Given that even modest changes in MDM2 levels might influence the p53 tumor suppressor signaling pathway, we postulated that sequence variation in the promoter region of MDM2 could lead to disregulated expression and variation in gene dosage. Two promoters have been reported for MDM2; an internal promoter (P2, which is located near the end of intron 1 and is p53-responsive, and an upstream constitutive promoter (P1, which is p53-independent. Both promoter regions contain DNA variants that could influence the expression levels of MDM2, including the well-studied single nucleotide polymorphism (SNP SNP309, which is located in the promoter P2; i.e., upstream of exon 2. In this report, we screened the promoter P1 for DNA variants and assessed the functional impact of the corresponding SNPs. Using the dbSNP database and genotyping validation in individuals of European descent, we identified three common SNPs (−1494 G > A; indel 40 bp; and −182 C > G. Three major promoter haplotypes were inferred by using these three promoter SNPs together with rs2279744 (SNP309. Following subcloning into a gene reporter system, we found that two of the haplotypes significantly influenced MDM2 promoter activity in a haplotype-specific manner. Site-directed mutagenesis experiments indicated that the 40 bp insertion/deletion variation is causing the observed allelic promoter activity. This study suggests that part of the variability in the MDM2 expression levels could be explained by allelic p53-independent P1 promoter activity.
MDM2 promoter SNP344T>A (rs1196333 status does not affect cancer risk.
Directory of Open Access Journals (Sweden)
Stian Knappskog
Full Text Available The MDM2 proto-oncogene plays a key role in central cellular processes like growth control and apoptosis, and the gene locus is frequently amplified in sarcomas. Two polymorphisms located in the MDM2 promoter P2 have been shown to affect cancer risk. One of these polymorphisms (SNP309T>G; rs2279744 facilitates Sp1 transcription factor binding to the promoter and is associated with increased cancer risk. In contrast, SNP285G>C (rs117039649, located 24 bp upstream of rs2279744, and in complete linkage disequilibrium with the SNP309G allele, reduces Sp1 recruitment and lowers cancer risk. Thus, fine tuning of MDM2 expression has proven to be of significant importance with respect to tumorigenesis. We assessed the potential functional effects of a third MDM2 promoter P2 polymorphism (SNP344T>A; rs1196333 located on the SNP309T allele. While in silico analyses indicated SNP344A to modulate TFAP2A, SPIB and AP1 transcription factor binding, we found no effect of SNP344 status on MDM2 expression levels. Assessing the frequency of SNP344A in healthy Caucasians (n = 2,954 and patients suffering from ovarian (n = 1,927, breast (n = 1,271, endometrial (n = 895 or prostatic cancer (n = 641, we detected no significant difference in the distribution of this polymorphism between any of these cancer forms and healthy controls (6.1% in healthy controls, and 4.9%, 5.0%, 5.4% and 7.2% in the cancer groups, respectively. In conclusion, our findings provide no evidence indicating that SNP344A may affect MDM2 transcription or cancer risk.
Haam, Keeok; Kim, Hee-Jin; Lee, Kyung-Tae; Kim, Jeong-Hwan; Kim, Mirang; Kim, Seon-Young; Noh, Seung-Moo; Song, Kyu-Sang; Kim, Yong Sung
2014-09-01
BTB and CNC homology 2 (BACH2) is a lymphoid-specific transcription factor with a prominent role in B-cell development. Genetic polymorphisms within a single locus encoding BACH2 are associated with various autoimmune diseases and allergies. In this study, restriction landmark genomic scanning revealed methylation at a NotI site in a CpG island covering the BACH2 promoter in gastric cancer cell lines and primary gastric tumors. Increased methylation of the BACH2 promoter was observed in 52% (43/83) of primary gastric tumors, and BACH2 hypermethylation was significantly associated with decreased gene expression. Treatment with 5-aza-2'-deoxycytidine and/or trichostatin. A restored BACH2 expression in BACH2-silenced gastric cancer cell lines, and knockdown of BACH2 using short hairpin RNA (i.e. RNA interference) increased cell proliferation in gastric cancer cells. Clinicopathologic data showed that decreased BACH2 expression occurred significantly more frequently in intestinal-type (27/44, 61%) compared with diffuse-type (13/50, 26%) gastric cancers (P<0.001). Furthermore, BACH2 promoter methylation paralleled that of previously identified targets, such as LRRC3B, LIMS2, PRKD1 and POPDC3, in a given set of gastric tumors. We propose that concerted methylation in many promoters plays a role in accelerating gastric tumor formation and that methylated promoter loci may be targets for therapeutic treatment, such as the recently introduced technique of epigenetic editing. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
International Nuclear Information System (INIS)
Charlson, Aaron T.; Zeliadt, Nicholette A.; Wattenberg, Elizabeth V.
2009-01-01
Palytoxin is classified as a non-12-O-tetradecanoylphorbol-13-acetate (TPA)-type skin tumor because it does not bind to or activate protein kinase C. Palytoxin is thus a novel tool for investigating alternative signaling pathways that may affect carcinogenesis. We previously showed that palytoxin activates three major members of the mitogen activated protein kinase (MAPK) family, extracellular signal regulated kinase 1 and 2 (ERK1/2), c-Jun N-terminal kinase (JNK), and p38. Here we report that palytoxin also activates another MAPK family member, called ERK5, in HeLa cells and in keratinocytes derived from initiated mouse skin (308 cells). By contrast, TPA does not activate ERK5 in these cell lines. The major cell surface receptor for palytoxin is the Na+,K+-ATPase. Accordingly, ouabain blocked the ability of palytoxin to activate ERK5. Ouabain alone did not activate ERK5. ERK5 thus represents a divergence in the signaling pathways activated by these two agents that bind to the Na+,K+-ATPase. Cycloheximide, okadaic acid, and sodium orthovanadate did not mimic the effect of palytoxin on ERK5. These results indicate that the stimulation of ERK5 by palytoxin is not simply due to inhibition of protein synthesis or inhibition of serine/threonine or tyrosine phosphatases. Therefore, the mechanism by which palytoxin activates ERK5 differs from that by which it activates ERK1/2, JNK, and p38. Finally, studies that used pharmacological inhibitors and shRNA to block ERK5 action indicate that ERK5 contributes to palytoxin-stimulated c-Fos gene expression. These results suggest that ERK5 can act as an alternative mediator for transmitting diverse tumor promoter-stimulated signals.
Promoting Critical Thinking through Service Learning: A Home-Visiting Case Study
Campbell, Cynthia G.; Oswald, Brianna R.
2018-01-01
As stated in APA Learning Outcomes 2 and 3, two central goals of higher education instruction are promoting students' critical thinking skills and connecting student learning to real-life applications. To meet these goals, a community-based service-learning experience was designed using task value, interpersonal accountability, cognitive…
HOXB5 cooperates with NKX2-1 in the transcription of human RET.
Directory of Open Access Journals (Sweden)
Jiang Zhu
Full Text Available The enteric nervous system (ENS regulates peristaltic movement of the gut, and abnormal ENS causes Hirschsprung's disease (HSCR in newborns. HSCR is a congenital complex genetic disorder characterised by a lack of enteric ganglia along a variable length of the intestine. The receptor tyrosine kinase gene (RET is the major HSCR gene and its expression is crucial for ENS development. We have previously reported that (i HOXB5 transcription factor mediates RET expression, and (ii mouse with defective HOXB5 activity develop HSCR phenotype. In this study, we (i elucidate the underlying mechanisms that HOXB5 mediate RET expression, and (ii examine the interactions between HOXB5 and other transcription factors implicated in RET expression. We show that human HOXB5 binds to the promoter region 5' upstream of the binding site of NKX2-1 and regulates RET expression. HOXB5 and NKX2-1 form a protein complex and mediate RET expression in a synergistic manner. HSCR associated SNPs at the NKX2-1 binding site (-5G>A rs10900296; -1A>C rs10900297, which reduce NKX2-1 binding, abolish the synergistic trans-activation of RET by HOXB5 and NKX2-1. In contrast to the synergistic activation of RET with NKX2-1, HOXB5 cooperates in an additive manner with SOX10, PAX3 and PHOX2B in trans-activation of RET promoter. Taken together, our data suggests that HOXB5 in coordination with other transcription factors mediates RET expression. Therefore, defects in cis- or trans-regulation of RET by HOXB5 could lead to reduction of RET expression and contribute to the manifestation of the HSCR phenotype.
Pliske, Gerald; Emmermacher, Peter; Weinbeer, Veronika; Witte, Kerstin
2016-12-01
Demographic changes resulting in an aging population are major factors for an increase of fall-related injuries. Especially in situations where dual tasks such as walking whilst talking have to be performed simultaneously the risk of a fall-related injury increases. It is well known that some types of martial art (e.g. Tai Chi) can reduce the risk of a fall. It is unknown if the same is true for karate. In this randomized, controlled study 68 people with a mean age of 69 years underwent 5-month karate training, 5-month fitness training or were part of a control group. Before and after the time of intervention a gait analysis with normal walk, a cognitive dual task and a motor dual task were performed. The gait parameter step frequency, walking speed, single-step time and single-step length were investigated. It could be seen that all groups improved their gait parameters after a 5-month period, even the control group. A sporty intervention seems to affect mainly the temporal gait parameters positively. This effect was especially demonstrated for normal walk and cognitive dual task. An improvement of the human walk seems to be possible through karate and fitness training, even under dual-task conditions. A prolonged intervention time with multiple repetitions of gait analysis could give better evidence if karate is a useful tool to increase fall prevention.
H2A/K pseudogene mutation may promote cell proliferation
Energy Technology Data Exchange (ETDEWEB)
Guo, Jisheng; Jing, Ruirui; Lv, Xin; Wang, Xiaoyue; Li, Junqiang; Li, Lin; Li, Cuiling; Wang, Daoguang; Bi, Baibing; Chen, Xinjun [Cancer Research Center, Shandong University School of Medicine, Jinan 250012 (China); Yang, Jing-Hua, E-mail: sdu_crc_group1@126.com [Cancer Research Center, Shandong University School of Medicine, Jinan 250012 (China); Department of Surgery, VA Boston Healthcare System, Boston University School of Medicine, Boston 510660, MA (United States)
2016-05-15
Highlights: • The mutant H2A/K pseudogene is active. • The mutant H2A/K pseudogene can promote cell proliferation. - Abstract: Little attention has been paid to the histone H2A/K pseudogene. Results from our laboratory showed that 7 of 10 kidney cancer patients carried a mutant H2A/K pseudogene; therefore, we were interested in determining the relationship between mutant H2A/K and cell proliferation. We used shotgun and label-free proteomics methods to study whether mutant H2A/K lncRNAs affected cell proliferation. Quantitative proteomic analysis indicated that the expression of mutant H2A/K lncRNAs resulted in the upregulation of many oncogenes, which promoted cell proliferation. Further interaction analyses revealed that a proliferating cell nuclear antigen (PCNA)-protein interaction network, with PCNA in the center, contributes to cell proliferation in cells expressing the mutant H2A/K lncRNAs. Western blotting confirmed the critical upregulation of PCNA by mutant H2A/K lncRNA expression. Finally, the promotion of cell proliferation by mutant H2A/K lncRNAs (C290T, C228A and A45G) was confirmed using cell proliferation assays. Although we did not determine the exact mechanism by which the oncogenes were upregulated by the mutant H2A/K lncRNAs, we confirmed that the mutant H2A/K lncRNAs promoted cell proliferation by upregulating PCNA and other oncogenes. The hypothesis that cell proliferation is promoted by the mutant H2A/K lncRNAs was supported by the protein expression and cell proliferation assay results. Therefore, mutant H2A/K lncRNAs may be a new factor in renal carcinogenesis.
Directory of Open Access Journals (Sweden)
Pierre-Benoit Ancey
2017-07-01
Full Text Available Understanding the processes that govern liver progenitor cell differentiation has important implications for the design of strategies targeting chronic liver diseases, whereby regeneration of liver tissue is critical. Although DNA methylation (5mC and hydroxymethylation (5hmC are highly dynamic during early embryonic development, less is known about their roles at later stages of differentiation. Using an in vitro model of hepatocyte differentiation, we show here that 5hmC precedes the expression of promoter 1 (P1-dependent isoforms of HNF4A, a master transcription factor of hepatocyte identity. 5hmC and HNF4A expression from P1 are dependent on ten-eleven translocation (TET dioxygenases. In turn, the liver pioneer factor FOXA2 is necessary for TET1 binding to the P1 locus. Both FOXA2 and TETs are required for the 5hmC-related switch in HNF4A expression. The epigenetic event identified here may be a key step for the establishment of the hepatocyte program by HNF4A.
Challenging Tasks Lead to Productive Struggle!
Livy, Sharyn; Muir, Tracey; Sullivan, Peter
2018-01-01
Productive struggle leads to productive classrooms where students work on complex problems, are encouraged to take risks, can struggle and fail yet still feel good about working on hard problems (Boaler, 2016). Teachers can foster a classroom culture that values and promotes productive struggle by providing students with challenging tasks. These…
Han, Songyan; Lu, Jun; Zhang, Yu; Cheng, Cao; Li, Lin; Han, Liping; Huang, Baiqu
2007-02-15
The expression of IL-5 correlated tightly with the maturation and differentiation of eosinophils, and is considered as a cytokine responsible for allergic inflammation. We report here that inhibition of HDAC activity by Trichostatin A (TSA) and sodium butyrate (NaBu), the two specific HDAC inhibitors, resulted in the elevation of both endogenous and exogenous activity of IL-5 promoter. We demonstrated that both the mRNA expression and protein production of IL-5 were stimulated by TSA and NaBu treatments. ChIP assays showed that treatments of TSA and NaBu caused hyperacetylation of histones H3 and H4 on IL-5 promoter in Jurkat cells, which consequently promoted the exogenous luciferase activity driven by this promoter. Moreover, site-directed mutagenesis studies showed that the binding sites for transcription factors NFAT, GATA3 and YY1 on IL-5 promoter were critical for the effects of TSA and NaBu, suggesting that the transcriptional activation of IL-5 gene by these inhibitors was achieved by affecting HDAC function on IL-5 promoter via transcription factors. These data will contribute to elucidating the unique mechanism of IL-5 transcriptional control and to the therapy of allergic disorders related to IL-5.
Proceedings of the Task 2 workshop Waste Isolation Safety Assessment Program
International Nuclear Information System (INIS)
Bradley, D.J.
1979-01-01
The reports from the workshop on waste form release rate analysis are presented. The workshop started with overview presentations on the Office of Nuclear Waste Isolation (ONWI), the Waste Isolation Safety Assessment Program (WISAP), WISAP Task 2 (Waste Form Release Rate Analysis), and WISAP Task 4 (Sorption/Desorption Analysis). Technical presentations followed in these areas: leaching studies on spent fuels, leaching studies on high-level waste glass, waste form surface science experiments, radiation effects, and leach modeling. Separate abstracts were prepared for each
Proceedings of the Task 2 workshop Waste Isolation Safety Assessment Program
Energy Technology Data Exchange (ETDEWEB)
Bradley, D.J.
1979-01-01
The reports from the workshop on waste form release rate analysis are presented. The workshop started with overview presentations on the Office of Nuclear Waste Isolation (ONWI), the Waste Isolation Safety Assessment Program (WISAP), WISAP Task 2 (Waste Form Release Rate Analysis), and WISAP Task 4 (Sorption/Desorption Analysis). Technical presentations followed in these areas: leaching studies on spent fuels, leaching studies on high-level waste glass, waste form surface science experiments, radiation effects, and leach modeling. Separate abstracts were prepared for each.
Reithmeier, Anja; Panizza, Elena; Krumpel, Michael; Orre, Lukas M; Branca, Rui M M; Lehtiö, Janne; Ek-Rylander, Barbro; Andersson, Göran
2017-09-15
Tartrate-resistant acid phosphatase (TRAP/ACP5), a metalloenzyme that is characteristic for its expression in activated osteoclasts and in macrophages, has recently gained considerable focus as a driver of metastasis and was associated with clinically relevant parameters of cancer progression and cancer aggressiveness. MDA-MB-231 breast cancer cells with different TRAP expression levels (overexpression and knockdown) were generated and characterized for protein expression and activity levels. Functional cell experiments, such as proliferation, migration and invasion assays were performed as well as global phosphoproteomic and proteomic analysis was conducted to connect molecular perturbations to the phenotypic changes. We identified an association between metastasis-related properties of TRAP-overexpressing MDA-MB-231 breast cancer cells and a TRAP-dependent regulation of Transforming growth factor (TGFβ) pathway proteins and Cluster of differentiation 44 (CD44). Overexpression of TRAP increased anchorage-independent and anchorage-dependent cell growth and proliferation, induced a more elongated cellular morphology and promoted cell migration and invasion. Migration was increased in the presence of the extracellular matrix (ECM) proteins osteopontin and fibronectin and the basement membrane proteins collagen IV and laminin I. TRAP-induced properties were reverted upon shRNA-mediated knockdown of TRAP or treatment with the small molecule TRAP inhibitor 5-PNA. Global phosphoproteomics and proteomics analyses identified possible substrates of TRAP phosphatase activity or signaling intermediates and outlined a TRAP-dependent regulation of proteins involved in cell adhesion and ECM organization. Upregulation of TGFβ isoform 2 (TGFβ2), TGFβ receptor type 1 (TβR1) and Mothers against decapentaplegic homolog 2 (SMAD2), as well as increased intracellular phosphorylation of CD44 were identified upon TRAP perturbation. Functional antibody-mediated blocking and chemical
A rapid detection method for PAI-1 promoter insertion/deletion polymorphism (4G/5G
Directory of Open Access Journals (Sweden)
Annichino-Bizzacchi Joyce M.
1998-01-01
Full Text Available Plasminogen activator inhibitor-1 (PAI-1 is an important inhibitor of fibrinolysis, and increased levels of PAI-1 are associated with atheroma and myocardial infarction. A common 4G/5G insertion/deletion polymorphism located in the promoter region of PAI-1 gene has been described associated with PAI-1 activity in plasma levels. Genotyping of this polymorphism is commonly conducted with an allele-specific oligonucleotide melting technique. In the present study, we describe a quick, easy method for genotyping 4G/5G polymorphism in the promoter region of the PAI-1 gene.
Sox2 promotes survival of satellite glial cells in vitro
International Nuclear Information System (INIS)
Koike, Taro; Wakabayashi, Taketoshi; Mori, Tetsuji; Hirahara, Yukie; Yamada, Hisao
2015-01-01
Sox2 is a transcriptional factor expressed in neural stem cells. It is known that Sox2 regulates cell differentiation, proliferation and survival of the neural stem cells. Our previous study showed that Sox2 is expressed in all satellite glial cells of the adult rat dorsal root ganglion. In this study, to examine the role of Sox2 in satellite glial cells, we establish a satellite glial cell-enriched culture system. Our culture method succeeded in harvesting satellite glial cells with the somata of neurons in the dorsal root ganglion. Using this culture system, Sox2 was downregulated by siRNA against Sox2. The knockdown of Sox2 downregulated ErbB2 and ErbB3 mRNA at 2 and 4 days after siRNA treatment. MAPK phosphorylation, downstream of ErbB, was also inhibited by Sox2 knockdown. Because ErbB2 and ErbB3 are receptors that support the survival of glial cells in the peripheral nervous system, apoptotic cells were also counted. TUNEL-positive cells increased at 5 days after siRNA treatment. These results suggest that Sox2 promotes satellite glial cell survival through the MAPK pathway via ErbB receptors. - Highlights: • We established satellite glial cell culture system. • Function of Sox2 in satellite glial cell was examined using siRNA. • Sox2 knockdown downregulated expression level of ErbB2 and ErbB3 mRNA. • Sox2 knockdown increased apoptotic satellite glial cell. • Sox2 promotes satellite glial cell survival through ErbB signaling
Sox2 promotes survival of satellite glial cells in vitro
Energy Technology Data Exchange (ETDEWEB)
Koike, Taro, E-mail: koiket@hirakata.kmu.ac.jp; Wakabayashi, Taketoshi; Mori, Tetsuji; Hirahara, Yukie; Yamada, Hisao
2015-08-14
Sox2 is a transcriptional factor expressed in neural stem cells. It is known that Sox2 regulates cell differentiation, proliferation and survival of the neural stem cells. Our previous study showed that Sox2 is expressed in all satellite glial cells of the adult rat dorsal root ganglion. In this study, to examine the role of Sox2 in satellite glial cells, we establish a satellite glial cell-enriched culture system. Our culture method succeeded in harvesting satellite glial cells with the somata of neurons in the dorsal root ganglion. Using this culture system, Sox2 was downregulated by siRNA against Sox2. The knockdown of Sox2 downregulated ErbB2 and ErbB3 mRNA at 2 and 4 days after siRNA treatment. MAPK phosphorylation, downstream of ErbB, was also inhibited by Sox2 knockdown. Because ErbB2 and ErbB3 are receptors that support the survival of glial cells in the peripheral nervous system, apoptotic cells were also counted. TUNEL-positive cells increased at 5 days after siRNA treatment. These results suggest that Sox2 promotes satellite glial cell survival through the MAPK pathway via ErbB receptors. - Highlights: • We established satellite glial cell culture system. • Function of Sox2 in satellite glial cell was examined using siRNA. • Sox2 knockdown downregulated expression level of ErbB2 and ErbB3 mRNA. • Sox2 knockdown increased apoptotic satellite glial cell. • Sox2 promotes satellite glial cell survival through ErbB signaling.
Lin, Su-Yueh; Fetzer, Susan J; Lee, Po-Chang; Chen, Ching-Huey
2011-12-01
This study examined health promotion behaviours of kidney transplant recipients, 1-5 years after transplant and identified the risk factors predicting non-adherence to post-transplant recommendations. Non-adherence to health care recommendations and health promotion behaviours is one of the top three reasons for graft loss following kidney transplantation. A cross-sectional study. Kidney transplant recipients (n=101) in southern Taiwan completed a self reported survey, the Kidney Transplant Health Promotion Behavior and Healthcare Provider Support survey. Kidney transplant patients had better adherence with medication and least adherence with regular exercise health promotion behaviours. Age, post kidney transplant time, health care provider support and financial satisfaction accounted for 37·2% of the explained variance in monitoring and management for rejection and infection. Marital status, post kidney transplant time and gender accounted for 16·2% of the explained variance in infection prevention. Age was the sole predictor of exercise (odds ratio=1·08, p=0·025). Health promotion behaviours declined with time and perceived healthcare provider support decreased at the third (p=0·04) post kidney transplant year. In this study, young, single, males were identified as requiring specific strategies to improve post kidney transplant health promotion behaviours. The need for health promotion must be continually reinforce by healthcare providers throughout the lifespan of a kidney transplant recipient. Understanding the changes of health behaviours of post kidney transplant recipients and their risk factors, healthcare providers can be more aware of the needs of patients in maintaining health promotion behaviours. © 2011 Blackwell Publishing Ltd.
Characterization and sequence analysis of the F2 promoter from corynephage BFK20
International Nuclear Information System (INIS)
Koptides, M.; Ugorcakova, J.; Baloghova, E.; Bukovska, G.; Timko, J.
1994-01-01
F2 promoter from corynephage BFK20 was isolated and characterized. It was functional in Escherichia coli and Corynebacterium glutamicum. Cloning of the F2 promoter into the pJUP05 promoter probe vector caused an increase of the neomycin phosphotransferase II specific activity. According to the Northern blot hybridization the nptII gene was expressed from the cloned F2 promoter. The apparent transcription start point in E. coli and C. glutamicum was determined. The-35 region of F2 promoter showed high similarity to that of E. coli promoter consensus sequence, but its - 10 region was G+C rich and had no significant homology to that. (author)
Role of CeO2 promoter in NiO/α-Al2O3 catalyst for dry reforming of methane
Loc, Luu Cam; Phuong, Phan Hong; Tri, Nguyen
2017-09-01
A series of Ni/α-Al2O3 (NiAl) catalysts promoted by CeO2 was prepared by co-impregnation methods with content of (NiO+CeO2) being in the range of 10-30 wt%. The NiO:CeO2 weight ratio was fluctuated at 1:1, 1:2 and 1:3. Several techniques, including X-ray powder diffraction (XRD), Hydrogen temperature-programmed reduction (H2-TPR), and transmission electron microscopy (TEM) were used to investigate catalysts' physico-chemical properties. The activity of these catalysts in dry reforming of CH4 was investigated at temperature range of 550-800 °C. The results revealed that the most suitable CeO2 promoted Ni catalyst contained 20 wt% of (NiO+CeO2) and NiO:CeO2 weight ratio of 1:2. The best catalytic performance of catalyst [20(1Ni2Ce)Al] due to a better reducibility resulted in a higher amount of free small particle NiO. At 700 °C and CH4:CO2 molar ratio of 1:1, the conversion of CH4 and CO2 on the most suitable CeO2 promoted Ni catalyst reached 86% and 67%, respectively; H2 and CO selectivity of 90% and H2:CO molar ratio of 1.15 were obtained. Being similar to MgO [1], promoter CeO2 could improve catalytic activity of Ni/α-Al2O3 catalyst at a lower range of temperature. Besides, both MgO and CeO2 had a great impact on improving coke resistance of Ni catalysts. At higher temperature, the role of CeO2 as well as MgO in preventing coke formation on catalyst was clarified by temperature-programmed oxidation (TPO) technique. Coke amount formed after 30-h TOS on 20(1Ni2Ce) catalyst was found to be 22.18 mgC/gcat, being less than on non-promoted catalyst (36.75 mgC/gcat), but more than on 20(1Ni2Mg)Al one (5.25 mgC/gcat).
Electrochemical promotion of sulfur dioxide catalytic oxidation
DEFF Research Database (Denmark)
Petrushina, Irina; Bandur, Viktor; Cappeln, Frederik Vilhelm
2000-01-01
investigation was to study a possible non-Faradaic electrochemical promotion of the liquid-phase catalytic reaction. It has been shown that there are two negative potential promotion areas with maximum effects at approximately -0.1 and -0.2 V, and one positive potential promotion area with the maximum effect...... between 0.1 and 0.3 V. There were no Faradaic reactions in the negative polarization region, and there was an anodic current which was less than 16% of the theoretical value for an exclusively Faradaic SO2 oxidation. Therefore the promotion effects at negative polarization are completely non-Faradaic. All...... the promotion effects have been explained as mainly due to charging of the electric double layer at the gold electrode. The effect at -0.2 V also depends on the V2O5 concentration and is more pronounced at higher V2O5 concentrations. This has been ascribed to a destruction of the vanadium polymeric chains...
Masticatory muscle activity during deliberately performed oral tasks
International Nuclear Information System (INIS)
Farella, M; Palla, S; Erni, S; Gallo, L M; Michelotti, A
2008-01-01
The aim of this study was to investigate masticatory muscle activity during deliberately performed functional and non-functional oral tasks. Electromyographic (EMG) surface activity was recorded unilaterally from the masseter, anterior temporalis and suprahyoid muscles in 11 subjects (5 men, 6 women; age = 34.6 ± 10.8 years), who were accurately instructed to perform 30 different oral tasks under computer guidance using task markers. Data were analyzed by descriptive statistics, repeated measurements analysis of variance (ANOVA) and hierarchical cluster analysis. The maximum EMG amplitude of the masseter and anterior temporalis muscles was more often found during hard chewing tasks than during maximum clenching tasks. The relative contribution of masseter and anterior temporalis changed across the tasks examined (F ≥ 5.2; p ≤ 0.001). The masseter muscle was significantly (p ≤ 0.05) more active than the anterior temporalis muscle during tasks involving incisal biting, jaw protrusion, laterotrusion and jaw cupping, the difference being statistically significant (p ≤ 0.05). The anterior temporalis muscle was significantly (p ≤ 0.01) more active than the masseter muscle during tasks performed in intercuspal position, during tooth grinding, and during hard chewing on the working side. Based upon the relative contribution of the masseter, anterior temporalis, and suprahyoid muscles, the investigated oral tasks could be grouped into six separate clusters. The findings provided further insight into muscle- and task-specific EMG patterns during functional and non-functional oral behaviors
Revisa milestones report. Task 2.1: development of material models
International Nuclear Information System (INIS)
Nicolas, L.
1998-01-01
This report is the CEA contribution to the Milestone report of the REVISA project (Task 2.1). This task is particularly devoted to the development of advanced material models. CEA uses two different constitutive concepts. The first model is a coupled damage-visco-plasticity model proposed by Lemaitre and Chaboche. The second model is a non unified visco-plasticity model proposed by Contesti and Cailletaud, where the classical decomposition of the total inelastic strain into a time independent plastic part and a time dependent creep part is assumed. The introduction of isotropic damage in this model is part of the developments presented in this report. (author)
Ma, Jing-Hui; Song, Shao-Hua; Guo, Meng; Zhou, Ji; Liu, Fang; Peng, Li; Fu, Zhi-Ren
2017-11-18
Atmospheric particulates, especially PM2.5, not only damage the respiratory system, but also play important roles in pulmonary immunity. China is influenced by atmospheric diffusion conditions, industrial manufacturers, and heating and discharging. PM2.5 levels in the air rise substantially in the winter, which is also a period of flu high-incidence. Although an epidemiological link exists between PM2.5 and flu, we do not understand how long-term PM2.5 inhalation affects pulmonary immunity and the influenza virus response. Our study has prepared an in vivo PM2.5 mouse pharyngeal wall drop-in model and has found that PM2.5 exposure leads to mouse inflammatory injuries and furthers influenza A infection. Our results suggest that short-term exposure to PM2.5 significantly enhances the survival rate of influenza A-contaminated mice, while long-term PM2.5 inhalation lowers the capacity of pulmonary macrophages to secrete IL-6 and IFN-β. A disorder in the pulmonary innate defense system results in increased death rates following influenza infection. On a macromolecular level, this mechamism involves Kdm6a down-regulation after long-term exposure to PM 2.5 and a resultant increase in H3K4 and H3K9 methylation in IL-6 and IFN-β promoter regions. In summary, PM2.5 causes injuries of lung tissue cells and downregulates immune defense mechanisms in the lung. Copyright © 2017. Published by Elsevier Inc.
Human FAN1 promotes strand incision in 5'-flapped DNA complexed with RPA.
Takahashi, Daisuke; Sato, Koichi; Hirayama, Emiko; Takata, Minoru; Kurumizaka, Hitoshi
2015-09-01
Fanconi anaemia (FA) is a human infantile recessive disorder. Seventeen FA causal proteins cooperatively function in the DNA interstrand crosslink (ICL) repair pathway. Dual DNA strand incisions around the crosslink are critical steps in ICL repair. FA-associated nuclease 1 (FAN1) is a DNA structure-specific endonuclease that is considered to be involved in DNA incision at the stalled replication fork. Replication protein A (RPA) rapidly assembles on the single-stranded DNA region of the stalled fork. However, the effect of RPA on the FAN1-mediated DNA incision has not been determined. In this study, we purified human FAN1, as a bacterially expressed recombinant protein. FAN1 exhibited robust endonuclease activity with 5'-flapped DNA, which is formed at the stalled replication fork. We found that FAN1 efficiently promoted DNA incision at the proper site of RPA-coated 5'-flapped DNA. Therefore, FAN1 possesses the ability to promote the ICL repair of 5'-flapped DNA covered by RPA. © The Authors 2015. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.
TMI-2 Lessons Learned Task Force status report and short-term recommendations
International Nuclear Information System (INIS)
1979-07-01
Review of the Three Mile Island accident by the TMI-2 Lessons Learned Task Force has disclosed a number of actions in the areas of design and analysis and plant operations that the Task Force recommends be required in the short term to provide substantial additional protection which is required for the public health and safety. All nuclear power plants in operation or in various stages of construction or licensing action are affected to varying degrees by the specific recommendations. The Task Force is continuing work in areas of general safety criteria, systems design requirements, nuclear power plant operations, and nuclear power plant licensing
Grossmann, Vicki M; Turner, Barbara S; Snyder, Denise; Stewart, Robert D; Bowen, Toni; Cifuentes, Ariadna A; Cliff, Cheryl
2015-09-01
Malnutrition is an urgent problem in the developing world, especially for children under 5 years of age. The article describes the utilization of a standard of practice designed to prevent illness in a malnourished, under-5 indigenous population and reinforced by weekly basic health messages taught by lay community health promoters. The two villages were chosen for observation after administration of the standard of care among the Maya-Kíché, the most numerous Mayan group in Guatemala. The standard of practice, 20 mg of daily oral zinc, was administered for 10 days in the home and followed by daily vitamin supplementation that continued throughout the 3 months of the project. All patients received four monthly clinic visits, with one of the village groups receiving weekly health promoter visits. Data evaluated after the quality improvement project showed significant differences in adherence to the zinc regimen (χ(2) = 3.677, p ≤ .05) as well as lower rates of diarrheal illnesses (χ(2) = 5.850, p ≤ .05), with both of these improved in the health promoter group. This study suggests that the training and implementation of para-health professionals from the lay community in response to specific health care needs could be considered a best practice in developing countries. Public health professionals are key to health promoter training and direction, and their importance in the global setting cannot be understated. © The Author(s) 2014.
Parental Verbal Strategies and Children's Capacities at 3 and 5 Years during a Memory Task
Labrell, Florence; Ubersfeld, Guillaume
2004-01-01
In order to study the influence on memorization of external inputs as well as children's own strategies, we examined both parental discourses in terms of distancing (Sigel, 1970) and spontaneous rehearsal by children during a memory task. Our aim was to assess the influence of each factor for children between 3 and 5 years of age. In our study of…
Kozel, Caitlin; Thompson, Brytteny; Hustak, Samantha; Moore, Chelsea; Nakashima, Akio; Singh, Chingakham Ranjit; Reid, Megan; Cox, Christian; Papadopoulos, Evangelos; Luna, Rafael E; Anderson, Abbey; Tagami, Hideaki; Hiraishi, Hiroyuki; Slone, Emily Archer; Yoshino, Ken-Ichi; Asano, Masayo; Gillaspie, Sarah; Nietfeld, Jerome; Perchellet, Jean-Pierre; Rothenburg, Stefan; Masai, Hisao; Wagner, Gerhard; Beeser, Alexander; Kikkawa, Ushio; Fleming, Sherry D; Asano, Katsura
2016-10-14
ATF4 is a pro-oncogenic transcription factor whose translation is activated by eIF2 phosphorylation through delayed re-initiation involving two uORFs in the mRNA leader. However, in yeast, the effect of eIF2 phosphorylation can be mimicked by eIF5 overexpression, which turns eIF5 into translational inhibitor, thereby promoting translation of GCN4, the yeast ATF4 equivalent. Furthermore, regulatory protein termed eIF5-mimic protein (5MP) can bind eIF2 and inhibit general translation. Here, we show that 5MP1 overexpression in human cells leads to strong formation of 5MP1:eIF2 complex, nearly comparable to that of eIF5:eIF2 complex produced by eIF5 overexpression. Overexpression of eIF5, 5MP1 and 5MP2, the second human paralog, promotes ATF4 expression in certain types of human cells including fibrosarcoma. 5MP overexpression also induces ATF4 expression in Drosophila The knockdown of 5MP1 in fibrosarcoma attenuates ATF4 expression and its tumor formation on nude mice. Since 5MP2 is overproduced in salivary mucoepidermoid carcinoma, we propose that overexpression of eIF5 and 5MP induces translation of ATF4 and potentially other genes with uORFs in their mRNA leaders through delayed re-initiation, thereby enhancing the survival of normal and cancer cells under stress conditions. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
DEFF Research Database (Denmark)
Caballero Puntiverio, Maitane; Fitzpatrick, Ciarán Martin; Woldbye, David Paul Drucker
2017-01-01
assessed. Saline treatment data determined high- and lowattentive (LA), and high- and low-impulsive (LI) subgroups according to the upper and lower 30th percentiles, respectively. Results: In the LA subgroup accuracy was improved by 0.5 mg/kg AMPH and 2 mg/kg MPH, while no effect was found in the high-attentive......Background: Few studies have investigated the effects of conventional attention deficit-hyperactivity disorder (ADHD) medication in the mouse 5-choice serial reaction time task (5-CSRTT), and rat studies have yielded inconsistent results. Objective: We aimed to examine the effects of acute...... (HA) subgroup. Premature responses were increased by 1 mg/kg AMPH and 0.5 mg/kg MPH for all animals, and by 1 mg/kg AMPH for the LI subgroup. Conclusions: The use of variable stimulus duration, along with the division into high- and LA, and high-and LI subgroups, may improve the sensitivity of the 5...
