WorldWideScience

Sample records for targeted gene silencing

  1. Analysis of the siRNA-Mediated Gene Silencing Process Targeting Three Homologous Genes Controlling Soybean Seed Oil Quality.

    Science.gov (United States)

    Lu, Sha; Yin, Xiaoyan; Spollen, William; Zhang, Ning; Xu, Dong; Schoelz, James; Bilyeu, Kristin; Zhang, Zhanyuan J

    2015-01-01

    In the past decade, RNA silencing has gained significant attention because of its success in genomic scale research and also in the genetic improvement of crop plants. However, little is known about the molecular basis of siRNA processing in association with its target transcript. To reveal this process for improving hpRNA-mediated gene silencing in crop plants, the soybean GmFAD3 gene family was chosen as a test model. We analyzed RNAi mutant soybean lines in which three members of the GmFAD3 gene family were silenced. The silencing levels of FAD3A, FAD3B and FAD3C were correlated with the degrees of sequence homology between the inverted repeat of hpRNA and the GmFAD3 transcripts in the RNAi lines. Strikingly, transgenes in two of the three RNAi lines were heavily methylated, leading to a dramatic reduction of hpRNA-derived siRNAs. Small RNAs corresponding to the loop portion of the hairpin transcript were detected while much lower levels of siRNAs were found outside of the target region. siRNAs generated from the 318-bp inverted repeat were found to be diced much more frequently at stem sequences close to the loop and associated with the inferred cleavage sites on the target transcripts, manifesting "hot spots". The top candidate hpRNA-derived siRNA share certain sequence features with mature miRNA. This is the first comprehensive and detailed study revealing the siRNA-mediated gene silencing mechanism in crop plants using gene family GmFAD3 as a test model.

  2. Analysis of the siRNA-Mediated Gene Silencing Process Targeting Three Homologous Genes Controlling Soybean Seed Oil Quality.

    Directory of Open Access Journals (Sweden)

    Sha Lu

    Full Text Available In the past decade, RNA silencing has gained significant attention because of its success in genomic scale research and also in the genetic improvement of crop plants. However, little is known about the molecular basis of siRNA processing in association with its target transcript. To reveal this process for improving hpRNA-mediated gene silencing in crop plants, the soybean GmFAD3 gene family was chosen as a test model. We analyzed RNAi mutant soybean lines in which three members of the GmFAD3 gene family were silenced. The silencing levels of FAD3A, FAD3B and FAD3C were correlated with the degrees of sequence homology between the inverted repeat of hpRNA and the GmFAD3 transcripts in the RNAi lines. Strikingly, transgenes in two of the three RNAi lines were heavily methylated, leading to a dramatic reduction of hpRNA-derived siRNAs. Small RNAs corresponding to the loop portion of the hairpin transcript were detected while much lower levels of siRNAs were found outside of the target region. siRNAs generated from the 318-bp inverted repeat were found to be diced much more frequently at stem sequences close to the loop and associated with the inferred cleavage sites on the target transcripts, manifesting "hot spots". The top candidate hpRNA-derived siRNA share certain sequence features with mature miRNA. This is the first comprehensive and detailed study revealing the siRNA-mediated gene silencing mechanism in crop plants using gene family GmFAD3 as a test model.

  3. Thermodynamic control of small RNA-mediated gene silencing

    Directory of Open Access Journals (Sweden)

    Kumiko eUi-Tei

    2012-06-01

    Full Text Available Small interfering RNAs (siRNAs and microRNAs (miRNAs are crucial regulators of posttranscriptional gene silencing, which is referred to as RNA interference (RNAi or RNA silencing. In RNAi, siRNA loaded onto the RNA-induced silencing complex (RISC downregulates target gene expression by cleaving mRNA whose sequence is perfectly complementary to the siRNA guide strand. We previously showed that highly functional siRNAs possessed the following characteristics: A or U residues at nucleotide position 1 measured from the 5’ terminal, four to seven A/Us in positions 1–7, and G or C residues at position 19. This finding indicated that an RNA strand with a thermodynamically unstable 5’ terminal is easily retained in the RISC and functions as a guide strand. In addition, it is clear that unintended genes with complementarities only in the seed region (positions 2–8 are also downregulated by off-target effects. siRNA efficiency is mainly determined by the Watson-Crick base-pairing stability formed between the siRNA seed region and target mRNA. siRNAs with a low seed-target duplex melting temperature (Tm have little or no seed-dependent off-target activity. Thus, important parts of the RNA silencing machinery may be regulated by nucleotide base-pairing thermodynamic stability. A mechanistic understanding of thermodynamic control may enable an efficient target gene-specific RNAi for functional genomics and safe therapeutic applications.

  4. Inhibition of human esophageal squamous cell carcinomas by targeted silencing of tumor enhancer genes: an overview

    International Nuclear Information System (INIS)

    Islamian, Jalil Pirayesh; Mohammadi, Mohsen; Baradaran, Behzad

    2014-01-01

    Esophageal cancer has been reported as the ninth most common malignancy and ranks as the sixth most frequent cause of death worldwide. Esophageal cancer treatment involves surgery, chemotherapy, radiation therapy, or combination therapy. Novel strategies are needed to boost the oncologic outcome. Recent advances in the molecular biology of esophageal cancer have documented the role of genetic alterations in tumorigenesis. Oncogenes serve a pivotal function in tumorigenesis. Targeted therapies are directed at the unique molecular signature of cancer cells for enhanced efficacy with low toxicity. RNA interference (RNAi) technology is a powerful tool for silencing endogenous or exogenous genes in mammalian cells. Related results have shown that targeting oncogenes with siRNAs, specifically the mRNA, effectively reduces tumor cell proliferation and induces apoptotic cell death. This article will briefly review studies on silencing tumor enhancer genes related to the induction of esophageal cancer

  5. An intronic microRNA silences genes that are functionally antagonistic to its host gene.

    Science.gov (United States)

    Barik, Sailen

    2008-09-01

    MicroRNAs (miRNAs) are short noncoding RNAs that down-regulate gene expression by silencing specific target mRNAs. While many miRNAs are transcribed from their own genes, nearly half map within introns of 'host' genes, the significance of which remains unclear. We report that transcriptional activation of apoptosis-associated tyrosine kinase (AATK), essential for neuronal differentiation, also generates miR-338 from an AATK gene intron that silences a family of mRNAs whose protein products are negative regulators of neuronal differentiation. We conclude that an intronic miRNA, transcribed together with the host gene mRNA, may serve the interest of its host gene by silencing a cohort of genes that are functionally antagonistic to the host gene itself.

  6. Simultaneous gene silencing of Bcl-2, XIAP and Survivin re-sensitizes pancreatic cancer cells towards apoptosis

    International Nuclear Information System (INIS)

    Rückert, Felix; Samm, Nicole; Lehner, Anne-Kathrin; Saeger, Hans-Detlev; Grützmann, Robert; Pilarsky, Christian

    2010-01-01

    Pancreatic ductal adenocarcinoma shows a distinct apoptosis resistance, which contributes significantly to the aggressive nature of this tumor and constrains the effectiveness of new therapeutic strategies. Apoptosis resistance is determined by the net balance of the cells pro-and anti-apoptotic 'control mechanisms'. Numerous dysregulated anti-apoptotic genes have been identified in pancreatic cancer and seem to contribute to the high anti-apoptotic buffering capacity. We aimed to compare the benefit of simultaneous gene silencing (SGS) of several candidate genes with conventional gene silencing of single genes. From literature search we identified the anti-apoptotic genes XIAP, Survivin and Bcl-2 as commonly upregulated in pancreatic cancer. We performed SGS and silencing of single candidate genes using siRNA molecules in two pancreatic cancer cell lines. Effectiveness of SGS was assessed by qRT-PCR and western blotting. Apoptosis induction was measured by flow cytometry and caspase activation. Simultaneous gene silencing reduced expression of the three target genes effectively. Compared to silencing of a single target or control, SGS of these genes resulted in a significant higher induction of apoptosis in pancreatic cancer cells. In the present study we performed a subliminal silencing of different anti-apoptotic target genes simultaneously. Compared to silencing of single target genes, SGS had a significant higher impact on apoptosis induction in pancreatic cancer cells. Thereby, we give further evidence for the concept of an anti-apoptotic buffering capacity of pancreatic cancer cells

  7. Down-Regulation of Gene Expression by RNA-Induced Gene Silencing

    Science.gov (United States)

    Travella, Silvia; Keller, Beat

    Down-regulation of endogenous genes via post-transcriptional gene silencing (PTGS) is a key to the characterization of gene function in plants. Many RNA-based silencing mechanisms such as post-transcriptional gene silencing, co-suppression, quelling, and RNA interference (RNAi) have been discovered among species of different kingdoms (plants, fungi, and animals). One of the most interesting discoveries was RNAi, a sequence-specific gene-silencing mechanism initiated by the introduction of double-stranded RNA (dsRNA), homologous in sequence to the silenced gene, which triggers degradation of mRNA. Infection of plants with modified viruses can also induce RNA silencing and is referred to as virus-induced gene silencing (VIGS). In contrast to insertional mutagenesis, these emerging new reverse genetic approaches represent a powerful tool for exploring gene function and for manipulating gene expression experimentally in cereal species such as barley and wheat. We examined how RNAi and VIGS have been used to assess gene function in barley and wheat, including molecular mechanisms involved in the process and available methodological elements, such as vectors, inoculation procedures, and analysis of silenced phenotypes.

  8. Simultaneous Silencing of Xylanase Genes in Botrytis cinerea

    Directory of Open Access Journals (Sweden)

    Néstor García

    2017-12-01

    Full Text Available The endo-β-1,4-xylanase BcXyn11A is one of several plant cell-wall degrading enzymes that the phytopathogenic fungus Botrytis cinerea secretes during interaction with its hosts. In addition to its enzymatic activity, this protein also acts as an elicitor of the defense response in plants and has been identified as a virulence factor. In the present work, other four endoxylanase coding genes (Bcxyn11B, Bcxyn11C, Bcxyn10A, and Bcxyn10B were identified in the B. cinerea genome and the expression of all five genes was analyzed by Q-RT- PCR in vitro and in planta. A cross-regulation between xylanase genes was identified analyzing their expression pattern in the ΔBcxyn11A mutant strain and a putative BcXyn11A-dependt induction of Bcxyn10B gene was found. In addition, multiple knockdown strains were obtained for the five endoxylanase genes by transformation of B. cinerea with a chimeric DNA construct composed of 50-nt sequences from the target genes. The silencing of each xylanase gene was analyzed in axenic cultures and during infection and the results showed that the efficiency of the multiple silencing depends on the growth conditions and on the cross-regulation between them. Although the simultaneous silencing of the five genes was observed by Q-RT-PCR when the silenced strains were grown on medium supplemented with tomato extract, the endoxylanase activity measured in the supernatants was reduced only by 40%. Unexpectedly, the silenced strains overexpressed the Bcxyn11A and Bcxyn11C genes during the infection of tomato leaves, making difficult the analysis of the role of the endo-β-1,4-xylanases in the virulence of the fungus.

  9. Gene silencing of HPV16 E6/E7 induced by promoter-targeting siRNA in SiHa cells

    OpenAIRE

    Hong, D; Lu, W; Ye, F; Hu, Y; Xie, X

    2009-01-01

    Background: Recently, transcriptional gene silencing induced by small interfering RNA (siRNA) was found in mammalian and human cells. However, previous studies focused on endogenous genes. Methods: In this study, we designed siRNA targeting the promoter of human papillomavirus 16 E6/E7 and transfected it into the cervical cancer cell line, SiHa. E6 and E7 mRNA and protein expression were detected in cells treated by promoter-targeting siRNA. Futhermore, cellular growth, proliferation, apoptos...

  10. Host-Induced Gene Silencing of Rice Blast Fungus Magnaporthe oryzae Pathogenicity Genes Mediated by the Brome Mosaic Virus.

    Science.gov (United States)

    Zhu, Lin; Zhu, Jian; Liu, Zhixue; Wang, Zhengyi; Zhou, Cheng; Wang, Hong

    2017-09-26

    Magnaporthe oryzae is a devastating plant pathogen, which has a detrimental impact on rice production worldwide. Despite its agronomical importance, some newly-emerging pathotypes often overcome race-specific disease resistance rapidly. It is thus desirable to develop a novel strategy for the long-lasting resistance of rice plants to ever-changing fungal pathogens. Brome mosaic virus (BMV)-induced RNA interference (RNAi) has emerged as a useful tool to study host-resistance genes for rice blast protection. Planta-generated silencing of targeted genes inside biotrophic pathogens can be achieved by expression of M. oryzae -derived gene fragments in the BMV-mediated gene silencing system, a technique termed host-induced gene silencing (HIGS). In this study, the effectiveness of BMV-mediated HIGS in M. oryzae was examined by targeting three predicted pathogenicity genes, MoABC1, MoMAC1 and MoPMK1 . Systemic generation of fungal gene-specific small interfering RNA (siRNA) molecules induced by inoculation of BMV viral vectors inhibited disease development and reduced the transcription of targeted fungal genes after subsequent M. oryzae inoculation. Combined introduction of fungal gene sequences in sense and antisense orientation mediated by the BMV silencing vectors significantly enhanced the efficiency of this host-generated trans-specific RNAi, implying that these fungal genes played crucial roles in pathogenicity. Collectively, our results indicated that BMV-HIGS system was a great strategy for protecting host plants against the invasion of pathogenic fungi.

  11. Phenotyping of VIGS-mediated gene silencing in rice using a vector derived from a DNA virus.

    Science.gov (United States)

    Kant, Ravi; Dasgupta, Indranil

    2017-07-01

    Target genes in rice can be optimally silenced if inserted in antisense or hairpin orientation in the RTBV-derived VIGS vector and plants grown at 28 °C and 80% humidity after inoculation. Virus induced gene silencing (VIGS) is a method used to transiently silence genes in dicot as well as monocot plants. For the important monocot species rice, the Rice tungro bacilliform virus (RTBV)-derived VIGS system (RTBV-VIGS), which uses agroinoculation to initiate silencing, has not been standardized for optimal use. Here, using RTBV-VIGS, three sets of conditions were tested to achieve optimal silencing of the rice marker gene phytoene desaturase (pds). The effect of orientation of the insert in the RTBV-VIGS plasmid (sense, antisense and hairpin) on the silencing of the target gene was then evaluated using rice magnesium chelatase subunit H (chlH). Finally, the rice Xa21 gene, conferring resistance against bacterial leaf blight disease (BLB) was silenced using RTBV-VIGS system. In each case, real-time PCR-based assessment indicated approximately 40-80% fall in the accumulation levels of the transcripts of pds, chlH and Xa21. In the case of pds, the appearance of white streaks in the emerging leaves, and for chlH, chlorophyll levels and F v /F m ratio were assessed as phenotypes for silencing. For Xa21, the resistance levels to BLB were assessed by measuring the lesion length and the percent diseased areas of leaves, following challenge inoculation with Xanthomonas oryzae. In each case, the RTBV-MVIGS system gave rise to a discernible phenotype indicating the silencing of the respective target gene using condition III (temperature 28 °C, humidity 80% and 1 mM MES and 20 µM acetosyringone in secondary agrobacterium culture), which revealed the robustness of this gene silencing system for rice.

  12. Technical advances in trigger-induced RNA interference gene silencing in the parasite Entamoeba histolytica.

    Science.gov (United States)

    Khalil, Mohamed I; Foda, Bardees M; Suresh, Susmitha; Singh, Upinder

    2016-03-01

    Entamoeba histolytica has a robust endogenous RNA interference (RNAi) pathway. There are abundant 27 nucleotide (nt) anti-sense small RNAs (AS sRNAs) that target genes for silencing and the genome encodes many genes involved in the RNAi pathway such as Argonaute proteins. Importantly, an E. histolytica gene with numerous AS sRNAs can function as a "trigger" to induce silencing of a gene that is fused to the trigger. Thus, the amebic RNAi pathway regulates gene expression relevant to amebic biology and has additionally been harnessed as a tool for genetic manipulation. In this study we have further improved the trigger-induced gene silencing method. We demonstrate that rather than using the full-length gene, a short portion of the coding region fused to a trigger is sufficient to induce silencing; the first 537 bp of the E. histolytica rhomboid gene (EhROM1) fused in-frame to the trigger was sufficient to silence EhROM1. We also demonstrated that the trigger method could silence two amebic genes concomitantly; fusion of the coding regions of EhROM1 and transcription factor, EhMyb, in-frame to a trigger gene resulted in both genes being silenced. Alternatively, two genes can be silenced sequentially: EhROM1-silenced parasites with no drug selection plasmid were transfected with trigger-EhMyb, resulting in parasites with both EhROM1 and EhMyb silenced. With all approaches tested, the trigger-mediated silencing was substantive and silencing was maintained despite loss of the G418 selectable marker. All gene silencing was associated with generation of AS sRNAs to the silenced gene. We tested the reversibility of the trigger system using inhibitors of histone modifications but found that the silencing was highly stable. This work represents a technical advance in the trigger gene silencing method in E. histolytica. Approaches that readily silence multiple genes add significantly to the genetic toolkit available to the ameba research community. Copyright © 2016

  13. A systemic gene silencing method suitable for high throughput, reverse genetic analyses of gene function in fern gametophytes

    Directory of Open Access Journals (Sweden)

    Tanurdzic Milos

    2004-04-01

    Full Text Available Abstract Background Ceratopteris richardii is a useful experimental system for studying gametophyte development and sexual reproduction in plants. However, few tools for cloning mutant genes or disrupting gene function exist for this species. The feasibility of systemic gene silencing as a reverse genetics tool was examined in this study. Results Several DNA constructs targeting a Ceratopteris protoporphyrin IX magnesium chelatase (CrChlI gene that is required for chlorophyll biosynthesis were each introduced into young gametophytes by biolistic delivery. Their transient expression in individual cells resulted in a colorless cell phenotype that affected most cells of the mature gametophyte, including the meristem and gametangia. The colorless phenotype was associated with a 7-fold decrease in the abundance of the endogenous transcript. While a construct designed to promote the transient expression of a CrChlI double stranded, potentially hairpin-forming RNA was found to be the most efficient in systemically silencing the endogenous gene, a plasmid containing the CrChlI cDNA insert alone was sufficient to induce silencing. Bombarded, colorless hermaphroditic gametophytes produced colorless embryos following self-fertilization, demonstrating that the silencing signal could be transmitted through gametogenesis and fertilization. Bombardment of young gametophytes with constructs targeting the Ceratopteris filamentous temperature sensitive (CrFtsZ and uroporphyrin dehydrogenase (CrUrod genes also produced the expected mutant phenotypes. Conclusion A method that induces the systemic silencing of target genes in the Ceratopteris gametophyte is described. It provides a simple, inexpensive and rapid means to test the functions of genes involved in gametophyte development, especially those involved in cellular processes common to all plants.

  14. Targeted transfection increases siRNA uptake and gene silencing of primary endothelial cells in vitro--a quantitative study.

    Science.gov (United States)

    Asgeirsdóttir, Sigridur A; Talman, Eduard G; de Graaf, Inge A; Kamps, Jan A A M; Satchell, Simon C; Mathieson, Peter W; Ruiters, Marcel H J; Molema, Grietje

    2010-01-25

    Applications of small-interfering RNA (siRNA) call for specific and efficient delivery of siRNA into particular cell types. We developed a novel, non-viral targeting system to deliver siRNA specifically into inflammation-activated endothelial cells. This was achieved by conjugating the cationic amphiphilic lipid SAINT to antibodies recognizing the inflammatory cell adhesion molecule E-selectin. These anti-E-selectin-SAINT lipoplexes (SAINTarg) maintained antigen recognition capacity of the parental antibody in vitro, and ex vivo in human kidney tissue slices subjected to inflammatory conditions. Regular SAINT mediated transfection resulted in efficient gene silencing in human microvascular endothelial cells (HMEC-1) and conditionally immortalized glomerular endothelial cells (ciGEnC). However, primary human umbilical vein endothelial cells (HUVEC) transfected poorly, a phenomenon that we could quantitatively correlate with a cell-type specific capacity to facilitate siRNA uptake. Importantly, SAINTarg increased siRNA uptake and transfection specificity for activated endothelial cells. Transfection with SAINTarg delivered significantly more siRNA into activated HUVEC, compared to transfection with non-targeted SAINT. The enhanced uptake of siRNA was corroborated by improved silencing of both gene- and protein expression of VE-cadherin in activated HUVEC, indicating that SAINTarg delivered functionally active siRNA into endothelial cells. The obtained results demonstrate a successful design of a small nucleotide carrier system with improved and specific siRNA delivery into otherwise difficult-to-transfect primary endothelial cells, which in addition reduced considerably the amount of siRNA needed for gene silencing. Copyright 2009 Elsevier B.V. All rights reserved.

  15. Systemic RNAi-mediated Gene Silencing in Nonhuman Primate and Rodent Myeloid Cells

    Directory of Open Access Journals (Sweden)

    Tatiana I Novobrantseva

    2012-01-01

    Full Text Available Leukocytes are central regulators of inflammation and the target cells of therapies for key diseases, including autoimmune, cardiovascular, and malignant disorders. Efficient in vivo delivery of small interfering RNA (siRNA to immune cells could thus enable novel treatment strategies with broad applicability. In this report, we develop systemic delivery methods of siRNA encapsulated in lipid nanoparticles (LNP for durable and potent in vivo RNA interference (RNAi-mediated silencing in myeloid cells. This work provides the first demonstration of siRNA-mediated silencing in myeloid cell types of nonhuman primates (NHPs and establishes the feasibility of targeting multiple gene targets in rodent myeloid cells. The therapeutic potential of these formulations was demonstrated using siRNA targeting tumor necrosis factor-α (TNFα which induced substantial attenuation of disease progression comparable to a potent antibody treatment in a mouse model of rheumatoid arthritis (RA. In summary, we demonstrate a broadly applicable and therapeutically relevant platform for silencing disease genes in immune cells.

  16. Antisense gene silencing

    DEFF Research Database (Denmark)

    Nielsen, Troels T; Nielsen, Jørgen E

    2013-01-01

    Since the first reports that double-stranded RNAs can efficiently silence gene expression in C. elegans, the technology of RNA interference (RNAi) has been intensively exploited as an experimental tool to study gene function. With the subsequent discovery that RNAi could also be applied...

  17. Genome-wide methylation analysis identifies genes silenced in non-seminoma cell lines.

    Science.gov (United States)

    Noor, Dzul Azri Mohamed; Jeyapalan, Jennie N; Alhazmi, Safiah; Carr, Matthew; Squibb, Benjamin; Wallace, Claire; Tan, Christopher; Cusack, Martin; Hughes, Jaime; Reader, Tom; Shipley, Janet; Sheer, Denise; Scotting, Paul J

    2016-01-01

    Silencing of genes by DNA methylation is a common phenomenon in many types of cancer. However, the genome-wide effect of DNA methylation on gene expression has been analysed in relatively few cancers. Germ cell tumours (GCTs) are a complex group of malignancies. They are unique in developing from a pluripotent progenitor cell. Previous analyses have suggested that non-seminomas exhibit much higher levels of DNA methylation than seminomas. The genomic targets that are methylated, the extent to which this results in gene silencing and the identity of the silenced genes most likely to play a role in the tumours' biology have not yet been established. In this study, genome-wide methylation and expression analysis of GCT cell lines was combined with gene expression data from primary tumours to address this question. Genome methylation was analysed using the Illumina infinium HumanMethylome450 bead chip system and gene expression was analysed using Affymetrix GeneChip Human Genome U133 Plus 2.0 arrays. Regulation by methylation was confirmed by demethylation using 5-aza-2-deoxycytidine and reverse transcription-quantitative PCR. Large differences in the level of methylation of the CpG islands of individual genes between tumour cell lines correlated well with differential gene expression. Treatment of non-seminoma cells with 5-aza-2-deoxycytidine verified that methylation of all genes tested played a role in their silencing in yolk sac tumour cells and many of these genes were also differentially expressed in primary tumours. Genes silenced by methylation in the various GCT cell lines were identified. Several pluripotency-associated genes were identified as a major functional group of silenced genes.

  18. Growth inhibition of head and neck squamous cell carcinoma cells by sgRNA targeting the cyclin D1 mRNA based on TRUE gene silencing.

    Directory of Open Access Journals (Sweden)

    Satoshi Iizuka

    Full Text Available Head and neck squamous cell carcinoma (HNSCC exhibits increased expression of cyclin D1 (CCND1. Previous studies have shown a correlation between poor prognosis of HNSCC and cyclin D1 overexpression. tRNase ZL-utilizing efficacious gene silencing (TRUE gene silencing is one of the RNA-mediated gene expression control technologies that have therapeutic potential. This technology is based on a unique enzymatic property of mammalian tRNase ZL, which is that it can cleave any target RNA at any desired site by recognizing a pre-tRNA-like complex formed between the target RNA and an artificial small guide RNA (sgRNA. In this study, we designed several sgRNAs targeting human cyclin D1 mRNA to examine growth inhibition of HNSCC cells. Transfection of certain sgRNAs decreased levels of cyclin D1 mRNA and protein in HSC-2 and HSC-3 cells, and also inhibited their proliferation. The combination of these sgRNAs and cisplatin showed more than additive inhibition of cancer cell growth. These findings demonstrate that TRUE gene silencing of cyclin D1 leads to inhibition of the growth of HNSCC cells and suggest that these sgRNAs alone or combined with cisplatin may be a useful new therapy for HNSCCs.

  19. An Algorithm for Generating Small RNAs Capable of Epigenetically Modulating Transcriptional Gene Silencing and Activation in Human Cells

    Directory of Open Access Journals (Sweden)

    Amanda Ackley

    2013-01-01

    Full Text Available Small noncoding antisense RNAs (sasRNAs guide epigenetic silencing complexes to target loci in human cells and modulate gene transcription. When these targeted loci are situated within a promoter, long-term, stable epigenetic silencing of transcription can occur. Recent studies suggest that there exists an endogenous form of such epigenetic regulation in human cells involving long noncoding RNAs. In this article, we present and validate an algorithm for the generation of highly effective sasRNAs that can mimic the endogenous noncoding RNAs involved in the epigenetic regulation of gene expression. We validate this algorithm by targeting several oncogenes including AKT-1, c-MYC, K-RAS, and H-RAS. We also target a long antisense RNA that mediates the epigenetic repression of the tumor suppressor gene DUSP6, silenced in pancreatic cancer. An algorithm that can efficiently design small noncoding RNAs for the epigenetic transcriptional silencing or activation of specific genes has potential therapeutic and experimental applications.

  20. Strategy of gene silencing in cassava for validation of resistance genes

    International Nuclear Information System (INIS)

    Cortes, Simon; Lopez, Camilo

    2010-01-01

    Cassava (Manihot esculenta) is a major source of food for more than 1000 million people in the world and constitutes an important staple crop. Cassava bacterial blight, caused by the gram negative bacterium Xanthomonas axonopodis pv. manihotis, is one of the most important constraints for this crop. A candidate resistance gene against cassava bacterial blight, named RXam1, has been identified previously. In this work, we employed the gene silencing approach using the African cassava mosaic virus (ACMV) to validate the function of the RXam1 gene. We used as positive control the su gen, which produce photo blanching in leaves when is silenced. Plants from the SG10735 variety were bombardment with the ACMV-A-SU+ACMV-B y ACMV-A-RXam1+ACMV-B constructions. The silencing efficiency employing the su gene was low, only one of seven plants showed photo blanching. In the putative silenced plants for the RXam1 gene, no presence of siRNAs corresponding to RXam1 was observed; although a low diminution of the RXam1 gene expression was obtained. The growth curves for the Xam strain CIO136 in cassava plants inoculated showing a little but no significance difference in the susceptibility in the silenced plants compared to not silenced

  1. Locus-specific ribosomal RNA gene silencing in nucleolar dominance.

    Directory of Open Access Journals (Sweden)

    Michelle S Lewis

    2007-08-01

    Full Text Available The silencing of one parental set of rRNA genes in a genetic hybrid is an epigenetic phenomenon known as nucleolar dominance. We showed previously that silencing is restricted to the nucleolus organizer regions (NORs, the loci where rRNA genes are tandemly arrayed, and does not spread to or from neighboring protein-coding genes. One hypothesis is that nucleolar dominance is the net result of hundreds of silencing events acting one rRNA gene at a time. A prediction of this hypothesis is that rRNA gene silencing should occur independent of chromosomal location. An alternative hypothesis is that the regulatory unit in nucleolar dominance is the NOR, rather than each individual rRNA gene, in which case NOR localization may be essential for rRNA gene silencing. To test these alternative hypotheses, we examined the fates of rRNA transgenes integrated at ectopic locations. The transgenes were accurately transcribed in all independent transgenic Arabidopsis thaliana lines tested, indicating that NOR localization is not required for rRNA gene expression. Upon crossing the transgenic A. thaliana lines as ovule parents with A. lyrata to form F1 hybrids, a new system for the study of nucleolar dominance, the endogenous rRNA genes located within the A. thaliana NORs are silenced. However, rRNA transgenes escaped silencing in multiple independent hybrids. Collectively, our data suggest that rRNA gene activation can occur in a gene-autonomous fashion, independent of chromosomal location, whereas rRNA gene silencing in nucleolar dominance is locus-dependent.

  2. Functional analyses of cellulose synthase genes in flax (Linum usitatissimum) by virus-induced gene silencing.

    Science.gov (United States)

    Chantreau, Maxime; Chabbert, Brigitte; Billiard, Sylvain; Hawkins, Simon; Neutelings, Godfrey

    2015-12-01

    Flax (Linum usitatissimum) bast fibres are located in the stem cortex where they play an important role in mechanical support. They contain high amounts of cellulose and so are used for linen textiles and in the composite industry. In this study, we screened the annotated flax genome and identified 14 distinct cellulose synthase (CESA) genes using orthologous sequences previously identified. Transcriptomics of 'primary cell wall' and 'secondary cell wall' flax CESA genes showed that some were preferentially expressed in different organs and stem tissues providing clues as to their biological role(s) in planta. The development for the first time in flax of a virus-induced gene silencing (VIGS) approach was used to functionally evaluate the biological role of different CESA genes in stem tissues. Quantification of transcript accumulation showed that in many cases, silencing not only affected targeted CESA clades, but also had an impact on other CESA genes. Whatever the targeted clade, inactivation by VIGS affected plant growth. In contrast, only clade 1- and clade 6-targeted plants showed modifications in outer-stem tissue organization and secondary cell wall formation. In these plants, bast fibre number and structure were severely impacted, suggesting that the targeted genes may play an important role in the establishment of the fibre cell wall. Our results provide new fundamental information about cellulose biosynthesis in flax that should facilitate future plant improvement/engineering. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  3. Antisense targeting of 3' end elements involved in DUX4 mRNA processing is an efficient therapeutic strategy for facioscapulohumeral dystrophy: a new gene-silencing approach.

    Science.gov (United States)

    Marsollier, Anne-Charlotte; Ciszewski, Lukasz; Mariot, Virginie; Popplewell, Linda; Voit, Thomas; Dickson, George; Dumonceaux, Julie

    2016-04-15

    Defects in mRNA 3'end formation have been described to alter transcription termination, transport of the mRNA from the nucleus to the cytoplasm, stability of the mRNA and translation efficiency. Therefore, inhibition of polyadenylation may lead to gene silencing. Here, we choose facioscapulohumeral dystrophy (FSHD) as a model to determine whether or not targeting key 3' end elements involved in mRNA processing using antisense oligonucleotide drugs can be used as a strategy for gene silencing within a potentially therapeutic context. FSHD is a gain-of-function disease characterized by the aberrant expression of the Double homeobox 4 (DUX4) transcription factor leading to altered pathogenic deregulation of multiple genes in muscles. Here, we demonstrate that targeting either the mRNA polyadenylation signal and/or cleavage site is an efficient strategy to down-regulate DUX4 expression and to decrease the abnormally high-pathological expression of genes downstream of DUX4. We conclude that targeting key functional 3' end elements involved in pre-mRNA to mRNA maturation with antisense drugs can lead to efficient gene silencing and is thus a potentially effective therapeutic strategy for at least FSHD. Moreover, polyadenylation is a crucial step in the maturation of almost all eukaryotic mRNAs, and thus all mRNAs are virtually eligible for this antisense-mediated knockdown strategy. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  4. Strategies for Improving siRNA-Induced Gene Silencing Efficiency.

    Science.gov (United States)

    Safari, Fatemeh; Rahmani Barouji, Solmaz; Tamaddon, Ali Mohammad

    2017-12-01

    Purpose: Human telomerase reverse transcriptase (hTERT) plays a crucial role in tumorigenesis and progression of cancers. Gene silencing of hTERT by short interfering RNA (siRNA) is considered as a promising strategy for cancer gene therapy. Various algorithms have been devised for designing a high efficient siRNA which is a significant issue in the clinical usage. Thereby, in the present study, the relation of siRNA designing criteria and the gene silencing efficiency was evaluated. Methods: The siRNA sequences were designed and characterized by using on line soft wares. Cationic co-polymer (polyethylene glycol-g-polyethylene imine (PEG-g-PEI)) was used for the construction of polyelectrolyte complexes (PECs) containing siRNAs. The cellular uptake of the PECs was evaluated. The gene silencing efficiency of different siRNA sequences was investigated and the effect of observing the rational designing on the functionality of siRNAs was assessed. Results: The size of PEG-g-PEI siRNA with N/P (Nitrogen/Phosphate) ratio of 2.5 was 114 ± 0.645 nm. The transfection efficiency of PECs was desirable (95.5% ± 2.4%.). The results of Real-Time PCR showed that main sequence (MS) reduced the hTERT expression up to 90% and control positive sequence (CPS) up to 63%. These findings demonstrated that the accessibility to the target site has priority than the other criteria such as sequence preferences and thermodynamic features. Conclusion: siRNA opens a hopeful window in cancer therapy which provides a convenient and tolerable therapeutic approach. Thereby, using the set of criteria and rational algorithms in the designing of siRNA remarkably affect the gene silencing efficiency.

  5. Insights on ornithine decarboxylase silencing as a potential strategy for targeting retinoblastoma.

    Science.gov (United States)

    Muthukumaran, Sivashanmugam; Bhuvanasundar, Renganathan; Umashankar, Vetrivel; Sulochana, K N

    2018-02-01

    Ornithine Decarboxylase (ODC) is a key enzyme involved in polyamine synthesis and is reported to be up regulated in several cancers. However, the effect of ODC gene silencing in retinoblastoma is to be understood for utilization in therapeutic applications. Hence, in this study, a novel siRNA (small interference RNA) targeting ODC was designed and validated in Human Y79 retinoblastoma cells for its effects on intracellular polyamine levels, Matrix Metalloproteinase 2 & 9 activity and Cell cycle. The designed siRNA showed efficient silencing of ODC mRNA expression and protein levels in Y79 cells. It also showed significant reduction of intracellular polyamine levels and altered levels of oncogenic LIN28b expression. By this study, a regulatory loop is proposed, wherein, ODC silencing in Y79 cells to result in decreased polyamine levels, thereby, leading to altered protein levels of Lin28b, MMP-2 and MMP-9, which falls in line with earlier studies in neuroblastoma. Thus, by this study, we propose ODC silencing as a prospective strategy for targeting retinoblastoma. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  6. Validation of RNAi Silencing Efficiency Using Gene Array Data shows 18.5% Failure Rate across 429 Independent Experiments

    Directory of Open Access Journals (Sweden)

    Gyöngyi Munkácsy

    2016-01-01

    Full Text Available No independent cross-validation of success rate for studies utilizing small interfering RNA (siRNA for gene silencing has been completed before. To assess the influence of experimental parameters like cell line, transfection technique, validation method, and type of control, we have to validate these in a large set of studies. We utilized gene chip data published for siRNA experiments to assess success rate and to compare methods used in these experiments. We searched NCBI GEO for samples with whole transcriptome analysis before and after gene silencing and evaluated the efficiency for the target and off-target genes using the array-based expression data. Wilcoxon signed-rank test was used to assess silencing efficacy and Kruskal–Wallis tests and Spearman rank correlation were used to evaluate study parameters. All together 1,643 samples representing 429 experiments published in 207 studies were evaluated. The fold change (FC of down-regulation of the target gene was above 0.7 in 18.5% and was above 0.5 in 38.7% of experiments. Silencing efficiency was lowest in MCF7 and highest in SW480 cells (FC = 0.59 and FC = 0.30, respectively, P = 9.3E−06. Studies utilizing Western blot for validation performed better than those with quantitative polymerase chain reaction (qPCR or microarray (FC = 0.43, FC = 0.47, and FC = 0.55, respectively, P = 2.8E−04. There was no correlation between type of control, transfection method, publication year, and silencing efficiency. Although gene silencing is a robust feature successfully cross-validated in the majority of experiments, efficiency remained insufficient in a significant proportion of studies. Selection of cell line model and validation method had the highest influence on silencing proficiency.

  7. Impact of target mRNA structure on siRNA silencing efficiency: A large-scale study.

    Science.gov (United States)

    Gredell, Joseph A; Berger, Angela K; Walton, S Patrick

    2008-07-01

    The selection of active siRNAs is generally based on identifying siRNAs with certain sequence and structural properties. However, the efficiency of RNA interference has also been shown to depend on the structure of the target mRNA, primarily through studies using exogenous transcripts with well-defined secondary structures in the vicinity of the target sequence. While these studies provide a means for examining the impact of target sequence and structure independently, the predicted secondary structures for these transcripts are often not reflective of structures that form in full-length, native mRNAs where interactions can occur between relatively remote segments of the mRNAs. Here, using a combination of experimental results and analysis of a large dataset, we demonstrate that the accessibility of certain local target structures on the mRNA is an important determinant in the gene silencing ability of siRNAs. siRNAs targeting the enhanced green fluorescent protein were chosen using a minimal siRNA selection algorithm followed by classification based on the predicted minimum free energy structures of the target transcripts. Transfection into HeLa and HepG2 cells revealed that siRNAs targeting regions of the mRNA predicted to have unpaired 5'- and 3'-ends resulted in greater gene silencing than regions predicted to have other types of secondary structure. These results were confirmed by analysis of gene silencing data from previously published siRNAs, which showed that mRNA target regions unpaired at either the 5'-end or 3'-end were silenced, on average, approximately 10% more strongly than target regions unpaired in the center or primarily paired throughout. We found this effect to be independent of the structure of the siRNA guide strand. Taken together, these results suggest minimal requirements for nucleation of hybridization between the siRNA guide strand and mRNA and that both mRNA and guide strand structure should be considered when choosing candidate si

  8. Development of a gene silencing DNA vector derived from a broad host range geminivirus

    Directory of Open Access Journals (Sweden)

    Hancock Leandria C

    2009-07-01

    Full Text Available Abstract Background Gene silencing is proving to be a powerful tool for genetic, developmental, and physiological analyses. The use of viral induced gene silencing (VIGS offers advantages to transgenic approaches as it can be potentially applied to non-model systems for which transgenic techniques are not readily available. However, many VIGS vectors are derived from Gemini viruses that have limited host ranges. We present a new, unipartite vector that is derived from a curtovirus that has a broad host range and will be amenable to use in many non-model systems. Results The construction of a gene silencing vector derived from the geminivirus Beet curly top virus (BCTV, named pWSRi, is reported. Two versions of the vector have been developed to allow application by biolistic techniques or by agro-infiltration. We demonstrate its ability to silence nuclear genes including ribulose bisphosphate carboxylase small subunit (rbcS, transketolase, the sulfur allele of magnesium chelatase (ChlI, and two homeotic transcription factors in spinach or tomato by generating gene-specific knock-down phenotypes. Onset of phenotypes occurred 3 to 12 weeks post-inoculation, depending on the target gene, in organs that developed after the application. The vector lacks movement genes and we found no evidence for significant spread from the site of inoculation. However, viral amplification in inoculated tissue was detected and is necessary for systemic silencing, suggesting that signals generated from active viral replicons are efficiently transported within the plant. Conclusion The unique properties of the pWSRi vector, the ability to silence genes in meristem tissue, the separation of virus and silencing phenotypes, and the broad natural host range of BCTV, suggest that it will have wide utility.

  9. Visceral adipose tissue macrophage-targeted TACE silencing to treat obesity-induced type 2 diabetes.

    Science.gov (United States)

    Yong, Seok-Beom; Song, Yoonsung; Kim, Yong-Hee

    2017-12-01

    Obesity is an increasingly prevalent global health problem. Due to its close relations with metabolic diseases and cancer, new therapeutic approaches for treating obesity and obesity-induced metabolic diseases are required. Visceral white adipose tissue (WAT) has been closely associated with obesity-induced inflammation and adipose tissue macrophages (ATMs) are responsible for obesity-induced inflammation by releasing inflammatory cytokines such as tumor necrosis factor-α (TNF-α) and interleukin-6. TNF-α converting enzyme (TACE) is a transmembrane enzyme that induces the enzymatic cleavage and release of inflammatory cytokines. In this study, we developed a nonviral gene delivery system consisting of an oligopeptide (ATS-9R) that can selectively target visceral ATMs. In here we shows visceral adipose tissue-dominant inflammatory gene over-expressions in obese mouse and our strategy enabled the preferential delivery of therapeutic genes to visceral ATMs and successfully achieved ATM-targeted gene silencing. Finally, ATS-9R-mediated TACE gene silencing in visceral ATMs alleviated visceral fat inflammation and improved type 2 diabetes by reducing whole body inflammation. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Investigating Gene Function in Cereal Rust Fungi by Plant-Mediated Virus-Induced Gene Silencing.

    Science.gov (United States)

    Panwar, Vinay; Bakkeren, Guus

    2017-01-01

    Cereal rust fungi are destructive pathogens, threatening grain production worldwide. Targeted breeding for resistance utilizing host resistance genes has been effective. However, breakdown of resistance occurs frequently and continued efforts are needed to understand how these fungi overcome resistance and to expand the range of available resistance genes. Whole genome sequencing, transcriptomic and proteomic studies followed by genome-wide computational and comparative analyses have identified large repertoire of genes in rust fungi among which are candidates predicted to code for pathogenicity and virulence factors. Some of these genes represent defence triggering avirulence effectors. However, functions of most genes still needs to be assessed to understand the biology of these obligate biotrophic pathogens. Since genetic manipulations such as gene deletion and genetic transformation are not yet feasible in rust fungi, performing functional gene studies is challenging. Recently, Host-induced gene silencing (HIGS) has emerged as a useful tool to characterize gene function in rust fungi while infecting and growing in host plants. We utilized Barley stripe mosaic virus-mediated virus induced gene silencing (BSMV-VIGS) to induce HIGS of candidate rust fungal genes in the wheat host to determine their role in plant-fungal interactions. Here, we describe the methods for using BSMV-VIGS in wheat for functional genomics study in cereal rust fungi.

  11. Homology-dependent Gene Silencing in Paramecium

    Science.gov (United States)

    Ruiz, Françoise; Vayssié, Laurence; Klotz, Catherine; Sperling, Linda; Madeddu, Luisa

    1998-01-01

    Microinjection at high copy number of plasmids containing only the coding region of a gene into the Paramecium somatic macronucleus led to a marked reduction in the expression of the corresponding endogenous gene(s). The silencing effect, which is stably maintained throughout vegetative growth, has been observed for all Paramecium genes examined so far: a single-copy gene (ND7), as well as members of multigene families (centrin genes and trichocyst matrix protein genes) in which all closely related paralogous genes appeared to be affected. This phenomenon may be related to posttranscriptional gene silencing in transgenic plants and quelling in Neurospora and allows the efficient creation of specific mutant phenotypes thus providing a potentially powerful tool to study gene function in Paramecium. For the two multigene families that encode proteins that coassemble to build up complex subcellular structures the analysis presented herein provides the first experimental evidence that the members of these gene families are not functionally redundant. PMID:9529389

  12. Virus-induced gene silencing in diverse maize lines using the Brome Mosaic virus-based silencing vector

    Science.gov (United States)

    Virus-induced gene silencing (VIGS) is a widely used tool for gene function studies in many plant species, though its use in monocots has been limited. Using a Brome mosaic virus (BMV) vector designed to silence the maize phytoene desaturase gene, a genetically diverse set of maize inbred lines was ...

  13. Klotho gene silencing promotes pathology in the mdx mouse model of Duchenne muscular dystrophy

    Science.gov (United States)

    Wehling-Henricks, Michelle; Li, Zhenzhi; Lindsey, Catherine; Wang, Ying; Welc, Steven S.; Ramos, Julian N.; Khanlou, Négar; Kuro-o, Makoto; Tidball, James G.

    2016-01-01

    Duchenne muscular dystrophy (DMD) is a lethal muscle disease involving progressive loss of muscle regenerative capacity and increased fibrosis. We tested whether epigenetic silencing of the klotho gene occurs in the mdx mouse model of DMD and whether klotho silencing is an important feature of the disease. Our findings show that klotho undergoes muscle-specific silencing at the acute onset of mdx pathology. Klotho experiences increased methylation of CpG sites in its promoter region, which is associated with gene silencing, and increases in a repressive histone mark, H3K9me2. Expression of a klotho transgene in mdx mice restored their longevity, reduced muscle wasting, improved function and greatly increased the pool of muscle-resident stem cells required for regeneration. Reductions of fibrosis in late, progressive stages of the mdx pathology achieved by transgene expression were paralleled by reduced expression of Wnt target genes (axin-2), transforming growth factor-beta (TGF-β1) and collagens types 1 and 3, indicating that Klotho inhibition of the profibrotic Wnt/TGFβ axis underlies its anti-fibrotic effect in aging, dystrophic muscle. Thus, epigenetic silencing of klotho during muscular dystrophy contributes substantially to lost regenerative capacity and increased fibrosis of dystrophic muscle during late progressive stages of the disease. PMID:27154199

  14. Silence of the Genes

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 12; Issue 4. Silence of the Genes - 2006 Nobel Prize in Physiology or Medicine. Utpal Nath Saumitra Das. General Article Volume 12 Issue 4 April 2007 pp 6-18. Fulltext. Click here to view fulltext PDF. Permanent link:

  15. RNAi dynamics in Juvenile Fasciola spp. Liver flukes reveals the persistence of gene silencing in vitro.

    Directory of Open Access Journals (Sweden)

    Paul McVeigh

    2014-09-01

    Full Text Available Fasciola spp. liver fluke cause pernicious disease in humans and animals. Whilst current control is unsustainable due to anthelmintic resistance, gene silencing (RNA interference, RNAi has the potential to contribute to functional validation of new therapeutic targets. The susceptibility of juvenile Fasciola hepatica to double stranded (dsRNA-induced RNAi has been reported. To exploit this we probe RNAi dynamics, penetrance and persistence with the aim of building a robust platform for reverse genetics in liver fluke. We describe development of standardised RNAi protocols for a commercially-available liver fluke strain (the US Pacific North West Wild Strain, validated via robust transcriptional silencing of seven virulence genes, with in-depth experimental optimisation of three: cathepsin L (FheCatL and B (FheCatB cysteine proteases, and a σ-class glutathione transferase (FheσGST.Robust transcriptional silencing of targets in both F. hepatica and Fasciola gigantica juveniles is achievable following exposure to long (200-320 nt dsRNAs or 27 nt short interfering (siRNAs. Although juveniles are highly RNAi-susceptible, they display slower transcript and protein knockdown dynamics than those reported previously. Knockdown was detectable following as little as 4h exposure to trigger (target-dependent and in all cases silencing persisted for ≥25 days following long dsRNA exposure. Combinatorial silencing of three targets by mixing multiple long dsRNAs was similarly efficient. Despite profound transcriptional suppression, we found a significant time-lag before the occurrence of protein suppression; FheσGST and FheCatL protein suppression were only detectable after 9 and 21 days, respectively.In spite of marked variation in knockdown dynamics, we find that a transient exposure to long dsRNA or siRNA triggers robust RNAi penetrance and persistence in liver fluke NEJs supporting the development of multiple-throughput phenotypic screens for control

  16. DNA triplet repeats mediate heterochromatin-protein-1-sensitive variegated gene silencing.

    Science.gov (United States)

    Saveliev, Alexander; Everett, Christopher; Sharpe, Tammy; Webster, Zoë; Festenstein, Richard

    2003-04-24

    Gene repression is crucial to the maintenance of differentiated cell types in multicellular organisms, whereas aberrant silencing can lead to disease. The organization of DNA into chromatin and heterochromatin is implicated in gene silencing. In chromatin, DNA wraps around histones, creating nucleosomes. Further condensation of chromatin, associated with large blocks of repetitive DNA sequences, is known as heterochromatin. Position effect variegation (PEV) occurs when a gene is located abnormally close to heterochromatin, silencing the affected gene in a proportion of cells. Here we show that the relatively short triplet-repeat expansions found in myotonic dystrophy and Friedreich's ataxia confer variegation of expression on a linked transgene in mice. Silencing was correlated with a decrease in promoter accessibility and was enhanced by the classical PEV modifier heterochromatin protein 1 (HP1). Notably, triplet-repeat-associated variegation was not restricted to classical heterochromatic regions but occurred irrespective of chromosomal location. Because the phenomenon described here shares important features with PEV, the mechanisms underlying heterochromatin-mediated silencing might have a role in gene regulation at many sites throughout the mammalian genome and modulate the extent of gene silencing and hence severity in several triplet-repeat diseases.

  17. Normalization of Overexpressed α-Synuclein Causing Parkinson's Disease By a Moderate Gene Silencing With RNA Interference

    Directory of Open Access Journals (Sweden)

    Masaki Takahashi

    2015-01-01

    Full Text Available The α-synuclein (SNCA gene is a responsible gene for Parkinson's disease (PD; and not only nucleotide variations but also overexpression of SNCA appears to be involved in the pathogenesis of PD. A specific inhibition against mutant SNCA genes carrying nucleotide variations may be feasible by a specific silencing such as an allele-specific RNA interference (RNAi; however, there is no method for restoring the SNCA overexpression to a normal level. Here, we show that an atypical RNAi using small interfering RNAs (siRNAs that confer a moderate level of gene silencing is capable of controlling overexpressed SNCA genes to return to a normal level; named “expression-control RNAi” (ExCont-RNAi. ExCont-RNAi exhibited little or no significant off-target effects in its treated PD patient's fibroblasts that carry SNCA triplication. To further assess the therapeutic effect of ExCont-RNAi, PD-model flies that carried the human SNCA gene underwent an ExCont-RNAi treatment. The treated PD-flies demonstrated a significant improvement in their motor function. Our current findings suggested that ExCont-RNAi might be capable of becoming a novel therapeutic procedure for PD with the SNCA overexpression, and that siRNAs conferring a moderate level of gene silencing to target genes, which have been abandoned as useless siRNAs so far, might be available for controlling abnormally expressed disease-causing genes without producing adverse effects.

  18. MicroRNA-Mediated Gene Silencing in Plant Defense and Viral Counter-Defense

    Directory of Open Access Journals (Sweden)

    Sheng-Rui Liu

    2017-09-01

    Full Text Available MicroRNAs (miRNAs are non-coding RNAs of approximately 20–24 nucleotides in length that serve as central regulators of eukaryotic gene expression by targeting mRNAs for cleavage or translational repression. In plants, miRNAs are associated with numerous regulatory pathways in growth and development processes, and defensive responses in plant–pathogen interactions. Recently, significant progress has been made in understanding miRNA-mediated gene silencing and how viruses counter this defense mechanism. Here, we summarize the current knowledge and recent advances in understanding the roles of miRNAs involved in the plant defense against viruses and viral counter-defense. We also document the application of miRNAs in plant antiviral defense. This review discusses the current understanding of the mechanisms of miRNA-mediated gene silencing and provides insights on the never-ending arms race between plants and viruses.

  19. Manipulation of Cell Physiology Enables Gene Silencing in Well-differentiated Airway Epithelia

    Directory of Open Access Journals (Sweden)

    Sateesh Krishnamurthy

    2012-01-01

    Full Text Available The application of RNA interference-based gene silencing to the airway surface epithelium holds great promise to manipulate host and pathogen gene expression for therapeutic purposes. However, well-differentiated airway epithelia display significant barriers to double-stranded small-interfering RNA (siRNA delivery despite testing varied classes of nonviral reagents. In well-differentiated primary pig airway epithelia (PAE or human airway epithelia (HAE grown at the air–liquid interface (ALI, the delivery of a Dicer-substrate small-interfering RNA (DsiRNA duplex against hypoxanthine–guanine phosphoribosyltransferase (HPRT with several nonviral reagents showed minimal uptake and no knockdown of the target. In contrast, poorly differentiated cells (2–5-day post-seeding exhibited significant oligonucleotide internalization and target knockdown. This finding suggested that during differentiation, the barrier properties of the epithelium are modified to an extent that impedes oligonucleotide uptake. We used two methods to overcome this inefficiency. First, we tested the impact of epidermal growth factor (EGF, a known enhancer of macropinocytosis. Treatment of the cells with EGF improved oligonucleotide uptake resulting in significant but modest levels of target knockdown. Secondly, we used the connectivity map (Cmap database to correlate gene expression changes during small molecule treatments on various cells types with genes that change upon mucociliary differentiation. Several different drug classes were identified from this correlative assessment. Well-differentiated epithelia treated with DsiRNAs and LY294002, a PI3K inhibitor, significantly improved gene silencing and concomitantly reduced target protein levels. These novel findings reveal that well-differentiated airway epithelia, normally resistant to siRNA delivery, can be pretreated with small molecules to improve uptake of synthetic oligonucleotide and RNA interference (RNAi responses.

  20. Virus-induced gene silencing (VIGS) as a reverse genetic tool to study development of symbiotic root nodules

    DEFF Research Database (Denmark)

    Kjær, Gabriela Didina Constantin; Grønlund, Mette; Stougaard, Jens

    2008-01-01

    Virus-induced gene silencing (VIGS) can provide a shortcut to plants with altered expression of specific genes. Here, we report that VIGS of the Nodule inception gene (Nin) can alter the nodulation phenotype and Nin gene expression in Pisum sativum. PsNin was chosen as target because of the disti...

  1. RNA-mediated gene silencing signals are not graft transmissible from the rootstock to the scion in greenhouse-grown apple plants Malus sp.

    Science.gov (United States)

    Flachowsky, Henryk; Tränkner, Conny; Szankowski, Iris; Waidmann, Sascha; Hanke, Magda-Viola; Treutter, Dieter; Fischer, Thilo C

    2012-01-01

    RNA silencing describes the sequence specific degradation of RNA targets. Silencing is a non-cell autonomous event that is graft transmissible in different plant species. The present study is the first report on systemic acquired dsRNA-mediated gene silencing of transgenic and endogenous gene sequences in a woody plant like apple. Transgenic apple plants overexpressing a hairpin gene construct of the gusA reporter gene were produced. These plants were used as rootstocks and grafted with scions of the gusA overexpressing transgenic apple clone T355. After grafting, we observed a reduction of the gusA gene expression in T355 scions in vitro, but not in T355 scions grown in the greenhouse. Similar results were obtained after silencing of the endogenous Mdans gene in apple that is responsible for anthocyanin biosynthesis. Subsequently, we performed grafting experiments with Mdans silenced rootstocks and red leaf scions of TNR31-35 in order to evaluate graft transmitted silencing of the endogenous Mdans. The results obtained suggested a graft transmission of silencing signals in in vitro shoots. In contrast, no graft transmission of dsRNA-mediated gene silencing signals was detectable in greenhouse-grown plants and in plants grown in an insect protection tent.

  2. RNAi-mediated Gene Silencing of Mutant Myotilin Improves Myopathy in LGMD1A Mice

    Directory of Open Access Journals (Sweden)

    Jian Liu

    2014-01-01

    Full Text Available Recent progress suggests gene therapy may one day be an option for treating some forms of limb girdle muscular dystrophy (LGMD. Nevertheless, approaches targeting LGMD have so far focused on gene replacement strategies for recessive forms of the disease. In contrast, no attempts have been made to develop molecular therapies for any of the eight dominantly inherited forms of LGMD. Importantly, the emergence of RNA interference (RNAi therapeutics in the last decade provided new tools to combat dominantly inherited LGMDs with molecular therapy. In this study, we describe the first RNAi-based, preclinical gene therapy approach for silencing a gene associated with dominant LGMD. To do this, we developed adeno-associated viral vectors (AAV6 carrying designed therapeutic microRNAs targeting mutant myotilin (MYOT, which is the underlying cause of LGMD type 1A (LGMD1A. Our best MYOT-targeted microRNA vector (called miMYOT significantly reduced mutant myotilin mRNA and soluble protein expression in muscles of LGMD1A mice (the TgT57I model both 3 and 9 months after delivery, demonstrating short- and long-term silencing effects. This MYOT gene silencing subsequently decreased deposition of MYOT-seeded intramuscular protein aggregates, which is the hallmark feature of LGMD1A. Histological improvements were accompanied by significant functional correction, as miMYOT-treated animals showed increased muscle weight and improved specific force in the gastrocnemius, which is one of the most severely affected muscles in TgT57I mice and patients with dominant myotilin mutations. These promising results in a preclinical model of LGMD1A support the further development of RNAi-based molecular therapy as a prospective treatment for LGMD1A. Furthermore, this study sets a foundation that may be refined and adapted to treat other dominant LGMD and related disorders.

  3. Host-Induced Silencing of Pathogenicity Genes Enhances Resistance to Fusarium oxysporum Wilt in Tomato.

    Science.gov (United States)

    Bharti, Poonam; Jyoti, Poonam; Kapoor, Priya; Sharma, Vandana; Shanmugam, V; Yadav, Sudesh Kumar

    2017-08-01

    This study presents a novel approach of controlling vascular wilt in tomato by RNAi expression directed to pathogenicity genes of Fusarium oxysporum f. sp. lycopersici. Vascular wilt of tomato caused by Fusarium oxysporum f. sp. lycopersici leads to qualitative and quantitative loss of the crop. Limitation in the existing control measures necessitates the development of alternative strategies to increase resistance in the plants against pathogens. Recent findings paved way to RNAi, as a promising method for silencing of pathogenicity genes in fungus and provided effective resistance against fungal pathogens. Here, two important pathogenicity genes FOW2, a Zn(II)2Cys6 family putative transcription regulator, and chsV, a putative myosin motor and a chitin synthase domain, were used for host-induced gene silencing through hairpinRNA cassettes of these genes against Fusarium oxysporum f. sp. lycopersici. HairpinRNAs were assembled in appropriate binary vectors and transformed into tomato plant targeting FOW2 and chsV genes, for two highly pathogenic strains of Fusarium oxysporum viz. TOFOL-IHBT and TOFOL-IVRI. Transgenic tomatoes were analyzed for possible attainment of resistance in transgenic lines against fungal infection. Eight transgenic lines expressing hairpinRNA cassettes showed trivial disease symptoms after 6-8 weeks of infection. Hence, the host-induced posttranscriptional gene silencing of pathogenicity genes in transgenic tomato plants has enhanced their resistance to vascular wilt disease caused by Fusarium oxysporum.

  4. Investigation of a miRNA-Induced Gene Silencing Technique in Petunia Reveals Alterations in miR173 Precursor Processing and the Accumulation of Secondary siRNAs from Endogenous Genes.

    Directory of Open Access Journals (Sweden)

    Yao Han

    Full Text Available MIGS (miRNA-induced gene silencing is a straightforward and efficient gene silencing technique in Arabidopsis. It works by exploiting miR173 to trigger the production of phasiRNAs (phased small interfering RNAs. MIGS can be used in plant species other than Arabidopsis by co-expression of miR173 and target gene fragments fused to an upstream miR173 target site. However, the efficiency and technical mechanisms have not been thoroughly investigated in other plants. In this work, two vectors, pMIGS-chs and pMIGS-pds, were constructed and transformed into petunia plants. The transgenic plants showed CHS (chalcone synthase and PDS (phytoene desaturase gene-silencing phenotypes respectively, indicating that MIGS functions in petunia. MIGS-chs plants were used to investigate the mechanisms of this technique in petunia. Results of 5'- RACE showed that the miR173 target site was cleaved at the expected position and that endogenous CHS genes were cut at multiple positions. Small RNA deep sequencing analysis showed that the processing of Arabidopsis miR173 precursors in MIGS-chs transgenic petunia plants did not occur in exactly the same way as in Arabidopsis, suggesting differences in the machinery of miRNA processing between plant species. Small RNAs in-phase with the miR173 cleavage register were produced immediately downstream from the cleavage site and out-of-phase small RNAs were accumulated at relatively high levels from processing cycle 5 onwards. Secondary siRNAs were generated from multiple sites of endogenous CHS-A and CHS-J genes, indicating that miR173 cleavage induced siRNAs have the same ability to initiate siRNA transitivity as the siRNAs functioning in co-suppression and hpRNA silencing. On account of the simplicity of vector construction and the transitive amplification of signals from endogenous transcripts, MIGS is a good alternative gene silencing method for plants, especially for silencing a cluster of homologous genes with redundant

  5. Investigation of a miRNA-Induced Gene Silencing Technique in Petunia Reveals Alterations in miR173 Precursor Processing and the Accumulation of Secondary siRNAs from Endogenous Genes.

    Science.gov (United States)

    Han, Yao; Zhang, Bin; Qin, Xiaoting; Li, Mingyang; Guo, Yulong

    2015-01-01

    MIGS (miRNA-induced gene silencing) is a straightforward and efficient gene silencing technique in Arabidopsis. It works by exploiting miR173 to trigger the production of phasiRNAs (phased small interfering RNAs). MIGS can be used in plant species other than Arabidopsis by co-expression of miR173 and target gene fragments fused to an upstream miR173 target site. However, the efficiency and technical mechanisms have not been thoroughly investigated in other plants. In this work, two vectors, pMIGS-chs and pMIGS-pds, were constructed and transformed into petunia plants. The transgenic plants showed CHS (chalcone synthase) and PDS (phytoene desaturase) gene-silencing phenotypes respectively, indicating that MIGS functions in petunia. MIGS-chs plants were used to investigate the mechanisms of this technique in petunia. Results of 5'- RACE showed that the miR173 target site was cleaved at the expected position and that endogenous CHS genes were cut at multiple positions. Small RNA deep sequencing analysis showed that the processing of Arabidopsis miR173 precursors in MIGS-chs transgenic petunia plants did not occur in exactly the same way as in Arabidopsis, suggesting differences in the machinery of miRNA processing between plant species. Small RNAs in-phase with the miR173 cleavage register were produced immediately downstream from the cleavage site and out-of-phase small RNAs were accumulated at relatively high levels from processing cycle 5 onwards. Secondary siRNAs were generated from multiple sites of endogenous CHS-A and CHS-J genes, indicating that miR173 cleavage induced siRNAs have the same ability to initiate siRNA transitivity as the siRNAs functioning in co-suppression and hpRNA silencing. On account of the simplicity of vector construction and the transitive amplification of signals from endogenous transcripts, MIGS is a good alternative gene silencing method for plants, especially for silencing a cluster of homologous genes with redundant functions.

  6. An SGS3-like protein functions in RNA-directed DNA methylation and transcriptional gene silencing in Arabidopsis

    KAUST Repository

    Zheng, Zhimin

    2010-01-06

    RNA-directed DNA methylation (RdDM) is an important epigenetic mechanism for silencing transgenes and endogenous repetitive sequences such as transposons. The RD29A promoter-driven LUCIFERASE transgene and its corresponding endogenous RD29A gene are hypermethylated and silenced in the Arabidopsis DNA demethylase mutant ros1. By screening for second-site suppressors of ros1, we identified the RDM12 locus. The rdm12 mutation releases the silencing of the RD29A-LUC transgene and the endogenous RD29A gene by reducing the promoter DNA methylation. The rdm12 mutation also reduces DNA methylation at endogenous RdDM target loci, including transposons and other repetitive sequences. In addition, the rdm12 mutation affects the levels of small interfering RNAs (siRNAs) from some of the RdDM target loci. RDM12 encodes a protein with XS and coiled-coil domains, and is similar to SGS3, which is a partner protein of RDR6 and can bind to double-stranded RNAs with a 5′ overhang, and is required for several post-transcriptional gene silencing pathways. Our results show that RDM12 is a component of the RdDM pathway, and suggest that RdDM may involve double-stranded RNAs with a 5′ overhang and the partnering between RDM12 and RDR2. © 2010 Blackwell Publishing Ltd.

  7. Targeted gene insertion for molecular medicine.

    Science.gov (United States)

    Voigt, Katrin; Izsvák, Zsuzsanna; Ivics, Zoltán

    2008-11-01

    Genomic insertion of a functional gene together with suitable transcriptional regulatory elements is often required for long-term therapeutical benefit in gene therapy for several genetic diseases. A variety of integrating vectors for gene delivery exist. Some of them exhibit random genomic integration, whereas others have integration preferences based on attributes of the targeted site, such as primary DNA sequence and physical structure of the DNA, or through tethering to certain DNA sequences by host-encoded cellular factors. Uncontrolled genomic insertion bears the risk of the transgene being silenced due to chromosomal position effects, and can lead to genotoxic effects due to mutagenesis of cellular genes. None of the vector systems currently used in either preclinical experiments or clinical trials displays sufficient preferences for target DNA sequences that would ensure appropriate and reliable expression of the transgene and simultaneously prevent hazardous side effects. We review in this paper the advantages and disadvantages of both viral and non-viral gene delivery technologies, discuss mechanisms of target site selection of integrating genetic elements (viruses and transposons), and suggest distinct molecular strategies for targeted gene delivery.

  8. Pathways of cellular internalisation of liposomes delivered siRNA and effects on siRNA engagement with target mRNA and silencing in cancer cells.

    Science.gov (United States)

    Alshehri, Abdullah; Grabowska, Anna; Stolnik, Snow

    2018-02-28

    Design of an efficient delivery system is a generally recognised bottleneck in translation of siRNA technology into clinic. Despite research efforts, cellular processes that determine efficiency of siRNA silencing achieved by different delivery formulations remain unclear. Here, we investigated the mechanism(s) of cellular internalisation of a model siRNA-loaded liposome system in a correlation to the engagement of delivered siRNA with its target and consequent silencing by adopting siRNA molecular beacon technology. Probing of cellular internalisation pathways by a panel of pharmacological inhibitors indicated that clathrin-mediated (dynamin-dependent) endocytosis, macropinocytosis (dynamine independent), and cell membrane cholesterol dependent process(es) (clathrin and caveolea-independent) all play a role in the siRNA-liposomes internalization. The inhibition of either of these entry routes was, in general, mirrored by a reduction in the level of siRNA engagement with its target mRNA, as well as in a reduction of the target gene silencing. A dramatic increase in siRNA engagement with its target RNA was observed on disruption of endosomal membrane (by chloroquine), accompanied with an increased silencing. The work thus illustrates that employing molecular beacon siRNA technology one can start to assess the target RNA engagement - a stage between initial cellular internalization and final gene silencing of siRNA delivery systems.

  9. The Polerovirus F box protein P0 targets ARGONAUTE1 to suppress RNA silencing.

    Science.gov (United States)

    Bortolamiol, Diane; Pazhouhandeh, Maghsoud; Marrocco, Katia; Genschik, Pascal; Ziegler-Graff, Véronique

    2007-09-18

    Plants employ post-transcriptional gene silencing (PTGS) as an antiviral defense response. In this mechanism, viral-derived small RNAs are incorporated into the RNA-induced silencing complex (RISC) to guide degradation of the corresponding viral RNAs. ARGONAUTE1 (AGO1) is a key component of RISC: it carries the RNA slicer activity. As a counter-defense, viruses have evolved various proteins that suppress PTGS. Recently, we showed that the Polerovirus P0 protein carries an F box motif required to form an SCF-like complex, which is also essential for P0's silencing suppressor function. Here, we investigate the molecular mechanism by which P0 impairs PTGS. First we show that P0's expression does not affect the biogenesis of primary siRNAs in an inverted repeat-PTGS assay, but it does affect their activity. Moreover, P0's expression in transformed Arabidopsis plants leads to various developmental abnormalities reminiscent of mutants affected in miRNA pathways, which is accompanied by enhanced levels of several miRNA-target transcripts, suggesting that P0 acts at the level of RISC. Interestingly, ectopic expression of P0 triggered AGO1 protein decay in planta. Finally, we provide evidence that P0 physically interacts with AGO1. Based on these results, we propose that P0 hijacks the host SCF machinery to modulate gene silencing by destabilizing AGO1.

  10. Increasing the amylose content of durum wheat through silencing of the SBEIIa genes

    Directory of Open Access Journals (Sweden)

    Masci Stefania

    2010-07-01

    Full Text Available Abstract Background High amylose starch has attracted particular interest because of its correlation with the amount of Resistant Starch (RS in food. RS plays a role similar to fibre with beneficial effects for human health, providing protection from several diseases such as colon cancer, diabetes, obesity, osteoporosis and cardiovascular diseases. Amylose content can be modified by a targeted manipulation of the starch biosynthetic pathway. In particular, the inactivation of the enzymes involved in amylopectin synthesis can lead to the increase of amylose content. In this work, genes encoding starch branching enzymes of class II (SBEIIa were silenced using the RNA interference (RNAi technique in two cultivars of durum wheat, using two different methods of transformation (biolistic and Agrobacterium. Expression of RNAi transcripts was targeted to the seed endosperm using a tissue-specific promoter. Results Amylose content was markedly increased in the durum wheat transgenic lines exhibiting SBEIIa gene silencing. Moreover the starch granules in these lines were deformed, possessing an irregular and deflated shape and being smaller than those present in the untransformed controls. Two novel granule bound proteins, identified by SDS-PAGE in SBEIIa RNAi lines, were investigated by mass spectrometry and shown to have strong homologies to the waxy proteins. RVA analysis showed new pasting properties associated with high amylose lines in comparison with untransformed controls. Finally, pleiotropic effects on other starch genes were found by semi-quantitative and Real-Time reverse transcription-polymerase chain reaction (RT-PCR. Conclusion We have found that the silencing of SBEIIa genes in durum wheat causes obvious alterations in granule morphology and starch composition, leading to high amylose wheat. Results obtained with two different methods of transformation and in two durum wheat cultivars were comparable.

  11. Development of Agrobacterium-mediated virus-induced gene silencing and performance evaluation of four marker genes in Gossypium barbadense.

    Directory of Open Access Journals (Sweden)

    Jinhuan Pang

    Full Text Available Gossypiumbarbadense is a cultivated cotton species and possesses many desirable traits, including high fiber quality and resistance to pathogens, especially Verticilliumdahliae (a devastating pathogen of Gossypium hirsutum, the main cultivated species. These elite traits are difficult to be introduced into G. hirsutum through classical breeding methods. In addition, genetic transformation of G. barbadense has not been successfully performed. It is therefore important to develop methods for evaluating the function and molecular mechanism of genes in G. barbadense. In this study, we had successfully introduced a virus-induced gene silencing (VIGS system into three cultivars of G. barbadense by inserting marker genes into the tobacco rattle virus (TRV vector. After we optimized the VIGS conditions, including light intensity, photoperiod, seedling age and Agrobacterium strain, 100% of plants agroinfiltrated with the GaPDS silencing vector showed white colored leaves. Three other marker genes, GaCLA1, GaANS and GaANR, were employed to further test this VIGS system in G. barbadense. The transcript levels of the endogenous genes in the silenced plants were reduced by more than 99% compared to control plants; these plants presented phenotypic symptoms 2 weeks after inoculation. We introduced a fusing sequence fragment of GaPDS and GaANR gene silencing vectors into a single plant, which resulted in both photobleaching and brownish coloration. The extent of silencing in plants agroinfiltrated with fusing two-gene-silencing vector was consistent with plants harboring a single gene silencing vector. The development of this VIGS system should promote analysis of gene function in G. barbadense, and help to contribute desirable traits for breeding of G. barbadense and G. hirsutum.

