WorldWideScience

Sample records for targeting nrf2 signaling

  1. Targeting NRF2 signaling for cancer chemoprevention

    International Nuclear Information System (INIS)

    Kwak, Mi-Kyoung; Kensler, Thomas W.

    2010-01-01

    Modulation of the metabolism and disposition of carcinogens through induction of cytoprotective enzymes is one of several promising strategies to prevent cancer. Chemopreventive efficacies of inducers such as dithiolethiones and sulforaphane have been extensively studied in animals as well as in humans. The KEAP1-NRF2 system is a key, but not unilateral, molecular target for these chemopreventive agents. The transcription factor NRF2 (NF-E2-related factor 2) is a master regulator of the expression of a subset of genes, which produce proteins responsible for the detoxication of electrophiles and reactive oxygen species as well as the removal or repair of some of their damage products. It is believed that chemopreventive enzyme inducers affect the interaction between KEAP1 and NRF2 through either mediating conformational changes of the KEAP1 protein or activating phosphorylation cascades targeting the KEAP1-NRF2 complex. These events in turn affect NRF2 stability and trafficking. Recent advances elucidating the underlying structural biology of KEAP1-NRF2 signaling and identification of the gene clusters under the transcriptional control of NRF2 are facilitating understanding of the potential pleiotropic effects of NRF2 activators and discovery of novel classes of potent chemopreventive agents such as the triterpenoids. Although there is appropriately a concern regarding a deleterious role of the KEAP1-NRF2 system in cancer cell biology, especially as the pathway affects cell survival and drug resistance, the development and the use of NRF2 activators as chemopreventive agents still holds a great promise for protection of normal cells from a diversity of environmental stresses that contribute to the burden of cancer and other chronic, degenerative diseases.

  2. Antihyperalgesic Properties of Honokiol in Inflammatory Pain Models by Targeting of NF-κB and Nrf2 Signaling

    Directory of Open Access Journals (Sweden)

    Sidra Khalid

    2018-03-01

    Full Text Available The present study investigates the possible anti-nociceptive effect of intraperitoneal (i.p. honokiol: a phenolic compound originally isolated from Magnolia officinalis, in acute and chronic inflammatory pain models. Doses of 0.1, 5, and 10 mg/kg honokiol were administered in carrageenan induced pain and the dose (honokiol 10 mg/kg i.p. with most significant response among behavioral tests was selected for further experiments. The i.p. administration of honokiol inhibits mechanical hyperalgesia, mechanical allodynia, and thermal hyperalgesia, without causing any apparent toxicity. To elucidate the effect of honokiol on various cytokines and antioxidant enzymes, quantitative real-time-PCR was performed to determine the expression levels of pro-inflammatory cytokines and antioxidant enzymes. It is demonstrated that honokiol significantly reduced the expression levels of tumor necrosis factor (TNF-α, interleukin-1β (IL-1β, interleukin-6 (IL-6, and vascular endothelial growth factor (VEGF. Similarly, honokiol was also found to potentiate the expression of nuclear factor erythroid 2–related factor 2 (Nrf2, superoxide dismutase 2 (SOD2, and heme oxygenase-1 (HO-1 levels. Additionally, honokiol significantly reduced plasma nitrite levels as compared to complete Freund’s adjuvant (CFA induced group. X-ray analysis and hematoxylin and eosin (H&E staining of inflamed and treated paws showed that honokiol reduced the inflammation with significantly less leukocyte infiltration and soft tissue inflammation. In order to explore the possible mechanism of action of honokiol, agonists [piroxicam (5 mg/kg, tramadol (50 mg/kg, and gabapentin (5 mg/kg i.p.] as well as antagonists [naloxone (4 mg/kg, olanzapine (10 mg/kg, and flumazenil (0.2 mg/kg i.p.] were used to study involvement of various receptors on the anti-nociceptive effect of honokiol. The potential side effects of honokiol on muscle activity were assessed. An adverse effect testing of honokiol by

  3. Activation of anti-oxidant Nrf2 signaling by enone analogues of curcumin.

    Science.gov (United States)

    Deck, Lorraine M; Hunsaker, Lucy A; Vander Jagt, Thomas A; Whalen, Lisa J; Royer, Robert E; Vander Jagt, David L

    2018-01-01

    Inflammation and oxidative stress are common in many chronic diseases. Targeting signaling pathways that contribute to these conditions may have therapeutic potential. The transcription factor Nrf2 is a major regulator of phase II detoxification and anti-oxidant genes as well as anti-inflammatory and neuroprotective genes. Nrf2 is widespread in the CNS and is recognized as an important regulator of brain inflammation. The natural product curcumin exhibits numerous biological activities including ability to induce the expression of Nrf2-dependent phase II and anti-oxidant enzymes. Curcumin has been examined in a number of clinical studies with limited success, mainly owing to limited bioavailability and rapid metabolism. Enone analogues of curcumin were examined with an Nrf2 reporter assay to identify Nrf2 activators. Analogues were separated into groups with a 7-carbon dienone spacer, as found in curcumin; a 5-carbon enone spacer with and without a ring; and a 3-carbon enone spacer. Activators of Nrf2 were found in all three groups, many of which were more active than curcumin. Dose-response studies demonstrated that a range of substituents on the aromatic rings of these enones influenced not only the sensitivity to activation, reflected in EC 50 values, but also the extent of activation, which suggests that multiple mechanisms are involved in the activation of Nrf2 by these analogues. Copyright © 2017. Published by Elsevier Masson SAS.

  4. Targeting of the Glutathione, Thioredoxin, and Nrf2 Antioxidant Systems in Head and Neck Cancer.

    Science.gov (United States)

    Roh, Jong-Lyel; Jang, Hyejin; Kim, Eun Hye; Shin, Daiha

    2017-07-10

    The glutathione (GSH), thioredoxin (Trx), and Nrf2 systems represent a major defense against reactive oxygen species (ROS), the cellular imbalance of which in cancer promotes growth and therapeutic resistance. This study investigated whether targeting the GSH, Trx, and Nrf2 antioxidant systems effectively eliminated head and neck cancer (HNC). At high concentrations, auranofin, but not buthionine sulfoximine (BSO) alone, decreased the viability of HNC, whereas even at low concentrations, auranofin plus BSO synergized to kill HNC cells. Dual silencing of the genes for GCLM and TrxR1 induced GSH depletion, Trx activity inhibition, and ROS accumulation, synergistically killing HNC cells. Inhibition of the GSH and Trx systems resulted in activation of the Nrf2-antioxidant response element (ARE) pathway, which may result in suboptimal GSH and Trx inhibition where HNC is resistant. Genetic inhibition of Nrf2 and/or HO-1 or trigonelline enhanced growth suppression, ROS accumulation, and cell death from GSH and Trx inhibition. The in vivo effects of GSH, Trx, and Nrf2 system inhibition were confirmed in a mouse HNC xenograft model by achieving growth inhibition >60% compared with those of control. Innovations: This study is the first to show that triple inhibition of GSH, Trx, and Nrf2 pathways could be an effective method to overcome the resistance of HNC. Inhibition of the Nrf2-ARE pathway in addition to dual inhibition of the GSH and Trx antioxidant systems can effectively eliminate resistant HNC. Antioxid. Redox Signal. 27, 106-114.

  5. Nrf2 regulates cellular behaviors and Notch signaling in oral squamous cell carcinoma cells.

    Science.gov (United States)

    Fan, Hong; Paiboonrungruan, Chorlada; Zhang, Xinyan; Prigge, Justin R; Schmidt, Edward E; Sun, Zheng; Chen, Xiaoxin

    2017-11-04

    Oxidative stress is known to play a pivotal role in the development of oral squamous cell carcinoma (OSCC). We have demonstrated that activation of the nuclear factor erythroid 2-related factor 2 (Nrf2) signaling pathway has chemopreventive effects against oxidative stress-associated OSCC. However, Nrf2 have dual roles in cancer development; while it prevents carcinogenesis of normal cells, hyperactive Nrf2 also promotes the survival of cancer cells. This study is aimed to understand the function of Nrf2 in regulating cellular behaviors of OSCC cells, and the potential mechanisms through which Nrf2 facilitates OSCC. We established the Nrf2-overexpressing and Nrf2-knockdown OSCC cell lines, and examined the function of Nrf2 in regulating cell proliferation, migration, invasion, cell cycle and colony formation. Our data showed that Nrf2 overexpression promoted cancer phenotypes in OSCC cells, whereas Nrf2 silencing inhibited these phenotypes. In addition, Nrf2 positively regulated Notch signaling pathway in OSCC cells in vitro. Consistent with this observation, Nrf2 activation in Keap1 -/- mice resulted in not only hyperproliferation of squamous epithelial cells in mouse tongue as evidenced by increased expression of PCNA, but also activation of Notch signaling in these cells as evidenced by increased expression of NICD1 and Hes1. In conclusion, Nrf2 regulates cancer behaviors and Notch signaling in OSCC cells. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Targeted deletion of Nrf2 reduces urethane-induced lung tumor development in mice.

    Directory of Open Access Journals (Sweden)

    Alison K Bauer

    Full Text Available Nrf2 is a key transcription factor that regulates cellular redox and defense responses. However, permanent Nrf2 activation in human lung carcinomas promotes pulmonary malignancy and chemoresistance. We tested the hypothesis that Nrf2 has cell survival properties and lack of Nrf2 suppresses chemically-induced pulmonary neoplasia by treating Nrf2(+/+ and Nrf2(-/- mice with urethane. Airway inflammation and injury were assessed by bronchoalveolar lavage analyses and histopathology, and lung tumors were analyzed by gross and histologic analysis. We used transcriptomics to assess Nrf2-dependent changes in pulmonary gene transcripts at multiple stages of neoplasia. Lung hyperpermeability, cell death and apoptosis, and inflammatory cell infiltration were significantly higher in Nrf2(-/- mice compared to Nrf2(+/+ mice 9 and 11 wk after urethane. Significantly fewer lung adenomas were found in Nrf2(-/- mice than in Nrf2(+/+ mice at 12 and 22 wk. Nrf2 modulated expression of genes involved cell-cell signaling, glutathione metabolism and oxidative stress response, and immune responses during early stage neoplasia. In lung tumors, Nrf2-altered genes had roles in transcriptional regulation of cell cycle and proliferation, carcinogenesis, organismal injury and abnormalities, xenobiotic metabolism, and cell-cell signaling genes. Collectively, Nrf2 deficiency decreased susceptibility to urethane-induced lung tumorigenesis in mice. Cell survival properties of Nrf2 were supported, at least in part, by reduced early death of initiated cells and heightened advantage for tumor cell expansion in Nrf2(+/+ mice relative to Nrf2(-/- mice. Our results were consistent with the concept that Nrf2 over-activation is an adaptive response of cancer conferring resistance to anti-cancer drugs and promoting malignancy.

  7. Nrf2 and Notch Signaling in Lung Cancer: Near the Crossroad

    Directory of Open Access Journals (Sweden)

    Angelo Sparaneo

    2016-01-01

    Full Text Available The transcription factor Nrf2 (NF-E2 related factor 2 is a master regulator of the cell antioxidant response associated with tumor growth and resistance to cytotoxic treatments. In particular, Nrf2 induces upregulation of cytoprotective genes by interacting with the closely situated AREs (Antioxidant Response Elements in response to endogenous or exogenous stress stimuli and takes part to several oncogenic signaling pathways. Among these, the crosstalk with Notch pathway has been shown to enhance cytoprotection and maintenance of cellular homeostasis, tissue organization by modulating cell proliferation kinetics, and stem cell self-renewal in several organs. The role of Notch and Nrf2 related pathways in tumorigenesis is highly variable and when they are both abnormally activated they can synergistically cause neoplastic proliferation by promoting cell survival, differentiation, invasion, and metastases. NFE2L2, KEAP1, and NOTCH genes family appear in the list of significantly mutated genes in tumors in both combined and individual sets, supporting the crucial role that the aberrant Nrf2-Notch crosstalk might have in cancerogenesis. In this review, we summarize current knowledge about the alterations of Nrf2 and Notch pathways and their reciprocal transcriptional regulation throughout tumorigenesis and progression of lung tumors, supporting the potentiality of putative biomarkers and therapeutic targets.

  8. A newly synthesized macakurzin C-derivative attenuates acute and chronic skin inflammation: The Nrf2/heme oxygenase signaling as a potential target

    Energy Technology Data Exchange (ETDEWEB)

    Akram, Muhammad [College of Pharmacy Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan (Korea, Republic of); Shin, Iljin [College of Pharmacy and Research Institute of Pharmaceutical Science and Technology (RIPST), Ajou University, Suwon (Korea, Republic of); Kim, Kyeong-A; Noh, Dabi [College of Pharmacy Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan (Korea, Republic of); Baek, Seung-Hoon; Chang, Sun-Young [College of Pharmacy and Research Institute of Pharmaceutical Science and Technology (RIPST), Ajou University, Suwon (Korea, Republic of); Kim, Hyoungsu, E-mail: hkimajou@ajou.ac.kr [College of Pharmacy and Research Institute of Pharmaceutical Science and Technology (RIPST), Ajou University, Suwon (Korea, Republic of); Bae, Ok-Nam, E-mail: onbae@hanyang.ac.kr [College of Pharmacy Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan (Korea, Republic of)

    2016-09-15

    Impaired immune responses in skin play a pivotal role in the development and progression of chemical-associated inflammatory skin disorders. In this study, we synthesized new flavonoid derivatives from macakurzin C, and identified in vitro and in vivo efficacy of a potent anti-inflammatory flavonoid, Compound 14 (CPD 14), with its underlying mechanisms. In lipopolysaccharide (LPS)-stimulated murine macrophages and IFN-γ/TNF-α-stimulated human keratinocytes, CPD 14 significantly inhibited the release of inflammatory mediators including nitric oxide (NO), prostaglandins, and cytokines (IC{sub 50} for NO inhibition in macrophages: 4.61 μM). Attenuated NF-κB signaling and activated Nrf2/HO-1 pathway were responsible for the anti-inflammatory effects of CPD 14. The in vivo relevance was examined in phorbol 12-myristate 13-acetate (TPA)-induced acute skin inflammation and oxazolone-induced atopic dermatitis models. Topically applied CPD 14 significantly protected both irritation- and sensitization-associated skin inflammation by suppressing the expression of inflammatory mediators. In summary, we demonstrated that a newly synthesized flavonoid, CPD 14, has potent inhibitory effects on skin inflammation, suggesting it is a potential therapeutic candidate to treat skin disorders associated with excessive inflammation. - Highlights: • An anti-inflammatory flavonoid CPD 14 was newly synthesized from macakurzin C. • CPD 14 potently inhibited inflammatory reaction in keratinocytes and macrophages. • Dermal toxicity by irritation or sensitization in rats was protected by CPD 14. • Attenuated NF-κB and activated Nrf2/HO-1 were main mechanisms of CPD 14 action.

  9. Escin activates AKT-Nrf2 signaling to protect retinal pigment epithelium cells from oxidative stress

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Kaijun [Eye Center, The 2nd Affiliated Hospital, Medical College of Zhejiang University, Hangzhou (China); Zhejiang Provincial Key Lab of Ophthalmology, Hangzhou (China); Jiang, Yiqian [The First People Hospital of Xiaoshan, Hangzhou (China); Wang, Wei; Ma, Jian [Eye Center, The 2nd Affiliated Hospital, Medical College of Zhejiang University, Hangzhou (China); Zhejiang Provincial Key Lab of Ophthalmology, Hangzhou (China); Chen, Min, E-mail: eyedrchenminzj@163.com [Eye Center, The 2nd Affiliated Hospital, Medical College of Zhejiang University, Hangzhou (China); Zhejiang Provincial Key Lab of Ophthalmology, Hangzhou (China)

    2015-12-25

    Here we explored the anti-oxidative and cytoprotective potentials of escin, a natural triterpene-saponin, against hydrogen peroxide (H{sub 2}O{sub 2}) in retinal pigment epithelium (RPE) cells. We showed that escin remarkably attenuated H{sub 2}O{sub 2}-induced death and apoptosis of established (ARPE-19) and primary murine RPE cells. Meanwhile, ROS production and lipid peroxidation by H{sub 2}O{sub 2} were remarkably inhibited by escin. Escin treatment in RPE cells resulted in NF-E2-related factor 2 (Nrf2) signaling activation, evidenced by transcription of anti-oxidant-responsive element (ARE)-regulated genes, including HO-1, NQO-1 and SRXN-1. Knockdown of Nrf2 through targeted shRNAs/siRNAs alleviated escin-mediated ARE gene transcription, and almost abolished escin-mediated anti-oxidant activity and RPE cytoprotection against H{sub 2}O{sub 2}. Reversely, escin was more potent against H{sub 2}O{sub 2} damages in Nrf2-over-expressed ARPE-19 cells. Further studies showed that escin-induced Nrf2 activation in RPE cells required AKT signaling. AKT inhibitors (LY294002 and perifosine) blocked escin-induced AKT activation, and dramatically inhibited Nrf2 phosphorylation, its cytosol accumulation and nuclear translocation in RPE cells. Escin-induced RPE cytoprotection against H{sub 2}O{sub 2} was also alleviated by the AKT inhibitors. Together, these results demonstrate that escin protects RPE cells from oxidative stress possibly through activating AKT-Nrf2 signaling.

  10. Novel Hematopoietic Target Genes in the NRF2-Mediated Transcriptional Pathway

    Directory of Open Access Journals (Sweden)

    Michelle R. Campbell

    2013-01-01

    Full Text Available Nuclear factor- (erythroid-derived 2 like 2 (NFE2L2, NRF2 is a key transcriptional activator of the antioxidant response pathway and is closely related to erythroid transcription factor NFE2. Under oxidative stress, NRF2 heterodimerizes with small Maf proteins and binds cis-acting enhancer sequences found near oxidative stress response genes. Using the dietary isothiocyanate sulforaphane (SFN to activate NRF2, chromatin immunoprecipitation sequencing (ChIP-seq identified several hundred novel NRF2-mediated targets beyond its role in oxidative stress. Activated NRF2 bound the antioxidant response element (ARE in promoters of several known and novel target genes involved in iron homeostasis and heme metabolism, including known targets FTL and FTH1, as well as novel binding in the globin locus control region. Five novel NRF2 target genes were chosen for followup: AMBP, ABCB6, FECH, HRG-1 (SLC48A1, and TBXAS1. SFN-induced gene expression in erythroid K562 and lymphoid cells were compared for each target gene. NRF2 silencing showed reduced expression in lymphoid, lung, and hepatic cells. Furthermore, stable knockdown of NRF2 negative regulator KEAP1 in K562 cells resulted in increased NQO1, AMBP, and TBXAS1 expression. NFE2 binding sites in K562 cells revealed similar binding profiles as lymphoid NRF2 sites in all potential NRF2 candidates supporting a role for NRF2 in heme metabolism and erythropoiesis.

  11. Direct Keap1-Nrf2 disruption as a potential therapeutic target for Alzheimer's disease.

    Directory of Open Access Journals (Sweden)

    Fiona Kerr

    2017-03-01

    Full Text Available Nrf2, a transcriptional activator of cell protection genes, is an attractive therapeutic target for the prevention of neurodegenerative diseases, including Alzheimer's disease (AD. Current Nrf2 activators, however, may exert toxicity and pathway over-activation can induce detrimental effects. An understanding of the mechanisms mediating Nrf2 inhibition in neurodegenerative conditions may therefore direct the design of drugs targeted for the prevention of these diseases with minimal side-effects. Our study provides the first in vivo evidence that specific inhibition of Keap1, a negative regulator of Nrf2, can prevent neuronal toxicity in response to the AD-initiating Aβ42 peptide, in correlation with Nrf2 activation. Comparatively, lithium, an inhibitor of the Nrf2 suppressor GSK-3, prevented Aβ42 toxicity by mechanisms independent of Nrf2. A new direct inhibitor of the Keap1-Nrf2 binding domain also prevented synaptotoxicity mediated by naturally-derived Aβ oligomers in mouse cortical neurons. Overall, our findings highlight Keap1 specifically as an efficient target for the re-activation of Nrf2 in AD, and support the further investigation of direct Keap1 inhibitors for the prevention of neurodegeneration in vivo.

  12. N-acetylcysteine Ameliorates Prostatitis via miR-141 Regulating Keap1/Nrf2 Signaling.

    Science.gov (United States)

    Wang, Liang-Liang; Huang, Yu-Hua; Yan, Chun-Yin; Wei, Xue-Dong; Hou, Jian-Quan; Pu, Jin-Xian; Lv, Jin-Xing

    2016-04-01

    Chronic prostatitis was the most common type of prostatitis and oxidative stress was reported to be highly elevated in prostatitis patients. In this study, we determined the effect of N-acetylcysteine (NAC) on prostatitis and the molecular mechanism involved in it. Male Sprague-Dawley rats were divided into three groups: control group (group A, n = 20), carrageenan-induced chronic nonbacterial prostatitis (CNP) model group (group B, n = 20), and carrageenan-induced CNP model group with NAC injection (group C, n = 20). Eye score, locomotion score, inflammatory cell count, cyclooxygenase 2 (COX2) expression, and Evans blue were compared in these three groups. The expression of miR-141 was determined by quantitative real-time PCR (qRT-PCR). Moreover, protein expressions of Kelch-like ECH-associated protein-1 (Keap1) and nuclear factor erythroid-2 related factor 2 (Nrf2) and its target genes were examined by Western blot. Luciferase reporter assay was performed in RWPE-1 cells transfected miR-141 mimic or inhibitor and the plasmid carrying 3'-UTR of Keap1. The value of eye score, locomotion score, inflammatory cell count, and Evans blue were significantly decreased in group C, as well as the expression of COX2, when comparing to that of group B. These results indicated that NAC relieved the carrageenan-induced CNP. Further, we found that NAC increased the expression of miR-141 and activated the Keap1/Nrf2 signaling. Luciferase reporter assay revealed that miR-141 mimic could suppress the activity of Keap1 and stimulate the downstream target genes of Nrf2. In addition, miR-141 inhibitor could reduce the effect of NAC on prostatitis. NAC ameliorates the carrageenan-induced prostatitis and prostate inflammation pain through miR-141 regulating Keap1/Nrf2 signaling.

  13. Perspectives of the Nrf-2 signaling pathway in cancer progression and therapy

    Directory of Open Access Journals (Sweden)

    Priyanka Basak

    Full Text Available The Nuclear factor erythroid2-related factor2 (Nrf2, a master regulator of redox homoeostasis, is a key transcription factor regulating a wide array of genes for antioxidant and detoxification enzymes. It protects organs from various kinds of toxic insults. On the other hand, activation of Nrf2 is also correlated with cancer progression and chemoresistance. Downregulation of Nrf2 activity has attracted an increasing amount of attention as it may provide an alternative cancer therapy. In this review, we examine recent studies on roles of Nrf2 in several pathophysiological conditions emphasising cancer. We discuss elaborately the current knowledge on Nrf2 regulation including KEAP1-dependent and KEAP1-independent cascades. KEAP1/Nrf2 system is a master regulator of cellular response against a variety of environmental stresses. We also highlight several tightly controlled regulations of Nrf2 by numerous proteins, small molecules, toxic metals, etc. In addition, we evaluate the possible therapeutic approaches of increasing chemosensitivity via modulating Nrf2 signaling. Keywords: Nrf2, Transcription factor, KEAP1, Oxidative stress, Cell proliferation, Carcinogenesis, Chemoprevention

  14. Salidroside Suppresses HUVECs Cell Injury Induced by Oxidative Stress through Activating the Nrf2 Signaling Pathway

    Directory of Open Access Journals (Sweden)

    Yao Zhu

    2016-08-01

    Full Text Available Oxidative stress plays an important role in the pathogenesis of cardiovascular diseases. Salidroside (SAL, one of the main effective constituents of Rhodiola rosea, has been reported to suppress oxidative stress-induced cardiomyocyte injury and necrosis by promoting transcription of nuclear factor E2-related factor 2 (Nrf2-regulated genes such as heme oxygenase-1 (HO-1 and NAD(PH dehydrogenase (quinone1 (NQO1. However, it has not been indicated whether SAL might ameliorate endothelial injury induced by oxidative stress. Here, our study demonstrated that SAL might suppress HUVEC cell injury induced by oxidative stress through activating the Nrf2 signaling pathway. The results of our study indicated that SAL decreased the levels of intercellular reactive oxygen species (ROS and malondialdehyde (MDA, and improved the activities of superoxide dismutase (SOD and catalase (CAT, resulting in protective effects against oxidative stress-induced cell damage in HUVECs. It suppressed oxidative stress damage by inducing Nrf2 nuclear translocation and activating the expression of Nrf2-regulated antioxidant enzyme genes such as HO-1 and NQO1 in HUVECs. Knockdown of Nrf2 with siRNA abolished the cytoprotective effects against oxidative stress, decreased the expression of Nrf2, HO-1, and NQO1, and inhibited the nucleus translocation of Nrf2 in HUVECs. This study is the first to demonstrate that SAL suppresses HUVECs cell injury induced by oxidative stress through activating the Nrf2 signaling pathway.

  15. Overview of Nrf2 as Therapeutic Target in Epilepsy

    Directory of Open Access Journals (Sweden)

    Liliana Carmona-Aparicio

    2015-08-01

    Full Text Available Oxidative stress is a biochemical state of imbalance in the production of reactive oxygen and nitrogen species and antioxidant defenses. It is involved in the physiopathology of degenerative and chronic neuronal disorders, such as epilepsy. Experimental evidence in humans and animals support the involvement of oxidative stress before and after seizures. In the past few years, research has increasingly focused on the molecular pathways of this process, such as that involving transcription factor nuclear factor E2-related factor 2 (Nrf2, which plays a central role in the regulation of antioxidant response elements (ARE and modulates cellular redox status. The aim of this review is to present experimental evidence on the role of Nrf2 in this neurological disorder and to further determine the therapeutic impact of Nrf2 in epilepsy.

  16. The rise of antioxidant signaling-The evolution and hormetic actions of Nrf2

    International Nuclear Information System (INIS)

    Maher, Jonathan; Yamamoto, Masayuki

    2010-01-01

    Organisms have evolved sophisticated and redundant mechanisms to manage oxidative and electrophilic challenges that arise from internal metabolism or xenobiotic challenge for survival. NF-E2-related factor 2 (Nrf2) is a transcription factor that has evolved over millennia from primitive origins, with homologues traceable back to invertebrate Caenorhabditis and Drosophila species. The ancestry of Nrf2 clearly has deep-seated roots in hematopoiesis, yet has diversified into a transcription factor that can mediate a multitude of antioxidant signaling and detoxification genes. In higher organisms, a more sophisticated means of tightly regulating Nrf2 activity was introduced via the cysteine-rich kelch-like ECH-associated protein 1 (Keap1), thus suggesting a need to modulate Nrf2 activity. This is evidenced in Keap1 -/- mice, which succumb to juvenile mortality due to hyperkeratosis of the gastrointestinal tract. Although Nrf2 activation protects against acute toxicity and prevents or attenuates several disease states, constitutive activation in some tumors leads to poor clinical outcomes, suggesting Nrf2 has evolved in response to a multitude of selective pressures. The purpose of this review is to examine the origins of Nrf2, while highlighting the versatility and protective abilities elicited upon activation. Various model systems in which Nrf2 is normally beneficial but in which exaggerated pharmacology exacerbates a physiological or pathological condition will be addressed. Although Darwinian principles have selected Nrf2 activity for maximal beneficial effect based on environmental and oxidative challenge, both sub- or super-physiological effects have been noted to be detrimental. The functions of Nrf2 thus suggest a hormetic factor that has evolved empirically over time.

  17. Curcumin plays neuroprotective roles against traumatic brain injury partly via Nrf2 signaling.

    Science.gov (United States)

    Dong, Wenwen; Yang, Bei; Wang, Linlin; Li, Bingxuan; Guo, Xiangshen; Zhang, Miao; Jiang, Zhenfei; Fu, Jingqi; Pi, Jingbo; Guan, Dawei; Zhao, Rui

    2018-05-01

    Traumatic brain injury (TBI), which leads to high mortality and morbidity, is a prominent public health problem worldwide with no effective treatment. Curcumin has been shown to be beneficial for neuroprotection in vivo and in vitro, but the underlying mechanism remains unclear. This study determined whether the neuroprotective role of curcumin in mouse TBI is dependent on the NF-E2-related factor (Nrf2) pathway. The Feeney weight-drop contusion model was used to mimic TBI. Curcumin was administered intraperitoneally 15 min after TBI induction, and brains were collected at 24 h after TBI. The levels of Nrf2 and its downstream genes (Hmox-1, Nqo1, Gclm, and Gclc) were detected by Western blot and qRT-PCR at 24 h after TBI. In addition, edema, oxidative damage, cell apoptosis and inflammatory reactions were evaluated in wild type (WT) and Nrf2-knockout (Nrf2-KO) mice to explore the role of Nrf2 signaling after curcumin treatment. In wild type mice, curcumin treatment resulted in reduced ipsilateral cortex injury, neutrophil infiltration, and microglia activation, improving neuron survival against TBI-induced apoptosis and degeneration. These effects were accompanied by increased expression and nuclear translocation of Nrf2, and enhanced expression of antioxidant enzymes. However, Nrf2 deletion attenuated the neuroprotective effects of curcumin in Nrf2-KO mice after TBI. These findings demonstrated that curcumin effects on TBI are associated with the activation the Nrf2 pathway, providing novel insights into the neuroprotective role of Nrf2 and the potential therapeutic use of curcumin for TBI. Copyright © 2018. Published by Elsevier Inc.

  18. Soybean-Derived Phytoalexins Improve Cognitive Function through Activation of Nrf2/HO-1 Signaling Pathway

    Directory of Open Access Journals (Sweden)

    Ji Yeon Seo

    2018-01-01

    Full Text Available As soy-derived glyceollins are known to induce antioxidant enzymes in various types of cells and tissues, we hypothesized that the compounds could protect neurons from damage due to reactive oxygen species (ROS. In order to examine the neuroprotective effect of glyceollins, primary cortical neurons collected from mice and mouse hippocampal HT22 cells were challenged with glutamate. Glyceollins attenuated glutamate-induced cytotoxicity in primary cortical neuron isolated from mice carrying wild-type nuclear factor (erythroid-derived 2-like 2 (Nrf2, but the compounds were ineffective in those isolated from Nrf2 knockout mice, suggesting the involvement of the Nrf2 signaling pathway in glyceollin-mediated neuroprotection. Furthermore, the inhibition of heme oxygenase-1 (HO-1, a major downstream enzyme of Nrf2, abolished the suppressive effect of glyceollins against glutamate-induced ROS production and cytotoxicity, confirming that activation of HO-1 by glyceollins is responsible for the neuroprotection. To examine whether glyceollins also improve cognitive ability, mice pretreated with glyceollins were challenged with scopolamine and subjected to behavioral tests. Glyceollins attenuated scopolamine-induced cognitive impairment of mice, but failed to enhance memory in Nrf2 knockout mice, suggesting that the memory-enhancing effect is also mediated by the Nrf2 signaling pathway. Overall, glyceollins showed neuroprotection against glutamate-induced damage, and attenuated scopolamine-induced memory deficits in an Nrf2-dependent manner.

  19. ABCF2, an Nrf2 target gene, contributes to cisplatin resistance in ovarian cancer cells.

    Science.gov (United States)

    Bao, Lingjie; Wu, Jianfa; Dodson, Matthew; Rojo de la Vega, Elisa Montserrat; Ning, Yan; Zhang, Zhenbo; Yao, Ming; Zhang, Donna D; Xu, Congjian; Yi, Xiaofang

    2017-06-01

    Previously, we have demonstrated that NRF2 plays a key role in mediating cisplatin resistance in ovarian cancer. To further explore the mechanism underlying NRF2-dependent cisplatin resistance, we stably overexpressed or knocked down NRF2 in parental and cisplatin-resistant human ovarian cancer cells, respectively. These two pairs of stable cell lines were then subjected to microarray analysis, where we identified 18 putative NRF2 target genes. Among these genes, ABCF2, a cytosolic member of the ABC superfamily of transporters, has previously been reported to contribute to chemoresistance in clear cell ovarian cancer. A detailed analysis on ABCF2 revealed a functional antioxidant response element (ARE) in its promoter region, establishing ABCF2 as an NRF2 target gene. Next, we investigated the contribution of ABCF2 in NRF2-mediated cisplatin resistance using our stable ovarian cancer cell lines. The NRF2-overexpressing cell line, containing high levels of ABCF2, was more resistant to cisplatin-induced apoptosis compared to its control cell line; whereas the NRF2 knockdown cell line with low levels of ABCF2, was more sensitive to cisplatin treatment than its control cell line. Furthermore, transient overexpression of ABCF2 in the parental cells decreased apoptosis and increased cell viability following cisplatin treatment. Conversely, knockdown of ABCF2 using specific siRNA notably increased apoptosis and decreased cell viability in cisplatin-resistant cells treated with cisplatin. This data indicate that the novel NRF2 target gene, ABCF2, plays a critical role in cisplatin resistance in ovarian cancer, and that targeting ABCF2 may be a new strategy to improve chemotherapeutic efficiency. © 2017 Wiley Periodicals, Inc.

  20. Mangiferin Upregulates Glyoxalase 1 Through Activation of Nrf2/ARE Signaling in Central Neurons Cultured with High Glucose.

    Science.gov (United States)

    Liu, Yao-Wu; Cheng, Ya-Qin; Liu, Xiao-Li; Hao, Yun-Chao; Li, Yu; Zhu, Xia; Zhang, Fan; Yin, Xiao-Xing

    2017-08-01

    Mangiferin, a natural C-glucoside xanthone, has anti-inflammatory, anti-oxidative, neuroprotective actions. Our previous study showed that mangiferin could attenuate diabetes-associated cognitive impairment of rats by enhancing the function of glyoxalase 1 (Glo-1) in brain. The aim of this study was to investigate whether Glo-1 upregulation by mangiferin in central neurons exposed to chronic high glucose may be related to activation of Nrf2/ARE pathway. Compared with normal glucose (25 mmol/L) culture, Glo-1 protein, mRNA, and activity levels were markedly decreased in primary hippocampal and cerebral cortical neurons cultured with high glucose (50 mmol/L) for 72 h, accompanied by the declined Nrf2 nuclear translocation and protein expression of Nrf2 in cell nucleus, as well as protein expression and mRNA level of γ-glutamylcysteine synthetase (γ-GCS) and superoxide dismutase activity, target genes of Nrf2/ARE signaling. Nonetheless, high glucose cotreating with mangiferin or sulforaphane, a typical inducer of Nrf2 activation, attenuated the above changes in both central neurons. In addition, mangiferin and sulforaphane significantly prevented the formation of advanced glycation end-products (AGEs) reflecting Glo-1 activity, while elevated the level of glutathione, a cofactor of Glo-1 activity and production of γ-GCS, in high glucose cultured central neurons. These findings demonstrated that Glo-1 was greatly downregulated in central neurons exposed to chronic high glucose, which is expected to lead the formation of AGEs and oxidative stress damages. We also proved that mangiferin enhanced the function of Glo-1 under high glucose condition by inducing activation of Nrf2/ARE signaling pathway.

  1. Naringenin protects against 6-OHDA-induced neurotoxicity via activation of the Nrf2/ARE signaling pathway.

    Science.gov (United States)

    Lou, Haiyan; Jing, Xu; Wei, Xinbing; Shi, Huanying; Ren, Dongmei; Zhang, Xiumei

    2014-04-01

    There is increasing evidence that oxidative stress is critically involved in the pathogenesis of Parkinson's disease (PD), suggesting that pharmacological targeting of the antioxidant machinery may have therapeutic value. Naringenin, a natural flavonoid compound, has been reported to possess neuroprotective effect against PD related pathology; however the mechanisms underlying its beneficial effects are poorly defined. Thus, the purpose of the present study was to investigate the potential neuroprotective role of naringenin and to delineate its mechanism of action against 6-hydroxydopamine (6-OHDA)-induced neurotoxicity in models of PD both in vitro and in vivo. Naringenin treatment resulted in an increase in nuclear factor E2-related factor 2 (Nrf2) protein levels and subsequent activation of antioxidant response element (ARE) pathway genes in SH-SY5Y cells and in mice. Exposure of SH-SY5Y cells to naringenin provided protection against 6-OHDA-induced oxidative insults that was dependent on Nrf2, since treatment with Nrf2 siRNA failed to block against 6-OHDA neurotoxicity or induce Nrf2-dependent cytoprotective genes in SH-SY5Y cells. In mice, oral administration of naringenin resulted in significant protection against 6-OHDA-induced nigrostriatal dopaminergic neurodegeneration and oxidative damage. Our results indicate that activation of Nrf2/ARE signaling by naringenin is strongly associated with its neuroprotective effects against 6-OHDA neurotoxicity and suggest that targeting the Nrf2/ARE pathway may be a promising approach for therapeutic intervention in PD. Copyright © 2013 Elsevier Ltd. All rights reserved.

  2. NRF2 ACTIVATION AS TARGET TO IMPLEMENT THERAPEUTIC TREATMENTS

    Directory of Open Access Journals (Sweden)

    Velio eBocci

    2015-02-01

    Full Text Available A chronic increase of oxidative stress is typical of serious pathologies such as myocardial infarction, stroke, chronic limb ischemia, chronic obstructive pulmonary disease (COPD, type II-diabetes, age-related macular degeneration leads to an epic increase of morbidity and mortality in all countries of the world. The initial inflammation followed by an excessive release of reactive oxygen species (ROS implies a diffused cellular injury that needs to be corrected by an inducible expression of the innate detoxifying and antioxidant system. The transcription factor Nrf2, when properly activated, is able to restore a redox homeostasis and possibly improve human health.

  3. Nrf2 signaling contributes to the neuroprotective effects of urate against 6-OHDA toxicity.

    Directory of Open Access Journals (Sweden)

    Ning Zhang

    Full Text Available BACKGROUND: Mounting evidence shows that urate may become a biomarker of Parkinson's disease (PD diagnosis and prognosis and a neuroprotectant candidate for PD therapy. However, the cellular and molecular mechanisms underlying its neuroprotective actions remain poorly understood. RESULTS: In this study, we showed that urate pretreatment protected dopaminergic cell line (SH-SY5Y and MES23.5 against 6-hydroxydopamine (6-OHDA- and hydrogen peroxide- induced cell damage. Urate was found to be accumulated into SH-SY5Y cells after 30 min treatment. Moreover, urate induced NF-E2-related factor 2 (Nrf2 accumulation by inhibiting its ubiquitinationa and degradation, and also promoted its nuclear translocation; however, it did not modulate Nrf2 mRNA level or Kelch-like ECH-associated protein 1 (Keap1 expression. In addition, urate markedly up-regulated the transcription and protein expression of γ-glutamate-cysteine ligase catalytic subunit (γ-GCLC and heme oxygenase-1 (HO-1, both of which are controlled by Nrf2 activity. Furthermore, Nrf2 knockdown by siRNA abolished the intracellular glutathione augmentation and the protection exerted by urate pretreatment. CONCLUSION: Our findings demonstrated that urate treatment may result in Nrf2-targeted anti-oxidant genes transcription and expression by reducing Nrf2 ubiquitination and degradation and promoting its nuclear translocation, and thus offer neuroprotection on dopaminergic cells against oxidative stresses.

  4. Piper betle induces phase I & II genes through Nrf2/ARE signaling pathway in mouse embryonic fibroblasts derived from wild type and Nrf2 knockout cells.

    Science.gov (United States)

    Wan Hasan, Wan Nuraini; Kwak, Mi-Kyoung; Makpol, Suzana; Wan Ngah, Wan Zurinah; Mohd Yusof, Yasmin Anum

    2014-02-23

    Nuclear factor-erythroid 2 p45 related factor 2 (Nrf2) is a primary transcription factor, protecting cells from oxidative stress by regulating a number of antioxidants and phase II detoxifying enzymes. Dietary components such as sulforaphane in broccoli and quercetin in onions have been shown to be inducers of Nrf2. Piper betle (PB) grows well in tropical climate and the leaves are used in a number of traditional remedies for the treatment of stomach ailments and infections among Asians. The aim of this study was to elucidate the effect of Piper betle (PB) leaves extract in Nrf2 signaling pathway by using 2 types of cells; mouse embryonic fibroblasts (MEFs) derived from wild-type (WT) and Nrf2 knockout (N0) mice. WT and N0 cells were treated with 5 and 10 μg/ml of PB for 10 and 12-h for the determination of nuclear translocation of Nrf2 protein. Luciferase reporter gene activity was performed to evaluate the antioxidant response element (ARE)-induction by PB. Real-time PCR and Western blot were conducted on both WT and N0 cells after PB treatment for the determination of antioxidant enzymes [superoxide dismutase (SOD1) and heme-oxygenase (HO-1)], phase I oxidoreductase enzymes [ quinone oxidoreductase (NQO1)] and phase II detoxifying enzyme [glutathione S-transferase (GST)]. Nuclear translocation of Nrf2 by PB in WT cells was better after 10 h incubation compared to 12 h. Real time PCR and Western blot analysis showed increased expressions of Nrf2, NQO1 and GSTA1 genes with corresponding increases in glutathione, NQO1 and HO-1 proteins in WT cells. Reporter gene ARE was stimulated by PB as shown by ARE/luciferase assay. Interestingly, PB induced SOD1 gene and protein expressions in N0 cells but not in WT cells. The results of this study confirmed that PB activated Nrf2-ARE signaling pathway which subsequently induced some phase I oxidoreductase, phase II detoxifying and antioxidant genes expression via ARE reporter gene involved in the Nrf2 pathway with the

  5. Luteolin inhibits the Nrf2 signaling pathway and tumor growth in vivo

    Energy Technology Data Exchange (ETDEWEB)

    Chian, Song; Thapa, Ruby; Chi, Zhexu [Department of Biochemistry and Genetics, School of Medicine, Zhejiang University, Hangzhou 310058 (China); Wang, Xiu Jun [Department of Pharmacology, School of Medicine, Zhejiang University, Hangzhou 310058 (China); Tang, Xiuwen, E-mail: xiuwentang@zju.edu.cn [Department of Biochemistry and Genetics, School of Medicine, Zhejiang University, Hangzhou 310058 (China)

    2014-05-16

    Highlights: • Luteolin inhibits the Nrf2 pathway in mouse liver and in xenografted tumors. • Luteolin markedly inhibits the growth of xenograft tumors. • Luteolin enhances the anti-cancer effect of cisplatin in mice in vivo. • Luteolin could serve as an adjuvant in the chemotherapy of NSCLC. - Abstract: Nuclear factor erythroid 2-related factor 2 (Nrf2) is over-expressed in many types of tumor, promotes tumor growth, and confers resistance to anticancer therapy. Hence, Nrf2 is regarded as a novel therapeutic target in cancer. Previously, we reported that luteolin is a strong inhibitor of Nrf2 in vitro. Here, we showed that luteolin reduced the constitutive expression of NAD(P)H quinone oxidoreductase 1 in mouse liver in a time- and dose-dependent manner. Further, luteolin inhibited the expression of antioxidant enzymes and glutathione transferases, decreasing the reduced glutathione in the liver of wild-type mice under both constitutive and butylated hydroxyanisole-induced conditions. In contrast, such distinct responses were not detected in Nrf2{sup −/−} mice. In addition, oral administration of luteolin, either alone or combined with intraperitoneal injection of the cytotoxic drug cisplatin, greatly inhibited the growth of xenograft tumors from non-small-cell lung cancer (NSCLC) cell line A549 cells grown subcutaneously in athymic nude mice. Cell proliferation, the expression of Nrf2, and antioxidant enzymes were all reduced in tumor xenograft tissues. Furthermore, luteolin enhanced the anti-cancer effect of cisplatin. Together, our findings demonstrated that luteolin inhibits the Nrf2 pathway in vivo and can serve as an adjuvant in the chemotherapy of NSCLC.

  6. Mechanisms underlying the perifocal neuroprotective effect of the Nrf2–ARE signaling pathway after intracranial hemorrhage

    Directory of Open Access Journals (Sweden)

    Yin XP

    2015-11-01

    -κB and TNF-α expression in the RA groups was increased. In conclusion, RA inhibits Nrf2 dissociation and translocation into nucleus, thereby suppressing the anti-inflammatory effect of Nrf2–ARE signaling pathway. The activation of Nrf2–ARE signaling pathway by SFN can elevate expression of antioxidant enzyme HO-1, reduce perifocal inflammatory response after ICH, and thus may play a neuroprotective role.Conclusion: The results suggest that Nrf2–ARE signaling pathway may serve as a new target for treatment of perifocal inflammatory injury caused by ICH. Keywords: cerebral hemorrhage, injuries, NF-E2-related factor 2, antioxidant response elements

  7. Can Co-Activation of Nrf2 and Neurotrophic Signaling Pathway Slow Alzheimer’s Disease?

    Directory of Open Access Journals (Sweden)

    Kelsey E. Murphy

    2017-05-01

    Full Text Available Alzheimer’s disease (AD is a multifaceted disease that is hard to treat by single-modal treatment. AD starts with amyloid peptides, mitochondrial dysfunction, and oxidative stress and later is accompanied with chronic endoplasmic reticulum (ER stress and autophagy dysfunction, resulting in more complicated pathogenesis. Currently, few treatments can modify the complicated pathogenic progress of AD. Compared to the treatment with exogenous antioxidants, the activation of global antioxidant defense system via Nrf2 looks more promising in attenuating oxidative stress in AD brains. Accompanying the activation of the Nrf2-mediated antioxidant defense system that reduce the AD-causative factor, oxidative stress, it is also necessary to activate the neurotrophic signaling pathway that replaces damaged organelles and molecules with new ones. Thus, the dual actions to activate both the Nrf2 antioxidant system and neurotrophic signaling pathway are expected to provide a better strategy to modify AD pathogenesis. Here, we review the current understanding of AD pathogenesis and neuronal defense systems and discuss a possible way to co-activate the Nrf2 antioxidant system and neurotrophic signaling pathway with the hope of helping to find a better strategy to slow AD.

  8. Pharmacological targeting of GSK-3 and NRF2 provides neuroprotection in a preclinical model of tauopathy

    Directory of Open Access Journals (Sweden)

    Antonio Cuadrado

    2018-04-01

    Full Text Available Tauopathies are a group of neurodegenerative disorders where TAU protein is presented as aggregates or is abnormally phosphorylated, leading to alterations of axonal transport, neuronal death and neuroinflammation. Currently, there is no treatment to slow progression of these diseases. Here, we have investigated whether dimethyl fumarate (DMF, an inducer of the transcription factor NRF2, could mitigate tauopathy in a mouse model. The signaling pathways modulated by DMF were also studied in mouse embryonic fibroblast (MEFs from wild type or KEAP1-deficient mice. The effect of DMF on neurodegeneration, astrocyte and microglial activation was examined in Nrf2+/+ and Nrf2−/− mice stereotaxically injected in the right hippocampus with an adeno-associated vector expressing human TAUP301L and treated daily with DMF (100 mg/kg, i.g during three weeks. DMF induces the NRF2 transcriptional through a mechanism that involves KEAP1 but also PI3K/AKT/GSK-3-dependent pathways. DMF modulates GSK-3β activity in mouse hippocampi. Furthermore, DMF modulates TAU phosphorylation, neuronal impairment measured by calbindin-D28K and BDNF expression, and inflammatory processes involved in astrogliosis, microgliosis and pro-inflammatory cytokines production. This study reveals neuroprotective effects of DMF beyond disruption of the KEAP1/NRF2 axis by inhibiting GSK3 in a mouse model of tauopathy. Our results support repurposing of this drug for treatment of these diseases. Keywords: DMF, Inflammation, Neurodegeneration, NRF2, Oxidative stress, TAU/ GSK-3

  9. PCB 126 toxicity is modulated by cross-talk between caveolae and Nrf2 signaling

    Energy Technology Data Exchange (ETDEWEB)

    Petriello, Michael C. [Graduate Center for Toxicology, College of Medicine, University of Kentucky, Lexington, KY 40536 (United States); University of Kentucky Superfund Research Center, Lexington, KY 40536 (United States); Han, Sung Gu [University of Kentucky Superfund Research Center, Lexington, KY 40536 (United States); Department of Food Science and Biotechnology of Animal Resources, College of Animal Bioscience and Technology, Konkuk University, Seoul 143-701 (Korea, Republic of); Newsome, Bradley J. [University of Kentucky Superfund Research Center, Lexington, KY 40536 (United States); Department of Chemistry, College of Arts and Sciences, University of Kentucky, Lexington, KY 40506 (United States); Hennig, Bernhard [Graduate Center for Toxicology, College of Medicine, University of Kentucky, Lexington, KY 40536 (United States); University of Kentucky Superfund Research Center, Lexington, KY 40536 (United States); Department of Animal and Food Sciences, College of Agriculture, Food and Environment, University of Kentucky, KY 40506 (United States)

    2014-06-01

    Environmental toxicants such as polychlorinated biphenyls (PCBs) have been implicated in the promotion of multiple inflammatory disorders including cardiovascular disease, but information regarding mechanisms of toxicity and cross-talk between relevant cell signaling pathways is lacking. To examine the hypothesis that cross-talk between membrane domains called caveolae and nuclear factor (erythroid-derived 2)-like 2 (Nrf2) pathways alters PCB-induced inflammation, caveolin-1 was silenced in vascular endothelial cells, resulting in a decreased PCB-induced inflammatory response. Cav-1 silencing (siRNA treatment) also increased levels of Nrf2-ARE transcriptional binding, resulting in higher mRNA levels of the antioxidant genes glutathione s-transferase and NADPH dehydrogenase quinone-1 in both vehicle and PCB-treated systems. Along with this upregulated antioxidant response, Cav-1 siRNA treated cells exhibited decreased mRNA levels of the Nrf2 inhibitory protein Keap1 in both vehicle and PCB-treated samples. Silencing Cav-1 also decreased protein levels of Nrf2 inhibitory proteins Keap1 and Fyn kinase, especially in PCB-treated cells. Further, endothelial cells from wildtype and Cav-1 −/− mice were isolated and treated with PCB to better elucidate the role of functional caveolae in PCB-induced endothelial inflammation. Cav-1 −/− endothelial cells were protected from PCB-induced cellular dysfunction as evidenced by decreased vascular cell adhesion molecule (VCAM-1) protein induction. Compared to wildtype cells, Cav-1 −/− endothelial cells also allowed for a more effective antioxidant response, as observed by higher levels of the antioxidant genes. These data demonstrate novel cross-talk mechanisms between Cav-1 and Nrf2 and implicate the reduction of Cav-1 as a protective mechanism for PCB-induced cellular dysfunction and inflammation. - Highlights: • Reduction of caveolin-1 protein protects against polychlorinated biphenyl toxicity. • Decreasing

  10. Sinomenine attenuates renal fibrosis through Nrf2-mediated inhibition of oxidative stress and TGFβ signaling

    Energy Technology Data Exchange (ETDEWEB)

    Qin, Tian [School of Life Science & Technology, China Pharmaceutical University, Nanjing 210009 (China); Yin, Shasha; Yang, Jun; Zhang, Qin; Liu, Yangyang [Jiangsu Key Laboratory of Molecular Medicine, Nanjing University School of Medicine, Nanjing 210093 (China); Huang, Fengjie, E-mail: hfj@cpu.edu.cn [School of Life Science & Technology, China Pharmaceutical University, Nanjing 210009 (China); Cao, Wangsen, E-mail: wangsencao@nju.edu.cn [Jiangsu Key Laboratory of Molecular Medicine, Nanjing University School of Medicine, Nanjing 210093 (China)

    2016-08-01

    Renal fibrosis is the common feature of chronic kidney disease and mainly mediated by TGFβ-associated pro-fibrogenic signaling, which causes excessive extracellular matrix accumulation and successive loss of kidney functions. Sinomenine (SIN), an alkaloid derived from medicinal herb extensively used in treatment of rheumatoid arthritis and various inflammatory disorders, displays renal protective properties in experimental animals; however its pharmacological potency against renal fibrosis is not explored. In this study we report that SIN possesses strong anti-renal fibrosis functions in kidney cell and in mouse fibrotic kidney. SIN beneficially modulated the pro-fibrogenic protein expression in TGFβ-treated kidney cells and attenuated the renal fibrotic pathogenesis incurred by unilateral ureteral obstruction (UUO), which correlated with its activation of Nrf2 signaling - the key defender against oxidative stress with anti-fibrotic potentials. Further investigation on its regulation of Nrf2 downstream events revealed that SIN significantly balanced oxidative stress via improving the expression and activity of anti-oxidant and detoxifying enzymes, and interrupted the pro-fibrogenic signaling of TGFβ/Smad and Wnt/β-catenin. Even more impressively SIN achieved its anti-fibrotic activities in an Nrf2-dependent manner, suggesting that SIN regulation of Nrf2-associated anti-fibrotic activities constitutes a critical component of SIN's renoprotective functions. Collectively our studies have demonstrated a novel anti-fibrotic property of SIN and its upstream events and provided a molecular basis for SIN's potential applications in treatment of renal fibrosis-associated kidney disorders. - Highlights: • Sinomenine has strong potency of inhibiting renal fibrosis in UUO mouse kidney. • Sinomenine attenuates the expression of profibrogenic proteins. • Sinomenine balances renal fibrosis-associated oxidative stress. • Sinomenine mitigates profibrogenic

  11. PFOS induces adipogenesis and glucose uptake in association with activation of Nrf2 signaling pathway

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Jialin [Institute of Biochemistry and Molecular Biology, College of Life and Health Sciences, Northeastern University, Shenyang 110819 (China); Department of Biomedical and Pharmaceutical Sciences, University of Rhode Island, Kingston, RI 02881 (United States); Shimpi, Prajakta; Armstrong, Laura; Salter, Deanna [Department of Biomedical and Pharmaceutical Sciences, University of Rhode Island, Kingston, RI 02881 (United States); Slitt, Angela L., E-mail: aslitt@uri.edu [Department of Biomedical and Pharmaceutical Sciences, University of Rhode Island, Kingston, RI 02881 (United States)

    2016-01-01

    PFOS is a chemical of nearly ubiquitous exposure in humans. Recent studies have associated PFOS exposure to adipose tissue-related effects. The present study was to determine whether PFOS alters the process of adipogenesis and regulates insulin-stimulated glucose uptake in mouse and human preadipocytes. In murine-derived 3T3-L1 preadipocytes, PFOS enhanced hormone-induced differentiation to adipocytes and adipogenic gene expression, increased insulin-stimulated glucose uptake at concentrations ranging from 10 to 100 μM, and enhanced Glucose transporter type 4 and Insulin receptor substrate-1 expression. Nuclear factor (erythroid-derived 2)-like 2 (Nrf2), NAD(P)H dehydrogenase, quinone 1 and Glutamate-cysteine ligase, catalytic subunit were significantly induced in 3T3-L1 cells treated with PFOS, along with a robust induction of Antioxidant Response Element (ARE) reporter in mouse embryonic fibroblasts isolated from ARE-hPAP transgenic mice by PFOS treatment. Chromatin immunoprecipitation assays further illustrated that PFOS increased Nrf2 binding to ARE sites in mouse Nqo1 promoter, suggesting that PFOS activated Nrf2 signaling in murine-derived preadipocytes. Additionally, PFOS administration in mice (100 μg/kg/day) induced adipogenic gene expression and activated Nrf2 signaling in epididymal white adipose tissue. Moreover, the treatment on human visceral preadipocytes illustrated that PFOS (5 and 50 μM) promoted adipogenesis and increased cellular lipid accumulation. It was observed that PFOS increased Nrf2 binding to ARE sites in association with Nrf2 signaling activation, induction of Peroxisome proliferator-activated receptor γ and CCAAT/enhancer-binding protein α expression, and increased adipogenesis. This study points to a potential role of PFOS in dysregulation of adipose tissue expandability, and warrants further investigations on the adverse effects of persistent pollutants on human health. - Highlights: • PFOS induces adipogenesis in association

  12. Cardiac Aging - Benefits of Exercise, Nrf2 Activation and Antioxidant Signaling.

    Science.gov (United States)

    Narasimhan, Madhusudhanan; Rajasekaran, Namakkal-Soorappan

    2017-01-01

    Cardiovascular dysfunction and heart failure associated with aging not only impairs the cardiac function but also the quality of life eventually decreasing the life expectancy of the elderly. Notably, cardiac tissue can prematurely age under certain conditions such as genetic mutation, persistent redox stress and overload, aberrant molecular signaling, DNA damage, telomere attrition, and other pathological insults. While cardiovascular-related morbidity and mortality is on the rise and remains a global health threat, there has been only little to moderate improvements in its medical management. This is due to the fact that the lifestyle changes to molecular mechanisms underlying age-related myocardial structure and functional remodeling are multifactorial and intricately operate at different levels. Along these lines, the intrinsic redox mechanisms and oxidative stress (OS) are widely studied in the myocardium. The accumulation of reactive oxygen species (ROS) with age and the resultant oxidative damage has been shown to increase the susceptibility of the myocardium to multiple complications such as atherosclerosis, hypertension, ischemic heart disease, cardiac myopathy, and heart failure. There has been growing interest in trying to enhance the mechanisms that neutralize the ROS and curtailing OS as a possible anti-aging intervention and as a treatment for age-related disorders. Natural defense system to fight against OS involves a master transcription factor named nuclear erythroid-2-p45-related factor-2 (Nrf2) that regulates several antioxidant genes. Compelling evidence exists on the Nrf2 gain of function through pharmacological interventions in counteracting the oxidative damage and affords cytoprotection in several organs including but not limited to lung, liver, kidney, brain, etc. Nevertheless, thus far, only a few studies have described the potential role of Nrf2 and its non-pharmacological induction in cardiac aging. This chapter explores the effects of

  13. Chronic Endurance Exercise Impairs Cardiac Structure and Function in Middle-Aged Mice with Impaired Nrf2 Signaling

    Directory of Open Access Journals (Sweden)

    Gobinath Shanmugam

    2017-05-01

    Full Text Available Nuclear factor erythroid 2 related factor 2 (Nrf2 signaling maintains the redox homeostasis and its activation is shown to suppress cardiac maladaptation. Earlier we reported that acute endurance exercise (2 days evoked antioxidant cytoprotection in young WT animals but not in aged WT animals. However, the effect of repeated endurance exercise during biologic aging (WT characterized by an inherent deterioration in Nrf2 signaling and pathological aging (pronounced oxidative susceptibility—Nrf2 absence in the myocardium remains elusive. Thus, the purpose of our study was to determine the effect of chronic endurance exercise-induced cardiac adaptation in aged mice with and without Nrf2. Age-matched WT and Nrf2-null mice (Nrf2−/− (>22 months were subjected to 6 weeks chronic endurance exercise (25 meter/min, 12% grade. The myocardial redox status was assessed by expression of antioxidant defense genes and proteins along with immunochemical detection of DMPO-radical adduct, GSH-NEM, and total ubiquitination. Cardiac functions were assessed by echocardiography and electrocardiogram. At sedentary state, loss of Nrf2 resulted in significant downregulation of antioxidant gene expression (Nqo1, Ho1, Gclm, Cat, and Gst-α with decreased GSH-NEM immuno-fluorescence signals. While Nrf2−/− mice subjected to CEE showed an either similar or more pronounced reduction in the transcript levels of Gclc, Nqo1, Gsr, and Gst-α in relation to WT littermates. In addition, the hearts of Nrf2−/− on CEE showed a substantial reduction in specific antioxidant proteins, G6PD and CAT along with decreased GSH, a pronounced increase in DMPO-adduct and the total ubiquitination levels. Further, CEE resulted in a significant upregulation of hypertrophy genes (Anf, Bnf, and β-Mhc (p < 0.05 in the Nrf2−/− hearts in relation to WT mice. Moreover, the aged Nrf2−/− mice exhibited a higher degree of cardiac remodeling in association with a significant decrease in

  14. VPA and MEL induce apoptosis by inhibiting the Nrf2-ARE signaling pathway in TMZ-resistant U251 cells.

    Science.gov (United States)

    Pan, Hao; Wang, Handong; Jia, Yue; Wang, Qiang; Li, Liwen; Wu, Qi; Chen, Longbang

    2017-07-01

    Chemoresistance is the primary obstacle to effective treatment of glioblastoma, the most lethal brain tumor. Our previous study demonstrated that Nf-E2 related factor 2 (Nrf2), a traditional cytoprotective transcription factor, was overexpressed in gliomas and promoted malignancy. The present study aimed to investigate the expression levels of Nrf2‑antioxidant response element (ARE) signaling pathway genes in temozolomide (TMZ)‑resistant U251 human glioblastoma cells (U251‑TMZ). Additionally, the effect of valproic acid (VPA) and melatonin (MEL) on Nrf2 expression in U251‑TMZ cells and their association with chemoresistance was investigated. The results of the present study indicated that the expression levels of components of the Nrf2‑ARE signaling pathway were increased in U251‑TMZ cells compared with U251 parent cells. Silencing of Nrf2 by transfection with small interfering RNA restored the chemosensitivity of U251‑TMZ cells. The Nrf2 inhibitors VPA and MEL successfully reduced Nrf2 expression and survival in U251‑TMZ cells treated with TMZ, accompanied by increased reactive oxygen species levels and apoptosis. Therefore, VPA and MEL may be potential chemotherapeutic sensitizers for the treatment of chemoresistant glioblastoma.

  15. Isorhamnetin protects against oxidative stress by activating Nrf2 and inducing the expression of its target genes

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Ji Hye; Shin, Bo Yeon; Han, Jae Yun; Kim, Mi Gwang; Wi, Ji Eun [College of Pharmacy, Chosun University, Gwangju, 501-759 (Korea, Republic of); Kim, Young Woo; Cho, Il Je; Kim, Sang Chan [Medical Research Center for Globalization of Herbal Formulation, College of Korean Medicine, Daegu Haany University, Gyeongsan 712-715 (Korea, Republic of); Shin, Sang Mi [College of Pharmacy, Chosun University, Gwangju, 501-759 (Korea, Republic of); Ki, Sung Hwan, E-mail: shki@chosun.ac.kr [College of Pharmacy, Chosun University, Gwangju, 501-759 (Korea, Republic of)

    2014-01-15

    Isorhamentin is a 3′-O-methylated metabolite of quercetin, and has been reported to have anti-inflammatory and anti-proliferative effects. However, the effects of isorhamnetin on Nrf2 activation and on the expressions of its downstream genes in hepatocytes have not been elucidated. Here, we investigated whether isorhamnetin has the ability to activate Nrf2 and induce phase II antioxidant enzyme expression, and to determine the protective role of isorhamnetin on oxidative injury in hepatocytes. In HepG2 cells, isorhamnetin increased the nuclear translocation of Nrf2 in a dose- and time-dependent manner, and consistently, increased antioxidant response element (ARE) reporter gene activity and the protein levels of hemeoxygenase (HO-1) and of glutamate cysteine ligase (GCL), which resulted in intracellular GSH level increases. The specific role of Nrf2 in isorhamnetin-induced Nrf2 target gene expression was verified using an ARE-deletion mutant plasmid and Nrf2-knockout MEF cells. Deletion of the ARE in the promoter region of the sestrin2 gene, which is recently identified as the Nrf2 target gene by us, abolished the ability of isorhamnetin to increase luciferase activity. In addition, Nrf2 deficiency completely blocked the ability of isorhamnetin to induce HO-1 and GCL. Furthermore, isorhamnetin pretreatment blocked t-BHP-induced ROS production and reversed GSH depletion by t-BHP and consequently, due to reduced ROS levels, decreased t-BHP-induced cell death. In addition isorhamnetin increased ERK1/2, PKCδ and AMPK phosphorylation. Finally, we showed that Nrf2 deficiency blocked the ability of isorhamnetin to protect cells from injury induced by t-BHP. Taken together, our results demonstrate that isorhamnetin is efficacious in protecting hepatocytes against oxidative stress by Nrf2 activation and in inducing the expressions of its downstream genes. - Highlights: • We investigated the effect of isorhamnetin on Nrf2 activation. • Isorhamnetin increased Nrf2

  16. Metformin inhibits heme oxygenase-1 expression in cancer cells through inactivation of Raf-ERK-Nrf2 signaling and AMPK-independent pathways

    International Nuclear Information System (INIS)

    Do, Minh Truong; Kim, Hyung Gyun; Khanal, Tilak; Choi, Jae Ho; Kim, Dong Hee; Jeong, Tae Cheon; Jeong, Hye Gwang

    2013-01-01

    Resistance to therapy is the major obstacle to more effective cancer treatment. Heme oxygenase-1 (HO-1) is often highly up-regulated in tumor tissues, and its expression is further increased in response to therapies. It has been suggested that inhibition of HO-1 expression is a potential therapeutic approach to sensitize tumors to chemotherapy and radiotherapy. In this study, we tested the hypothesis that the anti-tumor effects of metformin are mediated by suppression of HO-1 expression in cancer cells. Our results indicate that metformin strongly suppresses HO-1 mRNA and protein expression in human hepatic carcinoma HepG2, cervical cancer HeLa, and non-small-cell lung cancer A549 cells. Metformin also markedly reduced Nrf2 mRNA and protein levels in whole cell lysates and suppressed tert-butylhydroquinone (tBHQ)-induced Nrf2 protein stability and antioxidant response element (ARE)-luciferase activity in HepG2 cells. We also found that metformin regulation of Nrf2 expression is mediated by a Keap1-independent mechanism and that metformin significantly attenuated Raf-ERK signaling to suppress Nrf2 expression in cancer cells. Inhibition of Raf-ERK signaling by PD98059 decreased Nrf2 mRNA expression in HepG2 cells, confirming that the inhibition of Nrf2 expression is mediated by an attenuation of Raf-ERK signaling in cancer cells. The inactivation of AMPK by siRNA, DN-AMPK or the pharmacological AMPK inhibitor compound C, revealed that metformin reduced HO-1 expression in an AMPK-independent manner. These results highlight the Raf-ERK-Nrf2 axis as a new molecular target in anticancer therapy in response to metformin treatment. - Highlights: • Metformin inhibits HO-1 expression in cancer cells. • Metformin attenuates Raf-ERK-Nrf2 signaling. • Suppression of HO-1 by metformin is independent of AMPK. • HO-1 inhibition contributes to anti-proliferative effects of metformin

  17. Ameliorating mitochondrial dysfunction restores carbon ion-induced cognitive deficits via co-activation of NRF2 and PINK1 signaling pathway

    Directory of Open Access Journals (Sweden)

    Yang Liu

    2018-07-01

    Full Text Available Carbon ion therapy is a promising modality in radiotherapy to treat tumors, however, a potential risk of induction of late normal tissue damage should still be investigated and protected. The aim of the present study was to explore the long-term cognitive deficits provoked by a high-linear energy transfer (high-LET carbon ions in mice by targeting to hippocampus which plays a crucial role in memory and learning. Our data showed that, one month after 4 Gy carbon ion exposure, carbon ion irradiation conspicuously resulted in the impaired cognitive performance, neurodegeneration and neuronal cell death, as well as the reduced mitochondrial integrity, the disrupted activities of tricarboxylic acid cycle flux and electron transport chain, and the depressed antioxidant defense system, consequently leading to a decline of ATP production and persistent oxidative damage in the hippocampus region. Mechanistically, we demonstrated the disruptions of mitochondrial homeostasis and redox balance typically characterized by the disordered mitochondrial dynamics, mitophagy and glutathione redox couple, which is closely associated with the inhibitions of PINK1 and NRF2 signaling pathway as the key regulators of molecular responses in the context of neurotoxicity and neurodegenerative disorders. Most importantly, we found that administration with melatonin as a mitochondria-targeted antioxidant promoted the PINK1 accumulation on the mitochondrial membrane, and augmented the NRF2 accumulation and translocation. Moreover, melatonin pronouncedly enhanced the molecular interplay between NRF2 and PINK1. Furthermore, in the mouse hippocampal neuronal cells, overexpression of NRF2/PINK1 strikingly protected the hippocampal neurons from carbon ion-elicited toxic insults. Thus, these data suggest that alleviation of the sustained mitochondrial dysfunction and oxidative stress through co-modulation of NRF2 and PINK1 may be in charge of restoration of the cognitive

  18. ROS signaling, oxidative stress and Nrf2 in pancreatic beta-cell function

    International Nuclear Information System (INIS)

    Pi Jingbo; Zhang Qiang; Fu Jingqi; Woods, Courtney G.; Hou Yongyong; Corkey, Barbara E.; Collins, Sheila; Andersen, Melvin E.

    2010-01-01

    This review focuses on the emerging evidence that reactive oxygen species (ROS) derived from glucose metabolism, such as H 2 O 2 , act as metabolic signaling molecules for glucose-stimulated insulin secretion (GSIS) in pancreatic beta-cells. Particular emphasis is placed on the potential inhibitory role of endogenous antioxidants, which rise in response to oxidative stress, in glucose-triggered ROS and GSIS. We propose that cellular adaptive response to oxidative stress challenge, such as nuclear factor E2-related factor 2 (Nrf2)-mediated antioxidant induction, plays paradoxical roles in pancreatic beta-cell function. On the one hand, induction of antioxidant enzymes protects beta-cells from oxidative damage and possible cell death, thus minimizing oxidative damage-related impairment of insulin secretion. On the other hand, the induction of antioxidant enzymes by Nrf2 activation blunts glucose-triggered ROS signaling, thus resulting in reduced GSIS. These two premises are potentially relevant to impairment of beta-cells occurring in the late and early stage of Type 2 diabetes, respectively. In addition, we summarized our recent findings that persistent oxidative stress due to absence of uncoupling protein 2 activates cellular adaptive response which is associated with impaired pancreatic beta-cell function.

  19. Modulatory Mechanism of Polyphenols and Nrf2 Signaling Pathway in LPS Challenged Pregnancy Disorders

    Directory of Open Access Journals (Sweden)

    Tarique Hussain

    2017-01-01

    Full Text Available Early embryonic loss and adverse birth outcomes are the major reproductive disorders that affect both human and animals. The LPS induces inflammation by interacting with robust cellular mechanism which was considered as a plethora of numerous reproductive disorders such as fetal resorption, preterm birth, teratogenicity, intrauterine growth restriction, abortion, neural tube defects, fetal demise, and skeletal development retardation. LPS-triggered overproduction of free radicals leads to oxidative stress which mediates inflammation via stimulation of NF-κB and PPARγ transcription factors. Flavonoids, which exist in copious amounts in nature, possess a wide array of functions; their supplementation during pregnancy activates Nrf2 signaling pathway which encounters pregnancy disorders. It was further presumed that the development of strong antioxidant uterine environment during gestation can alleviate diseases which appear at adult stages. The purpose of this review is to focus on modulatory properties of flavonoids on oxidative stress-mediated pregnancy insult and abnormal outcomes and role of Nrf2 activation in pregnancy disorders. These findings would be helpful for providing new insights in ameliorating oxidative stress-induced pregnancy disorders.

  20. Global mapping of binding sites for Nrf2 identifies novel targets in cell survival response through ChIP-Seq profiling and network analysis

    Science.gov (United States)

    Malhotra, Deepti; Portales-Casamar, Elodie; Singh, Anju; Srivastava, Siddhartha; Arenillas, David; Happel, Christine; Shyr, Casper; Wakabayashi, Nobunao; Kensler, Thomas W.; Wasserman, Wyeth W.; Biswal, Shyam

    2010-01-01

    The Nrf2 (nuclear factor E2 p45-related factor 2) transcription factor responds to diverse oxidative and electrophilic environmental stresses by circumventing repression by Keap1, translocating to the nucleus, and activating cytoprotective genes. Nrf2 responses provide protection against chemical carcinogenesis, chronic inflammation, neurodegeneration, emphysema, asthma and sepsis in murine models. Nrf2 regulates the expression of a plethora of genes that detoxify oxidants and electrophiles and repair or remove damaged macromolecules, such as through proteasomal processing. However, many direct targets of Nrf2 remain undefined. Here, mouse embryonic fibroblasts (MEF) with either constitutive nuclear accumulation (Keap1−/−) or depletion (Nrf2−/−) of Nrf2 were utilized to perform chromatin-immunoprecipitation with parallel sequencing (ChIP-Seq) and global transcription profiling. This unique Nrf2 ChIP-Seq dataset is highly enriched for Nrf2-binding motifs. Integrating ChIP-Seq and microarray analyses, we identified 645 basal and 654 inducible direct targets of Nrf2, with 244 genes at the intersection. Modulated pathways in stress response and cell proliferation distinguish the inducible and basal programs. Results were confirmed in an in vivo stress model of cigarette smoke-exposed mice. This study reveals global circuitry of the Nrf2 stress response emphasizing Nrf2 as a central node in cell survival response. PMID:20460467

  1. Activating Nrf-2 signaling depresses unilateral ureteral obstruction-evoked mitochondrial stress-related autophagy, apoptosis and pyroptosis in kidney.

    Directory of Open Access Journals (Sweden)

    Shue Dong Chung

    Full Text Available Exacerbated oxidative stress and inflammation may induce three types of programmed cell death, autophagy, apoptosis and pyroptosis in unilateral ureteral obstruction (UUO kidney. Sulforaphane activating NF-E2-related nuclear factor erythroid-2 (Nrf-2 signaling may ameliorate UUO-induced renal damage. UUO was induced in the left kidney of female Wistar rats. The level of renal blood flow, cortical and medullary oxygen tension and reactive oxygen species (ROS was evaluated. Fibrosis, ED-1 (macrophage/monocyte infiltration, oxidative stress, autophagy, apoptosis and pyroptosis were evaluated by immunohistochemistry and Western blot in UUO kidneys. Effects of sulforaphane, an Nrf-2 activator, on Nrf-2- and mitochondrial stress-related proteins and renal injury were examined. UUO decreased renal blood flow and oxygen tension and increased renal ROS, 3-nitrotyrosine stain, ED-1 infiltration and fibrosis. Enhanced renal tubular Beclin-1 expression started at 4 h UUO and further enhanced at 3d UUO, whereas increased Atg-5-Atg12 and LC3-II expression were found at 3d UUO. Increased renal Bax/Bcl-2 ratio, caspase 3 and PARP fragments, apoptosis formation associated with increased caspase 1 and IL-1β expression for pyroptosis formation were started from 3d UUO. UUO reduced nuclear Nrf-2 translocation, increased cytosolic and inhibitory Nrf-2 expression, increased cytosolic Bax translocation to mitochondrial and enhanced mitochondrial Cytochrome c release into cytosol of the UUO kidneys. Sulforaphane significantly increased nuclear Nrf-2 translocation and decreased mitochondrial Bax translocation and Cytochrome c release into cytosol resulting in decreased renal injury. In conclusion, sulforaphane via activating Nrf-2 signaling preserved mitochondrial function and suppressed UUO-induced renal oxidative stress, inflammation, fibrosis, autophagy, apoptosis and pyroptosis.

  2. Activation of Nrf2 Signaling Augments Vesicular Stomatitis Virus Oncolysis via Autophagy-Driven Suppression of Antiviral Immunity.

    Science.gov (United States)

    Olagnier, David; Lababidi, Rassin R; Hadj, Samar Bel; Sze, Alexandre; Liu, Yiliu; Naidu, Sharadha Dayalan; Ferrari, Matteo; Jiang, Yuan; Chiang, Cindy; Beljanski, Vladimir; Goulet, Marie-Line; Knatko, Elena V; Dinkova-Kostova, Albena T; Hiscott, John; Lin, Rongtuan

    2017-08-02

    Oncolytic viruses (OVs) offer a promising therapeutic approach to treat multiple types of cancer. In this study, we show that the manipulation of the antioxidant network via transcription factor Nrf2 augments vesicular stomatitis virus Δ51 (VSVΔ51) replication and sensitizes cancer cells to viral oncolysis. Activation of Nrf2 signaling by the antioxidant compound sulforaphane (SFN) leads to enhanced VSVΔ51 spread in OV-resistant cancer cells and improves the therapeutic outcome in different murine syngeneic and xenograft tumor models. Chemoresistant A549 lung cancer cells that display constitutive dominant hyperactivation of Nrf2 signaling are particularly vulnerable to VSVΔ51 oncolysis. Mechanistically, enhanced Nrf2 signaling stimulated viral replication in cancer cells and disrupted the type I IFN response via increased autophagy. This study reveals a previously unappreciated role for Nrf2 in the regulation of autophagy and the innate antiviral response that complements the therapeutic potential of VSV-directed oncolysis against multiple types of OV-resistant or chemoresistant cancer. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  3. Targeting NRF2 for Improved Skin Barrier Function and Photoprotection: Focus on the Achiote-Derived Apocarotenoid Bixin.

    Science.gov (United States)

    Rojo de la Vega, Montserrat; Krajisnik, Andrea; Zhang, Donna D; Wondrak, Georg T

    2017-12-18

    The transcription factor NRF2 (nuclear factor-E2-related factor 2) orchestrates major cellular defense mechanisms including phase-II detoxification, inflammatory signaling, DNA repair, and antioxidant response. Recent studies strongly suggest a protective role of NRF2-mediated gene expression in the suppression of cutaneous photodamage induced by solar UV (ultraviolet) radiation. The apocarotenoid bixin, a Food and Drug Administration (FDA)-approved natural food colorant (referred to as 'annatto') originates from the seeds of the achiote tree native to tropical America, consumed by humans since ancient times. Use of achiote preparations for skin protection against environmental insult and for enhanced wound healing has long been documented. We have recently reported that (i) bixin is a potent canonical activator of the NRF2-dependent cytoprotective response in human skin keratinocytes; that (ii) systemic administration of bixin activates NRF2 with protective effects against solar UV-induced skin damage; and that (iii) bixin-induced suppression of photodamage is observable in Nrf2 +/+ but not in Nrf2 -/- SKH-1 mice confirming the NRF2-dependence of bixin-induced antioxidant and anti-inflammatory effects. In addition, bixin displays molecular activities as sacrificial antioxidant, excited state quencher, PPAR (peroxisome proliferator-activated receptor) α/γ agonist, and TLR (Toll-like receptor) 4/NFκB (nuclear factor kappa-light-chain-enhancer of activated B cells) antagonist, all of which might be relevant to the enhancement of skin barrier function and environmental stress protection. Potential skin photoprotection and photochemoprevention benefits provided by topical application or dietary consumption of this ethno-pharmacologically validated phytochemical originating from the Americas deserves further preclinical and clinical examination.

  4. Targeting NRF2 for Improved Skin Barrier Function and Photoprotection: Focus on the Achiote-Derived Apocarotenoid Bixin

    Directory of Open Access Journals (Sweden)

    Montserrat Rojo de la Vega

    2017-12-01

    Full Text Available The transcription factor NRF2 (nuclear factor-E2-related factor 2 orchestrates major cellular defense mechanisms including phase-II detoxification, inflammatory signaling, DNA repair, and antioxidant response. Recent studies strongly suggest a protective role of NRF2-mediated gene expression in the suppression of cutaneous photodamage induced by solar UV (ultraviolet radiation. The apocarotenoid bixin, a Food and Drug Administration (FDA-approved natural food colorant (referred to as ‘annatto’ originates from the seeds of the achiote tree native to tropical America, consumed by humans since ancient times. Use of achiote preparations for skin protection against environmental insult and for enhanced wound healing has long been documented. We have recently reported that (i bixin is a potent canonical activator of the NRF2-dependent cytoprotective response in human skin keratinocytes; that (ii systemic administration of bixin activates NRF2 with protective effects against solar UV-induced skin damage; and that (iii bixin-induced suppression of photodamage is observable in Nrf2+/+ but not in Nrf2−/− SKH-1 mice confirming the NRF2-dependence of bixin-induced antioxidant and anti-inflammatory effects. In addition, bixin displays molecular activities as sacrificial antioxidant, excited state quencher, PPAR (peroxisome proliferator-activated receptor α/γ agonist, and TLR (Toll-like receptor 4/NFκB (nuclear factor kappa-light-chain-enhancer of activated B cells antagonist, all of which might be relevant to the enhancement of skin barrier function and environmental stress protection. Potential skin photoprotection and photochemoprevention benefits provided by topical application or dietary consumption of this ethno-pharmacologically validated phytochemical originating from the Americas deserves further preclinical and clinical examination.

  5. L-Arginine ameliorates cardiac left ventricular oxidative stress by upregulating eNOS and Nrf2 target genes in alloxan-induced hyperglycemic rats

    International Nuclear Information System (INIS)

    Ramprasath, Tharmarajan; Hamenth Kumar, Palani; Syed Mohamed Puhari, Shanavas; Senthil Murugan, Ponniah; Vasudevan, Varadaraj; Selvam, Govindan Sadasivam

    2012-01-01

    Highlights: ► L-Arginine treatment reduced the metabolic disturbances in diabetic animals. ► Antioxidant marker proteins were found high in myocardium by L-arginine treatment. ► Elevated antioxidant status, mediates the reduced TBA-reactivity in left ventricle. ► L-Arginine treatment enhanced the Nrf2 and eNOS signaling in left ventricle. ► Improved cell survival signaling by arginine, offers a novel tactic for targeting. -- Abstract: Hyperglycemia is independently related with excessive morbidity and mortality in cardiovascular disorders. L-Arginine-nitric oxide (NO) pathway and the involvement of NO in modulating nuclear factor-E2-related factor-2 (Nrf2) signaling were well established. In the present study we investigated, whether L-arginine supplementation would improve the myocardial antioxidant defense under hyperglycemia through activation of Nrf2 signaling. Diabetes was induced by alloxan monohydrate (90 mg kg −1 body weight) in rats. Both non-diabetic and diabetic group of rats were divided into three subgroups and they were administered either with L-arginine (2.25%) or L-NAME (0.01%) in drinking water for 12 days. Results showed that L-arginine treatment reduced the metabolic disturbances in diabetic rats. Antioxidant enzymes and glutathione levels were found to be increased in heart left ventricles, thereby reduction of lipid peroxidation by L-arginine treatment. Heart histopathological analysis further validates the reversal of typical diabetic characteristics consisting of alterations in myofibers and myofibrillary degeneration. qRT-PCR studies revealed that L-arginine treatment upregulated the transcription of Akt and downregulated NF-κB. Notably, transcription of eNOS and Nrf2 target genes was also upregulated, which were accompanied by enhanced expression of Nrf2 in left ventricular tissue from diabetic and control rats. Under these findings, we suggest that targeting of eNOS and Nrf2 signaling by L-arginine supplementation could be

  6. L-Arginine ameliorates cardiac left ventricular oxidative stress by upregulating eNOS and Nrf2 target genes in alloxan-induced hyperglycemic rats

    Energy Technology Data Exchange (ETDEWEB)

    Ramprasath, Tharmarajan; Hamenth Kumar, Palani; Syed Mohamed Puhari, Shanavas; Senthil Murugan, Ponniah; Vasudevan, Varadaraj [Molecular Cardiology Unit, Department of Biochemistry, Center for Excellence in Genomic Sciences, School of Biological Sciences, Madurai Kamaraj University, Madurai 625 021, Tamilnadu (India); Selvam, Govindan Sadasivam, E-mail: drselvamgsbiochem@rediffmail.com [Molecular Cardiology Unit, Department of Biochemistry, Center for Excellence in Genomic Sciences, School of Biological Sciences, Madurai Kamaraj University, Madurai 625 021, Tamilnadu (India)

    2012-11-23

    Highlights: Black-Right-Pointing-Pointer L-Arginine treatment reduced the metabolic disturbances in diabetic animals. Black-Right-Pointing-Pointer Antioxidant marker proteins were found high in myocardium by L-arginine treatment. Black-Right-Pointing-Pointer Elevated antioxidant status, mediates the reduced TBA-reactivity in left ventricle. Black-Right-Pointing-Pointer L-Arginine treatment enhanced the Nrf2 and eNOS signaling in left ventricle. Black-Right-Pointing-Pointer Improved cell survival signaling by arginine, offers a novel tactic for targeting. -- Abstract: Hyperglycemia is independently related with excessive morbidity and mortality in cardiovascular disorders. L-Arginine-nitric oxide (NO) pathway and the involvement of NO in modulating nuclear factor-E2-related factor-2 (Nrf2) signaling were well established. In the present study we investigated, whether L-arginine supplementation would improve the myocardial antioxidant defense under hyperglycemia through activation of Nrf2 signaling. Diabetes was induced by alloxan monohydrate (90 mg kg{sup -1} body weight) in rats. Both non-diabetic and diabetic group of rats were divided into three subgroups and they were administered either with L-arginine (2.25%) or L-NAME (0.01%) in drinking water for 12 days. Results showed that L-arginine treatment reduced the metabolic disturbances in diabetic rats. Antioxidant enzymes and glutathione levels were found to be increased in heart left ventricles, thereby reduction of lipid peroxidation by L-arginine treatment. Heart histopathological analysis further validates the reversal of typical diabetic characteristics consisting of alterations in myofibers and myofibrillary degeneration. qRT-PCR studies revealed that L-arginine treatment upregulated the transcription of Akt and downregulated NF-{kappa}B. Notably, transcription of eNOS and Nrf2 target genes was also upregulated, which were accompanied by enhanced expression of Nrf2 in left ventricular tissue from diabetic

  7. Ameliorating mitochondrial dysfunction restores carbon ion-induced cognitive deficits via co-activation of NRF2 and PINK1 signaling pathway.