Insulin Promoter Factor 1 variation is associated with type 2 diabetes in African Americans
Directory of Open Access Journals (Sweden)
Wang Xiaoqin
2005-10-01
Full Text Available Abstract Background Defective insulin secretion is a key defect in the pathogenesis of type 2 diabetes (T2DM. The β-cell specific transcription factor, insulin promoter factor 1 gene (IPF1, is essential to pancreatic development and the maintenance of β-cell mass. We hypothesized that regulatory or coding variants in IPF1 contribute to defective insulin secretion and thus T2DM. Methods We screened 71 Caucasian and 69 African American individuals for genetic variants in the promoter region, three highly conserved upstream regulatory sequences (PH1, PH2 and PH3, the human β-cell specific enhancer, and the two exons with adjacent introns. We tested for an association of each variant with T2DM Caucasians (192 cases and 192 controls and African Americans (341 cases and 186 controls. Results We identified 8 variants in the two populations, including a 3 bp insertion in exon 2 (InsCCG243 in African Americans that resulted in an in-frame proline insertion in the transactivation domain. No variant was associated with T2DM in Caucasians, but polymorphisms at -3766 in the human β-cell enhancer, at -2877 bp in the PH1 domain, and at -108 bp in the promoter region were associated with T2DM in African American subjects (p Conculsion The common alleles of regulatory variants in the 5' enhancer and promoter regions of the IPF1 gene increase susceptibility to type 2 diabetes among African American individuals, likely as a result of gene-gene or gene-environment interactions. In contrast, IPF1 is not a cause of type 2 diabetes in Caucasians. A previously described InsCCG243 variant may contribute to diabetes susceptibility in African American individuals, but is of low penetrance.
Shariati J, Vahid; Malboobi, Mohammad Ali; Tabrizi, Zeinab; Tavakol, Elahe; Owilia, Parviz; Safari, Maryam
2017-11-15
In this study, we provide a comparative genomic analysis of Pantoea agglomerans strain P5 and 10 closely related strains based on phylogenetic analyses. A next-generation shotgun strategy was implemented using the Illumina HiSeq 2500 technology followed by core- and pan-genome analysis. The genome of P. agglomerans strain P5 contains an assembly size of 5082485 bp with 55.4% G + C content. P. agglomerans consists of 2981 core and 3159 accessory genes for Coding DNA Sequences (CDSs) based on the pan-genome analysis. Strain P5 can be grouped closely with strains PG734 and 299 R using pan and core genes, respectively. All the predicted and annotated gene sequences were allocated to KEGG pathways. Accordingly, genes involved in plant growth-promoting (PGP) ability, including phosphate solubilization, IAA and siderophore production, acetoin and 2,3-butanediol synthesis and bacterial secretion, were assigned. This study provides an in-depth view of the PGP characteristics of strain P5, highlighting its potential use in agriculture as a biofertilizer.
Elekes, Fruzsina; Varga, Máté; Király, Ildikó
2017-11-01
It has been widely assumed that computing how a scene looks from another perspective (level-2 perspective taking, PT) is an effortful process, as opposed to the automatic capacity of tracking visual access to objects (level-1 PT). Recently, adults have been found to compute both forms of visual perspectives in a quick but context-sensitive way, indicating that the two functions share more features than previously assumed. However, the developmental literature still shows the dissociation between automatic level-1 and effortful level-2 PT. In the current paper, we report an experiment showing that in a minimally social situation, participating in a number verification task with an adult confederate, eight- to 9.5-year-old children demonstrate similar online level-2 PT capacities as adults. Future studies need to address whether online PT shows selectivity in children as well and develop paradigms that are adequate to test preschoolers' online level-2 PT abilities. Statement of Contribution What is already known on this subject? Adults can access how objects appear to others (level-2 perspective) spontaneously and online Online level-1, but not level-2 perspective taking (PT) has been documented in school-aged children What the present study adds? Eight- to 9.5-year-olds performed a number verification task with a confederate who had the same task Children showed similar perspective interference as adults, indicating spontaneous level-2 PT Not only agent-object relations but also object appearances are computed online by eight- to 9.5-year-olds. © 2017 The British Psychological Society.
Directory of Open Access Journals (Sweden)
Schwarzenbach Heidi
2010-06-01
Full Text Available Abstract Background The aim of the current study was to analyze the involvement of methyl-CpG binding proteins (MBDs and histone modifications on the regulation of CD44, Cyclin D2, GLIPR1 and PTEN in different cellular contexts such as the prostate cancer cells DU145 and LNCaP, and the breast cancer cells MCF-7. Since global chromatin changes have been shown to occur in tumours and regions of tumour-associated genes are affected by epigenetic modifications, these may constitute important regulatory mechanisms for the pathogenesis of malignant transformation. Methods In DU145, LNCaP and MCF-7 cells mRNA expression levels of CD44, Cyclin D2, GLIPR1 and PTEN were determined by quantitative RT-PCR at the basal status as well as after treatment with demethylating agent 5-aza-2'-deoxycytidine and/or histone deacetylase inhibitor Trichostatin A. Furthermore, genomic DNA was bisulfite-converted and sequenced. Chromatin immunoprecipitation was performed with the stimulated and unstimulated cells using antibodies for MBD1, MBD2 and MeCP2 as well as 17 different histone antibodies. Results Comparison of the different promoters showed that MeCP2 and MBD2a repressed promoter-specifically Cyclin D2 in all cell lines, whereas in MCF-7 cells MeCP2 repressed cell-specifically all methylated promoters. Chromatin immunoprecipitation showed that all methylated promoters associated with at least one MBD. Treatment of the cells by the demethylating agent 5-aza-2'-deoxycytidine (5-aza-CdR caused dissociation of the MBDs from the promoters. Only MBD1v1 bound and repressed methylation-independently all promoters. Real-time amplification of DNA immunoprecipitated by 17 different antibodies showed a preferential enrichment for methylated lysine of histone H3 (H3K4me1, H3K4me2 and H3K4me3 at the particular promoters. Notably, the silent promoters were associated with unmodified histones which were acetylated following treatment by 5-aza-CdR. Conclusions This study is one
STAT5A-mediated NOX5-L expression promotes the proliferation and metastasis of breast cancer cells
Energy Technology Data Exchange (ETDEWEB)
Dho, So Hee [Aging Research Center, Korea Research Institute of Bioscience and Biotechnology, Daejeon 305-806 (Korea, Republic of); Radioisotope Research Division, Department of Research Reactor Utilization, Korea Atomic Energy Research Institute, Daejeon 305-353 (Korea, Republic of); Kim, Ji Young; Lee, Kwang-Pyo; Kwon, Eun-Soo [Aging Research Center, Korea Research Institute of Bioscience and Biotechnology, Daejeon 305-806 (Korea, Republic of); Lim, Jae Cheong [Radioisotope Research Division, Department of Research Reactor Utilization, Korea Atomic Energy Research Institute, Daejeon 305-353 (Korea, Republic of); Kim, Chang-Jin [Department of Pathology, Soonchunhyang Medical Science Research Institute, Chonan 330-090 (Korea, Republic of); Jeong, Dongjun, E-mail: juny1024@sch.ac.kr [Department of Pathology, Soonchunhyang Medical Science Research Institute, Chonan 330-090 (Korea, Republic of); Kwon, Ki-Sun, E-mail: kwonks@kribb.re.kr [Aging Research Center, Korea Research Institute of Bioscience and Biotechnology, Daejeon 305-806 (Korea, Republic of); Department of Functional Genomics, Korea University of Science and Technology (UST), Daejeon 305-333 (Korea, Republic of)
2017-02-01
NADPH oxidase (NOX) generates reactive oxygen species (ROS) and has been suggested to mediate cell proliferation in some cancers. Here, we show that an increase in the expression of NOX5 long form (NOX5-L) is critical for tumor progression in breast tumor tissues. Immunostaining of clinical samples indicated that NOX5 was overexpressed in 41.1% of breast ductal carcinoma samples. NOX5-L depletion consistently suppressed cell proliferation, invasion, and migration in vitro. Antibody-mediated neutralization of NOX5-L attenuated tumor progression in a mouse xenograft model. Promoter analysis revealed that NOX5-L expression is regulated by STAT5A in breast cancer cells. Based on our novel findings, we suggest that inhibition of NOX5-L may be a promising therapeutic strategy that exerts anti-cancer effects via the modulation of ROS-mediated cell signaling. - Highlights: • The ROS-generating protein, NOX5-L, determines cellular proliferation and metastasis in subset of breast tumor. • Tumor growth was attenuated by the treatment of anti-NOX5-L antibody in a xenograft model. • NOX5-L expression is transcriptionally regulated by STAT5A in breast cancer cells.
Pre-task music improves swimming performance.
Smirmaul, B P; Dos Santos, R V; Da Silva Neto, L V
2015-12-01
The purpose of this study was to investigate the effects of pre-task music on swimming performance and other psychological variables. A randomized counterbalanced within-subjects (experimental and control condition) design was employed. Eighteen regional level male swimmers performed two 200-m freestyle swimming time trials. Participants were exposed to either 5 minutes of self-selected music (pre-task music condition) or 5 minutes of silence (control condition) and, after 1 minute, performed the swimming task. Swimming time was significantly shorter (-1.44%) in the pre-task music condition. Listening to pre-task music increased motivation to perform the swimming task, while arousal remained unchanged. While fatigue increased after the swimming task in both conditions, vigor, ratings of perceived exertion and affective valence were unaltered. It is concluded, for the first time, that pre-task music improves swimming performance.
Energy Technology Data Exchange (ETDEWEB)
Tahir, Muhammad, E-mail: mtahir@cheme.utm.my [Chemical Reaction Engineering Group (CREG), Faculty of Chemical and Energy Engineering, Universiti Teknologi Malaysia, 81310, UTM, Johor Bahru, Johor (Malaysia); Department of Chemical Engineering, COMSATS Institute of Information Technology, Lahore, Punjab (Pakistan); Tahir, Beenish; Saidina Amin, Nor Aishah; Alias, Hajar [Chemical Reaction Engineering Group (CREG), Faculty of Chemical and Energy Engineering, Universiti Teknologi Malaysia, 81310, UTM, Johor Bahru, Johor (Malaysia)
2016-12-15
Highlights: • Cu-promoted In{sub 2}O{sub 3}/TiO{sub 2} nanocatalysts tested for CO{sub 2} photoreduction with H{sub 2}O/H{sub 2}. • Production of CH{sub 4} and CH{sub 3}OH depends on reductants type and metal-loading to TiO{sub 2}. • CH{sub 4} production over Cu-In/TiO{sub 2} was 1.5 fold more than In/TiO{sub 2} and 5 times the TiO{sub 2}. • The Cu-promoted CH{sub 3}OH production while In gave more CH{sub 4} with water vapors. • The H{sub 2} reductant gave negative effect for CH{sub 4} but enhanced CH{sub 3}OH production. - Abstract: Photocatalytic CO{sub 2} reduction by H{sub 2}O and/or H{sub 2} reductant to selective fuels over Cu-promoted In{sub 2}O{sub 3}/TiO{sub 2} photocatalyst has been investigated. The samples, prepared via a simple and direct sol-gel method, were characterized by XRD, SEM, TEM, XPS, N{sub 2} adsorption-desorption, UV–vis diffuse reflectance, Raman and PL spectroscopy. Cu and In loaded into TiO{sub 2}, oxidized as Cu{sup 2+} and In{sup 3+}, promoted efficient separation of photo-generated electron/hole pairs (e{sup −}/h{sup +}). The results indicate that the reduction rate of CO{sub 2} by H{sub 2}O to CH{sub 4} approached to 181 μmol g{sup −1} h{sup −1} using 0.5% Cu-3% In{sub 2}O{sub 3}/TiO{sub 2} catalyst, a 1.53 fold higher than the production rate over the 3% In{sub 2}O{sub 3}/TiO{sub 2} and 5 times the amount produced over the pure TiO{sub 2}. In addition, Cu was found to promote efficient production of CH{sub 3}OH and yield rate reached to 68 μmol g{sup −1} h{sup −1} over 1% Cu-3% In{sub 2}O{sub 3}/TiO{sub 2} catalyst. This improvement was attributed to charge transfer property and suppressed recombination rate by Cu-metal. More importantly, H{sub 2} reductant was less favorable for CH{sub 4} production, yet a significant amount of CH{sub 4} and CH{sub 3}OH were obtained using a mixture of H{sub 2}O/H{sub 2} reductant. Therefore, Cu-loaded In{sub 2}O{sub 3}/TiO{sub 2} catalyst has shown to be capable for
Wirzberger, Maria; Esmaeili Bijarsari, Shirin; Rey, Günter Daniel
2017-09-01
Cognitive processes related to schema acquisition comprise an essential source of demands in learning situations. Since the related amount of cognitive load is supposed to change over time, plausible temporal models of load progression based on different theoretical backgrounds are inspected in this study. A total of 116 student participants completed a basal symbol sequence learning task, which provided insights into underlying cognitive dynamics. Two levels of task complexity were determined by the amount of elements within the symbol sequence. In addition, interruptions due to an embedded secondary task occurred at five predefined stages over the task. Within the resulting 2x5-factorial mixed between-within design, the continuous monitoring of efficiency in learning performance enabled assumptions on relevant resource investment. From the obtained results, a nonlinear change of learning efficiency over time seems most plausible in terms of cognitive load progression. Moreover, different effects of the induced interruptions show up in conditions of task complexity, which indicate the activation of distinct cognitive mechanisms related to structural aspects of the task. Findings are discussed in the light of evidence from research on memory and information processing. Copyright © 2017 Elsevier B.V. All rights reserved.
A novel splice variant of supervillin, SV5, promotes carcinoma cell proliferation and cell migration
International Nuclear Information System (INIS)
Chen, Xueran; Yang, Haoran; Zhang, Shangrong; Wang, Zhen; Ye, Fang; Liang, Chaozhao; Wang, Hongzhi; Fang, Zhiyou
2017-01-01
Supervillin is an actin-associated protein that regulates actin dynamics by interacting with Myosin II, F-actin, and Cortactin to promote cell contractility and cell motility. Two splicing variants of human Supervillin (SV1 and SV4) have been reported in non-muscle cells; SV1 lacks 3 exons present in the larger isoform SV4. SV2, also called archvillin, is present in striated muscle; SV3, also called smooth muscle archvillin or SmAV, was cloned from smooth muscle. In the present study, we identify a novel splicing variant of Supervillin (SV5). SV5 contains a new splicing pattern. In the mouse tissues and cell lines examined, SV5 was predominantly expressed in skeletal and cardiac muscles and in proliferating cells, but was virtually undetectable in most normal tissues. Using RNAi and rescue experiments, we show here that SV5 displays altered functional properties in cancer cells, and regulates cell proliferation and cell migration.
Tet1 and Tet2 maintain mesenchymal stem cell homeostasis via demethylation of the P2rX7 promoter.
Yang, Ruili; Yu, Tingting; Kou, Xiaoxing; Gao, Xiang; Chen, Chider; Liu, Dawei; Zhou, Yanheng; Shi, Songtao
2018-06-01
Ten-eleven translocation (Tet) family-mediated DNA oxidation represents an epigenetic modification capable of converting 5-methylcytosine (5-mC) to 5-hydroxymethylcytosine (5-hmC), which regulates various biological processes. However, it is unknown whether Tet family affects mesenchymal stem cells (MSCs) or the skeletal system. Here we show that depletion of Tet1 and Tet2 results in impaired self-renewal and differentiation of bone marrow MSCs (BMMSCs) and a significant osteopenia phenotype. Tet1 and Tet2 deficiency reduces demethylation of the P2rX7 promoter and downregulates exosome release, leading to intracellular accumulation of miR-297a-5p, miR-297b-5p, and miR-297c-5p. These miRNAs inhibit Runx2 signaling to impair BMMSC function. We show that overexpression of P2rX7 rescues the impaired BMMSCs and osteoporotic phenotype in Tet1 and Tet2 double knockout mice. These results indicate that Tet1 and Tet2 play a critical role in maintaining BMMSC and bone homeostasis through demethylation of P2rX7 to control exosome and miRNA release. This Tet/P2rX7/Runx2 cascade may serve as a target for the development of novel therapies for osteopenia disorders.
Survival Processing and the Stroop Task
Directory of Open Access Journals (Sweden)
Stephanie A. Kazanas
2015-11-01
Full Text Available This study was designed to investigate the impact of survival processing with a novel task for this paradigm: the Stroop color-naming task. As the literature is mixed with regard to task generalizability, with survival processing promoting better memory for words, but not better memory for faces or paired associates, these types of task investigations are important to a growing field of research. Using the Stroop task provides a unique contribution, as identifying items by color is an important evolutionary adaptation and not specific to humans as is the case with word recall. Our results indicate that survival processing, with its accompanying survival-relevance rating task, remains the best mnemonic strategy for word memory. However, our results also indicate that presenting the survival passage does not motivate better color-naming performance than color-naming alone. In addition, survival processing led to a larger amount of Stroop interference, though not significantly larger than the other conditions. Together, these findings suggest that considering one’s survival when performing memory and attention-based tasks does not enhance cognitive performance generally, although greater allocation of attentional resources to color-incongruent concrete objects could be considered adaptive. These findings support the notion that engaging in deeper processing via survival-relevance ratings may preserve these words across a variety of experimental manipulations.
CO2 methanation on the catalyst of Ni/MCM-41 promoted with CeO2.
Wang, Xiaoliu; Zhu, Lingjun; Liu, Yincong; Wang, Shurong
2018-06-01
CO 2 as a raw feed combined with renewable hydrogen for the production of useful chemicals and alternative energy products is one of the solutions to environmental and energy problems. In this study, a series of Ni-xCeO 2 /MCM-41 catalysts with a nickel content of 20wt% were prepared through deposition precipitation method for CO 2 methanation. Different characterization methods, including BET, XRD, TEM, SEM, H 2 -TPR and H 2 -TPD were applied to help explore the influence mechanism of CeO 2 on Ni/MCM-41 in CO 2 methanation. It was found that all CeO 2 -promoted catalysts exhibited enhanced catalytic activity when compared to Ni/MCM-41. The catalyst modified with 20wt% CeO 2 showed the best catalytic performance, with CO 2 conversion and CH 4 selectivity of 85.6% and 99.8%, respectively, at the temperature of 380°C under atmospheric pressure. The synergetic effects among Ni 0 active sites, the promoter and the support, including nickel dispersion improvement and increased CO 2 adsorption sites due to the addition of CeO 2 , were considered as important factors for high reactivity of the promoted catalysts. The stability test showed that the promoted catalyst maintained its high reactivity after 30h. Copyright © 2017 Elsevier B.V. All rights reserved.
Promoter2.0: for the recognition of PolII promoter sequences
DEFF Research Database (Denmark)
Knudsen, Steen; Knudsen, Steen
1999-01-01
Motivation : A new approach to the prediction of eukaryotic PolII promoters from DNA sequence takesadvantage of a combination of elements similar to neural networks and genetic algorithms to recognize a set ofdiscrete subpatterns with variable separation as one pattern: a promoter. The neural...... of optimization, the algorithm was able todiscriminate between vertebrate promoter and non-promoter sequences in a test set with a correlationcoefficient of 0.63. In addition, all five known transcription start sites on the plus strand of the completeadenovirus genome were within 161 bp of 35 predicted...
IAEA INTOR workshop report, groups 2, 5, 7, 9, 10 and 15
International Nuclear Information System (INIS)
1980-02-01
In order to prove scientific feasibility of magnetic confinement fusion, large fusion devices are under construction in several countries (JT-60 in Japan, T-15 in U.S.S.R., TFTR in U.S.A. and JET in EC). International Tokamak Reactor (INTOR) Workshop was organized by the International Atomic Energy Agency (IAEA) to identify roles, objectives and characteristics of the next generation fusion device. This report is a compilation of the home task reports of six groups on INTOR engineering aspects by Japan Atomic Energy Research Institute for workshop sessions 2 and 3 held in 1979. Tasks of the respective groups are group 2: first wall/blanket/shield, group 5: magnetics, group 7: systems integration and structure, group 9: assembly and remote maintenance, group 10: radiation shielding and personnel access, group 15: safety and environment. (author)
Eustache, Eddy; Gerbasi, Margaret E.; Severe, Jennifer; Fils-Aimé, J. Reginald; Smith Fawzi, Mary C.; Raviola, Giuseppe J.; Darghouth, Sarah; Boyd, Kate; Thérosmé, Tatiana; Legha, Rupinder; Pierre, Ermaze L.; Affricot, Emmeline; Alcindor, Yoldie; Grelotti, David J.; Becker, Anne E.
2017-01-01
Background Task-sharing with teachers to promote youth mental health is a promising but underdeveloped strategy in improving care access in low-income countries. Aims To assess feasibility, acceptability, and utility of the teacher accompaniment phase of a school-based teacher accompagnateur pilot study (TAPS) in Haiti. Methods We assigned student participants, ages 18–22 (n=120) to a teacher participant (n=22) within four Haitian schools; we instructed participants to arrange meetings with their assigned counterparts to discuss mental health treatment, academic skills, and/or well-being. We measured student and teacher perceived feasibility, acceptability, and utility of meetings with self-report Likert-style questions. We examined overall program feasibility by the percentage of students with a documented meeting, acceptability by a composite measure of student satisfaction, and utility by the percentage with identified mental health need who discussed treatment with a teacher. Results Favorable ratings support feasibility, acceptability, and utility of teacher-accompagnateur meetings with students. The majority of students (54%) met with a teacher. Among students with an identified mental disorder, 43.2% discussed treatment during a meeting. Conclusions This accompaniment approach to mental health task-sharing with teachers provided a school-based opportunity for students with mental health need to discuss treatment and has potential relevance to other low-income settings. PMID:28367718
TiO2 promoted by two different non-noble metal cocatalysts for enhanced photocatalytic H2 evolution
International Nuclear Information System (INIS)
Lin, Jing-Dong; Yan, Shi; Huang, Qin-Dong; Fan, Mei-Ting; Yuan, You-Zhu; Tan, Timothy Thatt-Yang; Liao, Dai-Wei
2014-01-01
TiO 2 photocatalysts modified by cobalt and nickel cocatalysts were prepared via polymerized complex method (PCM) and evaluated by photocatalytic hydrogen evolution. Hydrogen generation in 6 h for the TiO 2 promoted by cobalt and nickel (0.1%Co + 0.2%Ni/TiO 2 ) is about two times (2456 μmol H 2 ) compared to that of TiO 2 promoted only by cobalt (1180 μmol H 2 for 0.1%Co/TiO 2 ) or nickel (1127 μmol H 2 for 0.2%Ni/TiO 2 ), and mechanically mixed TiO 2 promoted by cobalt and TiO 2 promoted by nickel (0.1%Co/TiO 2 :0.2%Ni/TiO 2 = 1:1 (m/m), 1282 μmol H 2 ). The high photocatalytic H 2 evolution activity over TiO 2 promoted by cobalt and nickel is ascribed to enhanced photo response due to the presence of cobalt and nickel impurity level, and effective separation of photogenerated electrons and holes due to the synergistic effect of cobalt and nickel, which serve as active sites for H 2 evolution reaction (HER) and oxidation reaction (OR) respectively. This study demonstrates a viable strategy to design more active photocatalysts for photocatalytic H 2 evolution by substituting noble metals with more abundant elements using as HER and OR cocatalysts, respectively.
Induction of NFATc2 expression by interleukin 6 promotes T helper type 2 differentiation.
Diehl, Sean; Chow, Chi-Wing; Weiss, Linda; Palmetshofer, Alois; Twardzik, Thomas; Rounds, Laura; Serfling, Edgar; Davis, Roger J; Anguita, Juan; Rincón, Mercedes
2002-07-01
Interleukin (IL)-6 is produced by professional antigen-presenting cells (APCs) such as B cells, macrophages, and dendritic cells. It has been previously shown that APC-derived IL-6 promotes the differentiation of naive CD4+ T cells into effector T helper type 2 (Th2) cells. Here, we have studied the molecular mechanism for IL-6-mediated Th2 differentiation. During the activation of CD4+ T cells, IL-6 induces the production of IL-4, which promotes the differentiation of these cells into effector Th2 cells. Regulation of IL-4 gene expression by IL-6 is mediated by nuclear factor of activated T cells (NFAT), as inhibition of NFAT prevents IL-6-driven IL-4 production and Th2 differentiation. IL-6 upregulates NFAT transcriptional activity by increasing the levels of NFATc2. The ability of IL-6 to promote Th2 differentiation is impaired in CD4+ T cells that lack NFATc2, demonstrating that NFATc2 is required for regulation of IL-4 gene expression by IL-6. Regulation of NFATc2 expression and NFAT transcriptional activity represents a novel pathway by which IL-6 can modulate gene expression.
Heart Rate Response During Mission-Critical Tasks After Space Flight
Arzeno, Natalia M.; Lee, S. M. C.; Stenger, M. B.; Lawrence, E. L.; Platts, S. H.; Bloomberg, J. J.
2010-01-01
Adaptation to microgravity could impair crewmembers? ability to perform required tasks upon entry into a gravity environment, such as return to Earth, or during extraterrestrial exploration. Historically, data have been collected in a controlled testing environment, but it is unclear whether these physiologic measures result in changes in functional performance. NASA?s Functional Task Test (FTT) aims to investigate whether adaptation to microgravity increases physiologic stress and impairs performance during mission-critical tasks. PURPOSE: To determine whether the well-accepted postflight tachycardia observed during standard laboratory tests also would be observed during simulations of mission-critical tasks during and after recovery from short-duration spaceflight. METHODS: Five astronauts participated in the FTT 30 days before launch, on landing day, and 1, 6, and 30 days after landing. Mean heart rate (HR) was measured during 5 simulations of mission-critical tasks: rising from (1) a chair or (2) recumbent seated position followed by walking through an obstacle course (egress from a space vehicle), (3) translating graduated masses from one location to another (geological sample collection), (4) walking on a treadmill at 6.4 km/h (ambulation on planetary surface), and (5) climbing 40 steps on a passive treadmill ladder (ingress to lander). For tasks 1, 2, 3, and 5, astronauts were encouraged to complete the task as quickly as possible. Time to complete tasks and mean HR during each task were analyzed using repeated measures ANOVA and ANCOVA respectively, in which task duration was a covariate. RESULTS: Landing day HR was higher (P < 0.05) than preflight during the upright seat egress (7%+/-3), treadmill walk (13%+/-3) and ladder climb (10%+/-4), and HR remained elevated during the treadmill walk 1 day after landing. During tasks in which HR was not elevated on landing day, task duration was significantly greater on landing day (recumbent seat egress: 25
Mechanism of Methane Chemical Looping Combustion with Hematite Promoted with CeO 2
Energy Technology Data Exchange (ETDEWEB)
Miller, Duane D.; Siriwardane, Ranjani
2013-08-15
Chemical looping combustion (CLC) is a promising technology for fossil fuel combustion that produces sequestration-ready CO{sub 2} stream, reducing the energy penalty of CO{sub 2} separation from flue gases. An effective oxygen carrier for CLC will readily react with the fuel gas and will be reoxidized upon contact with oxygen. This study investigated the development of a CeO{sub 2}-promoted Fe{sub 2}O{sub 3}-hematite oxygen carrier suitable for the methane CLC process. Composition of CeO{sub 2} is between 5 and 25 wt % and is lower than what is generally used for supports in Fe{sub 2}O{sub 3} carrier preparations. The incorporation of CeO{sub 2} to the natural ore hematite strongly modifies the reduction behavior in comparison to that of CeO{sub 2} and hematite alone. Temperature-programmed reaction studies revealed that the addition of even 5 wt % CeO{sub 2} enhances the reaction capacity of the Fe{sub 2}O{sub 3} oxygen carrier by promoting the decomposition and partial oxidation of methane. Fixed-bed reactor data showed that the 5 wt % cerium oxides with 95 wt % iron oxide produce 2 times as much carbon dioxide in comparison to the sum of carbon dioxide produced when the oxides were tested separately. This effect is likely due to the reaction of CeO{sub 2} with methane forming intermediates, which are reactive for extracting oxygen from Fe{sub 2}O{sub 3} at a considerably faster rate than the rate of the direct reaction of Fe{sub 2}O{sub 3} with methane. These studies reveal that 5 wt % CeO{sub 2}/Fe{sub 2}O{sub 3} gives stable conversions over 15 reduction/oxidation cycles. Lab-scale reactor studies (pulsed mode) suggest the methane reacts initially with CeO{sub 2} lattice oxygen to form partial oxidation products (CO + H{sub 2}), which continue to react with oxygen from neighboring Fe{sub 2}O{sub 3}, leading to its complete oxidation to form CO{sub 2}. The reduced cerium oxide promotes the methane decomposition reaction to form C + H{sub 2}, which continue to
Machado, Filipe Brum; Machado, Fabricio Brum; Faria, Milena Amendro; Lovatel, Viviane Lamim; Alves da Silva, Antonio Francisco; Radic, Claudia Pamela; De Brasi, Carlos Daniel; Rios, Álvaro Fabricio Lopes; de Sousa Lopes, Susana Marina Chuva; da Silveira, Leonardo Serafim; Ruiz-Miranda, Carlos Ramon; Ramos, Ester Silveira; Medina-Acosta, Enrique
2014-01-01
X-chromosome inactivation (XCI) is the epigenetic transcriptional silencing of an X-chromosome during the early stages of embryonic development in female eutherian mammals. XCI assures monoallelic expression in each cell and compensation for dosage-sensitive X-linked genes between females (XX) and males (XY). DNA methylation at the carbon-5 position of the cytosine pyrimidine ring in the context of a CpG dinucleotide sequence (5meCpG) in promoter regions is a key epigenetic marker for transcriptional gene silencing. Using computational analysis, we revealed an extragenic tandem GAAA repeat 230-bp from the landmark CpG island of the human X-linked retinitis pigmentosa 2 RP2 promoter whose 5meCpG status correlates with XCI. We used this RP2 onshore tandem GAAA repeat to develop an allele-specific 5meCpG-based PCR assay that is highly concordant with the human androgen receptor (AR) exonic tandem CAG repeat-based standard HUMARA assay in discriminating active (Xa) from inactive (Xi) X-chromosomes. The RP2 onshore tandem GAAA repeat contains neutral features that are lacking in the AR disease-linked tandem CAG repeat, is highly polymorphic (heterozygosity rates approximately 0.8) and shows minimal variation in the Xa/Xi ratio. The combined informativeness of RP2/AR is approximately 0.97, and this assay excels at determining the 5meCpG status of alleles at the Xp (RP2) and Xq (AR) chromosome arms in a single reaction. These findings are relevant and directly translatable to nonhuman primate models of XCI in which the AR CAG-repeat is monomorphic. We conducted the RP2 onshore tandem GAAA repeat assay in the naturally occurring chimeric New World monkey marmoset (Callitrichidae) and found it to be informative. The RP2 onshore tandem GAAA repeat will facilitate studies on the variable phenotypic expression of dominant and recessive X-linked diseases, epigenetic changes in twins, the physiology of aging hematopoiesis, the pathogenesis of age-related hematopoietic
Directory of Open Access Journals (Sweden)
Filipe Brum Machado
Full Text Available X-chromosome inactivation (XCI is the epigenetic transcriptional silencing of an X-chromosome during the early stages of embryonic development in female eutherian mammals. XCI assures monoallelic expression in each cell and compensation for dosage-sensitive X-linked genes between females (XX and males (XY. DNA methylation at the carbon-5 position of the cytosine pyrimidine ring in the context of a CpG dinucleotide sequence (5meCpG in promoter regions is a key epigenetic marker for transcriptional gene silencing. Using computational analysis, we revealed an extragenic tandem GAAA repeat 230-bp from the landmark CpG island of the human X-linked retinitis pigmentosa 2 RP2 promoter whose 5meCpG status correlates with XCI. We used this RP2 onshore tandem GAAA repeat to develop an allele-specific 5meCpG-based PCR assay that is highly concordant with the human androgen receptor (AR exonic tandem CAG repeat-based standard HUMARA assay in discriminating active (Xa from inactive (Xi X-chromosomes. The RP2 onshore tandem GAAA repeat contains neutral features that are lacking in the AR disease-linked tandem CAG repeat, is highly polymorphic (heterozygosity rates approximately 0.8 and shows minimal variation in the Xa/Xi ratio. The combined informativeness of RP2/AR is approximately 0.97, and this assay excels at determining the 5meCpG status of alleles at the Xp (RP2 and Xq (AR chromosome arms in a single reaction. These findings are relevant and directly translatable to nonhuman primate models of XCI in which the AR CAG-repeat is monomorphic. We conducted the RP2 onshore tandem GAAA repeat assay in the naturally occurring chimeric New World monkey marmoset (Callitrichidae and found it to be informative. The RP2 onshore tandem GAAA repeat will facilitate studies on the variable phenotypic expression of dominant and recessive X-linked diseases, epigenetic changes in twins, the physiology of aging hematopoiesis, the pathogenesis of age-related hematopoietic
Aquaporin 2 promotes cell migration and epithelial morphogenesis.
Chen, Ying; Rice, William; Gu, Zhizhan; Li, Jian; Huang, Jianmin; Brenner, Michael B; Van Hoek, Alfred; Xiong, Jianping; Gundersen, Gregg G; Norman, Jim C; Hsu, Victor W; Fenton, Robert A; Brown, Dennis; Lu, Hua A Jenny
2012-09-01
The aquaporin 2 (AQP2) water channel, expressed in kidney collecting ducts, contributes critically to water homeostasis in mammals. Animals lacking or having significantly reduced levels of AQP2, however, have not only urinary concentrating abnormalities but also renal tubular defects that lead to neonatal mortality from renal failure. Here, we show that AQP2 is not only a water channel but also an integrin-binding membrane protein that promotes cell migration and epithelial morphogenesis. AQP2 expression modulates the trafficking and internalization of integrin β1, facilitating its turnover at focal adhesions. In vitro, disturbing the interaction between AQP2 and integrin β1 by mutating the RGD motif led to reduced endocytosis, retention of integrin β1 at the cell surface, and defective cell migration and tubulogenesis. Similarly, in vivo, AQP2-null mice exhibited significant retention of integrin β1 at the basolateral membrane and had tubular abnormalities. In summary, these data suggest that the water channel AQP2 interacts with integrins to promote renal epithelial cell migration, contributing to the structural and functional integrity of the mammalian kidney.