  12. Dendrimers as Carriers for siRNA Delivery and Gene Silencing: A Review

    Directory of Open Access Journals (Sweden)

    Jiangyu Wu

    2013-01-01

    Full Text Available RNA interference (RNAi was first literaturally reported in 1998 and has become rapidly a promising tool for therapeutic applications in gene therapy. In a typical RNAi process, small interfering RNAs (siRNA are used to specifically downregulate the expression of the targeted gene, known as the term “gene silencing.” One key point for successful gene silencing is to employ a safe and efficient siRNA delivery system. In this context, dendrimers are emerging as potential nonviral vectors to deliver siRNA for RNAi purpose. Dendrimers have attracted intense interest since their emanating research in the 1980s and are extensively studied as efficient DNA delivery vectors in gene transfer applications, due to their unique features based on the well-defined and multivalent structures. Knowing that DNA and RNA possess a similar structure in terms of nucleic acid framework and the electronegative nature, one can also use the excellent DNA delivery properties of dendrimers to develop effective siRNA delivery systems. In this review, the development of dendrimer-based siRNA delivery vectors is summarized, focusing on the vector features (siRNA delivery efficiency, cytotoxicity, etc. of different types of dendrimers and the related investigations on structure-activity relationship to promote safe and efficient siRNA delivery system.

  13. Dendrimers as Carriers for siRNA Delivery and Gene Silencing: A Review

    Science.gov (United States)

    Huang, Weizhe; He, Ziying

    2013-01-01

    RNA interference (RNAi) was first literaturally reported in 1998 and has become rapidly a promising tool for therapeutic applications in gene therapy. In a typical RNAi process, small interfering RNAs (siRNA) are used to specifically downregulate the expression of the targeted gene, known as the term “gene silencing.” One key point for successful gene silencing is to employ a safe and efficient siRNA delivery system. In this context, dendrimers are emerging as potential nonviral vectors to deliver siRNA for RNAi purpose. Dendrimers have attracted intense interest since their emanating research in the 1980s and are extensively studied as efficient DNA delivery vectors in gene transfer applications, due to their unique features based on the well-defined and multivalent structures. Knowing that DNA and RNA possess a similar structure in terms of nucleic acid framework and the electronegative nature, one can also use the excellent DNA delivery properties of dendrimers to develop effective siRNA delivery systems. In this review, the development of dendrimer-based siRNA delivery vectors is summarized, focusing on the vector features (siRNA delivery efficiency, cytotoxicity, etc.) of different types of dendrimers and the related investigations on structure-activity relationship to promote safe and efficient siRNA delivery system. PMID:24288498

  14. Assessment of RNAi-induced silencing in banana (Musa spp.).

    Science.gov (United States)

    Dang, Tuong Vi T; Windelinckx, Saskia; Henry, Isabelle M; De Coninck, Barbara; Cammue, Bruno P A; Swennen, Rony; Remy, Serge

    2014-09-18

    In plants, RNA- based gene silencing mediated by small RNAs functions at the transcriptional or post-transcriptional level to negatively regulate target genes, repetitive sequences, viral RNAs and/or transposon elements. Post-transcriptional gene silencing (PTGS) or the RNA interference (RNAi) approach has been achieved in a wide range of plant species for inhibiting the expression of target genes by generating double-stranded RNA (dsRNA). However, to our knowledge, successful RNAi-application to knock-down endogenous genes has not been reported in the important staple food crop banana. Using embryogenic cell suspension (ECS) transformed with ß-glucuronidase (GUS) as a model system, we assessed silencing of gusAINT using three intron-spliced hairpin RNA (ihpRNA) constructs containing gusAINT sequences of 299-nt, 26-nt and 19-nt, respectively. Their silencing potential was analysed in 2 different experimental set-ups. In the first, Agrobacterium-mediated co-transformation of banana ECS with a gusAINT containing vector and an ihpRNA construct resulted in a significantly reduced GUS enzyme activity 6-8 days after co-cultivation with either the 299-nt and 19-nt ihpRNA vectors. In the second approach, these ihpRNA constructs were transferred to stable GUS-expressing ECS and their silencing potential was evaluated in the regenerated in vitro plants. In comparison to control plants, transgenic plants transformed with the 299-nt gusAINT targeting sequence showed a 4.5 fold down-regulated gusA mRNA expression level, while GUS enzyme activity was reduced by 9 fold. Histochemical staining of plant tissues confirmed these findings. Northern blotting used to detect the expression of siRNA in the 299-nt ihpRNA vector transgenic in vitro plants revealed a negative relationship between siRNA expression and GUS enzyme activity. In contrast, no reduction in GUS activity or GUS mRNA expression occurred in the regenerated lines transformed with either of the two gusAINT oligo target

  15. Strain Specific Factors Control Effector Gene Silencing in Phytophthora sojae.

    Directory of Open Access Journals (Sweden)

    Sirjana Devi Shrestha

    Full Text Available The Phytophthora sojae avirulence gene Avr3a encodes an effector that is capable of triggering immunity on soybean plants carrying the resistance gene Rps3a. P. sojae strains that express Avr3a are avirulent to Rps3a plants, while strains that do not are virulent. To study the inheritance of Avr3a expression and virulence towards Rps3a, genetic crosses and self-fertilizations were performed. A cross between P. sojae strains ACR10 X P7076 causes transgenerational gene silencing of Avr3a allele, and this effect is meiotically stable up to the F5 generation. However, test-crosses of F1 progeny (ACR10 X P7076 with strain P6497 result in the release of silencing of Avr3a. Expression of Avr3a in the progeny is variable and correlates with the phenotypic penetrance of the avirulence trait. The F1 progeny from a direct cross of P6497 X ACR10 segregate for inheritance for Avr3a expression, a result that could not be explained by parental imprinting or heterozygosity. Analysis of small RNA arising from the Avr3a gene sequence in the parental strains and hybrid progeny suggests that the presence of small RNA is necessary but not sufficient for gene silencing. Overall, we conclude that inheritance of the Avr3a gene silenced phenotype relies on factors that are variable among P. sojae strains.

  16. Agrobacterium mediated transient gene silencing (AMTS in Stevia rebaudiana: insights into steviol glycoside biosynthesis pathway.

    Directory of Open Access Journals (Sweden)

    Praveen Guleria

    Full Text Available Steviol glycoside biosynthesis pathway has emerged as bifurcation from ent-kaurenoic acid, substrate of methyl erythritol phosphate pathway that also leads to gibberellin biosynthesis. However, the genetic regulation of steviol glycoside biosynthesis has not been studied. So, in present study RNA interference (RNAi based Agrobacterium mediated transient gene silencing (AMTS approach was followed. SrKA13H and three SrUGTs (SrUGT85C2, SrUGT74G1 and SrUGT76G1 genes encoding ent-kaurenoic acid-13 hydroxylase and three UDP glycosyltransferases of steviol glycoside biosynthesis pathway were silenced in Stevia rebaudiana to understand its molecular mechanism and association with gibberellins.RNAi mediated AMTS of SrKA13H and three SrUGTs has significantly reduced the expression of targeted endogenous genes as well as total steviol glycoside accumulation. While gibberellins (GA3 content was significantly enhanced on AMTS of SrUGT85C2 and SrKA13H. Silencing of SrKA13H and SrUGT85C2 was found to block the metabolite flux of steviol glycoside pathway and shifted it towards GA3 biosynthesis. Further, molecular docking of three SrUGT proteins has documented highest affinity of SrUGT76G1 for the substrates of alternate pathways synthesizing steviol glycosides. This could be a plausible reason for maximum reduction in steviol glycoside content on silencing of SrUGT76G1 than other genes.SrKA13H and SrUGT85C2 were identified as regulatory genes influencing carbon flux between steviol glycoside and gibberellin biosynthesis. This study has also documented the existence of alternate steviol glycoside biosynthesis route.

  17. Drosophila PAF1 Modulates PIWI/piRNA Silencing Capacity.

    Science.gov (United States)

    Clark, Josef P; Rahman, Reazur; Yang, Nachen; Yang, Linda H; Lau, Nelson C

    2017-09-11

    To test the directness of factors in initiating PIWI-directed gene silencing, we employed a Piwi-interacting RNA (piRNA)-targeted reporter assay in Drosophila ovary somatic sheet (OSS) cells [1]. This assay confirmed direct silencing roles for piRNA biogenesis factors and PIWI-associated factors [2-12] but suggested that chromatin-modifying proteins may act downstream of the initial silencing event. Our data also revealed that RNA-polymerase-II-associated proteins like PAF1 and RTF1 antagonize PIWI-directed silencing. PAF1 knockdown enhances PIWI silencing of reporters when piRNAs target the transcript region proximal to the promoter. Loss of PAF1 suppresses endogenous transposable element (TE) transcript maturation, whereas a subset of gene transcripts and long-non-coding RNAs adjacent to TE insertions are affected by PAF1 knockdown in a similar fashion to piRNA-targeted reporters. Additionally, transcription activation at specific TEs and TE-adjacent loci during PIWI knockdown is suppressed when PIWI and PAF1 levels are both reduced. Our study suggests a mechanistic conservation between fission yeast PAF1 repressing AGO1/small interfering RNA (siRNA)-directed silencing [13, 14] and Drosophila PAF1 opposing PIWI/piRNA-directed silencing. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Reduced rates of gene loss, gene silencing, and gene mutation in Dnmt1-deficient embryonic stem cells

    NARCIS (Netherlands)

    Chan, M.F.; van Amerongen, R.; Nijjar, T.; Cuppen, E.; Jones, P.A.; Laird, P.W.

    2001-01-01

    Tumor suppressor gene inactivation is a crucial event in oncogenesis. Gene inactivation mechanisms include events resulting in loss of heterozygosity (LOH), gene mutation, and transcriptional silencing. The contribution of each of these different pathways varies among tumor suppressor genes and by

  19. The Anti-Adipogenic Potential of COUP-TFII Is Mediated by Downregulation of the Notch Target Gene Hey1.

    Directory of Open Access Journals (Sweden)

    Ilse Scroyen

    Full Text Available Chicken ovalbumin upstream promoter transcription factor II (COUP-TFII belongs to the steroid/thyroid hormone receptor superfamily and may contribute to the pathogenesis of obesity. It has not conclusively been established, however, whether its role is pro- or anti-adipogenic.Gene silencing of Coup-tfII in 3T3-F442A preadipocytes resulted in enhanced differentiation into mature adipocytes. This was associated with upregulation of the Notch signaling target gene Hey1. A functional role of Hey1 was confirmed by gene silencing in 3T3-F442A preadipocytes, resulting in impaired differentiation. In vivo, de novo fat pad formation in NUDE mice was significantly stimulated following injection of preadipocytes with Coup-tfII gene silencing, but impaired with Hey1 gene silencing. Moreover, expression of Coup-tfII was lower and that of Hey1 higher in isolated adipocytes of obese as compared to lean adipose tissue.These in vitro and in vivo data support an anti-adipogenic role of COUP-TFII via downregulating the Notch signaling target gene Hey1.

  20. Hydrogel-Assisted Antisense LNA Gapmer Delivery for In Situ Gene Silencing in Spinal Cord Injury

    DEFF Research Database (Denmark)

    Moreno, Pedro M.D.; Ferreira, Ana R.; Salvador, Daniela

    2018-01-01

    )-modified AON gapmers in combination with a fibrin hydrogel bridging material to induce gene silencing in situ at a SCI lesion site. LNA gapmers were effectively developed against two promising gene targets aiming at enhancing axonal regeneration—RhoA and GSK3β. The fibrin-matrix-assisted AON delivery system......After spinal cord injury (SCI), nerve regeneration is severely hampered due to the establishment of a highly inhibitory microenvironment at the injury site, through the contribution of multiple factors. The potential of antisense oligonucleotides (AONs) to modify gene expression at different levels...

  1. Agrobacterium Mediated Transient Gene Silencing (AMTS) in Stevia rebaudiana: Insights into Steviol Glycoside Biosynthesis Pathway

    Science.gov (United States)

    Guleria, Praveen; Yadav, Sudesh Kumar

    2013-01-01

    Background Steviol glycoside biosynthesis pathway has emerged as bifurcation from ent-kaurenoic acid, substrate of methyl erythritol phosphate pathway that also leads to gibberellin biosynthesis. However, the genetic regulation of steviol glycoside biosynthesis has not been studied. So, in present study RNA interference (RNAi) based Agrobacterium mediated transient gene silencing (AMTS) approach was followed. SrKA13H and three SrUGTs (SrUGT85C2, SrUGT74G1 and SrUGT76G1) genes encoding ent-kaurenoic acid-13 hydroxylase and three UDP glycosyltransferases of steviol glycoside biosynthesis pathway were silenced in Stevia rebaudiana to understand its molecular mechanism and association with gibberellins. Methodology/Principal Findings RNAi mediated AMTS of SrKA13H and three SrUGTs has significantly reduced the expression of targeted endogenous genes as well as total steviol glycoside accumulation. While gibberellins (GA3) content was significantly enhanced on AMTS of SrUGT85C2 and SrKA13H. Silencing of SrKA13H and SrUGT85C2 was found to block the metabolite flux of steviol glycoside pathway and shifted it towards GA3 biosynthesis. Further, molecular docking of three SrUGT proteins has documented highest affinity of SrUGT76G1 for the substrates of alternate pathways synthesizing steviol glycosides. This could be a plausible reason for maximum reduction in steviol glycoside content on silencing of SrUGT76G1 than other genes. Conclusions SrKA13H and SrUGT85C2 were identified as regulatory genes influencing carbon flux between steviol glycoside and gibberellin biosynthesis. This study has also documented the existence of alternate steviol glycoside biosynthesis route. PMID:24023961

  2. The development and application of a multiple gene co-silencing system using endogenous URA3 as a reporter gene in Ganoderma lucidum.

    Directory of Open Access Journals (Sweden)

    Dashuai Mu

    Full Text Available Ganoderma lucidum is one of the most important medicinal mushrooms; however, molecular genetics research on this species has been limited due to a lack of reliable reverse genetic tools. In this study, the endogenous orotidine 5'-monophosphate decarboxylase gene (URA3 was cloned as a silencing reporter, and four gene-silencing methods using hairpin, sense, antisense, and dual promoter constructs, were introduced into G. lucidum through a simple electroporation procedure. A comparison and evaluation of silencing efficiency demonstrated that all of the four methods differentially suppressed the expression of URA3. Our data unequivocally indicate that the dual promoter silencing vector yields the highest rate of URA3 silencing compared with other vectors (up to 81.9%. To highlight the advantages of the dual promoter system, we constructed a co-silencing system based on the dual promoter method and succeeded in co-silencing URA3 and laccase in G. lucidum. The reduction of the mRNA levels of the two genes were correlated. Thus, the screening efficiency for RNAi knockdown of multiple genes may be improved by the co-silencing of an endogenous reporter gene. The molecular tools developed in this study should facilitate the isolation of genes and the characterization of the functions of multiple genes in this pharmaceutically important species, and these tools should be highly useful for the study of other basidiomycetes.

  3. Transgene-induced gene silencing is not affected by a change in ploidy level.

    Directory of Open Access Journals (Sweden)

    Daniela Pignatta

    Full Text Available BACKGROUND: Whole genome duplication, which results in polyploidy, is a common feature of plant populations and a recurring event in the evolution of flowering plants. Polyploidy can result in changes to gene expression and epigenetic instability. Several epigenetic phenomena, occurring at the transcriptional or post-transcriptional level, have been documented in allopolyploids (polyploids derived from species hybrids of Arabidopsis thaliana, yet findings in autopolyploids (polyploids derived from the duplication of the genome of a single species are limited. Here, we tested the hypothesis that an increase in ploidy enhances transgene-induced post-transcriptional gene silencing using autopolyploids of A. thaliana. METHODOLOGY/PRINCIPAL FINDINGS: Diploid and tetraploid individuals of four independent homozygous transgenic lines of A. thaliana transformed with chalcone synthase (CHS inverted repeat (hairpin constructs were generated. For each line diploids and tetraploids were compared for efficiency in post-transcriptional silencing of the endogenous CHS gene. The four lines differed substantially in their silencing efficiency. Yet, diploid and tetraploid plants derived from these plants and containing therefore identical transgene insertions showed no difference in the efficiency silencing CHS as assayed by visual scoring, anthocyanin assays and quantification of CHS mRNA. CONCLUSIONS/SIGNIFICANCE: Our results in A. thaliana indicated that there is no effect of ploidy level on transgene-induced post-transcriptional gene silencing. Our findings that post-transcriptional mechanisms were equally effective in diploids and tetraploids supports the use of transgene-driven post-transcriptional gene silencing as a useful mechanism to modify gene expression in polyploid species.

  4. Dimerization site 2 of the bacterial DNA-binding protein H-NS is required for gene silencing and stiffened nucleoprotein filament formation.

    Science.gov (United States)

    Yamanaka, Yuki; Winardhi, Ricksen S; Yamauchi, Erika; Nishiyama, So-Ichiro; Sowa, Yoshiyuki; Yan, Jie; Kawagishi, Ikuro; Ishihama, Akira; Yamamoto, Kaneyoshi

    2018-06-15

    The bacterial nucleoid-associated protein H-NS is a DNA-binding protein, playing a major role in gene regulation. To regulate transcription, H-NS silences genes, including horizontally acquired foreign genes. Escherichia coli H-NS is 137 residues long and consists of two discrete and independent structural domains: an N-terminal oligomerization domain and a C-terminal DNA-binding domain, joined by a flexible linker. The N-terminal oligomerization domain is composed of two dimerization sites, dimerization sites 1 and 2, which are both required for H-NS oligomerization, but the exact role of dimerization site 2 in gene silencing is unclear. To this end, we constructed a whole set of single amino acid substitution variants spanning residues 2 to 137. Using a well-characterized H-NS target, the slp promoter of the glutamic acid-dependent acid resistance (GAD) cluster promoters, we screened for any variants defective in gene silencing. Focusing on the function of dimerization site 2, we analyzed four variants, I70C/I70A and L75C/L75A, which all could actively bind DNA but are defective in gene silencing. Atomic force microscopy analysis of DNA-H-NS complexes revealed that all of these four variants formed condensed complexes on DNA, whereas WT H-NS formed rigid and extended nucleoprotein filaments, a conformation required for gene silencing. Single-molecule stretching experiments confirmed that the four variants had lost the ability to form stiffened filaments. We conclude that dimerization site 2 of H-NS plays a key role in the formation of rigid H-NS nucleoprotein filament structures required for gene silencing. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  5. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...

  6. Activation of silenced cytokine gene promoters by the synergistic effect of TBP-TALE and VP64-TALE activators.

    Science.gov (United States)

    Anthony, Kim; More, Abhijit; Zhang, Xiaoliu

    2014-01-01

    Recent work has shown that the combinatorial use of multiple TALE activators can selectively activate certain cellular genes in inaccessible chromatin regions. In this study, we aimed to interrogate the activation potential of TALEs upon transcriptionally silenced immune genes in the context of non-immune cells. We designed a unique strategy, in which a single TALE fused to the TATA-box binding protein (TBP-TALE) is coupled with multiple VP64-TALE activators. We found that our strategy is significantly more potent than multiple TALE activators alone in activating expression of IL-2 and GM-CSF in diverse cell origins in which both genes are otherwise completely silenced. Chromatin analysis revealed that the gene activation was due in part to displacement of a distinctly positioned nucleosome. These studies provide a novel epigenetic mechanism for artificial gene induction and have important implications for targeted cancer immunotherapy, DNA vaccine development, as well as rational design of TALE activators.

  7. Gene duplication, silencing and expression alteration govern the molecular evolution of PRC2 genes in plants.

    Science.gov (United States)

    Furihata, Hazuka Y; Suenaga, Kazuya; Kawanabe, Takahiro; Yoshida, Takanori; Kawabe, Akira

    2016-10-13

    PRC2 genes were analyzed for their number of gene duplications, d N /d S ratios and expression patterns among Brassicaceae and Gramineae species. Although both amino acid sequences and copy number of the PRC2 genes were generally well conserved in both Brassicaceae and Gramineae species, we observed that some rapidly evolving genes experienced duplications and expression pattern changes. After multiple duplication events, all but one or two of the duplicated copies tend to be silenced. Silenced copies were reactivated in the endosperm and showed ectopic expression in developing seeds. The results indicated that rapid evolution of some PRC2 genes is initially caused by a relaxation of selective constraint following the gene duplication events. Several loci could become maternally expressed imprinted genes and acquired functional roles in the endosperm.

  8. Nucleases as a barrier to gene silencing in the cotton boll weevil, Anthonomus grandis.

    Science.gov (United States)

    Almeida Garcia, Rayssa; Lima Pepino Macedo, Leonardo; Cabral do Nascimento, Danila; Gillet, François-Xavier; Moreira-Pinto, Clidia Eduarda; Faheem, Muhammad; Moreschi Basso, Angelina Maria; Mattar Silva, Maria Cristina; Grossi-de-Sa, Maria Fatima

    2017-01-01

    RNA interference (RNAi) approaches have been applied as a biotechnological tool for controlling plant insect pests via selective gene down regulation. However, the inefficiency of RNAi mechanism in insects is associated with several barriers, including dsRNA delivery and uptake by the cell, dsRNA interaction with the cellular membrane receptor and dsRNA exposure to insect gut nucleases during feeding. The cotton boll weevil (Anthonomus grandis) is a coleopteran in which RNAi-mediated gene silencing does not function efficiently through dsRNA feeding, and the factors involved in the mechanism remain unknown. Herein, we identified three nucleases in the cotton boll weevil transcriptome denoted AgraNuc1, AgraNuc2, and AgraNuc3, and the influences of these nucleases on the gene silencing of A. grandis chitin synthase II (AgraChSII) were evaluated through oral dsRNA feeding trials. A phylogenetic analysis showed that all three nucleases share high similarity with the DNA/RNA non-specific endonuclease family of other insects. These nucleases were found to be mainly expressed in the posterior midgut region of the insect. Two days after nuclease RNAi-mediated gene silencing, dsRNA degradation by the gut juice was substantially reduced. Notably, after nucleases gene silencing, the orally delivered dsRNA against the AgraChSII gene resulted in improved gene silencing efficiency when compared to the control (non-silenced nucleases). The data presented here demonstrates that A. grandis midgut nucleases are effectively one of the main barriers to dsRNA delivery and emphasize the need to develop novel RNAi delivery strategies focusing on protecting the dsRNA from gut nucleases and enhancing its oral delivery and uptake to crop insect pests.

  9. Epstein-Barr Virus (EBV) Latent Protein EBNA3A Directly Targets and Silences the STK39 Gene in B Cells Infected by EBV.

    Science.gov (United States)

    Bazot, Quentin; Paschos, Kostas; Allday, Martin J

    2018-04-01

    Epstein-Barr virus (EBV) establishes latent infection in human B cells and is associated with a wide range of cancers. The EBV nuclear antigen 3 (EBNA3) family proteins are critical for B cell transformation and function as transcriptional regulators. It is well established that EBNA3A and EBNA3C cooperate in the regulation of cellular genes. Here, we demonstrate that the gene STK39 is repressed only by EBNA3A. This is the first example of a gene regulated only by EBNA3A in EBV-transformed lymphoblastoid cell lines (LCLs) without the help of EBNA3C. This was demonstrated using a variety of LCLs carrying either knockout, revertant, or conditional EBNA3 recombinants. Investigating the kinetics of EBNA3A-mediated changes in STK39 expression showed that STK39 becomes derepressed quickly after EBNA3A inactivation. This derepression is reversible as EBNA3A reactivation represses STK39 in the same cells expressing a conditional EBNA3A. STK39 is silenced shortly after primary B cell infection by EBV, and no STK39 -encoded protein (SPAK) is detected 3 weeks postinfection. Chromatin immunoprecipitation (ChIP) analysis indicates that EBNA3A directly binds to a regulatory region downstream of the STK39 transcription start site. For the first time, we demonstrated that the polycomb repressive complex 2 with the deposition of the repressive mark H3K27me3 is not only important for the maintenance of an EBNA3A target gene ( STK39 ) but is also essential for the initial establishment of its silencing. Finally, we showed that DNA methyltransferases are involved in the EBNA3A-mediated repression of STK39 IMPORTANCE EBV is well known for its ability to transform B lymphocytes to continuously proliferating lymphoblastoid cell lines. This is achieved in part by the reprogramming of cellular gene transcription by EBV transcription factors, including the EBNA3 proteins that play a crucial role in this process. In the present study, we found that EBNA3A epigenetically silences STK39 This

  10. Receptor-targeted liposome-peptide-siRNA nanoparticles represent an efficient delivery system for MRTF silencing in conjunctival fibrosis.

    Science.gov (United States)

    Yu-Wai-Man, Cynthia; Tagalakis, Aristides D; Manunta, Maria D; Hart, Stephen L; Khaw, Peng T

    2016-02-24

    There is increasing evidence that the Myocardin-related transcription factor/Serum response factor (MRTF/SRF) pathway plays a key role in fibroblast activation and that knocking down MRTF can lead to reduced scarring and fibrosis. Here, we have developed a receptor-targeted liposome-peptide-siRNA nanoparticle as a non-viral delivery system for MRTF-B siRNA in conjunctival fibrosis. Using 50 nM siRNA, the MRTF-B gene was efficiently silenced by 76% and 72% with LYR and LER nanoparticles, respectively. The silencing efficiency was low when non-targeting peptides or siRNA alone or liposome-siRNA alone were used. LYR and LER nanoparticles also showed higher silencing efficiency than PEGylated LYR-P and LER-P nanoparticles. The nanoparticles were not cytotoxic using different liposomes, targeting peptides, and 50 nM siRNA. Three-dimensional fibroblast-populated collagen matrices were also used as a functional assay to measure contraction in vitro, and showed that MRTF-B LYR nanoparticles completely blocked matrix contraction after a single transfection treatment. In conclusion, this is the first study to develop and show that receptor-targeted liposome-peptide-siRNA nanoparticles represent an efficient and safe non-viral siRNA delivery system that could be used to prevent fibrosis after glaucoma filtration surgery and other contractile scarring conditions in the eye.

  11. Development of a virus-induced gene silencing (VIGS) system for Spinacia oleracea L

    DEFF Research Database (Denmark)

    Lee, Jungmin; Cao, Dang Viet; Kim, Jiwon

    2017-01-01

    Virus-induced gene silencing (VIGS) is known as a rapid and efficient system for studying functions of interesting genes in plants. Tobacco rattle virus (TRV) is widely applied for the gene silencing of many plants. Although spinach is a TRV-susceptible plant, a TRV-based VIGS system has not yet ...

  12. Silencing of the SlNAP7 gene influences plastid development and lycopene accumulation in tomato

    Science.gov (United States)

    Fu, Da-Qi; Meng, Lan-Huan; Zhu, Ben-Zhong; Zhu, Hong-Liang; Yan, Hua-Xue; Luo, Yun-Bo

    2016-12-01

    Ripening is an important stage of fruit development. To screen the genes associated with pigment formation in tomato fruit, a suppression subtractive hybridization (SSH) cDNA library was constructed by using tomato fruit in the green ripe and break ripe stages, and 129 differential genes were obtained. Using redness as a screening marker, virus-induced gene silencing (VIGS) of the differential genes was performed with a sprout vacuum-infiltration system (SVI). The results showed that silencing the SlNAP7 gene affected the chloroplast development of tomato leaves, manifesting as a photo-bleaching phenotype, and silenced fruit significantly affected the accumulation of lycopene, manifested as a yellow phenotype. In our study, we found that silencing the SlNAP7 gene downregulates the expression of the POR and PORA genes and destroys the normal development of the chloroplast. The expression of related genes included in the lycopene biosynthesis pathway was not significantly changed, but lycopene accumulation was significantly reduced in tomato fruit. Perhaps it was caused by the destruction of the chromoplast, which leads to the oxidation of lycopene. The results show that the SlNAP7 gene influences chloroplast development and lycopene accumulation in tomato.

  13. Effects of gene silencing of CypB on gastric cancer cells.

    Science.gov (United States)

    Guo, Feng; Zhang, Ying; Zhao, Chun-Na; Li, Lin; Guo, Yan-Jun

    2015-04-01

    To determine the effect of gene silencing of cyclophilin B (CypB) on growth and proliferation of gastric cancer cells. CypB siRNA lentivirus (LV-CypB-si) and control lentivirus (LV-si-con) were produced. CypB expression in gastric cancer cell lines was detected by Western blot. BGC823 and SGC7901 cells were chosen to be infected with LV-si-con and LV-CypB-si, and stable transfectants were isolated. The cell groups transfected with LV-CypB-siRNA, LV-siRNA-con and transfected no carrier were served as the experimental group, the implicit control group and the blank control group respectively. MTT and colony formation assays were used to examine the effect of CypB on the cell growth and proliferation in vitro. Cell cycle was analyzed with flow cytometry. The expression of VEGFR of BGC823-si and SGC7901-si was detected by Western blot. Gene silencing of CypB can inhibit gastric cancer cell growth, proliferation, cell cycle progress and tumorigenesis. CypB expression level was obviously higher in SGC7901 and BGC823 than MKN28 and GES. These two cell lines were infected with LV-si-con and LV-CypB-si respectively. MTT and cloney formation assays showed a significantly decreased rate of cell proliferation from the forth day or the fifth day in cells transfected with LV-CypB-si (PCypB resulted in slightly decreased percentage of S phase and increased percentage of G1 (PCypB could promote the G1-S transition of gastric cancer cell. In addition, the expression of VEGF of BGC823 and SGC7901 transfected with CypB siRNA was reduced in comparison with the implicit control group and the blank control group. Gene silencing of CypB decreases gastric cancer cells proliferation and in vivo tumorigenesis. These findings indiccate CypB could be a potential biomarker and therapeutic target for gastric cancer. Copyright © 2015 Hainan Medical College. Production and hosting by Elsevier B.V. All rights reserved.

  14. High-Throughput Screening Using iPSC-Derived Neuronal Progenitors to Identify Compounds Counteracting Epigenetic Gene Silencing in Fragile X Syndrome.

    Science.gov (United States)

    Kaufmann, Markus; Schuffenhauer, Ansgar; Fruh, Isabelle; Klein, Jessica; Thiemeyer, Anke; Rigo, Pierre; Gomez-Mancilla, Baltazar; Heidinger-Millot, Valerie; Bouwmeester, Tewis; Schopfer, Ulrich; Mueller, Matthias; Fodor, Barna D; Cobos-Correa, Amanda

    2015-10-01

    Fragile X syndrome (FXS) is the most common form of inherited mental retardation, and it is caused in most of cases by epigenetic silencing of the Fmr1 gene. Today, no specific therapy exists for FXS, and current treatments are only directed to improve behavioral symptoms. Neuronal progenitors derived from FXS patient induced pluripotent stem cells (iPSCs) represent a unique model to study the disease and develop assays for large-scale drug discovery screens since they conserve the Fmr1 gene silenced within the disease context. We have established a high-content imaging assay to run a large-scale phenotypic screen aimed to identify compounds that reactivate the silenced Fmr1 gene. A set of 50,000 compounds was tested, including modulators of several epigenetic targets. We describe an integrated drug discovery model comprising iPSC generation, culture scale-up, and quality control and screening with a very sensitive high-content imaging assay assisted by single-cell image analysis and multiparametric data analysis based on machine learning algorithms. The screening identified several compounds that induced a weak expression of fragile X mental retardation protein (FMRP) and thus sets the basis for further large-scale screens to find candidate drugs or targets tackling the underlying mechanism of FXS with potential for therapeutic intervention. © 2015 Society for Laboratory Automation and Screening.

  15. Gene silencing in primary and metastatic tumors by small interfering RNA delivery in mice: quantitative analysis using melanoma cells expressing firefly and sea pansy luciferases.

    Science.gov (United States)

    Takahashi, Yuki; Nishikawa, Makiya; Kobayashi, Naoki; Takakura, Yoshinobu

    2005-07-20

    Silencing of oncogenes or other genes contributing to tumor malignancy or progression by RNA interference (RNAi) offers a promising approach to treating tumor patients. To achieve RNAi-based tumor therapy, a small interfering RNA (siRNA) or siRNA-expressing vector needs to be delivered to tumor cells, but little information about its in vivo delivery has been reported. In this study, we examined whether the expression of the target gene in tumor cells can be suppressed by the delivery of RNAi effectors to primary and metastatic tumor cells. To quantitatively evaluate the RNAi effects in tumor cells, mouse melanoma B16-BL6 cells were stably transfected with both firefly (a model target gene) and sea pansy (an internal standard gene) luciferase genes to obtain B16-BL6/dual Luc cells. The target gene expression in subcutaneous primary tumors of B16-BL6/dual Luc cells was significantly suppressed by direct injection of the RNAi effectors followed by electroporation. The expression in metastatic hepatic tumors was also significantly reduced by an intravenous injection of either RNAi effector by the hydrodynamics-based procedure. These results indicate that the both RNAi effectors have a potential to silence target gene in tumor cells in vivo when successfully delivered to tumor cells.

  16. LNA-antisense rivals siRNA for gene silencing

    DEFF Research Database (Denmark)

    Jepsen, Jan Stenvang; Wengel, Jesper; Stenvang, Jan

    2004-01-01

    Locked nucleic acid (LNA) is a class of nucleic acid analogs possessing unprecedented binding affinity toward complementary DNA and RNA while obeying the Watson-Crick base-pairing rules. For efficient gene silencing in vitro and in vivo, fully modified or chimeric LNA oligonucleotides have been a...

  17. A Foxtail mosaic virus Vector for Virus-Induced Gene Silencing in Maize.

    Science.gov (United States)

    Mei, Yu; Zhang, Chunquan; Kernodle, Bliss M; Hill, John H; Whitham, Steven A

    2016-06-01

    Plant viruses have been widely used as vectors for foreign gene expression and virus-induced gene silencing (VIGS). A limited number of viruses have been developed into viral vectors for the purposes of gene expression or VIGS in monocotyledonous plants, and among these, the tripartite viruses Brome mosaic virus and Cucumber mosaic virus have been shown to induce VIGS in maize (Zea mays). We describe here a new DNA-based VIGS system derived from Foxtail mosaic virus (FoMV), a monopartite virus that is able to establish systemic infection and silencing of endogenous maize genes homologous to gene fragments inserted into the FoMV genome. To demonstrate VIGS applications of this FoMV vector system, four genes, phytoene desaturase (functions in carotenoid biosynthesis), lesion mimic22 (encodes a key enzyme of the porphyrin pathway), iojap (functions in plastid development), and brown midrib3 (caffeic acid O-methyltransferase), were silenced and characterized in the sweet corn line Golden × Bantam. Furthermore, we demonstrate that the FoMV infectious clone establishes systemic infection in maize inbred lines, sorghum (Sorghum bicolor), and green foxtail (Setaria viridis), indicating the potential wide applications of this viral vector system for functional genomics studies in maize and other monocots. © 2016 American Society of Plant Biologists. All Rights Reserved.

  18. GW182-Free microRNA Silencing Complex Controls Post-transcriptional Gene Expression during Caenorhabditis elegans Embryogenesis.

    Directory of Open Access Journals (Sweden)

    Guillaume Jannot

    2016-12-01

    Full Text Available MicroRNAs and Argonaute form the microRNA induced silencing complex or miRISC that recruits GW182, causing mRNA degradation and/or translational repression. Despite the clear conservation and molecular significance, it is unknown if miRISC-GW182 interaction is essential for gene silencing during animal development. Using Caenorhabditis elegans to explore this question, we examined the relationship and effect on gene silencing between the GW182 orthologs, AIN-1 and AIN-2, and the microRNA-specific Argonaute, ALG-1. Homology modeling based on human Argonaute structures indicated that ALG-1 possesses conserved Tryptophan-binding Pockets required for GW182 binding. We show in vitro and in vivo that their mutations severely altered the association with AIN-1 and AIN-2. ALG-1 tryptophan-binding pockets mutant animals retained microRNA-binding and processing ability, but were deficient in reporter silencing activity. Interestingly, the ALG-1 tryptophan-binding pockets mutant phenocopied the loss of alg-1 in worms during larval stages, yet was sufficient to rescue embryonic lethality, indicating the dispensability of AINs association with the miRISC at this developmental stage. The dispensability of AINs in miRNA regulation is further demonstrated by the capacity of ALG-1 tryptophan-binding pockets mutant to regulate a target of the embryonic mir-35 microRNA family. Thus, our results demonstrate that the microRNA pathway can act independently of GW182 proteins during C. elegans embryogenesis.

  19. Telomerase Reverse Transcriptase Deficiency Prevents Neointima Formation Through Chromatin Silencing of E2F1 Target Genes.

    Science.gov (United States)

    Endorf, Elizabeth B; Qing, Hua; Aono, Jun; Terami, Naoto; Doyon, Geneviève; Hyzny, Eric; Jones, Karrie L; Findeisen, Hannes M; Bruemmer, Dennis

    2017-02-01

    Aberrant proliferation of smooth muscle cells (SMC) in response to injury induces pathological vascular remodeling during atherosclerosis and neointima formation. Telomerase is rate limiting for tissue renewal and cell replication; however, the physiological role of telomerase in vascular diseases remains to be determined. The goal of the present study was to determine whether telomerase reverse transcriptase (TERT) affects proliferative vascular remodeling and to define the molecular mechanism by which TERT supports SMC proliferation. We first demonstrate high levels of TERT expression in replicating SMC of atherosclerotic and neointimal lesions. Using a model of guidewire-induced arterial injury, we demonstrate decreased neointima formation in TERT-deficient mice. Studies in SMC isolated from TERT-deficient and TERT overexpressing mice with normal telomere length established that TERT is necessary and sufficient for cell proliferation. TERT deficiency did not induce a senescent phenotype but resulted in G1 arrest albeit hyperphosphorylation of the retinoblastoma protein. This proliferative arrest was associated with stable silencing of the E2F1-dependent S-phase gene expression program and not reversed by ectopic overexpression of E2F1. Finally, chromatin immunoprecipitation and accessibility assays revealed that TERT is recruited to E2F1 target sites and promotes chromatin accessibility for E2F1 by facilitating the acquisition of permissive histone modifications. These data indicate a previously unrecognized role for TERT in neointima formation through epigenetic regulation of proliferative gene expression in SMC. © 2016 American Heart Association, Inc.

  20. Characterization of a Brome mosaic virus strain and its use as a vector for gene silencing in monocotyledonous hosts.

    Science.gov (United States)

    Ding, Xin Shun; Schneider, William L; Chaluvadi, Srinivasa Rao; Mian, M A Rouf; Nelson, Richard S

    2006-11-01

    Virus-induced gene silencing (VIGS) is used to analyze gene function in dicotyledonous plants but less so in monocotyledonous plants (particularly rice and corn), partially due to the limited number of virus expression vectors available. Here, we report the cloning and modification for VIGS of a virus from Festuca arundinacea Schreb. (tall fescue) that caused systemic mosaic symptoms on barley, rice, and a specific cultivar of maize (Va35) under greenhouse conditions. Through sequencing, the virus was determined to be a strain of Brome mosaic virus (BMV). The virus was named F-BMV (F for Festuca), and genetic determinants that controlled the systemic infection of rice were mapped to RNAs 1 and 2 of the tripartite genome. cDNA from RNA 3 of the Russian strain of BMV (R-BMV) was modified to accept inserts from foreign genes. Coinoculation of RNAs 1 and 2 from F-BMV and RNA 3 from R-BMV expressing a portion of a plant gene to leaves of barley, rice, and maize plants resulted in visual silencing-like phenotypes. The visual phenotypes were correlated with decreased target host transcript levels in the corresponding leaves. The VIGS visual phenotype varied from maintained during silencing of actin 1 transcript expression to transient with incomplete penetration through affected tissue during silencing of phytoene desaturase expression. F-BMV RNA 3 was modified to allow greater accumulation of virus while minimizing virus pathogenicity. The modified vector C-BMV(A/G) (C for chimeric) was shown to be useful for VIGS. These BMV vectors will be useful for analysis of gene function in rice and maize for which no VIGS system is reported.

  1. Silencing of Soybean Raffinose Synthase Gene Reduced Raffinose Family Oligosaccharides and Increased True Metabolizable Energy of Poultry Feed

    Directory of Open Access Journals (Sweden)

    Michelle F. Valentine

    2017-05-01

    Full Text Available Soybean [Glycine max (L. Merr.] is the number one oil and protein crop in the United States, but the seed contains several anti-nutritional factors that are toxic to both humans and livestock. RNA interference technology has become an increasingly popular technique in gene silencing because it allows for both temporal and spatial targeting of specific genes. The objective of this research is to use RNA-mediated gene silencing to down-regulate the soybean gene raffinose synthase 2 (RS2, to reduce total raffinose content in mature seed. Raffinose is a trisaccharide that is indigestible to humans and monogastric animals, and as monogastric animals are the largest consumers of soy products, reducing raffinose would improve the nutritional quality of soybean. An RNAi construct targeting RS2 was designed, cloned, and transformed to the soybean genome via Agrobacterium-mediated transformation. Resulting plants were analyzed for the presence and number of copies of the transgene by PCR and Southern blot. The efficiency of mRNA silencing was confirmed by real-time quantitative PCR. Total raffinose content was determined by HPLC analysis. Transgenic plant lines were recovered that exhibited dramatically reduced levels of raffinose in mature seed, and these lines were further analyzed for other phenotypes such as development and yield. Additionally, a precision-fed rooster assay was conducted to measure the true metabolizable energy (TME in full-fat soybean meal made from the wild-type or transgenic low-raffinose soybean lines. Transgenic low-raffinose soy had a measured TME of 2,703 kcal/kg, an increase as compared with 2,411 kcal/kg for wild-type. As low digestible energy is a major limiting factor in the percent of soybean meal that can be used in poultry diets, these results may substantiate the use of higher concentrations of low-raffinose, full-fat soy in formulated livestock diets.

  2. Silencing of Soybean Raffinose Synthase Gene Reduced Raffinose Family Oligosaccharides and Increased True Metabolizable Energy of Poultry Feed

    Science.gov (United States)

    Valentine, Michelle F.; De Tar, Joann R.; Mookkan, Muruganantham; Firman, Jeffre D.; Zhang, Zhanyuan J.

    2017-01-01

    Soybean [Glycine max (L.) Merr.] is the number one oil and protein crop in the United States, but the seed contains several anti-nutritional factors that are toxic to both humans and livestock. RNA interference technology has become an increasingly popular technique in gene silencing because it allows for both temporal and spatial targeting of specific genes. The objective of this research is to use RNA-mediated gene silencing to down-regulate the soybean gene raffinose synthase 2 (RS2), to reduce total raffinose content in mature seed. Raffinose is a trisaccharide that is indigestible to humans and monogastric animals, and as monogastric animals are the largest consumers of soy products, reducing raffinose would improve the nutritional quality of soybean. An RNAi construct targeting RS2 was designed, cloned, and transformed to the soybean genome via Agrobacterium-mediated transformation. Resulting plants were analyzed for the presence and number of copies of the transgene by PCR and Southern blot. The efficiency of mRNA silencing was confirmed by real-time quantitative PCR. Total raffinose content was determined by HPLC analysis. Transgenic plant lines were recovered that exhibited dramatically reduced levels of raffinose in mature seed, and these lines were further analyzed for other phenotypes such as development and yield. Additionally, a precision-fed rooster assay was conducted to measure the true metabolizable energy (TME) in full-fat soybean meal made from the wild-type or transgenic low-raffinose soybean lines. Transgenic low-raffinose soy had a measured TME of 2,703 kcal/kg, an increase as compared with 2,411 kcal/kg for wild-type. As low digestible energy is a major limiting factor in the percent of soybean meal that can be used in poultry diets, these results may substantiate the use of higher concentrations of low-raffinose, full-fat soy in formulated livestock diets. PMID:28559898

  3. Identification and characterization of a silencer regulatory element in the 3'-flanking region of the murine CD46 gene.

    Science.gov (United States)

    Nomura, M; Tsujimura, A; Begum, N A; Matsumoto, M; Wabiko, H; Toyoshima, K; Seya, T

    2000-01-01

    The murine membrane cofactor protein (CD46) gene is expressed exclusively in testis, in contrast to human CD46, which is expressed ubiquitously. To elucidate the mechanism of differential CD46 gene expression among species, we cloned entire murine CD46 genomic DNA and possible regulatory regions were placed in the flanking region of the luciferase reporter gene. The reporter gene assay revealed a silencing activity not in the promoter, but in the 3'-flanking region of the gene and the silencer-like element was identified within a 0.2-kb region between 0.6 and 0.8 kb downstream of the stop codon. This silencer-like element was highly similar to that of the pig MHC class-I gene. The introduction of a mutation into this putative silencer element of murine CD46 resulted in an abrogation of the silencing effect. Electrophoretic mobility-shift assay indicated the presence of the binding molecule(s) for this silencer sequence in murine cell lines and tissues. A size difference of the protein-silencer-element complex was observed depending upon the solubilizers used for preparation of the nuclear extracts. A mutated silencer sequence failed to interact with the binding molecules. The level of the binding factor was lower in the testicular germ cells compared with other organs. Thus the silencer element and its binding factor may play a role in transcriptional regulation of murine CD46 gene expression. These results imply that the effects of the CD46 silencer element encompass the innate immune and reproductive systems, and in mice may determine the testicular germ-cell-dominant expression of CD46. PMID:11023821

  4. Silencing of vacuolar invertase and asparagine synthetase genes and its impact on acrylamide formation of fried potato products.

    Science.gov (United States)

    Zhu, Xiaobiao; Gong, Huiling; He, Qunyan; Zeng, Zixian; Busse, James S; Jin, Weiwei; Bethke, Paul C; Jiang, Jiming

    2016-02-01

    Acrylamide is produced in a wide variety of carbohydrate-rich foods during high-temperature cooking. Dietary acrylamide is a suspected human carcinogen, and health concerns related to dietary acrylamide have been raised worldwide. French fries and potato chips contribute a significant proportion to the average daily intake of acrylamide, especially in developed countries. One way to mitigate health concerns related to acrylamide is to develop potato cultivars that have reduced contents of the acrylamide precursors asparagine, glucose and fructose in tubers. We generated a large number of silencing lines of potato cultivar Russet Burbank by targeting the vacuolar invertase gene VInv and the asparagine synthetase genes StAS1 and StAS2 with a single RNA interference construct. The transcription levels of these three genes were correlated with reducing sugar (glucose and fructose) and asparagine content in tubers. Fried potato products from the best VInv/StAS1/StAS2-triple silencing lines contained only one-fifteenth of the acrylamide content of the controls. Interestingly, the extent of acrylamide reduction of the best triple silencing lines was similar to that of the best VInv-single silencing lines developed previously from the same potato cultivar Russet Burbank. These results show that an acrylamide mitigation strategy focused on developing potato cultivars with low reducing sugars is likely to be an effective and sufficient approach for minimizing the acrylamide-forming potential of French fry processing potatoes. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  5. RNAi-based therapeutic nanostrategy: IL-8 gene silencing in pancreatic cancer cells using gold nanorods delivery vehicles

    International Nuclear Information System (INIS)

    Panwar, Nishtha; Yang, Chengbin; Yin, Feng; Chuan, Tjin Swee; Yong, Ken-Tye; Yoon, Ho Sup

    2015-01-01

    RNA interference (RNAi)-based gene silencing possesses great ability for therapeutic intervention in pancreatic cancer. Among various oncogene mutations, Interleukin-8 (IL-8) gene mutations are found to be overexpressed in many pancreatic cell lines. In this work, we demonstrate IL-8 gene silencing by employing an RNAi-based gene therapy approach and this is achieved by using gold nanorods (AuNRs) for efficient delivery of IL-8 small interfering RNA (siRNA) to the pancreatic cell lines of MiaPaCa-2 and Panc-1. Upon comparing to Panc-1 cells, we found that the dominant expression of the IL-8 gene in MiaPaCa-2 cells resulted in an aggressive behavior towards the processes of cell invasion and metastasis. We have hence investigated the suitability of using AuNRs as novel non-viral nanocarriers for the efficient uptake and delivery of IL-8 siRNA in realizing gene knockdown of both MiaPaCa-2 and Panc-1 cells. Flow cytometry and fluorescence imaging techniques have been applied to confirm transfection and release of IL-8 siRNA. The ratio of AuNRs and siRNA has been optimized and transfection efficiencies as high as 88.40 ± 2.14% have been achieved. Upon successful delivery of IL-8 siRNA into cancer cells, the effects of IL-8 gene knockdown are quantified in terms of gene expression, cell invasion, cell migration and cell apoptosis assays. Statistical comparative studies for both MiaPaCa-2 and Panc-1 cells are presented in this work. IL-8 gene silencing has been demonstrated with knockdown efficiencies of 81.02 ± 10.14% and 75.73 ± 6.41% in MiaPaCa-2 and Panc-1 cells, respectively. Our results are then compared with a commercial transfection reagent, Oligofectamine, serving as positive control. The gene knockdown results illustrate the potential role of AuNRs as non-viral gene delivery vehicles for RNAi-based targeted cancer therapy applications. (paper)

  6. De-repressing LncRNA-Targeted Genes to Upregulate Gene Expression: Focus on Small Molecule Therapeutics

    Directory of Open Access Journals (Sweden)

    Roya Pedram Fatemi

    2014-01-01

    Full Text Available Non-protein coding RNAs (ncRNAs make up the overwhelming majority of transcripts in the genome and have recently gained attention for their complex regulatory role in cells, including the regulation of protein-coding genes. Furthermore, ncRNAs play an important role in normal development and their expression levels are dysregulated in several diseases. Recently, several long noncoding RNAs (lncRNAs have been shown to alter the epigenetic status of genomic loci and suppress the expression of target genes. This review will present examples of such a mechanism and focus on the potential to target lncRNAs for achieving therapeutic gene upregulation by de-repressing genes that are epigenetically silenced in various diseases. Finally, the potential to target lncRNAs, through their interactions with epigenetic enzymes, using various tools, such as small molecules, viral vectors and antisense oligonucleotides, will be discussed. We suggest that small molecule modulators of a novel class of drug targets, lncRNA-protein interactions, have great potential to treat some cancers, cardiovascular disease, and neurological disorders.

  7. Gene silencing in Tribolium castaneum as a tool for the targeted identification of candidate RNAi targets in crop pests.

    Science.gov (United States)

    Knorr, Eileen; Fishilevich, Elane; Tenbusch, Linda; Frey, Meghan L F; Rangasamy, Murugesan; Billion, Andre; Worden, Sarah E; Gandra, Premchand; Arora, Kanika; Lo, Wendy; Schulenberg, Greg; Valverde-Garcia, Pablo; Vilcinskas, Andreas; Narva, Kenneth E

    2018-02-01

    RNAi shows potential as an agricultural technology for insect control, yet, a relatively low number of robust lethal RNAi targets have been demonstrated to control insects of agricultural interest. In the current study, a selection of lethal RNAi target genes from the iBeetle (Tribolium castaneum) screen were used to demonstrate efficacy of orthologous targets in the economically important coleopteran pests Diabrotica virgifera virgifera and Meligethes aeneus. Transcript orthologs of 50 selected genes were analyzed in D. v. virgifera diet-based RNAi bioassays; 21 of these RNAi targets showed mortality and 36 showed growth inhibition. Low dose injection- and diet-based dsRNA assays in T. castaneum and D. v. virgifera, respectively, enabled the identification of the four highly potent RNAi target genes: Rop, dre4, ncm, and RpII140. Maize was genetically engineered to express dsRNA directed against these prioritized candidate target genes. T 0 plants expressing Rop, dre4, or RpII140 RNA hairpins showed protection from D. v. virgifera larval feeding damage. dsRNA targeting Rop, dre4, ncm, and RpII140 in M. aeneus also caused high levels of mortality both by injection and feeding. In summary, high throughput systems for model organisms can be successfully used to identify potent RNA targets for difficult-to-work with agricultural insect pests.

  8. Silencing SlMED18, tomato Mediator subunit 18 gene, restricts internode elongation and leaf expansion.

    Science.gov (United States)

    Wang, Yunshu; Hu, Zongli; Zhang, Jianling; Yu, XiaoHui; Guo, Jun-E; Liang, Honglian; Liao, Changguang; Chen, Guoping

    2018-02-19

    Mediator complex, a conserved multi-protein, is necessary for controlling RNA polymerase II (Pol II) transcription in eukaryotes. Given little is known about them in tomato, a tomato Mediator subunit 18 gene was isolated and named SlMED18. To further explore the function of SlMED18, the transgenic tomato plants targeting SlMED18 by RNAi-mediated gene silencing were generated. The SlMED18-RNAi lines exhibited multiple developmental defects, including smaller size and slower growth rate of plant and significantly smaller compound leaves. The contents of endogenous bioactive GA 3 in SlMED18 silenced lines were slightly less than that in wild type. Furthermore, qRT-PCR analysis indicated that expression of gibberellins biosynthesis genes such as SlGACPS and SlGA20x2, auxin transport genes (PIN1, PIN4, LAX1 and LAX2) and several key regulators, KNOX1, KNOX2, PHAN and LANCEOLATE(LA), which involved in the leaf morphogenesis were significantly down-regulated in SlMED18-RNAi lines. These results illustrated that SlMED18 plays an essential role in regulating plant internode elongation and leaf expansion in tomato plants and it acts as a key positive regulator of gibberellins biosynthesis and signal transduction as well as auxin proper transport signalling. These findings are the basis for understanding the function of the individual Mediator subunits in tomato.

  9. Identification of Novel Fibrosis Modifiers by In Vivo siRNA Silencing

    Directory of Open Access Journals (Sweden)

    Elisabeth H. Vollmann

    2017-06-01

    Full Text Available Fibrotic diseases contribute to 45% of deaths in the industrialized world, and therefore a better understanding of the pathophysiological mechanisms underlying tissue fibrosis is sorely needed. We aimed to identify novel modifiers of tissue fibrosis expressed by myofibroblasts and their progenitors in their disease microenvironment through RNA silencing in vivo. We leveraged novel biology, targeting genes upregulated during liver and kidney fibrosis in this cell lineage, and employed small interfering RNA (siRNA-formulated lipid nanoparticles technology to silence these genes in carbon-tetrachloride-induced liver fibrosis in mice. We identified five genes, Egr2, Atp1a2, Fkbp10, Fstl1, and Has2, which modified fibrogenesis based on their silencing, resulting in reduced Col1a1 mRNA levels and collagen accumulation in the liver. These genes fell into different groups based on the effects of their silencing on a transcriptional mini-array and histological outcomes. Silencing of Egr2 had the broadest effects in vivo and also reduced fibrogenic gene expression in a human fibroblast cell line. Prior to our study, Egr2, Atp1a2, and Fkbp10 had not been functionally validated in fibrosis in vivo. Thus, our results provide a major advance over the existing knowledge of fibrogenic pathways. Our study is the first example of a targeted siRNA assay to identify novel fibrosis modifiers in vivo.

  10. Smuggling gold nanoparticles across cell types - A new role for exosomes in gene silencing.

    Science.gov (United States)

    Roma-Rodrigues, Catarina; Pereira, Francisca; Alves de Matos, António P; Fernandes, Marta; Baptista, Pedro V; Fernandes, Alexandra R

    2017-05-01

    Once released to the extracellular space, exosomes enable the transfer of proteins, lipids and RNA between different cells, being able to modulate the recipient cells' phenotypes. Members of the Rab small GTP-binding protein family, such as RAB27A, are responsible for the coordination of several steps in vesicle trafficking, including budding, mobility, docking and fusion. The use of gold nanoparticles (AuNPs) for gene silencing is considered a cutting-edge technology. Here, AuNPs were functionalized with thiolated oligonucleotides anti-RAB27A (AuNP@PEG@anti-RAB27A) for selective silencing of the gene with a consequent decrease of exosomes´ release by MCF-7 and MDA-MB-453 cells. Furthermore, communication between tumor and normal cells was observed both in terms of alterations in c-Myc gene expression and transportation of the AuNPs, mediating gene silencing in secondary cells. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Targeting Herpetic Keratitis by Gene Therapy

    Directory of Open Access Journals (Sweden)

    Hossein Mostafa Elbadawy

    2012-01-01

    Full Text Available Ocular gene therapy is rapidly becoming a reality. By November 2012, approximately 28 clinical trials were approved to assess novel gene therapy agents. Viral infections such as herpetic keratitis caused by herpes simplex virus 1 (HSV-1 can cause serious complications that may lead to blindness. Recurrence of the disease is likely and cornea transplantation, therefore, might not be the ideal therapeutic solution. This paper will focus on the current situation of ocular gene therapy research against herpetic keratitis, including the use of viral and nonviral vectors, routes of delivery of therapeutic genes, new techniques, and key research strategies. Whereas the correction of inherited diseases was the initial goal of the field of gene therapy, here we discuss transgene expression, gene replacement, silencing, or clipping. Gene therapy of herpetic keratitis previously reported in the literature is screened emphasizing candidate gene therapy targets. Commonly adopted strategies are discussed to assess the relative advantages of the protective therapy using antiviral drugs and the common gene therapy against long-term HSV-1 ocular infections signs, inflammation and neovascularization. Successful gene therapy can provide innovative physiological and pharmaceutical solutions against herpetic keratitis.

  12. Small RNA-Mediated Epigenetic Myostatin Silencing

    Directory of Open Access Journals (Sweden)

    Thomas C Roberts

    2012-01-01

    Full Text Available Myostatin (Mstn is a secreted growth factor that negatively regulates muscle mass and is therefore a potential pharmacological target for the treatment of muscle wasting disorders such as Duchenne muscular dystrophy. Here we describe a novel Mstn blockade approach in which small interfering RNAs (siRNAs complementary to a promoter-associated transcript induce transcriptional gene silencing (TGS in two differentiated mouse muscle cell lines. Silencing is sensitive to treatment with the histone deacetylase inhibitor trichostatin A, and the silent state chromatin mark H3K9me2 is enriched at the Mstn promoter following siRNA transfection, suggesting epigenetic remodeling underlies the silencing effect. These observations suggest that long-term epigenetic silencing may be feasible for Mstn and that TGS is a promising novel therapeutic strategy for the treatment of muscle wasting disorders.

  13. High-Throughput Screening of a Luciferase Reporter of Gene Silencing on the Inactive X Chromosome.

    Science.gov (United States)

    Keegan, Alissa; Plath, Kathrin; Damoiseaux, Robert

    2018-01-01

    Assays of luciferase gene activity are a sensitive and quantitative reporter system suited to high-throughput screening. We adapted a luciferase assay to a screening strategy for identifying factors that reactivate epigenetically silenced genes. This epigenetic luciferase reporter is subject to endogenous gene silencing mechanisms on the inactive X chromosome (Xi) in primary mouse cells and thus captures the multilayered nature of chromatin silencing in development. Here, we describe the optimization of an Xi-linked luciferase reactivation assay in 384-well format and adaptation of the assay for high-throughput siRNA and chemical screening. Xi-luciferase reactivation screening has applications in stem cell biology and cancer therapy. We have used the approach described here to identify chromatin-modifying proteins and to identify drug combinations that enhance the gene reactivation activity of the DNA demethylating drug 5-aza-2'-deoxycytidine.

  14. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    2016-11-09

    Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...

  15. Gene silencing activity of siRNA polyplexes based on thiolated N,N,N-trimethylated chitosan.

    Science.gov (United States)

    Varkouhi, Amir K; Verheul, Rolf J; Schiffelers, Raymond M; Lammers, Twan; Storm, Gert; Hennink, Wim E

    2010-12-15

    N,N,N-Trimethylated chitosan (TMC) is a biodegradable polymer emerging as a promising nonviral vector for nucleic acid and protein delivery. In the present study, we investigated whether the introduction of thiol groups in TMC enhances the extracellular stability of the complexes based on this polymer and promotes the intracellular release of siRNA. The gene silencing activity and the cellular cytotoxicity of polyplexes based on thiolated TMC were compared with those based on the nonthiolated counterpart and the regularly used lipidic transfection agent Lipofectamine. Incubation of H1299 human lung cancer cells expressing firefly luciferase with siRNA/thiolated TMC polyplexes resulted in 60-80% gene silencing activity, whereas complexes based on nonthiolated TMC showed less silencing (40%). The silencing activity of the complexes based on Lipofectamine 2000 was about 60-70%. Importantly, the TMC-SH polyplexes retained their silencing activity in the presence of hyaluronic acid, while nonthiolated TMC polyplexes hardly showed any silencing activity, demonstrating their stability against competing anionic macromolecules. Under the experimental conditions tested, the cytotoxicity of the thiolated and nonthiolated siRNA complexes was lower than those based on Lipofectamine. Given the good extracellular stability and good silencing activity, it is concluded that polyplexes based on TMC-SH are attractive systems for further in vivo evaluations.

  16. A var gene promoter implicated in severe malaria nucleates silencing and is regulated by 3' untranslated region and intronic cis-elements.

    Science.gov (United States)

    Muhle, Rebecca A; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J; Muhle, Michael E; Fidock, David A

    2009-11-01

    Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitised erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilising the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var subtelomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronised parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may result from the integrated UpsA promoter being largely silenced by the neighbouring cg6 promoter. Our analyses also revealed that the DownsA 3' untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA-promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyse promoter activity of Group A var genes, which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of var

  17. Simultaneous silencing of multiple genes in the apple scab fungus, Venturia inaequalis, by expression of RNA with chimeric inverted repeats

    NARCIS (Netherlands)

    Fitzgerald, A.; Kan, van J.A.L.; Plummer, K.M.

    2004-01-01

    RNA-mediated gene silencing has been demonstrated in plants, animals, and more recently in filamentous fungi. Here, we report high frequency, RNA-mediated gene silencing in the apple scab fungus, Venturia inaequalis. The green fluorescent protein (GFP) transgene was silenced in a GFP-expressing

  18. Antiviral RNA silencing suppression activity of Tomato spotted wilt virus NSs protein.

    Science.gov (United States)

    Ocampo Ocampo, T; Gabriel Peralta, S M; Bacheller, N; Uiterwaal, S; Knapp, A; Hennen, A; Ochoa-Martinez, D L; Garcia-Ruiz, H

    2016-06-17

    In addition to regulating gene expression, RNA silencing is an essential antiviral defense system in plants. Triggered by double-stranded RNA, silencing results in degradation or translational repression of target transcripts. Viruses are inducers and targets of RNA silencing. To condition susceptibility, most plant viruses encode silencing suppressors that interfere with this process, such as the Tomato spotted wilt virus (TSWV) NSs protein. The mechanism by which NSs suppresses RNA silencing and its role in viral infection and movement remain to be determined. We cloned NSs from the Hawaii isolate of TSWV and using two independent assays show for the first time that this protein restored pathogenicity and supported the formation of local infection foci by suppressor-deficient Turnip mosaic virus and Turnip crinkle virus. Demonstrating the suppression of RNA silencing directed against heterologous viruses establishes the foundation to determine the means used by NSs to block this antiviral process.

  19. Silencing the Honey Bee (Apis mellifera) Naked Cuticle Gene (nkd) Improves Host Immune Function and Reduces Nosema ceranae Infections

    Science.gov (United States)

    Li, Wenfeng; Evans, Jay D.; Huang, Qiang; Rodríguez-García, Cristina; Liu, Jie; Hamilton, Michele; Grozinger, Christina M.; Webster, Thomas C.; Su, Songkun

    2016-01-01

    ABSTRACT Nosema ceranae is a new and emerging microsporidian parasite of European honey bees, Apis mellifera, that has been implicated in colony losses worldwide. RNA interference (RNAi), a posttranscriptional gene silencing mechanism, has emerged as a potent and specific strategy for controlling infections of parasites and pathogens in honey bees. While previous studies have focused on the silencing of parasite/pathogen virulence factors, we explore here the possibility of silencing a host factor as a mechanism for reducing parasite load. Specifically, we used an RNAi strategy to reduce the expression of a honey bee gene, naked cuticle (nkd), which is a negative regulator of host immune function. Our studies found that nkd mRNA levels in adult bees were upregulated by N. ceranae infection (and thus, the parasite may use this mechanism to suppress host immune function) and that ingestion of double-stranded RNA (dsRNA) specific to nkd efficiently silenced its expression. Furthermore, we found that RNAi-mediated knockdown of nkd transcripts in Nosema-infected bees resulted in upregulation of the expression of several immune genes (Abaecin, Apidaecin, Defensin-1, and PGRP-S2), reduction of Nosema spore loads, and extension of honey bee life span. The results of our studies clearly indicate that silencing the host nkd gene can activate honey bee immune responses, suppress the reproduction of N. ceranae, and improve the overall health of honey bees. This study represents a novel host-derived therapeutic for honey bee disease treatment that merits further exploration. IMPORTANCE Given the critical role of honey bees in the pollination of agricultural crops, it is urgent to develop strategies to prevent the colony decline induced by the infection of parasites/pathogens. Targeting parasites and pathogens directly by RNAi has been proven to be useful for controlling infections in honey bees, but little is known about the disease impacts of RNAi silencing of host factors

  20. Silencing the Honey Bee (Apis mellifera) Naked Cuticle Gene (nkd) Improves Host Immune Function and Reduces Nosema ceranae Infections.

    Science.gov (United States)

    Li, Wenfeng; Evans, Jay D; Huang, Qiang; Rodríguez-García, Cristina; Liu, Jie; Hamilton, Michele; Grozinger, Christina M; Webster, Thomas C; Su, Songkun; Chen, Yan Ping

    2016-11-15

    Nosema ceranae is a new and emerging microsporidian parasite of European honey bees, Apis mellifera, that has been implicated in colony losses worldwide. RNA interference (RNAi), a posttranscriptional gene silencing mechanism, has emerged as a potent and specific strategy for controlling infections of parasites and pathogens in honey bees. While previous studies have focused on the silencing of parasite/pathogen virulence factors, we explore here the possibility of silencing a host factor as a mechanism for reducing parasite load. Specifically, we used an RNAi strategy to reduce the expression of a honey bee gene, naked cuticle (nkd), which is a negative regulator of host immune function. Our studies found that nkd mRNA levels in adult bees were upregulated by N. ceranae infection (and thus, the parasite may use this mechanism to suppress host immune function) and that ingestion of double-stranded RNA (dsRNA) specific to nkd efficiently silenced its expression. Furthermore, we found that RNAi-mediated knockdown of nkd transcripts in Nosema-infected bees resulted in upregulation of the expression of several immune genes (Abaecin, Apidaecin, Defensin-1, and PGRP-S2), reduction of Nosema spore loads, and extension of honey bee life span. The results of our studies clearly indicate that silencing the host nkd gene can activate honey bee immune responses, suppress the reproduction of N. ceranae, and improve the overall health of honey bees. This study represents a novel host-derived therapeutic for honey bee disease treatment that merits further exploration. Given the critical role of honey bees in the pollination of agricultural crops, it is urgent to develop strategies to prevent the colony decline induced by the infection of parasites/pathogens. Targeting parasites and pathogens directly by RNAi has been proven to be useful for controlling infections in honey bees, but little is known about the disease impacts of RNAi silencing of host factors. Here, we demonstrate

  1. Silencing of copine genes confers common wheat enhanced resistance to powdery mildew.

    Science.gov (United States)

    Zou, Baohong; Ding, Yuan; Liu, He; Hua, Jian

    2018-06-01

    Powdery mildew, caused by the biotrophic fungal pathogen Blumeria graminis f. sp. tritici (Bgt), is a major threat to the production of wheat (Triticum aestivum). It is of great importance to identify new resistance genes for the generation of Bgt-resistant or Bgt-tolerant wheat varieties. Here, we show that the wheat copine genes TaBON1 and TaBON3 negatively regulate wheat disease resistance to Bgt. Two copies of TaBON1 and three copies of TaBON3, located on chromosomes 6AS, 6BL, 1AL, 1BL and 1DL, respectively, were identified from the current common wheat genome sequences. The expression of TaBON1 and TaBON3 is responsive to both pathogen infection and temperature changes. Knocking down of TaBON1 or TaBON3 by virus-induced gene silencing (VIGS) induces the up-regulation of defence responses in wheat. These TaBON1- or TaBON3-silenced plants exhibit enhanced wheat disease resistance to Bgt, accompanied by greater accumulation of hydrogen peroxide and heightened cell death. In addition, high temperature has little effect on the up-regulation of defence response genes conferred by the silencing of TaBON1 or TaBON3. Our study shows a conserved function of plant copine genes in plant immunity and provides new genetic resources for the improvement of resistance to powdery mildew in wheat. © 2017 BSPP AND JOHN WILEY & SONS LTD.

  2. Bone marrow mesenchymal stem cells with Nogo-66 receptor gene silencing for repair of spinal cord injury

    Science.gov (United States)

    Li, Zhiyuan; Zhang, Zhanxiu; Zhao, Lili; Li, Hui; Wang, Suxia; Shen, Yong

    2014-01-01

    We hypothesized that RNA interference to silence Nogo-66 receptor gene expression in bone marrow mesenchymal stem cells before transplantation might further improve neurological function in rats with spinal cord transection injury. After 2 weeks, the number of neurons and BrdU-positive cells in the Nogo-66 receptor gene silencing group was higher than in the bone marrow mesenchymal stem cell group, and significantly greater compared with the model group. After 4 weeks, behavioral performance was significantly enhanced in the model group. After 8 weeks, the number of horseradish peroxidase-labeled nerve fibers was higher in the Nogo-66 receptor gene silencing group than in the bone marrow mesenchymal stem cell group, and significantly higher than in the model group. The newly formed nerve fibers and myelinated nerve fibers were detectable in the central transverse plane section in the bone marrow mesenchymal stem cell group and in the Nogo-66 receptor gene silencing group. PMID:25206893

  3. Molecular Subtyping of Primary Prostate Cancer Reveals Specific and Shared Target Genes of Different ETS Rearrangements

    Directory of Open Access Journals (Sweden)

    Paula Paulo

    2012-07-01

    Full Text Available This work aimed to evaluate whether ETS transcription factors frequently involved in rearrangements in prostate carcinomas (PCa, namely ERG and ETV1, regulate specific or shared target genes. We performed differential expression analysis on nine normal prostate tissues and 50 PCa enriched for different ETS rearrangements using exon-level expression microarrays, followed by in vitro validation using cell line models. We found specific deregulation of 57 genes in ERG-positive PCa and 15 genes in ETV1-positive PCa, whereas deregulation of 27 genes was shared in both tumor subtypes. We further showed that the expression of seven tumor-associated ERG target genes (PLA1A, CACNA1D, ATP8A2, HLA-DMB, PDE3B, TDRD1, and TMBIM1 and two tumor-associated ETV1 target genes (FKBP10 and GLYATL2 was significantly affected by specific ETS silencing in VCaP and LNCaP cell line models, respectively, whereas the expression of three candidate ERG and ETV1 shared targets (GRPR, KCNH8, and TMEM45B was significantly affected by silencing of either ETS. Interestingly, we demonstrate that the expression of TDRD1, the topmost overexpressed gene of our list of ERG-specific candidate targets, is inversely correlated with the methylation levels of a CpG island found at -66 bp of the transcription start site in PCa and that TDRD1 expression is regulated by direct binding of ERG to the CpG island in VCaP cells. We conclude that ETS transcription factors regulate specific and shared target genes and that TDRD1, FKBP10, and GRPR are promising therapeutic targets and can serve as diagnostic markers for molecular subtypes of PCa harboring specific fusion gene rearrangements.