    Science.gov (United States)

    Liu, Yang; Yan, Jiawei; Sun, Cao; Li, Guo; Li, Sirui; Zhang, Luwei; Di, Cuixia; Gan, Lu; Wang, Yupei; Zhou, Rong; Si, Jing; Zhang, Hong

    2018-07-01

    Carbon ion therapy is a promising modality in radiotherapy to treat tumors, however, a potential risk of induction of late normal tissue damage should still be investigated and protected. The aim of the present study was to explore the long-term cognitive deficits provoked by a high-linear energy transfer (high-LET) carbon ions in mice by targeting to hippocampus which plays a crucial role in memory and learning. Our data showed that, one month after 4 Gy carbon ion exposure, carbon ion irradiation conspicuously resulted in the impaired cognitive performance, neurodegeneration and neuronal cell death, as well as the reduced mitochondrial integrity, the disrupted activities of tricarboxylic acid cycle flux and electron transport chain, and the depressed antioxidant defense system, consequently leading to a decline of ATP production and persistent oxidative damage in the hippocampus region. Mechanistically, we demonstrated the disruptions of mitochondrial homeostasis and redox balance typically characterized by the disordered mitochondrial dynamics, mitophagy and glutathione redox couple, which is closely associated with the inhibitions of PINK1 and NRF2 signaling pathway as the key regulators of molecular responses in the context of neurotoxicity and neurodegenerative disorders. Most importantly, we found that administration with melatonin as a mitochondria-targeted antioxidant promoted the PINK1 accumulation on the mitochondrial membrane, and augmented the NRF2 accumulation and translocation. Moreover, melatonin pronouncedly enhanced the molecular interplay between NRF2 and PINK1. Furthermore, in the mouse hippocampal neuronal cells, overexpression of NRF2/PINK1 strikingly protected the hippocampal neurons from carbon ion-elicited toxic insults. Thus, these data suggest that alleviation of the sustained mitochondrial dysfunction and oxidative stress through co-modulation of NRF2 and PINK1 may be in charge of restoration of the cognitive impairments in a mouse

  8. Oxidative Stress in Cardiovascular Diseases: Involvement of Nrf2 Antioxidant Redox Signaling in Macrophage Foam Cells Formation

    Directory of Open Access Journals (Sweden)

    Bee Kee Ooi

    2017-11-01

    Full Text Available Oxidative stress is an important risk factor contributing to the pathogenesis of cardiovascular diseases. Oxidative stress that results from excessive reactive oxygen species (ROS production accounts for impaired endothelial function, a process which promotes atherosclerotic lesion or fatty streaks formation (foam cells. Nuclear factor erythroid 2-related factor 2 (Nrf2 is a transcription factor involved in cellular redox homeostasis. Upon exposure to oxidative stress, Nrf2 is dissociated from its inhibitor Keap-1 and translocated into the nucleus, where it results in the transcriptional activation of cell defense genes. Nrf2 has been demonstrated to be involved in the protection against foam cells formation by regulating the expression of antioxidant proteins (HO-1, Prxs, and GPx1, ATP-binding cassette (ABC efflux transporters (ABCA1 and ABCG1 and scavenger receptors (scavenger receptor class B (CD36, scavenger receptor class A (SR-A and lectin-type oxidized LDL receptor (LOX-1. However, Nrf2 has also been reported to exhibit pro-atherogenic effects. A better understanding on the mechanism of Nrf2 in oxidative stress-induced cardiac injury, as well as the regulation of cholesterol uptake and efflux, are required before it can serve as a novel therapeutic target for cardiovascular diseases prevention and treatment.

  9. Continuous activation of Nrf2 and its target antioxidant enzymes leads to arsenite-induced malignant transformation of human bronchial epithelial cells

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Xu [Department of Toxicology, School of Public Health, Jiangsu Key Laboratory of Preventive and Translational Medicine for Geriatric Diseases, Medical College of Soochow University, Suzhou, Jiangsu (China); Wang, Dapeng [Department of Toxicology, School of Public Health, Jiangsu Key Laboratory of Preventive and Translational Medicine for Geriatric Diseases, Medical College of Soochow University, Suzhou, Jiangsu (China); Department of Toxicology, School of Public Health, Guizhou Medical University, Guiyang, Guizhou (China); Ma, Yuan; Xu, Xiguo; Zhu, Zhen; Wang, Xiaojuan; Deng, Hanyi; Li, Chunchun; Chen, Min; Tong, Jian [Department of Toxicology, School of Public Health, Jiangsu Key Laboratory of Preventive and Translational Medicine for Geriatric Diseases, Medical College of Soochow University, Suzhou, Jiangsu (China); Yamanaka, Kenzo [Laboratory of Environmental Toxicology and Carcinogenesis, School of Pharmacy, Nihon University, Chiba (Japan); An, Yan, E-mail: dranyan@126.com [Department of Toxicology, School of Public Health, Jiangsu Key Laboratory of Preventive and Translational Medicine for Geriatric Diseases, Medical College of Soochow University, Suzhou, Jiangsu (China)

    2015-12-01

    Long-term exposure to arsenite leads to human lung cancer, but the underlying mechanisms of carcinogenesis remain obscure. The transcription factor of nuclear factor-erythroid-2 p45-related factor (Nrf2)-mediated antioxidant response represents a critical cellular defense mechanism and protection against various diseases. Paradoxically, emerging data suggest that the constitutive activation of Nrf2 is associated with cancer development, progression and chemotherapy resistance. However, the role of Nrf2 in the occurrence of cancer induced by long-term arsenite exposure remains to be fully understood. By establishing transformed human bronchial epithelial (HBE) cells via chronic low-dose arsenite treatment, we showed that, in acquiring this malignant phenotype, continuous low level of ROS and sustained enhancement of Nrf2 and its target antioxidant enzyme levels were observed in the later-stage of arsenite-induced cell transformation. The downregulation of Keap1 level may be responsible for the over-activation of Nrf2 and its target enzymes. To validate these observations, Nrf2 was knocked down in arsenite-transformed HBE cells by SiRNA transfection, and the levels of Nrf2 and its target antioxidant enzymes, ROS, cell proliferation, migration, and colony formation were determined following these treatments. Results showed that blocked Nrf2 expression significantly reduced Nrf2 and its target antioxidant enzyme levels, restored ROS levels, and eventually suppressed cell proliferation, migration, and colony formation of the transformed cells. In summary, the results of the study strongly suggested that the continuous activation of Nrf2 and its target antioxidant enzymes led to the over-depletion of intracellular ROS levels, which contributed to arsenite-induced HBE cell transformation. - Highlights: • Low level, long term arsenite exposure induces malignant transformation in vitro. • Long term arsenite exposure reduces ROS and MDA levels. • Long term arsenite

  10. Continuous activation of Nrf2 and its target antioxidant enzymes leads to arsenite-induced malignant transformation of human bronchial epithelial cells

    International Nuclear Information System (INIS)

    Yang, Xu; Wang, Dapeng; Ma, Yuan; Xu, Xiguo; Zhu, Zhen; Wang, Xiaojuan; Deng, Hanyi; Li, Chunchun; Chen, Min; Tong, Jian; Yamanaka, Kenzo; An, Yan

    2015-01-01

    Long-term exposure to arsenite leads to human lung cancer, but the underlying mechanisms of carcinogenesis remain obscure. The transcription factor of nuclear factor-erythroid-2 p45-related factor (Nrf2)-mediated antioxidant response represents a critical cellular defense mechanism and protection against various diseases. Paradoxically, emerging data suggest that the constitutive activation of Nrf2 is associated with cancer development, progression and chemotherapy resistance. However, the role of Nrf2 in the occurrence of cancer induced by long-term arsenite exposure remains to be fully understood. By establishing transformed human bronchial epithelial (HBE) cells via chronic low-dose arsenite treatment, we showed that, in acquiring this malignant phenotype, continuous low level of ROS and sustained enhancement of Nrf2 and its target antioxidant enzyme levels were observed in the later-stage of arsenite-induced cell transformation. The downregulation of Keap1 level may be responsible for the over-activation of Nrf2 and its target enzymes. To validate these observations, Nrf2 was knocked down in arsenite-transformed HBE cells by SiRNA transfection, and the levels of Nrf2 and its target antioxidant enzymes, ROS, cell proliferation, migration, and colony formation were determined following these treatments. Results showed that blocked Nrf2 expression significantly reduced Nrf2 and its target antioxidant enzyme levels, restored ROS levels, and eventually suppressed cell proliferation, migration, and colony formation of the transformed cells. In summary, the results of the study strongly suggested that the continuous activation of Nrf2 and its target antioxidant enzymes led to the over-depletion of intracellular ROS levels, which contributed to arsenite-induced HBE cell transformation. - Highlights: • Low level, long term arsenite exposure induces malignant transformation in vitro. • Long term arsenite exposure reduces ROS and MDA levels. • Long term arsenite

  11. Nrf2 mediates redox adaptations to exercise

    Directory of Open Access Journals (Sweden)

    Aaron J. Done

    2016-12-01

    Full Text Available The primary aim of this review is to summarize the current literature on the effects of acute exercise and regular exercise on nuclear factor erythroid 2-related factor 2 (Nrf2 activity and downstream targets of Nrf2 signaling. Nrf2 (encoded in humans by the NFE2L2 gene is the master regulator of antioxidant defenses, a transcription factor that regulates expression of more than 200 cytoprotective genes. Increasing evidence indicates that Nrf2 signaling plays a key role in how oxidative stress mediates the beneficial effects of exercise. Episodic increases in oxidative stress induced through bouts of acute exercise stimulate Nrf2 activation and when applied repeatedly, as with regular exercise, leads to upregulation of endogenous antioxidant defenses and overall greater ability to counteract the damaging effects of oxidative stress. The evidence of Nrf2 activation in response to exercise across variety of tissues may be an important mechanism of how exercise exerts its well-known systemic effects that are not limited to skeletal muscle and myocardium. Additionally there are emerging data that results from animal studies translate to humans.

  12. The berry constituents quercetin, kaempferol, and pterostilbene synergistically attenuate reactive oxygen species: involvement of the Nrf2-ARE signaling pathway.

    Science.gov (United States)

    Saw, Constance Lay Lay; Guo, Yue; Yang, Anne Yuqing; Paredes-Gonzalez, Ximena; Ramirez, Christina; Pung, Douglas; Kong, Ah-Ng Tony

    2014-10-01

    Quercetin, kaempferol, and pterostilbene are abundant in berries. The anti-oxidative properties of these constituents may contribute to cancer chemoprevention. However, their precise mechanisms of action and their combinatorial effects are not completely understood. Nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates anti-oxidative stress enzymes and Phase II drug metabolizing/detoxifying enzymes by binding to antioxidant response element (ARE). This study aimed to investigate the anti-oxidative stress activities of quercetin, kaempferol, and pterostilbene individually and in combination, as well as the involvement of the Nrf2-ARE signaling pathway. Quercetin, kaempferol, and pterostilbene all exhibited strong free-radical scavenging activity in the DPPH assay. The MTS assay revealed that low concentration combinations we tested were relatively non-toxic to HepG2-C8 cells. The results of the DCFH-DA assay and combination index (CI) indicated that quercetin, kaempferol, and pterostilbene attenuated intracellular reactive oxygen species (ROS) levels when pretreated individually and had synergistic effects when used in combination. In addition, the combination treatment significantly induced ARE and increased the mRNA and protein expression of Nrf2-regulated genes. Collectively, our study demonstrated that the berry constituents quercetin, kaempferol, and pterostilbene activated the Nrf2-ARE signaling pathway and exhibited synergistic anti-oxidative stress activity at appropriate concentrations. Copyright © 2014 Elsevier Ltd. All rights reserved.

  13. Activation of apoptosis signal-regulating kinase 1 is a key factor in paraquat-induced cell death: modulation by the Nrf2/Trx axis.

    Science.gov (United States)

    Niso-Santano, Mireia; González-Polo, Rosa A; Bravo-San Pedro, José M; Gómez-Sánchez, Rubén; Lastres-Becker, Isabel; Ortiz-Ortiz, Miguel A; Soler, Germán; Morán, José M; Cuadrado, Antonio; Fuentes, José M

    2010-05-15

    Although oxidative stress is fundamental to the etiopathology of Parkinson disease, the signaling molecules involved in transduction after oxidant exposure to cell death are ill-defined, thus making it difficult to identify molecular targets of therapeutic relevance. We have addressed this question in human dopaminergic neuroblastoma SH-SY5Y cells exposed to the parkinsonian toxin paraquat (PQ). This toxin elicited a dose-dependent increase in reactive oxygen species and cell death that correlated with activation of ASK1 and the stress kinases p38 and JNK. The relevance of these kinases in channeling PQ neurotoxicity was demonstrated with the use of interference RNA for ASK1 and two well-established pharmaceutical inhibitors for JNK and p38. The toxic effect of PQ was substantially attenuated by preincubation with vitamin E, blocking ASK1 pathways and preventing oxidative stress and cell death. In a search for a physiological pathway that might counterbalance PQ-induced ASK1 activation, we analyzed the role of the transcription factor Nrf2, master regulator of redox homeostasis, and its target thioredoxin (Trx), which binds and inhibits ASK1. Trx levels were undetectable in Nrf2-deficient mouse embryo fibroblasts (MEFs), whereas they were constitutively high in Keap1-deficient MEFs as well as in SH-SY5Y cells treated with sulforaphane (SFN). Consistent with these data, Nrf2-deficient MEFs were more sensitive and Keap1-deficient MEFs and SH-SY5Y cells incubated with SFN were more resistant to PQ-induced cell death. This study identifies ASK1/JNK and ASK1/p38 as two critical pathways involved in the activation of cell death under oxidative stress conditions and identifies the Nrf2/Trx axis as a new target to block these pathways and protect from oxidant exposure such as that found in Parkinson and other neurodegenerative diseases. Copyright 2010 Elsevier Inc. All rights reserved.

  14. The Biofunctions of Phytochemicals and Their Applications in Farm Animals: The Nrf2/Keap1 System as a Target

    Directory of Open Access Journals (Sweden)

    Si Qin

    2017-10-01

    Full Text Available Reactive oxygen species (ROS can be caused by mechanical, thermal, infectious, and chemical stimuli, and their negative effects on the health of humans and other animals are of considerable concern. The nuclear factor (erythroid-derived 2-like 2/Kelch-like ECH-associated protein 1 (Nrf2/Keap1 system plays a major role in maintaining the balance between the production and elimination of ROS via the regulation of a series of detoxifying and antioxidant enzyme gene expressions by means of the antioxidant response element (ARE. Dietary phytochemicals, which are generally found in vegetables, fruits, grains, and herbs, have been reported to have health benefits and to improve the growth performance and meat quality of farm animals through the regulation of Nrf2-mediated phase II enzymes in a variety of ways. However, the enormous quantity of somewhat chaotic data that is available on the effects of phytochemicals needs to be properly classified according to the functions or mechanisms of phytochemicals. In this review, we first introduce the antioxidant properties of phytochemicals and their relation to the Nrf2/Keap1 system. We then summarize the effects of phytochemicals on the growth performance, meat quality, and intestinal microbiota of farm animals via targeting the Nrf2/Keap1 system. These exhaustive data contribute to better illuminate the underlying biofunctional properties of phytochemicals in farm animals.

  15. Enhanced B-Raf-mediated NRF2 gene transcription and HATs-mediated NRF2 protein acetylation contributes to ABCC1-mediated chemoresistance and glutathione-mediated survival in acquired topoisomerase II poison-resistant cancer cells.

    Science.gov (United States)

    Chen, Huang-Hui; Chang, Hsin-Huei; Chang, Jang-Yang; Tang, Ya-Chu; Cheng, Yung-Chi; Lin, Li-Mei; Cheng, Shu-Ying; Huang, Chih-Hsiang; Sun, Man-Wu; Chen, Chiung-Tong; Kuo, Ching-Chuan

    2017-12-01

    Nuclear factor erythroid-2-related factor 2 (NRF2) mainly regulates transcriptional activation through antioxidant-responsive elements (AREs) present in the promoters of NRF2 target genes. Recently, we found that NRF2 was overexpressed in a KB-derived drug-resistant cancer cell panel. In this panel, KB-7D cells, which show acquired resistance to topoisomerase II (Top II) poisons, exhibited the highest NRF2 activation. To investigate whether NRF2 directly contributed to acquired resistance against Top II poisons, we manipulated NRF2 by genetic and pharmacological approaches. The result demonstrated that silencing of NRF2 by RNA interference increased the sensitivity and treatment with NRF2 activator decreased the sensitivity of KB and KB-7D cells toward Top II poisons. Further, increased B-Raf-mediated NRF2 gene transcription and HATs-mediated NRF2 protein acetylation activated NRF2 signaling in KB-7D cells. Moreover, increased binding of NRF2 to an ARE in the promoter of ATP-binding cassette subfamily C member 1 (ABCC1) directly contributed to Top II poison resistance. In addition, activation of NRF2 increased glutathione level and antioxidant capacity in KB-7D cells compared with that in KB cells; moreover, high glutathione level provided survival advantage to KB-7D cells. Our study is the first to show that aberrant NRF2 activation is via increased B-Raf-mediated NRF2 gene transcription and HATs-mediated NRF2 protein acetylation, which increases the acquired resistance and promote the survival of Top II poison-resistant cancer cells. Importantly, NRF2 downstream effectors ABCC1 and glutathione directly contribute to acquired resistance and survival, respectively. These results suggest that blockade of NRF2 signaling may enhance therapeutic efficacy and reduce the survival of Top II poison-refractory tumors in clinical. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Targeting the Nrf2/Amyloid-Beta Liaison in Alzheimer's Disease: A Rational Approach.

    Science.gov (United States)

    Simoni, Elena; Serafini, Melania M; Caporaso, Roberta; Marchetti, Chiara; Racchi, Marco; Minarini, Anna; Bartolini, Manuela; Lanni, Cristina; Rosini, Michela

    2017-07-19

    Amyloid is a prominent feature of Alzheimer's disease (AD). Yet, a linear linkage between amyloid-β peptide (Aβ) and the disease onset and progression has recently been questioned. In this context, the crucial partnership between Aβ and Nrf2 pathways is acquiring paramount importance, offering prospects for deciphering the Aβ-centered disease network. Here, we report on a new class of antiaggregating agents rationally designed to simultaneously activate transcription-based antioxidant responses, whose lead 1 showed interesting properties in a preliminary investigation. Relying on the requirements of Aβ recognition, we identified the catechol derivative 12. In SH-SY5Y neuroblastoma cells, 12 combined remarkable free radical scavenger properties to the ability to trigger the Nrf2 pathway and induce the Nrf2-dependent defensive gene NQO1 by means of electrophilic activation of the transcriptional response. Moreover, 12 prevented the formation of cytotoxic stable oligomeric intermediates, being significantly more effective, and per se less toxic, than prototype 1. More importantly, as different chemical features were exploited to regulate Nrf2 and Aβ activities, the two pathways could be tuned independently. These findings point to compound 12 and its derivatives as promising tools for investigating the therapeutic potential of the Nrf2/Aβ cellular network, laying foundation for generating new drug leads to confront AD.

  17. The Nrf1 and Nrf2 Balance in Oxidative Stress Regulation and Androgen Signaling in Prostate Cancer Cells

    Energy Technology Data Exchange (ETDEWEB)

    Schultz, Michelle A. [Department of Pharmacology, Tulane University Medical Center, 1430 Tulane Avenue, New Orleans, LA 70112 (United States); Abdel-Mageed, Asim B. [Department of Urology, Tulane University Medical Center, 1430 Tulane Avenue, New Orleans, LA 70112 (United States); Mondal, Debasis, E-mail: dmondal@tulane.edu [Department of Pharmacology, Tulane University Medical Center, 1430 Tulane Avenue, New Orleans, LA 70112 (United States)

    2010-06-21

    Reactive oxygen species (ROS) signaling has recently sparked a surge of interest as being the molecular underpinning for cancer cell survival, but the precise mechanisms involved have not been completely elucidated. This review covers the possible roles of two ROS-induced transcription factors, Nrf1 and Nrf2, and the antioxidant proteins peroxiredoxin-1 (Prx-1) and Thioredoxin-1 (Txn-1) in modulating AR expression and signaling in aggressive prostate cancer (PCa) cells. In androgen independent (AI) C4-2B cells, in comparison to the parental androgen dependent (AD) LNCaP cells, we present evidence of high Nrf1 and Prx-1 expression and low Nrf2 expression in these aggressive PCa cells. Furthermore, in DHT treated C4-2B cells, increased expression of the p65 (active) isoform of Nrf1 correlated with enhanced AR transactivation. Our findings implicate a crucial balance of Nrf1 and Nrf2 signaling in regulating AR activity in AI-PCa cells. Here we will discuss how understanding the mechanisms by which oxidative stress may affect AR signaling may aid in developing novel therapies for AI-PCa.

  18. Melatonin successfully rescues hippocampal bioenergetics and improves cognitive function following drug intoxication by promoting Nrf2-ARE signaling activity.

    Science.gov (United States)

    Chen, Li-You; Renn, Ting-Yi; Liao, Wen-Chieh; Mai, Fu-Der; Ho, Ying-Jui; Hsiao, George; Lee, Ai-Wei; Chang, Hung-Ming

    2017-09-01

    Prolonged exposure to gamma-hydroxybutyric acid (GHB) would cause drug intoxication in which impaired cognitive function results from enhanced hippocampal oxidative stress may serve as a major symptom in this deficiency. Considering melatonin possesses significant anti-oxidative efficacy, this study aimed to determine whether melatonin would successfully promote the nuclear factor erythroid 2-related factor 2 and antioxidant responsive element (Nrf2-ARE) signaling, depress oxidative stress, and rescue hippocampal bioenergetics and cognitive function following drug intoxication injury. Adolescent rats subjected to 10 days of GHB were received melatonin at doses of either 10 or 100 mg/kg. Time-of-flight secondary ion mass spectrometry, biochemical assay, quantitative histochemistry, [ 14 C]-2-deoxyglucose analysis, together with Morris water maze were employed to detect the molecular signaling, oxidative status, bioenergetic level, as well as the cognitive performances, respectively. Results indicated that in GHB-intoxicated rats, enhanced oxidative stress, increased cholesterol level, and decreased anti-oxidative enzymes activities were detected in hippocampal regions. Intense oxidative stress paralleled well with reduced bioenergetics and poor performance in behavioral testing. However, in rats treated with melatonin following GHB intoxication, all above parameters and cognitive function were gradually returned to nearly normal levels. Melatonin also remarkably promoted the translocation of Nrf2 from cytoplasm to nucleus in a dose-dependent manner, thereby increased the Nrf2-ARE signaling-related downstream anti-oxidative enzymes activities. As melatonin effectively rescues hippocampal bioenergetics through depressing the oxidative stress by promoting Nrf2-ARE molecular machinery, this study thus highlights for the first time that clinical use of melatonin may serve as a therapeutic strategy to improve the cognitive function in unsuspecting victims suffered from

  19. Schisandra chinensis regulates drug metabolizing enzymes and drug transporters via activation of Nrf2-mediated signaling pathway

    Directory of Open Access Journals (Sweden)

    He JL

    2014-12-01

    increase in the intracellular level of glutathione and total glutathione S-transferase content. SCE significantly elevated the messenger ribonucleic acid and protein levels of P-glycoprotein and multidrug resistance-associated protein 2 and 4, whereas the expression of organic anion transporting peptide 1A2 and 1B1 was significantly downregulated by SCE. Knockdown of Nrf2 by small interfering ribonucleic acid attenuated the regulatory effect of SCE on these DMEs and drug transporters. SCE significantly upregulated Nrf2 and promoted the translocation of Nrf2 from cytoplasm to the nuclei. Additionally, SCE significantly suppressed the expression of cytosolic Kelch-like ECH-associated protein 1 (the repressor of Nrf2 and remarkably increased Nrf2 stability in HepG2 cells. Taken together, our findings suggest that the hepatoprotective effects of SCE may be partially ascribed to the modulation of DMEs and drug transporters via Nrf2-mediated signaling pathway. SCE may alter the pharmacokinetics of other coadministered drugs that are substrates of these DMEs and transporters and thus cause unfavorable herb–drug interactions. Keywords: Nrf2, Keap1, HepG2 cell, drug metabolizing enzyme, drug transporter, P-gp, MRP, OATP, Schisandra chinensis

  20. Taurine Protects Mouse Spermatocytes from Ionizing Radiation-Induced Damage Through Activation of Nrf2/HO-1 Signaling.

    Science.gov (United States)

    Yang, Wenjun; Huang, Jinfeng; Xiao, Bang; Liu, Yan; Zhu, Yiqing; Wang, Fang; Sun, Shuhan

    2017-01-01

    The increasing prevalence of ionizing radiation exposure has inevitably raised public concern over the potential detrimental effects of ionizing radiation on male reproductive system function. The detection of drug candidates to prevent reproductive system from damage caused by ionizing radiation is urgent. We aimed to investigate the protective role of taurine on the injury of mouse spermatocyte-derived cells (GC-2) subjected to ionizing radiation. mouse spermatocytes (GC-2 cells) were exposed to ionizing radiation with or without treatment of Taurine. The effect of ionizing radiation and Taurine treatment on GC-2 cells were evaluated by cell viability assay (CCK8), cell cycle and apoptosis. The relative protein abundance change was determined by Western blotting. The siRNA was used to explore whether Nrf2 signaling was involved in the cytoprotection of Taurine. Taurine significantly inhibited the decrease of cell viability, percentage of apoptotic cells and cell cycle arrest induced by ionizing radiation. Western blot analysis showed that taurine significantly limited the ionizing radiation-induced down-regulation of CyclinB1 and CDK1, and suppressed activation of Fas/FasL system pathway. In addition, taurine treatment significantly increased the expression of Nrf2 and HO-1 in GC-2 cells exposed to ionizing radiation, two components in antioxidant pathway. The above cytoprotection of Taurine was blocked by siNrf2. Our results demonstrate that taurine has the potential to effectively protect GC-2 cells from ionizing radiation- triggered damage via upregulation of Nrf2/HO-1 signaling. © 2017 The Author(s). Published by S. Karger AG, Basel.

  1. Pyrrolidine dithiocarbamate activates the Nrf2 pathway in astrocytes.

    Science.gov (United States)

    Liddell, Jeffrey R; Lehtonen, Sarka; Duncan, Clare; Keksa-Goldsteine, Velta; Levonen, Anna-Liisa; Goldsteins, Gundars; Malm, Tarja; White, Anthony R; Koistinaho, Jari; Kanninen, Katja M

    2016-02-26

    Endogenous defense against oxidative stress is controlled by nuclear factor erythroid 2-related factor 2 (Nrf2). The normal compensatory mechanisms to combat oxidative stress appear to be insufficient to protect against the prolonged exposure to reactive oxygen species during disease. Counterbalancing the effects of oxidative stress by up-regulation of Nrf2 signaling has been shown to be effective in various disease models where oxidative stress is implicated, including Alzheimer's disease. Stimulation of Nrf2 signaling by small-molecule activators is an appealing strategy to up-regulate the endogenous defense mechanisms of cells. Here, we investigate Nrf2 induction by the metal chelator and known nuclear factor-κB inhibitor pyrrolidine dithiocarbamate (PDTC) in cultured astrocytes and neurons, and mouse brain. Nrf2 induction is further examined in cultures co-treated with PDTC and kinase inhibitors or amyloid-beta, and in Nrf2-deficient cultures. We show that PDTC is a potent inducer of Nrf2 signaling specifically in astrocytes and demonstrate the critical role of Nrf2 in PDTC-mediated protection against oxidative stress. This induction appears to be regulated by both Keap1 and glycogen synthase kinase 3β. Furthermore, the presence of amyloid-beta magnifies PDTC-mediated induction of endogenous protective mechanisms, therefore suggesting that PDTC may be an effective Nrf2 inducer in the context of Alzheimer's disease. Finally, we show that PDTC increases brain copper content and glial expression of heme oxygenase-1, and decreases lipid peroxidation in vivo, promoting a more antioxidative environment. PDTC activates Nrf2 and its antioxidative targets in astrocytes but not neurons. These effects may contribute to the neuroprotection observed for PDTC in models of Alzheimer's disease.

  2. The PTEN/NRF2 Axis Promotes Human Carcinogenesis

    DEFF Research Database (Denmark)

    Rojo, Ana I; Rada, Patricia; Mendiola, Marta

    2014-01-01

    and tumorigenic advantage. Tissue microarrays from endometrioid carcinomas showed that 80% of PTEN-negative tumors expressed high levels of NRF2 or its target heme oxygenase-1 (HO-1). INNOVATION: These results uncover a new mechanism of oncogenic activation of NRF2 by loss of its negative regulation by PTEN/GSK-3....../β-TrCP that may be relevant to a large number of tumors, including endometrioid carcinomas. CONCLUSION: Increased activity of NRF2 due to loss of PTEN is instrumental in human carcinogenesis and represents a novel therapeutic target. Antioxid. Redox Signal. 21, 2498-2514....

  3. Sulforaphane Prevents Testicular Damage in Kunming Mice Exposed to Cadmium via Activation of Nrf2/ARE Signaling Pathways

    Directory of Open Access Journals (Sweden)

    Shu-Hua Yang

    2016-10-01

    Full Text Available Sulforaphane (SFN is a natural and highly effective antioxidant. Studies suggest that SFN protects cells and tissues against cadmium (Cd toxicity. This study investigated the protective effect of SFN against oxidative damage in the testes of Kunming mice exposed to cadmium, and explored the possible molecular mechanisms involved. Cadmium greatly reduced the serum testosterone levels in mice, reduced sperm motility, total sperm count, and increased the sperm deformity rate. Cadmium also reduces superoxide dismutase (T-SOD and glutathione (GSH levels and increases malondialdehyde (MDA concentrations. SFN intervention improved sperm quality, serum testosterone, and antioxidant levels. Both mRNA and protein expression of mouse testicular nuclear factor-erythroid 2-related factor 2 (Nrf2 was reduced in cadmium-treated group. Furthermore, the downstream genes of Nrf2, glutathione peroxidase (GSH-Px, γ-glutamyl cysteine synthetase (γ-GCS, heme oxygenase-1 (HO-1, and NAD(PH:quinone oxidoreductase-1 (NQO1 were also decreased in cadmium-treated group. SFN intervention increases the expression of these genes. Sulforaphane prevents cadmium-induced testicular damage, probably via activation of Nrf2/ARE signaling.

  4. The neuroprotective effects of α-iso-cubebene on dopaminergic cell death: involvement of CREB/Nrf2 signaling.

    Science.gov (United States)

    Park, Sun Young; Son, Beung Gu; Park, Young Hoon; Kim, Cheol-Min; Park, Geuntae; Choi, Young-Whan

    2014-09-01

    As a part of ongoing studies to elucidate pharmacologically active components of Schisandra chinensis, we isolated and studied α-iso-cubebene. The neuroprotective mechanisms of α-iso-cubebene in human neuroblastoma SH-SY5Y cells were investigated. α-Iso-cubebene significantly inhibited cytotoxicity and apoptosis due to 6-hydroxydopamine (6-OHDA)-induced neurotoxicity in dopaminergic SH-SY5Y cells. Pretreatment of cells with α-iso-cubebene reduced intracellular accumulation of ROS and calcium in response to 6-OHDA. The neuroprotective effects of α-iso-cubebene were found to result from protecting the mitochondrial membrane potential. Notably, α-iso-cubebene inhibited the release of apoptosis-inducing factor from the mitochondria into the cytosol and nucleus after 6-OHDA treatment. α-Iso-cubebene also induced the activation of PKA/PKB/CREB/Nrf2 and suppressed 6-OHDA-induced neurotoxicity. α-Iso-cubebene was found to induce phosphorylation of PKA and PKB and activate Nrf2 and CREB signaling pathways in a dose-dependent manner. Additionally, α-iso-cubebene stimulated the expression of the antioxidant response genes NQO1 and HO-1. Finally, α-iso-cubebene-mediated neuroprotective effects were found to be reversible after transfection with CREB and Nrf2 small interfering RNAs.

  5. 5-HMF attenuates striatum oxidative damage via Nrf2/ARE signaling pathway following transient global cerebral ischemia.

    Science.gov (United States)

    Ya, Bai-Liu; Li, Hong-Fang; Wang, Hai-Ying; Wu, Fei; Xin, Qing; Cheng, Hong-Ju; Li, Wen-Juan; Lin, Na; Ba, Zai-Hua; Zhang, Ru-Juan; Liu, Qian; Li, Ya-Nan; Bai, Bo; Ge, Feng

    2017-01-01

    Recent studies have shown 5-hydroxymethyl-2-furfural (5-HMF) has favorable biological effects, and its neuroprotection in a variety of neurological diseases has been noted. Our previous study showed that treatment of 5-HMF led to protection against permanent global cerebral ischemia. However, the underlying mechanisms in cerebral ischemic injury are not fully understood. This study was conducted to investigate the neuroprotective effect of 5-HMF and elucidate the nuclear factor erythroid 2-related factor 2 (Nrf2)/antioxidant response element (ARE) signaling pathway mechanism in the striatum after transient global cerebral ischemia. C57BL/6 mice were subjected to bilateral common carotid artery occlusion for 20 min and sacrificed 24 h after reperfusion. 5-HMF (12 mg/kg) or an equal volume of vehicle was intraperitoneally injected 30 min before ischemia and 5 min after the onset of reperfusion. At 24 h after reperfusion, neurological function was evaluated by neurological disability status scale, locomotor activity test and inclined beam walking test. Histological injury of the striatum was observed by cresyl violet staining and terminal deoxynucleotidyl transferase (TdT)-mediated dNTP nick end labeling (TUNEL) staining. Oxidative stress was evaluated by the carbonyl groups introduced into proteins, and malondialdehyde (MDA) levels. An enzyme-linked immunosorbent assay (ELISA)-based measurement was used to detect Nrf2 DNA binding activity. Nrf2 and its downstream ARE pathway protein expression such as heme oxygenase-1, NAD (P)H:quinone oxidoreductase 1, glutamate-cysteine ligase catalytic subunit and glutamate-cysteine ligase modulatory subunit were detected by western blot. Our results showed that 5-HMF treatment significantly ameliorated neurological deficits, reduced brain water content, attenuated striatum neuronal damage, decreased the carbonyl groups and MDA levels, and activated Nrf2/ARE signaling pathway. Taken together, these results demonstrated that

  6. Salvianolic acid B protects against paraquat-induced pulmonary injury by mediating Nrf2/Nox4 redox balance and TGF-β1/Smad3 signaling

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Bin, E-mail: iamicehe@163.com [Department of Respiratory and Critical Care Medicine, Affiliated Hospital of Logistic University of Chinese People' s Armed Police Force, Tianjin 300162 (China); Cao, Bo, E-mail: caobo19814@126.com [Logistics University of Chinese People' s Armed Police Force, Tianjin 300162 (China); Tianjin Key Laboratory of Cardiovascular Remodeling and Target Organ Injury, Tianjin, 300162 (China); Zhang, Di, E-mail: zhangdibad@163.com [Department of Otorhinolaryngology Head and Neck Surgery, Institute of Otorhinolaryngology, Tianjin First Center Hospital, Tianjin 300192 (China); Xiao, Na [Department of Respiratory and Critical Care Medicine, Affiliated Hospital of Logistic University of Chinese People' s Armed Police Force, Tianjin 300162 (China); Chen, Hong [Logistics University of Chinese People' s Armed Police Force, Tianjin 300162 (China); Li, Guo-qiang; Peng, Shou-chun [Department of Respiratory and Critical Care Medicine, Affiliated Hospital of Logistic University of Chinese People' s Armed Police Force, Tianjin 300162 (China); Wei, Lu-qing, E-mail: luqing-wei@163.com [Department of Respiratory and Critical Care Medicine, Affiliated Hospital of Logistic University of Chinese People' s Armed Police Force, Tianjin 300162 (China)

    2016-10-15

    The present study was aimed at exploring the protective effects of Salvianolic acid B (SalB) against paraquat (PQ)-induced lung injury in mice. Lung fibrotic injuries were induced in mice by a single intragastrical administration of 300 mg/kg PQ, then the mice were administrated with 200 mg/kg, 400 mg/kg SalB, 100 mg/kg vitamin C (Vit C) and dexamethasone (DXM) for 14 days. PQ-triggered structure distortion, collagen overproduction, excessive inflammatory infiltration, pro-inflammatory cytokine release, and oxidative stress damages in lung tissues and mortality of mice were attenuated by SalB in a dose-dependent manner. Furthermore, SalB was noted to enhance the expression and nuclear translocation of nuclear factor erythroid 2–related factor 2 (Nrf2) and reduce expression of the reactive oxygen species-generating enzyme Nox4 [NADPH (reduced form of nicotinamide adenine dinucleotide phosphate) oxidase-4]. SalB also inhibited the increasing expression of transforming growth factor (TGF)-β1 and the phosphorylation of its downstream target Smad3 which were enhanced by PQ. These results suggest that SalB may exert protective effects against PQ-induced lung injury and pulmonary fibrosis. Its mechanisms involve the mediation of Nrf2/Nox4 redox balance and TGF-β1/Smad3 signaling. - Highlights: • Salvianolic acid B (SalB) reduced Paraquat-induced mortality and pulmonary injury in mice. • SalB has anti-oxidation, anti-inflammatory and anti-fibrogenic effects simultaneously. • Its mechanisms were targeting Nrf2-Nox4 redox balance and TGF-β1/Smad3 signaling.

  7. Salvianolic acid B protects against paraquat-induced pulmonary injury by mediating Nrf2/Nox4 redox balance and TGF-β1/Smad3 signaling

    International Nuclear Information System (INIS)

    Liu, Bin; Cao, Bo; Zhang, Di; Xiao, Na; Chen, Hong; Li, Guo-qiang; Peng, Shou-chun; Wei, Lu-qing

    2016-01-01

    The present study was aimed at exploring the protective effects of Salvianolic acid B (SalB) against paraquat (PQ)-induced lung injury in mice. Lung fibrotic injuries were induced in mice by a single intragastrical administration of 300 mg/kg PQ, then the mice were administrated with 200 mg/kg, 400 mg/kg SalB, 100 mg/kg vitamin C (Vit C) and dexamethasone (DXM) for 14 days. PQ-triggered structure distortion, collagen overproduction, excessive inflammatory infiltration, pro-inflammatory cytokine release, and oxidative stress damages in lung tissues and mortality of mice were attenuated by SalB in a dose-dependent manner. Furthermore, SalB was noted to enhance the expression and nuclear translocation of nuclear factor erythroid 2–related factor 2 (Nrf2) and reduce expression of the reactive oxygen species-generating enzyme Nox4 [NADPH (reduced form of nicotinamide adenine dinucleotide phosphate) oxidase-4]. SalB also inhibited the increasing expression of transforming growth factor (TGF)-β1 and the phosphorylation of its downstream target Smad3 which were enhanced by PQ. These results suggest that SalB may exert protective effects against PQ-induced lung injury and pulmonary fibrosis. Its mechanisms involve the mediation of Nrf2/Nox4 redox balance and TGF-β1/Smad3 signaling. - Highlights: • Salvianolic acid B (SalB) reduced Paraquat-induced mortality and pulmonary injury in mice. • SalB has anti-oxidation, anti-inflammatory and anti-fibrogenic effects simultaneously. • Its mechanisms were targeting Nrf2-Nox4 redox balance and TGF-β1/Smad3 signaling.

  8. Dihydro-CDDO-trifluoroethyl amide (dh404, a novel Nrf2 activator, suppresses oxidative stress in cardiomyocytes.

    Directory of Open Access Journals (Sweden)

    Tomonaga Ichikawa

    Full Text Available Targeting Nrf2 signaling appears to be an attractive approach for the treatment of maladaptive cardiac remodeling and dysfunction; however, pharmacological modulation of the Nrf2 pathway in the cardiovascular system remains to be established. Herein, we report that a novel synthetic triterpenoid derivative, dihydro-CDDO-trifluoroethyl amide (dh404, activates Nrf2 and suppresses oxidative stress in cardiomyocytes. Dh404 interrupted the Keap1-Cul3-Rbx1 E3 ligase complex-mediated Nrf2 ubiquitination and subsequent degradation saturating the binding capacity of Keap1 to Nrf2, thereby rendering more Nrf2 to be translocated into the nuclei to activate Nrf2-driven gene transcription. A mutant Keap1 protein containing a single cysteine-to-serine substitution at residue 151 within the BTB domain of Keap1 was resistant to dh404-induced stabilization of Nrf2 protein. In addition, dh404 did not dissociate the interaction of Nrf2 with the Keap1-Cul3-Rbx1 E3 ligase complex. Thus, it is likely that dh404 inhibits the ability of Keap1-Cul3-Rbx1 E3 ligase complex to target Nrf2 for ubiquitination and degradation via modifying Cys-151 of Keap1 to change the conformation of the complex. Moreover, dh404 was able to stabilize Nrf2 protein, to enhance Nrf2 nuclear translocation, to activate Nrf2-driven transcription, and to suppress angiotensin II (Ang II-induced oxidative stress in cardiomyocytes. Knockdown of Nrf2 almost blocked the anti-oxidative effect of dh404. Dh404 activated Nrf2 signaling in the heart. Taken together, dh404 appears to be a novel Nrf2 activator with a therapeutic potential for cardiac diseases via suppressing oxidative stress.

  9. Uric acid demonstrates neuroprotective effect on Parkinson's disease mice through Nrf2-ARE signaling pathway.

    Science.gov (United States)

    Huang, Ting-Ting; Hao, Dong-Lin; Wu, Bo-Na; Mao, Lun-Lin; Zhang, Jin

    2017-12-02

    Uric acid has neuroprotective effect on Parkinson's disease (PD) by inhibiting oxidative damage and neuronal cell death. Our previous study has shown that uric acid protected dopaminergic cell line damage through inhibiting accumulation of NF-E2-related factor 2 (Nrf2). This study aimed to investigate its in vivo neuroprotective effect. PD was induced by MPTP intraperitoneally injection for 7 d in male C57BL/6 mice. Mice were treated with either uric acid (intraperitoneally injection 250 mg/kg) or saline for a total of 13 d. We showed that uric acid improved behavioral performances and cognition of PD mice, increased TH-positive dopaminergic neurons and decreased GFAP-positive astrocytes in substantia nigra (SN). Uric acid increased mRNA and protein expressions of Nrf2 and three Nrf2-responsive genes, including γ-glutamate-cysteine ligase catalytic subunit (γ-GCLC), heme oxygenase-1 (HO-1) and NQO1. Uric acid significantly increased superoxide dismutase (SOD), CAT, glutathione (GSH) levels and decreased malondialdehyde (MDA) level in SN regions of MPTP-treated mice. Uric acid inhibited the hippocampal expression of IL-1β and decreased serum and hippocampus levels of interleukin-1β (IL-1β), IL-6 and tumor necrosis factor-α (TNF-α). In conclusion, uric acid demonstrates neuroprotective properties for dopaminergic neurons in PD mice through modulation of neuroinflammation and oxidative stress. Copyright © 2017. Published by Elsevier Inc.

  10. Docosahexaenoic Acid (DHA) Provides Neuroprotection in Traumatic Brain Injury Models via Activating Nrf2-ARE Signaling.

    Science.gov (United States)

    Zhu, Wei; Ding, Yuexia; Kong, Wei; Li, Tuo; Chen, Hongguang

    2018-04-16

    In this study, we explored the neuroprotective effects of docosahexaenoic acid (DHA) in traumatic brain injury (TBI) models. In this study, we first confirmed that DHA was neuroprotective against TBI via the NSS test and Morris water maze experiment. Western blot was conducted to identify the expression of Bax, caspase-3, and Bcl-2. And the cell apoptosis of the TBI models was validated by TUNEL staining. Relationships between nuclear factor erythroid 2-related factor 2-antioxidant response element (Nrf2-ARE) pathway-related genes and DHA were explored by RT-PCR and Western blot. Rats of the DHA group performed remarkably better than those of the TBI group in both NSS test and water maze experiment. DHA conspicuously promoted the expression of Bcl-2 and diminished that of cleaved caspase-3 and Bax, indicating the anti-apoptotic role of DHA. Superoxide dismutase (SOD) activity and cortical malondialdehyde content, glutathione peroxidase (GPx) activity were renovated in rats receiving DHA treatment, implying that the neuroprotective influence of DHA was derived from lightening the oxidative stress caused by TBI. Moreover, immunofluorescence and Western blot experiments revealed that DHA facilitated the translocation of Nrf2 to the nucleus. DHA administration also notably increased the expression of the downstream factors NAD(P)H:quinone oxidoreductase (NQO-1) and heme oxygenase 1(HO-1). DHA exerted neuroprotective influence on the TBI models, potentially through activating the Nrf2- ARE pathway.

  11. Protective Effect of Tempol on Acute Kidney Injury Through PI3K/Akt/Nrf2 Signaling Pathway

    Directory of Open Access Journals (Sweden)

    Gensheng Zhang

    2016-02-01

    Full Text Available Background/Aims: Tempol is a protective antioxidant against ischemic injury in many animal models. The molecular mechanisms are not well understood. Nuclear factor erythroid 2-related factor (Nrf2 is a master transcription factor during oxidative stress, which is enhanced by activation of protein kinase C (PKC pathway. Another factor, tubular epithelial apoptosis, is mediated by activation of phosphoinositide 3-kinase (PI3K/protein kinase B (PKB, Akt signaling pathway during renal ischemic injury. We tested the hypothesis that tempol activates PKC or PI3K/Akt/Nrf2 pathways to transcribe many genes that coordinate endogenous antioxidant defense. Methods: The right renal pedicle was clamped for 45 minutes and the left kidney was removed to study renal ischemia/reperfusion (I/R injury in C57BL/6 mice. The response was assessed from serum parameters, renal morphology and renal expression of PKC, phosphorylated-PKC (p-PKC, Nrf2, heme oxygenase-1 (HO-1, Akt, phosphorylated-Akt (p-Akt, pro-caspase-3 and cleaved caspase-3 in groups of sham and I/R mice given vehicle, or tempol (50 or 100 mg/kg, intraperitoneal injection. Results: The serum malondialdehyde (MDA, marker of reactive oxygen species doubled and the BUN and creatinine increased 5- to 10-fold after I/R injury. Tempol (50 or 100 mg/kg prevented the increases in MDA but only tempol (50 mg/kg lessened the increases in BUN and creatinine and moderated the acute tubular necrosis. I/R did not change expression of PKC or p-PKC but reduced renal expression of Nrf2, p-Akt, HO-1 and pro-caspase-3 and increased cleaved caspase-3. Tempol (50 mg/kg prevented these changes produced by I/R whereas tempol (100 mg/kg had lesser or inconsistent effects. Conclusion: Tempol (50 mg/kg prevents lipid peroxidation and attenuates renal damage after I/R injury. The beneficial pathway apparently is not dependent on upregulation or phosphorylation of PKC, at lower tempol doses, does implicate upregulation of Akt with

  12. Silencing Nrf2 impairs glioma cell proliferation via AMPK-activated mTOR inhibition

    Energy Technology Data Exchange (ETDEWEB)

    Jia, Yue [Department of Neurosurgery, Jinling Hospital, School of Medicine, Nanjing University, 305 East Zhongshan Road, Nanjing 210002, Jiangsu Province (China); Wang, Handong, E-mail: njhdwang@hotmail.com [Department of Neurosurgery, Jinling Hospital, School of Medicine, Nanjing University, 305 East Zhongshan Road, Nanjing 210002, Jiangsu Province (China); Wang, Qiang [Department of Neurosurgery, Jinling Hospital, School of Medicine, Nanjing University, 305 East Zhongshan Road, Nanjing 210002, Jiangsu Province (China); Ding, Hui [Department of Neurosurgery, Jinling Hospital, School of Medicine, Southern Medical University (Guangzhou), 305 East Zhongshan Road, Nanjing 210002, Jiangsu Province (China); Wu, Heming [Department of Neurosurgery, Nanjing Jingdu Hospital, No. 34, Biao 34, Yanggongjing Road, Nanjing 210002, Jiangsu Province (China); Pan, Hao [Department of Neurosurgery, Jinling Hospital, School of Medicine, Nanjing University, 305 East Zhongshan Road, Nanjing 210002, Jiangsu Province (China)

    2016-01-15

    Gliomas are the leading cause of death among adults with primary brain malignancies. Treatment for malignant gliomas remains limited, and targeted therapies have been incompletely explored. Nuclear factor erythroid 2-related factor 2 (Nrf2), a key transcription regulator for antioxidant and detoxification enzymes, is abundantly expressed in cancer cells. In this study, the role and mechanism of Nrf2 in cancer cell proliferation was investigated in multiple glioma cell lines. We first evaluated the expression patterns of Nrf2 in four glioma cell lines and found all four cell lines expressed Nrf2, but the highest level was observed in U251 cells. We further evaluated the biological functions of Nrf2 in U251 glioma cell proliferation by specific inhibition of Nrf2 using short hairpin RNA (shRNA). We found that Nrf2 depletion inhibited glioma cell proliferation. Nrf2 depletion also decreased colony formation in U251 cells stably expressing Nrf2 shRNA compared to scrambled control shRNA. Moreover, suppression of Nrf2 expression could lead to ATP depletion (with concomitant rise in AMP/ATP ratio) and consequently to AMPK-activated mTOR inhibition. Finally, activation of adenosine monophosphate–activated protein kinase (AMPK) by treated with phenformin, an AMPK agonist, can mimic the inhibitory effect of Nrf2 knockdown in U251 cells. In conclusion, our findings will shed light to the role and mechanism of Nrf2 in regulating glioma proliferation via ATP-depletion-induced AMPK activation and consequent mTOR inhibition, a novel insight into our understanding the role and mechanism of Nrf2 in glioma pathoetiology. To our knowledge, this is also the first report to provide a rationale for the implication of cross-linking between Nrf2 and mTOR signaling.

  13. Paeonia lactiflora Pall. protects against ANIT-induced cholestasis by activating Nrf2 via PI3K/Akt signaling pathway

    Directory of Open Access Journals (Sweden)

    Ma X

    2015-09-01

    Full Text Available Xiao Ma,1,2 Yan-ling Zhao,2 Yun Zhu,3 Zhe Chen,1,2 Jia-bo Wang,4 Rui-yu Li,1,4 Chang Chen,1,2 Shi-zhang Wei,1,2 Jian-yu Li,3 Bing Liu,5 Rui-lin Wang,3 Yong-gang Li,3 Li-fu Wang,3 Xiao-he Xiao4 1Pharmacy College, Chengdu University of Traditional Chinese Medicine, Chengdu, People’s Republic of China; 2Department of Pharmacy, 302 Military Hospital of People’s Liberation Army, Beijing, People’s Republic of China; 3Department of Integrative Medical Center, 302 Military Hospital of People’s Liberation Army, Beijing, People’s Republic of China; 4China Military Institute of Chinese Medicine, 302 Military Hospital of People’s Liberation Army, Beijing, People’s Republic of China; 5School of Chinese Medicine, The University of Hong Kong, Hong Kong Background: Paeonia lactiflora Pall. (PLP, a traditional Chinese herbal medicine, has been used for hepatic disease treatment over thousands of years. In our previous study, PLP was shown to demonstrate therapeutic effect on hepatitis with severe cholestasis. The aim of this study was to evaluate the antioxidative effect of PLP on alpha-naphthylisothiocyanate (ANIT-induced cholestasis by activating NF-E2-related factor 2 (Nrf2 via phosphatidylinositol 3-kinase (PI3K/Akt signaling pathway. Materials and methods: Liquid chromatography-mass spectrometry (LC-MS was performed to identify the main compounds present in PLP. The mechanism of action of PLP and its therapeutic effect on cholestasis, induced by ANIT, were further investigated. Serum indices such as total bilirubin (TBIL, direct bilirubin (DBIL, aspartate aminotransferase (AST, alanine aminotransferase (ALT, alkaline phosphatase (ALP, γ-glutamyl transpeptidase (γ-GT, and total bile acid (TBA were measured, and histopathology of liver was also performed to determine the efficacy of treatment with PLP. Moreover, in order to illustrate the underlying signaling pathway, liver glutathione (GSH content and mRNA or protein levels of glutamate

  14. Inhibition of microRNA-153 protects neurons against ischemia/reperfusion injury in an oxygen-glucose deprivation and reoxygenation cellular model by regulating Nrf2/HO-1 signaling.

    Science.gov (United States)

    Ji, Qiong; Gao, Jianbo; Zheng, Yan; Liu, Xueli; Zhou, Qiangqiang; Shi, Canxia; Yao, Meng; Chen, Xia

    2017-07-01

    MicroRNAs are emerging as critical regulators in cerebral ischemia/reperfusion injury; however, their exact roles remain poorly understood. miR-153 is reported to be a neuron-related miRNA involved in neuroprotection. In this study, we aimed to investigate the precise role of miR-153 in regulating neuron survival during cerebral ischemia/reperfusion injury using an oxygen-glucose deprivation and reoxygenation (OGD/R) cellular model. We found that miR-153 was significantly upregulated in neurons subjected to OGD/R treatment. Inhibition of miR-153 significantly attenuated OGD/R-induced injury and oxidative stress in neurons. Nuclear factor erythroid 2-related factor 2 (Nrf2) was identified as a target gene of miR-153. Inhibition of miR-153 significantly promoted the expression of Nrf2 and heme oxygenase-1 (HO-1). However, silencing of Nrf2 significantly blocked the protective effects of miR-153 inhibition. Our study indicates that the inhibition of miR-153 protects neurons against OGD/R-induced injury by regulating Nrf2/HO-1 signaling and suggests a potential therapeutic target for cerebral ischemia/reperfusion injury. © 2017 Wiley Periodicals, Inc.

  15. Activation of Nrf2 Reduces UVA-Mediated MMP-1 Upregulation via MAPK/AP-1 Signaling Cascades: The Photoprotective Effects of Sulforaphane and Hispidulin

    Science.gov (United States)

    Chaiprasongsuk, Anyamanee; Lohakul, Jinaphat; Soontrapa, Kitipong; Sampattavanich, Somponnat; Akarasereenont, Pravit

    2017-01-01

    UVA irradiation plays a role in premature aging of the skin through triggering oxidative stress-associated stimulation of matrix metalloproteinase-1 (MMP-1) responsible for collagen degradation, a hallmark of photoaged skin. Compounds that can activate nuclear factor E2-related factor 2 (Nrf2), a transcription factor regulating antioxidant gene expression, should therefore serve as effective antiphotoaging agents. We investigated whether genetic silencing of Nrf2 could relieve UVA-mediated MMP-1 upregulation via activation of mitogen-activated protein kinase (MAPK)/activator protein 1 (AP-1) signaling using human keratinocyte cell line (HaCaT). Antiphotoaging effects of hispidulin (HPD) and sulforaphane (SFN) were assessed on their abilities to activate Nrf2 in controlling MMP-1 and collagen expressions in association with phosphorylation of MAPKs (extracellular signal-regulated kinase, c-Jun N-terminal kinase, and p38), c-Jun, and c-Fos, using the skin of BALB/c mice subjected to repetitive UVA irradiation. Our findings suggested that depletion of Nrf2 promoted both mRNA expression and activity of MMP-1 in the UVA-irradiated HaCaT cells. Treatment of Nrf2 knocked-down HaCaT cells with MAPK inhibitors significantly suppressed UVA-induced MMP-1 and AP-1 activities. Moreover, pretreatment of the mouse skin with HPD and SFN, which could activate Nrf2, provided protective effects against UVA-mediated MMP-1 induction and collagen depletion in correlation with the decreased levels of phosphorylated MAPKs, c-Jun, and c-Fos in the mouse skin. In conclusion, Nrf2 could influence UVA-mediated MMP-1 upregulation through the MAPK/AP-1 signaling cascades. HPD and SFN may therefore represent promising antiphotoaging candidates. PMID:28011874

  16. Resveratrol-Induced Downregulation of NAF-1 Enhances the Sensitivity of Pancreatic Cancer Cells to Gemcitabine via the ROS/Nrf2 Signaling Pathways

    Directory of Open Access Journals (Sweden)

    Liang Cheng

    2018-01-01

    Full Text Available NAF-1 (nutrient-deprivation autophagy factor-1, which is an outer mitochondrial membrane protein, is known to play important roles in calcium metabolism, antiapoptosis, and antiautophagy. Resveratrol, a natural polyphenolic compound, is considered as a potent anticancer agent. Nevertheless, the molecular mechanisms underlying the effects of resveratrol and NAF-1 and their mediation of drug resistance in pancreatic cancer remain unclear. Here, we demonstrate that resveratrol suppresses the expression of NAF-1 in pancreatic cancer cells by inducing cellular reactive oxygen species (ROS accumulation and activating Nrf2 signaling. In addition, the knockdown of NAF-1 activates apoptosis and impedes the proliferation of pancreatic cancer cells. More importantly, the targeting of NAF-1 by resveratrol can improve the sensitivity of pancreatic cancer cells to gemcitabine. These results highlight the significance of strategies that target NAF-1, which may enhance the efficacy of gemcitabine in pancreatic cancer therapy.

  17. NRF2 Signaling Negatively Regulates Phorbol-12-Myristate-13-Acetate (PMA-Induced Differentiation of Human Monocytic U937 Cells into Pro-Inflammatory Macrophages.

    Directory of Open Access Journals (Sweden)

    Min-Gu Song

    Full Text Available Blood monocytes are recruited to injured tissue sites and differentiate into macrophages, which protect against pathogens and repair damaged tissues. Reactive oxygen species (ROS are known to be an important contributor to monocytes' differentiation and macrophages' function. NF-E2-related factor 2 (NRF2, a transcription factor regulating cellular redox homeostasis, is known to be a critical modulator of inflammatory responses. We herein investigated the role of NRF2 in macrophage differentiation using the human monocytic U937 cell line and phorbol-12-myristate-13-acetate (PMA. In U937 cells with NRF2 silencing, PMA-stimulated cell adherence was significantly facilitated when compared to control U937 cells. Both transcript and protein levels for pro-inflammatory cytokines, including interleukine-1β (IL-1β, IL-6, and tumor necrosis factor-α (TNFα were highly elevated in PMA-stimulated NRF2-silenced U937 compared to the control. In addition, PMA-inducible secretion of monocyte chemotactic protein 1 (MCP-1 was significantly high in NRF2-silenced U937. As an underlying mechanism, we showed that NRF2-knockdown U937 retained high levels of cellular ROS and endoplasmic reticulum (ER stress markers expression; and subsequently, PMA-stimulated levels of Ca2+ and PKCα were greater in NRF2-knockdown U937 cells, which caused enhanced nuclear accumulation of nuclear factor-ҡB (NFҡB p50 and extracellular signal-regulated kinase (ERK-1/2 phosphorylation. Whereas the treatment of NRF2-silenced U937 cells with pharmacological inhibitors of NFҡB or ERK1/2 largely blocked PMA-induced IL-1β and IL-6 expression, indicating that these pathways are associated with cell differentiation. Taken together, our results suggest that the NRF2 system functions to suppress PMA-stimulated U937 cell differentiation into pro-inflammatory macrophages and provide evidence that the ROS-PKCα-ERK-NFҡB axis is involved in PMA-facilitated differentiation of NRF2-silenced U937

  18. Estrogen receptor and PI3K/Akt signaling pathway involvement in S-(-equol-induced activation of Nrf2/ARE in endothelial cells.

    Directory of Open Access Journals (Sweden)

    Ting Zhang

    Full Text Available S-(-equol, a natural product of the isoflavone daidzein, has been reported to offer cytoprotective effects with respect to the cardiovascular system, but how this occurs is unclear. Interestingly, S-(-equol is produced by the human gut, suggesting a role in physiological processes. We report that treatment of human umbilical vein endothelial cells and EA.hy926 cells with S-(-equol induces ARE-luciferase reporter gene activity that is dose and time dependent. S-(-equol (10-250 nM increases nuclear factor-erythroid 2-related factor 2 (Nrf2 as well as gene products of Nrf2 target genes heme oxygenase-1 (HO-1 and NAD(PH (nicotinamide-adenine-dinucleotide-phosphate quinone oxidoreductase 1 (NQO1. Endothelial cells transfected with an HA-Nrf2 expression plasmid had elevated HA-Nrf2, HO-1, and NQO1 in response to S-(-equol exposure. S-(-equol treatment affected Nrf2 mRNA only slightly but significantly increased HO-1 and NQO1 mRNA. The pretreatment of cells with specific ER inhibitors or PI3K/Akt (ICI182,780 and LY294002 increased Nrf2, HO-1, and NQO1 protein, impaired nuclear translocation of HA-Nrf2, and decreased ARE-luciferase activity. Identical experiments were conducted with daidzein, which had effects similar to S-(-equol. In addition, DPN treatment (an ERβ agonist induced the ARE-luciferase reporter gene, promoting Nrf2 nuclear translocation. Cell pretreatment with an ERβ antagonist (PHTPP impaired S-(-equol-induced Nrf2 activation. Pre-incubation of cells followed by co-treatment with S-(-equol significantly improved cell survival in response to H2O2 or tBHP and reduced apoptotic and TUNEL-positively-stained cells. Notably, the ability of S-(-equol to protect against H2O2-induced cell apoptosis was attenuated in cells transfected with an siRNA against Nrf2. Thus, beneficial effects of S-(-equol with respect to cytoprotective antioxidant gene activation may represent a novel strategy to prevent and treat cardiovascular diseases.

  19. A novel role for small molecule glycomimetics in the protection against lipid-induced endothelial dysfunction: Involvement of Akt/eNOS and Nrf2/ARE signaling.

    Science.gov (United States)

    Mahmoud, Ayman M; Wilkinson, Fiona L; Jones, Alan M; Wilkinson, James A; Romero, Miguel; Duarte, Juan; Alexander, M Yvonne

    2017-01-01

    Glycomimetics are a diverse array of saccharide-inspired compounds, designed to mimic the bioactive functions of glycosaminoglycans. Therefore, glycomimetics represent a unique source of novel therapies to target aberrant signaling and protein interactions in a wide range of diseases. We investigated the protective effects of four newly synthesized small molecule glycomimetics against lipid-induced endothelial dysfunction, with an emphasis on nitric oxide (NO) and oxidative stress. Four aromatic sugar mimetics were synthesized by the stepwise transformation of 2,5-dihydroxybenzoic acid to derivatives (C1-C4) incorporating sulfate groups to mimic the structure of heparan sulfate. Glycomimetic-treated human umbilical vein endothelial cells (HUVECs) were exposed to palmitic acid to model lipid-induced oxidative stress. Palmitate-induced impairment of NO production was restored by the glycomimetics, through activation of Akt/eNOS signaling. Furthermore, C1-C4 significantly inhibited palmitate-induced reactive oxygen species (ROS) production, lipid peroxidation, and activity and expression of NADPH oxidase. These effects were attributed to activation of the Nrf2/ARE pathway and downstream activation of cellular antioxidant and cytoprotective proteins. In ex vivo vascular reactivity studies, the glycomimetics (C1-C4) also demonstrated a significant improvement in endothelium-dependent relaxation and decreased ROS production and NADPH oxidase activity in isolated mouse thoracic aortic rings exposed to palmitate. The small molecule glycomimetics, C1-C4, protect against lipid-induced endothelial dysfunction through up-regulation of Akt/eNOS and Nrf2/ARE signaling pathways. Thus, carbohydrate-derived therapeutics are a new class of glycomimetic drugs targeting endothelial dysfunction, regarded as the first line of defense against vascular complications in cardiovascular disease. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Protective role of Nrf2 against mechanical-stretch-induced apoptosis in mouse fibroblasts: a potential therapeutic target of mechanical-trauma-induced stress urinary incontinence.

    Science.gov (United States)

    Li, Qiannan; Li, Bingshu; Liu, Cheng; Wang, Linlin; Tang, Jianming; Hong, Li

    2018-01-10

    We investigated the protective effect and underlying molecular mechanism of nuclear factor-E2-related factor 2 (Nrf2) against mechanical-stretch-induced apoptosis in mouse fibroblasts. Normal cells, Nrf2 silencing cells, and Nrf2 overexpressing cells were respectively divided into two groups-nonintervention and cyclic mechanical strain (CMS)-subjected to CMS of 5333 μ (1.0 Hz for 4 h), six groups in total (control, CMS, shNfe212, shNfe212 + CMS, LV-shNfe212, and LV-shNfe212 + CMS). After treatment, cell apoptosis; cell-cycle distribution; expressions of Nrf2, Bax, Bcl-2, Cyt-C, caspase-3, caspase-9, cleaved-caspase-3, and cleaved-caspase-9; mitochondrial membrane potential (ΔΨm); reactive oxygen species (ROS); and malondialdehyde (MDA) levels were measured. Thirty virgin female C57BL/6 mice were divided into two groups: control (without intervention) and vaginal distension (VD) groups, which underwent VD for 1 h with an 8-mm dilator (0.3 ml saline). Leak-point pressure (LPP) was tested on day 7 after VD; Nrf2 expression, apoptosis, and MDA levels were then measured in urethra and anterior vaginal wall. Mechanical stretch decreased Nrf2 messenger RNA (mRNA) and protein expressions. Overexpression of Nrf2 alleviated mechanical-stretch-induced cell apoptosis; S-phase arrest of cell cycle; up-regulation of Bax, cytochrome C (Cyt-C), ROS, MDA, ratio of cleaved-caspase-3/caspase-3 and cleaved-caspase-9/caspase-9; and exacerbated the decrease of Bcl2 and ΔΨm in L929 cells. On the contrary, silencing of Nrf2 showed opposite effects. Besides, VD reduced LPP levels and Nrf2 expression and increased cell apoptosis and MDA generation in the urethra and anterior vaginal wall. Nrf2 exhibits a protective role against mechanical-stretch -induced apoptosis on mouse fibroblasts, which might indicate a potential therapeutic target of mechanical-trauma-induced stress urinary incontinence (SUI).

  1. Xanthohumol ameliorates lipopolysaccharide (LPS-induced acute lung injury via induction of AMPK/GSK3β-Nrf2 signal axis

    Directory of Open Access Journals (Sweden)

    Hongming Lv

    2017-08-01

    Full Text Available Abundant natural flavonoids can induce nuclear factor-erythroid 2 related factor 2 (Nrf2 and/or AMP-activated protein kinase (AMPK activation, which play crucial roles in the amelioration of various inflammation- and oxidative stress-induced diseases, including acute lung injury (ALI. Xanthohumol (Xn, a principal prenylflavonoid, possesses anti-inflammation and anti-oxidant activities. However, whether Xn could protect from LPS-induced ALI through inducing AMPK/Nrf2 activation and its downstream signals, are still poorly elucidated. Accordingly, we focused on exploring the protective effect of Xn in the context of ALI and the involvement of underlying molecular mechanisms. Our findings indicated that Xn effectively alleviated lung injury by reduction of lung W/D ratio and protein levels, neutrophil infiltration, MDA and MPO formation, and SOD and GSH depletion. Meanwhile, Xn significantly lessened histopathological changes, reactive oxygen species (ROS generation, several cytokines secretion, and iNOS and HMGB1 expression, and inhibited Txnip/NLRP3 inflammasome and NF-κB signaling pathway activation. Additionally, Xn evidently decreased t-BHP-stimulated cell apoptosis, ROS generation and GSH depletion but increased various anti-oxidative enzymes expression regulated by Keap1-Nrf2/ARE activation, which may be associated with AMPK and GSK3β phosphorylation. However, Xn-mediated inflammatory cytokines and ROS production, histopathological changes, Txnip/NLRP3 inflammasome and NF-κB signaling pathway in WT mice were remarkably abrogated in Nrf2-/- mice. Our experimental results firstly provided a support that Xn effectively protected LPS-induced ALI against oxidative stress and inflammation damage which are largely dependent upon upregulation of the Nrf2 pathway via activation of AMPK/GSK3β, thereby suppressing LPS-activated Txnip/NLRP3 inflammasome and NF-κB signaling pathway. Keywords: Xanthohumol, Acute lung injury, Oxidative stress

  2. Baicalin Ameliorates H2O2 Induced Cytotoxicity in HK-2 Cells through the Inhibition of ER Stress and the Activation of Nrf2 Signaling

    Directory of Open Access Journals (Sweden)

    Miao Lin

    2014-07-01

    Full Text Available Renal ischemia-reperfusion injury plays a key role in renal transplantation and greatly affects the outcome of allograft. Our previous study proved that Baicalin, a flavonoid glycoside isolated from Scutellaria baicalensis, protects kidney from ischemia-reperfusion injury. This study aimed to study the underlying mechanism in vitro. Human renal proximal tubular epithelial cell line HK-2 cells were stimulated by H2O2 with and without Baicalin pretreatment. The cell viability, apoptosis and oxidative stress level were measured. The expression of endoplasmic reticulum (ER stress hallmarks, such as binding immunoglobulin protein (BiP and C/EBP homologous protein (CHOP, were analyzed by western blot and real-time PCR. NF-E2-related factor 2 (Nrf2 expression was also measured. In the H2O2 group, cell viability decreased and cell apoptosis increased. Reactive Oxygen Species (ROS and Glutathione/Oxidized Glutathione (GSH/GSSG analysis revealed increased oxidative stress. ER stress and Nrf2 signaling also increased. Baicalin pretreatment ameliorated H2O2-induced cytotoxicity, reduced oxidative stress and ER stress and further activated the anti-oxidative Nrf2 signaling pathway. The inducer of ER stress and the inhibitor of Nrf2 abrogated the protective effects, while the inhibitor of ER stress and the inducer of Nrf2 did not improve the outcome. This study revealed that Baicalin pretreatment serves a protective role against H2O2-induced cytotoxicity in HK-2 cells, where the inhibition of ER stress and the activation of downstream Nrf2 signaling are involved.

  3. Dietary Lycium barbarum Polysaccharide Induces Nrf2/ARE Pathway and Ameliorates Insulin Resistance Induced by High-Fat via Activation of PI3K/AKT Signaling

    Directory of Open Access Journals (Sweden)

    Yi Yang

    2014-01-01

    Full Text Available Lycium barbarum polysaccharide (LBP, an antioxidant from wolfberry, displays the antioxidative and anti-inflammatory effects on experimental models of insulin resistance in vivo. However, the effective mechanism of LBP on high-fat diet-induced insulin resistance is still unknown. The objective of the study was to investigate the mechanism involved in LBP-mediated phosphatidylinositol 3-kinase (PI3K/AKT/Nrf2 axis against high-fat-induced insulin resistance. HepG2 cells were incubated with LBP for 12 hrs in the presence of palmitate. C57BL/6J mice were fed a high-fat diet supplemented with LBP for 24 weeks. We analyzed the expression of nuclear factor-E2-related factor 2 (Nrf2, Jun N-terminal kinases (JNK, and glycogen synthase kinase 3β (GSK3β involved in insulin signaling pathway in vivo and in vitro. First, LBP significantly induced phosphorylation of Nrf2 through PI3K/AKT signaling. Second, LBP obviously increased detoxification and antioxidant enzymes expression and reduced reactive oxygen species (ROS levels via PI3K/AKT/Nrf2 axis. Third, LBP also regulated phosphorylation levels of GSK3β and JNK through PI3K/AKT signaling. Finally, LBP significantly reversed glycolytic and gluconeogenic genes expression via the activation of Nrf2-mediated cytoprotective effects. In summary, LBP is novel antioxidant against insulin resistance induced by high-fat diet via activation of PI3K/AKT/Nrf2 pathway.

  4. Curcumin Derivative Epigenetically Reactivates Nrf2 Antioxidative Stress Signaling in Mouse Prostate Cancer TRAMP C1 Cells.

    Science.gov (United States)

    Li, Wenji; Su, Zheng-Yuan; Guo, Yue; Zhang, Chengyue; Wu, Renyi; Gao, Linbo; Zheng, Xi; Du, Zhi-Yun; Zhang, Kun; Kong, Ah-Ng

    2018-02-19

    The carcinogenesis of prostate cancer (PCa) in TRAMP model is highly correlated with hypermethylation in the promoter region of Nrf2 and the accompanying reduced transcription of Nrf2 and its regulated detoxifying genes. We aimed to investigate the effects of (3E,5E)-3,5-bis-(3,4,5-trimethoxybenzylidene)-tetrahydro-thiopyran-4-one (F10) and (3E,5E)-3,5-bis-(3,4,5-trimethoxy-benzylidene)-tetrahydropyran-4-one (E10), two synthetic curcumin derivatives, on restoring Nrf2 activity in TRAMP C1 cells. HepG2-C8 cells transfected with an antioxidant-response element (ARE)-luciferase vector were treated with F10, E10, curcumin, and sulforaphane (SFN) to compare their effects on Nrf2-ARE pathways. We performed real-time quantitative PCR and Western blotting to investigate the effects of F10 and E10 on Nrf2, correlated phase II detoxification genes. We also measured expression and activity of DNMTand HDAC enzymes. Enrichment of H3K27me3 on the promoter region of Nrf2 was explored with a chromatin immunoprecipitation (ChIP) assay. Methylation of the CpG region in Nrf2 promoter was doubly examined by bisulfite genomic sequencing (BGS) and methylation DNA immunoprecipitation (MeDIP). Compared with curcumin and SFN, F10 is more potent in activating Nrf2-ARE pathways. Both F10 and E10 enhanced level of Nrf2 and the correlated phase II detoxifying genes. BGS and MeDIP assays indicated that F10 but not E10 hypomethylated the Nrf2 promoter. F10 also downregulated the protein level of DNMT1, DNMT3a, DNMT3b, HDAC1, HDAC4, and HDAC7 and the activity of DNMTs and HDACs. F10 but not E10 effectively reduced the accumulation of H3k27me3 on the promoter of Nrf2. F10 and E10 can activate the Nrf2-ARE pathway and increase the level of Nrf2 and correlated phase II detoxification genes. The reactivation effect on Nrf2 by F10 in TRAMP C1 may come from demethylation, decrease of HDACs, and inhibition of H3k27me3 accumulation.

  5. Target based screening of small molecule library identifies pregnelonene, a Nrf2 agonist, as a potential radioprotector in zebrafish

    International Nuclear Information System (INIS)

    Joshi, Jayadev; Ghosh, Subhajit; Dimri, Manali; Shrivastava, Nitisha; Indracanti, Prem Kumar; Ray, Jharna

    2014-01-01

    Reactive oxygen species, cellular oxidative stress, tissue inflammation and cell death are the downstream consequences of radiation exposures which ultimately could lead to organism death. Present study aims at identifying potential targets and screening of small molecule compound library for identifying novel and effective radioprotectors. In-silco analysis of known radioprotectors revealed three main function, antioxidant, anti-inflammation and antiapoptosis. In this study, a collection of small molecules (John Hopkins Clinical Compound Library, JHCCL) were screened for these different functions using the biological activity database of NCBI with the help of in-house developed python script. Further, filtering of the JHCCL was done by searching for molecules which are known to be active against target of radiobiological significance, Nrf-2. Close observation of potential hits identified, pregnenolone, as an Nrf-2 agonist which was further evaluated for radioprotection in zebrafish model. Pregnenolone rendered significant protection (at 40 μM; added 1 hour prior to 20 Gy gamma radiation) in terms of damage manifestations (pericardial edema, microcephaly, micropthalmia, yolk sac resorption, curvature of spine, blood flow, body length, heart-beat, blood clot, roughness of skin) and survival advantage (60%) when compared to irradiated control. Further, the ability of pregnenolone to act as a neuroprotectant was also carried out using in-house developed software for assessing neuromotor functions. In comparison to radiation alone group, pregnenolone was found to possess significant neuroactive functions and diminished radiation induced neuronal impairment. Over all these results suggests that pregnenolone is an effective radioprotector which warrants further investigation for validation of its radioprotective action in higher vertebrates. Apart from that the utility of approach to screen out bioactivity data base of various chemical compound libraries for possible

  6. DNA demethylation upregulated Nrf2 expression in Alzheimer's disease cellular model

    Directory of Open Access Journals (Sweden)

    Huimin eCao

    2016-01-01

    Full Text Available Nuclear factor erythroid 2-related factor 2 (Nrf2 is an important transcription factor in the defense against oxidative stress. Cumulative evidence has shown that oxidative stress plays a key role in the pathogenesis of Alzheimer's disease (AD. Previous animal and clinical studies had observed decreased expression of Nrf2 in AD. However, the underlying regulation mechanisms of Nrf2 in AD remain unclear. Here, we used the DNA methyltransferases (Dnmts inhibitor 5-aza-2′-deoxycytidine (5-Aza to test whether Nrf2 expression was regulated by methylation in N2a cells characterizing by expressing human Swedish mutant amyloid precursor protein (N2a/APPswe. We found 5-Aza treatment increased Nrf2 at both mRNA and protein levels via down-regulating the expression of Dnmts and DNA demethylation. In addition, 5-Aza mediated upregulation of Nrf2 expression was concomitant with increased nuclear translocation of Nrf2 and higher expression of Nrf2 downstream target gene NAD(PH:quinone oxidoreductas (NQO1. Our study showed that DNA demethylation promoted the Nrf2 cell signaling pathway, which may enhance the antioxidant system against AD development.

  7. Nrf2 protects against airway disorders

    International Nuclear Information System (INIS)

    Cho, Hye-Youn; Kleeberger, Steven R.

    2010-01-01

    Nuclear factor-erythroid 2 related factor 2 (Nrf2) is a ubiquitous master transcription factor that regulates antioxidant response elements (AREs)-mediated expression of antioxidant enzyme and cytoprotective proteins. In the unstressed condition, Kelch-like ECH-associated protein 1 (Keap1) suppresses cellular Nrf2 in cytoplasm and drives its proteasomal degradation. Nrf2 can be activated by diverse stimuli including oxidants, pro-oxidants, antioxidants, and chemopreventive agents. Nrf2 induces cellular rescue pathways against oxidative injury, abnormal inflammatory and immune responses, apoptosis, and carcinogenesis. Application of Nrf2 germ-line mutant mice has identified an extensive range of protective roles for Nrf2 in experimental models of human disorders in the liver, gastrointestinal tract, airway, kidney, brain, circulation, and immune or nerve system. In the lung, lack of Nrf2 exacerbated toxicity caused by multiple oxidative insults including supplemental respiratory therapy (e.g., hyperoxia, mechanical ventilation), cigarette smoke, allergen, virus, bacterial endotoxin and other inflammatory agents (e.g., carrageenin), environmental pollution (e.g., particles), and a fibrotic agent bleomycin. Microarray analyses and bioinformatic studies elucidated functional AREs and Nrf2-directed genes that are critical components of signaling mechanisms in pulmonary protection by Nrf2. Association of loss of function with promoter polymorphisms in NRF2 or somatic and epigenetic mutations in KEAP1 and NRF2 has been found in cohorts of patients with acute lung injury/acute respiratory distress syndrome or lung cancer, which further supports the role for NRF2 in these lung diseases. In the current review, we address the role of Nrf2 in airways based on emerging evidence from experimental oxidative disease models and human studies.

  8. Role of Keap1-Nrf2 signaling in depression and dietary intake of glucoraphanin confers stress resilience in mice

    OpenAIRE

    Yao, Wei; Zhang, Ji-chun; Ishima, Tamaki; Dong, Chao; Yang, Chun; Ren, Qian; Ma, Min; Han, Mei; Wu, Jin; Suganuma, Hiroyuki; Ushida, Yusuke; Yamamoto, Masayuki; Hashimoto, Kenji

    2016-01-01

    The transcription factor Keap1-Nrf2 system plays a key role in inflammation which is involved in depression. We found lower expression of Keap1 and Nrf2 proteins in the prefrontal cortex (PFC), CA3 and dentate gyrus (DG) of hippocampus in mice with depression-like phenotype compared to control mice. Serum levels of pro-inflammatory cytokines in Nrf2 knock-out (KO) mice were higher than those of wild-type mice, suggestive of enhanced inflammation in KO mice. Decreased brain-derived neurotrophi...