Eye blink frequency during different computer tasks quantified by electrooculography
DEFF Research Database (Denmark)
Skotte, J H; Nøjgaard, J K; Jørgensen, L V
2007-01-01
The purpose of the study was to evaluate electrooculography (EOG) as an automatic method to measure the human eye blink frequency (BF) during passive and interactive computer tasks performed at two screen heights. Ten healthy subjects (5 males and 5 females) participated in the study in a 23...... degrees C temperature and 30-35% relative humidity controlled simulated office environment. Each test subject completed a 2 x 10 min active task of computer work and a 3 x 10 min passive task of watching a film on a video display unit (VDU). Both tasks included two viewing angles: standard (the monitors...... counted manually from the video recordings and compared to the EOG measurements. The method showed a high validity to detect blinks during computer work: 95.4% of the blinks were retrieved by the EOG method and very few artefacts from eye movements were erroneously classified as eye blinks (2.4%). By use...
Vliegenthart, J.F.G.; Vleugel, D.J.M. van der; Wassenburg, F.R.; Zwikker, J.W.
1982-01-01
Condensation of methyl 5-acetamido-4,7,8,9-tetra-O-acetyl-2-chloro-2,3,5-trideoxy-beta-D-glycero-D-galacto-2-nonulopyranosonate with benzyl 2,3,4-tri-O-benzyl-beta-D-galactopyranoside, using silver salicylate as promoter, gave benzyl 2,3,4-tri-O-benzyl-6-O-(methyl
On the importance of Task 1 and error performance measures in PRP dual-task studies
Strobach, Tilo; Schütz, Anja; Schubert, Torsten
2015-01-01
The psychological refractory period (PRP) paradigm is a dominant research tool in the literature on dual-task performance. In this paradigm a first and second component task (i.e., Task 1 and Task 2) are presented with variable stimulus onset asynchronies (SOAs) and priority to perform Task 1. The main indicator of dual-task impairment in PRP situations is an increasing Task 2-RT with decreasing SOAs. This impairment is typically explained with some task components being processed strictly sequentially in the context of the prominent central bottleneck theory. This assumption could implicitly suggest that processes of Task 1 are unaffected by Task 2 and bottleneck processing, i.e., decreasing SOAs do not increase reaction times (RTs) and error rates of the first task. The aim of the present review is to assess whether PRP dual-task studies included both RT and error data presentations and statistical analyses and whether studies including both data types (i.e., RTs and error rates) show data consistent with this assumption (i.e., decreasing SOAs and unaffected RTs and/or error rates in Task 1). This review demonstrates that, in contrast to RT presentations and analyses, error data is underrepresented in a substantial number of studies. Furthermore, a substantial number of studies with RT and error data showed a statistically significant impairment of Task 1 performance with decreasing SOA. Thus, these studies produced data that is not primarily consistent with the strong assumption that processes of Task 1 are unaffected by Task 2 and bottleneck processing in the context of PRP dual-task situations; this calls for a more careful report and analysis of Task 1 performance in PRP studies and for a more careful consideration of theories proposing additions to the bottleneck assumption, which are sufficiently general to explain Task 1 and Task 2 effects. PMID:25904890
On the importance of Task 1 and error performance measures in PRP dual-task studies.
Strobach, Tilo; Schütz, Anja; Schubert, Torsten
2015-01-01
The psychological refractory period (PRP) paradigm is a dominant research tool in the literature on dual-task performance. In this paradigm a first and second component task (i.e., Task 1 and Task 2) are presented with variable stimulus onset asynchronies (SOAs) and priority to perform Task 1. The main indicator of dual-task impairment in PRP situations is an increasing Task 2-RT with decreasing SOAs. This impairment is typically explained with some task components being processed strictly sequentially in the context of the prominent central bottleneck theory. This assumption could implicitly suggest that processes of Task 1 are unaffected by Task 2 and bottleneck processing, i.e., decreasing SOAs do not increase reaction times (RTs) and error rates of the first task. The aim of the present review is to assess whether PRP dual-task studies included both RT and error data presentations and statistical analyses and whether studies including both data types (i.e., RTs and error rates) show data consistent with this assumption (i.e., decreasing SOAs and unaffected RTs and/or error rates in Task 1). This review demonstrates that, in contrast to RT presentations and analyses, error data is underrepresented in a substantial number of studies. Furthermore, a substantial number of studies with RT and error data showed a statistically significant impairment of Task 1 performance with decreasing SOA. Thus, these studies produced data that is not primarily consistent with the strong assumption that processes of Task 1 are unaffected by Task 2 and bottleneck processing in the context of PRP dual-task situations; this calls for a more careful report and analysis of Task 1 performance in PRP studies and for a more careful consideration of theories proposing additions to the bottleneck assumption, which are sufficiently general to explain Task 1 and Task 2 effects.
Higgins, Guy A; Silenieks, Leo B; Altherr, Everett B; MacMillan, Cam; Fletcher, Paul J; Pratt, Wayne E
2016-07-01
The 5-HT2C receptor agonist lorcaserin (Belviq®) has been approved by the FDA for the treatment of obesity. Impulsivity is a contributory feature of some eating disorders. Experiments investigated the effect of lorcaserin and the highly selective 5-HT2C agonist CP-809101 on measures of impulsivity and on reinstatement of food-seeking behaviour, a model of dietary relapse. The effect of both drugs on 22-h deprivation-induced feeding was also examined, as was the effect of prefeeding in each impulsivity test. Lorcaserin (0.3-0.6 mg/kg SC) and CP-809101 (0.6-1 mg/kg SC) reduced premature responding in rats trained on the 5-CSRTT and improved accuracy in a Go-NoGo task by reducing false alarms. At equivalent doses, both drugs also reduced reinstatement for food-seeking behaviour. Neither drug altered impulsive choice measured in a delay-discounting task. Lorcaserin (1-3 mg/kg SC) and CP-809101 (3-6 mg/kg SC) reduced deprivation-induced feeding but only at higher doses. These results suggest that in addition to previously reported effects on satiety and reward, altered impulse control may represent a contributory factor to the anti-obesity property of 5-HT2C receptor agonists. Lorcaserin may promote weight loss by improving adherence to dietary regimens in individuals otherwise prone to relapse and may be beneficial in cases where obesity is associated with eating disorders tied to impulsive traits, such as binge eating disorder.
Task Force Report 4. Report of the Task Force on Marketing and Communications
Dickinson, John C.; Evans, Kenneth L.; Carter, Jan; Burke, Kevin
2004-01-01
BACKGROUND To ensure the success of the proposed New Model of family medicine and to create a better understanding of the nature and role of family medicine, an effective communications plan must be developed and implemented. This Future of Family Medicine task force report proposes strategies for communicating the role of family physicians within medicine, as well as to purchasers, consumers, and other entities. METHODS After reviewing the findings from the research conducted for the Future of Family Medicine project, the task force presents a preliminary brand-positioning strategy for family medicine messages. Based on this strategy, the task force identifies 5 major audiences to which family medicine communications should be directed. A consistent method was used to determine optimum strategies to address each audience: defining the audience, assessing the literature and other pertinent evidence, identifying the communication objectives, determining the key messages, developing brand promises, and proposing strategies and tactics to support the messages and objectives. Preliminary communications plans are then presented for each of the 5 target audiences. MAJOR FINDINGS It is important that the organizations involved in family medicine make a multiyear commitment of resources to implement and support an aggressive communications strategy, which is based on key messages to target audiences. A concerted effort is particularly needed to address the declining interest among medical students in the specialty. Implementing a comprehensive family medicine career development program may be one effective strategy to reverse this trend. To help eliminate the current confusion among the public regarding family medicine and to promote clarity and consistency in terminology, the specialty should replace the name family practice with family medicine and a new graphic symbol for the discipline of family medicine should be developed. CONCLUSION As a discipline, family medicine
Tasks of physicists and graduated engineers in diagnostic radiology
International Nuclear Information System (INIS)
Angerstein, W.
1987-01-01
The tasks of physicists and engineers in diagnostic radiology are compiled and trends of development are discussed. Specific duties can be selected from these tasks for each department and physicist individually. An attempt is made to characterize the specific tasks of medical physics. The most important tasks are concerning subjects of (1) investment planning, (2) quality control and quality assurance, (3) service and maintenance, (4) radiation protection and electrical safety, (5) development, testing and adaption of equipment, (6) assistance in running the radiologic department, (7) research, (8) pre- and postgraduate training, (9) educational training, (10) miscellaneous. (author)
Impact of Ni promotion on the hydrogenation pathways of phenanthrene on MoS 2 /γ-Al 2 O 3
Energy Technology Data Exchange (ETDEWEB)
Schachtl, Eva; Yoo, Jong Suk; Gutiérrez, Oliver Y.; Studt, Felix; Lercher, Johannes A.
2017-08-01
The reaction network and elementary steps of the hydrogenation of phenanthrene are explored on parent and Ni-promoted MoS2/c-Al2O3. Two pathways were identified, i.e., Path 1: Phenanthrene _ 9,10-dihydrophenanthrene (DiHPhe)?1,2,3,4,4a,9,10,10a-octahydro-phenanthrene (asymOHPhe), and Path 2: Phenanthrene ?1,2,3,4-tetrahydrophenanthrene (TetHPhe)?1,2,3,4,5,6,7,8-octahydrophenan threne. The steps TetHPhe?asymOHPhe (hydrogenation), and DiHPhe?TetHPhe (hydrogenationisomerization) become notable at phenanthrene conversions above 20%. The reaction preferentially proceeds via Path 1 (90% selectivity) on MoS2/Al2O3. Ni promotion (Ni/(Ni + Mo) molar ratio of 0.3 at the edges on MoS2) increases the hydrogenation activity per active edge twofold and leads to 50% selectivity to both pathways. The reaction orders in H2 vary from _0.8 on MoS2/Al2O3 to _1.2 on Ni-MoS2/Al2O3, whereas the reaction orders in phenanthrene (_0.6) hardly depend on Ni promotion. The reaction orders in H2S are zero on MoS2/Al2O3 and slightly negative on Ni-MoS2/Al2O3. DFT calculations indicate that phenanthrene is preferentially adsorbed parallel to the basal planes, while H is located at the edges perpendicular to the basal planes. Theory also suggests that Ni atoms, incorporated preferentially on the S-edges, increase the stability of hydrogenated intermediates. Hydrogenation of phenanthrene proceeds through quasi-equilibrated adsorption of the reactants followed by consecutive addition of hydrogen pairs to the adsorbed hydrocarbon. The rate determining steps for the formation of DiHPhe and TetHPhe are the addition of the first and second hydrogen pair, respectively. The concentration of SH groups (activated H at the edges) increases with Ni promotion linearly correlating the rates of Path 1 and Path 2, albeit with different functions. The enhancing effect of Ni on Path 2 is attributed to accelerated hydrogen addition to adsorbed hydrocarbons without important changes in their coverages.
Task-Based Language Teaching for Beginner-Level Learners of L2 French: An Exploratory Study
Erlam, Rosemary; Ellis, Rod
2018-01-01
This study investigated the effect of input-based tasks on the acquisition of vocabulary and grammar by beginner-level learners of L2 French and reported the introduction of task-based teaching as an innovation in a state secondary school. The experimental group (n = 19) completed a series of focused input-based language tasks, taught by their…
Directory of Open Access Journals (Sweden)
Ling Yang
2013-01-01
Full Text Available Abstract Background To evaluate the promoter methylation status of MUC2 gene and mRNA expression in patients with hepatocellular carcinoma. Methods We analyzed MUC2 methylation by MSP, and MUC2 mRNA by real-time PCR in 74 HCC. Results MUC2 mRNA were lower in HCC tissues (Mean -ΔCt = −4.70 than that in Non-HCC tissues (Mean -ΔCt = −2.98. Expression of MUC2 was elevated in only 23 (31.08% of the 74 HCC patients. MUC2 promoter was hypermethylated in 62.2% (46/74 of HCCs, and in only 18.9% (14/74 of non-tumor samples. MUC2 mRNA were lower in HCC patients with hypermethylation (Mean -ΔΔCt = −2.25 than those with demethylation (Mean -ΔΔCt = −0.22, and there is a decreased tendency for MUC2 mRNA in HCC patients with promoter hypermethylation (p = 0.011. There was a significantly correlation found between MUC2 mRNA and HBV and AFP in HCC. The loss of MUC2 mRNA and hypermethylation could be poor prognostic factors. After treated by 5-Aza-CdR and TSA, we found that MUC2 mRNA induced significantly in 7721, Huh7 and HepG2 cells. Conclusion The results suggested that MUC2 mRNA silenced by promoter hypermethylation is associated with high levels HBV in HCC.
Meneses, Alfredo
2003-01-01
Recent studies using both invertebrates and mammals have revealed that endogenous serotonin (5-hydroxytryptamine [5-HT]) modulates plasticity processes, including learning and memory. However, little is currently known about the mechanisms, loci, or time window of the actions of 5-HT. The aim of this review is to discuss some recent results on the effects of systemic administration of selective agonists and antagonists of 5-HT on associative learning in a Pavlovian/instrumental autoshaping (P/I-A) task in rats. The results indicate that pharmacological manipulation of 5-HT1-7 receptors or 5-HT reuptake sites might modulate memory consolidation, which is consistent with the emerging notion that 5-HT plays a key role in memory formation. PMID:14557609
On the importance of Task 1 and error performance measures in PRP dual-task studies
Directory of Open Access Journals (Sweden)
Tilo eStrobach
2015-04-01
Full Text Available The Psychological Refractory Period (PRP paradigm is a dominant research tool in the literature on dual-task performance. In this paradigm a first and second component task (i.e., Task 1 and 2 are presented with variable stimulus onset asynchronies (SOAs and priority to perform Task 1. The main indicator of dual-task impairment in PRP situations is an increasing Task 2-RT with decreasing SOAs. This impairment is typically explained with some task components being processed strictly sequentially in the context of the prominent central bottleneck theory. This assumption could implicitly suggest that processes of Task 1 are unaffected by Task 2 and bottleneck processing, i.e. decreasing SOAs do not increase RTs and error rates of the first task. The aim of the present review is to assess whether PRP dual-task studies included both RT and error data presentations and statistical analyses and whether studies including both data types (i.e., RTs and error rates show data consistent with this assumption (i.e., decreasing SOAs and unaffected RTs and/ or error rates in Task 1. This review demonstrates that, in contrast to RT presentations and analyses, error data is underrepresented in a substantial number of studies. Furthermore, a substantial number of studies with RT and error data showed a statistically significant impairment of Task 1 performance with decreasing SOA. Thus, these studies produced data that is not primarily consistent with the strong assumption that processes of Task 1 are unaffected by Task 2 and bottleneck processing in the context of PRP dual-task situations; this calls for a more careful report and analysis of Task 1 performance in PRP studies and for a more careful consideration of theories proposing additions to the bottleneck assumption, which are sufficiently general to explain Task 1 and Task 2 effects.
HMGA2 promotes adipogenesis by activating C/EBPβ-mediated expression of PPARγ
Energy Technology Data Exchange (ETDEWEB)
Xi, Yang; Shen, Wanjing; Ma, Lili; Zhao, Ming; Zheng, Jiachen [Diabetes Center, and Zhejiang Provincial Key Laboratory of Pathophysiology, Institute of Biochemistry and Molecular Biology, School of Medicine, Ningbo University, Ningbo 315211 (China); Bu, Shizhong, E-mail: bushizhong@nbu.edu.cn [Diabetes Center, and Zhejiang Provincial Key Laboratory of Pathophysiology, Institute of Biochemistry and Molecular Biology, School of Medicine, Ningbo University, Ningbo 315211 (China); Hino, Shinjiro [Department of Medical Cell Biology, Institute of Molecular Embryology and Genetics, Kumamoto University, Kumamoto, 860-0811 (Japan); Nakao, Mitsuyoshi, E-mail: mnakao@gpo.kumamoto-u.ac.jp [Department of Medical Cell Biology, Institute of Molecular Embryology and Genetics, Kumamoto University, Kumamoto, 860-0811 (Japan); Core Research for Evolutional Science and Technology (CREST), Japan Agency for Medical Research and Development, Tokyo (Japan)
2016-04-15
Adipogenesis is orchestrated by a highly ordered network of transcription factors including peroxisome-proliferator activated receptor-gamma (PPARγ) and CCAAT-enhancer binding protein (C/EBP) family proteins. High mobility group protein AT-hook 2 (HMGA2), an architectural transcription factor, has been reported to play an essential role in preadipocyte proliferation, and its overexpression has been implicated in obesity in mice and humans. However, the direct role of HMGA2 in regulating the gene expression program during adipogenesis is not known. Here, we demonstrate that HMGA2 is required for C/EBPβ-mediated expression of PPARγ, and thus promotes adipogenic differentiation. We observed a transient but marked increase of Hmga2 transcript at an early phase of differentiation of mouse 3T3-L1 preadipocytes. Importantly, Hmga2 knockdown greatly impaired adipocyte formation, while its overexpression promoted the formation of mature adipocytes. We found that HMGA2 colocalized with C/EBPβ in the nucleus and was required for the recruitment of C/EBPβ to its binding element at the Pparγ2 promoter. Accordingly, HMGA2 and C/EBPβ cooperatively enhanced the Pparγ2 promoter activity. Our results indicate that HMGA2 is an essential constituent of the adipogenic transcription factor network, and thus its function may be affected during the course of obesity. - Highlights: • Overexpression of HMGA2 has been implicated in obesity in mice and humans. • HMGA2 is required for adipocyte formation. • HMGA2 colocalizes with C/EBPβ and is required for C/EBPβ recruitment to Pparγ2 promoter. • HMGA2 and C/EBPβ cooperatively enhance the Pparγ2 promoter activity.
HMGA2 promotes adipogenesis by activating C/EBPβ-mediated expression of PPARγ
International Nuclear Information System (INIS)
Xi, Yang; Shen, Wanjing; Ma, Lili; Zhao, Ming; Zheng, Jiachen; Bu, Shizhong; Hino, Shinjiro; Nakao, Mitsuyoshi
2016-01-01
Adipogenesis is orchestrated by a highly ordered network of transcription factors including peroxisome-proliferator activated receptor-gamma (PPARγ) and CCAAT-enhancer binding protein (C/EBP) family proteins. High mobility group protein AT-hook 2 (HMGA2), an architectural transcription factor, has been reported to play an essential role in preadipocyte proliferation, and its overexpression has been implicated in obesity in mice and humans. However, the direct role of HMGA2 in regulating the gene expression program during adipogenesis is not known. Here, we demonstrate that HMGA2 is required for C/EBPβ-mediated expression of PPARγ, and thus promotes adipogenic differentiation. We observed a transient but marked increase of Hmga2 transcript at an early phase of differentiation of mouse 3T3-L1 preadipocytes. Importantly, Hmga2 knockdown greatly impaired adipocyte formation, while its overexpression promoted the formation of mature adipocytes. We found that HMGA2 colocalized with C/EBPβ in the nucleus and was required for the recruitment of C/EBPβ to its binding element at the Pparγ2 promoter. Accordingly, HMGA2 and C/EBPβ cooperatively enhanced the Pparγ2 promoter activity. Our results indicate that HMGA2 is an essential constituent of the adipogenic transcription factor network, and thus its function may be affected during the course of obesity. - Highlights: • Overexpression of HMGA2 has been implicated in obesity in mice and humans. • HMGA2 is required for adipocyte formation. • HMGA2 colocalizes with C/EBPβ and is required for C/EBPβ recruitment to Pparγ2 promoter. • HMGA2 and C/EBPβ cooperatively enhance the Pparγ2 promoter activity.
Task-set inertia and memory-consolidation bottleneck in dual tasks.
Koch, Iring; Rumiati, Raffaella I
2006-11-01
Three dual-task experiments examined the influence of processing a briefly presented visual object for deferred verbal report on performance in an unrelated auditory-manual reaction time (RT) task. RT was increased at short stimulus-onset asynchronies (SOAs) relative to long SOAs, showing that memory consolidation processes can produce a functional processing bottleneck in dual-task performance. In addition, the experiments manipulated the spatial compatibility of the orientation of the visual object and the side of the speeded manual response. This cross-task compatibility produced relative RT benefits only when the instruction for the visual task emphasized overlap at the level of response codes across the task sets (Experiment 1). However, once the effective task set was in place, it continued to produce cross-task compatibility effects even in single-task situations ("ignore" trials in Experiment 2) and when instructions for the visual task did not explicitly require spatial coding of object orientation (Experiment 3). Taken together, the data suggest a considerable degree of task-set inertia in dual-task performance, which is also reinforced by finding costs of switching task sequences (e.g., AC --> BC vs. BC --> BC) in Experiment 3.
Identiifcation and validation of root-speciifc promoters in rice
Institute of Scientific and Technical Information of China (English)
HUANG Li-yu; ZHANG Fan; QIN Qiao; WANG Wen-sheng; ZHANG Ting; FU Bin-ying
2015-01-01
Novel promoters that confer root-speciifc expression would be useful for engineering resistance against problems of nutrient and water absorption by roots. In this study, the reverse transcriptase polymerase chain reaction was used to identify seven genes with root-speciifc expression in rice. The isolation and characterization of upstream promoter regions of ifve selected genes rice root-speciifc promoter (rRSP) 1 to 5 (rRSP1-rRSP5) and A2P (the promoter ofOsAct2) revealed that rRSP1, rRSP3, and rRSP5 are particularly important with respect to root-speciifc activities. Furthermore, rRSP1, rRSP3, and rRSP5 were observed to make different contributions to root activities in various species. These three promoters could be used for root-speciifc enhancement of target gene(s).
SALES PROMOTION, A SUGGESTED ADULT DISTRIBUTIVE EDUCATION COURSE OUTLINE.
RUBIN, ALAN J.; AND OTHERS
THIS SUGGESTED OUTLINE FOR A BASIC COURSE IN SALES PROMOTION IS DESIGNED FOR NOT LESS THAN FIVE 2-HOUR SESSIONS ON (1) ASPECTS OF SALES PROMOTION, (2) SALES PROMOTION TECHNIQUES, (3) NEWSPAPER ADVERTISING, (4) WINDOW AND INTERIOR DISPLAY PRINCIPLES, AND (5) SELECTED PROMOTIONAL MEDIA AND DEVICES. POSSIBLE TEACHERS INCLUDE A SALES PROMOTION…
Task analysis methods applicable to control room design review (CDR)
International Nuclear Information System (INIS)
Moray, N.P.; Senders, J.W.; Rhodes, W.
1985-06-01
This report presents the results of a research study conducted in support of the human factors engineering program of the Atomic Energy Control Board in Canada. It contains five products which may be used by the Atomic Enegy Control Board in relation to Task Analysis of jobs in CANDU nuclear power plants: 1. a detailed method for preparing for a task analysis; 2. a Task Data Form for recording task analysis data; 3. a detailed method for carrying out task analyses; 4. a guide to assessing alternative methods for performing task analyses, if such are proposed by utilities or consultants; and 5. an annotated bibliography on task analysis. In addition, a short explanation of the origins, nature and uses of task analysis is provided, with some examples of its cost effectiveness. 35 refs
2015-07-01
This report includes fulfillment of Task 3.2 of a multi-task contract to further enhance concrete filled FRP tubes, or : the Bridge in a Backpack. Task 3 is an investigation of soil-structure interaction for the FRP tubes. Task 3.2 is the : modeling ...
Cloud Computing Task Scheduling Based on Cultural Genetic Algorithm
Directory of Open Access Journals (Sweden)
Li Jian-Wen
2016-01-01
Full Text Available The task scheduling strategy based on cultural genetic algorithm(CGA is proposed in order to improve the efficiency of task scheduling in the cloud computing platform, which targets at minimizing the total time and cost of task scheduling. The improved genetic algorithm is used to construct the main population space and knowledge space under cultural framework which get independent parallel evolution, forming a mechanism of mutual promotion to dispatch the cloud task. Simultaneously, in order to prevent the defects of the genetic algorithm which is easy to fall into local optimum, the non-uniform mutation operator is introduced to improve the search performance of the algorithm. The experimental results show that CGA reduces the total time and lowers the cost of the scheduling, which is an effective algorithm for the cloud task scheduling.
Overview of the interactive task in BioCreative V.
Wang, Qinghua; S Abdul, Shabbir; Almeida, Lara; Ananiadou, Sophia; Balderas-Martínez, Yalbi I; Batista-Navarro, Riza; Campos, David; Chilton, Lucy; Chou, Hui-Jou; Contreras, Gabriela; Cooper, Laurel; Dai, Hong-Jie; Ferrell, Barbra; Fluck, Juliane; Gama-Castro, Socorro; George, Nancy; Gkoutos, Georgios; Irin, Afroza K; Jensen, Lars J; Jimenez, Silvia; Jue, Toni R; Keseler, Ingrid; Madan, Sumit; Matos, Sérgio; McQuilton, Peter; Milacic, Marija; Mort, Matthew; Natarajan, Jeyakumar; Pafilis, Evangelos; Pereira, Emiliano; Rao, Shruti; Rinaldi, Fabio; Rothfels, Karen; Salgado, David; Silva, Raquel M; Singh, Onkar; Stefancsik, Raymund; Su, Chu-Hsien; Subramani, Suresh; Tadepally, Hamsa D; Tsaprouni, Loukia; Vasilevsky, Nicole; Wang, Xiaodong; Chatr-Aryamontri, Andrew; Laulederkind, Stanley J F; Matis-Mitchell, Sherri; McEntyre, Johanna; Orchard, Sandra; Pundir, Sangya; Rodriguez-Esteban, Raul; Van Auken, Kimberly; Lu, Zhiyong; Schaeffer, Mary; Wu, Cathy H; Hirschman, Lynette; Arighi, Cecilia N
2016-01-01
Fully automated text mining (TM) systems promote efficient literature searching, retrieval, and review but are not sufficient to produce ready-to-consume curated documents. These systems are not meant to replace biocurators, but instead to assist them in one or more literature curation steps. To do so, the user interface is an important aspect that needs to be considered for tool adoption. The BioCreative Interactive task (IAT) is a track designed for exploring user-system interactions, promoting development of useful TM tools, and providing a communication channel between the biocuration and the TM communities. In BioCreative V, the IAT track followed a format similar to previous interactive tracks, where the utility and usability of TM tools, as well as the generation of use cases, have been the focal points. The proposed curation tasks are user-centric and formally evaluated by biocurators. In BioCreative V IAT, seven TM systems and 43 biocurators participated. Two levels of user participation were offered to broaden curator involvement and obtain more feedback on usability aspects. The full level participation involved training on the system, curation of a set of documents with and without TM assistance, tracking of time-on-task, and completion of a user survey. The partial level participation was designed to focus on usability aspects of the interface and not the performance per se In this case, biocurators navigated the system by performing pre-designed tasks and then were asked whether they were able to achieve the task and the level of difficulty in completing the task. In this manuscript, we describe the development of the interactive task, from planning to execution and discuss major findings for the systems tested.Database URL: http://www.biocreative.org. Published by Oxford University Press 2016. This work is written by US Government employees and is in the public domain in the US.
Self-Controlled Feedback for a Complex Motor Task
Directory of Open Access Journals (Sweden)
Wolf Peter
2011-12-01
Full Text Available Self-controlled augmented feedback enhances learning of simple motor tasks. Thereby, learners tend to request feedback after trials that were rated as good by themselves. Feedback after good trials promotes positive reinforcement, which enhances motor learning. The goal of this study was to investigate when naïve learners request terminal visual feedback in a complex motor task, as conclusions drawn on simple tasks can hardly be transferred to complex tasks. Indeed, seven of nine learners stated to have intended to request feedback predominantly after good trials, but in contrast to their intention, kinematic analysis showed that feedback was rather requested randomly (23% after good, 44% after intermediate, 33% after bad trials. Moreover, requesting feedback after good trials did not correlate with learning success. It seems that self-estimation of performance in complex tasks is challenging. As a consequence, learners might have focused on certain movement aspects rather than on the overall movement. Further studies should assess the current focus of the learner in detail to gain more insight in self-estimation capabilities during complex motor task learning.
Revealing driving factors of China's PM2.5 pollution
Zheng, Y.; Zhao, H.; Zhang, Q.; Geng, G.; Tong, D.; Peng, L.; He, K.
2017-12-01
China's rapid economic development and intensive energy consumption are deteriorating the air quality significantly. Understanding the key driving factors behind China's growing emissions of air pollutants and the accompanying PM2.5 pollution is critical for the development of China's clean air policies and also provides insight into how other emerging economies may develop a clear sky future. Here we reveal the socioeconomic drivers of the variations of China's PM2.5 concentrations during 2002-2012 by using an interdisciplinary framework that integrates an emission inventory model, an index decomposition analysis model, and a regional air quality model. The decomposition results demostrate that the improvements in emission efficiency and energy efficiency failed to offset the increased emissions of both primary PM2.5 and gaseous PM2.5 precursors (including SO2 NOx, and volatile organic compounds) triggered by the surging economic growth during 2002-2012. During the same time, the effects of energy structure, production structure and population growth were relatively less significant to all pollutants, which indicates the potential of large emission abatements through energy structure and production structure adjustment. Sensitivity simulations by the air quality model based on the provincial decomposition results also show that the economic growth have outpaced efficiency improvements in the increments of PM2.5 concentrations during the study years. As China continues to develop rapidly, future policies should promote further improvements in efficiency and accelerate the adjustments toward clean energy and production structures, which are critical for reducing China's emissions and alleviating the severe PM2.5 pollution.
Task Repetition Effects on L1 Use in EFL Child Task-Based Interaction
Azkarai, Agurtzane; García Mayo, María del Pilar
2017-01-01
Research has shown that tasks provide second language (L2) learners with many opportunities to learn the L2. Task repetition has been claimed to benefit L2 learning since familiarity with procedure and/or content gives learners the chance to focus on more specific aspects of language. Most research on task repetition has focused on adult…
Lithium niobate bulk crystallization promoted by CO2 laser radiation
Ferreira, N. M.; Costa, F. M.; Nogueira, R. N.; Graça, M. P. F.
2012-09-01
The crystallization induced by laser radiation is a very promising technique to promote glass/ceramic transformation, being already used to produce crystalline patterns on glass surfaces. In this work, a SiO2-Li2O-Nb2O5 glass, prepared by the sol-gel route, was submitted to CO2 laser radiation and conventional heat-treatments in order to induce the LiNbO3 crystallization. The structure and morphology of the samples prepared by both routes was analyzed as a function of exposure time, radiation power and heat-treatment temperatures by XRD, Raman spectroscopy and SEM. The results reveal a correlation between the crystallization degree of LiNbO3 particles and glass matrix with the heat treatment type and experimental parameters. An heat-treatment at 650 °C/4 h was necessary to induce crystallization in heat treatments samples while 4 W/500 s was enough for laser radiation ones, corresponding a reduction time processing of ˜14 000 s.
2015-01-01
This report includes fulfillment of Task 2.3 of a multi-task contract to further enhance concrete filled FRP tubes, or : the Bridge in a Backpack. Task 2 is an investigation of alternative shapes for the FRP tubes with varying radii. Task : 2.3 explo...
International Nuclear Information System (INIS)
Loriaux, E.F.; Jehee, J.N.T.
1995-01-01
Report on CRP-OSS Task 4.1.1. ''Survey of existing documentation relevant to this programme's goals'' and report on CRP-OSS Task 4.1.2. ''Survey of existing Operator Support Systems and the experience with them'' are presented. 2 tabs
The promotion of work safety. A continuous task for the Swiss gas industry
International Nuclear Information System (INIS)
Luescher, H.J.
1993-01-01
The modern Western European population values the work safety very highly because of ethical and economical reasons. In Switzerland too, safety at work is actively promoted. Based on national legislation and on the SGWA-Association Statutes, the Swiss Gas Industry, with great engagement, promotes the measures for accident prevention. Following a general introduction into the legislative basis, possible ways and means for the promotion of safety at work are described. Subsequently, the concrete activities of the Gas Supply Authorities and the SGWA are pointed out, followed by a description of the future work-safety programmes of the Swiss Gas Industry. (orig.) [de
[The Role of 5-Aza-CdR on Methylation of Promoter in RASSF1A Gene in Endometrial Carcinoma].
Huang, Li-ping; Chen, Chen; Wang, Xue-ping; Liu, Hui
2015-05-01
To explore the effect of demethylating drug 5-Aza-2'-deoxycytidine (5-Aza-CdR) on methtylation status of the Ras-association domain familylA gene (RASSF1A) in human endometrial carcinoma. Randomly'assign the human endometrial carcinoma cell line HEC-1-B into groups and use demethylating drug 5-Aza-CdR of different concentration to treat them. Then Methylation-specific polymerase chain reaction (MSP), real-time PCR, Western blot, TUNEL technology were used to analyze methylation status of RASSF1A promoter CpG islands, RASSF1A mRNA expression, RASSF1A protein expression and apoptosis of HEC-1-B cell. High DNA methylation in RASSF1A gene promoter region, low RASSF1A mRNA level and protein expression and out of control of human endometrial carcinoma cell HEC-1-B apoptosis were observed. 5-Aza-CdR of different concentration could reverse RASSF1A gene's methylation status, recover the expression of mRNA and protein, and control the growth of HEC-1-B by inducing apoptosis. Aberrant methylation of RASSF1A in endometrial cancer as a therapeutic target, demethylating agent 5-Aza-CdR could be an effective way of gene therapy.
International Nuclear Information System (INIS)
Arpiainen, Satu; Jaervenpaeae, Sanna-Mari; Manninen, Aki; Viitala, Pirkko; Lang, Matti A.; Pelkonen, Olavi; Hakkola, Jukka
2008-01-01
The nutritional state of organisms and energy balance related diseases such as diabetes regulate the metabolism of xenobiotics such as drugs, toxins and carcinogens. However, the mechanisms behind this regulation are mostly unknown. The xenobiotic-metabolizing cytochrome P450 (CYP) 2A5 enzyme has been shown to be induced by fasting and by glucagon and cyclic AMP (cAMP), which mediate numerous fasting responses. Peroxisome proliferator-activated receptor γ coactivator (PGC)-1α triggers many of the important hepatic fasting effects in response to elevated cAMP levels. In the present study, we were able to show that cAMP causes a coordinated induction of PGC-1α and CYP2A5 mRNAs in murine primary hepatocytes. Furthermore, the elevation of the PGC-1α expression level by adenovirus mediated gene transfer increased CYP2A5 transcription. Co-transfection of Cyp2a5 5' promoter constructs with the PGC-1α expression vector demonstrated that PGC-1α is able to activate Cyp2a5 transcription through the hepatocyte nuclear factor (HNF)-4α response element in the proximal promoter of the Cyp2a5 gene. Chromatin immunoprecipitation assays showed that PGC-1α binds, together with HNF-4α, to the same region at the Cyp2a5 proximal promoter. In conclusion, PGC-1α mediates the expression of CYP2A5 induced by cAMP in mouse hepatocytes through coactivation of transcription factor HNF-4α. This strongly suggests that PGC-1α is the major factor mediating the fasting response of CYP2A5
The Usage of Web 2.0 as a Media Promotion in Indonesia University Libraries
Directory of Open Access Journals (Sweden)
Nove E. Variant Anna
2015-04-01
Full Text Available The usage of web 2.0 has become popular among young people in Indonesia. One of the purpose of using web 2.0 is for promotion in some university libraries. The emerging of the web 2.0 as promotional media is corelating with the development of digital library. The paper aims are (1 to describe the usage of web 2.0 for academic libraries promotion. (2 to describe the information / content of those web 2.0. (3 to describe the promotion activity through web 2.0. This research population is all university libraries in Indonesia, but only 40 university libraries that conduct promotion through web 2.0. The website observation is done between May-July 2013. The research results are (1 the university libraries in Indonesia are use facebook, twitter, and flicker to promote library programs and interaction with users. The web 2.0 consist of information about new book release, user education, general information about library services, and information literacy. (3 some of univerity libraries taking seriously and actively promote their library services, but some of them are don’t use the web 2.0.