  4. Plasmodium falciparum var Gene Silencing Is Determined by cis DNA Elements That Form Stable and Heritable Interactions ▿

    Science.gov (United States)

    Swamy, Lakshmi; Amulic, Borko; Deitsch, Kirk W.

    2011-01-01

    Antigenic variation in the human malaria parasite Plasmodium falciparum depends on the transcriptional regulation of the var gene family. In each individual parasite, mRNA is expressed exclusively from 1 var gene out of ∼60, while the rest of the genes are transcriptionally silenced. Both modifications to chromatin structure and DNA regulatory elements associated with each var gene have been implicated in the organization and maintenance of the silent state. Whether silencing is established at the level of entire chromosomal regions via heterochromatin spreading or at the level of individual var promoters through the action of a silencing element within each var intron has been debated. Here, we consider both possibilities, using clonal parasite lines carrying chromosomally integrated transgenes. We confirm a previous finding that the loss of an adjacent var intron results in var promoter activation and further show that transcriptional activation of a var promoter within a cluster does not affect the transcriptional activity of neighboring var promoters. Our results provide more evidence for the hypothesis that var genes are primarily silenced at the level of an individual gene, rather than by heterochromatin spreading. We also tested the intrinsic directionality of an intron's silencing effect on upstream or downstream var promoters. We found that an intron is capable of silencing in either direction and that, once established, a var promoter-intron pair is stably maintained through many generations, suggesting a possible role in epigenetic memory. This study provides insights into the regulation of endogenous var gene clusters. PMID:21317310

  5. A Foxtail mosaic virus Vector for Virus-Induced Gene Silencing in Maize1[OPEN

    Science.gov (United States)

    Mei, Yu; Kernodle, Bliss M.; Hill, John H.

    2016-01-01

    Plant viruses have been widely used as vectors for foreign gene expression and virus-induced gene silencing (VIGS). A limited number of viruses have been developed into viral vectors for the purposes of gene expression or VIGS in monocotyledonous plants, and among these, the tripartite viruses Brome mosaic virus and Cucumber mosaic virus have been shown to induce VIGS in maize (Zea mays). We describe here a new DNA-based VIGS system derived from Foxtail mosaic virus (FoMV), a monopartite virus that is able to establish systemic infection and silencing of endogenous maize genes homologous to gene fragments inserted into the FoMV genome. To demonstrate VIGS applications of this FoMV vector system, four genes, phytoene desaturase (functions in carotenoid biosynthesis), lesion mimic22 (encodes a key enzyme of the porphyrin pathway), iojap (functions in plastid development), and brown midrib3 (caffeic acid O-methyltransferase), were silenced and characterized in the sweet corn line Golden × Bantam. Furthermore, we demonstrate that the FoMV infectious clone establishes systemic infection in maize inbred lines, sorghum (Sorghum bicolor), and green foxtail (Setaria viridis), indicating the potential wide applications of this viral vector system for functional genomics studies in maize and other monocots. PMID:27208311

  6. RNA-Interference Components Are Dispensable for Transcriptional Silencing of the Drosophila Bithorax-Complex

    KAUST Repository

    Cernilogar, Filippo M.

    2013-06-13

    Background:Beyond their role in post-transcriptional gene silencing, Dicer and Argonaute, two components of the RNA interference (RNAi) machinery, were shown to be involved in epigenetic regulation of centromeric heterochromatin and transcriptional gene silencing. In particular, RNAi mechanisms appear to play a role in repeat induced silencing and some aspects of Polycomb-mediated gene silencing. However, the functional interplay of RNAi mechanisms and Polycomb group (PcG) pathways at endogenous loci remains to be elucidated.Principal Findings:Here we show that the endogenous Dicer-2/Argonaute-2 RNAi pathway is dispensable for the PcG mediated silencing of the homeotic Bithorax Complex (BX-C). Although Dicer-2 depletion triggers mild transcriptional activation at Polycomb Response Elements (PREs), this does not induce transcriptional changes at PcG-repressed genes. Moreover, Dicer-2 is not needed to maintain global levels of methylation of lysine 27 of histone H3 and does not affect PRE-mediated higher order chromatin structures within the BX-C. Finally bioinformatic analysis, comparing published data sets of PcG targets with Argonaute-2-bound small RNAs reveals no enrichment of these small RNAs at promoter regions associated with PcG proteins.Conclusions:We conclude that the Dicer-2/Argonaute-2 RNAi pathway, despite its role in pairing sensitive gene silencing of transgenes, does not have a role in PcG dependent silencing of major homeotic gene cluster loci in Drosophila. © 2013 Cernilogar et al.

  7. Construction of RNAi lentiviral vector targeting mouse Islet-1 gene

    Directory of Open Access Journals (Sweden)

    Shen-shen ZHI

    2011-02-01

    Full Text Available Objective To construct and select RNAi lentiviral vectors that can silence mouse Islet-1 gene effectively.Methods Three groups of RNAi-target of mouse Islet-1 gene were designed,and corresponding shRNA oligo(sh1,sh2 and sh3 were synthesized,and then they were respectively inserted to the PLVTHM vector that had been digested by endonuclease.Agarose gel electrophoresis and sequencing were used to select and indentify the positive clones.The positive clones were extracted and then mixed with E.coli to amplify positive clones.The amplified clones were then infected into 293T along with the other 3 helper plasmids to produce lentiviral vector.After the construction of the lentiviral vector,plaque formation test was performed to determine the titer of lentiviral vector.The lentiviral vectors were then infected into C3H10T1/2 cells.The transfect efficiency of the lentiviral vectors was determined with flow cytometry with detection of green fluorescent protein(GFP.Q-PCR was employed to detect the RNAi efficiency of the lentiviral vectors.Results Agarose gel electrophoresis analysis showed that the clones with right gene at the target size were successfully established;gene sequencing showed that the right DNA fragments had been inserted;plaque formation test showed that the titer of the virus solution was 3.87×108TU/ml;the transfect efficiency of the lentiviral vector infected into C3H10T1/2 cells was 90.36%.All the 3 groups of shRNA targets(sh1,sh2 and sh3 showed an inhibitory effect on Islet-1 gene,and the sh1 showed the highest inhibitory effect(76.8%,as compared with that of normal cells(P < 0.05.Conclusion The RNAi lentiviral vector that can effectively silence the mouse Islet-1 gene has been constructed successfully,which may lay a foundation for further investigation of Islet-1 gene.

  8. Mobile gene silencing in Arabidopsis is regulated by hydrogen peroxide

    Directory of Open Access Journals (Sweden)

    Dacheng Liang

    2014-12-01

    Full Text Available In plants and nematodes, RNAi can spread from cells from which it is initiated to other cells in the organism. The underlying mechanism controlling the mobility of RNAi signals is not known, especially in the case of plants. A genetic screen designed to recover plants impaired in the movement but not the production or effectiveness of the RNAi signal identified RCI3, which encodes a hydrogen peroxide (H2O2-producing type III peroxidase, as a key regulator of silencing mobility in Arabidopsis thaliana. Silencing initiated in the roots of rci3 plants failed to spread into leaf tissue or floral tissue. Application of exogenous H2O2 reinstated the spread in rci3 plants and accelerated it in wild-type plants. The addition of catalase or MnO2, which breaks down H2O2, slowed the spread of silencing in wild-type plants. We propose that endogenous H2O2, under the control of peroxidases, regulates the spread of gene silencing by altering plasmodesmata permeability through remodelling of local cell wall structure, and may play a role in regulating systemic viral defence.

  9. Identification of an attenuated barley stripe mosaic virus for the virus-induced gene silencing of pathogenesis-related wheat genes.

    Science.gov (United States)

    Buhrow, Leann M; Clark, Shawn M; Loewen, Michele C

    2016-01-01

    Virus-induced gene silencing (VIGS) has become an emerging technology for the rapid, efficient functional genomic screening of monocot and dicot species. The barley stripe mosaic virus (BSMV) has been described as an effective VIGS vehicle for the evaluation of genes involved in wheat and barley phytopathogenesis; however, these studies have been obscured by BSMV-induced phenotypes and defense responses. The utility of BSMV VIGS may be improved using a BSMV genetic background which is more tolerable to the host plant especially upon secondary infection of highly aggressive, necrotrophic pathogens such as Fusarium graminearum. BSMV-induced VIGS in Triticum aestivum (bread wheat) cv. 'Fielder' was assessed for the study of wheat genes putatively related to Fusarium Head Blight (FHB), the necrotrophism of wheat and other cereals by F. graminearum. Due to the lack of 'Fielder' spike viability and increased accumulation of Fusarium-derived deoxynivalenol contamination upon co-infection of BSMV and FHB, an attenuated BSMV construct was generated by the addition of a glycine-rich, C-terminal peptide to the BSMV γ b protein. This attenuated BSMV effectively silenced target wheat genes while limiting disease severity, deoxynivalenol contamination, and yield loss upon Fusarium co-infection compared to the original BSMV construct. The attenuated BSMV-infected tissue exhibited reduced abscisic, jasmonic, and salicylic acid defense phytohormone accumulation upon secondary Fusarium infection. Finally, the attenuated BSMV was used to investigate the role of the salicylic acid-responsive pathogenesis-related 1 in response to FHB. The use of an attenuated BSMV may be advantageous in characterizing wheat genes involved in phytopathogenesis, including Fusarium necrotrophism, where minimal viral background effects on defense are required. Additionally, the attenuated BSMV elicits reduced defense hormone accumulation, suggesting that this genotype may have applications for the

  10. A var gene promoter implicated in severe malaria nucleates silencing and is regulated by 3’ untranslated region and intronic cis-elements

    Science.gov (United States)

    Muhle, Rebecca A.; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J.; Muhle, Michael E.; Fidock, David A.

    2009-01-01

    Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitized erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilizing the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var sub-telomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronized parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may well result from the integrated UpsA promoter being largely silenced by the neighboring cg6 promoter. Our analyses also revealed that the DownsA 3’ untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyze promoter activity of Group A var genes which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of

  11. Grape seed proanthocyanidins reactivate silenced tumor suppressor genes in human skin cancer cells by targeting epigenetic regulators

    International Nuclear Information System (INIS)

    Vaid, Mudit; Prasad, Ram; Singh, Tripti; Jones, Virginia; Katiyar, Santosh K.

    2012-01-01

    Grape seed proanthocyanidins (GSPs) have been shown to have anti-skin carcinogenic effects in in vitro and in vivo models. However, the precise epigenetic molecular mechanisms remain unexplored. This study was designed to investigate whether GSPs reactivate silenced tumor suppressor genes following epigenetic modifications in skin cancer cells. For this purpose, A431 and SCC13 human squamous cell carcinoma cell lines were used as in vitro models. The effects of GSPs on DNA methylation, histone modifications and tumor suppressor gene expressions were studied in these cell lines using enzyme activity assays, western blotting, dot-blot analysis and real-time polymerase chain reaction (RT-PCR). We found that treatment of A431 and SCC13 cells with GSPs decreased the levels of: (i) global DNA methylation, (ii) 5-methylcytosine, (iii) DNA methyltransferase (DNMT) activity and (iv) messenger RNA (mRNA) and protein levels of DNMT1, DNMT3a and DNMT3b in these cells. Similar effects were noted when these cancer cells were treated identically with 5-aza-2′-deoxycytidine, an inhibitor of DNA methylation. GSPs decreased histone deacetylase activity, increased levels of acetylated lysines 9 and 14 on histone H3 (H3-Lys 9 and 14) and acetylated lysines 5, 12 and 16 on histone H4, and reduced the levels of methylated H3-Lys 9. Further, GSP treatment resulted in re-expression of the mRNA and proteins of silenced tumor suppressor genes, RASSF1A, p16 INK4a and Cip1/p21. Together, this study provides a new insight into the epigenetic mechanisms of GSPs and may have significant implications for epigenetic therapy in the treatment/prevention of skin cancers in humans. -- Highlights: ►Epigenetic modulations have been shown to have a role in cancer risk. ►Proanthocyanidins decrease the levels of DNA methylation and histone deacetylation. ►Proanthocyanidins inhibit histone deacetylase activity in skin cancer cells. ►Proanthocyanidins reactivate tumor suppressor genes in skin

  12. Silencing of Taxol-Sensitizer Genes in Cancer Cells: Lack of Sensitization Effects

    International Nuclear Information System (INIS)

    Huang, Shang-Lang; Chao, Chuck C.-K.

    2015-01-01

    A previous genome-wide screening analysis identified a panel of genes that sensitize the human non-small-cell lung carcinoma cell line NCI-H1155 to taxol. However, whether the identified genes sensitize other cancer cells to taxol has not been examined. Here, we silenced the taxol-sensitizer genes identified (acrbp, atp6v0d2, fgd4, hs6st2, psma6, and tubgcp2) in nine other cancer cell types (including lung, cervical, ovarian, and hepatocellular carcinoma cell lines) that showed reduced cell viability in the presence of a sub-lethal concentration of taxol. Surprisingly, none of the genes studied increased sensitivity to taxol in the tested panel of cell lines. As observed in H1155 cells, SKOV3 cells displayed induction of five of the six genes studied in response to a cell killing dose of taxol. The other cell types were much less responsive to taxol. Notably, four of the five inducible taxol-sensitizer genes tested (acrbp, atp6v0d2, psma6, and tubgcp2) were upregulated in a taxol-resistant ovarian cancer cell line. These results indicate that the previously identified taxol-sensitizer loci are not conserved genetic targets involved in inhibiting cell proliferation in response to taxol. Our findings also suggest that regulation of taxol-sensitizer genes by taxol may be critical for acquired cell resistance to the drug

  13. Silencing of Taxol-Sensitizer Genes in Cancer Cells: Lack of Sensitization Effects

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Shang-Lang [Department of Biochemistry and Molecular Biology, College of Medicine, Chang Gung University, Taoyuan 333, Taiwan (China); Chao, Chuck C.-K., E-mail: cckchao@mail.cgu.edu.tw [Department of Biochemistry and Molecular Biology, College of Medicine, Chang Gung University, Taoyuan 333, Taiwan (China); Graduate Institute of Biomedical Sciences, College of Medicine, Chang Gung University, Taoyuan 333, Taiwan (China); Department of Medical Research and Development, Chang Gung Memorial Hospital, Taoyuan 333, Taiwan (China)

    2015-06-16

    A previous genome-wide screening analysis identified a panel of genes that sensitize the human non-small-cell lung carcinoma cell line NCI-H1155 to taxol. However, whether the identified genes sensitize other cancer cells to taxol has not been examined. Here, we silenced the taxol-sensitizer genes identified (acrbp, atp6v0d2, fgd4, hs6st2, psma6, and tubgcp2) in nine other cancer cell types (including lung, cervical, ovarian, and hepatocellular carcinoma cell lines) that showed reduced cell viability in the presence of a sub-lethal concentration of taxol. Surprisingly, none of the genes studied increased sensitivity to taxol in the tested panel of cell lines. As observed in H1155 cells, SKOV3 cells displayed induction of five of the six genes studied in response to a cell killing dose of taxol. The other cell types were much less responsive to taxol. Notably, four of the five inducible taxol-sensitizer genes tested (acrbp, atp6v0d2, psma6, and tubgcp2) were upregulated in a taxol-resistant ovarian cancer cell line. These results indicate that the previously identified taxol-sensitizer loci are not conserved genetic targets involved in inhibiting cell proliferation in response to taxol. Our findings also suggest that regulation of taxol-sensitizer genes by taxol may be critical for acquired cell resistance to the drug.

  14. Optimisation of tomato Micro-tom regeneration and selection on glufosinate/Basta and dependency of gene silencing on transgene copy number.

    Science.gov (United States)

    Khuong, Thi Thu Huong; Crété, Patrice; Robaglia, Christophe; Caffarri, Stefano

    2013-09-01

    An efficient protocol of transformation and selection of transgenic lines of Micro-tom, a widespread model cultivar for tomato, is reported. RNA interference silencing efficiency and stability have been investigated and correlated with the number of insertions. Given its small size and ease of cultivation, the tomato (Solanum lycopersicon) cultivar Micro-tom is of widespread use as a model tomato plant. To create and screen transgenic plants, different selectable markers are commonly used. The bar marker carrying the resistance to the herbicide glufosinate/Basta, has many advantages, but it has been little utilised and with low efficiency for identification of tomato transgenic plants. Here we describe a procedure for accurate selection of transgenic Micro-tom both in vitro and in soil. Immunoblot, Southern blot and phenotypic analyses showed that 100 % of herbicide-resistant plants were transgenic. In addition, regeneration improvement has been obtained by using 2 mg/l Gibberellic acid in the shoot elongation medium; rooting optimisation on medium containing 1 mg/l IAA allowed up to 97 % of shoots developing strong and very healthy roots after only 10 days. Stable transformation frequency by infection of leaf explants with Agrobacterium reached 12 %. Shoots have been induced by combination of 1 mg/l zeatin-trans and 0.1 mg/l IAA. Somatic embryogenesis of cotyledon on medium containing 1 mg/l zeatin + 2 mg/l IAA is described in Micro-tom. The photosynthetic psbS gene has been used as reporter gene for RNA silencing studies. The efficiency of gene silencing has been found equivalent using three different target gene fragments of 519, 398 and 328 bp. Interestingly, silencing efficiency decreased from T0 to the T3 generation in plants containing multiple copies of the inserted T-DNA, while it was stable in plants containing a single insertion.

  15. Gene silencing of beta-catenin in melanoma cells retards their growth but promotes the formation of pulmonary metastasis in mice.

    Science.gov (United States)

    Takahashi, Yuki; Nishikawa, Makiya; Suehara, Tetsuya; Takiguchi, Naomi; Takakura, Yoshinobu

    2008-11-15

    Altered expression of beta-catenin, a key component of the Wnt signaling pathway, is involved in a variety of cancers because increased levels of beta-catenin protein are frequently associated with enhanced cellular proliferation. Although our previous study demonstrated that gene silencing of beta-catenin in melanoma B16-BL6 cells by plasmid DNA (pDNA) expressing short-hairpin RNA targeting the gene (pshbeta-catenin) markedly suppressed their growth in vivo, gene silencing of beta-catenin could promote tumor metastasis by the rearranging cell adhesion complex. In this study, we investigated how silencing of beta-catenin affects metastatic aspects of melanoma cells. Transfection of B16-BL6 cells with pshbeta-catenin significantly reduced the amount of cadherin protein, a cell adhesion molecule binding to beta-catenin, with little change in its mRNA level. Cadherin-derived fragments were detected in culture media of B16-BL6 cells transfected with pshbeta-catenin, suggesting that cadherin is shed from the cell surface when the expression of beta-catenin is reduced. The mobility of B16-BL6 cells transfected with pshbeta-catenin was greater than that of cells transfected with any of the control pDNAs. B16-BL6 cells stably transfected with pshbeta-catenin (B16/pshbeta-catenin) formed less or an equal number of tumor nodules in the lung than cells stably transfected with other plasmids when injected into mice via the tail vein. However, when subcutaneously inoculated, B16/pshbeta-catenin cells formed more nodules in the lung than the other stably transfected cells. These results raise concerns about the gene silencing of beta-catenin for inhibiting tumor growth, because it promotes tumor metastasis by reducing the amount of cadherin in tumor cells. (c) 2008 Wiley-Liss, Inc.

  16. Virus-induced gene silencing of Withania somnifera squalene synthase negatively regulates sterol and defence-related genes resulting in reduced withanolides and biotic stress tolerance.

    Science.gov (United States)

    Singh, Anup Kumar; Dwivedi, Varun; Rai, Avanish; Pal, Shaifali; Reddy, Sajjalavarahalli Gangireddy Eswara; Rao, Dodaghatta Krishnarao Venkata; Shasany, Ajit Kumar; Nagegowda, Dinesh A

    2015-12-01

    Withania somnifera (L.) Dunal is an important Indian medicinal plant that produces withanolides, which are triterpenoid steroidal lactones having diverse biological activities. To enable fast and efficient functional characterization of genes in this slow-growing and difficult-to-transform plant, a virus-induced gene silencing (VIGS) was established by silencing phytoene desaturase (PDS) and squalene synthase (SQS). VIGS of the gene encoding SQS, which provides precursors for triterpenoids, resulted in significant reduction of squalene and withanolides, demonstrating its application in studying withanolides biosynthesis in W. somnifera leaves. A comprehensive analysis of gene expression and sterol pathway intermediates in WsSQS-vigs plants revealed transcriptional modulation with positive feedback regulation of mevalonate pathway genes, and negative feed-forward regulation of downstream sterol pathway genes including DWF1 (delta-24-sterol reductase) and CYP710A1 (C-22-sterol desaturase), resulting in significant reduction of sitosterol, campesterol and stigmasterol. However, there was little effect of SQS silencing on cholesterol, indicating the contribution of sitosterol, campesterol and stigmasterol, but not of cholesterol, towards withanolides formation. Branch-point oxidosqualene synthases in WsSQS-vigs plants exhibited differential regulation with reduced CAS (cycloartenol synthase) and cycloartenol, and induced BAS (β-amyrin synthase) and β-amyrin. Moreover, SQS silencing also led to the down-regulation of brassinosteroid-6-oxidase-2 (BR6OX2), pathogenesis-related (PR) and nonexpressor of PR (NPR) genes, resulting in reduced tolerance to bacterial and fungal infection as well as to insect feeding. Taken together, SQS silencing negatively regulated sterol and defence-related genes leading to reduced phytosterols, withanolides and biotic stress tolerance, thus implicating the application of VIGS for functional analysis of genes related to withanolides

  17. Silencing of the pentose phosphate pathway genes influences DNA replication in human fibroblasts.

    Science.gov (United States)

    Fornalewicz, Karolina; Wieczorek, Aneta; Węgrzyn, Grzegorz; Łyżeń, Robert

    2017-11-30

    Previous reports and our recently published data indicated that some enzymes of glycolysis and the tricarboxylic acid cycle can affect the genome replication process by changing either the efficiency or timing of DNA synthesis in human normal cells. Both these pathways are connected with the pentose phosphate pathway (PPP pathway). The PPP pathway supports cell growth by generating energy and precursors for nucleotides and amino acids. Therefore, we asked if silencing of genes coding for enzymes involved in the pentose phosphate pathway may also affect the control of DNA replication in human fibroblasts. Particular genes coding for PPP pathway enzymes were partially silenced with specific siRNAs. Such cells remained viable. We found that silencing of the H6PD, PRPS1, RPE genes caused less efficient enterance to the S phase and decrease in efficiency of DNA synthesis. On the other hand, in cells treated with siRNA against G6PD, RBKS and TALDO genes, the fraction of cells entering the S phase was increased. However, only in the case of G6PD and TALDO, the ratio of BrdU incorporation to DNA was significantly changed. The presented results together with our previously published studies illustrate the complexity of the influence of genes coding for central carbon metabolism on the control of DNA replication in human fibroblasts, and indicate which of them are especially important in this process. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Silencing of SARS-CoV spike gene by small interfering RNA in HEK 293T cells

    International Nuclear Information System (INIS)

    Qin Zhaoling; Zhao Ping; Zhang Xiaolian; Yu Jianguo; Cao Mingmei; Zhao Lanjuan; Luan Jie; Qi Zhongtian

    2004-01-01

    Two candidate small interfering RNAs (siRNAs) corresponding to severe acute respiratory syndrome-associated coronavirus (SARS-CoV) spike gene were designed and in vitro transcribed to explore the possibility of silencing SARS-CoV S gene. The plasmid pEGFP-optS, which contains the codon-optimized SARS-CoV S gene and expresses spike-EGFP fusion protein (S-EGFP) as silencing target and expressing reporter, was transfected with siRNAs into HEK 293T cells. At various time points of posttransfection, the levels of S-EGFP expression and amounts of spike mRNA transcript were detected by fluorescence microscopy, flow cytometry, Western blot, and real-time quantitative PCR, respectively. The results showed that the cells transfected with pEGFP-optS expressed S-EGFP fusion protein at a higher level compared with those transfected with pEGFP-S, which contains wildtype SARS-CoV spike gene sequence. The green fluorescence, mean fluorescence intensity, and SARS-CoV S RNA transcripts were found significantly reduced, and the expression of SARS-CoV S glycoprotein was strongly inhibited in those cells co-transfected with either EGFP- or S-specific siRNAs. Our findings demonstrated that the S-specific siRNAs used in this study were able to specifically and effectively inhibit SARS-CoV S glycoprotein expression in cultured cells through blocking the accumulation of S mRNA, which may provide an approach for studies on the functions of SARS-CoV S gene and development of novel prophylactic or therapeutic agents for SARS-CoV

  19. The potential of virus-induced gene silencing for speeding up functional characterization of plant genes

    NARCIS (Netherlands)

    Benedito, V.A.; Visser, P.B.; Angenent, G.C.; Krens, F.A.

    2004-01-01

    Virus-induced gene silencing (VIGS) has been shown to be of great potential in plant reverse genetics. Advantages of VIGS over other approaches, such as T-DNA or transposon tagging, include the circumvention of plant transformation, methodological simplicity and robustness, and speedy results. These

  20. An RNA-seq transcriptome analysis of histone modifiers and RNA silencing genes in soybean during floral initiation process.

    Directory of Open Access Journals (Sweden)

    Lim Chee Liew

    Full Text Available Epigenetics has been recognised to play vital roles in many plant developmental processes, including floral initiation through the epigenetic regulation of gene expression. The histone modifying proteins that mediate these modifications involve the SET domain-containing histone methyltransferases, JmjC domain-containing demethylase, acetylases and deacetylases. In addition, RNA interference (RNAi-associated genes are also involved in epigenetic regulation via RNA-directed DNA methylation and post-transcriptional gene silencing. Soybean, a major crop legume, requires a short day to induce flowering. How histone modifications regulate the plant response to external cues that initiate flowering is still largely unknown. Here, we used RNA-seq to address the dynamics of transcripts that are potentially involved in the epigenetic programming and RNAi mediated gene silencing during the floral initiation of soybean. Soybean is a paleopolyploid that has been subjected to at least two rounds of whole genome duplication events. We report that the expanded genomic repertoire of histone modifiers and RNA silencing genes in soybean includes 14 histone acetyltransferases, 24 histone deacetylases, 47 histone methyltransferases, 15 protein arginine methyltransferases, 24 JmjC domain-containing demethylases and 47 RNAi-associated genes. To investigate the role of these histone modifiers and RNA silencing genes during floral initiation, we compared the transcriptional dynamics of the leaf and shoot apical meristem at different time points after a short-day treatment. Our data reveal that the extensive activation of genes that are usually involved in the epigenetic programming and RNAi gene silencing in the soybean shoot apical meristem are reprogrammed for floral development following an exposure to inductive conditions.

  1. Alternative epigenetic chromatin states of polycomb target genes.

    Directory of Open Access Journals (Sweden)

    Yuri B Schwartz

    2010-01-01

    Full Text Available Polycomb (PcG regulation has been thought to produce stable long-term gene silencing. Genomic analyses in Drosophila and mammals, however, have shown that it targets many genes, which can switch state during development. Genetic evidence indicates that critical for the active state of PcG target genes are the histone methyltransferases Trithorax (TRX and ASH1. Here we analyze the repertoire of alternative states in which PcG target genes are found in different Drosophila cell lines and the role of PcG proteins TRX and ASH1 in controlling these states. Using extensive genome-wide chromatin immunoprecipitation analysis, RNAi knockdowns, and quantitative RT-PCR, we show that, in addition to the known repressed state, PcG targets can reside in a transcriptionally active state characterized by formation of an extended domain enriched in ASH1, the N-terminal, but not C-terminal moiety of TRX and H3K27ac. ASH1/TRX N-ter domains and transcription are not incompatible with repressive marks, sometimes resulting in a "balanced" state modulated by both repressors and activators. Often however, loss of PcG repression results instead in a "void" state, lacking transcription, H3K27ac, or binding of TRX or ASH1. We conclude that PcG repression is dynamic, not static, and that the propensity of a target gene to switch states depends on relative levels of PcG, TRX, and activators. N-ter TRX plays a remarkable role that antagonizes PcG repression and preempts H3K27 methylation by acetylation. This role is distinct from that usually attributed to TRX/MLL proteins at the promoter. These results have important implications for Polycomb gene regulation, the "bivalent" chromatin state of embryonic stem cells, and gene expression in development.

  2. DNA replication factor C1 mediates genomic stability and transcriptional gene silencing in Arabidopsis

    KAUST Repository

    Liu, Qian; Wang, Junguo; Miki, Daisuke; Xia, Ran; Yu, Wenxiang; He, Junna; Zheng, Zhimin; Zhu, Jian-Kang; Gonga, Zhizhong

    2010-01-01

    Genetic screening identified a suppressor of ros1-1, a mutant of REPRESSOR OF SILENCING1 (ROS1; encoding a DNA demethylation protein). The suppressor is a mutation in the gene encoding the largest subunit of replication factor C (RFC1). This mutation of RFC1 reactivates the unlinked 35S-NPTII transgene, which is silenced in ros1 and also increases expression of the pericentromeric Athila retrotransposons named transcriptional silent information in a DNA methylationindependent manner. rfc1 is more sensitive than the wild type to the DNA-damaging agent methylmethane sulphonate and to the DNA inter- and intra- cross-linking agent cisplatin. The rfc1 mutant constitutively expresses the G2/M-specific cyclin CycB1;1 and other DNA repair-related genes. Treatment with DNA-damaging agents mimics the rfc1 mutation in releasing the silenced 35S-NPTII, suggesting that spontaneously induced genomic instability caused by the rfc1 mutation might partially contribute to the released transcriptional gene silencing (TGS). The frequency of somatic homologous recombination is significantly increased in the rfc1 mutant. Interestingly, ros1 mutants show increased telomere length, but rfc1 mutants show decreased telomere length and reduced expression of telomerase. Our results suggest that RFC1 helps mediate genomic stability and TGS in Arabidopsis thaliana. © 2010 American Society of Plant Biologists.

  3. DNA replication factor C1 mediates genomic stability and transcriptional gene silencing in Arabidopsis

    KAUST Repository

    Liu, Qian

    2010-07-01

    Genetic screening identified a suppressor of ros1-1, a mutant of REPRESSOR OF SILENCING1 (ROS1; encoding a DNA demethylation protein). The suppressor is a mutation in the gene encoding the largest subunit of replication factor C (RFC1). This mutation of RFC1 reactivates the unlinked 35S-NPTII transgene, which is silenced in ros1 and also increases expression of the pericentromeric Athila retrotransposons named transcriptional silent information in a DNA methylationindependent manner. rfc1 is more sensitive than the wild type to the DNA-damaging agent methylmethane sulphonate and to the DNA inter- and intra- cross-linking agent cisplatin. The rfc1 mutant constitutively expresses the G2/M-specific cyclin CycB1;1 and other DNA repair-related genes. Treatment with DNA-damaging agents mimics the rfc1 mutation in releasing the silenced 35S-NPTII, suggesting that spontaneously induced genomic instability caused by the rfc1 mutation might partially contribute to the released transcriptional gene silencing (TGS). The frequency of somatic homologous recombination is significantly increased in the rfc1 mutant. Interestingly, ros1 mutants show increased telomere length, but rfc1 mutants show decreased telomere length and reduced expression of telomerase. Our results suggest that RFC1 helps mediate genomic stability and TGS in Arabidopsis thaliana. © 2010 American Society of Plant Biologists.

  4. Epigenetic silencing of host cell defense genes enhances intracellular survival of the rickettsial pathogen Anaplasma phagocytophilum.

    Directory of Open Access Journals (Sweden)

    Jose C Garcia-Garcia

    2009-06-01

    Full Text Available Intracellular bacteria have evolved mechanisms that promote survival within hostile host environments, often resulting in functional dysregulation and disease. Using the Anaplasma phagocytophilum-infected granulocyte model, we establish a link between host chromatin modifications, defense gene transcription and intracellular bacterial infection. Infection of THP-1 cells with A. phagocytophilum led to silencing of host defense gene expression. Histone deacetylase 1 (HDAC1 expression, activity and binding to the defense gene promoters significantly increased during infection, which resulted in decreased histone H3 acetylation in infected cells. HDAC1 overexpression enhanced infection, whereas pharmacologic and siRNA HDAC1 inhibition significantly decreased bacterial load. HDAC2 does not seem to be involved, since HDAC2 silencing by siRNA had no effect on A. phagocytophilum intracellular propagation. These data indicate that HDAC up-regulation and epigenetic silencing of host cell defense genes is required for A. phagocytophilum infection. Bacterial epigenetic regulation of host cell gene transcription could be a general mechanism that enhances intracellular pathogen survival while altering cell function and promoting disease.

  5. Reactivation of CDX2 in Gastric Cancer as Mark for Gene Silencing Memory

    International Nuclear Information System (INIS)

    Kameoka, Yuri; Kitazawa, Riko; Ariasu, Kanazu; Tachibana, Ryosuke; Mizuno, Yosuke; Haraguchi, Ryuma; Kitazawa, Sohei

    2015-01-01

    To explore the epigenetic mechanism that reactivates CDX2 (a homeobox transcription factor that serves as a tumor-suppressor gene) in intestinal-type gastric cancer during cancer progression, we examined the methylation status of the CDX2 gene promoter and the expression pattern of methyl-CpG binding protein-2 (MeCP2). From archives of the pathology records of surgically excised advanced stomach cancer cases in the Department of Molecular Pathology, Ehime University in a past decate (n=265), 10 cases of intestinal-type tubular adenocarcinoma, well-differentiated type (wel) with minor poorly-differentiated adenocarcinoma (por) components were selected. The expression pattern of CDX2, MUC2 and MeCP2 in these 10 cases was analyzed by immunohistochemistry. The cancerous and non-cancerous areas were selectively obtained by microdissection, and the methylation status of the CDX2 promoter of each area was assessed by methylation-specific polymerase chain reaction (MSP). In all 10 cases, CDX2 expression was clearly observed in the nucleus of the non-cancerous background of the intestinal metaplasic area, where the unmethylation pattern of the CDX2 gene promoter prevailed with reduced MeCP2 expression. In this metaplastic area, CDX2 expression was co-localized with its target gene, MUC2. CDX2 expression then disappeared from the deep invasive wel area. Reflecting the reduced CDX2 expression, microdissected samples from all the wel areas showed hypermethylation of the CDX2 gene promoter by MSP, with prominent MeCP2 expression. Interestingly, while hypermethylation of the CDX2 gene promoter was maintained in the por area in 8 of the 10 cases, CDX2 expression was restored in por areas where MeCP2 expression was markedly and selectively reduced. The other two cases, however, showed a constant MeCP2 expression level comparable to the surrounding deep invasive wel area with negative CDX2 expression. Therefore, gene silencing by hypermethylation may be overcome by the reduction of

  6. An efficient viral vector for functional genomic studies of Prunus fruit trees and its induced resistance to Plum pox virus via silencing of a host factor gene.

    Science.gov (United States)

    Cui, Hongguang; Wang, Aiming

    2017-03-01

    RNA silencing is a powerful technology for molecular characterization of gene functions in plants. A commonly used approach to the induction of RNA silencing is through genetic transformation. A potent alternative is to use a modified viral vector for virus-induced gene silencing (VIGS) to degrade RNA molecules sharing similar nucleotide sequence. Unfortunately, genomic studies in many allogamous woody perennials such as peach are severely hindered because they have a long juvenile period and are recalcitrant to genetic transformation. Here, we report the development of a viral vector derived from Prunus necrotic ringspot virus (PNRSV), a widespread fruit tree virus that is endemic in all Prunus fruit production countries and regions in the world. We show that the modified PNRSV vector, harbouring the sense-orientated target gene sequence of 100-200 bp in length in genomic RNA3, could efficiently trigger the silencing of a transgene or an endogenous gene in the model plant Nicotiana benthamiana. We further demonstrate that the PNRSV-based vector could be manipulated to silence endogenous genes in peach such as eukaryotic translation initiation factor 4E isoform (eIF(iso)4E), a host factor of many potyviruses including Plum pox virus (PPV). Moreover, the eIF(iso)4E-knocked down peach plants were resistant to PPV. This work opens a potential avenue for the control of virus diseases in perennial trees via viral vector-mediated silencing of host factors, and the PNRSV vector may serve as a powerful molecular tool for functional genomic studies of Prunus fruit trees. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  7. Silencing of the major family of NBS-LRR-encoding genes in lettuce results in the loss of multiple resistance specificities.

    Science.gov (United States)

    Wroblewski, Tadeusz; Piskurewicz, Urszula; Tomczak, Anna; Ochoa, Oswaldo; Michelmore, Richard W

    2007-09-01

    The RGC2 gene cluster in lettuce (Lactuca sativa) is one of the largest known families of genes encoding nucleotide binding site-leucine-rich repeat (NBS-LRR) proteins. One of its members, RGC2B, encodes Dm3 which determines resistance to downy mildew caused by the oomycete Bremia lactucae carrying the cognate avirulence gene, Avr3. We developed an efficient strategy for analysis of this large family of low expressed genes using post-transcriptional gene silencing (PTGS). We transformed lettuce cv. Diana (carrying Dm3) using chimeric gene constructs designed to simultaneously silence RGC2B and the GUS reporter gene via the production of interfering hairpin RNA (ihpRNA). Transient assays of GUS expression in leaves accurately predicted silencing of both genes and were subsequently used to assay silencing in transgenic T(1) plants and their offspring. Levels of mRNA were reduced not only for RGC2B but also for all seven diverse RGC2 family members tested. We then used the same strategy to show that the resistance specificity encoded by the genetically defined Dm18 locus in lettuce cv. Mariska is the result of two resistance specificities, only one of which was silenced by ihpRNA derived from RGC2B. Analysis of progeny from crosses between transgenic, silenced tester stocks and lettuce accessions carrying other resistance genes previously mapped to the RGC2 locus indicated that two additional resistance specificities to B. lactucae, Dm14 and Dm16, as well as resistance to lettuce root aphid (Pemphigus bursarius L.), Ra, are encoded by RGC2 family members.

  8. Enhanced Host-Parasite Resistance Based on Down-Regulation of Phelipanche aegyptiaca Target Genes Is Likely by Mobile Small RNA

    Directory of Open Access Journals (Sweden)

    Neeraj K. Dubey

    2017-09-01

    Full Text Available RNA silencing refers to diverse mechanisms that control gene expression at transcriptional and post-transcriptional levels which can also be used in parasitic pathogens of plants that Broomrapes (Orobanche/Phelipanche spp. are holoparasitic plants that subsist on the roots of a variety of agricultural crops and cause severe negative effects on the yield and yield quality of those crops. Effective methods for controlling parasitic weeds are scarce, with only a few known cases of genetic resistance. In the current study, we suggest an improved strategy for the control of parasitic weeds based on trans-specific gene-silencing of three parasite genes at once. We used two strategies to express dsRNA containing selected sequences of three Phelipanche aegyptiaca genes PaACS, PaM6PR, and PaPrx1 (pma: transient expression using Tobacco rattle virus (TRV:pma as a virus-induced gene-silencing vector and stable expression in transgenic tomato Solanum lycopersicum (Mill. plants harboring a hairpin construct (pBINPLUS35:pma. siRNA-mediated transgene-silencing (20–24 nt was detected in the host plants. Our results demonstrate that the quantities of PaACS and PaM6PR transcripts from P. aegyptiaca tubercles grown on transgenic tomato or on TRV-infected Nicotiana benthamiana plants were significantly reduced. However, only partial reductions in the quantity of PaPrx1 transcripts were observed in the parasite tubercles grown on tomato and on N. benthamiana plants. Concomitant with the suppression of the target genes, there were significant decreases in the number and weight of the parasite tubercles that grew on the host plants, in both the transient and the stable experimental systems. The results of the work carried out using both strategies point to the movement of mobile exogenous siRNA from the host to the parasite, leading to the impaired expression of essential parasite target genes.

  9. Expression of cancer stem markers could be influenced by silencing of p16 gene in HeLa cervical carcinoma cells.

    Science.gov (United States)

    Wu, H; Zhang, J; Shi, H

    2016-01-01

    Effect of the tumor suppression gene p16 on the biological characteristics of HeLa cervical carcinoma cells was explored. The expression of p16 protein was increased in HeLa tumor sphere cells, and no significant difference in tumor spheres from the first to the fourth passages. Compared with those of parental HeLa cells, the proportion of CD44+/CD24- and ABCG2+ cells increased significantly in tumor spheres. However after the cells were silenced by the p16-sh289 vector, expression of P16 protein and the cell number of CD44+/CD24- and ABCG2+ decreased. Moreover, HeLa cells with p16 gene silencing showed decreased abilities of sphere formation and matrigel invasion. More HeLa cells with p16 gene silence were needed for tumor formation in nude mice. Tumor size and weight in mouse model established with p16 gene silenced HeLa cells were less than those with HeLa parental cell model. The present results indicate that silencing of the p16 gene inhibits expression of cancer stem cell markers and tumorigenic ability of HeLa cells.

  10. PCA3 Silencing Sensitizes Prostate Cancer Cells to Enzalutamide-mediated Androgen Receptor Blockade.

    Science.gov (United States)

    Özgür, Emre; Celik, Ayca Iribas; Darendeliler, Emin; Gezer, Ugur

    2017-07-01

    Prostate cancer (PCa) is an androgen-dependent disease. Novel anti-androgens (i.e. enzalutamide) have recently been developed for the treatment of patients with metastatic castration-resistant prostate cancer (CRPC). Evidence is accumulating that prostate cancer antigen 3 (PCA3) is involved in androgen receptor (AR) signaling. Here, in combination with enzalutamide-mediated AR blockade, we investigated the effect of PCA3 targeting on the viability of PCa cells. In hormone-sensitive LNCaP cells, AR-overexpressing LNCaP-AR + cells and VCaP cells (representing CRPC), PCA3 was silenced using siRNA oligonucleotides. Gene expression and cell viability was assessed in PCA3-silenced and/or AR-blocked cells. PCA3 targeting reduced the expression of AR-related genes (i.e. prostate-specific antigen (PSA) and prostate-specific transcript 1 (non-protein coding) (PCGEM1)) and potentiated the effect of enzalutamide. Proliferation of PCa cells was suppressed upon PCA3 silencing with a greater effect in LNCaP-AR + cells. Furthermore, PCA3 silencing sensitized PCa cells to enzalutamide-induced loss of cell growth. PCA3, as a therapeutic target in PCa, might be used to potentiate AR antagonists. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  11. MicroRNA-Mediated Myostatin Silencing in Caprine Fetal Fibroblasts

    Science.gov (United States)

    Zhong, Bushuai; Zhang, Yanli; Yan, Yibo; Wang, Ziyu; Ying, Shijia; Huang, Mingrui; Wang, Feng

    2014-01-01

    Myostatin functions as a negative regulator of skeletal muscle growth by suppressing proliferation and differentiation of myoblasts. Dysfunction of the myostatin gene, either due to natural mutation or genetic manipulations such as knockout or knockdown, has been reported to increase muscle mass in mammalian species. RNA interference (RNAi) mediated by microRNAs (miRNAs) is a promising method for gene knockdown studies. In the present study, transient and stable silencing of the myostatin gene in caprine fetal fibroblasts (CFF) was evaluated using the two most effective constructs selected from four different miRNA expression constructs screened in 293FT cells. Using these two miRNA constructs, we achieved up to 84% silencing of myostatin mRNA in transiently transfected CFF cells and up to 31% silencing in stably transfected CFF cells. Moreover, off-target effects due to induction of interferon (IFN) response genes, such as interferon beta (IFN-β) and 2′-5′-oligoadenylate synthetase 2 (OAS2), were markedly fewer in stably transfected CFF cells than in transiently transfected cells. Stable expression of anti-myostatin miRNA with minimal induction of interferon shows great promise for increasing muscle mass in transgenic goats. PMID:25244645

  12. MicroRNA-mediated myostatin silencing in caprine fetal fibroblasts.

    Directory of Open Access Journals (Sweden)

    Bushuai Zhong

    Full Text Available Myostatin functions as a negative regulator of skeletal muscle growth by suppressing proliferation and differentiation of myoblasts. Dysfunction of the myostatin gene, either due to natural mutation or genetic manipulations such as knockout or knockdown, has been reported to increase muscle mass in mammalian species. RNA interference (RNAi mediated by microRNAs (miRNAs is a promising method for gene knockdown studies. In the present study, transient and stable silencing of the myostatin gene in caprine fetal fibroblasts (CFF was evaluated using the two most effective constructs selected from four different miRNA expression constructs screened in 293FT cells. Using these two miRNA constructs, we achieved up to 84% silencing of myostatin mRNA in transiently transfected CFF cells and up to 31% silencing in stably transfected CFF cells. Moreover, off-target effects due to induction of interferon (IFN response genes, such as interferon beta (IFN-β and 2'-5'-oligoadenylate synthetase 2 (OAS2, were markedly fewer in stably transfected CFF cells than in transiently transfected cells. Stable expression of anti-myostatin miRNA with minimal induction of interferon shows great promise for increasing muscle mass in transgenic goats.

  13. An albumin-mediated cholesterol design-based strategy for tuning siRNA pharmacokinetics and gene silencing.

    Science.gov (United States)

    Bienk, Konrad; Hvam, Michael Lykke; Pakula, Malgorzata Maria; Dagnæs-Hansen, Frederik; Wengel, Jesper; Malle, Birgitte Mølholm; Kragh-Hansen, Ulrich; Cameron, Jason; Bukrinski, Jens Thostrup; Howard, Kenneth A

    2016-06-28

    Major challenges for the clinical translation of small interfering RNA (siRNA) include overcoming the poor plasma half-life, site-specific delivery and modulation of gene silencing. In this work, we exploit the intrinsic transport properties of human serum albumin to tune the blood circulatory half-life, hepatic accumulation and gene silencing; based on the number of siRNA cholesteryl modifications. We demonstrate by a gel shift assay a strong and specific affinity of recombinant human serum albumin (rHSA) towards cholesteryl-modified siRNA (Kd>1×10(-7)M) dependent on number of modifications. The rHSA/siRNA complex exhibited reduced nuclease degradation and reduced induction of TNF-α production by human peripheral blood mononuclear cells. The increased solubility of heavily cholesteryl modified siRNA in the presence of rHSA facilitated duplex annealing and consequent interaction that allowed in vivo studies using multiple cholesteryl modifications. A structural-activity-based screen of in vitro EGFP-silencing was used to select optimal siRNA designs containing cholesteryl modifications within the sense strand that were used for in vivo studies. We demonstrate plasma half-life extension in NMRI mice from t1/2 12min (naked) to t1/2 45min (single cholesteryl) and t1/2 71min (double cholesteryl) using fluorescent live bioimaging. The biodistribution showed increased accumulation in the liver for the double cholesteryl modified siRNA that correlated with an increase in hepatic Factor VII gene silencing of 28% (rHSA/siRNA) compared to 4% (naked siRNA) 6days post-injection. This work presents a novel albumin-mediated cholesteryl design-based strategy for tuning pharmacokinetics and systemic gene silencing. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Illuminating the gateway of gene silencing: perspective of RNA interference technology in clinical therapeutics.

    Science.gov (United States)

    Sindhu, Annu; Arora, Pooja; Chaudhury, Ashok

    2012-07-01

    A novel laboratory revolution for disease therapy, the RNA interference (RNAi) technology, has adopted a new era of molecular research as the next generation "Gene-targeted prophylaxis." In this review, we have focused on the chief technological challenges associated with the efforts to develop RNAi-based therapeutics that may guide the biomedical researchers. Many non-curable maladies, like neurodegenerative diseases and cancers have effectively been cured using this technology. Rapid advances are still in progress for the development of RNAi-based technologies that will be having a major impact on medical research. We have highlighted the recent discoveries associated with the phenomenon of RNAi, expression of silencing molecules in mammals along with the vector systems used for disease therapeutics.

  15. Flexible tools for gene expression and silencing in tomato.

    Science.gov (United States)

    Fernandez, Ana I; Viron, Nicolas; Alhagdow, Moftah; Karimi, Mansour; Jones, Matthew; Amsellem, Ziva; Sicard, Adrien; Czerednik, Anna; Angenent, Gerco; Grierson, Donald; May, Sean; Seymour, Graham; Eshed, Yuval; Lemaire-Chamley, Martine; Rothan, Christophe; Hilson, Pierre

    2009-12-01

    As a genetic platform, tomato (Solanum lycopersicum) benefits from rich germplasm collections and ease of cultivation and transformation that enable the analysis of biological processes impossible to investigate in other model species. To facilitate the assembly of an open genetic toolbox designed to study Solanaceae, we initiated a joint collection of publicly available gene manipulation tools. We focused on the characterization of promoters expressed at defined time windows during fruit development, for the regulated expression or silencing of genes of interest. Five promoter sequences were captured as entry clones compatible with the versatile MultiSite Gateway format: PPC2, PG, TPRP, and IMA from tomato and CRC from Arabidopsis (Arabidopsis thaliana). Corresponding transcriptional fusions were made with the GUS gene, a nuclear-localized GUS-GFP reporter, and the chimeric LhG4 transcription factor. The activity of the promoters during fruit development and in fruit tissues was confirmed in transgenic tomato lines. Novel Gateway destination vectors were generated for the transcription of artificial microRNA (amiRNA) precursors and hairpin RNAs under the control of these promoters, with schemes only involving Gateway BP and LR Clonase reactions. Efficient silencing of the endogenous phytoene desaturase gene was demonstrated in transgenic tomato lines producing a matching amiRNA under the cauliflower mosaic virus 35S or PPC2 promoter. Lastly, taking advantage of the pOP/LhG4 two-component system, we found that well-characterized flower-specific Arabidopsis promoters drive the expression of reporters in patterns generally compatible with heterologous expression. Tomato lines and plasmids will be distributed through a new Nottingham Arabidopsis Stock Centre service unit dedicated to Solanaceae resources.

  16. The Polerovirus silencing suppressor P0 targets ARGONAUTE proteins for degradation.

    Science.gov (United States)

    Baumberger, Nicolas; Tsai, Ching-Hsui; Lie, Miranda; Havecker, Ericka; Baulcombe, David C

    2007-09-18

    Plant and animal viruses encode suppressor proteins of an adaptive immunity mechanism in which viral double-stranded RNA is processed into 21-25 nt short interfering (si)RNAs. The siRNAs guide ARGONAUTE (AGO) proteins so that they target viral RNA. Most viral suppressors bind long dsRNA or siRNAs and thereby prevent production of siRNA or binding of siRNA to AGO. The one exception is the 2b suppressor of Cucumoviruses that binds to and inhibits AGO1. Here we describe a novel suppressor mechanism in which a Polerovirus-encoded F box protein (P0) targets the PAZ motif and its adjacent upstream sequence in AGO1 and mediates its degradation. F box proteins are components of E3 ubiquitin ligase complexes that add polyubiquitin tracts on selected lysine residues and thereby mark a protein for proteasome-mediated degradation. With P0, however, the targeted degradation of AGO is insensitive to inhibition of the proteasome, indicating that the proteasome is not involved. We also show that P0 does not block a mobile signal of silencing, indicating that the signal molecule does not have AGO protein components. The ability of P0 to block silencing without affecting signal movement may contribute to the phloem restriction of viruses in the Polerovirus group.

  17. SETD1A modulates cell cycle progression through a miRNA network that regulates p53 target genes

    OpenAIRE

    Tajima, Ken; Yae, Toshifumi; Javaid, Sarah; Tam, Oliver; Comaills, Valentine; Morris, Robert; Wittner, Ben S.; Liu, Mingzhu; Engstrom, Amanda; Takahashi, Fumiyuki; Black, Joshua C.; Ramaswamy, Sridhar; Shioda, Toshihiro; Hammell, Molly; Haber, Daniel A.

    2015-01-01

    Expression of the p53-inducible antiproliferative gene BTG2 is suppressed in many cancers in the absence of inactivating gene mutations, suggesting alternative mechanisms of silencing. Using a shRNA screen targeting 43 histone lysine methyltransferases (KMTs), we show that SETD1A suppresses BTG2 expression through its induction of several BTG2-targeting miRNAs. This indirect but highly specific mechanism, by which a chromatin regulator that mediates transcriptional activating marks can lead t...

  18. SGS3 Cooperates with RDR6 in Triggering Geminivirus-Induced Gene Silencing and in Suppressing Geminivirus Infection in Nicotiana Benthamiana

    Directory of Open Access Journals (Sweden)

    Fangfang Li

    2017-09-01

    Full Text Available RNA silencing has an important role in defending against virus infection in plants. Plants with the deficiency of RNA silencing components often show enhanced susceptibility to viral infections. RNA-dependent RNA polymerase (RDRs mediated-antiviral defense has a pivotal role in resistance to many plant viruses. In RDR6-mediated defense against viral infection, a plant-specific RNA binding protein, Suppressor of Gene Silencing 3 (SGS3, was also found to fight against some viruses in Arabidopsis. In this study, we showed that SGS3 from Nicotiana benthamiana (NbSGS3 is required for sense-RNA induced post-transcriptional gene silencing (S-PTGS and initiating sense-RNA-triggered systemic silencing. Further, the deficiency of NbSGS3 inhibited geminivirus-induced endogenous gene silencing (GIEGS and promoted geminivirus infection. During TRV-mediated NbSGS3 or N. benthamiana RDR6 (NbRDR6 silencing process, we found that their expression can be effectively fine-tuned. Plants with the knock-down of both NbSGS3 and NbRDR6 almost totally blocked GIEGS, and were more susceptible to geminivirus infection. These data suggest that NbSGS3 cooperates with NbRDR6 against GIEGS and geminivirus infection in N. benthamiana, which provides valuable information for breeding geminivirus-resistant plants.

  19. Phosphorus starvation induces post-transcriptional CHS gene silencing in Petunia corolla.

    Science.gov (United States)

    Hosokawa, Munetaka; Yamauchi, Takayoshi; Takahama, Masayoshi; Goto, Mariko; Mikano, Sachiko; Yamaguchi, Yuki; Tanaka, Yoshiyuki; Ohno, Sho; Koeda, Sota; Doi, Motoaki; Yazawa, Susumu

    2013-05-01

    The corolla of Petunia 'Magic Samba' exhibits unstable anthocyanin expression depending on its phosphorus content. Phosphorus deficiency enhanced post-transcriptional gene silencing of chalcone synthase - A in the corolla. Petunia (Petunia hybrida) 'Magic Samba' has unstable red-white bicolored corollas that respond to nutrient deficiency. We grew this cultivar hydroponically using solutions that lacked one or several nutrients to identify the specific nutrient related to anthocyanin expression in corolla. The white area of the corolla widened under phosphorus (P)-deficient conditions. When the P content of the corolla grown under P-deficient conditions dropped to 40 corollas until the plants died. Other elemental deficiencies had no clear effects on anthocyanin suppression in the corolla. After phosphate was resupplied to the P-deficient plants, anthocyanin was restored in the corollas. The expression of chalcone synthase-A (CHS-A) was suppressed in the white area that widened under P-suppressed conditions, whereas the expression of several other genes related to anthocyanin biosynthesis was enhanced more in the white area than in the red area. Reddish leaves and sepals developed under the P-deficient condition, which is a typical P-deficiency symptom. Two genes related to anthocyanin biosynthesis were enhanced in the reddish organs. Small interfering RNA analysis of CHS-A showed that the suppression resulted from post-transcriptional gene silencing (PTGS). Thus, it was hypothesized that the enhancement of anthocyanin biosynthetic gene expression due to P-deficiency triggered PTGS of CHS-A, which resulted in white corolla development.

  20. Disruption of prefoldin-2 protein synthesis in root-knot nematodes via host-mediated gene silencing efficiently reduces nematode numbers and thus protects plants.

    Science.gov (United States)

    Ajjappala, Hemavathi; Chung, Ha Young; Sim, Joon-Soo; Choi, Inchan; Hahn, Bum-Soo

    2015-03-01

    The aim of this study is to demonstrate the feasibility of down-regulating endogeneous prefoldin-2 root-knot nematode transcripts by expressing dsRNA with sequence identity to the nematode gene in tobacco roots under the influence of strong Arabidopsis ubiquitin (UBQ1) promoter. Root-knot nematodes (RKNs) are sedentary endoparasites infecting a wide range of plant species. They parasitise the root system, thereby disrupting water and nutrient uptake and causing major reductions in crop yields. The most reliable means of controlling RKNs is via the use of soil fumigants such as methyl bromide. With the emergence of RNA interference (RNAi) technology, which permits host-mediated nematode gene silencing, a new strategy to control plant pathogens has become available. In the present study, we investigated host-induced RNAi gene silencing of prefoldin-2 in transgenic Nicotiana benthamiana. Reductions in prefoldin-2 mRNA transcript levels were observed when nematodes were soaked in a dsRNA solution in vitro. Furthermore, nematode reproduction was suppressed in RNAi transgenic lines, as evident by reductions in the numbers of root knots (by 34-60 % in independent RNAi lines) and egg masses (by 33-58 %). Endogenous expression of prefoldin-2, analysed via real-time polymerase chain reaction and Western blotting, revealed that the gene was strongly expressed in the pre-parasitic J2 stage. Our observations demonstrate the relevance and potential importance of targeting the prefoldin gene during the nematode life cycle. The work also suggests that further improvements in silencing efficiency in economically important crops can be accomplished using RNAi directed against plant-parasitic nematodes.

  1. Targeted Gene-Silencing Reveals the Functional Significance of Myocardin Signaling in the Failing Heart

    Science.gov (United States)

    Torrado, Mario; Iglesias, Raquel; Centeno, Alberto; López, Eduardo; Mikhailov, Alexander T.

    2011-01-01

    Background Myocardin (MYOCD), a potent transcriptional coactivator of smooth muscle (SM) and cardiac genes, is upregulated in failing myocardium in animal models and human end-stage heart failure (HF). However, the molecular and functional consequences of myocd upregulation in HF are still unclear. Methodology/Principal Findings The goal of the present study was to investigate if targeted inhibition of upregulated expression of myocd could influence failing heart gene expression and function. To this end, we used the doxorubicin (Dox)-induced diastolic HF (DHF) model in neonatal piglets, in which, as we show, not only myocd but also myocd-dependent SM-marker genes are highly activated in failing left ventricular (LV) myocardium. In this model, intra-myocardial delivery of short-hairpin RNAs, designed to target myocd variants expressed in porcine heart, leads on day 2 post-delivery to: (1) a decrease in the activated expression of myocd and myocd-dependent SM-marker genes in failing myocardium to levels seen in healthy control animals, (2) amelioration of impaired diastolic dysfunction, and (3) higher survival rates of DHF piglets. The posterior restoration of elevated myocd expression (on day 7 post-delivery) led to overexpression of myocd-dependent SM-marker genes in failing LV-myocardium that was associated with a return to altered diastolic function. Conclusions/Significance These data provide the first evidence that a moderate inhibition (e.g., normalization) of the activated MYOCD signaling in the diseased heart may be promising from a therapeutic point of view. PMID:22028870

  2. Targeted gene-silencing reveals the functional significance of myocardin signaling in the failing heart.

    Directory of Open Access Journals (Sweden)

    Mario Torrado

    Full Text Available BACKGROUND: Myocardin (MYOCD, a potent transcriptional coactivator of smooth muscle (SM and cardiac genes, is upregulated in failing myocardium in animal models and human end-stage heart failure (HF. However, the molecular and functional consequences of myocd upregulation in HF are still unclear. METHODOLOGY/PRINCIPAL FINDINGS: The goal of the present study was to investigate if targeted inhibition of upregulated expression of myocd could influence failing heart gene expression and function. To this end, we used the doxorubicin (Dox-induced diastolic HF (DHF model in neonatal piglets, in which, as we show, not only myocd but also myocd-dependent SM-marker genes are highly activated in failing left ventricular (LV myocardium. In this model, intra-myocardial delivery of short-hairpin RNAs, designed to target myocd variants expressed in porcine heart, leads on day 2 post-delivery to: (1 a decrease in the activated expression of myocd and myocd-dependent SM-marker genes in failing myocardium to levels seen in healthy control animals, (2 amelioration of impaired diastolic dysfunction, and (3 higher survival rates of DHF piglets. The posterior restoration of elevated myocd expression (on day 7 post-delivery led to overexpression of myocd-dependent SM-marker genes in failing LV-myocardium that was associated with a return to altered diastolic function. CONCLUSIONS/SIGNIFICANCE: These data provide the first evidence that a moderate inhibition (e.g., normalization of the activated MYOCD signaling in the diseased heart may be promising from a therapeutic point of view.

  3. Overcoming cisplatin resistance in non-small cell lung cancer with Mad2 silencing siRNA delivered systemically using EGFR-targeted chitosan nanoparticles.

    Science.gov (United States)

    Nascimento, Ana Vanessa; Singh, Amit; Bousbaa, Hassan; Ferreira, Domingos; Sarmento, Bruno; Amiji, Mansoor M

    2017-01-01

    Efficiency of chemotherapy is often limited by low therapeutic index of the drug as well as emergence of inherent and acquired drug resistance in cancer cells. As a common strategy to overcome drug resistance, higher doses of chemo-agents are administered. However, adverse side effects are usually increased as a consequence. A potentially effective approach is to combine chemotherapy with other therapeutic strategies such as small interfering RNAs (siRNAs) that allow the use of lower yet efficient doses of the anticancer drugs. We previously developed epidermal growth factor receptor (EGFR)-targeted chitosan (CS) nanoparticles as a versatile delivery system for silencing the essential mitotic checkpoint gene Mad2, and induce cell death. Here, we tested this system as a single therapy and in combination with cisplatin in cisplatin sensitive and resistant lung cancer models, and characterized its in vivo efficacy and safety. Combination treatment resulted in significant improvement in tumor inhibition that was strikingly more effective in cisplatin-resistant tumors. Importantly, effective cisplatin dosage was dramatically reduced in the co-therapy regimen resulting in negligible toxic effects from the drug as confirmed by parameters such as body weight gain, biochemical markers of hepatic and renal function, and histopathology of liver/kidney/spleen tissues. Overall, we demonstrate that the combination of Mad2 siRNA-loaded CS nanoparticles strategy with chemotherapeutic agents such as cisplatin constitutes an efficient and safe approach for the treatment of drug resistant tumors. Lung cancer remains one of the leading killers in the United States and around the world. Platinum agents, including cisplatin, are the first line treatment in lung cancer, including non-small cell lung cancer (NSCLC), which is the predominant form of lung cancer. In this study, we have evaluated Mad2 cell-cycle checkpoint gene silencing using small interfering RNA (siRNA) delivered

  4. Novel RNA Duplex Locks HIV-1 in a Latent State via Chromatin-mediated Transcriptional Silencing

    Directory of Open Access Journals (Sweden)

    Chantelle Ahlenstiel

    2015-01-01

    Full Text Available Transcriptional gene silencing (TGS of mammalian genes can be induced by short interfering RNA (siRNA targeting promoter regions. We previously reported potent TGS of HIV-1 by siRNA (PromA, which targets tandem NF-κB motifs within the viral 5′LTR. In this study, we screened a siRNA panel with the aim of identifying novel 5′LTR targets, to provide multiplexing potential with enhanced viral silencing and application toward developing alternate therapeutic strategies. Systematic examination identified a novel siRNA target, si143, confirmed to induce TGS as the silencing mechanism. TGS was prolonged with virus suppression >12 days, despite a limited ability to induce post- TGS. Epigenetic changes associated with silencing were suggested by partial reversal by histone deacetylase inhibitors and confirmed by chromatin immunoprecipitation analyses, which showed induction of H3K27me3 and H3K9me3, reduction in H3K9Ac, and recruitment of argonaute-1, all characteristic marks of heterochromatin and TGS. Together, these epigenetic changes mimic those associated with HIV-1 latency. Further, robust resistance to reactivation was observed in the J-Lat 9.2 cell latency model, when transduced with shPromA and/or sh143. These data support si/shRNA-mediated TGS approaches to HIV-1 and provide alternate targets to pursue a functional cure, whereby the viral reservoir is locked in latency following antiretroviral therapy cessation.

  5. H Ferritin Gene Silencing in a Human Metastatic Melanoma Cell Line: A Proteomic Analysis

    DEFF Research Database (Denmark)

    Di Sanzo, Maddalena; Gaspari, Marco; Misaggi, Roberta

    2011-01-01

    Ferritin, the major intracellular iron-storage protein, is made of 24 subunits of two types, H and L. Besides regulating intracellular iron homeostasis, it has been found that ferritin, in particular the H subunit (FHC), is involved in different biological events such as cell differentiation...... and pathologic states (i.e., neurodegeneration and cancer). This study is aimed at investigating the whole-cell proteome of FHC-expressing and sh-RNA-silenced human metastatic melanoma cells (MM07(m)) in the attempt to identify and classify the highest number of proteins directly or indirectly controlled...... of H ferritin signaling pathways and lend support to the hypothesis that specific targeting of this gene might be an attractive and potentially effective strategy for the management of metastatic melanoma....

  6. Genome-Wide DNA Methylation Indicates Silencing of Tumor Suppressor Genes in Uterine Leiomyoma

    Science.gov (United States)

    Navarro, Antonia; Yin, Ping; Monsivais, Diana; Lin, Simon M.; Du, Pan; Wei, Jian-Jun; Bulun, Serdar E.

    2012-01-01

    Background Uterine leiomyomas, or fibroids, represent the most common benign tumor of the female reproductive tract. Fibroids become symptomatic in 30% of all women and up to 70% of African American women of reproductive age. Epigenetic dysregulation of individual genes has been demonstrated in leiomyoma cells; however, the in vivo genome-wide distribution of such epigenetic abnormalities remains unknown. Principal Findings We characterized and compared genome-wide DNA methylation and mRNA expression profiles in uterine leiomyoma and matched adjacent normal myometrial tissues from 18 African American women. We found 55 genes with differential promoter methylation and concominant differences in mRNA expression in uterine leiomyoma versus normal myometrium. Eighty percent of the identified genes showed an inverse relationship between DNA methylation status and mRNA expression in uterine leiomyoma tissues, and the majority of genes (62%) displayed hypermethylation associated with gene silencing. We selected three genes, the known tumor suppressors KLF11, DLEC1, and KRT19 and verified promoter hypermethylation, mRNA repression and protein expression using bisulfite sequencing, real-time PCR and western blot. Incubation of primary leiomyoma smooth muscle cells with a DNA methyltransferase inhibitor restored KLF11, DLEC1 and KRT19 mRNA levels. Conclusions These results suggest a possible functional role of promoter DNA methylation-mediated gene silencing in the pathogenesis of uterine leiomyoma in African American women. PMID:22428009

  7. Novel Hematopoietic Target Genes in the NRF2-Mediated Transcriptional Pathway

    Directory of Open Access Journals (Sweden)

    Michelle R. Campbell

    2013-01-01

    Full Text Available Nuclear factor- (erythroid-derived 2 like 2 (NFE2L2, NRF2 is a key transcriptional activator of the antioxidant response pathway and is closely related to erythroid transcription factor NFE2. Under oxidative stress, NRF2 heterodimerizes with small Maf proteins and binds cis-acting enhancer sequences found near oxidative stress response genes. Using the dietary isothiocyanate sulforaphane (SFN to activate NRF2, chromatin immunoprecipitation sequencing (ChIP-seq identified several hundred novel NRF2-mediated targets beyond its role in oxidative stress. Activated NRF2 bound the antioxidant response element (ARE in promoters of several known and novel target genes involved in iron homeostasis and heme metabolism, including known targets FTL and FTH1, as well as novel binding in the globin locus control region. Five novel NRF2 target genes were chosen for followup: AMBP, ABCB6, FECH, HRG-1 (SLC48A1, and TBXAS1. SFN-induced gene expression in erythroid K562 and lymphoid cells were compared for each target gene. NRF2 silencing showed reduced expression in lymphoid, lung, and hepatic cells. Furthermore, stable knockdown of NRF2 negative regulator KEAP1 in K562 cells resulted in increased NQO1, AMBP, and TBXAS1 expression. NFE2 binding sites in K562 cells revealed similar binding profiles as lymphoid NRF2 sites in all potential NRF2 candidates supporting a role for NRF2 in heme metabolism and erythropoiesis.

  8. Protocol: using virus-induced gene silencing to study the arbuscular mycorrhizal symbiosis in Pisum sativum

    DEFF Research Database (Denmark)

    Grønlund, Mette; Olsen, Anne; Johansen, Elisabeth

    2010-01-01

    , the available PEBV-VIGS protocols are inadequate for studying genes involved in the symbiosis with arbuscular mycorrhizal fungi (AMF). Here we describe a PEBV-VIGS protocol suitable for reverse genetics studies in pea of genes involved in the symbiosis with AMF and show its effectiveness in silencing genes...... involved in the early and late stages of AMF symbiosis....

  9. Oligopeptide complex for targeted non-viral gene delivery to adipocytes

    Science.gov (United States)

    Won, Young-Wook; Adhikary, Partho Protim; Lim, Kwang Suk; Kim, Hyung Jin; Kim, Jang Kyoung; Kim, Yong-Hee

    2014-12-01

    Commercial anti-obesity drugs acting in the gastrointestinal tract or the central nervous system have been shown to have limited efficacy and severe side effects. Anti-obesity drug development is thus focusing on targeting adipocytes that store excess fat. Here, we show that an adipocyte-targeting fusion-oligopeptide gene carrier consisting of an adipocyte-targeting sequence and 9-arginine (ATS-9R) selectively transfects mature adipocytes by binding to prohibitin. Injection of ATS-9R into obese mice confirmed specific binding of ATS-9R to fat vasculature, internalization and gene expression in adipocytes. We also constructed a short-hairpin RNA (shRNA) for silencing fatty-acid-binding protein 4 (shFABP4), a key lipid chaperone in fatty-acid uptake and lipid storage in adipocytes. Treatment of obese mice with ATS-9R/shFABP4 led to metabolic recovery and body-weight reduction (>20%). The ATS-9R/shFABP4 oligopeptide complex could prove to be a safe therapeutic approach to regress and treat obesity as well as obesity-induced metabolic syndromes.

  10. Epigenetic silencing of nucleolar rRNA genes in Alzheimer's disease.

    Directory of Open Access Journals (Sweden)

    Maciej Pietrzak

    Full Text Available Ribosomal deficits are documented in mild cognitive impairment (MCI, which often represents an early stage Alzheimer's disease (AD, as well as in advanced AD. The nucleolar rRNA genes (rDNA, transcription of which is critical for ribosomal biogenesis, are regulated by epigenetic silencing including promoter CpG methylation.To assess whether CpG methylation of the rDNA promoter was dysregulated across the AD spectrum, we analyzed brain samples from 10 MCI-, 23 AD-, and, 24 age-matched control individuals using bisulfite mapping. The rDNA promoter became hypermethylated in cerebro-cortical samples from MCI and AD groups. In parietal cortex, the rDNA promoter was hypermethylated more in MCI than in advanced AD. The cytosine methylation of total genomic DNA was similar in AD, MCI, and control samples. Consistent with a notion that hypermethylation-mediated silencing of the nucleolar chromatin stabilizes rDNA loci, preventing their senescence-associated loss, genomic rDNA content was elevated in cerebrocortical samples from MCI and AD groups.In conclusion, rDNA hypermethylation could be a new epigenetic marker of AD. Moreover, silencing of nucleolar chromatin may occur during early stages of AD pathology and play a role in AD-related ribosomal deficits and, ultimately, dementia.