  9. Erdosteine protects HEI-OC1 auditory cells from cisplatin toxicity through suppression of inflammatory cytokines and induction of Nrf2 target proteins

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Se-Jin [Department of Microbiology, Center for Metabolic Function Regulation (CMFR), Wonkwang University, College of Medicine, 460 Iksandae-ro, Iksan, Jeonbuk 570-749 (Korea, Republic of); Park, Channy [Department of Head and Neck Surgery, David Geffen School of Medicine, University of California Los Angeles, Los Angeles, CA (United States); Lee, Joon No [Department of Microbiology, Center for Metabolic Function Regulation (CMFR), Wonkwang University, College of Medicine, 460 Iksandae-ro, Iksan, Jeonbuk 570-749 (Korea, Republic of); Lim, Hyewon; Hong, Gi-yeon [Department of Obstetrics and Gynecology, Wonkwang University, College of Medicine, 460 Iksandae-ro, Iksan, Jeonbuk 570-749 (Korea, Republic of); Moon, Sung K.; Lim, David J. [Department of Head and Neck Surgery, David Geffen School of Medicine, University of California Los Angeles, Los Angeles, CA (United States); Choe, Seong-Kyu, E-mail: seongkyu642@wku.ac.kr [Department of Microbiology, Center for Metabolic Function Regulation (CMFR), Wonkwang University, College of Medicine, 460 Iksandae-ro, Iksan, Jeonbuk 570-749 (Korea, Republic of); Park, Raekil, E-mail: rkpark@wku.ac.kr [Department of Microbiology, Center for Metabolic Function Regulation (CMFR), Wonkwang University, College of Medicine, 460 Iksandae-ro, Iksan, Jeonbuk 570-749 (Korea, Republic of)

    2015-10-15

    Cisplatin has many adverse effects, which are a major limitation to its use, including ototoxicity, neurotoxicity, and nephrotoxicity. This study aims to elucidate the protective mechanisms of erdosteine against cisplatin in HEI-OC1 cells. Pretreatment with erdosteine protects HEI-OC1 cells from cisplatin-medicated apoptosis, which is characterized by increase in nuclear fragmentation, DNA laddering, sub-G{sub 0}/G{sub 1} phase, H2AX phosphorylation, PARP cleavage, and caspase-3 activity. Erdosteine significantly suppressed the production of reactive nitrogen/oxygen species and pro-inflammatory cytokines such as tumor necrosis factor-α, interleukin (IL)-1β, and IL-6 in cisplatin-treated cells. Studies using pharmacologic inhibitors demonstrated that phosphatidylinositol-3-kinases (PI3K) and protein kinase B (Akt) have protective roles in the action of erdosteine against cisplatin in HEI-OC1 cells. In addition, pretreatment with erdosteine clearly suppressed the phosphorylation of p53 (Ser15) and expression of p53-upregulated modulator of apoptosis. Erdosteine markedly induces expression of NF-E2-related factor 2 (Nrf2), which may contribute to the increase in expression of glutathione redox genes γ-L-glutamate-L-cysteine-ligase catalytic and γ-L-glutamate-L-cysteine-ligase modifier subunits, as well as in the antioxidant genes HO-1 and SOD2 in cisplatin-treated HEI-OC1 cells. Furthermore, the increase in expression of phosphorylated p53 induced by cisplatin is markedly attenuated by pretreatment with erdosteine in the mitochondrial fraction. This increased expression may inhibit the cytosolic expression of the apoptosis-inducing factor, cytochrome c, and Bax/Bcl-xL ratio. Thus, our results suggest that treatment with erdosteine is significantly attenuated cisplatin-induced damage through the activation of Nrf2-dependent antioxidant genes, inhibition of pro-inflammatory cytokines, activation of the PI3K/Akt signaling, and mitochondrial-related inhibition of pro

  10. Erdosteine protects HEI-OC1 auditory cells from cisplatin toxicity through suppression of inflammatory cytokines and induction of Nrf2 target proteins

    International Nuclear Information System (INIS)

    Kim, Se-Jin; Park, Channy; Lee, Joon No; Lim, Hyewon; Hong, Gi-yeon; Moon, Sung K.; Lim, David J.; Choe, Seong-Kyu; Park, Raekil

    2015-01-01

    Cisplatin has many adverse effects, which are a major limitation to its use, including ototoxicity, neurotoxicity, and nephrotoxicity. This study aims to elucidate the protective mechanisms of erdosteine against cisplatin in HEI-OC1 cells. Pretreatment with erdosteine protects HEI-OC1 cells from cisplatin-medicated apoptosis, which is characterized by increase in nuclear fragmentation, DNA laddering, sub-G 0 /G 1 phase, H2AX phosphorylation, PARP cleavage, and caspase-3 activity. Erdosteine significantly suppressed the production of reactive nitrogen/oxygen species and pro-inflammatory cytokines such as tumor necrosis factor-α, interleukin (IL)-1β, and IL-6 in cisplatin-treated cells. Studies using pharmacologic inhibitors demonstrated that phosphatidylinositol-3-kinases (PI3K) and protein kinase B (Akt) have protective roles in the action of erdosteine against cisplatin in HEI-OC1 cells. In addition, pretreatment with erdosteine clearly suppressed the phosphorylation of p53 (Ser15) and expression of p53-upregulated modulator of apoptosis. Erdosteine markedly induces expression of NF-E2-related factor 2 (Nrf2), which may contribute to the increase in expression of glutathione redox genes γ-L-glutamate-L-cysteine-ligase catalytic and γ-L-glutamate-L-cysteine-ligase modifier subunits, as well as in the antioxidant genes HO-1 and SOD2 in cisplatin-treated HEI-OC1 cells. Furthermore, the increase in expression of phosphorylated p53 induced by cisplatin is markedly attenuated by pretreatment with erdosteine in the mitochondrial fraction. This increased expression may inhibit the cytosolic expression of the apoptosis-inducing factor, cytochrome c, and Bax/Bcl-xL ratio. Thus, our results suggest that treatment with erdosteine is significantly attenuated cisplatin-induced damage through the activation of Nrf2-dependent antioxidant genes, inhibition of pro-inflammatory cytokines, activation of the PI3K/Akt signaling, and mitochondrial-related inhibition of pro

  11. Eriodictyol-7-O-glucoside activates Nrf2 and protects against cerebral ischemic injury

    International Nuclear Information System (INIS)

    Jing, Xu; Ren, Dongmei; Wei, Xinbing; Shi, Huanying; Zhang, Xiumei; Perez, Ruth G.; Lou, Haiyan; Lou, Hongxiang

    2013-01-01

    Stroke is a complex disease that may involve oxidative stress-related pathways in its pathogenesis. The nuclear factor erythroid-2-related factor 2/antioxidant response element (Nrf2/ARE) pathway plays an important role in inducing phase II detoxifying enzymes and antioxidant proteins and thus has been considered a potential target for neuroprotection in stroke. The aim of the present study was to determine whether eriodictyol-7-O-glucoside (E7G), a novel Nrf2 activator, can protect against cerebral ischemic injury and to understand the role of the Nrf2/ARE pathway in neuroprotection. In primary cultured astrocytes, E7G increased the nuclear localization of Nrf2 and induced the expression of the Nrf2/ARE-dependent genes. Exposure of astrocytes to E7G provided protection against oxygen and glucose deprivation (OGD)-induced oxidative insult. The protective effect of E7G was abolished by RNA interference-mediated knockdown of Nrf2 expression. In vivo administration of E7G in a rat model of focal cerebral ischemia significantly reduced the amount of brain damage and ameliorated neurological deficits. These data demonstrate that activation of Nrf2/ARE signaling by E7G is directly associated with its neuroprotection against oxidative stress-induced ischemic injury and suggest that targeting the Nrf2/ARE pathway may be a promising approach for therapeutic intervention in stroke. - Highlights: • E7G activates Nrf2 in astrocytes. • E7G stimulates expression of Nrf2-mediated cytoprotective proteins in astrocytes. • E7G protects astrocytes against OGD-induced cell death and apoptosis. • The neuroprotective effect of E7G involves the Nrf2/ARE pathway. • E7G protects rats against cerebral ischemic injury

  12. Eriodictyol-7-O-glucoside activates Nrf2 and protects against cerebral ischemic injury

    Energy Technology Data Exchange (ETDEWEB)

    Jing, Xu [Department of Pharmacology, School of Medicine, Shandong University, Jinan 250012 (China); Ren, Dongmei [Department of Natural Product Chemistry, Key Lab of Chemical Biology of Ministry of Education, Shandong University, Jinan 250012 (China); Wei, Xinbing; Shi, Huanying; Zhang, Xiumei [Department of Pharmacology, School of Medicine, Shandong University, Jinan 250012 (China); Perez, Ruth G. [Health Science Center, Paul L. Foster School of Medicine, Texas Tech University, El Paso, TX, 79905 (United States); Lou, Haiyan, E-mail: louhaiyan@sdu.edu.cn [Department of Pharmacology, School of Medicine, Shandong University, Jinan 250012 (China); Lou, Hongxiang [Department of Natural Product Chemistry, Key Lab of Chemical Biology of Ministry of Education, Shandong University, Jinan 250012 (China)

    2013-12-15

    Stroke is a complex disease that may involve oxidative stress-related pathways in its pathogenesis. The nuclear factor erythroid-2-related factor 2/antioxidant response element (Nrf2/ARE) pathway plays an important role in inducing phase II detoxifying enzymes and antioxidant proteins and thus has been considered a potential target for neuroprotection in stroke. The aim of the present study was to determine whether eriodictyol-7-O-glucoside (E7G), a novel Nrf2 activator, can protect against cerebral ischemic injury and to understand the role of the Nrf2/ARE pathway in neuroprotection. In primary cultured astrocytes, E7G increased the nuclear localization of Nrf2 and induced the expression of the Nrf2/ARE-dependent genes. Exposure of astrocytes to E7G provided protection against oxygen and glucose deprivation (OGD)-induced oxidative insult. The protective effect of E7G was abolished by RNA interference-mediated knockdown of Nrf2 expression. In vivo administration of E7G in a rat model of focal cerebral ischemia significantly reduced the amount of brain damage and ameliorated neurological deficits. These data demonstrate that activation of Nrf2/ARE signaling by E7G is directly associated with its neuroprotection against oxidative stress-induced ischemic injury and suggest that targeting the Nrf2/ARE pathway may be a promising approach for therapeutic intervention in stroke. - Highlights: • E7G activates Nrf2 in astrocytes. • E7G stimulates expression of Nrf2-mediated cytoprotective proteins in astrocytes. • E7G protects astrocytes against OGD-induced cell death and apoptosis. • The neuroprotective effect of E7G involves the Nrf2/ARE pathway. • E7G protects rats against cerebral ischemic injury.

  13. Dihydro-CDDO-trifluoroethyl amide suppresses inflammatory responses in macrophages via activation of Nrf2

    International Nuclear Information System (INIS)

    Li, Bin; Abdalrahman, Akram; Lai, Yimu; Janicki, Joseph S.; Ward, Keith W.; Meyer, Colin J.; Wang, Xing Li; Tang, Dongqi; Cui, Taixing

    2014-01-01

    Highlights: • Dh404 suppresses the expression of a selected set of pro-inflammatory cytokines in inflamed macrophages via activating Nrf2. • Dh404 activates Nrf2 while keeping Keap1 function intact in macrophages. • Dh404 minimally regulates NF-κB pathway in macrophages. - Abstract: Nuclear factor erythroid 2-related factor (Nrf2) is the major regulator of cellular defenses against various pathological stresses in a variety of organ systems, thus Nrf2 has evolved to be an attractive drug target for the treatment and/or prevention of human disease. Several synthetic oleanolic triterpenoids including dihydro-CDDO-trifluoroethyl amide (dh404) appear to be potent activators of Nrf2 and exhibit chemopreventive promises in multiple disease models. While the pharmacological efficacy of Nrf2 activators may be dependent on the nature of Nrf2 activation in specific cell types of target organs, the precise role of Nrf2 in mediating biological effects of Nrf2 activating compounds in various cell types remains to be further explored. Herein we report a unique and Nrf2-dependent anti-inflammatory profile of dh404 in inflamed macrophages. In lipopolysaccharide (LPS)-inflamed RAW264.7 macrophages, dh404 dramatically suppressed the expression of pro-inflammatory cytokines including inducible nitric oxide synthase (iNOS), monocyte chemotactic protein-1 (MCP-1), and macrophage inflammatory protein-1 beta (MIP-1β), while minimally regulating the expression of interleulin-6 (IL-6), IL-1β, and tumor necrosis factor alpha (TNFα). Dh404 potently activated Nrf2 signaling; however, it did not affect LPS-induced NF-κB activity. Dh404 did not interrupt the interaction of Nrf2 with its endogenous inhibitor Kelch-like ECH associating protein 1 (Keap1) in macrophages. Moreover, knockout of Nrf2 blocked the dh404-induced anti-inflammatory responses in LPS-inflamed macrophages. These results demonstrated that dh404 suppresses pro-inflammatory responses in macrophages via an activation

  14. Dihydro-CDDO-trifluoroethyl amide suppresses inflammatory responses in macrophages via activation of Nrf2

    Energy Technology Data Exchange (ETDEWEB)

    Li, Bin [Shandong University Qilu Hospital Research Center for Cell Therapy, Key Laboratory of Cardiovascular Remodeling and Function Research, Qilu Hospital of Shandong University, Jinan 250012 (China); Department of Cell Biology and Anatomy, University of South Carolina School of Medicine, Columbia, SC 29208 (United States); Abdalrahman, Akram; Lai, Yimu; Janicki, Joseph S. [Department of Cell Biology and Anatomy, University of South Carolina School of Medicine, Columbia, SC 29208 (United States); Ward, Keith W.; Meyer, Colin J. [Department of Pharmacology, Reata Pharmaceuticals, Inc., Irving, TX 75063 (United States); Wang, Xing Li [Shandong University Qilu Hospital Research Center for Cell Therapy, Key Laboratory of Cardiovascular Remodeling and Function Research, Qilu Hospital of Shandong University, Jinan 250012 (China); Tang, Dongqi, E-mail: Dongqi.Tang@uscmed.sc.edu [Shandong University Qilu Hospital Research Center for Cell Therapy, Key Laboratory of Cardiovascular Remodeling and Function Research, Qilu Hospital of Shandong University, Jinan 250012 (China); Department of Cell Biology and Anatomy, University of South Carolina School of Medicine, Columbia, SC 29208 (United States); Cui, Taixing, E-mail: taixing.cui@uscmed.sc.edu [Shandong University Qilu Hospital Research Center for Cell Therapy, Key Laboratory of Cardiovascular Remodeling and Function Research, Qilu Hospital of Shandong University, Jinan 250012 (China); Department of Cell Biology and Anatomy, University of South Carolina School of Medicine, Columbia, SC 29208 (United States)

    2014-02-21

    Highlights: • Dh404 suppresses the expression of a selected set of pro-inflammatory cytokines in inflamed macrophages via activating Nrf2. • Dh404 activates Nrf2 while keeping Keap1 function intact in macrophages. • Dh404 minimally regulates NF-κB pathway in macrophages. - Abstract: Nuclear factor erythroid 2-related factor (Nrf2) is the major regulator of cellular defenses against various pathological stresses in a variety of organ systems, thus Nrf2 has evolved to be an attractive drug target for the treatment and/or prevention of human disease. Several synthetic oleanolic triterpenoids including dihydro-CDDO-trifluoroethyl amide (dh404) appear to be potent activators of Nrf2 and exhibit chemopreventive promises in multiple disease models. While the pharmacological efficacy of Nrf2 activators may be dependent on the nature of Nrf2 activation in specific cell types of target organs, the precise role of Nrf2 in mediating biological effects of Nrf2 activating compounds in various cell types remains to be further explored. Herein we report a unique and Nrf2-dependent anti-inflammatory profile of dh404 in inflamed macrophages. In lipopolysaccharide (LPS)-inflamed RAW264.7 macrophages, dh404 dramatically suppressed the expression of pro-inflammatory cytokines including inducible nitric oxide synthase (iNOS), monocyte chemotactic protein-1 (MCP-1), and macrophage inflammatory protein-1 beta (MIP-1β), while minimally regulating the expression of interleulin-6 (IL-6), IL-1β, and tumor necrosis factor alpha (TNFα). Dh404 potently activated Nrf2 signaling; however, it did not affect LPS-induced NF-κB activity. Dh404 did not interrupt the interaction of Nrf2 with its endogenous inhibitor Kelch-like ECH associating protein 1 (Keap1) in macrophages. Moreover, knockout of Nrf2 blocked the dh404-induced anti-inflammatory responses in LPS-inflamed macrophages. These results demonstrated that dh404 suppresses pro-inflammatory responses in macrophages via an activation

  15. Involvement of ERK-Nrf-2 signaling in ionizing radiation induced cell death in normal and tumor cells.

    Directory of Open Access Journals (Sweden)

    Raghavendra S Patwardhan

    Full Text Available Prolonged oxidative stress favors tumorigenic environment and inflammation. Oxidative stress may trigger redox adaptation mechanism(s in tumor cells but not normal cells. This may increase levels of intracellular antioxidants and establish a new redox homeostasis. Nrf-2, a master regulator of battery of antioxidant genes is constitutively activated in many tumor cells. Here we show that, murine T cell lymphoma EL-4 cells show constitutive and inducible radioresistance via activation of Nrf-2/ERK pathway. EL-4 cells contained lower levels of ROS than their normal counterpart murine splenic lymphocytes. In response to radiation, the thiol redox circuits, GSH and thioredoxin were modified in EL-4 cells. Pharmacological inhibitors of ERK and Nrf-2 significantly enhanced radiosensitivity and reduced clonogenic potential of EL-4 cells. Unirradiated lymphoma cells showed nuclear accumulation of Nrf-2, upregulation of its dependent genes and protein levels. Interestingly, MEK inhibitor abrogated its nuclear translocation suggesting role of ERK in basal and radiation induced Nrf-2 activation in tumor cells. Double knockdown of ERK and Nrf-2 resulted in higher sensitivity to radiation induced cell death as compared to individual knockdown cells. Importantly, NF-kB which is reported to be constitutively active in many tumors was not present at basal levels in EL-4 cells and its inhibition did not influence radiosensitivity of EL-4 cells. Thus our results reveal that, tumor cells which are subjected to heightened oxidative stress employ master regulator cellular redox homeostasis Nrf-2 for prevention of radiation induced cell death. Our study reveals the molecular basis of tumor radioresistance and highlights role of Nrf-2 and ERK.

  16. Antioxidant Opuntia ficus-indica Extract Activates AHR-NRF2 Signaling and Upregulates Filaggrin and Loricrin Expression in Human Keratinocytes.

    Science.gov (United States)

    Nakahara, Takeshi; Mitoma, Chikage; Hashimoto-Hachiya, Akiko; Takahara, Masakazu; Tsuji, Gaku; Uchi, Hiroshi; Yan, Xianghong; Hachisuka, Junichi; Chiba, Takahito; Esaki, Hitokazu; Kido-Nakahara, Makiko; Furue, Masutaka

    2015-10-01

    Opuntia ficus-indica (OFI) is a cactus species widely used as an anti-inflammatory, antilipidemic, and hypoglycemic agent. It has been shown that OFI extract (OFIE) inhibits oxidative stress in animal models of diabetes and hepatic disease; however, its antioxidant mechanism remains largely unknown. In this study, we demonstrated that OFIE exhibited potent antioxidant activity through the activation of nuclear factor erythroid 2-related factor 2 (NRF2) and the downstream antioxidant enzyme quinone oxidoreductase 1 (NQO1), which inhibited the generation of reactive oxygen species in keratinocytes challenged with tumor necrosis factor α or benzo[α]pyrene. The antioxidant capacity of OFIE was canceled in NRF2 knockdown keratinocytes. OFIE exerted this NRF2-NQO1 upregulation through activation of the aryl hydrocarbon receptor (AHR). Moreover, the ligation of AHR by OFIE upregulated the expression of epidermal barrier proteins: filaggrin and loricrin. OFIE also prevented TH2 cytokine-mediated downregulation of filaggrin and loricrin expression in an AHR-dependent manner because it was canceled in AHR knockdown keratinocytes. Antioxidant OFIE is a potent activator of AHR-NRF2-NQO1 signaling and may be beneficial in treating barrier-disrupted skin disorders.

  17. Maresin 1 Ameliorates Lung Ischemia/Reperfusion Injury by Suppressing Oxidative Stress via Activation of the Nrf-2-Mediated HO-1 Signaling Pathway

    Directory of Open Access Journals (Sweden)

    Quanchao Sun

    2017-01-01

    Full Text Available Lung ischemia/reperfusion (I/R injury occurs in various clinical conditions and heavily damaged lung function. Oxidative stress reaction and antioxidant enzymes play a pivotal role in the etiopathogenesis of lung I/R injury. In the current study, we investigated the impact of Maresin 1 on lung I/R injury and explored the possible mechanism involved in this process. MaR 1 ameliorated I/R-induced lung injury score, wet/dry weight ratio, myeloperoxidase, tumor necrosis factor, bronchoalveolar lavage fluid (BALF leukocyte count, BALF neutrophil ratio, and pulmonary permeability index levels in lung tissue. MaR 1 significantly reduced ROS, methane dicarboxylic aldehyde, and 15-F2t-isoprostane generation and restored antioxidative enzyme (superoxide dismutase, glutathione peroxidase, and catalase activities. Administration of MaR 1 improved the expression of nuclear Nrf-2 and cytosolic HO-1 in I/R-treated lung tissue. Furthermore, we also found that the protective effects of MaR 1 on lung tissue injury and oxidative stress were reversed by HO-1 activity inhibitor, Znpp-IX. Nrf-2 transcription factor inhibitor, brusatol, significantly decreased MaR 1-induced nuclear Nrf-2 and cytosolic HO-1 expression. In conclusion, these results indicate that MaR 1 protects against lung I/R injury through suppressing oxidative stress. The mechanism is partially explained by activation of the Nrf-2-mediated HO-1 signaling pathway.

  18. Andrographolide protects liver cells from H2O2 induced cell death by upregulation of Nrf-2/HO-1 mediated via adenosine A2a receptor signalling.

    Science.gov (United States)

    Mittal, Smriti P K; Khole, Swati; Jagadish, Nidhi; Ghosh, Debjani; Gadgil, Vijay; Sinkar, Vilas; Ghaskadbi, Saroj S

    2016-11-01

    Andrographolide, principle constituent of Andrographis paniculata Nees is used in traditional medicine in Southeast Asia and is known to exhibit various biological activities. Its antioxidant activity is due to its ability to activate one of the antioxidant enzymes, heme oxygenase-1 (HO-1) which is regulated transcriptionally through Nrf-2. However, molecular mechanism underlying activation of Nrf-2/HO-1 has not yet been clearly understood. Protective effect of andrographolide against H2O2 induced cell death, reactive oxygen species and lipid peroxidation was observed in HepG2 cells. Ability of andrographolide to modulate G-protein coupled receptor (GPCR) mediated signalling was determined using in silico docking and gene expression was analyzed by qRT-PCR, confocal microscopy and western blot analysis. We clearly show that andrographolide via adenosine A2A receptor signalling leads to activation of p38 MAP kinase, resulting in upregulation of Nrf-2, its translocation to nucleus and activation of HO-1. Additionally, it activates adenylate cyclase resulting in cAMP formation which in turn activates protein kinase A leading to inhibition of GSK-3β by phosphorylation. Inactivated GSK-3β leads to retention of Nrf-2 in the nucleus leading to sustained expression of HO-1 by binding to its antioxidant response element (ARE). Thus, andrographolide probably by binding to adenosine A2a receptor activates Nrf-2 transcription and also inhibits its exclusion from the nucleus by inactivating GSK-3β, together resulting in activation of HO-1. We speculate that andrographolide can be used as a therapeutic drug to combat oxidative stress implicated in pathogenesis of various diseases such as diabetes, osteoporosis, neurodegenerative diseases etc. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Melatonin Attenuates Memory Impairment Induced by Klotho Gene Deficiency Via Interactive Signaling Between MT2 Receptor, ERK, and Nrf2-Related Antioxidant Potential

    Science.gov (United States)

    Shin, Eun-Joo; Chung, Yoon Hee; Le, Hoang-Lan Thi; Jeong, Ji Hoon; Dang, Duy-Khanh; Nam, Yunsung; Wie, Myung Bok; Nah, Seung-Yeol; Nabeshima, Yo-Ichi; Nabeshima, Toshitaka; Kim, Hyoung-Chun

    2015-01-01

    Background: We demonstrated that oxidative stress plays a crucial role in cognitive impairment in klotho mutant mice, a genetic model of aging. Since down-regulation of melatonin due to aging is well documented, we used this genetic model to determine whether the antioxidant property of melatonin affects memory impairment. Methods: First, we examined the effects of melatonin on hippocampal oxidative parameters and the glutathione/oxidized glutathione (GSH/GSSG) ratio and memory dysfunction of klotho mutant mice. Second, we investigated whether a specific melatonin receptor is involved in the melatonin-mediated pharmacological response by application with melatonin receptor antagonists. Third, we examined phospho-extracellular-signal-regulated kinase (ERK) expression, nuclear factor erythroid 2-related factor 2 (Nrf2) nuclear translocation, Nrf2 DNA binding activity, and glutamate-cysteine ligase (GCL) mRNA expression. Finally, we examined effects of the ERK inhibitor SL327 in response to antioxidant efficacy and memory enhancement mediated by melatonin. Results: Treatment with melatonin resulted in significant attenuations of oxidative damage, a decrease in the GSH/GSSG ratio, and a significant amelioration of memory impairment in this aging model. These effects of melatonin were significantly counteracted by the selective MT2 receptor antagonist 4-P-PDOT. Importantly, 4-P-PDOT or SL327 also counteracted melatonin-mediated attenuation in response to the decreases in phospho-ERK expression, Nrf2 nuclear translocation, Nrf2 DNA-binding activity, and GCL mRNA expression in the hippocampi of klotho mutant mice. SL327 also counteracted the up-regulation of the GSH/GSSG ratio and the memory enhancement mediated by melatonin in klotho mutant mice. Conclusions: Melatonin attenuates oxidative stress and the associated memory impairment induced by klotho deficiency via signaling interaction between the MT2 receptor and ERK- and Nrf2-related antioxidant potential. PMID

  20. Resveratrol, an Nrf2 activator, ameliorates aging-related progressive renal injury.

    Science.gov (United States)

    Kim, Eun Nim; Lim, Ji Hee; Kim, Min Young; Ban, Tae Hyun; Jang, In-Ae; Yoon, Hye Eun; Park, Cheol Whee; Chang, Yoon Sik; Choi, Bum Soon

    2018-01-11

    Two important issues in the aging kidney are mitochondrial dysfunction and oxidative stress. An Nrf2 activator, resveratrol, is known to have various effects. Resveratrol may prevent inflammation and oxidative stress by activating Nrf2 and SIRT1 signaling. We examined whether resveratrol could potentially ameliorate the cellular condition, such as renal injury due to cellular oxidative stress and mitochondrial dysfunction caused by aging. Male 18-month-old C57BL/6 mice were used. Resveratrol (40 mg/kg) was administered to aged mice for 6 months. We compared histological changes, oxidative stress, and aging-related protein expression in the kidney between the resveratrol-treated group (RSV) and the control group (cont). We performed experiments using small-interfering RNAs (siRNAs) for Nrf2 and SIRT1 in cultured HK2 cells. Resveratrol improved renal function, proteinuria, histological changes and inflammation in aging mice. Also, expression of Nrf2-HO-1-NOQ-1 signaling and SIRT1-AMPK-PGC-1α signaling was increased in the RSV group. Transfection with Nrf2 and SIRT1 siRNA prevented resveratrol-induced anti-oxidative effect in HK2 cells in media treated with H 2 O 2 . Activation of the Nrf2 and SIRT1 signaling pathways ameliorated oxidative stress and mitochondrial dysfunction. Pharmacological targeting of Nrf2 signaling molecules may reduce the pathologic changes of aging in the kidney.

  1. Neuroprotective effects of vildagliptin in rat rotenone Parkinson's disease model: role of RAGE-NFκB and Nrf2-antioxidant signaling pathways.

    Science.gov (United States)

    Abdelsalam, Rania M; Safar, Marwa M

    2015-06-01

    Gliptins have been recently shown to conquer neuronal degeneration in cell cultures via modulating glucagon-like peptide (GLP)-1. This peptide produced in the gut not only crosses the blood-brain barrier but is also synthesized in the brain and acts on GLP-1R exerting central anti-inflammatory and antiapoptotic effects, thus impeding neuronal damage. This study investigated the antiparkinsonian effect of vildagliptin, a dipeptidyl peptidase (DPP)-4 inhibitor in a rat rotenone model targeting mainly the RAGE-NFκB/Nrf2-signaling pathways, to judge the potential anti-inflammatory/antioxidant effects of the drug. Vildagliptin markedly improved the motor performance in the open field and rotarod tests, effects that were emphasized by the accompanied reduction in striatal dopamine content. It modified the striatal energy level (ADP/ATP) associated with partial antagonism of body weight reduction. This incretin enhancer suppressed nuclear factor (NF)κB and, consequently, the downstream inflammatory mediator tumor necrosis factor-α. Normalization of receptor for advanced glycated end product (RAGE) is a main finding which justifies the anti-inflammatory effects of vildagliptin, together with hampering striatal inducible nitric oxide synthase, intracellular adhesion molecule-1 as well as myeloperoxidase. The antioxidant potential of vildagliptin was depicted as entailing reduction in thiobarbituric acid-reactive substances and the transcriptional factor Nrf-2 level. Vildagliptin guarded against neuronal demise through an antiapoptotic effect as reflected by the reduction in the mitochondrial matrix component cytochrome c and the key downstream executioner caspase-3. In conclusion, vildagliptin is endowed with various neuroprotective effects and thus can be a promising candidate for the management of Parkinson's disease. In the rat rotenone model of Parkinson's disease (PD), striatal RAGE/NFκB signaling was up-regulated associated with elevated levels of inflammatory

  2. Regulation by Phloroglucinol of Nrf2/Maf-Mediated Expression of Antioxidant Enzymes and Inhibition of Osteoclastogenesis via the RANKL/RANK Signaling Pathway: In Silico study

    Science.gov (United States)

    Rahim, Agus Hadian; Setiawan, Bambang; Dewi, Firli Rahmah Primula; Noor, Zairin

    2015-01-01

    Introduction: Phloroglucinol is an antioxidant compound with many positive effects on health. The purpose of this study was to determine the role of phloroglucinol in osteoclastogenesis via the RANKL/RANK signaling pathway and the activity of the transcription factor Nrf2. Material and methods: Analysis was performed in silico using the primary method of docking by the use of Hex 8.0 software and Haddock web server. Analysis of interactions was then performed to determine interactions between the ligand and its receptors by using the software LigPlus and LigandScout 3.1. Results: Results indicated that phloroglucinol compound was thought to inhibit osteoclastogenesis via three mechanisms: inhibiting RANKL−RANK interaction, sustaining the RANKL−OPG bond, and increasing the activity of the transcription factor Nrf2. PMID:26483597

  3. The chalcone compound isosalipurposide (ISPP) exerts a cytoprotective effect against oxidative injury via Nrf2 activation

    Energy Technology Data Exchange (ETDEWEB)

    Han, Jae Yun [College of Pharmacy, Chosun University, Gwangju 501-759 (Korea, Republic of); Cho, Seung Sik [College of Pharmacy, Mokpo National University, Muan, Jeonnam 535-729 (Korea, Republic of); Yang, Ji Hye; Kim, Kyu Min; Jang, Chang Ho [College of Pharmacy, Chosun University, Gwangju 501-759 (Korea, Republic of); Park, Da Eon [College of Pharmacy, Mokpo National University, Muan, Jeonnam 535-729 (Korea, Republic of); Bang, Joon Seok [Graduate School of Clinical Pharmacy, Sookmyung Women' s University, Seoul (Korea, Republic of); Jung, Young Suk [College of Pharmacy, Pusan National University, Busan (Korea, Republic of); Ki, Sung Hwan, E-mail: shki@chosun.ac.kr [College of Pharmacy, Chosun University, Gwangju 501-759 (Korea, Republic of)

    2015-08-15

    The chalcone compound isosalipurposide (ISPP) has been successfully isolated from the native Korean plant species Corylopsis coreana Uyeki (Korean winter hazel). However, the therapeutic efficacy of ISPP remains poorly understood. This study investigated whether ISPP has the capacity to activate NF-E2-related factor (Nrf2)-antioxidant response element (ARE) signaling and induce its target gene expression, and to determined the protective role of ISPP against oxidative injury of hepatocytes. In HepG2 cells, nuclear translocation of Nrf2 is augmented by ISPP treatment. Consistently, ISPP increased ARE reporter gene activity and the protein levels of glutamate cysteine ligase (GCL) and hemeoxygenase (HO-1), resulting in increased intracellular glutathione levels. Cells pretreated with ISPP were rescued from tert-butylhydroperoxide-induced reactive oxygen species (ROS) production and glutathione depletion and consequently, apoptotic cell death. Moreover, ISPP ameliorated the mitochondrial dysfunction and apoptosis induced by rotenone which is an inhibitor of complex 1 of the mitochondrial respiratory chain. The specific role of Nrf2 activation by ISPP was demonstrated using an ARE-deletion mutant plasmid and Nrf2-knockout cells. Finally, we observed that extracellular signal-regulated kinase (ERK) and AMP-activated protein kinase (AMPK), but not protein kinase C (PKC)-δ or other mitogen-activated protein kinases (MAPKs), are involved in the activation of Nrf2 by ISPP. Taken together, our results demonstrate that ISPP has a cytoprotective effect against oxidative damage mediated through Nrf2 activation and induction of its target gene expression in hepatocytes. - Highlights: • We investigated the effect of ISPP on Nrf2 activation. • ISPP increased Nrf2 activity and its target gene expression. • ISPP inhibited the mitochondrial dysfunction and ROS production. • Nrf2 activation by ISPP is dependent on ERK1/2 and AMPK phosphorylation. • ISPP may be a promising

  4. The chalcone compound isosalipurposide (ISPP) exerts a cytoprotective effect against oxidative injury via Nrf2 activation

    International Nuclear Information System (INIS)

    Han, Jae Yun; Cho, Seung Sik; Yang, Ji Hye; Kim, Kyu Min; Jang, Chang Ho; Park, Da Eon; Bang, Joon Seok; Jung, Young Suk; Ki, Sung Hwan

    2015-01-01

    The chalcone compound isosalipurposide (ISPP) has been successfully isolated from the native Korean plant species Corylopsis coreana Uyeki (Korean winter hazel). However, the therapeutic efficacy of ISPP remains poorly understood. This study investigated whether ISPP has the capacity to activate NF-E2-related factor (Nrf2)-antioxidant response element (ARE) signaling and induce its target gene expression, and to determined the protective role of ISPP against oxidative injury of hepatocytes. In HepG2 cells, nuclear translocation of Nrf2 is augmented by ISPP treatment. Consistently, ISPP increased ARE reporter gene activity and the protein levels of glutamate cysteine ligase (GCL) and hemeoxygenase (HO-1), resulting in increased intracellular glutathione levels. Cells pretreated with ISPP were rescued from tert-butylhydroperoxide-induced reactive oxygen species (ROS) production and glutathione depletion and consequently, apoptotic cell death. Moreover, ISPP ameliorated the mitochondrial dysfunction and apoptosis induced by rotenone which is an inhibitor of complex 1 of the mitochondrial respiratory chain. The specific role of Nrf2 activation by ISPP was demonstrated using an ARE-deletion mutant plasmid and Nrf2-knockout cells. Finally, we observed that extracellular signal-regulated kinase (ERK) and AMP-activated protein kinase (AMPK), but not protein kinase C (PKC)-δ or other mitogen-activated protein kinases (MAPKs), are involved in the activation of Nrf2 by ISPP. Taken together, our results demonstrate that ISPP has a cytoprotective effect against oxidative damage mediated through Nrf2 activation and induction of its target gene expression in hepatocytes. - Highlights: • We investigated the effect of ISPP on Nrf2 activation. • ISPP increased Nrf2 activity and its target gene expression. • ISPP inhibited the mitochondrial dysfunction and ROS production. • Nrf2 activation by ISPP is dependent on ERK1/2 and AMPK phosphorylation. • ISPP may be a promising

  5. Down-regulation of microRNA-142-5p attenuates oxygen-glucose deprivation and reoxygenation-induced neuron injury through up-regulating Nrf2/ARE signaling pathway.

    Science.gov (United States)

    Wang, Ning; Zhang, Lingmin; Lu, Yang; Zhang, Mingxin; Zhang, Zhenni; Wang, Kui; Lv, Jianrui

    2017-05-01

    MicroRNAs (miRNAs) play vital roles in regulating neuron survival during cerebral ischemia/reperfusion injury. miR-142-5p is reported to be an important regulator of cellular survival. However, little is known about the role of miR-142-5p in regulating neuron survival during cerebral ischemia/reperfusion injury. In this study, we aimed to investigate the precise function and mechanism of miR-142-5p in the regulation of neuron ischemia/reperfusion injury using a cellular model of oxygen-glucose deprivation and reoxygenation (OGD/R)-induced injury in hippocampal neurons in vitro. We found that miR-142-5p was induced in hippocampal neurons with OGD/R treatment. The inhibition of miR-142-5p attenuated OGD/R-induced cell injury and oxidative stress, whereas the overexpression of miR-142-5p aggravated them. Nuclear factor erythroid 2-related factor 2 (Nrf2) was identified as a target gene of miR-142-5p. Moreover, miR-142-5p regulated Nrf2 expression and downstream signaling. Knockdown of Nrf2 abolished the protective effects of miR-142-5p suppression. In addition, we showed an inverse correlation relationship between miR-142-5p and Nrf2 in an in vivo model of middle cerebral artery occlusion in rats. Taken together, these results suggest that miR-142-5p contributes to OGD/R-induced cell injury and the down-regulation of miR-142-5p attenuates OGD/R-induced neuron injury through promoting Nrf2 expression. Our study provides a novel insight into understanding the molecular pathogenesis of cerebral ischemia/reperfusion injury and indicates a potential therapeutic target for the treatment of cerebral ischemia/reperfusion injury. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  6. Cudarflavone B Provides Neuroprotection against Glutamate-Induced Mouse Hippocampal HT22 Cell Damage through the Nrf2 and PI3K/Akt Signaling Pathways

    Directory of Open Access Journals (Sweden)

    Dong-Sung Lee

    2014-07-01

    Full Text Available Oxidative cell damage contributes to neuronal degeneration in many central nervous system (CNS diseases such as Alzheimer’s disease, Parkinson’s disease, and ischemia. Nrf2 signaling-mediated heme oxygenase (HO-1 expression acts against oxidants that are thought to play a key role in the pathogenesis of neuronal diseases. Cudraflavone B is a prenylated flavone isolated from C. tricuspidata which has shown anti-proliferative activity, mouse brain monoamine oxidase (MAO inhibitory effects, apoptotic actions in human gastric carcinoma cells and mouse melanoma cells, and hepatoprotective activity. In this study, cudraflavone B showed neuroprotective effects and reactive oxygen species (ROS inhibition against glutamate-induced neurotoxicity by inducing the expression of HO-1 in mouse hippocampal HT22 cells. Furthermore, cudraflavone B caused the nuclear accumulation of nuclear factor-E2-related factor 2 (Nrf2 and increased the promoter activity of antioxidant response elements (ARE in mouse hippocampal HT22 cells. In addition, we found that the Nrf2-midiated HO-1 expression by cudraflavone B is involved in the cell protective response and ROS reductions, and cudraflavone B-induced expression of HO-1 was mediated through the phosphatidylinositol 3-kinase (PI3K/Akt pathway in HT22 cells. Our results demonstrated the potential application of naturally occurring cudraflavone B as a therapeutic agent from neurodegenerative disease.

  7. Cancer Chemoprevention by Traditional Chinese Herbal Medicine and Dietary Phytochemicals: Targeting Nrf2-Mediated Oxidative Stress/Anti-Inflammatory Responses, Epigenetics, and Cancer Stem Cells

    Directory of Open Access Journals (Sweden)

    Jong Hun Lee

    2013-01-01

    Full Text Available Excessive oxidative stress induced by reactive oxygen species (ROS, reactive nitrogen species (RNS, and reactive metabolites of carcinogens alters cellular homeostasis, leading to genetic/epigenetic changes, genomic instability, neoplastic transformation, and cancer initiation/progression. As a protective mechanism against oxidative stress, antioxidant/detoxifying enzymes reduce these reactive species and protect normal cells from endo-/exogenous oxidative damage. The transcription factor nuclear factor-erythroid 2 p45 (NF-E2-related factor 2 (Nrf2, a master regulator of the antioxidative stress response, plays a critical role in the expression of many cytoprotective enzymes, including NAD(PH:quinine oxidoreductase (NQO1, heme oxygenase-1 (HO-1, UDP-glucuronosyltransferase (UGT, and glutathione S-transferase (GST. Recent studies demonstrated that many dietary phytochemicals derived from various vegetables, fruits, spices, and herbal medicines induce Nrf2-mediated antioxidant/detoxifying enzymes, restore aberrant epigenetic alterations, and eliminate cancer stem cells (CSCs. The Nrf2-mediated antioxidant response prevents many age-related diseases, including cancer. Owing to their fundamental contribution to carcinogenesis, epigenetic modifications and CSCs are novel targets of dietary phytochemicals and traditional Chinese herbal medicine (TCHM. In this review, we summarize cancer chemoprevention by dietary phytochemicals, including TCHM, which have great potential as a safer and more effective strategy for preventing cancer.

  8. Enhanced expression of Nrf2 in mice attenuates the fatty liver produced by a methionine- and choline-deficient diet

    International Nuclear Information System (INIS)

    Zhang, Yu-Kun Jennifer; Yeager, Ronnie L.; Tanaka, Yuji; Klaassen, Curtis D.

    2010-01-01

    Oxidative stress has been proposed as an important promoter of the progression of fatty liver diseases. The current study investigates the potential functions of the Nrf2-Keap1 signaling pathway, an important hepatic oxidative stress sensor, in a rodent fatty liver model. Mice with no (Nrf2-null), normal (wild type, WT), and enhanced (Keap1 knockdown, K1-kd) expression of Nrf2 were fed a methionine- and choline-deficient (MCD) diet or a control diet for 5 days. Compared to WT mice, the MCD diet-caused hepatosteatosis was more severe in the Nrf2-null mice and less in the K1-kd mice. The Nrf2-null mice had lower hepatic glutathione and exhibited more lipid peroxidation, whereas the K1-kd mice had the highest amount of glutathione in the liver and developed the least lipid peroxidation among the three genotypes fed the MCD diet. The Nrf2 signaling pathway was activated by the MCD diet, and the Nrf2-targeted cytoprotective genes Nqo1 and Gstα1/2 were induced in WT and even more in K1-kd mice. In addition, Nrf2-null mice on both control and MCD diets exhibited altered expression profiles of fatty acid metabolism genes, indicating Nrf2 may influence lipid metabolism in liver. For example, mRNA levels of long chain fatty acid translocase CD36 and the endocrine hormone Fgf21 were higher in livers of Nrf2-null mice and lower in the K1-kd mice than WT mice fed the MCD diet. Taken together, these observations indicate that Nrf2 could decelerate the onset of fatty livers caused by the MCD diet by increasing hepatic antioxidant and detoxification capabilities.

  9. Constitutive activation of Nrf2 induces a stable reductive state in the mouse myocardium

    Directory of Open Access Journals (Sweden)

    Gobinath Shanmugam

    2017-08-01

    Full Text Available Redox homeostasis regulates key cellular signaling pathways in both physiology and pathology. The cell's antioxidant response provides a defense against oxidative stress and establishes a redox tone permissive for cell signaling. The molecular regulation of the well-known Keap1/Nrf2 system acts as sensor responding to changes in redox homeostasis and is poorly studied in the heart. Importantly, it is not yet known whether Nrf2 alone can serve as a master regulator of cellular redox homeostasis without compensation of the transcriptional regulation of antioxidant response element (ARE genes through alternate mechanisms. Here, we addressed this question using cardiac-specific transgenic expression at two different levels of constitutively active nuclear erythroid related factor 2 (caNrf2 functioning independently of Keap1. The caNrf2 mice showed augmentation of glutathione (GSH, the key regulator of the cellular thiol redox state. The Trans-AM assay for Nrf2-binding to the antioxidant response element (ARE showed a dose-dependent increase associated with upregulation of several major antioxidant genes and proteins. This was accompanied by a significant decrease in dihydroethidium staining and malondialdehyde (MDA in the caNrf2-TG mice myocardium. Interestingly, caNrf2 gene-dosage dependent redox changes were noted resulting in generation of a multi-stage model of pro-reductive and reductive conditions in the myocardium of TG-low and TG-high mice, respectively. These data clearly show that Nrf2 levels alone are capable of serving as the master regulator of the ARE. These models provide an important platform to investigate the impact of the Nrf2 system independent of the need to regulate the activity of Keap1 and the consequent exposure to pro-oxidants or electrophiles, which have numerous off-target effects.

  10. Nrf2 mediates redox adaptation in NOX4-overexpressed non-small cell lung cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Qipeng; Yao, Bei; Li, Ning; Ma, Lei; Deng, Yanchao; Yang, Yang; Zeng, Cheng; Yang, Zhicheng [Department of Clinical Pharmacy, School of Pharmacy, Guangdong Pharmaceutical University, Guangzhou 510006 (China); Liu, Bing, E-mail: liubing520@gdpu.edu.cn [Department of Clinical Pharmacy, School of Pharmacy, Guangdong Pharmaceutical University, Guangzhou 510006 (China); Guangdong Key Laboratory of Pharmaceutical Bioactive Substances, Guangdong Pharmaceutical University, Guangzhou 510006 (China)

    2017-03-15

    The redox adaptation mechanisms in cancer cells are very complex and remain largely unclear. Our previous studies have confirmed that NADPH oxidase 4 (NOX4) is abundantly expressed in non-small cell lung cancer (NSCLC) and confers apoptosis resistance on NSCLC cells. However, the comprehensive mechanisms for NOX4-mediated oxidative resistance of cancer cells remain still undentified. The present study found that NOX4-derived H{sub 2}O{sub 2} enhanced the nuclear factor erythroid 2-related factor 2 (Nrf2) stability via disruption of redox-dependent proteasomal degradation and stimulated its activity through activation of PI3K signaling. Specifically, the results showed that ectopic NOX4 expression did not induce apoptosis of A549 cells; however, inhibition of Nrf2 resulted in obvious apoptotic death of NOX4-overexpressed A549 cells, accompanied by a significant increase in H{sub 2}O{sub 2} level and decrease in GSH content. Besides, inhibition of Nrf2 could suppress cell growth and efficiently reverse the enhancement effect of NOX4 on cell growth. The in vivo data confirmed that inhibition of Nrf2 could interfere apoptosis resistance in NOX4-overexpressed A549 tumors and led to cell growth inhibition. In conclusion, these results reveal that Nrf2 is critically involved in redox adaptation regulation in NOX4-overexpressed NSCLC cells. Therefore, NOX4 and Nrf2 may be promising combination targets against malignant progression of NSCLC. - Highlights: • NOX4-derived H{sub 2}O{sub 2} upregulates Nrf2 expression and activity in NSCLC. • Nrf2 confers apoptosis resistance in NOX4-overexpressed NSCLC cells. • Inhibition of Nrf2 reverses the enhancement effect of NOX4 on cell growth.

  11. Britanin Ameliorates Cerebral Ischemia-Reperfusion Injury by Inducing the Nrf2 Protective Pathway.

    Science.gov (United States)

    Wu, Guozhen; Zhu, Lili; Yuan, Xing; Chen, Hao; Xiong, Rui; Zhang, Shoude; Cheng, Hao; Shen, Yunheng; An, Huazhang; Li, Tiejun; Li, Honglin; Zhang, Weidong

    2017-10-10

    Oxidative stress is considered the major cause of tissue injury after cerebral ischemia. The nuclear factor erythroid 2-related factor 2 (Nrf2) pathway is one of the most important defensive mechanisms against oxidative stresses and has been confirmed as a target for stroke treatment. Thus, we desired to find new Nrf2 activators and test their neuronal protective activity both in vivo and in vitro. The herb-derived compound, Britanin, is a potent inducer of the Nrf2 system. Britanin can induce the expression of protective enzymes and reverse oxygen-glucose deprivation, followed by reperfusion (OGD-R)-induced neuronal injury in primary cortical neurons in vitro. Furthermore, the administration of Britanin significantly ameliorated middle cerebral artery occlusion-reperfusion (MCAO-R) insult in vivo. We report here the crystal structure of the complex of Britanin and the BTB domain of Keap1. Britanin selectively binds to a conserved cysteine residue, cysteine 151, of Keap1 and inhibits Keap1-mediated ubiquitination of Nrf2, leading to induction of the Nrf2 pathway. Britanin is a potent inducer of Nrf2. The complex crystal structure of Britanin and the BTB domain of Keap1 help clarify the mechanism of Nrf2 induction. Britanin was proven to protect primary cortical neurons against OGD-R-induced injury in an Nrf2-dependant way. Additionally, Britanin had excellent cerebroprotective effect in an MCAO-R model. Our results demonstrate that the natural product Britanin with potent Nrf2-activating and neural protective activities both in vitro and in vivo could be developed into a cerebroprotective therapeutic agent. Antioxid. Redox Signal. 27, 754-768.

  12. Naturally Occurring Nrf2 Activators: Potential in Treatment of Liver Injury

    Directory of Open Access Journals (Sweden)

    Ravirajsinh N. Jadeja

    2016-01-01

    Full Text Available Oxidative stress plays a major role in acute and chronic liver injury. In hepatocytes, oxidative stress frequently triggers antioxidant response by activating nuclear erythroid 2-related factor 2 (Nrf2, a transcription factor, which upregulates various cytoprotective genes. Thus, Nrf2 is considered a potential therapeutic target to halt liver injury. Several studies indicate that activation of Nrf2 signaling pathway ameliorates liver injury. The hepatoprotective potential of naturally occurring compounds has been investigated in various models of liver injuries. In this review, we comprehensively appraise various phytochemicals that have been assessed for their potential to halt acute and chronic liver injury by enhancing the activation of Nrf2 and have the potential for use in humans.

  13. Chaetominine reduces MRP1-mediated drug resistance via inhibiting PI3K/Akt/Nrf2 signaling pathway in K562/Adr human leukemia cells

    Energy Technology Data Exchange (ETDEWEB)

    Yao, Jingyun; Wei, Xing [State Key Laboratory of Bioreactor Engineering, East China University of Science and Technology, 130 Meilong Road, Shanghai (China); Shanghai Collaborative Innovation Center for Biomanufacturing Technology, 130 Meilong Road, Shanghai (China); Lu, Yanhua, E-mail: luyanhua@ecust.edu.cn [State Key Laboratory of Bioreactor Engineering, East China University of Science and Technology, 130 Meilong Road, Shanghai (China); Shanghai Collaborative Innovation Center for Biomanufacturing Technology, 130 Meilong Road, Shanghai (China)

    2016-05-13

    Drug resistance limits leukemia treatment and chaetominine, a cytotoxic alkaloid that promotes apoptosis in a K562 human leukemia cell line via the mitochondrial pathway was studied with respect to chemoresistance in a K562/Adr human resistant leukemia cell line. Cytotoxicity assays indicated that K562/Adr resistance to adriamycin (ADR) did not occur in the presence of chaetominine and that chaetominine increased chemosensitivity of K562/Adr to ADR. Data show that chaetominine enhanced ADR-induced apoptosis and intracellular ADR accumulation in K562/Adr cells. Accordingly, chaetominine induced apoptosis by upregulating ROS, pro-apoptotic Bax and downregulating anti-apoptotic Bcl-2. RT-PCR and western-blot confirmed that chaetominine suppressed highly expressed MRP1 at mRNA and protein levels. But little obvious alternation of another drug transporter MDR1 mRNA was observed. Furthermore, inhibition of MRP1 by chaetominine relied on inhibiting Akt phosphorylation and nuclear Nrf2. In summary, chaetominine strongly reverses drug resistance by interfering with the PI3K/Akt/Nrf2 signaling, resulting in reduction of MRP1-mediated drug efflux and induction of Bax/Bcl-2-dependent apoptosis in an ADR-resistant K562/Adr leukemia cell line. - Highlights: • Chaetominine enhanced chemosensitivity of ADR against K562/Adr cells. • Chaetominine increased intracellular ADR levels via inhibiting MRP1. • Chaetominine induced apoptosis of K562/Adr cells through upregulation of ROS and modulation of Bax/Bcl-2. • Inhibition of MRP1 and Nrf2 by chaetominine treatment was correlative with blockade of PI3K/Akt signaling.

  14. Sulforaphane induces apoptosis in T24 human urinary bladder cancer cells through a reactive oxygen species-mediated mitochondrial pathway: the involvement of endoplasmic reticulum stress and the Nrf2 signaling pathway.

    Science.gov (United States)

    Jo, Guk Heui; Kim, Gi-Young; Kim, Wun-Jae; Park, Kun Young; Choi, Yung Hyun

    2014-10-01

    Sulforaphane, a naturally occurring isothiocyanate found in cruciferous vegetables, has received a great deal of attention because of its ability to inhibit cell proliferation and induce apoptosis in cancer cells. In this study, we investigated the anticancer activity of sulforaphane in the T24 human bladder cancer line, and explored its molecular mechanism of action. Our results showed that treatment with sulforaphane inhibited cell viability and induced apoptosis in T24 cells in a concentration-dependent manner. Sulforaphane-induced apoptosis was associated with mitochondria dysfunction, cytochrome c release and Bcl-2/Bax dysregulation. Furthermore, the increased activity of caspase-9 and -3, but not caspase-8, was accompanied by the cleavage of poly ADP-ribose polymerase, indicating the involvement of the mitochondria-mediated intrinsic apoptotic pathway. Concomitant with these changes, sulforaphane triggered reactive oxygen species (ROS) generation, which, along with the blockage of sulforaphane-induced loss of mitochondrial membrane potential and apoptosis, was strongly attenuated by the ROS scavenger N-acetyl-L-cysteine. Furthermore, sulforaphane was observed to activate endoplasmic reticulum (ER) stress and the nuclear factor-E2-related factor-2 (Nrf2) signaling pathway, as demonstrated by the upregulation of ER stress‑related proteins, including glucose-regulated protein 78 and C/EBP-homologous protein, and the accumulation of phosphorylated Nrf2 proteins in the nucleus and induction of heme oxygenase-1 expression, respectively. Taken together, these results demonstrate that sulforaphane has antitumor effects against bladder cancer cells through an ROS-mediated intrinsic apoptotic pathway, and suggest that ER stress and Nrf2 may represent strategic targets for sulforaphane-induced apoptosis.

  15. 6-OHDA-induced apoptosis and mitochondrial dysfunction are mediated by early modulation of intracellular signals and interaction of Nrf2 and NF-κB factors

    International Nuclear Information System (INIS)

    Tobón-Velasco, Julio C.; Limón-Pacheco, Jorge H.; Orozco-Ibarra, Marisol; Macías-Silva, Marina; Vázquez-Victorio, Genaro; Cuevas, Elvis; Ali, Syed F.

    2013-01-01

    6-Hydroxydopamine (6-OHDA) is a neurotoxin that generates an experimental model of Parkinson's disease in rodents and is commonly employed to induce a lesion in dopaminergic pathways. The characterization of those molecular mechanisms linked to 6-OHDA-induced early toxicity is needed to better understand the cellular events further leading to neurodegeneration. The present work explored how 6-OHDA triggers early downstream signaling pathways that activate neurotoxicity in the rat striatum. Mitochondrial function, caspases-dependent apoptosis, kinases signaling (Akt, ERK 1/2, SAP/JNK and p38) and crosstalk between nuclear factor kappa B (NF-κB) and nuclear factor-erythroid-2-related factor 2 (Nrf2) were evaluated at early times post-lesion. We found that 6-OHDA initiates cell damage via mitochondrial complex I inhibition, cytochrome c and apoptosis-inducing factor (AIF) release, as well as activation of caspases 9 and 3 to induce apoptosis, kinase signaling modulation and NF-κB-mediated inflammatory responses, accompanied by inhibition of antioxidant systems regulated by the Nrf2 pathway. Our results suggest that kinases SAP/JNK and p38 up-regulation may play a role in the early stages of 6-OHDA toxicity to trigger intrinsic pathways for apoptosis and enhanced NF-κB activation. In turn, these cellular events inhibit the activation of cytoprotective mechanisms, thereby leading to a condition of general damage

  16. Effect of choline on antioxidant defenses and gene expressions of Nrf2 signaling molecule in the spleen and head kidney of juvenile Jian carp (Cyprinus carpio var. Jian).

    Science.gov (United States)

    Wu, Pei; Jiang, Wei-Dan; Liu, Yang; Chen, Gang-Fu; Jiang, Jun; Li, Shu-Hong; Feng, Lin; Zhou, Xiao-Qiu

    2014-06-01

    The present work evaluates the effects of various levels of dietary choline on antioxidant defenses and gene expressions of Nrf2 signaling molecule in spleen and head kidney of juvenile Jian carp (Cyprinus carpio var. Jian). Fish were fed with six different experimental diets containing graded levels of choline at 165 (choline-deficient control), 310, 607, 896, 1167 and 1820 mg kg(-1) diet for 65 days. At the end of the feeding trail, fish were challenged with Aeromonas hydrophila and mortalities were recorded over 17 days. Dietary choline significantly decreased malondialdehyde and protein carbonyl contents in spleen and head kidney. However, anti-superoxide anion and anti-hydroxyl radical activities in spleen and head kidney also decreased. Interestingly, activities of superoxide dismutase (SOD), catalase (CAT), glutathione peroxidase (GPx), glutathione-S-transferase (GST) and glutathione reductase (GR) in spleen, GPx activity in head kidney, and glutathione contents in spleen and head kidney were decreased with increase of dietary choline levels up to a certain point, whereas, activities of SOD, GST and GR in head kidney showed no significantly differences among groups. Similarly, expression levels of CuZnSOD, MnSOD, CAT, GPx1a, GPx1b and GR gene in spleen and head kidney were significantly lower in group with choline level of 607 mg kg(-1) diet than those in the choline-deficient group. The relative gene expressions of Nrf2 in head kidney and Keap1a in spleen and head kidney were decreased with increasing of dietary choline up to a certain point. However, the relative gene expression of Nrf2 in spleen were not significantly affected by dietary choline. In conclusion, dietary choline decreased the oxidant damage and regulated the antioxidant system in immune organs of juvenile Jian carp. Copyright © 2014 Elsevier Ltd. All rights reserved.

  17. Tartary buckwheat flavonoids ameliorate high fructose-induced insulin resistance and oxidative stress associated with the insulin signaling and Nrf2/HO-1 pathways in mice.

    Science.gov (United States)

    Hu, Yuanyuan; Hou, Zuoxu; Yi, Ruokun; Wang, Zhongming; Sun, Peng; Li, Guijie; Zhao, Xin; Wang, Qiang

    2017-08-01

    The present study was conducted to explore the effects of a purified tartary buckwheat flavonoid fraction (TBF) on insulin resistance and hepatic oxidative stress in mice fed high fructose in drinking water (20%) for 8 weeks. The results indicated that continuous administration of TBF dose-dependently improved the insulin sensitivity and glucose intolerance in high fructose-fed mice. TBF treatment also reversed the reduced level of insulin action on the phosphorylation of insulin receptor substrate-1 (IRS-1), protein kinase B (Akt) and phosphatidylinositol 3-kinase (PI3K), as well as the translocation of glucose transporter type 4 (GLUT4) in the insulin-resistant liver. Furthermore, TBF was found to exert high antioxidant capacity as it acts as a shield against oxidative stress induced by high fructose by restoring the antioxidant status, and modulating nuclear factor E2 related factor 2 (Nrf2) translocation to the nucleus with subsequently up-regulated antioxidative enzyme protein expression. Histopathological examinations revealed that impaired pancreatic/hepatic tissues were effectively restored in high fructose-fed mice following TBF treatment. Our results show that TBF intake is effective in preventing the conversion of high fructose-induced insulin resistance and hepatic oxidative stress in mice by improving the insulin signaling molecules and the Nrf2 signal pathway in the liver.

  18. A protective role of nuclear factor-erythroid 2-related factor-2 (Nrf2) in inflammatory disorders

    International Nuclear Information System (INIS)

    Kim, Jiyoung; Cha, Young-Nam; Surh, Young-Joon

    2010-01-01

    Nuclear factor-erythroid 2-related factor-2 (Nrf2) is a key transcription factor that plays a central role in cellular defense against oxidative and electrophilic insults by timely induction of antioxidative and phase-2 detoxifying enzymes and related stress-response proteins. The 5'-flanking regions of genes encoding these cytoprotective proteins contain a specific consensus sequence termed antioxidant response element (ARE) to which Nrf2 binds. Recent studies have demonstrated that Nrf2-ARE signaling is also involved in attenuating inflammation-associated pathogenesis, such as autoimmune diseases, rheumatoid arthritis, asthma, emphysema, gastritis, colitis and atherosclerosis. Thus, disruption or loss of Nrf2 signaling causes enhanced susceptibility not only to oxidative and electrophilic stresses but also to inflammatory tissue injuries. During the early-phase of inflammation-mediated tissue damage, activation of Nrf2-ARE might inhibit the production or expression of pro-inflammatory mediators including cytokines, chemokines, cell adhesion molecules, matrix metalloproteinases, cyclooxygenase-2 and inducible nitric oxide synthase. It is likely that the cytoprotective function of genes targeted by Nrf2 may cooperatively regulate the innate immune response and also repress the induction of pro-inflammatory genes. This review highlights the protective role of Nrf2 in inflammation-mediated disorders with special focus on the inflammatory signaling modulated by this redox-regulated transcription factor.

  19. A protective role of nuclear factor-erythroid 2-related factor-2 (Nrf2) in inflammatory disorders

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jiyoung [National Research Laboratory, College of Pharmacy, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Cha, Young-Nam [Inha University College of Medicine, Incheon 382-751 (Korea, Republic of); Surh, Young-Joon, E-mail: surh@plaza.snu.ac.kr [National Research Laboratory, College of Pharmacy, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Department of Molecular Medicine and Biopharmaceutical Sciences, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Cancer Research Institute, Seoul National University, Seoul 110-799 (Korea, Republic of)

    2010-08-07

    Nuclear factor-erythroid 2-related factor-2 (Nrf2) is a key transcription factor that plays a central role in cellular defense against oxidative and electrophilic insults by timely induction of antioxidative and phase-2 detoxifying enzymes and related stress-response proteins. The 5'-flanking regions of genes encoding these cytoprotective proteins contain a specific consensus sequence termed antioxidant response element (ARE) to which Nrf2 binds. Recent studies have demonstrated that Nrf2-ARE signaling is also involved in attenuating inflammation-associated pathogenesis, such as autoimmune diseases, rheumatoid arthritis, asthma, emphysema, gastritis, colitis and atherosclerosis. Thus, disruption or loss of Nrf2 signaling causes enhanced susceptibility not only to oxidative and electrophilic stresses but also to inflammatory tissue injuries. During the early-phase of inflammation-mediated tissue damage, activation of Nrf2-ARE might inhibit the production or expression of pro-inflammatory mediators including cytokines, chemokines, cell adhesion molecules, matrix metalloproteinases, cyclooxygenase-2 and inducible nitric oxide synthase. It is likely that the cytoprotective function of genes targeted by Nrf2 may cooperatively regulate the innate immune response and also repress the induction of pro-inflammatory genes. This review highlights the protective role of Nrf2 in inflammation-mediated disorders with special focus on the inflammatory signaling modulated by this redox-regulated transcription factor.

  20. Photoprotection by dietary phenolics against melanogenesis induced by UVA through Nrf2-dependent antioxidant responses

    Science.gov (United States)

    Chaiprasongsuk, Anyamanee; Onkoksoong, Tasanee; Pluemsamran, Thanyawan; Limsaengurai, Saowalak; Panich, Uraiwan

    2015-01-01

    Dietary phenolics may play a protective role in UV-mediated skin pigmentation through their antioxidant and UV-absorbing actions. In this study, we investigated whether genetic silencing of Nrf2, regulating the transcription of antioxidant genes, affected melanogenesis in primary human epidermal melanocytes (HEMn) and B16F10 melanoma cells subjected to UVA (8 J/cm2) exposure. Then, we explored the antimelanogenic actions of phenolics; caffeic acid (CA) and ferulic acid (FA) providing partial UVA protection; quercetin (QU) and rutin (RU) providing strong UVA protection and; avobenzone (AV), an efficient UVA filter, in association with modulation of Nrf2-mediated antioxidant defenses in response to UVA insults in B16F10 cells. Upon oxidative insults, Nrf2 silencing promoted melanogenesis in both HEMn and B16F10 cells irradiated with UVA. Stimulation of melanogenesis by UVA correlated with increased ROS and oxidative DNA damage (8-OHdG), GSH depletion as well as a transient downregulation of Nrf2 nuclear translocation and of Nrf2-ARE signaling in B16F10 cells. All test compounds exerted antimelanogenic effects with respect to their abilities to reverse UVA-mediated oxidative damage as well as downregulation of Nrf2 activity and its target antioxidants (GCLC, GST and NQO1) in B16F10 cells. In conclusion, defective Nrf2 may promote melanogenesis under UVA irradiation through oxidative stress mechanisms. Compounds with antioxidant and/or UVA absorption properties could protect against UVA-induced melanogenesis through indirect regulatory effect on Nrf2-ARE pathway. PMID:26765101

  1. 4-methoxychalcone enhances cisplatin-induced oxidative stress and cytotoxicity by inhibiting the Nrf2/ARE-mediated defense mechanism in A549 lung cancer cells.

    Science.gov (United States)

    Lim, Juhee; Lee, Sung Ho; Cho, Sera; Lee, Ik-Soo; Kang, Bok Yun; Choi, Hyun Jin

    2013-10-01

    Nuclear factor erythroid 2-related factor 2 (Nrf2) is a key transcriptional regulator for the protection of cells against oxidative and xenobiotic stresses. Recent studies have demonstrated that high constitutive expression of Nrf2 is observed in many types of cancer cells showing resistance to anti-cancer drugs, suggesting that the suppression of overexpressed Nrf2 could be an attractive therapeutic strategy to overcome cancer drug resistance. In the present study, we aimed to find small molecule compounds that enhance the sensitivity of tumor cells to cisplatin induced cytotoxicity by suppressing Nrf2-mediated defense mechanism. A549 lung cancer cells were shown to be more resistant to the anti-cancer drug cisplatin than HEK293 cells, with higher Nrf2 signaling activity; constitutively high amounts of Nrf2-downstream target proteins were observed in A549 cells. Among the three chalcone derivatives 4-methoxy-chalcone (4-MC), hesperidin methylchalcone, and neohesperidin dihydrochalcone, 4-MC was found to suppress transcriptional activity of Nrf2 in A549 cells but to activate it in HEK293 cells. 4-MC was also shown to down-regulate expression of Nrf2 and the downstream phase II detoxifying enzyme NQO1 in A549 cells. The PI3K/Akt pathway was found to be involved in the 4-MC-induced inhibition of Nrf2/ARE activity in A549 cells. This inhibition of Nrf2 signaling results in the accelerated generation of reactive oxygen species and exacerbation of cytotoxicity in cisplatin-treated A549 cells. Taken together, these results suggest that the small molecule compound 4-MC could be used to enhance the sensitivity of tumor cells to the therapeutic effect of cisplatin through the regulation of Nrf2/ARE signaling.

  2. Role of the Nrf2-heme oxygenase-1 pathway in silver nanoparticle-mediated cytotoxicity

    International Nuclear Information System (INIS)

    Kang, Su Jin; Ryoo, In-geun; Lee, Young Joon; Kwak, Mi-Kyoung

    2012-01-01

    Silver nanoparticles (nano-Ag) have been widely used in various commercial products including textiles, electronic appliances and biomedical products. However, there remains insufficient information on the potential risk of nano-Ag to human health and environment. In the current study, we have investigated the role of NF-E2-related factor 2 (Nrf2) transcription factor in nano-Ag-induced cytotoxicity. When Nrf2 expression was blocked using interring RNA expression in ovarian carcinoma cell line, nano-Ag treatment showed a substantial decrease in cell viability with concomitant increases in apoptosis and DNA damage compared to the control cells. Target gene analysis revealed that the expression of heme oxygenase-1 (HO-1) was highly elevated by nano-Ag in nonspecific shRNA expressing cells, while Nrf2 knockdown cells (NRF2i) did not increase HO-1 expression. The role of HO-1 in cytoprotection against nano-Ag was reinforced by results using pharmacological inducer of HO-1: cobalt protoporphyrin-mediated HO-1 activation in the NRF2i cells prevented nano-Ag-mediated cell death. Similarly, pharmacological or genetic inhibition of HO-1 in nonspecific control cells exacerbated nano-Ag toxicity. As the upstream signaling mechanism, nano-Ag required the phosphoinositide 3-kinase (PI3K) and p38MAPK signaling cascades for HO-1 induction. The treatment with either PI3K inhibitor or p38MAPK inhibitor suppressed HO-1 induction and intensified nano-Ag-induced cell death. Taken together, these results suggest that Nrf2-dependent HO-1 up-regulation plays a protective role in nano-Ag-induced DNA damage and consequent cell death. In addition, nano-Ag-mediated HO-1 induction is associated with the PI3K and p38MAPK signaling pathways. -- Highlights: ► Role of Nrf2 signaling in silver nanoparticle toxicity. ► Silver nanoparticle toxicity is increased by Nrf2 blockade. ► Nrf2-dependent HO-1 induction protects cells from silver nanoparticle toxicity. ► PI3K and p38MAPK cascades are

  3. Xanthohumol attenuates cisplatin-induced nephrotoxicity through inhibiting NF-κB and activating Nrf2 signaling pathways.

    Science.gov (United States)

    Li, Fan; Yao, Yunyi; Huang, Hui; Hao, Hua; Ying, Mingzhong

    2018-06-12

    Cisplatin is a chemotherapeutic agent that widely used in the treatment of cancer. However, cisplatin has been reported to induce nephrotoxicity by directly inducing inflammatory response and oxidative stress. In this study, we aimed to investigate the protective effects and mechanism of xanthohumol on cisplatin-induced nephrotoxicity. The model of nephrotoxicity was induced by intraperitoneal injection of cisplatin and xanthohumol was given intraperitoneally for three consecutive days. The results showed that xanthohumol significantly attenuated kidney histological changes and serum creatinine and BUN production. The levels of TNF-α, IL-1ß and IL-6 in kidney tissues were suppressed by xanthohumol. The levels of malondialdehyde (MDA) and ROS were suppressed by treatment of xanthohumol. The activities of glutathione (GSH) and superoxide dismutase (SOD) decreased by cisplatin were reversed by xanthohumol. Furthermore, the expression of TLR4 and the activation of NF-κB induced by cisplatin were significantly inhibited by xanthohumol. The expression of Nrf2 and HO-1 were dose-dependently up-regulated by the treatment of xanthohumol. In conclusion, xanthohumol protects against cisplatin-induced nephrotoxicity by ameliorating inflammatory and oxidative responses. Copyright © 2018 Elsevier B.V. All rights reserved.

  4. The synthetic progestin norgestrel modulates Nrf2 signaling and acts as an antioxidant in a model of retinal degeneration

    Directory of Open Access Journals (Sweden)

    Ashleigh M. Byrne

    2016-12-01

    Full Text Available Retinitis pigmentosa (RP is one of the most common retinal degenerative conditions affecting people worldwide, and is currently incurable. It is characterized by the progressive loss of photoreceptors, in which the death of rod cells leads to the secondary death of cone cells; the cause of eventual blindness. As rod cells die, retinal-oxygen metabolism becomes perturbed, leading to increased levels of reactive oxygen species (ROS and thus oxidative stress; a key factor in the secondary death of cones. In this study, norgestrel, an FDA-approved synthetic analog of progesterone, was found to be a powerful neuroprotective antioxidant, preventing light-induced ROS in photoreceptor cells, and subsequent cell death. Norgestrel also prevented light-induced photoreceptor morphological changes that were associated with ROS production, and that are characteristic of RP. Further investigation showed that norgestrel acts via post-translational modulation of the major antioxidant transcription factor Nrf2; bringing about its phosphorylation, subsequent nuclear translocation, and increased levels of its effector protein superoxide dismutase 2 (SOD2. In summary, these results demonstrate significant protection of photoreceptor cells from oxidative stress, and underscore the potential of norgestrel as a therapeutic option for RP.

  5. Antioxidant and glucose metabolizing potential of edible insect, Brachytrupes orientalis via modulating Nrf2/AMPK/GLUT4 signaling pathway.

    Science.gov (United States)

    Dutta, Prachurjya; Dey, Tapan; Dihingia, Anjum; Manna, Prasenjit; Kalita, Jatin

    2017-11-01

    Brachytrupes orientalis (Gryllidae) is a common edible insect species eaten by the different tribes of North East India. This study investigated the potentiality of Brachytrupes orientalis extracts in different solvent hydro-alcoholic (AEBO), hexane (HEBO) and ethyl acetate (EEBO) on glucose utilization and cell viability in high glucose (HG) treated myotubes. It has been observed that AEBO supplementation significantly increased the glucose utilization against HG exposure; however, treatment HEBO and EEBO have no significant effect. AEBO also increased the intercellular glucose-6-phosphate level and the protein expression of both phospho-AMPK and GLUT4 in HG treated myotubes in a dose dependent manner. Furthermore, supplementation with AEBO decreased the intercellular ROS production, lipid peroxidation, and up-regulated the protein expression of Nrf2 and GST. Chromatography and Spectroscopic analyses of AEBO also suggest that Ursolic acid may be one of the bioactive principles with rich potassium, sodium, calcium and magnesium content. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  6. Compensatory role of the Nrf2–ARE pathway against paraquat toxicity: Relevance of 26S proteasome activity

    Directory of Open Access Journals (Sweden)

    Yasuhiko Izumi

    2015-11-01

    Full Text Available Oxidative stress and the ubiquitin–proteasome system play a key role in the pathogenesis of Parkinson disease. Although the herbicide paraquat is an environmental factor that is involved in the etiology of Parkinson disease, the role of 26S proteasome in paraquat toxicity remains to be determined. Using PC12 cells overexpressing a fluorescent protein fused to the proteasome degradation signal, we report here that paraquat yielded an inhibitory effect on 26S proteasome activity without an obvious decline in 20S proteasome activity. Relative low concentrations of proteasome inhibitors caused the accumulation of nuclear factor erythroid 2-related factor 2 (Nrf2, which is targeted to the ubiquitin–proteasome system, and activated the antioxidant response element (ARE-dependent transcription. Paraquat also upregulated the protein level of Nrf2 without increased expression of Nrf2 mRNA, and activated the Nrf2–ARE pathway. Consequently, paraquat induced expression of Nrf2-dependent ARE-driven genes, such as γ-glutamylcysteine synthetase, catalase, and hemeoxygenase-1. Knockdown of Nrf2 or inhibition of γ-glutamylcysteine synthetase and catalase exacerbated paraquat-induced toxicity, whereas suppression of hemeoxygenase-1 did not. These data indicate that the compensatory activation of the Nrf2–ARE pathway via inhibition of 26S proteasome serves as part of a cellular defense mechanism to protect against paraquat toxicity.

  7. A Novel EphA2 Inhibitor Exerts Beneficial Effects in PI-IBS in Vivo and in Vitro Models via Nrf2 and NF-κB Signaling Pathways

    Directory of Open Access Journals (Sweden)

    Li Zeng

    2018-03-01

    Full Text Available Though the detailed pathological mechanism of post-infectious irritable bowel syndrome (PI-IBS remains unclear, accumulating evidence indicates that oxidative stress and inflammation are implicated in the process of PI-IBS. Oxidative stress and inflammation are regulated by Nrf2 and NF-κB signaling pathways, respectively. EphA2, a member of Eph receptor family, promotes oxidative stress and inflammatory responses via regulation of Nrf2 and NF-κB signaling pathways in various types of human diseases. Understanding the mechanisms by which EphA2 regulate oxidative stress and inflammation in PI-IBS is important for the development of new strategies to treat PI-IBS. However, the effects of ALW-II-41-27, a novel EphA2 inhibitor on PI-IBS and the underlying molecular mechanisms have never been studied. In the present study, we showed that ALW-II-41-27 decreased gastrointestinal motility and abdominal withdrawal reflex (AWR scores, markedly reduced the levels of oxidative stress markers [4-hydroxy-2-nonenal (4-HNE, protein carbonyl, and 8-hydroxy-2-de-axyguanine (8-OHdG] and proinflammatory cytokines (TNF-α, IL-6, IL-17, and ICAM-1, and remarkably increased the level of anti-inflammatory cytokine (IL-10 in serum and colon of Trichinella spiralis-infected mice. Moreover, ALW-II-41-27 was effective in suppressing oxidative stress and inflammation in LPS-treated NCM460 colonic cells. Treatment of ALW-II-41-27 reversed the activation of NF-κB and inactivation of Nrf2 in LPS-treated NCM460 cells. Importantly, these protective effects of ALW-II-41-27 were partially inhibited by EphA2 KO and abolished by EphA2 overexpression. In conclusion, EphA2 may represent a promising therapeutic target for patients with PI-IBS and ALW-II-41-27 might function as a novel therapeutic agent for PI-IBS.

  8. Exercise Training Mitigates Water Pipe Smoke Exposure-Induced Pulmonary Impairment via Inhibiting NF-κB and Activating Nrf2 Signalling Pathways

    Directory of Open Access Journals (Sweden)

    Abderrahim Nemmar

    2018-01-01

    activating Nrf2 signalling pathways.

  9. Long term effect of curcumin in restoration of tumour suppressor p53 and phase-II antioxidant enzymes via activation of Nrf2 signalling and modulation of inflammation in prevention of cancer.

    Directory of Open Access Journals (Sweden)

    Laxmidhar Das

    Full Text Available Inhibition of carcinogenesis may be a consequence of attenuation of oxidative stress via activation of antioxidant defence system, restoration and stabilization of tumour suppressor proteins along with modulation of inflammatory mediators. Previously we have delineated significant role of curcumin during its long term effect in regulation of glycolytic pathway and angiogenesis, which in turn results in prevention of cancer via modulation of stress activated genes. Present study was designed to investigate long term effect of curcumin in regulation of Nrf2 mediated phase-II antioxidant enzymes, tumour suppressor p53 and inflammation under oxidative tumour microenvironment in liver of T-cell lymphoma bearing mice. Inhibition of Nrf2 signalling observed during lymphoma progression, resulted in down regulation of phase II antioxidant enzymes, p53 as well as activation of inflammatory signals. Curcumin potentiated significant increase in Nrf2 activation. It restored activity of phase-II antioxidant enzymes like GST, GR, NQO1, and tumour suppressor p53 level. In addition, curcumin modulated inflammation via upregulation of TGF-β and reciprocal regulation of iNOS and COX2. The study suggests that during long term effect, curcumin leads to prevention of cancer by inducing phase-II antioxidant enzymes via activation of Nrf2 signalling, restoration of tumour suppressor p53 and modulation of inflammatory mediators like iNOS and COX2 in liver of lymphoma bearing mice.

  10. Tanshinol ameliorates CCl4-induced liver fibrosis in rats through the regulation of Nrf2/HO-1 and NF-κB/IκBα signaling pathway

    Directory of Open Access Journals (Sweden)

    Wang R

    2018-05-01

    Full Text Available Rong Wang,* Jing Wang,* Fuxing Song, Shengnan Li, Yongfang Yuan Department of Pharmacy, Shanghai 9th People’s Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China *These authors contributed equally to this work Abstract: Tanshinol, a water-soluble component isolated from Salvia miltiorrhiza Bunge, has a variety of biological activities involving anti-fibrotic effect. However, the exact role and the underlying mechanisms remain largely unclear. This study mainly focused on the anti-hepatic fibrotic activities and mechanisms of tanshinol on carbon tetrachloride (CCl4-induced liver fibrosis in rats via anti-oxidative and anti-inflammation pathways. The rats were divided into 4 groups as follows: control, model, tanshinol 20 mg/kg, and tanshinol 40 mg/kg. Except for the control group, CCl4 was used to induce liver fibrosis processing for 8 weeks, meanwhile rats in tanshinol groups were intraperitoneally injected with additional tanshinol. Control group simultaneously received the same volumes of olive oil and saline. The potentially protective effect and mechanisms of tanshinol on liver fibrosis in rats were evaluated. The serum levels of alanine aminotransferase, aspartate aminotransferase, and total bilirubin were obviously lower in the tanshinol treatment groups related to model group. Compared with the model group, the levels of hyaluronic acid, type IV collagen, Laminin (LN, and procollagen III peptide (PIIIP in serum were significantly decreased after tanshinol treatment. Furthermore, tanshinol could regulate Nrf2/HO-1 signaling pathway and increase the level of superoxide dismutase (SOD and glutathione peroxidase (GSH-Px, and also decrease the level of malondialdehyde (MDA to against damage induced by oxidative stress. Simultaneously tanshinol could regulate nuclear factor kappa B signaling pathway to inhibit expression of inflammation factors, including transforming growth factor-β, tumor necrosis factor-α, Cox-2

  11. 17β-Estradiol up-regulates Nrf2 via PI3K/AKT and estrogen receptor signaling pathways to suppress light-induced degeneration in rat retina.

    Science.gov (United States)

    Zhu, C; Wang, S; Wang, B; Du, F; Hu, C; Li, H; Feng, Y; Zhu, R; Mo, M; Cao, Y; Li, A; Yu, X

    2015-09-24

    Human age-related retinal diseases, such as age-related macular degeneration (AMD), are intimately associated with decreased tissue oxygenation and hypoxia. Different antioxidants have been investigated to reverse AMD. In the present study, we describe the antioxidant 17β-estradiol (βE2) and investigate its protective effects on retinal neurons. Fourteen days after ovariectomy, adult Sprague-Dawley rats were exposed to 8000-lux light for 12h to induce retinal degeneration. Reactive oxygen species (ROS) levels were assessed by confocal fluorescence microscopy using 2,7-dichlorofluorescein diacetate. Nuclear factor erythroid 2-related factor 2 (Nrf2) and antioxidant enzyme mRNA expression were detected by real-time PCR. Western blotting was used to evaluate NRF2 activation. NRF2 translocation was determined by immunohistochemistry, with morphological changes monitored by hematoxylin and eosin staining. Following light exposure, βE2 significantly reduced ROS production. βE2 also up-regulated NRF2 mRNA and protein levels, with maximal expression at 4 and 12h post-exposure, respectively. Interestingly, following βE2 administration, NRF2 was translocated from the cytoplasm to the nucleus, primarily in the outer nuclear layer. βE2 also up-regulated NRF2, which triggered phase-2 antioxidant enzyme expression (superoxide dismutases 1 and 2, catalase, glutaredoxins 1 and 2, and thioredoxins 1 and 2), reduced ROS production, and ameliorated retinal damage. However, the beneficial effects of βE2 were markedly suppressed by pretreatment with LY294002 or ICI182780, specific inhibitors of the phosphatidylinositol 3-kinase-Akt (PI3K/AKT), and estrogen receptor (ER) signaling pathways, respectively. Taken together, these observations suggest that βE2 exerts antioxidative effects following light-induced retinal degeneration potentially via NRF2 activation. This protective mechanism may depend on two pathways: a rapid, non-genomic-type PI3K/AKT response, and a genomic-type ER

  12. Perilla frutescens Extracts Protects against Dextran Sulfate Sodium-Induced Murine Colitis: NF-κB, STAT3, and Nrf2 as Putative Targets

    Directory of Open Access Journals (Sweden)

    Deung Dae Park

    2017-08-01

    Full Text Available Perilla frutescens is a culinary and medicinal herb which has a strong anti-inflammatory and antioxidative effects. In the present study, we investigated the effects of Perilla frutescens extract (PE against dextran sulfate sodium (DSS-induced mouse colitis, an animal model that mimics human inflammatory bowel disease (IBD. Five-week-old male ICR mice were treated with a daily dose of PE (20 or 100 mg/kg, p.o. for 1 week, followed by administration of 3% DSS in double distilled drinking water and PE by gavage for another week. DSS-induced colitis was characterized by body weight loss, colon length shortening, diarrhea and bloody stool, and these symptoms were significantly ameliorated by PE treatment. PE administration suppressed DSS-induced expression of proinflammatory enzymes, including cyclooxygenase-2 and inducible nitric oxide synthase as well as cyclin D1, in a dose-dependent fashion. Nuclear factor-kappa B (NF-κB and signal transducer and activator of transcription 3 (STAT3 are major transcriptional regulators of inflammatory signaling. PE administration significantly inhibited the activation of both NF-κB and STAT3 induced by DSS, while it elevated the accumulation of Nrf2 and heme oxygenase-1 in the colon. In another experiment, treatment of CCD841CoN human normal colon epithelial cells with PE (10 mg/ml resulted in the attenuation of the tumor necrosis factor-α-induced expression/activation of mediators of proinflammatory signaling. The above results indicate that PE has a preventive potential for use in the management of IBD.