The Usage of Web 2.0 as a Media Promotion in Indonesia University Libraries
Directory of Open Access Journals (Sweden)
Nove E. Variant Anna
2018-01-01
Full Text Available The usage of web 2.0 has become popular among young people in Indonesia. One of the purpose of using web 2.0 is for promotion in some university libraries. The emerging of the web 2.0 as promotional media is corelating with the development of digital library. The paper aims are (1 to describe the usage of web 2.0 for academic libraries promotion. (2 to describe the information / content of those web 2.0. (3 to describe the promotion activity through web 2.0. This research population is all university libraries in Indonesia, but only 40 university librraries that conduct promotion through web 2.0. The website observation is done between May-July 2013. The research results are (1 the university libraries in Indonesia are use facebook, twitter, and flikr to promote library programs and interaction with users. The web 2.0 consist of information about new book release, user education, general information about library services, and information literacy. (3 some of univerity libraries taking seriously and actively promote their library services, but some of them are don’t use the web 2.0.
Energy Technology Data Exchange (ETDEWEB)
Starska, Katarzyna, E-mail: katarzyna.starska@umed.lodz.pl [I Department of Otolaryngology and Laryngological Oncology, Medical University of Łódź, Kopcinskiego 22, 90-153 Łódź (Poland); Krześlak, Anna; Forma, Ewa [Department of Cytobiochemistry, University of Łódź, Pomorska 142/143, 90-236 Łódź (Poland); Olszewski, Jurek [II Department of Otolaryngology and Laryngological Oncology, Medical University of Łódź, Żeromskiego 113, 90-549 Łódź (Poland); Morawiec-Sztandera, Alina [Department of Head and Neck Surgery, Medical University of Łódź, Paderewskiego 4, 93-509 Łódź (Poland); Aleksandrowicz, Paweł [Department of Otolaryngology and Laryngological Oncology, Medical University of Lublin, Jaczewskiego 8, 20-954 Lublin (Poland); Lewy-Trenda, Iwona [Department of Pathology, Medical University of Łódź, Pomorska 251, 92-213 Łódź (Poland); and others
2014-10-15
Metallothioneins (MTs) are low molecular weight, cysteine-rich heavy metal-binding proteins which participate in the mechanisms of Zn homeostasis, and protect against toxic metals. MTs contain metal-thiolate cluster groups and suppress metal toxicity by binding to them. The aim of this study was to determine the − 5 A/G (rs28366003) single-nucleotide polymorphism (SNP) in the core promoter region of the MT2A gene and to investigate its effect on allele-specific gene expression and Cd, Zn and Cu content in squamous cell laryngeal cancer (SCC) and non-cancerous laryngeal mucosa (NCM) as a control. The MT2A promoter region − 5 A/G SNP was determined by restriction fragment length polymorphism using 323 SCC and 116 NCM. MT2A gene analysis was performed by quantitative real-time PCR. The frequency of A allele carriage was 94.2% and 91.8% in SCC and NCM, respectively, while G allele carriage was detected in 5.8% and 8.2% of SCC and NCM samples, respectively. As a result, a significant association was identified between the − 5 A/G SNP in the MT2A gene with mRNA expression in both groups. Metal levels were analyzed by flame atomic absorption spectrometry. The significant differences were identified between A/A and both the A/G and G/G genotypes, with regard to the concentration of the contaminating metal. The Spearman rank correlation results showed that the MT2A expression and Cd, Zn, Cu levels were negatively correlated. Results obtained in this study suggest that − 5 A/G SNP in MT2A gene may have an effect on allele-specific gene expression and accumulation of metal levels in laryngeal cancer. - Highlights: • MT2A gene expression and metal content in laryngeal cancer tissues • Association between SNP (rs28366003) and expression of MT2A • Significant associations between the SNP and Cd, Zn and Cu levels • Negative correlation between MT2A gene expression and Cd, Zn and Cu levels.
International Nuclear Information System (INIS)
Starska, Katarzyna; Krześlak, Anna; Forma, Ewa; Olszewski, Jurek; Morawiec-Sztandera, Alina; Aleksandrowicz, Paweł; Lewy-Trenda, Iwona
2014-01-01
Metallothioneins (MTs) are low molecular weight, cysteine-rich heavy metal-binding proteins which participate in the mechanisms of Zn homeostasis, and protect against toxic metals. MTs contain metal-thiolate cluster groups and suppress metal toxicity by binding to them. The aim of this study was to determine the − 5 A/G (rs28366003) single-nucleotide polymorphism (SNP) in the core promoter region of the MT2A gene and to investigate its effect on allele-specific gene expression and Cd, Zn and Cu content in squamous cell laryngeal cancer (SCC) and non-cancerous laryngeal mucosa (NCM) as a control. The MT2A promoter region − 5 A/G SNP was determined by restriction fragment length polymorphism using 323 SCC and 116 NCM. MT2A gene analysis was performed by quantitative real-time PCR. The frequency of A allele carriage was 94.2% and 91.8% in SCC and NCM, respectively, while G allele carriage was detected in 5.8% and 8.2% of SCC and NCM samples, respectively. As a result, a significant association was identified between the − 5 A/G SNP in the MT2A gene with mRNA expression in both groups. Metal levels were analyzed by flame atomic absorption spectrometry. The significant differences were identified between A/A and both the A/G and G/G genotypes, with regard to the concentration of the contaminating metal. The Spearman rank correlation results showed that the MT2A expression and Cd, Zn, Cu levels were negatively correlated. Results obtained in this study suggest that − 5 A/G SNP in MT2A gene may have an effect on allele-specific gene expression and accumulation of metal levels in laryngeal cancer. - Highlights: • MT2A gene expression and metal content in laryngeal cancer tissues • Association between SNP (rs28366003) and expression of MT2A • Significant associations between the SNP and Cd, Zn and Cu levels • Negative correlation between MT2A gene expression and Cd, Zn and Cu levels
5,5-Dimethyl-2-methylseleno-1,3,2-dioxaphosphorinan-2-one
Directory of Open Access Journals (Sweden)
Grzegorz Cholewinski
2010-04-01
Full Text Available The title compound, C6H13O3PSe, was obtained in the reaction of 5,5-dimethyl-2-oxo-2-seleno-1,3,2-dioxaphosphorinane potassium salt with methyl iodide. The selenomethyl group is in the axial position in relation to the six-membered dioxaphosphorinane ring.
Directory of Open Access Journals (Sweden)
Shawn K Acheson
Full Text Available Ethanol is well known to adversely affect frontal executive functioning, which continues to develop throughout adolescence and into young adulthood. This is also a developmental window in which ethanol is misused by a significant number of adolescents. We examined the effects of acute and chronic ethanol exposure during adolescence on behavioral inhibition and efficiency using a modified water maze task. During acquisition, rats were trained to find a stable visible platform onto which they could escape. During the test phase, the stable platform was converted to a visible floating platform (providing no escape and a new hidden platform was added in the opposite quadrant. The hidden platform was the only means of escape during the test phase. In experiment 1, adolescent animals received ethanol (1.0 g/kg 30 min before each session during the test phase. In experiment 2, adolescent animals received chronic intermittent ethanol (5.0 g/kg for 16 days (PND30 To PND46 prior to any training in the maze. At PND72, training was initiated in the same modified water maze task. Results from experiment 1 indicated that acute ethanol promoted behavioral disinhibition and inefficiency. Experiment 2 showed that chronic intermittent ethanol during adolescence appeared to have no lasting effect on behavioral disinhibition or new spatial learning during adulthood. However, chronic ethanol did promote behavioral inefficiency. In summary, results indicate that ethanol-induced promotion of perseverative behavior may contribute to the many adverse behavioral sequelae of alcohol intoxication in adolescents and young adults. Moreover, the long-term effect of adolescent chronic ethanol exposure on behavioral efficiency is similar to that observed after chronic exposure in humans.
Radogna, Flavia
2015-03-01
Extra-neurological functions of melatonin include control of the immune system and modulation of apoptosis. We previously showed that melatonin inhibits the intrinsic apoptotic pathway in leukocytes via stimulation of high affinity MT1/MT2 receptors, thereby promoting re-localization of the anti-apoptotic Bcl-2 protein to mitochondria. Here we show that Bcl-2 sequesters pro-apoptotic Bax into mitochondria in an inactive form after melatonin treatment, thus reducing cell propensity to apoptosis. Bax translocation and the anti-apoptotic effect of melatonin are strictly dependent on the presence of Bcl-2, and on the 5-lipoxygenase (5-LOX) metabolite 5-hydroxyeicosatetraenoic acid (5-HETE), which we have previously shown to be produced as a consequence of melatonin binding to its low affinity target calmodulin. Therefore, the anti-apoptotic effect of melatonin requires the simultaneous, independent interaction with high (MT1/MT2) and low (calmodulin) affinity targets, eliciting two independent signal transduction pathways converging into Bax sequestration and inactivation. MT1/MT2 vs. lipoxygenase pathways are activated by 10-9 vs. 10-5M melatonin, respectively; the anti-apoptotic effect of melatonin is achieved at 10-5M, but drops to 10-9M upon addition of exogenous 5-HETE, revealing that lipoxygenase activation is the rate-limiting pathway. Therefore, in areas of inflammation with increased 5-HETE levels, physiological nanomolar concentrations of melatonin may suffice to maintain leukocyte viability.
International Nuclear Information System (INIS)
Tong, Joanna H; Lo, Kwok W; To, Ka F; Ng, David C; Chau, Shuk L; So, Ken K; Leung, Patrick P; Lee, Tin L; Lung, Raymond W; Chan, Michael W; Chan, Anthony W
2010-01-01
Human Disabled-2 (DAB2), is a multi-function signalling molecule that it is frequently down-regulated in human cancers. We aimed to investigate the possible tumour suppressor effect of DAB2 in nasopharyngeal carcinoma (NPC). We studied the expression of DAB2 in NPC cell lines, xenografts and primary tumour samples. The status of promoter methylation was assessed by methylation specific PCR and bisulfite sequencing. The functional role of DAB2 in NPC was investigated by re-introducing DAB2 expression into NPC cell line C666-1. Decrease or absent of DAB2 transcript was observed in NPC cell lines and xenografts. Loss of DAB2 protein expression was seen in 72% (33/46) of primary NPC as demonstrated by immunohistochemistry. Aberrant DAB2 promoter methylation was detected in 65.2% (30/46) of primary NPC samples by methylation specific PCR. Treatment of the DAB2 negative NPC cell line C666-1 with 5-aza-2'-deoxycytidine resulted in restoration of DAB2 expression in a dose-dependent manner. Overexpression of DAB2 in NPC cell line C666-1 resulted in reduced growth rate and 35% reduction in anchorage-dependent colony formation, and inhibition of serum-induced c-Fos expression compared to vector-transfected controls. Over expression of DAB2 resulted in alterations of multiple pathways as demonstrated by expression profiling and functional network analysis, which confirmed the role of DAB2 as an adaptor molecule involved in multiple receptor-mediated signalling pathways. We report the frequent down regulation of DAB2 in NPC and the promoter hypermethylation contributes to the loss of expression of DAB2. This is the first study demonstrating frequent DAB2 promoter hypermethylation in human cancer. Our functional studies support the putative tumour suppressor effect of DAB2 in NPC cells
Directory of Open Access Journals (Sweden)
Rosenbaum Joel L
2011-01-01
Full Text Available Abstract Background Chlamydomonas reinhardtii is a model system for the biology of unicellular green algae. Chemically regulated promoters, such as the nickel-inducible CYC6 or the low CO2-inducible CAH1 promoter, may prove useful for expressing, at precise times during its cell cycle, proteins with relevant biological functions, or complementing mutants in genes encoding such proteins. To this date, this has not been reported for the above promoters. Results We fused the CYC6 and CAH1 promoters to an HA-tagged RSP3 gene, encoding a protein of the flagellar radial spoke complex. The constructs were used for chemically regulated complementation of the pf14 mutant, carrying an ochre mutation in the RSP3 gene. 7 to 8% of the transformants showed cells with restored motility after induction with nickel or transfer to low CO2 conditions, but not in non-inducing conditions. Maximum complementation (5% motile cells was reached with very different kinetics (5-6 hours for CAH1, 48 hours for CYC6. The two inducible promoters drive much lower levels of RSP3 protein expression than the constitutive PSAD promoter, which shows almost complete rescue of motility. Conclusions To our knowledge, this is the first example of the use of the CYC6 or CAH1 promoters to perform a chemically regulated complementation of a Chlamydomonas mutant. Based on our data, the CYC6 and CAH1 promoters should be capable of fully complementing mutants in genes whose products exert their biological activity at low concentrations.
Cellular Interaction of Integrin α3β1 with Laminin 5 Promotes Gap Junctional Communication
Lampe, Paul D.; Nguyen, Beth P.; Gil, Susana; Usui, Marcia; Olerud, John; Takada, Yoshikazu; Carter, William G.
1998-01-01
Wounding of skin activates epidermal cell migration over exposed dermal collagen and fibronectin and over laminin 5 secreted into the provisional basement membrane. Gap junctional intercellular communication (GJIC) has been proposed to integrate the individual motile cells into a synchronized colony. We found that outgrowths of human keratinocytes in wounds or epibole cultures display parallel changes in the expression of laminin 5, integrin α3β1, E-cadherin, and the gap junctional protein connexin 43. Adhesion of keratinocytes on laminin 5, collagen, and fibronectin was found to differentially regulate GJIC. When keratinocytes were adhered on laminin 5, both structural (assembly of connexin 43 in gap junctions) and functional (dye transfer) assays showed a two- to threefold increase compared with collagen and five- to eightfold over fibronectin. Based on studies with immobilized integrin antibody and integrin-transfected Chinese hamster ovary cells, the interaction of integrin α3β1 with laminin 5 was sufficient to promote GJIC. Mapping of intermediate steps in the pathway linking α3β1–laminin 5 interactions to GJIC indicated that protein trafficking and Rho signaling were both required. We suggest that adhesion of epithelial cells to laminin 5 in the basement membrane via α3β1 promotes GJIC that integrates individual cells into synchronized epiboles. PMID:9852164
Multiple promoters and alternative splicing: Hoxa5 transcriptional complexity in the mouse embryo.
Directory of Open Access Journals (Sweden)
Yan Coulombe
2010-05-01
Full Text Available The genomic organization of Hox clusters is fundamental for the precise spatio-temporal regulation and the function of each Hox gene, and hence for correct embryo patterning. Multiple overlapping transcriptional units exist at the Hoxa5 locus reflecting the complexity of Hox clustering: a major form of 1.8 kb corresponding to the two characterized exons of the gene and polyadenylated RNA species of 5.0, 9.5 and 11.0 kb. This transcriptional intricacy raises the question of the involvement of the larger transcripts in Hox function and regulation.We have undertaken the molecular characterization of the Hoxa5 larger transcripts. They initiate from two highly conserved distal promoters, one corresponding to the putative Hoxa6 promoter, and a second located nearby Hoxa7. Alternative splicing is also involved in the generation of the different transcripts. No functional polyadenylation sequence was found at the Hoxa6 locus and all larger transcripts use the polyadenylation site of the Hoxa5 gene. Some larger transcripts are potential Hoxa6/Hoxa5 bicistronic units. However, even though all transcripts could produce the genuine 270 a.a. HOXA5 protein, only the 1.8 kb form is translated into the protein, indicative of its essential role in Hoxa5 gene function. The Hoxa6 mutation disrupts the larger transcripts without major phenotypic impact on axial specification in their expression domain. However, Hoxa5-like skeletal anomalies are observed in Hoxa6 mutants and these defects can be explained by the loss of expression of the 1.8 kb transcript. Our data raise the possibility that the larger transcripts may be involved in Hoxa5 gene regulation.Our observation that the Hoxa5 larger transcripts possess a developmentally-regulated expression combined to the increasing sum of data on the role of long noncoding RNAs in transcriptional regulation suggest that the Hoxa5 larger transcripts may participate in the control of Hox gene expression.
The effects of age on processing and storage in working memory span tasks and reading comprehension.
Schroeder, Paul J
2014-01-01
BACKGROUND/STUDY CONTEXT: Declines in verbal working memory span task performance have been associated with deficits in the language processing abilities of healthy older adults, but it is unclear how storage and processing contribute to this relationship. Moreover, recent studies of the psychometric properties of span measures in the general cognitive literature highlight the need for a critical reassessment of age-related differences in working memory task performance. Forty-two young (Mage = 19.45 years) and 42 older participants (Mage = 73.00 years) completed a series of neuropsychological screening measures, four memory span tasks (one-syllable word span, three-syllable word span, reading span, and sentence span), and a measure of reading comprehension. Each span measure was completed under self-paced and timed encoding conditions. A 2 (age) × 2 (task type) × 2 (encoding conditions) mixed-model design was used. (1) Age effects were reliable for both simple and complex span task performance; (2) limiting the available encoding time yielded lower recall scores across tasks and exacerbated age differences in simple span performance; and (3) both encoding condition and age affected the relationship between each of the span measures and the relationship between span and reading comprehension. Declines in both storage and processing abilities contributed to age differences in span task performance and the relationship between span and reading comprehension. Although older people appear to benefit from task administration protocols that promote successful memory encoding, researchers should be aware of the potential risks to validity posed by such accommodations.
International Nuclear Information System (INIS)
Asting, Annika Gustafsson; Carén, Helena; Andersson, Marianne; Lönnroth, Christina; Lagerstedt, Kristina; Lundholm, Kent
2011-01-01
Increased cyclooxygenase activity promotes progression of colorectal cancer, but the mechanisms behind COX-2 induction remain elusive. This study was therefore aimed to define external cell signaling and transcription factors relating to high COX-2 expression in colon cancer tissue. Tumor and normal colon tissue were collected at primary curative operation in 48 unselected patients. COX-2 expression in tumor and normal colon tissue was quantified including microarray analyses on tumor mRNA accounting for high and low tumor COX-2 expression. Cross hybridization was performed between tumor and normal colon tissue. Methylation status of up-stream COX-2 promoter region was evaluated. Tumors with high COX-2 expression displayed large differences in gene expression compared to normal colon. Numerous genes with altered expression appeared in tumors of high COX-2 expression compared to tumors of low COX-2. COX-2 expression in normal colon was increased in patients with tumors of high COX-2 compared to normal colon from patients with tumors of low COX-2. IL1β, IL6 and iNOS transcripts were up-regulated among external cell signaling factors; nine transcription factors (ATF3, C/EBP, c-Fos, Fos-B, JDP2, JunB, c-Maf, NF-κB, TCF4) showed increased expression and 5 (AP-2, CBP, Elk-1, p53, PEA3) were decreased in tumors with high COX-2. The promoter region of COX-2 gene did not show consistent methylation in tumor or normal colon tissue. Transcription and external cell signaling factors are altered as covariates to COX-2 expression in colon cancer tissue, but DNA methylation of the COX-2 promoter region was not a significant factor behind COX-2 expression in tumor and normal colon tissue
Directory of Open Access Journals (Sweden)
Lagerstedt Kristina
2011-06-01
Full Text Available Abstract Background Increased cyclooxygenase activity promotes progression of colorectal cancer, but the mechanisms behind COX-2 induction remain elusive. This study was therefore aimed to define external cell signaling and transcription factors relating to high COX-2 expression in colon cancer tissue. Method Tumor and normal colon tissue were collected at primary curative operation in 48 unselected patients. COX-2 expression in tumor and normal colon tissue was quantified including microarray analyses on tumor mRNA accounting for high and low tumor COX-2 expression. Cross hybridization was performed between tumor and normal colon tissue. Methylation status of up-stream COX-2 promoter region was evaluated. Results Tumors with high COX-2 expression displayed large differences in gene expression compared to normal colon. Numerous genes with altered expression appeared in tumors of high COX-2 expression compared to tumors of low COX-2. COX-2 expression in normal colon was increased in patients with tumors of high COX-2 compared to normal colon from patients with tumors of low COX-2. IL1β, IL6 and iNOS transcripts were up-regulated among external cell signaling factors; nine transcription factors (ATF3, C/EBP, c-Fos, Fos-B, JDP2, JunB, c-Maf, NF-κB, TCF4 showed increased expression and 5 (AP-2, CBP, Elk-1, p53, PEA3 were decreased in tumors with high COX-2. The promoter region of COX-2 gene did not show consistent methylation in tumor or normal colon tissue. Conclusions Transcription and external cell signaling factors are altered as covariates to COX-2 expression in colon cancer tissue, but DNA methylation of the COX-2 promoter region was not a significant factor behind COX-2 expression in tumor and normal colon tissue.
Increased Task Demand during Spatial Memory Testing Recruits the Anterior Cingulate Cortex
Carr, Joshua K.; Fournier, Neil M.; Lehmann, Hugo
2016-01-01
We examined whether increasing retrieval difficulty in a spatial memory task would promote the recruitment of the anterior cingulate cortex (ACC) similar to what is typically observed during remote memory retrieval. Rats were trained on the hidden platform version of the Morris Water Task and tested three or 30 d later. Retrieval difficulty was…
Fischer matrices of Dempwolff group $2^{5}{^{cdot}}GL(5,2$
Directory of Open Access Journals (Sweden)
Ayoub Basheer Mohammed Basheer
2012-12-01
Full Text Available In cite{Demp2} Dempwolff proved the existence of a group of theform $2^{5}{^{cdot}}GL(5,2$ (a non split extension of theelementary abelian group $2^{5}$ by the general linear group$GL(5,2$. This group is the second largest maximal subgroup of thesporadic Thompson simple group $mathrm{Th}.$ In this paper wecalculate the Fischer matrices of Dempwolff group $overline{G} =2^{5}{^{cdot}}GL(5,2.$ The theory of projective characters isinvolved and we have computed the Schur multiplier together with aprojective character table of an inertia factor group. The fullcharacter table of $overline{G}$ is then can be calculated easily.
Xing, Changsheng; Ci, Xinpei; Sun, Xiaodong; Fu, Xiaoying; Zhang, Zhiqian; Dong, Eric N; Hao, Zhao-Zhe; Dong, Jin-Tang
2014-11-01
Krüppel-like factor 5 (KLF5) regulates multiple biologic processes. Its function in tumorigenesis appears contradictory though, showing both tumor suppressor and tumor promoting activities. In this study, we examined whether and how Klf5 functions in prostatic tumorigenesis using mice with prostate-specific deletion of Klf5 and phosphatase and tensin homolog (Pten), both of which are frequently inactivated in human prostate cancer. Histologic analysis demonstrated that when one Pten allele was deleted, which causes mouse prostatic intraepithelial neoplasia (mPIN), Klf5 deletion accelerated the emergence and progression of mPIN. When both Pten alleles were deleted, which causes prostate cancer, Klf5 deletion promoted tumor growth, increased cell proliferation, and caused more severe morphologic and molecular alterations. Homozygous deletion of Klf5 was more effective than hemizygous deletion. Unexpectedly, while Pten deletion alone expanded basal cell population in a tumor as reported, Klf5 deletion in the Pten-null background clearly reduced basal cell population while expanding luminal cell population. Global gene expression profiling, pathway analysis, and experimental validation indicate that multiple mechanisms could mediate the tumor-promoting effect of Klf5 deletion, including the up-regulation of epidermal growth factor and its downstream signaling molecules AKT and ERK and the inactivation of the p15 cell cycle inhibitor. KLF5 also appears to cooperate with several transcription factors, including CREB1, Sp1, Myc, ER and AR, to regulate gene expression. These findings validate the tumor suppressor function of KLF5. They also yield a mouse model that shares two common genetic alterations with human prostate cancer-mutation/deletion of Pten and deletion of Klf5.
Energy Technology Data Exchange (ETDEWEB)
Xia, Jun [Department of Respiratory Medicine, The First Affiliated Hospital of Nanjing Medical University (China); Department of Respiratory Medicine, Jiangsu Provincial Hospital of Chinese Traditional Medicine (China); Wu, Xiaoyan; Yang, Yuyu; Zhao, Yuhao [Atherosclerosis Research Center, Key Laboratory of Cardiovascular Disease and Molecular Intervention, Department of Pathophysiology, Nanjing Medical University (China); Fang, Mingming [Jiangsu Jiankang Vocational Institute (China); Xie, Weiping, E-mail: wpxienjmu@gmail.com [Department of Respiratory Medicine, The First Affiliated Hospital of Nanjing Medical University (China); Wang, Hong, E-mail: hwangnjmu@gmail.com [Department of Respiratory Medicine, The First Affiliated Hospital of Nanjing Medical University (China); Xu, Yong [Atherosclerosis Research Center, Key Laboratory of Cardiovascular Disease and Molecular Intervention, Department of Pathophysiology, Nanjing Medical University (China)
2012-11-16
Highlights: Black-Right-Pointing-Pointer SIRT1 interacts with and deacetylates RFX5. Black-Right-Pointing-Pointer SIRT1 activation attenuates whereas SIRT1 inhibition enhances collagen repression by RFX5 in vascular smooth muscle cells. Black-Right-Pointing-Pointer SIRT1 promotes cytoplasmic localization and proteasomal degradation of RFX5 and cripples promoter recruitment of RFX5. Black-Right-Pointing-Pointer IFN-{gamma} represses SIRT1 expression in vascular smooth muscle cells. Black-Right-Pointing-Pointer SIRT1 agonist alleviates collagen repression by IFN-{gamma} in vascular smooth muscle cells. -- Abstract: Decreased expression of collagen by vascular smooth muscle cells (SMCs) within the atherosclerotic plaque contributes to the thinning of the fibrous cap and poses a great threat to plaque rupture. Elucidation of the mechanism underlying repressed collagen type I (COL1A2) gene would potentially provide novel solutions that can prevent rupture-induced complications. We have previously shown that regulatory factor for X-box (RFX5) binds to the COL1A2 transcription start site and represses its transcription. Here we report that SIRT1, an NAD-dependent, class III deacetylase, forms a complex with RFX5. Over-expression of SIRT1 or NAMPT, which synthesizes NAD+ to activate SIRT1, or treatment with the SIRT1 agonist resveratrol decreases RFX5 acetylation and disrupts repression of the COL1A2 promoter activity by RFX5. On the contrary, knockdown of SIRT1 or treatment with SIRT1 inhibitors induces RFX5 acetylation and enhances the repression of collagen transcription. SIRT1 antagonizes RFX5 activity by promoting its nuclear expulsion and proteasomal degradation hence dampening its binding to the COL1A2 promoter. The pro-inflammatory cytokine IFN-{gamma} represses COL1A2 transcription by down-regulating SIRT1 expression in SMCs. Therefore, our data have identified as novel pathway whereby SIRT1 maintains collagen synthesis in SMCs by modulating RFX5 activity.
Synthesis and Characterization of Ag-Modified V2O5 Photocatalytic Materials
Directory of Open Access Journals (Sweden)
Dora Alicia Solis-Casados
2017-01-01
Full Text Available V2O5 powders modified with different theoretical silver contents (1, 5, 10, 15, and 20 wt% as Ag2O were obtained with acicular morphologies observed by scanning electron microscopy (SEM. Shcherbinaite crystalline phase is transformed into the Ag0.33V2O5 crystalline one with the incorporation and increase in silver content as was suggested by X-ray diffraction (XRD and X-ray photoelectron spectroscopy (XPS analysis. With further increase in silver contents the Ag2O phase appears. Catalysts were active in photocatalytic degradation of malachite green dye under simulated solar light, which is one of the most remarkable facts of this work. It was found that V2O5-20Ag was the most active catalytic formulation and its activity was attributed to the mixture of coupled semiconductors that promotes the slight decrease in the rate of the electron-hole pair recombination.
The contemporary Romanian paradigm of marketing promotion
Directory of Open Access Journals (Sweden)
Manic Marius
2018-01-01
Full Text Available Contemporary marketing takes place in the field of permanent interconnection, of instant information and immediate rewards. Communication through marketing promotion will take these characteristics into account or will be just an inefficient spending. The Romanian market is no different from the global one. Marketing promotion currently has new tools that lead to new challenges in that it makes use of traditional, yet pow erful forms, but also absolute ways of communication. The Romanian promotion is helped today by these tools, but its task is more complex than it was a decade ago .
Directory of Open Access Journals (Sweden)
Aebi Stefan
2008-10-01
Full Text Available Abstract Background The activity of dihydropyrimidine dehydrogenase (DPD, the key enzyme of pyrimidine catabolism, is thought to be an important determinant for the occurrence of severe toxic reactions to 5-fluorouracil (5-FU, which is one of the most commonly prescribed chemotherapeutic agents for the treatment of solid cancers. Genetic variation in the DPD gene (DPYD has been proposed as a main factor for variation in DPD activity in the population. However, only a small proportion of severe toxicities in 5-FU based chemotherapy can be explained with such rare deleterious DPYD mutations resulting in severe enzyme deficiencies. Recently, hypermethylation of the DPYD promoter region has been proposed as an alternative mechanism for DPD deficiency and thus as a major cause of severe 5-FU toxicity. Methods Here, the prognostic significance of this epigenetic marker with respect to severe 5-FU toxicity was assessed in 27 cancer patients receiving 5-FU based chemotherapy, including 17 patients experiencing severe toxic side effects following drug administration, none of which were carriers of a known deleterious DPYD mutation, and ten control patients. The methylation status of the DPYD promoter region in peripheral blood mononuclear cells was evaluated by analysing for each patient between 19 and 30 different clones of a PCR-amplified 209 base pair fragment of the bisulfite-modified DPYD promoter region. The fragments were sequenced to detect bisulfite-induced, methylation-dependent sequence differences. Results No evidence of DPYD promoter methylation was observed in any of the investigated patient samples, whereas in a control experiment, as little as 10% methylated genomic DNA could be detected. Conclusion Our results indicate that DYPD promoter hypermethylation is not of major importance as a prognostic factor for severe toxicity in 5-FU based chemotherapy.
Olive, Joshua A; Cowan, J A
2018-07-01
Iron‑sulfur clusters are essential cofactors found across all domains of life. Their assembly and transfer are accomplished by highly conserved protein complexes and partners. In eukaryotes a [2Fe-2S] cluster is first assembled in the mitochondria on the iron‑sulfur cluster scaffold protein ISCU in tandem with iron, sulfide, and electron donors. Current models suggest that a chaperone pair interacts with a cluster-bound ISCU to facilitate cluster transfer to a monothiol glutaredoxin. In humans this protein is glutaredoxin 5 (GLRX5) and the cluster can then be exchanged with a variety of target apo proteins. By use of circular dichroism spectroscopy, the kinetics of cluster exchange reactivity has been evaluated for human GLRX5 with a variety of cluster donor and acceptor partners, and the role of chaperones determined for several of these. In contrast to the prokaryotic model, where heat-shock type chaperone proteins HscA and HscB are required for successful and efficient transfer of a [2Fe-2S] cluster from the ISCU scaffold to a monothiol glutaredoxin. However, in the human system the chaperone homologs, HSPA9 and HSC20, are not necessary for human ISCU to promote cluster transfer to GLRX5, and appear to promote the reverse transfer. Cluster exchange with the human iron‑sulfur cluster carrier protein NFU1 and ferredoxins (FDX's), and the role of chaperones, has also been evaluated, demonstrating in certain cases control over the directionality of cluster transfer. In contrast to other prokaryotic and eukaryotic organisms, NFU1 is identified as a more likely physiological donor of [2Fe-2S] cluster to human GLRX5 than ISCU. Copyright © 2018 Elsevier Inc. All rights reserved.
Ubiquitin-like protein UBL5 promotes the functional integrity of the Fanconi anemia pathway
DEFF Research Database (Denmark)
Oka, Yasuyoshi; Bekker-Jensen, Simon; Mailand, Niels
2015-01-01
in promoting the function of the Fanconi anemia (FA) pathway for repair of DNA interstrand crosslinks (ICLs), mediated by a specific interaction with the central FA pathway component FANCI. UBL5-deficient cells display spliceosome-independent reduction of FANCI protein stability, defective FANCI function...
Shibahara, Fumitoshi; Kitagawa, Asumi; Yamaguchi, Eiji; Murai, Toshiaki
2006-11-23
Iodine-mediated, oxidative desulfurization promoted cyclization of N-2-pyridylmethyl thioamides serves as an efficient and versatile method for the preparation of 2-azaindolizines (imidazo[1,5-a]pyridines) and rare 2-azaindolizine sulfur-bridged dimers. The 2-azaindolizines prepared in this manner are readily converted to a variety of fluorescent compounds by using transition-metal-catalyzed cross-coupling reactions. [reaction: see text].
MicroRNA-148b promotes proliferation of hair follicle cells by targeting NFAT5
Directory of Open Access Journals (Sweden)
Wanbao YANG,Qinqun LI,Bo SU,Mei YU
2016-03-01
Full Text Available MicroRNAs (miRNAs, small non-coding RNAs, are involved in many aspects of biological processes. Previous studies have indicated that miRNAs are important for hair follicle development and growth. In our study, we found by qRT-PCR that miR-148b was significantly upregulated in sheep wool follicle bulbs in anagen phase compared with the telogen phase of the hair follicle cycle. Overexpression of miR-148b promoted proliferation of both HHDPC and HHGMC. By using the TOPFlash system we demonstrated that miR-148b could activate Wnt/β-catenin pathway and b-catenin, cycD, c-jun and PPARD were consistently upregulated accordingly. Furthermore, transcript factor nuclear factor of activated T cells type 5 (NFAT5 and Wnt10b were predicted to be the target of miR-148b and this was substantiated using a Dual-Luciferase reporter system. Subsequently NFAT5 was further identified as the target of miR-148b using western blotting. These results were considered to indicate that miR-148b could activate the Wnt/β-catenin signal pathway by targeting NFAT5 to promote the proliferation of human hair follicle cells.
MECP2 promoter methylation and X chromosome inactivation in autism.
Nagarajan, Raman P; Patzel, Katherine A; Martin, Michelle; Yasui, Dag H; Swanberg, Susan E; Hertz-Picciotto, Irva; Hansen, Robin L; Van de Water, Judy; Pessah, Isaac N; Jiang, Ruby; Robinson, Wendy P; LaSalle, Janine M
2008-06-01
Epigenetic mechanisms have been proposed to play a role in the etiology of autism. This hypothesis is supported by the discovery of increased MECP2 promoter methylation associated with decreased MeCP2 protein expression in autism male brain. To further understand the influence of female X chromosome inactivation (XCI) and neighboring methylation patterns on aberrant MECP2 promoter methylation in autism, multiple methylation analyses were peformed on brain and blood samples from individuals with autism. Bisulfite sequencing analyses of a region 0.6 kb upstream of MECP2 in brain DNA samples revealed an abrupt transition from a highly methylated region in both sexes to a region unmethylated in males and subject to XCI in females. Chromatin immunoprecipitation analysis demonstrated that the CCTC-binding factor (CTCF) bound to this transition region in neuronal cells, consistent with a chromatin boundary at the methylation transition. Male autism brain DNA samples displayed a slight increase in methylation in this transition region, suggesting a possible aberrant spreading of methylation into the MECP2 promoter in autism males across this boundary element. In addition, autistic female brain DNA samples showed evidence for aberrant MECP2 promoter methylation as an increase in the number of bisulfite sequenced clones with undefined XCI status for MECP2 but not androgen receptor (AR). To further investigate the specificity of MECP2 methylation alterations in autism, blood DNA samples from females and mothers of males with autism were also examined for XCI skewing at AR, but no significant increase in XCI skewing was observed compared to controls. These results suggest that the aberrant MECP2 methylation in autism brain DNA samples is due to locus-specific rather than global X chromosome methylation changes.