  11. In planta assays involving epigenetically silenced genes reveal inhibition of cytosine methylation by genistein

    Directory of Open Access Journals (Sweden)

    Arase Sachiko

    2012-03-01

    Full Text Available Abstract Background Cytosine methylation is involved in epigenetic control of gene expression in a wide range of organisms. An increasing number of examples indicate that changing the frequency of cytosine methylation in the genome is a feasible tool to engineer novel traits in plants. Although demethylating effects of compounds have been analyzed in human cultured cells in terms of suppressing cancer, their effect in plant cells has not been analyzed extensively. Here, we developed in planta assay systems to detect inhibition of cytosine methylation using plants that contain a transgene transcriptionally silenced by an epigenetic mechanism. Results Seeds of two transgenic plants were used: a petunia line that has been identified as a revertant of the co-suppression of the chalcone synthase-A (CHS-A gene and contains CHS-A transgenes whose transcription is repressed; Nicotiana benthamiana plants that contain the green fluorescent protein (GFP reporter gene whose transcription is repressed through virus-induced transcriptional gene silencing. Seeds of these plants were sown on a medium that contained a demethylating agent, either 5-azacytidine or trichostatin A, and the restoration of the transcriptionally active state of the transgene was detected in seedlings. Using these systems, we found that genistein, a major isoflavonoid compound, inhibits cytosine methylation, thus restoring transgene transcription. Genistein also restored the transcription of an epigenetically silenced endogenous gene in Arabidopsis plants. Conclusions Our assay systems allowed us to assess the inhibition of cytosine methylation, in particular of maintenance of methylation, by compounds in plant cells. These results suggest a novel role of flavonoids in plant cells and that genistein is useful for modifying the epigenetic state of plant genomes.

  12. Gene dosage induction of silencing directed against an Arabidopsis Myb transgene in tobacco

    Science.gov (United States)

    An unexpected reduction in petal pigmentation on petunia plants genetically engineered for enhanced flower color was one of the first experimental demonstrations of the natural process of RNA-associated gene silencing. The obvious visual nature of such alterations to pigment patterns of transgenic ...

  13. Induction and maintenance of DNA methylation in plant promoter sequences by apple latent spherical virus-induced transcriptional gene silencing

    Directory of Open Access Journals (Sweden)

    Tatsuya eKon

    2014-11-01

    Full Text Available Apple latent spherical virus (ALSV is an efficient virus-induced gene silencing vector in functional genomics analyses of a broad range of plant species. Here, an Agrobacterium-mediated inoculation (agroinoculation system was developed for the ALSV vector, and virus-induced transcriptional gene silencing (VITGS is described in plants infected with the ALSV vector. The cDNAs of ALSV RNA1 and RNA2 were inserted between the CaMV 35S promoter and the NOS-T sequences in a binary vector pCAMBIA1300 to produce pCALSR1 and pCALSR2-XSB or pCALSR2-XSB/MN. When these vector constructs were agroinoculated into Nicotiana benthamiana plants with a construct expressing a viral silencing suppressor, the infection efficiency of the vectors was 100%. A recombinant ALSV vector carrying part of the 35S promoter sequence induced transcriptional gene silencing of the green fluorescent protein gene in a line of N. benthamiana plants, resulting in the disappearance of green fluorescence of infected plants. Bisulfite sequencing showed that cytosine residues at CG and CHG sites of the 35S promoter sequence were highly methylated in the silenced generation 0 plants infected with the ALSV carrying the promoter sequence as well as in progeny. The ALSV-mediated VITGS state was inherited by progeny for multiple generations. In addition, induction of VITGS of an endogenous gene (chalcone synthase-A was demonstrated in petunia plants infected with an ALSV vector carrying the native promoter sequence. These results suggest that ALSV-based vectors can be applied to study DNA methylation in plant genomes, and provide a useful tool for plant breeding via epigenetic modification.

  14. RNA-mediated gene silencing in Candida albicans: inhibition of hyphae formation by use of RNAi technology.

    Science.gov (United States)

    Moazeni, Maryam; Khoramizadeh, Mohammad Reza; Kordbacheh, Parivash; Sepehrizadeh, Zargham; Zeraati, Hojat; Noorbakhsh, Fatemeh; Teimoori-Toolabi, Ladan; Rezaie, Sassan

    2012-09-01

    The introduction of RNA silencing machinery in fungi has led to the promising application of RNAi methodology to knock down essential vital factor or virulence factor genes in the microorganisms. Efg1p is required for development of a true hyphal growth form which is known to be essential for interactions with human host cells and for the yeast's pathogenesis. In this paper, we describe the development of a system for presenting and studying the RNAi function on the EFG1 gene in C. albicans. The 19-nucleotide siRNA was designed on the basis of the cDNA sequence of the EFG1 gene in C. albicans and transfection was performed by use of a modified-PEG/LiAc method. To investigate EFG1 gene silencing in siRNA-treated cells, the yeasts were grown in human serum; to induce germ tubes a solid medium was used with the serum. Quantitative changes in expression of the EFG1 gene were analyzed by measuring the cognate EFG1 mRNA level by use of a quantitative real-time RT-PCR assay. Compared with the positive control, true hyphae formation was significantly reduced by siRNA at concentrations of 1 μM, 500 nM, and 100 nM (P < 0.05). In addition, siRNA at a concentration of 1 μM was revealed to inhibit expression of the EFG1 gene effectively (P < 0.05). On the basis of the potential of post-transcriptional gene silencing to control the expression of specific genes, these techniques may be regarded as promising means of drug discovery, with applications in biomedicine and functional genomics analysis.

  15. F-box-like domain in the polerovirus protein P0 is required for silencing suppressor function

    Science.gov (United States)

    Pazhouhandeh, Maghsoud; Dieterle, Monika; Marrocco, Katia; Lechner, Esther; Berry, Bassam; Brault, Véronique; Hemmer, Odile; Kretsch, Thomas; Richards, Kenneth E.; Genschik, Pascal; Ziegler-Graff, Véronique

    2006-01-01

    Plants employ small RNA-mediated posttranscriptional gene silencing as a virus defense mechanism. In response, plant viruses encode proteins that can suppress RNA silencing, but the mode of action of most such proteins is poorly understood. Here, we show that the silencing suppressor protein P0 of two Arabidopsis-infecting poleroviruses interacts by means of a conserved minimal F-box motif with Arabidopsis thaliana orthologs of S-phase kinase-related protein 1 (SKP1), a component of the SCF family of ubiquitin E3 ligases. Point mutations in the F-box-like motif abolished the P0–SKP1 ortholog interaction, diminished virus pathogenicity, and inhibited the silencing suppressor activity of P0. Knockdown of expression of a SKP1 ortholog in Nicotiana benthamiana rendered the plants resistant to polerovirus infection. Together, the results support a model in which P0 acts as an F-box protein that targets an essential component of the host posttranscriptional gene silencing machinery. PMID:16446454

  16. A Single RNaseIII Domain Protein from Entamoeba histolytica Has dsRNA Cleavage Activity and Can Help Mediate RNAi Gene Silencing in a Heterologous System.

    Science.gov (United States)

    Pompey, Justine M; Foda, Bardees; Singh, Upinder

    2015-01-01

    Dicer enzymes process double-stranded RNA (dsRNA) into small RNAs that target gene silencing through the RNA interference (RNAi) pathway. Dicer enzymes are complex, multi-domain RNaseIII proteins, however structural minimalism of this protein has recently emerged in parasitic and fungal systems. The most minimal Dicer, Saccharomyces castellii Dicer1, has a single RNaseIII domain and two double stranded RNA binding domains. In the protozoan parasite Entamoeba histolytica 27nt small RNAs are abundant and mediate silencing, yet no canonical Dicer enzyme has been identified. Although EhRNaseIII does not exhibit robust dsRNA cleavage in vitro, it can process dsRNA in the RNAi-negative background of Saccharomyces cerevisiae, and in conjunction with S. castellii Argonaute1 can partially reconstitute the RNAi pathway. Thus, although EhRNaseIII lacks the domain architecture of canonical or minimal Dicer enzymes, it has dsRNA processing activity that contributes to gene silencing via RNAi. Our data advance the understanding of small RNA biogenesis in Entamoeba as well as broaden the spectrum of non-canonical Dicer enzymes that contribute to the RNAi pathway.

  17. A Single RNaseIII Domain Protein from Entamoeba histolytica Has dsRNA Cleavage Activity and Can Help Mediate RNAi Gene Silencing in a Heterologous System.

    Directory of Open Access Journals (Sweden)

    Justine M Pompey

    Full Text Available Dicer enzymes process double-stranded RNA (dsRNA into small RNAs that target gene silencing through the RNA interference (RNAi pathway. Dicer enzymes are complex, multi-domain RNaseIII proteins, however structural minimalism of this protein has recently emerged in parasitic and fungal systems. The most minimal Dicer, Saccharomyces castellii Dicer1, has a single RNaseIII domain and two double stranded RNA binding domains. In the protozoan parasite Entamoeba histolytica 27nt small RNAs are abundant and mediate silencing, yet no canonical Dicer enzyme has been identified. Although EhRNaseIII does not exhibit robust dsRNA cleavage in vitro, it can process dsRNA in the RNAi-negative background of Saccharomyces cerevisiae, and in conjunction with S. castellii Argonaute1 can partially reconstitute the RNAi pathway. Thus, although EhRNaseIII lacks the domain architecture of canonical or minimal Dicer enzymes, it has dsRNA processing activity that contributes to gene silencing via RNAi. Our data advance the understanding of small RNA biogenesis in Entamoeba as well as broaden the spectrum of non-canonical Dicer enzymes that contribute to the RNAi pathway.

  18. Genetic transformation and gene silencing mediated by multiple copies of a transgene in eastern white pine.

    Science.gov (United States)

    Tang, Wei; Newton, Ronald J; Weidner, Douglas A

    2007-01-01

    An efficient transgenic eastern white pine (Pinus strobus L.) plant regeneration system has been established using Agrobacterium tumefaciens strain GV3850-mediated transformation and the green fluorescent protein (gfp) gene as a reporter in this investigation. Stable integration of transgenes in the plant genome of pine was confirmed by polymerase chain reaction (PCR), Southern blot, and northern blot analyses. Transgene expression was analysed in pine T-DNA transformants carrying different numbers of copies of T-DNA insertions. Post-transcriptional gene silencing (PTGS) was mostly obtained in transgenic lines with more than three copies of T-DNA, but not in transgenic lines with one copy of T-DNA. In situ hybridization chromosome analysis of transgenic lines demonstrated that silenced transgenic lines had two or more T-DNA insertions in the same chromosome. These results suggest that two or more T-DNA insertions in the same chromosome facilitate efficient gene silencing in transgenic pine cells expressing green fluorescent protein. There were no differences in shoot differentiation and development between transgenic lines with multiple T-DNA copies and transgenic lines with one or two T-DNA copies.

  19. HvCKX2 gene silencing by biolistic or Agrobacterium-mediated transformation in barley leads to different phenotypes.

    Science.gov (United States)

    Zalewski, Wojciech; Orczyk, Wacław; Gasparis, Sebastian; Nadolska-Orczyk, Anna

    2012-11-07

    CKX genes encode cytokinin dehydrogenase enzymes (CKX), which metabolize cytokinins in plants and influence developmental processes. The genes are expressed in different tissues and organs during development; however, their exact role in barley is poorly understood. It has already been proven that RNA interference (RNAi)-based silencing of HvCKX1 decreased the CKX level, especially in those organs which showed the highest expression, i.e. developing kernels and roots, leading to higher plant productivity and higher mass of the roots [1]. The same type of RNAi construct was applied to silence HvCKX2 and analyze the function of the gene. Two cultivars of barley were transformed with the same silencing and selection cassettes by two different methods: biolistic and via Agrobacterium. The mean Agrobacterium-mediated transformation efficiency of Golden Promise was 3.47% (±2.82). The transcript level of HvCKX2 in segregating progeny of T(1) lines was decreased to 34%. The reduction of the transcript in Agrobacterium-derived plants resulted in decreased CKX activity in the developing and developed leaves as well as in 7 DAP (days after pollination) spikes. The final phenotypic effect was increased productivity of T(0) plants and T(1) lines. Higher productivity was the result of the higher number of seeds and higher grain yield. It was also correlated with the higher 1000 grain weight, increased (by 7.5%) height of the plants and higher (from 0.5 to 2) numbers of spikes. The transformation efficiency of Golden Promise after biolistic transformation was more than twice as low compared to Agrobacterium. The transcript level in segregating progeny of T(1) lines was decreased to 24%. Otherwise, the enzyme activity found in the leaves of the lines after biolistic transformation, especially in cv. Golden Promise, was very high, exceeding the relative level of the control lines. These unbalanced ratios of the transcript level and the activity of the CKX enzyme negatively

  20. The C. elegans CSR-1 argonaute pathway counteracts epigenetic silencing to promote germline gene expression.

    Science.gov (United States)

    Seth, Meetu; Shirayama, Masaki; Gu, Weifeng; Ishidate, Takao; Conte, Darryl; Mello, Craig C

    2013-12-23

    Organisms can develop adaptive sequence-specific immunity by reexpressing pathogen-specific small RNAs that guide gene silencing. For example, the C. elegans PIWI-Argonaute/piwi-interacting RNA (piRNA) pathway recruits RNA-dependent RNA polymerase (RdRP) to foreign sequences to amplify a transgenerational small-RNA-induced epigenetic silencing signal (termed RNAe). Here, we provide evidence that, in addition to an adaptive memory of silenced sequences, C. elegans can also develop an opposing adaptive memory of expressed/self-mRNAs. We refer to this mechanism, which can prevent or reverse RNAe, as RNA-induced epigenetic gene activation (RNAa). We show that CSR-1, which engages RdRP-amplified small RNAs complementary to germline-expressed mRNAs, is required for RNAa. We show that a transgene with RNAa activity also exhibits accumulation of cognate CSR-1 small RNAs. Our findings suggest that C. elegans adaptively acquires and maintains a transgenerational CSR-1 memory that recognizes and protects self-mRNAs, allowing piRNAs to recognize foreign sequences innately, without the need for prior exposure

  1. Enhancement of allele discrimination by introduction of nucleotide mismatches into siRNA in allele-specific gene silencing by RNAi.

    Directory of Open Access Journals (Sweden)

    Yusuke Ohnishi

    Full Text Available Allele-specific gene silencing by RNA interference (RNAi is therapeutically useful for specifically inhibiting the expression of disease-associated alleles without suppressing the expression of corresponding wild-type alleles. To realize such allele-specific RNAi (ASP-RNAi, the design and assessment of small interfering RNA (siRNA duplexes conferring ASP-RNAi is vital; however, it is also difficult. In a previous study, we developed an assay system to assess ASP-RNAi with mutant and wild-type reporter alleles encoding the Photinus and Renilla luciferase genes. In line with experiments using the system, we realized that it is necessary and important to enhance allele discrimination between mutant and corresponding wild-type alleles. Here, we describe the improvement of ASP-RNAi against mutant alleles carrying single nucleotide variations by introducing base substitutions into siRNA sequences, where original variations are present in the central position. Artificially mismatched siRNAs or short-hairpin RNAs (shRNAs against mutant alleles of the human Prion Protein (PRNP gene, which appear to be associated with susceptibility to prion diseases, were examined using this assessment system. The data indicates that introduction of a one-base mismatch into the siRNAs and shRNAs was able to enhance discrimination between the mutant and wild-type alleles. Interestingly, the introduced mismatches that conferred marked improvement in ASP-RNAi, appeared to be largely present in the guide siRNA elements, corresponding to the 'seed region' of microRNAs. Due to the essential role of the 'seed region' of microRNAs in their association with target RNAs, it is conceivable that disruption of the base-pairing interactions in the corresponding seed region, as well as the central position (involved in cleavage of target RNAs, of guide siRNA elements could influence allele discrimination. In addition, we also suggest that nucleotide mismatches at the 3'-ends of sense

  2. Silencing of Stress-Regulated miRNAs in Plants by Short Tandem Target Mimic (STTM) Approach.

    Science.gov (United States)

    Teotia, Sachin; Tang, Guiliang

    2017-01-01

    In plants, microRNAs (miRNAs) regulate more than hundred target genes comprising largely transcription factors that control growth and development as well as stress responses. However, the exact functions of miRNA families could not be deciphered because each miRNA family has multiple loci in the genome, thus are functionally redundant. Therefore, an ideal approach to study the function of a miRNA family is to silence the expression of all members simultaneously, which is a daunting task. However, this can be partly overcome by Target Mimic (TM) approach that can knockdown an entire miRNA family. STTM is a modification of TM approach and complements it. STTMs have been successfully used in monocots and dicots to block miRNA functions. miR159 has been shown to be differentially regulated by various abiotic stresses including ABA in various plant species. Here, we describe in detail the protocol for designing STTM construct to block miR159 functions in Arabidopsis, with the potential to apply this technique on a number of other stress-regulated miRNAs in plants.

  3. Differential Cotton leaf crumple virus-VIGS-mediated gene silencing and viral genome localization in different Gossypium hirsutum genetic backgrounds

    KAUST Repository

    Idris, Ali

    2010-12-01

    A Cotton leaf crumple virus (CLCrV)-based gene silencing vector containing a fragment of the Gossypium hirsutum Magnesium chelatase subunit I was used to establish endogenous gene silencing in cotton of varied genetic backgrounds. Biolistic inoculation resulted in systemic and persistent photo-bleaching of the leaves and bolls of the seven cultivars tested, however, the intensity of silencing was variable. CLCrV-VIGS-mediated expression of green fluorescent protein was used to monitor the in planta distribution of the vector, indicating successful phloem invasion in all cultivars tested. Acala SJ-1, one of the cotton cultivars, was identified as a particularly optimal candidate for CLCrV-VIGS-based cotton reverse-genetics. © 2010 Elsevier Ltd.

  4. H3K9me-independent gene silencing in fission yeast heterochromatin by Clr5 and histone deacetylases

    DEFF Research Database (Denmark)

    Hansen, Klavs R; Hazan, Idit; Shanker, Sreenath

    2011-01-01

    organisms such as fission yeast. In spite of numerous studies, the relative contributions of the various heterochromatic histone marks to the properties of heterochromatin remain largely undefined. Here, we report that silencing of the fission yeast mating-type cassettes, which are located in a well......, our results point to histone deacetylases as prominent repressors of gene expression in fission yeast heterochromatin. These deacetylases can act in concert with, or independently of, the widely studied H3K9me mark to influence gene silencing at heterochromatic loci....

  5. Host-induced silencing of essential genes in Puccinia triticina through transgenic expression of RNAi sequences reduces severity of leaf rust infection in wheat.

    Science.gov (United States)

    Panwar, Vinay; Jordan, Mark; McCallum, Brent; Bakkeren, Guus

    2018-05-01

    Leaf rust, caused by the pathogenic fungus Puccinia triticina (Pt), is one of the most serious biotic threats to sustainable wheat production worldwide. This obligate biotrophic pathogen is prevalent worldwide and is known for rapid adaptive evolution to overcome resistant wheat varieties. Novel disease control approaches are therefore required to minimize the yield losses caused by Pt. Having shown previously the potential of host-delivered RNA interference (HD-RNAi) in functional screening of Pt genes involved in pathogenesis, we here evaluated the use of this technology in transgenic wheat plants as a method to achieve protection against wheat leaf rust (WLR) infection. Stable expression of hairpin RNAi constructs with sequence homology to Pt MAP-kinase (PtMAPK1) or a cyclophilin (PtCYC1) encoding gene in susceptible wheat plants showed efficient silencing of the corresponding genes in the interacting fungus resulting in disease resistance throughout the T 2 generation. Inhibition of Pt proliferation in transgenic lines by in planta-induced RNAi was associated with significant reduction in target fungal transcript abundance and reduced fungal biomass accumulation in highly resistant plants. Disease protection was correlated with the presence of siRNA molecules specific to targeted fungal genes in the transgenic lines harbouring the complementary HD-RNAi construct. This work demonstrates that generating transgenic wheat plants expressing RNAi-inducing transgenes to silence essential genes in rust fungi can provide effective disease resistance, thus opening an alternative way for developing rust-resistant crops. © 2017 Her Majesty the Queen in Right of Canada. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  6. The drug target genes show higher evolutionary conservation than non-target genes.

    Science.gov (United States)

    Lv, Wenhua; Xu, Yongdeng; Guo, Yiying; Yu, Ziqi; Feng, Guanglong; Liu, Panpan; Luan, Meiwei; Zhu, Hongjie; Liu, Guiyou; Zhang, Mingming; Lv, Hongchao; Duan, Lian; Shang, Zhenwei; Li, Jin; Jiang, Yongshuai; Zhang, Ruijie

    2016-01-26

    Although evidence indicates that drug target genes share some common evolutionary features, there have been few studies analyzing evolutionary features of drug targets from an overall level. Therefore, we conducted an analysis which aimed to investigate the evolutionary characteristics of drug target genes. We compared the evolutionary conservation between human drug target genes and non-target genes by combining both the evolutionary features and network topological properties in human protein-protein interaction network. The evolution rate, conservation score and the percentage of orthologous genes of 21 species were included in our study. Meanwhile, four topological features including the average shortest path length, betweenness centrality, clustering coefficient and degree were considered for comparison analysis. Then we got four results as following: compared with non-drug target genes, 1) drug target genes had lower evolutionary rates; 2) drug target genes had higher conservation scores; 3) drug target genes had higher percentages of orthologous genes and 4) drug target genes had a tighter network structure including higher degrees, betweenness centrality, clustering coefficients and lower average shortest path lengths. These results demonstrate that drug target genes are more evolutionarily conserved than non-drug target genes. We hope that our study will provide valuable information for other researchers who are interested in evolutionary conservation of drug targets.

  7. Persistent interferon transgene expression by RNA interference-mediated silencing of interferon receptors.

    Science.gov (United States)

    Takahashi, Yuki; Vikman, Elin; Nishikawa, Makiya; Ando, Mitsuru; Watanabe, Yoshihiko; Takakura, Yoshinobu

    2010-09-01

    The in vivo half-life of interferons (IFNs) is very short, and its extension would produce a better therapeutic outcome in IFN-based therapy. Delivery of IFN genes is one solution for providing a sustained supply. IFNs have a variety of functions, including the suppression of transgene expression, through interaction with IFN receptors (IFNRs). This suppression could prevent IFNs from being expressed from vectors delivered. Silencing the expression of IFNAR and IFNGR, the receptors for type I and II IFNs, respectively, in cells expressing IFNs may prolong transgene expression of IFNs. Mouse melanoma B16-BL6 cells or mouse liver were selected as a site expressing IFNs (not a target for IFN gene therapy) and IFN-expressing plasmid DNA was delivered with or without small interfering RNA (siRNA) targeting IFNRs. Transfection of B16-BL6 cells with siRNA targeting IFNAR1 subunit (IFNAR1) resulted in the reduced expression of IFNAR on the cell surface. This silencing significantly increased the IFN-beta production in cells that were transfected with IFN-beta-expressing plasmid DNA. Similar results were obtained with the combination of IFN-gamma and IFNGR. Co-injection of IFN-beta-expressing plasmid DNA with siRNA targeting IFNAR1 into mice resulted in sustained plasma concentration of IFN-beta. These results provide experimental evidence that the RNAi-mediated silencing of IFNRs in cells expressing IFN, such as hepatocytes, is an effective approach for improving transgene expression of IFNs when their therapeutic target comprises cells other than those expressing IFNs.

  8. CRISPR Interference Efficiently Induces Specific and Reversible Gene Silencing in Human iPSCs

    DEFF Research Database (Denmark)

    Mandegar, Mohammad A.; Huebsch, Nathaniel; Frolov, Ekaterina B.

    2016-01-01

    repression system is tunable and has the potential to silence single alleles. Compared with CRISPR nuclease (CRISPRn), CRISPRi gene repression is more efficient and homogenous across cell populations. The CRISPRi system in iPSCs provides a powerful platform to perform genome-scale screens in a wide range...

  9. The dynamics and efficacy of antiviral RNA silencing: A model study

    Directory of Open Access Journals (Sweden)

    Hogeweg Paulien

    2008-03-01

    Full Text Available Abstract Background Mathematical modeling is important to provide insight in the complicated pathway of RNA silencing. RNA silencing is an RNA based mechanism that is widely used by eukaryotes to fight viruses, and to control gene expression. Results We here present the first mathematical model that combines viral growth with RNA silencing. The model involves a plus-strand RNA virus that replicates through a double-strand RNA intermediate. The model of the RNA silencing pathway consists of cleavage of viral RNA into siRNA by Dicer, target cleavage of viral RNA via the RISC complex, and a secondary response. We found that, depending on the strength of the silencing response, different viral growth patterns can occur. Silencing can decrease viral growth, cause oscillations, or clear the virus completely. Our model can explain various observed phenomena, even when they seem contradictory at first: the diverse responses to the removal of RNA dependent RNA polymerase; different viral growth curves; and the great diversity in observed siRNA ratios. Conclusion The model presented here is an important step in the understanding of the natural functioning of RNA silencing in viral infections.

  10. Involvement of Multiple Gene-Silencing Pathways in a Paramutation-like Phenomenon in Arabidopsis

    Directory of Open Access Journals (Sweden)

    Zhimin Zheng

    2015-05-01

    Full Text Available Paramutation is an epigenetic phenomenon that has been observed in a number of multicellular organisms. The epigenetically silenced state of paramutated alleles is not only meiotically stable but also “infectious” to active homologous alleles. The molecular mechanism of paramutation remains unclear, but components involved in RNA-directed DNA methylation (RdDM are required. Here, we report a multi-copy pRD29A-LUC transgene in Arabidopsis thaliana that behaves like a paramutation locus. The silent state of LUC is induced by mutations in the DNA glycosylase gene ROS1. The silent alleles of LUC are not only meiotically stable but also able to transform active LUC alleles into silent ones, in the absence of ros1 mutations. Maintaining silencing at the LUC gene requires action of multiple pathways besides RdDM. Our study identified specific factors that are involved in the paramutation-like phenomenon and established a model system for the study of paramutation in Arabidopsis.

  11. Functional characterization of endogenous siRNA target genes in Caenorhabditis elegans

    Directory of Open Access Journals (Sweden)

    Heikkinen Liisa

    2008-06-01

    Full Text Available Abstract Background Small interfering RNA (siRNA molecules mediate sequence specific silencing in RNA interference (RNAi, a gene regulatory phenomenon observed in almost all organisms. Large scale sequencing of small RNA libraries obtained from C. elegans has revealed that a broad spectrum of siRNAs is endogenously transcribed from genomic sequences. The biological role and molecular diversity of C. elegans endogenous siRNA (endo-siRNA molecules, nonetheless, remain poorly understood. In order to gain insight into their biological function, we annotated two large libraries of endo-siRNA sequences, identified their cognate targets, and performed gene ontology analysis to identify enriched functional categories. Results Systematic trends in categorization of target genes according to the specific length of siRNA sequences were observed: 18- to 22-mer siRNAs were associated with genes required for embryonic development; 23-mers were associated uniquely with post-embryonic development; 24–26-mers were associated with phosphorus metabolism or protein modification. Moreover, we observe that some argonaute related genes associate with siRNAs with multiple reads. Sequence frequency graphs suggest that different lengths of siRNAs share similarities in overall sequence structure: the 5' end begins with G, while the body predominates with U and C. Conclusion These results suggest that the lengths of endogenous siRNA molecules are consequential to their biological functions since the gene ontology categories for their cognate mRNA targets vary depending upon their lengths.

  12. Silencing of mitochondrial NADP+-dependent isocitrate dehydrogenase gene enhances glioma radiosensitivity

    International Nuclear Information System (INIS)

    Kim, Sung Youl; Yoo, Young Hyun; Park, Jeen-Woo

    2013-01-01

    Highlights: •Silencing of the IDPm gene enhances IR-induced autophagy in glioma cells. •Autophagy inhibition augmented apoptosis of irradiated glioma cells. •Results offer a redox-active therapeutic strategy for the treatment of cancer. -- Abstract: Reactive oxygen species (ROS) levels are elevated in organisms that have been exposed to ionizing radiation and are protagonists in the induction of cell death. Recently, we demonstrated that the control of mitochondrial redox balance and the cellular defense against oxidative damage are primary functions of mitochondrial NADP + -dependent isocitrate dehydrogenase (IDPm) via the supply of NADPH for antioxidant systems. In the present study, we report an autophagic response to ionizing radiation in A172 glioma cells transfected with small interfering RNA (siRNA) targeting the IDPm gene. Autophagy in A172 transfectant cells was associated with enhanced autophagolysosome formation and GFP–LC3 punctuation/aggregation. Furthermore, we found that the inhibition of autophagy by chloroquine augmented apoptotic cell death of irradiated A172 cells transfected with IDPm siRNA. Taken together, our data suggest that autophagy functions as a survival mechanism in A172 cells against ionizing radiation-induced apoptosis and the sensitizing effect of IDPm siRNA and autophagy inhibitor on the ionizing radiation-induced apoptotic cell death of glioma cells offers a novel redox-active therapeutic strategy for the treatment of cancer

  13. Silencing of a putative immunophilin gene in the cattle tick Rhipicephalus (Boophilus microplus increases the infection rate of Babesia bovis in larval progeny

    Directory of Open Access Journals (Sweden)

    Knowles Donald P

    2009-11-01

    Full Text Available Abstract Background The cattle tick Rhipicephalus (Boophilus microplus is involved in the transmission of the protozoan Babesia bovis, the etiological agent of bovine babesiosis. Interactions between ticks and protozoa are poorly understood and the investigation of tick genes that affect tick fitness and protozoan infection can set the stage for dissecting the molecular interactions between the two species. Results In this study, RNA interference was used to silence R. microplus genes that had been previously shown to be up-regulated in response to B. bovis infection. The silencing of a putative immunophilin gene (Imnp in female ticks fed on a calf acutely infected with B. bovis decreased the hatching rate and survival of larval progeny. Interestingly, Imnp was up-regulated significantly in ovaries of R. microplus in response to B. bovis infection and its silencing in female ticks significantly increased the infection rate of the protozoan in larval progeny. The results also showed that the silencing of a putative Kunitz-type serine protease inhibitor (Spi gene and a putative lipocalin (Lpc gene decreased the fitness of R. microplus females, but had no significant effect on the infection rate of B. bovis in larval progeny. Conclusion The silencing of the Imnp, Spi or Lpc genes decreased the fitness of R. microplus females fed on a calf during acute B. bovis infection. The Imnp gene data suggest that this putative immunophilin gene is involved in the defense system of R. microplus against B. bovis and may play a role in controlling the protozoan infection in tick ovaries and larval progeny.

  14. Utilizing virus-induced gene silencing for the functional characterization of maize genes during infection with the fungal pathogen Ustilago maydis.

    Science.gov (United States)

    van der Linde, Karina; Doehlemann, Gunther

    2013-01-01

    While in dicotyledonous plants virus-induced gene silencing (VIGS) is well established to study plant-pathogen interaction, in monocots only few examples of efficient VIGS have been reported so far. One of the available systems is based on the brome mosaic virus (BMV) which allows gene silencing in different cereals including barley (Hordeum vulgare), wheat (Triticum aestivum), and maize (Zea mays).Infection of maize plants by the corn smut fungus Ustilago maydis leads to the formation of large tumors on stem, leaves, and inflorescences. During this biotrophic interaction, plant defense responses are actively suppressed by the pathogen, and previous transcriptome analyses of infected maize plants showed comprehensive and stage-specific changes in host gene expression during disease progression.To identify maize genes that are functionally involved in the interaction with U. maydis, we adapted a VIGS system based on the Brome mosaic virus (BMV) to maize at conditions that allow successful U. maydis infection of BMV pre-infected maize plants. This setup enables quantification of VIGS and its impact on U. maydis infection using a quantitative real-time PCR (q(RT)-PCR)-based readout.

  15. Silencing the SpMPK1, SpMPK2, and SpMPK3 Genes in Tomato Reduces Abscisic Acid—Mediated Drought Tolerance

    Directory of Open Access Journals (Sweden)

    Yan Liang

    2013-11-01

    Full Text Available Drought is a major threat to agriculture production worldwide. Mitogen-activated protein kinases (MAPKs play a pivotal role in sensing and converting stress signals into appropriate responses so that plants can adapt and survive. To examine the function of MAPKs in the drought tolerance of tomato plants, we silenced the SpMPK1, SpMPK2, and SpMPK3 genes in wild-type plants using the virus-induced gene silencing (VIGS method. The results indicate that silencing the individual genes or co-silencing SpMPK1, SpMPK2, and SpMPK3 reduced the drought tolerance of tomato plants by varying degrees. Co-silencing SpMPK1 and SpMPK2 impaired abscisic acid (ABA-induced and hydrogen peroxide (H2O2-induced stomatal closure and enhanced ABA-induced H2O2 production. Similar results were observed when silencing SpMPK3 alone, but not when SpMPK1 and SpMPK2 were individually silenced. These data suggest that the functions of SpMPK1 and SpMPK2 are redundant, and they overlap with that of SpMPK3 in drought stress signaling pathways. In addition, we found that SpMPK3 may regulate H2O2 levels by mediating the expression of CAT1. Hence, SpMPK1, SpMPK2, and SpMPK3 may play crucial roles in enhancing tomato plants’ drought tolerance by influencing stomatal activity and H2O2 production via the ABA-H2O2 pathway.

  16. Identification of highly effective target genes for RNAi-mediated control of emerald ash borer, Agrilus planipennis.

    Science.gov (United States)

    Rodrigues, Thais B; Duan, Jian J; Palli, Subba R; Rieske, Lynne K

    2018-03-22

    Recent study has shown that RNA interference (RNAi) is efficient in emerald ash borer (EAB), Agrilus planipennis, and that ingestion of double-stranded RNA (dsRNA) targeting specific genes causes gene silencing and mortality in neonates. Here, we report on the identification of highly effective target genes for RNAi-mediated control of EAB. We screened 13 candidate genes in neonate larvae and selected the most effective target genes for further investigation, including their effect on EAB adults and on a non-target organism, Tribolium castaneum. The two most efficient target genes selected, hsp (heat shock 70-kDa protein cognate 3) and shi (shibire), caused up to 90% mortality of larvae and adults. In EAB eggs, larvae, and adults, the hsp is expressed at higher levels when compared to that of shi. Ingestion of dsHSP and dsSHI caused mortality in both neonate larvae and adults. Administration of a mixture of both dsRNAs worked better than either dsRNA by itself. In contrast, injection of EAB.dsHSP and EAB.dsSHI did not cause mortality in T. castaneum. Thus, the two genes identified cause high mortality in the EAB with no apparent phenotype effects in a non-target organism, the red flour beetle, and could be used in RNAi-mediated control of this invasive pest.

  17. Gene regulatory mechanisms in infected fish

    DEFF Research Database (Denmark)

    Schyth, Brian Dall; Hajiabadi, Seyed Amir Hossein Jalali; Kristensen, Lasse Bøgelund Juel

    2011-01-01

    molecules produced by the eukaryotic cell is used to program the RNA Induced Silencing Complex (RISC) for cleavage of specific mRNA transcripts and/or translational repression in the cytoplasm or even chromatin methylation in the nucleus. All processes leading to silencing of the target gene. MicroRNAs (or...... differentiation. Thus the expression of these miRNAs might be steered by different mechanisms in different cell types and have different roles in terms of the genes they target in different cell types. Thus gene regulation and function is better looked upon as a web of interactions. Data from zebrafish studies...

  18. Identification of an attenuated barley stripe mosaic virus for the virus-induced gene silencing of pathogenesis-related wheat genes

    OpenAIRE

    Buhrow, Leann M.; Clark, Shawn M.; Loewen, Michele C.

    2016-01-01

    Background Virus-induced gene silencing (VIGS) has become an emerging technology for the rapid, efficient functional genomic screening of monocot and dicot species. The barley stripe mosaic virus (BSMV) has been described as an effective VIGS vehicle for the evaluation of genes involved in wheat and barley phytopathogenesis; however, these studies have been obscured by BSMV-induced phenotypes and defense responses. The utility of BSMV VIGS may be improved using a BSMV genetic background which...

  19. In vitro silencing of Brugia malayi trehalose-6-phosphate phosphatase impairs embryogenesis and in vivo development of infective larvae in jirds.

    Directory of Open Access Journals (Sweden)

    Susheela Kushwaha

    Full Text Available The trehalose metabolic enzymes have been considered as potential targets for drug or vaccine in several organisms such as Mycobacterium, plant nematodes, insects and fungi due to crucial role of sugar trehalose in embryogenesis, glucose uptake and protection from stress. Trehalose-6-phosphate phosphatase (TPP is one of the enzymes of trehalose biosynthesis that has not been reported in mammals. Silencing of tpp gene in Caenorhabditis elegans revealed an indispensable functional role of TPP in nematodes.In the present study, functional role of B. malayi tpp gene was investigated by siRNA mediated silencing which further validated this enzyme to be a putative antifilarial drug target. The silencing of tpp gene in adult female B. malayi brought about severe phenotypic deformities in the intrauterine stages such as distortion and embryonic development arrest. The motility of the parasites was significantly reduced and the microfilarial production as well as their in vitro release from the female worms was also drastically abridged. A majority of the microfilariae released in to the culture medium were found dead. B. malayi infective larvae which underwent tpp gene silencing showed 84.9% reduced adult worm establishment after inoculation into the peritoneal cavity of naïve jirds.The present findings suggest that B. malayi TPP plays an important role in the female worm embryogenesis, infectivity of the larvae and parasite viability. TPP enzyme of B. malayi therefore has the potential to be exploited as an antifilarial drug target.

  20. MicroRNA silencing in primates: towards development of novel therapeutics

    DEFF Research Database (Denmark)

    Petri, Andreas; Lindow, Morten; Kauppinen, Sakari

    2009-01-01

    MicroRNAs (miRNA) comprise an abundant class of small noncoding RNAs that act as important posttranscriptional regulators of gene expression. Accumulating evidence showing that aberrantly expressed miRNAs play important roles in human cancers underscores them as potential targets for therapeutic ...... intervention. Recent reports on efficient miRNA silencing in rodents and nonhuman primates using high-affinity targeting by chemically modified antisense oligonucleotides highlight the utility of such compounds in the development of miRNA-based cancer therapeutics....

  1. Paramutation of tobacco transgenes by small RNA-mediated transcriptional gene silencing

    Czech Academy of Sciences Publication Activity Database

    Crhák Khaitová, Lucie; Fojtová, M.; Křížová, Kateřina; Lunerová Bedřichová, Jana; Fulneček, Jaroslav; Depicker, A.; Kovařík, Aleš

    2011-01-01

    Roč. 6, č. 5 (2011), s. 650-660 ISSN 1559-2294 R&D Projects: GA ČR(CZ) GD204/09/H002; GA MŠk(CZ) LC06004 Grant - others:GA ČR(CZ) GPP501/11/P667 Program:GP Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : transcriptional gene silencing * transgene epialleles * DNA methylation Subject RIV: BO - Biophysics Impact factor: 4.318, year: 2011

  2. Virus-induced gene silencing in Medicago truncatula and Lathyrus odorata

    DEFF Research Database (Denmark)

    Grønlund, Mette; Kjær, Gabriela Didina Constantin; Piednoir, Elodie

    2008-01-01

    Virus-induced gene silencing (VIGS) has become an important reverse genetics tool for functional genomics. VIGS vectors based on Pea early browning virus (PEBV, genus Tobravirus) and Bean pod mottle virus (genus Comovirus) are available for the legume species Pisum sativum and Glycine max, respec...

  3. Deep sequencing uncovers commonality in small RNA profiles between transgene-induced and naturally occurring RNA silencing of chalcone synthase-A gene in petunia.

    Science.gov (United States)

    Kasai, Megumi; Matsumura, Hideo; Yoshida, Kentaro; Terauchi, Ryohei; Taneda, Akito; Kanazawa, Akira

    2013-01-30

    Introduction of a transgene that transcribes RNA homologous to an endogenous gene in the plant genome can induce silencing of both genes, a phenomenon termed cosuppression. Cosuppression was first discovered in transgenic petunia plants transformed with the CHS-A gene encoding chalcone synthase, in which nonpigmented sectors in flowers or completely white flowers are produced. Some of the flower-color patterns observed in transgenic petunias having CHS-A cosuppression resemble those in existing nontransgenic varieties. Although the mechanism by which white sectors are generated in nontransgenic petunia is known to be due to RNA silencing of the CHS-A gene as in cosuppression, whether the same trigger(s) and/or pattern of RNA degradation are involved in these phenomena has not been known. Here, we addressed this question using deep-sequencing and bioinformatic analyses of small RNAs. We analyzed short interfering RNAs (siRNAs) produced in nonpigmented sectors of petal tissues in transgenic petunia plants that have CHS-A cosuppression and a nontransgenic petunia variety Red Star, that has naturally occurring CHS-A RNA silencing. In both silencing systems, 21-nt and 22-nt siRNAs were the most and the second-most abundant size classes, respectively. CHS-A siRNA production was confined to exon 2, indicating that RNA degradation through the RNA silencing pathway occurred in this exon. Common siRNAs were detected in cosuppression and naturally occurring RNA silencing, and their ranks based on the number of siRNAs in these plants were correlated with each other. Noticeably, highly abundant siRNAs were common in these systems. Phased siRNAs were detected in multiple phases at multiple sites, and some of the ends of the regions that produced phased siRNAs were conserved. The features of siRNA production found to be common to cosuppression and naturally occurring silencing of the CHS-A gene indicate mechanistic similarities between these silencing systems especially in the

  4. Dimethylated H3K27 Is a Repressive Epigenetic Histone Mark in the Protist Entamoeba histolytica and Is Significantly Enriched in Genes Silenced via the RNAi Pathway*

    Science.gov (United States)

    Foda, Bardees M.; Singh, Upinder

    2015-01-01

    RNA interference (RNAi) is a fundamental biological process that plays a crucial role in regulation of gene expression in many organisms. Transcriptional gene silencing (TGS) is one of the important nuclear roles of RNAi. Our previous data show that Entamoeba histolytica has a robust RNAi pathway that links to TGS via Argonaute 2-2 (Ago2-2) associated 27-nucleotide small RNAs with 5′-polyphosphate termini. Here, we report the first repressive histone mark to be identified in E. histolytica, dimethylation of H3K27 (H3K27Me2), and demonstrate that it is enriched at genes that are silenced by RNAi-mediated TGS. An RNAi-silencing trigger can induce H3K27Me2 deposits at both episomal and chromosomal loci, mediating gene silencing. Our data support two phases of RNAi-mediated TGS: an active silencing phase where the RNAi trigger is present and both H3K27Me2 and Ago2-2 concurrently enrich at chromosomal loci; and an established silencing phase in which the RNAi trigger is removed, but gene silencing with H3K27Me2 enrichment persist independently of Ago2-2 deposition. Importantly, some genes display resistance to chromosomal silencing despite induction of functional small RNAs. In those situations, the RNAi-triggering plasmid that is maintained episomally gets partially silenced and has H3K27Me2 enrichment, but the chromosomal copy displays no repressive histone enrichment. Our data are consistent with a model in which H3K27Me2 is a repressive histone modification, which is strongly associated with transcriptional repression. This is the first example of an epigenetic histone modification that functions to mediate RNAi-mediated TGS in the deep-branching eukaryote E. histolytica. PMID:26149683

  5. Dimethylated H3K27 Is a Repressive Epigenetic Histone Mark in the Protist Entamoeba histolytica and Is Significantly Enriched in Genes Silenced via the RNAi Pathway.

    Science.gov (United States)

    Foda, Bardees M; Singh, Upinder

    2015-08-21

    RNA interference (RNAi) is a fundamental biological process that plays a crucial role in regulation of gene expression in many organisms. Transcriptional gene silencing (TGS) is one of the important nuclear roles of RNAi. Our previous data show that Entamoeba histolytica has a robust RNAi pathway that links to TGS via Argonaute 2-2 (Ago2-2) associated 27-nucleotide small RNAs with 5'-polyphosphate termini. Here, we report the first repressive histone mark to be identified in E. histolytica, dimethylation of H3K27 (H3K27Me2), and demonstrate that it is enriched at genes that are silenced by RNAi-mediated TGS. An RNAi-silencing trigger can induce H3K27Me2 deposits at both episomal and chromosomal loci, mediating gene silencing. Our data support two phases of RNAi-mediated TGS: an active silencing phase where the RNAi trigger is present and both H3K27Me2 and Ago2-2 concurrently enrich at chromosomal loci; and an established silencing phase in which the RNAi trigger is removed, but gene silencing with H3K27Me2 enrichment persist independently of Ago2-2 deposition. Importantly, some genes display resistance to chromosomal silencing despite induction of functional small RNAs. In those situations, the RNAi-triggering plasmid that is maintained episomally gets partially silenced and has H3K27Me2 enrichment, but the chromosomal copy displays no repressive histone enrichment. Our data are consistent with a model in which H3K27Me2 is a repressive histone modification, which is strongly associated with transcriptional repression. This is the first example of an epigenetic histone modification that functions to mediate RNAi-mediated TGS in the deep-branching eukaryote E. histolytica. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. [Small interfering RNA-mediated COX-2 gene silencing enhances chemosensitivity of KB/VCR cells by suppressing MDR-1 gene expression and P-glycoprotein activity].

    Science.gov (United States)

    Mo, Xianchao; Li, Weizhong

    2014-05-01

    To investigate the effect of small interfering RNA (siRNA)-mediated COX-2 gene silencing in enhancing the chemosensitivity of KB/VCR cell lines. KB/VCR cells were trasnfected with COX-2 siRNA were examined for expressions of COX-2 and MDR-1 mRNAs with RT-PCR and for Rho-123 accumulation using flow cytometry. MTT assay was used to analyze the proliferation of the transfected KB/VCR cells. Compared with the negative and blank control groups, COX-2 siRNA transfection resulted in significant growth inhibition of KB/VCR cells exposed to vincristine (PKB/VCR cells. COX-2 gene silencing can enhance the chemosensitivity of KB/VCR cells to vincristine, the mechanism of which may involve down-regulated MDR-1 gene expression and inhibition of P-glycoprotein activity.

  7. Increased RNA-induced silencing complex (RISC) activity contributes to hepatocellular carcinoma.

    Science.gov (United States)

    Yoo, Byoung Kwon; Santhekadur, Prasanna K; Gredler, Rachel; Chen, Dong; Emdad, Luni; Bhutia, Sujit; Pannell, Lewis; Fisher, Paul B; Sarkar, Devanand

    2011-05-01

    There is virtually no effective treatment for advanced hepatocellular carcinoma (HCC) and novel targets need to be identified to develop effective treatment. We recently documented that the oncogene Astrocyte elevated gene-1 (AEG-1) plays a seminal role in hepatocarcinogenesis. Employing yeast two-hybrid assay and coimmunoprecipitation followed by mass spectrometry, we identified staphylococcal nuclease domain containing 1 (SND1), a nuclease in the RNA-induced silencing complex (RISC) facilitating RNAi-mediated gene silencing, as an AEG-1 interacting protein. Coimmunoprecipitation and colocalization studies confirmed that AEG-1 is also a component of RISC and both AEG-1 and SND1 are required for optimum RISC activity facilitating small interfering RNA (siRNA) and micro RNA (miRNA)-mediated silencing of luciferase reporter gene. In 109 human HCC samples SND1 was overexpressed in ≈74% cases compared to normal liver. Correspondingly, significantly higher RISC activity was observed in human HCC cells compared to immortal normal hepatocytes. Increased RISC activity, conferred by AEG-1 or SND1, resulted in increased degradation of tumor suppressor messenger RNAs (mRNAs) that are target of oncomiRs. Inhibition of enzymatic activity of SND1 significantly inhibited proliferation of human HCC cells. As a corollary, stable overexpression of SND1 augmented and siRNA-mediated inhibition of SND1 abrogated growth of human HCC cells in vitro and in vivo, thus revealing a potential role of SND1 in hepatocarcinogenesis. We unravel a novel mechanism that overexpression of AEG-1 and SND1 leading to increased RISC activity might contribute to hepatocarcinogenesis. Targeted inhibition of SND1 enzymatic activity might be developed as an effective therapy for HCC. Copyright © 2011 American Association for the Study of Liver Diseases.

  8. Silencing of the PiAvr3a effector-encoding gene from Phytophthora infestans by transcriptional fusion to a short interspersed element.

    Science.gov (United States)

    Vetukuri, Ramesh R; Tian, Zhendong; Avrova, Anna O; Savenkov, Eugene I; Dixelius, Christina; Whisson, Stephen C

    2011-12-01

    Phytophthora infestans is the notorious oomycete causing late blight of potato and tomato. A large proportion of the P. infestans genome is composed of transposable elements, the activity of which may be controlled by RNA silencing. Accumulation of small RNAs is one of the hallmarks of RNA silencing. Here we demonstrate the presence of small RNAs corresponding to the sequence of a short interspersed retrotransposable element (SINE) suggesting that small RNAs might be involved in silencing of SINEs in P. infestans. This notion was exploited to develop novel tools for gene silencing in P. infestans by engineering transcriptional fusions of the PiAvr3a gene, encoding an RXLR avirulence effector, to the infSINEm retroelement. Transgenic P. infestans lines expressing either 5'-infSINEm::PiAvr3a-3' or 5'-PiAvr3a::SINEm-3' chimeric transcripts initially exhibited partial silencing of PiAvr3a. Over time, PiAvr3a either recovered wild type transcript levels in some lines, or became fully silenced in others. Introduction of an inverted repeat construct was also successful in yielding P. infestans transgenic lines silenced for PiAvr3a. In contrast, constructs expressing antisense or aberrant RNA transcripts failed to initiate silencing of PiAvr3a. Lines exhibiting the most effective silencing of PiAvr3a were either weakly or non-pathogenic on susceptible potato cv. Bintje. This study expands the repertoire of reverse genetics tools available for P. infestans research, and provides insights into a possible mode of variation in effector expression through spread of silencing from adjacent retroelements. Crown Copyright © 2011. Published by Elsevier Ltd. All rights reserved.

  9. Global Transcriptomic Analysis of Targeted Silencing of Two Paralogous ACC Oxidase Genes in Banana

    Science.gov (United States)

    Xia, Yan; Kuan, Chi; Chiu, Chien-Hsiang; Chen, Xiao-Jing; Do, Yi-Yin; Huang, Pung-Ling

    2016-01-01

    Among 18 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase homologous genes existing in the banana genome there are two genes, Mh-ACO1 and Mh-ACO2, that participate in banana fruit ripening. To better understand the physiological functions of Mh-ACO1 and Mh-ACO2, two hairpin-type siRNA expression vectors targeting both the Mh-ACO1 and Mh-ACO2 were constructed and incorporated into the banana genome by Agrobacterium-mediated transformation. The generation of Mh-ACO1 and Mh-ACO2 RNAi transgenic banana plants was confirmed by Southern blot analysis. To gain insights into the functional diversity and complexity between Mh-ACO1 and Mh-ACO2, transcriptome sequencing of banana fruits using the Illumina next-generation sequencer was performed. A total of 32,093,976 reads, assembled into 88,031 unigenes for 123,617 transcripts were obtained. Significantly enriched Gene Oncology (GO) terms and the number of differentially expressed genes (DEGs) with GO annotation were ‘catalytic activity’ (1327, 56.4%), ‘heme binding’ (65, 2.76%), ‘tetrapyrrole binding’ (66, 2.81%), and ‘oxidoreductase activity’ (287, 12.21%). Real-time RT-PCR was further performed with mRNAs from both peel and pulp of banana fruits in Mh-ACO1 and Mh-ACO2 RNAi transgenic plants. The results showed that expression levels of genes related to ethylene signaling in ripening banana fruits were strongly influenced by the expression of genes associated with ethylene biosynthesis. PMID:27681726

  10. Hairpin RNA Targeting Multiple Viral Genes Confers Strong Resistance to Rice Black-Streaked Dwarf Virus

    Directory of Open Access Journals (Sweden)

    Fangquan Wang

    2016-05-01

    Full Text Available Rice black-streaked dwarf virus (RBSDV belongs to the genus Fijivirus in the family of Reoviridae and causes severe yield loss in rice-producing areas in Asia. RNA silencing, as a natural defence mechanism against plant viruses, has been successfully exploited for engineering virus resistance in plants, including rice. In this study, we generated transgenic rice lines harbouring a hairpin RNA (hpRNA construct targeting four RBSDV genes, S1, S2, S6 and S10, encoding the RNA-dependent RNA polymerase, the putative core protein, the RNA silencing suppressor and the outer capsid protein, respectively. Both field nursery and artificial inoculation assays of three generations of the transgenic lines showed that they had strong resistance to RBSDV infection. The RBSDV resistance in the segregating transgenic populations correlated perfectly with the presence of the hpRNA transgene. Furthermore, the hpRNA transgene was expressed in the highly resistant transgenic lines, giving rise to abundant levels of 21–24 nt small interfering RNA (siRNA. By small RNA deep sequencing, the RBSDV-resistant transgenic lines detected siRNAs from all four viral gene sequences in the hpRNA transgene, indicating that the whole chimeric fusion sequence can be efficiently processed by Dicer into siRNAs. Taken together, our results suggest that long hpRNA targeting multiple viral genes can be used to generate stable and durable virus resistance in rice, as well as other plant species.

  11. Hairpin RNA Targeting Multiple Viral Genes Confers Strong Resistance to Rice Black-Streaked Dwarf Virus.

    Science.gov (United States)

    Wang, Fangquan; Li, Wenqi; Zhu, Jinyan; Fan, Fangjun; Wang, Jun; Zhong, Weigong; Wang, Ming-Bo; Liu, Qing; Zhu, Qian-Hao; Zhou, Tong; Lan, Ying; Zhou, Yijun; Yang, Jie

    2016-05-11

    Rice black-streaked dwarf virus (RBSDV) belongs to the genus Fijivirus in the family of Reoviridae and causes severe yield loss in rice-producing areas in Asia. RNA silencing, as a natural defence mechanism against plant viruses, has been successfully exploited for engineering virus resistance in plants, including rice. In this study, we generated transgenic rice lines harbouring a hairpin RNA (hpRNA) construct targeting four RBSDV genes, S1, S2, S6 and S10, encoding the RNA-dependent RNA polymerase, the putative core protein, the RNA silencing suppressor and the outer capsid protein, respectively. Both field nursery and artificial inoculation assays of three generations of the transgenic lines showed that they had strong resistance to RBSDV infection. The RBSDV resistance in the segregating transgenic populations correlated perfectly with the presence of the hpRNA transgene. Furthermore, the hpRNA transgene was expressed in the highly resistant transgenic lines, giving rise to abundant levels of 21-24 nt small interfering RNA (siRNA). By small RNA deep sequencing, the RBSDV-resistant transgenic lines detected siRNAs from all four viral gene sequences in the hpRNA transgene, indicating that the whole chimeric fusion sequence can be efficiently processed by Dicer into siRNAs. Taken together, our results suggest that long hpRNA targeting multiple viral genes can be used to generate stable and durable virus resistance in rice, as well as other plant species.

  12. Small silencing RNAs: an expanding universe.

    Science.gov (United States)

    Ghildiyal, Megha; Zamore, Phillip D

    2009-02-01

    Since the discovery in 1993 of the first small silencing RNA, a dizzying number of small RNA classes have been identified, including microRNAs (miRNAs), small interfering RNAs (siRNAs) and Piwi-interacting RNAs (piRNAs). These classes differ in their biogenesis, their modes of target regulation and in the biological pathways they regulate. There is a growing realization that, despite their differences, these distinct small RNA pathways are interconnected, and that small RNA pathways compete and collaborate as they regulate genes and protect the genome from external and internal threats.

  13. Double-stranded RNA uptake through topical application, mediates silencing of five CYP4 genes and suppresses insecticide resistance in Diaphorina citri.

    Science.gov (United States)

    Killiny, Nabil; Hajeri, Subhas; Tiwari, Siddharth; Gowda, Siddarame; Stelinski, Lukasz L

    2014-01-01

    Silencing of genes through RNA interference (RNAi) in insects has gained momentum during the past few years. RNAi has been used to cause insect mortality, inhibit insect growth, increase insecticide susceptibility, and prevent the development of insecticide resistance. We investigated the efficacy of topically applied dsRNA to induce RNAi for five Cytochrome P450 genes family 4 (CYP4) in Diaphorina citri. We previously reported that these CYP4 genes are associated with the development of insecticide resistance in D. citri. We targeted five CYP4 genes that share a consensus sequence with one dsRNA construct. Quantitative PCR confirmed suppressed expression of the five CYP4 genes as a result of dsRNA topically applied to the thoracic region of D. citri when compared to the expression levels in a control group. Western blot analysis indicated a reduced signal of cytochrome P450 proteins (45 kDa) in adult D. citri treated with the dsRNA. In addition, oxidase activity and insecticide resistance were reduced for D. citri treated with dsRNA that targeted specific CYP4 genes. Mortality was significantly higher in adults treated with dsRNA than in adults treated with water. Our results indicate that topically applied dsRNA can penetrate the cuticle of D. citri and induce RNAi. These results broaden the scope of RNAi as a mechanism to manage pests by targeting a broad range of genes. The results also support the application of RNAi as a viable tool to overcome insecticide resistance development in D. citri populations. However, further research is needed to develop grower-friendly delivery systems for the application of dsRNA under field conditions. Considering the high specificity of dsRNA, this tool can also be used for management of D. citri by targeting physiologically critical genes involved in growth and development.

  14. Double-stranded RNA uptake through topical application, mediates silencing of five CYP4 genes and suppresses insecticide resistance in Diaphorina citri.

    Directory of Open Access Journals (Sweden)

    Nabil Killiny

    Full Text Available Silencing of genes through RNA interference (RNAi in insects has gained momentum during the past few years. RNAi has been used to cause insect mortality, inhibit insect growth, increase insecticide susceptibility, and prevent the development of insecticide resistance. We investigated the efficacy of topically applied dsRNA to induce RNAi for five Cytochrome P450 genes family 4 (CYP4 in Diaphorina citri. We previously reported that these CYP4 genes are associated with the development of insecticide resistance in D. citri. We targeted five CYP4 genes that share a consensus sequence with one dsRNA construct. Quantitative PCR confirmed suppressed expression of the five CYP4 genes as a result of dsRNA topically applied to the thoracic region of D. citri when compared to the expression levels in a control group. Western blot analysis indicated a reduced signal of cytochrome P450 proteins (45 kDa in adult D. citri treated with the dsRNA. In addition, oxidase activity and insecticide resistance were reduced for D. citri treated with dsRNA that targeted specific CYP4 genes. Mortality was significantly higher in adults treated with dsRNA than in adults treated with water. Our results indicate that topically applied dsRNA can penetrate the cuticle of D. citri and induce RNAi. These results broaden the scope of RNAi as a mechanism to manage pests by targeting a broad range of genes. The results also support the application of RNAi as a viable tool to overcome insecticide resistance development in D. citri populations. However, further research is needed to develop grower-friendly delivery systems for the application of dsRNA under field conditions. Considering the high specificity of dsRNA, this tool can also be used for management of D. citri by targeting physiologically critical genes involved in growth and development.

  15. Establishment of an efficient virus-induced gene silencing (VIGS) assay in Arabidopsis by Agrobacterium-mediated rubbing infection.

    Science.gov (United States)

    Manhães, Ana Marcia E de A; de Oliveira, Marcos V V; Shan, Libo

    2015-01-01

    Several VIGS protocols have been established for high-throughput functional genomic screens as it bypasses the time-consuming and laborious process of generation of transgenic plants. The silencing efficiency in this approach is largely hindered by a technically demanding step in which the first pair of newly emerged true leaves at the 2-week-old stage are infiltrated with a needleless syringe. To further optimize VIGS efficiency and achieve rapid inoculation for a large-scale functional genomic study, here we describe a protocol of an efficient VIGS assay in Arabidopsis using Agrobacterium-mediated rubbing infection. The Agrobacterium inoculation is performed by simply rubbing the leaves with Filter Agent Celite(®) 545. The highly efficient and uniform silencing effect was indicated by the development of a visibly albino phenotype due to silencing of the Cloroplastos alterados 1 (CLA1) gene in the newly emerged leaves. In addition, the albino phenotype could be observed in stems and flowers, indicating its potential application for gene functional studies in the late vegetative development and flowering stages.

  16. AGO6 functions in RNA-mediated transcriptional gene silencing in shoot and root meristems in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Changho Eun

    Full Text Available RNA-directed DNA methylation (RdDM is a small interfering RNA (siRNA-mediated epigenetic modification that contributes to transposon silencing in plants. RdDM requires a complex transcriptional machinery that includes specialized RNA polymerases, named Pol IV and Pol V, as well as chromatin remodelling proteins, transcription factors, RNA binding proteins, and other plant-specific proteins whose functions are not yet clarified. In Arabidopsis thaliana, DICER-LIKE3 and members of the ARGONAUTE4 group of ARGONAUTE (AGO proteins are involved, respectively, in generating and using 24-nt siRNAs that trigger methylation and transcriptional gene silencing of homologous promoter sequences. AGO4 is the main AGO protein implicated in the RdDM pathway. Here we report the identification of the related AGO6 in a forward genetic screen for mutants defective in RdDM and transcriptional gene silencing in shoot and root apical meristems in Arabidopsis thaliana. The identification of AGO6, and not AGO4, in our screen is consistent with the primary expression of AGO6 in shoot and root growing points.

  17. High-level HIV-1 Nef transient expression in Nicotiana benthamiana using the P19 gene silencing suppressor protein of Artichoke Mottled Crinckle Virus

    Directory of Open Access Journals (Sweden)

    Bianco Linda

    2009-11-01

    Full Text Available Abstract Background In recent years, different HIV antigens have been successfully expressed in plants by either stable transformation or transient expression systems. Among HIV proteins, Nef is considered a promising target for the formulation of a multi-component vaccine due to its implication in the first steps of viral infection. Attempts to express Nef as a single protein product (not fused to a stabilizing protein in transgenic plants resulted in disappointingly low yields (about 0.5% of total soluble protein. In this work we describe a transient expression system based on co-agroinfiltration of plant virus gene silencing suppressor proteins in Nicotiana benthamiana, followed by a two-step affinity purification protocol of plant-derived Nef. Results The effect of three gene silencing viral suppressor proteins (P25 of Potato Virus X, P19 of either Artichoke Mottled Crinckle virus and Tomato Bushy Stunt virus on Nef transient expression yield was evaluated. The P19 protein of Artichoke Mottled Crinckle virus (AMCV-P19 gave the highest expression yield in vacuum co-agroinfiltration experiments reaching 1.3% of total soluble protein, a level almost three times higher than that previously reported in stable transgenic plants. The high yield observed in the co-agroinfiltrated plants was correlated to a remarkable decrease of Nef-specific small interfering RNAs (siRNAs indicating an effective modulation of RNA silencing mechanisms by AMCV-P19. Interestingly, we also showed that expression levels in top leaves of vacuum co-agroinfiltrated plants were noticeably reduced compared to bottom leaves. Moreover, purification of Nef from agroinfiltrated tissue was achieved by a two-step immobilized metal ion affinity chromatography protocol with yields of 250 ng/g of fresh tissue. Conclusion We demonstrated that expression level of HIV-1 Nef in plant can be improved using a transient expression system enhanced by the AMCV-P19 gene silencing suppressor

  18. Modulation of histone methylation and MLH1 gene silencing by hexavalent chromium

    International Nuclear Information System (INIS)

    Sun Hong; Zhou Xue; Chen Haobin; Li Qin; Costa, Max

    2009-01-01

    Hexavalent chromium [Cr(VI)] is a mutagen and carcinogen, and occupational exposure can lead to lung cancers and other adverse health effects. Genetic changes resulting from DNA damage have been proposed as an important mechanism that mediates chromate's carcinogenicity. Here we show that chromate exposure of human lung A549 cells increased global levels of di- and tri-methylated histone H3 lysine 9 (H3K9) and lysine 4 (H3K4) but decreased the levels of tri-methylated histone H3 lysine 27 (H3K27) and di-methylated histone H3 arginine 2 (H3R2). Most interestingly, H3K9 dimethylation was enriched in the human MLH1 gene promoter following chromate exposure and this was correlated with decreased MLH1 mRNA expression. Chromate exposure increased the protein as well as mRNA levels of G9a a histone methyltransferase that specifically methylates H3K9. This Cr(VI)-induced increase in G9a may account for the global elevation of H3K9 dimethylation. Furthermore, supplementation with ascorbate, the primary reductant of Cr(VI) and also an essential cofactor for the histone demethylase activity, partially reversed the H3K9 dimethylation induced by chromate. Thus our studies suggest that Cr(VI) may target histone methyltransferases and demethylases, which in turn affect both global and gene promoter specific histone methylation, leading to the silencing of specific tumor suppressor genes such as MLH1.

  19. An Optimized Protocol to Increase Virus-Induced Gene Silencing Efficiency and Minimize Viral Symptoms in Petunia

    OpenAIRE

    Broderick, Shaun R.; Jones, Michelle L.

    2013-01-01

    Virus-induced gene silencing (VIGS) is used to down-regulate endogenous plant genes. VIGS efficiency depends on viral proliferation and systemic movement throughout the plant. Although tobacco rattle virus (TRV)-based VIGS has been successfully used in petunia (Petunia × hybrida), the protocol has not been thoroughly optimized for efficient and uniform gene down-regulation in this species. Therefore, we evaluated six parameters that improved VIGS in petunia. Inoculation of mechanically wounde...

  20. An active role for endogenous beta-1,3-glucanase genes in transgene-mediated co-suppression in tobacco.

    Science.gov (United States)

    Sanders, Matthew; Maddelein, Wendy; Depicker, Anna; Van Montagu, Marc; Cornelissen, Marc; Jacobs, John

    2002-11-01

    Post-transcriptional gene silencing (PTGS) is characterized by the accumulation of short interfering RNAs that are proposed to mediate sequence-specific degradation of cognate and secondary target mRNAs. In plants, it is unclear to what extent endogenous genes contribute to this process. Here, we address the role of the endogenous target genes in transgene-mediated PTGS of beta-1,3-glucanases in tobacco. We found that mRNA sequences of the endogenous glucanase glb gene with varying degrees of homology to the Nicotiana plumbaginifolia gn1 transgene are targeted by the silencing machinery, although less efficiently than corresponding transgene regions. Importantly, we show that endogene-specific nucleotides in the glb sequence provide specificity to the silencing process. Consistent with this finding, small sense and antisense 21- to 23-nucleotide RNAs homologous to the endogenous glb gene were detected. Combined, these data demonstrate that a co-suppressed endogenous glucan ase gene is involved in signal amplification and selection of homologous targets, and show that endogenous genes can actively participate in PTGS in plants. The findings are introduced as a further sophistication of the post-transciptional silencing model.

  1. Genome-wide identification and characterization of microRNA genes and their targets in flax (Linum usitatissimum): Characterization of flax miRNA genes.

    Science.gov (United States)

    Barvkar, Vitthal T; Pardeshi, Varsha C; Kale, Sandip M; Qiu, Shuqing; Rollins, Meaghen; Datla, Raju; Gupta, Vidya S; Kadoo, Narendra Y

    2013-04-01

    MicroRNAs (miRNAs) are small (20-24 nucleotide long) endogenous regulatory RNAs that play important roles in plant growth and development. They regulate gene expression at the post-transcriptional level by translational repression or target degradation and gene silencing. In this study, we identified 116 conserved miRNAs belonging to 23 families from the flax (Linum usitatissimum L.) genome using a computational approach. The precursor miRNAs varied in length; while most of the mature miRNAs were 21 nucleotide long, intergenic and showed conserved signatures of RNA polymerase II transcripts in their upstream regions. Promoter region analysis of the flax miRNA genes indicated prevalence of MYB transcription factor binding sites. Four miRNA gene clusters containing members of three phylogenetic groups were identified. Further, 142 target genes were predicted for these miRNAs and most of these represent transcriptional regulators. The miRNA encoding genes were expressed in diverse tissues as determined by digital expression analysis as well as real-time PCR. The expression of fourteen miRNAs and nine target genes was independently validated using the quantitative reverse transcription PCR (qRT-PCR). This study suggests that a large number of conserved plant miRNAs are also found in flax and these may play important roles in growth and development of flax.

  2. Detection of the argonaute protein Ago2 and microRNAs in the RNA induced silencing complex (RISC) using a monoclonal antibody.

    Science.gov (United States)

    Ikeda, Keigo; Satoh, Minoru; Pauley, Kaleb M; Fritzler, Marvin J; Reeves, Westley H; Chan, Edward K L

    2006-12-20

    MicroRNAs (miRNAs) are short RNA molecules responsible for post-transcriptional gene silencing by the degradation or translational inhibition of their target messenger RNAs (mRNAs). This process of gene silencing, known as RNA interference (RNAi), is mediated by highly conserved Argonaute (Ago) proteins which are the key components of the RNA induced silencing complex (RISC). In humans, Ago2 is responsible for the endonuclease cleavage of targeted mRNA and it interacts with the mRNA-binding protein GW182, which is a marker for cytoplasmic foci referred to as GW bodies (GWBs). We demonstrated that the anti-Ago2 monoclonal antibody 4F9 recognized GWBs in a cell cycle dependent manner and was capable of capturing miRNAs associated with Ago2. Since Ago2 protein is the effector protein of RNAi, anti-Ago2 monoclonal antibody may be useful in capturing functional miRNAs.

  3. The Nuclear Cap-Binding Complex Mediates Meiotic Silencing by Unpaired DNA

    Directory of Open Access Journals (Sweden)

    Logan M. Decker

    2017-04-01

    Full Text Available In the filamentous fungus Neurospora crassa, cross walls between individual cells are normally incomplete, making the entire fungal network vulnerable to attack by viruses and selfish DNAs. Accordingly, several genome surveillance mechanisms are maintained to help the fungus combat these repetitive elements. One of these defense mechanisms is called meiotic silencing by unpaired DNA (MSUD, which identifies and silences unpaired genes during meiosis. Utilizing common RNA interference (RNAi proteins, such as Dicer and Argonaute, MSUD targets mRNAs homologous to the unpaired sequence to achieve silencing. In this study, we have identified an additional silencing component, namely the cap-binding complex (CBC. Made up of cap-binding proteins CBP20 and CBP80, CBC associates with the 5′ cap of mRNA transcripts in eukaryotes. The loss of CBC leads to a deficiency in MSUD activity, suggesting its role in mediating silencing. As confirmed in this study, CBC is predominantly nuclear, although it is known to travel in and out of the nucleus to facilitate RNA transport. As seen in animals but not in plants, CBP20’s robust nuclear import depends on CBP80 in Neurospora. CBC interacts with a component (Argonaute of the perinuclear meiotic silencing complex (MSC, directly linking the two cellular factors.

  4. RNAi-mediated silencing of enolase confirms its biological importance in Clonorchis sinensis.

    Science.gov (United States)

    Wang, Xiaoyun; Chen, Wenjun; Tian, Yanli; Huang, Yan; Li, Xuerong; Yu, Xinbing

    2014-04-01

    Clonorchis sinensis (C. sinensis) infection is still a common public health problem in freshwater fish consumption areas in Asian countries. More molecular evidence are required to speed up the prevention strategies to control this kind of infectious disease. In the present study, to confirm the biological importance of Csenolase followed by our previous observations of the key metabolic enzyme, we explored the RNA silence effect of the Csenolase-derived RNA interference (RNAi) in C. sinensis. The extramembranous region aa105-226 was selected as the target sequence of RNA silence. Csenolase-derived double strand RNA (dsRNA-Csenolase, 366 bp) was synthetized and delivered into C. sinensis by soaking approach. The penetration of dsRNA into adult worms and metacercariae was tracked using fluorescently labeled RNA. Western blotting and qRT-PCR experiments were performed to determine dsRNA-Csenolase-silencing effect. Our results showed that, after incubating for 120 h, dsRNA-Csenolase could effectively target and downregulate the expression of Csenolase in both adult worms (P sinensis adult worms (P sinensis, allowing further applications in identifying functional genes in C. sinensis.