  13. Perilla frutescens Extracts Protects against Dextran Sulfate Sodium-Induced Murine Colitis: NF-κB, STAT3, and Nrf2 as Putative Targets.

    Science.gov (United States)

    Dae Park, Deung; Yum, Hye-Won; Zhong, Xiancai; Kim, Seung Hyeon; Kim, Seong Hoon; Kim, Do-Hee; Kim, Su-Jung; Na, Hye-Kyung; Sato, Atsuya; Miura, Takehito; Surh, Young-Joon

    2017-01-01

    Perilla frutescens is a culinary and medicinal herb which has a strong anti-inflammatory and antioxidative effects. In the present study, we investigated the effects of Perilla frutescens extract (PE) against dextran sulfate sodium (DSS)-induced mouse colitis, an animal model that mimics human inflammatory bowel disease (IBD). Five-week-old male ICR mice were treated with a daily dose of PE (20 or 100 mg/kg, p.o. ) for 1 week, followed by administration of 3% DSS in double distilled drinking water and PE by gavage for another week. DSS-induced colitis was characterized by body weight loss, colon length shortening, diarrhea and bloody stool, and these symptoms were significantly ameliorated by PE treatment. PE administration suppressed DSS-induced expression of proinflammatory enzymes, including cyclooxygenase-2 and inducible nitric oxide synthase as well as cyclin D1, in a dose-dependent fashion. Nuclear factor-kappa B (NF-κB) and signal transducer and activator of transcription 3 (STAT3) are major transcriptional regulators of inflammatory signaling. PE administration significantly inhibited the activation of both NF-κB and STAT3 induced by DSS, while it elevated the accumulation of Nrf2 and heme oxygenase-1 in the colon. In another experiment, treatment of CCD841CoN human normal colon epithelial cells with PE (10 mg/ml) resulted in the attenuation of the tumor necrosis factor-α-induced expression/activation of mediators of proinflammatory signaling. The above results indicate that PE has a preventive potential for use in the management of IBD.

  14. Omeprazole induces heme oxygenase-1 in fetal human pulmonary microvascular endothelial cells via hydrogen peroxide-independent Nrf2 signaling pathway

    International Nuclear Information System (INIS)

    Patel, Ananddeep; Zhang, Shaojie; Shrestha, Amrit Kumar; Maturu, Paramahamsa; Moorthy, Bhagavatula; Shivanna, Binoy

    2016-01-01

    Omeprazole (OM) is an aryl hydrocarbon receptor (AhR) agonist and a proton pump inhibitor that is used to treat humans with gastric acid related disorders. Recently, we showed that OM induces NAD (P) H quinone oxidoreductase-1 (NQO1) via nuclear factor erythroid 2-related factor 2 (Nrf2)-dependent mechanism. Heme oxygenase-1 (HO-1) is another cytoprotective and antioxidant enzyme that is regulated by Nrf2. Whether OM induces HO-1 in fetal human pulmonary microvascular endothelial cells (HPMEC) is unknown. Therefore, we tested the hypothesis that OM will induce HO-1 expression via Nrf2 in HPMEC. OM induced HO-1 mRNA and protein expression in a dose-dependent manner. siRNA-mediated knockdown of AhR failed to abrogate, whereas knockdown of Nrf2 abrogated HO-1 induction by OM. To identify the underlying molecular mechanisms, we determined the effects of OM on cellular hydrogen peroxide (H 2 O 2 ) levels since oxidative stress mediated by the latter is known to activate Nrf2. Interestingly, the concentration at which OM induced HO-1 also increased H 2 O 2 levels. Furthermore, H 2 O 2 independently augmented HO-1 expression. Although N-acetyl cysteine (NAC) significantly decreased H 2 O 2 levels in OM-treated cells, we observed that OM further increased HO-1 mRNA and protein expression in NAC-pretreated compared to vehicle-pretreated cells, suggesting that OM induces HO-1 via H 2 O 2 -independent mechanisms. In conclusion, we provide evidence that OM transcriptionally induces HO-1 via AhR - and H 2 O 2 - independent, but Nrf2 - dependent mechanisms. These results have important implications for human disorders where Nrf2 and HO-1 play a beneficial role. - Highlights: • Omeprazole induces HO-1 in human fetal lung cells. • AhR deficiency fails to abrogate omeprazole-mediated induction of HO-1. • Nrf2 knockdown abrogates omeprazole-mediated HO-1 induction in human lung cells. • Hydrogen peroxide depletion augments omeprazole-mediated induction of HO-1.

  15. Omeprazole induces heme oxygenase-1 in fetal human pulmonary microvascular endothelial cells via hydrogen peroxide-independent Nrf2 signaling pathway

    Energy Technology Data Exchange (ETDEWEB)

    Patel, Ananddeep; Zhang, Shaojie; Shrestha, Amrit Kumar; Maturu, Paramahamsa; Moorthy, Bhagavatula; Shivanna, Binoy, E-mail: shivanna@bcm.edu

    2016-11-15

    Omeprazole (OM) is an aryl hydrocarbon receptor (AhR) agonist and a proton pump inhibitor that is used to treat humans with gastric acid related disorders. Recently, we showed that OM induces NAD (P) H quinone oxidoreductase-1 (NQO1) via nuclear factor erythroid 2-related factor 2 (Nrf2)-dependent mechanism. Heme oxygenase-1 (HO-1) is another cytoprotective and antioxidant enzyme that is regulated by Nrf2. Whether OM induces HO-1 in fetal human pulmonary microvascular endothelial cells (HPMEC) is unknown. Therefore, we tested the hypothesis that OM will induce HO-1 expression via Nrf2 in HPMEC. OM induced HO-1 mRNA and protein expression in a dose-dependent manner. siRNA-mediated knockdown of AhR failed to abrogate, whereas knockdown of Nrf2 abrogated HO-1 induction by OM. To identify the underlying molecular mechanisms, we determined the effects of OM on cellular hydrogen peroxide (H{sub 2}O{sub 2}) levels since oxidative stress mediated by the latter is known to activate Nrf2. Interestingly, the concentration at which OM induced HO-1 also increased H{sub 2}O{sub 2} levels. Furthermore, H{sub 2}O{sub 2} independently augmented HO-1 expression. Although N-acetyl cysteine (NAC) significantly decreased H{sub 2}O{sub 2} levels in OM-treated cells, we observed that OM further increased HO-1 mRNA and protein expression in NAC-pretreated compared to vehicle-pretreated cells, suggesting that OM induces HO-1 via H{sub 2}O{sub 2}-independent mechanisms. In conclusion, we provide evidence that OM transcriptionally induces HO-1 via AhR - and H{sub 2}O{sub 2} - independent, but Nrf2 - dependent mechanisms. These results have important implications for human disorders where Nrf2 and HO-1 play a beneficial role. - Highlights: • Omeprazole induces HO-1 in human fetal lung cells. • AhR deficiency fails to abrogate omeprazole-mediated induction of HO-1. • Nrf2 knockdown abrogates omeprazole-mediated HO-1 induction in human lung cells. • Hydrogen peroxide depletion augments

  16. Nrf2, the Master Regulator of Anti-Oxidative Responses

    Directory of Open Access Journals (Sweden)

    Sandra Vomund

    2017-12-01

    Full Text Available Tight regulation of inflammation is very important to guarantee a balanced immune response without developing chronic inflammation. One of the major mediators of the resolution of inflammation is the transcription factor: the nuclear factor erythroid 2-like 2 (Nrf2. Stabilized following oxidative stress, Nrf2 induces the expression of antioxidants as well as cytoprotective genes, which provoke an anti-inflammatory expression profile, and is crucial for the initiation of healing. In view of this fundamental modulatory role, it is clear that both hyper- or hypoactivation of Nrf2 contribute to the onset of chronic diseases. Understanding the tight regulation of Nrf2 expression/activation and its interaction with signaling pathways, known to affect inflammatory processes, will facilitate development of therapeutic approaches to prevent Nrf2 dysregulation and ameliorate chronic inflammatory diseases. We discuss in this review the principle mechanisms of Nrf2 regulation with a focus on inflammation and autophagy, extending the role of dysregulated Nrf2 to chronic diseases and tumor development.

  17. Fisetin Protects PC12 Cells from Tunicamycin-Mediated Cell Death via Reactive Oxygen Species Scavenging and Modulation of Nrf2-Driven Gene Expression, SIRT1 and MAPK Signaling in PC12 Cells.

    Science.gov (United States)

    Yen, Jui-Hung; Wu, Pei-Shan; Chen, Shu-Fen; Wu, Ming-Jiuan

    2017-04-17

    Fisetin (3,7,3',4'-tetrahydroxyflavone) is a dietary flavonol and exhibits antioxidant, anti-inflammatory, and neuroprotective activities. However, high concentration of fisetin is reported to produce reactive oxygen species (ROS), induce endoplasmic reticulum (ER) stress and cause cytotoxicity in cancer cells. The aim of this study is to investigate the cytoprotective effects of low concentration of fisetin against tunicamycin (Tm)-mediated cytotoxicity in neuronal-like catecholaminergic PC12 cells. Cell viability was assayed by MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) and apoptotic and autophagic markers were analyzed by Western blot. Gene expression of unfolded protein response (UPR) and Phase II enzymes was further investigated using RT-Q-PCR or Western blotting. Intracellular ROS level was measured using 2',7'-dichlorodihydrofluorescein diacetate (H₂DCFDA) by a fluorometer. The effects of fisetin on mitogen activated protein kinases (MAPKs) and SIRT1 (Sirtuin 1) signaling pathways were examined using Western blotting and specific inhibitors. Fisetin (<20 µM) restored cell viability and repressed apoptosis, autophagy and ROS production in Tm-treated cells. Fisetin attenuated Tm-mediated expression of ER stress genes, such as glucose-regulated proteins 78 (GRP78), C/EBP homologous protein (CHOP also known as GADD153) and Tribbles homolog 3 (TRB3), but induced the expression of nuclear E2 related factor (Nrf)2-targeted heme oxygenase (HO)-1, glutamate cysteine ligase (GCL) and cystine/glutamate transporter (xCT/SLC7A11), in both the presence and absence of Tm. Moreover, fisetin enhanced phosphorylation of ERK (extracellular signal-regulated kinase), JNK (c-JUN NH₂-terminal protein kinase), and p38 MAPK. Addition of JNK and p38 MAPK inhibitor significantly antagonized its cytoprotective activity and modulatory effects on UPR. Fisetin also restored Tm-inhibited SIRT1 expression and addition of sirtinol (SIRT1 activation inhibitor

  18. Activation of Nrf2 protects against triptolide-induced hepatotoxicity.

    Directory of Open Access Journals (Sweden)

    Jia Li

    Full Text Available Triptolide, the major active component of Tripterygium wilfordii Hook f. (TWHF, has a wide range of pharmacological activities. However, the toxicities of triptolide, particularly the hepatotoxicity, limit its clinical application. The hepatotoxicity of triptolide has not been well characterized yet. The aim of this study was to investigate the role of NF-E2-related factor 2 (Nrf2 in triptolide-induced toxicity and whether activation of Nrf2 could protect against triptolide-induced hepatotoxicity. The results showed that triptolide caused oxidative stress and cell damage in HepG2 cells, and these toxic effects could be aggravated by Nrf2 knockdown or be counteracted by overexpression of Nrf2. Treatment with a typical Nrf2 agonist, sulforaphane (SFN, attenuated triptolide-induced liver dysfunction, structural damage, glutathione depletion and decrease in antioxidant enzymes in BALB/C mice. Moreover, the hepatoprotective effect of SFN on triptolide-induced liver injury was associated with the activation of Nrf2 and its downstream targets. Collectively, these results indicate that Nrf2 activation protects against triptolide-induced hepatotoxicity.

  19. Copper-induced tight junction mRNA expression changes, apoptosis and antioxidant responses via NF-κB, TOR and Nrf2 signaling molecules in the gills of fish: Preventive role of arginine

    International Nuclear Information System (INIS)

    Wang, Biao; Feng, Lin; Jiang, Wei-Dan; Wu, Pei; Kuang, Sheng-Yao; Jiang, Jun; Tang, Ling; Tang, Wu-Neng; Zhang, Yong-An; Liu, Yang

    2015-01-01

    Highlights: • Cu exposure induced oxidative stress via disruption of antioxidant system. • Cu exposure disrupted TJ mRNA expression through regulation of cytokines in fish. • Cu induced gill apoptosis partly via intrinsic pathway but not extrinsic pathway. • Cu exposure can regulate Nrf2, NF-κB and TOR signaling molecules in fish. • Arginine can effectively prevent Cu-induced fish gill damage. - Abstract: This study explored the possible preventive effects of dietary arginine on copper (Cu)-induced tight junction mRNA expression changes, apoptosis and antioxidant responses in the gills of young grass carp (Ctenopharyngodon idella). The results indicated that exposure to 0.7 mg/L (11.01 μmol/L) Cu for 96 h induced the production of reactive oxygen species (ROS), thereby increasing protein oxidation, lipid peroxidation and DNA damage in the gills of fish. However, these oxidative effects were prevented by arginine supplementation. Arginine also prevented the toxic effects of Cu on the activities of copper/zinc superoxide dismutase (SOD1), glutathione-S-transferase (GST), glutathione peroxidase (GPx), glutathione reductase (GR) and the glutathione (GSH) content (P < 0.05). However, Cu induced an adaptive increase in the activity of catalase (CAT), and arginine supplementation further increased CAT activity (P < 0.05). Moreover, Cu induced increases in the relative mRNA expressions of SOD1, CAT, GPx, GST, caspase-3, caspase-9, NF-E2-related factor 2 (Nrf2), Kelch-like-ECH-associated protein 1a (Keap1a), tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), interleukin-8 (IL-8), transforming growth factor-β (TGF-β) and nuclear transcription factor-κB p65 (NF-κB p65) in the gills of grass carp (P < 0.05). In contrast, the relative mRNA expression levels of occludin, zonula occludens-1 (ZO-1), claudin b, claudin 3, claudin 12, target of rapamycin (TOR) and inhibitor factor κBα (IκBα) in the gills were decreased by Cu (P < 0.05). However, pre

  20. Copper-induced tight junction mRNA expression changes, apoptosis and antioxidant responses via NF-κB, TOR and Nrf2 signaling molecules in the gills of fish: Preventive role of arginine

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Biao [Animal Nutrition Institute, Sichuan Agricultural University, Chengdu 611130, Sichuan (China); Feng, Lin; Jiang, Wei-Dan [Animal Nutrition Institute, Sichuan Agricultural University, Chengdu 611130, Sichuan (China); Fish Nutrition and Safety Production University Key Laboratory of Sichuan Province, Sichuan Agricultural University, Chengdu 611130, Sichuan (China); Key Laboratory for Animal Disease-Resistance Nutrition of China Ministry of Education, Sichuan Agricultural University, Chengdu 611130, Sichuan (China); Wu, Pei [Animal Nutrition Institute, Sichuan Agricultural University, Chengdu 611130, Sichuan (China); Kuang, Sheng-Yao [Animal Nutrition Institute, Sichuan Academy of Animal Science, Chengdu, 610066, Sichuan (China); Jiang, Jun [Animal Nutrition Institute, Sichuan Agricultural University, Chengdu 611130, Sichuan (China); Fish Nutrition and Safety Production University Key Laboratory of Sichuan Province, Sichuan Agricultural University, Chengdu 611130, Sichuan (China); Key Laboratory for Animal Disease-Resistance Nutrition of China Ministry of Education, Sichuan Agricultural University, Chengdu 611130, Sichuan (China); Tang, Ling; Tang, Wu-Neng [Animal Nutrition Institute, Sichuan Academy of Animal Science, Chengdu, 610066, Sichuan (China); Zhang, Yong-An [Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan 430072 (China); Liu, Yang, E-mail: kyckgk@hotmail.com [Animal Nutrition Institute, Sichuan Agricultural University, Chengdu 611130, Sichuan (China); Fish Nutrition and Safety Production University Key Laboratory of Sichuan Province, Sichuan Agricultural University, Chengdu 611130, Sichuan (China); Key Laboratory for Animal Disease-Resistance Nutrition of China Ministry of Education, Sichuan Agricultural University, Chengdu 611130, Sichuan (China); and others

    2015-01-15

    Highlights: • Cu exposure induced oxidative stress via disruption of antioxidant system. • Cu exposure disrupted TJ mRNA expression through regulation of cytokines in fish. • Cu induced gill apoptosis partly via intrinsic pathway but not extrinsic pathway. • Cu exposure can regulate Nrf2, NF-κB and TOR signaling molecules in fish. • Arginine can effectively prevent Cu-induced fish gill damage. - Abstract: This study explored the possible preventive effects of dietary arginine on copper (Cu)-induced tight junction mRNA expression changes, apoptosis and antioxidant responses in the gills of young grass carp (Ctenopharyngodon idella). The results indicated that exposure to 0.7 mg/L (11.01 μmol/L) Cu for 96 h induced the production of reactive oxygen species (ROS), thereby increasing protein oxidation, lipid peroxidation and DNA damage in the gills of fish. However, these oxidative effects were prevented by arginine supplementation. Arginine also prevented the toxic effects of Cu on the activities of copper/zinc superoxide dismutase (SOD1), glutathione-S-transferase (GST), glutathione peroxidase (GPx), glutathione reductase (GR) and the glutathione (GSH) content (P < 0.05). However, Cu induced an adaptive increase in the activity of catalase (CAT), and arginine supplementation further increased CAT activity (P < 0.05). Moreover, Cu induced increases in the relative mRNA expressions of SOD1, CAT, GPx, GST, caspase-3, caspase-9, NF-E2-related factor 2 (Nrf2), Kelch-like-ECH-associated protein 1a (Keap1a), tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), interleukin-8 (IL-8), transforming growth factor-β (TGF-β) and nuclear transcription factor-κB p65 (NF-κB p65) in the gills of grass carp (P < 0.05). In contrast, the relative mRNA expression levels of occludin, zonula occludens-1 (ZO-1), claudin b, claudin 3, claudin 12, target of rapamycin (TOR) and inhibitor factor κBα (IκBα) in the gills were decreased by Cu (P < 0.05). However, pre

  1. A novel shogaol analog suppresses cancer cell invasion and inflammation, and displays cytoprotective effects through modulation of NF-κB and Nrf2-Keap1 signaling pathways

    Energy Technology Data Exchange (ETDEWEB)

    Gan, Fei-Fei; Ling, Hui; Ang, Xiaohui; Reddy, Shridhivya A.; Lee, Stephanie S-H.; Yang, Hong; Tan, Sock-Hoon [Department of Pharmacy, Faculty of Science, National University of Singapore (Singapore); Hayes, John D. [Jacqui Wood Cancer Centre, Division of Cancer Research, Ninewells Hospital and Medical School, University of Dundee, Dundee, Scotland (United Kingdom); Chui, Wai-Keung [Department of Pharmacy, Faculty of Science, National University of Singapore (Singapore); Chew, Eng-Hui, E-mail: phaceh@nus.edu.sg [Department of Pharmacy, Faculty of Science, National University of Singapore (Singapore)

    2013-11-01

    Natural compounds containing vanilloid and Michael acceptor moieties appear to possess anti-cancer and chemopreventive properties. The ginger constituent shogaol represents one such compound. In this study, the anti-cancer potential of a synthetic novel shogaol analog 3-phenyl-3-shogaol (3-Ph-3-SG) was assessed by evaluating its effects on signaling pathways. At non-toxic concentrations, 3-Ph-3-SG suppressed cancer cell invasion in MDA-MB-231 and MCF-7 breast carcinoma cells through inhibition of PMA-activated MMP-9 expression. At similar concentrations, 3-Ph-3-SG reduced expression of the inflammatory mediators nitric oxide (NO), inducible nitric oxide synthase (iNOS), cyclooxygenase-2 (COX-2) and prostanglandin-E{sub 2} (PGE{sub 2}) in RAW 264.7 macrophage-like cells. Inhibition of cancer cell invasion and inflammation by 3-Ph-3-SG were mediated through suppression of the nuclear factor-kappaB (NF-κB) signaling pathway. The 3-Ph-3-SG also demonstrated cytoprotective effects by inducing the antioxidant response element (ARE)-driven genes NAD(P)H quinone oxidoreductase-1 (NQO1) and heme oxygenase-1 (HO-1). Cytoprotection by 3-Ph-3-SG was achieved at least partly through modification of cysteine residues in the E3 ubiquitin ligase substrate adaptor Kelch-like ECH-associated protein 1 (Keap1), which resulted in accumulation of transcription factor NF-E2 p45-related factor 2 (Nrf2). The activities of 3-Ph-3-SG were comparable to those of 6-shogaol, the most abundant naturally-occurring shogaol, and stronger than those of 4-hydroxyl-null deshydroxy-3-phenyl-3-shogaol, which attested the importance of the 4-hydroxy substituent in the vanilloid moiety for bioactivity. In summary, 3-Ph-3-SG is shown to possess activities that modulate stress-associated pathways relevant to multiple steps in carcinogenesis. Therefore, it warrants further investigation of this compound as a promising candidate for use in chemotherapeutic and chemopreventive strategies. - Highlights:

  2. Interplay between VEGF and Nrf2 regulates angiogenesis due to intracranial venous hypertension.

    Science.gov (United States)

    Li, Liwen; Pan, Hao; Wang, Handong; Li, Xiang; Bu, Xiaomin; Wang, Qiang; Gao, Yongyue; Wen, Guodao; Zhou, Yali; Cong, Zixiang; Yang, Youqing; Tang, Chao; Liu, Zhengwei

    2016-11-21

    Venous hypertension(VH) plays an important role in the pathogenesis of cerebral arteriovenous malformations (AVMs) and is closely associated with the HIF-1α/VEGF signaling pathway. Nuclear factor erythroid 2-related factor 2(Nrf2) significantly influences angiogenesis; however, the interplay between Nrf2 and VEGF under VH in brain AVMs remains unclear. Therefore, our study aimed to investigate the interplay between Nrf2 and VEGF due to VH in brain AVMs. Immunohistochemistry indicated that Nrf2 and VEGF were highly expressed in human brain AVM tissues. In vivo, we established a VH model in both wild-type (WT) and siRNA-mediated Nrf2 knockdown rats. VH significantly increased the expression of Nrf2 and VEGF. Loss of Nrf2 markedly inhibited the upregulation of VEGF, as determined by Western blot analysis and qRT-PCR. In vitro, primary brain microvascular endothelial cells (BMECs) were isolated from WT and Nrf2 -/- mice, and a VEGF-Nrf2 positive feed-back loop was observed in BMECs. By trans well assay and angiogenesis assay, Nrf2 knockout significantly inhibited the migration and vascular tube formation of BMECs. These findings suggest that the interplay between Nrf2 and VEGF can contribute to VH-induced angiogenesis in brain AVMs pathogenesis.

  3. Ectodermal-neural cortex 1 down-regulates Nrf2 at the translational level.

    Directory of Open Access Journals (Sweden)

    Xiao-Jun Wang

    Full Text Available The transcription factor Nrf2 is the master regulator of a cellular defense mechanism against environmental insults. The Nrf2-mediated antioxidant response is accomplished by the transcription of a battery of genes that encode phase II detoxifying enzymes, xenobiotic transporters, and antioxidants. Coordinated expression of these genes is critical in protecting cells from toxic and carcinogenic insults and in maintaining cellular redox homeostasis. Activation of the Nrf2 pathway is primarily controlled by Kelch-like ECH-associated protein 1 (Keap1, which is a molecular switch that turns on or off the Nrf2 signaling pathway according to intracellular redox conditions. Here we report our finding of a novel Nrf2 suppressor ectodermal-neural cortex 1 (ENC1, which is a BTB-Kelch protein and belongs to the same family as Keap1. Transient expression of ENC1 reduced steady-state levels of Nrf2 and its downstream gene expression. Although ENC1 interacted with Keap1 indirectly, the ENC1-mediated down-regulation of Nrf2 was independent of Keap1. The negative effect of ENC1 on Nrf2 was not due to a change in the stability of Nrf2 because neither proteasomal nor lysosomal inhibitors had any effects. Overexpression of ENC1 did not result in a change in the level of Nrf2 mRNA, rather, it caused a decrease in the rate of Nrf2 protein synthesis. These results demonstrate that ENC1 functions as a negative regulator of Nrf2 through suppressing Nrf2 protein translation, which adds another level of complexity in controlling the Nrf2 signaling pathway.

  4. Inhibition of early T cell cytokine production by arsenic trioxide occurs independently of Nrf2.

    Directory of Open Access Journals (Sweden)

    Kelly R VanDenBerg

    Full Text Available Nuclear factor erythroid 2-related factor 2 (Nrf2 is a stress-activated transcription factor that induces a variety of cytoprotective genes. Nrf2 also mediates immunosuppressive effects in multiple inflammatory models. Upon activation, Nrf2 dissociates from its repressor protein, Keap1, and translocates to the nucleus where it induces Nrf2 target genes. The Nrf2-Keap1 interaction is disrupted by the environmental toxicant and chemotherapeutic agent arsenic trioxide (ATO. The purpose of the present study was to determine the effects of ATO on early events of T cell activation and the role of Nrf2 in those effects. The Nrf2 target genes Hmox-1, Nqo-1, and Gclc were all upregulated by ATO (1-2 μM in splenocytes derived from wild-type, but not Nrf2-null, mice, suggesting that Nrf2 is activated by ATO in splenocytes. ATO also inhibited IFNγ, IL-2, and GM-CSF mRNA and protein production in wild-type splenocytes activated with the T cell activator, anti-CD3/anti-CD28. However, ATO also decreased production of these cytokines in activated splenocytes from Nrf2-null mice, suggesting the inhibition is independent of Nrf2. Interestingly, ATO inhibited TNFα protein secretion, but not mRNA expression, in activated splenocytes suggesting the inhibition is due to post-transcriptional modification. In addition, c-Fos DNA binding was significantly diminished by ATO in wild-type and Nrf2-null splenocytes activated with anti-CD3/anti-CD28, consistent with the observed inhibition of cytokine production by ATO. Collectively, this study suggests that although ATO activates Nrf2 in splenocytes, inhibition of early T cell cytokine production by ATO occurs independently of Nrf2 and may instead be due to impaired AP-1 DNA binding.

  5. Nrf2 deficiency improves glucose tolerance in mice fed a high-fat diet

    International Nuclear Information System (INIS)

    Zhang, Yu-Kun Jennifer; Wu, Kai Connie; Liu, Jie; Klaassen, Curtis D.

    2012-01-01

    Nrf2, a master regulator of intracellular redox homeostasis, is indicated to participate in fatty acid metabolism in liver. However, its role in diet-induced obesity remains controversial. In the current study, genetically engineered Nrf2-null, wild-type (WT), and Nrf2-activated, Keap1-knockdown (K1-KD) mice were fed either a control or a high-fat Western diet (HFD) for 12 weeks. The results indicate that the absence or enhancement of Nrf2 activity did not prevent diet-induced obesity, had limited effects on lipid metabolism, but affected blood glucose homeostasis. Whereas the Nrf2-null mice were resistant to HFD-induced glucose intolerance, the Nrf2-activated K1-KD mice exhibited prolonged elevation of circulating glucose during a glucose tolerance test even on the control diet. Feeding a HFD did not activate the Nrf2 signaling pathway in mouse livers. Fibroblast growth factor 21 (Fgf21) is a liver-derived anti-diabetic hormone that exerts glucose- and lipid-lowering effects. Fgf21 mRNA and protein were both elevated in livers of Nrf2-null mice, and Fgf21 protein was lower in K1-KD mice than WT mice. The inverse correlation between Nrf2 activity and hepatic expression of Fgf21 might explain the improved glucose tolerance in Nrf2-null mice. Furthermore, a more oxidative cellular environment in Nrf2-null mice could affect insulin signaling in liver. For example, mRNA of insulin-like growth factor binding protein 1, a gene repressed by insulin in hepatocytes, was markedly elevated in livers of Nrf2-null mice. In conclusion, genetic alteration of Nrf2 does not prevent diet-induced obesity in mice, but deficiency of Nrf2 improves glucose homeostasis, possibly through its effects on Fgf21 and/or insulin signaling. -- Highlights: ► Nrf2 deficiency improves glucose tolerance in mice fed a high-fat diet. ► The anti-diabetic hormone, Fgf21, is highly expressed in livers of Nrf2-null mice. ► The absence of Nrf2 increases the insulin-regulated Igfbp-1 mRNA in liver.

  6. Nrf2 deficiency improves glucose tolerance in mice fed a high-fat diet

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Yu-Kun Jennifer; Wu, Kai Connie; Liu, Jie; Klaassen, Curtis D., E-mail: cklaasse@kumc.edu

    2012-11-01

    Nrf2, a master regulator of intracellular redox homeostasis, is indicated to participate in fatty acid metabolism in liver. However, its role in diet-induced obesity remains controversial. In the current study, genetically engineered Nrf2-null, wild-type (WT), and Nrf2-activated, Keap1-knockdown (K1-KD) mice were fed either a control or a high-fat Western diet (HFD) for 12 weeks. The results indicate that the absence or enhancement of Nrf2 activity did not prevent diet-induced obesity, had limited effects on lipid metabolism, but affected blood glucose homeostasis. Whereas the Nrf2-null mice were resistant to HFD-induced glucose intolerance, the Nrf2-activated K1-KD mice exhibited prolonged elevation of circulating glucose during a glucose tolerance test even on the control diet. Feeding a HFD did not activate the Nrf2 signaling pathway in mouse livers. Fibroblast growth factor 21 (Fgf21) is a liver-derived anti-diabetic hormone that exerts glucose- and lipid-lowering effects. Fgf21 mRNA and protein were both elevated in livers of Nrf2-null mice, and Fgf21 protein was lower in K1-KD mice than WT mice. The inverse correlation between Nrf2 activity and hepatic expression of Fgf21 might explain the improved glucose tolerance in Nrf2-null mice. Furthermore, a more oxidative cellular environment in Nrf2-null mice could affect insulin signaling in liver. For example, mRNA of insulin-like growth factor binding protein 1, a gene repressed by insulin in hepatocytes, was markedly elevated in livers of Nrf2-null mice. In conclusion, genetic alteration of Nrf2 does not prevent diet-induced obesity in mice, but deficiency of Nrf2 improves glucose homeostasis, possibly through its effects on Fgf21 and/or insulin signaling. -- Highlights: ► Nrf2 deficiency improves glucose tolerance in mice fed a high-fat diet. ► The anti-diabetic hormone, Fgf21, is highly expressed in livers of Nrf2-null mice. ► The absence of Nrf2 increases the insulin-regulated Igfbp-1 mRNA in liver.

  7. Schisandra sphenanthera extract (Wuzhi Tablet protects against chronic-binge and acute alcohol-induced liver injury by regulating the NRF2-ARE pathway in mice

    Directory of Open Access Journals (Sweden)

    Xuezhen Zeng

    2017-09-01

    Full Text Available Alcohol abuse leads to alcoholic liver disease and no effective therapy is currently available. Wuzhi Tablet (WZ, a preparation of extract from Schisandra sphenanthera that is a traditional hepato-protective herb, exerted a significant protective effect against acetaminophen-induced liver injury in our recent studies, but whether WZ can alleviate alcohol-induced toxicity remains unclear. This study aimed to investigate the contribution of WZ to alcohol-induced liver injury by using chronic-binge and acute models of alcohol feeding. The activities of ALT and AST in serum were assessed as well as the level of GSH and the activity of SOD in the liver. The expression of CYP2E1 and proteins in the NRF2-ARE signaling pathway including NRF2, GCLC, GCLM, HO-1 were measured, and the effect of WZ on NRF2 transcriptional activity was determined. We found that both models resulted in liver steatosis accompanied by increased transaminase activities, but that liver injury was significantly attenuated by WZ. WZ administration also inhibited CYP2E1 expression induced by alcohol, and elevated the level of GSH and the activity of SOD in the liver. Moreover, the NRF2-ARE signaling pathway was activated by WZ and the target genes were all upregulated. Furthermore, WZ significantly activated NRF2 transcriptional activity. Collectively, our study demonstrates that WZ protected against alcohol-induced liver injury by reducing oxidative stress and improving antioxidant defense, possibly by activating the NRF2-ARE pathway.

  8. Brain-Derived Neurotrophic Factor Increases Synaptic Protein Levels via the MAPK/Erk Signaling Pathway and Nrf2/Trx Axis Following the Transplantation of Neural Stem Cells in a Rat Model of Traumatic Brain Injury.

    Science.gov (United States)

    Chen, Tao; Wu, Yu; Wang, Yuzi; Zhu, Jigao; Chu, Haiying; Kong, Li; Yin, Liangwei; Ma, Haiying

    2017-11-01

    Brain-derived neurotrophic factor (BDNF) plays an important role in promoting the growth, differentiation, survival and synaptic stability of neurons. Presently, the transplantation of neural stem cells (NSCs) is known to induce neural repair to some extent after injury or disease. In this study, to investigate whether NSCs genetically modified to encode the BDNF gene (BDNF/NSCs) would further enhance synaptogenesis, BDNF/NSCs or naive NSCs were directly engrafted into lesions in a rat model of traumatic brain injury (TBI). Immunohistochemistry, western blotting and RT-PCR were performed to detect synaptic proteins, BDNF-TrkB and its downstream signaling pathways, at 1, 2, 3 or 4 weeks after transplantation. Our results showed that BDNF significantly increased the expression levels of the TrkB receptor gene and the phosphorylation of the TrkB protein in the lesions. The expression levels of Ras, phosphorylated Erk1/2 and postsynaptic density protein-95 were elevated in the BDNF/NSCs-transplanted groups compared with those in the NSCs-transplanted groups throughout the experimental period. Moreover, the nuclear factor (erythroid-derived 2)-like 2/Thioredoxin (Nrf2/Trx) axis, which is a specific therapeutic target for the treatment of injury or cell death, was upregulated by BDNF overexpression. Therefore, we determined that the increased synaptic proteins level implicated in synaptogenesis might be associated with the activation of the MAPK/Erk1/2 signaling pathway and the upregulation of the antioxidant agent Trx modified by BDNF-TrkB following the BDNF/NSCs transplantation after TBI.

  9. PF-4708671, a specific inhibitor of p70 ribosomal S6 kinase 1, activates Nrf2 by promoting p62-dependent autophagic degradation of Keap1

    Energy Technology Data Exchange (ETDEWEB)

    Park, Jeong Su [Severance Biomedical Science Institute (Korea, Republic of); Yonsei Biomedical Research Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Kang, Dong Hoon [Department of Life Science and Ewha Research Center for Systems Biology (Korea, Republic of); The Research Center for Cell Homeostasis, Ewha Womans University, Seoul 127-750 (Korea, Republic of); Lee, Da Hyun [Severance Biomedical Science Institute (Korea, Republic of); Yonsei Biomedical Research Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Bae, Soo Han, E-mail: soohanbae@yuhs.ac [Severance Biomedical Science Institute (Korea, Republic of); Yonsei Biomedical Research Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of)

    2015-10-23

    p70 ribosomal S6 kinase 1 (S6K1) is an important serine/threonine kinase and downstream target of the mechanistic target of rapamycin complex 1 (mTORC1) signaling pathway. PF-4708671 is a specific inhibitor of S6K1, and prevents S6K1-mediated phosphorylation of the S6 protein. PF-4708671 treatment often leads to apoptotic cell death. However, the protective mechanism against PF-4708671-induced cell death has not been elucidated. The nuclear factor erythroid 2-related factor 2 (Nrf2)-Kelch-like ECH-associated protein 1 (Keap1) pathway is essential for protecting cells against oxidative stress. p62, an adaptor protein in the autophagic process, enhances Nrf2 activation through the impairment of Keap1 activity. In this study, we showed that PF-4708671 induces autophagic Keap1 degradation-mediated Nrf2 activation in p62-dependent manner. Furthermore, p62-dependent Nrf2 activation plays a crucial role in protecting cells from PF-4708671-mediated apoptosis. - Highlights: • PF-4708671, a S6K1-specific inhibitor, prevents S6K1-mediated S6 phosphorylation. • However, PF-4708671 treatment often leads to apoptotic cell death. • Protective mechanism against PF-4708671-induced cell death remains to be elucidated. • PF-4708671 induced p62-dependent, autophagic Keap1 degradation-mediated Nrf2 activation. • p62-dependent Nrf2 activation protects cells from PF-4708671-mediated apoptosis.

  10. Impaired transcriptional activity of Nrf2 in age-related myocardial oxidative stress is reversible by moderate exercise training.

    Directory of Open Access Journals (Sweden)

    Sellamuthu S Gounder

    Full Text Available Aging promotes accumulation of reactive oxygen/nitrogen species (ROS/RNS in cardiomyocytes, which leads to contractile dysfunction and cardiac abnormalities. These changes may contribute to increased cardiovascular disease in the elderly. Inducible antioxidant pathways are regulated by nuclear erythroid 2 p45-related factor 2 (Nrf2 through antioxidant response cis-elements (AREs and are impaired in the aging heart. Whereas acute exercise stress (AES activates Nrf2 signaling and promotes myocardial antioxidant function in young mice (~2 months, aging mouse (>23 months hearts exhibit significant oxidative stress as compared to those of the young. The purpose of this study was to investigate age-dependent regulation of Nrf2-antioxidant mechanisms and redox homeostasis in mouse hearts and the impact of exercise. Old mice were highly susceptible to oxidative stress following high endurance exercise stress (EES, but demonstrated increased adaptive redox homeostasis after moderate exercise training (MET; 10m/min, for 45 min/day for ~6 weeks. Following EES, transcription and protein levels for most of the ARE-antioxidants were increased in young mice but their induction was blunted in aging mice. In contrast, 6-weeks of chronic MET promoted nuclear levels of Nrf2 along with its target antioxidants in the aging heart to near normal levels as seen in young mice. These observations suggest that enhancing Nrf2 function and endogenous cytoprotective mechanisms by MET, may combat age-induced ROS/RNS and protect the myocardium from oxidative stress diseases.

  11. Copper exposure induces toxicity to the antioxidant system via the destruction of Nrf2/ARE signaling and caspase-3-regulated DNA damage in fish muscle: Amelioration by myo-inositol

    International Nuclear Information System (INIS)

    Jiang, Wei-Dan; Liu, Yang; Jiang, Jun; Wu, Pei; Feng, Lin; Zhou, Xiao-Qiu

    2015-01-01

    Highlights: • Cu stress decreased fish muscle CuZnSOD, GPx1a, GPx1b and PKCδ mRNA levels. • Cu stress caused fish muscle lower nuclear Nrf2 levels and poor ARE binding ability. • Cu stress induced caspase-3 signaling-modulated DNA fragmentation in fish muscle. • Pre-treatment with MI prevented fish muscle from Cu-induced oxidative damages. - Abstract: The muscle is the main portion of fish that is consumed by humans. Copper (Cu) can induce oxidative damage in fish muscle. However, the effects of Cu exposure on the muscle antioxidant system and molecular patterns and preventive measures against these effects remain unclear. In this study, ROS production, enzymatic and mRNA levels of antioxidant enzymes and NF-E2-related factor 2 (Nrf2) signaling-related molecules, antioxidant response element (ARE) binding ability, DNA fragmentation and caspase-3 activities were analyzed in fish muscle following Cu exposure or myo-inositol (MI) pre-administration. The results indicated that contamination due to copper exposure caused an approximately three-fold increase in ROS production, induced lipid peroxidation and protein oxidation, and resulted in depletion of the glutathione (GSH) content of fish muscle. Moreover, Cu exposure caused decreases in the activities of total superoxide dismutase (T-SOD), CuZnSOD, and glutathione peroxidase (GPx) that were accompanied by decreases in CuZnSOD, GPx1a, GPx1b and signaling factor protein kinase C delta mRNA levels. The decreases in the antioxidant enzyme gene mRNA levels were confirmed to be partly due to the reduced nuclear Nrf2 protein levels, poor ARE binding ability and increased caspase-3 signaling-modulated DNA fragmentation in the fish muscle. Interestingly, MI pre-treatment prevented fish muscle from Cu-induced oxidative damages mainly through increasing the GSH content, and increasing the CuZnSOD and GPx activities and corresponding mRNA levels and ARE binding ability. Taken together, our results show for the first

  12. Copper exposure induces toxicity to the antioxidant system via the destruction of Nrf2/ARE signaling and caspase-3-regulated DNA damage in fish muscle: Amelioration by myo-inositol

    Energy Technology Data Exchange (ETDEWEB)

    Jiang, Wei-Dan; Liu, Yang [Animal Nutrition Institute, Sichuan Agricultural University, Chengdu 611130, Sichuan (China); Fish Nutrition and Safety Production University Key Laboratory of Sichuan Province, Sichuan Agricultural University, Chengdu 611130, Sichuan (China); Key Laboratory for Animal Disease-Resistance Nutrition of China Ministry of Education, Sichuan Agricultural University, Chengdu 611130, Sichuan (China); Jiang, Jun [Animal Nutrition Institute, Sichuan Agricultural University, Chengdu 611130, Sichuan (China); Wu, Pei [Animal Nutrition Institute, Sichuan Agricultural University, Chengdu 611130, Sichuan (China); Fish Nutrition and Safety Production University Key Laboratory of Sichuan Province, Sichuan Agricultural University, Chengdu 611130, Sichuan (China); Key Laboratory for Animal Disease-Resistance Nutrition of China Ministry of Education, Sichuan Agricultural University, Chengdu 611130, Sichuan (China); Feng, Lin, E-mail: fenglin@sicau.edu.cn [Animal Nutrition Institute, Sichuan Agricultural University, Chengdu 611130, Sichuan (China); Fish Nutrition and Safety Production University Key Laboratory of Sichuan Province, Sichuan Agricultural University, Chengdu 611130, Sichuan (China); Key Laboratory for Animal Disease-Resistance Nutrition of China Ministry of Education, Sichuan Agricultural University, Chengdu 611130, Sichuan (China); Zhou, Xiao-Qiu, E-mail: zhouxq@sicau.edu.cn [Animal Nutrition Institute, Sichuan Agricultural University, Chengdu 611130, Sichuan (China); Fish Nutrition and Safety Production University Key Laboratory of Sichuan Province, Sichuan Agricultural University, Chengdu 611130, Sichuan (China); Key Laboratory for Animal Disease-Resistance Nutrition of China Ministry of Education, Sichuan Agricultural University, Chengdu 611130, Sichuan (China)

    2015-02-15

    Highlights: • Cu stress decreased fish muscle CuZnSOD, GPx1a, GPx1b and PKCδ mRNA levels. • Cu stress caused fish muscle lower nuclear Nrf2 levels and poor ARE binding ability. • Cu stress induced caspase-3 signaling-modulated DNA fragmentation in fish muscle. • Pre-treatment with MI prevented fish muscle from Cu-induced oxidative damages. - Abstract: The muscle is the main portion of fish that is consumed by humans. Copper (Cu) can induce oxidative damage in fish muscle. However, the effects of Cu exposure on the muscle antioxidant system and molecular patterns and preventive measures against these effects remain unclear. In this study, ROS production, enzymatic and mRNA levels of antioxidant enzymes and NF-E2-related factor 2 (Nrf2) signaling-related molecules, antioxidant response element (ARE) binding ability, DNA fragmentation and caspase-3 activities were analyzed in fish muscle following Cu exposure or myo-inositol (MI) pre-administration. The results indicated that contamination due to copper exposure caused an approximately three-fold increase in ROS production, induced lipid peroxidation and protein oxidation, and resulted in depletion of the glutathione (GSH) content of fish muscle. Moreover, Cu exposure caused decreases in the activities of total superoxide dismutase (T-SOD), CuZnSOD, and glutathione peroxidase (GPx) that were accompanied by decreases in CuZnSOD, GPx1a, GPx1b and signaling factor protein kinase C delta mRNA levels. The decreases in the antioxidant enzyme gene mRNA levels were confirmed to be partly due to the reduced nuclear Nrf2 protein levels, poor ARE binding ability and increased caspase-3 signaling-modulated DNA fragmentation in the fish muscle. Interestingly, MI pre-treatment prevented fish muscle from Cu-induced oxidative damages mainly through increasing the GSH content, and increasing the CuZnSOD and GPx activities and corresponding mRNA levels and ARE binding ability. Taken together, our results show for the first

  13. Effects of various feeding patterns of Bacillus coagulans on growth performance, antioxidant response and Nrf2-Keap1 signaling pathway in juvenile gibel carp (Carassius auratus gibelio).

    Science.gov (United States)

    Yu, Yebing; Wang, Changhai; Wang, Aimin; Yang, Wenping; Lv, Fu; Liu, Fei; Liu, Bo; Sun, Cunxin

    2018-02-01

    The present study was conducted to evaluate the effects of various Bacillus coagulans feeding patterns on growth, antioxidant parameter and Nrf2 pathway in juvenile gibel carp. The similar size of gibel carp (initial weight: 14.33 ± 0.15 g) were subjected to three levels of B. coagulans supplementation (0, 500, and 1000 mg/kg) and two feeding modes (supplementing B. coagulans continuously or for two days of B. coagulans after 5 days of a basal diet) according to a 3 × 2 factorial design. The fish that were continuously fed 500 mg/kg B. coagulans (P2) and those fed the first basal diet for 5 days followed by 500 mg/kg or 1000 mg/kg B.coagulans for 2 days (P4 or P5) showed higher weight gain rate and specific growth rate than the other groups. Blood respiratory burst (RB), myeloperoxidase (MPO), and anti-superoxide anion free radical (AFASER) activities in the P4 group were higher than those of the control. White blood cell count (WBC), RB activity, MPO activity, and glutathione (GSH) content in the P5 group were also higher than those of the control. A similar higher trend was observed in the gene expressions of NADPH oxidase 2 (NOX2), NFE2-related factor (Nrf2), Kelch-like-ECH-associated protein(Keap1) in the P4 and NOX2, NRF2, CNC homolog 1 (Bach1), peroxiredoxin 2 (Prx2) in the P5 group compared with the control. Additionally, we observed a significantly lower level of plasma aspartate aminotransferase (AST), lower activity of alanine aminotransferase (ALT), a higher level of MPO, higher GPX activity, and increased NRF2 and Prx2 expression were all observed in the P2 treatment group compared with the control. Furthermore, the malondialdehyde (MDA) content in the P2, P3, and P4 groups was lower than that of the control. These results indicate that a diet supplemented with appropriate levels of B.coagulans could improve the growth, immune response, and antioxidant capability of gibel carp. We concluded that the pattern of two days of 500 or 1000 mg/kg B

  14. Gemfibrozil pretreatment affecting antioxidant defense system and inflammatory, but not Nrf-2 signaling pathways resulted in female neuroprotection and male neurotoxicity in the rat models of global cerebral ischemia-reperfusion.

    Science.gov (United States)

    Mohagheghi, Fatemeh; Khalaj, Leila; Ahmadiani, Abolhassan; Rahmani, Behrouz

    2013-04-01

    Two important pathophysiological mechanisms involved during cerebral ischemia are oxidative stress and inflammation. In pathological conditions such as brain ischemia the ability of free radicals production is greater than that of elimination by endogenous antioxidative systems, so brain is highly injured due to oxidation and neuroinflammation. Fibrates as peroxisome proliferator-activated receptor (PPAR)-α ligands, are reported to have antioxidant and anti-inflammatory actions. In this study, gemfibrozil, a fibrate is investigated for its therapeutic potential against global cerebral ischemia-reperfusion (I/R) injury of male and female rats. This study particularly has focused on inflammatory and antioxidant signaling pathways, such as nuclear factor erythroid-related factor (Nrf)-2, as well as the activity of some endogenous antioxidant agents. It was found that pretreatment of animals with gemfibrozil prior to I/R resulted in a sexually dimorphic outcome. Within females it proved to be protective, modulating inflammatory factors and inducing antioxidant defense system including superoxide dismutase (SOD), catalase, as well as glutathione level. However, Nrf-2 signaling pathway was not affected. It also decreased malondialdehyde level as an index of lipid peroxidation. In contrast, gemfibrozil pretreatment was toxic to males, enhancing the expression of inflammatory factors such as tumor necrosis factor-α, nuclear factor-κB, and cyclooxygenase-2, and decreasing Nrf-2 expression and SOD activity, leading to hippocampal neurodegeneration. Considering that gemfibrozil is a commonly used anti-hyperlipidemic agent in clinic, undoubtedly more investigations are crucial to exactly unravel its sex-dependent neuroprotective/neurodegenerative potential.

  15. Antioxidant and Antifibrotic Effect of a Herbal Formulation In Vitro and in the Experimental Andropause via Nrf2/HO-1 Signaling Pathway

    Directory of Open Access Journals (Sweden)

    Woong Jin Bae

    2017-01-01

    Full Text Available The Korean herbal formulation Ojayeonjonghwan is used for improving late-onset hypogonadism (LOH symptoms such as erectile dysfunction (ED. A previous research suggested that a modified Ojayeonjonghwan (KH-204 could be used as an alternative to the treatment for ED. The pharmacological effects were examined in different conditions, including in vitro and in vivo. We measured the survival rate of TM3 Leydig cells under the oxidative stress condition. The s.c. injection of leuprorelin was used to induce androgen deprivation. We measured serum testosterone levels, oxidative stress, and apoptosis. The results of the treatment by KH-204 (1 preserved TM3 cells from oxidative stress by improving the expression of nuclear factor erythroid 2-related factor 2 (Nrf2/heme oxygenase-1 (HO-1; (2 lowered the expression of transforming growth factor-beta (TGF-β 1/SMAD; (3 increased the average of serum testosterone in androgen-deprived male rats; (4 kept the activation of spermatogenesis; (5 upgraded the contents of 8-hydroxy-20-deoxyguanosine (8-OHdG and degraded the contents of superoxide dismutase (SOD; and (6 reduced apoptosis. We studied that KH-204 improved testicular dysfunction in LOH. It is likely, at least in part, to degrade oxidative stress through the Nrf2/HO-1 pathway. These findings may offer credible evidences for the use of new alternative therapies to treat LOH.

  16. Bardoxolone methyl (BARD) ameliorates aristolochic acid (AA)-induced acute kidney injury through Nrf2 pathway.

    Science.gov (United States)

    Wu, Juan; Liu, Xinhui; Fan, Jinjin; Chen, Wenfang; Wang, Juan; Zeng, Youjia; Feng, Xiaorang; Yu, Xueqing; Yang, Xiao

    2014-04-06

    Bardoxolone methyl (BARD) is an antioxidant modulator that acts through induction of the nuclear factor erythroid 2-related factor 2 (Nrf2) signaling pathway. This study aimed to investigate the role of BARD in protecting kidneys from aristolochic acid (AA)-induced acute kidney injury (AKI). Male C57BL/6 mice received intraperitoneal (i.p.) injections of aristolochic acid I (AAI) (5mg/kg/day) for 5 days to produce acute AA nephropathy (AAN) model. BARD (10mg/kg/day, i.p.) was applied for 7 consecutive days, starting 2 days prior to AAI administration. The mice in the AA group showed AKI as evidenced by worsening kidney function evaluated by blood urea nitrogen (BUN) and serum creatinine (SCr) levels, and severe tubulointerstitial injury marked by massive tubule necrosis in kidney tissues. BARD significantly reduced BUN and SCr levels which were elevated by AAI. Additionally, AAI-induced histopathological renal damage was ameliorated by BARD. Furthermore, the expression of Nrf2 was reduced, and its repressor Kelch-like ECH-associated protein 1 (Keap1) was increased significantly, whereas heme oxygenase-1 (HO-1) was upregulated and NAD(P)H quinone oxidoreductase-1 (NQO1) was barely increased in the cytoplasm of tubules in kidneys after treatment with AAI. BARD significantly upregulated renal Nrf2, NQO1 and HO-1 expression and downregulated Keap1 expression compared with those in the AA group. Moreover, it was found that Nrf2 was expressed both in the cytoplasm and nuclear of glomeruli and tubules, whereas NQO1 and HO-1 were localized in the cytoplasm of tubules only. In conclusion, AA-induced acute renal injury was associated with impaired Nrf2 activation and expression of its downstream target genes in renal tissues. BARD prevented renal damage induced by AAI, and this renoprotective effect may be exerted by activating the Nrf2 signaling pathway and increasing expression of the downstream target genes. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  17. Gold-quercetin nanoparticles prevent metabolic endotoxemia-induced kidney injury by regulating TLR4/NF-κB signaling and Nrf2 pathway in high fat diet fed mice.

    Science.gov (United States)

    Xu, Min-Xuan; Wang, Ming; Yang, Wei-Wei

    2017-01-01

    High-fat diet-induced metabolic syndrome followed by chronic kidney disease caused by intestinal endotoxemia have received extensive attention. Toll-like receptor 4 (TLR4)/nuclear factor-kappa B (NF-κB) and oxidative stress-related Nrf2/Keap1 were regarded as the key target points involved in metabolic inflammation and kidney injury. However, the molecular mechanism of interaction between TLR4/NF-κB and Nrf2 activation in high-fat diet-induced renal injury is not absolutely understood. Quercetin, a natural product, has been reported to possess antitumor and anti-inflammatory effects. In this regard, this study attempted to prepare poly(d,l-lactide- co -glycolide)-loaded gold nanoparticles precipitated with quercetin (GQ) to investigate the anti-inflammatory and anti-oxidative stress effects in high-fat diet-induced kidney failure. For this study, C57BL/6 mice fed fat-rich fodder were used as the metabolic syndrome model to evaluate the protective effects of GQ on kidney injury and to determine whether TLR4/NF-κB and Nrf2 pathways were associated with the process. Moreover, histological examinations, enzyme-linked immunosorbent assay, Western blot, and basic blood tests and systemic inflammation-related indicators were used to investigate the inhibitory effects of GQ and underlying molecular mechanism by which it may reduce renal injury. Of note, podocyte injury was found to participate in endotoxin-stimulated inflammatory response. TLR4/NF-κB and Nrf2 pathways were upregulated with high-fat diet intake in mice, resulting in reduction of superoxide dismutase activity and increase in superoxide radical, H 2 O 2 , malondialdehyde, XO, XDH, and XO/XDH ratio. In addition, upregulation of TLR4/NF-κB and oxidative stress by endotoxin were observed in vitro, which were suppressed by GQ administration, ultimately alleviating podocyte injury. These findings indicated that GQ could restore the metabolic disorders caused by high-fat diet, which suppresses insulin

  18. Dwindling of cardio damaging effect of isoproterenol by Punica granatum L. peel extract involve activation of nitric oxide-mediated Nrf2/ARE signaling pathway and apoptosis inhibition.

    Science.gov (United States)

    Gupta, Mahesh; Sharma, Pallavi; Mazumder, Arindam Ghosh; Patial, Vikram; Singh, Damanpreet

    2015-09-09

    Punica granatum L. (Punicaceae) peel is often considered as a food waste in-spite of its high bioactive metabolite composition. Primarily it is rich in therapeutically active phenolics that act on multiple cellular sites, through diverse mechanisms. Hence, the present study was envisaged to investigate the effect of standardised peel extract of P. granatum against isoproterenol (ISO)-induced myocardial infarction (MI). ISO administration at a dose of 150 mg/kg; s.c., twice at 24 h interval resulted in electrocardiographic abnormalities with increased heart weight and myocardial tissue damage signifying MI. Pretreatment with the extract at 50, 100 and 200 mg/kg; p.o., for 21 days prior to ISO intoxication (30 min prior to intoxication on day 22 and 23) attenuated the observed changes, along with increased myocardial tissue superoxide dismutase activity, reduced glutathione and nitrite levels, and decreased lipid peroxidation. The extract treated groups also showed reduced serum marker enzymes of MI, showing maximum effect at highest tested dose. Immunohistochemical studies revealed increased myocardial expression of nuclear factor erythroid 2-related factor 2 (Nrf2), endothelial nitric oxide synthase (eNOS) and Bcl-2 proteins in the extract treated groups with decreased Bax expression. From the results it can be concluded that the extract pretreatment prevents ISO-induced MI through increased myocardial expression of eNOS, leading to nitric oxide-mediated Nrf2 activation, thus upregulating antioxidant mechanisms, along with inhibition of apoptosis. Copyright © 2015 Elsevier Inc. All rights reserved.

  19. Copper exposure induces oxidative injury, disturbs the antioxidant system and changes the Nrf2/ARE (CuZnSOD) signaling in the fish brain: Protective effects of myo-inositol

    International Nuclear Information System (INIS)

    Jiang, Wei-Dan; Liu, Yang; Hu, Kai; Jiang, Jun; Li, Shu-Hong; Feng, Lin; Zhou, Xiao-Qiu

    2014-01-01

    Highlights: • Cu exposure increased ROS production, lipid and protein oxidation of fish brain. • Cu exposure caused depletion of some antioxidants in the brain of fish. • Cu exposure up-regulated mRNA levels of brain CuZnSOD, GPx1a and GR genes in fish. • Cu exposure induced Nrf2 nuclear translocation and binding to ARE in fish brain. • Myo-inositol can inhibit Cu-induced toxic effects in the brain of fish. - Abstract: The brain is the center of the nervous system in all vertebrates, and homeostasis of the brain is crucial for fish survival. Copper (Cu) is essential for normal cellular processes in most eukaryotic organisms but is toxic in excess. Although Cu is indicated as a potent neurotoxicant, information regarding its threat to fish brain and underlying mechanisms is still scarce. In accordance, the objective of this study was to assess the effects and the potential mechanism of Cu toxicity by evaluating brain oxidative status, the enzymatic and mRNA levels of antioxidant genes, as well as the Nrf2/ARE signaling in the brain of fish after Cu exposure. The protective effects of myo-inositol (MI) against subsequent Cu exposure were also investigated. The results indicate that induction of oxidative stress by Cu is shown by increases in brain ROS production, lipid peroxidation and protein oxidation, which are accompanied by depletions of antioxidants, including total superoxide dismutase (T-SOD), CuZnSOD, glutathione-S-transferase (GST) and glutathione reductase (GR) activities and glutathione (GSH) content. Cu exposure increased the catalase (CAT) and glutathione peroxidase (GPx) activities. Further molecular results showed that Cu exposure up-regulated CuZnSOD, GPx1a and GR mRNA levels, suggesting an adaptive mechanism against stress. Moreover, Cu exposure increased fish brain Nrf2 nuclear accumulation and increased its ability of binding to ARE (CuZnSOD), which supported the increased CuZnSOD mRNA levels. In addition, Cu exposure caused increases of

  20. Copper exposure induces oxidative injury, disturbs the antioxidant system and changes the Nrf2/ARE (CuZnSOD) signaling in the fish brain: Protective effects of myo-inositol

    Energy Technology Data Exchange (ETDEWEB)

    Jiang, Wei-Dan; Liu, Yang [Animal Nutrition Institute, Sichuan Agricultural University, Chengdu 611130, Sichuan (China); Fish Nutrition and Safety Production University Key Laboratory of Sichuan Province, Sichuan Agricultural University, Chengdu 611130, Sichuan (China); Key Laboratory for Animal Disease-Resistance Nutrition of China Ministry of Education, Sichuan Agricultural University, Chengdu 611130, Sichuan (China); Hu, Kai [Animal Nutrition Institute, Sichuan Agricultural University, Chengdu 611130, Sichuan (China); Jiang, Jun [Animal Nutrition Institute, Sichuan Agricultural University, Chengdu 611130, Sichuan (China); Fish Nutrition and Safety Production University Key Laboratory of Sichuan Province, Sichuan Agricultural University, Chengdu 611130, Sichuan (China); Key Laboratory for Animal Disease-Resistance Nutrition of China Ministry of Education, Sichuan Agricultural University, Chengdu 611130, Sichuan (China); Li, Shu-Hong [Animal Nutrition Institute, Sichuan Agricultural University, Chengdu 611130, Sichuan (China); Feng, Lin, E-mail: fenglin@sicau.edu.cn [Animal Nutrition Institute, Sichuan Agricultural University, Chengdu 611130, Sichuan (China); Fish Nutrition and Safety Production University Key Laboratory of Sichuan Province, Sichuan Agricultural University, Chengdu 611130, Sichuan (China); Key Laboratory for Animal Disease-Resistance Nutrition of China Ministry of Education, Sichuan Agricultural University, Chengdu 611130, Sichuan (China); Zhou, Xiao-Qiu, E-mail: xqzhouqq@tom.com [Animal Nutrition Institute, Sichuan Agricultural University, Chengdu 611130, Sichuan (China); Fish Nutrition and Safety Production University Key Laboratory of Sichuan Province, Sichuan Agricultural University, Chengdu 611130, Sichuan (China); Key Laboratory for Animal Disease-Resistance Nutrition of China Ministry of Education, Sichuan Agricultural University, Chengdu 611130, Sichuan (China)

    2014-10-15

    Highlights: • Cu exposure increased ROS production, lipid and protein oxidation of fish brain. • Cu exposure caused depletion of some antioxidants in the brain of fish. • Cu exposure up-regulated mRNA levels of brain CuZnSOD, GPx1a and GR genes in fish. • Cu exposure induced Nrf2 nuclear translocation and binding to ARE in fish brain. • Myo-inositol can inhibit Cu-induced toxic effects in the brain of fish. - Abstract: The brain is the center of the nervous system in all vertebrates, and homeostasis of the brain is crucial for fish survival. Copper (Cu) is essential for normal cellular processes in most eukaryotic organisms but is toxic in excess. Although Cu is indicated as a potent neurotoxicant, information regarding its threat to fish brain and underlying mechanisms is still scarce. In accordance, the objective of this study was to assess the effects and the potential mechanism of Cu toxicity by evaluating brain oxidative status, the enzymatic and mRNA levels of antioxidant genes, as well as the Nrf2/ARE signaling in the brain of fish after Cu exposure. The protective effects of myo-inositol (MI) against subsequent Cu exposure were also investigated. The results indicate that induction of oxidative stress by Cu is shown by increases in brain ROS production, lipid peroxidation and protein oxidation, which are accompanied by depletions of antioxidants, including total superoxide dismutase (T-SOD), CuZnSOD, glutathione-S-transferase (GST) and glutathione reductase (GR) activities and glutathione (GSH) content. Cu exposure increased the catalase (CAT) and glutathione peroxidase (GPx) activities. Further molecular results showed that Cu exposure up-regulated CuZnSOD, GPx1a and GR mRNA levels, suggesting an adaptive mechanism against stress. Moreover, Cu exposure increased fish brain Nrf2 nuclear accumulation and increased its ability of binding to ARE (CuZnSOD), which supported the increased CuZnSOD mRNA levels. In addition, Cu exposure caused increases of

  1. Activation of apoptosis signal-regulating kinase 1 is a key factor in paraquat-induced cell death : modulation by the Nrf2/Trx axis

    NARCIS (Netherlands)

    Niso-Santano, Mireia; González-Polo, Rosa A; Bravo-San Pedro, José M; Gómez-Sánchez, Rubén; Lastres-Becker, Isabel; Ortiz-Ortiz, Miguel A; Soler, Germán; Morán, José M; Cuadrado, Antonio; Fuentes, José M

    2010-01-01

    Although oxidative stress is fundamental to the etiopathology of Parkinson disease, the signaling molecules involved in transduction after oxidant exposure to cell death are ill-defined, thus making it difficult to identify molecular targets of therapeutic relevance. We have addressed this question

  2. Induction of Mrp3 and Mrp4 transporters during acetaminophen hepatotoxicity is dependent on Nrf2

    International Nuclear Information System (INIS)

    Aleksunes, Lauren M.; Slitt, Angela L.; Maher, Jonathan M.; Augustine, Lisa M.; Goedken, Michael J.; Chan, Jefferson Y.; Cherrington, Nathan J.; Klaassen, Curtis D.; Manautou, Jose E.

    2008-01-01

    The transcription factor NFE2-related factor 2 (Nrf2) mediates detoxification and antioxidant gene transcription following electrophile exposure and oxidative stress. Mice deficient in Nrf2 (Nrf2-null) are highly susceptible to acetaminophen (APAP) hepatotoxicity and exhibit lower basal and inducible expression of cytoprotective genes, including NADPH quinone oxidoreductase 1 (Nqo1) and glutamate cysteine ligase (catalytic subunit, or Gclc). Administration of toxic APAP doses to C57BL/6J mice generates electrophilic stress and subsequently increases levels of hepatic Nqo1, Gclc and the efflux multidrug resistance-associated protein transporters 1-4 (Mrp1-4). It was hypothesized that induction of hepatic Mrp1-4 expression following APAP is Nrf2 dependent. Plasma and livers from wild-type (WT) and Nrf2-null mice were collected 4, 24 and 48 h after APAP. As expected, hepatotoxicity was greater in Nrf2-null compared to WT mice. Gene and protein expression of Mrp1-4 and the Nrf2 targets, Nqo1 and Gclc, was measured. Induction of Nqo1 and Gclc mRNA and protein after APAP was dependent on Nrf2 expression. Similarly, APAP treatment increased hepatic Mrp3 and Mrp4 mRNA and protein in WT, but not Nrf2-null mice. Mrp1 was induced in both genotypes after APAP, suggesting that elevated expression of this transporter was independent of Nrf2. Mrp2 was not induced in either genotype at the mRNA or protein levels. These results show that Nrf2 mediates induction of Mrp3 and Mrp4 after APAP but does not affect Mrp1 or Mrp2. Thus coordinated regulation of detoxification enzymes and transporters by Nrf2 during APAP hepatotoxicity is a mechanism by which hepatocytes may limit intracellular accumulation of potentially toxic chemicals

  3. Expression of Nrf2 in neurodegenerative diseases.

    Science.gov (United States)

    Ramsey, Chenere P; Glass, Charles A; Montgomery, Marshall B; Lindl, Kathryn A; Ritson, Gillian P; Chia, Luis A; Hamilton, Ronald L; Chu, Charleen T; Jordan-Sciutto, Kelly L

    2007-01-01

    In response to oxidative stress, the nuclear factor E2-related factor 2 (Nrf2) transcription factor translocates from the cytoplasm into the nucleus and transactivates expression of genes with antioxidant activity. Despite this cellular mechanism, oxidative damage is abundant in Alzheimer and Parkinson disease (AD and PD). To investigate mechanisms by which Nrf2 activity may be aberrant or insufficient in neurodegenerative conditions, we assessed Nrf2 localization in affected brain regions of AD, Lewy body variant of AD (LBVAD), and PD. By immunohistochemistry, Nrf2 is expressed in both the nucleus and the cytoplasm of neurons in normal hippocampi with predominant expression in the nucleus. In AD and LBVAD, Nrf2 was predominantly cytoplasmic in hippocampal neurons and was not a major component of beta amyloid plaques or neurofibrillary tangles. By immunoblotting, we observed a significant decrease in nuclear Nrf2 levels in AD cases. In contrast, Nrf2 was strongly nuclear in PD nigral neurons but cytoplasmic in substantia nigra of normal, AD, and LBVAD cases. These findings suggest that Nrf2-mediated transcription is not induced in neurons in AD despite the presence of oxidative stress. In PD, nuclear localization of Nrf2 is strongly induced, but this response may be insufficient to protect neurons from degeneration.

  4. Nrf2: bane or blessing in cancer?

    Science.gov (United States)

    Xiang, MingJun; Namani, Akhileshwar; Wu, ShiJun; Wang, XiaoLi

    2014-08-01

    The Kelch-like ECH-associated protein 1 (Keap1)-nuclear factor-E2-related factor 2 (Nrf2)-antioxidant response element pathway serves a major function in endogenous cytoprotection in normal cells. Nrf2 is a transcription factor that mainly regulates the expression of a wide array of genes that produce the antioxidants and other proteins responsible for the detoxification of xenobiotics and reactive oxygen species. Nrf2 mediates the chemoprevention of cancer in normal cells. Growing body of evidence suggests that Nrf2 is not only involved in the chemoprevention of normal cells but also promotes the growth of cancer cells. However, the mechanism underlying the function of Nrf2 in oncogenesis and tumor protection in cancer cells remains unclear and thus requires further study. This review aims to rationalize the existing functions of Nrf2 in chemoprevention and tumorigenesis, as well as the somatic mutations of Nrf2 and Keap1 in cancer and Nrf2 cross talk with miRNAs. This review also discusses the future challenges in Nrf2 research.

  5. Gold-quercetin nanoparticles prevent metabolic endotoxemia-induced kidney injury by regulating TLR4/NF-kB signaling and Nrf2 pathway in high fat diet fed mice

    Directory of Open Access Journals (Sweden)

    Xu MX

    2017-01-01

    Full Text Available Min-Xuan Xu,1,2,* Ming Wang,3,* Wei-Wei Yang4 1Chongqing Key Laboratory of Medicinal Resources in the Three Gorges Reservoir Region, School of Biological and Chemical Engineering, Chongqing University of Education, Chongqing, 2College of Engineering and Applied Sciences, Nanjing University, Nanjing, 3Department of Urology, The Second Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou, Zhejiang, 4Department of Nephrology, Huai’an First People’s Hospital, Nanjing Medical University, Jiangsu, People’s Republic of China *These authors contributed equally to this work Abstract: High-fat diet-induced metabolic syndrome followed by chronic kidney disease caused by intestinal endotoxemia have received extensive attention. Toll-like receptor 4 (TLR4/nuclear factor-kappa B (NF-κB and oxidative stress-related Nrf2/Keap1 were regarded as the key target points involved in metabolic inflammation and kidney injury. However, the molecular mechanism of interaction between TLR4/NF-κB and Nrf2 activation in high-fat diet-induced renal injury is not absolutely understood. Quercetin, a natural product, has been reported to possess antitumor and anti-inflammatory effects. In this regard, this study attempted to prepare poly(d,l-lactide-co-glycolide-loaded gold nanoparticles precipitated with quercetin (GQ to investigate the anti-inflammatory and anti-oxidative stress effects in high-fat diet-induced kidney failure. For this study, C57BL/6 mice fed fat-rich fodder were used as the metabolic syndrome model to evaluate the protective effects of GQ on kidney injury and to determine whether TLR4/NF-κB and Nrf2 pathways were associated with the process. Moreover, histological examinations, enzyme-linked immunosorbent assay, Western blot, and basic blood tests and systemic inflammation-related indicators were used to investigate the inhibitory effects of GQ and underlying molecular mechanism by which it may reduce renal injury. Of note, podocyte

  6. Supplementation of Superfine Powder Prepared from Chaenomeles speciosa Fruit Increases Endurance Capacity in Rats via Antioxidant and Nrf2/ARE Signaling Pathway

    Directory of Open Access Journals (Sweden)

    Ka Chen

    2014-01-01

    Full Text Available Chaenomeles speciosa fruit is a traditional herb medicine widely used in China. In this study, superfine powder of C. speciosa fruit (SCE, ground by supersonic nitrogen airflow at −140°C, was investigated to assess its in vitro antioxidant activity and in vivo antiphysical fatigue activity. SCE was homogenous (d<10 μm and rich in antioxidants like polyphenols, saponins, oleanolic acid, ursolic acid, ascorbic acid, and SOD. According to the in vitro experiments, SCE displayed promising antioxidant activity with powerful FARP, SC-DPPH, and SC-SAR activities. According to the in vivo experiments, rats supplemented with SCE had prolonged exhaustive swimming time (57% compared to the nonsupplemented rats. Meanwhile, compared to the nonsupplemented rats, the SCE-supplemented rats had higher levels of blood glucose and liver and muscular glycogen and lower levels of LA and BUN. Lower MDA, higher antioxidant enzymes (SOD, CAT, and GSH-Px activities, and upregulated Nrf2/ARE mediated antioxidant enzymes (HO-1, Trx, GCLM, and GCLC expression were also detected in the supplemented group. This study indicates that SCE is a potent antioxidant and antifatigue agent, and SCE could be a promising raw material for the food and pharmaceutical industries.

  7. Novel function of transcription factor Nrf2 as an inhibitor of RON tyrosine kinase receptor-mediated cancer cell invasion.

    Science.gov (United States)

    Thangasamy, Amalraj; Rogge, Jessica; Krishnegowda, Naveen K; Freeman, James W; Ammanamanchi, Sudhakar

    2011-09-16

    Recepteur d' origine nantais (RON), a tyrosine kinase receptor, is aberrantly expressed in human tumors and promotes cancer cell invasion. RON receptor activation is also associated with resistance to tamoxifen treatment in breast cancer cells. Nrf2 is a positive regulator of cytoprotective genes. Using chromatin immunoprecipitation (ChIP) and site-directed mutagenesis studies of the RON promoter, we identified Nrf2 as a negative regulator of RON gene expression. High Nrf2 and low RON expression was observed in normal mammary tissue whereas high RON and low or undetectable expression of Nrf2 was observed in breast tumors. The Nrf2 inducer sulforaphane (SFN) as well as ectopic Nrf2 expression or knock-down of the Nrf2 negative regulator keap1, which stabilizes Nrf2, inhibited RON expression and invasion of carcinoma cells. Consequently, our studies identified a novel functional role for Nrf2 as a "repressor" and RON kinase as a molecular target of SFN, which mediates the anti-tumor effects of SFN. These results are not limited to breast cancer cells since the Nrf2 inducer SFN stabilized Nrf2 and inhibited RON expression in carcinoma cells from various tumor types.

  8. Peracetylated hydroxytyrosol, a new hydroxytyrosol derivate, attenuates LPS-induced inflammatory response in murine peritoneal macrophages via regulation of non-canonical inflammasome, Nrf2/HO1 and JAK/STAT signaling pathways.

    Science.gov (United States)

    Montoya, Tatiana; Aparicio-Soto, Marina; Castejón, María Luisa; Rosillo, María Ángeles; Sánchez-Hidalgo, Marina; Begines, Paloma; Fernández-Bolaños, José G; Alarcón-de-la-Lastra, Catalina

    2018-03-18

    The present study was designed to investigate the anti-inflammatory effects of a new derivative of hydroxytyrosol (HTy), peracetylated hydroxytyrosol (Per-HTy), compared with its parent, HTy, on lipopolysaccharide (LPS)-stimulated murine macrophages as well as potential signaling pathways involved. In particular, we attempted to characterize the role of the inflammasome underlying Per-HTy possible anti-inflammatory effects. Isolated murine peritoneal macrophages were treated with HTy or its derivative in the presence or absence of LPS (5 μg/ml) for 18 h. Cell viability was determined using sulforhodamine B (SRB) assay. Nitric oxide (NO) production was analyzed by Griess method. Production of pro-inflammatory cytokines was evaluated by enzyme-linked immunosorbent assay (ELISA) and inducible nitric oxide synthase (iNOS) and cyclooxygenase (COX)-2, janus kinase/signal transducer and activator of transcription (JAK/STAT) pathway (STAT3), haem oxigenase 1 (HO1), nuclear factor (erythroid-derived 2)-like 2 (Nrf2) expression and mitogen-activated protein kinases (MAPKs) activation was determined by Western blot. Per-HTy significantly reduced the levels of NO and pro-inflammatory cytokines as well as both COX-2 and iNOS expressions. Furthermore, Per-HTy treatment inhibited STAT3 and increased Nrf2 and HO1 protein levels in murine macrophages exposed to LPS. In addition, Per-HTy anti-inflammatory activity was related with an inhibition of non-canonical nucleotide binding domain (NOD)-like receptor (NLRP3) inflammasome pathways by decreasing pro-inflammatory interleukin (IL)-1β and IL-18 cytokine levels as consequence of regulation of cleaved caspase-11 enzyme. These results support that this new HTy derivative may offer a new promising nutraceutical therapeutic strategy in the management of inflammatory-related pathologies. Copyright © 2018. Published by Elsevier Inc.

  9. Cytoprotective Role of Nrf2 in Electrical Pulse Stimulated C2C12 Myotube.

    Directory of Open Access Journals (Sweden)

    Masaki Horie

    Full Text Available Regular physical exercise is central to a healthy lifestyle. However, exercise-related muscle contraction can induce reactive oxygen species and reactive nitrogen species (ROS/RNS production in skeletal muscle. The nuclear factor-E2-related factor-2 (Nrf2 transcription factor is a cellular sensor for oxidative stress. Regulation of nuclear Nrf2 signaling regulates antioxidant responses and protects organ structure and function. However, the role of Nrf2 in exercise- or contraction-induced ROS/RNS production in skeletal muscle is not clear. In this study, using differentiated C2C12 cells and electrical pulse stimulation (EPS of muscle contraction, we explored whether Nrf2 plays a role in the skeletal muscle response to muscle contraction-induced ROS/RNS. We found that EPS (40 V, 1 Hz, 2 ms stimulated ROS/RNS accumulation and Nrf2 activation. We also showed that expression of NQO1, HO-1 and GCLM increased after EPS-induced muscle contraction and was remarkably suppressed in cells with Nrf2 knockdown. We also found that the antioxidant N-acetylcysteine (NAC significantly attenuated Nrf2 activation after EPS, whereas the nitric oxide synthetase inhibitor Nω-nitro-L-arginine methyl ester (L-NAME did not. Furthermore, Nrf2 knockdown after EPS markedly decreased ROS/RNS redox potential and cell viability and increased expression of the apoptosis marker Annexin V in C2C12 myotubes. These results indicate that Nrf2 activation and expression of Nrf2 regulated-genes protected muscle against the increased ROS caused by EPS-induced muscle contraction. Thus, our findings suggest that Nrf2 may be a key factor for preservation of muscle function during muscle contraction.

  10. Kalopanacis Cortex extract-capped gold nanoparticles activate NRF2 signaling and ameliorate damage in human neuronal SH-SY5Y cells exposed to oxygen–glucose deprivation and reoxygenation

    Directory of Open Access Journals (Sweden)

    Park SY

    2017-06-01

    53, p21, and B-cell lymphoma 2-associated X protein were reversed by KC-GNs. The KC-GN-mediated protection against OGD/R-induced neurotoxicity was diminished by NRF2 and heme oxygenase-1 gene knockdowns. Collectively, these results suggested that KC-GNs exerted strong neuroprotective effects on human neuronal cells, which might be attributed to the attenuation of OGD/R-induced neuronal cell injury through the NRF2 signaling pathway. Keywords: gold nanoparticle, Kalopanacis Cortex, oxygen–glucose deprivation, neuroprotection, NRF2 

  11. Asbestos Induces Oxidative Stress and Activation of Nrf2 Signaling in Murine Macrophages: Chemopreventive Role of the Synthetic Lignan Secoisolariciresinol Diglucoside (LGM2605

    Directory of Open Access Journals (Sweden)

    Ralph A. Pietrofesa

    2016-03-01

    Full Text Available The interaction of asbestos fibers with macrophages generates harmful reactive oxygen species (ROS and subsequent oxidative cell damage that are key processes linked to malignancy. Secoisolariciresinol diglucoside (SDG is a non-toxic, flaxseed-derived pluripotent compound that has antioxidant properties and may thus function as a chemopreventive agent for asbestos-induced mesothelioma. We thus evaluated synthetic SDG (LGM2605 in asbestos-exposed, elicited murine peritoneal macrophages as an in vitro model of tissue phagocytic response to the presence of asbestos in the pleural space. Murine peritoneal macrophages (MFs were exposed to crocidolite asbestos fibers (20 µg/cm2 and evaluated at various times post exposure for cytotoxicity, ROS generation, malondialdehyde (MDA, and levels of 8-iso Prostaglandin F2α (8-isoP. We then evaluated the ability of LGM2605 to mitigate asbestos-induced oxidative stress by administering LGM2605 (50 µM 4-h prior to asbestos exposure. We observed a significant (p < 0.0001, time-dependent increase in asbestos-induced cytotoxicity, ROS generation, and the release of MDA and 8-iso Prostaglandin F2α, markers of lipid peroxidation, which increased linearly over time. LGM2605 treatment significantly (p < 0.0001 reduced asbestos-induced cytotoxicity and ROS generation, while decreasing levels of MDA and 8-isoP by 71%–88% and 41%–73%, respectively. Importantly, exposure to asbestos fibers induced cell protective defenses, such as cellular Nrf2 activation and the expression of phase II antioxidant enzymes, HO-1 and Nqo1 that were further enhanced by LGM2605 treatment. LGM2605 boosted antioxidant defenses, as well as reduced asbestos-induced ROS generation and markers of oxidative stress in murine peritoneal macrophages, supporting its possible use as a chemoprevention agent in the development of asbestos-induced malignant mesothelioma.

  12. Nrf2 and Keap1 Abnormalities in 104 Lung Adenocarcinoma Cases and Association with Clinicopathologic Features

    Directory of Open Access Journals (Sweden)

    Yu XIAO

    2018-03-01

    correlated with PFS and OS of EGFR-TKIs. Therefore, Nrf2 may be a biomarker for predicting response of EGFR-TKIs and a potential target for overcoming resistance of EGFR-TKIs.

  13. Disruption of Nrf2, a key inducer of antioxidant defenses, attenuates ApoE-mediated atherosclerosis in mice.

    Directory of Open Access Journals (Sweden)

    Thomas E Sussan

    Full Text Available BACKGROUND: Oxidative stress and inflammation are two critical factors that drive the formation of plaques in atherosclerosis. Nrf2 is a redox-sensitive transcription factor that upregulates a battery of antioxidative genes and cytoprotective enzymes that constitute the cellular response to oxidative stress. Our previous studies have shown that disruption of Nrf2 in mice (Nrf2(-/- causes increased susceptibility to pulmonary emphysema, asthma and sepsis due to increased oxidative stress and inflammation. Here we have tested the hypothesis that disruption of Nrf2 in mice causes increased atherosclerosis. PRINCIPAL FINDINGS: To investigate the role of Nrf2 in the development of atherosclerosis, we crossed Nrf2(-/- mice with apoliporotein E-deficient (ApoE(-/- mice. ApoE(-/- and ApoE(-/-Nrf2(-/- mice were fed an atherogenic diet for 20 weeks, and plaque area was assessed in the aortas. Surprisingly, ApoE(-/-Nrf2(-/- mice exhibited significantly smaller plaque area than ApoE(-/- controls (11.5% vs 29.5%. This decrease in plaque area observed in ApoE(-/-Nrf2(-/- mice was associated with a significant decrease in uptake of modified low density lipoproteins (AcLDL by isolated macrophages from ApoE(-/-Nrf2(-/- mice. Furthermore, atherosclerotic plaques and isolated macrophages from ApoE(-/-Nrf2(-/- mice exhibited decreased expression of the scavenger receptor CD36. CONCLUSIONS: Nrf2 is pro-atherogenic in mice, despite its antioxidative function. The net pro-atherogenic effect of Nrf2 may be mediated via positive regulation of CD36. Our data demonstrates that the potential effects of Nrf2-targeted therapies on cardiovascular disease need to be investigated.

  14. Natural product-derived pharmacological modulators of Nrf2/ARE pathway for chronic diseases.

    Science.gov (United States)

    Kumar, Hemant; Kim, In-Su; More, Sandeep Vasant; Kim, Byung-Wook; Choi, Dong-Kug

    2014-01-01

    Covering: 2000 to 2013. Oxidative stress is the central component of chronic diseases. The nuclear factor erythroid 2-related factor 2/antioxidant response element (Nrf2/ARE) pathway is vital in the up-regulation of cytoprotective genes and enzymes in response to oxidative stress and treatment with certain dietary phytochemicals. Herein, we classify bioactive compounds derived from natural products that are Nrf2/ARE pathway activators and recapitulate the molecular mechanisms for inducing Nrf2 to provide favorable effects in experimental models of chronic diseases. Moreover, pharmacological inhibition of Nrf2 signalling has emerged as promising strategy against multi-drug resistance thereby improving the treatment efficacy. We have also enlisted natural product-derived inhibitors of Nrf2/ARE pathway.