Simons, Pascale A M; Houben, Ruud; Benders, Jos; Pijls-Johannesma, Madelon; Vandijck, Dominique; Marneffe, Wim; Backes, Huub; Groothuis, Siebren
2014-10-01
To realize safe radiotherapy treatment, processes must be stabilized. Standard operating procedures (SOP's) were expected to stabilize the treatment process and perceived task importance would increase sustainability in compliance. This paper presents the effects on compliance to safety related tasks of a process redesign based on lean principles. Compliance to patient safety tasks was measured by video recording of actual radiation treatment, before (T0), directly after (T1) and 1.5 years after (T2) a process redesign. Additionally, technologists were surveyed on perceived task importance and reported incidents were collected for three half-year periods between 2007 and 2009. Compliance to four out of eleven tasks increased at T1, of which improvements on three sustained (T2). Perceived importance of tasks strongly correlated (0.82) to compliance rates at T2. The two tasks, perceived as least important, presented low base-line compliance, improved (T1), but relapsed at T2. The reported near misses (patient-level not reached) on accelerators increased (P improvements sustained after 1.5 years, indicating increased stability. Perceived importance of tasks correlated positively to compliance and sustainability. Raising the perception of task importance is thus crucial to increase compliance. The redesign resulted in increased willingness to report incidents, creating opportunities for patient safety improvement in radiotherapy treatment. Copyright © 2014 Elsevier Ltd. All rights reserved.
Halder, Sebok K; Kant, Ravi; Milner, Richard
2018-05-01
Spinal cord injury (SCI) leads to rapid destruction of neuronal tissue, resulting in devastating motor and sensory deficits. This is exacerbated by damage to spinal cord blood vessels and loss of vascular integrity. Thus, approaches that protect existing blood vessels or stimulate the growth of new blood vessels might present a novel approach to minimize loss or promote regeneration of spinal cord tissue following SCI. In light of the remarkable power of chronic mild hypoxia (CMH) to stimulate vascular remodeling in the brain, the goal of this study was to examine how CMH (8% O 2 for up to 7 days) affects blood vessel remodeling in the spinal cord. We found that CMH promoted the following: (1) endothelial proliferation and increased vascularity as a result of angiogenesis and arteriogenesis, (2) increased vascular expression of the angiogenic extracellular matrix protein fibronectin as well as concomitant increases in endothelial expression of the fibronectin receptor α5β1 integrin, (3) strongly upregulated endothelial expression of the tight junction proteins claudin-5, ZO-1 and occludin and (4) astrocyte activation. Of note, the vascular remodeling changes induced by CMH were more extensive in white matter. Interestingly, hypoxic-induced vascular remodeling in spinal cord blood vessels was markedly attenuated in mice lacking endothelial α5 integrin expression (α5-EC-KO mice). Taken together, these studies demonstrate the considerable remodeling potential of spinal cord blood vessels and highlight an important angiogenic role for the α5β1 integrin in promoting endothelial proliferation. They also imply that stimulation of the α5β1 integrin or controlled use of mild hypoxia might provide new approaches for promoting angiogenesis and improving vascular integrity in spinal cord blood vessels.
Combining environment-driven adaptation and task-driven optimisation in evolutionary robotics.
Haasdijk, Evert; Bredeche, Nicolas; Eiben, A E
2014-01-01
Embodied evolutionary robotics is a sub-field of evolutionary robotics that employs evolutionary algorithms on the robotic hardware itself, during the operational period, i.e., in an on-line fashion. This enables robotic systems that continuously adapt, and are therefore capable of (re-)adjusting themselves to previously unknown or dynamically changing conditions autonomously, without human oversight. This paper addresses one of the major challenges that such systems face, viz. that the robots must satisfy two sets of requirements. Firstly, they must continue to operate reliably in their environment (viability), and secondly they must competently perform user-specified tasks (usefulness). The solution we propose exploits the fact that evolutionary methods have two basic selection mechanisms-survivor selection and parent selection. This allows evolution to tackle the two sets of requirements separately: survivor selection is driven by the environment and parent selection is based on task-performance. This idea is elaborated in the Multi-Objective aNd open-Ended Evolution (monee) framework, which we experimentally validate. Experiments with robotic swarms of 100 simulated e-pucks show that monee does indeed promote task-driven behaviour without compromising environmental adaptation. We also investigate an extension of the parent selection process with a 'market mechanism' that can ensure equitable distribution of effort over multiple tasks, a particularly pressing issue if the environment promotes specialisation in single tasks.
Combining environment-driven adaptation and task-driven optimisation in evolutionary robotics.
Directory of Open Access Journals (Sweden)
Evert Haasdijk
Full Text Available Embodied evolutionary robotics is a sub-field of evolutionary robotics that employs evolutionary algorithms on the robotic hardware itself, during the operational period, i.e., in an on-line fashion. This enables robotic systems that continuously adapt, and are therefore capable of (re-adjusting themselves to previously unknown or dynamically changing conditions autonomously, without human oversight. This paper addresses one of the major challenges that such systems face, viz. that the robots must satisfy two sets of requirements. Firstly, they must continue to operate reliably in their environment (viability, and secondly they must competently perform user-specified tasks (usefulness. The solution we propose exploits the fact that evolutionary methods have two basic selection mechanisms-survivor selection and parent selection. This allows evolution to tackle the two sets of requirements separately: survivor selection is driven by the environment and parent selection is based on task-performance. This idea is elaborated in the Multi-Objective aNd open-Ended Evolution (monee framework, which we experimentally validate. Experiments with robotic swarms of 100 simulated e-pucks show that monee does indeed promote task-driven behaviour without compromising environmental adaptation. We also investigate an extension of the parent selection process with a 'market mechanism' that can ensure equitable distribution of effort over multiple tasks, a particularly pressing issue if the environment promotes specialisation in single tasks.
Is a "Complex" Task Really Complex? Validating the Assumption of Cognitive Task Complexity
Sasayama, Shoko
2016-01-01
In research on task-based learning and teaching, it has traditionally been assumed that differing degrees of cognitive task complexity can be inferred through task design and/or observations of differing qualities in linguistic production elicited by second language (L2) communication tasks. Without validating this assumption, however, it is…
Zhao, Chumin; Kanicki, Jerzy
2017-09-01
High-resolution, low-noise X-ray detectors based on CMOS active pixel sensor (APS) technology have demonstrated superior imaging performance for digital breast tomosynthesis (DBT). This paper presents a task-based model for a high-resolution medical imaging system to evaluate its ability to detect simulated microcalcifications and masses as lesions for breast cancer. A 3-D cascaded system analysis for a 50- [Formula: see text] pixel pitch CMOS APS X-ray detector was integrated with an object task function, a medical imaging display model, and the human eye contrast sensitivity function to calculate the detectability index and area under the ROC curve (AUC). It was demonstrated that the display pixel pitch and zoom factor should be optimized to improve the AUC for detecting small microcalcifications. In addition, detector electronic noise of smaller than 300 e - and a high display maximum luminance (>1000 cd/cm 2 ) are desirable to distinguish microcalcifications of [Formula: see text] in size. For low contrast mass detection, a medical imaging display with a minimum of 12-bit gray levels is recommended to realize accurate luminance levels. A wide projection angle range of greater than ±30° in combination with the image gray level magnification could improve the mass detectability especially when the anatomical background noise is high. On the other hand, a narrower projection angle range below ±20° can improve the small, high contrast object detection. Due to the low mass contrast and luminance, the ambient luminance should be controlled below 5 cd/ [Formula: see text]. Task-based modeling provides important firsthand imaging performance of the high-resolution CMOS-based medical imaging system that is still at early stage development for DBT. The modeling results could guide the prototype design and clinical studies in the future.
Age-related differences in working memory performance in a 2-back task
Directory of Open Access Journals (Sweden)
Nele eWild-Wall
2011-08-01
Full Text Available The present study aimed to elucidate the neuro-cognitive processes underlying age-related differences in working memory. Young and middle-aged participants performed a two-choice task with low and a 2-back task with high working memory load. The P300, an event-related potential reflecting controlled stimulus-response processing in working memory, and the underlying neuronal sources of expected age-related differences were analyzed using sLORETA. Response speed was generally slower for the middle-aged than the young group. Under low working memory load the middle-aged participants traded speed for accuracy. The middle-aged were less efficient in the 2-back task as they responded slower while the error rates did not differ for groups. An age-related decline of the P300 amplitude and characteristic topographical differences were especially evident in the 2-back task. A more detailed analysis of the P300 in non-target trials revealed that amplitudes in the young but not middle-aged group differentiate between correctly detected vs. missed targets in the following trial. For these trials, source analysis revealed higher activation for the young vs. middle-aged group in brain areas which support working memory processes. The relationship between P300 and overt performance was validated by significant correlations. To sum up, under high working memory load the young group showed an increased neuronal activity before a successful detected target, while the middle-aged group showed the same neuronal pattern regardless of whether a subsequent target will be detected or missed. This stable memory trace before detected targets was reflected by a specific activation enhancement in brain areas which orchestrate maintenance, update, storage and retrieval of information in working memory.
Age-Related Differences in Working Memory Performance in A 2-Back Task
Wild-Wall, Nele; Falkenstein, Michael; Gajewski, Patrick D.
2011-01-01
The present study aimed to elucidate the neuro-cognitive processes underlying age-related differences in working memory. Young and middle-aged participants performed a two-choice task with low and a 2-back task with high working memory load. The P300, an event-related potential reflecting controlled stimulus–response processing in working memory, and the underlying neuronal sources of expected age-related differences were analyzed using sLORETA. Response speed was generally slower for the middle-aged than the young group. Under low working memory load the middle-aged participants traded speed for accuracy. The middle-aged were less efficient in the 2-back task as they responded slower while the error rates did not differ for groups. An age-related decline of the P300 amplitude and characteristic topographical differences were especially evident in the 2-back task. A more detailed analysis of the P300 in non-target trials revealed that amplitudes in the young but not middle-aged group differentiate between correctly detected vs. missed targets in the following trial. For these trials, source analysis revealed higher activation for the young vs. middle-aged group in brain areas which support working memory processes. The relationship between P300 and overt performance was validated by significant correlations. To sum up, under high working memory load the young group showed an increased neuronal activity before a successful detected target, while the middle-aged group showed the same neuronal pattern regardless of whether a subsequent target will be detected or missed. This stable memory trace before detected targets was reflected by a specific activation enhancement in brain areas which orchestrate maintenance, update, storage, and retrieval of information in working memory. PMID:21909328
Loo, Tze Mun; Kamachi, Fumitaka; Watanabe, Yoshihiro; Yoshimoto, Shin; Kanda, Hiroaki; Arai, Yuriko; Nakajima-Takagi, Yaeko; Iwama, Atsushi; Koga, Tomoaki; Sugimoto, Yukihiko; Ozawa, Takayuki; Nakamura, Masaru; Kumagai, Miho; Watashi, Koichi; Taketo, Makoto M; Aoki, Tomohiro; Narumiya, Shuh; Oshima, Masanobu; Arita, Makoto; Hara, Eiji; Ohtani, Naoko
2017-05-01
Obesity increases the risk of cancers, including hepatocellular carcinomas (HCC). However, the precise molecular mechanisms through which obesity promotes HCC development are still unclear. Recent studies have shown that gut microbiota may influence liver diseases by transferring its metabolites and components. Here, we show that the hepatic translocation of obesity-induced lipoteichoic acid (LTA), a Gram-positive gut microbial component, promotes HCC development by creating a tumor-promoting microenvironment. LTA enhances the senescence-associated secretory phenotype (SASP) of hepatic stellate cells (HSC) collaboratively with an obesity-induced gut microbial metabolite, deoxycholic acid, to upregulate the expression of SASP factors and COX2 through Toll-like receptor 2. Interestingly, COX2-mediated prostaglandin E 2 (PGE 2 ) production suppresses the antitumor immunity through a PTGER4 receptor, thereby contributing to HCC progression. Moreover, COX2 overexpression and excess PGE 2 production were detected in HSCs in human HCCs with noncirrhotic, nonalcoholic steatohepatitis (NASH), indicating that a similar mechanism could function in humans. Significance: We showed the importance of the gut-liver axis in obesity-associated HCC. The gut microbiota-driven COX2 pathway produced the lipid mediator PGE 2 in senescent HSCs in the tumor microenvironment, which plays a pivotal role in suppressing antitumor immunity, suggesting that PGE 2 and its receptor may be novel therapeutic targets for noncirrhotic NASH-associated HCC. Cancer Discov; 7(5); 522-38. ©2017 AACR. This article is highlighted in the In This Issue feature, p. 443 . ©2017 American Association for Cancer Research.
Sox2 Is an Androgen Receptor-Repressed Gene That Promotes Castration-Resistant Prostate Cancer
Kregel, Steven; Kiriluk, Kyle J.; Rosen, Alex M.; Cai, Yi; Reyes, Edwin E.; Otto, Kristen B.; Tom, Westin; Paner, Gladell P.; Szmulewitz, Russell Z.; Vander Griend, Donald J.
2013-01-01
Despite advances in detection and therapy, castration-resistant prostate cancer continues to be a major clinical problem. The aberrant activity of stem cell pathways, and their regulation by the Androgen Receptor (AR), has the potential to provide insight into novel mechanisms and pathways to prevent and treat advanced, castrate-resistant prostate cancers. To this end, we investigated the role of the embryonic stem cell regulator Sox2 [SRY (sex determining region Y)-box 2] in normal and malignant prostate epithelial cells. In the normal prostate, Sox2 is expressed in a portion of basal epithelial cells. Prostate tumors were either Sox2-positive or Sox2-negative, with the percentage of Sox2-positive tumors increasing with Gleason Score and metastases. In the castration-resistant prostate cancer cell line CWR-R1, endogenous expression of Sox2 was repressed by AR signaling, and AR chromatin-IP shows that AR binds the enhancer element within the Sox2 promoter. Likewise, in normal prostate epithelial cells and human embryonic stem cells, increased AR signaling also decreases Sox2 expression. Resistance to the anti-androgen MDV3100 results in a marked increase in Sox2 expression within three prostate cancer cell lines, and in the castration-sensitive LAPC-4 prostate cancer cell line ectopic expression of Sox2 was sufficient to promote castration-resistant tumor formation. Loss of Sox2 expression in the castration-resistant CWR-R1 prostate cancer cell line inhibited cell growth. Up-regulation of Sox2 was not associated with increased CD133 expression but was associated with increased FGF5 (Fibroblast Growth Factor 5) expression. These data propose a model of elevated Sox2 expression due to loss of AR-mediated repression during castration, and consequent castration-resistance via mechanisms not involving induction of canonical embryonic stem cell pathways. PMID:23326489
International Nuclear Information System (INIS)
Hurst, Helen C
2001-01-01
Overexpression of the ERBB2 proto-oncogene is associated with amplification of the gene in breast cancer but increased activity of the promoter also plays a significant role. Members of two transcription factor families (AP-2 and Ets) show increased binding to the promoter in over-expressing cells. Consequently, strategies have been devised to target promoter activity, either through the DNA binding sites for these factors, or through another promoter sequence, a polypurine-polypyrimidine repeat structure. The promoter has also been exploited for its tumour-specific activity to direct the accumulation of cytotoxic compounds selectively within cancer cells. Our current understanding of the ERBB2 promoter is reviewed and the status of these therapeutic avenues is discussed
Kuntze, Sebastian; Aizikovitsh-Udi, Einav; Clarke, David
2017-01-01
Stimulating thinking related to mathematical content is the focus of many tasks in the mathematics classroom. Beyond such content-related thinking, promoting forms of higher order thinking is among the goals of mathematics instruction as well. So-called hybrid tasks focus on combining both goals: they aim at fostering mathematical thinking and…
Promoting effect of bile acids on neoplastic transformation of x-irradiated 10T1/2 cells
International Nuclear Information System (INIS)
Han, A.; Hill, C.K.
1984-01-01
Experimental studies have raised a concern about a role of bile acids in colo-rectal carcinogenesis. Studies in vivo suggest that bile acids may act as tumor promoters. Using 10T1/2 mouse cells as a model system, the authors explored the effects of cholic and cheno-deoxycholic acid on x-ray-induced neoplastic transformation in these cells. Addition of either cheno-deoxycholic acid or cholic acid to 10T1/2 cells, 24 hours after exposure to x-rays (50kv) increases significantly the frequencies of transformation. The compounds were present in the medium throughout the entire postirradiation refeeding period. At the concentrations used (0.5μg/ml), neither acid was cytotoxic and did not have any effect on cell survival. The enhancement of radiation-induced transformation seems to be greater in the presence of cholic acid, as compared to the effect of cheno-deoxycholic acid. Increase in transformation was relatively greater after low compared to high doses of radiation. The effect of bile acids on transformation of 10T1/2 cells is similar to that of a known tumor promoter TPA. The authors' observations support the conclusion that promotional effect of bile acids is not because of their specific effect on colonic epithelium, but rather due to their general properties as tumor promoters
Health promotion training in dental and oral health degrees: a scoping review.
Bracksley-O'Grady, Stacey A; Dickson-Swift, Virginia A; Anderson, Karen S; Gussy, Mark G
2015-05-01
Dental diseases are a major burden on health; however, they are largely preventable. Dental treatment alone will not eradicate dental disease with a shift to prevention required. Prevention of dental diseases is a role of dental professionals, with most countries having formalized health promotion competencies for dental and oral health graduates. In spite of this, there may be minimal health promotion being undertaken in clinical practice. Therefore, the aim of this study was to conduct a scoping review to identify some published studies on health promotion training in dental and oral health degrees. Key search terms were developed and used to search selected databases, which identified 84 articles. Four articles met the inclusion/exclusion criteria and were included in the review. Of these studies, the type of oral health promotion tasks and instructions received before the tasks varied. However, for all studies the health promotion content was focused on health education. In terms of evaluation of outcomes, only two studies evaluated the health promotion content using student reflections. More good-quality information on health promotions training is needed to inform practice.
Task-specific impairments and enhancements induced by magnetic stimulation of human visual area V5.
Walsh, V; Ellison, A; Battelli, L; Cowey, A
1998-01-01
Transcranial magnetic stimulation (TMS) can be used to simulate the effects of highly circumscribed brain damage permanently present in some neuropsychological patients, by reversibly disrupting the normal functioning of the cortical area to which it is applied. By using TMS we attempted to recreate deficits similar to those reported in a motion-blind patient and to assess the specificity of deficits when TMS is applied over human area V5. We used six visual search tasks and showed that subje...
CHANGE@CERN:Task Force 2: reshaping for the future
2002-01-01
Second in our series reviewing the Task Forces reports. How to lay the foundations for a more efficient organisational structure. Our present organization is based on sixteen Divisions and units under the Directorate. CERN's organization is based on a Directorate and sixteen Divisions and units, while its activities are broadly divided into four Sectors: Research, Accelerators, Technical and Administration. The mandate of Task Force 2, led by Horst Wenninger, was to identify if a structural change and a reduction of duplicated efforts could result in an increased efficiency at CERN, especially as the Laboratory continues to focus its resources on the LHC. 'This is the most difficult project ever undertaken at CERN', acknowledges Wenninger, 'a double accelerator at a temperature of 1.9 K'. For the next five years the success of the LHC must be the main priority, and CERN will have to adapt the procedures of how it works. Wenninger sees the process as an opportunity for the Laboratory to move into the 21st c...
Directory of Open Access Journals (Sweden)
Lewin Harris A
2009-04-01
Full Text Available Abstract Background Bidirectional promoters are shared regulatory regions that influence the expression of two oppositely oriented genes. This type of regulatory architecture is found more frequently than expected by chance in the human genome, yet many specifics underlying the regulatory design are unknown. Given that the function of most orthologous genes is similar across species, we hypothesized that the architecture and regulation of bidirectional promoters might also be similar across species, representing a core regulatory structure and enabling annotation of these regions in additional mammalian genomes. Results By mapping the intergenic distances of genes in human, chimpanzee, bovine, murine, and rat, we show an enrichment for pairs of genes equal to or less than 1,000 bp between their adjacent 5' ends ("head-to-head" compared to pairs of genes that fall in the same orientation ("head-to-tail" or whose 3' ends are side-by-side ("tail-to-tail". A representative set of 1,369 human bidirectional promoters was mapped to orthologous sequences in other mammals. We confirmed predictions for 5' UTRs in nine of ten manual picks in bovine based on comparison to the orthologous human promoter set and in six of seven predictions in human based on comparison to the bovine dataset. The two predictions that did not have orthology as bidirectional promoters in the other species resulted from unique events that initiated transcription in the opposite direction in only those species. We found evidence supporting the independent emergence of bidirectional promoters from the family of five RecQ helicase genes, which gained their bidirectional promoters and partner genes independently rather than through a duplication process. Furthermore, by expanding our comparisons from pairwise to multispecies analyses we developed a map representing a core set of bidirectional promoters in mammals. Conclusion We show that the orthologous positions of bidirectional
Wilson, Rhonda H; Maruoka, Shuichiro; Whitehead, Gregory S; Foley, Julie F; Flake, Gordon P; Sever, Michelle L; Zeldin, Darryl C; Kraft, Monica; Garantziotis, Stavros; Nakano, Hideki; Cook, Donald N
2012-11-01
Allergic asthma is a complex disease characterized by eosinophilic pulmonary inflammation, mucus production and reversible airway obstruction. Exposure to indoor allergens is a risk factor for asthma, but this disease is also associated with high household levels of total and particularly Gram-negative bacteria. The ability of bacterial products to act as adjuvants suggests they might promote asthma by priming allergic sensitization to inhaled allergens. In support of this idea, house dust extracts (HDEs) can activate antigen-presenting dendritic cells (DCs) in vitro and promote allergic sensitization to inhaled innocuous proteins in vivo. It is unknown which microbial products provide most of the adjuvant activity in HDEs. A screen for adjuvant activity of microbial products revealed that the bacterial protein flagellin (FLA) stimulated strong allergic airway responses to an innocuous inhaled protein, ovalbumin (OVA). Moreover, Toll-like receptor 5 (TLR5), the mammalian receptor for FLA, was required for priming strong allergic responses to natural indoor allergens present in HDEs. In addition, individuals with asthma have higher serum levels of FLA-specific antibodies as compared to nonasthmatic individuals. Together, these findings suggest that household FLA promotes the development of allergic asthma by TLR5-dependent priming of allergic responses to indoor allergens.
International Nuclear Information System (INIS)
Hochreiter, L.E.; Basel, R.A.; Dennis, R.J.; Lee, N.; Massie, H.W. Jr.; Loftus, M.J.; Rosal, E.R.; Valkovic, M.M.
1980-10-01
This report presents a descriptive plan of tests for the 21-Rod Bundle Flow Blockage Task of the Full-Length Emergency Cooling Heat Transfer Separate Effects and Systems Effects Test Program (FLECHT SEASET). This task will consist of forced and gravity reflooding tests utilizing electrical heater rods to simulate PWR nuclear core fuel rod arrays. All tests will be performed with a cosine axial power profile. These tests are planned to be used to determine effects of various flow blockage configurations (shapes and distributions) on reflooding behavior, to aid in development/assessment of computational models in predicting reflooding behavior of flow blockage configurations, and to screen flow blockage configurations for future 161-rod flow blockage bundle tests
Shanks, Julia; Herring, Neil; Johnson, Errin; Liu, Kun; Li, Dan
2017-01-01
Reduced cardiomyocyte excitation–contraction coupling and downregulation of the SERCA2a (sarcoendoplasmic reticulum calcium ATPase 2a) is associated with heart failure. This has led to viral transgene upregulation of SERCA2a in cardiomyocytes as a treatment. We hypothesized that SERCA2a gene therapy expressed under a similar promiscuous cytomegalovirus promoter could also affect the cardiac sympathetic neural axis and promote sympathoexcitation. Stellate neurons were isolated from 90 to 120 g male, Sprague–Dawley, Wistar Kyoto, and spontaneously hypertensive rats. Neurons were infected with Ad-mCherry or Ad-mCherry-hATP2Aa (SERCA2a). Intracellular Ca2+ changes were measured using fura-2AM in response to KCl, caffeine, thapsigargin, and carbonylcyanide-p-trifluoromethoxyphenylhydrazine to mobilize intracellular Ca2+ stores. The effect of SERCA2a on neurotransmitter release was measured using [3H]-norepinephrine overflow from 340 to 360 g Sprague–Dawley rat atria in response to right stellate ganglia stimulation. Upregulation of SERCA2a resulted in greater neurotransmitter release in response to stellate stimulation compared with control (empty: 98.7±20.5 cpm, n=7; SERCA: 186.5±28.41 cpm, n=8; Pneurons, SERCA2a overexpression facilitated greater depolarization-induced Ca2+ transients (empty: 0.64±0.03 au, n=57; SERCA: 0.75±0.03 au, n=68; Pneurons resulted in increased neurotransmission and increased Ca2+ loading into intracellular stores. Whether the increased Ca2+ transient and neurotransmission after SERCA2A overexpression contributes to enhanced sympathoexcitation in heart failure patients remains to be determined. PMID:28223472
Investment Portfolio Simulation: An Assessment Task in Finance
Parle, Gabrielle; Laing, Gregory K.
2017-01-01
The use of an investment portfolio simulation as an assessment task is intended to reinforce learning by involving students in practical application of theoretical principles in a real-time actual financial market. Simulation as a teaching pedagogy promotes individual involvement and provides students with a deeper understanding of the issues, and…
International Nuclear Information System (INIS)
Biden, T.J.; Peter-Riesch, B.; Schlegel, W.; Wollheim, C.B.
1987-01-01
The role of Ca2+ in the generation of inositol phosphates was investigated using rat pancreatic islets after steady state labeling with myo-[2- 3 H]inositol. Depolarizing K+ concentrations (24 mM) evoked early (2 s) increases in inositol 1,4,5-trisphosphate (Ins-1,4,5-P3) and inositol 1,3,4,5-tetrakisphosphate (Ins-1,3,4,5-P4) as measured by high performance anion-exchange chromatography. The increase in Ins-1,4,5-P3 was transient and was followed by a more pronounced rise in Ins-1,3,4-P3. These effects were dependent on the presence of extracellular Ca2+ but were not secondary to release of either neurotransmitters or metabolites of arachidonic acid. K+ also promoted the breakdown of phosphatidylinositol 4,5-bisphosphate (PtdIns-4,5-P2) and of the other phosphoinositides. Glucose (16.7 mM) was less marked in its effects but still promoted rapid increases in Ins-1,3,4,5-P4 (2 s) and Ins-1,4,5-P3 (10 s) and a slower rise in Ins-1,3,4-P3 (30 s). The levels of all three metabolites rose steadily over 10 min stimulation. These responses to glucose could be largely, although not entirely, inhibited by depletion of extracellular Ca2+ or by Ca2+ channel blockade with verapamil (20 microM). Carbamylcholine (0.5 mM) was the most potent stimulus used evoking early rises in Ins-1,4,5-P3 and Ins-1,3,4,5-P4 (2 s) followed by Ins-1,3,4-P3 (10 s), effects which were only partially dependent on extracellular Ca2+. The results suggest that a Ca2+-mediated PtdIns-4,5-P2 hydrolysis accounts for most of the Ins-1,4,5-P3 generated in response to glucose but not carbamylcholine
Characteristics of NaNO3-Promoted CdO as a Midtemperature CO2 Absorbent.
Kim, Kang-Yeong; Kwak, Jin-Su; An, Young-In; Oh, Kyung-Ryul; Kwon, Young-Uk
2017-06-28
In this study, we explored the reaction system CdO(s) + CO 2 (g) ⇄ CdCO 3 (s) as a model system for CO 2 capture agent in the intermediate temperature range of 300-400 °C. While pure CdO does not react with CO 2 at all up to 500 °C, CdO mixed with an appropriate amount of NaNO 3 (optimal molar ratio NaNO 3 /CdO = 0.14) greatly enhances the conversion of CdO into CdCO 3 up to ∼80% (5.68 mmol/g). These NaNO 3 -promoted CdO absorbents can undergo many cycles of absorption and desorption by temperature swing between 300 and 370 °C under a 100% CO 2 condition. Details of how NaNO 3 promotes the CO 2 absorption of CdO have been delineated through various techniques using thermogravimetry, coupled with X-ray diffraction and electron microscopy. On the basis of the observed data, we propose a mechanism of CO 2 absorption and desorption of NaNO 3 -promoted CdO. The absorption proceeds through a sequence of events of CO 2 adsorption on the CdO surface covered by NaNO 3 , dissolution of so-formed CdCO 3 , and precipitation of CdCO 3 particles in the NaNO 3 medium. The desorption occurs through the decomposition of CdCO 3 in the dissolved state in the NaNO 3 medium where CdO nanoparticles are formed dispersed in the NaNO 3 medium. The CdO nanoparticles are aggregated into micrometer-large particles with smooth surfaces and regular shapes.
Snapshots of mathematics teacher noticing during task design
Choy, Ban Heng
2016-09-01
Designing a mathematically worthwhile task is critical for promoting students' reasoning. To improve task design skills, teachers often engage in collaborative lesson planning activities such as lesson study. However, to learn from the process of lesson study, it is important for teachers to notice productively the concepts, students' confusion and the design of the task. But what researchers mean by productive noticing varies. In this article, I present the FOCUS Framework which highlights two characteristics of productive noticing: having an explicit focus for noticing and focusing noticing through pedagogical reasoning. Using these two characteristics, I develop snapshots of noticing as a representation of practice to present a fine-grained analysis of teacher noticing. Through vignettes of teachers discussing the design of a task to teach fractions, I illustrate how two teachers' noticing can be analysed and represented using snapshots of noticing. To conclude, I highlight what snapshots of noticing tell us about a teacher's noticing and suggest ways to use these snapshots in future studies of noticing.
DEFF Research Database (Denmark)
Møller, A M; Jensen, N M; Pildal, J
2001-01-01
This study was performed to test the hypothesis that genetic variation in the promoter of the glucose transporter 2 (GLUT2) might predispose to prediabetic phenotypes or type 2 diabetes. A total of 1611 bp comprising the minimal promoter region of the GLUT2 gene were examined by combined single......-tolerant subjects. In conclusion, we found no evidence supporting the hypothesis that genetic variability in the minimal promoter of the GLUT2 is associated with type 2 diabetes or prediabetic phenotypes in the Danish population.......-strand conformational polymorphism and heteroduplex analysis followed by direct sequencing of identified variants on genomic DNA from 96 randomly recruited Danish type 2 diabetic patients. We identified 4 nucleotide variants, -447g-->a, -149c-->a, -122t-->c, and -44g-->a. None of the variants were positioned in known...
RCP-driven α5β1 recycling suppresses Rac and promotes RhoA activity via the RacGAP1-IQGAP1 complex.
Jacquemet, Guillaume; Green, David M; Bridgewater, Rebecca E; von Kriegsheim, Alexander; Humphries, Martin J; Norman, Jim C; Caswell, Patrick T
2013-09-16
Inhibition of αvβ3 or expression of mutant p53 promotes invasion into fibronectin (FN)-containing extracellular matrix (ECM) by enhancing Rab-coupling protein (RCP)-dependent recycling of α5β1 integrin. RCP and α5β1 cooperatively recruit receptor tyrosine kinases, including EGFR1, to regulate their trafficking and downstream signaling via protein kinase B (PKB)/Akt, which, in turn, promotes invasive migration. In this paper, we identify a novel PKB/Akt substrate, RacGAP1, which is phosphorylated as a consequence of RCP-dependent α5β1 trafficking. Phosphorylation of RacGAP1 promotes its recruitment to IQGAP1 at the tips of invasive pseudopods, and RacGAP1 then locally suppresses the activity of the cytoskeletal regulator Rac and promotes the activity of RhoA in this subcellular region. This Rac to RhoA switch promotes the extension of pseudopodial processes and invasive migration into FN-containing matrices, in a RhoA-dependent manner. Thus, the localized endocytic trafficking of α5β1 within the tips of invasive pseudopods elicits signals that promote the reorganization of the actin cytoskeleton, protrusion, and invasion into FN-rich ECM.
Viana, Antonio A B; Fragoso, Rodrigo R; Guimarães, Luciane M; Pontes, Naiara; Oliveira-Neto, Osmundo B; Artico, Sinara; Nardeli, Sarah M; Alves-Ferreira, Marcio; Batista, João A N; Silva, Maria C M; Grossi-de-Sa, Maria F
2011-11-24
Cotton (Gossypium spp.) is an important crop worldwide that provides raw material to 40% of the textile fiber industry. Important traits have been studied aiming the development of genetically modified crops including resistance to insect and diseases, and tolerance to drought, cold and herbicide. Therefore, the characterization of promoters and regulatory regions is also important to achieve high gene expression and/or a specific expression pattern. Commonly, genes involved in ubiquitination pathways are highly and differentially expressed. In this study, we analyzed the expression of a cotton ubiquitin-conjugating enzyme (E2) family member with no previous characterization. Nucleotide analysis revealed high identity with cotton E2 homologues. Multiple alignment showed a premature stop codon, which prevents the encoding of the conserved cysteine residue at the E2 active site, and an intron that is spliced in E2 homologues, but not in GhGDRP85. The GhGDRP85 gene is highly expressed in different organs of cotton plants, and has high transcript levels in roots. Its promoter (uceApro2) and the 5'UTR compose a regulatory region named uceA1.7, and were isolated from cotton and studied in Arabidopsis thaliana. uceA1.7 shows strong expression levels, equaling or surpassing the expression levels of CaMV35S. The uceA1.7 regulatory sequence drives GUS expression 7-fold higher in flowers, 2-fold in roots and at similar levels in leaves and stems. GUS expression levels are decreased 7- to 15-fold when its 5'UTR is absent in uceApro2. uceA1.7 is a strong constitutive regulatory sequence composed of a promoter (uceApro2) and its 5'UTR that will be useful in genetic transformation of dicots, having high potential to drive high levels of transgene expression in crops, particularly for traits desirable in flower and root tissues.
Energy Technology Data Exchange (ETDEWEB)
NONE
2001-03-01
Based on 'the Implementing agreement for a research cooperation project on the photovoltaic power system' being promoted by IEA, collection of the information was made on Task IX: Promotion of the effective spread of the PV technology in developing countries, and the FY 2000 results were summarized. In Task IX, for technical/economic subjects in introducing the PV system to developing countries, a commendable/practical guide using the experiences having been gained was to be arranged. Also, workshop was to be opened in developing countries as model, and cooperation was to be promoted with international organizations such as the Bank of the World. In this fiscal year, two meetings of specialists (abroad) and four sectional meetings of operation (in Japan) were held. This fiscal year was the second year of the 5-year plan. The standard for selecting developing countries as model was studied, and a draft of the commendable/practical guide was made and discussed in the meeting of specialists. (NEDO)
Energy Technology Data Exchange (ETDEWEB)
NONE
2001-03-01
Based on 'the Implementing agreement for a research cooperation project on the photovoltaic power system' being promoted by IEA, collection of the information was made on Task IX: Promotion of the effective spread of the PV technology in developing countries, and the FY 2000 results were summarized. In Task IX, for technical/economic subjects in introducing the PV system to developing countries, a commendable/practical guide using the experiences having been gained was to be arranged. Also, workshop was to be opened in developing countries as model, and cooperation was to be promoted with international organizations such as the Bank of the World. In this fiscal year, two meetings of specialists (abroad) and four sectional meetings of operation (in Japan) were held. This fiscal year was the second year of the 5-year plan. The standard for selecting developing countries as model was studied, and a draft of the commendable/practical guide was made and discussed in the meeting of specialists. (NEDO)
Zr-2.5 Nb microstructure evolution during heat treatments
International Nuclear Information System (INIS)
Campitelli, Emiliano N.; Banchik, Abrahan D.; Versaci, Raul A.