  5. Gene silencing of stearoyl-ACP desaturase enhances the stearic acid content in Chlamydomonas reinhardtii

    NARCIS (Netherlands)

    Jaeger, de L.; Springer, J.; Wolbert, E.J.H.; Martens, D.E.; Eggink, G.; Wijffels, R.H.

    2017-01-01

    In this study, stearoyl-ACP desaturase (SAD), the enzyme that converts stearic acid into oleic acid, is silenced by artificial microRNA in the green microalga Chlamydomonas reinhardtii. Two different constructs, which target different positions on the mRNA of stearoyl-ACP desaturase, were tested.

  6. MicroRNA-373 functions as an oncogene and targets YOD1 gene in cervical cancer

    International Nuclear Information System (INIS)

    Wang, Luo-Qiao; Zhang, Yue; Yan, Huan; Liu, Kai-Jiang; Zhang, Shu

    2015-01-01

    miR-373 was reported to be elevated in several tumors; however, the role of miR-373 in cervical cancer has not been investigated. In this study we aimed to investigate the role of miR-373 in tumorigenicity of cervical cancer cells in vivo and in vitro. The expression of miR-373 was investigated using real-time reverse transcription-polymerase chain reaction assay in 45 cervical specimens and cervical cancer cell lines. The role of miR-373 in tumorigenicity of cervical cancer cells was assessed by cell proliferation, colony formation in vitro as well as tumor growth assays in vivo with the overexpression of miR-373 or gene silencing. The functional target gene of miR-373 in cervical cancer cells was identified using integrated bioinformatics analysis, gene expression arrays, and luciferase assay. We founded that the expression of miR-373 is upregulated in human cervical cancer tissues and cervical carcinoma cell lines when compared to the corresponding noncancerous tissues. Ectopic overexpression of miR-373 in human cervical cancer cells promoted cell growth in vitro and tumorigenicity in vivo, whereas silencing the expression of miR-373 decreased the rate of cell growth. YOD1 was identified as a direct and functional target of miR-373 in cervical cancer cells. Expression levels of miR-373 were inversely correlated with YOD1 levels in human cervical cancer tissues. RNAi-mediated knockdown of YOD1 phenocopied the proliferation-promoting effect of miR-373. Moreover, overexpression of YOD1 abrogated miR-373-induced proliferation of cervical cancer cells. These results demonstrate that miR-373 increases proliferation by directly targeting YOD1, a new potential therapeutic target in cervical cancer. - Highlights: • The expression of miR-373 is upregulated in human cervical cancer tissues. • miR-373 effects as oncogenic miRNA in cervical cancer in vitro and in vivo. • miR-373 increases proliferation of cervical cancer cells by directly targeting YOD1

  7. Stability of RNA silencing-based traits after virus infection

    DEFF Research Database (Denmark)

    Jørgensen, Bodil; Albrechtsen, Merete

    2007-01-01

    with constructs based on virus coat protein (CP) genes or other viral genes has been successfully used to engineer PTGS-mediated virus resistance into a large number of crop plants and some transgenic lines have been commercially exploited. However the discovery that plant viruses encode suppressors of gene...... silencing has raised concerns that virus infection of crop plants might reverse the new silencing-based traits. Most studies of virus suppression of silencing have used model systems based on silencing of reporter genes. A few studies have analysed the effects of virus infections on plants with genetically...... engineered virus resistance based on either a simple sense or an inverted repeat construct. We decided to use genetically engineered virus resistance in potato as a model system for further studies of the effect of virus infection on genetically engineered traits. We present for the first time a comparison...

  8. Thrombin-induced, TNFR-dependent miR-181c downregulation promotes MLL1 and NF-κB target gene expression in human microglia.

    Science.gov (United States)

    Yin, Min; Chen, Zhiying; Ouyang, Yetong; Zhang, Huiyan; Wan, Zhigang; Wang, Han; Wu, Wei; Yin, Xiaoping

    2017-06-29

    Controlling thrombin-driven microglial activation may serve as a therapeutic target for intracerebral hemorrhage (ICH). Here, we investigated microRNA (miRNA)-based regulation of thrombin-driven microglial activation using an in vitro thrombin toxicity model applied to primary human microglia. A miRNA array identified 22 differential miRNA candidates. Quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR) identified miR-181c as the most significantly downregulated miRNA. TargetScan analysis identified mixed lineage leukemia-1 (MLL1) as a putative gene target for miR-181c. qRT-PCR was applied to assess tumor necrosis factor-alpha (TNF-α), miR-181c, and MLL1 levels following thrombin or proteinase-activated receptor-4-specific activating peptide (PAR4AP) exposure. Anti-TNF-α antibodies and tumor necrosis factor receptor (TNFR) silencing were employed to test TNF-α/TNFR dependence. A dual-luciferase reporter system and miR-181c mimic transfection assessed whether mir-181c directly binds to and negatively regulates MLL1. Nuclear factor kappa-B (NF-κB)-dependent luciferase reporter assays and NF-κB target gene expression were assessed in wild-type (MLL1+) and MLL1-silenced cells. Thrombin or PAR4AP-induced miR-181c downregulation (p < 0.05) and MLL1 upregulation (p < 0.05) that were dependent upon TNF-α/TNFR. miR-181c decreased wild-type MLL1 3'-UTR luciferase reporter activity (p < 0.05), and a miR-181c mimic suppressed MLL1 expression (p < 0.05). Thrombin treatment increased, while miR-181c reduced, NF-κB activity and NF-κB target gene expression in both wild-type (MLL1+) and MLL1-silenced cells (p < 0.05). Thrombin-induced, TNF-α/TNFR-dependent miR-181c downregulation promotes MLL1 expression, increases NF-κB activity, and upregulates NF-κB target gene expression. As miR-181c opposes thrombin's stimulation of pro-inflammatory NF-κB activity, miR-181c mimic therapy may show promise in controlling thrombin

  9. Virus-Induced Silencing of Key Genes Leads to Differential Impact on Withanolide Biosynthesis in the Medicinal Plant, Withania somnifera.

    Science.gov (United States)

    Agarwal, Aditya Vikram; Singh, Deeksha; Dhar, Yogeshwar Vikram; Michael, Rahul; Gupta, Parul; Chandra, Deepak; Trivedi, Prabodh Kumar

    2018-02-01

    Withanolides are a collection of naturally occurring, pharmacologically active, secondary metabolites synthesized in the medicinally important plant, Withania somnifera. These bioactive molecules are C28-steroidal lactone triterpenoids and their synthesis is proposed to take place via the mevalonate (MVA) and 2-C-methyl-d-erythritol-4-phosphate (MEP) pathways through the sterol pathway using 24-methylene cholesterol as substrate flux. Although the phytochemical profiles as well as pharmaceutical activities of Withania extracts have been well studied, limited genomic information and difficult genetic transformation have been a major bottleneck towards understanding the participation of specific genes in withanolide biosynthesis. In this study, we used the Tobacco rattle virus (TRV)-mediated virus-induced gene silencing (VIGS) approach to study the participation of key genes from MVA, MEP and triterpenoid biosynthesis for their involvement in withanolide biosynthesis. TRV-infected W. somnifera plants displayed unique phenotypic characteristics and differential accumulation of total Chl as well as carotenoid content for each silenced gene suggesting a reduction in overall isoprenoid synthesis. Comprehensive expression analysis of putative genes of withanolide biosynthesis revealed transcriptional modulations conferring the presence of complex regulatory mechanisms leading to withanolide biosynthesis. In addition, silencing of genes exhibited modulated total and specific withanolide accumulation at different levels as compared with control plants. Comparative analysis also suggests a major role for the MVA pathway as compared with the MEP pathway in providing substrate flux for withanolide biosynthesis. These results demonstrate that transcriptional regulation of selected Withania genes of the triterpenoid biosynthetic pathway critically affects withanolide biosynthesis, providing new horizons to explore this process further, in planta.

  10. TGIF1 Gene Silencing in Tendon-Derived Stem Cells Improves the Tendon-to-Bone Insertion Site Regeneration

    Directory of Open Access Journals (Sweden)

    Liyang Chen

    2015-11-01

    Full Text Available Background/Aims: The slow healing process of tendon-to-bone junctions can be accelerated via implanted tendon-derived stem cells (TDSCs with silenced transforming growth interacting factor 1 (TGIF1 gene. Tendon-to-bone insertion site is the special form of connective tissues derivatives of common connective progenitors, where TGF-β plays bidirectional effects (chondrogenic or fibrogenic through different signaling pathways at different stages. A recent study revealed that TGF-β directly induces the chondrogenic gene Sox9. However, TGIF1 represses the expression of the cartilage master Sox9 gene and changes its expression rate against the fibrogenesis gene Scleraxis (Scx. Methods: TGIF1 siRNA was transduced or TGIF1 was over-expressed in tendon-derived stem cells. Following suprapinatus tendon repair, rats were either treated with transduced TDSCs or nontransduced TDSCs. Histologic examination and Western blot were performed in both groups. Results: In this study, the silencing of TGIF1 significantly upregulated the chondrogenic genes and markers. Similarly, TGIF1 inhibited TDSC differentiation into cartilage via interactions with TGF-β-activated Smad2 and suppressed the phosphorylation of Smad2. The area of fibrocartilage at the tendon-bone interface was significantly increased in the TGIF1 (- group compared with the control and TGIF1-overexpressing groups in the early stages of the animal model. The interface between the tendon and bone showed a increase of new bone and fibrocartilage in the TGIF1 (- group at 4 weeks. Fibrovascular scar tissue was observed in the TGIF1-overexpressing group and the fibrin glue only group. Low levels of fibrocartilage and fibrovascular scar tissue were found in the TDSCs group. Conclusion: Collectively, this study shows that the tendon-derived stem cell modified with TGIF1 gene silencing has promising effects on tendon-to-bone healing which can be further explored as a therapeutic tool in regenerative medicine.

  11. Identification of downstream metastasis-associated target genes regulated by LSD1 in colon cancer cells.

    Science.gov (United States)

    Chen, Jiang; Ding, Jie; Wang, Ziwei; Zhu, Jian; Wang, Xuejian; Du, Jiyi

    2017-03-21

    This study aims to identify downstream target genes regulated by lysine-specific demethylase 1 (LSD1) in colon cancer cells and investigate the molecular mechanisms of LSD1 influencing invasion and metastasis of colon cancer. We obtained the expression changes of downstream target genes regulated by small-interfering RNA-LSD1 and LSD1-overexpression via gene expression profiling in two human colon cancer cell lines. An Affymetrix Human Transcriptome Array 2.0 was used to identify differentially expressed genes (DEGs). We screened out LSD1-target gene associated with proliferation, metastasis, and invasion from DEGs via Gene Ontology and Pathway Studio. Subsequently, four key genes (CABYR, FOXF2, TLE4, and CDH1) were computationally predicted as metastasis-related LSD1-target genes. ChIp-PCR was applied after RT-PCR and Western blot validations to detect the occupancy of LSD1-target gene promoter-bound LSD1. A total of 3633 DEGs were significantly upregulated, and 4642 DEGs were downregulated in LSD1-silenced SW620 cells. A total of 4047 DEGs and 4240 DEGs were upregulated and downregulated in LSD1-overexpressed HT-29 cells, respectively. RT-PCR and Western blot validated the microarray analysis results. ChIP assay results demonstrated that LSD1 might be negative regulators for target genes CABYR and CDH1. The expression level of LSD1 is negatively correlated with mono- and dimethylation of histone H3 lysine4(H3K4) at LSD1- target gene promoter region. No significant mono-methylation and dimethylation of H3 lysine9 methylation was detected at the promoter region of CABYR and CDH1. LSD1- depletion contributed to the upregulation of CABYR and CDH1 through enhancing the dimethylation of H3K4 at the LSD1-target genes promoter. LSD1- overexpression mediated the downregulation of CABYR and CDH1expression through decreasing the mono- and dimethylation of H3K4 at LSD1-target gene promoter in colon cancer cells. CABYR and CDH1 might be potential LSD1-target genes in colon

  12. Epigenetic mismatches with mutated transcribing genes at leukemogenic S-phase binding/start sites--potential targets for therapy with enzyme inhibitors.

    Science.gov (United States)

    Prindull, Gregor

    2012-11-01

    This review focuses on gene transcription patterns of leukemogenic S-phases in mitotic cell cycles for identification of enzymatic reactions as potential targets for epigenetics-based drug therapy. Transcription of leukemic genes is triggered by reprogrammed transcription factors (TFs) mediated by chromatin histones. Reprogrammed TFs originate from transcriptional alterations of CpG methylation patterns of mutated epigenetic genes. They preserve memory information of earlier leukemogenic exposures, even transgenerationally via the zygote, through small (e.g. pi)RNA transmitted between cells by exosomes. Normally, reprogrammed TFs are enzymatically silenced and stored as markers in heterochromatic domains. Failure of intra S-phase surveillance (IS) permits the formation and continual operation of DNA replication forks in spite of persisting genotoxic stress. Silenced TFs are re-activated by euchromatin, most likely through leakages of insulator barriers of cis-regulating chromatin modulators (CRM) that normally separate hetero- from euchromatin domains. During transport by sliding nucleosomes, reprogrammed leukemogenic TFs are misplaced at transcription factor binding-/starting-sites (TFBS /TSS) allowing them to interact with and trigger replication of mutated leukemic genes. Interactions of enzymatically reprogrammed TFs, transcribed from mutated epigenetic genes, with replicating leukemic genes at TFBS/TSSs are key driving forces in leukemogenesis. Probably, epigenetic genes, although mutated, still retain their control of replication of leukemic genes. Epigenetics-based enzyme inhibitors must target reprogrammed TFs. Prudently, therapeutic corrections should be introduced within the frame of conventional, cytoreductive treatment protocols. Alternatively, reprogrammed TFs could be replaced by cell populations with regular TF production. Clinically, classification of leukemias should be based on their epigenetic presentation.

  13. Silencing of human T-cell leukemia virus type I gene transcription by epigenetic mechanisms

    Directory of Open Access Journals (Sweden)

    Mueller Nancy

    2005-10-01

    Full Text Available Abstract Background Human T-cell leukemia virus type I (HTLV-I causes adult T-cell leukemia (ATL after a long latent period. Among accessory genes encoded by HTLV-I, the tax gene is thought to play a central role in oncogenesis. However, Tax expression is disrupted by several mechanims including genetic changes of the tax gene, deletion/hypermethylation of 5'-LTR. To clarify the role of epigenetic changes, we analyzed DNA methylation and histone modification in the whole HTLV-I provirus genome. Results The gag, pol and env genes of HTLV-I provirus were more methylated than pX region, whereas methylation of 5'-LTR was variable and 3'-LTR was not methylated at all. In ATL cell lines, complete DNA methylation of 5'-LTR was associated with transcriptional silencing of viral genes. HTLV-I provirus was more methylated in primary ATL cells than in carrier state, indicating the association with disease progression. In seroconvertors, DNA methylation was already observed in internal sequences of provirus just after seroconversion. Taken together, it is speculated that DNA methylation first occurs in the gag, pol and env regions and then extends in the 5' and 3' directions in vivo, and when 5'-LTR becomes methylated, viral transcription is silenced. Analysis of histone modification in the HTLV-I provirus showed that the methylated provirus was associated with hypoacetylation. However, the tax gene transcript could not be detected in fresh ATL cells regardless of hyperacetylated histone H3 in 5'-LTR. The transcription rapidly recovered after in vitro culture in such ATL cells. Conclusion These results showed that epigenetic changes of provirus facilitated ATL cells to evade host immune system by suppressing viral gene transcription. In addition, this study shows the presence of another reversible mechanism that suppresses the tax gene transcription without DNA methylation and hypoacetylated histone.

  14. Methylation and silencing of the retinoic acid receptor-β2 gene in cervical cancer

    International Nuclear Information System (INIS)

    Ivanova, Tatyana; Petrenko, Anatolii; Gritsko, Tatyana; Vinokourova, Svetlana; Eshilev, Ernest; Kobzeva, Vera; Kisseljov, Fjodor; Kisseljova, Natalia

    2002-01-01

    Expression of the retinoic acid receptor β2 (RAR-β2), a putative tumor suppressor gene, is reduced in various human cancers, including squamous cell carcinomas (SCC) of the uterine cervix. The mechanism of the inhibition of RAR-β2 expression remains obscure. We examined whether methylation of RAR-β2 gene could be responsible for this silencing in cervical SCC. Expression of RAR-β2 mRNA and methylation status of the 5' region of RAR-β2 gene were examined in 20 matched specimens from patients with cervical SCC and in three cervical cancer cell lines by Northern blot analysis and methylation-specific PCR (MSP) assay or Southern blot analysis respectively. In 8 out 20 cervical SCC (40%) the levels of RAR-β2 mRNA were decreased or undetectable in comparison with non-neoplastic cervix tissues. All 8 tumors with reduced levels of RAR-β2 mRNA expression showed methylation of the promoter and the first exon expressed in the RAR-β2 transcript. The RAR-β2 gene from non-neoplastic cervical tissues was mostly unmethylated and expressed, but methylated alleles of the gene were found in three samples of the morphologically normal tissues adjacent to the tumors. Three cervical cancer cell lines with extremely low level of RAR-β2 mRNA expression, SiHA, HeLA and CaSki, also showed methylation of this region of the RAR-β2 gene. These findings suggest that methylation of the 5' region of RAR-β2 gene may contribute to gene silencing and that methylation of this region may be an important and early event in cervical carcinogenesis. These findings may be useful to make retinoids more effective as preventive and therapeutic agents in combination with inhibitors of DNA methylation

  15. Efficient transformation and artificial miRNA gene silencing in Lemna minor.

    Science.gov (United States)

    Cantó-Pastor, A; Mollá-Morales, A; Ernst, E; Dahl, W; Zhai, J; Yan, Y; Meyers, B C; Shanklin, J; Martienssen, R

    2015-01-01

    Despite rapid doubling time, simple architecture and ease of metabolic labelling, a lack of genetic tools in the Lemnaceae (duckweed) has impeded the full implementation of this organism as a model for biological research. Here, we present technologies to facilitate high-throughput genetic studies in duckweed. We developed a fast and efficient method for producing Lemna minor stable transgenic fronds via Agrobacterium-mediated transformation and regeneration from tissue culture. Additionally, we engineered an artificial microRNA (amiRNA) gene silencing system. We identified a Lemna gibba endogenous miR166 precursor and used it as a backbone to produce amiRNAs. As a proof of concept we induced the silencing of CH42, a magnesium chelatase subunit, using our amiRNA platform. Expression of CH42 in transgenic L. minor fronds was significantly reduced, which resulted in reduction of chlorophyll pigmentation. The techniques presented here will enable tackling future challenges in the biology and biotechnology of Lemnaceae. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.

  16. Silencing of a Germin-Like Gene in Nicotiana attenuata Improves Performance of Native Herbivores1[W

    Science.gov (United States)

    Lou, Yonggen; Baldwin, Ian T.

    2006-01-01

    Germins and germin-like proteins (GLPs) are known to function in pathogen resistance, but their involvement in defense against insect herbivores is poorly understood. In the native tobacco Nicotiana attenuata, attack from the specialist herbivore Manduca sexta or elicitation by adding larval oral secretions (OS) to wounds up-regulates transcripts of a GLP. To understand the function of this gene, which occurs as a single copy, we cloned the full-length NaGLP and silenced its expression in N. attenuata by expressing a 250-bp fragment in an antisense orientation with an Agrobacterium-based transformation system and by virus-induced gene silencing (VIGS). Homozygous lines harboring a single insert and VIGS plants had significantly reduced constitutive (measured in roots) and elicited NaGLP transcript levels (in leaves). Silencing NaGLP improved M. sexta larval performance and Tupiocoris notatus preference, two native herbivores of N. attenuata. Silencing NaGLP also attenuated the OS-induced hydrogen peroxide (H2O2), diterpene glycosides, and trypsin proteinase inhibitor responses, which may explain the observed susceptibility of antisense or VIGS plants to herbivore attack and increased nicotine contents, but did not influence the OS-elicited jasmonate and salicylate bursts, or the release of the volatile organic compounds (limonene, cis-α-bergamotene, and germacrene-A) that function as an indirect defense. This suggests that NaGLP is involved in H2O2 production and might also be related to ethylene production and/or perception, which in turn influences the defense responses of N. attenuata via H2O2 and ethylene-signaling pathways. PMID:16461381

  17. ETS transcription factors control transcription of EZH2 and epigenetic silencing of the tumor suppressor gene Nkx3.1 in prostate cancer.

    Directory of Open Access Journals (Sweden)

    Paolo Kunderfranco

    2010-05-01

    Full Text Available ETS transcription factors regulate important signaling pathways involved in cell differentiation and development in many tissues and have emerged as important players in prostate cancer. However, the biological impact of ETS factors in prostate tumorigenesis is still debated.We performed an analysis of the ETS gene family using microarray data and real-time PCR in normal and tumor tissues along with functional studies in normal and cancer cell lines to understand the impact in prostate tumorigenesis and identify key targets of these transcription factors. We found frequent dysregulation of ETS genes with oncogenic (i.e., ERG and ESE1 and tumor suppressor (i.e., ESE3 properties in prostate tumors compared to normal prostate. Tumor subgroups (i.e., ERG(high, ESE1(high, ESE3(low and NoETS tumors were identified on the basis of their ETS expression status and showed distinct transcriptional and biological features. ERG(high and ESE3(low tumors had the most robust gene signatures with both distinct and overlapping features. Integrating genomic data with functional studies in multiple cell lines, we demonstrated that ERG and ESE3 controlled in opposite direction transcription of the Polycomb Group protein EZH2, a key gene in development, differentiation, stem cell biology and tumorigenesis. We further demonstrated that the prostate-specific tumor suppressor gene Nkx3.1 was controlled by ERG and ESE3 both directly and through induction of EZH2.These findings provide new insights into the role of the ETS transcriptional network in prostate tumorigenesis and uncover previously unrecognized links between aberrant expression of ETS factors, deregulation of epigenetic effectors and silencing of tumor suppressor genes. The link between aberrant ETS activity and epigenetic gene silencing may be relevant for the clinical management of prostate cancer and design of new therapeutic strategies.

  18. Tumor-targeted inhibition by a novel strategy - mimoretrovirus expressing siRNA targeting the Pokemon gene.

    Science.gov (United States)

    Tian, Zhiqiang; Wang, Huaizhi; Jia, Zhengcai; Shi, Jinglei; Tang, Jun; Mao, Liwei; Liu, Hongli; Deng, Yijing; He, Yangdong; Ruan, Zhihua; Li, Jintao; Wu, Yuzhang; Ni, Bing

    2010-12-01

    Pokemon gene has crucial but versatile functions in cell differentiation, proliferation and tumorigenesis. It is a master regulator of the ARF-HDM2-p53 and Rb-E2F pathways. The facts that the expression of Pokemon is essential for tumor formation and many kinds of tumors over-express the Pokemon gene make it an attractive target for therapeutic intervention for cancer treatment. In this study, we used an RNAi strategy to silence the Pokemon gene in a cervical cancer model. To address the issues involving tumor specific delivery and durable expression of siRNA, we applied the Arg-Gly-Asp (RGD) peptide ligand and polylysine (K(18)) fusion peptide to encapsulate a recombinant retrovirus plasmid expressing a siRNA targeting the Pokemon gene and produced the 'mimoretrovirus'. At charge ratio 2.0 of fusion peptide/plasmid, the mimoretrovirus formed stable and homogenous nanoparticles, and provided complete DNase I protection and complete gel retardation. This nanoparticle inhibited SiHa cell proliferation and invasion, while it promoted SiHa cell apoptosis. The binding of the nanoparticle to SiHa cells was mediated via the RGD-integrin α(v)β(3) interaction, as evidenced by the finding that unconjugated RGD peptide inhibited this binding significantly. This tumor-targeting mimoretrovirus exhibited excellent anti-tumor capacity in vivo in a nude mouse model. Moreover, the mimoretrovirus inhibited tumor growth with a much higher efficiency than recombinant retrovirus expressing siRNA or the K(18)/P4 nanoparticle lacking the RGD peptide. Results suggest that the RNAi/RGD-based mimoretrovirus developed in this study represents a novel anti-tumor strategy that may be applicable to most research involving cancer therapy and, thus, has promising potential as a cervical cancer treatment.

  19. siRNA-mediated Erc gene silencing suppresses tumor growth in Tsc2 mutant renal carcinoma model.

    Science.gov (United States)

    Imamura, Osamu; Okada, Hiroaki; Takashima, Yuuki; Zhang, Danqing; Kobayashi, Toshiyuki; Hino, Okio

    2008-09-18

    Silencing of gene expression by small interfering RNAs (siRNAs) is rapidly becoming a powerful tool for genetic analysis and represents a potential strategy for therapeutic product development. However, there are no reports of systemic delivery of siRNAs for stable treatment except short hairpin RNAs (shRNAs). On the other hand, there are many reports of systemic delivery of siRNAs for transient treatment using liposome carriers and others. With regard to shRNAs, a report showed fatality in mice due to oversaturation of cellular microRNA/short hairpin RNA pathways. Therefore, we decided to use original siRNA microspheres instead of shRNA for stable treatment of disease. In this study, we designed rat-specific siRNA sequences for Erc/mesothelin, which is a tumor-specific gene expressed in the Eker (Tsc2 mutant) rat model of hereditary renal cancer and confirmed the efficacy of gene silencing in vitro. Then, by using siRNA microspheres, we found that the suppression of Erc/mesothelin caused growth inhibition of Tsc2 mutant renal carcinoma cells in tumor implantation experiments in mice.

  20. Dissecting epigenetic silencing complexity in the mouse lung cancer suppressor gene Cadm1.

    Directory of Open Access Journals (Sweden)

    Stella Marie Reamon-Buettner

    Full Text Available Disease-oriented functional analysis of epigenetic factors and their regulatory mechanisms in aberrant silencing is a prerequisite for better diagnostics and therapy. Yet, the precise mechanisms are still unclear and complex, involving the interplay of several effectors including nucleosome positioning, DNA methylation, histone variants and histone modifications. We investigated the epigenetic silencing complexity in the tumor suppressor gene Cadm1 in mouse lung cancer progenitor cell lines, exhibiting promoter hypermethylation associated with transcriptional repression, but mostly unresponsive to demethylating drug treatments. After predicting nucleosome positions and transcription factor binding sites along the Cadm1 promoter, we carried out single-molecule mapping with DNA methyltransferase M.SssI, which revealed in silent promoters high nucleosome occupancy and occlusion of transcription factor binding sites. Furthermore, M.SssI maps of promoters varied within and among the different lung cancer cell lines. Chromatin analysis with micrococcal nuclease also indicated variations in nucleosome positioning to have implications in the binding of transcription factors near nucleosome borders. Chromatin immunoprecipitation showed that histone variants (H2A.Z and H3.3, and opposing histone modification marks (H3K4me3 and H3K27me3 all colocalized in the same nucleosome positions that is reminiscent of epigenetic plasticity in embryonic stem cells. Altogether, epigenetic silencing complexity in the promoter region of Cadm1 is not only defined by DNA hypermethylation, but high nucleosome occupancy, altered nucleosome positioning, and 'bivalent' histone modifications, also likely contributed in the transcriptional repression of this gene in the lung cancer cells. Our results will help define therapeutic intervention strategies using epigenetic drugs in lung cancer.

  1. Expression of RNA interference triggers from an oncolytic herpes simplex virus results in specific silencing in tumour cells in vitro and tumours in vivo

    International Nuclear Information System (INIS)

    Anesti, Anna-Maria; Simpson, Guy R; Price, Toby; Pandha, Hardev S; Coffin, Robert S

    2010-01-01

    Delivery of small interfering RNA (siRNA) to tumours remains a major obstacle for the development of RNA interference (RNAi)-based therapeutics. Following the promising pre-clinical and clinical results with the oncolytic herpes simplex virus (HSV) OncoVEX GM-CSF , we aimed to express RNAi triggers from oncolytic HSV, which although has the potential to improve treatment by silencing tumour-related genes, was not considered possible due to the highly oncolytic properties of HSV. To evaluate RNAi-mediated silencing from an oncolytic HSV backbone, we developed novel replicating HSV vectors expressing short-hairpin RNA (shRNA) or artificial microRNA (miRNA) against the reporter genes green fluorescent protein (eGFP) and β-galactosidase (lacZ). These vectors were tested in non-tumour cell lines in vitro and tumour cells that are moderately susceptible to HSV infection both in vitro and in mice xenografts in vivo. Silencing was assessed at the protein level by fluorescent microscopy, x-gal staining, enzyme activity assay, and western blotting. Our results demonstrate that it is possible to express shRNA and artificial miRNA from an oncolytic HSV backbone, which had not been previously investigated. Furthermore, oncolytic HSV-mediated delivery of RNAi triggers resulted in effective and specific silencing of targeted genes in tumour cells in vitro and tumours in vivo, with the viruses expressing artificial miRNA being comprehensibly more effective. This preliminary data provide the first demonstration of oncolytic HSV-mediated expression of shRNA or artificial miRNA and silencing of targeted genes in tumour cells in vitro and in vivo. The vectors developed in this study are being adapted to silence tumour-related genes in an ongoing study that aims to improve the effectiveness of oncolytic HSV treatment in tumours that are moderately susceptible to HSV infection and thus, potentially improve response rates seen in human clinical trials

  2. Capturing microRNA targets using an RNA-induced silencing complex (RISC)-trap approach.

    Science.gov (United States)

    Cambronne, Xiaolu A; Shen, Rongkun; Auer, Paul L; Goodman, Richard H

    2012-12-11

    Identifying targets is critical for understanding the biological effects of microRNA (miRNA) expression. The challenge lies in characterizing the cohort of targets for a specific miRNA, especially when targets are being actively down-regulated in miRNA- RNA-induced silencing complex (RISC)-messengerRNA (mRNA) complexes. We have developed a robust and versatile strategy called RISCtrap to stabilize and purify targets from this transient interaction. Its utility was demonstrated by determining specific high-confidence target datasets for miR-124, miR-132, and miR-181 that contained known and previously unknown transcripts. Two previously unknown miR-132 targets identified with RISCtrap, adaptor protein CT10 regulator of kinase 1 (CRK1) and tight junction-associated protein 1 (TJAP1), were shown to be endogenously regulated by miR-132 in adult mouse forebrain. The datasets, moreover, differed in the number of targets and in the types and frequency of microRNA recognition element (MRE) motifs, thus revealing a previously underappreciated level of specificity in the target sets regulated by individual miRNAs.

  3. Musashi-2 Silencing Exerts Potent Activity against Acute Myeloid Leukemia and Enhances Chemosensitivity to Daunorubicin.

    Directory of Open Access Journals (Sweden)

    Yixiang Han

    Full Text Available RNA-binding protein Musashi-2 (Msi2 is known to play a critical role in leukemogenesis and contributes to poor clinical prognosis in acute myeloid leukemia (AML. However, the effect of Msi2 silencing on treatment for AML still remains poorly understood. In this study, we used lentivirus-mediated RNA interference targeting Msi2 to investigate the resulting changes in cellular processes and the underlying mechanisms in AML cell lines as well as primary AML cells isolated from AML patients. We found that Msi2 was highly expressed in AML cells, and its depletion inhibited Ki-67 expression and resulted in decreased in vitro and in vivo proliferation. Msi2 silencing induced cell cycle arrest in G0/G1 phase, with decreased Cyclin D1 and increased p21 expression. Msi2 silencing induced apoptosis through down-regulation of Bcl-2 expression and up-regulation of Bax expression. Suppression of Akt, Erk1/2 and p38 phosphorylation also contributed to apoptosis mediated by Msi2 silencing. Finally, Msi2 silencing in AML cells also enhanced their chemosensitivity to daunorubicin. Conclusively, our data suggest that Msi2 is a promising target for gene therapy to optimize conventional chemotherapeutics in AML treatment.

  4. Co-silencing of tomato S-adenosylhomocysteine hydrolase genes confers increased immunity against Pseudomonas syringae pv. tomato DC3000 and enhanced tolerance to drought stress

    Directory of Open Access Journals (Sweden)

    Li Xiao Hui

    2015-09-01

    Full Text Available S-adenosylhomocysteine hydrolase (SAHH, catalyzing the reversible hydrolysis of S-adenosylhomocysteine to adenosine and homocysteine, is a key enzyme that maintain the cellular methylation potential in all organisms. We report here the biological functions of tomato SlSAHHs in stress response. The tomato genome contains three SlSAHH genes that encode SlSAHH proteins with high level of sequence identity. qRT-PCR analysis revealed that SlSAHHs responded with distinct expression induction patterns to Pseudomonas syringae pv. tomato (Pst DC3000 and Botrytis cinerea as well as to defense signaling hormones such as salicylic acid, jasmonic acid and a precursor of ethylene. Virus-induced gene silencing-based knockdown of individual SlSAHH gene did not affect the growth performance and the response to Pst DC3000. However, co-silencing of three SlSAHH genes using a conserved sequence led to significant inhibition of vegetable growth. The SlSAHH-co-silenced plants displayed increased resistance to Pst DC3000 but did not alter the resistance to B. cinerea. Co-silencing of SlSAHHs resulted in constitutively activated defense responses including elevated SA level, upregulated expression of defense-related and PAMP-triggered immunity marker genes and increased callose deposition and H2O2 accumulation. Furthermore, the SlSAHH-co-silenced plants also exhibited enhanced drought stress tolerance although they had relatively small roots. These data demonstrate that, in addition to the functions in growth and development, SAHHs also play important roles in regulating biotic and abiotic stress responses in plants.

  5. Short-hairpin RNA-mediated Heat shock protein 90 gene silencing inhibits human breast cancer cell growth in vitro and in vivo

    International Nuclear Information System (INIS)

    Zuo, Keqiang; Li, Dan; Pulli, Benjamin; Yu, Fei; Cai, Haidong; Yuan, Xueyu; Zhang, Xiaoping; Lv, Zhongwei

    2012-01-01

    Highlights: ► Hsp90 is over-expressed in human breast cancer. ► The shRNA-mediated gene silencing of Hsp90 resulted in inhibition of cell growth. ► Akt and NF-kB were down-regulation after transfection due to Hsp90 silencing. ► The tumor growth ratio was decline due to Hsp90 silencing. ► The PCNA expression was down-regulation due to Hsp90 silencing. -- Abstract: Hsp90 interacts with proteins that mediate signaling pathways involved in the regulation of essential processes such as proliferation, cell cycle control, angiogenesis and apoptosis. Hsp90 inhibition is therefore an attractive strategy for blocking abnormal pathways that are crucial for cancer cell growth. In the present study, the role of Hsp90 in human breast cancer MCF-7 cells was examined by stably silencing Hsp90 gene expression with an Hsp90-silencing vector (Hsp90-shRNA). RT-PCR and Western blot analyses showed that Hsp90-shRNA specifically and markedly down-regulated Hsp90 mRNA and protein expression. NF-kB and Akt protein levels were down-regulated in Hsp90-shRNA transfected cells, indicating that Hsp90 knockout caused a reduction of survival factors and induced apoptosis. Treatment with Hsp90-shRNA significantly increased apoptotic cell death and caused cell cycle arrest in the G1/S phase in MCF-7 cells, as shown by flow cytometry. Silencing of Hsp90 also reduced cell viability, as determined by MTT assay. In vivo experiments showed that MCF-7 cells stably transfected with Hsp90-shRNA grew slowly in nude mice as compared with control groups. In summary, the Hsp90-shRNA specifically silenced the Hsp90 gene, and inhibited MCF-7 cell growth in vitro and in vivo. Possible molecular mechanisms underlying the effects of Hsp90-shRNA include the degradation of Hsp90 breast cancer-related client proteins, the inhibition of survival signals and the upregulation of apoptotic pathways. shRNA-mediated interference may have potential therapeutic utility in human breast cancer.

  6. Identification of miRNAs and their target genes in developing soybean seeds by deep sequencing

    Directory of Open Access Journals (Sweden)

    Chen Shou-Yi

    2011-01-01

    Full Text Available Abstract Background MicroRNAs (miRNAs regulate gene expression by mediating gene silencing at transcriptional and post-transcriptional levels in higher plants. miRNAs and related target genes have been widely studied in model plants such as Arabidopsis and rice; however, the number of identified miRNAs in soybean (Glycine max is limited, and global identification of the related miRNA targets has not been reported in previous research. Results In our study, a small RNA library and a degradome library were constructed from developing soybean seeds for deep sequencing. We identified 26 new miRNAs in soybean by bioinformatic analysis and further confirmed their expression by stem-loop RT-PCR. The miRNA star sequences of 38 known miRNAs and 8 new miRNAs were also discovered, providing additional evidence for the existence of miRNAs. Through degradome sequencing, 145 and 25 genes were identified as targets of annotated miRNAs and new miRNAs, respectively. GO analysis indicated that many of the identified miRNA targets may function in soybean seed development. Additionally, a soybean homolog of Arabidopsis SUPPRESSOR OF GENE SLIENCING 3 (AtSGS3 was detected as a target of the newly identified miRNA Soy_25, suggesting the presence of feedback control of miRNA biogenesis. Conclusions We have identified large numbers of miRNAs and their related target genes through deep sequencing of a small RNA library and a degradome library. Our study provides more information about the regulatory network of miRNAs in soybean and advances our understanding of miRNA functions during seed development.

  7. The molecular basis for stability of heterochromatin-mediated silencing in mammals.

    Science.gov (United States)

    Hiragami-Hamada, Kyoko; Xie, Sheila Q; Saveliev, Alexander; Uribe-Lewis, Santiago; Pombo, Ana; Festenstein, Richard

    2009-11-04

    The archetypal epigenetic phenomenon of position effect variegation (PEV) in Drosophila occurs when a gene is brought abnormally close to heterochromatin, resulting in stochastic silencing of the affected gene in a proportion of cells that would normally express it. PEV has been instrumental in unraveling epigenetic mechanisms. Using an in vivo mammalian model for PEV we have extensively investigated the molecular basis for heterochromatin-mediated gene silencing. Here we distinguish 'epigenetic effects' from other cellular differences by studying ex vivo cells that are identical, apart from the expression of the variegating gene which is silenced in a proportion of the cells. By separating cells according to transgene expression we show here that silencing appears to be associated with histone H3 lysine 9 trimethylation (H3K9me3), DNA methylation and the localization of the silenced gene to a specific nuclear compartment enriched in these modifications. In contrast, histone H3 acetylation (H3Ac) and lysine 4 di or tri methylation (H3K4me2/3) are the predominant modifications associated with expression where we see the gene in a euchromatic compartment. Interestingly, DNA methylation and inaccessibility, rather than H3K9me3, correlated most strongly with resistance to de-repression by cellular activation. These results have important implications for understanding the contribution of specific factors involved in the establishment and maintenance of gene silencing and activation in vivo.

  8. The molecular basis for stability of heterochromatin-mediated silencing in mammals

    Directory of Open Access Journals (Sweden)

    Hiragami-Hamada Kyoko

    2009-11-01

    Full Text Available Abstract The archetypal epigenetic phenomenon of position effect variegation (PEV in Drosophila occurs when a gene is brought abnormally close to heterochromatin, resulting in stochastic silencing of the affected gene in a proportion of cells that would normally express it. PEV has been instrumental in unraveling epigenetic mechanisms. Using an in vivo mammalian model for PEV we have extensively investigated the molecular basis for heterochromatin-mediated gene silencing. Here we distinguish 'epigenetic effects' from other cellular differences by studying ex vivo cells that are identical, apart from the expression of the variegating gene which is silenced in a proportion of the cells. By separating cells according to transgene expression we show here that silencing appears to be associated with histone H3 lysine 9 trimethylation (H3K9me3, DNA methylation and the localization of the silenced gene to a specific nuclear compartment enriched in these modifications. In contrast, histone H3 acetylation (H3Ac and lysine 4 di or tri methylation (H3K4me2/3 are the predominant modifications associated with expression where we see the gene in a euchromatic compartment. Interestingly, DNA methylation and inaccessibility, rather than H3K9me3, correlated most strongly with resistance to de-repression by cellular activation. These results have important implications for understanding the contribution of specific factors involved in the establishment and maintenance of gene silencing and activation in vivo.

  9. Expression Profile of Stress-responsive Arabidopsis thaliana miRNAs and their Target Genes in Response to Inoculation with Pectobacterium carotovorum subsp. carotovorum.

    Science.gov (United States)

    Djami-Tchatchou, A T; Ntushelo, K

    2017-01-01

    Pectobacterium carotovorum subsp. carotovorum (Pcc) is a soft rot bacterium which upon entry into the plant macerates plant tissues by producing plant cell wall degrading enzymes. It has a wide host range which includes carrot, potato, tomato, leafy greens, squash and other cucurbits, onion, green peppers and cassava. During plant-microbe interactions, one of the ways of plant response to pathogen infection is through the small RNA silencing mechanism. Under pathogen attack the plant utilizes microRNAs to regulate gene expression by means of mediating gene silencing at transcriptional and post-transcriptional level. This study aims to assess for the first time, the expression profile of some stress-responsive miRNA and differential expression pattern of their target genes in Arabidopsis thaliana inoculated with Pcc. Leaves of five weeks old Arabidopsis thaliana plants were infected with Pcc and the quantitative real time-PCR, was used to investigate after 0, 24, 48 and 72 h post infection, the expression profiling of the stress-responsive miRNAs which include: miR156, miR159, miR169, miR393, miR396 miR398, miR399 and miR408 along with their target genes which include: Squamosa promoter-binding-like protein, myb domain protein 101, nuclear factor Y subunit A8, concanavalin A-like lectin protein kinase, growth regulating factor 4, copper superoxide dismutase, ubiquitin-protein ligase and plantacyanin respectively. The findings showed that the overexpression of 6 miRNAs at 24, 48 and 72 h after infection resulted in the repression of their target genes and the expression of 2 miRNAs didn't affect their target genes. These results provide the first indication of the miRNAs role in response to the infection of Pcc in A. thaliana and open new vistas for a better understanding of miRNA regulation of plant response to Pcc.

  10. Apple latent spherical virus vectors for reliable and effective virus-induced gene silencing among a broad range of plants including tobacco, tomato, Arabidopsis thaliana, cucurbits, and legumes

    International Nuclear Information System (INIS)

    Igarashi, Aki; Yamagata, Kousuke; Sugai, Tomokazu; Takahashi, Yukari; Sugawara, Emiko; Tamura, Akihiro; Yaegashi, Hajime; Yamagishi, Noriko; Takahashi, Tsubasa; Isogai, Masamichi; Takahashi, Hideki; Yoshikawa, Nobuyuki

    2009-01-01

    Apple latent spherical virus (ALSV) vectors were evaluated for virus-induced gene silencing (VIGS) of endogenous genes among a broad range of plant species. ALSV vectors carrying partial sequences of a subunit of magnesium chelatase (SU) and phytoene desaturase (PDS) genes induced highly uniform knockout phenotypes typical of SU and PDS inhibition on model plants such as tobacco and Arabidopsis thaliana, and economically important crops such as tomato, legume, and cucurbit species. The silencing phenotypes persisted throughout plant growth in these plants. In addition, ALSV vectors could be successfully used to silence a meristem gene, proliferating cell nuclear antigen and disease resistant N gene in tobacco and RCY1 gene in A. thaliana. As ALSV infects most host plants symptomlessly and effectively induces stable VIGS for long periods, the ALSV vector is a valuable tool to determine the functions of interested genes among a broad range of plant species.

  11. Concurrent epigenetic silencing of wnt/β-catenin pathway inhibitor genes in B cell chronic lymphocytic leukaemia

    International Nuclear Information System (INIS)

    Moskalev, Evgeny A; Pötz, Oliver; Joos, Thomas O; Hoheisel, Jörg D; Luckert, Katrin; Vorobjev, Ivan A; Mastitsky, Sergey E; Gladkikh, Aleena A; Stephan, Achim; Schrenk, Marita; Kaplanov, Kamil D; Kalashnikova, Olga B

    2012-01-01

    The Wnt/β-catenin signalling is aberrantly activated in primary B cell chronic lymphocytic leukaemia (CLL). Epigenetic silencing of pathway inhibitor genes may be a mechanism for its activation. In this study, we investigated systematically and quantitatively the methylation status of 12 Wnt/β-catenin pathway inhibitor genes – CDH1, DACT1, DKK1, DKK2, DKK3, DKK4, SFRP1, SFRP2, SFRP3, SFRP4, SFRP5 and WIF1 – in the cell lines EHEB and MEC-1 as well as patient samples. Quantification of DNA methylation was performed by means of bisulphite pyrosequencing and confirmed by bisulphite Sanger sequencing. Gene expression was analysed by qPCR using GAPDH as internal control. E-cadherin and β-catenin protein quantification was carried out by microsphere-based immunoassays. Methylation differences observed between the patient and control groups were tested using generalised least squares models. For 10 genes, a higher methylation level was observed in tumour material. Only DKK4 exhibited similarly high methylation levels in both tumour and normal specimens, while DACT1 was always essentially unmethylated. However, also for these inhibitors, treatment of cells with the demethylating agent 5-aza-2´-deoxycytidine resulted in an induction of their expression, as shown by quantitative PCR, suggesting an indirect epigenetic control of activity. While the degree of demethylation and its transcriptional consequences differed between the genes, there was an overall high correlation of demethylation and increased activity. Protein expression studies revealed that no constitutive Wnt/β-catenin signalling occurred in the cell lines, which is in discrepancy with results from primary CLL. However, treatment with 5-aza-2´-deoxycytidine caused accumulation of β-catenin. Simultaneously, E-cadherin expression was strongly induced, leading to the formation of a complex with β-catenin and thus demonstrating its epigenetically regulated inhibition effect. The results suggest an

  12. Systematic Evaluation of Promising Clinical Trials-Gene Silencing for the Treatment of Glioblastoma.

    Science.gov (United States)

    Karaarslan, Numan; Yilmaz, Ibrahim; Ozbek, Hanefi; Caliskan, Tezcan; Topuk, Savas; Sirin, Duygu Yasar; Ates, Ozkan

    2018-04-06

    The aim of this study was to systematically investigate the role of artificial small interfering RNA (siRNA) molecules in glioblastoma treatment and to give a detailed overview of the literature concerning studies performed in this field worldwide in the last 31 years. Articles about clinical trials conducted between December 1, 1949 and November 8, 2017, were identified from the Cochrane Collaboration, the Cochrane Library, Ovid MEDLINE, ProQuest, the National Library of Medicine, and PubMed electronic databases, using the terms "post transcriptional gene silencing," "small interfering RNA," "siRNA," and "glioblastoma," either individually or combined (\\"OR\\" and \\"AND"), without language and country restrictions. Articles that met the examination criteria were included in the study. After descriptive statistical evaluation, the results were reported in frequency (%). After scanning 2.752 articles, five articles were found that met the research criteria. Examination of full texts of the five identified articles provided no sufficient evidence for research conducted with regard to the use of gene silencing via siRNAs in glioblastoma treatment. To be able to evaluate the clinical use of siRNAs, there is an urgent need for in-vivo studies and for trials with randomized, controlled, and clinical designs that provide long-term functional outcomes.

  13. Titration and hysteresis in epigenetic chromatin silencing

    International Nuclear Information System (INIS)

    Dayarian, Adel; Sengupta, Anirvan M

    2013-01-01

    Epigenetic mechanisms of silencing via heritable chromatin modifications play a major role in gene regulation and cell fate specification. We consider a model of epigenetic chromatin silencing in budding yeast and study the bifurcation diagram and characterize the bistable and the monostable regimes. The main focus of this paper is to examine how the perturbations altering the activity of histone modifying enzymes affect the epigenetic states. We analyze the implications of having the total number of silencing proteins, given by the sum of proteins bound to the nucleosomes and the ones available in the ambient, to be constant. This constraint couples different regions of chromatin through the shared reservoir of ambient silencing proteins. We show that the response of the system to perturbations depends dramatically on the titration effect caused by the above constraint. In particular, for a certain range of overall abundance of silencing proteins, the hysteresis loop changes qualitatively with certain jump replaced by continuous merger of different states. In addition, we find a nonmonotonic dependence of gene expression on the rate of histone deacetylation activity of Sir2. We discuss how these qualitative predictions of our model could be compared with experimental studies of the yeast system under anti-silencing drugs. (paper)

  14. Histone Methylation and Epigenetic Silencing in Breast Cancer

    National Research Council Canada - National Science Library

    Simon, Jeffrey A; Lange, Carol A

    2008-01-01

    .... EZH2 is a histone methyltransferase which modifies lysine-27 of histone H3 an epigenetic mark which is generally linked to gene silencing and is implicated in tumor suppressor silencing during breast cancer progression...

  15. Charged residues in the H-NS linker drive DNA binding and gene silencing in single cells.

    Science.gov (United States)

    Gao, Yunfeng; Foo, Yong Hwee; Winardhi, Ricksen S; Tang, Qingnan; Yan, Jie; Kenney, Linda J

    2017-11-21

    Nucleoid-associated proteins (NAPs) facilitate chromosome organization in bacteria, but the precise mechanism remains elusive. H-NS is a NAP that also plays a major role in silencing pathogen genes. We used genetics, single-particle tracking in live cells, superresolution microscopy, atomic force microscopy, and molecular dynamics simulations to examine H-NS/DNA interactions in single cells. We discovered a role for the unstructured linker region connecting the N-terminal oligomerization and C-terminal DNA binding domains. In the present work we demonstrate that linker amino acids promote engagement with DNA. In the absence of linker contacts, H-NS binding is significantly reduced, although no change in chromosome compaction is observed. H-NS is not localized to two distinct foci; rather, it is scattered all around the nucleoid. The linker makes DNA contacts that are required for gene silencing, while chromosome compaction does not appear to be an important H-NS function.

  16. Enhancing potency of siRNA targeting fusion genes by optimization outside of target sequence.

    Science.gov (United States)

    Gavrilov, Kseniya; Seo, Young-Eun; Tietjen, Gregory T; Cui, Jiajia; Cheng, Christopher J; Saltzman, W Mark

    2015-12-01

    Canonical siRNA design algorithms have become remarkably effective at predicting favorable binding regions within a target mRNA, but in some cases (e.g., a fusion junction site) region choice is restricted. In these instances, alternative approaches are necessary to obtain a highly potent silencing molecule. Here we focus on strategies for rational optimization of two siRNAs that target the junction sites of fusion oncogenes BCR-ABL and TMPRSS2-ERG. We demonstrate that modifying the termini of these siRNAs with a terminal G-U wobble pair or a carefully selected pair of terminal asymmetry-enhancing mismatches can result in an increase in potency at low doses. Importantly, we observed that improvements in silencing at the mRNA level do not necessarily translate to reductions in protein level and/or cell death. Decline in protein level is also heavily influenced by targeted protein half-life, and delivery vehicle toxicity can confound measures of cell death due to silencing. Therefore, for BCR-ABL, which has a long protein half-life that is difficult to overcome using siRNA, we also developed a nontoxic transfection vector: poly(lactic-coglycolic acid) nanoparticles that release siRNA over many days. We show that this system can achieve effective killing of leukemic cells. These findings provide insights into the implications of siRNA sequence for potency and suggest strategies for the design of more effective therapeutic siRNA molecules. Furthermore, this work points to the importance of integrating studies of siRNA design and delivery, while heeding and addressing potential limitations such as restricted targetable mRNA regions, long protein half-lives, and nonspecific toxicities.

  17. Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing.

    Science.gov (United States)

    Hedil, Marcio; Sterken, Mark G; de Ronde, Dryas; Lohuis, Dick; Kormelink, Richard

    2015-01-01

    RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS. Although the tomato spotted wilt virus (TSWV) tospovirus NSs protein has been shown to exhibit affinity to long and small dsRNA molecules, its ability to suppress the non-cell autonomous part of RNA silencing has only been studied to a limited extent. Here, the NSs proteins of TSWV, groundnut ringspot virus (GRSV) and tomato yellow ring virus (TYRV), representatives for three distinct tospovirus species, have been studied on their ability and strength to suppress local and systemic silencing. A system has been developed to quantify suppression of GFP silencing in Nicotiana benthamiana 16C lines, to allow a comparison of relative RNA silencing suppressor strength. It is shown that NSs of all three tospoviruses are suppressors of local and systemic silencing. Unexpectedly, suppression of systemic RNA silencing by NSsTYRV was just as strong as those by NSsTSWV and NSsGRSV, even though NSsTYRV was expressed in lower amounts. Using the system established, a set of selected NSsTSWV gene constructs mutated in predicted RNA binding domains, as well as NSs from TSWV isolates 160 and 171 (resistance breakers of the Tsw resistance gene), were analyzed for their ability to suppress systemic GFP silencing. The results indicate another mode of RNA silencing suppression by NSs that acts further downstream the biogenesis of siRNAs and their sequestration. The findings are discussed in light of the affinity of NSs for small and long dsRNA, and recent mutant screen of NSsTSWV to map domains required for RSS activity and triggering of Tsw-governed resistance.

  18. Delivery of chitosan/dsRNA nanoparticles for silencing of wing development vestigial (vg) gene in Aedes aegypti mosquitoes.

    Science.gov (United States)

    Ramesh Kumar, D; Saravana Kumar, P; Gandhi, M Rajiv; Al-Dhabi, Naif Abdullah; Paulraj, M Gabriel; Ignacimuthu, S

    2016-05-01

    RNA interference (RNAi) has been used as a gene silencing strategy by the introduction of long double stranded RNA (dsRNA) for the control of pest insects. The aim of the present study was to examine whether the expression of vg gene which is responsible for wing development, can be repressed by chitosan/dsRNA based nanoparticles in Aedes aegypti. The vestigial gene (vg) was amplified from adult mosquito and cloned in pLitmus28i vector. Genetically engineered recombinant plasmid was transformed into RNase III deficient strain for synthesis of bacterially expressed dsRNA. Nanoparticles were prepared via electrostatic interaction between cationic polymer chitosan and anionic nucleic acids (dsRNA). The formation of chitosan/dsRNAnanoparticles and their size were confirmed by Atomic force microscopy (AFM). Chitosan/dsRNA mediated knockdown of Enhanced Green Fluorescence Protein (EGFP) was demonstrated in Sf21 cells. Further, we tested whether such an approach could be used to target vg gene in Ae. aegypti. The results showed that chitosan/dsRNA caused significant mortality, delayed growth development and caused adult wing-malformation. A qRT-PCR analysis confirmed that the chitosan/dsRNA mediated transcriptional level was downregulated. Our findings suggest that vg gene intervention strategies through RNAi can emerge as viable option for pest control. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing

    NARCIS (Netherlands)

    Hedil, M.; Sterken, M.G.; Ronde, de D.; Lohuis, D.; Kormelink, R.

    2015-01-01

    RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS.

  20. Stanniocalcin-2 is a HIF-1 target gene that promotes cell proliferation in hypoxia

    Energy Technology Data Exchange (ETDEWEB)

    Law, Alice Y.S. [Department of Biology, Hong Kong Baptist University, Kowloon Tong (Hong Kong); Wong, Chris K.C., E-mail: ckcwong@hkbu.edu.hk [Department of Biology, Hong Kong Baptist University, Kowloon Tong (Hong Kong)

    2010-02-01

    Stanniocalcin-2 (STC2), the paralog of STC1, has been suggested as a novel target of oxidative stress response to protect cells from apoptosis. The expression of STC2 has been reported to be highly correlated with human cancer development. In this study, we reported that STC2 is a HIF-1 target gene and is involved in the regulation of cell proliferation. STC2 was shown to be up-regulated in different breast and ovarian cancer cells, following exposure to hypoxia. Using ovarian cancer cells (SKOV3), the underlying mechanism of HIF-1 mediated STC2 gene transactivation was characterized. Hypoxia-induced STC2 expression was found to be HIF-1{alpha} dependent and required the recruitment of p300 and HDAC7. Using STC2 promoter deletion constructs and site-directed mutagenesis, two authentic consensus HIF-1 binding sites were identified. Under hypoxic condition, the silencing of STC2 reduced while the overexpression of STC2 increased the levels of phosphorylated retinoblastoma and cyclin D in both SKOV3 and MCF7 cells. The change in cell cycle proteins correlated with the data of the serial cell counts. The results indicated that cell proliferation was reduced in STC2-silenced cells but was increased in STC2-overexpressing hypoxic cells. Solid tumor progression is usually associated with hypoxia. The identification and functional analysis of STC2 up-regulation by hypoxia, a feature of the tumor microenvironment, sheds light on a possible role for STC2 in tumors.

  1. Investigations of barley stripe mosaic virus as a gene silencing vector in barley roots and in Brachypodium distachyon and oat

    DEFF Research Database (Denmark)

    Pacak, Andrzej; Geisler, Katrin; Jørgensen, Bodil

    2010-01-01

    -expressed genes we wanted to explore the potential of BSMV for silencing genes in root tissues. Furthermore, the newly completed genome sequence of the emerging cereal model species Brachypodium distachyon as well as the increasing amount of EST sequence information available for oat (Avena species) have created...

  2. Computational analysis of siRNA recognition by the Ago2 PAZ domain and identification of the determinants of RNA-induced gene silencing.

    Directory of Open Access Journals (Sweden)

    Mahmoud Kandeel

    Full Text Available RNA interference (RNAi is a highly specialized process of protein-siRNA interaction that results in the regulation of gene expression and cleavage of target mRNA. The PAZ domain of the Argonaute proteins binds to the 3' end of siRNA, and during RNAi the attaching end of the siRNA switches between binding and release from its binding pocket. This biphasic interaction of the 3' end of siRNA with the PAZ domain is essential for RNAi activity; however, it remains unclear whether stronger or weaker binding with PAZ domain will facilitate or hinder the overall RNAi process. Here we report the correlation between the binding of modified siRNA 3' overhang analogues and their in vivo RNAi efficacy. We found that higher RNAi efficacy was associated with the parameters of lower Ki value, lower total intermolecular energy, lower free energy, higher hydrogen bonding, smaller total surface of interaction and fewer van der Waals interactions. Electrostatic interaction was a minor contributor to compounds recognition, underscoring the presence of phosphate groups in the modified analogues. Thus, compounds with lower binding affinity are associated with better gene silencing. Lower binding strength along with the smaller interaction surface, higher hydrogen bonding and fewer van der Waals interactions were among the markers for favorable RNAi activity. Within the measured parameters, the interaction surface, van der Waals interactions and inhibition constant showed a statistically significant correlation with measured RNAi efficacy. The considerations provided in this report will be helpful in the design of new compounds with better gene silencing ability.

  3. Silence in the Communication or Communicating through Silence: Silence in Psychoanalysis

    Directory of Open Access Journals (Sweden)

    Rita Marta

    2014-10-01

    Full Text Available This paper is a reflection upon the meaning and importance of silence in the psychoanalytical relationship. Beginning with the silence in the “normal” relationship between people, we show how silence can be experienced as confortable or unconfortable, and how it can be used to achieve a bigger proximity or distance in the relationship with others. We show these same aspects in the psychoanalytical relationship, and the evolution of the regard towards silence along the development of psychoanalysis. We end, presenting the Nacht’s thinking about silence, who emphasizes its integrative and fundamental role in the psychoanalytical relationship. Thus, only through silence certain affects can be born, and silence allows the patient to internalize the analyst.

  4. Inter-genomic DNA Exchanges and Homeologous Gene Silencing Shaped the Nascent Allopolyploid Coffee Genome (Coffea arabica L.

    Directory of Open Access Journals (Sweden)

    Philippe Lashermes

    2016-09-01

    Full Text Available Allopolyploidization is a biological process that has played a major role in plant speciation and evolution. Genomic changes are common consequences of polyploidization, but their dynamics over time are still poorly understood. Coffea arabica, a recently formed allotetraploid, was chosen to study genetic changes that accompany allopolyploid formation. Both RNA-seq and DNA-seq data were generated from two genetically distant C. arabica accessions. Genomic structural variation was investigated using C. canephora, one of its diploid progenitors, as reference genome. The fate of 9047 duplicate homeologous genes was inferred and compared between the accessions. The pattern of SNP density along the reference genome was consistent with the allopolyploid structure. Large genomic duplications or deletions were not detected. Two homeologous copies were retained and expressed in 96% of the genes analyzed. Nevertheless, duplicated genes were found to be affected by various genomic changes leading to homeolog loss or silencing. Genetic and epigenetic changes were evidenced that could have played a major role in the stabilization of the unique ancestral allotetraploid and its subsequent diversification. While the early evolution of C. arabica mainly involved homeologous crossover exchanges, the later stage appears to have relied on more gradual evolution involving gene conversion and homeolog silencing.

  5. Soft computing model for optimized siRNA design by identifying off target possibilities using artificial neural network model.

    Science.gov (United States)

    Murali, Reena; John, Philips George; Peter S, David

    2015-05-15

    The ability of small interfering RNA (siRNA) to do posttranscriptional gene regulation by knocking down targeted genes is an important research topic in functional genomics, biomedical research and in cancer therapeutics. Many tools had been developed to design exogenous siRNA with high experimental inhibition. Even though considerable amount of work has been done in designing exogenous siRNA, design of effective siRNA sequences is still a challenging work because the target mRNAs must be selected such that their corresponding siRNAs are likely to be efficient against that target and unlikely to accidentally silence other transcripts due to sequence similarity. In some cases, siRNAs may tolerate mismatches with the target mRNA, but knockdown of genes other than the intended target could make serious consequences. Hence to design siRNAs, two important concepts must be considered: the ability in knocking down target genes and the off target possibility on any nontarget genes. So before doing gene silencing by siRNAs, it is essential to analyze their off target effects in addition to their inhibition efficacy against a particular target. Only a few methods have been developed by considering both efficacy and off target possibility of siRNA against a gene. In this paper we present a new design of neural network model with whole stacking energy (ΔG) that enables to identify the efficacy and off target effect of siRNAs against target genes. The tool lists all siRNAs against a particular target with their inhibition efficacy and number of matches or sequence similarity with other genes in the database. We could achieve an excellent performance of Pearson Correlation Coefficient (R=0. 74) and Area Under Curve (AUC=0.906) when the threshold of whole stacking energy is ≥-34.6 kcal/mol. To the best of the author's knowledge, this is one of the best score while considering the "combined efficacy and off target possibility" of siRNA for silencing a gene. The proposed model

  6. The rde-1 gene, RNA interference, and transposon silencing in C. elegans.

    Science.gov (United States)

    Tabara, H; Sarkissian, M; Kelly, W G; Fleenor, J; Grishok, A; Timmons, L; Fire, A; Mello, C C

    1999-10-15

    Double-stranded (ds) RNA can induce sequence-specific inhibition of gene function in several organisms. However, both the mechanism and the physiological role of the interference process remain mysterious. In order to study the interference process, we have selected C. elegans mutants resistant to dsRNA-mediated interference (RNAi). Two loci, rde-1 and rde-4, are defined by mutants strongly resistant to RNAi but with no obvious defects in growth or development. We show that rde-1 is a member of the piwi/sting/argonaute/zwille/eIF2C gene family conserved from plants to vertebrates. Interestingly, several, but not all, RNAi-deficient strains exhibit mobilization of the endogenous transposons. We discuss implications for the mechanism of RNAi and the possibility that one natural function of RNAi is transposon silencing.

  7. Engineering of small interfering RNA-loaded lipidoid-poly(DL-lactic-co-glycolic acid) hybrid nanoparticles for highly efficient and safe gene silencing: A quality by design-based approach.

    Science.gov (United States)

    Thanki, Kaushik; Zeng, Xianghui; Justesen, Sarah; Tejlmann, Sarah; Falkenberg, Emily; Van Driessche, Elize; Mørck Nielsen, Hanne; Franzyk, Henrik; Foged, Camilla

    2017-11-01

    Safety and efficacy of therapeutics based on RNA interference, e.g., small interfering RNA (siRNA), are dependent on the optimal engineering of the delivery technology, which is used for intracellular delivery of siRNA to the cytosol of target cells. We investigated the hypothesis that commonly used and poorly tolerated cationic lipids might be replaced with more efficacious and safe lipidoids as the lipid component of siRNA-loaded lipid-polymer hybrid nanoparticles (LPNs) for achieving more efficient gene silencing at lower and safer doses. However, formulation design of such a complex formulation is highly challenging due to a strong interplay between several contributing factors. Hence, critical formulation variables, i.e. the lipidoid content and siRNA:lipidoid ratio, were initially identified, followed by a systematic quality-by-design approach to define the optimal operating space (OOS), eventually resulting in the identification of a robust, highly efficacious and safe formulation. A 17-run design of experiment with an I-optimal approach was performed to systematically assess the effect of selected variables on critical quality attributes (CQAs), i.e. physicochemical properties (hydrodynamic size, zeta potential, siRNA encapsulation/loading) and the biological performance (in vitro gene silencing and cell viability). Model fitting of the obtained data to construct predictive models revealed non-linear relationships for all CQAs, which can be readily overlooked in one-factor-at-a-time optimization approaches. The response surface methodology further enabled the identification of an OOS that met the desired quality target product profile. The optimized lipidoid-modified LPNs revealed more than 50-fold higher in vitro gene silencing at well-tolerated doses and approx. a twofold increase in siRNA loading as compared to reference LPNs modified with the commonly used cationic lipid dioleyltrimethylammonium propane (DOTAP). Thus, lipidoid-modified LPNs show highly

  8. Context dependent regulatory patterns of the androgen receptor and androgen receptor target genes

    International Nuclear Information System (INIS)

    Olsen, Jan Roger; Azeem, Waqas; Hellem, Margrete Reime; Marvyin, Kristo; Hua, Yaping; Qu, Yi; Li, Lisha; Lin, Biaoyang; Ke, XI- Song; Øyan, Anne Margrete; Kalland, Karl- Henning

    2016-01-01

    Expression of the androgen receptor (AR) is associated with androgen-dependent proliferation arrest and terminal differentiation of normal prostate epithelial cells. Additionally, activation of the AR is required for survival of benign luminal epithelial cells and primary cancer cells, thus androgen deprivation therapy (ADT) leads to apoptosis in both benign and cancerous tissue. Escape from ADT is known as castration-resistant prostate cancer (CRPC). In the course of CRPC development the AR typically switches from being a cell-intrinsic inhibitor of normal prostate epithelial cell proliferation to becoming an oncogene that is critical for prostate cancer cell proliferation. A clearer understanding of the context dependent activation of the AR and its target genes is therefore desirable. Immortalized human prostate basal epithelial EP156T cells and progeny cells that underwent epithelial to mesenchymal transition (EMT), primary prostate epithelial cells (PrECs) and prostate cancer cell lines LNCaP, VCaP and 22Rv1 were used to examine context dependent restriction and activation of the AR and classical target genes, such as KLK3. Genome-wide gene expression analyses and single cell protein analyses were applied to study the effect of different contexts. A variety of growth conditions were tested and found unable to activate AR expression and transcription of classical androgen-dependent AR target genes, such as KLK3, in prostate epithelial cells with basal cell features or in mesenchymal type prostate cells. The restriction of androgen- and AR-dependent transcription of classical target genes in prostate basal epithelial cells was at the level of AR expression. Exogenous AR expression was sufficient for androgen-dependent transcription of AR target genes in prostate basal epithelial cells, but did not exert a positive feedback on endogenous AR expression. Treatment of basal prostate epithelial cells with inhibitors of epigenetic gene silencing was not efficient in

  9. Transient GFP expression in Nicotiana plumbaginifolia suspension cells: the role of gene silencing, cell death and T-DNA loss.

    Science.gov (United States)

    Weld, R; Heinemann, J; Eady, C

    2001-03-01

    The transient nature of T-DNA expression was studied with a gfp reporter gene transferred to Nicotiana plumbaginifolia suspension cells from Agrobacterium tumefaciens. Individual GFP-expressing protoplasts were isolated after 4 days' co-cultivation. The protoplasts were cultured without selection and 4 weeks later the surviving proto-calluses were again screened for GFP expression. Of the proto-calluses initially expressing GFP, 50% had lost detectable GFP activity during the first 4 weeks of culture. Multiple T-DNA copies of the gfp gene were detected in 10 of 17 proto-calluses lacking visible GFP activity. The remaining 7 cell lines contained no gfp sequences. Our results confirm that transiently expressed T-DNAs can be lost during growth of somatic cells and demonstrate that transiently expressing cells frequently integrate multiple T-DNAs that become silenced. In cells competent for DNA uptake, cell death and gene silencing were more important barriers to the recovery of stably expressing transformants than lack of T-DNA integration.

  10. Silencing a sugar transporter gene reduces growth and fecundity in the brown planthopper, Nilaparvata lugens (Stål) (Hemiptera: Delphacidae).

    Science.gov (United States)

    Ge, Lin-Quan; Jiang, Yi-Ping; Xia, Ting; Song, Qi-Sheng; Stanley, David; Kuai, Peng; Lu, Xiu-Li; Yang, Guo-Qing; Wu, Jin-Cai

    2015-07-17

    The brown planthopper (BPH), Nilaparvata lugens, sugar transporter gene 6 (Nlst6) is a facilitative glucose/fructose transporter (often called a passive carrier) expressed in midgut that mediates sugar transport from the midgut lumen to hemolymph. The influence of down regulating expression of sugar transporter genes on insect growth, development, and fecundity is unknown. Nonetheless, it is reasonable to suspect that transporter-mediated uptake of dietary sugar is essential to the biology of phloem-feeding insects. Based on this reasoning, we posed the hypothesis that silencing, or reducing expression, of a BPH sugar transporter gene would be deleterious to the insects. To test our hypothesis, we examined the effects of Nlst6 knockdown on BPH biology. Reducing expression of Nlst6 led to profound effects on BPHs. It significantly prolonged the pre-oviposition period, shortened the oviposition period, decreased the number of eggs deposited and reduced body weight, compared to controls. Nlst6 knockdown also significantly decreased fat body and ovarian (particularly vitellogenin) protein content as well as vitellogenin gene expression. Experimental BPHs accumulated less fat body glucose compared to controls. We infer that Nlst6 acts in BPH growth and fecundity, and has potential as a novel target gene for control of phloem-feeding pest insects.

  11. Double silencing of relevant genes suggests the existence of the direct link between DNA replication/repair and central carbon metabolism in human fibroblasts.

    Science.gov (United States)

    Wieczorek, Aneta; Fornalewicz, Karolina; Mocarski, Łukasz; Łyżeń, Robert; Węgrzyn, Grzegorz

    2018-04-15

    Genetic evidence for a link between DNA replication and glycolysis has been demonstrated a decade ago in Bacillus subtilis, where temperature-sensitive mutations in genes coding for replication proteins could be suppressed by mutations in genes of glycolytic enzymes. Then, a strong influence of dysfunctions of particular enzymes from the central carbon metabolism (CCM) on DNA replication and repair in Escherichia coli was reported. Therefore, we asked if such a link occurs only in bacteria or it is a more general phenomenon. Here, we demonstrate that effects of silencing (provoked by siRNA) of expression of genes coding for proteins involved in DNA replication and repair (primase, DNA polymerase ι, ligase IV, and topoisomerase IIIβ) on these processes (less efficient entry into the S phase of the cell cycle and decreased level of DNA synthesis) could be suppressed by silencing of specific genes of enzymes from CMM. Silencing of other pairs of replication/repair and CMM genes resulted in enhancement of the negative effects of lower expression levels of replication/repair genes. We suggest that these results may be proposed as a genetic evidence for the link between DNA replication/repair and CMM in human cells, indicating that it is a common biological phenomenon, occurring from bacteria to humans. Copyright © 2018 Elsevier B.V. All rights reserved.