  15. Hericium erinaceus Inhibits TNF-α-Induced Angiogenesis and ROS Generation through Suppression of MMP-9/NF-κB Signaling and Activation of Nrf2-Mediated Antioxidant Genes in Human EA.hy926 Endothelial Cells

    Directory of Open Access Journals (Sweden)

    Hebron C. Chang

    2016-01-01

    Full Text Available Hericium erinaceus (HE is an edible mushroom that has been shown to exhibit anticancer and anti-inflammatory activities. We investigated the antiangiogenic and antioxidant potentials of ethanol extracts of HE in human endothelial (EA.hy926 cells upon tumor necrosis factor-α- (TNF-α- stimulation (10 ng/mL. The underlying molecular mechanisms behind the pharmacological efficacies were elucidated. We found that noncytotoxic concentrations of HE (50–200 μg/mL significantly inhibited TNF-α-induced migration/invasion and capillary-like tube formation of endothelial cells. HE treatment suppressed TNF-α-induced activity and/or overexpression of matrix metalloproteinase-9 (MMP-9 and intercellular adhesion molecule-1 (ICAM-1. Furthermore, HE downregulated TNF-α-induced nuclear translocation and transcriptional activation of nuclear factor-κB (NF-κB followed by suppression of I-κB (inhibitor-κB degradation. Data from fluorescence microscopy illustrated that increased intracellular ROS production upon TNF-α-stimulation was remarkably inhibited by HE pretreatment in a dose-dependent manner. Notably, HE triggered antioxidant gene expressions of heme oxygenase-1 (HO-1, γ-glutamylcysteine synthetase (γ-GCLC, and glutathione levels, which may contribute to inhibition of ROS. Increased antioxidant status was associated with upregulated nuclear translocation and transcriptional activation of NF-E2 related factor-2 (Nrf2 in HE treated cells. Our findings conclude that antiangiogenic and anti-inflammatory activities of H. erinaceus may contribute to its anticancer property through modulation of MMP-9/NF-κB and Nrf2-antioxidant signaling pathways.

  16. Hericium erinaceus Inhibits TNF-α-Induced Angiogenesis and ROS Generation through Suppression of MMP-9/NF-κB Signaling and Activation of Nrf2-Mediated Antioxidant Genes in Human EA.hy926 Endothelial Cells.

    Science.gov (United States)

    Chang, Hebron C; Yang, Hsin-Ling; Pan, Jih-Hao; Korivi, Mallikarjuna; Pan, Jian-You; Hsieh, Meng-Chang; Chao, Pei-Min; Huang, Pei-Jane; Tsai, Ching-Tsan; Hseu, You-Cheng

    2016-01-01

    Hericium erinaceus (HE) is an edible mushroom that has been shown to exhibit anticancer and anti-inflammatory activities. We investigated the antiangiogenic and antioxidant potentials of ethanol extracts of HE in human endothelial (EA.hy926) cells upon tumor necrosis factor-α- (TNF-α-) stimulation (10 ng/mL). The underlying molecular mechanisms behind the pharmacological efficacies were elucidated. We found that noncytotoxic concentrations of HE (50-200 μg/mL) significantly inhibited TNF-α-induced migration/invasion and capillary-like tube formation of endothelial cells. HE treatment suppressed TNF-α-induced activity and/or overexpression of matrix metalloproteinase-9 (MMP-9) and intercellular adhesion molecule-1 (ICAM-1). Furthermore, HE downregulated TNF-α-induced nuclear translocation and transcriptional activation of nuclear factor-κB (NF-κB) followed by suppression of I-κB (inhibitor-κB) degradation. Data from fluorescence microscopy illustrated that increased intracellular ROS production upon TNF-α-stimulation was remarkably inhibited by HE pretreatment in a dose-dependent manner. Notably, HE triggered antioxidant gene expressions of heme oxygenase-1 (HO-1), γ-glutamylcysteine synthetase (γ-GCLC), and glutathione levels, which may contribute to inhibition of ROS. Increased antioxidant status was associated with upregulated nuclear translocation and transcriptional activation of NF-E2 related factor-2 (Nrf2) in HE treated cells. Our findings conclude that antiangiogenic and anti-inflammatory activities of H. erinaceus may contribute to its anticancer property through modulation of MMP-9/NF-κB and Nrf2-antioxidant signaling pathways.

  17. Nrf2 impacts cellular bioenergetics by controlling substrate availability for mitochondrial respiration

    Directory of Open Access Journals (Sweden)

    Kira M. Holmström

    2013-06-01

    Transcription factor Nrf2 and its repressor Keap1 regulate a network of cytoprotective genes involving more than 1% of the genome, their best known targets being drug-metabolizing and antioxidant genes. Here we demonstrate a novel role for this pathway in directly regulating mitochondrial bioenergetics in murine neurons and embryonic fibroblasts. Loss of Nrf2 leads to mitochondrial depolarisation, decreased ATP levels and impaired respiration, whereas genetic activation of Nrf2 increases the mitochondrial membrane potential and ATP levels, the rate of respiration and the efficiency of oxidative phosphorylation. We further show that Nrf2-deficient cells have increased production of ATP in glycolysis, which is then used by the F1Fo-ATPase for maintenance of the mitochondrial membrane potential. While the levels and in vitro activities of the respiratory complexes are unaffected by Nrf2 deletion, their activities in isolated mitochondria and intact live cells are substantially impaired. In addition, the rate of regeneration of NADH after inhibition of respiration is much slower in Nrf2-knockout cells than in their wild-type counterparts. Taken together, these results show that Nrf2 directly regulates cellular energy metabolism through modulating the availability of substrates for mitochondrial respiration. Our findings highlight the importance of efficient energy metabolism in Nrf2-mediated cytoprotection.

  18. Effects of rehabilitation training on apoptosis of nerve cells and the recovery of neural and motor functions in rats with ischemic stroke through the PI3K/Akt and Nrf2/ARE signaling pathways.

    Science.gov (United States)

    Jin, Xiao-Fei; Wang, Shan; Shen, Min; Wen, Xin; Han, Xin-Rui; Wu, Jun-Chang; Tang, Gao-Zhuo; Wu, Dong-Mei; Lu, Jun; Zheng, Yuan-Lin

    2017-09-01

    This study was designed in order to investigate the effects between rehabilitation training on the apoptosis of nerve cells and the recovery of neural and motor functions of rats with ischemic stroke by way of the phosphatidylinositol 3-kinase/protein kinase B (PI3K/Akt) and nuclear factor E2-related factor 2/antioxidant responsive element (Nrf2/ARE) signaling pathways. In total, 110 healthy adult male Sprague-Dawley (SD) rats were selected in order to take part in this study. Ninety SD rats were used in order to establish the middle cerebral artery occlusion (MCAO), among which 80 rats were randomly assigned as part of the natural recovery, natural recovery+Rp-PI3K (the rats injected with PI3K/Akt inhibitor LY294002), rehabilitation training, and rehabilitation training+Rp-PI3K groups. Meanwhile, 20 rats were selected as part of the sham operation group. The neural and motor functions of these rats were evaluated using a balance beam test and the Bederson score. The mRNA expressions of PI3K, Akt, Nrf2 and HO-1 were measured using an RT-qPCR. The protein expressions of PI3K, p-PI3K, Akt, p-Akt, Nrf2 and HO-1 were also detected by using western blotting and the immunohistochemistry process. The cell cycle and cell apoptosis were detected by using a flow cytometry and TUNEL assay. The sham operation group exhibited lower neural and motor function scores than other groups. At the 7, 14, and 21 d marks of this study, the neural and motor function scores were increased in the natural recovery, natural recovery+Rp-PI3K, and rehabilitation training+Rp-PI3K groups in comparison with the rehabilitation training group but found to be decreased in the natural recovery group in comparison with the natural recovery+Rp-PI3K group. In comparison with the sham operation group, expressions of PI3K, Nrf2 and HO-1, and proportions of p-PI3K/PI3K and p-Akt/Akt were all higher in the natural recovery, rehabilitation training, and rehabilitation training+Rp-PI3K groups. Same trends were

  19. Role of miR-155 in fluorooctane sulfonate-induced oxidative hepatic damage via the Nrf2-dependent pathway

    Energy Technology Data Exchange (ETDEWEB)

    Wan, Chong; Han, Rui; Liu, Limin [Laboratory of Environment and Health, College of Life Sciences, University of Chinese Academy of Sciences, No. 19A Yuquan Road, Beijing 100049 (China); Zhang, Fang, E-mail: zhangfang@ucas.ac.cn [Laboratory of Environment and Health, College of Life Sciences, University of Chinese Academy of Sciences, No. 19A Yuquan Road, Beijing 100049 (China); Li, Fang [Laboratory of Environment and Health, College of Life Sciences, University of Chinese Academy of Sciences, No. 19A Yuquan Road, Beijing 100049 (China); Xiang, Mingdeng [State Key Laboratory of Environmental Criteria and Risk Assessment, Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); Ding, Wenjun, E-mail: dingwj@ucas.ac.cn [Laboratory of Environment and Health, College of Life Sciences, University of Chinese Academy of Sciences, No. 19A Yuquan Road, Beijing 100049 (China)

    2016-03-15

    Studies demonstrated that perfluorooctane sulfonate (PFOS) tends to accumulate in the liver and is capable to cause hepatomegaly. In the present study, we investigated the roles of miR-155 in PFOS-induced hepatotoxicity in SD rats and HepG2 cells. Male SD rats were orally administrated with PFOS at 1 or 10 mg/kg/day for 28 days while HepG2 cells were treated with 0–50 μM of PFOS for 24 h or 50 μM of PFOS for 1, 3, 6, 12 or 24 h, respectively. We found that PFOS significantly increased the liver weight and serum alanine transaminase (ALT) and aspartate amino transferase (AST) levels in rats. Morphologically, PFOS caused actin filament remodeling and endothelial permeability changes in the liver. Moreover, PFOS triggered reactive oxygen species (ROS) generation and induced apoptosis in both in vivo and in vitro assays. Immunoblotting data showed that NF-E2-related factor-2 (Nrf2) expression and activation and its target genes were all suppressed by PFOS in the liver and HepG2 cells. However, PFOS significantly increased miR-155 expression. Further studies showed that pretreatment of HepG2 cells with catalase significantly decreased miR-155 expression and substantially increased Nrf2 expression and activation, resulting in reduction of PFOS-induced cytotoxicity and oxidative stress. Taken together, these results indicated that miR-155 plays an important role in the PFOS-induced hepatotoxicity by disrupting Nrf2/ARE signaling pathway. - Highlights: • PFOS is capable to cause hepatotoxicity. • PFOS triggers ROS generation and induces apoptosis both in vivo and in vitro assays. • PFOS-induced ROS inhibits Nrf2 expression and its transactivation function. • PFOS promotes miR155 expression in liver and HepG2 cells. • miR-155 is involved in PFOS-induced hepatotoxicity by disrupting Nrf2/ARE pathway.

  20. MDM2 controls NRF2 antioxidant activity in prevention of diabetic kidney disease.

    Science.gov (United States)

    Guo, Weiying; Tian, Dan; Jia, Ye; Huang, Wenlin; Jiang, Mengnan; Wang, Junnan; Sun, Weixia; Wu, Hao

    2018-04-26

    Oxidative stress and P53 contribute to the pathogenesis of diabetic kidney disease (DKD). Nuclear factor erythroid 2-related factor 2 (NRF2) is a master regulator of cellular antioxidant defense system, is negatively regulated by P53 and prevents DKD. Recent findings revealed an important role of mouse double minute 2 (MDM2) in protection against DKD. However, the mechanism remained unclear. We hypothesized that MDM2 enhances NRF2 antioxidant signaling in DKD given that MDM2 is a key negative regulator of P53. The MDM2 inhibitor nutlin3a elevated renal P53, inhibited NRF2 signaling and induced oxidative stress, inflammation, fibrosis, DKD-like renal pathology and albuminuria in the wild-type (WT) non-diabetic mice. These effects exhibited more prominently in nutlin3a-treated WT diabetic mice. Interestingly, nutlin3a failed to induce greater renal injuries in the Nrf2 knockout (KO) mice under both the diabetic and non-diabetic conditions, indicating that NRF2 predominantly mediates MDM2's action. On the contrary, P53 inhibition by pifithrin-α activated renal NRF2 signaling and the expression of Mdm2, and attenuated DKD in the WT diabetic mice, but not in the Nrf2 KO diabetic mice. In high glucose-treated mouse mesangial cells, P53 gene silencing completely abolished nutlin3a's inhibitory effect on NRF2 signaling. The present study demonstrates for the first time that MDM2 controls renal NRF2 antioxidant activity in DKD via inhibition of P53, providing MDM2 activation and P53 inhibition as novel strategies in the management of DKD. Copyright © 2018 Elsevier B.V. All rights reserved.

  1. Fluvastatin inhibits AGE-induced cell proliferation and migration via an ERK5-dependent Nrf2 pathway in vascular smooth muscle cells.

    Directory of Open Access Journals (Sweden)

    Ae-Rang Hwang

    Full Text Available Advanced glycation endproduct (AGE-induced vascular smooth muscle cell (VSMC proliferation and reactive oxygen species (ROS production are emerging as important mechanisms of diabetic vasculopathy, but little is known about the molecular mechanism responsible for the antioxidative effects of statins on AGEs. It has been reported that statins exert pleiotropic effects on the cardiovascular system due to decreases in AGE-induced cell proliferation, migration, and vascular inflammation. Thus, in the present study, the authors investigated the molecular mechanism by which statins decrease AGE-induced cell proliferation and VSMC migration. In cultured VSMCs, statins upregulated Nrf2-related antioxidant gene, NQO1 and HO-1, via an ERK5-dependent Nrf2 pathway. Inhibition of ERK5 by siRNA or BIX02189 (a specific ERK5 inhibitor reduced the statin-induced upregulations of Nrf2, NQO1, and HO-1. Furthermore, fluvastatin was found to significantly increase ARE promoter activity through ERK5 signaling, and to inhibit AGE-induced VSMC proliferation and migration as determined by MTT assay, cell counting, FACS analysis, a wound scratch assay, and a migration chamber assay. In addition, AGE-induced proliferation was diminished in the presence of Ad-CA-MEK5α encoding a constitutively active mutant form of MEK5α (an upstream kinase of ERK5, whereas depletion of Nrf2 restored statin-mediated reduction of AGE-induced cell proliferation. Moreover, fluvastatin suppressed the protein expressions of cyclin D1 and Cdk4, but induced p27, and blocked VSMC proliferation by regulating cell cycle. These results suggest statin-induced activation of an ERK5-dependent Nrf2 pathway reduces VSMC proliferation and migration induced by AGEs, and that the ERK5-Nrf2 signal module be viewed as a potential therapeutic target of vasculopathy in patients with diabetes and complications of the disease.

  2. The age- and sex-specific decline of the 20s proteasome and the Nrf2/CncC signal transduction pathway in adaption and resistance to oxidative stress in Drosophila melanogaster.

    Science.gov (United States)

    Pomatto, Laura C D; Wong, Sarah; Carney, Caroline; Shen, Brenda; Tower, John; Davies, Kelvin J A

    2017-04-01

    Hallmarks of aging include loss of protein homeostasis and dysregulation of stress-adaptive pathways. Loss of adaptive homeostasis, increases accumulation of DNA, protein, and lipid damage. During acute stress, the Cnc-C ( Drosophila Nrf2 orthologue) transcriptionally-regulated 20S proteasome degrades damaged proteins in an ATP-independent manner. Exposure to very low, non-toxic, signaling concentrations of the redox-signaling agent hydrogen peroxide (H 2 O 2 ) cause adaptive increases in the de novo expression and proteolytic activity/capacity of the 20S proteasome in female D. melanogaster (fruit-flies). Female 20S proteasome induction was accompanied by increased tolerance to a subsequent normally toxic but sub-lethal amount of H 2 O 2 , and blocking adaptive increases in proteasome expression also prevented full adaptation. We find, however, that this adaptive response is both sex- and age-dependent. Both increased proteasome expression and activity, and increased oxidative-stress resistance, in female flies, were lost with age. In contrast, male flies exhibited no H 2 O 2 adaptation, irrespective of age. Furthermore, aging caused a generalized increase in basal 20S proteasome expression, but proteolytic activity and adaptation were both compromised. Finally, continual knockdown of Keep1 (the cytosolic inhibitor of Cnc-C) in adults resulted in older flies with greater stress resistance than their age-matched controls, but who still exhibited an age-associated loss of adaptive homeostasis.

  3. A generalizable platform for interrogating target- and signal-specific consequences of electrophilic modifications in redox-dependent cell signaling.

    Science.gov (United States)

    Lin, Hong-Yu; Haegele, Joseph A; Disare, Michael T; Lin, Qishan; Aye, Yimon

    2015-05-20

    Despite the known propensity of small-molecule electrophiles to react with numerous cysteine-active proteins, biological actions of individual signal inducers have emerged to be chemotype-specific. To pinpoint and quantify the impacts of modifying one target out of the whole proteome, we develop a target-protein-personalized "electrophile toolbox" with which specific intracellular targets can be selectively modified at a precise time by specific reactive signals. This general methodology, T-REX (targetable reactive electrophiles and oxidants), is established by (1) constructing a platform that can deliver a range of electronic and sterically different bioactive lipid-derived signaling electrophiles to specific proteins in cells; (2) probing the kinetics of targeted delivery concept, which revealed that targeting efficiency in cells is largely driven by initial on-rate of alkylation; and (3) evaluating the consequences of protein-target- and small-molecule-signal-specific modifications on the strength of downstream signaling. These data show that T-REX allows quantitative interrogations into the extent to which the Nrf2 transcription factor-dependent antioxidant response element (ARE) signaling is activated by selective electrophilic modifications on Keap1 protein, one of several redox-sensitive regulators of the Nrf2-ARE axis. The results document Keap1 as a promiscuous electrophile-responsive sensor able to respond with similar efficiencies to discrete electrophilic signals, promoting comparable strength of Nrf2-ARE induction. T-REX is also able to elicit cell activation in cases in which whole-cell electrophile flooding fails to stimulate ARE induction prior to causing cytotoxicity. The platform presents a previously unavailable opportunity to elucidate the functional consequences of small-molecule-signal- and protein-target-specific electrophilic modifications in an otherwise unaffected cellular background.

  4. Activation of Nrf2-mediated oxidative stress response in macrophages by hypochlorous acid

    International Nuclear Information System (INIS)

    Pi Jingbo; Zhang Qiang; Woods, Courtney G.; Wong, Victoria; Collins, Sheila; Andersen, Melvin E.

    2008-01-01

    Hypochlorous acid (HOCl), a potent oxidant generated when chlorine gas reacts with water, is important in the pathogenesis of many disorders. Transcription factor Nrf2-mediated antioxidant response represents a critical cellular defense mechanism that serves to maintain intracellular redox homeostasis and limit oxidative damage. In the present study, the effect of HOCl on Nrf2 activation was investigated in macrophages, one of the target cells of chlorine gas exposure. Exposure of RAW 264.7 macrophages to HOCl resulted in increased protein levels of Nrf2 in nuclear extractions, as well as a time- and dose-dependent increase in the expression of Nrf2 target genes, including heme oxygenase-1, NAD(P)H:quinone oxidoreductase 1 (NQO-1), glutamate cysteine ligase catalytic subunit (GCLC), and glutathione synthetase (GS). Additionally, intracellular glutathione (GSH), which is the prime scavenger for HOCl in cells, decreased within the first hour of HOCl exposure. The decline was followed by a GSH rebound that surpassed the initial basal levels by up to 4-fold. This reversal in GSH levels closely correlated with the gene expression profile of GCLC and GS. To study the mechanisms of Nrf2 activation in response to HOCl exposure, we examined the effects of several antioxidants on Nrf2-mediated response. Pretreatment with cell-permeable catalase, N-acetyl-L-cysteine or GSH-monoethyl ester markedly reduced expression of NQO-1 and GCLC under HOCl challenge conditions, suggesting intracellular ROS-scavenging capacity affects HOCl-induced Nrf2 activation. Importantly, pre-activation of Nrf2 with low concentrations of pro-oxidants protected the cells against HOCl-induced cell damage. Taken together, we provide direct evidence that HOCl activates Nrf2-mediated antioxidant response, which protects cells from oxidative damage

  5. Nrf2 the rescue: Effects of the antioxidative/electrophilic response on the liver

    International Nuclear Information System (INIS)

    Klaassen, Curtis D.; Reisman, Scott A.

    2010-01-01

    Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcription factor that positively regulates the basal and inducible expression of a large battery of cytoprotective genes. These gene products include proteins that catalyze reduction reactions (NAD(P)H:quinone oxidoreductase 1, Nqo1), conjugation reactions (glutathione-S-transferases, Gsts and UDP-glucuronosyltransferases, Ugts), as well as the efflux of potentially toxic xenobiotics and xenobiotic conjugates (multidrug resistance-associated proteins, Mrps). The significance of Nrf2 in the liver has been established, as livers of Nrf2-null mice are more susceptible to various oxidative/electrophilic stress-induced pathologies than wild-type mice. In contrast, both pharmacological and genetic models of hepatic Nrf2 activation are protective against oxidative/electrophilic stress. Furthermore, because certain Nrf2-target genes in the liver could affect the distribution, metabolism, and excretion of xenobiotics, the effects of Nrf2 on the kinetics of drugs and other xenobiotics should also be considered, with a special emphasis on metabolism and excretion. Therefore, this review highlights the research that has contributed to the understanding of the importance of Nrf2 in toxicodynamics and toxicokinetics, especially that which pertains to the liver.

  6. Abnormal expression of Nrf2 may play an important role in the pathogenesis and development of adenomyosis.

    Directory of Open Access Journals (Sweden)

    Ning Chen

    Full Text Available To explore the expression level of Nrf2 in adenomyosis and study the mechanism of abnormal expression of Nrf2 in the pathogenesis of adenomyosis.Western blot, immunohistochemistry(IHC and real time PCR were used to measure Nrf2 expression levels in tissue and cell samples. Knockdown and overexpression of Nrf2 were used to investigate the variation of migration ability of endometrial glandular cells as well as the regulatory mechanism.Nrf2 protein levels were significantly higher in the eutopic and ectopic endometrial glands when compared with control cases using IHC and western blot methods. (p< 0.05. However, there was no statistical difference in Nrf2 mRNA expression levels between the adenomyosis and control groups. Using an agonist and Nrf2 siRNA, we regulated the Nrf2 protein levels of primary cultured endometrial glandular cells. With increased expression of Nrf2, cell scratch assay showed that the agonist-treated group migrated significantly faster than the control group, with MMP9 protein level markedly elevated. In contrast, Nrf2 siRNA-treated group migrated slower than the control group, with decreased expression of MMP9 protein. All of the scratching healing spaces and protein levels between the treated and control groups were statistically significant (p< 0.05.Abnormal expression of Nrf2 may play an important role in the pathogenesis and development of adenomyosis. Specified reduction of Nrf2 expression could prove to be a new therapeutic target in the clinical treatment of adenomyosis.

  7. The Role of Nrf2: Adipocyte Differentiation, Obesity, and Insulin Resistance

    Directory of Open Access Journals (Sweden)

    Hyun-Ae Seo

    2013-01-01

    Full Text Available Metabolic diseases, such as type 2 diabetes and obesity, are increasing globally, and much work has been performed to elucidate the regulatory mechanisms of these diseases. Nuclear factor E2-related factor 2 (Nrf2 is a basic leucine zipper transcription factor that serves as a primary cellular defense against the cytotoxic effects of oxidative stress. Recent studies have proposed a close relationship between oxidative stress and energy metabolism-associated disease. The Nrf2 pathway, as a master regulator of cellular defense against oxidative stress, has emerged as a critical target of energy metabolism; however, its effects are controversial. This review examines the current state of research on the role of Nrf2 on energy metabolism, specifically with respect to its participation in adipocyte differentiation, obesity, and insulin resistance, and discusses the possibility of using Nrf2 as a therapeutic target in the clinic.

  8. Abnormal expression of Nrf2 may play an important role in the pathogenesis and development of adenomyosis.

    Science.gov (United States)

    Chen, Ning; Du, Baoying; Zhou, Hao; Shen, Fengxian; Li, Juan; Xie, Zhenwei

    2017-01-01

    To explore the expression level of Nrf2 in adenomyosis and study the mechanism of abnormal expression of Nrf2 in the pathogenesis of adenomyosis. Western blot, immunohistochemistry(IHC) and real time PCR were used to measure Nrf2 expression levels in tissue and cell samples. Knockdown and overexpression of Nrf2 were used to investigate the variation of migration ability of endometrial glandular cells as well as the regulatory mechanism. Nrf2 protein levels were significantly higher in the eutopic and ectopic endometrial glands when compared with control cases using IHC and western blot methods. (pendometrial glandular cells. With increased expression of Nrf2, cell scratch assay showed that the agonist-treated group migrated significantly faster than the control group, with MMP9 protein level markedly elevated. In contrast, Nrf2 siRNA-treated group migrated slower than the control group, with decreased expression of MMP9 protein. All of the scratching healing spaces and protein levels between the treated and control groups were statistically significant (p< 0.05). Abnormal expression of Nrf2 may play an important role in the pathogenesis and development of adenomyosis. Specified reduction of Nrf2 expression could prove to be a new therapeutic target in the clinical treatment of adenomyosis.

  9. The NRF2-KEAP1 Pathway Is an Early Responsive Gene Network in Arsenic Exposed Lymphoblastoid Cells

    Science.gov (United States)

    Córdova, Emilio J.; Martínez-Hernández, Angélica; Uribe-Figueroa, Laura; Centeno, Federico; Morales-Marín, Mirna; Koneru, Harsha; Coleman, Matthew A.; Orozco, Lorena

    2014-01-01

    Inorganic arsenic (iAs), a major environmental contaminant, has risen as an important health problem worldwide. More detailed identification of the molecular mechanisms associated with iAs exposure would help to establish better strategies for prevention and treatment. Although chronic iAs exposures have been previously studied there is little to no information regarding the early events of exposure to iAs. To better characterize the early mechanisms of iAs exposure we conducted gene expression studies using sublethal doses of iAs at two different time-points. The major transcripts differentially regulated at 2 hrs of iAs exposure included antioxidants, detoxificants and chaperones. Moreover, after 12 hrs of exposure many of the down-regulated genes were associated with DNA replication and S phase cell cycle progression. Interestingly, the most affected biological pathway by both 2 or 12 hrs of iAs exposure were the Nrf2-Keap1 pathway, represented by the highly up-regulated HMOX1 transcript, which is transcriptionally regulated by the transcription factor Nrf2. Additional Nrf2 targets included SQSTM1 and ABCB6, which were not previously associated with acute iAs exposure. Signalling pathways such as interferon, B cell receptor and AhR route were also responsive to acute iAs exposure. Since HMOX1 expression increased early (20 min) and was responsive to low iAs concentrations (0.1 µM), this gene could be a suitable early biomarker for iAs exposure. In addition, the novel Nrf2 targets SQSTM1 and ABCB6 could play an important and previously unrecognized role in cellular protection against iAs. PMID:24516582

  10. Proteomics analysis of dendritic cell activation by contact allergens reveals possible biomarkers regulated by Nrf2

    Energy Technology Data Exchange (ETDEWEB)

    Mussotter, Franz, E-mail: franz.mussotter@bfr.bund.de [German Federal Institute for Risk Assessment (BfR), Department of Chemical and Product Safety, Berlin (Germany); Tomm, Janina Melanie [Helmholtz Centre for Environmental Research (UFZ), Department of Molecular Systems Biology, Leipzig (Germany); El Ali, Zeina; Pallardy, Marc; Kerdine-Römer, Saadia [INSERM UMR 996, Univ Paris-Sud, Université Paris-Saclay, Chátenay-Malabry (France); Götz, Mario [German Federal Institute for Risk Assessment (BfR), Department of Chemical and Product Safety, Berlin (Germany); Bergen, Martin von [Helmholtz Centre for Environmental Research (UFZ), Department of Molecular Systems Biology, Leipzig (Germany); University of Leipzig, Institute of Biochemistry, Leipzig (Germany); Aalborg University, Department of Chemistry and Bioscience, Aalborg (Denmark); Haase, Andrea; Luch, Andreas [German Federal Institute for Risk Assessment (BfR), Department of Chemical and Product Safety, Berlin (Germany)

    2016-12-15

    Allergic contact dermatitis is a widespread disease with high clinical relevance affecting approximately 20% of the general population. Typically, contact allergens are low molecular weight electrophilic compounds which can activate the Keap1/Nrf2 pathway. We performed a proteomics study to reveal possible biomarkers for dendritic cell (DC) activation by contact allergens and to further elucidate the role of Keap1/Nrf2 signaling in this process. We used bone marrow derived dendritic cells (BMDCs) of wild-type (nrf2{sup +/+}) and Nrf2 knockout (nrf2{sup −/−}) mice and studied their response against the model contact sensitizers 2,4-dinitrochlorobenzene (DNCB), cinnamaldehyde (CA) and nickel(II) sulfate by 2-dimensional polyacrylamide gel electrophoresis (2D-PAGE) in combination with electrospray ionization tandem mass spectrometry (ESI-MS/MS). Sodium dodecyl sulfate (SDS, 100 μM) served as irritant control. While treatment with nickel(II) sulfate and SDS had only little effects, CA and DNCB led to significant changes in protein expression. We found 18 and 30 protein spots up-regulated in wild-type cells treated with 50 and 100 μM CA, respectively. For 5 and 10 μM DNCB, 32 and 37 spots were up-regulated, respectively. Almost all of these proteins were not differentially expressed in nrf2{sup −/−} BMDCs, indicating an Nrf2-dependent regulation. Among them proteins were detected which are involved in oxidative stress and heat shock responses, as well as in signal transduction or basic cellular pathways. The applied approach allowed us to differentiate between Nrf2-dependent and Nrf2-independent cellular biomarkers differentially regulated upon allergen-induced DC activation. The data presented might contribute to the further development of suitable in vitro testing methods for chemical-mediated sensitization. - Highlights: • Contact allergens induce proteins involved in DC maturation Nrf2-dependently. • Induction of these proteins points to a functional

  11. An overview of the molecular mechanisms and novel roles of Nrf2 in neurodegenerative disorders.

    Science.gov (United States)

    Yang, Yang; Jiang, Shuai; Yan, Juanjuan; Li, Yue; Xin, Zhenlong; Lin, Yan; Qu, Yan

    2015-02-01

    Recently, growing evidence has demonstrated that nuclear factor erythroid 2-related factor 2 (Nrf2) is a pivotal regulator of endogenous defense systems that function via the activation of a set of protective genes, and this is particularly clear in the central nervous system (CNS). Therefore, it is highly useful to summarize the current literature on the molecular mechanisms and role of Nrf2 in the CNS. In this review, we first briefly introduce the molecular features of Nrf2. We then discuss the regulation, cerebral actions, upstream modulators and downstream targets of Nrf2 pathway. Following this background, we expand our discussion to the role of Nrf2 in several major neurodegenerative disorders (NDDs) such as Alzheimer's disease, Parkinson's disease, Huntington's disease, multiple sclerosis and amyotrophic lateral sclerosis. Lastly, we discuss some potential future directions. The information reviewed here may be significant in the design of further experimental research and increase the potential of Nrf2 as a therapeutic target in the future. Copyright © 2014 Elsevier Ltd. All rights reserved.

  12. Introducing the "TCDD-inducible AhR-Nrf2 gene battery".

    Science.gov (United States)

    Yeager, Ronnie L; Reisman, Scott A; Aleksunes, Lauren M; Klaassen, Curtis D

    2009-10-01

    2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) induces genes via the transcription factor aryl hydrocarbon receptor (AhR), including Cyp1a1, NAD(P)H:quinone oxidoreductase 1 (Nqo1), UDP-glucuronosyltransferase 1a6 (Ugt1a6), and glutathione S-transferase a1 (Gsta1). These genes are referred to as the "AhR gene battery." However, Nqo1 is also considered a prototypical target gene of the transcription factor nuclear factor erythroid 2-related factor 2 (Nrf2). In mice, TCDD induction of Nrf2 and Nrf2 target, Nqo1, is dependent on AhR, and thus TCDD induction of drug-processing genes may be routed through an AhR-Nrf2 sequence. There has been speculation that Nrf2 may be involved in the TCDD induction of drug-processing genes; however, the data are not definitive. Therefore, to address whether TCDD induction of Nqo1, Ugts, and Gsts is dependent on Nrf2, we conducted the definitive experiment by administering TCDD (50 mug/kg, ip) to Nrf2-null and wild-type (WT) mice and collecting livers 24 h later to quantify the mRNA of drug-processing genes. TCDD induction of Cyp1a1 and Ugt1a1 was similar in WT and Nrf2-null mice, whereas TCDD induction of Ugt1a5 and 1a9 was blunted in Nrf2-null mice. TCDD induced Nqo1, Ugt1a6, 2b34, 2b35, 2b36, UDP-glucuronic acid-synthesizing gene UDP-glucose dehydrogenase, and Gsta1, m1, m2, m3, m6, p2, t2, and microsomal Gst1 in WT mice but not in Nrf2-null mice. Therefore, the present study demonstrates the novel finding that Nrf2 is required for TCDD induction of classical AhR battery genes Nqo1, Ugt1a6, and Gsta1, as well as most Ugt and Gst isoforms in livers of mice.

  13. Protective function of pyridoxamine on retinal photoreceptor cells via activation of the p‑Erk1/2/Nrf2/Trx/ASK1 signalling pathway in diabetic mice.

    Science.gov (United States)

    Ren, Xiang; Sun, Hong; Zhang, Chenghong; Li, Chen; Wang, Jinlei; Shen, Jie; Yu, Dong; Kong, Li

    2016-07-01

    The present study aimed to investigate the mechanisms that mediate the protective effects of pyridoxamine (PM) on light‑damaged retinal photoreceptor cells in diabetic mice. A high‑fat diet and streptozotocin were used to induce a mouse model of type II diabetes. During the experiment, mice were divided the mice into three types of group, as follows: Control groups (negative control and light‑damaged groups); experimental groups (diabetic and diabetic light‑damaged groups); and treatment groups (25, 50 and 100 mg/kg PM‑treated groups). Using hematoxylin‑eosin staining, the number of nuclear layer cells were counted. Western blotting and immunohistochemistry were performed to measure the levels of thioredoxin (Trx), phospho‑extracellular signal‑regulated kinase 1/2 (p‑Erk1/2), nuclear factor erythroid 2‑related factor 2 (Nrf2) and apoptosis signal‑regulating kinase 1 (ASK1). The photoreceptor cell count in the outer nuclear layer of the light‑damaged, diabetic control and diabetic light‑damaged groups were significantly reduced compared with the negative control group (PTrx, p‑Erk1/2 and Nrf2 expression levels (PTrx, p‑Erk1/2 and Nrf2 expression levels were significantly increased (PTrx, p‑Erk1/2 and Nrf2 expression, and the downregulation of ASK1 expression.

  14. Design, synthesis, and evaluation of curcumin derivatives as Nrf2 activators and cytoprotectors against oxidative death.

    Science.gov (United States)

    Tu, Zhi-Shan; Wang, Qi; Sun, Dan-Dan; Dai, Fang; Zhou, Bo

    2017-07-07

    Activation of nuclear factor erythroid-2-related factor 2 (Nrf2) has been proven to be an effective means to prevent the development of cancer, and natural curcumin stands out as a potent Nrf2 activator and cancer chemopreventive agent. In this study, we synthesized a series of curcumin analogs by introducing the geminal dimethyl substituents on the active methylene group to find more potent Nrf2 activators and cytoprotectors against oxidative death. The geminally dimethylated and catechol-type curcumin analog (compound 3) was identified as a promising lead molecule in terms of its increased stability and cytoprotective activity against the tert-butyl hydroperoxide (t-BHP)-induced death of HepG2 cells. Mechanism studies indicate that its cytoprotective effects are mediated by activating the Nrf2 signaling pathway in the Michael acceptor- and catechol-dependent manners. Additionally, we verified by using copper and iron ion chelators that the two metal ion-mediated oxidations of compound 3 to its corresponding electrophilic o-quinone, contribute significantly to its Nrf2-dependent cytoprotection. This work provides an example of successfully designing natural curcumin-directed Nrf2 activators by a stability-increasing and proelectrophilic strategy. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  15. Clinical significance of Keap1 and Nrf2 in oral squamous cell carcinoma.

    Directory of Open Access Journals (Sweden)

    Cong-Fa Huang

    Full Text Available Oxidative stress has been reported to play an important role in progression and prognostication in various kinds of cancers. However, the role and clinical significance of oxidative stress markers Keap1 and Nrf2 in oral squamous cell carcinoma (OSCC has not been elucidated. This study aimed to investigate the correlation of oxidative stress markers Keap1 and Nrf2 expression and pathological features in OSCC by using tissue microarray. Tissue microarrays containing 17 normal oral mucosa, 7 oral epithelial dysplasia and 43 OSCC specimens were studied by immunohistochemistry. The association among these proteins and pathological features were analyzed. Expression of oxidative stress markers Keap1, Nrf2, and antioxidants PPIA, Prdx6, as well as CD147 was found to increase consecutively from normal oral mucosa to OSCC, and the Keap1, Nrf2, PPIA, Prdx6, CD147 expression in OSCC were significantly higher when compared to normal oral mucosa. Expression of Keap1, Nrf2 in tumors was not found to be significantly associated with T category, lymph node metastases, and pathological grade. Furthermore, we checked the relationship among these oxidative stress markers and found that Keap1 was significantly correlated with Nrf2, Prdx6 and CD147. Significant relationship between Nrf2 and Prdx6 was also detected. Finally, we found patients with overexpression of Keap1 and Nrf2 had not significantly worse overall survival by Kaplan-Meier analysis. These findings suggest that ROS markers are associated with carcinogenesis and progression of OSCC, which may have prognostic value and could be regarded as potential therapeutic targets in OSCC.

  16. 4-Hydroxy hexenal derived from docosahexaenoic acid protects endothelial cells via Nrf2 activation.

    Directory of Open Access Journals (Sweden)

    Atsushi Ishikado

    Full Text Available Recent studies have proposed that n-3 polyunsaturated fatty acids (n-3 PUFAs have direct antioxidant and anti-inflammatory effects in vascular tissue, explaining their cardioprotective effects. However, the molecular mechanisms are not yet fully understood. We tested whether n-3 PUFAs showed antioxidant activity through the activation of nuclear factor erythroid 2-related factor 2 (Nrf2, a master transcriptional factor for antioxidant genes. C57BL/6 or Nrf2(-/- mice were fed a fish-oil diet for 3 weeks. Fish-oil diet significantly increased the expression of heme oxygenase-1 (HO-1, and endothelium-dependent vasodilation in the aorta of C57BL/6 mice, but not in the Nrf2(-/- mice. Furthermore, we observed that 4-hydroxy hexenal (4-HHE, an end-product of n-3 PUFA peroxidation, was significantly increased in the aorta of C57BL/6 mice, accompanied by intra-aortic predominant increase in docosahexaenoic acid (DHA rather than that in eicosapentaenoic acid (EPA. Human umbilical vein endothelial cells were incubated with DHA or EPA. We found that DHA, but not EPA, markedly increased intracellular 4-HHE, and nuclear expression and DNA binding of Nrf2. Both DHA and 4-HHE also increased the expressions of Nrf2 target genes including HO-1, and the siRNA of Nrf2 abolished these effects. Furthermore, DHA prevented oxidant-induced cellular damage or reactive oxygen species production, and these effects were disappeared by an HO-1 inhibitor or the siRNA of Nrf2. Thus, we found protective effects of DHA through Nrf2 activation in vascular tissue, accompanied by intra-vascular increases in 4-HHE, which may explain the mechanism of the cardioprotective effects of DHA.

  17. NRF2 activation is involved in ozonated human serum upregulation of HO-1 in endothelial cells

    International Nuclear Information System (INIS)

    Pecorelli, Alessandra; Bocci, Velio; Acquaviva, Alessandra; Belmonte, Giuseppe; Gardi, Concetta; Virgili, Fabio; Ciccoli, Lucia; Valacchi, Giuseppe

    2013-01-01

    During the last decade, it has been shown that the activation of NRF2 and the binding to electrophile-responsive element (EpREs), stimulates the expression of a great number of genes responsible for the synthesis of phase I and phase II proteins, including antioxidants enzymes and heme oxygenase-1 (HO-1). This critical cell response occurs in cardiovascular, degenerative and chronic infective diseases aggravated by a chronic oxidative stress. In our previous reports we have shown that ozonated plasma is able to up-regulate HO-1 expression in endothelial cells. In the present work we investigated a candidate mechanism involved in this process. After treatment with increasing doses of ozonated serum (20, 40 and 80 μg/mL O 3 per mL of serum), a clear dose dependent activation of NRF2 and the subsequent induction of HO-1 and NAD(P)H quinone oxidoreductase 1(NQO1) was observed. This effect was also present when cells were treated with serum and hydrogen peroxide (H 2 O 2 ) or serum and 4-hydroxynonenal (4HNE). Moreover, the treatment with ozonated serum was associated with a dose-dependent activation of extracellular-signal-regulated kinases (ERK1/2) and p38 MAP kinases (p38), not directly involved in NRF2 activation. These data, provide a new insight on the mechanism responsible for the induction of HO-1 expression by ozonated serum in the endothelium, and have a practical importance as an expedient approach to the treatment of patients with both effective orthodox drugs and ozonated autohemotherapy, targeted to the restoration of redox homeostasis. - Highlights: ► Endothelial HO1 is upregulated by ozonated plasma ► This activation is induced by NRF2 and it is ERK independent. ► 4HNE and H 2 O 2 are the main molecules involved in this process. ► Ozonated plasma induced a hormetic effect ► Combination of orthodox medicine and ozonated plasma can be a useful treatment

  18. NRF2 activation is involved in ozonated human serum upregulation of HO-1 in endothelial cells

    Energy Technology Data Exchange (ETDEWEB)

    Pecorelli, Alessandra [Department of Molecular and Developmental Medicine, University of Siena (Italy); Child Neuropsychiatry Unit, University Hospital, AOUS, Siena (Italy); Bocci, Velio [Department of Physiology, University of Siena (Italy); Acquaviva, Alessandra [Department of Molecular and Developmental Medicine, University of Siena (Italy); Belmonte, Giuseppe [Department of Biomedical Sciences, University of Siena (Italy); Gardi, Concetta [Department of Molecular and Developmental Medicine, University of Siena (Italy); Virgili, Fabio [INRAN, Rome (Italy); Ciccoli, Lucia [Department of Molecular and Developmental Medicine, University of Siena (Italy); Valacchi, Giuseppe, E-mail: giuseppe.valacchi@unife.it [Department of Life Sciences and Biotechnology, University of Ferrara (Italy); Department of Food and Nutrition, Kyung Hee University, Seoul (Korea, Republic of)

    2013-02-15

    During the last decade, it has been shown that the activation of NRF2 and the binding to electrophile-responsive element (EpREs), stimulates the expression of a great number of genes responsible for the synthesis of phase I and phase II proteins, including antioxidants enzymes and heme oxygenase-1 (HO-1). This critical cell response occurs in cardiovascular, degenerative and chronic infective diseases aggravated by a chronic oxidative stress. In our previous reports we have shown that ozonated plasma is able to up-regulate HO-1 expression in endothelial cells. In the present work we investigated a candidate mechanism involved in this process. After treatment with increasing doses of ozonated serum (20, 40 and 80 μg/mL O{sub 3} per mL of serum), a clear dose dependent activation of NRF2 and the subsequent induction of HO-1 and NAD(P)H quinone oxidoreductase 1(NQO1) was observed. This effect was also present when cells were treated with serum and hydrogen peroxide (H{sub 2}O{sub 2}) or serum and 4-hydroxynonenal (4HNE). Moreover, the treatment with ozonated serum was associated with a dose-dependent activation of extracellular-signal-regulated kinases (ERK1/2) and p38 MAP kinases (p38), not directly involved in NRF2 activation. These data, provide a new insight on the mechanism responsible for the induction of HO-1 expression by ozonated serum in the endothelium, and have a practical importance as an expedient approach to the treatment of patients with both effective orthodox drugs and ozonated autohemotherapy, targeted to the restoration of redox homeostasis. - Highlights: ► Endothelial HO1 is upregulated by ozonated plasma ► This activation is induced by NRF2 and it is ERK independent. ► 4HNE and H{sub 2}O{sub 2} are the main molecules involved in this process. ► Ozonated plasma induced a hormetic effect ► Combination of orthodox medicine and ozonated plasma can be a useful treatment.

  19. An essential role of Nrf2 in American ginseng-mediated anti-oxidative actions in cardiomyocytes.

    Science.gov (United States)

    Li, Jinqing; Ichikawa, Tomonaga; Jin, Yu; Hofseth, Lorne J; Nagarkatti, Prakash; Nagarkatti, Mitzi; Windust, Anthony; Cui, Taixing

    2010-07-20

    Ginseng has been used as a folk medicine for thousands of years in Asia, and has become a popular herbal medicine world-wide. Recent studies have revealed that ginseng, including American ginseng, exerts antioxidant effects in the cardiovascular system; however, the underlying mechanisms are not fully understood. Thus, we investigated role of Nrf2, a master transcription factor of endogenous anti-oxidative defense systems, in the regulation of American ginseng-mediated anti-oxidative actions in cardiomyocytes. A standardized crude extract of American ginseng was supplied by the National Research Council of Canada, Institute for National Measurement Standards. H9C2 cells, a rat cardiomyocyte cell line, were exposed to angiotensin II (Ang II) or tumor necrosis factor alpha (TNFalpha) to induce oxidative stress that was examined by measuring formation of reactive oxygen and nitrogen species. Oxidative stress-induced cell death was induced by exogenous addition of hydrogen peroxide (H(2)O(2)). Proteins were measured by Western blot and mRNA expression was determined by quantitative real time PCR. Nrf2-driven transcriptional activity was assessed by antioxidant response element (ARE)-luciferase reporter assay. Direct Nrf2 binding to its target gene promoters was determined by chromatin immunoprecipitation assay. Adenoviral over-expression of Nrf2 shRNA was utilized to knock down Nrf2 in H9C2 cells. Immunochemical staining was applied for Nrf2 expression in the heart. American ginseng induced dramatic increases in Nrf2 protein expression, Nrf2 nuclear translocation, Nrf2 transcriptional activity, direct Nrf2 binding to its target gene promoters, and expression of a group of anti-oxidative genes driven by Nrf2 in H9C2 cells. In addition, American ginseng inhibited Ang II- or TNFalpha-induced free radical formation and H(2)O(2)-induced cell death in H9C2 cells over-expressed with control shRNA but not in the cells over-expressed with Nrf2 shRNA. Finally, oral

  20. Concerted action of p62 and Nrf2 protects cells from palmitic acid-induced lipotoxicity

    Energy Technology Data Exchange (ETDEWEB)

    Park, Jeong Su [Severance Biomedical Science Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Yonsei Biomedical Research Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Kang, Dong Hoon [Department of Life Science and Ewha Research Center for Systems Biology (Korea, Republic of); The Research Center for Cell Homeostasis, Ewha Womans University, Seoul 127-750 (Korea, Republic of); Lee, Da Hyun [Severance Biomedical Science Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Yonsei Biomedical Research Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Bae, Soo Han, E-mail: soohanbae@yuhs.ac [Severance Biomedical Science Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Yonsei Biomedical Research Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of)

    2015-10-09

    Nonalcoholic fatty liver disease (NAFLD), frequently associated with obesity and diabetes mellitus, is caused by the accumulation of excess fatty acids within liver cells. Palmitic acid (PA), a common saturated fatty acid found in mammals, induces the generation of reactive oxygen species (ROS) and elicits apoptotic cell death, known as lipotoxicity. However, protective mechanisms against PA-induced lipotoxicity have not been elucidated. In this study, we aimed to clarify the role of p62, an adapter protein in the autophagic process, as well as the nuclear factor erythroid 2-related factor 2 (Nrf2)-Kelch-like ECH-associated protein 1 (Keap1) pathway, in protecting cells from PA-induced lipotoxicity. The Nrf2-Keap1 pathway is essential for the protection of cells from oxidative stress. p62 enhances its binding to Keap1 and leads to Nrf2 activation. Here, we show that PA potentiates Keap1 degradation and thereby activates the transcription of Nrf2 target genes partially through autophagy. Furthermore, this PA-mediated Keap1 degradation depends on p62. Correspondingly, a lack of p62 attenuates the PA-mediated Nrf2 activation and increases the susceptibility of cells to oxidative stress. These results indicate that p62 plays an important role in protecting cells against lipotoxicity through Keap1 degradation-mediated Nrf2 activation. - Highlights: • PA induces Keap1 downregulation and activates Nrf2 target gene transcription. • PA-induced Keap1 degradation is partly mediated by the autophagic pathway. • PA-induced Keap1 degradation depends on p62. • Ablation of p62 exacerbates PA-mediated apoptotic cell death.

  1. Concerted action of p62 and Nrf2 protects cells from palmitic acid-induced lipotoxicity

    International Nuclear Information System (INIS)

    Park, Jeong Su; Kang, Dong Hoon; Lee, Da Hyun; Bae, Soo Han

    2015-01-01

    Nonalcoholic fatty liver disease (NAFLD), frequently associated with obesity and diabetes mellitus, is caused by the accumulation of excess fatty acids within liver cells. Palmitic acid (PA), a common saturated fatty acid found in mammals, induces the generation of reactive oxygen species (ROS) and elicits apoptotic cell death, known as lipotoxicity. However, protective mechanisms against PA-induced lipotoxicity have not been elucidated. In this study, we aimed to clarify the role of p62, an adapter protein in the autophagic process, as well as the nuclear factor erythroid 2-related factor 2 (Nrf2)-Kelch-like ECH-associated protein 1 (Keap1) pathway, in protecting cells from PA-induced lipotoxicity. The Nrf2-Keap1 pathway is essential for the protection of cells from oxidative stress. p62 enhances its binding to Keap1 and leads to Nrf2 activation. Here, we show that PA potentiates Keap1 degradation and thereby activates the transcription of Nrf2 target genes partially through autophagy. Furthermore, this PA-mediated Keap1 degradation depends on p62. Correspondingly, a lack of p62 attenuates the PA-mediated Nrf2 activation and increases the susceptibility of cells to oxidative stress. These results indicate that p62 plays an important role in protecting cells against lipotoxicity through Keap1 degradation-mediated Nrf2 activation. - Highlights: • PA induces Keap1 downregulation and activates Nrf2 target gene transcription. • PA-induced Keap1 degradation is partly mediated by the autophagic pathway. • PA-induced Keap1 degradation depends on p62. • Ablation of p62 exacerbates PA-mediated apoptotic cell death.

  2. Identification of an unintended consequence of Nrf2-directed cytoprotection against a key tobacco carcinogen plus a counteracting chemopreventive intervention

    Science.gov (United States)

    Paonessa, Joseph D.; Ding, Yi; Randall, Kristen L.; Munday, Rex; Argoti, Dayana; Vouros, Paul; Zhang, Yuesheng

    2011-01-01

    Nrf2 is a major cytoprotective gene and is a key chemopreventive target against cancer and other diseases. Here we show that Nrf2 faces a dilemma in defense against 4-aminobiphenyl (ABP), a major human bladder carcinogen from tobacco smoke and other environmental sources. While Nrf2 protected mouse liver against ABP (which is metabolically activated in liver), the bladder level of N-(deoxyguanosin-8-yl)-4-aminobiphenyl (dG-C8-ABP), the predominant ABP-DNA adduct formed in bladder cells and tissues, was markedly higher in Nrf2+/+ mice than in Nrf2−/− mice after ABP exposure. Notably, Nrf2 protected bladder cells against ABP in vitro. Mechanistic investigations showed that the dichotomous effects of Nrf2 could be explained at least partly by upregulation of UDP-glucuronosyltransferase (UGT). Nrf2 promoted conjugation of ABP with glucuronic acid in the liver, increasing urinary excretion of the conjugate. While glucuronidation of ABP and its metabolites is a detoxification process, these conjugates, which are excreted in urine, are known to be unstable in acidic urine, leading to delivery of the parent compounds to bladder. Hence, while higher liver UGT activity may protect the liver against ABP it increases bladder exposure to ABP. These findings raise concerns of potential bladder toxicity when Nrf2-activating chemopreventive agents are used in humans exposed to ABP, especially in smokers. We further demonstrate that 5,6-dihydrocyclopenta[c][1,2]-dithiole-3(4H)-thione (CPDT) significantly inhibits dG-C8-ABP formation in bladder cells and tissues, but does not appear to significantly modulate ABP-catalyzing UGT in liver. Thus, CPDT exemplifies a counteracting solution to the dilemma posed by Nrf2. PMID:21487034

  3. Vitamin E deficiency depressed fish growth, disease resistance, and the immunity and structural integrity of immune organs in grass carp (Ctenopharyngodon idella): Referring to NF-κB, TOR and Nrf2 signaling.

    Science.gov (United States)

    Pan, Jia-Hong; Feng, Lin; Jiang, Wei-Dan; Wu, Pei; Kuang, Sheng-Yao; Tang, Ling; Zhang, Yong-An; Zhou, Xiao-Qiu; Liu, Yang

    2017-01-01

    This study investigated the effects of dietary vitamin E on growth, disease resistance and the immunity and structural integrity of head kidney, spleen and skin in grass carp (Ctenopharyngodon idella). The fish were fed six diets containing graded levels of vitamin E (0, 45, 90, 135, 180 and 225 mg/kg diet) for 10 weeks. Subsequently, a challenge test was conducted by injection of Aeromonas hydrophila. The results showed that compared with optimal vitamin E supplementation, vitamin E deficiency caused depressed growth, poor survival rates and increased skin lesion morbidity in grass carp. Meanwhile, vitamin E deficiency decreased lysozyme and acid phosphatase activities, complement component 3 and complement component 4 contents in the head kidney, spleen and skin of grass carp (P vitamin E deficiency down-regulated antimicrobial peptides (Hepcidin, liver-expressed antimicrobial peptide-2A, -2B, β-defensin), IL-10, TGFβ1, IκBα, TOR and S6K1 mRNA levels (P vitamin E deficiency caused oxidative damage, decreased superoxide dismutase (SOD), glutathione peroxidase (GPx), catalase (CAT) and glutathione reductase (GR) activities, and down-regulated the mRNA levels of antioxidant enzymes and signaling molecules Nrf2 (P Vitamin E deficiency also induced apoptosis by up-regulating capase-2, -3, -7, and -8 mRNA levels in the head kidney, spleen and skin of grass carp. In conclusion, this study indicated that dietary vitamin E deficiency depressed fish growth, impaired the immune function and disturbed the structural integrity of the head kidney, spleen and skin in grass carp, but optimal vitamin E supplementation can reverse those negative effects in fish. The optimal vitamin E requirements for young grass carp (266.39-1026.63 g) to achieve optimal growth performance and disease resistance based on the percent weight gain (PWG) and skin lesion morbidity were estimated to be 116.2 and 130.9 mg/kg diet, respectively. Meanwhile, based on immune indicator (LA activity

  4. Estrogen increases Nrf2 activity through activation of the PI3K pathway in MCF-7 breast cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Juanjuan, E-mail: jwu32@emory.edu [Department of Gynecology and Obstetrics, Emory University School of Medicine, 101 Woodruff Circle, Suite 4211 WMB, Atlanta, GA 30322 (United States); Williams, Devin [Department of Obstetrics and Gynecology, Morehouse School of Medicine, Atlanta, GA 30310 (United States); Walter, Grant A. [Department of Gynecology and Obstetrics, Emory University School of Medicine, 101 Woodruff Circle, Suite 4211 WMB, Atlanta, GA 30322 (United States); Thompson, Winston E. [Department of Obstetrics and Gynecology, Morehouse School of Medicine, Atlanta, GA 30310 (United States); Sidell, Neil [Department of Gynecology and Obstetrics, Emory University School of Medicine, 101 Woodruff Circle, Suite 4211 WMB, Atlanta, GA 30322 (United States)

    2014-11-01

    The actions of the transcription factor Nuclear factor erythroid 2-related factor (Nrf2) in breast cancer have been shown to include both pro-oncogenic and anti-oncogenic activities which is influenced, at least in part, by the hormonal environment. However, direct regulation of Nrf2 by steroid hormones (estrogen and progesterone) has received only scant attention. Nrf2 is known to be regulated by its cytosolic binding protein, Kelch-like ECH-associated protein 1 (Keap1), and by a Keap1-independent mechanism involving a series of phosphorylation steps mediated by phosphatidylinositol 3-kinase (PI3K) and glycogen synthase kinase 3 beta (GSK3β). Here, we report that estrogen (E2) increases Nrf2 activity in MCF7 breast cancer cells through activation of the PI3K/GSK3β pathway. Utilizing antioxidant response element (ARE)-containing luciferase reporter constructs as read-outs for Nrf2 activity, our data indicated that E2 increased ARE activity >14-fold and enhanced the action of the Nrf2 activators, tertiary butylhydroquinone (tBHQ) and sulforaphane (Sul) 4 to 9 fold compared with cells treated with tBHQ or Sul as single agents. This activity was shown to be an estrogen receptor-mediated phenomenon and was antagonized by progesterone. In addition to its action on the reporter constructs, mRNA and protein levels of heme oxygenase 1, an endogenous target gene of Nrf2, was markedly upregulated by E2 both alone and in combination with tBHQ. Importantly, E2-induced Nrf2 activation was completely suppressed by the PI3K inhibitors LY294002 and Wortmannin while the GSK3β inhibitor CT99021 upregulated Nrf2 activity. Confirmation that E2 was, at least partly, acting through the PI3K/GSK3β pathway was indicated by our finding that E2 increased the phosphorylation status of both GSK3β and Akt, a well-characterized downstream target of PI3K. Together, these results demonstrate a novel mechanism by which E2 can regulate Nrf2 activity in estrogen receptor-positive breast cancer

  5. Nrf2 activation prevents cadmium-induced acute liver injury

    International Nuclear Information System (INIS)

    Wu, Kai C.; Liu, Jie J.; Klaassen, Curtis D.

    2012-01-01

    Oxidative stress plays an important role in cadmium-induced liver injury. Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcription factor that up-regulates cytoprotective genes in response to oxidative stress. To investigate the role of Nrf2 in cadmium-induced hepatotoxicity, Nrf2-null mice, wild-type mice, kelch-like ECH-associated protein 1-knockdown (Keap1-KD) mice with enhanced Nrf2, and Keap1-hepatocyte knockout (Keap1-HKO) mice with maximum Nrf2 activation were treated with cadmium chloride (3.5 mg Cd/kg, i.p.). Blood and liver samples were collected 8 h thereafter. Cadmium increased serum alanine aminotransferase (ALT) and lactate dehydrogenase (LDH) activities, and caused extensive hepatic hemorrhage and necrosis in the Nrf2-null mice. In contrast, Nrf2-enhanced mice had lower serum ALT and LDH activities and less morphological alternations in the livers than wild-type mice. H 2 DCFDA (2′,7′-dichlorodihydrofluoresein diacetate) staining of primary hepatocytes isolated from the four genotypes of mice indicated that oxidative stress was higher in Nrf2-null cells, and lower in Nrf2-enhanced cells than in wild-type cells. To further investigate the mechanism of the protective effect of Nrf2, mRNA of metallothionein (MT) and other cytoprotective genes were determined. Cadmium markedly induced MT-1 and MT-2 in livers of all four genotypes of mice. In contrast, genes involved in glutathione synthesis and reducing reactive oxygen species, including glutamate-cysteine ligase (Gclc), glutathione peroxidase-2 (Gpx2), and sulfiredoxin-1 (Srxn-1) were only induced in Nrf2-enhanced mice, but not in Nrf2-null mice. In conclusion, the present study shows that Nrf2 activation prevents cadmium-induced oxidative stress and liver injury through induction of genes involved in antioxidant defense rather than genes that scavenge Cd. -- Highlights: ► Cadmium caused extensive hepatic hemorrhage and necrosis in Nrf2-null mice. ► Keap1-KD and Keap1-HKO mice were

  6. Nrf2 activation prevents cadmium-induced acute liver injury

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Kai C. [Department of Pharmacology, Toxicology, and Therapeutics, University of Kansas Medical Center, Kansas City, KS (United States); Liu, Jie J. [Department of Internal Medicine, University of Kansas Medical Center, Kansas City, KS (United States); Klaassen, Curtis D., E-mail: cklaasse@kumc.edu [Department of Internal Medicine, University of Kansas Medical Center, Kansas City, KS (United States)

    2012-08-15

    Oxidative stress plays an important role in cadmium-induced liver injury. Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcription factor that up-regulates cytoprotective genes in response to oxidative stress. To investigate the role of Nrf2 in cadmium-induced hepatotoxicity, Nrf2-null mice, wild-type mice, kelch-like ECH-associated protein 1-knockdown (Keap1-KD) mice with enhanced Nrf2, and Keap1-hepatocyte knockout (Keap1-HKO) mice with maximum Nrf2 activation were treated with cadmium chloride (3.5 mg Cd/kg, i.p.). Blood and liver samples were collected 8 h thereafter. Cadmium increased serum alanine aminotransferase (ALT) and lactate dehydrogenase (LDH) activities, and caused extensive hepatic hemorrhage and necrosis in the Nrf2-null mice. In contrast, Nrf2-enhanced mice had lower serum ALT and LDH activities and less morphological alternations in the livers than wild-type mice. H{sub 2}DCFDA (2′,7′-dichlorodihydrofluoresein diacetate) staining of primary hepatocytes isolated from the four genotypes of mice indicated that oxidative stress was higher in Nrf2-null cells, and lower in Nrf2-enhanced cells than in wild-type cells. To further investigate the mechanism of the protective effect of Nrf2, mRNA of metallothionein (MT) and other cytoprotective genes were determined. Cadmium markedly induced MT-1 and MT-2 in livers of all four genotypes of mice. In contrast, genes involved in glutathione synthesis and reducing reactive oxygen species, including glutamate-cysteine ligase (Gclc), glutathione peroxidase-2 (Gpx2), and sulfiredoxin-1 (Srxn-1) were only induced in Nrf2-enhanced mice, but not in Nrf2-null mice. In conclusion, the present study shows that Nrf2 activation prevents cadmium-induced oxidative stress and liver injury through induction of genes involved in antioxidant defense rather than genes that scavenge Cd. -- Highlights: ► Cadmium caused extensive hepatic hemorrhage and necrosis in Nrf2-null mice. ► Keap1-KD and Keap1-HKO mice

  7. Inorganic Arsenic Induces NRF2-Regulated Antioxidant Defenses in Both Cerebral Cortex and Hippocampus in Vivo.

    Science.gov (United States)

    Zhang, Yang; Duan, Xiaoxu; Li, Jinlong; Zhao, Shuo; Li, Wei; Zhao, Lu; Li, Wei; Nie, Huifang; Sun, Guifang; Li, Bing

    2016-08-01

    Inorganic arsenic is reported to induce the reactive oxygen species-mediated oxidative stress, which is supposed to be one of the main mechanisms of arsenic-related neurological diseases. Nuclear factor erythroid 2-related factor 2 (NRF2), a master regulator of antioxidant defense systems, up-regulates the expression of target genes to fight against oxidative damages caused by harmful substances, including metals. In the present study, mice were used as a model to investigate the oxidative stress levels and the expressions of NRF2-regulated antioxidant substances in both cerebral cortex and hippocampus with 5, 10 and 20 mg/kg NaAsO2 exposure intra-gastrically. Our results showed that acute NaAsO2 treatment resulted in decreased total anti-oxidative capacity (T-AOC) and increased maleic dialdehyde production in the nervous system. We also detected rapidly elevation of NRF2 protein levels by enhancement of Nrf2 transcription, especially at 20 mg/kg NaAsO2 exposure group. In the meantime, mRNA and protein levels of Nrf2 encoding antioxidant enzymes heme oxygenase-1 (HO-1), NAD(P)H: quinine oxidoreductase 1 (NQO1) and glutathione S-transferase (GST) were consistently elevated time- and dose-dependently both in the cerebral cortex and hippocampus. Taken together, the presence study demonstrated the activation of NRF2 pathway, an early antioxidant defensive response, in both cerebral cortex and hippocampus upon inorganic arsenic (iAs) exposure in vivo. A better knowledge on the roles of NRF2 pathway in maintaining cellular redox homeostasis would be helpful for the strategies on improvement of neurotoxicity related to this metalloid.

  8. Nrf2 protects against 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD)-induced oxidative injury and steatohepatitis

    International Nuclear Information System (INIS)

    Lu Hong; Cui Wei; Klaassen, Curtis D.

    2011-01-01

    Previous studies demonstrate that Nrf2, a master regulator of antioxidative responses, is essential in mediating induction of many antioxidative enzymes by acute activation of the AhR. However, the role of Nrf2 in protecting against oxidative stress and DNA damage induced by sustained activation of the AhR remains unknown and was investigated herein. Tissue and blood samples were collected from wild-type (WT) and Nrf2-null mice 21 days after administration of a low-toxic dose (10 μg/kg ip) of TCDD. Only Nrf2-null mice lost body weight after TCDD treatment; however, blood levels of ALT were not markedly changed in either genotype, indicating a lack of extensive necrosis. Compared to livers of TCDD-treated WT mice, livers of TCDD-treated Nrf2-null mice had: 1) degenerated hepatocytes, lobular inflammation, marked fat accumulation, and higher mRNA expression of inflammatory and fibrotic genes; 2) depletion of glutathione, elevation in lipid peroxidation and marker of DNA damage; 3) attenuated induction of phase-II enzymes Nqo1, Gsta1/2, and Ugt2b35 mRNAs, but higher induction of cytoprotective Ho-1, Prdx1, Trxr1, Gclc, and Epxh1 mRNAs; 4) higher mRNA expression of Fgf21 and triglyceride-synthesis genes, but down-regulation of bile-acid-synthesis genes and cholesterol-efflux transporters; and 5) trend of induction/activation of c-jun and NF-kB. Additionally, TCDD-treated Nrf2-null mice had impaired adipogenesis in white adipose tissue. In conclusion, Nrf2 protects livers of mice against oxidative stress, DNA damage, and steatohepatitis induced by TCDD-mediated sustained activation of the AhR. The aggravated hepatosteatosis in TCDD-treated Nrf2-null mice is due to increased lipogenesis in liver and impaired lipogenesis in white adipose tissue. - Highlights: → TCDD causes hepatosteatosis and induction of Nrf2-target genes in wild-type mice. → TCDD causes weight loss, oxidative injury, and steatohepatitis in Nrf2-null mice. → Livers of TCDD-treated Nrf2-null mice

  9. Alteration of Nrf2 and Glutamate Cysteine Ligase expression contribute to lesions growth and fibrogenesis in ectopic endometriosis.

    Science.gov (United States)

    Marcellin, L; Santulli, P; Chouzenoux, S; Cerles, O; Nicco, C; Dousset, B; Pallardy, M; Kerdine-Römer, S; Just, P A; Chapron, C; Batteux, F

    2017-09-01

    The redox-sensitive nuclear factor erythroid-derived 2-like 2 (NRF2) controls endogenous antioxidant enzymes' transcription and protects against oxidative damage which is triggered by inflammation and known to favor progression of endometriosis. Glutamate Cysteine Ligase (GCL), a target gene of NRF2, is the first enzyme in the synthesis cascade of glutathione, an important endogenous antioxidant. Sixty-one patients, with thorough surgical examination of the abdominopelvic cavity, were recruited for the study: 31 with histologically-proven endometriosis and 30 disease-free women taken as controls. Expressions of NRF2 and GCL were investigated by quantitative RT-PCR and immunohistochemistry in eutopic and ectopic endometria from endometriosis-affected women and in endometrium of disease-free women. Ex vivo stromal and epithelial cells were extracted and purified from endometrial and endometriotic biopsies to explore expression of NRF2 and GCL in both stromal and epithelial compartments by western blot. Finally, in order to strengthen the role of NRF2 in endometriosis pathogenesis, we evaluated the drop of NRF2 expression in a mouse model of endometriosis using NRF2 knockout (NRF2 -/- ) mice. The mRNA levels of NRF2 and GCL were significantly lower in ectopic endometria of endometriosis-affected women compared to eutopic endometria of disease-free women. The immunohistochemical analysis confirmed the decreased expression of both NRF2 and GCL in ectopic endometriotic tissues compared to eutopic endometria of endometriosis-affected and disease-free women. Immunoblotting revealed a significant decreased of NRF2 and GCL expression in epithelial and stroma cells from ectopic lesions of endometriosis-affected women compared to eutopic endometria from controls. Using a murine model of endometriosis, NRF2 -/- implants were more fibrotic compared to wild-type with an increased weight and volume. These findings indicate that expression of the transcription factor NRF2 and its

  10. Novel cytoprotective mechanism of anti-parkinsonian drug deprenyl: PI3K and Nrf2-derived induction of antioxidative proteins

    International Nuclear Information System (INIS)

    Nakaso, Kazuhiro; Nakamura, Chiharu; Sato, Hiromi; Imamura, Keiko; Takeshima, Takao; Nakashima, Kenji

    2006-01-01

    Neuroprotection has received considerable attention as a strategy for the treatment of Parkinson's disease (PD). Deprenyl (Selegiline) is a promising candidate for neuroprotection; however, its cytoprotective mechanism has not been fully clarified. Here, we report a novel cytoprotective mechanism of deprenyl involving PI3K and Nrf2-mediated induction of oxidative stress-related proteins. Deprenyl increased the expression of HO-1, PrxI, TrxI, TrxRxI, γGCS, and p62/A170 in SH-SY5Y cells. Deprenyl also induced the nuclear accumulation of Nrf2 and increased the binding activity of Nrf2 to the enhancer region of human genomic HO-1. The Nrf2-mediated induction of antioxidative molecules was controlled by PI3K. Indeed, furthermore, neurotrophin receptor TrkB was identified as an upstream signal for PI3K-Nrf2 activation by deprenyl. These results suggest that the cytoprotective effect of deprenyl is, in part, dependent on Nrf2-mediated induction of antioxidative proteins, suggesting that activation of the PI3K-Nrf2 system may be a useful therapeutic strategy for PD

  11. Sulforaphane Prevents Angiotensin II-Induced Testicular Cell Death via Activation of NRF2

    Directory of Open Access Journals (Sweden)

    Yonggang Wang

    2017-01-01

    Full Text Available Although angiotensin II (Ang II was reported to facilitate sperm motility and intratesticular sperm transport, recent findings shed light on the efficacy of Ang II in stimulating inflammatory events in testicular peritubular cells, effect of which may play a role in male infertility. It is still unknown whether Ang II can induce testicular apoptotic cell death, which may be a more direct action of Ang II in male infertility. Therefore, the present study aims to determine whether Ang II can induce testicular apoptotic cell death and whether this action can be prevented by sulforaphane (SFN via activating nuclear factor (erythroid-derived 2-like 2 (NRF2, the governor of antioxidant-redox signalling. Eight-week-old male C57BL/6J wild type (WT and Nrf2 gene knockout mice were treated with Ang II, in the presence or absence of SFN. In WT mice, SFN activated testicular NRF2 expression and function, along with a marked attenuation in Ang II-induced testicular oxidative stress, inflammation, endoplasmic reticulum stress, and apoptotic cell death. Deletion of the Nrf2 gene led to a complete abolishment of these efficacies of SFN. The present study indicated that Ang II may result in testicular apoptotic cell death, which can be prevented by SFN via the activation of NRF2.

  12. Nrf2-peroxiredoxin I axis in polymorphous adenocarcinoma is associated with low matrix metalloproteinase 2 level.

    Science.gov (United States)

    Brod, J M; Demasi, Ana Paula Dias; Montalli, V A; Teixeira, L N; Furuse, C; Aguiar, M C; Soares, A B; Sperandio, M; Araujo, V C

    2017-12-01

    Polymorphous adenocarcinoma (PAC) is a malignant epithelial neoplasm that affects almost exclusively the minor salivary glands, generally described as having a relatively good prognosis. Aberrant nuclear factor erythroid 2 (NF-E2)-related factor (Nrf2) activation in tumor cells has been associated with induction of antioxidant enzymes, such as peroxiredoxin I (Prx I) and increased matrix metalloproteinase (MMP) expression. In this context, the aim of the present study was to evaluate the expression of Nrf2 and correlate it with Prx I and MMP-2 secretion in PAC. Thirty-one cases of PAC from oral biopsies were selected and immunohistochemically analyzed for Nrf2 and Prx I. MMP-2 quantification was performed on primary cell cultures derived from PAC. Oral squamous cell carcinoma (OSCC) cell cultures were used as control. A high immunoexpression of Nrf2 was observed in both the cytoplasm and the nucleus of neoplastic cells from PAC. Nuclear staining for Nrf2 suggested its activation in the majority of the PAC cells, which was confirmed by the high expression of its target gene, Prx I. Quantification of MMP-2 secretion showed lower levels in PAC cell cultures when compared to OSCC cell cultures (p high-grade malignancies, such relationship is not infallible and, in fact, the opposite may occur in low-grade tumors, such as PAC of minor salivary glands.

  13. Marine Natural Product Honaucin A Attenuates Inflammation by Activating the Nrf2-ARE Pathway.

    Science.gov (United States)

    Mascuch, Samantha J; Boudreau, Paul D; Carland, Tristan M; Pierce, N Tessa; Olson, Joshua; Hensler, Mary E; Choi, Hyukjae; Campanale, Joseph; Hamdoun, Amro; Nizet, Victor; Gerwick, William H; Gaasterland, Teresa; Gerwick, Lena

    2018-03-23

    The cyanobacterial marine natural product honaucin A inhibits mammalian innate inflammation in vitro and in vivo. To decipher its mechanism of action, RNA sequencing was used to evaluate differences in gene expression of cultured macrophages following honaucin A treatment. This analysis led to the hypothesis that honaucin A exerts its anti-inflammatory activity through activation of the cytoprotective nuclear erythroid 2-related factor 2 (Nrf2)-antioxidant response element/electrophile response element (ARE/EpRE) signaling pathway. Activation of this pathway by honaucin A in cultured human MCF7 cells was confirmed using an Nrf2 luciferase reporter assay. In vitro alkylation experiments with the natural product and N-acetyl-l-cysteine suggest that honaucin A activates this pathway through covalent interaction with the sulfhydryl residues of the cytosolic repressor protein Keap1. Honaucin A presents a potential therapeutic lead for diseases with an inflammatory component modulated by Nrf2-ARE.

  14. Suppression of NRF2–ARE activity sensitizes chemotherapeutic agent-induced cytotoxicity in human acute monocytic leukemia cells

    International Nuclear Information System (INIS)

    Peng, Hui; Wang, Huihui; Xue, Peng; Hou, Yongyong; Dong, Jian; Zhou, Tong; Qu, Weidong; Peng, Shuangqing; Li, Jin; Carmichael, Paul L.; Nelson, Bud; Clewell, Rebecca; Zhang, Qiang; Andersen, Melvin E.; Pi, Jingbo

    2016-01-01

    Nuclear factor erythroid 2-related factor 2 (NRF2), a master regulator of the antioxidant response element (ARE)-dependent transcription, plays a pivotal role in chemical detoxification in normal and tumor cells. Consistent with previous findings that NRF2–ARE contributes to chemotherapeutic resistance of cancer cells, we found that stable knockdown of NRF2 by lentiviral shRNA in human acute monocytic leukemia (AML) THP-1 cells enhanced the cytotoxicity of several chemotherapeutic agents, including arsenic trioxide (As 2 O 3 ), etoposide and doxorubicin. Using an ARE-luciferase reporter expressed in several human and mouse cells, we identified a set of compounds, including isonicotinic acid amides, isoniazid and ethionamide, that inhibited NRF2–ARE activity. Treatment of THP-1 cells with ethionamide, for instance, significantly reduced mRNA expression of multiple ARE-driven genes under either basal or As 2 O 3 -challenged conditions. As determined by cell viability and cell cycle, suppression of NRF2–ARE by ethionamide also significantly enhanced susceptibility of THP-1 and U937 cells to As 2 O 3 -induced cytotoxicity. In THP-1 cells, the sensitizing effect of ethionamide on As 2 O 3 -induced cytotoxicity was highly dependent on NRF2. To our knowledge, the present study is the first to demonstrate that ethionamide suppresses NRF2–ARE signaling and disrupts the transcriptional network of the antioxidant response in AML cells, leading to sensitization to chemotherapeutic agents. - Highlights: • Identification of novel inhibitors of ARE-dependent transcription • Suppression of NRF2–ARE sensitizes THP-1 cells to chemotherapy. • Ethionamide suppresses ARE-dependent transcriptional activity. • Ethionamide and isoniazid increase the cytotoxicity of As 2 O 3 in AML cells. • Sensitization of THP-1 cells to As 2 O 3 toxicity by ethionamide is NRF2-dependent.

  15. Effects of trigonelline inhibition of the Nrf2 transcription factor in vitro on Echinococcus granulosus.

    Science.gov (United States)

    Qin, Wenjuan; Guan, Dongfang; Ma, Rongji; Yang, Rentan; Xing, Guoqiang; Shi, Hongjuan; Tang, Guangyao; Li, Jiajie; Lv, Hailong; Jiang, Yufeng

    2017-08-01

    The aim of this study was to investigate the impact of trigonelline (TRG) on Echinococcus granulosus, and to explore the inhibition impact of nuclear factor erythroid-2-related factor 2 (Nrf2) signaling pathway on E. granulosus protoscoleces. Echinococcus granulosus protoscoleces were incubated with various concentrations of TRG, and then Nrf2 protein expression and its localization in protoscoleces were detected by western blot analysis and immunofluorescence assay, respectively. Reactive oxygen species (ROS) level in protoscoleces was measured using ROS detection kit. Caspase-3 activity was measured using a caspase-3 activity assay kit, and NAD(P)H quinone oxidoreductase (NQO)-1 and heme oxygenase (HO)-1 activities in protoscoleces were measured by ELISA. The effect of TRG on protoscoleces viability was investigated using 0.1% eosin staining, and ultrastructural alterations in protoscoleces were examined by scanning electron microscopy (SEM). Immunolocalization experiment clearly showed that Nrf2 protein was predominantly present in cells of protoscoleces. TRG treatment reduced NQO-1 and HO-1 activities in protoscoleces, but could increase ROS level at early time. Protoscoleces could not survive when treated with 250 μM TRG for 12 days. SEM results showed that TRG-treated protoscoleces presented damage in the protoscoleces region, including hook deformation, lesions, and digitiform protuberance. Nrf2 protein expression was significantly decreased and caspase-3 activity was clearly increased in protoscoleces treated with TRG for 24 and 48 h, respectively, when compared with that in controls (P granulosus protoscoleces. Nrf2 protein was mainly expressed in the cells and TRG could efficiently inhibit the Nrf2 signaling pathway in E. granulosus. © The Author 2017. Published by Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. All rights reserved. For

  16. Effects of Nrf2 deficiency on arsenic metabolism in mice.

    Science.gov (United States)

    Wang, Huihui; Zhu, Jiayu; Li, Lu; Li, Yongfang; Lv, Hang; Xu, Yuanyuan; Sun, Guifan; Pi, Jingbo

    2017-12-15

    Inorganic arsenic (iAs) is a known toxicant and carcinogen. Worldwide arsenic exposure has become a threat to human health. The severity of arsenic toxicity is strongly correlated with the speed of arsenic metabolism (methylation) and clearance. Furthermore, oxidative stress is recognized as a major mechanism for arsenic-induced toxicity. Nuclear factor-E2-related factor 2 (Nrf2), a key regulator in cellular adaptive antioxidant response, is clearly involved in alleviation of arsenic-induced oxidative damage. Multiple studies demonstrate that Nrf2 deficiency mice are more vulnerable to arsenic-induced intoxication. However, what effect Nrf2 deficiency might have on arsenic metabolism in mice is still unknown. In the present study, we measured the key enzymes involved in arsenic metabolism in Nrf2-WT and Nrf2-KO mice. Our results showed that basal transcript levels of glutathione S-transferase omega 2 (Gsto2) were significantly higher and GST mu 1 (Gstm1) lower in Nrf2-KO mice compared to Nrf2-WT control. Arsenic speciation and methylation rate in liver and urine was then studied in mice treated with 5mg/kg sodium arsenite for 12h. Although there were some alterations in arsenic metabolism enzymes between Nrf2-WT and Nrf2-KO mice, the Nrf2 deficiency had no significant effect on arsenic methylation. These results suggest that the Nrf2-KO mice are more sensitive to arsenic than Nrf2-WT mainly because of differences in adaptive antioxidant detoxification capacity rather than arsenic methylation capacity. Copyright © 2017. Published by Elsevier Inc.

  17. Translational control of Nrf2 within the open reading frame

    International Nuclear Information System (INIS)

    Perez-Leal, Oscar; Barrero, Carlos A.; Merali, Salim

    2013-01-01

    Highlights: •Identification of a novel Nrf2 translational repression mechanism. •The repressor is within the 3′ portion of the Nrf2 ORF. •The translation of Nrf2 or eGFP is reduced by the regulatory element. •The translational repression can be reversed with synonymous codon substitutions. •The molecular mechanism requires the mRNA sequence, but not the encoded amino acids. -- Abstract: Nuclear Factor Erythroid 2-Related Factor 2 (Nrf2) is a transcription factor that is essential for the regulation of an effective antioxidant and detoxifying response. The regulation of its activity can occur at transcription, translation and post-translational levels. Evidence suggests that under environmental stress conditions, new synthesis of Nrf2 is required – a process that is regulated by translational control and is not fully understood. Here we described the identification of a novel molecular process that under basal conditions strongly represses the translation of Nrf2 within the open reading frame (ORF). This mechanism is dependent on the mRNA sequence within the 3′ portion of the ORF of Nrf2 but not in the encoded amino acid sequence. The Nrf2 translational repression can be reversed with the use of synonymous codon substitutions. This discovery suggests an additional layer of control to explain the reason for the low Nrf2 concentration under quiescent state

  18. NRF2 Protection against Liver Injury Produced by Various Hepatotoxicants

    Directory of Open Access Journals (Sweden)

    Jie Liu

    2013-01-01

    Full Text Available To investigate the role of Nrf2 as a master defense against the hepatotoxicity produced by various chemicals, Nrf2-null, wild-type, Keap1-knock down (Keap1-Kd and Keap1-hepatocyte knockout (Keap1-HKO mice were used as a “graded Nrf2 activation” model. Mice were treated with 14 hepatotoxicants at appropriate doses, and blood and liver samples were collected thereafter (6 h to 7 days depending on the hepatotoxicant. Graded activation of Nrf2 offered a Nrf2-dependent protection against the hepatotoxicity produced by carbon tetrachloride, acetaminophen, microcystin, phalloidin, furosemide, cadmium, and lithocholic acid, as evidenced by serum alanine aminotransferase (ALT activities and by histopathology. Nrf2 activation also offered moderate protection against liver injury produced by ethanol, arsenic, bromobenzene, and allyl alcohol but had no effects on the hepatotoxicity produced by D-galactosamine/endotoxin and the Fas ligand antibody Jo-2. Graded Nrf2 activation reduced the expression of inflammatory genes (MIP-2, mKC, IL-1β, IL-6, and TNFα, oxidative stress genes (Ho-1, Egr1, ER stress genes (Gadd45 and Gadd153, and genes encoding cell death (Noxa, Bax, Bad, and caspase3. Thus, this study demonstrates that Nrf2 prevents the liver from many, but not all, hepatotoxicants. The Nrf2-mediated protection is accompanied by induction of antioxidant genes, suppression of inflammatory responses, and attenuation of oxidative stress.