1999-01-01
This work has the following two basic objectives: 1) To gain experience in the preparation of thin layers of zirconium alloys to be used as T.E.M specimens. To construct a double jet thinning prototype able to perform this task with appropriate finishing and reproducible results to be used in a future work (point 2). To become familiar with the relevant parameters of the thinning process and to apply this experience in the prototype. The layers must have sufficient area with good transmission and mechanical support, free of deformations and defects polishing. 2) To perform T.E.M. observations and metallographies to study the microstructural evolution during heat treatments of Zr-2.5 Nb alloy samples. These samples were obtained from a pressure tube similar to those used in Candu power plants, in the as-received condition. This alloy served, in this application, to replace Zircaloy-2, for better creep and corrosion resistance. (author)
Observation of a Griffiths-like Phase in the Magnetocaloric Compound Tb5Si2Ge2
International Nuclear Information System (INIS)
Magen, C.; Algarabel, P.A.; Morellon, L.; Ibarra, M.R.; Araujo, J.P.; Pereira, A.M.; Sousa, J.B.; Ritter, C.
2006-01-01
The onset of a Griffiths-like phase has been observed in Tb 5 Si 2 Ge 2 (T C =110 K) by means of magnetic susceptibility and small-angle neutron scattering experiments. We show the growth of a ferromagnetic cluster system characterized by an inverse susceptibility exponent lower than unity at T C G ≅200 K. We suggest that the Griffiths-like state is originated by local disorder within the crystallographic structure, stabilized and enhanced by competing intralayer and interlayer magnetic interactions. Both factors thus promote segregation of nanometric regions with ferromagnetic interactions
Directory of Open Access Journals (Sweden)
Weina Cao
2018-02-01
Full Text Available Background/Aims: Impaired adipogenesis may be the underlying cause in the development of obesity and type II diabetes. Mechanistically, the family of Homeobox transcription factors is implicated in the regulation of adipocyte fate. Hoxa5 is highly expressed in adipocytes, and its mRNA expression is decreased during differentiation. However, the function of Hoxa5 in adipose tissue has been poorly understood. The aim of this study is to unveil the role of Hoxa5 on adipocyte differentiation and its underlying mechanisms. Methods: Quantitative real-time PCR (qPCR and western blot were performed to determine Hoxa5 expression in primary adipocytes and in adipose tissues from mice. Lipid accumulation was evaluated by bodipy staining. Dual luciferase assay was applied to explore the transcription factor of Hoxa5 and the transcriptional target gene modulated by Hoxa5. All measurements were performed at least for three times at least. Results: A significant reduction of Hoxa5 expression was observed in adipose tissue of High Fat Diet (HFD induced obesity mice. We determined Hoxa5 increased adipocytes differentiation and mitochondrial biogenesis in adipocytes in vitro. CEBPβ was determined a transcription factor of Hoxa5 and inhibited methylation level of Hoxa5 by combining on the promoter of Hoxa5. Importantly, we found Fabp4, a known positive regulator of adipocytes differentiation, was transcriptional activation by Hoxa5. In addition, Hoxa5 promotes adipocytes differentiation by inhibiting PKA/HSL pathway. Conclusion: Our study demonstrated the promoting role of Hoxa5 in adipocytes differentiation and therefore bringing a new therapeutic mean to the treatment of obesity and type II diabetes.
Assistive Technologies Promoting the Experience of Self for People with Alzheimer’s Disease
Directory of Open Access Journals (Sweden)
Andrea Bosco
2015-08-01
Full Text Available There is growing evidence on the importance of rehabilitation interventions promoting the persistence of the sense of self in people with Alzheimer's disease (AD or other forms of dementia. Assistive Technologies (AT may contribute to the development of interventions aimed to improve adaptive responses to environmental demands. This, in turns, can promote self-awareness. At the same time AT can manage computer interfaces able to record and reproduce autobiographical multimedia contents that can be very useful during reminiscence tasks carried out during conversations with supportive staff. These tasks could promote the self-concept. Globally the AT can be of great help in setting up rehabilitation and leisure environments promoting the experience of self in people with AD and other dementias.
Insulin-like peptide 5 is a microbially regulated peptide that promotes hepatic glucose production
DEFF Research Database (Denmark)
Lee, Ying Shiuan; De Vadder, Filipe; Tremaroli, Valentina
2016-01-01
expression in the brain was higher in CONV-R versus GF mice. We also observed that colonic Insl5 expression was suppressed by increasing the energy supply in GF mice by colonization or high-fat feeding. We did not observe any differences in food intake, gut transit or oral glucose tolerance between Insl5......-/- and wild-type mice. However, we showed impaired intraperitoneal glucose tolerance in Insl5-/- mice. We also observed improved insulin tolerance and reduced hepatic glucose production in Insl5-/- mice. CONCLUSIONS: We have shown that colonic Insl5 expression is regulated by the gut microbiota and energy...... availability. We propose that INSL5 is a hormone that could play a role in promoting hepatic glucose production during periods of energy deprivation....
Screening mammography in a health promotion center for 5 years : results of medical audits
International Nuclear Information System (INIS)
Kim, Mi Hye; Lee, Mi Ja; Oh, Ki Keun; Lee, Kyong Sik
2000-01-01
The purpose of this study was to perform a medical audit of the screening of mammographic results according to ACR BI-RADS Follow-Up and Outcome Monitoring and to evaluate the efficacy of screening mammography in the early detection of breast cancer. We reviewed the results of 15,300 mammographic examinations of 13,889 women aged 30-75 years who underwent mammography at least once at the Severance Health Promotion Center between 1994-1998. Women with abnormal mammographic findings were recalled for additional study and those with dense breast composition (3, 4) underwent additional ultrasound. All results were categorized on the basis of the ACR BI-RADS final assessment scale, 1-5. We reviewed the pathologic or follow-up results of all women in categories 4 and 5, and/or those in any category who took the films out of the health center. The recall rate was 13%. Biopsy or surgical consultation was recommended for 92 women and biopsy was performed in 52. Pathology revealed 17 cancers and 35 benign lesions. Positive predictive value 2 was found in 18.5% of cases, and positive predictive value 3 in 33%. The cancer detection rate was 1.2/1,000, and sensitivity was 89.5%. Invasive cancers smaller than 1 cm or in situ ductal cancers were found in eight of 17 cases (47%), while node-positive invasive cancers were found in nine of 14 cases (64%). Four of 17 mammographically detected cancers were palpated by a surgeon. In asymptomatic women, screening mammography is an effective method for the detection of early breast cancer. (author)
International Nuclear Information System (INIS)
Si, Lina; Shi, Jin; Gao, Wenqun; Zheng, Min; Liu, Lingjuan; Zhu, Jing; Tian, Jie
2014-01-01
Highlights: • BMP2 can upregulated cardiac related gene GATA4, Nkx2.5, MEF2c and Tbx5. • Inhibition of Smad4 decreased BMP2-induced hyperacetylation of histone H3. • Inhibition of Smad4 diminished BMP2-induced overexpression of GATA4 and Nkx2.5. • Inhibition of Smad4 decreased hyperacetylated H3 in the promoter of GATA4 and Nkx2.5. • Smad4 is essential for BMP2 induced hyperacetylated histone H3. - Abstract: BMP2 signaling pathway plays critical roles during heart development, Smad4 encodes the only common Smad protein in mammals, which is a pivotal nuclear mediator. Our previous studies showed that BMP2 enhanced the expression of cardiac transcription factors in part by increasing histone H3 acetylation. In the present study, we tested the hypothesis that Smad4 mediated BMP2 signaling pathway is essential for the expression of cardiac core transcription factors by affecting the histone H3 acetylation. We successfully constructed a lentivirus-mediated short hairpin RNA interference vector targeting Smad4 (Lv-Smad4) in rat H9c2 embryonic cardiac myocytes (H9c2 cells) and demonstrated that it suppressed the expression of the Smad4 gene. Cultured H9c2 cells were transfected with recombinant adenoviruses expressing human BMP2 (AdBMP2) with or without Lv-Smad4. Quantitative real-time RT-PCR analysis showed that knocking down of Smad4 substantially inhibited both AdBMP2-induced and basal expression levels of cardiac transcription factors GATA4 and Nkx2.5, but not MEF2c and Tbx5. Similarly, chromatin immunoprecipitation (ChIP) analysis showed that knocking down of Smad4 inhibited both AdBMP2-induced and basal histone H3 acetylation levels in the promoter regions of GATA4 and Nkx2.5, but not of Tbx5 and MEF2c. In addition, Lv-Smad4 selectively suppressed AdBMP2-induced expression of HAT p300, but not of HAT GCN5 in H9c2 cells. The data indicated that inhibition of Smad4 diminished both AdBMP2 induced and basal histone acetylation levels in the promoter regions of
Energy Technology Data Exchange (ETDEWEB)
Si, Lina; Shi, Jin; Gao, Wenqun [Heart Centre, Children’s Hospital of Chongqing Medical University, 136 Zhongshan 2nd Road, Yu Zhong District, Chongqing 400014 (China); Ministry of Education Key Laboratory of Child Development and Disorders, Key Laboratory of Pediatrics in Chongqing, Chongqing International Science and Technology Cooperation Center for Child Development and Disorders, 136 Zhongshan 2nd Road, Yu Zhong District, Chongqing 400014 (China); Zheng, Min [Heart Centre, Children’s Hospital of Chongqing Medical University, 136 Zhongshan 2nd Road, Yu Zhong District, Chongqing 400014 (China); Liu, Lingjuan; Zhu, Jing [Ministry of Education Key Laboratory of Child Development and Disorders, Key Laboratory of Pediatrics in Chongqing, Chongqing International Science and Technology Cooperation Center for Child Development and Disorders, 136 Zhongshan 2nd Road, Yu Zhong District, Chongqing 400014 (China); Tian, Jie, E-mail: jietian@cqmu.edu.cn [Heart Centre, Children’s Hospital of Chongqing Medical University, 136 Zhongshan 2nd Road, Yu Zhong District, Chongqing 400014 (China)
2014-07-18
Highlights: • BMP2 can upregulated cardiac related gene GATA4, Nkx2.5, MEF2c and Tbx5. • Inhibition of Smad4 decreased BMP2-induced hyperacetylation of histone H3. • Inhibition of Smad4 diminished BMP2-induced overexpression of GATA4 and Nkx2.5. • Inhibition of Smad4 decreased hyperacetylated H3 in the promoter of GATA4 and Nkx2.5. • Smad4 is essential for BMP2 induced hyperacetylated histone H3. - Abstract: BMP2 signaling pathway plays critical roles during heart development, Smad4 encodes the only common Smad protein in mammals, which is a pivotal nuclear mediator. Our previous studies showed that BMP2 enhanced the expression of cardiac transcription factors in part by increasing histone H3 acetylation. In the present study, we tested the hypothesis that Smad4 mediated BMP2 signaling pathway is essential for the expression of cardiac core transcription factors by affecting the histone H3 acetylation. We successfully constructed a lentivirus-mediated short hairpin RNA interference vector targeting Smad4 (Lv-Smad4) in rat H9c2 embryonic cardiac myocytes (H9c2 cells) and demonstrated that it suppressed the expression of the Smad4 gene. Cultured H9c2 cells were transfected with recombinant adenoviruses expressing human BMP2 (AdBMP2) with or without Lv-Smad4. Quantitative real-time RT-PCR analysis showed that knocking down of Smad4 substantially inhibited both AdBMP2-induced and basal expression levels of cardiac transcription factors GATA4 and Nkx2.5, but not MEF2c and Tbx5. Similarly, chromatin immunoprecipitation (ChIP) analysis showed that knocking down of Smad4 inhibited both AdBMP2-induced and basal histone H3 acetylation levels in the promoter regions of GATA4 and Nkx2.5, but not of Tbx5 and MEF2c. In addition, Lv-Smad4 selectively suppressed AdBMP2-induced expression of HAT p300, but not of HAT GCN5 in H9c2 cells. The data indicated that inhibition of Smad4 diminished both AdBMP2 induced and basal histone acetylation levels in the promoter regions of
Directory of Open Access Journals (Sweden)
Potrich D.P.
2001-01-01
Full Text Available A 40-kb DNA region containing the major cluster of nif genes has been isolated from the Azospirillum brasilense Sp7 genome. In this region three nif operons have been identified: nifHDKorf1Y, nifENXorf3orf5fdxAnifQ and orf2nifUSVorf4. The operons containing nifENX and nifUSV genes are separated from the structural nifHDKorf1Y operon by about 5 kb and 10 kb, respectively. The present study shows the sequence analysis of the 6045-bp DNA region containing the nifENX genes. The deduced amino acid sequences from the open reading frames were compared to the nif gene products of other diazotrophic bacteria and indicate the presence of seven ORFs, all reading in the same direction as that of the nifHDKorf1Y operon. Consensus sigma54 and NifA-binding sites are present only in the promoter region upstream of the nifE gene. This promoter is activated by NifA protein and is approximately two-times less active than the nifH promoter, as indicated by the ß-galactosidase assays. This result suggests the differential expression of the nif genes and their respective products in Azospirillum.
Kitajima, Ryu
2013-01-01
The studies in task-based approaches in second language acquisition claim that controlled and goal convergent tasks such as information gap tasks surpass open-ended conversations such as personal information exchange tasks for the development of the learner's interlanguage, in that the formers promote more repair negotiation. And yet, few studies…
Common variants in the TPH2 promoter confer susceptibility to paranoid schizophrenia.
Yi, Zhenghui; Zhang, Chen; Lu, Weihong; Song, Lisheng; Liu, Dentang; Xu, Yifeng; Fang, Yiru
2012-07-01
Serotonergic system-related genes may be good candidates in investigating the genetic basis of schizophrenia. Our previous study suggested that promoter region of tryptophan hydroxylase 2 gene (TPH2) may confer the susceptibility to paranoid schizophrenia. In this study, we investigated whether common variants within TPH2 promoter may predispose to paranoid schizophrenia in Han Chinese. A total of 509 patients who met DSM-IV criteria for paranoid schizophrenia and 510 matched healthy controls were recruited for this study. Five polymorphisms within TPH2 promoter region were tested. No statistically significant differences were found in allele or genotype frequencies between schizophrenic patients and healthy controls. The frequency of the rs4448731T-rs6582071A-rs7963803A-rs4570625T-rs11178997A haplotype was significantly higher in cases compared to the controls (P = 0.003; OR = 1.49; 95% CI, 1.15-1.95). Our results suggest that the common variants within TPH2 promoter are associated with paranoid schizophrenia in Han Chinese. Further studies in larger samples are warranted to elucidate the role of TPH2 in the etiology of paranoid schizophrenia.
Linguistic dimensions of l2 accentedness and comprehensibility vary across speaking tasks
Crowther, D.; Trofimovich, P.; Isaacs, T.; Saito, Kazuya
2017-01-01
This study critically examined the previously reported partial independence between second language (L2) accentedness (degree to which L2 speech differs from the target variety) and comprehensibility (ease of understanding). In prior work, comprehensibility was linked to multiple linguistic dimensions of L2 speech (phonology, fluency, lexis, grammar) whereas accentedness was narrowly associated with L2 phonology. However, these findings stemmed from a single task (picture narrative), suggesti...
Dixon, Helen; Scully, Maree; Kelly, Bridget; Donovan, Robert; Chapman, Kathy; Wakefield, Melanie
2014-01-01
Assess the effect of counter-advertisements on parents' appraisals of unhealthy foods featuring front-of-package promotions (FOPPs). A 2 × 2 × 5 between-subjects Web-based experiment. Parents were randomly shown an advertisement (counter-advertisement challenging FOPP/control advertisement) and then a pair of food products from the same category: an unhealthy product featuring an FOPP (nutrient content claim/sports celebrity endorsement) and a healthier control product with no FOPP. Australia. A total of 1,269 Australian-based parents of children aged 5-12 years recruited from an online panel. Parents nominated which product they would prefer to buy and which they thought was healthier, then rated the unhealthy product and FOPP on various characteristics. Differences between advertisement conditions were assessed using logistic regression (product choice tasks) and analysis of variance tests (ratings of unhealthy product and FOPP). Compared with parents who saw a control advertisement, parents who saw a counter-advertisement perceived unhealthy products featuring FOPPs as less healthy, expressed weaker intentions for buying such products, and were more likely to read the nutrition facts panel before nominating choices (all P influence of unhealthy food marketing and improve the accuracy of parents' evaluations of how nutritious promoted food products are. Copyright © 2014 Society for Nutrition Education and Behavior. Published by Elsevier Inc. All rights reserved.
Promoting Physics Among Female Learners in the Western Cape Through Active Engagement (abstract)
Arendse, Gillian J.
2009-04-01
In 2006 the author organized a one-day intervention aimed at promoting physics among female learners at the University of Stellenbosch. The activities included an interactive lecture demonstration promoting active engagement, a hands-on session, and short presentations by female physicists addressing issues such as balancing family and career, breaking the stereotypes, and launching a successful career in physics. Each learner was expected to evaluate the program. In 2007 the author joined forces with Hip2B2 (Shuttleworth Foundation) to host a competition among grade-10 learners with the theme, ``promoting creativity through interactivity.'' The author was tasked by the Hip2B2-team to assist with a program for female learners planned for August 2008, coinciding with our national celebration of Women's Day. The event targeted 160 learners and took place in Durban, East London, Cape Town, and Johannesburg. The author shares some of the learners' experiences and personal triumphs.
5 CFR 335.103 - Agency promotion programs.
2010-01-01
...-Level and Scientific and Professional positions. (d) Grievances. Employees have the right to file a... prescribed by the Office of Personnel Management (OPM). Methods of evaluation for promotion and placement...) Requirement 4. Selection procedures will provide for management's right to select or not select from among a...
NERI PROJECT 99-119. TASK 2. DATA-DRIVEN PREDICTION OF PROCESS VARIABLES. FINAL REPORT
Energy Technology Data Exchange (ETDEWEB)
Upadhyaya, B.R.
2003-04-10
This report describes the detailed results for task 2 of DOE-NERI project number 99-119 entitled ''Automatic Development of Highly Reliable Control Architecture for Future Nuclear Power Plants''. This project is a collaboration effort between the Oak Ridge National Laboratory (ORNL,) The University of Tennessee, Knoxville (UTK) and the North Carolina State University (NCSU). UTK is the lead organization for Task 2 under contract number DE-FG03-99SF21906. Under task 2 we completed the development of data-driven models for the characterization of sub-system dynamics for predicting state variables, control functions, and expected control actions. We have also developed the ''Principal Component Analysis (PCA)'' approach for mapping system measurements, and a nonlinear system modeling approach called the ''Group Method of Data Handling (GMDH)'' with rational functions, and includes temporal data information for transient characterization. The majority of the results are presented in detailed reports for Phases 1 through 3 of our research, which are attached to this report.
SNHG5 promotes colorectal cancer cell survival by counteracting STAU1-mediated mRNA destabilization
DEFF Research Database (Denmark)
Damas, Nkerorema Djodji; Marcatti, Michela; Côme, Christophe
2016-01-01
We currently have limited knowledge of the involvement of long non-coding RNAs (lncRNAs) in normal cellular processes and pathologies. Here, we identify and characterize SNHG5 as a stable cytoplasmic lncRNA with up-regulated expression in colorectal cancer. Depletion of SNHG5 induces cell cycle...... characterize SNHG5 as a lncRNA promoting tumour cell survival in colorectal cancer and delineate a novel mechanism in which a cytoplasmic lncRNA functions through blocking the action of STAU1....
The functional neuroanatomy of multitasking: combining dual tasking with a short term memory task.
Deprez, Sabine; Vandenbulcke, Mathieu; Peeters, Ron; Emsell, Louise; Amant, Frederic; Sunaert, Stefan
2013-09-01
Insight into the neural architecture of multitasking is crucial when investigating the pathophysiology of multitasking deficits in clinical populations. Presently, little is known about how the brain combines dual-tasking with a concurrent short-term memory task, despite the relevance of this mental operation in daily life and the frequency of complaints related to this process, in disease. In this study we aimed to examine how the brain responds when a memory task is added to dual-tasking. Thirty-three right-handed healthy volunteers (20 females, mean age 39.9 ± 5.8) were examined with functional brain imaging (fMRI). The paradigm consisted of two cross-modal single tasks (a visual and auditory temporal same-different task with short delay), a dual-task combining both single tasks simultaneously and a multi-task condition, combining the dual-task with an additional short-term memory task (temporal same-different visual task with long delay). Dual-tasking compared to both individual visual and auditory single tasks activated a predominantly right-sided fronto-parietal network and the cerebellum. When adding the additional short-term memory task, a larger and more bilateral frontoparietal network was recruited. We found enhanced activity during multitasking in components of the network that were already involved in dual-tasking, suggesting increased working memory demands, as well as recruitment of multitask-specific components including areas that are likely to be involved in online holding of visual stimuli in short-term memory such as occipito-temporal cortex. These results confirm concurrent neural processing of a visual short-term memory task during dual-tasking and provide evidence for an effective fMRI multitasking paradigm. © 2013 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Friederike Klempin
2010-07-01
Full Text Available Serotonin (5-HT appears to play a major role in controlling adult hippocampal neurogenesis and thereby it is relevant for theories linking failing adult neurogenesis to the pathogenesis of major depression and the mechanisms of action of antidepressants. Serotonergic drugs lack acute effects on adult neurogenesis in many studies, which suggests a surprising long latency phase. Here we report that the selective serotonin reuptake inhibitor fluoxetine, which has no acute effect on precursor cell proliferation, causes the well-described increase in net neurogenesis upon prolonged treatment partly by promoting the survival and maturation of new postmitotic neurons. We hypothesized that this result is the cumulative effect of several 5-HT-dependent events in the course of adult neurogenesis. Thus, we used specific agonists and antagonists to 5-HT1a, 2, and 2c receptor subtypes to analyze their impact on different developmental stages. We found that 5-HT exerts acute and opposing effects on proliferation and survival or differentiation of precursor cells by activating the diverse receptor subtypes on different stages within the neuronal lineage in vivo. This was confirmed in vitro by demonstrating that 5-HT1a receptors are involved in self-renewal of precursor cells, whereas 5-HT2 receptors effect both proliferation and promote neuronal differentiation. We propose that under acute conditions 5-HT2 effects counteract the positive proliferative effect of 5-HT1a receptor activation. However, prolonged 5-HT2c receptor activation fosters an increase in late stage progenitor cells and early postmitotic neurons, leading to a net increase in adult neurogenesis. Our data indicate that serotonin does not show effect latency in the adult dentate gyrus. Rather, the delayed response to serotonergic drugs with respect to endpoints downstream of the immediate receptor activity is largely due to the initially antagonistic and un-balanced action of different 5-HT
Rutkowski, Melanie R; Conejo-Garcia, Jose R
2015-08-01
We have reported that TLR5-mediated recognition of commensal microbiota modulates systemic tumor-promoting inflammation and malignant progression of tumors at distal locations. Approximately 7-10% of the general population harbors a deleterious single nucleotide polymorphism in TLR5, implicating a novel role for genetic variation during the initiation and progression of cancer.
Wu, Pingsheng; Larkin, Emma K; Reiss, Sara S; Carroll, Kecia N; Summar, Marshall L; Minton, Patricia A; Woodward, Kimberly B; Liu, Zhouwen; Islam, Jessica Y; Hartert, Tina V; Moore, Paul E
2015-09-14
Despite the significant interest in β2-Adrenergic receptor (ADRB2) polymorphisms related to asthma, whether ADRB2 genetic variants are similarly associated with acute respiratory tract infections have not been studied. We hypothesized that genetic variants in ADRB2 associated with a response to asthma therapy during an asthma exacerbation were also associated with severity of acute respiratory tract infections. To test this hypothesis, we genotyped 5 common polymorphisms in the promoter region and coding block of the ADRB2 gene (loci -2387, -2274, -1343, +46, and +79) from 374 Caucasian and African American term infants who were enrolled at the time of acute respiratory illness over four respiratory viral seasons. Severity of respiratory tract infections was measured using a bronchiolitis severity score (BSS; range = 0-12, clinically significant difference = 0.5) with a higher score indicating more severe disease. We assigned the promoter, coding and combined promoter and coding haplotypes to the unphased genotype data. The associations between each of these five single-nucleotide polymorphisms (SNPs) as well as the haplotypes and infant BSS were analyzed using nonparametric univariate analysis and multivariable proportional odds model separately in Caucasians and African Americans. There was no significant association between infant BSS and each of the SNPs in both Caucasians and African Americans. However, promoter haplotype CCA was associated with a decreased BSS in African Americans in a dose dependent manner. The median (interquartile range) BSS of infants with no copies of the CCA haplotype, one copy, and two copies of the CCA haplotype were 5.5 (2.0, 8.0), 4.0 (1.0, 7.5), and 3.0 (1.0, 4.0), respectively. This dose dependent relationship persisted after adjusting for infant age, gender, daycare exposure, secondhand smoke exposure, prior history of breastfeeding, siblings at home, and enrollment season (adjusted odds ratio: 0.59, 95% confidence
Directory of Open Access Journals (Sweden)
Jing Yang
2018-01-01
Full Text Available MicroRNAs play significant roles in the development of cancer and may serve as promising therapeutic targets. In our previous work, miR-219-5p was identified as one of the important metastasis-related microRNAs in HCC. Here we demonstrated that miR-219-5p expression was elevated in HCC tissues and was associated with vascular invasion and dismal prognosis. In multivariate analysis, miR-219-5p was identified as an independent prognostic indicator for HCC patients. Functional mechanism analyses showed that miR-219-5p promoted HCC cell proliferation and invasion in in vitro, as well as in vivo, tumor growth and metastasis in nude mice models bearing human HCC tumors. In addition, cadherin 1 (CDH1 was revealed to be a downstream target of miR-219-5p in HCC cells. In conclusion, miR-219-5p promotes tumor growth and metastasis of HCC by regulating CDH1 and can serve as a prognostic marker for HCC patients.
MRG15 activates the cdc2 promoter via histone acetylation in human cells
International Nuclear Information System (INIS)
Pena, AndreAna N.; Tominaga, Kaoru; Pereira-Smith, Olivia M.
2011-01-01
Chromatin remodeling is required for transcriptional activation and repression. MRG15 (MORF4L1), a chromatin modulator, is a highly conserved protein and is present in complexes containing histone acetyltransferases (HATs) as well as histone deacetylases (HDACs). Loss of expression of MRG15 in mice and Drosophila results in embryonic lethality and fibroblast and neural stem/progenitor cells cultured from Mrg15 null mouse embryos exhibit marked proliferative defects when compared with wild type cells. To determine the role of MRG15 in cell cycle progression we performed chromatin immunoprecipitation with an antibody to MRG15 on normal human fibroblasts as they entered the cell cycle from a quiescent state, and analyzed various cell cycle gene promoters. The results demonstrated a 3-fold increase in MRG15 occupancy at the cdc2 promoter during S phase of the cell cycle and a concomitant increase in acetylated histone H4. H4 lysine 12 was acetylated at 24 h post-serum stimulation while there was no change in acetylation of lysine 16. HDAC1 and 2 were decreased at this promoter during cell cycle progression. Over-expression of MRG15 in HeLa cells activated a cdc2 promoter-reporter construct in a dose-dependent manner, whereas knockdown of MRG15 resulted in decreased promoter activity. In order to implicate HAT activity, we treated cells with the HAT inhibitor anacardic acid and determined that HAT inhibition results in loss of expression of cdc2 mRNA. Further, chromatin immunoprecipitation with Tip60 localizes the protein to the same 110 bp stretch of the cdc2 promoter pulled down by MRG15. Additionally, we determined that cotransfection of MRG15 with the known associated HAT Tip60 had a cooperative effect in activating the cdc2 promoter. These results suggest that MRG15 is acting in a HAT complex involving Tip60 to modify chromatin via acetylation of histone H4 at the cdc2 promoter to activate transcription.
MRG15 activates the cdc2 promoter via histone acetylation in human cells
Energy Technology Data Exchange (ETDEWEB)
Pena, AndreAna N., E-mail: andreana.pena@gmail.com [Sam and Ann Barshop Institute for Longevity and Aging Studies, The University of Texas Health Science Center at San Antonio, San Antonio, TX (United States); Department of Cellular and Structural Biology, The University of Texas Health Science Center at San Antonio, San Antonio, TX (United States); Tominaga, Kaoru; Pereira-Smith, Olivia M. [Sam and Ann Barshop Institute for Longevity and Aging Studies, The University of Texas Health Science Center at San Antonio, San Antonio, TX (United States); Department of Cellular and Structural Biology, The University of Texas Health Science Center at San Antonio, San Antonio, TX (United States)
2011-07-01
Chromatin remodeling is required for transcriptional activation and repression. MRG15 (MORF4L1), a chromatin modulator, is a highly conserved protein and is present in complexes containing histone acetyltransferases (HATs) as well as histone deacetylases (HDACs). Loss of expression of MRG15 in mice and Drosophila results in embryonic lethality and fibroblast and neural stem/progenitor cells cultured from Mrg15 null mouse embryos exhibit marked proliferative defects when compared with wild type cells. To determine the role of MRG15 in cell cycle progression we performed chromatin immunoprecipitation with an antibody to MRG15 on normal human fibroblasts as they entered the cell cycle from a quiescent state, and analyzed various cell cycle gene promoters. The results demonstrated a 3-fold increase in MRG15 occupancy at the cdc2 promoter during S phase of the cell cycle and a concomitant increase in acetylated histone H4. H4 lysine 12 was acetylated at 24 h post-serum stimulation while there was no change in acetylation of lysine 16. HDAC1 and 2 were decreased at this promoter during cell cycle progression. Over-expression of MRG15 in HeLa cells activated a cdc2 promoter-reporter construct in a dose-dependent manner, whereas knockdown of MRG15 resulted in decreased promoter activity. In order to implicate HAT activity, we treated cells with the HAT inhibitor anacardic acid and determined that HAT inhibition results in loss of expression of cdc2 mRNA. Further, chromatin immunoprecipitation with Tip60 localizes the protein to the same 110 bp stretch of the cdc2 promoter pulled down by MRG15. Additionally, we determined that cotransfection of MRG15 with the known associated HAT Tip60 had a cooperative effect in activating the cdc2 promoter. These results suggest that MRG15 is acting in a HAT complex involving Tip60 to modify chromatin via acetylation of histone H4 at the cdc2 promoter to activate transcription.
Enhanced Photocatalytic Hydrogen Evolution by Loading Cd0.5Zn0.5S QDs onto Ni2P Porous Nanosheets.
Xiao, Lingfeng; Su, Tong; Wang, Zhuo; Zhang, Kun; Peng, Xiaoniu; Han, Yibo; Li, Quan; Wang, Xina
2018-02-02
Ni 2 P has been decorated on CdS nanowires or nanorods for efficient photocatalytic H 2 production, whereas the specific surface area remains limited because of the large size. Here, the composites of Cd 0.5 Zn 0.5 S quantum dots (QDs) on thin Ni 2 P porous nanosheets with high specific surface area were constructed for noble metal-free photocatalytic H 2 generation. The porous Ni 2 P nanosheets, which were formed by the interconnection of 15-30 nm-sized Ni 2 P nanoparticles, allowed the uniform loading of 7 nm-sized Cd 0.5 Zn 0.5 S QDs and the loading density being controllable. By tuning the content of Ni 2 P, H 2 generation rates of 43.3 μM h - 1 (1 mg photocatalyst) and 700 μM h - 1 (100 mg photocatalyst) and a solar to hydrogen efficiency of 1.5% were achieved for the Ni 2 P-Cd 0.5 Zn 0.5 S composites. The effect of Ni 2 P content on the light absorption, photoluminescence, and electrochemical property of the composite was systematically studied. Together with the band structure calculation based on density functional theory, the promotion of Ni 2 P in charge transfer and HER activity together with the shading effect on light absorption were revealed. Such a strategy can be applied to other photocatalysts toward efficient solar hydrogen generation.
Enhanced Photocatalytic Hydrogen Evolution by Loading Cd0.5Zn0.5S QDs onto Ni2P Porous Nanosheets
Xiao, Lingfeng; Su, Tong; Wang, Zhuo; Zhang, Kun; Peng, Xiaoniu; Han, Yibo; Li, Quan; Wang, Xina
2018-02-01
Ni2P has been decorated on CdS nanowires or nanorods for efficient photocatalytic H2 production, whereas the specific surface area remains limited because of the large size. Here, the composites of Cd0.5Zn0.5S quantum dots (QDs) on thin Ni2P porous nanosheets with high specific surface area were constructed for noble metal-free photocatalytic H2 generation. The porous Ni2P nanosheets, which were formed by the interconnection of 15-30 nm-sized Ni2P nanoparticles, allowed the uniform loading of 7 nm-sized Cd0.5Zn0.5S QDs and the loading density being controllable. By tuning the content of Ni2P, H2 generation rates of 43.3 μM h- 1 (1 mg photocatalyst) and 700 μM h- 1 (100 mg photocatalyst) and a solar to hydrogen efficiency of 1.5% were achieved for the Ni2P-Cd0.5Zn0.5S composites. The effect of Ni2P content on the light absorption, photoluminescence, and electrochemical property of the composite was systematically studied. Together with the band structure calculation based on density functional theory, the promotion of Ni2P in charge transfer and HER activity together with the shading effect on light absorption were revealed. Such a strategy can be applied to other photocatalysts toward efficient solar hydrogen generation.
Role of accentuation in the selection/rejection task framing effect.
Chen, Jing; Proctor, Robert W
2017-04-01
Procedure invariance is a basic assumption of rational theories of choice, however, it has been shown to be violated: Different response modes, or task frames, sometimes reveal opposite preferences. The current study focused on selection and rejection task frames, involving a unique type of problem with enriched and impoverished options, which has previously led to conflicting findings and theoretical explanations: the compatibility hypothesis (Shafir, 1993) and the accentuation hypothesis (Wedell, 1997). We examined the role of task frame by distinguishing these 2 hypotheses and evaluating the information-processing basis of the choices. Experiments conducted online (Experiments 1 and 3) and in-lab (Experiment 4 with eye-tracking technique) revealed a difference between the 2 task frames in the choice data (i.e., the task-framing effect) as a function of the relative attractiveness of the options. Also, this task-framing effect was not influenced by imposed time constraints (Experiments 5 and 6) and was similarly evident with a more direct measure for the option attractiveness (obtained in Experiment 7). Experiment 2, conducted in a lab setting with verbal-protocol requirements, yielded no task-framing effect, suggesting that a requirement to verbalize reasons for choice minimizes accentuation. With this exception, the choice data are in agreement with the accentuation hypothesis, and the combined findings in choice, decision time, task confusion, and eye-tracking data provide evidence of a basis in cognitive effort rather than motivation, as Wedell proposed. (PsycINFO Database Record (c) 2017 APA, all rights reserved).