  12. RNA interference silences Microplitis demolitor bracovirus genes and implicates glc1.8 in disruption of adhesion in infected host cells

    International Nuclear Information System (INIS)

    Beck, Markus; Strand, Michael R.

    2003-01-01

    The family Polydnaviridae consists of ds-DNA viruses that are symbiotically associated with certain parasitoid wasps. PDVs are transmitted vertically but also are injected by wasps into hosts where they cause several physiological alterations including immunosuppression. The PDV genes responsible for mediating immunosuppression and other host alterations remain poorly characterized in large measure because viral mutants cannot be produced to study gene function. Here we report the use of RNA interference (RNAi) to specifically silence the glc1.8 and egf1.0 genes from Microplitis demolitor bracovirus (MdBV) in High Five cells derived from the lepidopteran Trichoplusia ni. Dose-response studies indicated that MdBV infects High Five cells and blocks the ability of these cells to adhere to culture plates. This response was very similar to what occurs in two classes of hemocytes, granular cells, and plasmatocytes, after infection by MdBV. Screening of monoclonal antibody (mAb) markers that distinguish different classes of lepidopteran hemocytes indicated that High Five cells cross-react with three mAbs that recognize granular cells from T. ni. Double-stranded RNA (dsRNA) complementary to glc1.8 specifically silenced glc1.8 expression and rescued the adhesive phenotype of High Five cells. Reciprocally, dsRNA complementary to egf1.0 silenced egf1.0 expression but had no effect on adhesion. The simplicity and potency of RNAi could be extremely useful for analysis of other PDV genes

  13. Development of marker-free transgenic Jatropha curcas producing curcin-deficient seeds through endosperm-specific RNAi-mediated gene silencing.

    Science.gov (United States)

    Gu, Keyu; Tian, Dongsheng; Mao, Huizhu; Wu, Lifang; Yin, Zhongchao

    2015-10-08

    Jatropha curcas L. is a potential biofuel plant and its seed oil is suitable for biodiesel production. Despite this promising application, jatropha seeds contain two major toxic components, namely phorbol esters and curcins. These compounds would reduce commercial value of seed cake and raise safety and environment concerns on jatropha plantation and processing. Curcins are Type I ribosome inactivating proteins. Several curcin genes have been identified in the jatropha genome. Among which, the Curcin 1 (C1) gene is identified to be specifically expressed in endosperm, whereas the Curcin 2A (C2A) is mainly expressed in young leaves. A marker-free RNAi construct carrying a β-estradiol-regulated Cre/loxP system and a C1 promoter-driven RNAi cassette for C1 gene was made and used to generate marker-free transgenic RNAi plants to specifically silence the C1 gene in the endosperm of J. curcas. Plants of transgenic line L1, derived from T0-1, carry two copies of marker-free RNAi cassette, whereas plants of L35, derived from T0-35, harbored one copy of marker-free RNAi cassette and three copies of closely linked and yet truncated Hpt genes. The C1 protein content in endosperm of L1 and L35 seeds was greatly reduced or undetectable, while the C2A proteins in young leaves of T0-1 and T0-35 plants were unaffected. In addition, the C1 mRNA transcripts were undetectable in the endosperm of T3 seeds of L1 and L35. The results demonstrated that the expression of the C1 gene was specifically down-regulated or silenced by the double-stranded RNA-mediated RNA interference generated from the RNAi cassette. The C1 promoter-driven RNAi cassette for the C1 gene in transgenic plants was functional and heritable. Both C1 transcripts and C1 proteins were greatly down-regulated or silenced in the endosperm of transgenic J. curcas. The marker-free transgenic plants and curcin-deficient seeds developed in this study provided a solution for the toxicity of curcins in jatropha seeds and

  14. Suicide genes or p53 gene and p53 target genes as targets for cancer gene therapy by ionizing radiation

    International Nuclear Information System (INIS)

    Liu Bing; Chinese Academy of Sciences, Beijing; Zhang Hong

    2005-01-01

    Radiotherapy has some disadvantages due to the severe side-effect on the normal tissues at a curative dose of ionizing radiation (IR). Similarly, as a new developing approach, gene therapy also has some disadvantages, such as lack of specificity for tumors, limited expression of therapeutic gene, potential biological risk. To certain extent, above problems would be solved by the suicide genes or p53 gene and its target genes therapies targeted by ionizing radiation. This strategy not only makes up the disadvantage from radiotherapy or gene therapy alone, but also promotes success rate on the base of lower dose. By present, there have been several vectors measuring up to be reaching clinical trials. This review focused on the development of the cancer gene therapy through suicide genes or p53 and its target genes mediated by IR. (authors)

  15. HC-Pro silencing suppressor significantly alters the gene expression profile in tobacco leaves and flowers

    Directory of Open Access Journals (Sweden)

    Lehto Kirsi

    2011-04-01

    Full Text Available Abstract Background RNA silencing is used in plants as a major defence mechanism against invasive nucleic acids, such as viruses. Accordingly, plant viruses have evolved to produce counter defensive RNA-silencing suppressors (RSSs. These factors interfere in various ways with the RNA silencing machinery in cells, and thereby disturb the microRNA (miRNA mediated endogene regulation and induce developmental and morphological changes in plants. In this study we have explored these effects using previously characterized transgenic tobacco plants which constitutively express (under CaMV 35S promoter the helper component-proteinase (HC-Pro derived from a potyviral genome. The transcript levels of leaves and flowers of these plants were analysed using microarray techniques (Tobacco 4 × 44 k, Agilent. Results Over expression of HC-Pro RSS induced clear phenotypic changes both in growth rate and in leaf and flower morphology of the tobacco plants. The expression of 748 and 332 genes was significantly changed in the leaves and flowers, respectively, in the HC-Pro expressing transgenic plants. Interestingly, these transcriptome alterations in the HC-Pro expressing tobacco plants were similar as those previously detected in plants infected with ssRNA-viruses. Particularly, many defense-related and hormone-responsive genes (e.g. ethylene responsive transcription factor 1, ERF1 were differentially regulated in these plants. Also the expression of several stress-related genes, and genes related to cell wall modifications, protein processing, transcriptional regulation and photosynthesis were strongly altered. Moreover, genes regulating circadian cycle and flowering time were significantly altered, which may have induced a late flowering phenotype in HC-Pro expressing plants. The results also suggest that photosynthetic oxygen evolution, sugar metabolism and energy levels were significantly changed in these transgenic plants. Transcript levels of S

  16. Disruption of plant carotenoid biosynthesis through virus-induced gene silencing affects oviposition behaviour of the butterfly Pieris rapae

    NARCIS (Netherlands)

    Zheng, S.J.; Snoeren, T.A.L.; Hogewoning, S.W.; Loon, van J.J.A.; Dicke, M.

    2010-01-01

    Optical plant characteristics are important cues to plant-feeding insects. In this article, we demonstrate for the first time that silencing the phytoene desaturase (PDS) gene, encoding a key enzyme in plant carotenoid biosynthesis, affects insect oviposition site selection behaviour. Virus-induced

  17. Down-regulation of osmotin (PR5) gene by virus-induced gene silencing (VIGS) leads to susceptibility of resistant Piper colubrinum Link. to the oomycete pathogen Phytophthora capsici Leonian.

    Science.gov (United States)

    Anu, K; Jessymol, K K; Chidambareswaren, M; Gayathri, G S; Manjula, S

    2015-06-01

    Piper colubrinum Link., a distant relative of Piper nigrum L., is immune to the oomycete pathogen Phytophthora capsici Leonian that causes 'quick wilt' in cultivated black pepper (P. nigrum). The osmotin, PR5 gene homologue, earlier identified from P. colubrinum, showed significant overexpression in response to pathogen and defense signalling molecules. The present study focuses on the functional validation of P. colubrinum osmotin (PcOSM) by virus induced gene silencing (VIGS) using Tobacco Rattle Virus (TRV)-based vector. P. colubrinum plants maintained under controlled growth conditions in a growth chamber were infiltrated with Agrobacterium carrying TRV empty vector (control) and TRV vector carrying PcOSM. Three weeks post infiltration, viral movement was confirmed in newly emerged leaves of infiltrated plants by RT-PCR using TRV RNA1 and TRV RNA2 primers. Semi-quantitative RT-PCR confirmed significant down-regulation of PcOSM gene in TRV-PcOSM infiltrated plant compared with the control plants. The control and silenced plants were challenged with Phytophthora capsici which demonstrated that knock-down of PcOSM in P. colubrinum leads to increased fungal mycelial growth in silenced plants compared to control plants, which was accompanied by decreased accumulation of H2O2 as indicated by 3,3'-diaminobenzidine (DAB) staining. Thus, in this study, we demonstrated that Piper colubrinum osmotin gene is required for resisting P. capsici infection and has possible role in hypersensitive cell death response and oxidative burst signaling during infection.

  18. A viral suppressor of RNA silencing inhibits ARGONAUTE 1 function by precluding target RNA binding to pre-assembled RISC.

    Science.gov (United States)

    Kenesi, Erzsébet; Carbonell, Alberto; Lózsa, Rita; Vértessy, Beáta; Lakatos, Lóránt

    2017-07-27

    In most eukaryotes, RNA silencing is an adaptive immune system regulating key biological processes including antiviral defense. To evade this response, viruses of plants, worms and insects have evolved viral suppressors of RNA silencing proteins (VSRs). Various VSRs, such as P1 from Sweet potato mild mottle virus (SPMMV), inhibit the activity of RNA-induced silencing complexes (RISCs) including an ARGONAUTE (AGO) protein loaded with a small RNA. However, the specific mechanisms explaining this class of inhibition are unknown. Here, we show that SPMMV P1 interacts with AGO1 and AGO2 from Arabidopsis thaliana, but solely interferes with AGO1 function. Moreover, a mutational analysis of a newly identified zinc finger domain in P1 revealed that this domain could represent an effector domain as it is required for P1 suppressor activity but not for AGO1 binding. Finally, a comparative analysis of the target RNA binding capacity of AGO1 in the presence of wild-type or suppressor-defective P1 forms revealed that P1 blocks target RNA binding to AGO1. Our results describe the negative regulation of RISC, the small RNA containing molecular machine. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. RNAi Mediated curcin precursor gene silencing in Jatropha (Jatropha curcas L.).

    Science.gov (United States)

    Patade, Vikas Yadav; Khatri, Deepti; Kumar, Kamal; Grover, Atul; Kumari, Maya; Gupta, Sanjay Mohan; Kumar, Devender; Nasim, Mohammed

    2014-07-01

    Curcin, a type I ribosomal inhibiting protein-RIP, encoded by curcin precursor gene, is a phytotoxin present in Jatropha (Jatropha curcas L.). Here, we report designing of RNAi construct for the curcin precursor gene and further its genetic transformation of Jatropha to reduce its transcript expression. Curcin precursor gene was first cloned from Jatropha strain DARL-2 and part of the gene sequence was cloned in sense and antisense orientation separated by an intron sequence in plant expression binary vector pRI101 AN. The construction of the RNAi vector was confirmed by double digestion and nucleotide sequencing. The vector was then mobilized into Agrobacterium tumefaciens strain GV 3101 and used for tissue culture independent in planta transformation protocol optimized for Jatropha. Germinating seeds were injured with a needle before infection with Agrobacterium and then transferred to sterilized sand medium. The seedlings were grown for 90 days and genomic DNA was isolated from leaves for transgenic confirmation based on real time PCR with NPT II specific dual labeled probe. Result of the transgenic confirmation analysis revealed presence of the gene silencing construct in ten out of 30 tested seedlings. Further, quantitative transcript expression analysis of the curcin precursor gene revealed reduction in the transcript abundance by more than 98% to undetectable level. The transgenic plants are being grown in containment for further studies on reduction in curcin protein content in Jatropha seeds.

  20. MLH1-Silenced and Non-Silenced Subgroups of Hypermutated Colorectal Carcinomas Have Distinct Mutational Landscapes

    Science.gov (United States)

    Donehower, Lawrence A.; Creighton, Chad J.; Schultz, Nikolaus; Shinbrot, Eve; Chang, Kyle; Gunaratne, Preethi H.; Muzny, Donna; Sander, Chris; Hamilton, Stanley R.; Gibbs, Richard A.; Wheeler, David

    2014-01-01

    Approximately 15% of colorectal carcinomas (CRC) exhibit a hypermutated genotype accompanied by high levels of microsatellite instability (MSI-H) and defects in DNA mismatch repair. These tumors, unlike the majority of colorectal carcinomas, are often diploid, exhibit frequent epigenetic silencing of the MLH1 DNA mismatch repair gene, and have a better clinical prognosis. As an adjunct study to The Cancer Genome Atlas consortium that recently analyzed 224 colorectal cancers by whole exome sequencing, we compared the 35 CRC (15.6%) with a hypermutated genotype to those with a non-hypermutated genotype. We found that 22 (63%) of hypermutated CRC exhibited transcriptional silencing of the MLH1 gene, a high frequency of BRAF V600E gene mutations and infrequent APC and KRAS mutations, a mutational pattern significantly different from their non-hypermutated counterparts. However, the remaining 13 (37%) hypermutated CRC lacked MLH1 silencing, contained tumors with the highest mutation rates (“ultramutated” CRC), and exhibited higher incidences of APC and KRAS mutations, but infrequent BRAF mutations. These patterns were confirmed in an independent validation set of 250 exome-sequenced CRC. Analysis of mRNA and microRNA expression signatures revealed that hypermutated CRC with MLH1 silencing had greatly reduced levels of WNT signaling and increased BRAF signaling relative non-hypermutated CRC. Our findings suggest that hypermutated CRC include one subgroup with fundamentally different pathways to malignancy than the majority of CRC. Examination of MLH1 expression status and frequencies of APC, KRAS, and BRAF mutation in CRC may provide a useful diagnostic tool that could supplement the standard microsatellite instability assays and influence therapeutic decisions. PMID:22899370

  1. Conifers have a unique small RNA silencing signature

    OpenAIRE

    Dolgosheina, Elena V.; Morin, Ryan D.; Aksay, Gozde; Sahinalp, S. Cenk; Magrini, Vincent; Mardis, Elaine R.; Mattsson, Jim; Unrau, Peter J.

    2008-01-01

    Plants produce small RNAs to negatively regulate genes, viral nucleic acids, and repetitive elements at either the transcriptional or post-transcriptional level in a process that is referred to as RNA silencing. While RNA silencing has been extensively studied across the different phyla of the animal kingdom (e.g., mouse, fly, worm), similar studies in the plant kingdom have focused primarily on angiosperms, thus limiting evolutionary studies of RNA silencing in plants. Here we report on an u...

  2. Lipocalin 2, a new GADD153 target gene, as an apoptosis inducer of endoplasmic reticulum stress in lung cancer cells

    International Nuclear Information System (INIS)

    Hsin, I-Lun; Hsiao, Yueh-Chieh; Wu, Ming-Fang; Jan, Ming-Shiou; Tang, Sheau-Chung; Lin, Yu-Wen; Hsu, Chung-Ping; Ko, Jiunn-Liang

    2012-01-01

    Endoplasmic reticulum (ER) stress is activated under severe cellular conditions. GADD153, a member of the C/EBP family, is an unfolded protein response (UPR) responsive transcription factor. Increased levels of lipocalin 2, an acute phase protein, have been found in several epithelial cancers. The aim of this study is to investigate the function of lipocalin 2 in lung cancer cells under ER stress. Treatment with thapsigargin, an ER stress activator, led to increases in cytotoxicity, ER stress, apoptosis, and lipocalin 2 expression in A549 cells. GADD153 silencing decreased lipocalin 2 expression in A549 cells. On chromatin immunoprecipitation assay, ER stress increased GADD153 DNA binding to lipocalin 2 promoter. Furthermore, silencing of lipocalin 2 mitigated ER stress-mediated apoptosis in A549 cells. Our findings demonstrated that lipocalin 2 is a new GADD153 target gene that mediates ER stress-induced apoptosis. Highlights: ► We demonstrate that Lipocalin 2 is a new GADD153 target gene. ► Lipocalin 2 mediates ER stress-induced apoptosis. ► ER stress-induced lipocalin 2 expression is calcium-independent in A549 cells. ► Lipocalin 2 dose not play a major role in ER stress-induced autophagy.

  3. Gene silencing of mannose 6-phosphate reductase in the parasitic weed Orobanche aegyptiaca through the production of homologous dsRNA sequences in the host plant.

    Science.gov (United States)

    Aly, Radi; Cholakh, Hila; Joel, Daniel M; Leibman, Diana; Steinitz, Benjamin; Zelcer, Aaron; Naglis, Anna; Yarden, Oded; Gal-On, Amit

    2009-08-01

    Orobanche spp. (broomrape) are parasitic plants which subsist on the roots of a wide range of hosts, including tomato, causing severe losses in yield quality and quantity. Large amounts of mannitol accumulate in this parasitic weed during development. Mannose 6-phosphate reductase (M6PR) is a key enzyme in mannitol biosynthesis, and it has been suggested that mannitol accumulation may be very important for Orobanche development. Therefore, the Orobanche M6PR gene is a potential target for efforts to control this parasite. Transgenic tomato plants were produced bearing a gene construct containing a specific 277-bp fragment from Orobanche aegyptiaca M6PR-mRNA, in an inverted-repeat configuration. M6PR-siRNA was detected in three independent transgenic tomato lines in the R1 generation, but was not detected in the parasite. Quantitative RT-PCR analysis showed that the amount of endogenous M6PR mRNA in the tubercles and underground shoots of O. aegyptiaca grown on transgenic host plants was reduced by 60%-80%. Concomitant with M6PR mRNA suppression, there was a significant decrease in mannitol level and a significant increase in the percentage of dead O. aegyptiaca tubercles on the transgenic host plants. The detection of mir390, which is involved with cytoplasmic dsRNA processing, is the first indication of the existence of gene-silencing mechanisms in Orobanche spp. Gene silencing mechanisms are probably involved with the production of decreased levels of M6PR mRNA in the parasites grown on the transformed tomato lines.

  4. Concurrent growth rate and transcript analyses reveal essential gene stringency in Escherichia coli.

    Directory of Open Access Journals (Sweden)

    Shan Goh

    Full Text Available BACKGROUND: Genes essential for bacterial growth are of particular scientific interest. Many putative essential genes have been identified or predicted in several species, however, little is known about gene expression requirement stringency, which may be an important aspect of bacterial physiology and likely a determining factor in drug target development. METHODOLOGY/PRINCIPAL FINDINGS: Working from the premise that essential genes differ in absolute requirement for growth, we describe silencing of putative essential genes in E. coli to obtain a titration of declining growth rates and transcript levels by using antisense peptide nucleic acids (PNA and expressed antisense RNA. The relationship between mRNA decline and growth rate decline reflects the degree of essentiality, or stringency, of an essential gene, which is here defined by the minimum transcript level for a 50% reduction in growth rate (MTL(50. When applied to four growth essential genes, both RNA silencing methods resulted in MTL(50 values that reveal acpP as the most stringently required of the four genes examined, with ftsZ the next most stringently required. The established antibacterial targets murA and fabI were less stringently required. CONCLUSIONS: RNA silencing can reveal stringent requirements for gene expression with respect to growth. This method may be used to validate existing essential genes and to quantify drug target requirement.

  5. Deletion of an X-inactivation boundary disrupts adjacent gene silencing.

    Directory of Open Access Journals (Sweden)

    Lindsay M Horvath

    2013-11-01

    Full Text Available In mammalian females, genes on one X are largely silenced by X-chromosome inactivation (XCI, although some "escape" XCI and are expressed from both Xs. Escapees can closely juxtapose X-inactivated genes and provide a tractable model for assessing boundary function at epigenetically regulated loci. To delimit sequences at an XCI boundary, we examined female mouse embryonic stem cells carrying X-linked BAC transgenes derived from an endogenous escape locus. Previously we determined that large BACs carrying escapee Kdm5c and flanking X-inactivated transcripts are properly regulated. Here we identify two lines with truncated BACs that partially and completely delete the distal Kdm5c XCI boundary. This boundary is not required for escape, since despite integrating into regions that are normally X inactivated, transgenic Kdm5c escapes XCI, as determined by RNA FISH and by structurally adopting an active conformation that facilitates long-range preferential association with other escapees. Yet, XCI regulation is disrupted in the transgene fully lacking the distal boundary; integration site genes up to 350 kb downstream of the transgene now inappropriately escape XCI. Altogether, these results reveal two genetically separable XCI regulatory activities at Kdm5c. XCI escape is driven by a dominant element(s retained in the shortest transgene that therefore lies within or upstream of the Kdm5c locus. Additionally, the distal XCI boundary normally plays an essential role in preventing nearby genes from escaping XCI.

  6. H-ferritin-regulated microRNAs modulate gene expression in K562 cells.

    Directory of Open Access Journals (Sweden)

    Flavia Biamonte

    Full Text Available In a previous study, we showed that the silencing of the heavy subunit (FHC offerritin, the central iron storage molecule in the cell, is accompanied by a modification in global gene expression. In this work, we explored whether different FHC amounts might modulate miRNA expression levels in K562 cells and studied the impact of miRNAs in gene expression profile modifications. To this aim, we performed a miRNA-mRNA integrative analysis in K562 silenced for FHC (K562shFHC comparing it with K562 transduced with scrambled RNA (K562shRNA. Four miRNAs, namely hsa-let-7g, hsa-let-7f, hsa-let-7i and hsa-miR-125b, were significantly up-regulated in silenced cells. The remarkable down-regulation of these miRNAs, following FHC expression rescue, supports a specific relation between FHC silencing and miRNA-modulation. The integration of target predictions with miRNA and gene expression profiles led to the identification of a regulatory network which includes the miRNAs up-regulated by FHC silencing, as well as91 down-regulated putative target genes. These genes were further classified in 9 networks; the highest scoring network, "Cell Death and Survival, Hematological System Development and Function, Hematopoiesis", is composed by 18 focus molecules including RAF1 and ERK1/2. We confirmed that, following FHC silencing, ERK1/2 phosphorylation is severely impaired and that RAF1 mRNA is significantly down-regulated. Taken all together, our data indicate that, in our experimental model, FHC silencing may affect RAF1/pERK1/2 levels through the modulation of a specific set of miRNAs and add new insights in to the relationship among iron homeostasis and miRNAs.

  7. Self-focusing therapeutic gene delivery with intelligent gene vector swarms: intra-swarm signalling through receptor transgene expression in targeted cells.

    Science.gov (United States)

    Tolmachov, Oleg E

    2015-01-01

    are then attracted to and internalized into the intended target cells via the expressed cognate strongly binding extra-cellular receptor, causing escalation of gene transfer into these cells and increasing the copy number of the therapeutic gene expression modules. Such self-focusing swarms of gene vectors can be either homogeneous, with 'scout' and 'therapeutic' members of the swarm being structurally identical, or, alternatively, heterogeneous (split), with 'scout' and 'therapeutic' members of the swarm being structurally specialized. It is hoped that the proposed self-focusing cell-targeted gene vector swarms with receptor-mediated intra-swarm signalling could be particularly effective in 'top-up' gene delivery scenarios, achieving high-level and sustained expression of therapeutic transgenes that are prone to shut-down through degradation and silencing. Crucially, in contrast to low-precision 'general location' vector guidance by diffusible chemo-attractants, ear-marking non-diffusible receptors can provide high-accuracy targeting of therapeutic vector particles to the specific cell, which has undergone a 'successful cell-specific hit' by a 'scout' vector particle. Opportunities for cell targeting could be expanded, since in the proposed model of self-focusing it could be possible to probe a broad selection of intra-cellular determinants of cell-specificity and not just to rely exclusively on extra-cellular markers of cell-specificity. By employing such self-focusing gene vectors for the improvement of cell-targeted delivery of therapeutic genes, e.g., in cancer therapy or gene addition therapy of recessive genetic diseases, it could be possible to broaden a leeway for the reduction of the vector load and, consequently, to minimize undesired vector cytotoxicity, immune reactions, and the risk of inadvertent genetic modification of germline cells in genetic treatment in vivo. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. Allele-specific Gene Silencing of Mutant mRNA Restores Cellular Function in Ullrich Congenital Muscular Dystrophy Fibroblasts

    Directory of Open Access Journals (Sweden)

    Satoru Noguchi

    2014-01-01

    Full Text Available Ullrich congenital muscular dystrophy (UCMD is an inherited muscle disorder characterized clinically by muscle weakness, distal joint hyperlaxity, and proximal joint contractures. Sporadic and recessive mutations in the three collagen VI genes, COL6A1, COL6A2, and COL6A3, are reported to be causative. In the sporadic forms, a heterozygous point mutation causing glycine substitution in the triple helical domain has been identified in higher rate. In this study, we examined the efficacy of siRNAs, which target point mutation site, on specific knockdown toward transcripts from mutant allele and evaluated consequent cellular phenotype of UCMD fibroblasts. We evaluated the effect of siRNAs targeted to silence-specific COL6A1 alleles in UCMD fibroblasts, where simultaneous expression of both wild-type and mutant collagen VI resulted in defective collagen localization. Addition of mutant-specific siRNAs allowed normal extracellular localization of collagen VI surrounding fibroblasts, suggesting selective inhibition of mutant collagen VI. Targeting the single-nucleotide COL6A1 c.850G>A (p.G284R mutation responsible a sporadic autosomal dominant form of UCMD can potently and selectively block expression of mutant collagen VI. These results suggest that allele-specific knockdown of the mutant mRNA can potentially be considered as a therapeutic procedure in UCMD due to COL6A1 point mutations.

  9. Epigenetic silencing of the DNA mismatch repair gene, MLH1, induced by hypoxic stress in a pathway dependent on the histone demethylase, LSD1

    Science.gov (United States)

    Lu, Yuhong; Wajapeyee, Narendra; Turker, Mitchell S.; Glazer, Peter M.

    2014-01-01

    SUMMARY Silencing of the MLH1 gene is frequently seen in sporadic cancers. We report that hypoxia causes decreased H3K4 methylation at the MLH1 promoter via the H3K4 demethylases, LSD1 and PLU-1, and promotes long-term silencing of the promoter in a pathway that requires LSD1. Knockdown of LSD1 or its co-repressor, CoREST, also prevents the re-silencing (and cytosine DNA methylation) of the endogenous MLH1 promoter in RKO colon cancer cells following transient reactivation by the DNA methyltransferase inhibitor 5-aza-2′-deoxycytidine (5-aza-dC). The results demonstrate that hypoxia is a critical driving force for silencing of MLH1 through chromatin modification and indicate that the LSD1/CoREST complex is essential for MLH1 silencing. PMID:25043185

  10. Gene silencing of indoleamine 2,3-dioxygenase 2 in melanoma cells induces apoptosis through the suppression of NAD+ and inhibits in vivo tumor growth.

    Science.gov (United States)

    Liu, Yanling; Zhang, Yujuan; Zheng, Xiufen; Zhang, Xusheng; Wang, Hongmei; Li, Qin; Yuan, Keng; Zhou, Nanjing; Yu, Yanrong; Song, Na; Fu, Jiamin; Min, Weiping

    2016-05-31

    Indoleamine 2,3-dioxygenase 2 (IDO2) is a newly discovered enzyme that catalyzes the initial and rate-limiting step in the degradation of tryptophan. As a homologous protein of IDO1, IDO2 plays an inhibitory role in T cell proliferation, and it is essential for regulatory T cell (Treg) generation in healthy conditions. Little is known about the immune-independent functions of IDO2 relevant to its specific contributions to physiology and pathophysiology in cancer cells. The purpose of this study was to assess the impact of IDO2 gene silencing as a way to inhibit B16-BL6 cancer cells in a murine model. Here, for the first time, we show that knockdown of IDO2 using small interfering RNA (siRNA) inhibits cancer cell proliferation, arrests cell cycle in G1, induces greater cell apoptosis, and reduces cell migration in vitro. Knockdown of IDO2 decreased the generation of nicotinamide adenine dinucleotide (NAD+) while increasing the generation of reactive oxygen species (ROS). We further demonstrate that cell apoptosis, induced by IDO2 downregulation, can be weakened by addition of exogenous NAD+, suggesting a novel mechanism by which IDO2 promotes tumor growth through its metabolite product NAD+. In addition to in vitro findings, we also demonstrate that IDO2 silencing in tumor cells using short hairpin RNA (shRNA) delayed tumor formation and arrested tumor growth in vivo. In conclusion, this study demonstrates a new non-immune-associated mechanism of IDO2 in vitro and IDO2 expression in B16-BL6 cells contributes to cancer development and progression. Our research provides evidence of a novel target for gene silencing that has the potential to enhance cancer therapy.

  11. RNA interference: ready to silence cancer?

    Science.gov (United States)

    Mocellin, Simone; Costa, Rodolfo; Nitti, Donato

    2006-01-01

    RNA interference (RNAi) is considered the most promising functional genomics tool recently developed. As in other medical fields, this biotechnology might revolutionize the approach to dissecting the biology of cancer, ultimately speeding up the discovery pace of novel targets suitable for molecularly tailored antitumor therapies. In addition, preclinical results suggest that RNAi itself might be used as a therapeutic weapon. With the aim of illustrating not only the potentials but also the current limitations of RNAi as a tool in the fight against cancer, here we summarize the physiology of RNAi, discuss the main technical issues of RNAi-based gene silencing, and review some of the most interesting preclinical results obtained so far with its implementation in the field of oncology.

  12. Inhibition of Androgen-Independent Growth of Prostate Cancer by siRNA- Mediated Androgen Receptor Gene Silencing

    Science.gov (United States)

    2008-02-01

    and then photographed using a digital camera . AAV production and infection. To silence AR gene expression, a hairpin- structured expression vector...Sandusky GE, Vessella RL, Neubauer BL. Increased AKT activity contributes to prostate cancer progression by dramatically accelerating prostate tumor...HeNe laser. The spectrograph has an f/2.0 Czerny–Turner imaging spec- trometer plus a thermo-electrically cooled Kodak 0401 CCD camera . The fiberoptic

  13. Synthesis and Gene Silencing Properties of siRNAs Containing Terminal Amide Linkages

    Directory of Open Access Journals (Sweden)

    Maria Gaglione

    2014-01-01

    Full Text Available The active components of the RNAi are 21 nucleotides long dsRNAs containing a 2 nucleotide overhang at the 3′ end, carrying 5′-phosphate and 3′-hydroxyl groups (siRNAs. Structural analysis revealed that the siRNA is functionally bound at both ends to RISC. Terminal modifications are considered with interest as the introduction of chemical moieties interferes with the 3′ overhang recognition by the PAZ domain and the 5′-phosphate recognition by the MID and PIWI domains of RISC. Herein, we report the synthesis of modified siRNAs containing terminal amide linkages by introducing hydroxyethylglycine PNA (hegPNA moieties at 5′, and at 3′ positions and on both terminals. Results of gene silencing studies highlight that some of these modifications are compatible with the RNAi machinery and markedly increase the resistance to serum-derived nucleases even after 24 h of incubation. Molecular docking simulations were attained to give at atomistic level a clearer picture of the effect of the most performing modifications on the interactions with the human Argonaute 2 PAZ, MID, and PIWI domains. This study adds another piece to the puzzle of the heterogeneous chemical modifications that can be attained to enhance the silencing efficiency of siRNAs.

  14. RNA-Interference Components Are Dispensable for Transcriptional Silencing of the Drosophila Bithorax-Complex

    KAUST Repository

    Cernilogar, Filippo M.; Burroughs, A. Maxwell; Lanzuolo, Chiara; Breiling, Achim; Imhof, Axel; Orlando, Valerio

    2013-01-01

    .Conclusions:We conclude that the Dicer-2/Argonaute-2 RNAi pathway, despite its role in pairing sensitive gene silencing of transgenes, does not have a role in PcG dependent silencing of major homeotic gene cluster loci in Drosophila. © 2013 Cernilogar et al.

  15. A two-cassette reporter system for assessing target gene translation and target gene product inclusion body formation

    DEFF Research Database (Denmark)

    2016-01-01

    The present invention relates to a dual cassette reporter system capable of assessing target gene translation and target gene product folding. The present invention further relates to vectors and host cells comprising the dual cassette reporter system. In addition the invention relates to the use...... of the dual cassette reporter system for assessing target gene translation and target gene product folding....

  16. Knockdown of Rice microRNA166 by Short Tandem Target Mimic (STTM).

    Science.gov (United States)

    Teotia, Sachin; Zhang, Dabing; Tang, Guiliang

    2017-01-01

    Small RNAs, including microRNAs (miRNAs), are abundant in plants and play key roles in controlling plant development and physiology. miRNAs regulate the expression of the target genes involved in key plant processes. Due to functional redundancy among miRNA family members in plants, an ideal approach to silence the expression of all members simultaneously, for their functional characterization, is desirable. Target mimic (TM) was the first approach to achieve this goal. Short tandem target mimic (STTM) is a potent approach complementing TM for silencing miRNAs in plants. STTMs have been successfully used in dicots to block miRNA functions. Here, we describe in detail the protocol for designing STTM construct to block miRNA functions in rice. Such approach can be applied to silence miRNAs in other monocots as well.

  17. Gene Silencing in Skin After Deposition of Self-Delivery siRNA With a Motorized Microneedle Array Device

    Directory of Open Access Journals (Sweden)

    Robyn P Hickerson

    2013-01-01

    Full Text Available Despite the development of potent siRNAs that effectively target genes responsible for skin disorders, translation to the clinic has been hampered by inefficient delivery through the stratum corneum barrier and into the live cells of the epidermis. Although hypodermic needles can be used to transport siRNA through the stratum corneum, this approach is limited by pain caused by the injection and the small volume of tissue that can be accessed by each injection. The use of microneedle arrays is a less painful method for siRNA delivery, but restricted payload capacity limits this approach to highly potent molecules. To address these challenges, a commercially available motorized microneedle array skin delivery device was evaluated. This device combines the positive elements of both hypodermic needles and microneedle array technologies with little or no pain to the patient. Application of fluorescently tagged self-delivery (sd-siRNA to both human and murine skin resulted in distribution throughout the treated skin. In addition, efficient silencing (78% average reduction of reporter gene expression was achieved in a transgenic fluorescent reporter mouse skin model. These results indicate that this device effectively delivers functional sd-siRNA with an efficiency that predicts successful clinical translation.

  18. Manipulation of saponin biosynthesis by RNA interference-mediated silencing of β-amyrin synthase gene expression in soybean.

    Science.gov (United States)

    Takagi, Kyoko; Nishizawa, Keito; Hirose, Aya; Kita, Akiko; Ishimoto, Masao

    2011-10-01

    Soybean seeds contain substantial amount of diverse triterpenoid saponins that influence the seed quality, although little is known about the physiologic functions of saponins in plants. We now describe the modification of saponin biosynthesis by RNA interference (RNAi)-mediated gene silencing targeted to β-amyrin synthase, a key enzyme in the synthesis of a common aglycon of soybean saponins. We identified two putative β-amyrin synthase genes in soybean that manifested distinct expression patterns with regard to developmental stage and tissue specificity. Given that one of these genes, GmBAS1, was expressed at a much higher level than the other (GmBAS2) in various tissues including the developing seeds, we constructed two RNAi vectors that encode self-complementary hairpin RNAs corresponding to the distinct regions of GmBAS1 under the control of a seed-specific promoter derived from the soybean gene for the α' subunit of the seed storage protein β-conglycinin. These vectors were introduced independently into soybean. Six independent transgenic lines exhibited a stable reduction in seed saponin content, with the extent of saponin deficiency correlating with the β-amyrin synthase mRNA depletion. Although some transgenic lines produced seeds almost devoid of saponins, no abnormality in their growth was apparent and the antioxidant activity of their seeds was similar to that of control seeds. These results suggest that saponins are not required for seed development and survival, and that soybean seeds may therefore be amenable to the modification of triterpenoid saponin content and composition through molecular biologic approaches.

  19. SAD-3, a Putative Helicase Required for Meiotic Silencing by Unpaired DNA, Interacts with Other Components of the Silencing Machinery

    Science.gov (United States)

    Hammond, Thomas M.; Xiao, Hua; Boone, Erin C.; Perdue, Tony D.; Pukkila, Patricia J.; Shiu, Patrick K. T.

    2011-01-01

    In Neurospora crassa, genes lacking a pairing partner during meiosis are suppressed by a process known as meiotic silencing by unpaired DNA (MSUD). To identify novel MSUD components, we have developed a high-throughput reverse-genetic screen for use with the N. crassa knockout library. Here we describe the screening method and the characterization of a gene (sad-3) subsequently discovered. SAD-3 is a putative helicase required for MSUD and sexual spore production. It exists in a complex with other known MSUD proteins in the perinuclear region, a center for meiotic silencing activity. Orthologs of SAD-3 include Schizosaccharomyces pombe Hrr1, a helicase required for RNAi-induced heterochromatin formation. Both SAD-3 and Hrr1 interact with an RNA-directed RNA polymerase and an Argonaute, suggesting that certain aspects of silencing complex formation may be conserved between the two fungal species. PMID:22384347

  20. Silencing of the violaxanthin de-epoxidase gene in the diatom Phaeodactylum tricornutum reduces diatoxanthin synthesis and non-photochemical quenching.

    Directory of Open Access Journals (Sweden)

    Johann Lavaud

    Full Text Available Diatoms are a major group of primary producers ubiquitous in all aquatic ecosystems. To protect themselves from photooxidative damage in a fluctuating light climate potentially punctuated with regular excess light exposures, diatoms have developed several photoprotective mechanisms. The xanthophyll cycle (XC dependent non-photochemical chlorophyll fluorescence quenching (NPQ is one of the most important photoprotective processes that rapidly regulate photosynthesis in diatoms. NPQ depends on the conversion of diadinoxanthin (DD into diatoxanthin (DT by the violaxanthin de-epoxidase (VDE, also called DD de-epoxidase (DDE. To study the role of DDE in controlling NPQ, we generated transformants of P. tricornutum in which the gene (Vde/Dde encoding for DDE was silenced. RNA interference was induced by genetic transformation of the cells with plasmids containing either short (198 bp or long (523 bp antisense (AS fragments or, alternatively, with a plasmid mediating the expression of a self-complementary hairpin-like construct (inverted repeat, IR. The silencing approaches generated diatom transformants with a phenotype clearly distinguishable from wildtype (WT cells, i.e. a lower degree as well as slower kinetics of both DD de-epoxidation and NPQ induction. Real-time PCR based quantification of Dde transcripts revealed differences in transcript levels between AS transformants and WT cells but also between AS and IR transformants, suggesting the possible presence of two different gene silencing mediating mechanisms. This was confirmed by the differential effect of the light intensity on the respective silencing efficiency of both types of transformants. The characterization of the transformants strengthened some of the specific features of the XC and NPQ and confirmed the most recent mechanistic model of the DT/NPQ relationship in diatoms.

  1. Silencing of the Violaxanthin De-Epoxidase Gene in the Diatom Phaeodactylum tricornutum Reduces Diatoxanthin Synthesis and Non-Photochemical Quenching

    Science.gov (United States)

    Vugrinec, Sascha; Kroth, Peter G.

    2012-01-01

    Diatoms are a major group of primary producers ubiquitous in all aquatic ecosystems. To protect themselves from photooxidative damage in a fluctuating light climate potentially punctuated with regular excess light exposures, diatoms have developed several photoprotective mechanisms. The xanthophyll cycle (XC) dependent non-photochemical chlorophyll fluorescence quenching (NPQ) is one of the most important photoprotective processes that rapidly regulate photosynthesis in diatoms. NPQ depends on the conversion of diadinoxanthin (DD) into diatoxanthin (DT) by the violaxanthin de-epoxidase (VDE), also called DD de-epoxidase (DDE). To study the role of DDE in controlling NPQ, we generated transformants of P. tricornutum in which the gene (Vde/Dde) encoding for DDE was silenced. RNA interference was induced by genetic transformation of the cells with plasmids containing either short (198 bp) or long (523 bp) antisense (AS) fragments or, alternatively, with a plasmid mediating the expression of a self-complementary hairpin-like construct (inverted repeat, IR). The silencing approaches generated diatom transformants with a phenotype clearly distinguishable from wildtype (WT) cells, i.e. a lower degree as well as slower kinetics of both DD de-epoxidation and NPQ induction. Real-time PCR based quantification of Dde transcripts revealed differences in transcript levels between AS transformants and WT cells but also between AS and IR transformants, suggesting the possible presence of two different gene silencing mediating mechanisms. This was confirmed by the differential effect of the light intensity on the respective silencing efficiency of both types of transformants. The characterization of the transformants strengthened some of the specific features of the XC and NPQ and confirmed the most recent mechanistic model of the DT/NPQ relationship in diatoms. PMID:22629333

  2. Transcriptional Silencing of Retroviral Vectors

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M.; Pedersen, F.S.

    1996-01-01

    . Extinction of long-term vector expression has been observed after implantation of transduced hematopoietic cells as well as fibroblasts, myoblasts and hepatocytes. Here we review the influence of vector structure, integration site and cell type on transcriptional silencing. While down-regulation of proviral...... transcription is known from a number of cellular and animal models, major insight has been gained from studies in the germ line and embryonal cells of the mouse. Key elements for the transfer and expression of retroviral vectors, such as the viral transcriptional enhancer and the binding site for the t......RNA primer for reverse transcription may have a major influence on transcriptional silencing. Alterations of these elements of the vector backbone as well as the use of internal promoter elements from housekeeping genes may contribute to reduce transcriptional silencing. The use of cell culture and animal...

  3. Citrus tristeza virus-based RNAi in citrus plants induces gene silencing in Diaphorina citri, a phloem-sap sucking insect vector of citrus greening disease (Huanglongbing).

    Science.gov (United States)

    Hajeri, Subhas; Killiny, Nabil; El-Mohtar, Choaa; Dawson, William O; Gowda, Siddarame

    2014-04-20

    A transient expression vector based on Citrus tristeza virus (CTV) is unusually stable. Because of its stability it is being considered for use in the field to control Huanglongbing (HLB), which is caused by Candidatus Liberibacter asiaticus (CLas) and vectored by Asian citrus psyllid, Diaphorina citri. In the absence of effective control strategies for CLas, emphasis has been on control of D. citri. Coincident cohabitation in phloem tissue by CLas, D. citri and CTV was exploited to develop a novel method to mitigate HLB through RNA interference (RNAi). Since CTV has three RNA silencing suppressors, it was not known if CTV-based vector could induce RNAi in citrus. Yet, expression of sequences targeting citrus phytoene desaturase gene by CTV-RNAi resulted in photo-bleaching phenotype. CTV-RNAi vector, engineered with truncated abnormal wing disc (Awd) gene of D. citri, induced altered Awd expression when silencing triggers ingested by feeding D. citri nymphs. Decreased Awd in nymphs resulted in malformed-wing phenotype in adults and increased adult mortality. This impaired ability of D. citri to fly would potentially limit the successful vectoring of CLas bacteria between citrus trees in the grove. CTV-RNAi vector would be relevant for fast-track screening of candidate sequences for RNAi-mediated pest control. Copyright © 2014. Published by Elsevier B.V.

  4. Systemic virus-induced gene silencing allows functional characterization of maize genes during biotrophic interaction with Ustilago maydis.

    Science.gov (United States)

    van der Linde, Karina; Kastner, Christine; Kumlehn, Jochen; Kahmann, Regine; Doehlemann, Gunther

    2011-01-01

    Infection of maize (Zea mays) plants with the corn smut fungus Ustilago maydis leads to the formation of large tumors on the stem, leaves and inflorescences. In this biotrophic interaction, plant defense responses are actively suppressed by the pathogen, and previous transcriptome analyses of infected maize plants showed massive and stage-specific changes in host gene expression during disease progression. To identify maize genes that are functionally involved in the interaction with U. maydis, we adapted a virus-induced gene silencing (VIGS) system based on the brome mosaic virus (BMV) for maize. Conditions were established that allowed successful U. maydis infection of BMV-preinfected maize plants. This set-up enabled quantification of VIGS and its impact on U. maydis infection using a quantitative real-time PCR (qRT-PCR)-based readout. In proof-of-principle experiments, an U. maydis-induced terpene synthase was shown to negatively regulate disease development while a protein involved in cell death inhibition was required for full virulence of U. maydis. The results suggest that this system is a versatile tool for the rapid identification of maize genes that determine compatibility with U. maydis. © (2010) Max Planck Society. Journal compilation © New Phytologist Trust (2010).

  5. Silencing the Transcriptional Repressor, ZCT1, Illustrates the Tight Regulation of Terpenoid Indole Alkaloid Biosynthesis in Catharanthus roseus Hairy Roots.

    Directory of Open Access Journals (Sweden)

    Noreen F Rizvi

    Full Text Available The Catharanthus roseus plant is the source of many valuable terpenoid indole alkaloids (TIAs, including the anticancer compounds vinblastine and vincristine. Transcription factors (TFs are promising metabolic engineering targets due to their ability to regulate multiple biosynthetic pathway genes. To increase TIA biosynthesis, we elicited the TIA transcriptional activators (ORCAs and other unidentified TFs with the plant hormone, methyl jasmonate (MJ, while simultaneously silencing the expression of the transcriptional repressor ZCT1. To silence ZCT1, we developed transgenic hairy root cultures of C. roseus that expressed an estrogen-inducible Zct1 hairpin for activating RNA interference. The presence of 17β-estradiol (5μM effectively depleted Zct1 in hairy root cultures elicited with MJ dosages that either optimize or inhibit TIA production (250 or 1000μM. However, silencing Zct1 was not sufficient to increase TIA production or the expression of the TIA biosynthetic genes (G10h, Tdc, and Str, illustrating the tight regulation of TIA biosynthesis. The repression of the TIA biosynthetic genes at the inhibitory MJ dosage does not appear to be solely regulated by ZCT1. For instance, while Zct1 and Zct2 levels decreased through activating the Zct1 hairpin, Zct3 levels remained elevated. Since ZCT repressors have redundant yet distinct functions, silencing all three ZCTs may be necessary to relieve their repression of alkaloid biosynthesis.

  6. Trans-specific gene silencing of acetyl-CoA carboxylase in a root-parasitic plant.

    Science.gov (United States)

    Bandaranayake, Pradeepa C G; Yoder, John I

    2013-05-01

    Parasitic species of the family Orobanchaceae are devastating agricultural pests in many parts of the world. The control of weedy Orobanchaceae spp. is challenging, particularly due to the highly coordinated life cycles of the parasite and host plants. Although host genetic resistance often provides the foundation of plant pathogen management, few genes that confer resistance to root parasites have been identified and incorporated into crop species. Members of the family Orobanchaceae acquire water, nutrients, macromolecules, and oligonucleotides from host plants through haustoria that connect parasite and host plant roots. We are evaluating a resistance strategy based on using interfering RNA (RNAi) that is made in the host but inhibitory in the parasite as a parasite-derived oligonucleotide toxin. Sequences from the cytosolic acetyl-CoA carboxylase (ACCase) gene from Triphysaria versicolor were cloned in hairpin conformation and introduced into Medicago truncatula roots by Agrobacterium rhizogenes transformation. Transgenic roots were recovered for four of five ACCase constructions and infected with T. versicolor against parasitic weeds. In all cases, Triphysaria root viability was reduced up to 80% when parasitizing a host root bearing the hairpin ACCase. Triphysaria root growth was recovered by exogenous application of malonate. Reverse-transcriptase polymerase chain reaction (RT-PCR) showed that ACCase transcript levels were dramatically decreased in Triphysaria spp. parasitizing transgenic Medicago roots. Northern blot analysis identified a 21-nucleotide, ACCase-specific RNA in transgenic M. truncatula and in T. versicolor attached to them. One hairpin ACCase construction was lethal to Medicago spp. unless grown in media supplemented with malonate. Quantitative RT-PCR showed that the Medicago ACCase was inhibited by the Triphysaria ACCase RNAi. This work shows that ACCase is an effective target for inactivation in parasitic plants by trans-specific gene

  7. Enhancement of antiproliferative activity of interferons by RNA interference-mediated silencing of SOCS gene expression in tumor cells.

    Science.gov (United States)

    Takahashi, Yuki; Kaneda, Haruka; Takasuka, Nana; Hattori, Kayoko; Nishikawa, Makiya; Watanabe, Yoshihiko; Takakura, Yoshinobu

    2008-08-01

    The suppressor of cytokine signaling (SOCS) proteins, negative regulators of interferon (IFN)-induced signaling pathways, is involved in IFN resistance of tumor cells. To improve the growth inhibitory effect of IFN-beta and IFN-gamma on a murine melanoma cell line, B16-BL6, and a murine colon carcinoma cell line, Colon26 cells, SOCS-1 and SOCS-3 gene expression in tumor cells was downregulated by transfection of plasmid DNA expressing short hairpin RNA targeting one of these genes (pshSOCS-1 and pshSOCS-3, respectively). Transfection of pshSOCS-1 significantly increased the antiproliferative effect of IFN-gamma on B16-BL6 cells. However, any other combinations of plasmids and IFN had little effect on the growth of B16-BL6 cells. In addition, transfection of pshSOCS-1 and pshSOCS-3 produced little improvement in the effect of IFN on Colon26 cells. To understand the mechanism underlining these findings, the level of SOCS gene expression was measured by real time polymerase chain reaction. Addition of IFN-gamma greatly increased the SOCS-1 mRNA expression in B16-BL6 cells. Taking into account the synergistic effect of pshSOCS-1 and IFN-gamma on the growth of B16-BL6 cells, these findings suggest that IFN-gamma-induced high SOCS-1 gene expression in B16-BL6 cells significantly interferes with the antiproliferative effect of IFN-gamma. These results indicate that silencing SOCS gene expression can be an effective strategy to enhance the antitumor effect of IFN under conditions in which the SOCS gene expression is upregulated by IFN.

  8. STAT3 Gene Silencing by Aptamer-siRNA Chimera as Selective Therapeutic for Glioblastoma

    Directory of Open Access Journals (Sweden)

    Carla Lucia Esposito

    2018-03-01

    Full Text Available Glioblastoma (GBM is the most frequent and aggressive primary brain tumor in adults, and despite advances in neuro-oncology, the prognosis for patients remains dismal. The signal transducer and activator of transcription-3 (STAT3 has been reported as a key regulator of the highly aggressive mesenchymal GBM subtype, and its direct silencing (by RNAi oligonucleotides has revealed a great potential as an anti-cancer therapy. However, clinical use of oligonucleotide-based therapies is dependent on safer ways for tissue-specific targeting and increased membrane penetration. The objective of this study is to explore the use of nucleic acid aptamers as carriers to specifically drive a STAT3 siRNA to GBM cells in a receptor-dependent manner. Using an aptamer that binds to and antagonizes the oncogenic receptor tyrosine kinase PDGFRβ (Gint4.T, here we describe the design of a novel aptamer-siRNA chimera (Gint4.T-STAT3 to target STAT3. We demonstrate the efficient delivery and silencing of STAT3 in PDGFRβ+ GBM cells. Importantly, the conjugate reduces cell viability and migration in vitro and inhibits tumor growth and angiogenesis in vivo in a subcutaneous xenograft mouse model. Our data reveals Gint4.T-STAT3 conjugate as a novel molecule with great translational potential for GBM therapy.

  9. The Drosophila FoxA ortholog Fork head regulates growth and gene expression downstream of Target of rapamycin.

    Directory of Open Access Journals (Sweden)

    Margret H Bülow

    2010-12-01

    Full Text Available Forkhead transcription factors of the FoxO subfamily regulate gene expression programs downstream of the insulin signaling network. It is less clear which proteins mediate transcriptional control exerted by Target of rapamycin (TOR signaling, but recent studies in nematodes suggest a role for FoxA transcription factors downstream of TOR. In this study we present evidence that outlines a similar connection in Drosophila, in which the FoxA protein Fork head (FKH regulates cellular and organismal size downstream of TOR. We find that ectopic expression and targeted knockdown of FKH in larval tissues elicits different size phenotypes depending on nutrient state and TOR signaling levels. FKH overexpression has a negative effect on growth under fed conditions, and this phenotype is not further exacerbated by inhibition of TOR via rapamycin feeding. Under conditions of starvation or low TOR signaling levels, knockdown of FKH attenuates the size reduction associated with these conditions. Subcellular localization of endogenous FKH protein is shifted from predominantly cytoplasmic on a high-protein diet to a pronounced nuclear accumulation in animals with reduced levels of TOR or fed with rapamycin. Two putative FKH target genes, CG6770 and cabut, are transcriptionally induced by rapamycin or FKH expression, and silenced by FKH knockdown. Induction of both target genes in heterozygous TOR mutant animals is suppressed by mutations in fkh. Furthermore, TOR signaling levels and FKH impact on transcription of the dFOXO target gene d4E-BP, implying a point of crosstalk with the insulin pathway. In summary, our observations show that an alteration of FKH levels has an effect on cellular and organismal size, and that FKH function is required for the growth inhibition and target gene induction caused by low TOR signaling levels.

  10. Simultaneous silencing of two arginine decarboxylase genes alters development in Arabidopsis

    Directory of Open Access Journals (Sweden)

    Diana eSánchez-Rangel

    2016-03-01

    Full Text Available Polyamines (PAs are small aliphatic polycations that are found ubiquitously in all organisms. In plants, PAs are involved in diverse biological processes such as growth, development, and stress responses. In Arabidopsis thaliana, the arginine decarboxylase enzymes (ADC1 and 2 catalyze the first step of PA biosynthesis. For a better understanding of PA biological functions, mutants in PA biosynthesis have been generated; however, the double adc1/adc2 mutant is not viable in A. thaliana. In this study, we generated non-lethal A. thaliana lines through an artificial microRNA that simultaneously silenced the two ADC genes (amiR:ADC. The generated transgenic lines (amiR:ADC-L1 and -L2 showed reduced AtADC1 and AtADC2 transcript levels. For further analyses the amiR:ADC-L2 line was selected. We found that the amiR:ADC-L2 line showed a significant decrease of their PA levels. The co-silencing revealed a stunted growth in A. thaliana seedlings, plantlets and delay in its flowering rate; these phenotypes were reverted with PA treatment. In addition, amiR:ADC-L2 plants displayed two seed phenotypes, such as yellow and brownish seeds. The yellow mutant seeds were smaller than adc1, adc2 mutants and wild type seeds; however, the brownish were the smallest seeds with arrested embryos at the torpedo stage. These data reinforce the importance of PA homeostasis in the plant development processes.

  11. Comparative Analysis of RNAi-Based Methods to Down-Regulate Expression of Two Genes Expressed at Different Levels in Myzus persicae

    Directory of Open Access Journals (Sweden)

    Michaël Mulot

    2016-11-01

    Full Text Available With the increasing availability of aphid genomic data, it is necessary to develop robust functional validation methods to evaluate the role of specific aphid genes. This work represents the first study in which five different techniques, all based on RNA interference and on oral acquisition of double-stranded RNA (dsRNA, were developed to silence two genes, ALY and Eph, potentially involved in polerovirus transmission by aphids. Efficient silencing of only Eph transcripts, which are less abundant than those of ALY, could be achieved by feeding aphids on transgenic Arabidopsis thaliana expressing an RNA hairpin targeting Eph, on Nicotiana benthamiana infected with a Tobacco rattle virus (TRV-Eph recombinant virus, or on in vitro-synthesized Eph-targeting dsRNA. These experiments showed that the silencing efficiency may differ greatly between genes and that aphid gut cells seem to be preferentially affected by the silencing mechanism after oral acquisition of dsRNA. In addition, the use of plants infected with recombinant TRV proved to be a promising technique to silence aphid genes as it does not require plant transformation. This work highlights the need to pursue development of innovative strategies to reproducibly achieve reduction of expression of aphid genes.

  12. Phenotypic silencing of cytoplasmic genes using sequence-specific double-stranded short interfering RNA and its application in the reverse genetics of wild type negative-strand RNA viruses

    Directory of Open Access Journals (Sweden)

    Barik Sailen

    2001-12-01

    Full Text Available Abstract Background Post-transcriptional gene silencing (PTGS by short interfering RNA has opened up new directions in the phenotypic mutation of cellular genes. However, its efficacy on non-nuclear genes and its effect on the interferon pathway remain unexplored. Since directed mutation of RNA genomes is not possible through conventional mutagenesis, we have tested sequence-specific 21-nucleotide long double-stranded RNAs (dsRNAs for their ability to silence cytoplasmic RNA genomes. Results Short dsRNAs were generated against specific mRNAs of respiratory syncytial virus, a nonsegmented negative-stranded RNA virus with a cytoplasmic life cycle. At nanomolar concentrations, the dsRNAs specifically abrogated expression of the corresponding viral proteins, and produced the expected mutant phenotype ex vivo. The dsRNAs did not induce an interferon response, and did not inhibit cellular gene expression. The ablation of the viral proteins correlated with the loss of the specific mRNAs. In contrast, viral genomic and antigenomic RNA, which are encapsidated, were not directly affected. Conclusions Synthetic inhibitory dsRNAs are effective in specific silencing of RNA genomes that are exclusively cytoplasmic and transcribed by RNA-dependent RNA polymerases. RNA-directed RNA gene silencing does not require cloning, expression, and mutagenesis of viral cDNA, and thus, will allow the generation of phenotypic null mutants of specific RNA viral genes under normal infection conditions and at any point in the infection cycle. This will, for the first time, permit functional genomic studies, attenuated infections, reverse genetic analysis, and studies of host-virus signaling pathways using a wild type RNA virus, unencumbered by any superinfecting virus.

  13. Solanum venturii, a suitable model system for virus-induced gene silencing studies in potato reveals StMKK6 as an important player in plant immunity

    NARCIS (Netherlands)

    Dobnik, David; Lazar, Ana; Stare, Tjaša; Gruden, Kristina; Vleeshouwers, Vivianne G.A.A.; Žel, Jana

    2016-01-01

    Background: Virus-induced gene silencing (VIGS) is an optimal tool for functional analysis of genes in plants, as the viral vector spreads throughout the plant and causes reduced expression of selected gene over the whole plant. Potato (Solanum tuberosum) is one of the most important food crops,

  14. Regulation of sonic hedgehog-GLI1 downstream target genes PTCH1, Cyclin D2, Plakoglobin, PAX6 and NKX2.2 and their epigenetic status in medulloblastoma and astrocytoma

    International Nuclear Information System (INIS)

    Shahi, Mehdi H; Afzal, Mohammad; Sinha, Subrata; Eberhart, Charles G; Rey, Juan A; Fan, Xing; Castresana, Javier S

    2010-01-01

    The Sonic hedgehog (Shh) signaling pathway is critical for cell growth and differentiation. Impairment of this pathway can result in both birth defects and cancer. Despite its importance in cancer development, the Shh pathway has not been thoroughly investigated in tumorigenesis of brain tumors. In this study, we sought to understand the regulatory roles of GLI1, the immediate downstream activator of the Shh signaling pathway on its downstream target genes PTCH1, Cyclin D2, Plakoglobin, NKX2.2 and PAX6 in medulloblastoma and astrocytic tumors. We silenced GLI1 expression in medulloblastoma and astrocytic cell lines by transfection of siRNA against GLI1. Subsequently, we performed RT-PCR and quantitative real time RT-PCR (qRT-PCR) to assay the expression of downstream target genes PTCH1, Cyclin D2, Plakoglobin, NKX2.2 and PAX6. We also attempted to correlate the pattern of expression of GLI1 and its regulated genes in 14 cell lines and 41 primary medulloblastoma and astrocytoma tumor samples. We also assessed the methylation status of the Cyclin D2 and PTCH1 promoters in these 14 cell lines and 58 primary tumor samples. Silencing expression of GLI1 resulted up-regulation of all target genes in the medulloblastoma cell line, while only PTCH1 was up-regulated in astrocytoma. We also observed methylation of the cyclin D2 promoter in a significant number of astrocytoma cell lines (63%) and primary astrocytoma tumor samples (32%), but not at all in any medulloblastoma samples. PTCH1 promoter methylation was less frequently observed than Cyclin D2 promoter methylation in astrocytomas, and not at all in medulloblastomas. Our results demonstrate different regulatory mechanisms of Shh-GLI1 signaling. These differences vary according to the downstream target gene affected, the origin of the tissue, as well as epigenetic regulation of some of these genes

  15. Efficient and nontoxic biological response carrier delivering TNF-α shRNA for gene silencing in a murine model of rheumatoid arthritis

    Directory of Open Access Journals (Sweden)

    Jialin Song

    2016-08-01

    Full Text Available Small interfering RNA (siRNA is an effective and specific method for silencing genes. However, an efficient and nontoxic carrier is needed to deliver the siRNA into the target cells. Tumor necrosis factor α (TNF-α plays a central role in the occurrence and progression of rheumatoid arthritis. In this study, we pre-synthetized a degradable cationic polymer (PDAPEI from 2,6-pyridinedicarboxaldehyde and low molecular weight polyethyleneimine (PEI, Mw=1.8 kDa as a gene vector for the delivery of TNF-α shRNA. The PDAPEI/pDNA complex showed a suitable particle size and stable zeta potential for transfection. In vitro study of the PDAPEI/pDNA complex revealed a lower cytotoxicity and higher transfection efficiency when transfecting TNF-α shRNA to macrophages by significantly down-regulating the expression of TNF-α. Moreover, the complex was extremely efficient in decreasing the severity of arthritis in mice with collagen-induced arthritis (CIA. PDAPEI delivered TNF-α shRNA has great potential in the treatment of rheumatoid arthritis.

  16. Effective silencing of ENaC by siRNA delivered with epithelial-targeted nanocomplexes in human cystic fibrosis cells and in mouse lung.

    Science.gov (United States)

    Tagalakis, Aristides D; Munye, Mustafa M; Ivanova, Rositsa; Chen, Hanpeng; Smith, Claire M; Aldossary, Ahmad M; Rosa, Luca Z; Moulding, Dale; Barnes, Josephine L; Kafetzis, Konstantinos N; Jones, Stuart A; Baines, Deborah L; Moss, Guy W J; O'Callaghan, Christopher; McAnulty, Robin J; Hart, Stephen L

    2018-05-10

    Loss of the cystic fibrosis transmembrane conductance regulator in cystic fibrosis (CF) leads to hyperabsorption of sodium and fluid from the airway due to upregulation of the epithelial sodium channel (ENaC). Thickened mucus and depleted airway surface liquid (ASL) then lead to impaired mucociliary clearance. ENaC regulation is thus a promising target for CF therapy. Our aim was to develop siRNA nanocomplexes that mediate effective silencing of airway epithelial ENaC in vitro and in vivo with functional correction of epithelial ion and fluid transport. We investigated translocation of nanocomplexes through mucus and their transfection efficiency in primary CF epithelial cells grown at air-liquid interface (ALI).Short interfering RNA (SiRNA)-mediated silencing was examined by quantitative RT-PCR and western analysis of ENaC. Transepithelial potential (V t ), short circuit current (I sc ), ASL depth and ciliary beat frequency (CBF) were measured for functional analysis. Inflammation was analysed by histological analysis of normal mouse lung tissue sections. Nanocomplexes translocated more rapidly than siRNA alone through mucus. Transfections of primary CF epithelial cells with nanocomplexes targeting αENaC siRNA, reduced αENaC and βENaC mRNA by 30%. Transfections reduced V t , the amiloride-sensitive I sc and mucus protein concentration while increasing ASL depth and CBF to normal levels. A single dose of siRNA in mouse lung silenced ENaC by approximately 30%, which persisted for at least 7 days. Three doses of siRNA increased silencing to approximately 50%. Nanoparticle-mediated delivery of ENaCsiRNA to ALI cultures corrected aspects of the mucociliary defect in human CF cells and offers effective delivery and silencing in vivo. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  17. Discovering Host Genes Involved in the Infection by the Tomato Yellow Leaf Curl Virus Complex and in the Establishment of Resistance to the Virus Using Tobacco Rattle Virus-based Post Transcriptional Gene Silencing

    Directory of Open Access Journals (Sweden)

    Rosa Lozano-Durán

    2013-03-01

    Full Text Available The development of high-throughput technologies allows for evaluating gene expression at the whole-genome level. Together with proteomic and metabolomic studies, these analyses have resulted in the identification of plant genes whose function or expression is altered as a consequence of pathogen attacks. Members of the Tomato yellow leaf curl virus (TYLCV complex are among the most important pathogens impairing production of agricultural crops worldwide. To understand how these geminiviruses subjugate plant defenses, and to devise counter-measures, it is essential to identify the host genes affected by infection and to determine their role in susceptible and resistant plants. We have used a reverse genetics approach based on Tobacco rattle virus-induced gene silencing (TRV-VIGS to uncover genes involved in viral infection of susceptible plants, and to identify genes underlying virus resistance. To identify host genes with a role in geminivirus infection, we have engineered a Nicotiana benthamiana line, coined 2IRGFP, which over-expresses GFP upon virus infection. With this system, we have achieved an accurate description of the dynamics of virus replication in space and time. Upon silencing selected N. benthamiana genes previously shown to be related to host response to geminivirus infection, we have identified eighteen genes involved in a wide array of cellular processes. Plant genes involved in geminivirus resistance were studied by comparing two tomato lines: one resistant (R, the other susceptible (S to the virus. Sixty-nine genes preferentially expressed in R tomatoes were identified by screening cDNA libraries from infected and uninfected R and S genotypes. Out of the 25 genes studied so far, the silencing of five led to the total collapse of resistance, suggesting their involvement in the resistance gene network. This review of our results indicates that TRV-VIGS is an exquisite reverse genetics tool that may provide new insights into the

  18. Identification of the TaBTF3 gene in wheat (Triticum aestivum L.) and the effect of its silencing on wheat chloroplast, mitochondria and mesophyll cell development.

    Science.gov (United States)

    Ma, Hong-Zhen; Liu, Guo-Qin; Li, Cheng-Wei; Kang, Guo-Zhang; Guo, Tian-Cai

    2012-10-05

    The full-length cDNA (882bp) and DNA (1742bp) sequences encoding a basic transcription factor 3, designated as TaBTF3, were first isolated from common wheat (Triticum aestivum L.). Subcellular localization studies revealed that the TaBTF3 protein was mainly located in the cytoplasm and nucleus. In TaBTF3-silenced transgenic wheat seedlings obtained using the Virus-induced gene silencing (VIGS) method, the chlorophyll pigment content was markedly reduced. However, the malonaldehyde (MDA) and H(2)O(2) contents were enhanced, and the structure of the wheat mesophyll cell was seriously damaged. Furthermore, transcripts of the chloroplast- and mitochondrial-encoded genes were significantly reduced in TaBTF3-silenced transgenic wheat plants. These results suggest that the TaBTF3 gene might function in the development of the wheat chloroplast, mitochondria and mesophyll cell. This paper is the first report to describe the involvement of TaBTF3 in maintaining the normal plant mesophyll cell structure. Copyright © 2012 Elsevier Inc. All rights reserved.

  19. About miRNAs, miRNA seeds, target genes and target pathways.

    Science.gov (United States)

    Kehl, Tim; Backes, Christina; Kern, Fabian; Fehlmann, Tobias; Ludwig, Nicole; Meese, Eckart; Lenhof, Hans-Peter; Keller, Andreas

    2017-12-05

    miRNAs are typically repressing gene expression by binding to the 3' UTR, leading to degradation of the mRNA. This process is dominated by the eight-base seed region of the miRNA. Further, miRNAs are known not only to target genes but also to target significant parts of pathways. A logical line of thoughts is: miRNAs with similar (seed) sequence target similar sets of genes and thus similar sets of pathways. By calculating similarity scores for all 3.25 million pairs of 2,550 human miRNAs, we found that this pattern frequently holds, while we also observed exceptions. Respective results were obtained for both, predicted target genes as well as experimentally validated targets. We note that miRNAs target gene set similarity follows a bimodal distribution, pointing at a set of 282 miRNAs that seems to target genes with very high specificity. Further, we discuss miRNAs with different (seed) sequences that nonetheless regulate similar gene sets or pathways. Most intriguingly, we found miRNA pairs that regulate different gene sets but similar pathways such as miR-6886-5p and miR-3529-5p. These are jointly targeting different parts of the MAPK signaling cascade. The main goal of this study is to provide a general overview on the results, to highlight a selection of relevant results on miRNAs, miRNA seeds, target genes and target pathways and to raise awareness for artifacts in respective comparisons. The full set of information that allows to infer detailed results on each miRNA has been included in miRPathDB, the miRNA target pathway database (https://mpd.bioinf.uni-sb.de).

  20. A Convenient In Vivo Model Using Small Interfering RNA Silencing to Rapidly Assess Skeletal Gene Function.

    Directory of Open Access Journals (Sweden)

    Wen Zhang

    Full Text Available It is difficult to study bone in vitro because it contains various cell types that engage in cross-talk. Bone biologically links various organs, and it has thus become increasingly evident that skeletal physiology must be studied in an integrative manner in an intact animal. We developed a model using local intraosseous small interfering RNA (siRNA injection to rapidly assess the effects of a target gene on the local skeletal environment. In this model, 160-g male Sprague-Dawley rats were treated for 1-2 weeks. The left tibia received intraosseous injection of a parathyroid hormone 1 receptor (Pth1r or insulin-like growth factor 1 receptor (Igf-1r siRNA transfection complex loaded in poloxamer 407 hydrogel, and the right tibia received the same volume of control siRNA. All the tibias received an intraosseous injection of recombinant human parathyroid hormone (1-34 (rhPTH (1-34 or insulin-like growth factor-1 (IGF-1. Calcein green and alizarin red were injected 6 and 2 days before euthanasia, respectively. IGF-1R and PTH1R expression levels were detected via RT-PCR assays and immunohistochemistry. Bone mineral density (BMD, microstructure, mineral apposition rates (MARs, and strength were determined by dual-energy X-ray absorptiometry, micro-CT, histology and biomechanical tests. The RT-PCR and immunohistochemistry results revealed that IGF-1R and PTH1R expression levels were dramatically diminished in the siRNA-treated left tibias compared to the right tibias (both p<0.05. Using poloxamer 407 hydrogel as a controlled-release system prolonged the silencing effect of a single dose of siRNA; the mRNA expression levels of IGF-1R were lower at two weeks than at one week (p<0.01. The BMD, bone microstructure parameters, MAR and bone strength were significantly decreased in the left tibias compared to the right tibias (all p<0.05. This simple and convenient local intraosseous siRNA injection model achieved gene silencing with very small quantities of

  1. An analysis of suppressing migratory effect on human urinary bladder cancer cell line by silencing of snail-1.

    Science.gov (United States)

    Salehi, Shima; Mansoori, Behzad; Mohammadi, Ali; Davoudian, Sadaf; Musavi Shenas, Seyed Mohammad Hossein; Shajari, Neda; Majidi, Jafar; Baradaran, Behzad

    2017-12-01

    Snail-1 actively participates in tumor progression, invasion, and migration. Targeting snail-1 expression can suppress the EMT process in cancer. The aim of this study was to investigate the effect of snail1 silencing on urinary bladder cancer. Quantitative RT-PCR was used to detect snail-1 and other related metastatic genes expression following siRNA knockdown in urinary bladder cancer EJ-138 cells. The protein level of snail1 was assessed by Western blot. MTT and TUNEL assays were assessed to understand if snail-1 had survival effects on EJ-138 cells. Scratch wound healing assay measured cell motility effects after snail1 suppression. The significant silencing of snail-1 reached 60pmol siRNA in a 48-h post-transfection. The result of scratch assay showed that snail-1 silencing significantly decreased Vimentin, MMPs, and CXCR4 expression; however, expression of E-cadherin was induced. The cell death assay indicated that snail-1 played the crucial role in bladder cancer survival rate. These results propose that snail-1 plays a major role in the progression and migration of urinary bladder cancer, and can be a potential therapeutic target for target therapy of invasive urinary bladder cancer. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  2. Effective gene silencing activity of prodrug-type 2'-O-methyldithiomethyl siRNA compared with non-prodrug-type 2'-O-methyl siRNA.