  19. Nrf2 Inhibits Periodontal Ligament Stem Cell Apoptosis under Excessive Oxidative Stress

    Directory of Open Access Journals (Sweden)

    Yanli Liu

    2017-05-01

    Full Text Available The present study aimed to analyze novel mechanisms underlying Nrf2-mediated anti-apoptosis in periodontal ligament stem cells (PDLSCs in the periodontitis oxidative microenvironment. We created an oxidative stress model with H2O2-treated PDLSCs. We used real-time PCR, Western blotting, TUNEL staining, fluorogenic assay and transfer genetics to confirm the degree of oxidative stress and apoptosis as well as the function of nuclear factor-erythroid 2-related factor 2 (Nrf2. We demonstrated that with upregulated levels of reactive oxygen species (ROS and malondialdehyde (MDA, the effect of oxidative stress was obvious under H2O2 treatment. Oxidative molecules were altered after the H2O2 exposure, whereby the signaling of Nrf2 was activated with an increase in its downstream effectors, heme oxygenase-1 (HO-1, NAD(PH:quinone oxidoreductase 1 (NQO1 and γ-glutamyl cysteine synthetase (γ-GCS. Additionally, the apoptosis levels gradually increased with oxidative stress by the upregulation of caspase-9, caspase-3, Bax and c-Fos levels in addition to the downregulation of Bcl-2. However, there was no alterations in levels of caspase-8. The enhanced antioxidant effect could not mitigate the occurrence of apoptosis. Furthermore, Nrf2 overexpression effectively improved the anti-oxidative levels and increased cell proliferation. At the same time, overexpression effectively restrained TUNEL staining and decreased the molecular levels of caspase-9, caspase-3, Bax and c-Fos, but not that of caspase-8. In contrast, silencing the expression of Nrf2 levels had the opposite effect. Collectively, Nrf2 alleviates PDLSCs via its effects on regulating oxidative stress and anti-intrinsic apoptosis by the activation of oxidative enzymes.

  20. Licochalcone A Upregulates Nrf2 Antioxidant Pathway and Thereby Alleviates Acetaminophen-Induced Hepatotoxicity

    Directory of Open Access Journals (Sweden)

    Hongming Lv

    2018-03-01

    Full Text Available Acetaminophen (APAP overdose-induced fatal hepatotoxicity is majorly characterized by overwhelmingly increased oxidative stress while enhanced nuclear factor-erythroid 2-related factor 2 (Nrf2 is involved in prevention of hepatotoxicity. Although Licochalcone A (Lico A upregulates Nrf2 signaling pathway against oxidative stress-triggered cell injury, whether it could protect from APAP-induced hepatotoxicity by directly inducing Nrf2 activation is still poorly elucidated. This study aims to explore the protective effect of Lico A against APAP-induced hepatotoxicity and its underlying molecular mechanisms. Our findings indicated that Lico A effectively decreased tert-butyl hydroperoxide (t-BHP- and APAP-stimulated cell apoptosis, mitochondrial dysfunction and reactive oxygen species generation and increased various anti-oxidative enzymes expression, which is largely dependent on upregulating Nrf2 nuclear translocation, reducing the Keap1 protein expression, and strengthening the antioxidant response element promoter activity. Meanwhile, Lico A dramatically protected against APAP-induced acute liver failure by lessening the lethality; alleviating histopathological liver changes; decreasing the alanine transaminase and aspartate aminotransferase levels, malondialdehyde formation, myeloperoxidase level and superoxide dismutase depletion, and increasing the GSH-to-GSSG ratio. Furthermore, Lico A not only significantly modulated apoptosis-related protein by increasing Bcl-2 expression, and decreasing Bax and caspase-3 cleavage expression, but also efficiently alleviated mitochondrial dysfunction by reducing c-jun N-terminal kinase phosphorylation and translocation, inhibiting Bax mitochondrial translocation, apoptosis-inducing factor and cytochrome c release. However, Lico A-inhibited APAP-induced the lethality, histopathological changes, hepatic apoptosis, and mitochondrial dysfunction in WT mice were evidently abrogated in Nrf2-/- mice. These

  1. Andrographolide induces Nrf2 and heme oxygenase 1 in astrocytes by activating p38 MAPK and ERK.

    Science.gov (United States)

    Wong, Siew Ying; Tan, Michelle G K; Wong, Peter T H; Herr, Deron R; Lai, Mitchell K P

    2016-09-23

    Andrographolide is the major labdane diterpenoid originally isolated from Andrographis paniculata and has been shown to have anti-inflammatory and antioxidative effects. However, there is a dearth of studies on the potential therapeutic utility of andrographolide in neuroinflammatory conditions. Here, we aimed to investigate the mechanisms underlying andrographolide's effect on the expression of anti-inflammatory and antioxidant heme oxygenase-1 (HO-1) in primary astrocytes. Measurements of the effects of andrograholide on antioxidant HO-1 and its transcription factor, Nrf2, include gene expression, protein turnover, and activation of putative signaling regulators. Andrographolide potently activated Nrf2 and also upregulated HO-1 expression in primary astrocytes. Andrographolide's effects on Nrf2 seemed to be biphasic, with acute (within 1 h) reductions in Nrf2 ubiquitination efficiency and turnover rate, followed by upregulation of Nrf2 mRNA between 8 and 24 h. The acute regulation of Nrf2 by andrographolide seemed to be independent of Keap1 and partly mediated by p38 MAPK and ERK signaling. These data provide further insights into the mechanisms underlying andrographolide's effects on astrocyte-mediated antioxidant, and anti-inflammatory responses and support the further assessment of andrographolide as a potential therapeutic for neurological conditions in which oxidative stress and neuroinflammation are implicated.

  2. Dimethylfumarate attenuates restenosis after acute vascular injury by cell-specific and Nrf2-dependent mechanisms

    Directory of Open Access Journals (Sweden)

    Chang Joo Oh

    2014-01-01

    Full Text Available Excessive proliferation of vascular smooth muscle cells (VSMCs and incomplete re-endothelialization is a major clinical problem limiting the long-term efficacy of percutaneous coronary angioplasty. We tested if dimethylfumarate (DMF, an anti-psoriasis drug, could inhibit abnormal vascular remodeling via NF−E2-related factor 2 (Nrf2-NAD(PH quinone oxidoreductase 1 (NQO1 activity. DMF significantly attenuated neointimal hyperplasia induced by balloon injury in rat carotid arteries via suppression of the G1 to S phase transition resulting from induction of p21 protein in VSMCs. Initially, DMF increased p21 protein stability through an enhancement in Nrf2 activity without an increase in p21 mRNA. Later on, DMF stimulated p21 mRNA expression through a process dependent on p53 activity. However, heme oxygenase-1 (HO-1 or NQO1 activity, well-known target genes induced by Nrf2, were dispensable for the DMF induction of p21 protein and the effect on the VSMC proliferation. Likewise, DMF protected endothelial cells from TNF-α-induced apoptosis and the dysfunction characterized by decreased eNOS expression. With knock-down of Nrf2 or NQO1, DMF failed to prevent TNF-α-induced cell apoptosis and decreased eNOS expression. Also, CD31 expression, an endothelial specific marker, was restored in vivo by DMF. In conclusion, DMF prevented abnormal proliferation in VSMCs by G1 cell cycle arrest via p21 upregulation driven by Nrf2 and p53 activity, and had a beneficial effect on TNF-α-induced apoptosis and dysfunction in endothelial cells through Nrf2–NQO1 activity suggesting that DMF might be a therapeutic drug for patients with vascular disease.

  3. Early induction of NRF2 antioxidant pathway by RHBDF2 mediates rapid cutaneous wound healing.

    Science.gov (United States)

    Hosur, Vishnu; Burzenski, Lisa M; Stearns, Timothy M; Farley, Michelle L; Sundberg, John P; Wiles, Michael V; Shultz, Leonard D

    2017-04-01

    Rhomboid family protein RHBDF2, an upstream regulator of the epidermal growth factor (EGF) receptor signaling, has been implicated in cutaneous wound healing. However, the underlying molecular mechanisms are still emerging. In humans, a gain-of-function mutation in the RHBDF2 gene accelerates cutaneous wound healing in an EGFR-dependent manner. Likewise, a gain-of-function mutation in the mouse Rhbdf2 gene (Rhbdf2 cub/cub ) shows a regenerative phenotype (rapid ear-hole closure) resulting from constitutive activation of the EGFR pathway. Because the RHBDF2-regulated EGFR pathway is relevant to cutaneous wound healing in humans, we used Rhbdf2 cub/cub mice to investigate the biological networks and pathways leading to accelerated ear-hole closure, with the goal of identifying therapeutic targets potentially effective in promoting wound healing in humans. Comparative transcriptome analysis of ear pinna tissue from Rhbdf2 cub/cub and Rhbdf2 +/+ mice at 0h, 15min, 2h, and 24h post-wounding revealed an early induction of the nuclear factor E2-related factor 2 (NRF2)-mediated anti-oxidative pathway (0h and 15min), followed by the integrin-receptor aggregation pathway (2h) as early-stage events immediately and shortly after wounding in Rhbdf2 cub/cub mice. Additionally, we observed genes enriched for the Fc fragment of the IgG receptor IIIa (FCGR3A)-mediated phagocytosis pathway 24h post-wounding. Although cutaneous wound repair in healthy individuals is generally non-problematic, it can be severely impaired due to aging, diabetes, and chronic inflammation. This study suggests that activation of the NRF2-antioxidant pathway by rhomboid protein RHBDF2 might be beneficial in treating chronic non-healing wounds. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. Berberine, a natural antidiabetes drug, attenuates glucose neurotoxicity and promotes Nrf2-related neurite outgrowth

    Energy Technology Data Exchange (ETDEWEB)

    Hsu, Ya-Yun [Department of Pharmacology, School of Medicine, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Graduate Institute of Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Tseng, Yu-Ting [Graduate Institute of Natural Products, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Lo, Yi-Ching, E-mail: yichlo@kmu.edu.tw [Department of Pharmacology, School of Medicine, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Graduate Institute of Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Graduate Institute of Natural Products, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China)

    2013-11-01

    production and neuronal cell death. • BBR activates IGF-1/Akt/GSK-3β signaling under normal and high glucose conditions. • BBR enhances HO-1 and NGF expression through stimulating Nrf2 translocation. • BBR promotes neurite outgrowth through Nrf2-dependent pathway.

  5. Berberine, a natural antidiabetes drug, attenuates glucose neurotoxicity and promotes Nrf2-related neurite outgrowth

    International Nuclear Information System (INIS)

    Hsu, Ya-Yun; Tseng, Yu-Ting; Lo, Yi-Ching

    2013-01-01

    neuronal cell death. • BBR activates IGF-1/Akt/GSK-3β signaling under normal and high glucose conditions. • BBR enhances HO-1 and NGF expression through stimulating Nrf2 translocation. • BBR promotes neurite outgrowth through Nrf2-dependent pathway

  6. Age-related retinopathy in NRF2-deficient mice.

    Directory of Open Access Journals (Sweden)

    Zhenyang Zhao

    2011-04-01

    Full Text Available Cumulative oxidative damage is implicated in the pathogenesis of age-related macular degeneration (AMD. Nuclear factor erythroid 2-related factor 2 (NRF2 is a transcription factor that plays key roles in retinal antioxidant and detoxification responses. The purposes of this study were to determine whether NRF2-deficient mice would develop AMD-like retinal pathology with aging and to explore the underlying mechanisms.Eyes of both wild type and Nrf2(-/- mice were examined in vivo by fundus photography and electroretinography (ERG. Structural changes of the outer retina in aged animals were examined by light and electron microscopy, and immunofluorescence labeling. Our results showed that Nrf2(-/- mice developed age-dependent degenerative pathology in the retinal pigment epithelium (RPE. Drusen-like deposits, accumulation of lipofuscin, spontaneous choroidal neovascularization (CNV and sub-RPE deposition of inflammatory proteins were present in Nrf2(-/- mice after 12 months. Accumulation of autophagy-related vacuoles and multivesicular bodies was identified by electron microscopy both within the RPE and in Bruch's membrane of aged Nrf2(-/- mice.Our data suggest that disruption of Nfe2l2 gene increased the vulnerability of outer retina to age-related degeneration. NRF2-deficient mice developed ocular pathology similar to cardinal features of human AMD and deregulated autophagy is likely a mechanistic link between oxidative injury and inflammation. The Nrf2(-/- mice can provide a novel model for mechanistic and translational research on AMD.

  7. Nrf2 transcription factor gene regulates basal transcription of ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-10-19

    Oct 19, 2009 ... induction in the Nrf2(-/-) mouse brain. In contrast, there ... mouse brain by any of the chemicals used . Key words: .... The blots were then probed with the human SOD2 .... Nrf2, null and wild mice as part of my PhD work. I wish.

  8. Modulation of proteostasis by transcription factor NRF2 and impact in neurodegenerative diseases

    Directory of Open Access Journals (Sweden)

    Marta Pajares

    2017-04-01

    Full Text Available Neurodegenerative diseases are linked to the accumulation of specific protein aggregates, suggesting an intimate connection between injured brain and loss of proteostasis. Proteostasis refers to all the processes by which cells control the abundance and folding of the proteome thanks to a wide network that integrates the regulation of signaling pathways, gene expression and protein degradation systems. This review attempts to summarize the most relevant findings about the transcriptional modulation of proteostasis exerted by the transcription factor NRF2 (nuclear factor (erythroid-derived 2-like 2. NRF2 has been classically considered as the master regulator of the antioxidant cell response, although it is currently emerging as a key component of the transduction machinery to maintain proteostasis. As we will discuss, NRF2 could be envisioned as a hub that compiles emergency signals derived from misfolded protein accumulation in order to build a coordinated and perdurable transcriptional response. This is achieved by functions of NRF2 related to the control of genes involved in the maintenance of the endoplasmic reticulum physiology, the proteasome and autophagy.

  9. Alkylating Agent-Induced NRF2 Blocks Endoplasmic Reticulum Stress-Mediated Apoptosis via Control of Glutathione Pools and Protein Thiol Homeostasis.

    Science.gov (United States)

    Zanotto-Filho, Alfeu; Masamsetti, V Pragathi; Loranc, Eva; Tonapi, Sonal S; Gorthi, Aparna; Bernard, Xavier; Gonçalves, Rosângela Mayer; Moreira, José C F; Chen, Yidong; Bishop, Alexander J R

    2016-12-01

    Alkylating agents are a commonly used cytotoxic class of anticancer drugs. Understanding the mechanisms whereby cells respond to these drugs is key to identify means to improve therapy while reducing toxicity. By integrating genome-wide gene expression profiling, protein analysis, and functional cell validation, we herein demonstrated a direct relationship between NRF2 and Endoplasmic Reticulum (ER) stress pathways in response to alkylating agents, which is coordinated by the availability of glutathione (GSH) pools. GSH is essential for both drug detoxification and protein thiol homeostasis within the ER, thus inhibiting ER stress induction and promoting survival, an effect independent of its antioxidant role. NRF2 accumulation induced by alkylating agents resulted in increased GSH synthesis via GCLC/GCLM enzyme, and interfering with this NRF2 response by either NRF2 knockdown or GCLC/GCLM inhibition with buthionine sulfoximine caused accumulation of damaged proteins within the ER, leading to PERK-dependent apoptosis. Conversely, upregulation of NRF2, through KEAP1 depletion or NRF2-myc overexpression, or increasing GSH levels with N-acetylcysteine or glutathione-ethyl-ester, decreased ER stress and abrogated alkylating agents-induced cell death. Based on these results, we identified a subset of lung and head-and-neck carcinomas with mutations in either KEAP1 or NRF2/NFE2L2 genes that correlate with NRF2 target overexpression and poor survival. In KEAP1-mutant cancer cells, NRF2 knockdown and GSH depletion increased cell sensitivity via ER stress induction in a mechanism specific to alkylating drugs. Overall, we show that the NRF2-GSH influence on ER homeostasis implicates defects in NRF2-GSH or ER stress machineries as affecting alkylating therapy toxicity. Mol Cancer Ther; 15(12); 3000-14. ©2016 AACR. ©2016 American Association for Cancer Research.

  10. Alkylating agent induced NRF2 blocks endoplasmic reticulum stress-mediated apoptosis via control of glutathione pools and protein thiol homeostasis

    Science.gov (United States)

    Zanotto-Filho, Alfeu; Masamsetti, V. Pragathi; Loranc, Eva; Tonapi, Sonal S.; Gorthi, Aparna; Bernard, Xavier; Gonçalves, Rosângela Mayer; Moreira, José C. F.; Chen, Yidong; Bishop, Alexander J. R.

    2016-01-01

    Alkylating agents are a commonly used cytotoxic class of anticancer drugs. Understanding the mechanisms whereby cells respond to these drugs is key to identify means to improve therapy while reducing toxicity. By integrating genome-wide gene expression profiling, protein analysis and functional cell validation, we herein demonstrated a direct relationship between NRF2 and Endoplasmic Reticulum (ER) stress pathways in response to alkylating agents, which is coordinated by the availability of glutathione (GSH) pools. GSH is essential for both drug detoxification and protein thiol homeostasis within the ER, thus inhibiting ER stress induction and promoting survival; an effect independent of its antioxidant role. NRF2 accumulation induced by alkylating agents resulted in increased GSH synthesis via GCLC/GCLM enzyme, and interfering with this NRF2 response by either NRF2 knockdown or GCLC/GCLM inhibition with buthionine sulfoximine (BSO) caused accumulation of damaged proteins within the ER, leading to PERK-dependent apoptosis. Conversely, upregulation of NRF2, through KEAP1 depletion or NRF2-myc overexpression, or increasing GSH levels with N-acetylcysteine (NAC) or glutathione-ethyl-ester (GSH-E), decreased ER stress and abrogated alkylating agents-induced cell death. Based on these results, we identified a subset of lung and head-and-neck carcinomas with mutations in either KEAP1 or NRF2/NFE2L2 genes that correlate with NRF2 targets overexpression and poor survival. In KEAP1 mutant cancer cells, NRF2 knockdown and GSH depletion increased cell sensitivity via ER stress induction in a mechanism specific to alkylating drugs. Overall, we show that the NRF2-GSH influence on ER homeostasis implicates defects in NRF2-GSH or ER stress machineries as affecting alkylating therapy toxicity. PMID:27638861

  11. Absence of Nrf2 or its selective overexpression in neurons and muscle does not affect survival in ALS-linked mutant hSOD1 mouse models.

    Directory of Open Access Journals (Sweden)

    Marcelo R Vargas

    Full Text Available The nuclear factor erythroid 2-related factor 2 (Nrf2 governs the expression of antioxidant and phase II detoxifying enzymes. Nrf2 activation can prevent or reduce cellular damage associated with several types of injury in many different tissues and organs. Dominant mutations in Cu/Zn-superoxide dismutase (SOD1 cause familial forms of amyotrophic lateral sclerosis (ALS, a fatal disorder characterized by the progressive loss of motor neurons and subsequent muscular atrophy. We have previously shown that Nrf2 activation in astrocytes delays neurodegeneration in ALS mouse models. To further investigate the role of Nrf2 in ALS we determined the effect of absence of Nrf2 or its restricted overexpression in neurons or type II skeletal muscle fibers on symptoms onset and survival in mutant hSOD1 expressing mice. We did not observe any detrimental effect associated with the lack of Nrf2 in two different mutant hSOD1 animal models of ALS. However, restricted Nrf2 overexpression in neurons or type II skeletal muscle fibers delayed disease onset but failed to extend survival in hSOD1(G93A mice. These results highlight the concept that not only the pharmacological target but also the cell type targeted may be relevant when considering a Nrf2-mediated therapeutic approach for ALS.

  12. Berberine activates Nrf2 nuclear translocation and inhibits apoptosis induced by high glucose in renal tubular epithelial cells through a phosphatidylinositol 3-kinase/Akt-dependent mechanism.

    Science.gov (United States)

    Zhang, Xiuli; Liang, Dan; Lian, Xu; Jiang, Yan; He, Hui; Liang, Wei; Zhao, Yue; Chi, Zhi-Hong

    2016-06-01

    Apoptosis of tubular epithelial cells is a major feature of diabetic kidney disease, and hyperglycemia triggers the generation of free radicals and oxidant stress in tubular cells. Berberine (BBR) is identified as a potential anti-diabetic herbal medicine due to its beneficial effects on insulin sensitivity, glucose metabolism and glycolysis. In this study, the underlying mechanisms involved in the protective effects of BBR on high glucose-induced apoptosis were explored using cultured renal tubular epithelial cells (NRK-52E cells) and human kidney proximal tubular cell line (HK-2 cells). We identified the pivotal role of phosphatidylinositol 3-kinase (PI3K)/Akt in BBR cellular defense mechanisms and revealed the novel effect of BBR on nuclear factor (erythroid-derived 2)-related factor-2 (Nrf2) and heme oxygenase (HO)-1 in NRK-52E and HK-2 cells. BBR attenuated reactive oxygen species production, antioxidant defense (GSH and SOD) and oxidant-sensitive proteins (Nrf2 and HO-1), which also were blocked by LY294002 (an inhibitor of PI3K) in HG-treated NRK-52E and HK-2 cells. Furthermore, BBR improved mitochondrial function by increasing mitochondrial membrane potential. BBR-induced anti-apoptotic function was demonstrated by decreasing apoptotic proteins (cytochrome c, Bax, caspase3 and caspase9). All these findings suggest that BBR exerts the anti-apoptosis effects through activation of PI3K/Akt signal pathways and leads to activation of Nrf2 and induction of Nrf2 target genes, and consequently protecting the renal tubular epithelial cells from HG-induced apoptosis.

  13. Dose-dependent transitions in Nrf2-mediated adaptive response and related stress responses to hypochlorous acid in mouse macrophages

    International Nuclear Information System (INIS)

    Woods, Courtney G.; Fu Jingqi; Xue Peng; Hou Yongyong; Pluta, Linda J.; Yang Longlong; Zhang Qiang; Thomas, Russell S.; Andersen, Melvin E.; Pi Jingbo

    2009-01-01

    Hypochlorous acid (HOCl) is potentially an important source of cellular oxidative stress. Human HOCl exposure can occur from chlorine gas inhalation or from endogenous sources of HOCl, such as respiratory burst by phagocytes. Transcription factor Nrf2 is a key regulator of cellular redox status and serves as a primary source of defense against oxidative stress. We recently demonstrated that HOCl activates Nrf2-mediated antioxidant response in cultured mouse macrophages in a biphasic manner. In an effort to determine whether Nrf2 pathways overlap with other stress pathways, gene expression profiling was performed in RAW 264.7 macrophages exposed to HOCl using whole genome mouse microarrays. Benchmark dose (BMD) analysis on gene expression data revealed that Nrf2-mediated antioxidant response and protein ubiquitination were the most sensitive biological pathways that were activated in response to low concentrations of HOCl (< 0.35 mM). Genes involved in chromatin architecture maintenance and DNA-dependent transcription were also sensitive to very low doses. Moderate concentrations of HOCl (0.35 to 1.4 mM) caused maximal activation of the Nrf2 pathway and innate immune response genes, such as IL-1β, IL-6, IL-10 and chemokines. At even higher concentrations of HOCl (2.8 to 3.5 mM) there was a loss of Nrf2-target gene expression with increased expression of numerous heat shock and histone cluster genes, AP-1-family genes, cFos and Fra1 and DNA damage-inducible Gadd45 genes. These findings confirm an Nrf2-centric mechanism of action of HOCl in mouse macrophages and provide evidence of interactions between Nrf2, inflammatory, and other stress pathways.

  14. Curcumin ameliorates dopaminergic neuronal oxidative damage via activation of the Akt/Nrf2 pathway.

    Science.gov (United States)

    Cui, Qunli; Li, Xin; Zhu, Hongcan

    2016-02-01

    Parkinson's disease (PD) is an age-related complex neurodegenerative disease that affects ≤ 80% of dopaminergic neurons in the substantia nigra pars compacta (SNpc). It has previously been suggested that mitochondrial dysfunction, oxidative stress and oxidative damage underlie the pathogenesis of PD. Curcumin, which is a major active polyphenol component extracted from the rhizomes of Curcuma longa (Zingiberaceae), has been reported to exert neuroprotective effects on an experimental model of PD. The present study conducted a series of in vivo experiments, in order to investigate the effects of curcumin on behavioral deficits, oxidative damage and related mechanisms. The results demonstrated that curcumin was able to significantly alleviate motor dysfunction and increase suppressed tyrosine hydroxylase (TH) activity in the SNpc of rotenone (ROT)-injured rats. Biochemical measurements indicated that rats pretreated with curcumin exhibited increased glutathione (GSH) levels, and reduced reactive oxygen species activity and malondialdehyde content. Mechanistic studies demonstrated that curcumin significantly restored the expression levels of heme oxygenase-1 and quinone oxidoreductase 1, thus ameliorating ROT-induced damage in vivo, via the phosphorylation of Akt and nuclear factor erythroid 2-related factor 2 (Nrf2). Further studies indicated that the Akt/Nrf2 signaling pathway was associated with the protective role of curcumin in ROT-treated rats. Inhibiting the Akt/Nrf2 pathway using a lentiviral vector containing Nrf2-specific short hairpin RNA, or the phosphoinositide 3-kinase inhibitor LY294002, markedly reduced the expression levels of TH and GSH, ultimately attenuating the neuroprotective effects of curcumin against oxidative damage. These results indicated that curcumin was able to significantly ameliorate ROT-induced dopaminergic neuronal oxidative damage in the SNpc of rats via activation of the Akt/Nrf2 signaling pathway.

  15. The Crosstalk between Nrf2 and TGF-β1 in the Epithelial-Mesenchymal Transition of Pancreatic Duct Epithelial Cells.

    Directory of Open Access Journals (Sweden)

    Sarah Arfmann-Knübel

    Full Text Available Nrf2 and TGF-β1 both affect tumorigenesis in a dual fashion, either by preventing carcinogen induced carcinogenesis and suppressing tumor growth, respectively, or by conferring cytoprotection and invasiveness to tumor cells during malignant transformation. Given the involvement of Nrf2 and TGF-β1 in the adaptation of epithelial cells to persistent inflammatory stress, e.g. of the pancreatic duct epithelium during chronic pancreatitis, a crosstalk between Nrf2 and TGF-β1 can be envisaged. By using premalignant human pancreatic duct cells (HPDE and the pancreatic ductal adenocarcinoma cell line Colo357, we could show that Nrf2 and TGF-β1 independently but additively conferred an invasive phenotype to HPDE cells, whereas acting synergistically in Colo357 cells. This was accompanied by differential regulation of EMT markers like vimentin, Slug, L1CAM and E-cadherin. Nrf2 activation suppressed E-cadherin expression through an as yet unidentified ARE related site in the E-cadherin promoter, attenuated TGF-β1 induced Smad2/3-activity and enhanced JNK-signaling. In Colo357 cells, TGF-β1 itself was capable of inducing Nrf2 whereas in HPDE cells TGF-β1 per-se did not affect Nrf2 activity, but enhanced Nrf2 induction by tBHQ. In Colo357, but not in HPDE cells, the effects of TGF-β1 on invasion were sensitive to Nrf2 knock-down. In both cell lines, E-cadherin re-expression inhibited the proinvasive effect of Nrf2. Thus, the increased invasion of both cell lines relates to the Nrf2-dependent downregulation of E-cadherin expression. In line, immunohistochemistry analysis of human pancreatic intraepithelial neoplasias in pancreatic tissues from chronic pancreatitis patients revealed strong Nrf2 activity already in premalignant epithelial duct cells, accompanied by partial loss of E-cadherin expression. Our findings indicate that Nrf2 and TGF-β1 both contribute to malignant transformation through distinct EMT related mechanisms accounting for an

  16. SPBP is a sulforaphane induced transcriptional coactivator of NRF2 regulating expression of the autophagy receptor p62/SQSTM1.

    Directory of Open Access Journals (Sweden)

    Sagar Ramesh Darvekar

    Full Text Available Organisms exposed to oxidative stress respond by orchestrating a stress response to prevent further damage. Intracellular levels of antioxidant agents increase, and damaged components are removed by autophagy induction. The KEAP1-NRF2 signaling pathway is the main pathway responsible for cell defense against oxidative stress and for maintaining the cellular redox balance at physiological levels. Sulforaphane, an isothiocyanate derived from cruciferous vegetables, is a potent inducer of KEAP1-NRF2 signaling and antioxidant response element driven gene expression. In this study, we show that sulforaphane enhances the expression of the transcriptional coregulator SPBP. The expression curve peaks 6-8 hours post stimulation, and parallels the sulforaphane-induced expression of NRF2 and the autophagy receptor protein p62/SQSTM1. Reporter gene assays show that SPBP stimulates the expression of p62/SQSTM1 via ARE elements in the promoter region, and siRNA mediated knock down of SPBP significantly decreases the expression of p62/SQSTM1 and the formation of p62/SQSTM1 bodies in HeLa cells. Furthermore, SPBP siRNA reduces the sulforaphane induced expression of NRF2, and the expression of the autophagy marker protein LC3B. Both these proteins contain ARE-like elements in their promoter regions. Over-expressed SPBP and NRF2 acts synergistically on the p62/SQSTM1 promoter and colocalize in nuclear speckles in HeLa cells. Collectively, these results suggest that SPBP is a coactivator of NRF2, and hence may be important for securing enhanced and sustained expression of NRF2 induced genes such as proteins involved in selective autophagy.

  17. Thyroid Hormone-Induced Cytosol-to-Nuclear Translocation of Rat Liver Nrf2 Is Dependent on Kupffer Cell Functioning

    Directory of Open Access Journals (Sweden)

    Luis A. Videla

    2012-01-01

    Full Text Available L-3,3′,5-triiodothyronine (T3 administration upregulates nuclear factor-E2-related factor 2 (Nrf2 in rat liver, which is redox-sensitive transcription factor mediating cytoprotection. In this work, we studied the role of Kupffer cell respiratory burst activity, a process related to reactive oxygen species generation and liver homeostasis, in Nrf2 activation using the macrophage inactivator gadolinium chloride (GdCl3; 10 mg/kg i.v. 72 h before T3 [0.1 mg/kg i.p.] or NADPH oxidase inhibitor apocynin (1.5 mmol/L added to the drinking water for 7 days before T3, and determinations were performed 2 h after T3. T3 increased nuclear/cytosolic Nrf2 content ratio and levels of heme oxygenase 1 (HO-1, catalytic subunit of glutamate cysteine ligase, and thioredoxin (Western blot over control values, proteins whose gene transcription is induced by Nrf2. These changes were suppressed by GdCl3 treatment prior to T3, an agent-eliciting Kupffer-cell depletion, inhibition of colloidal carbon phagocytosis, and the associated respiratory burst activity, with enhancement in nuclear inhibitor of Nrf2 kelch-like ECH-associated protein 1 (Keap1/Nrf2 content ratios suggesting Nrf2 degradation. Under these conditions, T3-induced tumor necrosis factor-α (TNF-α response was eliminated by previous GdCl3 administration. Similar to GdCl3, apocynin given before T3 significantly reduced liver Nrf2 activation and HO-1 expression, a NADPH oxidase inhibitor eliciting abolishment of colloidal carbon-induced respiratory burst activity without altering carbon phagocytosis. It is concluded that Kupffer cell functioning is essential for upregulation of liver Nrf2-signaling pathway by T3. This contention is supported by suppression of the respiratory burst activity of Kupffer cells and the associated reactive oxygen species production by GdCl3 or apocynin given prior to T3, thus hindering Nrf2 activation.

  18. Nrf2 and Redox Status in Prediabetic and Diabetic Patients

    Directory of Open Access Journals (Sweden)

    Angélica S. Jiménez-Osorio

    2014-11-01

    Full Text Available The redox status associated with nuclear factor erythroid 2-related factor-2 (Nrf2 was evaluated in prediabetic and diabetic subjects. Total antioxidant status (TAS in plasma and erythrocytes, glutathione (GSH and malondialdehyde (MDA content and activity of antioxidant enzymes were measured as redox status markers in 259 controls, 111 prediabetics and 186 diabetic type 2 subjects. Nrf2 was measured in nuclear extract fractions from peripheral blood mononuclear cells (PBMC. Nrf2 levels were lower in prediabetic and diabetic patients. TAS, GSH and activity of glutamate cysteine ligase were lower in diabetic subjects. An increase of MDA and superoxide dismutase activity was found in diabetic subjects. These results suggest that low levels of Nrf2 are involved in the development of oxidative stress and redox status disbalance in diabetic patients.

  19. Anti-neuroinflammatory Activity of Elephantopus scaber L. via Activation of Nrf2/HO-1 Signaling and Inhibition of p38 MAPK Pathway in LPS-Induced Microglia BV-2 Cells

    Directory of Open Access Journals (Sweden)

    Chim-Kei Chan

    2017-06-01

    Full Text Available Elephantopus scaber L. (family: Asteraceae has been traditionally utilized as a folkloric medicine and scientifically shown to exhibit anti-inflammatory activities in various in vivo inflammatory models. Given the lack of study on the effect of E. scaber in neuroinflammation, this study aimed to investigate the anti-neuroinflammatory effect and the underlying mechanisms of ethyl acetate fraction from the leaves of E. scaber (ESEAF on the release of pro-inflammatory mediators in lipopolysaccharide (LPS-induced microglia cells (BV-2. Present findings showed that ESEAF markedly attenuated the translocation of NF-κB to nucleus concomitantly with the significant mitigation on the LPS-induced production of NO, iNOS, COX-2, PGE2, IL-1β, and TNF-α. These inflammatory responses were reduced via the inhibition of p38. Besides, ESEAF was shown to possess antioxidant activities evident by the DPPH and SOD scavenging activities. The intracellular catalase enzyme activity was enhanced by ESEAF in the LPS-stimulated BV-2 cells. Furthermore, the formation of ROS induced by LPS in BV-2 cells was reduced upon the exposure to ESEAF. Intriguingly, the reduction of ROS was found in concerted with the activation of Nrf2 and HO-1. It is conceivable that the activation promotes the scavenging power of antioxidant enzymes as well as to ameliorate the inflammatory response in LPS-stimulated BV-2 cells. Finally, the safety profile analysis through oral administration of ESEAF at 2000 mg/kg did not result in any mortalities, adverse effects nor histopathologic abnormalities of organs in mice. Taken altogether, the cumulative findings suggested that ESEAF holds the potential to develop as nutraceutical for the intervention of neuroinflammatory disorders.

  20. Increased Alzheimer's disease-like pathology in the APP/ PS1ΔE9 mouse model lacking Nrf2 through modulation of autophagy.

    Science.gov (United States)

    Joshi, Gururaj; Gan, Kok Ann; Johnson, Delinda A; Johnson, Jeffrey A

    2015-02-01

    The presence of senile plaques is one of the major pathologic hallmarks of the brain with Alzheimer's disease (AD). The plaques predominantly contain insoluble amyloid β-peptide, a cleavage product of the larger amyloid precursor protein (APP). Two enzymes, named β and γ secretase, generate the neurotoxic amyloid-β peptide from APP. Mature APP is also turned over endogenously by autophagy, more specifically by the endosomal-lysosomal pathway. A defective lysosomal system is known to be pathogenic in AD. Modulation of NF-E2 related factor 2 (Nrf2) has been shown in several neurodegenerative disorders, and Nrf2 has become a potential therapeutic target for various neurodegenerative disorders, including AD, Parkinson's disease, and amyotrophic lateral sclerosis. In the current study, we explored the effect of genetic ablation of Nrf2 on APP/Aβ processing and/or aggregation as well as changes in autophagic dysfunction in APP/PS1 mice. There was a significant increase in inflammatory response in APP/PS1 mice lacking Nrf2. This was accompanied by increased intracellular levels of APP, Aβ (1-42), and Aβ (1-40), without a change total full-length APP. There was a shift of APP and Aβ into the insoluble fraction, as well as increased poly-ubiquitin conjugated proteins in mice lacking Nrf2. APP/PS1-mediated autophagic dysfunction is also enhanced in Nrf2-deficient mice. Finally, neurons in the APP/PS1/Nrf2-/- mice had increased accumulation of multivesicular bodies, endosomes, and lysosomes. These outcomes provide a better understanding of the role of Nrf2 in modulating autophagy in an AD mouse model and may help design better Nrf2 targeted therapeutics that could be efficacious in the treatment of AD. Published by Elsevier Inc.

  1. Minocycline attenuates sevoflurane-induced cell injury via activation of Nrf2.

    Science.gov (United States)

    Tian, Yue; Wu, Xiuying; Guo, Shanbin; Ma, Ling; Huang, Wei; Zhao, Xiaochun

    2017-04-01

    Minocycline has been demonstrated to exert neuroprotective effects in various experimental models. In the present study, we investigated the mechanisms underlying the protective effects of minocycline on cell injury induced by the inhalation of the anesthetic, sevoflurane. In our in vivo experiments using rats, minocycline attenuated sevoflurane-induced neuronal degeneration and apoptosis in the rat hippocampus, and this effect was associated with the minocycline-mediated suppression of oxidative stress in the hippocampus. In in vitro experiments, minocycline inhibited sevoflurane-induced apoptosis and the production of reactive oxygen species (ROS) in H4 human neuroglioma cells. In addition, minocycline suppressed the sevoflurane-induced upregulation of interleukin (IL)-6 and the activation of the nuclear factor-κB (NF-κB) signaling pathway in H4 cells. Furthermore, we found that nuclear factor E2-related factor 2 (Nrf2), an activator of the stress response, was upregulated and activated upon sevoflurane treatment both in the rat hippocampus and in H4 cells. In addition, minocycline further augmented the upregulation and activation of Nrf2 when used in conjunction with sevoflurane. Moreover, the knockdown of Nrf2 in H4 cells by small interfering RNA (siRNA) diminished the cytoprotective effect of minocycline, and attenuated the inhibitory effect of minocycline on ROS production, IL-6 upregulation and the activation of the NF-κB signaling pathway. On the whole, our findings indicate that minocycline may exert protective effects against sevoflurane-induced cell injury via the Nrf2-modulated antioxidant response and the inhibition of the activation of the NF-κB signaling pathway.

  2. Minocycline attenuates sevoflurane-induced cell injury via activation of Nrf2

    Science.gov (United States)

    Tian, Yue; Wu, Xiuying; Guo, Shanbin; Ma, Ling; Huang, Wei; Zhao, Xiaochun

    2017-01-01

    Minocycline has been demonstrated to exert neuroprotective effects in various experimental models. In the present study, we investigated the mechanisms underlying the protective effects of minocycline on cell injury induced by the inhalation of the anesthetic, sevoflurane. In our in vivo experiments using rats, minocycline attenuated sevoflurane-induced neuronal degeneration and apoptosis in the rat hippocampus, and this effect was associated with the minocycline-mediated suppression of oxidative stress in the hippocampus. In in vitro experiments, minocycline inhibited sevoflurane-induced apoptosis and the production of reactive oxygen species (ROS) in H4 human neuroglioma cells. In addition, minocycline suppressed the sevoflurane-induced upregulation of interleukin (IL)-6 and the activation of the nuclear factor-κB (NF-κB) signaling pathway in H4 cells. Furthermore, we found that nuclear factor E2-related factor 2 (Nrf2), an activator of the stress response, was upregulated and activated upon sevoflurane treatment both in the rat hippocampus and in H4 cells. In addition, minocycline further augmented the upregulation and activation of Nrf2 when used in conjunction with sevoflurane. Moreover, the knockdown of Nrf2 in H4 cells by small interfering RNA (siRNA) diminished the cytoprotective effect of minocycline, and attenuated the inhibitory effect of minocycline on ROS production, IL-6 upregulation and the activation of the NF-κB signaling pathway. On the whole, our findings indicate that minocycline may exert protective effects against sevoflurane-induced cell injury via the Nrf2-modulated antioxidant response and the inhibition of the activation of the NF-κB signaling pathway. PMID:28260081

  3. The Transcription Factor Nrf2 Protects Angiogenic Capacity of Endothelial Colony-Forming Cells in High-Oxygen Radical Stress Conditions

    Directory of Open Access Journals (Sweden)

    Hendrik Gremmels

    2017-01-01

    Full Text Available Background. Endothelial colony forming cells (ECFCs have shown a promise in tissue engineering of vascular constructs, where they act as endothelial progenitor cells. After implantation, ECFCs are likely to be subjected to elevated reactive oxygen species (ROS. The transcription factor Nrf2 regulates the expression of antioxidant enzymes in response to ROS. Methods. Stable knockdown of Nrf2 and Keap1 was achieved by transduction with lentiviral shRNAs; activation of Nrf2 was induced by incubation with sulforaphane (SFN. Expression of Nrf2 target genes was assessed by qPCR, oxidative stress was assessed using CM-DCFDA, and angiogenesis was quantified by scratch-wound and tubule-formation assays. Results. Nrf2 knockdown led to a reduction of antioxidant gene expression and increased ROS. Angiogenesis was disturbed after Nrf2 knockdown even in the absence of ROS. Conversely, angiogenesis was preserved in high ROS conditions after knockdown of Keap1. Preincubation of ECFCs with SFN reduced intracellular ROS in the presence of H2O2 and preserved scratch-wound closure and tubule-formation. Conclusion. The results of this study indicate that Nrf2 plays an important role in the angiogenic capacity of ECFCs, particularly under conditions of increased oxidative stress. Pretreatment of ECFCs with SFN prior to implantation may be a protective strategy for tissue-engineered constructs or cell therapies.

  4. Identification of novel microRNAs in post-transcriptional control of Nrf2 expression and redox homeostasis in neuronal, SH-SY5Y cells.

    Directory of Open Access Journals (Sweden)

    Madhusudhanan Narasimhan

    Full Text Available Nuclear factor-erythroid 2-related factor 2 (Nrf2/NFE2L2, a redox-sensitive transcription factor plays a critical role in adaptation to cellular stress and affords cellular defense by initiating transcription of antioxidative and detoxification genes. While a protein can be regulated at multiple levels, control of Nrf2 has been largely studied at post-translational regulation points by Keap1. Importantly, post-transcriptional/translational based regulation of Nrf2 is less understood and to date there are no reports on such mechanisms in neuronal systems. In this context, studies involving the role of microRNAs (miRs which are normally considered as fine tuning regulators of protein production through translation repression and/or post-transcriptional alterations, are in place. In the current study, based on in-silico analysis followed by immunoblotting and real time analysis, we have identified and validated for the first time that human NFE2L2 could be targeted by miR153/miR27a/miR142-5p/miR144 in neuronal, SH-SY5Y cells. Co-transfection studies with individual miR mimics along with either WT 3' UTR of human Nrf2 or mutated miRNA targeting seed sequence within Nrf2 3' UTR, demonstrated that Nrf2 is a direct regulatory target of these miRs. In addition, ectopic expression of miR153/miR27a/miR142-5p/miR144 affected Nrf2 mRNA abundance and nucleo-cytoplasmic concentration of Nrf2 in a Keap1 independent manner resulting in inefficient transactivating ability of Nrf2. Furthermore, forced expression of miRs diminished GCLC and GSR expression resulting in alteration of Nrf2 dependent redox homeostasis. Finally, bioinformatics based miRNA-disease network analysis (MDN along with extended computational network analysis of Nrf2 associated pathologic processes suggests that if in a particular cellular scenario where any of these miR153/miR27a/miR142-5p/miR144 either individually or as a group is altered, it could affect Nrf2 thus triggering and

  5. Contribution of Nrf2 to Atherogenic Phenotype Switching of Coronary Arterial Smooth Muscle Cells Lacking CD38 Gene

    Directory of Open Access Journals (Sweden)

    Ming Xu

    2015-08-01

    Full Text Available Background/Aims: Recent studies have indicated that CD38 gene deficiency results in dedifferentiation or transdifferentiation of arterial smooth muscle cells upon atherogenic stimulations. However, the molecular mechanisms mediating this vascular smooth muscle (SMC phenotypic switching remain unknown. Methods & Results: In the present study, we first characterized the phenotypic change in the primary cultures of coronary arterial myocytes (CAMs from CD38-/- mice. It was shown that CD38 deficiency decreased the expression of contractile marker calponin, SM22α and α-SMA but increased the expression of SMC dedifferentiation marker, vimentin, which was accompanied by enhanced cell proliferation. This phenotypic change in CD38-/- CAMs was enhanced by 7-ketocholesterol (7-Ket, an atherogenic stimulus. We further found that the CD38 deficiency decreased the expression and activity of nuclear factor E2-related factor 2 (Nrf2, a basic leucine zipper (bZIP transcription factor sensitive to redox regulation. Similar to CD38 deletion, Nrf2 gene silencing increased CAM dedifferentiation upon 7-Ket stimulation. In contrast, the overexpression of Nrf2 gene abolished 7-Ket-induced dedifferentiation in CD38-/- CAMs. Given the sensitivity of Nrf2 to oxidative stress, we determined the role of redox signaling in the regulation of Nrf2 expression and activity associated with CD38 effect in CAM phenotype changes. It was demonstrated that in CD38-/- CAMs, 7-Ket failed to stimulate the production of O2-., while in CD38+/+ CAMs 7-Ket induced marked O2-. production and enhancement of Nrf2 activity, which was substantially attenuated by NOX4 gene silencing. Finally, we demonstrated that 7-Ket-induced and NOX4-dependent O2-. production was inhibited by 8-Br-cADPR, an antagonist of cADPR or NED-19, an antagonist of NAADP as product of CD38 ADP-ribosylcyclase, which significantly inhibited the level of cytosolic Ca2+ and the activation of Nrf2 under 7-Ket. Conclusion

  6. Suppression of NRF2–ARE activity sensitizes chemotherapeutic agent-induced cytotoxicity in human acute monocytic leukemia cells

    Energy Technology Data Exchange (ETDEWEB)

    Peng, Hui [The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC (United States); Institute of Disease Control and Prevention, Academy of Military Medical Sciences, Beijing (China); Wang, Huihui [School of Public Health, China Medical University, 77 Puhe Road, Shenyang North New Area, Shenyang (China); Xue, Peng [The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC (United States); Key Laboratory of the Public Health Safety, Ministry of Education, School of Public Health, Fudan University, Shanghai (China); Hou, Yongyong [School of Public Health, China Medical University, 77 Puhe Road, Shenyang North New Area, Shenyang (China); Dong, Jian [The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC (United States); Institute of Biology and Medicine, Wuhan University of Science and Technology, Wuhan (China); Zhou, Tong [The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC (United States); Qu, Weidong [Key Laboratory of the Public Health Safety, Ministry of Education, School of Public Health, Fudan University, Shanghai (China); Peng, Shuangqing [Institute of Disease Control and Prevention, Academy of Military Medical Sciences, Beijing (China); Li, Jin; Carmichael, Paul L. [Unilever, Safety & Environmental Assurance Centre, Colworth Science Park, Sharnbrook, Bedfordshire MK44 1LQ (United Kingdom); Nelson, Bud; Clewell, Rebecca; Zhang, Qiang; Andersen, Melvin E. [The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC (United States); Pi, Jingbo, E-mail: jpi@mail.cmu.edu.cn [School of Public Health, China Medical University, 77 Puhe Road, Shenyang North New Area, Shenyang (China); The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC (United States)

    2016-02-01

    Nuclear factor erythroid 2-related factor 2 (NRF2), a master regulator of the antioxidant response element (ARE)-dependent transcription, plays a pivotal role in chemical detoxification in normal and tumor cells. Consistent with previous findings that NRF2–ARE contributes to chemotherapeutic resistance of cancer cells, we found that stable knockdown of NRF2 by lentiviral shRNA in human acute monocytic leukemia (AML) THP-1 cells enhanced the cytotoxicity of several chemotherapeutic agents, including arsenic trioxide (As{sub 2}O{sub 3}), etoposide and doxorubicin. Using an ARE-luciferase reporter expressed in several human and mouse cells, we identified a set of compounds, including isonicotinic acid amides, isoniazid and ethionamide, that inhibited NRF2–ARE activity. Treatment of THP-1 cells with ethionamide, for instance, significantly reduced mRNA expression of multiple ARE-driven genes under either basal or As{sub 2}O{sub 3}-challenged conditions. As determined by cell viability and cell cycle, suppression of NRF2–ARE by ethionamide also significantly enhanced susceptibility of THP-1 and U937 cells to As{sub 2}O{sub 3}-induced cytotoxicity. In THP-1 cells, the sensitizing effect of ethionamide on As{sub 2}O{sub 3}-induced cytotoxicity was highly dependent on NRF2. To our knowledge, the present study is the first to demonstrate that ethionamide suppresses NRF2–ARE signaling and disrupts the transcriptional network of the antioxidant response in AML cells, leading to sensitization to chemotherapeutic agents. - Highlights: • Identification of novel inhibitors of ARE-dependent transcription • Suppression of NRF2–ARE sensitizes THP-1 cells to chemotherapy. • Ethionamide suppresses ARE-dependent transcriptional activity. • Ethionamide and isoniazid increase the cytotoxicity of As{sub 2}O{sub 3} in AML cells. • Sensitization of THP-1 cells to As{sub 2}O{sub 3} toxicity by ethionamide is NRF2-dependent.

  7. Ebselen attenuates cisplatin-induced ROS generation through Nrf2 activation in auditory cells.

    Science.gov (United States)

    Kim, Se-Jin; Park, Channy; Han, A Lum; Youn, Myung-Ja; Lee, Jeong-Han; Kim, Yunha; Kim, Eun-Sook; Kim, Hyung-Jin; Kim, Jin-Kyung; Lee, Ho-Kyun; Chung, Sang-Young; So, Hongseob; Park, Raekil

    2009-05-01

    Ebselen, an organoselenium compound that acts as a glutathione peroxidase mimetic, has been demonstrated to possess antioxidant and anti-inflammatory activities. However, the molecular mechanism underlying this effect is not fully understood in auditory cells. The purpose of the present study is to investigate the protective effect of ebselen against cisplatin-induced toxicity in HEI-OC1 auditory cells, organotypic cultures of cochlear explants from two-day postnatal rats (P(2)) and adult Balb/C mice. Pretreatment with ebselen ameliorated apoptotic death induced by cisplatin in HEI-OC1 cells and organotypic cultures of Corti's organ. Ebselen pretreatment also significantly suppressed cisplatin-induced increases in intracellular reactive oxygen species (ROS), intracellular reactive nitrogen species (RNS) and lipid peroxidation levels. Ebselen dose-dependently increased the expression level of an antioxidant response element (ARE)-luciferase reporter in HEI-OC1 cells through the translocation of Nrf2 into the nucleus. Furthermore, we found that pretreatment with ebselen significantly restored Nrf2 function, whereas it ameliorated the cytotoxicity of cisplatin in cells transfectants with either a pcDNA3.1 (control) or a DN-Nrf2 (dominant-negative) plasmid. We also observed that Nrf2 activation by ebselen increased the expression of phase II antioxidant genes, including heme oxygenase (HO-1), NAD(P)H:quinine oxidoreductase, and gamma-glutamylcysteine synthetase (gamma-GCS). Treatment with ebselen resulted in an increased expression of HO-1 and intranuclear Nrf2 in hair cells of organotypic cultured cochlea. After intraperitoneal injection with cisplatin, auditory brainstem responses (ABRs) threshold was measured on 8th day in Balb/C mice. ABR threshold shift was marked occurred in mice injected with cisplatin (16 mg/kg, n=5; Click and 8-kHz stimuli, pebselen was not significantly changed. These results suggest that ebselen activates the Nrf2-ARE signaling pathway

  8. EGFR mediates astragaloside IV-induced Nrf2 activation to protect cortical neurons against in vitro ischemia/reperfusion damages

    International Nuclear Information System (INIS)

    Gu, Da-min; Lu, Pei-Hua; Zhang, Ke; Wang, Xiang; Sun, Min; Chen, Guo-Qian; Wang, Qiong

    2015-01-01

    In this study, we tested the potential role of astragaloside IV (AS-IV) against oxygen and glucose deprivation/re-oxygenation (OGD/R)-induced damages in murine cortical neurons, and studied the associated signaling mechanisms. AS-IV exerted significant neuroprotective effects against OGD/R by reducing reactive oxygen species (ROS) accumulation, thereby attenuating oxidative stress and neuronal cell death. We found that AS-IV treatment in cortical neurons resulted in NF-E2-related factor 2 (Nrf2) signaling activation, evidenced by Nrf2 Ser-40 phosphorylation, and its nuclear localization, as well as transcription of antioxidant-responsive element (ARE)-regulated genes: heme oxygenase-1 (HO-1), NAD(P)H:quinone oxidoreductase 1 (NQO-1) and sulphiredoxin 1 (SRXN-1). Knockdown of Nrf2 through lentiviral shRNAs prevented AS-IV-induced ARE genes transcription, and abolished its anti-oxidant and neuroprotective activities. Further, we discovered that AS-IV stimulated heparin-binding-epidermal growth factor (HB-EGF) release to trans-activate epidermal growth factor receptor (EGFR) in cortical neurons. Blockage or silencing EGFR prevented Nrf2 activation by AS-IV, thus inhibiting AS-IV-mediated anti-oxidant and neuroprotective activities against OGD/R. In summary, AS-IV protects cortical neurons against OGD/R damages through activating of EGFR-Nrf2 signaling. - Highlights: • Pre-treatment of astragaloside IV (AS-IV) protects murine cortical neurons from OGD/R. • AS-IV activates Nrf2-ARE signaling in murine cortical neurons. • Nrf2 is required for AS-IV-mediated anti-oxidant and neuroprotective activities. • AS-IV stimulates HB-EGF release to trans-activate EGFR in murine cortical neurons. • EGFR mediates AS-IV-induced Nrf2 activation and neuroprotection against OGD/R

  9. EGFR mediates astragaloside IV-induced Nrf2 activation to protect cortical neurons against in vitro ischemia/reperfusion damages

    Energy Technology Data Exchange (ETDEWEB)

    Gu, Da-min [Department of Anesthesiology, Affiliated Yixing People' s Hospital, Jiangsu University, Yixing (China); Lu, Pei-Hua, E-mail: lphty1_1@163.com [Department of Medical Oncology, Wuxi People' s Hospital Affiliated to Nanjing Medical University, Wuxi (China); Zhang, Ke; Wang, Xiang [Department of Anesthesiology, Affiliated Yixing People' s Hospital, Jiangsu University, Yixing (China); Sun, Min [Department of General Surgery, Affiliated Yixing People' s Hospital, Jiangsu University, Yixing (China); Chen, Guo-Qian [Department of Clinical Laboratory, Wuxi People' s Hospital Affiliated to Nanjing Medical University, Wuxi (China); Wang, Qiong, E-mail: WangQiongprof1@126.com [Department of Clinical Laboratory, Wuxi People' s Hospital Affiliated to Nanjing Medical University, Wuxi (China)

    2015-02-13

    In this study, we tested the potential role of astragaloside IV (AS-IV) against oxygen and glucose deprivation/re-oxygenation (OGD/R)-induced damages in murine cortical neurons, and studied the associated signaling mechanisms. AS-IV exerted significant neuroprotective effects against OGD/R by reducing reactive oxygen species (ROS) accumulation, thereby attenuating oxidative stress and neuronal cell death. We found that AS-IV treatment in cortical neurons resulted in NF-E2-related factor 2 (Nrf2) signaling activation, evidenced by Nrf2 Ser-40 phosphorylation, and its nuclear localization, as well as transcription of antioxidant-responsive element (ARE)-regulated genes: heme oxygenase-1 (HO-1), NAD(P)H:quinone oxidoreductase 1 (NQO-1) and sulphiredoxin 1 (SRXN-1). Knockdown of Nrf2 through lentiviral shRNAs prevented AS-IV-induced ARE genes transcription, and abolished its anti-oxidant and neuroprotective activities. Further, we discovered that AS-IV stimulated heparin-binding-epidermal growth factor (HB-EGF) release to trans-activate epidermal growth factor receptor (EGFR) in cortical neurons. Blockage or silencing EGFR prevented Nrf2 activation by AS-IV, thus inhibiting AS-IV-mediated anti-oxidant and neuroprotective activities against OGD/R. In summary, AS-IV protects cortical neurons against OGD/R damages through activating of EGFR-Nrf2 signaling. - Highlights: • Pre-treatment of astragaloside IV (AS-IV) protects murine cortical neurons from OGD/R. • AS-IV activates Nrf2-ARE signaling in murine cortical neurons. • Nrf2 is required for AS-IV-mediated anti-oxidant and neuroprotective activities. • AS-IV stimulates HB-EGF release to trans-activate EGFR in murine cortical neurons. • EGFR mediates AS-IV-induced Nrf2 activation and neuroprotection against OGD/R.

  10. Sulforaphane is a Nrf2-independent inhibitor of mitochondrial fission

    Directory of Open Access Journals (Sweden)

    Gary B. O'Mealey

    2017-04-01

    Full Text Available The KEAP1-Nrf2-ARE antioxidant system is a principal means by which cells respond to oxidative and xenobiotic stresses. Sulforaphane (SFN, an electrophilic isothiocyanate derived from cruciferous vegetables, activates the KEAP1-Nrf2-ARE pathway and has become a molecule-of-interest in the treatment of diseases in which chronic oxidative stress plays a major etiological role. We demonstrate here that the mitochondria of cultured, human retinal pigment epithelial (RPE-1 cells treated with SFN undergo hyperfusion that is independent of both Nrf2 and its cytoplasmic inhibitor KEAP1. Mitochondrial fusion has been reported to be cytoprotective by inhibiting pore formation in mitochondria during apoptosis, and consistent with this, we show Nrf2-independent, cytoprotection of SFN-treated cells exposed to the apoptosis-inducer, staurosporine. Mechanistically, SFN mitigates the recruitment and/or retention of the soluble fission factor Drp1 to mitochondria and to peroxisomes but does not affect overall Drp1 abundance. These data demonstrate that the beneficial properties of SFN extend beyond activation of the KEAP1-Nrf2-ARE system and warrant further interrogation given the current use of this agent in multiple clinical trials.

  11. Neutrophils in oral paracoccidioidomycosis and the involvement of Nrf2.

    Directory of Open Access Journals (Sweden)

    Vera Cavalcanti Araújo

    Full Text Available Neutrophils have been implicated in granuloma formation in several infectious diseases, in addition to their main phagocytic and pathogen destruction role. It has been demonstrated that Nrf2 regulates antioxidant protection in neutrophils, attenuating inflammation without compromising the hosts bacterial defense. In this study, we analyzed the presence of neutrophils in Paracoccidioides brasiliensis mycosis (PCM, as well as the immunoexpression of Nrf2. Thirty-nine cases of oral PCM were classified according to quantity of fungi and to the presence of loose or well-organized granulomas and microabscesses. An Nrf2 antibody was used for immunohistochemical analysis. The results showed that neutrophils are present in microabscesses and loose granulomas, but were absent in structured granulomas. A greater quantity of fungi was shown in cases with only loose granulomas when compared to loose and well organized granulomas. Nrf2 was observed in the nuclei of neutrophils of loose granulomas and abscesses, with its expression in loose granulomas maintained despite the additional presence of well organized granulomas in the same specimen. This study suggests that neutrophils participate in P. brasiliensis granuloma formation and that Nrf2 has a possible role in neutrophil survival, via modulation of the inflammatory response.

  12. Topical application of the synthetic triterpenoid RTA 408 activates Nrf2 and induces cytoprotective genes in rat skin.

    Science.gov (United States)

    Reisman, Scott A; Lee, Chun-Yue I; Meyer, Colin J; Proksch, Joel W; Ward, Keith W

    2014-07-01

    RTA 408 is a member of the synthetic oleanane triterpenoid class of compounds known to potently activate the cytoprotective transcription factor Nrf2. Because skin is constantly exposed to external oxidative stress, such as that from ultraviolet radiation, from chemical exposure, during improper wound healing, and throughout the course of cancer radiation therapy, it may benefit from activation of Nrf2. This study was conducted to evaluate the transdermal penetration properties and Nrf2 activation potential of RTA 408 in normal rat skin. RTA 408 (0.1, 1.0, or 3.0%) was applied topically to the shaved skin of male Sprague-Dawley rats twice daily for 4 days and once on Day 5. Topical application of RTA 408 resulted in transdermal penetration, with low but dose-dependent plasma exposure with AUC(0-24 h) values of 3.6, 26.0, and 41.1 h ng/mL for the 0.1, 1.0, and 3.0% doses, respectively. Further, topical application of RTA 408 resulted in increased translocation of Nrf2 to the nucleus, dose-dependent mRNA induction of Nrf2 target genes (e.g. Nqo1, Srxn1, Gclc, and Gclm), and induction of the protein expression of the prototypical Nrf2 target gene Nqo1 and increased total glutathione (GSH) in normal rat skin. Immunohistochemistry demonstrated that increased staining for Nqo1 and total GSH of structures in both the epidermis and dermis was consistent with the full transdermal penetration of RTA 408. Finally, topically administered RTA 408 was well tolerated with no adverse in-life observations and normal skin histology. Thus, the data support the further development of RTA 408 for the potential treatment of skin diseases.

  13. Piper betle Induced Cytoprotective Genes and Proteins via the Nrf2/ARE Pathway in Aging Mice.

    Science.gov (United States)

    Aliahmat, Nor Syahida; Abdul Sani, Nur Fathiah; Wan Hasan, Wan Nuraini; Makpol, Suzana; Wan Ngah, Wan Zurinah; Mohd Yusof, Yasmin Anum

    2016-01-01

    The objective of this study was to elucidate the underlying antioxidant mechanism of aqueous extract of Piper betle (PB) in aging rats. The nuclear factor erythroid 2-related factor 2 (Nrf2)/ARE pathway involving phase II detoxifying and antioxidant enzymes plays an important role in the antioxidant system by reducing electrophiles and reactive oxygen species through induction of phase II enzymes and proteins. Genes and proteins of phase II detoxifying antioxidant enzymes were analyzed by QuantiGenePlex 2.0 Assay and Western blot analysis. PB significantly induced genes and proteins of phase II and antioxidant enzymes, NAD(P)H quinone oxidoreductase 1, and catalase in aging mice (p < 0.05). The expression of these enzymes were stimulated via translocation of Nrf2 into the nucleus, indicating the involvement of ARE, a cis-acting motif located in the promoter region of nearly all phase II genes. PB was testified for the first time to induce cytoprotective genes through the Nrf2/ARE signaling pathway, thus unraveling the antioxidant mechanism of PB during the aging process. © 2016 S. Karger AG, Basel.

  14. Flavonoids as Putative Inducers of the Transcription Factors Nrf2, FoxO, and PPARγ.

    Science.gov (United States)

    Pallauf, Kathrin; Duckstein, Nils; Hasler, Mario; Klotz, Lars-Oliver; Rimbach, Gerald

    2017-01-01

    Dietary flavonoids have been shown to extend the lifespan of some model organisms and may delay the onset of chronic ageing-related diseases. Mechanistically, the effects could be explained by the compounds scavenging free radicals or modulating signalling pathways. Transcription factors Nrf2, FoxO, and PPAR γ possibly affect ageing by regulating stress response, adipogenesis, and insulin sensitivity. Using Hek-293 cells transfected with luciferase reporter constructs, we tested the potency of flavonoids from different subclasses (flavonols, flavones, flavanols, and isoflavones) to activate these transcription factors. Under cell-free conditions (ABTS and FRAP assays), we tested their free radical scavenging activities and used α -tocopherol and ascorbic acid as positive controls. Most of the tested flavonoids, but not the antioxidant vitamins, stimulated Nrf2-, FoxO-, and PPAR γ -dependent promoter activities. Flavonoids activating Nrf2 also tended to induce a FoxO and PPAR γ response. Interestingly, activation patterns of cellular stress response by flavonoids were not mirrored by their activities in ABTS and FRAP assays, which depended mostly on hydroxylation in the flavonoid B ring and, in some cases, extended that of the vitamins. In conclusion, the free radical scavenging properties of flavonoids do not predict whether these molecules can stimulate a cellular response linked to activation of longevity-associated transcription factors.

  15. NRF2 Orchestrates the Metabolic Shift during Induced Pluripotent Stem Cell Reprogramming

    Directory of Open Access Journals (Sweden)

    Kate E. Hawkins

    2016-03-01

    Full Text Available The potential of induced pluripotent stem cells (iPSCs in disease modeling and regenerative medicine is vast, but current methodologies remain inefficient. Understanding the cellular mechanisms underlying iPSC reprogramming, such as the metabolic shift from oxidative to glycolytic energy production, is key to improving its efficiency. We have developed a lentiviral reporter system to assay longitudinal changes in cell signaling and transcription factor activity in living cells throughout iPSC reprogramming of human dermal fibroblasts. We reveal early NF-κB, AP-1, and NRF2 transcription factor activation prior to a temporal peak in hypoxia inducible factor α (HIFα activity. Mechanistically, we show that an early burst in oxidative phosphorylation and elevated reactive oxygen species generation mediates increased NRF2 activity, which in turn initiates the HIFα-mediated glycolytic shift and may modulate glucose redistribution to the pentose phosphate pathway. Critically, inhibition of NRF2 by KEAP1 overexpression compromises metabolic reprogramming and results in reduced efficiency of iPSC colony formation.

  16. Flavonoids as Putative Inducers of the Transcription Factors Nrf2, FoxO, and PPARγ

    Directory of Open Access Journals (Sweden)

    Kathrin Pallauf

    2017-01-01

    Full Text Available Dietary flavonoids have been shown to extend the lifespan of some model organisms and may delay the onset of chronic ageing-related diseases. Mechanistically, the effects could be explained by the compounds scavenging free radicals or modulating signalling pathways. Transcription factors Nrf2, FoxO, and PPARγ possibly affect ageing by regulating stress response, adipogenesis, and insulin sensitivity. Using Hek-293 cells transfected with luciferase reporter constructs, we tested the potency of flavonoids from different subclasses (flavonols, flavones, flavanols, and isoflavones to activate these transcription factors. Under cell-free conditions (ABTS and FRAP assays, we tested their free radical scavenging activities and used α-tocopherol and ascorbic acid as positive controls. Most of the tested flavonoids, but not the antioxidant vitamins, stimulated Nrf2-, FoxO-, and PPARγ-dependent promoter activities. Flavonoids activating Nrf2 also tended to induce a FoxO and PPARγ response. Interestingly, activation patterns of cellular stress response by flavonoids were not mirrored by their activities in ABTS and FRAP assays, which depended mostly on hydroxylation in the flavonoid B ring and, in some cases, extended that of the vitamins. In conclusion, the free radical scavenging properties of flavonoids do not predict whether these molecules can stimulate a cellular response linked to activation of longevity-associated transcription factors.

  17. Prolonged fasting activates Nrf2 in post-weaned elephant seals.

    Science.gov (United States)

    Vázquez-Medina, José Pablo; Soñanez-Organis, José G; Rodriguez, Ruben; Viscarra, Jose A; Nishiyama, Akira; Crocker, Daniel E; Ortiz, Rudy M

    2013-08-01

    Elephant seals naturally experience prolonged periods of absolute food and water deprivation (fasting). In humans, rats and mice, prolonged food deprivation activates the renin-angiotensin system (RAS) and increases oxidative damage. In elephant seals, prolonged fasting activates RAS without increasing oxidative damage likely due to an increase in antioxidant defenses. The mechanism leading to the upregulation of antioxidant defenses during prolonged fasting remains elusive. Therefore, we investigated whether prolonged fasting activates the redox-sensitive transcription factor Nrf2, which controls the expression of antioxidant genes, and if such activation is potentially mediated by systemic increases in RAS. Blood and skeletal muscle samples were collected from seals fasting for 1, 3, 5 and 7 weeks. Nrf2 activity and nuclear content increased by 76% and 167% at week 7. Plasma angiotensin II (Ang II) and transforming growth factor β (TGF-β) were 5000% and 250% higher at week 7 than at week 1. Phosphorylation of Smad2, an effector of Ang II and TGF signaling, increased by 120% at week 7 and by 84% in response to intravenously infused Ang II. NADPH oxidase 4 (Nox4) mRNA expression, which is controlled by smad proteins, increased 430% at week 7, while Nox4 protein expression, which can activate Nrf2, was 170% higher at week 7 than at week 1. These results demonstrate that prolonged fasting activates Nrf2 in elephant seals and that RAS stimulation can potentially result in increased Nox4 through Smad phosphorylation. The results also suggest that Nox4 is essential to sustain the hormetic adaptive response to oxidative stress in fasting seals.

  18. Andrographolide protects against cigarette smoke-induced oxidative lung injury via augmentation of Nrf2 activity

    Science.gov (United States)

    Guan, SP; Tee, W; Ng, DSW; Chan, TK; Peh, HY; Ho, WE; Cheng, C; Mak, JC; Wong, WSF

    2013-01-01

    Background and Purpose Cigarette smoke is a major cause for chronic obstructive pulmonary disease (COPD). Andrographolide is an active biomolecule isolated from the plant Andrographis paniculata. Andrographolide has been shown to activate nuclear factor erythroid-2-related factor 2 (Nrf2), a redox-sensitive antioxidant transcription factor. As Nrf2 activity is reduced in COPD, we hypothesize that andrographolide may have therapeutic value for COPD. Experimental Approach Andrographolide was given i.p. to BALB/c mice daily 2 h before 4% cigarette smoke exposure for 1 h over five consecutive days. Bronchoalveolar lavage fluid and lungs were collected for analyses of cytokines, oxidative damage markers and antioxidant activities. BEAS-2B bronchial epithelial cells were exposed to cigarette smoke extract (CSE) and used to study the antioxidant mechanism of action of andrographolide. Key Results Andrographolide suppressed cigarette smoke-induced increases in lavage fluid cell counts; levels of IL-1β, MCP-1, IP-10 and KC; and levels of oxidative biomarkers 8-isoprostane, 8-OHdG and 3-nitrotyrosine in a dose-dependent manner. Andrographolide promoted inductions of glutathione peroxidase (GPx) and glutathione reductase (GR) activities in lungs from cigarette smoke-exposed mice. In BEAS-2B cells, andrographolide markedly increased nuclear Nrf2 accumulation, promoted binding to antioxidant response element (ARE) and total cellular glutathione level in response to CSE. Andrographolide up-regulated ARE-regulated gene targets including glutamate-cysteine ligase catalytic (GCLC) subunit, GCL modifier (GCLM) subunit, GPx, GR and heme oxygenase-1 in BEAS-2B cells in response to CSE. Conclusions Andrographolide possesses antioxidative properties against cigarette smoke-induced lung injury probably via augmentation of Nrf2 activity and may have therapeutic potential for treating COPD. PMID:23146110

  19. A novel Nrf2 activator from microbial transformation inhibits radiation-induced dermatitis in mice

    International Nuclear Information System (INIS)

    Nakagami, Yasuhiro; Masuda, Kayoko

    2016-01-01

    Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcriptional factor that regulates many antioxidants, and we have recently succeeded in obtaining a novel Nrf2 activator, RS9, from microbial transformation. RS9 is categorized as a triterpenoid, and well-known triterpenoids such as RTA 402 (bardoxolone methyl) and RTA 408 have been tested in clinical trials. RTA 408 lotion is currently being tested in patients at risk for radiation dermatitis. This prompted us to study the profiles of RS9 in the skin. All the above triterpenoids increased the level of an Nrf2-targeted gene, NADPH:quinone oxidoreductase-1, in normal human epidermal keratinocytes. Among them, the activity of RS9 was prominent; furthermore, the cellular toxicity was less compared with RTA compounds. BALB/c mice were irradiated with 30 Gy/day on Day 0, and compounds were topically applied on the back once daily from Day 1 to Day 30. Dermatitis scores peaked on Day 18, with a score of 2.6 in vehicle-treated mice, and topical applications of 0.1% RTA 402, RTA 408 and RS9 reduced the scores to 1.8, 2.0 and 1.4, respectively. Moreover, the percentage of animals with scores ≥2 was analyzed, and 0.1% RS9 suppressed the percentage from 100% to 47%. These results imply that RS9 has potential efficacy for treating radiation dermatitis.

  20. The Role of Nrf2-Mediated Pathway in Cardiac Remodeling and Heart Failure

    Directory of Open Access Journals (Sweden)

    Shanshan Zhou

    2014-01-01

    Full Text Available Heart failure (HF is frequently the consequence of sustained, abnormal neurohormonal, and mechanical stress and remains a leading cause of death worldwide. The key pathophysiological process leading to HF is cardiac remodeling, a term referring to maladaptation to cardiac stress at the molecular, cellular, tissue, and organ levels. HF and many of the conditions that predispose one to HF are associated with oxidative stress. Increased generation of reactive oxygen species (ROS in the heart can directly lead to increased necrosis and apoptosis of cardiomyocytes which subsequently induce cardiac remodeling and dysfunction. Nuclear factor-erythroid-2- (NF-E2- related factor 2 (Nrf2 is a transcription factor that controls the basal and inducible expression of a battery of antioxidant genes and other cytoprotective phase II detoxifying enzymes that are ubiquitously expressed in the cardiovascular system. Emerging evidence has revealed that Nrf2 and its target genes are critical regulators of cardiovascular homeostasis via the suppression of oxidative stress, which is the key player in the development and progression of HF. The purpose of this review is to summarize evidence that activation of Nrf2 enhances endogenous antioxidant defenses and counteracts oxidative stress-associated cardiac remodeling and HF.

  1. Pinocembrin Suppresses H2O2-Induced Mitochondrial Dysfunction by a Mechanism Dependent on the Nrf2/HO-1 Axis in SH-SY5Y Cells.

    Science.gov (United States)

    de Oliveira, Marcos Roberto; da Costa Ferreira, Gustavo; Brasil, Flávia Bittencourt; Peres, Alessandra

    2018-02-01

    Mitochondria are susceptible to redox impairment, which has been associated with neurodegeneration. These organelles are both a source and target of reactive species. In that context, there is increasing interest in finding natural compounds that modulate mitochondrial function and mitochondria-related signaling in order to prevent or to treat diseases involving mitochondrial impairment. Herein, we investigated whether and how pinocembrin (PB) would prevent mitochondrial dysfunction elicited by the exposure of human neuroblastoma SH-SY5Y cells to hydrogen peroxide (H 2 O 2 ). PB (25 μM) was administrated for 4 h before H 2 O 2 treatment (300 μM for 24 h). PB prevented H 2 O 2 -induced loss of cell viability mitochondrial depolarization in SH-SY5Y cells. PB also attenuated redox impairment in mitochondrial membranes. The production of superoxide anion radical (O 2 -• ) and nitric oxide (NO • ) was alleviated by PB in cells exposed to H 2 O 2 . PB suppressed the H 2 O 2 -induced inhibition of the tricarboxylic acid (TCA) cycle enzymes aconitase, α-ketoglutarate dehydrogenase, and succinate dehydrogenase. Furthermore, PB induced anti-inflammatory effects by abolishing the H 2 O 2 -dependent activation of the nuclear factor-κB (NF-κB) and upregulation of interleukin-1β (IL-1β) and tumor necrosis factor-α (TNF-α). The PB-induced antioxidant and anti-inflammatory effects are dependent on the heme oxygenate-1 (HO-1) enzyme and on the activation of the transcription factor nuclear factor erythroid 2-related factor 2 (Nrf2), since HO-1 inhibition (with 0.5 μM ZnPP IX) or Nrf2 silencing (with small interfering RNA (siRNA)) abolished the effects of PB. Overall, PB afforded cytoprotection by the Nrf2/HO-1 axis in H 2 O 2 -treated SH-SY5Y cells.

  2. Lycopene inhibits NF-κB activation and adhesion molecule expression through Nrf2-mediated heme oxygenase-1 in endothelial cells.

    Science.gov (United States)

    Yang, Po-Min; Chen, Huang-Zhi; Huang, Yu-Ting; Hsieh, Chia-Wen; Wung, Being-Sun

    2017-06-01

    The endothelial expression of cell adhesion molecules plays a leading role in atherosclerosis. Lycopene, a carotenoid with 11 conjugated double bonds, has been shown to have anti-inflammatory properties. In the present study, we demonstrate a putative mechanism for the anti-inflammatory effects of lycopene. We demonstrate that lycopene inhibits the adhesion of tumor necrosis factor α (TNFα)-stimulated monocytes to endothelial cells and suppresses the expression of intercellular cell adhesion molecule-1 (ICAM-1) at the transcriptional level. Moreover, lycopene was found to exert its inhibitory effects by blocking the degradation of the inhibitory protein, IκBα, following 6 h of pre-treatment. In TNFα-stimulated endothelial cells, nuclear factor-κB (NF-κB) nuclear translocation and transcriptional activity were abolished by up to 12 h of lycopene pre-treatment. We also found that lycopene increased the intracellular glutathione (GSH) level and glutamate-cysteine ligase expression. Subsequently, lycopene induced nuclear factor-erythroid 2 related factor 2 (Nrf2) activation, leading to the increased expression of downstream of heme oxygenase-1 (HO-1). The use of siRNA targeting HO-1 blocked the inhibitory effects of lycopene on IκB degradation and ICAM-1 expression. The inhibitory effects of lycopene thus appear to be mediated through its induction of Nrf2-mediated HO-1 expression. Therefore, the findings of the present study indicate that lycopene suppresses the activation of TNFα-induced signaling pathways through the upregulation of Nrf2-mediated HO-1 expression.

  3. Reduction of DNA damage induced by titanium dioxide nanoparticles through Nrf2 in vitro and in vivo

    Energy Technology Data Exchange (ETDEWEB)

    Shi, Zhiqin [Department of Toxicology, Hebei Medical University, Shijiazhuang (China); Department of Laboratory Diagnosis, Hebei Medical University, Shijiazhuang (China); Niu, Yujie [Department of Occupational Health and Environmental Health, Hebei Medical University, Shijiazhuang (China); Wang, Qian [Department of Toxicology, Hebei Medical University, Shijiazhuang (China); Shi, Lei [Department of Occupational Health and Environmental Health, Hebei Medical University, Shijiazhuang (China); Guo, Huicai; Liu, Yi; Zhu, Yue [Department of Toxicology, Hebei Medical University, Shijiazhuang (China); Liu, Shufeng; Liu, Chao [Hebei Keylab of Laboratory Animal Science, Shijiazhuang (China); Chen, Xin [Xiumen Community Health Service Centre, Shijiazhuang (China); Zhang, Rong, E-mail: rongzhang@hebmu.edu.cn [Department of Toxicology, Hebei Medical University, Shijiazhuang (China); Hebei Keylab of Laboratory Animal Science, Shijiazhuang (China)

    2015-11-15

    Highlights: • Nrf2 signals were partly responsible for the DNA damage induced by Nano-TiO{sub 2}. • Nrf2 loss could aggravate the DNA damage induced by Nano-TiO{sub 2}. • Acquired Nrf2 decreased the susceptibility to DNA damage induced by Nano-TiO{sub 2}. - Abstract: Titanium dioxide nanoparticles (Nano-TiO{sub 2}) are widely used to additives in cosmetics, pharmaceutical, paints and foods. Recent studies have demonstrated that Nano-TiO{sub 2} induces DNA damage and increased the risk of cancer and the mechanism might relate with oxidative stress. The aim of this study was to evaluate the effects of Nuclear factor erythroid 2 (NF-E2)-related factor 2 (Nrf2), an anti-oxidative mediator, on DNA damage induced by Nano-TiO{sub 2}. Wildtype, Nrf2 knockout (Nrf2(-/-)) and tert-butylhydroquinone (tBHQ) pre-treated HepG2 cells and mice were treated with Nano-TiO{sub 2}. And then the oxidative stress and DNA damage were evaluated. Our data showed that DNA damage, reactive oxygen species (ROS) generation and MDA content in Nano-TiO{sub 2} exposed cells were significantly increased than those of control in dose dependent manners. Nrf2/ARE droved the downstream genes including NAD(P)H dehydrogenase [quinine] 1(NQO1), heme oxygenase 1 (HO-1) and glutamate-cysteine ligase catalytic subunit (GCLC) expression were significantly higher in wildtype HepG2 cells after Nano-TiO{sub 2} treatment. After treatment with Nano-TiO{sub 2}, the DNA damages were significantly increased in Nrf(-/-) cells and mice whereas significantly decreased in tBHQ pre-treatment cells and mice, compared with the wildtype HepG2 cells and mice, respectively. Our results indicated that the acquired of Nrf2 leads to a decreased susceptibility to DNA damages induction by Nano-TiO{sub 2} and decreasing of risk of cancer which would provide a strategy for a more efficacious sensitization of against of Nano-TiO{sub 2} toxication.

  4. The Nrf2-inducers tanshinone I and dihydrotanshinone protect human skin cells and reconstructed human skin against solar simulated UV☆

    Science.gov (United States)

    Tao, Shasha; Justiniano, Rebecca; Zhang, Donna D.; Wondrak, Georg T.

    2013-01-01

    Exposure to solar ultraviolet (UV) radiation is a causative factor in skin photocarcinogenesis and photoaging, and an urgent need exists for improved strategies for skin photoprotection. The redox-sensitive transcription factor Nrf2 (nuclear factor-E2-related factor 2), a master regulator of the cellular antioxidant defense against environmental electrophilic insult, has recently emerged as an important determinant of cutaneous damage from solar UV, and the concept of pharmacological activation of Nrf2 has attracted considerable attention as a novel approach to skin photoprotection. In this study, we examined feasibility of using tanshinones, a novel class of phenanthrenequinone-based cytoprotective Nrf2 inducers derived from the medicinal plant Salvia miltiorrhiza, for protection of cultured human skin cells and reconstructed human skin against solar simulated UV. Using a dual luciferase reporter assay in human Hs27 dermal fibroblasts pronounced transcriptional activation of Nrf2 by four major tanshinones [tanshinone I (T-I), dihydrotanshinone (DHT), tanshinone IIA (T-II-A) and cryptotanshinone (CT)] was detected. In fibroblasts, the more potent tanshinones T-I and DHT caused a significant increase in Nrf2 protein half-life via blockage of ubiquitination, ultimately resulting in upregulated expression of cytoprotective Nrf2 target genes (GCLC, NQO1) with the elevation of cellular glutathione levels. Similar tanshinone-induced changes were also observed in HaCaT keratinocytes. T-I and DHT pretreatment caused significant suppression of skin cell death induced by solar simulated UV and riboflavin-sensitized UVA. Moreover, feasibility of tanshinone-based cutaneous photoprotection was tested employing a human skin reconstruct exposed to solar simulated UV (80 mJ/cm2 UVB; 1.53 J/cm2 UVA). The occurrence of markers of epidermal solar insult (cleaved procaspase 3, pycnotic nuclei, eosinophilic cytoplasm, acellular cavities) was significantly attenuated in DHT

  5. The Nrf2-inducers tanshinone I and dihydrotanshinone protect human skin cells and reconstructed human skin against solar simulated UV.