2012-04-20
... Recommendation Development Review of Services for PTSD TBI. 2-2:15 p.m. Break. 2:15-4 p.m. Task Force...-3:15 p.m. Break. 3:15-5 p.m. Task Force Recommendation Development Review of Transition Outcomes, Do...: Wednesday, May 16, 2012 8-8:30 a.m. Public Forum. 8:30-9:30 a.m. Task Force Recommendation Development...
Giant magnetocaloric effect in Gd5(Si2Ge2 alloy with low purity Gd
Directory of Open Access Journals (Sweden)
Cleber Santiago Alves
2004-12-01
Full Text Available Gd5(Ge1-xSi x, x < 4 based alloys are potential candidates for magnetic refrigeration in the range ~20 - ~290 K. However, one of the greatest obstacles for the use of that technology in large scale is the utilization of high pure Gd metal (99.99 wt. (% to produce the GdGeSi alloys, since the impurity elements decrease the intensity of the magnetocaloric effect (EMC¹. In this work, we prove that annealing of the Gd5Ge2Si2 can promote remarkable values for the EMC in comparison to those obtained for the alloy with high pure Gd. Also, the as cast alloy and the annealed alloy are not monophasic, but have at least two crystalline phases in their microstructure. Results for X-ray analysis, optical and electronic microscopy and magnetization measurements are reported.
Li, Rui; Qu, Shuli; Zhang, Ping; Chattopadhyay, Sajal; Gregg, Edward W.; Albright, Ann; Hopkins, David; Pronk, Nicolaas P.
2016-01-01
Background Diabetes is a highly prevalent and costly disease. Studies indicate that combined diet and physical activity promotion programs can prevent type 2 diabetes among persons at increased risk. Purpose To systematically evaluate the evidence on cost, cost-effectiveness, and cost-benefit estimates of diet and physical activity promotion programs. Data Sources Cochrane Library, EMBASE, MEDLINE, PsycINFO, Sociological Abstracts, Web of Science, EconLit, and CINAHL through 7 April 2015. Study Selection English-language studies from high-income countries that provided data on cost, cost-effectiveness, or cost-benefit ratios of diet and physical activity promotion programs with at least 2 sessions over at least 3 months delivered to persons at increased risk for type 2 diabetes. Data Extraction Dual abstraction and assessment of relevant study details. Data Synthesis Twenty-eight studies were included. Costs were expressed in 2013 U.S. dollars. The median program cost per participant was $653. Costs were lower for group-based programs (median, $417) and programs implemented in community or primary care settings (median, $424) than for the U.S. DPP (Diabetes Prevention Program) trial and the DPP Outcomes Study ($5881). Twenty-two studies assessed the incremental cost-effectiveness ratios (ICERs) of the programs. From a health system perspective, 16 studies reported a median ICER of $13 761 per quality-adjusted life-year (QALY) saved. Group-based programs were more cost-effective (median, $1819 per QALY) than those that used individual sessions (median, $15 846 per QALY). No cost-benefit studies were identified. Limitation Information on recruitment costs and cost-effectiveness of translational programs implemented in community and primary care settings was limited. Conclusion Diet and physical activity promotion programs to prevent type 2 diabetes are cost-effective among persons at increased risk. Costs are lower when programs are delivered to groups in community
International Nuclear Information System (INIS)
Kiehl, Anita; Huang, Lili; Franchi, David; Anders, David G.
2003-01-01
The human cytomegalovirus (HCMV) UL57 gene lies adjacent to HCMV oriLyt, from which it is separated by an organizationally conserved, mostly noncoding region that is thought to both regulate UL57 expression and activate oriLyt function. However, the UL57 promoter has not been studied. We determined the 5' ends of UL57 transcripts toward an understanding of the potential relationship between UL57 expression and oriLyt activation. The results presented here identified three distinct 5' ends spread over 800 bp, at nt 90302, 90530, and 91138; use of these sites exhibited differential sensitivity to phosphonoformic acid treatment. Interestingly, a 10-kb UL57 transcript accumulated in cycloheximide-treated infected cells, even though other early transcripts were not detectable. However, the 10-kb transcript did not accumulate in cells treated with the more stringent translation inhibitor anisomycin. Consistent with the notion that the identified 5' ends arise from distinct transcription start sites, the sequences upstream of sites I and II functioned as promoters responsive to HCMV infection in transient assays. However, the origin-proximal promoter region III required downstream sequences for transcriptional activity. Mutation of candidate core promoter elements suggested that promoter III is regulated by an initiator region (Inr) and a downstream promoter element. Finally, a 42-bp sequence containing the candidate Inr activated a minimal oriLyt core construct in transient replication assays. Thus, these studies showed that a large, complex promoter region with novel features controls UL57 expression, and identified a sequence that regulates both UL57 transcription and oriLyt activation
3,4-Dibromo-2,2,5,5-tetraphenyl-2,5-dihydrofuran
Directory of Open Access Journals (Sweden)
Nadine Seidel
2018-04-01
Full Text Available The crystal structure of the title compound, C28H20Br2O, was solved in the orthorhombic space group P212121 with one molecule in the asymmetric unit. The phenyl rings are nearly planar and inclined at angles of 67.7 (1, 68.8 (1, 79.3 (1 and 62.3 (1° to the plane of the 2,5-dihydrofuran ring. The crystal structure features C—H...π and Br...Br interactions, which connect the molecules to a three-dimensional supramolecular network.
Directory of Open Access Journals (Sweden)
Hongying Zhang
2017-07-01
Full Text Available Drought, salinity, and cold are the major factors limiting wheat quality and productivity; it is thus highly desirable to characterize the abiotic-stress-inducible promoters suitable for the genetic improvement of plant resistance. The sucrose non-fermenting 1-related protein kinase 2 (SnRK2 family genes show distinct regulatory properties in response to abiotic stresses. The present study characterized the approximately 3000-bp upstream sequence (the 313 bp upstream of the ATG was the transcription start site of the Triticum aestivum TaSnRK2.8 promoter under abscisic acid (ABA and abiotic stresses. Four different-length 5′ deletion fragments of TaSnRK2.8 promoter were fused with the GUS reporter gene and transformed into Arabidopsis. Tissue expression analysis showed that the TaSnRK2.8 promoter region from position -1481 to -821 contained the stalk-specific elements, and the region from position -2631 to -1481 contained the leaf- and root-specific elements. In the ABA-treated seedlings, the deletion analysis showed that the TaSnRK2.8 promoter region from position -821 to -2631 contained ABA response elements. The abiotic stress responses of the TaSnRK2.8 promoter derivatives demonstrated that they harbored abiotic-stress response elements: the region from position -821 to -408 harbored the osmotic-stress response elements, whereas the region from position -2631 to -1481 contained the positive regulatory motifs and the region from position -1481 to -821 contained the leaf- and stalk-specific enhancers. Further deletion analysis of the promoter region from position -821 to -408 indicated that a 125-bp region from position -693 to -568 was required to induce an osmotic-stress response. These results contribute to a better understanding of the molecular mechanisms of TaSnRK2.8 in response to abiotic stresses, and the TaSnRK2.8 promoter seems to be a candidate for regulating the expression of abiotic stress response genes in transgenic plants.
An Experimental Study on the Effects of Different Reading Tasks on L2 Vocabulary Acquisition
Xu, Jianping
2009-01-01
This empirical study was undertaken to test the Involvement Load Hypothesis (Laufer and Hulstijn, 2001) by examining the impact of three tasks on vocabulary acquisition. It was designed to test and develop the involvement load hypothesis by examining the impact of different reading tasks on the L2 vocabulary acquisition. The results show that…
Solianik, Rima; Satas, Andrius; Mickeviciene, Dalia; Cekanauskaite, Agne; Valanciene, Dovile; Majauskiene, Daiva; Skurvydas, Albertas
2018-06-01
This study aimed to explore the effect of prolonged speed-accuracy motor task on the indicators of psychological, cognitive, psychomotor and motor function. Ten young men aged 21.1 ± 1.0 years performed a fast- and accurate-reaching movement task and a control task. Both tasks were performed for 2 h. Despite decreased motivation, and increased perception of effort as well as subjective feeling of fatigue, speed-accuracy motor task performance improved during the whole period of task execution. After the motor task, the increased working memory function and prefrontal cortex oxygenation at rest and during conflict detection, and the decreased efficiency of incorrect response inhibition and visuomotor tracking were observed. The speed-accuracy motor task increased the amplitude of motor-evoked potentials, while grip strength was not affected. These findings demonstrate that to sustain the performance of 2-h speed-accuracy task under conditions of self-reported fatigue, task-relevant functions are maintained or even improved, whereas less critical functions are impaired.
Pokemon and MEF2D co-operationally promote invasion of hepatocellular carcinoma.
Hong, Xin; Hong, Xing-Yu; Li, Tao; He, Cheng-Yan
2015-12-01
Hepatocellular carcinoma (HCC) is one of the most deadly human malignancy, and frequent invasion and metastasis is closely associated with its poor prognosis. However, the molecular mechanism underlying HCC invasion is still not completely elucidated. Pokemon is a well-established oncogene for HCC growth, but its contribution to HCC invasion has not been studied yet. In this paper, Pokemon was found to be overexpressed in MHCC-97H HCC cell line, which possesses higher invasiveness. Downregulation of Pokemon abolished the invasion of MHCC-97H HCC cell lines. Pokemon overexpression was able to enhance the invasion of MHCC-97L cells with lower invasiveness. MEF2D, an oncogene promoting the invasion of HCC cells, was further detected to be upregulated and downregulated when Pokemon was overexpressed and silenced, respectively. Online database analysis indicated that one Pokemon recognition site was located within the promoter of MEF2D. Chromatin co-precipitation, luciferase, and qPCR assays all proved that Pokemon can promote the expression of MEF2D in HCC cells. Restoration of MEF2D expression can prevent the impaired invasion of HCC cells with Pokemon silencing, while suppression of MEF2D abolished the effect of Pokemon overexpression on HCC invasion. More interestingly, MEF2D was also found to increase the transcription of Pokemon by binding myocyte enhancer factor 2 (MEF2) sites within its promoter region, implying an auto-regulatory circuit consisting of these two oncogenes that can promote HCC invasion. Our findings can contribute to the understanding of molecular mechanism underlying HCC invasion, and provided evidence that targeting this molecular loop may be a promising strategy for anti-invasion therapy.
Experimental evaluation of the influence of various rests on task performance
International Nuclear Information System (INIS)
Nagasaka, Akihiko; Hirose, Ayako
2000-01-01
This report deals with the result of the experiment that 8 subjects had executed adding task and search task. They executed each task in 80 minutes under 5 conditions: (1) with no rest, and with 4 kinds of 20 minutes rests, in which they (2) opened eyes, (3) closed eyes, (4) closed eyes with listening classic music and (5) closed eyes with feet massage, in the middle of the task. The results of analysis of variance with the task performance in the latter half, there were significant differences between each condition with every subject in adding task, and with 6 subjects in search task. However, the orders of the task performance with each condition were not the same by each subject. It was suggested that transition of the arousal levels under the rest was related to the effects of the rest rather than the subjects' taste in rests. In the rest, the percentage of α wave of electroencephalogram and the coefficient of variation of R-R interval (time interval of heart beats) were increased than in executing task. The mean Kendall's rank correlation of coefficient with the order of increase rate of α/β wave and the task performance in the latter half was slightly negative in adding task, but was about 0.4 in search task. From these results, about six requirements for 'an effective rest' were able to be mentioned, for example, 'the devices that raises the arousal levels is carried out just before a rest end'. (author)
Experimental evaluation of the influence of various rests on task performance
Energy Technology Data Exchange (ETDEWEB)
Nagasaka, Akihiko; Hirose, Ayako [Central Research Inst. of Electric Power Industry, Tokyo (Japan)
2000-01-01
This report deals with the result of the experiment that 8 subjects had executed adding task and search task. They executed each task in 80 minutes under 5 conditions: (1) with no rest, and with 4 kinds of 20 minutes rests, in which they (2) opened eyes, (3) closed eyes, (4) closed eyes with listening classic music and (5) closed eyes with feet massage, in the middle of the task. The results of analysis of variance with the task performance in the latter half, there were significant differences between each condition with every subject in adding task, and with 6 subjects in search task. However, the orders of the task performance with each condition were not the same by each subject. It was suggested that transition of the arousal levels under the rest was related to the effects of the rest rather than the subjects' taste in rests. In the rest, the percentage of {alpha} wave of electroencephalogram and the coefficient of variation of R-R interval (time interval of heart beats) were increased than in executing task. The mean Kendall's rank correlation of coefficient with the order of increase rate of {alpha}/{beta} wave and the task performance in the latter half was slightly negative in adding task, but was about 0.4 in search task. From these results, about six requirements for 'an effective rest' were able to be mentioned, for example, 'the devices that raises the arousal levels is carried out just before a rest end'. (author)
PB2 mutations D701N and S714R promote adaptation of an influenza H5N1 virus to a mammalian host.
Czudai-Matwich, Volker; Otte, Anna; Matrosovich, Mikhail; Gabriel, Gülsah; Klenk, Hans-Dieter
2014-08-01
Mutation D701N in the PB2 protein is known to play a prominent role in the adaptation of avian influenza A viruses to mammalian hosts. In contrast, little is known about the nearby mutations S714I and S714R, which have been observed in some avian influenza viruses highly pathogenic for mammals. We have generated recombinant H5N1 viruses with PB2 displaying the avian signature 701D or the mammalian signature 701N and serine, isoleucine, and arginine at position 714 and compared them for polymerase activity and virus growth in avian and mammalian cells, as well as for pathogenicity in mice. Mutation D701N led to an increase in polymerase activity and replication efficiency in mammalian cells and in mouse pathogenicity, and this increase was significantly enhanced when mutation D701N was combined with mutation S714R. Stimulation by mutation S714I was less distinct. These observations indicate that PB2 mutation S714R, in combination with the mammalian signature at position 701, has the potential to promote the adaptation of an H5N1 virus to a mammalian host. Influenza A/H5N1 viruses are avian pathogens that have pandemic potential, since they are spread over large parts of Asia, Africa, and Europe and are occasionally transmitted to humans. It is therefore of high scientific interest to understand the mechanisms that determine the host specificity and pathogenicity of these viruses. It is well known that the PB2 subunit of the viral polymerase is an important host range determinant and that PB2 mutation D701N plays an important role in virus adaptation to mammalian cells. In the present study, we show that mutation S714R is also involved in adaptation and that it cooperates with D701N in exposing a nuclear localization signal that mediates importin-α binding and entry of PB2 into the nucleus, where virus replication and transcription take place. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
NF45/ILF2 tissue expression, promoter analysis, and interleukin-2 transactivating function
International Nuclear Information System (INIS)
Zhao Guohua; Shi Lingfang; Qiu Daoming; Hu Hong; Kao, Peter N.
2005-01-01
NF45/ILF2 associates with NF90/ILF3 in the nucleus and regulates IL-2 gene transcription at the antigen receptor response element (ARRE)/NF-AT DNA target sequence (P.N. Kao, L. Chen, G. Brock, J. Ng, A.J. Smith, B. Corthesy, J. Biol. Chem. 269 (1994) 20691-20699). NF45 is widely expressed in normal tissues, especially testis, brain, and kidney, with a predominantly nuclear distribution. NF45 mRNA expression is increased in lymphoma and leukemia cell lines. The human and murine NF45 proteins differ only by substitution of valine by isoleucine at amino acid 142. Fluorescence in situ hybridization localized the human NF45 gene to chromosome 1q21.3, and mouse NF45 gene to chromosome 3F1. Promoter analysis of 2.5 kB of the murine NF45 gene reveals that significant activation is conferred by factors, possible including NF-Y, that bind to the CCAAT-box sequence. The function of human NF45 in regulating IL-2 gene expression was characterized in Jurkat T-cells stably transfected with plasmids directing expression of NF45 cDNA in sense or antisense orientations. NF45 sense expression increased IL-2 luciferase reporter gene activity 120-fold, and IL-2 protein expression 2-fold compared to control cells. NF45 is a highly conserved, regulated transcriptional activator, and one target gene is IL-2
Theory of Visual Attention (TVA) applied to mice in the 5-choice serial reaction time task
DEFF Research Database (Denmark)
Fitzpatrick, C. M.; Caballero-Puntiverio, M.; Gether, U.
2017-01-01
Rationale The 5-choice serial reaction time task (5-CSRTT) is widely used to measure rodent attentional functions. In humans, many attention studies in healthy and clinical populations have used testing based on Bundesen’s Theory of Visual Attention (TVA) to estimate visual processing speeds...... on an individual level. Scopolamine HBr dose-dependently reduced 5-CSRTT attentional performance while also increasing reward collection latency at the highest dose. Upon TVA modelling, scopolamine HBr significantly reduced visual processing speed at both doses, while having less pronounced effects on visual...... modelled using a new three-parameter version of TVA to obtain estimates of visual processing speeds, visual thresholds and motor response baselines in each mouse. Results The parameter estimates for each animal were reliable across sessions, showing that the data were stable enough to support analysis...
International Nuclear Information System (INIS)
Arcimowicz, B.; Joshi, Y.N.; Kaufman, V.
1989-01-01
The spectrum of antimony was photographed in the 575-2300 A region (1A 10 -10 m) using a hollow cathode and a triggered spark source. The analysis of the 5s 2 5p 2 - (5s 2 5p5d + 5s5p 3 + 5s 2 5p6s + 5s 2 5p7s) transitions in Sb II spectrum was revised and interpreted on the basis of multiconfiguration interaction calculations. Accurate wavelength measurements of Sb III lines lead to a revised ground-state 5s 2 5p 2 P interval value of 6574.5 cm -1 . (author). 15 refs., 9 tabs., 1 fig
Syntheses of [5-2H]-uracil, [5-2H]-cytosine, [6-2H]-uracil and [6-2H]-cytosine
International Nuclear Information System (INIS)
Kiritani, Reiko; Asano, Takeyoshi; Fujita, Shin-ichi; Dohmaru, Takaaki; Kawanishi, Tetsuro
1986-01-01
Syntheses of [5- 2 H]-, [6- 2 H]-uracil and [5- 2 H]-, [6- 2 H]-cytosine were investigated. The catalytic reaction of uracil or cytosine with 2 H 2 gas in alkaline media gave rise to [6- 2 H]-compounds almost exclusively. On the other hand, the reaction of 5-bromouracil or 5-bromocytosine with 2 H 2 gas gave rise to a mixture of [5- 2 H]-, [6- 2 H]- and [5- 2 H, 6- 2 H]-compounds depending on the experimental conditions. By controlling the temperature, the pressure of 2 H 2 gas and the amount of catalyst, [5- 2 H]-uracil and [5- 2 H]-cytosine were obtained. The isotopic distribution in each product was measured by 1 H NMR spectroscopy combined with an HPLC method. (author)
Simon, C; Kellou, N; Dugas, J; Platat, C; Copin, N; Schweitzer, B; Hausser, F; Bergouignan, A; Lefai, E; Blanc, S
2014-07-01
Obesity in youth remains a major public health issue. Yet no effective long-term preventive strategy exists. We previously showed that a school-based socio-ecological approach targeting behavior and social/environmental influences on physical activity (PA) prevented 4-year excessive weight gain in 12-year olds. In this study, we investigated if this efficacy persists 30 months after intervention cessation. The program targeted students, family, school and the living environment to promote/support PA and prevent sedentary behavior (SB). A total of 732 students from eight randomized middle schools completed the 4-year trial. At the 30-month post-trial follow-up, body mass index (BMI), fat mass index (FMI), leisure PA (LPA), home/school/workplace active commuting, TV/video time (TVT), and attitudes toward PA were measured in 531 adolescents. The beneficial effects of the intervention on the excess BMI increase (+0.01 vs +0.34 kg m(-2) in the intervention and control groups, respectively) and on the overweight incidence in initially non-overweight students (4.3% vs 8.6%; odds ratio=0.48 (95% confidence interval: 0.23-1.01)) were maintained at the post-trial follow-up. LPA was not maintained at the level achieved during the trial. However, we still observed a prevention of the age-related decrease of the adolescents' percentage reporting regular LPA (-14.4% vs -26.5%) and a higher intention to exercise in the intervention group. The intervention promoted lower TVT (-14.0 vs +13.6 min per day) and higher active commuting changes (+11.7% vs -4.8%). Trends in higher BMI reduction in students with high initial TVT and in the least wealthy group were noted. TVT changes throughout the follow-up predicted excess BMI and FMI changes. Long-term multilevel approach targeting PA and SB prevents excessive weight gain up to 30 months after intervention cessation. The efficacy may be higher in the most sedentary and least wealthy adolescents. Healthy PA-related behavior
Marketing and promoting solar water heaters to home builders
Energy Technology Data Exchange (ETDEWEB)
Keller, C.; Ghent, P.
1999-12-06
This is the final report of a four-task project to develop a marketing plan designed for businesses interested in marketing solar water heaters in the new home industry. This report outlines suggested marketing communication materials and other promotional tools focused on selling products to the new home builder. Information relevant to promoting products to the new home buyer is also included.
A 2.5D Map-Based Mobile Robot Localization via Cooperation of Aerial and Ground Robots.
Nam, Tae Hyeon; Shim, Jae Hong; Cho, Young Im
2017-11-25
Recently, there has been increasing interest in studying the task coordination of aerial and ground robots. When a robot begins navigation in an unknown area, it has no information about the surrounding environment. Accordingly, for robots to perform tasks based on location information, they need a simultaneous localization and mapping (SLAM) process that uses sensor information to draw a map of the environment, while simultaneously estimating the current location of the robot on the map. This paper aims to present a localization method based in cooperation between aerial and ground robots in an indoor environment. The proposed method allows a ground robot to reach accurate destination by using a 2.5D elevation map built by a low-cost RGB-D (Red Green and Blue-Depth) sensor and 2D Laser sensor attached onto an aerial robot. A 2.5D elevation map is formed by projecting height information of an obstacle using depth information obtained by the RGB-D sensor onto a grid map, which is generated by using the 2D Laser sensor and scan matching. Experimental results demonstrate the effectiveness of the proposed method for its accuracy in location recognition and computing speed.
A 2.5D Map-Based Mobile Robot Localization via Cooperation of Aerial and Ground Robots
Directory of Open Access Journals (Sweden)
Tae Hyeon Nam
2017-11-01
Full Text Available Recently, there has been increasing interest in studying the task coordination of aerial and ground robots. When a robot begins navigation in an unknown area, it has no information about the surrounding environment. Accordingly, for robots to perform tasks based on location information, they need a simultaneous localization and mapping (SLAM process that uses sensor information to draw a map of the environment, while simultaneously estimating the current location of the robot on the map. This paper aims to present a localization method based in cooperation between aerial and ground robots in an indoor environment. The proposed method allows a ground robot to reach accurate destination by using a 2.5D elevation map built by a low-cost RGB-D (Red Green and Blue-Depth sensor and 2D Laser sensor attached onto an aerial robot. A 2.5D elevation map is formed by projecting height information of an obstacle using depth information obtained by the RGB-D sensor onto a grid map, which is generated by using the 2D Laser sensor and scan matching. Experimental results demonstrate the effectiveness of the proposed method for its accuracy in location recognition and computing speed.
Klementyeva, Svetlana V; Gamer, Michael T; Schmidt, Anna-Corina; Meyer, Karsten; Konchenko, Sergey N; Roesky, Peter W
2014-10-13
The reaction of decamethylytterbocene [(η(5) -C5 Me5 )2 Yb(THF)2 ] with SO2 at low temperature gave two new compounds, namely, the Yb(III) dithionite/sulfinate complex [{(η(5) -C5 Me5 )2 Yb(μ3 ,1κ(2) O(1,3) ,2κ(3) O(2,2',4) -S2 O4 )}2 {(η(5) -C5 Me5 )Yb(μ,1κO,2κO'-C5 Me5 SO2 )}2 ] (1) and the Yb(III) dithionite complex [{(η(5) -C5 Me5 )2 Yb}2 (μ,1κ(2) O(1,3) ,2κ(2) O(2,4) -S2 O4 )] (2). After extraction of 1, the mixture was heated to give the dinuclear tetrasulfinate complex [{(η(5) -C5 Me5 )Yb}2 (μ,κO,κO'-C5 Me5 SO2 )4 ] (3 a). In contrast, from the reaction of [(η(5) -C5 Me5 )2 Eu(THF)2 ] with SO2 only the tetrasulfinate complex [{(η(5) -C5 Me5 )Eu}2 (μ,κO,κO'-C5 Me5 SO2 )4 ] (3 b) was isolated. Two major reaction pathways were observed: 1) reductive coupling of two SO2 molecules to form the dithionite anion S2 O4 (2-) ; and 2) nucleophilic attack of one metallocene C5 Me5 ligand on the sulfur atom of SO2 . The compounds presented are the first dithionite and sulfinate complexes of the f-elements. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Operation REDWING Commander Task Group 7.3, Operation Plan Number 1-56.
1956-01-24
Radio Circuit Description SI. Tab B - Radio Frequency Plan 7:: Tab C - Aircraft Radio Frequency List Tab D - Radio Circuit Diagram Appendix 2 - Radio...Frequency Plan C Aircraft Radio Frequency List D Radio Circuit Diagrams 2 - Radio Call Signs and Code ’Words N. ROHI5BE2 E LCDR, U. S. Navy Flag...appendix. TABS: A Radio Circuit Description B Radio Frequency Plan C Aircraft Radio Frequency List D Radio Circuit Diagrams Joint Task Force SEVEN Task
RLIM interacts with Smurf2 and promotes TGF-β induced U2OS cell migration
International Nuclear Information System (INIS)
Huang, Yongsheng; Yang, Yang; Gao, Rui; Yang, Xianmei; Yan, Xiaohua; Wang, Chenji; Jiang, Sirui; Yu, Long
2011-01-01
Highlights: → RLIM directly binds to Smurf2. → RLIM enhances TGF-β responsiveness in U2OS cells. → RLIM promotes TGF-β driven migration of osteosarcoma U2OS cells. -- Abstract: TGF-β (transforming growth factor-β), a pleiotropic cytokine that regulates diverse cellular processes, has been suggested to play critical roles in cell proliferation, migration, and carcinogenesis. Here we found a novel E3 ubiquitin ligase RLIM which can directly bind to Smurf2, enhancing TGF-β responsiveness in osteosarcoma U2OS cells. We constructed a U2OS cell line stably over-expressing RLIM and demonstrated that RLIM promoted TGF-β-driven migration of U2OS cells as tested by wound healing assay. Our results indicated that RLIM is an important positive regulator in TGF-β signaling pathway and cell migration.
Comparable Rest-related Promotion of Spatial Memory Consolidation in Younger and Older Adults
Craig, Michael; Wolbers, Thomas; Harris, Mathew A.; Hauff, Patrick; Della Sala, Sergio; Dewar, Michaela
2017-01-01
Flexible spatial navigation depends on cognitive mapping, a function that declines with increasing age. In young adults, a brief period of post-navigation rest promotes the consolidation/integration of spatial memories into accurate cognitive maps. We examined (1) whether rest promotes spatial memory consolidation/integration in older adults and (2) whether the magnitude of the rest benefit changes with increasing age. Young and older adults learned a route through a virtual environment, followed by a 10min delay comprising either wakeful rest or a perceptual task, and a subsequent cognitive mapping task, requiring the pointing to landmarks from different locations. Pointing accuracy was lower in the older than younger adults. However, there was a comparable rest-related enhancement in pointing accuracy in the two age groups. Together our findings suggest that (i) the age-related decline in cognitive mapping cannot be explained by increased consolidation interference in older adults, and (ii) as we grow older rest continues to support the consolidation/integration of spatial memories. PMID:27689512
Promoter de-methylation of cyclin D2 by sulforaphane in prostate cancer cells
Directory of Open Access Journals (Sweden)
Hsu Anna
2011-10-01
Full Text Available Abstract Sulforaphane (SFN, an isothiocyanate derived from cruciferous vegetables, induces potent anti-proliferative effects in prostate cancer cells. One mechanism that may contribute to the anti-proliferative effects of SFN is the modulation of epigenetic marks, such as inhibition of histone deacetylase (HDAC enzymes. However, the effects of SFN on other common epigenetic marks such as DNA methylation are understudied. Promoter hyper-methylation of cyclin D2, a major regulator of cell cycle, is correlated with prostate cancer progression, and restoration of cyclin D2 expression exerts anti-proliferative effects on LnCap prostate cancer cells. Our study aimed to investigate the effects of SFN on DNA methylation status of cyclin D2 promoter, and how alteration in promoter methylation impacts cyclin D2 gene expression in LnCap cells. We found that SFN significantly decreased the expression of DNA methyltransferases (DNMTs, especially DNMT1 and DNMT3b. Furthermore, SFN significantly decreased methylation in cyclin D2 promoter regions containing c-Myc and multiple Sp1 binding sites. Reduced methlyation of cyclin D2 promoter corresponded to an increase in cyclin D2 transcript levels, suggesting that SFN may de-repress methylation-silenced cyclin D2 by impacting epigenetic pathways. Our results demonstrated the ability of SFN to epigenetically modulate cyclin D2 expression, and provide novel insights into the mechanisms by which SFN may regulate gene expression as a prostate cancer chemopreventive agent.
RCP-driven α5β1 recycling suppresses Rac and promotes RhoA activity via the RacGAP1–IQGAP1 complex
Jacquemet, Guillaume; Green, David M.; Bridgewater, Rebecca E.; von Kriegsheim, Alexander; Humphries, Martin J.; Norman, Jim C.
2013-01-01
Inhibition of αvβ3 or expression of mutant p53 promotes invasion into fibronectin (FN)-containing extracellular matrix (ECM) by enhancing Rab-coupling protein (RCP)–dependent recycling of α5β1 integrin. RCP and α5β1 cooperatively recruit receptor tyrosine kinases, including EGFR1, to regulate their trafficking and downstream signaling via protein kinase B (PKB)/Akt, which, in turn, promotes invasive migration. In this paper, we identify a novel PKB/Akt substrate, RacGAP1, which is phosphorylated as a consequence of RCP-dependent α5β1 trafficking. Phosphorylation of RacGAP1 promotes its recruitment to IQGAP1 at the tips of invasive pseudopods, and RacGAP1 then locally suppresses the activity of the cytoskeletal regulator Rac and promotes the activity of RhoA in this subcellular region. This Rac to RhoA switch promotes the extension of pseudopodial processes and invasive migration into FN-containing matrices, in a RhoA-dependent manner. Thus, the localized endocytic trafficking of α5β1 within the tips of invasive pseudopods elicits signals that promote the reorganization of the actin cytoskeleton, protrusion, and invasion into FN-rich ECM. PMID:24019536
10 CFR 960.5-2-5 - Environmental quality.
2010-01-01
... 10 Energy 4 2010-01-01 2010-01-01 false Environmental quality. 960.5-2-5 Section 960.5-2-5 Energy... REPOSITORY Preclosure Guidelines Environment, Socioeconomics, and Transportation § 960.5-2-5 Environmental... repository siting, construction, operation, closure, and decommissioning, and projected environmental impacts...
Overexpression of HMGA2-LPP fusion transcripts promotes expression of the α 2 type XI collagen gene
International Nuclear Information System (INIS)
Kubo, Takahiro; Matsui, Yoshito; Goto, Tomohiro; Yukata, Kiminori; Yasui, Natsuo
2006-01-01
In a subset of human lipomas, a specific t (3; 12) chromosome translocation gives rise to HMGA2-LPP fusion protein, containing the amino (N)-terminal DNA binding domains of HMGA2 fused to the carboxyl (C)-terminal LIM domains of LPP. In addition to its role in adipogenesis, several observations suggest that HMGA2-LPP is linked to chondrogenesis. Here, we analyzed whether HMGA2-LPP promotes chondrogenic differentiation, a marker of which is transactivation of the α 2 type XI collagen gene (Col11a2). Real-time PCR analysis showed that HMGA2-LPP and COL11A2 were co-expressed. Luciferase assay demonstrated that either of HMGA2-LPP, wild-type HMGA2 or the N-terminal HMGA2 transactivated the Col11a2 promoter in HeLa cells, while the C-terminal LPP did not. RT-PCR analysis revealed that HMGA2-LPP transcripts in lipomas with the fusion were 591-fold of full-length HMGA2 transcripts in lipomas without the fusion. These results indicate that in vivo overexpression of HMGA2-LPP promotes chondrogenesis by upregulating cartilage-specific collagen gene expression through the N-terminal DNA binding domains
Collaborative interplay between FGF-2 and VEGF-C promotes lymphangiogenesis and metastasis
DEFF Research Database (Denmark)
Cao, Renhai; Ji, Hong; Feng, Ninghan
2012-01-01
Interplay between various lymphangiogenic factors in promoting lymphangiogenesis and lymphatic metastasis remains poorly understood. Here we show that FGF-2 and VEGF-C, two lymphangiogenic factors, collaboratively promote angiogenesis and lymphangiogenesis in the tumor microenvironment, leading...... endothelial cell tip cell formation is a prerequisite for FGF-2-stimulated lymphangiogenesis. In the tumor microenvironment, the reciprocal interplay between FGF-2 and VEGF-C collaboratively stimulated tumor growth, angiogenesis, intratumoral lymphangiogenesis, and metastasis. Thus, intervention and targeting...
Maxwell, Andrew; Holland, Edward; Cibik, Lisa; Fakadej, Anna; Foster, Gary; Grosinger, Les; Moyes, Andrew; Nielsen, Stephen; Silverstein, Steven; Toyos, Melissa; Weinstein, Arthur; Hartzell, Scott
2017-01-01
To assess the effectiveness and safety of a multifocal intraocular lens (IOL) with +2.5 diopter (D) additional power compared with a monofocal IOL. Fifteen sites in the United States. Prospective randomized patient- and observer-masked clinical trial. Randomized patients received multifocal or monofocal IOLs bilaterally. Visual acuity (33 cm, 40 cm, 53 cm, 60 cm, 4 m) was measured; safety was assessed through adverse event rates. Patient-reported visual outcomes were evaluated using the Visual Tasks questionnaire. The frequency and severity of visual disturbances were evaluated using the Assessment of Photic Phenomena and Lens EffectS questionnaire. The multifocal IOL (n = 155) provided better corrected distance visual acuity at 53 cm than the monofocal IOL (n = 165) (0.322 versus 0.512 logMAR; between-group difference, -0.190 logMAR; P < .0001) and 40 cm but not at 4 m. Ocular adverse event rates were less than 3.84% in both groups. Serious adverse event rates were comparable between the 2 IOL types. Patients with multifocal IOLs reported less difficulty with near tasks (with and without correction) and intermediate tasks (without correction). Difficulty with extended-intermediate and distance tasks was similar between groups. The most frequently reported self-rated severe phenomena were halos, starbursts, and glare. Most patients (monofocal ≥72%; multifocal ≥73%) reported never experiencing blurred, distorted, or double vision. The +2.5 D multifocal IOL provided better vision at 40 cm and 53 cm and similar vision at 4 m compared with the monofocal IOL. Safety profiles and visual phenomena were comparable between groups. Copyright © 2017 ASCRS and ESCRS. Published by Elsevier Inc. All rights reserved.
Changes in step-width during dual-task walking predicts falls.