    Science.gov (United States)

    Hayashi, Junsuke; Nishigaki, Misa; Ochi, Yosuke; Wada, Shun-Ichi; Wada, Fumito; Nakagawa, Osamu; Obika, Satoshi; Harada-Shiba, Mariko; Urata, Hidehito

    2018-07-01

    Small interfering RNAs (siRNAs) are an active agent to induce gene silencing and they have been studied for becoming a biological and therapeutic tool. Various 2'-O-modified RNAs have been extensively studied to improve the nuclease resistance. However, the 2'-O-modified siRNA activities were often decreased by modification, since the bulky 2'-O-modifications inhibit to form a RNA-induced silencing complex (RISC). We developed novel prodrug-type 2'-O-methyldithiomethyl (MDTM) siRNA, which is converted into natural siRNA in an intracellular reducing environment. Prodrug-type 2'-O-MDTM siRNAs modified at the 5'-end side including 5'-end nucleotide and the seed region of the antisense strand exhibited much stronger gene silencing effect than non-prodrug-type 2'-O-methyl (2'-O-Me) siRNAs. Furthermore, the resistances for nuclease digestion of siRNAs were actually enhanced by 2'-O-MDTM modifications. Our results indicate that 2'-O-MDTM modifications improve the stability of siRNA in serum and they are able to be introduced at any positions of siRNA. Copyright © 2018 Elsevier Ltd. All rights reserved.

  3. A genome-wide analysis of the RNA-guided silencing pathway in coffee reveals insights into its regulatory mechanisms.

    Directory of Open Access Journals (Sweden)

    Christiane Noronha Fernandes-Brum

    Full Text Available microRNAs (miRNAs are derived from self-complementary hairpin structures, while small-interfering RNAs (siRNAs are derived from double-stranded RNA (dsRNA or hairpin precursors. The core mechanism of sRNA production involves DICER-like (DCL in processing the smallRNAs (sRNAs and ARGONAUTE (AGO as effectors of silencing, and siRNA biogenesis also involves action of RNA-Dependent RNA Polymerase (RDR, Pol IV and Pol V in biogenesis. Several other proteins interact with the core proteins to guide sRNA biogenesis, action, and turnover. We aimed to unravel the components and functions of the RNA-guided silencing pathway in a non-model plant species of worldwide economic relevance. The sRNA-guided silencing complex members have been identified in the Coffea canephora genome, and they have been characterized at the structural, functional, and evolutionary levels by computational analyses. Eleven AGO proteins, nine DCL proteins (which include a DCL1-like protein that was not previously annotated, and eight RDR proteins were identified. Another 48 proteins implicated in smallRNA (sRNA pathways were also identified. Furthermore, we identified 235 miRNA precursors and 317 mature miRNAs from 113 MIR families, and we characterized ccp-MIR156, ccp-MIR172, and ccp-MIR390. Target prediction and gene ontology analyses of 2239 putative targets showed that significant pathways in coffee are targeted by miRNAs. We provide evidence of the expansion of the loci related to sRNA pathways, insights into the activities of these proteins by domain and catalytic site analyses, and gene expression analysis. The number of MIR loci and their targeted pathways highlight the importance of miRNAs in coffee. We identified several roles of sRNAs in C. canephora, which offers substantial insight into better understanding the transcriptional and post-transcriptional regulation of this major crop.

  4. AGO/RISC-mediated antiviral RNA silencing in a plant in vitro system.

    Science.gov (United States)

    Schuck, Jana; Gursinsky, Torsten; Pantaleo, Vitantonio; Burgyán, Jozsef; Behrens, Sven-Erik

    2013-05-01

    AGO/RISC-mediated antiviral RNA silencing, an important component of the plant's immune response against RNA virus infections, was recapitulated in vitro. Cytoplasmic extracts of tobacco protoplasts were applied that supported Tombusvirus RNA replication, as well as the formation of RNA-induced silencing complexes (RISC) that could be functionally reconstituted with various plant ARGONAUTE (AGO) proteins. For example, when RISC containing AGO1, 2, 3 or 5 were programmed with exogenous siRNAs that specifically targeted the viral RNA, endonucleolytic cleavages occurred and viral replication was inhibited. Antiviral RNA silencing was disabled by the viral silencing suppressor p19 when this was present early during RISC formation. Notably, with replicating viral RNA, only (+)RNA molecules were accessible to RISC, whereas (-)RNA replication intermediates were not. The vulnerability of viral RNAs to RISC activity also depended on the RNA structure of the target sequence. This was most evident when we characterized viral siRNAs (vsiRNAs) that were particularly effective in silencing with AGO1- or AGO2/RISC. These vsiRNAs targeted similar sites, suggesting that accessible parts of the viral (+)RNA may be collectively attacked by different AGO/RISC. The in vitro system was, hence, established as a valuable tool to define and characterize individual molecular determinants of antiviral RNA silencing.

  5. ADAM33 gene silencing by promoter hypermethylation as a molecular marker in breast invasive lobular carcinoma

    Directory of Open Access Journals (Sweden)

    de Souza Emanuel M

    2009-03-01

    Full Text Available Abstract Background ADAM33 protein is a member of the family of transmembrane glycoproteins composed of multidomains. ADAM family members have different activities, such as proteolysis and adhesion, making them good candidates to mediate the extracellular matrix remodelling and changes in cellular adhesion that characterise certain pathologies and cancer development. It was reported that one family member, ADAM23, is down-regulated by promoter hypermethylation. This seems to correlate with tumour progression and metastasis in breast cancer. In this study, we explored the involvement of ADAM33, another ADAM family member, in breast cancer. Methods First, we analysed ADAM33 expression in breast tumour cell lines by RT-PCR and western blotting. We also used 5-aza-2'-deoxycytidine (5azadCR treatment and DNA bisulphite sequencing to study the promoter methylation of ADAM33 in breast tumour cell lines. We evaluated ADAM33 methylation in primary tumour samples by methylation specific PCR (MSP. Finally, ADAM33 promoter hypermethylation was correlated with clinicopathological data using the chi-square test and Fisher's exact test. Results The expression analysis of ADAM33 in breast tumour cell lines by RT-PCR revealed gene silencing in 65% of tumour cell lines. The corresponding lack of ADAM33 protein was confirmed by western blotting. We also used 5-aza-2'-deoxycytidine (5-aza-dCR demethylation and bisulphite sequencing methodologies to confirm that gene silencing is due to ADAM33 promoter hypermethylation. Using MSP, we detected ADAM33 promoter hypermethylation in 40% of primary breast tumour samples. The correlation between methylation pattern and patient's clinicopathological data was not significantly associated with histological grade; tumour stage (TNM; tumour size; ER, PR or ERBB2 status; lymph node status; metastasis or recurrence. Methylation frequency in invasive lobular carcinoma (ILC was 76.2% compared with 25.5% in invasive ductal carcinoma

  6. ADAM33 gene silencing by promoter hypermethylation as a molecular marker in breast invasive lobular carcinoma

    International Nuclear Information System (INIS)

    Seniski, Gerusa G; Zanata, Silvio M; Costa, Fabrício F; Klassen, Giseli; Camargo, Anamaria A; Ierardi, Daniela F; Ramos, Edneia AS; Grochoski, Mariana; Ribeiro, Enilze SF; Cavalli, Iglenir J; Pedrosa, Fabio O; Souza, Emanuel M de

    2009-01-01

    ADAM33 protein is a member of the family of transmembrane glycoproteins composed of multidomains. ADAM family members have different activities, such as proteolysis and adhesion, making them good candidates to mediate the extracellular matrix remodelling and changes in cellular adhesion that characterise certain pathologies and cancer development. It was reported that one family member, ADAM23, is down-regulated by promoter hypermethylation. This seems to correlate with tumour progression and metastasis in breast cancer. In this study, we explored the involvement of ADAM33, another ADAM family member, in breast cancer. First, we analysed ADAM33 expression in breast tumour cell lines by RT-PCR and western blotting. We also used 5-aza-2'-deoxycytidine (5azadCR) treatment and DNA bisulphite sequencing to study the promoter methylation of ADAM33 in breast tumour cell lines. We evaluated ADAM33 methylation in primary tumour samples by methylation specific PCR (MSP). Finally, ADAM33 promoter hypermethylation was correlated with clinicopathological data using the chi-square test and Fisher's exact test. The expression analysis of ADAM33 in breast tumour cell lines by RT-PCR revealed gene silencing in 65% of tumour cell lines. The corresponding lack of ADAM33 protein was confirmed by western blotting. We also used 5-aza-2'-deoxycytidine (5-aza-dCR) demethylation and bisulphite sequencing methodologies to confirm that gene silencing is due to ADAM33 promoter hypermethylation. Using MSP, we detected ADAM33 promoter hypermethylation in 40% of primary breast tumour samples. The correlation between methylation pattern and patient's clinicopathological data was not significantly associated with histological grade; tumour stage (TNM); tumour size; ER, PR or ERBB2 status; lymph node status; metastasis or recurrence. Methylation frequency in invasive lobular carcinoma (ILC) was 76.2% compared with 25.5% in invasive ductal carcinoma (IDC), and this difference was

  7. Surface functionalisation of PLGA nanoparticles for gene silencing

    DEFF Research Database (Denmark)

    Andersen, Morten Østergaard; Lichawska, Agata; Arpanaei, Ayyoob

    2010-01-01

    . In addition, particles containing cetylated-PEI achieved 64% silencing of TNFα in J774.1 cells. This rapid method for surface modification of PLGA nanoparticles promotes its application for alternative cetylated functional derivatives as a strategy to control specific biological properties of nanoparticles....

  8. Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing

    OpenAIRE

    Hedil, Marcio; Sterken, Mark G.; de Ronde, Dryas; Lohuis, Dick; Kormelink, Richard

    2015-01-01

    RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS. Although the tomato spotted wilt virus (TSWV) tospovirus NSs protein has been shown to exhibit affinity to long and small dsRNA molecules, its ability to suppress the non-cell autonomous part of RNA silen...

  9. RNA silencing is required for Arabidopsis defence against Verticillium wilt disease

    NARCIS (Netherlands)

    Ellendorff, U.; Fradin, E.F.; Jonge, de R.; Thomma, B.P.H.J.

    2009-01-01

    RNA silencing is a conserved mechanism in eukaryotes that plays an important role in various biological processes including regulation of gene expression. RNA silencing also plays a role in genome stability and protects plants against invading nucleic acids such as transgenes and viruses. Recently,

  10. Composite potato plants with transgenic roots on non-transgenic shoots: a model system for studying gene silencing in roots.

    Science.gov (United States)

    Horn, Patricia; Santala, Johanna; Nielsen, Steen Lykke; Hühns, Maja; Broer, Inge; Valkonen, Jari P T

    2014-12-01

    Composite potato plants offer an extremely fast, effective and reliable system for studies on gene functions in roots using antisense or inverted-repeat but not sense constructs for gene inactivation. Composite plants, with transgenic roots on a non-transgenic shoot, can be obtained by shoot explant transformation with Agrobacterium rhizogenes. The aim of this study was to generate composite potato plants (Solanum tuberosum) to be used as a model system in future studies on root-pathogen interactions and gene silencing in the roots. The proportion of transgenic roots among the roots induced was high (80-100%) in the four potato cultivars tested (Albatros, Desirée, Sabina and Saturna). No wild-type adventitious roots were formed at mock inoculation site. All strains of A. rhizogenes tested induced phenotypically normal roots which, however, showed a reduced response to cytokinin as compared with non-transgenic roots. Nevertheless, both types of roots were infected to a similar high rate with the zoospores of Spongospora subterranea, a soilborne potato pathogen. The transgenic roots of composite potato plants expressed significantly higher amounts of β-glucuronidase (GUS) than the roots of a GUS-transgenic potato line event. Silencing of the uidA transgene (GUS) was tested by inducing roots on the GUS-transgenic cv. Albatros event with strains of A. rhizogenes over-expressing either the uidA sense or antisense transcripts, or inverted-repeat or hairpin uidA RNA. The three last mentioned constructs caused 2.5-4.0 fold reduction in the uidA mRNA expression. In contrast, over-expression of uidA resulted in over 3-fold increase in the uidA mRNA and GUS expression, indicating that sense-mediated silencing (co-suppression) was not functional in roots. The results suggest that composite plants offer a useful experimental system for potato research, which has gained little previous attention.

  11. Identification and gene-silencing of a putative odorant receptor transcription factor in Varroa destructor: possible role in olfaction.

    Science.gov (United States)

    Singh, N K; Eliash, N; Stein, I; Kamer, Y; Ilia, Z; Rafaeli, A; Soroker, V

    2016-04-01

    The ectoparasitic mite Varroa destructor is one of the major threats to apiculture. Using a behavioural choice bioassay, we determined that phoretic mites were more successful in reaching a bee than reproductive mites, suggesting an energy trade-off between reproduction and host selection. We used both chemo-ecological and molecular strategies to identify the regulation of the olfactory machinery of Varroa and its association with reproduction. We focused on transcription regulation. Using primers designed to the conserved DNA binding region of transcription factors, we identified a gene transcript in V. destructor homologous to the pheromone receptor transcription factor (PRTF) gene of Pediculus humanus corporis. Quantitative PCR (qPCR) revealed that this PRTF-like gene transcript is expressed in the forelegs at higher levels than in the body devoid of forelegs. Subsequent comparative qPCR analysis showed that transcript expression was significantly higher in the phoretic as compared to the reproductive stage. Electrophysiological and behavioural studies revealed a reduction in the sensitivity of PRTF RNA interference-silenced mites to bee headspace, consistent with a reduction in the mites' ability to reach a host. In addition, vitellogenin expression was stimulated in PRTF-silenced mites to similar levels as found in reproductive mites. These data shed light upon the regulatory mechanism of host chemosensing in V. destructor. © 2016 The Royal Entomological Society.

  12. CNS-restricted Transduction and CRISPR/Cas9-mediated Gene Deletion with an Engineered AAV Vector

    Directory of Open Access Journals (Sweden)

    Giridhar Murlidharan

    2016-01-01

    Full Text Available Gene therapy using recombinant adeno-associated viral (AAV vectors is emerging as a promising approach to treat central nervous system disorders such as Spinal muscular atrophy, Batten, Parkinson and Alzheimer disease amongst others. A critical remaining challenge for central nervous system-targeted gene therapy, silencing or gene editing is to limit potential vector dose-related toxicity in off-target cells and organs. Here, we characterize a lab-derived AAV chimeric (AAV2g9, which displays favorable central nervous system attributes derived from both parental counterparts, AAV2 and AAV9. This synthetic AAV strain displays preferential, robust, and widespread neuronal transduction within the brain and decreased glial tropism. Importantly, we observed minimal systemic leakage, decreased sequestration and gene transfer in off-target organs with AAV2g9, when administered into the cerebrospinal fluid. A single intracranial injection of AAV2g9 vectors encoding guide RNAs targeting the schizophrenia risk gene MIR137 (encoding MIR137 in CRISPR/Cas9 knockin mice resulted in brain-specific gene deletion with no detectable events in the liver. This engineered AAV vector is a promising platform for treating neurological disorders through gene therapy, silencing or editing modalities.

  13. Virus-induced Gene Silencing-based Functional Analyses Revealed the Involvement of Several Putative Trehalose-6-Phosphate Synthase/Phosphatase Genes in Disease Resistance against Botrytis cinerea and Pseudomonas syringae pv. tomato DC3000 in Tomato

    Directory of Open Access Journals (Sweden)

    Huijuan Zhang

    2016-08-01

    Full Text Available Trehalose and its metabolism have been demonstrated to play important roles in control of plant growth, development and stress responses. However, direct genetic evidence supporting the functions of trehalose and its metabolism in defense response against pathogens is lacking. In the present study, genome-wide characterization of putative trehalose-related genes identified 11 SlTPSs for trehalose-6-phosphate synthase, 8 SlTPPs for trehalose-6-phosphate phosphatase and one SlTRE1 for trehalase in tomato genome. Nine SlTPSs, 4 SlTPPs and SlTRE1 were selected for functional analyses to explore their involvement in tomato disease resistance. Some selected SlTPSs, SlTPPs and SlTRE1 responded with distinct expression induction patterns to Botrytis cinerea and Pseudomonas syringae pv. tomato (Pst DC3000 as well as to defense signaling hormones (e.g. salicylic acid, jasmonic acid and a precursor of ethylene. Virus-induced gene silencing-mediated silencing of SlTPS3, SlTPS4 or SlTPS7 led to deregulation of ROS accumulation and attenuated the expression of defense-related genes upon pathogen infection and thus deteriorated the resistance against B. cinerea or Pst DC3000. By contrast, silencing of SlTPS5 or SlTPP2 led to an increased expression of the defense-related genes upon pathogen infection and conferred an increased resistance against Pst DC3000. Silencing of SlTPS3, SlTPS4, SlTPS5, SlTPS7 or SlTPP2 affected trehalose level in tomato plants with or without infection of B. cinerea or Pst DC3000. These results demonstrate that SlTPS3, SlTPS4, SlTPS5, SlTPS7 and SlTPP2 play roles in resistance against B. cinerea and Pst DC3000, implying the importance of trehalose and tis metabolism in regulation of defense response against pathogens in tomato.

  14. Silence multiple

    DEFF Research Database (Denmark)

    Søndergaard, Katia Dupret

    The article highlights the importance of silences in the processes of innovation in organizations, and the claim is that silence and the absence of talk distribute authority, responsibility and decisions. The act of silencing is conceptualised as a central “configurating actor”. Using an Actor......-Network Theoretical approach to organization studies silence is conceptualised as both a means and an effect of innovative efforts. It is a way of ordering practices. Thus silencing is thought of as a central potential change agent both in composing a kind of specific organizational collectivity and in composing new...... working practices more generally. In line with the approach to destabilise the mundane, invisible and taken-for-granted aspects of innovative efforts in organisations (crucial for ANT and foucauldian post-structuralism more broadly), this article suggests to non-silence the silence and make...

  15. The Role of piRNA-Mediated Epigenetic Silencing in the Population Dynamics of Transposable Elements in Drosophila melanogaster.

    Directory of Open Access Journals (Sweden)

    Yuh Chwen G Lee

    2015-06-01

    Full Text Available The piwi-interacting RNAs (piRNA are small RNAs that target selfish transposable elements (TEs in many animal genomes. Until now, piRNAs' role in TE population dynamics has only been discussed in the context of their suppression of TE transposition, which alone is not sufficient to account for the skewed frequency spectrum and stable containment of TEs. On the other hand, euchromatic TEs can be epigenetically silenced via piRNA-dependent heterochromatin formation and, similar to the widely known "Position-effect variegation", heterochromatin induced by TEs can "spread" into nearby genes. We hypothesized that the piRNA-mediated spread of heterochromatin from TEs into adjacent genes has deleterious functional effects and leads to selection against individual TEs. Unlike previously identified deleterious effects of TEs due to the physical disruption of DNA, the functional effect we investigated here is mediated through the epigenetic influences of TEs. We found that the repressive chromatin mark, H3K9me, is elevated in sequences adjacent to euchromatic TEs at multiple developmental stages in Drosophila melanogaster. Furthermore, the heterochromatic states of genes depend not only on the number of and distance from adjacent TEs, but also on the likelihood that their nearest TEs are targeted by piRNAs. These variations in chromatin status probably have functional consequences, causing genes near TEs to have lower expression. Importantly, we found stronger selection against TEs that lead to higher H3K9me enrichment of adjacent genes, demonstrating the pervasive evolutionary consequences of TE-induced epigenetic silencing. Because of the intrinsic biological mechanism of piRNA amplification, spread of TE heterochromatin could result in the theoretically required synergistic deleterious effects of TE insertions for stable containment of TE copy number. The indirect deleterious impact of piRNA-mediated epigenetic silencing of TEs is a previously

  16. Effective inhibition of foot-and-mouth disease virus (FMDV replication in vitro by vector-delivered microRNAs targeting the 3D gene

    Directory of Open Access Journals (Sweden)

    Cai Xuepeng

    2011-06-01

    Full Text Available Abstract Background Foot-and-mouth disease virus (FMDV causes an economically important and highly contagious disease of cloven-hoofed animals. RNAi triggered by small RNA molecules, including siRNAs and miRNAs, offers a new approach for controlling viral infections. There is no report available for FMDV inhibition by vector-delivered miRNA, although miRNA is believed to have more potential than siRNA. In this study, the inhibitory effects of vector-delivered miRNAs targeting the 3D gene on FMDV replication were examined. Results Four pairs of oligonucleotides encoding 3D-specific miRNA of FMDV were designed and selected for construction of miRNA expression plasmids. In the reporter assays, two of four miRNA expression plasmids were able to significantly silence the expression of 3D-GFP fusion proteins from the reporter plasmid, p3D-GFP, which was cotransfected with each miRNA expression plasmid. After detecting the silencing effects of the reporter genes, the inhibitory effects of FMDV replication were determined in the miRNA expression plasmid-transfected and FMDV-infected cells. Virus titration and real-time RT-PCR assays showed that the p3D715-miR and p3D983-miR plasmids were able to potently inhibit the replication of FMDV when BHK-21 cells were infected with FMDV. Conclusion Our results indicated that vector-delivered miRNAs targeting the 3D gene efficiently inhibits FMDV replication in vitro. This finding provides evidence that miRNAs could be used as a potential tool against FMDV infection.

  17. Silencing abnormal wing disc gene of the Asian citrus psyllid, Diaphorina citri disrupts adult wing development and increases nymph mortality.

    Directory of Open Access Journals (Sweden)

    Ibrahim El-Shesheny

    Full Text Available Huanglongbing (HLB causes considerable economic losses to citrus industries worldwide. Its management depends on controlling of the Asian citrus Psyllid (ACP, the vector of the bacterium, Candidatus Liberibacter asiaticus (CLas, the causal agent of HLB. Silencing genes by RNA interference (RNAi is a promising tool to explore gene functions as well as control pests. In the current study, abnormal wing disc (awd gene associated with wing development in insects is used to interfere with the flight of psyllids. Our study showed that transcription of awd is development-dependent and the highest level was found in the last instar (5(th of the nymphal stage. Micro-application (topical application of dsRNA to 5(th instar of nymphs caused significant nymphal mortality and adult wing-malformation. These adverse effects in ACP were positively correlated with the amounts of dsRNA used. A qRT-PCR analysis confirmed the dsRNA-mediated transcriptional down-regulation of the awd gene. Significant down-regulation was required to induce a wing-malformed phenotype. No effect was found when dsRNA-gfp was used, indicating the specific effect of dsRNA-awd. Our findings suggest a role for awd in ACP wing development and metamorphosis. awd could serve as a potential target for insect management either via direct application of dsRNA or by producing transgenic plants expressing dsRNA-awd. These strategies will help to mitigate HLB by controlling ACP.

  18. Targeting the human lysozyme gene on bovine αs1- casein gene ...

    African Journals Online (AJOL)

    Targeting an exogenous gene into a favorable gene locus and for expression under endogenous regulators is an ideal method in mammary gland bioreactor research. For this purpose, a gene targeting vector was constructed to targeting the human lysozyme gene on bovine αs1-casein gene locus. In this case, the ...

  19. PhOBF1, a petunia ocs element binding factor, plays an important role in antiviral RNA silencing.

    Science.gov (United States)

    Sun, Daoyang; Li, Shaohua; Niu, Lixin; Reid, Michael S; Zhang, Yanlong; Jiang, Cai-Zhong

    2017-02-01

    Virus-induced gene silencing (VIGS) is a common reverse genetics strategy for characterizing the function of genes in plants. The detailed mechanism governing RNA silencing efficiency triggered by viruses is largely unclear. Here, we reveal that a petunia (Petunia hybrida) ocs element binding factor, PhOBF1, one of the basic leucine zipper (bZIP) transcription factors, was up-regulated by Tobacco rattle virus (TRV) infection. Simultaneous silencing of PhOBF1 and a reporter gene, phytoene desaturase (PDS) or chalcone synthase (CHS), by TRV-based VIGS led to a failure of the development of leaf photobleaching or the white-corollas phenotype. PhOBF1 silencing caused down-regulation of RNA silencing-related genes, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonautes (AGOs). After inoculation with the TRV-PhPDS, PhOBF1-RNAi lines exhibited a substantially impaired PDS silencing efficiency, whereas overexpression of PhOBF1 resulted in a recovery of the silencing phenotype (photobleaching) in systemic leaves. A compromised resistance to TRV and Tobacco mosaic virus was found in PhOBF1-RNAi lines, while PhOBF1-overexpressing lines displayed an enhanced resistance to their infections. Compared with wild-type plants, PhOBF1-silenced plants accumulated lower levels of free salicylic acid (SA), salicylic acid glucoside, and phenylalanine, contrarily to higher levels of those in plants overexpressing PhOBF1. Furthermore, transcripts of a number of genes associated with the shikimate and phenylpropanoid pathways were decreased or increased in PhOBF1-RNAi or PhOBF1-overexpressing lines, respectively. Taken together, the data suggest that PhOBF1 regulates TRV-induced RNA silencing efficiency through modulation of RDRs, DCLs, and AGOs mediated by the SA biosynthesis pathway. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  20. Decreasing erucic acid level by RNAi-mediated silencing of fatty ...

    African Journals Online (AJOL)

    To develop low level of erucic acid in rapeseeds by intron-spliced hairpin RNA, an inverted repeat unit of a partial BnFAE1.1 gene interrupted by a spliceable intron ... In conclusion, the expression of endogenous BnFAE1.1 was efficiently silenced by the designed RNAi silencer, causing a significant down-regulation in the ...

  1. CXCL12 gene silencing down-regulates metastatic potential via blockage of MAPK/PI3K/AP-1 signaling pathway in colon cancer.

    Science.gov (United States)

    Ma, J; Su, H; Yu, B; Guo, T; Gong, Z; Qi, J; Zhao, X; Du, J

    2018-01-05

    To investigate the effect of CXCL12 gene silencing on proliferation,invasion, angiogenesis and the relationship of MAPK/PI3K/AP-1 signaling pathway in colon cancer cells. RT-PCR and Western-blot were used to detect the expression of CXCL12 mRNA and protein in four colon cancer cell lines. Human colon cancer cells were transfected with CXCL12 siRNA carrying by Lipofectamine 2000. The expression of CXCL12 protein was confirmed by immunoblotting. WST-1, invasion and angiogenesis assay were used to examine the effect on proliferation, invasion and angiogenesis in colon cancer cells after CXCL12 siRNA silence, respectively. The phosphorylation of MAPK/PI3K/AP-1 protein levels was detected by Western blotting in CXCL12 siRNA suppression DLD-1 cell. CXCL12 mRNA and proteins were only expressed in DLD-1 colon cancer cell lines. CXCL12 siRNA were transfected into DLD-1 cells, the expression CXCL12 proteins was significantly inhibited (P colon cancer cell. The silencing CXCL12 gene significantly inhibits the proliferation, invasion and angiogenesis ability of some types colon carcinoma cells through down-regulation of MAPK/PI3K/AP-1 signaling pathway.

  2. Hydrophobically Modified siRNAs Silence Huntingtin mRNA in Primary Neurons and Mouse Brain

    Directory of Open Access Journals (Sweden)

    Julia F Alterman

    2015-01-01

    Full Text Available Applications of RNA interference for neuroscience research have been limited by a lack of simple and efficient methods to deliver oligonucleotides to primary neurons in culture and to the brain. Here, we show that primary neurons rapidly internalize hydrophobically modified siRNAs (hsiRNAs added directly to the culture medium without lipid formulation. We identify functional hsiRNAs targeting the mRNA of huntingtin, the mutation of which is responsible for Huntington's disease, and show that direct uptake in neurons induces potent and specific silencing in vitro. Moreover, a single injection of unformulated hsiRNA into mouse brain silences Htt mRNA with minimal neuronal toxicity. Thus, hsiRNAs embody a class of therapeutic oligonucleotides that enable simple and straightforward functional studies of genes involved in neuronal biology and neurodegenerative disorders in a native biological context.

  3. Preclinical validation of Aurora kinases-targeting drugs in osteosarcoma

    NARCIS (Netherlands)

    Tavanti, E.; Sero, V.; Vella, S.; Fanelli, M.; Michelacci, F.; Landuzzi, L.; Magagnoli, G.; Versteeg, R.; Picci, P.; Hattinger, C. M.; Serra, M.

    2013-01-01

    Aurora kinases are key regulators of cell cycle and represent new promising therapeutic targets in several human tumours. Biological relevance of Aurora kinase-A and -B was assessed on osteosarcoma clinical samples and by silencing these genes with specific siRNA in three human osteosarcoma cell

  4. Silencing of acidic pathogenesis-related PR-1 genes increases extracellular beta-(1 -> 3)-glucanase activity at the onset of tobacco defence reactions

    DEFF Research Database (Denmark)

    Riviere, M.P.; Marais, A.; Ponchet, M.

    2008-01-01

    silenced. Plants lacking extracellular PR-1s were more susceptible than wild-type plants to the oomycete Phytophthora parasitica but displayed unaffected systemic acquired resistance and developmental resistance to this pathogen. Treatment with salicylic acid up-regulates the PR-1g gene, encoding a basic...... protein of the PR-1 family, in PR-1-deficient tobacco, indicating that PR-1 expression may repress that of PR-1g. This shows that acidic PR-1s are dispensable for expression of salicylic acid-dependent acquired resistances against P. parasitica and may reveal a functional overlap in tobacco defence......The class 1 pathogenesis-related (PR) proteins are thought to be involved in plant defence responses, but their molecular functions are unknown. The function of PR-1 was investigated in tobacco by generating stable PR-1a-silenced lines in which other acidic PR-1 genes (PR-1b and PR-1c) were...

  5. SiRNAs conjugated with aromatic compounds induce RISC-mediated antisense strand selection and strong gene-silencing activity

    Energy Technology Data Exchange (ETDEWEB)

    Kubo, Takanori, E-mail: kubo-t@yasuda-u.ac.jp [Faculty of Pharmacy, Yasuda Women' s University, 6-13-1 Yasuhigashi, Asaminami-ku, Hiroshima 731-0153 (Japan); Yanagihara, Kazuyoshi [Faculty of Pharmacy, Yasuda Women' s University, 6-13-1 Yasuhigashi, Asaminami-ku, Hiroshima 731-0153 (Japan); Division of Genetics, National Cancer Center Research Institute, 5-1-1 Tsukiji, Chuo-ku, Tokyo 104-0045 (Japan); Takei, Yoshifumi [Department of Biochemistry, Nagoya University Graduate School of Medicine, 65 Tsurumi-cho, Showa-ku, Nagoya 466-8550 (Japan); Mihara, Keichiro [Department of Hematology and Oncology, Research Institute for Radiation Biology and Medicine, Hiroshima University, 1-2-3 Kasumi, Minami-ku, Hiroshima 734-8553 (Japan); Sato, Yuichiro; Seyama, Toshio [Faculty of Pharmacy, Yasuda Women' s University, 6-13-1 Yasuhigashi, Asaminami-ku, Hiroshima 731-0153 (Japan)

    2012-10-05

    Highlights: Black-Right-Pointing-Pointer SiRNAs conjugated with aromatic compounds (Ar-siRNAs) at 5 Prime -sense strand were synthesized. Black-Right-Pointing-Pointer Ar-siRNAs increased resistance against nuclease degradation. Black-Right-Pointing-Pointer Ar-siRNAs were thermodynamically stable compared with the unmodified siRNA. Black-Right-Pointing-Pointer High levels of cellular uptake and cytoplasmic localization were found. Black-Right-Pointing-Pointer Strong gene-silencing efficacy was exhibited in the Ar-siRNAs. -- Abstract: Short interference RNA (siRNA) is a powerful tool for suppressing gene expression in mammalian cells. In this study, we focused on the development of siRNAs conjugated with aromatic compounds in order to improve the potency of RNAi and thus to overcome several problems with siRNAs, such as cellular delivery and nuclease stability. The siRNAs conjugated with phenyl, hydroxyphenyl, naphthyl, and pyrenyl derivatives showed strong resistance to nuclease degradation, and were thermodynamically stable compared with unmodified siRNA. A high level of membrane permeability in HeLa cells was also observed. Moreover, these siRNAs exhibited enhanced RNAi efficacy, which exceeded that of locked nucleic acid (LNA)-modified siRNAs, against exogenous Renilla luciferase in HeLa cells. In particular, abundant cytoplasmic localization and strong gene-silencing efficacy were found in the siRNAs conjugated with phenyl and hydroxyphenyl derivatives. The novel siRNAs conjugated with aromatic compounds are promising candidates for a new generation of modified siRNAs that can solve many of the problems associated with RNAi technology.

  6. siRNA-Mediated Silencing of doublesex during Female Development of the Dengue Vector Mosquito Aedes aegypti.

    Directory of Open Access Journals (Sweden)

    Keshava Mysore

    2015-11-01

    Full Text Available The development of sex-specific traits, including the female-specific ability to bite humans and vector disease, is critical for vector mosquito reproduction and pathogen transmission. Doublesex (Dsx, a terminal transcription factor in the sex determination pathway, is known to regulate sex-specific gene expression during development of the dengue fever vector mosquito Aedes aegypti. Here, the effects of developmental siRNA-mediated dsx silencing were assessed in adult females. Targeting of dsx during A. aegypti development resulted in decreased female wing size, a correlate for body size, which is typically larger in females. siRNA-mediated targeting of dsx also resulted in decreased length of the adult female proboscis. Although dsx silencing did not impact female membrane blood feeding or mating behavior in the laboratory, decreased fecundity and fertility correlated with decreased ovary length, ovariole length, and ovariole number in dsx knockdown females. Dsx silencing also resulted in disruption of olfactory system development, as evidenced by reduced length of the female antenna and maxillary palp and the sensilla present on these structures, as well as disrupted odorant receptor expression. Female lifespan, a critical component of the ability of A. aegypti to transmit pathogens, was also significantly reduced in adult females following developmental targeting of dsx. The results of this investigation demonstrate that silencing of dsx during A. aegypti development disrupts multiple sex-specific morphological, physiological, and behavioral traits of adult females, a number of which are directly or indirectly linked to mosquito reproduction and pathogen transmission. Moreover, the olfactory phenotypes observed connect Dsx to development of the olfactory system, suggesting that A. aegypti will be an excellent system in which to further assess the developmental genetics of sex-specific chemosensation.

  7. Characteristics of functional enrichment and gene expression level of human putative transcriptional target genes.

    Science.gov (United States)

    Osato, Naoki

    2018-01-19

    Transcriptional target genes show functional enrichment of genes. However, how many and how significantly transcriptional target genes include functional enrichments are still unclear. To address these issues, I predicted human transcriptional target genes using open chromatin regions, ChIP-seq data and DNA binding sequences of transcription factors in databases, and examined functional enrichment and gene expression level of putative transcriptional target genes. Gene Ontology annotations showed four times larger numbers of functional enrichments in putative transcriptional target genes than gene expression information alone, independent of transcriptional target genes. To compare the number of functional enrichments of putative transcriptional target genes between cells or search conditions, I normalized the number of functional enrichment by calculating its ratios in the total number of transcriptional target genes. With this analysis, native putative transcriptional target genes showed the largest normalized number of functional enrichments, compared with target genes including 5-60% of randomly selected genes. The normalized number of functional enrichments was changed according to the criteria of enhancer-promoter interactions such as distance from transcriptional start sites and orientation of CTCF-binding sites. Forward-reverse orientation of CTCF-binding sites showed significantly higher normalized number of functional enrichments than the other orientations. Journal papers showed that the top five frequent functional enrichments were related to the cellular functions in the three cell types. The median expression level of transcriptional target genes changed according to the criteria of enhancer-promoter assignments (i.e. interactions) and was correlated with the changes of the normalized number of functional enrichments of transcriptional target genes. Human putative transcriptional target genes showed significant functional enrichments. Functional

  8. Arabidopsis HDA6 regulates locus-directed heterochromatin silencing in cooperation with MET1.

    OpenAIRE

    Taiko Kim To; Jong-Myong Kim; Akihiro Matsui; Yukio Kurihara; Taeko Morosawa; Junko Ishida; Maho Tanaka; Takaho Endo; Tetsuji Kakutani; Tetsuro Toyoda; Hiroshi Kimura; Shigeyuki Yokoyama; Kazuo Shinozaki; Motoaki Seki

    2011-01-01

    Heterochromatin silencing is pivotal for genome stability in eukaryotes. In Arabidopsis, a plant-specific mechanism called RNA–directed DNA methylation (RdDM) is involved in heterochromatin silencing. Histone deacetylase HDA6 has been identified as a component of such machineries; however, its endogenous targets and the silencing mechanisms have not been analyzed globally. In this study, we investigated the silencing mechanism mediated by HDA6. Genome-wide transcript profiling revealed that t...

  9. Regulation of sonic hedgehog-GLI1 downstream target genes PTCH1, Cyclin D2, Plakoglobin, PAX6 and NKX2.2 and their epigenetic status in medulloblastoma and astrocytoma

    Directory of Open Access Journals (Sweden)

    Eberhart Charles G

    2010-11-01

    Full Text Available Abstract Background The Sonic hedgehog (Shh signaling pathway is critical for cell growth and differentiation. Impairment of this pathway can result in both birth defects and cancer. Despite its importance in cancer development, the Shh pathway has not been thoroughly investigated in tumorigenesis of brain tumors. In this study, we sought to understand the regulatory roles of GLI1, the immediate downstream activator of the Shh signaling pathway on its downstream target genes PTCH1, Cyclin D2, Plakoglobin, NKX2.2 and PAX6 in medulloblastoma and astrocytic tumors. Methods We silenced GLI1 expression in medulloblastoma and astrocytic cell lines by transfection of siRNA against GLI1. Subsequently, we performed RT-PCR and quantitative real time RT-PCR (qRT-PCR to assay the expression of downstream target genes PTCH1, Cyclin D2, Plakoglobin, NKX2.2 and PAX6. We also attempted to correlate the pattern of expression of GLI1 and its regulated genes in 14 cell lines and 41 primary medulloblastoma and astrocytoma tumor samples. We also assessed the methylation status of the Cyclin D2 and PTCH1 promoters in these 14 cell lines and 58 primary tumor samples. Results Silencing expression of GLI1 resulted up-regulation of all target genes in the medulloblastoma cell line, while only PTCH1 was up-regulated in astrocytoma. We also observed methylation of the cyclin D2 promoter in a significant number of astrocytoma cell lines (63% and primary astrocytoma tumor samples (32%, but not at all in any medulloblastoma samples. PTCH1 promoter methylation was less frequently observed than Cyclin D2 promoter methylation in astrocytomas, and not at all in medulloblastomas. Conclusions Our results demonstrate different regulatory mechanisms of Shh-GLI1 signaling. These differences vary according to the downstream target gene affected, the origin of the tissue, as well as epigenetic regulation of some of these genes.

  10. TBC2target: A Resource of Predicted Target Genes of Tea Bioactive Compounds

    Directory of Open Access Journals (Sweden)

    Shihua Zhang

    2018-02-01

    Full Text Available Tea is one of the most popular non-alcoholic beverages consumed worldwide. Numerous bioactive constituents of tea were confirmed to possess healthy benefits via the mechanisms of regulating gene expressions or protein activities. However, a complete interacting profile between tea bioactive compounds (TBCs and their target genes is lacking, which put an obstacle in the study of healthy function of tea. To fill this gap, we developed a database of target genes of TBCs (TBC2target, http://camellia.ahau.edu.cn/TBC2target based on a pharmacophore mapping approach. In TBC2target, 6,226 interactions between 240 TBCs and 673 target genes were documented. TBC2target contains detailed information about each interacting entry, such as TBC, CAS number, PubChem CID, source of compound (e.g., green, black, compound type, target gene(s of TBC, gene symbol, gene ID, ENSEMBL ID, PDB ID, TBC bioactivity and the reference. Using the TBC-target associations, we constructed a bipartite network and provided users the global network and local sub-network visualization and topological analyses. The entire database is free for online browsing, searching and downloading. In addition, TBC2target provides a BLAST search function to facilitate use of the database. The particular strengths of TBC2target are the inclusion of the comprehensive TBC-target interactions, and the capacity to visualize and analyze the interacting networks, which may help uncovering the beneficial effects of tea on human health as a central resource in tea health community.

  11. TBC2target: A Resource of Predicted Target Genes of Tea Bioactive Compounds.

    Science.gov (United States)

    Zhang, Shihua; Zhang, Liang; Wang, Yijun; Yang, Jian; Liao, Mingzhi; Bi, Shoudong; Xie, Zhongwen; Ho, Chi-Tang; Wan, Xiaochun

    2018-01-01

    Tea is one of the most popular non-alcoholic beverages consumed worldwide. Numerous bioactive constituents of tea were confirmed to possess healthy benefits via the mechanisms of regulating gene expressions or protein activities. However, a complete interacting profile between tea bioactive compounds (TBCs) and their target genes is lacking, which put an obstacle in the study of healthy function of tea. To fill this gap, we developed a database of target genes of TBCs (TBC2target, http://camellia.ahau.edu.cn/TBC2target) based on a pharmacophore mapping approach. In TBC2target, 6,226 interactions between 240 TBCs and 673 target genes were documented. TBC2target contains detailed information about each interacting entry, such as TBC, CAS number, PubChem CID, source of compound (e.g., green, black), compound type, target gene(s) of TBC, gene symbol, gene ID, ENSEMBL ID, PDB ID, TBC bioactivity and the reference. Using the TBC-target associations, we constructed a bipartite network and provided users the global network and local sub-network visualization and topological analyses. The entire database is free for online browsing, searching and downloading. In addition, TBC2target provides a BLAST search function to facilitate use of the database. The particular strengths of TBC2target are the inclusion of the comprehensive TBC-target interactions, and the capacity to visualize and analyze the interacting networks, which may help uncovering the beneficial effects of tea on human health as a central resource in tea health community.

  12. High-fidelity Glucagon-CreER mouse line generated by CRISPR-Cas9 assisted gene targeting

    Directory of Open Access Journals (Sweden)

    Amanda M. Ackermann

    2017-03-01

    Full Text Available Objective: α-cells are the second most prominent cell type in pancreatic islets and are responsible for producing glucagon to increase plasma glucose levels in times of fasting. α-cell dysfunction and inappropriate glucagon secretion occur in both type 1 and type 2 diabetes. Thus, there is growing interest in studying both normal function and pathophysiology of α-cells. However, tools to target gene ablation or activation specifically of α-cells have been limited, compared to those available for β-cells. Previous Glucagon-Cre and Glucagon-CreER transgenic mouse lines have suffered from transgene silencing, and the only available Glucagon-CreER “knock-in” mouse line results in glucagon haploinsufficiency, which can confound the interpretation of gene deletion analyses. Therefore, we sought to develop a Glucagon-CreERT2 mouse line that would maintain normal glucagon expression and would be less susceptible to transgene silencing. Methods: We utilized CRISPR-Cas9 technology to insert an IRES-CreERT2 sequence into the 3′ UTR of the Glucagon (Gcg locus in mouse embryonic stem cells (ESCs. Targeted ESC clones were then injected into mouse blastocysts to obtain Gcg-CreERT2 mice. Recombination efficiency in GCG+ pancreatic α-cells and glucagon-like peptide 1 positive (GLP1+ enteroendocrine L-cells was measured in Gcg-CreERT2;Rosa26-LSL-YFP mice injected with tamoxifen during fetal development and adulthood. Results: Tamoxifen injection of Gcg-CreERT2;Rosa26-LSL-YFP mice induced high recombination efficiency of the Rosa26-LSL-YFP locus in perinatal and adult α-cells (88% and 95%, respectively, as well as in first-wave fetal α-cells (36% and adult enteroendocrine L-cells (33%. Mice homozygous for the Gcg-CreERT2 allele were phenotypically normal. Conclusions: We successfully derived a Gcg-CreERT2 mouse line that expresses CreERT2 in pancreatic α-cells and enteroendocrine L-cells without disrupting preproglucagon gene expression. These mice

  13. An albumin-mediated cholesterol design-based strategy for tuning siRNA pharmacokinetics and gene silencing

    DEFF Research Database (Denmark)

    Bienk, Konrad; Hvam, Michael Lykke; Pakula, Malgorzata Maria

    2016-01-01

    /2 12 min (naked) to t1/2 45 min (single cholesteryl) and t1/2 71 min (double cholesteryl) using fluorescent live bioimaging. The biodistribution showed increased accumulation in the liver for the double cholesteryl modified siRNA that correlated with an increase in hepatic Factor VII gene silencing......HSA/siRNA complex exhibited reduced nuclease degradation and reduced induction of TNF-α production by human peripheral blood mononuclear cells. The increased solubility of heavily cholesteryl modified siRNA in the presence of rHSA facilitated duplex annealing and consequent interaction that allowed in vivo studies...

  14. Gene-silencing effects of anti-survivin siRNA delivered by RGDV-functionalized nanodiamond carrier in the breast carcinoma cell line MCF-7.

    Science.gov (United States)

    Bi, Yanzhao; Zhang, Yifan; Cui, Chunying; Ren, Lulu; Jiang, Xueyun

    Nanodiamond (ND) is a renowned material in nonviral small interfering RNA (siRNA) carrier field due to its unique physical, chemical, and biological properties. In our previous work, it was proven that ND could deliver siRNA into cells efficiently and downregulate the expression of desired protein. However, synthesizing a high-efficient tumor-targeting carrier using ND is still a challenge. In this study, a novel carrier, NDCONH(CH 2 ) 2 NH-VDGR, was synthesized for siRNA delivery, and its properties were characterized with methods including Fourier transform infrared spectrometry, transmission electron microscopy, scanning electron microscopy, gel retardation assay, differential scanning calorimetry, confocal microscopy, releasing test, real-time polymerase chain reaction (PCR) assay, enzyme-linked immunosorbent assay (ELISA), flow cytometry, cytotoxicity assay, and gene-silencing efficacy assay in vitro and in vivo. The mechanism of NDCONH(CH 2 ) 2 NH-VDGR/survivin-siRNA-induced tumor apoptosis was evaluated via flow cytometer assay using Annexin V-fluorescein isothiocyanate/propidium iodide staining method. The NDCONH(CH 2 ) 2 NH-VDGR/survivin-siRNA nanoparticle with 60-110 nm diameter and 35.65±3.90 mV zeta potential was prepared. For real-time PCR assay, the results showed that the expression of survivin mRNA was reduced to 46.77%±6.3%. The expression of survivin protein was downregulated to 48.49%±2.25%, as evaluated by ELISA assay. MTT assay showed that NDCONH(CH 2 ) 2 NH-VDGR/survivin-siRNA had an inhibitory effect on MCF-7 cell proliferation. According to these results, the survivin-siRNA could be delivered, transported, and released stably, which benefits in increasing the gene-silencing effect. Therefore, as an siRNA carrier, NDCONH(CH 2 ) 2 NH-VDGR was suggested to be used in siRNA delivery system and in cancer treatments.

  15. Silencing of BCR/ABL Chimeric Gene in Human Chronic Myelogenous Leukemia Cell Line K562 by siRNA-Nuclear Export Signal Peptide Conjugates.

    Science.gov (United States)

    Shinkai, Yasuhiro; Kashihara, Shinichi; Minematsu, Go; Fujii, Hirofumi; Naemura, Madoka; Kotake, Yojiro; Morita, Yasutaka; Ohnuki, Koichiro; Fokina, Alesya A; Stetsenko, Dmitry A; Filichev, Vyacheslav V; Fujii, Masayuki

    2017-06-01

    Herein we described the synthesis of siRNA-NES (nuclear export signal) peptide conjugates by solid phase fragment coupling and the application of them to silencing of bcr/abl chimeric gene in human chronic myelogenous leukemia cell line K562. Two types of siRNA-NES conjugates were prepared, and both sense strands at 5' ends were covalently linked to a NES peptide derived from TFIIIA and HIV-1 REV, respectively. Significant enhancement of silencing efficiency was observed for both of them. siRNA-TFIIIA NES conjugate suppressed the expression of BCR/ABL gene to 8.3% at 200 nM and 11.6% at 50 nM, and siRNA-HIV-1REV NES conjugate suppressed to 4.0% at 200 nM and 6.3% at 50 nM, whereas native siRNA suppressed to 36.3% at 200 nM and 30.2% at 50 nM. We could also show complex of siRNA-NES conjugate and designed amphiphilic peptide peptideβ7 could be taken up into cells with no cytotoxicity and showed excellent silencing efficiency. We believe that the complex siRNA-NES conjugate and peptideβ7 is a promising candidate for in vivo use and therapeutic applications.

  16. Transcriptional changes in epigenetic modifiers associated with gene silencing in the intestine of the sea cucumber, Apostichopus japonicus (Selenka), during aestivation

    Science.gov (United States)

    Wang, Tianming; Yang, Hongsheng; Zhao, Huan; Chen, Muyan; Wang, Bing

    2011-11-01

    The sea cucumber, Apostichopus japonicus, undergoes aestivation to improve survival during periods of high-temperature. During aestivation, the metabolic rate is depressed to reduce the consumption of reserved energy. We evaluated the role of epigenetic modification on global gene silencing during metabolic rate depression in the sea cucumber. We compared the expression of epigenetic modifiers in active and aestivating sea cucumbers. The expression of three genes involved in DNA methylation and chromatin remodeling (DNA (cytosine-5)-methyltransferase 1, Methyl-CpG-binding domain protein 2), and Chromodomain-helicase-DNA-binding protein 5) was significantly higher during aestivation (Days 20 and 40). Similarly, we observed an increase in the expression of genes involved in histone acetylation (Histone deacetylase 3) and Histone-binding protein RBBP4) during the early (Days 5 and 10) and late phases (Days 20 and 40) of aestivation. There was no change in the expression of KAT2B, a histone acetyltransferase. However, the expression of histone methylation associated modifiers (Histone-arginine methyltransferase CARMER and Histone-lysine N-methyltransferase MLL5) was significantly higher after 5 d in the aestivating group. The results suggest that the expression of epigenetic modifiers involved in DNA methylation, chromatin remodeling, histone acetylation, and histone methylation is upregulated during aestivation. We hypothesize that these changes regulate global gene silencing during aestivation in A. japonicus.

  17. Gene transfer technology and genetic radioisotope targeting therapy

    International Nuclear Information System (INIS)

    Wang Jiaqiong; Wang Zizheng

    2004-01-01

    With deeper cognition about mechanisms of disease at the cellular and molecular level, gene therapy has become one of the most important research fields in medical molecular biology at present. Gene transfer technology plays an important role during the course of gene therapy, and further improvement should be made about vectors carrying target gene sequences. Also, gene survey is needed during gene therapy, and gene imaging is the most effective method. The combination of gene therapy and targeted radiotherapy, that is, 'Genetic Radioisotope Targeting Therapy', will be a novel approach to tumor gene therapy

  18. Nicotiana plumbaginifolia plants silenced for the ATP-binding cassette transporter gene NpPDR1 show increased susceptibility to a group of fungal and oomycete pathogens.

    Science.gov (United States)

    Bultreys, Alain; Trombik, Tomasz; Drozak, Anna; Boutry, Marc

    2009-09-01

    SUMMARY The behaviour of Nicotiana plumbaginifolia plants silenced for the ATP-binding cassette transporter gene NpPDR1 was investigated in response to fungal and oomycete infections. The importance of NpPDR1 in plant defence was demonstrated for two organs in which NpPDR1 is constitutively expressed: the roots and the petal epidermis. The roots of the plantlets of two lines silenced for NpPDR1 expression were clearly more sensitive than those of controls to the fungal pathogens Botrytis cinerea, Fusarium oxysporum sp., F. oxysporum f. sp. nicotianae, F. oxysporum f. sp. melonis and Rhizoctonia solani, as well as to the oomycete pathogen Phytophthora nicotianae race 0. The Ph gene-linked resistance of N. plumbaginifolia to P. nicotianae race 0 was totally ineffective in NpPDR1-silenced lines. In addition, the petals of the NpPDR1-silenced lines were spotted 15%-20% more rapidly by B. cinerea than were the controls. The rapid induction (after 2-4 days) of NpPDR1 expression in N. plumbaginifolia and N. tabacum mature leaves in response to pathogen presence was demonstrated for the first time with fungi and one oomycete: R. solani, F. oxysporum and P. nicotianae. With B. cinerea, such rapid expression was not observed in healthy mature leaves. NpPDR1 expression was not observed during latent infections of B. cinerea in N. plumbaginifolia and N. tabacum, but was induced when conditions facilitated B. cinerea development in leaves, such as leaf ageing or an initial root infection. This work demonstrates the increased sensitivity of NpPDR1-silenced N. plumbaginifolia plants to all of the fungal and oomycete pathogens investigated.

  19. Novel system uses probasin-based promoter, transcriptional silencers and amplification loop to induce high-level prostate expression

    Directory of Open Access Journals (Sweden)

    Yu Hong

    2007-02-01

    Full Text Available Abstract Background Despite several effective treatment options available for prostate cancer, it remains the second leading cause of cancer death in American men. Thus, there is a great need for new treatments to improve outcomes. One such strategy is to eliminate cancer through the expression of cytotoxic genes specifically in prostate cells by gene therapy vectored delivery. To prevent systemic toxicity, tissue- and/or cancer-specific gene expression is required. However, the use of tissue- or cancer-specific promoters to target transgene expression has been hampered by their weak activity. Results To address this issue, we have developed a regulation strategy that includes feedback amplification of gene expression along with a differentially suppressible tetracycline regulated expression system (DiSTRES. By differentially suppressing expression of the tetracycline-regulated transcriptional activator (tTA and silencer (tTS genes based on the cell origin, this leads to the activation and silencing of the TRE promoter, respectively. In vitro transduction of LNCaP cells with Ad/GFPDiSTRES lead to GFP expression levels that were over 30-fold higher than Ad/CMV-GFP. Furthermore, Ad/FasL-GFPDiSTRES demonstrated cytotoxic effects in prostate cancer cells known to be resistant to Fas-mediated apoptosis. Conclusion Prostate-specific regulation from the DiSTRES system, therefore, serves as a promising new regulation strategy for future applications in the field of cancer gene therapy and gene therapy as a whole.

  20. Rescue of Metabolic Alterations in AR113Q Skeletal Muscle by Peripheral Androgen Receptor Gene Silencing

    Directory of Open Access Journals (Sweden)

    Elisa Giorgetti

    2016-09-01

    Full Text Available Spinal and bulbar muscular atrophy (SBMA, a progressive degenerative disorder, is caused by a CAG/glutamine expansion in the androgen receptor (polyQ AR. Recent studies demonstrate that skeletal muscle is an important site of toxicity that contributes to the SBMA phenotype. Here, we sought to identify critical pathways altered in muscle that underlie disease manifestations in AR113Q mice. This led to the unanticipated identification of gene expression changes affecting regulators of carbohydrate metabolism, similar to those triggered by denervation. AR113Q muscle exhibits diminished glycolysis, altered mitochondria, and an impaired response to exercise. Strikingly, the expression of genes regulating muscle energy metabolism is rescued following peripheral polyQ AR gene silencing by antisense oligonucleotides (ASO, a therapeutic strategy that alleviates disease. Our data establish the occurrence of a metabolic imbalance in SBMA muscle triggered by peripheral expression of the polyQ AR and indicate that alterations in energy utilization contribute to non-neuronal disease manifestations.

  1. Anti-viral RNA silencing: do we look like plants ?

    Directory of Open Access Journals (Sweden)

    Lecellier Charles-Henri

    2006-01-01

    Full Text Available Abstract The anti-viral function of RNA silencing was first discovered in plants as a natural manifestation of the artificial 'co-suppression', which refers to the extinction of endogenous gene induced by homologous transgene. Because silencing components are conserved among most, if not all, eukaryotes, the question rapidly arose as to determine whether this process fulfils anti-viral functions in animals, such as insects and mammals. It appears that, whereas the anti-viral process seems to be similarly conserved from plants to insects, even in worms, RNA silencing does influence the replication of mammalian viruses but in a particular mode: micro(miRNAs, endogenous small RNAs naturally implicated in translational control, rather than virus-derived small interfering (siRNAs like in other organisms, are involved. In fact, these recent studies even suggest that RNA silencing may be beneficial for viral replication. Accordingly, several large DNA mammalian viruses have been shown to encode their own miRNAs. Here, we summarize the seminal studies that have implicated RNA silencing in viral infection and compare the different eukaryotic responses.

  2. MicroRNA-145 Aggravates Hypoxia-Induced Injury by Targeting Rac1 in H9c2 Cells.

    Science.gov (United States)

    Wang, Ximing; Zhang, Yanxia; Wang, Hongshan; Zhao, Genshang; Fa, Xianen

    2017-01-01

    Myocardial infarction (MI) is a leading cause of morbidity and mortality. Here, we sought to explore the potential role and underlying mechanism of miR-145 in MI. H9c2 cells were cultured under persistent hypoxia to simulate MI. The hypoxia-induced injury was assessed on the basis of cell viability, migration, invasion and apoptosis. The expression of miR-145 was evaluated by qRT-PCR and the influence of aberrantly expressed miR-145 on H9c2 cells under hypoxia was also estimated. Utilizing bioinformatics methods, the target genes of miR-145 were verified by luciferase reporter assay. Then, effects of abnormally expressed target gene on miR-145 silenced H9c2 cells were assessed. Finally, the phosphorylation levels of key kinases in the phosphatidylinositol-3-kinase (PI3K)/AKT and the mitogen-activated protein kinase (MAPK)/extracellular signal-regulated kinase (ERK) pathways were detected by Western blot analysis. Hypoxia remarkably lowered viability, migration and invasion but promoted cell apoptosis. Meantime, the miR-145 level was up-regulated in H9c2 cells under hypoxia. Following experiments suggested that hypoxia-induced injury was exacerbated by miR-145 overexpression while was alleviated by miR-145 silence. Rac1 was predicted and further validated to be a target gene of miR-145. The influence of miR-145 silencing on H9c2 cells under hypoxia could be reversed by down-regulation of Rac1. Additionally, the phosphorylation levels of PI3K, AKT, MAPK and ERK were all elevated in miR-145 silenced cells and these alterations were reversed by down-regulation of Rac1. miR-145 silencing could protect H9c2 cells against hypoxia-induced injury by targeting Rac1, in which PI3K/AKT and MAPK/ERK pathways might be involved. © 2017 The Author(s). Published by S. Karger AG, Basel.

  3. 6-Thioguanine Reactivates Epigenetically Silenced Genes in Acute Lymphoblastic Leukemia Cells by Facilitating Proteasome-mediated Degradation of DNMT1

    OpenAIRE

    Yuan, Bifeng; Zhang, Jing; Wang, Hongxia; Xiong, Lei; Cai, Qian; Wang, Tina; Jacobsen, Steven; Pradhan, Sriharsa; Wang, Yinsheng

    2011-01-01

    Thiopurines including 6-thioguanine (SG), 6-mercaptopurine and azathioprine are effective anticancer agents with remarkable success in clinical practice, especially in effective treatment of acute lymphoblastic leukemia (ALL). SG is understood to act as a DNA hypomethylating agent in ALL cells, however, the underlying mechanism leading to global cytosine demethylation remains unclear. Here we report that SG treatment results in reactivation of epigenetically silenced genes in T leukemia cells...

  4. Mitochondrial damage and cholesterol storage in human hepatocellular carcinoma cells with silencing of UBIAD1 gene expression

    Directory of Open Access Journals (Sweden)

    Carlos R. Morales

    2014-01-01

    Full Text Available Heterozygous mutations in the UBIAD1 gene cause Schnyder corneal dystrophy characterized by abnormal cholesterol and phospholipid deposits in the cornea. Ubiad1 protein was recently identified as Golgi prenyltransferase responsible for biosynthesis of vitamin K2 and CoQ10, a key protein in the mitochondrial electron transport chain. Our study shows that silencing UBIAD1 in cultured human hepatocellular carcinoma cells causes dramatic morphological changes and cholesterol storage in the mitochondria, emphasizing an important role of UBIAD1 in mitochondrial function.

  5. The RNA silencing pathway: the bits and pieces that matter.

    Directory of Open Access Journals (Sweden)

    2005-07-01

    Full Text Available Cellular pathways are generally proposed on the basis of available experimental knowledge. The proposed pathways, however, may be inadequate to describe the phenomena they are supposed to explain. For instance, by means of concise mathematical models we are able to reveal shortcomings in the current description of the pathway of RNA silencing. The silencing pathway operates by cleaving siRNAs from dsRNA. siRNAs can associate with RISC, leading to the degradation of the target mRNA. We propose and analyze a few small extensions to the pathway: a siRNA degrading RNase, primed amplification of aberrant RNA pieces, and cooperation between aberrant RNA to trigger amplification. These extensions allow for a consistent explanation for various types of silencing phenomena, such as virus induced silencing, transgene and transposon induced silencing, and avoidance of self-reactivity, as well as for differences found between species groups.

  6. Therapeutic Silencing of Bcl-2 by Systemically Administered siRNA Nanotherapeutics Inhibits Tumor Growth by Autophagy and Apoptosis and Enhances the Efficacy of Chemotherapy in Orthotopic Xenograft Models of ER (− and ER (+ Breast Cancer

    Directory of Open Access Journals (Sweden)

    Ibrahim Tekedereli

    2013-01-01

    Full Text Available Bcl-2 is overexpressed in about a half of human cancers and 50–70% of breast cancer patients, thereby conferring resistance to conventional therapies and making it an excellent therapeutic target. Small interfering RNA (siRNA offers novel and powerful tools for specific gene silencing and molecularly targeted therapy. Here, we show that therapeutic silencing of Bcl-2 by systemically administered nanoliposomal (NL-Bcl-2 siRNA (0.15 mg siRNA/kg, intravenous twice a week leads to significant antitumor activity and suppression of growth in both estrogen receptor-negative (ER(− MDA-MB-231 and ER-positive (+ MCF7 breast tumors in orthotopic xenograft models (P < 0.05. A single intravenous injection of NL-Bcl-2-siRNA provided robust and persistent silencing of the target gene expression in xenograft tumors. NL-Bcl-2-siRNA treatment significantly increased the efficacy of chemotherapy when combined with doxorubicin in both MDA-MB-231 and MCF-7 animal models (P < 0.05. NL-Bcl-2-siRNA treatment-induced apoptosis and autophagic cell death, and inhibited cyclin D1, HIF1α and Src/Fak signaling in tumors. In conclusion, our data provide the first evidence that in vivo therapeutic targeting Bcl-2 by systemically administered nanoliposomal-siRNA significantly inhibits growth of both ER(− and ER(+ breast tumors and enhances the efficacy of chemotherapy, suggesting that therapeutic silencing of Bcl-2 by siRNA is a viable approach in breast cancers.

  7. Targeted DNA demethylation of the Arabidopsis genome using the human TET1 catalytic domain

    Science.gov (United States)

    Gallego-Bartolomé, Javier; Gardiner, Jason; Liu, Wanlu; Papikian, Ashot; Ghoshal, Basudev; Kuo, Hsuan Yu; Zhao, Jenny Miao-Chi; Jacobsen, Steven E.

    2018-01-01

    DNA methylation is an important epigenetic modification involved in gene regulation and transposable element silencing. Changes in DNA methylation can be heritable and, thus, can lead to the formation of stable epialleles. A well-characterized example of a stable epiallele in plants is fwa, which consists of the loss of DNA cytosine methylation (5mC) in the promoter of the FLOWERING WAGENINGEN (FWA) gene, causing up-regulation of FWA and a heritable late-flowering phenotype. Here we demonstrate that a fusion between the catalytic domain of the human demethylase TEN-ELEVEN TRANSLOCATION1 (TET1cd) and an artificial zinc finger (ZF) designed to target the FWA promoter can cause highly efficient targeted demethylation, FWA up-regulation, and a heritable late-flowering phenotype. Additional ZF–TET1cd fusions designed to target methylated regions of the CACTA1 transposon also caused targeted demethylation and changes in expression. Finally, we have developed a CRISPR/dCas9-based targeted demethylation system using the TET1cd and a modified SunTag system. Similar to the ZF–TET1cd fusions, the SunTag–TET1cd system is able to target demethylation and activate gene expression when directed to the FWA or CACTA1 loci. Our study provides tools for targeted removal of 5mC at specific loci in the genome with high specificity and minimal off-target effects. These tools provide the opportunity to develop new epialleles for traits of interest, and to reactivate expression of previously silenced genes, transgenes, or transposons. PMID:29444862

  8. Identification of novel target genes for safer and more specific control of root-knot nematodes from a pan-genome mining.

    Directory of Open Access Journals (Sweden)

    Etienne G J Danchin

    2013-10-01

    Full Text Available Root-knot nematodes are globally the most aggressive and damaging plant-parasitic nematodes. Chemical nematicides have so far constituted the most efficient control measures against these agricultural pests. Because of their toxicity for the environment and danger for human health, these nematicides have now been banned from use. Consequently, new and more specific control means, safe for the environment and human health, are urgently needed to avoid worldwide proliferation of these devastating plant-parasites. Mining the genomes of root-knot nematodes through an evolutionary and comparative genomics approach, we identified and analyzed 15,952 nematode genes conserved in genomes of plant-damaging species but absent from non target genomes of chordates, plants, annelids, insect pollinators and mollusks. Functional annotation of the corresponding proteins revealed a relative abundance of putative transcription factors in this parasite-specific set compared to whole proteomes of root-knot nematodes. This may point to important and specific regulators of genes involved in parasitism. Because these nematodes are known to secrete effector proteins in planta, essential for parasitism, we searched and identified 993 such effector-like proteins absent from non-target species. Aiming at identifying novel targets for the development of future control methods, we biologically tested the effect of inactivation of the corresponding genes through RNA interference. A total of 15 novel effector-like proteins and one putative transcription factor compatible with the design of siRNAs were present as non-redundant genes and had transcriptional support in the model root-knot nematode Meloidogyne incognita. Infestation assays with siRNA-treated M. incognita on tomato plants showed significant and reproducible reduction of the infestation for 12 of the 16 tested genes compared to control nematodes. These 12 novel genes, showing efficient reduction of parasitism when

  9. Silencing of the Wnt transcription factor TCF4 sensitizes colorectal cancer cells to (chemo-) radiotherapy

    Science.gov (United States)

    Kendziorra, Emil; Ahlborn, Kerstin; Spitzner, Melanie; Rave-Fränk, Margret; Emons, Georg; Gaedcke, Jochen; Kramer, Frank; Wolff, Hendrik A.; Becker, Heinz; Beissbarth, Tim; Ebner, Reinhard; Ghadimi, B.Michael; Pukrop, Tobias; Ried, Thomas; Grade, Marian

    2011-01-01

    A considerable percentage of rectal cancers are resistant to standard preoperative chemoradiotherapy. Because patients with a priori-resistant tumors do not benefit from multimodal treatment, understanding and overcoming this resistance remains of utmost clinical importance. We recently reported overexpression of the Wnt transcription factor TCF4, also known as TCF7L2, in rectal cancers that were resistant to 5-fluorouracil-based chemoradiotherapy. Because Wnt signaling has not been associated with treatment response, we aimed to investigate whether TCF4 mediates chemoradioresistance. RNA interference-mediated silencing of TCF4 was employed in three colorectal cancer (CRC) cell lines, and sensitivity to (chemo-) radiotherapy was assessed using a standard colony formation assay. Silencing of TCF4 caused a significant sensitization of CRC cells to clinically relevant doses of X-rays. This effect was restricted to tumor cells with high T cell factor (TCF) reporter activity, presumably in a β-catenin-independent manner. Radiosensitization was the consequence of (i) a transcriptional deregulation of Wnt/TCF4 target genes, (ii) a silencing-induced G2/M phase arrest, (iii) an impaired ability to adequately halt cell cycle progression after radiation and (iv) a compromised DNA double strand break repair as assessed by γH2AX staining. Taken together, our results indicate a novel mechanism through which the Wnt transcription factor TCF4 mediates chemoradioresistance. Moreover, they suggest that TCF4 is a promising molecular target to sensitize resistant tumor cells to (chemo-) radiotherapy. PMID:21983179

  10. Effect of Circular RNA UBAP2 Silencing on Proliferation and Invasion of Human Lung Cancer A549 Cells and Its Mechanism

    Directory of Open Access Journals (Sweden)

    Yujing YIN

    2017-12-01

    Full Text Available Background and objective It has been proven that circular RNAs (circRNAs play an important role on the process of many types cancer and circUBAP2 was a cancer-promoting circRNA, however, the role and mechanism in lung cancer was not clear. The aim of this study is to investigate the effects of circUBAP2 on cell proliferation and invasion of human lung cancer A549 cells. Methods CCK-8 assay was employed to detect the effect of circUBAP2 sliencing on cell proliferation of A549 cells. Fow cytometry was applied to detect the impact of circUBAP2 sliencing on cell cycle and cell anoikis, and Transwell invasion assay was applied to determine cell invasion of A549 cells. We also employed Western blot and Real-time PCR to determine the expressions of CDK6, cyclin D1, p27 and c-IAP1, Bcl-2, Survivin, Bax, FAK, Rac1 and MMP2, and the activities of JNK and ERK1/2, luciferase report gene assay was used to detect the targets. Results CCK-8 assay showed that the inhibition of cell proliferation in the circUBAP2-siRNA group compared to untreated group and siRNA control group. Results of cell cycle detected by flow cytometry showed that cell cycle arrestd at G0/G1 after circUBAP2 silencing, cell apoptosis rate increased also. We also found that after circUBAP2 silencing, cell invasion of A549 cells was significantly inhibited. Western blot and Real-time PCR results showed that expression of CDK6, cyclin D1, c-IAP1, Bcl-2, Survivin, FAK, Rac1 and MMP2 were down-regulated, and the expression of p27 and Bax were up-regulated. Moreover, the activities of JNK and ERK1/2 were inhibited because of circUBAP2 silencing, the target genes were miR-339-5p, miR-96-3p and miR-135b-3p. Conclusion CircUBAP2 plays an important role in the proliferation and invasion of human lung cancer. Silencing of circUBAP2 might be a novel target for molecular targeted therapy of patients with lung cancer.