    Science.gov (United States)

    Tao, Shasha; Justiniano, Rebecca; Zhang, Donna D; Wondrak, Georg T

    2013-01-01

    Exposure to solar ultraviolet (UV) radiation is a causative factor in skin photocarcinogenesis and photoaging, and an urgent need exists for improved strategies for skin photoprotection. The redox-sensitive transcription factor Nrf2 (nuclear factor-E2-related factor 2), a master regulator of the cellular antioxidant defense against environmental electrophilic insult, has recently emerged as an important determinant of cutaneous damage from solar UV, and the concept of pharmacological activation of Nrf2 has attracted considerable attention as a novel approach to skin photoprotection. In this study, we examined feasibility of using tanshinones, a novel class of phenanthrenequinone-based cytoprotective Nrf2 inducers derived from the medicinal plant Salvia miltiorrhiza, for protection of cultured human skin cells and reconstructed human skin against solar simulated UV. Using a dual luciferase reporter assay in human Hs27 dermal fibroblasts pronounced transcriptional activation of Nrf2 by four major tanshinones [tanshinone I (T-I), dihydrotanshinone (DHT), tanshinone IIA (T-II-A) and cryptotanshinone (CT)] was detected. In fibroblasts, the more potent tanshinones T-I and DHT caused a significant increase in Nrf2 protein half-life via blockage of ubiquitination, ultimately resulting in upregulated expression of cytoprotective Nrf2 target genes (GCLC, NQO1) with the elevation of cellular glutathione levels. Similar tanshinone-induced changes were also observed in HaCaT keratinocytes. T-I and DHT pretreatment caused significant suppression of skin cell death induced by solar simulated UV and riboflavin-sensitized UVA. Moreover, feasibility of tanshinone-based cutaneous photoprotection was tested employing a human skin reconstruct exposed to solar simulated UV (80 mJ/cm(2) UVB; 1.53 J/cm(2) UVA). The occurrence of markers of epidermal solar insult (cleaved procaspase 3, pycnotic nuclei, eosinophilic cytoplasm, acellular cavities) was significantly attenuated in DHT

  6. The Nrf2-inducers tanshinone I and dihydrotanshinone protect human skin cells and reconstructed human skin against solar simulated UV

    Directory of Open Access Journals (Sweden)

    Shasha Tao

    2013-01-01

    Full Text Available Exposure to solar ultraviolet (UV radiation is a causative factor in skin photocarcinogenesis and photoaging, and an urgent need exists for improved strategies for skin photoprotection. The redox-sensitive transcription factor Nrf2 (nuclear factor-E2-related factor 2, a master regulator of the cellular antioxidant defense against environmental electrophilic insult, has recently emerged as an important determinant of cutaneous damage from solar UV, and the concept of pharmacological activation of Nrf2 has attracted considerable attention as a novel approach to skin photoprotection. In this study, we examined feasibility of using tanshinones, a novel class of phenanthrenequinone-based cytoprotective Nrf2 inducers derived from the medicinal plant Salvia miltiorrhiza, for protection of cultured human skin cells and reconstructed human skin against solar simulated UV. Using a dual luciferase reporter assay in human Hs27 dermal fibroblasts pronounced transcriptional activation of Nrf2 by four major tanshinones [tanshinone I (T-I, dihydrotanshinone (DHT, tanshinone IIA (T-II-A and cryptotanshinone (CT] was detected. In fibroblasts, the more potent tanshinones T-I and DHT caused a significant increase in Nrf2 protein half-life via blockage of ubiquitination, ultimately resulting in upregulated expression of cytoprotective Nrf2 target genes (GCLC, NQO1 with the elevation of cellular glutathione levels. Similar tanshinone-induced changes were also observed in HaCaT keratinocytes. T-I and DHT pretreatment caused significant suppression of skin cell death induced by solar simulated UV and riboflavin-sensitized UVA. Moreover, feasibility of tanshinone-based cutaneous photoprotection was tested employing a human skin reconstruct exposed to solar simulated UV (80 mJ/cm2 UVB; 1.53 J/cm2 UVA. The occurrence of markers of epidermal solar insult (cleaved procaspase 3, pycnotic nuclei, eosinophilic cytoplasm, acellular cavities was significantly attenuated in DHT

  7. Induction of the pi class of glutathione S-transferase by carnosic acid in rat Clone 9 cells via the p38/Nrf2 pathway.

    Science.gov (United States)

    Lin, Chia-Yuan; Wu, Chi-Rei; Chang, Shu-Wei; Wang, Yu-Jung; Wu, Jia-Jiuan; Tsai, Chia-Wen

    2015-06-01

    Induction of phase II enzymes is important in cancer chemoprevention. We compared the effect of rosemary diterpenes on the expression of the pi class of glutathione S-transferase (GSTP) in rat liver Clone 9 cells and the signaling pathways involved. Culturing cells with 1, 5, 10, or 20 μM carnosic acid (CA) or carnosol (CS) for 24 h in a dose-dependent manner increased the GSTP expression. CA was more potent than CS. The RNA level and the enzyme activity of GSTP were also enhanced by CA treatment. Treatment with 10 μM CA highly induced the reporter activity of the enhancer element GPEI. Furthermore, CA markedly increased the translocation of nuclear factor erythroid-2 related factor 2 (Nrf2) from the cytosol to the nucleus after 30 to 60 min. CA the stimulated the protein induction of p38, nuclear Nrf2, and GSTP was diminished in the presence of SB203580 (a p38 inhibitor). In addition, SB203580 pretreatment or silencing of Nrf2 by siRNA suppressed the CA-induced GPEI-DNA binding activity and GSTP protein expression. Knockdown of p38 or Nrf2 by siRNA abolished the activation of p38 and Nrf2 as well as the protein induction and enzyme activity of GSTP by CA. These results suggest that CA up-regulates the expression and enzyme activity of GSTP via the p38/Nrf2/GPEI pathway.

  8. Carvedilol, a third-generation β-blocker prevents oxidative stress-induced neuronal death and activates Nrf2/ARE pathway in HT22 cells

    Energy Technology Data Exchange (ETDEWEB)

    Ouyang, Ying [Department of Pediatrics, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou (China); Chen, Ziwei [Department of Pharmacology and Toxicology, School of Pharmaceutical Sciences, Sun Yat-Sen University, Guangzhou (China); Tan, Min [Department of Pharmacology and Toxicology, School of Pharmaceutical Sciences, Sun Yat-Sen University, Guangzhou (China); Department of Traditional Chinese Medicine Chemistry, College of Chinese Materia Madica, Guangzhou University of Chinese Medicine, Guangzhou 510006 (China); Liu, Anmin [Department of Neurosurgery, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou (China); Chen, Meihui [Department of Pharmacology and Toxicology, School of Pharmaceutical Sciences, Sun Yat-Sen University, Guangzhou (China); Liu, Jun [Department of Neurology, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou (China); Pi, Rongbiao, E-mail: pirb@mail.sysu.edu.cn [Department of Pharmacology and Toxicology, School of Pharmaceutical Sciences, Sun Yat-Sen University, Guangzhou (China); Fang, Jianpei, E-mail: jpf2005@163.com [Department of Pediatrics, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou (China)

    2013-11-29

    Highlights: •Carvedilol significantly prevented oxidative stress-induced cell death. •Carvedilol significantly decreased the production of ROS. •Carvedilol activated Nrf2/ARE pathway. •Carvedilol increased the protein levels of HO-1 and NQO-1. -- Abstract: Carvedilol, a nonselective β-adrenoreceptor blocker with pleiotropic activities has been shown to exert neuroprotective effect due to its antioxidant property. However, the neuroprotective mechanism of carvedilol is still not fully uncovered. Nuclear factor E2-related factor 2 (Nrf2)/antioxidant response element (ARE) pathway is an important cellular stress response pathway involved in neuroprotection. Here we investigated the effect of carvedilol on oxidative stress-induced cell death (glutamate 2 mM and H{sub 2}O{sub 2} 600 μM) and the activity of Nrf2/ARE pathway in HT22 hippocampal cells. Carvedilol significantly increased cell viability and decreased ROS in HT22 cells exposed to glutamate or H{sub 2}O{sub 2}. Furthermore, carvedilol activated the Nrf2/ARE pathway in a concentration-dependent manner, and increased the protein levels of heme oxygenase-1(HO-1) and NAD(P)H quinone oxidoreductase-1(NQO-1), two downstream factors of the Nrf2/ARE pathway. Collectively, our results indicate that carvedilol protects neuronal cell against glutamate- and H{sub 2}O{sub 2}-induced neurotoxicity possibly through activating the Nrf2/ARE signaling pathway.

  9. EX4 stabilizes and activates Nrf2 via PKCδ, contributing to the prevention of oxidative stress-induced pancreatic beta cell damage

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Mi-Hwi; Kim, Eung-Hwi [College of Pharmacy, Gachon Institute of Pharmaceutical Science, Gachon University, Yeonsu-ku, Incheon (Korea, Republic of); Lee Gil Ya Cancer and Diabetes Institute, Gachon University, Yeonsu-ku, Incheon (Korea, Republic of); Jung, Hye Seung [Department of Internal Medicine, Seoul National University College of Medicine, Seoul (Korea, Republic of); Yang, Dongki [Department of Physiology, Gachon University College of Medicine, Incheon (Korea, Republic of); Park, Eun-Young, E-mail: parkey@mokpo.ac.kr [College of Pharmacy, Natural Medicine Research Institute, Mokpo National University, Muan-gun, Jeonnam (Korea, Republic of); Jun, Hee-Sook, E-mail: hsjun@gachon.ac.kr [College of Pharmacy, Gachon Institute of Pharmaceutical Science, Gachon University, Yeonsu-ku, Incheon (Korea, Republic of); Lee Gil Ya Cancer and Diabetes Institute, Gachon University, Yeonsu-ku, Incheon (Korea, Republic of); Gachon Medical Research Institute, Gil Hospital, Incheon (Korea, Republic of)

    2017-01-15

    Oxidative stress in pancreatic beta cells can inhibit insulin secretion and promote apoptotic cell death. Exendin-4 (EX4), a glucagon-like peptide-1 receptor agonist, can suppress beta cell apoptosis, improve beta cell function and protect against oxidative damage. In this study, we investigated the molecular mechanisms for antioxidative effects of EX4 in pancreatic beta cells. INS-1 cells, a rat insulinoma cell line, were pretreated with EX4 and exposed to palmitate or H{sub 2}O{sub 2}. Reactive oxygen species (ROS) production, and glutathione and insulin secretion were measured. The mRNA and protein expression levels of antioxidant genes were examined. The level of nuclear factor erythroid 2-related factor 2 (Nrf2), its binding to antioxidant response element (ARE), and its ubiquination in the presence of EX4 were determined. The Nrf2 signaling pathway was determined using rottlerin (protein kinase [PK]Cδ inhibitor), H89 (PKA inhibitor) and LY294002 (phosphatidylinositide 3-kinase [PI3K] inhibitor). EX4 treatment decreased ROS production, recovered cellular glutathione levels and insulin secretion in the presence of oxidative stress in INS-1 cells. The expression levels of glutamate-cysteine ligase catalytic subunit and heme oxygenase-1 were increased by EX4 treatment. EX4 promoted Nrf2 translocation, ARE binding activity and enhanced stabilization of Nrf2 by inhibition of ubiquitination. Knockdown of Nrf2 abolished the effect of EX4 on increased insulin secretion. Inhibition of PKCδ attenuated Nrf2 translocation and antioxidative gene expression by EX4 treatment. We suggest that EX4 activates and stabilizes Nrf2 through PKCδ activation, contributing to the increase of antioxidant gene expression and consequently improving beta cell function in the presence of oxidative stress. - Highlights: • EX4 protects against oxidative stress-induced pancreatic beta cell dysfunction. • EX4 increases antioxidant gene expression. • Antioxidative effect of EX4 is

  10. EX4 stabilizes and activates Nrf2 via PKCδ, contributing to the prevention of oxidative stress-induced pancreatic beta cell damage

    International Nuclear Information System (INIS)

    Kim, Mi-Hwi; Kim, Eung-Hwi; Jung, Hye Seung; Yang, Dongki; Park, Eun-Young; Jun, Hee-Sook

    2017-01-01

    Oxidative stress in pancreatic beta cells can inhibit insulin secretion and promote apoptotic cell death. Exendin-4 (EX4), a glucagon-like peptide-1 receptor agonist, can suppress beta cell apoptosis, improve beta cell function and protect against oxidative damage. In this study, we investigated the molecular mechanisms for antioxidative effects of EX4 in pancreatic beta cells. INS-1 cells, a rat insulinoma cell line, were pretreated with EX4 and exposed to palmitate or H 2 O 2 . Reactive oxygen species (ROS) production, and glutathione and insulin secretion were measured. The mRNA and protein expression levels of antioxidant genes were examined. The level of nuclear factor erythroid 2-related factor 2 (Nrf2), its binding to antioxidant response element (ARE), and its ubiquination in the presence of EX4 were determined. The Nrf2 signaling pathway was determined using rottlerin (protein kinase [PK]Cδ inhibitor), H89 (PKA inhibitor) and LY294002 (phosphatidylinositide 3-kinase [PI3K] inhibitor). EX4 treatment decreased ROS production, recovered cellular glutathione levels and insulin secretion in the presence of oxidative stress in INS-1 cells. The expression levels of glutamate-cysteine ligase catalytic subunit and heme oxygenase-1 were increased by EX4 treatment. EX4 promoted Nrf2 translocation, ARE binding activity and enhanced stabilization of Nrf2 by inhibition of ubiquitination. Knockdown of Nrf2 abolished the effect of EX4 on increased insulin secretion. Inhibition of PKCδ attenuated Nrf2 translocation and antioxidative gene expression by EX4 treatment. We suggest that EX4 activates and stabilizes Nrf2 through PKCδ activation, contributing to the increase of antioxidant gene expression and consequently improving beta cell function in the presence of oxidative stress. - Highlights: • EX4 protects against oxidative stress-induced pancreatic beta cell dysfunction. • EX4 increases antioxidant gene expression. • Antioxidative effect of EX4 is mediated by

  11. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  12. Hyperactivation of Nrf2 in early tubular development induces nephrogenic diabetes insipidus

    Science.gov (United States)

    Suzuki, Takafumi; Seki, Shiori; Hiramoto, Keiichiro; Naganuma, Eriko; Kobayashi, Eri H.; Yamaoka, Ayaka; Baird, Liam; Takahashi, Nobuyuki; Sato, Hiroshi; Yamamoto, Masayuki

    2017-01-01

    NF-E2-related factor-2 (Nrf2) regulates cellular responses to oxidative and electrophilic stress. Loss of Keap1 increases Nrf2 protein levels, and Keap1-null mice die of oesophageal hyperkeratosis because of Nrf2 hyperactivation. Here we show that deletion of oesophageal Nrf2 in Keap1-null mice allows survival until adulthood, but the animals develop polyuria with low osmolality and bilateral hydronephrosis. This phenotype is caused by defects in water reabsorption that are the result of reduced aquaporin 2 levels in the kidney. Renal tubular deletion of Keap1 promotes nephrogenic diabetes insipidus features, confirming that Nrf2 activation in developing tubular cells causes a water reabsorption defect. These findings suggest that Nrf2 activity should be tightly controlled during development in order to maintain renal homeostasis. In addition, tissue-specific ablation of Nrf2 in Keap1-null mice might create useful animal models to uncover novel physiological functions of Nrf2. PMID:28233855

  13. Green tea polyphenol (−)-epigallocatechin-3-gallate triggered hepatotoxicity in mice: Responses of major antioxidant enzymes and the Nrf2 rescue pathway

    International Nuclear Information System (INIS)

    Wang, Dongxu; Wang, Yijun; Wan, Xiaochun; Yang, Chung S.; Zhang, Jinsong

    2015-01-01

    (−)-Epigallocatechin-3-gallate (EGCG), a constituent of green tea, has been suggested to have numerous health-promoting effects. On the other hand, high-dose EGCG is able to evoke hepatotoxicity. In the present study, we elucidated the responses of hepatic major antioxidant enzymes and nuclear factor erythroid 2-related factor 2 (Nrf2) rescue pathway to high-dose levels of EGCG in Kunming mice. At a non-lethal toxic dose (75 mg/kg, i.p.), repeated EGCG treatments markedly decreased the levels of superoxide dismutase, catalase, and glutathione peroxidase. As a rescue response, the nuclear distribution of Nrf2 was significantly increased; a battery of Nrf2-target genes, including heme oxygenase 1 (HO1), NAD(P)H:quinone oxidoreductase 1 (NQO1), glutathione S-transferase (GST), and those involved in glutathione and thioredoxin systems, were all up-regulated. At the maximum tolerated dose (45 mg/kg, i.p.), repeated EGCG treatments did not disturb the major antioxidant defense. Among the above-mentioned genes, only HO1, NQO1, and GST genes were significantly but modestly up-regulated, suggesting a comprehensive and extensive activation of Nrf2-target genes principally occurs at toxic levels of EGCG. At a lethal dose (200 mg/kg, i.p.), a single EGCG treatment dramatically decreased not only the major antioxidant defense but also the Nrf2-target genes, demonstrating that toxic levels of EGCG are able to cause a biphasic response of Nrf2. Overall, the mechanism of EGCG-triggered hepatotoxicity involves suppression of major antioxidant enzymes, and the Nrf2 rescue pathway plays a vital role for counteracting EGCG toxicity. - Highlights: • EGCG at maximum tolerated dose does not disturb hepatic major antioxidant defense. • EGCG at maximum tolerated dose modestly upregulates hepatic Nrf2 target genes. • EGCG at toxic dose suppresses hepatic major antioxidant enzymes. • EGCG at non-lethal toxic dose pronouncedly activates hepatic Nrf2 rescue response. • EGCG at

  14. Green tea polyphenol (−)-epigallocatechin-3-gallate triggered hepatotoxicity in mice: Responses of major antioxidant enzymes and the Nrf2 rescue pathway

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Dongxu; Wang, Yijun; Wan, Xiaochun [Key Laboratory of Tea Biochemistry & Biotechnology, School of Tea & Food Science, Anhui Agricultural University, Hefei, Anhui 230036 (China); Yang, Chung S. [Department of Chemical Biology, Ernest Mario School of Pharmacy, Rutgers, The State University of New Jersey, Piscataway, NJ 08854 (United States); Zhang, Jinsong, E-mail: zjs@ahau.edu.cn [Key Laboratory of Tea Biochemistry & Biotechnology, School of Tea & Food Science, Anhui Agricultural University, Hefei, Anhui 230036 (China)

    2015-02-15

    (−)-Epigallocatechin-3-gallate (EGCG), a constituent of green tea, has been suggested to have numerous health-promoting effects. On the other hand, high-dose EGCG is able to evoke hepatotoxicity. In the present study, we elucidated the responses of hepatic major antioxidant enzymes and nuclear factor erythroid 2-related factor 2 (Nrf2) rescue pathway to high-dose levels of EGCG in Kunming mice. At a non-lethal toxic dose (75 mg/kg, i.p.), repeated EGCG treatments markedly decreased the levels of superoxide dismutase, catalase, and glutathione peroxidase. As a rescue response, the nuclear distribution of Nrf2 was significantly increased; a battery of Nrf2-target genes, including heme oxygenase 1 (HO1), NAD(P)H:quinone oxidoreductase 1 (NQO1), glutathione S-transferase (GST), and those involved in glutathione and thioredoxin systems, were all up-regulated. At the maximum tolerated dose (45 mg/kg, i.p.), repeated EGCG treatments did not disturb the major antioxidant defense. Among the above-mentioned genes, only HO1, NQO1, and GST genes were significantly but modestly up-regulated, suggesting a comprehensive and extensive activation of Nrf2-target genes principally occurs at toxic levels of EGCG. At a lethal dose (200 mg/kg, i.p.), a single EGCG treatment dramatically decreased not only the major antioxidant defense but also the Nrf2-target genes, demonstrating that toxic levels of EGCG are able to cause a biphasic response of Nrf2. Overall, the mechanism of EGCG-triggered hepatotoxicity involves suppression of major antioxidant enzymes, and the Nrf2 rescue pathway plays a vital role for counteracting EGCG toxicity. - Highlights: • EGCG at maximum tolerated dose does not disturb hepatic major antioxidant defense. • EGCG at maximum tolerated dose modestly upregulates hepatic Nrf2 target genes. • EGCG at toxic dose suppresses hepatic major antioxidant enzymes. • EGCG at non-lethal toxic dose pronouncedly activates hepatic Nrf2 rescue response. • EGCG at

  15. Eriodictyol Protects Endothelial Cells against Oxidative Stress-Induced Cell Death through Modulating ERK/Nrf2/ARE-Dependent Heme Oxygenase-1 Expression.

    Science.gov (United States)

    Lee, Seung Eun; Yang, Hana; Son, Gun Woo; Park, Hye Rim; Park, Cheung-Seog; Jin, Young-Ho; Park, Yong Seek

    2015-06-26

    The pathophysiology of cardiovascular diseases is complex and may involve oxidative stress-related pathways. Eriodictyol is a flavonoid present in citrus fruits that demonstrates anti-inflammatory, anti-cancer, neurotrophic, and antioxidant effects in a range of pathophysiological conditions including vascular diseases. Because oxidative stress plays a key role in the pathogenesis of cardiovascular disease, the present study was designed to verify whether eriodictyol has therapeutic potential. Upregulation of heme oxygenase-1 (HO-1), a phase II detoxifying enzyme, in endothelial cells is considered to be helpful in cardiovascular disease. In this study, human umbilical vein endothelial cells (HUVECs) treated with eriodictyol showed the upregulation of HO-1 through extracellular-regulated kinase (ERK)/nuclear factor erythroid 2-related factor 2 (Nrf2)/antioxidant response element (ARE) signaling pathways. Further, eriodictyol treatment provided protection against hydrogen peroxide-provoked cell death. This protective effect was eliminated by treatment with a specific inhibitor of HO-1 and RNA interference-mediated knockdown of HO-1 expression. These data demonstrate that eriodictyol induces ERK/Nrf2/ARE-mediated HO-1 upregulation in human endothelial cells, which is directly associated with its vascular protection against oxidative stress-related endothelial injury, and propose that targeting the upregulation of HO-1 is a promising approach for therapeutic intervention in cardiovascular disease.

  16. Evaluation of the rotenone-induced activation of the Nrf2 pathway in a neuronal model derived from human induced pluripotent stem cells.

    Science.gov (United States)

    Zagoura, Dimitra; Canovas-Jorda, David; Pistollato, Francesca; Bremer-Hoffmann, Susanne; Bal-Price, Anna

    2017-06-01

    Human induced pluripotent stem cells (hiPSCs) are considered as a powerful tool for drug and chemical screening and development of new in vitro testing strategies in the field of toxicology, including neurotoxicity evaluation. These cells are able to expand and efficiently differentiate into different types of neuronal and glial cells as well as peripheral neurons. These human cells-based neuronal models serve as test systems for mechanistic studies on different pathways involved in neurotoxicity. One of the well-known mechanisms that are activated by chemically-induced oxidative stress is the Nrf2 signaling pathway. Therefore, in the current study, we evaluated whether Nrf2 signaling machinery is expressed in human induced pluripotent stem cells (hiPSCs)-derived mixed neuronal/glial culture and if so whether it becomes activated by rotenone-induced oxidative stress mediated by complex I inhibition of mitochondrial respiration. Rotenone was found to induce the activation of Nrf2 signaling particularly at the highest tested concentration (100 nM), as shown by Nrf2 nuclear translocation and the up-regulation of the Nrf2-downstream antioxidant enzymes, NQO1 and SRXN1. Interestingly, exposure to rotenone also increased the number of astroglial cells in which Nrf2 activation may play an important role in neuroprotection. Moreover, rotenone caused cell death of dopaminergic neurons since a decreased percentage of tyrosine hydroxylase (TH + ) cells was observed. The obtained results suggest that hiPSC-derived mixed neuronal/glial culture could be a valuable in vitro human model for the establishment of neuronal specific assays in order to link Nrf2 pathway activation (biomarker of oxidative stress) with additional neuronal specific readouts that could be applied to in vitro neurotoxicity evaluation. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  17. Topical Bixin Confers NRF2-Dependent Protection Against Photodamage and Hair Graying in Mouse Skin

    Science.gov (United States)

    Rojo de la Vega, Montserrat; Zhang, Donna D.; Wondrak, Georg T.

    2018-01-01

    Environmental exposure to solar ultraviolet (UV) radiation causes acute photodamage, premature aging, and skin cancer, attributable to UV-induced genotoxic, oxidative, and inflammatory stress. The transcription factor NRF2 [nuclear factor erythroid 2 (E2)-related factor 2] is the master regulator of the cellular antioxidant response protecting skin against various environmental stressors including UV radiation and electrophilic pollutants. NRF2 in epidermal keratinocytes can be activated using natural chemopreventive compounds such as the apocarotenoid bixin, an FDA-approved food additive and cosmetic ingredient from the seeds of the achiote tree (Bixa orellana). Here, we tested the feasibility of topical use of bixin for NRF2-dependent skin photoprotection in two genetically modified mouse models [SKH1 and C57BL/6J (Nrf2+/+ versus Nrf2-/-)]. First, we observed that a bixin formulation optimized for topical NRF2 activation suppresses acute UV-induced photodamage in Nrf2+/+ but not Nrf2-/- SKH1 mice, a photoprotective effect indicated by reduced epidermal hyperproliferation and oxidative DNA damage. Secondly, it was demonstrated that topical bixin suppresses PUVA (psoralen + UVA)-induced hair graying in Nrf2+/+ but not Nrf2-/- C57BL/6J mice. Collectively, this research provides the first in vivo evidence that topical application of bixin can protect against UV-induced photodamage and PUVA-induced loss of hair pigmentation through NRF2 activation. Topical NRF2 activation using bixin may represent a novel strategy for human skin photoprotection, potentially complementing conventional sunscreen-based approaches. PMID:29636694

  18. Inducers of Senescence, Toxic Compounds, and Senolytics: The Multiple Faces of Nrf2-Activating Phytochemicals in Cancer Adjuvant Therapy

    Directory of Open Access Journals (Sweden)

    Marco Malavolta

    2018-01-01

    Full Text Available The reactivation of senescence in cancer and the subsequent clearance of senescent cells are suggested as therapeutic intervention in the eradication of cancer. Several natural compounds that activate Nrf2 (nuclear factor erythroid-derived 2-related factor 2 pathway, which is involved in complex cytoprotective responses, have been paradoxically shown to induce cell death or senescence in cancer. Promoting the cytoprotective Nrf2 pathway may be desirable for chemoprevention, but it might be detrimental in later stages and advanced cancers. However, senolytic activity shown by some Nrf2-activating compounds could be used to target senescent cancer cells (particularly in aged immune-depressed organisms that escape immunosurveillance. We herein describe in vitro and in vivo effects of fifteen Nrf2-interacting natural compounds (tocotrienols, curcumin, epigallocatechin gallate, quercetin, genistein, resveratrol, silybin, phenethyl isothiocyanate, sulforaphane, triptolide, allicin, berberine, piperlongumine, fisetin, and phloretin on cellular senescence and discuss their use in adjuvant cancer therapy. In light of available literature, it can be concluded that the meaning and the potential of adjuvant therapy with natural compounds in humans remain unclear, also taking into account the existence of few clinical trials mostly characterized by uncertain results. Further studies are needed to investigate the therapeutic potential of those compounds that display senolytic activity.

  19. UVA Irradiation Enhances Brusatol-Mediated Inhibition of Melanoma Growth by Downregulation of the Nrf2-Mediated Antioxidant Response

    Science.gov (United States)

    Wang, Mei; Shi, Guangwei; Bian, Chunxiang; Nisar, Muhammad Farrukh; Guo, Yingying; Wu, Yan; Li, Wei; Huang, Xiao; Jiang, Xuemei; Bartsch, Jörg W.

    2018-01-01

    Brusatol (BR) is a potent inhibitor of Nrf2, a transcription factor that is highly expressed in cancer tissues and confers chemoresistance. UVA-generated reactive oxygen species (ROS) can damage both normal and cancer cells and may be of potential use in phototherapy. In order to provide an alternative method to treat the aggressive melanoma, we sought to investigate whether low-dose UVA with BR is more effective in eliminating melanoma cells than the respective single treatments. We found that BR combined with UVA led to inhibition of A375 melanoma cell proliferation by cell cycle arrest in the G1 phase and triggers cell apoptosis. Furthermore, inhibition of Nrf2 expression attenuated colony formation and tumor development from A375 cells in heterotopic mouse models. In addition, cotreatment of UVA and BR partially suppressed Nrf2 and its downstream target genes such as HO-1 along with the PI3K/AKT pathway. We propose that cotreatment increased ROS-induced cell cycle arrest and cellular apoptosis and inhibits melanoma growth by regulating the AKT-Nrf2 pathway in A375 cells which offers a possible therapeutic intervention strategy for the treatment of human melanoma. PMID:29670684

  20. Cul3-mediated Nrf2 ubiquitination and antioxidant response element (ARE) activation are dependent on the partial molar volume at position 151 of Keap1.

    Science.gov (United States)

    Eggler, Aimee L; Small, Evan; Hannink, Mark; Mesecar, Andrew D

    2009-07-29

    Nrf2 (nuclear factor erythroid 2-related factor 2) is a transcription factor that activates transcription of a battery of cytoprotective genes by binding to the ARE (antioxidant response element). Nrf2 is repressed by the cysteine-rich Keap1 (kelch-like ECH-associated protein 1) protein, which targets Nrf2 for ubiquitination and subsequent degradation by a Cul3 (cullin 3)-mediated ubiquitination complex. We find that modification of Cys(151) of human Keap1, by mutation to a tryptophan, relieves the repression by Keap1 and allows activation of the ARE by Nrf2. The Keap1 C151W substitution has a decreased affinity for Cul3, and can no longer serve to target Nrf2 for ubiquitination, though it retains its affinity for Nrf2. A series of 12 mutant Keap1 proteins, each containing a different residue at position 151, was constructed to explore the chemistry required for this effect. The series reveals that the extent to which Keap1 loses the ability to target Nrf2 for degradation, and hence the ability to repress ARE activation, correlates well with the partial molar volume of the residue. Other physico-chemical properties do not appear to contribute significantly to the effect. Based on this finding, a structural model is proposed whereby large residues at position 151 cause steric clashes that lead to alteration of the Keap1-Cul3 interaction. This model has significant implications for how electrophiles which modify Cys(151), disrupt the repressive function of Keap1.

  1. Activation of Nrf2 is required for up-regulation of the π class of glutathione S-transferase in rat primary hepatocytes with L-methionine starvation.

    Science.gov (United States)

    Lin, Ai-Hsuan; Chen, Haw-Wen; Liu, Cheng-Tze; Tsai, Chia-Wen; Lii, Chong-Kuei

    2012-07-04

    Numerous genes expression is regulated in response to amino acid shortage, which helps organisms adapt to amino acid limitation. The expression of the π class of glutathione (GSH) S-transferase (GSTP), a highly inducible phase II detoxification enzyme, is regulated mainly by activates activating protein 1 (AP-1) binding to the enhancer I of GSTP (GPEI). Here we show the critical role of nuclear factor erythroid-2-related factor 2 (Nrf2) in up-regulating GSTP gene transcription. Primary rat hepatocytes were cultured in a methionine-restricted medium, and immunoblotting and RT-PCR analyses showed that methionine restriction time-dependently increased GSTP protein and mRNA expression over a 48 h period. Nrf2 translocation to the nucleus, nuclear proteins binding to GPEI, and antioxidant response element (ARE) luciferase reporter activity were increased by methionine restriction as well as by l-buthionine sulfoximine (BSO), a GSH synthesis inhibitor. Transfection with Nrf2 siRNA knocked down Nrf2 expression and reversed the methionine-induced GSTP expression and GPEI binding activity. Chromatin immunoprecipitation assay confirmed the binding of Nrf2 to the GPEI. Phosphorylation of extracellular signal-regulated kinase 2 (ERK2) was increased in methionine-restricted and BSO-treated cells. ERK2 siRNA abolished methionine restriction-induced Nrf2 nuclear translocation, GPEI binding activity, ARE-luciferase reporter activity, and GSTP expression. Our results suggest that the up-regulation of GSTP gene transcription in response to methionine restriction likely occurs via the ERK-Nrf2-GPEI signaling pathway.

  2. TGF-β and Hypoxia/Reoxygenation Promote Radioresistance of A549 Lung Cancer Cells through Activation of Nrf2 and EGFR

    Directory of Open Access Journals (Sweden)

    Sae-lo-oom Lee

    2016-01-01

    Full Text Available Although many studies have examined the roles of hypoxia and transforming growth factor- (TGF- β separately in the tumor microenvironment, the effects of simultaneous treatment with hypoxia/reoxygenation and TGF-β on tumor malignancy are unclear. Here, we investigated the effects of redox signaling and oncogenes on cell proliferation and radioresistance in A549 human lung cancer cells in the presence of TGF-β under hypoxia/reoxygenation conditions. Combined treatment with TGF-β and hypoxia activated epidermal growth factor receptor (EGFR and nuclear factor (erythroid-derived 2-like 2 (Nrf2, a redox-sensitive transcription factor. Interestingly, Nrf2 knockdown suppressed the effects of combined treatment on EGFR phosphorylation. In addition, blockade of EGFR signaling also suppressed induction of Nrf2 following combined treatment with hypoxia and TGF-β, indicating that the combined treatment induced positive crosstalk between Nrf2 and EGFR. TGF-β and hypoxia/reoxygenation increased the accumulation of reactive oxygen species (ROS, while treatment with N-acetyl-L-cysteine abolished the activation of Nrf2 and EGFR. Treatment with TGF-β under hypoxic conditions increased the proliferation of A549 cells compared with that after vehicle treatment. Moreover, cells treated with the combined treatment exhibited resistance to ionizing radiation (IR, and knockdown of Nrf2 increased IR-induced cell death under these conditions. Thus, taken together, our findings suggested that TGF-β and hypoxia/reoxygenation promoted tumor progression and radioresistance of A549 cells through ROS-mediated activation of Nrf2 and EGFR.

  3. Decreased histone deacetylase 2 impairs Nrf2 activation by oxidative stress

    International Nuclear Information System (INIS)

    Mercado, Nicolas; Thimmulappa, Rajesh; Thomas, Catherine M.R.; Fenwick, Peter S.; Chana, Kirandeep K.; Donnelly, Louise E.; Biswal, Shyam; Ito, Kazuhiro; Barnes, Peter J.

    2011-01-01

    Research highlights: → Nrf2 anti-oxidant function is impaired when HDAC activity is inhibited. → HDAC inhibition decreases Nrf2 protein stability. → HDAC2 is involved in reduced Nrf2 stability and both correlate in COPD samples. → HDAC inhibition increases Nrf2 acetylation. -- Abstract: Nuclear factor erythroid 2-related factor 2 (Nrf2) plays a crucial role in cellular defence against oxidative stress by inducing the expression of multiple anti-oxidant genes. However, where high levels of oxidative stress are observed, such as chronic obstructive pulmonary disease (COPD), Nrf2 activity is reduced, although the molecular mechanism for this defect is uncertain. Here, we show that down-regulation of histone deacetylase (HDAC) 2 causes Nrf2 instability, resulting in reduced anti-oxidant gene expression and increase sensitivity to oxidative stress. Although Nrf2 protein was clearly stabilized after hydrogen peroxide (H 2 O 2 ) stimulation in a bronchial epithelial cell line (BEAS2B), Nrf2 stability was decreased and Nrf2 acetylation increased in the presence of an HDAC inhibitor, trichostatin A (TSA). TSA also reduced Nrf2-regulated heme-oxygenase-1 (HO-1) expression in these cells, and this was confirmed in acute cigarette-smoke exposed mice in vivo. HDAC2 knock-down by RNA interference resulted in reduced H 2 O 2 -induced Nrf2 protein stability and activity in BEAS2B cells, whereas HDAC1 knockdown had no effect. Furthermore, monocyte-derived macrophages obtained from healthy volunteers (non-smokers and smokers) and COPD patients showed a significant correlation between HDAC2 expression and Nrf2 expression (r = 0.92, p < 0.0001). Thus, reduced HDAC2 activity in COPD may account for increased Nrf2 acetylation, reduced Nrf2 stability and impaired anti oxidant defences.

  4. Decreased histone deacetylase 2 impairs Nrf2 activation by oxidative stress

    Energy Technology Data Exchange (ETDEWEB)

    Mercado, Nicolas [Airway Disease Section, National Heart and Lung Institute, Imperial College, London SW3 6LY (United Kingdom); Thimmulappa, Rajesh [Department of Environmental Health Sciences, Johns Hopkins Bloomberg School of Public Health, Baltimore, MD (United States); Thomas, Catherine M.R.; Fenwick, Peter S.; Chana, Kirandeep K.; Donnelly, Louise E. [Airway Disease Section, National Heart and Lung Institute, Imperial College, London SW3 6LY (United Kingdom); Biswal, Shyam [Department of Environmental Health Sciences, Johns Hopkins Bloomberg School of Public Health, Baltimore, MD (United States); Ito, Kazuhiro [Airway Disease Section, National Heart and Lung Institute, Imperial College, London SW3 6LY (United Kingdom); Barnes, Peter J., E-mail: p.j.barnes@imperial.ac.uk [Airway Disease Section, National Heart and Lung Institute, Imperial College, London SW3 6LY (United Kingdom)

    2011-03-11

    Research highlights: {yields} Nrf2 anti-oxidant function is impaired when HDAC activity is inhibited. {yields} HDAC inhibition decreases Nrf2 protein stability. {yields} HDAC2 is involved in reduced Nrf2 stability and both correlate in COPD samples. {yields} HDAC inhibition increases Nrf2 acetylation. -- Abstract: Nuclear factor erythroid 2-related factor 2 (Nrf2) plays a crucial role in cellular defence against oxidative stress by inducing the expression of multiple anti-oxidant genes. However, where high levels of oxidative stress are observed, such as chronic obstructive pulmonary disease (COPD), Nrf2 activity is reduced, although the molecular mechanism for this defect is uncertain. Here, we show that down-regulation of histone deacetylase (HDAC) 2 causes Nrf2 instability, resulting in reduced anti-oxidant gene expression and increase sensitivity to oxidative stress. Although Nrf2 protein was clearly stabilized after hydrogen peroxide (H{sub 2}O{sub 2}) stimulation in a bronchial epithelial cell line (BEAS2B), Nrf2 stability was decreased and Nrf2 acetylation increased in the presence of an HDAC inhibitor, trichostatin A (TSA). TSA also reduced Nrf2-regulated heme-oxygenase-1 (HO-1) expression in these cells, and this was confirmed in acute cigarette-smoke exposed mice in vivo. HDAC2 knock-down by RNA interference resulted in reduced H{sub 2}O{sub 2}-induced Nrf2 protein stability and activity in BEAS2B cells, whereas HDAC1 knockdown had no effect. Furthermore, monocyte-derived macrophages obtained from healthy volunteers (non-smokers and smokers) and COPD patients showed a significant correlation between HDAC2 expression and Nrf2 expression (r = 0.92, p < 0.0001). Thus, reduced HDAC2 activity in COPD may account for increased Nrf2 acetylation, reduced Nrf2 stability and impaired anti oxidant defences.

  5. Nitroxide delivery system for Nrf2 activation and skin protection.

    Science.gov (United States)

    Ben Yehuda Greenwald, Maya; Frušić-Zlotkin, Marina; Soroka, Yoram; Sasson, Shmuel Ben; Bianco-Peled, Havazelet; Bitton, Ronit; Kohen, Ron

    2015-08-01

    Cyclic nitroxides are a large group of compounds composed of diverse stable radicals also known as synthetic antioxidants. Although nitroxides are valuable for use in several skin conditions, in in vivo conditions they have several drawbacks, such as nonspecific dispersion in normal tissue, preferential renal clearance and rapid reduction of the nitroxide to the corresponding hydroxylamine. However, these drawbacks can be easily addressed by encapsulating the nitroxides within microemulsions. This approach would allow nitroxide activity and therefore their valuable effects (e.g. activation of the Keap1-Nrf2-EpRE pathway) to continue. In this work, nitroxides were encapsulated in a microemulsion composed of biocompatible ingredients. The nanometric size and shape of the vehicle microemulsion and nitroxide microemulsion displayed high similarity, indicating that the stability of the microemulsions was preserved. Our studies demonstrated that nitroxide microemulsions were more potent inducers of the Keap1-Nrf2-EpRE pathway than the free nitroxides, causing the activation of phase II enzymes. Moreover, microemulsions containing nitroxides significantly reduced UVB-induced cytotoxicity in the skin. Understanding the mechanism of this improved activity may expand the usage of many other Nrf2 modulating molecules in encapsulated form, as a skin protection strategy against oxidative stress-related conditions. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. Dietary zinc deficiency reduced growth performance, intestinal immune and physical barrier functions related to NF-κB, TOR, Nrf2, JNK and MLCK signaling pathway of young grass carp (Ctenopharyngodon idella).

    Science.gov (United States)

    Song, Zheng-Xing; Jiang, Wei-Dan; Liu, Yang; Wu, Pei; Jiang, Jun; Zhou, Xiao-Qiu; Kuang, Sheng-Yao; Tang, Ling; Tang, Wu-Neng; Zhang, Yong-An; Feng, Lin

    2017-07-01

    Our study investigated the effects of dietary zinc (Zn) deficiency on growth performance, intestinal immune and physical barrier functions of young grass carp (Ctenopharyngodon idella). A total of 630 grass carp (244.14 ± 0.40 g) were fed graded levels of zinc lactate (10.71, 30.21, 49.84, 72.31, 92.56, 110.78 mg Zn/kg diet) and one zinc sulfate group (56.9 mg Zn/kg diet) for 60 days. At the end of the feeding trial, fish were challenged with Aeromonas hydrophila for 14 days. These results indicated that compared with optimal dietary Zn level, dietary Zn deficiency (10.71 mg/kg diet) decreased the production of antibacterial compounds, up-regulated pro-inflammatory cytokines related to nuclear factor kappa B (NF-κB) and down-regulated anti-inflammatory cytokines related to target of rapamycin (TOR) in three intestinal segments of young grass carp (P zinc lactate as Zn source) based on percent weight gain (PWG), against enteritis morbidity, acid phosphatase (ACP) activity in the proximal intestine (PI) and malondialdehyde (MDA) content in the PI of young grass carp was estimated to be 61.2, 61.4, 69.2 and 69.5 mg/kg diet, respectively. Finally, based on specific growth rate (SGR), feed efficiency (FE) and against enteritis morbidity of young grass carp, the efficacy of zinc lactate relative to zinc sulfate were 132.59%, 135.27% and 154.04%, respectively. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. The Keap1-Nrf2 system in cancers: Stress response and anabolic metabolism

    Directory of Open Access Journals (Sweden)

    Yoichiro eMitsuishi

    2012-12-01

    Full Text Available The Keap1-Nrf2 pathway plays a central role in the protection of cells against oxidative and xenobiotic stresses. Nrf2 is a potent transcription activator that recognizes a unique DNA sequence known as the antioxidant response element (ARE. Under normal conditions, Nrf2 binds to Keap1 in the cytoplasm, resulting in proteasomal degradation. Following exposure to electrophiles or reactive oxygen species, Nrf2 becomes stabilized, translocates into the nucleus and activates the transcription of various cytoprotective genes. Increasing attention has been paid to the role of Nrf2 in cancer cells because the constitutive stabilization of Nrf2 has been observed in many human cancers with poor prognosis. Recent studies have shown that the antioxidant and detoxification activities of Nrf2 confer chemo- and radio-resistance to cancer cells. In this review, we provide an overview of the Keap1-Nrf2 system and discuss its role under physiological and pathological conditions, including cancers. We also introduce the results of our recent study describing Nrf2 function in the metabolism of cancer cells. Nrf2 likely confers a growth advantage to cancer cells through enhancing cytoprotection and anabolism. Finally, we discuss the possible impact of Nrf2 inhibitors on cancer therapy.

  8. The anti-oxidative transcription factor Nuclear factor E2 related factor-2 (Nrf2) counteracts TGF-β1 mediated growth inhibition of pancreatic ductal epithelial cells -Nrf2 as determinant of pro-tumorigenic functions of TGF-β1

    International Nuclear Information System (INIS)

    Genrich, Geeske; Kruppa, Marcus; Lenk, Lennart; Helm, Ole; Broich, Anna; Freitag-Wolf, Sandra; Röcken, Christoph; Sipos, Bence; Schäfer, Heiner; Sebens, Susanne

    2016-01-01

    Nuclear factor E2 related factor-2 (Nrf2) is an oxidative stress inducible transcription factor being essential in regulating cell homeostasis. Thus, acute induction of Nrf2 in epithelial cells exposed to inflammation confers protection from oxidative cell damage and mutagenesis supporting an anti-tumorigenic role for Nrf2. However, pancreatic ductal adenocarcinoma (PDAC) is characterized by persistent Nrf2 activity conferring therapy resistance which points to a pro-tumorigenic role of Nrf2. A similar dichotomous role in tumorigenesis is described for the Transforming Growth Factor-beta 1 (TGF-β1). The present study therefore aimed at elucidating whether the switch of Nrf2 function towards a tumor promoting one relates to the modulation of TGF-β1 induced cell responses and whether this might occur early in PDAC development. In situ analysis comprised immunohistochemical stainings of activated (phosphorylated) Nrf2 and Ki67 in pancreatic tissues containing normal ducts and pancreatic intraepithelial neoplasia (PanINs). In vitro, Nrf2 levels in benign (H6c7-pBp), premalignant (H6c7-kras) and malignant (Colo357) pancreatic ductal epithelial cells were modulated by Nrf2 specific siRNA or Nrf2 overexpression. Then, the effect of Nrf2 alone and in combination with TGF-β1 on cell growth and survival was investigated by cell counting, Ki67 staining and apoptosis assays. The underlying cell signaling was investigated by western blotting. Statistical analysis was performed by Shapiro-Wilk test for normal distribution. Parametric data were analyzed by one-way ANOVA, while non-parametric data were analyzed by Kruskal-Wallis one-way ANOVA on ranks. Significantly elevated expression of activated Nrf2 and Ki67 could be detected in PanINs but not in normal pancreatic ductal epithelium. While the effect of Nrf2 on basal cell growth of H6c7-pBp, H6c7-kras and Colo357 cells was minor, it clearly attenuated the growth inhibiting effects of TGF-β1 in all cell lines. This enhanced

  9. Coenzyme Q10 Supplementation Modulates NFκB and Nrf2 Pathways in Exercise Training

    Directory of Open Access Journals (Sweden)

    Ragip Pala, Cemal Orhan, Mehmet Tuzcu, Nurhan Sahin, Shakir Ali, Vedat Cinar, Mustafa Atalay, Kazim Sahin

    2016-03-01

    Full Text Available This study reports the effects of Q10, coenzyme Q10 or ubiquinone, a component of the electron transport chain in mitochondria, on nuclear factor kappa-light-chain-enhancer of activated B cells (NFκB, inhibitors of kappa B (IκB, nuclear factor (erythroid-derived 2-like 2 (Nrf2 and hemeoxygenase 1 (HO-1 in rats after chronic exercise training for 6 weeks. 8-week old male Wistar rats were assigned randomly to one of four treatments planned in a 2 x 2 factorial arrangement of two condition (sedentary vs. exercise training, and two coenzyme Q10 levels (0 and 300 mg/kg per day for 6 weeks. The expression levels of the target proteins were determined in the heart, liver and muscle, and biochemical parameters including creatinine, urea, glucose and lipid profile were investigated in plasma. When compared with sedentary group, significant decreases in heart, liver and muscle NFκB levels by 45%, 26% and 44% were observed in Q10 supplemented rats after exercise training, respectively, while the inhibitory protein IκB increased by 179%, 111% and 127% in heart, liver and muscle tissues. Q10 supplementation caused an increase in Nrf2 (167%, 165% and 90% and HO-1 (107%, 156% and 114% after exercise training in heart, liver and muscle tissues (p < 0.05. No significant change was observed in any of the parameters associated with protein, carbohydrate and lipid metabolism, except that exercise caused a decrease in plasma triglyceride, which was further decreased by Q10. In conclusion, these results suggest that Q10 modulates the expression of NFκB, IκB, Nrf2 and HO-1 in exercise training, indicating an anti-inflammatory effect of Q10 and emphasizes its role in antioxidant defense.

  10. Role of Nrf2 in preventing oxidative stress induced chloride current alteration in human lung cells.

    Science.gov (United States)

    Canella, Rita; Benedusi, Mascia; Martini, Marta; Cervellati, Franco; Cavicchio, Carlotta; Valacchi, Giuseppe

    2018-08-01

    The lung tissue is one of the main targets of oxidative stress due to external sources and respiratory activity. In our previous work, we have demonstrated in that O 3 exposure alters the Cl - current-voltage relationship, with the appearance of a large outward rectifier component mainly sustained by outward rectifier chloride channels (ORCCs) in human lung epithelial cells (A549 line). In the present study, we have performed patch clamp experiments, in order to identify which one of the O 3 byproducts (4hydroxynonenal (HNE) and/or H 2 O 2 ) was responsible for chloride current change. While 4HNE exposition (up to 25 μM for 30' before electrophysiological analysis) did not reproduce O 3 effect, H 2 O 2 produced by glucose oxidase 10 mU for 24 hr before electrophysiological analysis mimicked O 3 response. This result was confirmed treating the cell with catalase (CAT) before O 3 exposure (1,000 U/ml for 2 hr): CAT was able to rescue Cl - current alteration. Since CAT is regulated by Nrf2 transcription factor, we pre-treated the cells with the Nrf2 activators, resveratrol and tBHQ. Immunochemical and immunocytochemical results showed Nrf2 activation with both substances that lead to prevent OS effect on Cl - current. These data bring new insights into the mechanisms involved in OS-induced lung tissue damage, pointing out the role of H 2 O 2 in chloride current alteration and the ability of Nfr2 activation in preventing this effect. © 2017 Wiley Periodicals, Inc.

  11. Benznidazole, the trypanocidal drug used for Chagas disease, induces hepatic NRF2 activation and attenuates the inflammatory response in a murine model of sepsis

    International Nuclear Information System (INIS)

    Lambertucci, Flavia; Motiño, Omar; Villar, Silvina; Rigalli, Juan Pablo; Luján Alvarez, María de; Catania, Viviana A; Martín-Sanz, Paloma; Carnovale, Cristina Ester; Quiroga, Ariel Darío; Francés, Daniel Eleazar; Ronco, María Teresa

    2017-01-01

    Molecular mechanisms on sepsis progression are linked to the imbalance between reactive oxygen species (ROS) production and cellular antioxidant capacity. Previous studies demonstrated that benznidazole (BZL), known for its antiparasitic action on Trypanosoma cruzi, has immunomodulatory effects, increasing survival in C57BL/6 mice in a model of polymicrobial sepsis induced by cecal ligation and puncture (CLP). The mechanism by which BZL inhibits inflammatory response in sepsis is poorly understood. Also, our group recently reported that BZL is able to activate the nuclear factor erytroide-derived 2-Like 2 (NRF2) in vitro. The aim of the present work was to delineate the beneficial role of BZL during sepsis, analyzing its effects on the cellular redox status and the possible link to the innate immunity receptor TLR4. Specifically, we analyzed the effect of BZL on Nrf2 regulation and TLR4 expression in liver of mice 24 hours post-CLP. BZL was able to induce NRF2 nuclear protein localization in CLP mice. Also, we found that protein kinase C (PKC) is involved in the NRF2 nuclear accumulation and induction of its target genes. In addition, BZL prompted a reduction in hepatic CLP-induced TLR4 protein membrane localization, evidencing its immunomodulatory effects. Together, our results demonstrate that BZL induces hepatic NRF2 activation with the concomitant increase in the antioxidant defenses, and the attenuation of inflammatory response, in part, by inhibiting TLR4 expression in a murine model of sepsis. - Highlights: • BZL improves survival rate after polymicrobial sepsis • BZL enhances hepatic NRF2 nuclear accumulation in a model of sepsis, in part, by a mechanism dependent on PKC activation • BZL-enhanced NRF2 induction regulates antioxidant enzymes and increases antioxidant cellular defenses in sepsis • BZL blocks liver ROS production and ROS-induced TLR4 plasma membrane expression in septic mice

  12. Benznidazole, the trypanocidal drug used for Chagas disease, induces hepatic NRF2 activation and attenuates the inflammatory response in a murine model of sepsis

    Energy Technology Data Exchange (ETDEWEB)

    Lambertucci, Flavia [Instituto de Fisiología Experimental (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina); Motiño, Omar [Instituto de Investigaciones Biomédicas Alberto Sols, CSIC-UAM, Arturo Duperier 4, 28029 Madrid (Spain); Villar, Silvina [Instituto de Inmunología, Facultad de Ciencias Médicas, UNR, Suipacha 531, 2000 Rosario (Argentina); Rigalli, Juan Pablo; Luján Alvarez, María de; Catania, Viviana A [Instituto de Fisiología Experimental (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina); Martín-Sanz, Paloma [Instituto de Investigaciones Biomédicas Alberto Sols, CSIC-UAM, Arturo Duperier 4, 28029 Madrid (Spain); Centro de Investigación Biomédica en Red de Enfermedades Hepáticas y Digestivas (CIBERehd), Monforte de Lemos 3-5, 28029 Madrid (Spain); Carnovale, Cristina Ester; Quiroga, Ariel Darío; Francés, Daniel Eleazar [Instituto de Fisiología Experimental (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina); Ronco, María Teresa, E-mail: ronco@ifise-conicet.gov.ar [Instituto de Fisiología Experimental (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina)

    2017-01-15

    Molecular mechanisms on sepsis progression are linked to the imbalance between reactive oxygen species (ROS) production and cellular antioxidant capacity. Previous studies demonstrated that benznidazole (BZL), known for its antiparasitic action on Trypanosoma cruzi, has immunomodulatory effects, increasing survival in C57BL/6 mice in a model of polymicrobial sepsis induced by cecal ligation and puncture (CLP). The mechanism by which BZL inhibits inflammatory response in sepsis is poorly understood. Also, our group recently reported that BZL is able to activate the nuclear factor erytroide-derived 2-Like 2 (NRF2) in vitro. The aim of the present work was to delineate the beneficial role of BZL during sepsis, analyzing its effects on the cellular redox status and the possible link to the innate immunity receptor TLR4. Specifically, we analyzed the effect of BZL on Nrf2 regulation and TLR4 expression in liver of mice 24 hours post-CLP. BZL was able to induce NRF2 nuclear protein localization in CLP mice. Also, we found that protein kinase C (PKC) is involved in the NRF2 nuclear accumulation and induction of its target genes. In addition, BZL prompted a reduction in hepatic CLP-induced TLR4 protein membrane localization, evidencing its immunomodulatory effects. Together, our results demonstrate that BZL induces hepatic NRF2 activation with the concomitant increase in the antioxidant defenses, and the attenuation of inflammatory response, in part, by inhibiting TLR4 expression in a murine model of sepsis. - Highlights: • BZL improves survival rate after polymicrobial sepsis • BZL enhances hepatic NRF2 nuclear accumulation in a model of sepsis, in part, by a mechanism dependent on PKC activation • BZL-enhanced NRF2 induction regulates antioxidant enzymes and increases antioxidant cellular defenses in sepsis • BZL blocks liver ROS production and ROS-induced TLR4 plasma membrane expression in septic mice.

  13. Sulforaphane reverses glucocorticoid-induced apoptosis in osteoblastic cells through regulation of the Nrf2 pathway

    Directory of Open Access Journals (Sweden)

    Lin H

    2014-07-01

    small interfering ribonucleic acid significantly blocked the cytoprotective effects of SFP against Dex-induced apoptosis, which suggest the important role of Nrf2 signaling pathway and cell apoptosis induced by Dex. Taken together, this study provides a novel strategy for molecular intervention against Dex-induced osteoporosis using phytochemicals. Keywords: osteoporosis, glucocorticoid, apoptosis, sulforaphane, Nrf2 pathway

  14. EGCG evokes Nrf2 nuclear translocation and dampens PTP1B expression to ameliorate metabolic misalignment under insulin resistance condition.

    Science.gov (United States)

    Mi, Yashi; Zhang, Wentong; Tian, Haoyu; Li, Runnan; Huang, Shuxian; Li, Xingyu; Qi, Guoyuan; Liu, Xuebo

    2018-03-01

    As a major nutraceutical component of green tea (-)-epigallocatechin-3-gallate (EGCG) has attracted interest from scientists due to its well-documented antioxidant and antiobesity bioactivities. In the current study, we aimed to investigate the protective effect of EGCG on metabolic misalignment and in balancing the redox status in mice liver and HepG2 cells under insulin resistance condition. Our results indicated that EGCG accelerates the glucose uptake and evokes IRS-1/Akt/GLUT2 signaling pathway via dampening the expression of protein tyrosine phosphatase 1B (PTP1B). Consistently, ectopic expression of PTP1B by Ad-PTP1B substantially impaired EGCG-elicited IRS-1/Akt/GLUT2 signaling pathway. Moreover, EGCG co-treatment stimulated nuclear translocation of Nrf2 by provoking P13K/AKT signaling pathway and thus modulated the downstream expressions of antioxidant enzymes such as HO-1 and NQO-1 in HepG2 cells. Furthermore, knockdown Nrf2 by small interfering RNA (siRNA) notably enhanced the expression of PTP1B and blunt EGCG-stimulated glucose uptake. Consistent with these results, in vivo study revealed that EGCG supplement significantly ameliorated high-fat and high-fructose diet (HFFD)-triggered insulin resistance and oxidative stress by up-regulating the IRS-1/AKT and Keap1/Nrf2 transcriptional pathways. Administration of an appropriate chemopreventive agent, such as EGCG, could potentially serve as an additional therapeutic intervention in the arsenal against obesity.

  15. Andrographolide exerts anti-hepatitis C virus activity by up-regulating haeme oxygenase-1 via the p38 MAPK/Nrf2 pathway in human hepatoma cells.

    Science.gov (United States)

    Lee, Jin-Ching; Tseng, Chin-Kai; Young, Kung-Chia; Sun, Hung-Yu; Wang, Shainn-Wei; Chen, Wei-Chun; Lin, Chun-Kuang; Wu, Yu-Hsuan

    2014-01-01

    This study aimed to evaluate the anti-hepatitis C virus (HCV) activity of andrographolide, a diterpenoid lactone extracted from Andrographis paniculata, and to identify the signalling pathway involved in its antiviral action. Using HCV replicon and HCVcc infectious systems, we identified anti-HCV activity of andrographolide by measuring protein and RNA levels. A reporter activity assay was used to determine transcriptional regulation of anti-HCV agents. A specific inhibitor and short hairpin RNAs were used to investigate the mechanism responsible for the effect of andrographolide on HCV replication. In HCV replicon and HCVcc infectious systems, andrographolide time- and dose-dependently suppressed HCV replication. When combined with IFN-α, an inhibitor targeting HCV NS3/4A protease (telaprevir), or NS5B polymerase (PSI-7977), andrographolide exhibited a significant synergistic effect. Andrographolide up-regulated the expression of haeme oxygenase-1 (HO-1), leading to increased amounts of its metabolite biliverdin, which was found to suppress HCV replication by promoting the antiviral IFN responses and inhibiting NS3/4A protease activity. Significantly, these antiviral effects were attenuated by an HO-1-specific inhibitor or HO-1 gene knockdown, indicating that HO-1 contributed to the anti-HCV activity of andrographolide. Andrographolide activated p38 MAPK phosphorylation, which stimulated nuclear factor erythroid 2-related factor 2 (Nrf2)-mediated HO-1 expression, and this was found to be associated with its anti-HCV activity. Our results demonstrate that andrographolide has the potential to control HCV replication and suggest that targeting the Nrf2-HO-1 signalling pathway might be a promising strategy for drug development. © 2013 The British Pharmacological Society.

  16. Effects of monascin on anti-inflammation mediated by Nrf2 activation in advanced glycation end product-treated THP-1 monocytes and methylglyoxal-treated wistar rats.

    Science.gov (United States)

    Lee, Bao-Hong; Hsu, Wei-Hsuan; Huang, Tao; Chang, Yu-Ying; Hsu, Ya-Wen; Pan, Tzu-Ming

    2013-02-13

    Hyperglycemia is associated with advanced glycation end products (AGEs). This study was designed to evaluate the inhibitory effects of monascin on receptor for advanced glycation end product (RAGE) signal and THP-1 monocyte inflammation after treatment with S100b, a specific ligand of RAGE. Monascin inhibited cytokine production by S100b-treated THP-1 monocytes via up-regulation of nuclear factor-erythroid 2-related factor-2 (Nrf2) and alleviated p47phox translocation to the membrane. Methylglyoxal (MG, 600 mg/kg bw) was used to induce diabetes in Wistar rats. Inhibitions of RAGE and p47phox by monascin were confirmed by peripheral blood mononuclear cells (PBMCs) of MG-induced rats. Silymarin (SM) was used as a positive control group. It was found that monascin promoted heme oxygenase-1 (HO-1) expression mediated by Nrf2. Suppressions of AGEs, tumor necrosis factor-α (TNF-α), and interleukin-1β (IL-β) in serum of MG-induced rats were attenuated in the monascin administration group treated with retinoic acid (RA). RA treatment resulted in Nrf2 inactivation by increasing RA receptor-α (RARα) activity, suggesting that RA acts as an inhibitor of Nrf2. The results showed that monascin exerted anti-inflammatory and antioxidative effects mediated by Nrf2 to prevent the development of diseases such as type 2 diabetes caused by inflammation.

  17. NRF2 Mutation Confers Malignant Potential and Resistance to Chemoradiation Therapy in Advanced Esophageal Squamous Cancer

    Directory of Open Access Journals (Sweden)

    Tatsuhiro Shibata

    2011-09-01

    Full Text Available Esophageal squamous cancer (ESC is one of the most aggressive tumors of the gastrointestinal tract. A combination of chemotherapy and radiation therapy (CRT has improved the clinical outcome, but the molecular background determining the effectiveness of therapy remains unknown. NRF2 is a master transcriptional regulator of stress adaptation, and gain of-function mutation of NRF2 in cancer confers resistance to stressors including anticancer therapy. Direct resequencing analysis revealed that Nrf2 gain-of-function mutation occurred recurrently (18/82, 22% in advanced ESC tumors and ESC cell lines (3/10. The presence of Nrf2 mutation was associated with tumor recurrence and poor prognosis. Short hairpin RNA-mediated down-regulation of NRF2 in ESC cells that harbor only mutated Nrf2 allele revealed that themutant NRF2 conferred increased cell proliferation, attachment-independent survival, and resistance to 5-fluorouracil and γ-irradiation. Based on the Nrf2 mutation status, gene expression signatures associated with NRF2 mutation were extracted from ESC cell lines, and their potential utility for monitoring and prognosis was examined in a cohort of 33 pre-CRT cases of ESC. The molecular signatures of NRF2 mutation were significantly predictive and prognostic for CRT response. In conclusion, recurrent NRF2 mutation confers malignant potential and resistance to therapy in advanced ESC, resulting in a poorer outcome. Molecular signatures of NRF2 mutation can be applied as predictive markers of response to CRT, and efficient inhibition of aberrant NRF2 activation could be a promising approach in combination with CRT.

  18. Carbon monoxide mediates heme oxygenase 1 induction via Nrf2 activation in hepatoma cells

    International Nuclear Information System (INIS)

    Lee, Bok-Soo; Heo, JungHee; Kim, Yong-Man; Shim, Sang Moo; Pae, Hyun-Ock; Kim, Young-Myeong; Chung, Hun-Taeg

    2006-01-01

    Carbon monoxide (CO) and nitric oxide (NO) are two gas molecules which have cytoprotective functions against oxidative stress and inflammatory responses in many cell types. Currently, it is known that NO produced by nitric oxide synthase (NOS) induces heme oxygenase 1 (HO1) expression and CO produced by the HO1 inhibits inducible NOS expression. Here, we first show CO-mediated HO1 induction and its possible mechanism in human hepatocytes. Exposure of HepG2 cells or primary hepatocytes to CO resulted in dramatic induction of HO1 in dose- and time-dependent manner. The CO-mediated HO1 induction was abolished by MAP kinase inhibitors (MAPKs) but not affected by inhibitors of PI3 kinase or NF-κB. In addition, CO induced the nuclear translocation and accumulation of Nrf2, which suppressed by MAPKs inhibitors. Taken together, we suggest that CO induces Nrf2 activation via MAPKs signaling pathways, thereby resulting in HO1 expression in HepG2 cells

  19. Nrf2 and regulation of the antioxidant system in the Antarctic silverfish, Pleuragramma antarctica: Adaptation to environmental changes of pro-oxidant pressure.

    Science.gov (United States)

    Giuliani, Maria Elisa; Benedetti, Maura; Nigro, Marco; Regoli, Francesco

    2017-08-01

    Despite the key importance of Nrf2-Keap1 in regulating antioxidant system in vertebrates, this system is still poorly investigated in marine species. The present study focused on the Antarctic silverfish Pleuragramma antarctica which, during the final phases of embryo development in platelet ice, is challenged by a sudden enhancement of environmental oxidative conditions associated to ice melting. Partial coding sequences were identified for Nrf2, its repressor Keap1 and for typical Nrf2-target antioxidant genes, like catalase, glutathione peroxidase isoform 1 and Cu/Zn-dependent superoxide dismutase. Compared to temperate homologues, the protein sequences showed an elevated conservation of amino acids essential for catalytic functions, while a few specific substitutions in non-essential regions may represent a molecular adaptation to improve flexibility and accessibility to active site at cold temperatures. The role of the Nrf2-Keap1 pathway in modulating the activation of antioxidant defences was demonstrated at both transcriptional and functional levels with a clear temporal increase of antioxidant protection in embryos before the hatching. Such findings confirm the importance of Nrf2 and highlight regulation of antioxidants as an adaptive strategy in P. antarctica to protect the early life stages toward the environmental changes of pro-oxidant pressure. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Spatially and Temporally Regulated NRF2 Gene Therapy Using Mcp-1 Promoter in Retinal Ganglion Cell Injury

    Directory of Open Access Journals (Sweden)

    Kosuke Fujita

    2017-06-01

    Full Text Available Retinal ganglion cell degeneration triggered by axonal injury is believed to underlie many ocular diseases, including glaucoma and optic neuritis. In these diseases, retinal ganglion cells are affected unevenly, both spatially and temporally, such that healthy and unhealthy cells coexist in different patterns at different time points. Herein, we describe a temporally and spatially regulated adeno-associated virus gene therapy aiming to reduce undesired off-target effects on healthy retinal neurons. The Mcp-1 promoter previously shown to be activated in stressed retinal ganglion cells following murine optic nerve injury was combined with the neuroprotective intracellular transcription factor Nrf2. In this model, Mcp-1 promoter-driven NRF2 expression targeting only stressed retinal ganglion cells showed efficacy equivalent to non-selective cytomegalovirus promoter-driven therapy for preventing cell death. However, cytomegalovirus promoter-mediated NRF2 transcription induced cellular stress responses and death of Brn3A-positive uninjured retinal ganglion cells. Such undesired effects were reduced substantially by adopting the Mcp-1 promoter. Combining a stress-responsive promoter and intracellular therapeutic gene is a versatile approach for specifically targeting cells at risk of degeneration. This strategy may be applicable to numerous chronic ocular and non-ocular conditions.

  1. Nrf2-dependent induction of innate host defense via heme oxygenase-1 inhibits Zika virus replication

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Hanxia; Falgout, Barry; Takeda, Kazuyo [Food and Drug Administration, Silver Spring, MD (United States); Yamada, Kenneth M. [National Institutes of Health, Bethesda, MD (United States); Dhawan, Subhash, E-mail: subhash.dhawan@fda.hhs.gov [Food and Drug Administration, Silver Spring, MD (United States)

    2017-03-15

    We identified primary human monocyte-derived macrophages (MDM) as vulnerable target cells for Zika virus (ZIKV) infection. We demonstrate dramatic effects of hemin, the natural inducer of the heme catabolic enzyme heme oxygenase-1 (HO-1), in the reduction of ZIKV replication in vitro. Both LLC-MK2 monkey kidney cells and primary MDM exhibited hemin-induced HO-1 expression with major reductions of >90% in ZIKV replication, with little toxicity to infected cells. Silencing expression of HO-1 or its upstream regulatory gene, nuclear factor erythroid-related factor 2 (Nrf2), attenuated hemin-induced suppression of ZIKV infection, suggesting an important role for induction of these intracellular mediators in retarding ZIKV replication. The inverse correlation between hemin-induced HO-1 levels and ZIKV replication provides a potentially useful therapeutic modality based on stimulation of an innate cellular response against Zika virus infection. - Highlights: •Hemin treatment protected monocyte-derived macrophages against Zika virus (ZIKV) infection. •Innate cellular protection against ZIKV infection correlated with Nrf2-dependent HO-1 expression. •Stimulation of innate cellular responses may provide a therapeutic strategy against ZIKV infection.

  2. Nrf2-dependent induction of innate host defense via heme oxygenase-1 inhibits Zika virus replication

    International Nuclear Information System (INIS)

    Huang, Hanxia; Falgout, Barry; Takeda, Kazuyo; Yamada, Kenneth M.; Dhawan, Subhash

    2017-01-01

    We identified primary human monocyte-derived macrophages (MDM) as vulnerable target cells for Zika virus (ZIKV) infection. We demonstrate dramatic effects of hemin, the natural inducer of the heme catabolic enzyme heme oxygenase-1 (HO-1), in the reduction of ZIKV replication in vitro. Both LLC-MK2 monkey kidney cells and primary MDM exhibited hemin-induced HO-1 expression with major reductions of >90% in ZIKV replication, with little toxicity to infected cells. Silencing expression of HO-1 or its upstream regulatory gene, nuclear factor erythroid-related factor 2 (Nrf2), attenuated hemin-induced suppression of ZIKV infection, suggesting an important role for induction of these intracellular mediators in retarding ZIKV replication. The inverse correlation between hemin-induced HO-1 levels and ZIKV replication provides a potentially useful therapeutic modality based on stimulation of an innate cellular response against Zika virus infection. - Highlights: •Hemin treatment protected monocyte-derived macrophages against Zika virus (ZIKV) infection. •Innate cellular protection against ZIKV infection correlated with Nrf2-dependent HO-1 expression. •Stimulation of innate cellular responses may provide a therapeutic strategy against ZIKV infection.

  3. Gene-expression signature regulated by the KEAP1-NRF2-CUL3 axis is associated with a poor prognosis in head and neck squamous cell cancer.

    Science.gov (United States)

    Namani, Akhileshwar; Matiur Rahaman, Md; Chen, Ming; Tang, Xiuwen

    2018-01-06

    tumorigenesis and drug resistance in HNSCC. This 17-gene signature provides potential biomarkers and therapeutic targets for HNSCC cases in which the NRF2 pathway is activated.

  4. MicroRNA-140-5p attenuated oxidative stress in Cisplatin induced acute kidney injury by activating Nrf2/ARE pathway through a Keap1-independent mechanism.

    Science.gov (United States)

    Liao, Weitang; Fu, Zongjie; Zou, Yanfang; Wen, Dan; Ma, Hongkun; Zhou, Fangfang; Chen, Yongxi; Zhang, Mingjun; Zhang, Wen

    2017-11-15

    Oxidative stress was predominantly involved in the pathogenesis of acute kidney injury (AKI). Recent studies had reported the protective role of specific microRNAs (miRNAs) against oxidative stress. Hence, we investigated the levels of miR140-5p and its functional role in the pathogenesis of Cisplatin induced AKI. A mice Cisplatin induced-AKI model was established. We found that miR-140-5p expression was markedly increased in mice kidney. Bioinformatics analysis revealed nuclear factor erythroid 2-related factor (Nrf2) was a potential target of miR-140-5p, We demonstrated that miR-140-5p did not affect Kelch-like ECH-associated protein 1 (Keap1) level but directly targeted the 3'-UTR of Nrf2 mRNA and played a positive role in the regulation of Nrf2 expression which was confirmed by luciferase activity assay and western blot. What was more, consistent with miR140-5p expression, the mRNA and protein levels of Nrf2, as well as antioxidant response element (ARE)-driven genes Heme Oxygenase-1 (HO-1) and NAD(P)H:quinone oxidoreductase l (NQO1) were significantly increased in mice kidney tissues. In vitro study, Enforced expression of miR-140-5p in HK2 cells significantly attenuated oxidative stress by decreasing ROS level and increasing the expression of manganese superoxide dismutase (MnSOD). Simultaneously, miR-140-5p decreased lactate dehydrogenase (LDH) leakage and improved cell vitality in HK2 cells under Cisplatin-induced oxidative stress. However, HK2 cells transfected with a siRNA targeting Nrf2 abrogated the protective effects of miR-140-5p against oxidative stress. These results indicated that miR-140-5p might exert its anti-oxidative stress function via targeting Nrf2. Our findings showed the novel transcriptional role of miR140-5p in the expression of Nrf2 and miR-140-5p protected against Cisplatin induced oxidative stress by activating Nrf2-dependent antioxidant pathway, providing a potentially therapeutic target in acute kidney injury. Copyright © 2017

  5. Naphthazarin protects against glutamate-induced neuronal death via activation of the Nrf2/ARE pathway

    Energy Technology Data Exchange (ETDEWEB)

    Son, Tae Gen; Kawamoto, Elisa M.; Yu, Qian-Sheng; Greig, Nigel H. [Laboratory of Neurosciences, National Institute on Aging, Intramural Research Program, 251 Bayview Blvd., Baltimore, MD 21224 (United States); Mattson, Mark P. [Laboratory of Neurosciences, National Institute on Aging, Intramural Research Program, 251 Bayview Blvd., Baltimore, MD 21224 (United States); Department of Neuroscience, Johns Hopkins University School of Medicine, Baltimore, MD (United States); Camandola, Simonetta, E-mail: camandolasi@mail.nih.gov [Laboratory of Neurosciences, National Institute on Aging, Intramural Research Program, 251 Bayview Blvd., Baltimore, MD 21224 (United States)

    2013-04-19

    Highlights: •Naphthazarin activates the Nrf2/ARE pathway. •Naphthazarin induces Nrf2-driven genes in neurons and astrocytes. •Naphthazarin protects neurons against excitotoxicity. -- Abstract: Nuclear factor E2-related factor 2 (Nrf2)/antioxidant response element (ARE) pathway is an important cellular stress response pathway involved in neuroprotection. We previously screened several natural phytochemicals and identified plumbagin as a novel activator of the Nrf2/ARE pathway that can protect neurons against ischemic injury. Here we extended our studies to natural and synthetic derivatives of plumbagin. We found that 5,8-dimethoxy-1,4-naphthoquinone (naphthazarin) is a potent activator of the Nrf2/ARE pathway, up-regulates the expression of Nrf2-driven genes in primary neuronal and glial cultures, and protects neurons against glutamate-induced excitotoxicity.

  6. Naphthazarin protects against glutamate-induced neuronal death via activation of the Nrf2/ARE pathway

    International Nuclear Information System (INIS)

    Son, Tae Gen; Kawamoto, Elisa M.; Yu, Qian-Sheng; Greig, Nigel H.; Mattson, Mark P.; Camandola, Simonetta

    2013-01-01

    Highlights: •Naphthazarin activates the Nrf2/ARE pathway. •Naphthazarin induces Nrf2-driven genes in neurons and astrocytes. •Naphthazarin protects neurons against excitotoxicity. -- Abstract: Nuclear factor E2-related factor 2 (Nrf2)/antioxidant response element (ARE) pathway is an important cellular stress response pathway involved in neuroprotection. We previously screened several natural phytochemicals and identified plumbagin as a novel activator of the Nrf2/ARE pathway that can protect neurons against ischemic injury. Here we extended our studies to natural and synthetic derivatives of plumbagin. We found that 5,8-dimethoxy-1,4-naphthoquinone (naphthazarin) is a potent activator of the Nrf2/ARE pathway, up-regulates the expression of Nrf2-driven genes in primary neuronal and glial cultures, and protects neurons against glutamate-induced excitotoxicity

  7. Sulforaphane Protects against Cardiovascular Disease via Nrf2 Activation

    Directory of Open Access Journals (Sweden)

    Yang Bai

    2015-01-01

    Full Text Available Cardiovascular disease (CVD causes an unparalleled proportion of the global burden of disease and will remain the main cause of mortality for the near future. Oxidative stress plays a major role in the pathophysiology of cardiac disorders. Several studies have highlighted the cardinal role played by the overproduction of reactive oxygen or nitrogen species in the pathogenesis of ischemic myocardial damage and consequent cardiac dysfunction. Isothiocyanates (ITC are sulfur-containing compounds that are broadly distributed among cruciferous vegetables. Sulforaphane (SFN is an ITC shown to possess anticancer activities by both in vivo and epidemiological studies. Recent data have indicated that the beneficial effects of SFN in CVD are due to its antioxidant and anti-inflammatory properties. SFN activates NF-E2-related factor 2 (Nrf2, a basic leucine zipper transcription factor that serves as a defense mechanism against oxidative stress and electrophilic toxicants by inducing more than a hundred cytoprotective proteins, including antioxidants and phase II detoxifying enzymes. This review will summarize the evidence from clinical studies and animal experiments relating to the potential mechanisms by which SFN modulates Nrf2 activation and protects against CVD.

  8. Topical Bixin Confers NRF2-Dependent Protection Against Photodamage and Hair Graying in Mouse Skin

    Directory of Open Access Journals (Sweden)

    Montserrat Rojo de la Vega

    2018-03-01

    Full Text Available Environmental exposure to solar ultraviolet (UV radiation causes acute photodamage, premature aging, and skin cancer, attributable to UV-induced genotoxic, oxidative, and inflammatory stress. The transcription factor NRF2 [nuclear factor erythroid 2 (E2-related factor 2] is the master regulator of the cellular antioxidant response protecting skin against various environmental stressors including UV radiation and electrophilic pollutants. NRF2 in epidermal keratinocytes can be activated using natural chemopreventive compounds such as the apocarotenoid bixin, an FDA-approved food additive and cosmetic ingredient from the seeds of the achiote tree (Bixa orellana. Here, we tested the feasibility of topical use of bixin for NRF2-dependent skin photoprotection in two genetically modified mouse models [SKH1 and C57BL/6J (Nrf2+/+ versus Nrf2-/-]. First, we observed that a bixin formulation optimized for topical NRF2 activation suppresses acute UV-induced photodamage in Nrf2+/+ but not Nrf2-/- SKH1 mice, a photoprotective effect indicated by reduced epidermal hyperproliferation and oxidative DNA damage. Secondly, it was demonstrated that topical bixin suppresses PUVA (psoralen + UVA-induced hair graying in Nrf2+/+ but not Nrf2-/- C57BL/6J mice. Collectively, this research provides the first in vivo evidence that topical application of bixin can protect against UV-induced photodamage and PUVA-induced loss of hair pigmentation through NRF2 activation. Topical NRF2 activation using bixin may represent a novel strategy for human skin photoprotection, potentially complementing conventional sunscreen-based approaches.

  9. NRF2 Pathway Activation and Adjuvant Chemotherapy Benefit in Lung Squamous Cell Carcinoma.

    Science.gov (United States)

    Cescon, David W; She, Desmond; Sakashita, Shingo; Zhu, Chang-Qi; Pintilie, Melania; Shepherd, Frances A; Tsao, Ming-Sound

    2015-06-01

    Genomic profiling of lung squamous cell carcinomas (SCC) has identified NRF2 pathway alterations, which activate oxidative response pathways, in one third of tumors. Preclinical data suggest these tumors may be resistant to platinum-based chemotherapy. We evaluated the clinical relevance of these findings and assessed whether NRF2 activation predicts benefit from adjuvant chemotherapy in SCC. Logistic regression (LR) and significance analysis of microarrays (SAM) were applied to all 104 TCGA (The Cancer Genome Atlas) SCC cases that had microarray gene expression and mutation data to identify genes associated with somatic NRF2 pathway alterations. The resulting signature (NRF2(ACT)) was tested in 3 independent SCC datasets to evaluate its prognostic and predictive effects. IHC and sequencing for NRF2 and KEAP1 were evaluated in one cohort (n = 43) to assess the relationship between gene expression, mutational status, and protein expression. Twenty-eight genes were identified by overlap between LR (291 genes) and SAM (30 genes), and these consistently separated SCC into 2 groups in all datasets, corresponding to putatively NRF pathway-activated and wild-type (WT) tumors. NRF2(ACT) was not prognostic. However, improved survival with adjuvant chemotherapy in the JBR.10-randomized trial appears limited to patients with the WT signature (HR 0.32, P = 0.16; NRF2(ACT) HR 2.28, P = 0.48; interaction P = 0.15). NRF2(ACT) was highly correlated with mutations in NRF2 and KEAP1, and with high NRF2 protein expression. A gene expression signature of NRF2 pathway activation is associated with benefit from adjuvant cisplatin/vinorelbine in SCC. Patients with NRF2 pathway-activating somatic alterations may have reduced benefit from this therapy. ©2015 American Association for Cancer Research.

  10. NRF2 deficiency replicates transcriptomic changes in Alzheimer's patients and worsens APP and TAU pathology

    Directory of Open Access Journals (Sweden)

    Ana I. Rojo

    2017-10-01

    Full Text Available Failure to translate successful neuroprotective preclinical data to a clinical setting in Alzheimer's disease (AD indicates that amyloidopathy and tauopathy alone provide an incomplete view of disease. We have tested here the relevance of additional homeostatic deviations that result from loss of activity of transcription factor NRF2, a crucial regulator of multiple stress responses whose activity declines with ageing. A transcriptomic analysis demonstrated that NRF2-KO mouse brains reproduce 7 and 10 of the most dysregulated pathways of human ageing and AD brains, respectively. Then, we generated a mouse that combines amyloidopathy and tauopathy with either wild type (AT-NRF2-WT or NRF2-deficiency (AT-NRF2-KO. AT-NRF2-KO brains presented increased markers of oxidative stress and neuroinflammation as well as higher levels of insoluble phosphorylated-TAU and Aβ*56 compared to AT-NRF2-WT mice. Young adult AT-NRF2-KO mice exhibited deficits in spatial learning and memory and reduced long term potentiation in the perforant pathway. This study demonstrates the relevance of normal homeostatic responses that decline with ageing, such as NRF2 activity, in the protection against proteotoxic, inflammatory and oxidative stress and provide a new strategy to fight AD.

  11. Naphthazarin protects against glutamate-induced neuronal death via activation of the Nrf2/ARE pathway.

    Science.gov (United States)

    Son, Tae Gen; Kawamoto, Elisa M; Yu, Qian-Sheng; Greig, Nigel H; Mattson, Mark P; Camandola, Simonetta

    2013-04-19

    Nuclear factor E2-related factor 2 (Nrf2)/antioxidant response element (ARE) pathway is an important cellular stress response pathway involved in neuroprotection. We previously screened several natural phytochemicals and identified plumbagin as a novel activator of the Nrf2/ARE pathway that can protect neurons against ischemic injury. Here we extended our studies to natural and synthetic derivatives of plumbagin. We found that 5,8-dimethoxy-1,4-naphthoquinone (naphthazarin) is a potent activator of the Nrf2/ARE pathway, up-regulates the expression of Nrf2-driven genes in primary neuronal and glial cultures, and protects neurons against glutamate-induced excitotoxicity. Published by Elsevier Inc.