Nordin, E; Moe-Nilssen, R; Ramnemark, A; Lundin-Olsson, L
2010-05-01
The aim was to evaluate whether gait pattern changes between single- and dual-task conditions were associated with risk of falling in older people. Dual-task cost (DTC) of 230 community living, physically independent people, 75 years or older, was determined with an electronic walkway. Participants were followed up each month for 1 year to record falls. Mean and variability measures of gait characteristics for 5 dual-task conditions were compared to single-task walking for each participant. Almost half (48%) of the participants fell at least once during follow-up. Risk of falling increased in individuals where DTC for performing a subtraction task demonstrated change in mean step-width compared to single-task walking. Risk of falling decreased in individuals where DTC for carrying a cup and saucer demonstrated change compared to single-task walking in mean step-width, mean step-time, and step-length variability. Degree of change in gait characteristics related to a change in risk of falling differed between measures. Prognostic guidance for fall risk was found for the above DTCs in mean step-width with a negative likelihood ratio of 0.5 and a positive likelihood ratio of 2.3, respectively. Findings suggest that changes in step-width, step-time, and step-length with dual tasking may be related to future risk of falling. Depending on the nature of the second task, DTC may indicate either an increased risk of falling, or a protective strategy to avoid falling. Copyright 2010. Published by Elsevier B.V.
Ultrasonics Promoted Synthesis of 5-(Pyrazol-4-yl-4,5-Dihydropyrazoles Derivatives
Directory of Open Access Journals (Sweden)
Manuel Nogueras
2013-04-01
Full Text Available A series of new 1,3-diaryl-5-(1-phenyl-3-methyl-5-chloropyrazol-4-yl-4,5-dihydropyrazole derivatives have been synthesized under sonication conditions in ethanol or methanol/glacial acetic acid mixture (5/1 ratio with two equivalents of hydrazines and seven kinds of chalcone-like heteroanalogues obtained from 5-chloro-3-methyl-1-phenyl-1H-pyrazole-4-carbaldehyde. The structures were established on the basis of NMR, IR, MS and element analysis. This method provides several advantages over current reaction methodologies, including a simple work-up procedure, shorter reaction times (2–20 min and good yields (65%–80%.
Five strands of math tasks big book : grades pk-2
Reed, Nat; Forest, Chris
2009-01-01
For grades PK-2, our Common Core State Standards-based resource meets the five strands of math concepts addressed by the NCTM standards and encourages the students to learn and review the concepts in unique ways. Included are challenging problem-solving tasks which will push the boundaries of critical thought and demonstrate to students the importance of mathematical problems in Number & Operations, Geometry, Measurement, Data Analysis & Probability and Algebra using real world situations.
Preschool physics: Using the invisible property of weight in causal reasoning tasks.
Wang, Zhidan; Williamson, Rebecca A; Meltzoff, Andrew N
2018-01-01
Causal reasoning is an important aspect of scientific thinking. Even young human children can use causal reasoning to explain observations, make predictions, and design actions to bring about specific outcomes in the physical world. Weight is an interesting type of cause because it is an invisible property. Here, we tested preschool children with causal problem-solving tasks that assessed their understanding of weight. In an experimental setting, 2- to 5-year-old children completed three different tasks in which they had to use weight to produce physical effects-an object displacement task, a balance-scale task, and a tower-building task. The results showed that the children's understanding of how to use object weight to produce specific object-to-object causal outcomes improved as a function of age, with 4- and 5-year-olds showing above-chance performance on all three tasks. The younger children's performance was more variable. The pattern of results provides theoretical insights into which aspects of weight processing are particularly difficult for preschool children and why they find it difficult.
Du, Hong; Guo, Hong-Li; Liu, Ya-Nan; Xie, Xiao; Liang, Kuang; Zhou, Xiao; Wang, Xin; Xu, An-Wu
2016-02-17
In the present work, metallic 1T-LixMoS2 is utilized as a novel cocatalyst for Cd0.5Zn0.5S photocatalyst. The obtained LixMoS2/Cd0.5Zn0.5S hybrids show excellent photocatalytic performance for H2 generation from aqueous solution containing Na2S and Na2SO3 under splitting visible light illumination (λ ≥ 420 nm) without precious metal cocatalysts. It turns out that a certain amount of intercalating Li(+) ions ultimately drives the transition of MoS2 crystal from semiconductor triagonal phase (2H phase) to metallic phase (1T phase). The distinct properties of 1T-LixMoS2 promote the efficient separation of photoexcited electrons and holes when used as cocatalyst for Cd0.5Zn0.5S photocatalyst. As compared to 2H-MoS2 nanosheets only having edge active sites, photoinduced electrons not only transfer to the edge sites of 1T-LixMoS2, but also to the plane active sites of 1T-LixMoS2 nanosheets. The content of LixMoS2 in hybrid photocatalysts influences the photocatalytic activity. The optimal 1T-LixMoS2 (1.0 wt %)/Cd0.5Zn0.5S nanojunctions display the best activity for hydrogen production, achieving a hydrogen evolution rate of 769.9 μmol h(-1), with no use of noble metal loading, which is about 3.5 times higher than that of sole Cd0.5Zn0.5S, and 2 times higher than that of 2H-MoS2 (1.0 wt %)/Cd0.5Zn0.5S samples. Our results demonstrate that Li(+)-intercalated MoS2 nanosheets with high conductivity, high densities of active sites, low cost, and environmental friendliness are a prominent H2 evolution cocatalyst that might substitute for noble metal for potential hydrogen energy applications.
Directory of Open Access Journals (Sweden)
Christopher A Hamm
Full Text Available Abnormal patterns of DNA methylation are observed in several types of human cancer. While localized DNA methylation of CpG islands has been associated with gene silencing, the effect that genome-wide loss of methylation has on tumorigenesis is not completely known. To examine its effect on tumorigenesis, we induced DNA demethylation in a rat model of human chondrosarcoma using 5-aza-2-deoxycytidine. Rat specific pyrosequencing assays were utilized to assess the methylation levels in both LINEs and satellite DNA sequences following 5-aza-2-deoxycytidine treatment. Loss of DNA methylation was accompanied by an increase in invasiveness of the rat chondrosarcoma cells, in vitro, as well as by an increase in tumor growth in vivo. Subsequent microarray analysis provided insight into the gene expression changes that result from 5-aza-2-deoxycytidine induced DNA demethylation. In particular, two genes that may function in tumorigenesis, sox-2 and midkine, were expressed at low levels in control cells but upon 5-aza-2-deoxycytidine treatment these genes became overexpressed. Promoter region DNA analysis revealed that these genes were methylated in control cells but became demethylated following 5-aza-2-deoxycytidine treatment. Following withdrawal of 5-aza-2-deoxycytidine, the rat chondrosarcoma cells reestablished global DNA methylation levels that were comparable to that of control cells. Concurrently, invasiveness of the rat chondrosarcoma cells, in vitro, decreased to a level indistinguishable to that of control cells. Taken together these experiments demonstrate that global DNA hypomethylation induced by 5-aza-2-deoxycytidine may promote specific aspects of tumorigenesis in rat chondrosarcoma cells.
Yan, Xiaohua; Wu, Jingyi; Jiang, Quanlong; Cheng, Hao; Han, Jing-Dong J; Chen, Ye-Guang
2018-02-01
Evading TGF-β-mediated growth inhibition is often associated with tumorigenesis in liver, including hepatocellular carcinoma (HCC). To better understand the functions and the underlying molecular mechanisms of TGF-β in HCC initiation and progression, we carried out transcriptome sequencing (RNA-Seq) to identify the target genes of TGF-β. CXXC5, a member of the CXXC-type zinc finger domain-containing protein family, was identified as a novel TGF-β target gene in Hep3B HCC cells. Knockdown of CXXC5 attenuated the expression of a substantial portion of TGF-β target genes and ameliorated TGF-β-induced growth inhibition or apoptosis of Hep3B cells, suggesting that CXXC5 is required for TGF-β-mediated inhibition of HCC progression. Analysis of the TCGA database indicated that CXXC5 expression is reduced in the majority of HCC tissue samples in comparison to that in normal tissues. Furthermore, CXXC5 associates with the histone deacetylase HDAC1 and competes its interaction with Smad2/3, thereby abolishing the inhibitory effect of HDAC1 on TGF-β signaling. These observations together suggest that CXXC5 may act as a tumor suppressor by promoting TGF-β signaling via a positive feedback loop, and reveal a strategy for HCC to bypass TGF-β-mediated cytostasis by disrupting the positive feedback regulation. Our findings shed new light on TGF-β signaling regulation and demonstrate the function of CXXC5 in HCC development.
Directory of Open Access Journals (Sweden)
Chunli Wang
Full Text Available The variation of G>T in the MUC5B promoter (rs35705950 has been associated with idiopathic pulmonary fibrosis (IPF and familial interstitial pneumonia (FIP in Caucasians, but no information is available regarding this variant in the Chinese population. We recruited 405 patients with interstitial lung diseases (ILD, including 165 IPF patients and 2043 healthy controls, for genotyping the MUC5B gene in the Chinese population. One hundred three patients with pneumonia and 360 patients with autoimmune diseases (ADs were recruited as disease controls. Our results indicated that the prevalence of the minor allele (T of the polymorphism rs35705950 in healthy Chinese subjects was approximately 0.66%, which was lower than that described in the Caucasian population. The frequencies of the T allele were 3.33% and 2.22% in IPF and ILD patients, respectively, and these values were significantly higher than those of healthy controls (P = 0.001, OR = 4.332 for IPF, and P = 0.002, OR = 2.855 for ILD. A stratified analysis showed that this variant in MUC5B associated with the risk for ILD mainly in older male Chinese subjects. No difference was observed between patients with pneumonia, AD patients, and healthy controls.
Non-SMC Element 2 (NSMCE2 of the SMC5/6 Complex Helps to Resolve Topological Stress
Directory of Open Access Journals (Sweden)
Dideke E. Verver
2016-10-01
Full Text Available The structural maintenance of chromosomes (SMC protein complexes shape and regulate the structure and dynamics of chromatin, thereby controlling many chromosome-based processes such as cell cycle progression, differentiation, gene transcription and DNA repair. The SMC5/6 complex is previously described to promote DNA double-strand breaks (DSBs repair by sister chromatid recombination, and found to be essential for resolving recombination intermediates during meiotic recombination. Moreover, in budding yeast, SMC5/6 provides structural organization and topological stress relief during replication in mitotically dividing cells. Despite the essential nature of the SMC5/6 complex, the versatile mechanisms by which SMC5/6 functions and its molecular regulation in mammalian cells remain poorly understood. By using a human osteosarcoma cell line (U2OS, we show that after the CRISPR-Cas9-mediated removal of the SMC5/6 subunit NSMCE2, treatment with the topoisomerase II inhibitor etoposide triggered an increased sensitivity in cells lacking NSMCE2. In contrast, NSMCE2 appeared not essential for a proper DNA damage response or cell survival after DSB induction by ionizing irradiation (IR. Interestingly, by way of immunoprecipitations (IPs and mass spectrometry, we found that the SMC5/6 complex physically interacts with the DNA topoisomerase II α (TOP2A. We therefore propose that the SMC5/6 complex functions in resolving TOP2A-mediated DSB-repair intermediates generated during replication.
Effects of the potential 5-HT7 receptor agonist AS 19 in an autoshaping learning task.
Perez-García, Georgina S; Meneses, A
2005-08-30
This work aimed to evaluate further the role of 5-HT7 receptors during memory formation in an autoshaping Pavlovian/instrumental learning task. Post-training administration of the potential 5-HT7 receptor agonist AS 19 or antagonist SB-269970 enhanced memory formation or had no effect, respectively. The AS 19 facilitatory effect was reversed by SB-269970, but not by the selective 5-HT1A antagonist WAY100635. Amnesia induced by scopolamine (cholinergic antagonist) or dizocilpine (NMDA antagonist) was also reversed by AS 19. Certainly, reservations regarding the selectivity of AS 19 for 5-HT7 and other 5-HT receptors in vivo are noteworthy and, therefore, its validity for use in animal models as a pharmacological tool. Having mentioned that, it should be noticed that together these data are providing further support to the notion of the 5-HT7 receptors role in memory formation. Importantly, this 5-HT7 receptor agonist AS 19 appears to represent a step forward respect to the notion that potent and selective 5-HT7 receptor agonists can be useful in the treatment of dysfunctional memory in aged-related decline and Alzheimer's disease.
The 5-choice continuous performance test: evidence for a translational test of vigilance for mice.
Directory of Open Access Journals (Sweden)
Jared W Young
Full Text Available Attentional dysfunction is related to functional disability in patients with neuropsychiatric disorders such as schizophrenia, bipolar disorder, and Alzheimer's disease. Indeed, sustained attention/vigilance is among the leading targets for new medications designed to improve cognition in schizophrenia. Although vigilance is assessed frequently using the continuous performance test (CPT in humans, few tests specifically assess vigilance in rodents.We describe the 5-choice CPT (5C-CPT, an elaboration of the 5-choice serial reaction (5CSR task that includes non-signal trials, thus mimicking task parameters of human CPTs that use signal and non-signal events to assess vigilance. The performances of C57BL/6J and DBA/2J mice were assessed in the 5C-CPT to determine whether this task could differentiate between strains. C57BL/6J mice were also trained in the 5CSR task and a simple reaction-time (RT task involving only one choice (1CRT task. We hypothesized that: 1 C57BL/6J performance would be superior to DBA/2J mice in the 5C-CPT as measured by the sensitivity index measure from signal detection theory; 2 a vigilance decrement would be observed in both strains; and 3 RTs would increase across tasks with increased attentional load (1CRT task<5CSR task<5C-CPT.C57BL/6J mice exhibited superior SI levels compared to DBA/2J mice, but with no difference in accuracy. A vigilance decrement was observed in both strains, which was more pronounced in DBA/2J mice and unaffected by response bias. Finally, we observed increased RTs with increased attentional load, such that 1CRT task<5CSR task<5C-CPT, consistent with human performance in simple RT, choice RT, and CPT tasks. Thus we have demonstrated construct validity for the 5C-CPT as a measure of vigilance that is analogous to human CPT studies.
The effect of emotions, promotion vs. prevention focus, and feedback on cognitive engagement
Directory of Open Access Journals (Sweden)
Wytykowska Agata
2015-09-01
Full Text Available The purpose of the study was to explore the role of emotions, promotion-prevention orientation and feedback on cognitive engagement. In the experiment participants had the possibility to engage in a categorization task thrice. After the first categorization all participants were informed that around 75% of their answers were correct. After the second categorization, depending on the experimental condition, participants received feedback either about success or failure. Involvement in the third categorization was depended on participants’ decision whether to take part in it or not. Each time, before and after categorization, the emotional state was assessed. Results showed that promotion orientation predicted experiencing curiosity before the task, which in turn led to a higher cognitive engagement in the first categorization. Promotion and prevention orientation moderated the type of emotional response to positive feedback. Promotion orientation also predicted cognitive engagement after the feedback of success was provided. Generally results confirmed the positive effect of positive emotions as well as promotion orientation on cognitive engagement.
Task reports of INFCE Working Group 6
International Nuclear Information System (INIS)
Task 1 Report summarizes on a country-by-country basis the data supplied by the participating states related to nuclear power forecast, spent fuel generation, AR storage capacity, AFR storage capacity, AFR storage and transport systems. Task Reports 2-5 analyse the spent fuel storage and transport situation according to reactor types. Information on the technical description of spent fuel existing storage and transport techniques and techniques under development and on costs is given. Task 6 summarizes the present legal framework for spent fuel management related to licensing, safety, environmental and physical protection, accounting and control of nuclear material by states, non-proliferation of nuclear weapons, assurances for national access to nuclear material contained in spent fuel, and protection of technology. The institutional practice for spent fuel storage and transport is described. For the period up to the year 2025 a prognosis and recommendations related to legal framework and institutional models are given. The special needs of developing countries and industrialized countries with a limited nuclear power programme with respect to spent fuel management are analysed in Task Reports 7 and 8
Gade, Miriam; Souza, Alessandra S; Druey, Michel D; Oberauer, Klaus
2017-01-01
Working memory (WM) holds and manipulates representations for ongoing cognition. Oberauer (Psychology of Learning and Motivation, 51, 45-100, 2009) distinguishes between two analogous WM sub-systems: a declarative WM which handles the objects of thought, and a procedural WM which handles the representations of (cognitive) actions. Here, we assessed whether analogous effects are observed when participants switch between memory sets (declarative representations) and when they switch between task sets (procedural representations). One mechanism assumed to facilitate switching in procedural WM is the inhibition of previously used, but currently irrelevant task sets, as indexed by n-2 task-repetition costs (Mayr & Keele, Journal of Experimental Psychology: General, 129(1), 4-26, 2000). In this study we tested for an analogous effect in declarative WM. We assessed the evidence for n-2 list-repetition costs across eight experiments in which participants switched between memory lists to perform speeded classifications, mental arithmetic, or a local recognition test. N-2 list-repetition costs were obtained consistently in conditions assumed to increase interference between memory lists, and when lists formed chunks in long-term memory. Further analyses across experiments revealed a substantial contribution of episodic memory to n-2 list-repetition costs, thereby questioning the interpretation of n-2 repetition costs as reflecting inhibition. We reanalyzed the data of eight task-switching experiments, and observed that episodic memory also contributes to n-2 task-repetition costs. Taken together, these results show analogous processing principles in declarative and procedural WM, and question the relevance of inhibitory processes for efficient switching between mental sets.
TME (Task Mapping Editor): tool for executing distributed parallel computing. TME user's manual
International Nuclear Information System (INIS)
Takemiya, Hiroshi; Yamagishi, Nobuhiro; Imamura, Toshiyuki
2000-03-01
At the Center for Promotion of Computational Science and Engineering, a software environment PPExe has been developed to support scientific computing on a parallel computer cluster (distributed parallel scientific computing). TME (Task Mapping Editor) is one of components of the PPExe and provides a visual programming environment for distributed parallel scientific computing. Users can specify data dependence among tasks (programs) visually as a data flow diagram and map these tasks onto computers interactively through GUI of TME. The specified tasks are processed by other components of PPExe such as Meta-scheduler, RIM (Resource Information Monitor), and EMS (Execution Management System) according to the execution order of these tasks determined by TME. In this report, we describe the usage of TME. (author)
Hong, Ki-Bae; Park, Yooheon; Suh, Hyung Joo
2016-04-01
This study was to investigate the sleep promoting effects of combined γ-aminobutyric acid (GABA) and 5-hydroxytryptophan (5-HTP), by examining neuronal processes governing mRNA level alterations, as well as assessing neuromodulator concentrations, in a fruit fly model. Behavioral assays were applied to investigate subjective nighttime activity, sleep episodes, and total duration of subjective nighttime sleep of two amino acids and GABA/5-HTP mixture with caffeine treated flies. Also, real-time PCR and HPLC analysis were applied to analyze the signaling pathway. Subjective nighttime activity and sleep patterns of individual flies significantly decreased with 1% GABA treatment in conjunction with 0.1% 5-HTP treatment (pGABA/5-HTP mixture resulted in significant differences between groups related to sleep patterns (40%, plevels of the GABAB receptor (GABAB-R1) and serotonin receptor (5-HT1A), compared to the control group. In addition, GABA/5-HTP mixture significantly increased GABA levels 1h and 12h following treatment (2.1 fold and 1.2 fold higher than the control, respectively) and also increased 5-HTP levels (0 h: 1.01 μg/protein, 12h: 3.45 μg/protein). In this regard, we successfully demonstrated that using a GABA/5-HTP mixture modulates subjective nighttime activity, sleep episodes, and total duration of subjective nighttime sleep to a greater extent than single administration of each amino acid, and that this modulation occurs via GABAergic and serotonergic signaling. Copyright © 2016 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Viana Antonio AB
2011-11-01
Full Text Available Abstract Background Cotton (Gossypium spp. is an important crop worldwide that provides raw material to 40% of the textile fiber industry. Important traits have been studied aiming the development of genetically modified crops including resistance to insect and diseases, and tolerance to drought, cold and herbicide. Therefore, the characterization of promoters and regulatory regions is also important to achieve high gene expression and/or a specific expression pattern. Commonly, genes involved in ubiquitination pathways are highly and differentially expressed. In this study, we analyzed the expression of a cotton ubiquitin-conjugating enzyme (E2 family member with no previous characterization. Results Nucleotide analysis revealed high identity with cotton E2 homologues. Multiple alignment showed a premature stop codon, which prevents the encoding of the conserved cysteine residue at the E2 active site, and an intron that is spliced in E2 homologues, but not in GhGDRP85. The GhGDRP85 gene is highly expressed in different organs of cotton plants, and has high transcript levels in roots. Its promoter (uceApro2 and the 5'UTR compose a regulatory region named uceA1.7, and were isolated from cotton and studied in Arabidopsis thaliana. uceA1.7 shows strong expression levels, equaling or surpassing the expression levels of CaMV35S. The uceA1.7 regulatory sequence drives GUS expression 7-fold higher in flowers, 2-fold in roots and at similar levels in leaves and stems. GUS expression levels are decreased 7- to 15-fold when its 5'UTR is absent in uceApro2. Conclusions uceA1.7 is a strong constitutive regulatory sequence composed of a promoter (uceApro2 and its 5'UTR that will be useful in genetic transformation of dicots, having high potential to drive high levels of transgene expression in crops, particularly for traits desirable in flower and root tissues.
Bloomberg, Jacob J.; Mulavara, Ajitkumar; Peters, Brian T.; Rescheke, Millard F.; Wood, Scott; Lawrence, Emily; Koffman, Igor; Ploutz-Snyder, Lori; Spiering, Barry A.; Feeback, Daniel L.;
2009-01-01
This slide presentation reviews the Functional Task Test (FTT), an interdisciplinary testing regimen that has been developed to evaluate astronaut postflight functional performance and related physiological changes. The objectives of the project are: (1) to develop a set of functional tasks that represent critical mission tasks for the Constellation Program, (2) determine the ability to perform these tasks after space flight, (3) Identify the key physiological factors that contribute to functional decrements and (4) Use this information to develop targeted countermeasures.
Mizuguchi, Hitoshi; Matsuda, Yuki; Mori, Takehito; Uehara, Atsushi; Ishikawa, Yuta; Endo, Masatoshi; Shida, Junichi
2008-02-01
A new visual colorimetry for trace antimony(V) based on ion-pair solid-phase extraction to a PTFE-type membrane filter with bis[2-(5-chloro-2-pyridylazo)-5-diethylaminophenolato]cobalt(III) ion ([Co(5-Cl-PADAP)(2)](+)) has been developed. Experiments showed that hexachloroantimonate(V) ion (SbCl(6)(-)) was adsorbed with [Co(5-Cl-PADAP)(2)](+) to the front surface of the PTFE filter. The adsorption of antimony(V) ion was promoted by the addition of lithium chloride as a source of chloride ion. The excess reagent of [Co(5-Cl-PADAP)(2)](+) was eluted by rinsing with a 10 wt% methanol aqueous solution. In this case, the slow rate of the hydrolysis reaction of SbCl(6)(-) and the difference of the hydrophobicity of the ion pairs were important for adsorption and separation with a PTFE-type membrane filter. The antimony(V) concentration was determined through a visual comparison with a standard series. The visual detection limit was 0.10 microg. The calibration curve assessed with the reflection spectrometric responses at 580 nm was linear in the concentration range of 0.10 - 1.2 microg (r = 0.996). The proposed method has been applied to the determination of sub-microgram levels of antimony(V) ion in water samples.
Two-dimensional systolic-array architecture for pixel-level vision tasks
Vijverberg, Julien A.; de With, Peter H. N.
2010-05-01
This paper presents ongoing work on the design of a two-dimensional (2D) systolic array for image processing. This component is designed to operate on a multi-processor system-on-chip. In contrast with other 2D systolic-array architectures and many other hardware accelerators, we investigate the applicability of executing multiple tasks in a time-interleaved fashion on the Systolic Array (SA). This leads to a lower external memory bandwidth and better load balancing of the tasks on the different processing tiles. To enable the interleaving of tasks, we add a shadow-state register for fast task switching. To reduce the number of accesses to the external memory, we propose to share the communication assist between consecutive tasks. A preliminary, non-functional version of the SA has been synthesized for an XV4S25 FPGA device and yields a maximum clock frequency of 150 MHz requiring 1,447 slices and 5 memory blocks. Mapping tasks from video content-analysis applications from literature on the SA yields reductions in the execution time of 1-2 orders of magnitude compared to the software implementation. We conclude that the choice for an SA architecture is useful, but a scaled version of the SA featuring less logic with fewer processing and pipeline stages yielding a lower clock frequency, would be sufficient for a video analysis system-on-chip.
AHP2, AHP3, and AHP5 act downstream of CKI1 in Arabidopsis female gametophyte development.
Liu, Zhenning; Yuan, Li; Song, Xiaoya; Yu, Xiaolin; Sundaresan, Venkatesan
2017-06-15
Histidine phosphotransfer proteins (HPs) are key elements of the two-component signaling system, which act as a shuttle to transfer phosphorylation signals from histidine kinases (HKs) to response regulators (RRs). CYTOKININ INDEPENDENT 1 (CKI1), a key regulator of central cell specification in the Arabidopsis female gametophyte, activates the cytokinin signaling pathway through the Arabidopsis histidine phosphotransfer proteins (AHPs). There are five HP genes in Arabidopsis, AHP1-AHP5, but it remains unknown which AHP genes act downstream of CKI1 in Arabidopsis female gametophyte development. Promoter activity analysis of AHP1-AHP5 in embryo sacs revealed AHP1, AHP2, AHP3, and AHP5 expression in the central cell. Phenotypic studies of various combinations of ahp mutants showed that triple mutations in AHP2, AHP3, and AHP5 resulted in defective embryo sac development. Using cell-specific single and double markers in the female gametophyte, the ahp2-2 ahp3 ahp5-2/+ triple mutant ovules showed loss of central cell and antipodal cell fates and gain of egg cell or synergid cell attributes, resembling the cki1 mutant phenotypes. These data suggest that AHP2, AHP3, and AHP5 are the major factors acting downstream of CKI1 in the two-component cytokinin signaling pathway to promote Arabidopsis female gametophyte development. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology.
Tasks that May Occasion Mathematical Creativity: Teachers' Choices
Levenson, Esther
2013-01-01
Promoting mathematical creativity is one of the aims of mathematics education. This study investigates the tasks teachers chose when their aim was to occasion mathematical creativity in the classroom. Five cases are described in depth, and general trends found among these cases as well as in additional data are discussed. Findings indicated that…
Storbeck, Justin; Davidson, Nicole A; Dahl, Chelsea F; Blass, Sara; Yung, Edwin
2015-01-01
We examined whether positive and negative affect motivates verbal and spatial working memory processes, respectively, which have implications for the expenditure of mental effort. We argue that when emotion promotes cognitive tendencies that are goal incompatible with task demands, greater cognitive effort is required to perform well. We sought to investigate whether this increase in cognitive effort impairs behavioural control over a broad domain of self-control tasks. Moreover, we predicted that individuals with higher behavioural inhibition system (BIS) sensitivities would report more negative affect within the goal incompatible conditions because such individuals report higher negative affect during cognitive challenge. Positive or negative affective states were induced followed by completing a verbal or spatial 2-back working memory task. All participants then completed one of three self-control tasks. Overall, we observed that conditions of emotion and working memory incompatibility (positive/spatial and negative/verbal) performed worse on the self-control tasks, and within the incompatible conditions individuals with higher BIS sensitivities reported more negative affect at the end of the study. The combination of findings suggests that emotion and working memory compatibility reduces cognitive effort and impairs behavioural control.
Hawaii Energy Strategy Project 2: Fossil Energy Review. Task IV. Scenario development and analysis
Energy Technology Data Exchange (ETDEWEB)
Yamaguchi, N.D.; Breazeale, K. [ed.
1993-12-01
The Hawaii Energy Strategy (HES) Program is a seven-project effort led by the State of Hawaii Department of Business, Economic Development & Tourism (DBEDT) to investigate a wide spectrum of Hawaii energy issues. The East-West Center`s Program on Resources: Energy and Minerals, has been assigned HES Project 2, Fossil Energy Review, which focuses on fossil energy use in Hawaii and the greater regional and global markets. HES Project 2 has four parts: Task I (World and Regional Fossil Energy Dynamics) covers petroleum, natural gas, and coal in global and regional contexts, along with a discussion of energy and the environment. Task II (Fossil Energy in Hawaii) focuses more closely on fossil energy use in Hawaii: current utilization and trends, the structure of imports, possible future sources of supply, fuel substitutability, and energy security. Task III`s emphasis is Greenfield Options; that is, fossil energy sources not yet used in Hawaii. This task is divided into two sections: first, an in-depth {open_quotes}Assessment of Coal Technology Options and Implications for the State of Hawaii,{close_quotes} along with a spreadsheet analysis model, which was subcontracted to the Environmental Assessment and Information Sciences Division of Argonne National Laboratory; and second, a chapter on liquefied natural gas (LNG) in the Asia-Pacific market and the issues surrounding possible introduction of LNG into the Hawaii market.
Mutational analysis of the UCP2 core promoter and relationships of variants with obesity
DEFF Research Database (Denmark)
Dalgaard, Louise T; Andersen, Gitte; Larsen, Lesli H
2003-01-01
To identify polymorphisms in the human uncoupling protein 2 gene (UCP2) promoter and to investigate whether these were associated with obesity or weight gain.......To identify polymorphisms in the human uncoupling protein 2 gene (UCP2) promoter and to investigate whether these were associated with obesity or weight gain....
Cheng, Jen-Wei; Chiu, Wei-La; Chang, Yi-Ying; Johnstone, Stewart
2014-01-01
This study aims to investigate the interactive effects of task performance and impression management tactics on career outcomes from the socioanalytic perspective. Based on a survey of 195 employee-supervisor dyads from various industries in Taiwan, a hierarchical regression analysis revealed that (1) the relationship between task performance and a one-year salary adjustment was greater among employees who frequently employ ingratiation than among those who do not, (2) the relationship between task performance and a one-year salary adjustment was greater among employees who frequently employ exemplification than among those who do not, and (3) the relationship between task performance and career satisfaction was greater among employees who frequently employ self-promotion than among those who do not. This study concludes by suggesting implications for research and practice, and offers some directions for future research.
Gene Expression in Class 2 Integrons Is SOS-Independent and Involves Two Pc Promoters.
Jové, Thomas; Da Re, Sandra; Tabesse, Aurore; Gassama-Sow, Amy; Ploy, Marie-Cécile
2017-01-01
Integrons are powerful bacterial genetic elements that permit the expression and dissemination of antibiotic-resistance gene cassettes. They contain a promoter Pc that allows the expression of gene cassettes captured through site-specific recombination catalyzed by IntI, the integron-encoded integrase. Class 1 and 2 integrons are found in both clinical and environmental settings. The regulation of intI and of Pc promoters has been extensively studied in class 1 integrons and the regulatory role of the SOS response on intI expression has been shown. Here we investigated class 2 integrons. We characterized the P intI2 promoter and showed that intI2 expression is not regulated via the SOS response. We also showed that, unlike class 1 integrons, class 2 integrons possess not one but two active Pc promoters that are located within the attI2 region that seem to contribute equally to gene cassette expression. Class 2 integrons mostly encode an inactive truncated integrase, but the rare class 2 integrons that encode an active integrase are associated with less efficient Pc2 promoter variants. We propose an evolutionary model for class 2 integrons in which the absence of repression of the integrase gene expression led to mutations resulting in either inactive integrase or Pc variants of weaker activity, thereby reducing the potential fitness cost of these integrons.
Directory of Open Access Journals (Sweden)
Jimena E. Díaz
2016-09-01
Full Text Available The first general procedure for the synthesis of 5 to 7-membered 1-aryl-2-iminoazacycloalkanes is presented, by microwave-assisted ring closure of ω-arylaminonitriles promoted by polyphosphoric acid (PPA esters. 1-Aryl-2-iminopyrrolidines were easily prepared from the acyclic precursors employing a chloroformic solution of ethyl polyphosphate (PPE. The use of trimethylsilyl polyphosphate (PPSE in solvent-free conditions allowed for the synthesis of 1-aryl-2-iminopiperidines and hitherto unreported 1-aryl-2-iminoazepanes. The cyclization reaction involves good to high yields and short reaction times, and represents a novel application of PPA esters in heterocyclic synthesis.
Uchida, Shotaro; Sato, Hiroki; Yoneda, Misako; Kai, Chieko
2016-09-01
Nipah virus belongs to the genus Henipavirus in the family Paramyxoviridae, and its RNA genome is larger than those of other paramyxoviruses because it has long untranslated regions (UTRs) in each gene. However, the functions of these UTRs are not fully understood. In this study, we investigated the functions of the 5' UTRs and found that the 5' UTR of the M gene upregulated the translation of a reporter gene. Using an RNA pull-down assay, we showed that eukaryotic elongation factor 1-beta (EEF1B2) interacts with nucleotides 81-100 of the M 5' UTR and specifically enhances its translation efficiency. Our results suggest that the M 5' UTR promotes the production of M protein and viral budding by recruiting EEF1B2.
Effect of alcohol and divided attention task on simulated driving performance of young drivers
FREYDIER , Chloé; BERTHELON , Catherine; Bastien-Toniazzo , Mireille; GINEYT , Guy
2013-01-01
The aim of this study is to evaluate driving impairment linked to divided attention task and alcohol and determinate if it is higher for novice drivers compared to more experienced drivers. Sixteen novice drivers and sixteen experienced drivers participated in three experimental sessions corresponding to blood alcohol concentration [BAC] of 0.0 g/L, 0.2 g/L and 0.5 g/L. They performed a divided attention task [car-following task combined with a number parity identification task], and their re...
Ozaki, Tomoka; Matsuoka, Junki; Tsubota, Maho; Tomita, Shiori; Sekiguchi, Fumiko; Minami, Takeshi; Kawabata, Atsufumi
2018-01-15
Ca v 3.2 T-type Ca 2+ channel activity is suppressed by zinc that binds to the extracellular histidine-191 of Ca v 3.2, and enhanced by H 2 S that interacts with zinc. Ca v 3.2 in nociceptors is upregulated in an activity-dependent manner. The enhanced Ca v 3.2 activity by H 2 S formed by the upregulated cystathionine-γ-lyase (CSE) is involved in the cyclophosphamide (CPA)-induced cystitis-related bladder pain in mice. We thus asked if zinc deficiency affects the cystitis-related bladder pain in mice by altering Ca v 3.2 function and/or expression. Dietary zinc deficiency for 2 weeks greatly decreased zinc concentrations in the plasma but not bladder tissue, and enhanced the bladder pain/referred hyperalgesia (BP/RH) following CPA at 200mg/kg, a subeffective dose, but not 400mg/kg, a maximal dose, an effect abolished by pharmacological blockade or gene silencing of Ca v 3.2. Acute zinc deficiency caused by systemic N,N,N',N'-tetrakis-(2-pyridylmethyl)-ethylendiamine (TPEN), a zinc chelator, mimicked the dietary zinc deficiency-induced Ca v 3.2-dependent promotion of BP/RH following CPA at 200mg/kg. CPA at 400mg/kg alone or TPEN plus CPA at 200mg/kg caused Ca v 3.2 overexpression accompanied by upregulation of Egr-1 and USP5, known to promote transcriptional expression and reduce proteasomal degradation of Ca v 3.2, respectively, in the dorsal root ganglia (DRG). The CSE inhibitor, β-cyano-l-alanine, prevented the BP/RH and upregulation of Ca v 3.2, Egr-1 and USP5 in DRG following TPEN plus CPA at 200mg/kg. Together, zinc deficiency promotes bladder pain accompanying CPA-induced cystitis by enhancing function and expression of Ca v 3.2 in nociceptors, suggesting a novel therapeutic avenue for treatment of bladder pain, such as zinc supplementation. Copyright © 2017 Elsevier B.V. All rights reserved.