  12. Troxerutin Reduces Kidney Damage against BDE-47-Induced Apoptosis via Inhibiting NOX2 Activity and Increasing Nrf2 Activity

    Directory of Open Access Journals (Sweden)

    Qun Shan

    2017-01-01

    Full Text Available 2,2,4,4-Tetrabromodiphenyl ether (BDE-47, one of the persistent organic pollutants, seriously influences the quality of life; however, its pathological mechanism remains unclear. Troxerutin is a flavonoid with pharmacological activity of antioxidation and anti-inflammation. In the present study, we investigated troxerutin against BDE-47-induced kidney cell apoptosis and explored the underlying mechanism. The results show that troxerutin reduced renal cell apoptosis and urinary protein secretion in BDE-47-treated mice. Western blot analysis shows that troxerutin supplement enhanced the ratio of Bcl-2/Bax; inhibited the release of cytochrome c from mitochondria, the activation of procaspase-9 and procaspase-3, and the cleavage of PARP; and reduced FAS, FASL, and caspase-8 levels induced by BDE-47. In addition, troxerutin decreased the production of reactive oxygen species (ROS and increased the activities of antioxidative enzymes. Furthermore, troxerutin blunted Nrf2 ubiquitylation, enhanced the activity of Nrf2, decreased the activity of NOX2, and ameliorated kidney oxidant status of BDE-47-treated mice. Together, these results confirm that troxerutin could alleviate the cytotoxicity of BDE-47 through antioxidation and antiapoptosis, which suggests that its protective mechanism is involved in the inhibition of apoptosis via suppressing NOX2 activity and increasing Nrf2 signaling pathway.

  13. Agmatine Reduces Lipopolysaccharide-Mediated Oxidant Response via Activating PI3K/Akt Pathway and Up-Regulating Nrf2 and HO-1 Expression in Macrophages.

    Directory of Open Access Journals (Sweden)

    Jianshen Chai

    Full Text Available Macrophages are key responders of inflammation and are closely related with oxidative stress. Activated macrophages can enhance oxygen depletion, which causes an overproduction of reactive oxygen species (ROS and leads to further excessive inflammatory response and tissue damage. Agmatine, an endogenous metabolite of L-arginine, has recently been shown to have neuroprotective effects based on its antioxidant properties. However, the antioxidant effects of agmatine in peripheral tissues and cells, especially macrophages, remain unclear. In this study we explored the role of agmatine in mediating antioxidant effects in RAW 264.7 cells and studied its antioxidant mechanism. Our data demonstrate that agmatine is an activator of Nrf2 signaling that markedly enhances Nrf2 nuclear translocation, increases nuclear Nrf2 protein level, up-regulates the expression of the Nrf2 downstream effector HO-1, and attenuates ROS generation induced by Lipopolysaccharide (LPS. We further demonstrated that the agmatine-induced activation of Nrf2 is likely through the PI3K/Akt pathway. LY294002, a specific PI3K/Akt inhibitor, abolished agmatine-induced HO-1 up-regulation and ROS suppression significantly. Inhibiting HO-1 pathway significantly attenuated the antioxidant effect of agmatine which the products of HO-1 enzymatic activity contributed to. Furthermore, the common membrane receptors of agmatine were evaluated, revealing that α2-adrenoceptor, I1-imidazoline receptor or I2-imidazoline receptor are not required by the antioxidant properties of agmatine. Taken together, our findings revealed that agmatine has antioxidant activity against LPS-induced ROS accumulation in RAW 264.7 cells involving HO-1 expression induced by Nrf2 via PI3K/Akt pathway activation.

  14. Sulforaphane attenuates di-N-butylphthalate-induced reproductive damage in pubertal mice: Involvement of the Nrf2-antioxidant system.

    Science.gov (United States)

    Jiang, Xu-Ping; Tang, Jing-Yuan; Xu, Zhen; Han, Peng; Qin, Zhi-Qiang; Yang, Cheng-di; Wang, Shang-Qian; Tang, Min; Wang, Wei; Qin, Chao; Xu, Yang; Shen, Bai-Xin; Zhou, Wei-Min; Zhang, Wei

    2017-07-01

    di-N-butylphthalate (DBP) is a ubiquitous environmental pollutant used for plastic coating and in the cosmetics industry. It has toxic effects on body health, especially the male reproductive system. Here, we investigated the effects of DBP on the male reproductive system of pubertal mice and explored the protective role of sulforaphane (SFN). The results showed that DBP significantly reduced the anogenital distance, testicular weight, sperm count and motility, and plasma and testicular testosterone levels and significantly increased the oxidative stress, sperm abnormalities, and testicular cell apoptosis. SFN supplementation ameliorated these effects. After DBP stimulation, the transcription factor nuclear factor erythroid-related factor 2 (Nrf2) was adaptively increased together with its target genes, such as HO-1 and NQO1. Upregulation of Nrf2 by SFN reduced the DBP-mediated intracellular oxidative toxicity and also increased testosterone secretion and spermatogenesis, which were decreased by DBP. These findings indicate that SFN can attenuate DBP-induced reproductive damage in pubertal mice via Nrf2-associated pathways. © 2017 Wiley Periodicals, Inc.

  15. Activation of the Nrf2 Cell Defense Pathway by Ancient Foods: Disease Prevention by Important Molecules and Microbes Lost from the Modern Western Diet.

    Directory of Open Access Journals (Sweden)

    Donald R Senger

    Full Text Available The Nrf2 (NFE2L2 cell defense pathway protects against oxidative stress and disorders including cancer and neurodegeneration. Although activated modestly by oxidative stress alone, robust activation of the Nrf2 defense mechanism requires the additional presence of co-factors that facilitate electron exchange. Various molecules exhibit this co-factor function, including sulforaphane from cruciferous vegetables. However, natural co-factors that are potent and widely available from dietary sources have not been identified previously. The objectives of this study were to investigate support of the Nrf2 cell defense pathway by the alkyl catechols: 4-methylcatechol, 4-vinylcatechol, and 4-ethylcatechol. These small electrochemicals are naturally available from numerous sources but have not received attention. Findings reported here illustrate that these compounds are indeed potent co-factors for activation of the Nrf2 pathway both in vitro and in vivo. Each strongly supports expression of Nrf2 target genes in a variety of human cell types; and, in addition, 4-ethylcatechol is orally active in mice. Furthermore, findings reported here identify important and previously unrecognized sources of these compounds, arising from biotransformation of common plant compounds by lactobacilli that express phenolic acid decarboxylase. Thus, for example, Lactobacillus plantarum, Lactobacillus brevis, and Lactobacillus collinoides, which are consumed from a diet rich in traditionally fermented foods and beverages, convert common phenolic acids found in fruits and vegetables to 4-vinylcatechol and/or 4-ethylcatechol. In addition, all of the alkyl catechols are found in wood smoke that was used widely for food preservation. Thus, the potentially numerous sources of alkyl catechols in traditional foods suggest that these co-factors were common in ancient diets. However, with radical changes in food preservation, alkyl catechols have been lost from modern foods. The

  16. Butylated hydroxyanisole induces distinct expression patterns of Nrf2 and detoxification enzymes in the liver and small intestine of C57BL/6 mice

    Energy Technology Data Exchange (ETDEWEB)

    Luo, Lin [Department of Pharmacology, School of Medicine, Zhejiang University, Hangzhou 310058 (China); Department of Pharmacology, University of Nantong, Nantong (China); Chen, Yeru; Wu, Deqi; Shou, Jiafeng [Department of Pharmacology, School of Medicine, Zhejiang University, Hangzhou 310058 (China); Wang, Shengcun [Department of Biochemistry and Genetics, School of Medicine, Zhejiang University, Hangzhou 310058 (China); Ye, Jie [Department of Pharmacology, School of Medicine, Zhejiang University, Hangzhou 310058 (China); Tang, Xiuwen, E-mail: xiuwentang@zju.edu.cn [Department of Biochemistry and Genetics, School of Medicine, Zhejiang University, Hangzhou 310058 (China); Wang, Xiu Jun, E-mail: xjwang@zju.edu.cn [Department of Pharmacology, School of Medicine, Zhejiang University, Hangzhou 310058 (China)

    2015-11-01

    Butylated hydroxyanisole (BHA) is widely used as an antioxidant and preservative in food, food packaging and medicines. Its chemopreventive properties are attributing to its ability to activate the transcription factor NF-E2 p45-related factor 2 (Nrf2), which directs central genetic programs of detoxification and protection against oxidative stress. This study was to investigate the histological changes of Nrf2 and its regulated phase II enzymes Nqo1, AKR1B8, and Ho-1 in wild-type (WT) and Nrf2{sup −/−} mice induced by BHA. The mice were given a 200 mg/kg oral dose of BHA daily for three days. Immunohistochemistry revealed that, in the liver from WT mice, BHA increased Nqo1 staining in hepatocytes, predominately in the pericentral region. In contrast, the induction of AKR1B8 appeared mostly in hepatocytes in the periportal region. The basal and inducible Ho-1 was located almost exclusively in Kupffer cells. In the small intestine from WT mice, the inducible expression patterns of Nqo1 and AKR1B8 were nearly identical to that of Nrf2, with more intense staining in the villus than that the crypt. Conversely, Keap1 was more highly expressed in the crypt, where the proliferative cells reside. Our study demonstrates that BHA elicited differential expression patterns of phase II-detoxifying enzymes in the liver and small intestine from WT but not Nrf2{sup −/−} mice, demonstrating a cell type specific response to BHA in vivo. - Highlights: • Histological view of basal and inducible Nrf2 and its targets in vivo • Induction of detoxification enzymes by BHA is cell-type dependent. • BHA induces the expression of HO-1 in Kupffer cells.

  17. Nrf2 protects human bladder urothelial cells from arsenite and monomethylarsonous acid toxicity

    International Nuclear Information System (INIS)

    Wang Xiaojun; Sun Zheng; Chen Weimin; Eblin, Kylee E.; Gandolfi, Jay A.; Zhang, Donna D.

    2007-01-01

    Arsenic is widely spread in our living environment and imposes a big challenge on human health worldwide. Arsenic damages biological systems through multiple mechanisms including the generation of reactive oxygen species. The transcription factor Nrf2 regulates the cellular antioxidant response that protects cells from various insults. In this study, the protective role of Nrf2 in arsenic toxicity was investigated in a human bladder urothelial cell line, UROtsa. Using a UROtsa cell line stably infected with Nrf2-siRNA, we clearly demonstrate that compromised Nrf2 expression sensitized the cells to As(III)- and MMA(III)-induced toxicity. On the other hand, the activation of the Nrf2 pathway by tert-butylhydroquinone (tBHQ) and sulforaphane (SF), the known Nrf2-inducers, rendered UROtsa cells more resistant to As(III) and MMA(III). Furthermore, the wild-type mouse embryo fibroblast (WT-MEF) cells were protected from As(III)- and MMA(III)-induced toxicity following Nrf2 activation by tBHQ or SF, whereas neither tBHQ nor SF conferred protection in the Nrf2 -/- MEF cells, demonstrating that tBHQ- or SF-mediated protection against As(III)- and MMA(III)-induced toxicity depends on Nrf2 activation. These results, obtained by both loss of function and gain of function analyses, clearly demonstrate the protective role of Nrf2 in arsenic-induced toxicity. The current work lays the groundwork for using Nrf2 activators for therapeutic and dietary interventions against adverse effects of arsenic

  18. Dopamine signaling: target in glioblastoma

    Czech Academy of Sciences Publication Activity Database

    Bartek, Jiří; Hodný, Zdeněk

    2014-01-01

    Roč. 5, č. 5 (2014), 1116-1117 ISSN 1949-2553 Institutional support: RVO:68378050 Keywords : Dopamine signaling * glioblastoma * MAPK Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 6.359, year: 2014

  19. When defense becomes dangerous – transcription factor Nrf2 and cancer

    Directory of Open Access Journals (Sweden)

    Adam Krysztofiak

    2015-01-01

    Full Text Available The transcription factor Nrf2 controls the expression of genes encoding cytoprotective enzymes and proteins. Its activation is related to conformational changes in the inhibitory protein Keap1 and/or Nrf2 phosphorylation by upstream kinases. Activation of Nrf2 can lead to the induction of phase II enzymes responsible for the inactivation of potential carcinogens. This may constitute an important strategy of chemoprevention. Moreover, these enzymatic systems participating in the biotransformation of drugs can reduce their therapeutic effects, contributing to drug resistance. For this reason, a clear understanding of the role of Nrf2 is essential to assess the beneficial and adverse effects of its up-regulation, particularly in relation to the prevention and treatment of cancer. This article summarizes the current state of knowledge on the significance of Nrf2 in tumorigenesis.

  20. Time- and cell-resolved dynamics of redox-sensitive Nrf2, HIF and NF-κB activities in 3D spheroids enriched for cancer stem cells

    Directory of Open Access Journals (Sweden)

    Anna P. Kipp

    2017-08-01

    Full Text Available Cancer cells have an altered redox status, with changes in intracellular signaling pathways. The knowledge of how such processes are regulated in 3D spheroids, being well-established tumor models, is limited. To approach this question we stably transfected HCT116 cells with a pTRAF reporter that enabled time- and cell-resolved activity monitoring of three redox-regulated transcription factors Nrf2, HIF and NF-κB in spheroids enriched for cancer stem cells. At the first day of spheroid formation, these transcription factors were activated and thereafter became repressed. After about a week, both HIF and Nrf2 were reactivated within the spheroid cores. Further amplifying HIF activation in spheroids by treatment with DMOG resulted in a dominant quiescent stem-cell-like phenotype, with high resistance to stress-inducing treatments. Auranofin, triggering oxidative stress and Nrf2 activation, had opposite effects with increased differentiation and proliferation. These novel high-resolution insights into spatiotemporal activation patterns demonstrate a striking coordination of redox regulated transcription factors within spheroids not occurring in conventional cell culture models. Keywords: Redox regulation, Cancer stem cells, Spheroids, Nrf2, HIF, NF-κB

  1. Fimasartan, a Novel Angiotensin-Receptor Blocker, Protects against Renal Inflammation and Fibrosis in Mice with Unilateral Ureteral Obstruction: the Possible Role of Nrf2

    Science.gov (United States)

    Kim, Soojeong; Kim, Sung Jun; Yoon, Hye Eun; Chung, Sungjin; Choi, Bum Soon; Park, Cheol Whee; Shin, Seok Joon

    2015-01-01

    Objectives: A newly developed angiotensin II receptor blocker, fimasartan, is effective in lowering blood pressure through its action on the renin-angiotensin system. Renal interstitial fibrosis, believed to be due to oxidative injury, is an end-stage process in the progression of chronic kidney disease. Nuclear factor erythroid 2-related factor 2 (Nrf2) is known to regulate cellular oxidative stress and induce expression of antioxidant genes. In this study we investigated the role of Nrf2 in fimasartan-mediated antioxidant effects in mice with renal fibrosis induced by unilateral ureteral obstruction (UUO). Materials and Methods: UUO was induced surgically in mice, followed by either no treatment with fimasartan or the intraperitoneal administration of fimasartan (3 mg/kg/day). On day 7, we evaluated the changes in the renin-angiotensin system (RAS) and the expression of Nrf2 and its downstream antioxidant genes, as well as renal inflammation, apoptosis, and fibrosis in the obstructed kidneys. The effect of fimasartan on the Nrf2 pathway was also investigated in HK-2 cells stimulated by tumor necrosis factor-α. Results: The mice with surgically induced UUO showed increased renal inflammation and fibrosis as evidenced by histopathologic findings and total collagen content in the kidney. These effects were attenuated in the obstructed kidneys of the fimasartan-treated mice. Fimasartan treatment inhibited RAS activation and the expression of Nox1, Nox2, and Nox4. In contrast, fimasartan upregulated the renal expression of Nrf2 and its downstream signaling molecules (such as NQO1; HO-1; GSTa2 and GSTm3). Furthermore, it increased the expression of antioxidant enzymes, including CuSOD, MnSOD, and catalase. The fimasartan-treated mice had significantly less apoptosis on TUNEL staining, with decreased levels of pro-apoptotic protein and increased levels of anti-apoptotic protein. In the HK-2 cells, fimasartan treatment inhibited RAS activation, decreased expression of

  2. Equol Attenuates Atherosclerosis in Apolipoprotein E-Deficient Mice by Inhibiting Endoplasmic Reticulum Stress via Activation of Nrf2 in Endothelial Cells.

    Directory of Open Access Journals (Sweden)

    Ting Zhang

    Full Text Available The development of atherosclerosis is closely related to excessive endoplasmic reticulum stress (ERs. Equol reportedly protects against cardiovascular disease; however, the underlying mechanism for this protection remains unknown. Herein, the mechanisms contributing to the atheroprotective effect of equol were addressed using apolipoprotein E knockout (apoE-/- mice fed a high-fat diet (HFD with or without equol. Equol intervention reduced atherosclerotic lesions in the aorta in HFD-fed apoE-/- mice. Plasma lipid analysis showed that equol intervention reduced triglycerides, total cholesterol and LDL-cholesterol and increased HDL-cholesterol. Additionally, equol administration decreased lipid accumulation in the liver. Simultaneously, equol treatment inhibited cell apoptosis induced by t-BHP and thapsigargin in human umbilical vein endothelial cells (HUVECs. Furthermore, equol treatment attenuated palmitate, t-BHP or thapsigargin-induced upregulation of ER stress markers, including p-PERK, p-eIF2α, GRP78, ATF6 and CHOP proteins expression. The same tendency was also observed in aortic lysates in apoE-/- mice fed with equol plus HFD compared with HFD alone. Moreover, equol treatment dose dependently activated the Nrf2 signaling pathway under oxidative stress. Additionally, elevation of Nrf2 induction was found in aortic lysates in apoE-/- mice fed with a HFD diet containing equol compared with a HFD diet without equol. Importantly, Nrf2 siRNA interference induced CHOP and attenuated the effect of equol to inhibit t-BHP mediated CHOP induction, furthermore, abrogated cell apoptosis induced by t-BHP, suggesting a role for Nrf2 in the protective effect of equol in HUVECs. Collectively, these findings implicate that the improvement of atherosclerosis by equol through attenuation of ER stress is mediated, at least in part, by activating the Nrf2 signaling pathway.

  3. Sulforaphane Ameliorates Bladder Dysfunction through Activation of the Nrf2-ARE Pathway in a Rat Model of Partial Bladder Outlet Obstruction

    Directory of Open Access Journals (Sweden)

    Chong Liu

    2016-01-01

    Full Text Available Purpose. We evaluated the effect of sulforaphane (SFN treatment on the function and changes of expression of Nrf2-ARE pathway in the bladder of rats with bladder outlet obstruction (BOO. Materials and Methods. A total of 18 male Sprague-Dawley rats at age of 8 weeks were divided into 3 groups (6 of each: the sham operated group, the BOO group, and the BOO+SFN group. We examined histological alterations and the changes of oxidative stress markers and the protein expression of the Nrf2-ARE pathway. Results. We found that SFN treatment could prolong micturition interval and increase bladder capacity and bladder compliance. However, the peak voiding pressure was lower than BOO group. SFN treatment can ameliorate the increase of collagen fibers induced by obstruction. SFN treatment also increased the activity of SOD, GSH-Px, and CAT compared to the other groups. The level of bladder cell apoptosis was decreased in BOO rats with SFN treatment. Moreover, SFN could reduce the ratio of Bax/Bcl-2 expression. Furthermore, SFN could activate the Nrf2 expression with elevation of its target antioxidant proteins. Conclusions. The sulforaphane-mediated decrease of oxidative stress and activation of the Nrf2-ARE pathway may ameliorate bladder dysfunction caused by bladder outlet obstruction.

  4. Sulforaphane Ameliorates Bladder Dysfunction through Activation of the Nrf2-ARE Pathway in a Rat Model of Partial Bladder Outlet Obstruction

    Science.gov (United States)

    Liu, Chong; Xu, Huan; Fu, Shi; Chen, Yanbo; Chen, Qi; Cai, Zhikang; Zhou, Juan; Wang, Zhong

    2016-01-01

    Purpose. We evaluated the effect of sulforaphane (SFN) treatment on the function and changes of expression of Nrf2-ARE pathway in the bladder of rats with bladder outlet obstruction (BOO). Materials and Methods. A total of 18 male Sprague-Dawley rats at age of 8 weeks were divided into 3 groups (6 of each): the sham operated group, the BOO group, and the BOO+SFN group. We examined histological alterations and the changes of oxidative stress markers and the protein expression of the Nrf2-ARE pathway. Results. We found that SFN treatment could prolong micturition interval and increase bladder capacity and bladder compliance. However, the peak voiding pressure was lower than BOO group. SFN treatment can ameliorate the increase of collagen fibers induced by obstruction. SFN treatment also increased the activity of SOD, GSH-Px, and CAT compared to the other groups. The level of bladder cell apoptosis was decreased in BOO rats with SFN treatment. Moreover, SFN could reduce the ratio of Bax/Bcl-2 expression. Furthermore, SFN could activate the Nrf2 expression with elevation of its target antioxidant proteins. Conclusions. The sulforaphane-mediated decrease of oxidative stress and activation of the Nrf2-ARE pathway may ameliorate bladder dysfunction caused by bladder outlet obstruction. PMID:27433291

  5. Aldose Reductase Inhibitor Protects against Hyperglycemic Stress by Activating Nrf2-Dependent Antioxidant Proteins

    Directory of Open Access Journals (Sweden)

    Kirtikar Shukla

    2017-01-01

    Full Text Available We have shown earlier that pretreatment of cultured cells with aldose reductase (AR inhibitors prevents hyperglycemia-induced mitogenic and proinflammatory responses. However, the effects of AR inhibitors on Nrf2-mediated anti-inflammatory responses have not been elucidated yet. We have investigated how AR inhibitor fidarestat protects high glucose- (HG- induced cell viability changes by increasing the expression of Nrf2 and its dependent phase II antioxidant enzymes. Fidarestat pretreatment prevents HG (25 mM-induced Thp1 monocyte viability. Further, treatment of Thp1 monocytes with fidarestat caused a time-dependent increase in the expression as well as the DNA-binding activity of Nrf2. In addition, fidarestat augmented the HG-induced Nrf2 expression and activity and also upregulated the expression of Nrf2-dependent proteins such as hemeoxygenase-1 (HO1 and NQO1 in Thp1 cells. Similarly, treatment with AR inhibitor also induced the expression of Nrf2 and HO1 in STZ-induced diabetic mice heart and kidney tissues. Further, AR inhibition increased the HG-induced expression of antioxidant enzymes such as SOD and catalase and activation of AMPK-α1 in Thp1 cells. Our results thus suggest that pretreatment with AR inhibitor prepares the monocytes against hyperglycemic stress by overexpressing the Nrf2-dependent antioxidative proteins.

  6. Aldose Reductase Inhibitor Protects against Hyperglycemic Stress by Activating Nrf2-Dependent Antioxidant Proteins.

    Science.gov (United States)

    Shukla, Kirtikar; Pal, Pabitra Bikash; Sonowal, Himangshu; Srivastava, Satish K; Ramana, Kota V

    2017-01-01

    We have shown earlier that pretreatment of cultured cells with aldose reductase (AR) inhibitors prevents hyperglycemia-induced mitogenic and proinflammatory responses. However, the effects of AR inhibitors on Nrf2-mediated anti-inflammatory responses have not been elucidated yet. We have investigated how AR inhibitor fidarestat protects high glucose- (HG-) induced cell viability changes by increasing the expression of Nrf2 and its dependent phase II antioxidant enzymes. Fidarestat pretreatment prevents HG (25 mM)-induced Thp1 monocyte viability. Further, treatment of Thp1 monocytes with fidarestat caused a time-dependent increase in the expression as well as the DNA-binding activity of Nrf2. In addition, fidarestat augmented the HG-induced Nrf2 expression and activity and also upregulated the expression of Nrf2-dependent proteins such as hemeoxygenase-1 (HO1) and NQO1 in Thp1 cells. Similarly, treatment with AR inhibitor also induced the expression of Nrf2 and HO1 in STZ-induced diabetic mice heart and kidney tissues. Further, AR inhibition increased the HG-induced expression of antioxidant enzymes such as SOD and catalase and activation of AMPK- α 1 in Thp1 cells. Our results thus suggest that pretreatment with AR inhibitor prepares the monocytes against hyperglycemic stress by overexpressing the Nrf2-dependent antioxidative proteins.

  7. Effects of Nrf2 Deficiency on Bone Microarchitecture in an Experimental Model of Osteoporosis

    Directory of Open Access Journals (Sweden)

    Lidia Ibáñez

    2014-01-01

    Full Text Available Objective. Redox imbalance contributes to bone fragility. We have evaluated the in vivo role of nuclear factor erythroid derived 2-related factor-2 (Nrf2, an important regulator of cellular responses to oxidative stress, in bone metabolism using a model of postmenopausal osteoporosis. Methods. Ovariectomy was performed in both wild-type and mice deficient in Nrf2 (Nrf2−/−. Bone microarchitecture was analyzed by μCT. Serum markers of bone metabolism were also measured. Reactive oxygen species production was determined using dihydrorhodamine 123. Results. Sham-operated or ovariectomized Nrf2−/− mice exhibit a loss in trabecular bone mineral density in femur, accompanied by a reduction in cortical area in vertebrae. Nrf2 deficiency tended to increase osteoblastic markers and significantly enhanced osteoclastic markers in sham-operated animals indicating an increased bone turnover with a main effect on bone resorption. We have also shown an increased production of oxidative stress in bone marrow-derived cells from sham-operated or ovariectomized Nrf2−/− mice and a higher responsiveness of bone marrow-derived cells to osteoclastogenic stimuli in vitro. Conclusion. We have demonstrated in vivo a key role of Nrf2 in the maintenance of bone microarchitecture.

  8. Nrf2 Activation Protects against Solar-Simulated Ultraviolet Radiation in Mice and Humans.

    Science.gov (United States)

    Knatko, Elena V; Ibbotson, Sally H; Zhang, Ying; Higgins, Maureen; Fahey, Jed W; Talalay, Paul; Dawe, Robert S; Ferguson, James; Huang, Jeffrey T-J; Clarke, Rosemary; Zheng, Suqing; Saito, Akira; Kalra, Sukirti; Benedict, Andrea L; Honda, Tadashi; Proby, Charlotte M; Dinkova-Kostova, Albena T

    2015-06-01

    The transcription factor Nrf2 determines the ability to adapt and survive under conditions of electrophilic, oxidative, and inflammatory stress by regulating the expression of elaborate networks comprising nearly 500 genes encoding proteins with versatile cytoprotective functions. In mice, disruption of Nrf2 increases susceptibility to carcinogens and accelerates disease pathogenesis. Paradoxically, Nrf2 is upregulated in established human tumors, but whether this upregulation drives carcinogenesis is not known. Here we show that the incidence, multiplicity, and burden of solar-simulated UV radiation-mediated cutaneous tumors that form in SKH-1 hairless mice in which Nrf2 is genetically constitutively activated are lower than those that arise in their wild-type counterparts. Pharmacologic Nrf2 activation by topical biweekly applications of small (40 nmol) quantities of the potent bis(cyano enone) inducer TBE-31 has a similar protective effect against solar-simulated UV radiation in animals receiving long-term treatment with the immunosuppressive agent azathioprine. Genetic or pharmacologic Nrf2 activation lowers the expression of the pro-inflammatory factors IL6 and IL1β, and COX2 after acute exposure of mice to UV radiation. In healthy human subjects, topical applications of extracts delivering the Nrf2 activator sulforaphane reduced the degree of solar-simulated UV radiation-induced skin erythema, a quantifiable surrogate endpoint for cutaneous damage and skin cancer risk. Collectively, these data show that Nrf2 is not a driver for tumorigenesis even upon exposure to a very potent and complete carcinogen and strongly suggest that the frequent activation of Nrf2 in established human tumors is a marker of metabolic adaptation. ©2015 American Association for Cancer Research.

  9. Nrf2 is required to maintain the self-renewal of glioma stem cells

    International Nuclear Information System (INIS)

    Zhu, Jianhong; Wang, Handong; Sun, Qing; Ji, Xiangjun; Zhu, Lin; Cong, Zixiang; Zhou, Yuan; Liu, Huandong; Zhou, Mengliang

    2013-01-01

    Glioblastomas are deadly cancers that display a functional cellular hierarchy maintained by self-renewing glioma stem cells (GSCs). Self-renewal is a complex biological process necessary for maintaining the glioma stem cells. Nuclear factor rythroid 2-related factor 2(Nrf2) plays a significant role in protecting cells from endogenous and exogenous stresses. Nrf2 is a key nuclear transcription factor that regulates antioxidant response element (ARE)-containing genes. Previous studies have demonstrated the significant role of Nrf2 in the proliferation of glioblastoma, and in their resistance to radioactive therapies. We examined the effect of knocking down Nrf2 in GSCs. Nrf2 expression was down-regulated by shRNA transinfected with lentivirus. Expression levels of Nestin, Nrf2, BMI-1, Sox2 and Cyclin E were assessed by western blotting, quantitative polymerase chain reaction (qPCR) and immunohistochemistry analysis. The capacity for self-renewal in vitro was assessed by genesis of colonies. The capacity for self-renewal in vivo was analyzed by tumor genesis of xenografts in nude mice. Knockdown of Nrf2 inhibited the proliferation of GSCs, and significantly reduced the expression of BMI-1, Sox2 and CyclinE. Knocking down of Nrf2 changed the cell cycle distribution of GSCs by causing an uncharacteristic increase in the proportion of cells in the G2 phase and a decrease in the proportion of cells in the S phase of the cell cycle. Nrf2 is required to maintain the self-renewal of GSCs, and its down-regulation can attenuate the self-renewal of GSCs significantly

  10. Epigenetics Reactivation of Nrf2 in Prostate TRAMP C1 Cells by Curcumin Analogue FN1.

    Science.gov (United States)

    Li, Wenji; Pung, Doug; Su, Zheng-Yuan; Guo, Yue; Zhang, Chengyue; Yang, Anne Yuqing; Zheng, Xi; Du, Zhi-Yun; Zhang, Kun; Kong, Ah-Ng

    2016-04-18

    It has previously been shown that curcumin can effectively inhibit prostate cancer proliferation and progression in TRAMP mice, potentially acting through the hypomethylation of the Nrf2 gene promoter and hence activation of the Nrf2 pathway to enhance cell antioxidative defense. FN1 is a synthetic curcumin analogue that shows stronger anticancer activity than curcumin in other reports. We aimed to explore the epigenetic modification of FN1 that restores Nrf2 expression in TRAMP-C1 cells. Stably transfected HepG2-C8 cells were used to investigate the effect of FN1 on the Nrf2- antioxidant response element (ARE) pathway. Real-time quantitative PCR and Western blotting were applied to study the influence of FN1 on endogenous Nrf2 and its downstream genes. Bisulfite genomic sequencing (BGS) and methylated DNA immunoprecipitation (MeDIP) were then performed to examine the methylation profile of the Nrf2 promoter. An anchorage-independent colony-formation analysis was conducted to examine the tumor inhibition activity of FN1. Epigenetic modification enzymes, including DNMTs and HDACs, were investigated by Western blotting. The luciferase reporter assay indicated that FN1 was more potent than curcumin in activating the Nrf2-ARE pathway. FN1 increased the expression of Nrf2 and its downstream detoxifying enzymes. FN1 significantly inhibited the colony formation of TRAMP-C1 cells. BGS and MeDIP assays revealed that FN1 treatment (250 nM for 3 days) reduced the percentage of CpG methylation of the Nrf2 promoter. FN1 also downregulated epigenetic modification enzymes. In conclusion, our results suggest that FN1 is a novel anticancer agent for prostate cancer. In the TRAMP-C1 cell line, FN1 can increase the level of Nrf2 and downstream genes via activating the Nrf2-ARE pathway and inhibit the colony formation potentially through the decreased expression of keap1 coupled with CpG demethylation of the Nrf2 promoter. This CpG demethylation effect may come from decreased

  11. Low-Dose Radiation Activates Akt and Nrf2 in the Kidney of Diabetic Mice: A Potential Mechanism to Prevent Diabetic Nephropathy

    Directory of Open Access Journals (Sweden)

    Xiao Xing

    2012-01-01

    Full Text Available Repetitive exposure of diabetic mice to low-dose radiation (LDR at 25 mGy could significantly attenuate diabetes-induced renal inflammation, oxidative damage, remodeling, and dysfunction, for which, however, the underlying mechanism remained unknown. The present study explored the effects of LDR on the expression and function of Akt and Nrf2 in the kidney of diabetic mice. C57BL/6J mice were used to induce type 1 diabetes with multiple low-dose streptozotocin. Diabetic and age-matched control mice were irradiated with whole body X-rays at either single 25 mGy and 75 mGy or accumulated 75 mGy (25 mGy daily for 3 days and then sacrificed at 1–12 h for examining renal Akt phosphorylation and Nrf2 expression and function. We found that 75 mGy of X-rays can stimulate Akt signaling pathway and upregulate Nrf2 expression and function in diabetic kidneys; single exposure of 25 mGy did not, but three exposures to 25 mGy of X-rays could offer a similar effect as single exposure to 75 mGy on the stimulation of Akt phosphorylation and the upregulation of Nrf2 expression and transcription function. These results suggest that single 75 mGy or multiple 25 mGy of X-rays can stimulate Akt phosphorylation and upregulate Nrf2 expression and function, which may explain the prevention of LDR against the diabetic nephropathy mentioned above.

  12. Small molecule activators of the Nrf2-HO-1 antioxidant axis modulate heme metabolism and inflammation in BV2 microglia cells.

    Science.gov (United States)

    Foresti, Roberta; Bains, Sandip K; Pitchumony, Tamil Selvi; de Castro Brás, Lisandra E; Drago, Filippo; Dubois-Randé, Jean-Luc; Bucolo, Claudio; Motterlini, Roberto

    2013-10-01

    The nuclear factor erythroid derived 2-related factor 2 (Nrf2) and the antioxidant protein heme oxygenase-1 (HO-1) are crucial components of the cellular stress response. These two systems work together to combat oxidative stress and inflammation and are attractive drug targets for counteracting different pathologies, including neuroinflammation. We aimed to identify the most effective Nrf2/HO-1 activators that modulate the inflammatory response in microglia cells. In the present study, we searched the literature and selected 56 compounds reported to activate Nrf2 or HO-1 and analyzed them for HO-1 induction at 6 and 24h and cytotoxicity in BV2 microglial cells in vitro. Approximately 20 compounds up-regulated HO-1 at the concentrations tested (5-20 μM) with carnosol, supercurcumin, cobalt protoporphyrin-IX and dimethyl fumarate exhibiting the best induction/low cytotoxicity profile. Up-regulation of HO-1 by some compounds resulted in increased cellular bilirubin levels but did not augment the expression of proteins involved in heme synthesis (ALAS 1) or biliverdin reductase. Bilirubin production by HO-1 inducers correlated with their potency in inhibiting nitrite production after challenge with interferon-γ (INF-γ) or lipopolysaccharide (LPS). The compounds down-regulated the inflammatory response (TNF-α, PGE2 and nitrite) more strongly in cells challenged with INF-γ than LPS, and silencing HO-1 or Nrf2 with shRNA differentially affected the levels of inflammatory markers. These findings indicate that some small activators of Nrf2/HO-1 are effective modulators of microglia inflammation and highlight the chemical scaffolds that can serve for the synthesis of potent new derivatives to counteract neuroinflammation and neurodegeneration. Copyright © 2013 Elsevier Ltd. All rights reserved.

  13. Hepatocyte-specific deletion of the keap1 gene activates Nrf2 and confers potent resistance against acute drug toxicity

    International Nuclear Information System (INIS)

    Okawa, Hiromi; Motohashi, Hozumi; Kobayashi, Akira; Aburatani, Hiroyuki; Kensler, Thomas W.; Yamamoto, Masayuki

    2006-01-01

    Nrf2 is a key regulator of many detoxifying enzyme genes, and cytoplasmic protein Keap1 represses the Nrf2 activity under quiescent conditions. Germ line deletion of the keap1 gene results in constitutive activation of Nrf2, but the pups unexpectedly died before weaning. To investigate how constitutive activation of Nrf2 influences the detoxification system in adult mice, we generated mice bearing a hepatocyte-specific disruption of the keap1 gene. Homozygous mice were viable and their livers displayed no apparent abnormalities, but nuclear accumulation of Nrf2 is elevated. Microarray analysis revealed that, while many detoxifying enzyme genes are highly expressed, some of the typical Nrf2-dependent genes are only marginally increased in the Keap1-deficient liver. The mutant mice were significantly more resistant to toxic doses of acetaminophen than control animals. These results demonstrate that chronic activation of Nrf2 confers animals with resistance to xenobiotics without affecting the morphological and physiological integrity of hepatocytes

  14. NRF2 and P73 polymorphisms in Egyptian women with breast cancer

    African Journals Online (AJOL)

    The aim of the study was to assess the role of Nrf2 promoter and P73 G4C14 to A4T14 polymorphisms in breast cancer and the potential relation to the onset of the disease. Eighty six female patients with breast tumor were included in this study. Nrf2 (rs6721961) and p73 (G4A) genetic polymorphisms in promoter and ...

  15. Intermittent hypoxia simulating obstructive sleep apnea causes pulmonary inflammation and activates the Nrf2/HO-1 pathway.

    Science.gov (United States)

    Wang, Yeying; Chai, Yanling; He, Xiaojie; Ai, Li; Sun, Xia; Huang, Yiling; Li, Yongxia

    2017-10-01

    Obstructive sleep apnea (OSA) is a disorder with high morbidity in adults. OSA damages multiple organs and tissues, including the cardiovascular and cerebrovascular systems, the metabolism system, the lungs, liver and heart. OSA-induced damage is earliest and greatest to the pulmonary tissue. The present study established a rat OSA model of differing severity by inducing intermittent hypoxia with different concentrations of O 2 and it was determined that OSA caused a severe oxidative stress response and pulmonary inflammation in a dose-dependent manner. OSA increased serum levels of C-reactive protein and 8-isoprostane and elevated the expression of malondialdehyde, tumor necrosis factor α, interleukin (IL)-1β and IL-6 in the pulmonary tissue. Furthermore, the expression of two important antioxidants, superoxide dismutase and glutathione, was downregulated following intermittent hypoxia. By contrast, levels of cylooxygenase 2 and inducible nitric oxide synthase, which are crucial in the antioxidative response, increased. In addition, OSA activates the nuclear factor erythroid 2-related factor 2 (Nrf2)/heme oxygenase (OH)-1 antioxidative signaling pathway. Finally, all increases and decreases in levels of inflammatory and antioxidative substances were dependent on oxygen concentrations. Therefore, the present study demonstrated that OSA, simulated by intermittent hypoxia, caused an oxidative stress response and pulmonary inflammation, and activated the canonical antioxidative Nrf2/HO-1 signaling pathway in a dose-dependent manner. These results may facilitate the development of clinical therapies to treat pulmonary diseases caused by OSA.

  16. Nrf2 deficiency potentiates methamphetamine-induced dopaminergic axonal damage and gliosis in the striatum.

    Science.gov (United States)

    Granado, Noelia; Lastres-Becker, Isabel; Ares-Santos, Sara; Oliva, Idaira; Martin, Eduardo; Cuadrado, Antonio; Moratalla, Rosario

    2011-12-01

    Oxidative stress that correlates with damage to nigrostriatal dopaminergic neurons and reactive gliosis in the basal ganglia is a hallmark of methamphetamine (METH) toxicity. In this study, we analyzed the protective role of the transcription factor Nrf2 (nuclear factor-erythroid 2-related factor 2), a master regulator of redox homeostasis, in METH-induced neurotoxicity. We found that Nrf2 deficiency exacerbated METH-induced damage to dopamine neurons, shown by an increase in loss of tyrosine hydroxylase (TH)- and dopamine transporter (DAT)-containing fibers in striatum. Consistent with these effects, Nrf2 deficiency potentiated glial activation, indicated by increased striatal expression of markers for microglia (Mac-1 and Iba-1) and astroglia (GFAP) one day after METH administration. At the same time, Nrf2 inactivation dramatically potentiated the increase in TNFα mRNA and IL-15 protein expression in GFAP+ cells in the striatum. In sharp contrast to the potentiation of striatal damage, Nrf2 deficiency did not affect METH-induced dopaminergic neuron death or expression of glial markers or proinflammatory molecules in the substantia nigra. This study uncovers a new role for Nrf2 in protection against METH-induced inflammatory and oxidative stress and striatal degeneration. Copyright © 2011 Wiley‐Liss, Inc.

  17. Identification of a Novel and Potent Nrf2 inhibitor as a Radiosensitizer with High Throughput Screening

    Energy Technology Data Exchange (ETDEWEB)

    Ahn, Ji Yeon; Park, Sa Rah; Yun, Yeon Sook; Song, Jie Young [Korea Institute of Radiological and Medical Sciences, Seoul (Korea, Republic of)

    2009-05-15

    Lung cancer is the leading cause of cancer death in both men and women in the United States. Non-small cell lung cancer (NSCLC) accounts for more than 75% of all lung cancers and radiotherapy (RT) is the general treatment modality for these lung cancer patients. Nuclear factor erythroid-2. related factor 2 (Nrf2) is a redox-sensitive transcription factor that regulates the expression of genes encoding electrophiles and xenobiotic detoxification enzymes and efflux proteins, which confer cytoprotection against oxidative stress and xenobiotics in normal cells. Kelch-like ECH-associated protein (Keap1) sequesters Nrf2 and leads to proteasomal degradation of Nrf2 in non-stressed condition. Keap1 is often found with biallelic mutation in NSCLC cell lines and NSCLC patients, results in constitutive activation of Nrf2 function, and contributes to resistance of chemotherapy (CT) or RT (3, 4). We thus postulated that inhibition of Nrf2 in cancer cells could increase sensitivity to RT. Our primary results show that IM3829, a putative Nrf2 inhibitor, enhances the efficacy of RT and CT in H1299 lung cancer cell.

  18. Novel curcumin analogue 14p protects against myocardial ischemia reperfusion injury through Nrf2-activating anti-oxidative activity

    Energy Technology Data Exchange (ETDEWEB)

    Li, Weixin [Department of Cardiology, The 5th Affiliated Hospital of Wenzhou Medical University, Lishui, Zhejiang (China); Chemical Biology Research Center, School of Pharmaceutical Science, Wenzhou Medical University, Wenzhou, Zhejiang (China); Wu, Mingchai [Department of Pharmacy, The Third Affiliated Hospital of Wenzhou Medical University, Wenzou, Zhejiang (China); Tang, Longguang; Pan, Yong; Liu, Zhiguo [Chemical Biology Research Center, School of Pharmaceutical Science, Wenzhou Medical University, Wenzhou, Zhejiang (China); Zeng, Chunlai [Department of Cardiology, The 5th Affiliated Hospital of Wenzhou Medical University, Lishui, Zhejiang (China); Wang, Jingying [Chemical Biology Research Center, School of Pharmaceutical Science, Wenzhou Medical University, Wenzhou, Zhejiang (China); Wei, Tiemin, E-mail: lswtm@sina.com [Department of Cardiology, The 5th Affiliated Hospital of Wenzhou Medical University, Lishui, Zhejiang (China); Liang, Guang, E-mail: wzmcliangguang@163.com [Chemical Biology Research Center, School of Pharmaceutical Science, Wenzhou Medical University, Wenzhou, Zhejiang (China)

    2015-01-15

    Background: Alleviating the oxidant stress associated with myocardial ischemia reperfusion has been demonstrated as a potential therapeutic approach to limit ischemia reperfusion (I/R)-induced cardiac damage. Curcumin, a natural compound with anti-oxidative activity, exerts beneficial effect against cardiac I/R injury, but poor chemical and metabolic stability. Previously, we have designed and synthesized a series of mono-carbonyl analogues of curcumin (MACs) with high stability. This study aims to find new anti-oxidant MACs and to demonstrate their effects and mechanisms against I/R-induced heart injury. Methods: H9c2 cells challenged with H{sub 2}O{sub 2} or TBHP were used for in vitro bio-screening and mechanistic studies. The MDA, H{sub 2}O{sub 2} and SOD levels in H9C2 cells were determined, and the cell viability was assessed by MTT assay. Myocardial I/R mouse models administrated with or without the compound were used for in vivo studies. Results: The in vitro cell-based screening showed that curcumin analogues 8d and 14p exhibited strong anti-oxidative effects. Pre-treatment of H9c2 cells with 14p activated Nrf2 signaling pathway, attenuated H{sub 2}O{sub 2}-increased MDA and SOD level, followed by the inhibition of TBHP-induced cell death and Bax/Bcl-2–caspase-3 pathway activation. Silencing Nrf2 significantly reversed the protective effects of 14p. In in vivo animal model of myocardial I/R, administration of low dose 14p (10 mg/kg) reduced infarct size and myocardial apoptosis to the same extent as the high dose curcumin (100 mg/kg). Conclusion: These data support the novel curcumin analogue 14p as a promising antioxidant to decrease oxidative stress and limit myocardial ischemia reperfusion injury via activating Nrf2. - Highlights: • Mono-carbonyl analogue of curcumin, 14p, exhibited better chemical stability. • Compound 14p inhibited TBHP-induced apoptosis through activating Nrf2 in vitro. • Compound 14p limited myocardial ischemia

  19. Acrylamide-induced oxidative stress and inflammatory response are alleviated by N-acetylcysteine in PC12 cells: Involvement of the crosstalk between Nrf2 and NF-κB pathways regulated by MAPKs.

    Science.gov (United States)

    Pan, Xiaoqi; Wu, Xu; Yan, Dandan; Peng, Cheng; Rao, Chaolong; Yan, Hong

    2018-05-15

    Acrylamide (ACR) is a classic neurotoxin in animals and humans. However, the mechanism underlying ACR neurotoxicity remains controversial, and effective prevention and treatment measures against this condition are scarce. This study focused on clarifying the crosstalk between the involved signaling pathways in ACR-induced oxidative stress and inflammatory response and investigating the protective effect of antioxidant N-acetylcysteine (NAC) against ACR in PC12 cells. Results revealed that ACR exposure led to oxidative stress characterized by significant increase in reactive oxygen species (ROS) and malondialdehyde (MDA) levels and glutathione (GSH) consumption. Inflammatory response was observed based on the dose-dependently increased levels of pro-inflammatory cytokines tumor necrosis factor-α (TNF-α) and interleukin 6 (IL-6). NAC attenuated ACR-induced enhancement of MDA and ROS levels and TNF-α generation. In addition, ACR activated nuclear transcription factor E2-related factor 2 (Nrf2) and nuclear factor-κB (NF-κB) signaling pathways. Knockdown of Nrf2 by siRNA significantly blocked the increased NF-κB p65 protein expression in ACR-treated PC12 cells. Down-regulation of NF-κB by specific inhibitor BAY11-7082 similarly reduced ACR-induced increase in Nrf2 protein expression. NAC treatment increased Nrf2 expression and suppressed NF-κB p65 expression to ameliorate oxidative stress and inflammatory response caused by ACR. Further results showed that mitogen-activated protein kinases (MAPKs) pathway was activated prior to the activation of Nrf2 and NF-κB pathways. Inhibition of MAPKs blocked Nrf2 and NF-κB pathways. Collectively, ACR activated Nrf2 and NF-κB pathways which were regulated by MAPKs. A crosstalk between Nrf2 and NF-κB pathways existed in ACR-induced cell damage. NAC protected against oxidative damage and inflammatory response induced by ACR by activating Nrf2 and inhibiting NF-κB pathways in PC12 cells. Copyright © 2018 Elsevier B

  20. Andrographolide Activates Keap1/Nrf2/ARE/HO-1 Pathway in HT22 Cells and Suppresses Microglial Activation by Aβ42 through Nrf2-Related Inflammatory Response.

    Science.gov (United States)

    Seo, Ji Yeon; Pyo, Euisun; An, Jin-Pyo; Kim, Jinwoong; Sung, Sang Hyun; Oh, Won Keun

    2017-01-01

    Therapeutic approach of Alzheimer's disease (AD) has been gradually diversified. We examined the therapeutic and preventive potential of andrographolide, which is a lactone diterpenoid from Andrographis paniculata , and focused on the Kelch-like ECH-associated protein 1 (Keap1)/nuclear factor (erythroid-derived 2)-like 2 (Nrf2)-mediated heme oxygenase (HO)-1-inducing effects and the inhibitory activity of amyloid beta (A β ) 42 -induced microglial activation related to Nrf2 and nuclear factor κ B (NF- κ B)-mediated inflammatory responses. Andrographolide induced the expression and translocation of Nrf2 from the cytoplasm to the nucleus, thereby activating antioxidant response element (ARE) gene transcription and HO-1 expression in murine hippocampal HT22 cells. Andrographolide eliminated intracellular A β 42 in BV-2 cells and decreased the production of interleukin (IL)-6, IL-1 β , prostaglandin (PG)E 2 , and nitric oxide (NO) because of artificial phagocytic A β 42 . It decreased pNF- κ B accumulation in the nucleus and the expression of inducible nitric oxide synthase (i-NOS) and cyclooxygenase II (COX-II) in the microglial BV-2 cell line. In summary, andrographolide activates Nrf2-mediated HO-1 expression and inhibits A β 42 -overexpressed microglial BV-2 cell activation. These results suggested that andrographolide might have the potential for further examination of the therapeutics of AD.

  1. Andrographolide Activates Keap1/Nrf2/ARE/HO-1 Pathway in HT22 Cells and Suppresses Microglial Activation by Aβ42 through Nrf2-Related Inflammatory Response

    Directory of Open Access Journals (Sweden)

    Ji Yeon Seo

    2017-01-01

    Full Text Available Therapeutic approach of Alzheimer’s disease (AD has been gradually diversified. We examined the therapeutic and preventive potential of andrographolide, which is a lactone diterpenoid from Andrographis paniculata, and focused on the Kelch-like ECH-associated protein 1 (Keap1/nuclear factor (erythroid-derived 2-like 2 (Nrf2-mediated heme oxygenase (HO-1-inducing effects and the inhibitory activity of amyloid beta (Aβ42-induced microglial activation related to Nrf2 and nuclear factor κB (NF-κB-mediated inflammatory responses. Andrographolide induced the expression and translocation of Nrf2 from the cytoplasm to the nucleus, thereby activating antioxidant response element (ARE gene transcription and HO-1 expression in murine hippocampal HT22 cells. Andrographolide eliminated intracellular Aβ42 in BV-2 cells and decreased the production of interleukin (IL-6, IL-1β, prostaglandin (PGE2, and nitric oxide (NO because of artificial phagocytic Aβ42. It decreased pNF-κB accumulation in the nucleus and the expression of inducible nitric oxide synthase (i-NOS and cyclooxygenase II (COX-II in the microglial BV-2 cell line. In summary, andrographolide activates Nrf2-mediated HO-1 expression and inhibits Aβ42-overexpressed microglial BV-2 cell activation. These results suggested that andrographolide might have the potential for further examination of the therapeutics of AD.

  2. Curcumin analog 1, 5-bis (2-trifluoromethylphenyl)-1, 4-pentadien-3-one exhibits enhanced ability on Nrf2 activation and protection against acrolein-induced ARPE-19 cell toxicity

    Energy Technology Data Exchange (ETDEWEB)

    Li, Yuan [Center for Mitochondrial Biology and Medicine, The Key Laboratory of Biomedical Information Engineering of Ministry of Education, School of Life Science and Technology and Frontier Institute of Life Science, FIST, Xi' an Jiaotong University, Xi' an (China); Zou, Xuan [Center for Translational Medicine, FIST, Xi' an Jiaotong University, Xi' an (China); Cao, Ke; Xu, Jie; Yue, Tingting [Center for Mitochondrial Biology and Medicine, The Key Laboratory of Biomedical Information Engineering of Ministry of Education, School of Life Science and Technology and Frontier Institute of Life Science, FIST, Xi' an Jiaotong University, Xi' an (China); Dai, Fang; Zhou, Bo [State Key Laboratory of Applied Organic Chemistry, Lanzhou University, Lanzhou (China); Lu, Wuyuan [Center for Translational Medicine, FIST, Xi' an Jiaotong University, Xi' an (China); Feng, Zhihui, E-mail: zhfeng@mail.xjtu.edu.cn [Center for Mitochondrial Biology and Medicine, The Key Laboratory of Biomedical Information Engineering of Ministry of Education, School of Life Science and Technology and Frontier Institute of Life Science, FIST, Xi' an Jiaotong University, Xi' an (China); Liu, Jiankang, E-mail: j.liu@mail.xjtu.edu.cn [Center for Mitochondrial Biology and Medicine, The Key Laboratory of Biomedical Information Engineering of Ministry of Education, School of Life Science and Technology and Frontier Institute of Life Science, FIST, Xi' an Jiaotong University, Xi' an (China)

    2013-11-01

    Curcumin, a phytochemical agent in the spice turmeric, has received increasing attention for its anticancer, anti-inflammatory and antioxidant properties. However, application of curcumin has been limited due to its insolubility in water and poor bioavailability both clinically and experimentally. In addition, the protective effects and mechanisms of curcumin in eye diseases have been poorly studied. In the present study, we synthesized a curcumin analog, 1, 5-bis (2-trifluoromethylphenyl)-1, 4-pentadien-3-one (C3), which displayed improved protective effect against acrolein-induced toxicity in a human retinal pigment epithelial cell line (ARPE-19). At 5 μM, curcumin completely protected against acrolein-induced cell oxidative damage and preserved GSH levels and mitochondrial function. Surprisingly, C3 displayed a complete protective effect at 0.5 μM, which was much more efficient than curcumin. Both 0.5 μM C3 and 5 μM curcumin induced Nrf2 nuclear translocation and Nrf2 target genes transcription similarly. Experiments using Nrf2 siRNA showed that the protective effects of curcumin and C3 were eliminated by Nrf2 knockdown. Additionally, both curcumin and C3 activated the PI3/Akt pathway, however, Nrf2 activation was independent of this pathway, and therefore, we hypothesized that both curcumin and C3 activated phase II enzymes via directly disrupting the Nrf2/Keap1 complex and promoting Nrf2's nuclear translocation. Since acrolein challenge of ARPE-19 cells has been used as a model of smoking and age-related macular degeneration (AMD), we concluded that the curcumin analog, C3, may be a more promising drug candidate for its potential application for the prevention and treatment of eye diseases, such as AMD. - Highlights: • We examine toxicity effects of cigarette smoking component acrolein in retina cells. • We report a more efficient curcumin analog (C3) protecting cellular function. • Mitochondrial function and phase II enzyme activation are the

  3. Curcumin analog 1, 5-bis (2-trifluoromethylphenyl)-1, 4-pentadien-3-one exhibits enhanced ability on Nrf2 activation and protection against acrolein-induced ARPE-19 cell toxicity

    International Nuclear Information System (INIS)

    Li, Yuan; Zou, Xuan; Cao, Ke; Xu, Jie; Yue, Tingting; Dai, Fang; Zhou, Bo; Lu, Wuyuan; Feng, Zhihui; Liu, Jiankang

    2013-01-01

    Curcumin, a phytochemical agent in the spice turmeric, has received increasing attention for its anticancer, anti-inflammatory and antioxidant properties. However, application of curcumin has been limited due to its insolubility in water and poor bioavailability both clinically and experimentally. In addition, the protective effects and mechanisms of curcumin in eye diseases have been poorly studied. In the present study, we synthesized a curcumin analog, 1, 5-bis (2-trifluoromethylphenyl)-1, 4-pentadien-3-one (C3), which displayed improved protective effect against acrolein-induced toxicity in a human retinal pigment epithelial cell line (ARPE-19). At 5 μM, curcumin completely protected against acrolein-induced cell oxidative damage and preserved GSH levels and mitochondrial function. Surprisingly, C3 displayed a complete protective effect at 0.5 μM, which was much more efficient than curcumin. Both 0.5 μM C3 and 5 μM curcumin induced Nrf2 nuclear translocation and Nrf2 target genes transcription similarly. Experiments using Nrf2 siRNA showed that the protective effects of curcumin and C3 were eliminated by Nrf2 knockdown. Additionally, both curcumin and C3 activated the PI3/Akt pathway, however, Nrf2 activation was independent of this pathway, and therefore, we hypothesized that both curcumin and C3 activated phase II enzymes via directly disrupting the Nrf2/Keap1 complex and promoting Nrf2's nuclear translocation. Since acrolein challenge of ARPE-19 cells has been used as a model of smoking and age-related macular degeneration (AMD), we concluded that the curcumin analog, C3, may be a more promising drug candidate for its potential application for the prevention and treatment of eye diseases, such as AMD. - Highlights: • We examine toxicity effects of cigarette smoking component acrolein in retina cells. • We report a more efficient curcumin analog (C3) protecting cellular function. • Mitochondrial function and phase II enzyme activation are the major

  4. Systemic administration of the apocarotenoid bixin protects skin against solar UV-induced damage through activation of NRF2.

    Science.gov (United States)

    Tao, Shasha; Park, Sophia L; Rojo de la Vega, Montserrat; Zhang, Donna D; Wondrak, Georg T

    2015-12-01

    Exposure to solar ultraviolet (UV) radiation is a causative factor in skin photodamage and carcinogenesis, and an urgent need exists for improved molecular photoprotective strategies different from (or synergistic with) photon absorption. Recent studies suggest a photoprotective role of cutaneous gene expression orchestrated by the transcription factor NRF2 (nuclear factor-E2-related factor 2). Here we have explored the molecular mechanism underlying carotenoid-based systemic skin photoprotection in SKH-1 mice and provide genetic evidence that photoprotection achieved by the FDA-approved apocarotenoid and food additive bixin depends on NRF2 activation. Bixin activates NRF2 through the critical Cys-151 sensor residue in KEAP1, orchestrating a broad cytoprotective response in cultured human keratinocytes as revealed by antioxidant gene expression array analysis. Following dose optimization studies for cutaneous NRF2 activation by systemic administration of bixin, feasibility of bixin-based suppression of acute cutaneous photodamage from solar UV exposure was investigated in Nrf2(+/+) versus Nrf2(-/-) SKH-1 mice. Systemic administration of bixin suppressed skin photodamage, attenuating epidermal oxidative DNA damage and inflammatory responses in Nrf2(+/+) but not in Nrf2(-/-) mice, confirming the NRF2-dependence of bixin-based cytoprotection. Taken together, these data demonstrate feasibility of achieving NRF2-dependent cutaneous photoprotection by systemic administration of the apocarotenoid bixin, a natural food additive consumed worldwide. Copyright © 2015 Elsevier Inc. All rights reserved.

  5. Dextran loading protects macrophages from lipid peroxidation and induces a Keap1/Nrf2/ARE-dependent antioxidant response.

    Science.gov (United States)

    Chechushkov, Anton; Zaitseva, Natalia; Vorontsova, Elena; Kozhin, Petr; Menshchikova, Elena; Shkurupiy, Vyacheslav

    2016-12-01

    Linear dextrans are often proposed as drug delivery systems with milder adverse effects and lower effective drug concentrations. Linear dextrans are polysaccharides that can potentially be used to load macrophages with drugs to transport them to a site of inflammation. Recently, it was reported that dextrans may exert a protective effect vis-à-vis drug cytotoxicity and during wound healing. The aim of the current work was to evaluate molecular mechanisms of action of dextrans that may be relevant to the cytoprotective effects. We determined the effect of treatment with 40- or 70-kDa dextran on production of reactive oxygen species, lipid peroxidation, and lysosomal pH in the J774 macrophage cell line. In addition, induction of Keap1/Nrf2/ARE and autophagic activity were evaluated. Dextrans of both molecular weights protected the cells from oxidative stress induced by cumene hydroperoxide and from lysosomal stress induced by ammonium chloride. The effect was associated with induction of the Keap1/Nrf2/ARE signaling pathway. Furthermore, dextran stimulated autophagy in a dose-dependent manner but inhibited the autophagosome-lysosome fusion in a time-dependent manner. This study shows possible cytoprotective effects of dextran under oxidative stress, and these findings may be used for the development of novel (dextran-based) drug delivery approaches. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. Baicalin Ameliorates Experimental Liver Cholestasis in Mice by Modulation of Oxidative Stress, Inflammation, and NRF2 Transcription Factor

    Directory of Open Access Journals (Sweden)

    Kezhen Shen

    2017-01-01

    Full Text Available Experimental cholestatic liver fibrosis was performed by bile duct ligation (BDL in mice, and significant liver injury was observed in 15 days. Administration of baicalin in mice significantly ameliorates liver fibrosis. Experimental cholestatic liver fibrosis was associated with induced gene expression of fibrotic markers such as collagen I, fibronectin, alpha smooth muscle actin (SMA, and connective tissue growth factor (CTGF; increased inflammatory cytokines (TNFα, MIP1α, IL1β, and MIP2; increased oxidative stress and reactive oxygen species- (ROS- inducing enzymes (NOX2 and iNOS; dysfunctional mitochondrial electron chain complexes; and apoptotic/necrotic cell death markers (DNA fragmentation, caspase 3 activity, and PARP activity. Baicalin administration on alternate day reduced fibrosis along with profibrotic gene expression, proinflammatory cytokines, oxidative stress, and cell death whereas improving the function of mitochondrial electron transport chain. We observed baicalin enhanced NRF2 activation by nuclear translocation and induced its target genes HO-1 and GCLM, thus enhancing antioxidant defense. Interplay of oxidative stress/inflammation and NRF2 were key players for baicalin-mediated protection. Stellate cell activation is crucial for initiation of fibrosis. Baicalin alleviated stellate cell activation and modulated TIMP1, SMA, collagen 1, and fibronectin in vitro. This study indicates that baicalin might be beneficial for reducing inflammation and fibrosis in liver injury models.

  7. Fisetin Imparts Neuroprotection in Experimental Diabetic Neuropathy by Modulating Nrf2 and NF-κB Pathways.

    Science.gov (United States)

    Sandireddy, Reddemma; Yerra, Veera Ganesh; Komirishetti, Prashanth; Areti, Aparna; Kumar, Ashutosh

    2016-08-01

    The current study is aimed to assess the therapeutic potential of fisetin, a phytoflavonoid in streptozotocin (STZ)-induced experimental diabetic neuropathy (DN) in rats. Fisetin was administered (5 and 10 mg/kg) for 2 weeks (7th and 8th week) post STZ administration. Thermal and mechanical hyperalgesia were assessed by measuring tactile sensitivity to thermal and mechanical stimuli, respectively. Motor nerve conduction velocity (MNCV) was determined using power lab system and sciatic nerve blood flow (NBF) was determined using laser Doppler system. Nerve sections were processed for TUNEL assay and NF-κB, COX-2 immunohistochemical staining. Sciatic nerve homogenate was used for biochemical and Western blotting analysis. MNCV and sciatic NBF deficits associated with DN were ameliorated in fisetin administered rats. Fisetin treatment reduced the interleukin-6 and tumour necrosis factor-alpha in sciatic nerves of diabetic rats (p < 0.001). Protein expression studies have identified that the therapeutic benefit of fisetin might be through regulation of redox sensitive transcription factors such as nuclear erythroid 2-related factor 2 (Nrf2) and nuclear factor kappa B (NF-κB). Our study provides an evidence for the therapeutic potential of fisetin in DN through simultaneous targeting of NF-κB and Nrf2.

  8. The angiogenic related functions of bone marrow mesenchymal stem cells are promoted by CBDL rat serum via the Akt/Nrf2 pathway

    Energy Technology Data Exchange (ETDEWEB)

    Shen, Cheng-Cheng; Chen, Bing; Gu, Jian-Teng; Ning, Jiao-Lin; Chen, Lin; Zeng, Jing; Yi, Bin, E-mail: yibin1974@163.com; Lu, Kai-Zhi, E-mail: lukaizhi2010@163.com

    2016-05-15

    Hepatopulmonary syndrome (HPS) is a complication of severe liver disease. It is characterized by an arterial oxygenation defect. Recent studies have demonstrated that pulmonary angiogenesis contributes to the abnormal gas exchange found in HPS. Additionally, mesenchymal stem cells (MSCs) are considered the stable source of VEGF-producing cells and have the potential to differentiate into multiple cell types. However, it has not been determined whether bone marrow mesenchymal stem cells (BM-MSCs) are mobilized and involved in the pulmonary angiogenesis in HPS. In this study, a CFU-F assay showed that the number of peripheral blood MSCs was increased in common bile duct ligation (CBDL) rats; however, there was no significant difference found in the number of BM-MSCs. In vitro, CBDL rat serum induced the overexpression of CXCR4 and PCNA in BM-MSCs. Consistently, the directional migration as well as the proliferation ability of BM-MSCs were enhanced by CBDL rat serum, as determined by a transwell migration and MTT assays. Moreover, the secretion of VEGF by BM-MSCs increased after treatment with CBDL rat serum. We also found that the expression of phospho-Akt, phospho-ERK, and Nrf2 in BM-MSCs was significantly up-regulated by CBDL rat serum in a time dependent manner, and the blockage of the Akt/Nrf2 signalling pathway with an Akt Inhibitor or Nrf2 siRNA, instead of an ERK inhibitor, attenuated the migration, proliferation and paracrine capacity of BM-MSCs. In conclusion, these findings indicated that the number of MSCs increased in the peripheral blood of CBDL rats, and the Akt/Nrf2 pathway plays a vital role in promoting the angiogenic related functions of BM-MSCs, which could be a potent contributor to pulmonary angiogenesis in HPS. - Highlights: • Peripheral blood MSCs was increased in CBDL rats; however, the difference found for the number of BM-MSCs was not significant. • The directional migration, proliferation and ability to secrete VEGF of BM-MSCs were

  9. The role of Nrf1 and Nrf2 in the regulation of glutathione and redox dynamics in the developing zebrafish embryo

    Directory of Open Access Journals (Sweden)

    Karilyn E. Sant

    2017-10-01

    Full Text Available Redox signaling is important for embryogenesis, guiding pathways that govern processes crucial for embryo patterning, including cell polarization, proliferation, and apoptosis. Exposure to pro-oxidants during this period can be deleterious, resulting in altered physiology, teratogenesis, later-life diseases, or lethality. We previously reported that the glutathione antioxidant defense system becomes increasingly robust, including a doubling of total glutathione and dynamic shifts in the glutathione redox potential at specific stages during embryonic development in the zebrafish, Danio rerio. However, the mechanisms underlying these changes are unclear, as is the effectiveness of the glutathione system in ameliorating oxidative insults to the embryo at different stages. Here, we examine how the glutathione system responds to the model pro-oxidants tert-butylhydroperoxide and tert-butylhydroquinone at different developmental stages, and the role of Nuclear factor erythroid 2-related factor (Nrf proteins in regulating developmental glutathione redox status. Embryos became increasingly sensitive to pro-oxidants after 72 h post-fertilization (hpf, after which the duration of the recovery period for the glutathione redox potential was increased. To determine whether the doubling of glutathione or the dynamic changes in glutathione redox potential are mediated by zebrafish paralogs of Nrf transcription factors, morpholino oligonucleotides were used to knock down translation of Nrf1 and Nrf2 (nrf1a, nrf1b, nrf2a, nrf2b. Knockdown of Nrf1a or Nrf1b perturbed glutathione redox state until 72 hpf. Knockdown of Nrf2 paralogs also perturbed glutathione redox state but did not significantly affect the response of glutathione to pro-oxidants. Nrf1b morphants had decreased gene expression of glutathione synthesis enzymes, while hsp70 increased in Nrf2b morphants. This work demonstrates that despite having a more robust glutathione system, embryos become more

  10. Gene expression profiling following NRF2 and KEAP1 siRNA knockdown in human lung fibroblasts identifies CCL11/Eotaxin-1 as a novel NRF2 regulated gene

    Science.gov (United States)

    2012-01-01

    Background Oxidative Stress contributes to the pathogenesis of many diseases. The NRF2/KEAP1 axis is a key transcriptional regulator of the anti-oxidant response in cells. Nrf2 knockout mice have implicated this pathway in regulating inflammatory airway diseases such as asthma and COPD. To better understand the role the NRF2 pathway has on respiratory disease we have taken a novel approach to define NRF2 dependent gene expression in a relevant lung system. Methods Normal human lung fibroblasts were transfected with siRNA specific for NRF2 or KEAP1. Gene expression changes were measured at 30 and 48 hours using a custom Affymetrix Gene array. Changes in Eotaxin-1 gene expression and protein secretion were further measured under various inflammatory conditions with siRNAs and pharmacological tools. Results An anti-correlated gene set (inversely regulated by NRF2 and KEAP1 RNAi) that reflects specific NRF2 regulated genes was identified. Gene annotations show that NRF2-mediated oxidative stress response is the most significantly regulated pathway, followed by heme metabolism, metabolism of xenobiotics by Cytochrome P450 and O-glycan biosynthesis. Unexpectedly the key eosinophil chemokine Eotaxin-1/CCL11 was found to be up-regulated when NRF2 was inhibited and down-regulated when KEAP1 was inhibited. This transcriptional regulation leads to modulation of Eotaxin-1 secretion from human lung fibroblasts under basal and inflammatory conditions, and is specific to Eotaxin-1 as NRF2 or KEAP1 knockdown had no effect on the secretion of a set of other chemokines and cytokines. Furthermore, the known NRF2 small molecule activators CDDO and Sulphoraphane can also dose dependently inhibit Eotaxin-1 release from human lung fibroblasts. Conclusions These data uncover a previously unknown role for NRF2 in regulating Eotaxin-1 expression and further the mechanistic understanding of this pathway in modulating inflammatory lung disease. PMID:23061798

  11. The Roles of 4β-Hydroxywithanolide E from Physalis peruviana on the Nrf2-Anti-Oxidant System and the Cell Cycle in Breast Cancer Cells.

    Science.gov (United States)

    Peng, Chieh Yu; You, Bang Jau; Lee, Chia Lin; Wu, Yang Chang; Lin, Wen Hsin; Lu, Te Ling; Chang, Fei-Ching; Lee, Hong Zin

    2016-01-01

    4[Formula: see text]-Hydroxywithanolide E is an active component of the extract of Physalis peruviana that has been reported to exhibit antitumor effects. Although the involvement of reactive oxygen species (ROS) production and the ataxia-telangiectasia mutated protein (ATM)-dependent DNA damage signaling pathway in 4[Formula: see text]-hydroxywithanolide E-induced apoptosis of breast cancer MCF-7 cells was demonstrated in our previous study, the relationship between ROS production and the cellular defense system response in 4[Formula: see text]-hydroxywithanolide E-induced cell death requires further verification. The present study suggests that ROS play an important role in 4[Formula: see text]-hydroxywithanolide E-induced MCF-7 cell death in which anti-oxidants, such as glutathione or N-acetylcysteine, can resist the 4[Formula: see text]-hydroxywithanolide E-induced accumulation of ROS and cell death. Furthermore, N-acetylcysteine or glutathione can reverse the 4[Formula: see text]-hydroxywithanolide E-induced changes in the cell cycle distribution and the expression of cell cycle regulators. We found that the 4[Formula: see text]-hydroxywithanolide E-induced ROS accumulation was correlated with the upregulation of Nrf2 and Nrf2-downstream genes, such as antioxidative defense enzymes. In general, the activity of Nrf2 is regulated by the Ras signalling pathway. However, we demonstrated that Nrf2 was activated during 4[Formula: see text]-hydroxywithanolide E-induced MCF-7 cell death in spite of the 4[Formula: see text]-hydroxywithanolide E-induced inhibition of the Ras/Raf/ERK pathway. The activity and protein expression of superoxide dismutase and catalase were involved in the 4[Formula: see text]-hydroxywithanolide E-induced ROS production in MCF-7 cells. Furthermore, 4[Formula: see text]-hydroxywithanolide E was demonstrated to significantly reduce the sizes of the tumor nodules in the human breast cancer MDA-MB231 xenograft tumor model.

  12. Targeting Apoptosis Signaling in Pancreatic Cancer

    International Nuclear Information System (INIS)

    Fulda, Simone

    2011-01-01

    The ability to escape apoptosis or programmed cell death is a hallmark of human cancers, for example pancreatic cancer. This can promote tumorigenesis, since too little cell death by apoptosis disturbs tissue homeostasis. Additionally, defective apoptosis signaling is the underlying cause of failure to respond to current treatment approaches, since therapy-mediated antitumor activity requires the intactness of apoptosis signaling pathways in cancer cells. Thus, the elucidation of defects in the regulation of apoptosis in pancreatic carcinoma can result in the identification of novel targets for therapeutic interference and for exploitation for cancer drug discovery

  13. Targeting Apoptosis Signaling in Pancreatic Cancer

    Energy Technology Data Exchange (ETDEWEB)

    Fulda, Simone [Institute for Experimental Cancer Research in Pediatrics, Goethe-University Frankfurt, Komturstr. 3a, 60528 Frankfurt (Germany)

    2011-01-11

    The ability to escape apoptosis or programmed cell death is a hallmark of human cancers, for example pancreatic cancer. This can promote tumorigenesis, since too little cell death by apoptosis disturbs tissue homeostasis. Additionally, defective apoptosis signaling is the underlying cause of failure to respond to current treatment approaches, since therapy-mediated antitumor activity requires the intactness of apoptosis signaling pathways in cancer cells. Thus, the elucidation of defects in the regulation of apoptosis in pancreatic carcinoma can result in the identification of novel targets for therapeutic interference and for exploitation for cancer drug discovery.

  14. Pharmacokinetics and pharmacodynamics of orally administered acetylenic tricyclic bis(cyanoenone), a highly potent Nrf2 activator with a reversible covalent mode of action

    Energy Technology Data Exchange (ETDEWEB)

    Kostov, Rumen V.; Knatko, Elena V.; McLaughlin, Lesley A.; Henderson, Colin J. [Jacqui Wood Cancer Centre, Division of Cancer Research, Medical Research Institute, University of Dundee, Dundee, DD1 9SY, Scotland (United Kingdom); Zheng, Suqing [Department of Chemistry and Institute of Chemical Biology & Drug Discovery, Stony Brook University, Stony Brook, NY, 11794 (United States); Huang, Jeffrey T.-J. [Jacqui Wood Cancer Centre, Division of Cancer Research, Medical Research Institute, University of Dundee, Dundee, DD1 9SY, Scotland (United Kingdom); Honda, Tadashi [Department of Chemistry and Institute of Chemical Biology & Drug Discovery, Stony Brook University, Stony Brook, NY, 11794 (United States); Dinkova-Kostova, Albena T., E-mail: a.dinkovakostova@dundee.ac.uk [Jacqui Wood Cancer Centre, Division of Cancer Research, Medical Research Institute, University of Dundee, Dundee, DD1 9SY, Scotland (United Kingdom); Department of Medicine, Johns Hopkins University School of Medicine, Baltimore, MD, 21205 (United States); Department of Pharmacology and Molecular Sciences, Johns Hopkins University School of Medicine, Baltimore, MD, 21205 (United States)

    2015-09-25

    The acetylenic tricyclic bis(cyanoenone) TBE-31 is a highly potent cysteine targeting compound with a reversible covalent mode of action; its best-characterized target being Kelch-like ECH-associated protein-1 (Keap1), the cellular sensor for oxidants and electrophiles. TBE-31 reacts with cysteines of Keap1, impairing its ability to target nuclear factor-erythroid 2 p45-related factor 2 (Nrf2) for degradation. Consequently, Nrf2 accumulates and orchestrates cytoprotective gene expression. In this study we investigated the pharmacokinetic and pharmacodynamic properties of TBE-31 in C57BL/6 mice. After a single oral dose of 10 μmol/kg (∼200 nmol/animal), the concentration of TBE-31 in blood exhibited two peaks, at 22.3 nM and at 15.5 nM, 40 min and 4 h after dosing, respectively, as determined by a quantitative stable isotope dilution LC-MS/MS method. The AUC{sub 0–24h} was 195.5 h/nmol/l, the terminal elimination half-life was 10.2 h, and the k{sub el} was 0.068 h{sup −1}. To assess the pharmacodynamics of Nrf2 activation by TBE-31, we determined the enzyme activity of its prototypic target, NAD(P)H:quinone oxidoreductase 1 (NQO1) and found it elevated by 2.4- and 1.5-fold in liver and heart, respectively. Continuous feeding for 18 days with diet delivering the same daily doses of TBE-31 under conditions of concurrent treatment with the immunosuppressive agent azathioprine had a similar effect on Nrf2 activation without any indications of toxicity. Together with previous reports showing the cytoprotective effects of TBE-31 in animal models of carcinogenesis, our results demonstrate the high potency, efficacy and suitability for chronic administration of cysteine targeting reversible covalent drugs. - Highlights: • TBE-31 is a cysteine targeting compound with a reversible covalent mode of action. • After a single oral dose, the blood concentration of TBE-31 exhibits two peaks. • Oral TBE-31 is a potent activator of Nrf2-dependent enzymes in

  15. The Role of the Nrf2/ARE Antioxidant System in Preventing Cardiovascular Diseases

    Directory of Open Access Journals (Sweden)

    Robert E. Smith

    2016-11-01

    Full Text Available It is widely believed that consuming foods and beverages that have high concentrations of antioxidants can prevent cardiovascular diseases and many types of cancer. As a result, many articles have been published that give the total antioxidant capacities of foods in vitro. However, many antioxidants behave quite differently in vivo. Some of them, such as resveratrol (in red wine and epigallocatechin gallate or EGCG (in green tea can activate the nuclear erythroid-2 like factor-2 (Nrf2 transcription factor. It is a master regulator of endogenous cellular defense mechanisms. Nrf2 controls the expression of many antioxidant and detoxification genes, by binding to antioxidant response elements (AREs that are commonly found in the promoter region of antioxidant (and other genes, and that control expression of those genes. The mechanisms by which Nrf2 relieves oxidative stress and limits cardiac injury as well as the progression to heart failure are described. Also, the ability of statins to induce Nrf2 in the heart, brain, lung, and liver is mentioned. However, there is a negative side of Nrf2. When over-activated, it can cause (not prevent cardiovascular diseases and multi-drug resistance cancer.

  16. Lansoprazole halts contrast induced nephropathy through activation of Nrf2 pathway in rats.

    Science.gov (United States)

    Khaleel, Sahar A; Alzokaky, Amany A; Raslan, Nahed A; Alwakeel, Asmaa I; Abd El-Aziz, Heba G; Abd-Allah, Adel R

    2017-05-25

    Contrast-induced nephropathy (CIN) is an important cause of acute kidney injury characterized by significant mortality and morbidity. To date, there is no successful protective regimen for CIN especially in poor kidney function patients. Lansoprazole has been shown to exert antioxidant action through induction of nuclear factor-erythroid 2-related factor 2 (Nrf2) pathway. The aim of the present study is to investigate the potential of lansoprazole to activate Nrf2 pathway in the kidney and consequently to protect against oxidative stress induced by iodinated contrast media. Lansoprazole, at a dose of 100 mg/kg, showed a significant induction of Nrf2 mRNA after 3 h. Administration of contrast media induced significant increase in serum creatinine and blood urea nitrogen, histological deterioration, and reduction in total antioxidant capacity. Moreover, it instigated the defensive Nrf2 gene expression and immunoreactivity. In addition, there were overexpression of HO-1, caspase 3, p53 and IL6 genes and downregulation of Bcl2 gene. Pre-treatment with lansoprazole (100 mg/kg) ameliorated the nephrotoxicity parameters and oxidative stress, improved histological lesions, and hijacked apoptotic and inflammatory markers that were provoked by contrast media. In conclusion, lansoprazole attenuates experimental CIN which might be due to activation of Nrf2 antioxidant defence pathway. These findings highlight the potential benefit of incorporating lansoprazole in the protective regimen against CIN especially for susceptible patients. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Sulforaphane and Other Nutrigenomic Nrf2 Activators: Can the Clinician's Expectation Be Matched by the Reality?

    Science.gov (United States)

    Houghton, Christine A.; Fassett, Robert G.; Coombes, Jeff S.

    2016-01-01

    The recognition that food-derived nonnutrient molecules can modulate gene expression to influence intracellular molecular mechanisms has seen the emergence of the fields of nutrigenomics and nutrigenetics. The aim of this review is to describe the properties of nutrigenomic activators of transcription factor Nrf2 (nuclear factor erythroid 2-related factor 2), comparing the potential for sulforaphane and other phytochemicals to demonstrate clinical efficacy as complementary medicines. Broccoli-derived sulforaphane emerges as a phytochemical with this capability, with oral doses capable of favourably modifying genes associated with chemoprevention. Compared with widely used phytochemical-based supplements like curcumin, silymarin, and resveratrol, sulforaphane more potently activates Nrf2 to induce the expression of a battery of cytoprotective genes. By virtue of its lipophilic nature and low molecular weight, sulforaphane displays significantly higher bioavailability than the polyphenol-based dietary supplements that also activate Nrf2. Nrf2 activation induces cytoprotective genes such as those playing key roles in cellular defense mechanisms including redox status and detoxification. Both its high bioavailability and significant Nrf2 inducer capacity contribute to the therapeutic potential of sulforaphane-yielding supplements. PMID:26881038

  18. Targeting Apoptosis Signaling Pathways for Anticancer Therapy

    Energy Technology Data Exchange (ETDEWEB)

    Fulda, Simone, E-mail: simone.fulda@kgu.de [Institute for Experimental Cancer Research in Pediatrics, Goethe-University, Frankfurt (Germany)

    2011-08-29

    Treatment approaches for cancer, for example chemotherapy, radiotherapy, or immunotherapy, primarily act by inducing cell death in cancer cells. Consequently, the inability to trigger cell death pathways or alternatively, evasion of cancer cells to the induction of cell death pathways can result in resistance of cancers to current treatment protocols. Therefore, in order to overcome treatment resistance a better understanding of the underlying mechanisms that regulate cell death and survival pathways in cancers and in response to cancer therapy is necessary to develop molecular-targeted therapies. This strategy should lead to more effective and individualized treatment strategies that selectively target deregulated signaling pathways in a tumor type- and patient-specific manner.

  19. Targeting Apoptosis Signaling Pathways for Anticancer Therapy

    International Nuclear Information System (INIS)

    Fulda, Simone

    2011-01-01

    Treatment approaches for cancer, for example chemotherapy, radiotherapy, or immunotherapy, primarily act by inducing cell death in cancer cells. Consequently, the inability to trigger cell death pathways or alternatively, evasion of cancer cells to the induction of cell death pathways can result in resistance of cancers to current treatment protocols. Therefore, in order to overcome treatment resistance a better understanding of the underlying mechanisms that regulate cell death and survival pathways in cancers and in response to cancer therapy is necessary to develop molecular-targeted therapies. This strategy should lead to more effective and individualized treatment strategies that selectively target deregulated signaling pathways in a tumor type- and patient-specific manner.

  20. Generation of a Nrf2 homozygous knockout human embryonic stem cell line using CRISPR/Cas9

    Directory of Open Access Journals (Sweden)

    So-Jung Kim

    2017-03-01

    Full Text Available Nuclear factor erythroid 2-related factor 2 (NFE2L2 or Nrf2 is a well-known transcription factor that regulates the expression of a large number of anti-oxidant genes in mammalian cells (J.H. Kim et al., 2014. Here, we generated a homozygous Nrf2 knockout human embryonic stem cell (hESC line, H9Nrf2KO-A13, using the CRISPR/Cas9 genome editing method. The Nrf2 homozygous knockout H9 cell line maintains pluripotency, differentiation potential into three germ layers, and a normal karyotype.