  11. MeCP2 silencing of LncRNA H19 controls hepatic stellate cell proliferation by targeting IGF1R

    International Nuclear Information System (INIS)

    Yang, Jing-Jing; Liu, Li-Ping; Tao, Hui; Hu, Wei; Shi, Peng; Deng, Zi-Yu; Li, Jun

    2016-01-01

    Highlights: • H19 plays a key role in HSCs proliferation and fibrosis. • MeCP2/H19 axis involvement in HSCs activation and fibrosis. • MeCP2 negative controls H19 expression in activated HSCs. • Identification of IGF1R as new target of H19 in HSC. - Abstract: Methyl-CpG-binding protein 2 (MeCP2) plays a key role in liver fibrosis. However, the potential mechanism of MeCP2 in liver fibrosis remains unclear. Early reports suggest that LncRNA H19 is important epigenetic regulator with critical roles in cell proliferation, but its role in hepatic fibrosis remains elusive. Sprague-Dawley rats liver fibrosis was generated by 12-weeks treatment with CCl 4 intraperitoneal injection. HSC-T6 cells were used in vitro study. The expression levels of MeCP2, H19, IGF1R, α-SMA, and Col1A1 were estimated by Western blotting, qRT-PCR and Immunohistochemistry. HSC-T6 cells were transfected with MeCP2-siRNA, pEGF-C1-MeCP2, pEX-3-H19, and H19-siRNA. Finally, cell proliferation ability was assessed by the MTT assay. Here, we found that H19 was significantly down-regulated in HSCs and fibrosis tissues, and an opposite pattern is observed for MeCP2 and IGF1R. Silencing of MeCP2 blocked HSCs proliferation. Knockdown of MeCP2 elevated H19 expression in activated HSCs, and over-expression of MeCP2 inhibited H19 expression in activated HSCs. Moreover, we investigated the effect of H19 on IGF1R expression. Overexpression of H19 in HSCs repressed the expression of IGF1R, and an opposite pattern is observed for H19 silenced. In addition, we reported that overexpression of H19 inhibited the TGF-β1-induced proliferation of HSCs. Furthermore, MeCP2 negative regulation of H19 by targeting the protein IGF1R. Taken together, these results demonstrated that MeCP2 silencing of H19 can alter the IGF1R overexpression, thus contributing to HSCs proliferation. These data could suggest the development of combination therapies that target the MeCP2.

  12. RNA Interference Screen to Identify Pathways That Enhance or Reduce Nonviral Gene Transfer During Lipofection

    OpenAIRE

    Barker, Gregory A; Diamond, Scott L

    2008-01-01

    Some barriers to DNA lipofection are well characterized; however, there is as yet no method of finding unknown pathways that impact the process. A druggable genome small-interfering RNA (siRNA) screen against 5,520 genes was tested for its effect on lipofection of human aortic endothelial cells (HAECs). We found 130 gene targets which, when silenced by pooled siRNAs (three siRNAs per gene), resulted in enhanced luminescence after lipofection (86 gene targets showed reduced expression). In con...

  13. Silencing the epigenetic silencer KDM4A for TRAIL and DR5 simultaneous induction and antitumor therapy.

    Science.gov (United States)

    Wang, Junjian; Wang, Haibin; Wang, Ling-Yu; Cai, Demin; Duan, Zhijian; Zhang, Yanhong; Chen, Peng; Zou, June X; Xu, Jianzhen; Chen, Xinbin; Kung, Hsing-Jien; Chen, Hong-Wu

    2016-11-01

    Recombinant TRAIL and agonistic antibodies to death receptors (DRs) have been in clinical trial but displayed limited anti-cancer efficacy. Lack of functional DR expression in tumors is a major limiting factor. We report here that chromatin regulator KDM4A/JMJD2A, not KDM4B, has a pivotal role in silencing tumor cell expression of both TRAIL and its receptor DR5. In TRAIL-sensitive and -resistant cancer cells of lung, breast and prostate, KDM4A small-molecule inhibitor compound-4 (C-4) or gene silencing strongly induces TRAIL and DR5 expression, and causes TRAIL-dependent apoptotic cell death. KDM4A inhibition also strongly sensitizes cells to TRAIL. C-4 alone potently inhibits tumor growth with marked induction of TRAIL and DR5 expression in the treated tumors and effectively sensitizes them to the newly developed TRAIL-inducer ONC201. Mechanistically, C-4 does not appear to act through the Akt-ERK-FOXO3a pathway. Instead, it switches histone modifying enzyme complexes at promoters of TRAIL and DR5 transcriptional activator CHOP gene by dissociating KDM4A and nuclear receptor corepressor (NCoR)-HDAC complex and inducing the recruitment of histone acetylase CBP. Thus, our results reveal KDM4A as a key epigenetic silencer of TRAIL and DR5 in tumors and establish inhibitors of KDM4A as a novel strategy for effectively sensitizing tumors to TRAIL pathway-based therapeutics.

  14. Evasion of short interfering RNA-directed antiviral silencing in Musa acuminata persistently infected with six distinct banana streak pararetroviruses.

    Science.gov (United States)

    Rajeswaran, Rajendran; Seguin, Jonathan; Chabannes, Matthieu; Duroy, Pierre-Olivier; Laboureau, Nathalie; Farinelli, Laurent; Iskra-Caruana, Marie-Line; Pooggin, Mikhail M

    2014-10-01

    Vegetatively propagated crop plants often suffer from infections with persistent RNA and DNA viruses. Such viruses appear to evade the plant defenses that normally restrict viral replication and spread. The major antiviral defense mechanism is based on RNA silencing generating viral short interfering RNAs (siRNAs) that can potentially repress viral genes posttranscriptionally through RNA cleavage and transcriptionally through DNA cytosine methylation. Here we examined the RNA silencing machinery of banana plants persistently infected with six pararetroviruses after many years of vegetative propagation. Using deep sequencing, we reconstructed consensus master genomes of the viruses and characterized virus-derived and endogenous small RNAs. Consistent with the presence of endogenous siRNAs that can potentially establish and maintain DNA methylation, the banana genomic DNA was extensively methylated in both healthy and virus-infected plants. A novel class of abundant 20-nucleotide (nt) endogenous small RNAs with 5'-terminal guanosine was identified. In all virus-infected plants, 21- to 24-nt viral siRNAs accumulated at relatively high levels (up to 22% of the total small RNA population) and covered the entire circular viral DNA genomes in both orientations. The hotspots of 21-nt and 22-nt siRNAs occurred within open reading frame (ORF) I and II and the 5' portion of ORF III, while 24-nt siRNAs were more evenly distributed along the viral genome. Despite the presence of abundant viral siRNAs of different size classes, the viral DNA was largely free of cytosine methylation. Thus, the virus is able to evade siRNA-directed DNA methylation and thereby avoid transcriptional silencing. This evasion of silencing likely contributes to the persistence of pararetroviruses in banana plants. We report that DNA pararetroviruses in Musa acuminata banana plants are able to evade DNA cytosine methylation and transcriptional gene silencing, despite being targeted by the host silencing

  15. Characterisation of genome-wide PLZF/RARA target genes.

    Directory of Open Access Journals (Sweden)

    Salvatore Spicuglia

    Full Text Available The PLZF/RARA fusion protein generated by the t(11;17(q23;q21 translocation in acute promyelocytic leukaemia (APL is believed to act as an oncogenic transcriptional regulator recruiting epigenetic factors to genes important for its transforming potential. However, molecular mechanisms associated with PLZF/RARA-dependent leukaemogenesis still remain unclear.We searched for specific PLZF/RARA target genes by ChIP-on-chip in the haematopoietic cell line U937 conditionally expressing PLZF/RARA. By comparing bound regions found in U937 cells expressing endogenous PLZF with PLZF/RARA-induced U937 cells, we isolated specific PLZF/RARA target gene promoters. We next analysed gene expression profiles of our identified target genes in PLZF/RARA APL patients and analysed DNA sequences and epigenetic modification at PLZF/RARA binding sites. We identify 413 specific PLZF/RARA target genes including a number encoding transcription factors involved in the regulation of haematopoiesis. Among these genes, 22 were significantly down regulated in primary PLZF/RARA APL cells. In addition, repressed PLZF/RARA target genes were associated with increased levels of H3K27me3 and decreased levels of H3K9K14ac. Finally, sequence analysis of PLZF/RARA bound sequences reveals the presence of both consensus and degenerated RAREs as well as enrichment for tissue-specific transcription factor motifs, highlighting the complexity of targeting fusion protein to chromatin. Our study suggests that PLZF/RARA directly targets genes important for haematopoietic development and supports the notion that PLZF/RARA acts mainly as an epigenetic regulator of its direct target genes.

  16. Low-weight polyethylenimine cross-linked 2-hydroxypopyl-ß-cyclodextrin and folic acid as an efficient and nontoxic siRNA carrier for gene silencing and tumor inhibition by VEGF siRNA

    Directory of Open Access Journals (Sweden)

    Li JM

    2013-06-01

    Full Text Available Jin-Ming Li, Yuan-Yuan Wang, Wei Zhang, Hua Su, Liang-Nian Ji, Zong-Wan Mao MOE Key Laboratory of Bioinorganic and Synthetic Chemistry, School of Chemistry and Chemical Engineering, Sun Yat-sen University, Guangzhou, People's Republic of China Background: Targeted delivery of small interfering RNA (siRNA has been regarded as one of the most important technologies for the development of siRNA therapeutics. However, the need for safe and efficient delivery systems is a barrier to further development of RNA interference therapeutics. In this work, a nontoxic and efficient siRNA carrier delivery system of low molecular weight polyethyleneimine (PEI-600 Da cross-linked with 2-hydroxypopyl-β-cyclodextrin (HP-β-CD and folic acid (FA was synthesized for biomedical application. Methods: The siRNA carrier was prepared using a simple method and characterized by nuclear magnetic resonance and Fourier transform infrared spectroscopy. The siRNA carrier nanoparticles were characterized in terms of morphology, size and zeta potential, stability, efficiency of delivery, and gene silencing efficiency in vitro and in vivo. Results: The siRNA carrier was synthesized successfully. It showed good siRNA binding capacity and ability to protect siRNA. Further, the toxicity of the carrier measured in vitro and in vivo appeared to be negligible, probably because of degradation of the low molecular weight PEI and HP-β-CD in the cytosol. Flow cytometry and confocal microscopy confirmed that the FA receptor-mediated endocytosis of the FA-HP-β-CD-PEI/siRNA complexes was greater than that of the HP-β-CD-PEI/siRNA complexes in FA receptor-enriched HeLa cells. The FA-HP-β-CD-PEI/siRNA complexes also demonstrated excellent gene silencing efficiency in vitro (in the range of 90%, and reduced vascular endothelial growth factor (VEGF protein expression in the presence of 20% serum. FA-HP-β-CD-PEI/siRNA complexes administered via tail vein injection resulted in marked

  17. Biosafety research for non-target organism risk assessment of RNAi-based GE plants

    Science.gov (United States)

    Roberts, Andrew F.; Devos, Yann; Lemgo, Godwin N. Y.; Zhou, Xuguo

    2015-01-01

    RNA interference, or RNAi, refers to a set of biological processes that make use of conserved cellular machinery to silence genes. Although there are several variations in the source and mechanism, they are all triggered by double stranded RNA (dsRNA) which is processed by a protein complex into small, single stranded RNA, referred to as small interfering RNAs (siRNA) with complementarity to sequences in genes targeted for silencing. The use of the RNAi mechanism to develop new traits in plants has fueled a discussion about the environmental safety of the technology for these applications, and this was the subject of a symposium session at the 13th ISBGMO in Cape Town, South Africa. This paper continues that discussion by proposing research areas that may be beneficial for future environmental risk assessments of RNAi-based genetically modified plants, with a particular focus on non-target organism assessment. PMID:26594220

  18. Post-transcriptional silencing of flavonol synthase mRNA in tobacco leads to fruits with arrested seed set.

    Directory of Open Access Journals (Sweden)

    Monika Mahajan

    Full Text Available Flavonoids are synthesized by phenylpropanoid pathway. They are known to participate in large number of physiological and biochemical processes in plants. Parthenocarpy and male sterility has earlier been reported by silencing chalcone synthase (CHS encoding gene. Silencing of CHS has blocked the synthesis of most of useful flavonoids including flavan-3-ols and flavonols. Also, these studies could not identify whether parthenocarpy/male sterility were due to lack of flavan-3-ols or flavonols or both. Flavonol synthase (FLS is an important enzyme of flavonoid pathway that catalyzes the formation of flavonols. In this article, we propose a novel strategy towards the generation of seedless or less-seeded fruits by downregulation of flavonol biosynthesis in tobacco (Nicotiana tabacum cv Xanthi through post-transcriptional gene silencing (PTGS of FLS encoding mRNA. The FLS silenced lines were observed for 20-80% reduction in FLS encoding gene expression and 25-93% reduction in flavonol (quercetin content. Interestingly, these FLS silenced tobacco lines also showed reduction in their anthocyanidins content. While the content of flavan-3-ols (catechin, epi-catechin and epi-gallocatechin was found to be increased in FLS silenced lines. The delayed flowering in FLS silenced lines could be due to decrease in level of indole acetic acid (IAA at apical region of their shoots. Furthermore, the pollen germination was hampered and pollens were unable to produce functional pollen tube in FLS silenced tobacco lines. Pods of FLS silenced lines contained significantly less number of seeds. The in vitro and in vivo studies where 1 µM quercetin was supplied to germination media, documented the restoration of normal pollen germination and pollen tube growth. This finding identified the role of flavonols particularly quercetin in pollen germination as well as in the regulation of plant fertility. Results also suggest a novel approach towards generation of seedless

  19. DNA demethylases target promoter transposable elements to positively regulate stress responsive genes in Arabidopsis.

    Science.gov (United States)

    Le, Tuan-Ngoc; Schumann, Ulrike; Smith, Neil A; Tiwari, Sameer; Au, Phil Chi Khang; Zhu, Qian-Hao; Taylor, Jennifer M; Kazan, Kemal; Llewellyn, Danny J; Zhang, Ren; Dennis, Elizabeth S; Wang, Ming-Bo

    2014-09-17

    DNA demethylases regulate DNA methylation levels in eukaryotes. Arabidopsis encodes four DNA demethylases, DEMETER (DME), REPRESSOR OF SILENCING 1 (ROS1), DEMETER-LIKE 2 (DML2), and DML3. While DME is involved in maternal specific gene expression during seed development, the biological function of the remaining DNA demethylases remains unclear. We show that ROS1, DML2, and DML3 play a role in fungal disease resistance in Arabidopsis. A triple DNA demethylase mutant, rdd (ros1 dml2 dml3), shows increased susceptibility to the fungal pathogen Fusarium oxysporum. We identify 348 genes differentially expressed in rdd relative to wild type, and a significant proportion of these genes are downregulated in rdd and have functions in stress response, suggesting that DNA demethylases maintain or positively regulate the expression of stress response genes required for F. oxysporum resistance. The rdd-downregulated stress response genes are enriched for short transposable element sequences in their promoters. Many of these transposable elements and their surrounding sequences show localized DNA methylation changes in rdd, and a general reduction in CHH methylation, suggesting that RNA-directed DNA methylation (RdDM), responsible for CHH methylation, may participate in DNA demethylase-mediated regulation of stress response genes. Many of the rdd-downregulated stress response genes are downregulated in the RdDM mutants nrpd1 and nrpe1, and the RdDM mutants nrpe1 and ago4 show enhanced susceptibility to F. oxysporum infection. Our results suggest that a primary function of DNA demethylases in plants is to regulate the expression of stress response genes by targeting promoter transposable element sequences.

  20. Effects of RNAi-mediated cathepsin L gene silencing on bionomics ...

    African Journals Online (AJOL)

    USER

    2010-08-02

    Aug 2, 2010 ... melanoma, gastric cancer, and pancreatic cancer. The main function of ... successfully applied in various areas of biological research, and its main ... molecule, the corresponding target gene mRNA is cut under RNA-induced ...

  1. Effective and specific in planta RNAi in cyst nematodes: expression interference of four parasitism genes reduces parasitic success.

    Science.gov (United States)

    Sindhu, Anoop S; Maier, Tom R; Mitchum, Melissa G; Hussey, Richard S; Davis, Eric L; Baum, Thomas J

    2009-01-01

    Cyst nematodes are highly evolved sedentary plant endoparasites that use parasitism proteins injected through the stylet into host tissues to successfully parasitize plants. These secretory proteins likely are essential for parasitism as they are involved in a variety of parasitic events leading to the establishment of specialized feeding cells required by the nematode to obtain nourishment. With the advent of RNA interference (RNAi) technology and the demonstration of host-induced gene silencing in parasites, a new strategy to control pests and pathogens has become available, particularly in root-knot nematodes. Plant host-induced silencing of cyst nematode genes so far has had only limited success but similarly should disrupt the parasitic cycle and render the host plant resistant. Additional in planta RNAi data for cyst nematodes are being provided by targeting four parasitism genes through host-induced RNAi gene silencing in transgenic Arabidopsis thaliana, which is a host for the sugar beet cyst nematode Heterodera schachtii. Here it is reported that mRNA abundances of targeted nematode genes were specifically reduced in nematodes feeding on plants expressing corresponding RNAi constructs. Furthermore, this host-induced RNAi of all four nematode parasitism genes led to a reduction in the number of mature nematode females. Although no complete resistance was observed, the reduction of developing females ranged from 23% to 64% in different RNAi lines. These observations demonstrate the relevance of the targeted parasitism genes during the nematode life cycle and, potentially more importantly, suggest that a viable level of resistance in crop plants may be accomplished in the future using this technology against cyst nematodes.

  2. [Construction and identification of eukaryotic plasmid pGC-silencer-U6/Neo/GFP/ABCG2].

    Science.gov (United States)

    Yu, Yanping; Zhang, Song; Kong, Weijia

    2010-09-01

    To construct three short hairpin RNA (shRNA) interference expression plasmid vectors of human ABCG2 gene, to assay the expression of ABCG2 in a human nasopharyngeal carcinoma (NPC) cell line, CEN-2 cell line, and to detect the RNAi effect of shRNA. Targeting ABCG2 gene sequence, three plasmid expression vectors coding for shRNA and a control vector containing random DNA fragment were constructed. The recombinant plasmids were amplified in Ecoli. DH5 and then identified by restriction digestion, PCR and sequencing. The recombinant plasmids were transfected into CEN-2 cells. ABCG2 expression was assayed by real-time quantitative PCR and Western blot. The construction of pGC-silencer-U6/Neo/GFP/ABCG2 was succeed. The shRNA plasmids significantly down-regulated the ABCG2 expression in CEN-2 cells, at both mRNA level and protein level. Recombinant plasmid 1 had the strongest effect compared with plasmids 2 and 3 (P < 0.05), with an inhibition ratio of 75% at the mRNA level and 68% at the protein level. pGC-silencer-U6/Neo/GFP/ABCG2 has been successfully constructed and it can down-regulate ABCG2 expression after transfected into CEN-2 cells, which could help further studies of ABCG2 functions CEN-2 cell line and contribute to the NPC gene therapy.

  3. Nymphal RNAi: systemic RNAi mediated gene knockdown in juvenile grasshopper

    Directory of Open Access Journals (Sweden)

    Dong Ying

    2005-10-01

    Full Text Available Abstract Background Grasshopper serves as important model system in neuroscience, development and evolution. Representatives of this primitive insect group are also highly relevant targets of pest control efforts. Unfortunately, the lack of genetics or gene specific molecular manipulation imposes major limitations to the study of grasshopper biology. Results We investigated whether juvenile instars of the grasshopper species Schistocerca americana are conducive to gene silencing via the systemic RNAi pathway. Injection of dsRNA corresponding to the eye colour gene vermilion into first instar nymphs triggered suppression of ommochrome formation in the eye lasting through two instars equivalent to 10–14 days in absolute time. QRT-PCR analysis revealed a two fold decrease of target transcript levels in affected animals. Control injections of EGFP dsRNA did not result in detectable phenotypic changes. RT-PCR and in situ hybridization detected ubiquitous expression of the grasshopper homolog of the dsRNA channel protein gene sid-1 in embryos, nymphs and adults. Conclusion Our results demonstrate that systemic dsRNA application elicits specific and long-term gene silencing in juvenile grasshopper instars. The conservation of systemic RNAi in the grasshopper suggests that this pathway can be exploited for gene specific manipulation of juvenile and adult instars in a wide range of primitive insects.

  4. The mechanism of gene targeting in human somatic cells.

    Directory of Open Access Journals (Sweden)

    Yinan Kan

    2014-04-01

    Full Text Available Gene targeting in human somatic cells is of importance because it can be used to either delineate the loss-of-function phenotype of a gene or correct a mutated gene back to wild-type. Both of these outcomes require a form of DNA double-strand break (DSB repair known as homologous recombination (HR. The mechanism of HR leading to gene targeting, however, is not well understood in human cells. Here, we demonstrate that a two-end, ends-out HR intermediate is valid for human gene targeting. Furthermore, the resolution step of this intermediate occurs via the classic DSB repair model of HR while synthesis-dependent strand annealing and Holliday Junction dissolution are, at best, minor pathways. Moreover, and in contrast to other systems, the positions of Holliday Junction resolution are evenly distributed along the homology arms of the targeting vector. Most unexpectedly, we demonstrate that when a meganuclease is used to introduce a chromosomal DSB to augment gene targeting, the mechanism of gene targeting is inverted to an ends-in process. Finally, we demonstrate that the anti-recombination activity of mismatch repair is a significant impediment to gene targeting. These observations significantly advance our understanding of HR and gene targeting in human cells.

  5. Gene Network Polymorphism Illuminates Loss and Retention of Novel RNAi Silencing Components in the Cryptococcus Pathogenic Species Complex.

    Directory of Open Access Journals (Sweden)

    Marianna Feretzaki

    2016-03-01

    Full Text Available RNAi is a ubiquitous pathway that serves central functions throughout eukaryotes, including maintenance of genome stability and repression of transposon expression and movement. However, a number of organisms have lost their RNAi pathways, including the model yeast Saccharomyces cerevisiae, the maize pathogen Ustilago maydis, the human pathogen Cryptococcus deuterogattii, and some human parasite pathogens, suggesting there may be adaptive benefits associated with both retention and loss of RNAi. By comparing the RNAi-deficient genome of the Pacific Northwest Outbreak C. deuterogattii strain R265 with the RNAi-proficient genomes of the Cryptococcus pathogenic species complex, we identified a set of conserved genes that were lost in R265 and all other C. deuterogattii isolates examined. Genetic and molecular analyses reveal several of these lost genes play roles in RNAi pathways. Four novel components were examined further. Znf3 (a zinc finger protein and Qip1 (a homolog of N. crassa Qip were found to be essential for RNAi, while Cpr2 (a constitutive pheromone receptor and Fzc28 (a transcription factor are involved in sex-induced but not mitosis-induced silencing. Our results demonstrate that the mitotic and sex-induced RNAi pathways rely on the same core components, but sex-induced silencing may be a more specific, highly induced variant that involves additional specialized or regulatory components. Our studies further illustrate how gene network polymorphisms involving known components of key cellular pathways can inform identification of novel elements and suggest that RNAi loss may have been a core event in the speciation of C. deuterogattii and possibly contributed to its pathogenic trajectory.

  6. A Novel AT-Rich DNA Recognition Mechanism for Bacterial Xenogeneic Silencer MvaT.

    Directory of Open Access Journals (Sweden)

    Pengfei Ding

    2015-06-01

    Full Text Available Bacterial xenogeneic silencing proteins selectively bind to and silence expression from many AT rich regions of the chromosome. They serve as master regulators of horizontally acquired DNA, including a large number of virulence genes. To date, three distinct families of xenogeneic silencers have been identified: H-NS of Proteobacteria, Lsr2 of the Actinomycetes, and MvaT of Pseudomonas sp. Although H-NS and Lsr2 family proteins are structurally different, they all recognize the AT-rich DNA minor groove through a common AT-hook-like motif, which is absent in the MvaT family. Thus, the DNA binding mechanism of MvaT has not been determined. Here, we report the characteristics of DNA sequences targeted by MvaT with protein binding microarrays, which indicates that MvaT prefers binding flexible DNA sequences with multiple TpA steps. We demonstrate that there are clear differences in sequence preferences between MvaT and the other two xenogeneic silencer families. We also determined the structure of the DNA-binding domain of MvaT in complex with a high affinity DNA dodecamer using solution NMR. This is the first experimental structure of a xenogeneic silencer in complex with DNA, which reveals that MvaT recognizes the AT-rich DNA both through base readout by an "AT-pincer" motif inserted into the minor groove and through shape readout by multiple lysine side chains interacting with the DNA sugar-phosphate backbone. Mutations of key MvaT residues for DNA binding confirm their importance with both in vitro and in vivo assays. This novel DNA binding mode enables MvaT to better tolerate GC-base pair interruptions in the binding site and less prefer A tract DNA when compared to H-NS and Lsr2. Comparison of MvaT with other bacterial xenogeneic silencers provides a clear picture that nature has evolved unique solutions for different bacterial genera to distinguish foreign from self DNA.

  7. The silencing of cathepsin K used in gene therapy for periodontal disease reveals the role of cathepsin K in chronic infection and inflammation.

    Science.gov (United States)

    Chen, W; Gao, B; Hao, L; Zhu, G; Jules, J; MacDougall, M J; Wang, J; Han, X; Zhou, X; Li, Y-P

    2016-10-01

    Periodontitis is a severe chronic inflammatory disease and one of the most prevalent non-communicable chronic diseases that affects the majority of the world's adult population. While great efforts have been devoted toward understanding the pathogenesis of periodontitis, there remains a pressing need for developing potent therapeutic strategies for targeting this dreadful disease. In this study, we utilized adeno-associated virus (AAV) expressing cathepsin K (Ctsk) small hairpin (sh)RNA (AAV-sh-Ctsk) to silence Ctsk in vivo and subsequently evaluated its impact in periodontitis as a potential therapeutic strategy for this disease. We used a known mouse model of periodontitis, in which wild-type BALB/cJ mice were infected with Porphyromonas gingivalis W50 in the maxillary and mandibular periodontium to induce the disease. AAV-sh-Ctsk was then administrated locally into the periodontal tissues in vivo, followed by analyses to assess progression of the disease. AAV-mediated Ctsk silencing drastically protected mice (> 80%) from P. gingivalis-induced bone resorption by osteoclasts. In addition, AAV-sh-Ctsk administration drastically reduced inflammation by impacting the expression of many inflammatory cytokines as well as T-cell and dendritic cell numbers in periodontal lesions. AAV-mediated Ctsk silencing can simultaneously target both the inflammation and bone resorption associated with periodontitis through its inhibitory effect on immune cells and osteoclast function. Thereby, AAV-sh-Ctsk administration can efficiently protect against periodontal tissue damage and alveolar bone loss, establishing this AAV-mediated local silencing of Ctsk as an important therapeutic strategy for effectively treating periodontal disease. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  8. Targeted integration of genes in Xenopus tropicalis

    DEFF Research Database (Denmark)

    Shi, Zhaoying; Tian, Dandan; Xin, Huhu

    2017-01-01

    With the successful establishment of both targeted gene disruption and integration methods in the true diploid frog Xenopus tropicalis, this excellent vertebrate genetic model now is making a unique contribution to modelling human diseases. Here, we summarize our efforts on establishing homologous...... recombination-mediated targeted integration in Xenopus tropicalis, the usefulness, and limitation of targeted integration via the homology-independent strategy, and future directions on how to further improve targeted gene integration in Xenopus tropicalis....

  9. RNA Silencing in Plants: Mechanisms, Technologies and Applications in Horticultural Crops.

    Science.gov (United States)

    Guo, Qigao; Liu, Qing; Smith, Neil A; Liang, Guolu; Wang, Ming-Bo

    2016-12-01

    Understanding the fundamental nature of a molecular process or a biological pathway is often a catalyst for the development of new technologies in biology. Indeed, studies from late 1990s to early 2000s have uncovered multiple overlapping but functionally distinct RNA silencing pathways in plants, including the posttranscriptional microRNA and small interfering RNA pathways and the transcriptional RNA-directed DNA methylation pathway. These findings have in turn been exploited for developing artificial RNA silencing technologies such as hairpin RNA, artificial microRNA, intrinsic direct repeat, 3' UTR inverted repeat, artificial trans-acting siRNA, and virus-induced gene silencing technologies. Some of these RNA silencing technologies, such as the hairpin RNA technology, have already been widely used for genetic improvement of crop plants in agriculture. For horticultural plants, RNA silencing technologies have been used to increase disease and pest resistance, alter plant architecture and flowering time, improve commercial traits of fruits and flowers, enhance nutritional values, remove toxic compounds and allergens, and develop high-value industrial products. In this article we aim to provide an overview of the RNA silencing pathways in plants, summarize the existing RNA silencing technologies, and review the current progress in applying these technologies for the improvement of agricultural crops particularly horticultural crops.

  10. RNA interference screen to identify pathways that enhance or reduce nonviral gene transfer during lipofection.

    Science.gov (United States)

    Barker, Gregory A; Diamond, Scott L

    2008-09-01

    Some barriers to DNA lipofection are well characterized; however, there is as yet no method of finding unknown pathways that impact the process. A druggable genome small-interfering RNA (siRNA) screen against 5,520 genes was tested for its effect on lipofection of human aortic endothelial cells (HAECs). We found 130 gene targets which, when silenced by pooled siRNAs (three siRNAs per gene), resulted in enhanced luminescence after lipofection (86 gene targets showed reduced expression). In confirmation tests with single siRNAs, 18 of the 130 hits showed enhanced lipofection with two or more individual siRNAs in the absence of cytotoxicity. Of these confirmed gene targets, we identified five leading candidates, two of which are isoforms of the regulatory subunit of protein phosphatase 2A (PP2A). The best candidate siRNA targeted the PPP2R2C gene and produced a 65% increase in luminescence from lipofection, with a quantitative PCR-validated knockdown of approximately 76%. Flow cytometric analysis confirmed that the silencing of the PPP2R2C gene resulted in an improvement of 10% in transfection efficiency, thereby demonstrating an increase in the number of transfected cells. These results show that an RNA interference (RNAi) high-throughput screen (HTS) can be applied to nonviral gene transfer. We have also demonstrated that siRNAs can be co-delivered with lipofected DNA to increase the transfection efficiency in vitro.

  11. RNA interference and retinoblastoma-related genes are required for repression of endogenous siRNA targets in Caenorhabditis elegans.

    Science.gov (United States)

    Grishok, Alla; Hoersch, Sebastian; Sharp, Phillip A

    2008-12-23

    In Caenorhabditis elegans, a vast number of endogenous short RNAs corresponding to thousands of genes have been discovered recently. This finding suggests that these short interfering RNAs (siRNAs) may contribute to regulation of many developmental and other signaling pathways in addition to silencing viruses and transposons. Here, we present a microarray analysis of gene expression in RNA interference (RNAi)-related mutants rde-4, zfp-1, and alg-1 and the retinoblastoma (Rb) mutant lin-35. We found that a component of Dicer complex RDE-4 and a chromatin-related zinc finger protein ZFP-1, not implicated in endogenous RNAi, regulate overlapping sets of genes. Notably, genes a) up-regulated in the rde-4 and zfp-1 mutants and b) up-regulated in the lin-35(Rb) mutant, but not the down-regulated genes are highly represented in the set of genes with corresponding endogenous siRNAs (endo-siRNAs). Our study suggests that endogenous siRNAs cooperate with chromatin factors, either C. elegans ortholog of acute lymphoblastic leukemia-1 (ALL-1)-fused gene from chromosome 10 (AF10), ZFP-1, or tumor suppressor Rb, to regulate overlapping sets of genes and predicts a large role for RNAi-based chromatin silencing in control of gene expression in C. elegans.

  12. Genome-wide analysis of Polycomb targets in Drosophila

    Energy Technology Data Exchange (ETDEWEB)

    Schwartz, Yuri B.; Kahn, Tatyana G.; Nix, David A.; Li,Xiao-Yong; Bourgon, Richard; Biggin, Mark; Pirrotta, Vincenzo

    2006-04-01

    Polycomb Group (PcG) complexes are multiprotein assemblages that bind to chromatin and establish chromatin states leading to epigenetic silencing. PcG proteins regulate homeotic genes in flies and vertebrates but little is known about other PcG targets and the role of the PcG in development, differentiation and disease. We have determined the distribution of the PcG proteins PC, E(Z) and PSC and of histone H3K27 trimethylation in the Drosophila genome. At more than 200 PcG target genes, binding sites for the three PcG proteins colocalize to presumptive Polycomb Response Elements (PREs). In contrast, H3 me3K27 forms broad domains including the entire transcription unit and regulatory regions. PcG targets are highly enriched in genes encoding transcription factors but receptors, signaling proteins, morphogens and regulators representing all major developmental pathways are also included.

  13. UV-C-Induced alleviation of transcriptional gene silencing through plant–plant communication: Key roles of jasmonic acid and salicylic acid pathways

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Wei; Wang, Ting [Key Laboratory of Ion Beam Bio-engineering, Hefei Institutes of Physical Science, Chinese Academy of Sciences, P.O. Box 1138, Hefei, Anhui, 230031 (China); Xu, Shaoxin [School of physics and materials science, Anhui University, Hefei, Anhui, 230601 (China); Li, Fanghua; Deng, Chenguang; Wu, Lijun; Wu, Yuejin [Key Laboratory of Ion Beam Bio-engineering, Hefei Institutes of Physical Science, Chinese Academy of Sciences, P.O. Box 1138, Hefei, Anhui, 230031 (China); Bian, Po, E-mail: bianpo@ipp.ac.cn [Key Laboratory of Ion Beam Bio-engineering, Hefei Institutes of Physical Science, Chinese Academy of Sciences, P.O. Box 1138, Hefei, Anhui, 230031 (China)

    2016-08-15

    Highlights: • Transcriptional gene silencing (TGS) in plants can be epigenetically alleviated by volatile signals from UV-C- irradiated neighboring plants. • Alleviation of TGS can be induced by UV-C irradiation through plant–plant–plant communication. • JA and SA signals take part in interplant communication for alleviation of TGS. - Abstract: Plant stress responses at the epigenetic level are expected to allow more permanent changes of gene expression and potentially long-term adaptation. While it has been reported that plants subjected to adverse environments initiate various stress responses in their neighboring plants, little is known regarding epigenetic responses to external stresses mediated by plant–plant communication. In this study, we show that DNA repetitive elements of Arabidopsis thaliana, whose expression is inhibited epigenetically by transcriptional gene silencing (TGS) mechanism, are activated by UV-C irradiation through airborne plant–plant and plant–plant–plant communications, accompanied by DNA demethylation at CHH sites. Moreover, the TGS is alleviated by direct treatments with exogenous methyl jasmonate (MeJA) and methyl salicylate (MeSA). Further, the plant–plant and plant–plant–plant communications are blocked by mutations in the biosynthesis or signaling of jasmonic acid (JA) or salicylic acid (SA), indicating that JA and SA pathways are involved in the interplant communication for epigenetic responses. For the plant–plant–plant communication, stress cues are relayed to the last set of receiver plants by promoting the production of JA and SA signals in relaying plants, which exhibit upregulated expression of genes for JA and SA biosynthesis and enhanced emanation of MeJA and MeSA.

  14. UV-C-Induced alleviation of transcriptional gene silencing through plant–plant communication: Key roles of jasmonic acid and salicylic acid pathways

    International Nuclear Information System (INIS)

    Xu, Wei; Wang, Ting; Xu, Shaoxin; Li, Fanghua; Deng, Chenguang; Wu, Lijun; Wu, Yuejin; Bian, Po

    2016-01-01

    Highlights: • Transcriptional gene silencing (TGS) in plants can be epigenetically alleviated by volatile signals from UV-C- irradiated neighboring plants. • Alleviation of TGS can be induced by UV-C irradiation through plant–plant–plant communication. • JA and SA signals take part in interplant communication for alleviation of TGS. - Abstract: Plant stress responses at the epigenetic level are expected to allow more permanent changes of gene expression and potentially long-term adaptation. While it has been reported that plants subjected to adverse environments initiate various stress responses in their neighboring plants, little is known regarding epigenetic responses to external stresses mediated by plant–plant communication. In this study, we show that DNA repetitive elements of Arabidopsis thaliana, whose expression is inhibited epigenetically by transcriptional gene silencing (TGS) mechanism, are activated by UV-C irradiation through airborne plant–plant and plant–plant–plant communications, accompanied by DNA demethylation at CHH sites. Moreover, the TGS is alleviated by direct treatments with exogenous methyl jasmonate (MeJA) and methyl salicylate (MeSA). Further, the plant–plant and plant–plant–plant communications are blocked by mutations in the biosynthesis or signaling of jasmonic acid (JA) or salicylic acid (SA), indicating that JA and SA pathways are involved in the interplant communication for epigenetic responses. For the plant–plant–plant communication, stress cues are relayed to the last set of receiver plants by promoting the production of JA and SA signals in relaying plants, which exhibit upregulated expression of genes for JA and SA biosynthesis and enhanced emanation of MeJA and MeSA.

  15. Characterization of the RNA silencing suppression activity of the Ebola virus VP35 protein in plants and mammalian cells.

    Science.gov (United States)

    Zhu, Yali; Cherukuri, Nil Celebi; Jackel, Jamie N; Wu, Zetang; Crary, Monica; Buckley, Kenneth J; Bisaro, David M; Parris, Deborah S

    2012-03-01

    Ebola virus (EBOV) causes a lethal hemorrhagic fever for which there is no approved effective treatment or prevention strategy. EBOV VP35 is a virulence factor that blocks innate antiviral host responses, including the induction of and response to alpha/beta interferon. VP35 is also an RNA silencing suppressor (RSS). By inhibiting microRNA-directed silencing, mammalian virus RSSs have the capacity to alter the cellular environment to benefit replication. A reporter gene containing specific microRNA target sequences was used to demonstrate that prior expression of wild-type VP35 was able to block establishment of microRNA silencing in mammalian cells. In addition, wild-type VP35 C-terminal domain (CTD) protein fusions were shown to bind small interfering RNA (siRNA). Analysis of mutant proteins demonstrated that reporter activity in RSS assays did not correlate with their ability to antagonize double-stranded RNA (dsRNA)-activated protein kinase R (PKR) or bind siRNA. The results suggest that enhanced reporter activity in the presence of VP35 is a composite of nonspecific translational enhancement and silencing suppression. Moreover, most of the specific RSS activity in mammalian cells is RNA binding independent, consistent with VP35's proposed role in sequestering one or more silencing complex proteins. To examine RSS activity in a system without interferon, VP35 was tested in well-characterized plant silencing suppression assays. VP35 was shown to possess potent plant RSS activity, and the activities of mutant proteins correlated strongly, but not exclusively, with RNA binding ability. The results suggest the importance of VP35-protein interactions in blocking silencing in a system (mammalian) that cannot amplify dsRNA.

  16. Silencing of OSBP-related protein 8 (ORP8) modifies the macrophage transcriptome, nucleoporin p62 distribution, and migration capacity

    International Nuclear Information System (INIS)

    Béaslas, Olivier; Vihervaara, Terhi; Li, Jiwei; Laurila, Pirkka-Pekka; Yan, Daoguang; Olkkonen, Vesa M.

    2012-01-01

    ORP8 is an oxysterol/cholesterol binding protein anchored to the endoplasmic reticulum and the nuclear envelope, and is abundantly expressed in the macrophage. We created and characterized mouse RAW264.7 macrophages with ORP8 stably silenced using shRNA lentiviruses. A microarray transcriptome and gene ontology pathway analysis revealed significant alterations in several nuclear pathways and ones associated with centrosome and microtubule organization. ORP8 knockdown resulted in increased expression and altered subcellular distribution of an interaction partner of ORP8, nucleoporin NUP62, with an intranuclear localization aspect and association with cytoplasmic vesicular structures and lamellipodial edges of the cells. Moreover, ORP8 silenced cells displayed enhanced migration, and a more pronounced microtubule cytoskeleton than controls expressing a non-targeting shRNA. ORP8 was shown to compete with Exo70 for interaction with NUP62, and NUP62 knockdown abolished the migration enhancement of ORP8-silenced cells, suggesting that the endogenous ORP8 suppresses migration via binding to NUP62. As a conclusion, the present study reveals new, unexpected aspects of ORP8 function in macrophages not directly involving lipid metabolism, but rather associated with nuclear functions, microtubule organization, and migration capacity. -- Highlights: ► The phenotype of Raw264.7 macrophage with ORP8 silenced is characterized. ► ORP8 silencing alters mRNA levels of nuclear and microtubule/centrosome pathways. ► ORP8 silencing results in increased expression and altered distribution of NUP62. ► ORP8 silenced macrophages show enhanced migration and altered microtubule cytoskeleton. ► ORP8 competes in vitro with Exo70 for binding to NUP62.

  17. Transplantation of Nogo-66 receptor gene-silenced cells in a poly(D,L-lactic-co-glycolic acid) scaffold for the treatment of spinal cord injury★

    Science.gov (United States)

    Wang, Dong; Fan, Yuhong; Zhang, Jianjun

    2013-01-01

    Inhibition of neurite growth, which is in large part mediated by the Nogo-66 receptor, affects neural regeneration following bone marrow mesenchymal stem cell transplantation. The tissue engineering scaffold poly(D,L-lactide-co-glycolic acid) has good histocompatibility and can promote the growth of regenerating nerve fibers. The present study used small interfering RNA to silence Nogo-66 receptor gene expression in bone marrow mesenchymal stem cells and Schwann cells, which were subsequently transplanted with poly(D,L-lactide-co-glycolic acid) into the spinal cord lesion regions in rats. Simultaneously, rats treated with scaffold only were taken as the control group. Hematoxylin-eosin staining and immunohistochemistry revealed that at 4 weeks after transplantation, rats had good motor function of the hind limb after treatment with Nogo-66 receptor gene-silenced cells plus the poly(D,L-lactide-co-glycolic acid) scaffold compared with rats treated with scaffold only, and the number of bone marrow mesenchymal stem cells and neuron-like cells was also increased. At 8 weeks after transplantation, horseradish peroxidase tracing and transmission electron microscopy showed a large number of unmyelinated and myelinated nerve fibers, as well as intact regenerating axonal myelin sheath following spinal cord hemisection injury. These experimental findings indicate that transplantation of Nogo-66 receptor gene-silenced bone marrow mesenchymal stem cells and Schwann cells plus a poly(D,L-lactide-co-glycolic acid) scaffold can significantly enhance axonal regeneration of spinal cord neurons and improve motor function of the extremities in rats following spinal cord injury. PMID:25206713

  18. Gene-silencing effects of anti-survivin siRNA delivered by RGDV-functionalized nanodiamond carrier in the breast carcinoma cell line MCF-7

    Directory of Open Access Journals (Sweden)

    Bi YZ

    2016-11-01

    Full Text Available Yanzhao Bi, Yifan Zhang, Chunying Cui, Lulu Ren, Xueyun Jiang School of Chemical Biology and Pharmaceutical Sciences, Capital Medical University, Beijing, People’s Republic of China Abstract: Nanodiamond (ND is a renowned material in nonviral small interfering RNA (siRNA carrier field due to its unique physical, chemical, and biological properties. In our previous work, it was proven that ND could deliver siRNA into cells efficiently and downregulate the expression of desired protein. However, synthesizing a high-efficient tumor-targeting carrier using ND is still a challenge. In this study, a novel carrier, NDCONH(CH22NH-VDGR, was synthesized for siRNA delivery, and its properties were characterized with methods including Fourier transform infrared spectrometry, transmission electron microscopy, scanning electron microscopy, gel retardation assay, differential scanning calorimetry, confocal microscopy, releasing test, real-time polymerase chain reaction (PCR assay, enzyme-linked immunosorbent assay (ELISA, flow cytometry, cytotoxicity assay, and gene-silencing efficacy assay in vitro and in vivo. The mechanism of NDCONH(CH22NH-VDGR/survivin-siRNA-induced tumor apoptosis was evaluated via flow cytometer assay using Annexin V–fluorescein isothiocyanate/propidium iodide staining method. The NDCONH(CH22NH-VDGR/survivin-siRNA nanoparticle with 60–110 nm diameter and 35.65±3.90 mV zeta potential was prepared. For real-time PCR assay, the results showed that the expression of survivin mRNA was reduced to 46.77%±6.3%. The expression of survivin protein was downregulated to 48.49%±2.25%, as evaluated by ELISA assay. MTT assay showed that NDCONH(CH22NH-VDGR/survivin-siRNA had an inhibitory effect on MCF-7 cell proliferation. According to these results, the survivin-siRNA could be delivered, transported, and released stably, which benefits in increasing the gene-silencing effect. Therefore, as an siRNA carrier, NDCONH(CH22NH-VDGR was suggested

  19. Potential proteins targeted by let-7f-5p in HeLa cells.

    Science.gov (United States)

    Wang, Yu; Chen, Xiujuan; Zhang, Yi; Song, Jiandong

    2017-07-24

    MicroRNAs are a class of small, endogenous, non-coding RNAs mediating posttranscriptional gene silencing. The current authors hypothesized that let-7f-5p is likely involved in cell invasion and proliferation by regulating the expression of target genes. The current study combined let-7f-5p with iTRAQ to assess its effect on gene expression in HeLa cells. Results indicated that 164 proteins were expressed at different levels in HeLa cells overexpressing let-7f-5p and negative controls and that 172 proteins were expressed at different levels in let-7f-5p-silenced HeLa cells and negative controls. Results indicated that let-7f-5p may suppress insulin-like growth factor 2 mRNA binding protein 1 (IGF2BP1) in HeLa cells.

  20. Small Ubiquitin-like Modifier (SUMO) Conjugation Impedes Transcriptional Silencing by the Polycomb Group Repressor Sex Comb on Midleg*

    OpenAIRE

    Smith, Matthew; Mallin, Daniel R.; Simon, Jeffrey A.; Courey, Albert J.

    2011-01-01

    The Drosophila protein Sex Comb on Midleg (Scm) is a member of the Polycomb group (PcG), a set of transcriptional repressors that maintain silencing of homeotic genes during development. Recent findings have identified PcG proteins both as targets for modification by the small ubiquitin-like modifier (SUMO) protein and as catalytic components of the SUMO conjugation pathway. We have found that the SUMO-conjugating enzyme Ubc9 binds to Scm and that this interaction, which requires the Scm C-te...

  1. Polycomb complexes and silencing mechanisms

    DEFF Research Database (Denmark)

    Lund, Anders H; van Lohuizen, Maarten

    2004-01-01

    Advances in the past couple of years have brought important new knowledge on the mechanisms by which Polycomb-group proteins regulate gene expression and on the consequences of their actions. The discovery of histone methylation imprints specific for Polycomb and Trithorax complexes has provided...... mechanistic insight on how this ancient epigenetic memory system acts to repress and indicates that it may share mechanistic aspects with other silencing and genome-protective processes, such as RNA interference....

  2. U1 Adaptor Oligonucleotides Targeting BCL2 and GRM1 Suppress Growth of Human Melanoma Xenografts In Vivo

    Directory of Open Access Journals (Sweden)

    Rafal Goraczniak

    2013-01-01

    Full Text Available U1 Adaptor is a recently discovered oligonucleotide-based gene-silencing technology with a unique mechanism of action that targets nuclear pre-mRNA processing. U1 Adaptors have two distinct functional domains, both of which must be present on the same oligonucleotide to exert their gene-silencing function. Here, we present the first in vivo use of U1 Adaptors by targeting two different human genes implicated in melanomagenesis, B-cell lymphoma 2 (BCL2 and metabotropic glutamate receptor 1 (GRM1, in a human melanoma cell xenograft mouse model system. Using a newly developed dendrimer delivery system, anti-BCL2 U1 Adaptors were very potent and suppressed tumor growth at doses as low as 34 µg/kg with twice weekly intravenous (iv administration. Anti-GRM1 U1 Adaptors suppressed tumor xenograft growth with similar potency. Mechanism of action was demonstrated by showing target gene suppression in tumors and by observing that negative control U1 Adaptors with just one functional domain show no tumor suppression activity. The anti-BCL2 and anti-GRM1 treatments were equally effective against cell lines harboring either wild-type or a mutant V600E B-RAF allele, the most common mutation in melanoma. Treatment of normal immune-competent mice (C57BL6 indicated no organ toxicity or immune stimulation. These proof-of-concept studies represent an in-depth (over 800 mice in ~108 treatment groups validation that U1 Adaptors are a highly potent gene-silencing therapeutic and open the way for their further development to treat other human diseases.

  3. Engineering nanoparticles to silence bacterial communication

    Directory of Open Access Journals (Sweden)

    Kristen Publicover Miller

    2015-03-01

    Full Text Available The alarming spread of bacterial resistance to traditional antibiotics has warranted the study of alternative antimicrobial agents. Quorum sensing is a chemical cell-to-cell communication mechanism utilized by bacteria to coordinate group behaviors and establish infections. Quorum sensing is integral to bacterial survival, and therefore provides a unique target for antimicrobial therapy. In this study, silicon dioxide nanoparticles (Si-NP were engineered to target the signaling molecules (i.e. acylhomoserine lactones (HSL used for quorum sensing in order to halt bacterial communication. Specifically, when Si-NP were surface functionalized with beta-cyclodextrin (beta-CD, then added to cultures of bacteria (Vibrio fischeri, whose luminous output depends upon HSL-mediated quorum sensing, the cell-to-cell communication was dramatically reduced. Reductions in luminescence were further verified by quantitative polymerase chain reaction (qPCR analyses of luminescence genes. Binding of AHLs to Si-NPs was examined using nuclear magnetic resonance (NMR spectroscopy. The results indicated that by delivering high concentrations of engineered NPs with associated quenching compounds, the chemical signals were removed from the immediate bacterial environment. In actively-metabolizing cultures, this treatment blocked the ability of bacteria to communicate and regulate quorum sensing, effectively silencing and isolating the cells. Si-NPs provide a scaffold and critical stepping-stone for more pointed developments in antimicrobial therapy, especially with regard to quorum sensing – a target that will reduce resistance pressures imposed by traditional antibiotics.

  4. Peroxisome Proliferator-Activated Receptor Alpha Target Genes

    Directory of Open Access Journals (Sweden)

    Maryam Rakhshandehroo

    2010-01-01

    Full Text Available The peroxisome proliferator-activated receptor alpha (PPARα is a ligand-activated transcription factor involved in the regulation of a variety of processes, ranging from inflammation and immunity to nutrient metabolism and energy homeostasis. PPARα serves as a molecular target for hypolipidemic fibrates drugs which bind the receptor with high affinity. Furthermore, PPARα binds and is activated by numerous fatty acids and fatty acid-derived compounds. PPARα governs biological processes by altering the expression of a large number of target genes. Accordingly, the specific role of PPARα is directly related to the biological function of its target genes. Here, we present an overview of the involvement of PPARα in lipid metabolism and other pathways through a detailed analysis of the different known or putative PPARα target genes. The emphasis is on gene regulation by PPARα in liver although many of the results likely apply to other organs and tissues as well.

  5. miR-122 promotes hepatic antioxidant defense of genetically improved farmed tilapia (GIFT, Oreochromis niloticus) exposed to cadmium by directly targeting a metallothionein gene

    International Nuclear Information System (INIS)

    Qiang, Jun; Tao, Yi-Fan; He, Jie; Xu, Pao; Bao, Jin-Wen; Sun, Yi-Lan

    2017-01-01

    Highlights: • MiR-122 regulated tilapia MT by directly targeting MT 3′UTR. • MiR-122 level was negatively related to MT level under Cd stress. • MiR-122 silencing caused up-regulation of MT expression. • MiR-122 loss relieved liver stress and stimulated antioxidant enzymes. - Abastract: MicroRNAs (miRNAs) are small, non-coding RNAs that regulate target gene expression by binding to the 3′untranslated region (3′UTR) of the target mRNA. MiRNAs regulate a large variety of genes, including those involved in liver homeostasis and energy metabolism. Down-regulated levels of hepatic miR-122 were found in genetically improved farmed tilapia (GIFT, Oreochromis niloticus) exposed to cadmium (Cd) stress. Here, we report for the first time that reduction of miR-122 post-transcriptionally increased metallothionein (MT) mRNA levels by binding to its 3′UTR, as shown by a 3′ UTR luciferase reporter assay. The expression levels of miR-122 were negatively related to MT levels in GIFT under Cd stress. We performed in vivo functional analysis of miR-122 by injecting the fish with a miR-122 antagomir. Inhibition of miR-122 levels in GIFT liver caused a significant increase in MT expression, affected white blood cell and red blood cell counts, and serum alanine and aspartate aminotransferase activities, and glucose levels, all of which may help to relieve Cd stress-related liver stress. miR-122 silencing modulated oxidative stress and stimulated the activity of antioxidant enzymes. Our findings indicate that miR-122 regulated MT levels by binding to the 3′UTR of MT mRNA, and this interaction affected Cd stress induction and the resistance response in GIFT. We concluded that miR-122 plays an important role in regulating the stress response in GIFT liver. Our findings may contribute to understanding the mechanisms of miRNA-mediated gene regulation in tilapia in response to environmental stresses.

  6. miR-122 promotes hepatic antioxidant defense of genetically improved farmed tilapia (GIFT, Oreochromis niloticus) exposed to cadmium by directly targeting a metallothionein gene

    Energy Technology Data Exchange (ETDEWEB)

    Qiang, Jun, E-mail: Qiangj@ffrc.cn [Key Laboratory of Freshwater Fisheries and Germplasm Resources Utilization, Ministry of Agriculture, Freshwater Fisheries Research Center, Chinese Academy of Fishery Sciences, Wuxi 214081, Jiangsu (China); Tao, Yi-Fan [Wuxi Fisheries College, Nanjing Agricultural University, Wuxi 214081 (China); He, Jie [Key Laboratory of Freshwater Fisheries and Germplasm Resources Utilization, Ministry of Agriculture, Freshwater Fisheries Research Center, Chinese Academy of Fishery Sciences, Wuxi 214081, Jiangsu (China); Xu, Pao, E-mail: Xup@ffrc.cn [Key Laboratory of Freshwater Fisheries and Germplasm Resources Utilization, Ministry of Agriculture, Freshwater Fisheries Research Center, Chinese Academy of Fishery Sciences, Wuxi 214081, Jiangsu (China); Bao, Jin-Wen [Wuxi Fisheries College, Nanjing Agricultural University, Wuxi 214081 (China); Sun, Yi-Lan [Key Laboratory of Freshwater Fisheries and Germplasm Resources Utilization, Ministry of Agriculture, Freshwater Fisheries Research Center, Chinese Academy of Fishery Sciences, Wuxi 214081, Jiangsu (China)

    2017-01-15

    Highlights: • MiR-122 regulated tilapia MT by directly targeting MT 3′UTR. • MiR-122 level was negatively related to MT level under Cd stress. • MiR-122 silencing caused up-regulation of MT expression. • MiR-122 loss relieved liver stress and stimulated antioxidant enzymes. - Abastract: MicroRNAs (miRNAs) are small, non-coding RNAs that regulate target gene expression by binding to the 3′untranslated region (3′UTR) of the target mRNA. MiRNAs regulate a large variety of genes, including those involved in liver homeostasis and energy metabolism. Down-regulated levels of hepatic miR-122 were found in genetically improved farmed tilapia (GIFT, Oreochromis niloticus) exposed to cadmium (Cd) stress. Here, we report for the first time that reduction of miR-122 post-transcriptionally increased metallothionein (MT) mRNA levels by binding to its 3′UTR, as shown by a 3′ UTR luciferase reporter assay. The expression levels of miR-122 were negatively related to MT levels in GIFT under Cd stress. We performed in vivo functional analysis of miR-122 by injecting the fish with a miR-122 antagomir. Inhibition of miR-122 levels in GIFT liver caused a significant increase in MT expression, affected white blood cell and red blood cell counts, and serum alanine and aspartate aminotransferase activities, and glucose levels, all of which may help to relieve Cd stress-related liver stress. miR-122 silencing modulated oxidative stress and stimulated the activity of antioxidant enzymes. Our findings indicate that miR-122 regulated MT levels by binding to the 3′UTR of MT mRNA, and this interaction affected Cd stress induction and the resistance response in GIFT. We concluded that miR-122 plays an important role in regulating the stress response in GIFT liver. Our findings may contribute to understanding the mechanisms of miRNA-mediated gene regulation in tilapia in response to environmental stresses.

  7. Reductive nanocomplex encapsulation of cRGD-siRNA conjugates for enhanced targeting to cancer cells

    Directory of Open Access Journals (Sweden)

    Zhou Z

    2017-10-01

    Full Text Available Zhaoxiu Zhou,* Shuang Liu,* Yanfen Zhang, Xiantao Yang, Yuan Ma, Zhu Guan, Yun Wu, Lihe Zhang, Zhenjun Yang State Key Laboratory of Natural and Biomimetic Drugs, School of Pharmaceutical Sciences, Peking University, Beijing, People’s Republic of China *These authors contributed equally to this work Abstract: In this study, through covalent conjugation and lipid material entrapment, a combined modification strategy was established for effective delivery of small interfering RNA (siRNA. Single strands of siRNA targeting to BRAFV600E gene (siMB3 conjugated with cRGD peptide at 3'-terminus or 5'-terminus via cleavable disulfide bond was synthesized and then annealed with corresponding strands to obtain single and bis-cRGD-siRNA conjugates. A cationic lipid material (CLD developed by our laboratory was mixed with the conjugates to generate nanocomplexes; their uniformity and electrical property were revealed by particle size and zeta potential measurement. Compared with CLD/siBraf, CLD/cRGD-siBraf achieved higher cell uptake and more excellent tumor-targeting ability, especially 21 (sense-5′/antisense-3″-cRGD-congjugate nanocomplex. Moreover, they can regulate multiple pathways to varying degree and reduce acidification of endosome. Compared with the gene silencing of different conjugates, single or bis-cRGD-conjugated siRNA showed little differences except 22 (5/5 which cRGD was conjugated at 5'-terminus of antisense strand and sense strand. However bis-cRGD conjugate 21 nanocomplex exhibited better specific target gene silencing at multiple time points. Furthermore, the serum stabilities of the bis-cRGD conjugates were higher than those of the single-cRGD conjugates. In conclusion, all these data suggested that CLD/bis-conjugates, especially CLD/21, can be an effective system for delivery of siRNA to target BRAFV600E gene for therapy of melanoma. Keywords: cRGD-siRNA conjugates, cationic lipids, targeting, silencing, intracellular pathways

  8. Epigenetic Silencing of the Proapoptotic Gene BIM in Anaplastic Large Cell Lymphoma through an MeCP2/SIN3a Deacetylating Complex

    Directory of Open Access Journals (Sweden)

    Rocco Piazza

    2013-05-01

    Full Text Available BIM is a proapoptotic member of the Bcl-2 family. Here, we investigated the epigenetic status of the BIM locus in NPM/ALK+ anaplastic large cell lymphoma (ALCL cell lines and in lymph node biopsies from NPM/ALK+ ALCL patients. We show that BIM is epigenetically silenced in cell lines and lymph node specimens and that treatment with the deacetylase inhibitor trichostatin A restores the histone acetylation, strongly upregulates BIM expression, and induces cell death. BIM silencing occurs through recruitment of MeCP2 and the SIN3a/histone deacetylase 1/2 (HDAC1/2 corepressor complex. This event requires BIM CpG methylation/demethylation with 5-azacytidine that leads to detachment of the MeCP2 corepressor complex and reacetylation of the histone tails. Treatment with the ALK inhibitor PF2341066 or with an inducible shRNA targeting NPM/ALK does not restore BIM locus reacetylation; however, enforced expression of NPM/ALK in an NPM/ALK-negative cell line significantly increases the methylation at the BIM locus. This study demonstrates that BIM is epigenetically silenced in NPM/ALK-positive cells through recruitment of the SIN3a/HDAC1/2 corepressor complex and that NPM/ALK is dispensable to maintain BIM epigenetic silencing but is able to act as an inducer of BIM methylation.

  9. Intratracheal Administration of Small Interfering RNA Targeting Fas Reduces Lung Ischemia-Reperfusion Injury.

    Science.gov (United States)

    Del Sorbo, Lorenzo; Costamagna, Andrea; Muraca, Giuseppe; Rotondo, Giuseppe; Civiletti, Federica; Vizio, Barbara; Bosco, Ornella; Martin Conte, Erica L; Frati, Giacomo; Delsedime, Luisa; Lupia, Enrico; Fanelli, Vito; Ranieri, V Marco

    2016-08-01

    Lung ischemia-reperfusion injury is the main cause of primary graft dysfunction after lung transplantation and results in increased morbidity and mortality. Fas-mediated apoptosis is one of the pathologic mechanisms involved in the development of ischemia-reperfusion injury. We hypothesized that the inhibition of Fas gene expression in lungs by intratracheal administration of small interfering RNA could reduce lung ischemia-reperfusion injury in an ex vivo model reproducing the procedural sequence of lung transplantation. Prospective, randomized, controlled experimental study. University research laboratory. C57/BL6 mice weighing 28-30 g. Ischemia-reperfusion injury was induced in lungs isolated from mice, 48 hours after treatment with intratracheal small interfering RNA targeting Fas, control small interfering RNA, or vehicle. Isolated lungs were exposed to 6 hours of cold ischemia (4°C), followed by 2 hours of warm (37°C) reperfusion with a solution containing 10% of fresh whole blood and mechanical ventilation with constant low driving pressure. Fas gene expression was significantly silenced at the level of messenger RNA and protein after ischemia-reperfusion in lungs treated with small interfering RNA targeting Fas compared with lungs treated with control small interfering RNA or vehicle. Silencing of Fas gene expression resulted in reduced edema formation (bronchoalveolar lavage protein concentration and lung histology) and improvement in lung compliance. These effects were associated with a significant reduction of pulmonary cell apoptosis of lungs treated with small interfering RNA targeting Fas, which did not affect cytokine release and neutrophil infiltration. Fas expression silencing in the lung by small interfering RNA is effective against ischemia-reperfusion injury. This approach represents a potential innovative strategy of organ preservation before lung transplantation.

  10. Cloning and functional analysis of succinate dehydrogenase gene PsSDHA in Phytophthora sojae.

    Science.gov (United States)

    Pan, Yuemin; Ye, Tao; Gao, Zhimou

    2017-07-01

    Succinate dehydrogenase (SDH) is one of the key enzymes of the tricarboxylic acid cycle (TCA cycle) and a proven target of fungicides for true fungi. To explore the roles of the SDHA gene in Phytophthora sojae, we first cloned PsSDHA to construct the PsSDHA silenced expression vector pHAM34-PsSDHA, and then utilized PEG to mediate the P. sojae protoplast transformation experiment. Through transformation screening, we obtained the silenced mutants A1 and A3, which have significant suppressive effect. Further study showed that the hyphae of the silenced mutant strains were shorter and more bifurcated; the growth of the silenced mutants was clearly inhibited in 10% V8 agar medium containing sodium chloride (NaCl), hydrogen peroxide (H 2 O 2 ) or Congo Red, respectively. The pathogenicity of the silenced mutants was significantly reduced compared with the wild-type strain and the mock. The results could help us better to understand the position and function of SDH in P. sojae and provide a proven target of fungicides for the oomycete. Copyright © 2017. Published by Elsevier Ltd.

  11. Polymer nanoparticles for drug and small silencing RNA delivery to treat cancers of different phenotypes

    Science.gov (United States)

    Devulapally, Rammohan; Paulmurugan, Ramasamy

    2013-01-01

    Advances in nanotechnology have provided powerful and efficient tools in development of cancer diagnosis and therapy. There are numerous nanocarriers that are currently approved for clinical use in cancer therapy. In recent years, biodegradable polymer nanoparticles (NPs) have attracted a considerable attention for their ability to function as a possible carrier for target-specific delivery of various drugs, genes, proteins, peptides, vaccines, and other biomolecules in humans without much toxicity. This review will specifically focus on the recent advances in polymer-based nanocarriers for various drugs and small silencing RNA’s loading and delivery to treat different types of cancer. PMID:23996830

  12. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  13. Silencing of IFN-stimulated gene transcription is regulated by histone H1 and its chaperone TAF-I.

    Science.gov (United States)

    Kadota, Shinichi; Nagata, Kyosuke

    2014-07-01

    Chromatin structure and its alteration play critical roles in the regulation of transcription. However, the transcriptional silencing mechanism with regard to the chromatin structure at an unstimulated state of the interferon (IFN)-stimulated gene (ISG) remains unclear. Here we investigated the role of template activating factor-I (TAF-I, also known as SET) in ISG transcription. Knockdown (KD) of TAF-I increased ISG transcript and simultaneously reduced the histone H1 level on the ISG promoters during the early stages of transcription after IFN stimulation from the unstimulated state. The transcription factor levels on the ISG promoters were increased in TAF-I KD cells only during the early stages of transcription. Furthermore, histone H1 KD also increased ISG transcript. TAF-I and histone H1 double KD did not show the additive effect in ISG transcription, suggesting that TAF-I and histone H1 may act on the same regulatory pathway to control ISG transcription. In addition, TAF-I KD and histone H1 KD affected the chromatin structure near the ISG promoters. On the basis of these findings, we propose that TAF-I and its target histone H1 are key regulators of the chromatin structure at the ISG promoter to maintain the silent state of ISG transcription. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. The fission yeast ubiquitin-conjugating enzymes UbcP3, Ubc15, and Rhp6 affect transcriptional silencing of the mating-type region

    DEFF Research Database (Denmark)

    Nielsen, Inga Sig; Nielsen, Olaf; Murray, Johanne M

    2002-01-01

    Genes transcribed by RNA polymerase II are silenced when introduced near the mat2 or mat3 mating-type loci of the fission yeast Schizosaccharomyces pombe. Silencing is mediated by a number of gene products and cis-acting elements. We report here the finding of novel trans-acting factors identified...... was not suppressed by a mutation in the 26S proteasome, suggesting that loss of silencing is not due to an increased degradation of silencing factors but rather to the posttranslational modification of proteins by ubiquitination. We discuss the implications of these results for the possible modes of action of UbcP3...

  15. Genome-wide identification of KANADI1 target genes.

    Directory of Open Access Journals (Sweden)

    Paz Merelo

    Full Text Available Plant organ development and polarity establishment is mediated by the action of several transcription factors. Among these, the KANADI (KAN subclade of the GARP protein family plays important roles in polarity-associated processes during embryo, shoot and root patterning. In this study, we have identified a set of potential direct target genes of KAN1 through a combination of chromatin immunoprecipitation/DNA sequencing (ChIP-Seq and genome-wide transcriptional profiling using tiling arrays. Target genes are over-represented for genes involved in the regulation of organ development as well as in the response to auxin. KAN1 affects directly the expression of several genes previously shown to be important in the establishment of polarity during lateral organ and vascular tissue development. We also show that KAN1 controls through its target genes auxin effects on organ development at different levels: transport and its regulation, and signaling. In addition, KAN1 regulates genes involved in the response to abscisic acid, jasmonic acid, brassinosteroids, ethylene, cytokinins and gibberellins. The role of KAN1 in organ polarity is antagonized by HD-ZIPIII transcription factors, including REVOLUTA (REV. A comparison of their target genes reveals that the REV/KAN1 module acts in organ patterning through opposite regulation of shared targets. Evidence of mutual repression between closely related family members is also shown.

  16. Genetic improvement of tomato by targeted control of fruit softening

    KAUST Repository

    Uluisik, Selman; Chapman, Natalie H; Smith, Rebecca; Poole, Mervin; Adams, Gary; Gillis, Richard B; Besong, Tabot M.D.; Sheldon, Judith; Stiegelmeyer, Suzy; Perez, Laura; Samsulrizal, Nurul; Wang, Duoduo; Fisk, Ian D; Yang, Ni; Baxter, Charles; Rickett, Daniel; Fray, Rupert; Blanco-Ulate, Barbara; Powell, Ann L T; Harding, Stephen E; Craigon, Jim; Rose, Jocelyn K C; Fich, Eric A; Sun, Li; Domozych, David S; Fraser, Paul D; Tucker, Gregory A; Grierson, Don; Seymour, Graham B

    2016-01-01

    Controlling the rate of softening to extend shelf life was a key target for researchers engineering genetically modified (GM) tomatoes in the 1990s, but only modest improvements were achieved. Hybrids grown nowadays contain 'non-ripening mutations' that slow ripening and improve shelf life, but adversely affect flavor and color. We report substantial, targeted control of tomato softening, without affecting other aspects of ripening, by silencing a gene encoding a pectate lyase. © 2016 Nature America, Inc. All rights reserved.

  17. Genetic improvement of tomato by targeted control of fruit softening

    KAUST Repository

    Uluisik, Selman

    2016-07-25

    Controlling the rate of softening to extend shelf life was a key target for researchers engineering genetically modified (GM) tomatoes in the 1990s, but only modest improvements were achieved. Hybrids grown nowadays contain \\'non-ripening mutations\\' that slow ripening and improve shelf life, but adversely affect flavor and color. We report substantial, targeted control of tomato softening, without affecting other aspects of ripening, by silencing a gene encoding a pectate lyase. © 2016 Nature America, Inc. All rights reserved.

  18. Silencing of OSBP-related protein 8 (ORP8) modifies the macrophage transcriptome, nucleoporin p62 distribution, and migration capacity

    Energy Technology Data Exchange (ETDEWEB)

    Beaslas, Olivier; Vihervaara, Terhi [Minerva Foundation Institute for Medical Research, FI-00290 Helsinki (Finland); Li, Jiwei [Department of Biology, Jinan University, Guangzhou 510632 (China); Laurila, Pirkka-Pekka [FIMM, Institute for Molecular Medicine Finland, FI-00290 Helsinki (Finland); National Institute for Health and Welfare, Public Health Genomics Unit, FI-00290 Helsinki (Finland); Yan, Daoguang [Department of Biology, Jinan University, Guangzhou 510632 (China); Olkkonen, Vesa M., E-mail: vesa.olkkonen@helsinki.fi [Minerva Foundation Institute for Medical Research, FI-00290 Helsinki (Finland); Institute of Biomedicine, Anatomy, University of Helsinki, FI-00014 (Finland)

    2012-09-10

    ORP8 is an oxysterol/cholesterol binding protein anchored to the endoplasmic reticulum and the nuclear envelope, and is abundantly expressed in the macrophage. We created and characterized mouse RAW264.7 macrophages with ORP8 stably silenced using shRNA lentiviruses. A microarray transcriptome and gene ontology pathway analysis revealed significant alterations in several nuclear pathways and ones associated with centrosome and microtubule organization. ORP8 knockdown resulted in increased expression and altered subcellular distribution of an interaction partner of ORP8, nucleoporin NUP62, with an intranuclear localization aspect and association with cytoplasmic vesicular structures and lamellipodial edges of the cells. Moreover, ORP8 silenced cells displayed enhanced migration, and a more pronounced microtubule cytoskeleton than controls expressing a non-targeting shRNA. ORP8 was shown to compete with Exo70 for interaction with NUP62, and NUP62 knockdown abolished the migration enhancement of ORP8-silenced cells, suggesting that the endogenous ORP8 suppresses migration via binding to NUP62. As a conclusion, the present study reveals new, unexpected aspects of ORP8 function in macrophages not directly involving lipid metabolism, but rather associated with nuclear functions, microtubule organization, and migration capacity. -- Highlights: Black-Right-Pointing-Pointer The phenotype of Raw264.7 macrophage with ORP8 silenced is characterized. Black-Right-Pointing-Pointer ORP8 silencing alters mRNA levels of nuclear and microtubule/centrosome pathways. Black-Right-Pointing-Pointer ORP8 silencing results in increased expression and altered distribution of NUP62. Black-Right-Pointing-Pointer ORP8 silenced macrophages show enhanced migration and altered microtubule cytoskeleton. Black-Right-Pointing-Pointer ORP8 competes in vitro with Exo70 for binding to NUP62.

  19. Performative Silences

    DEFF Research Database (Denmark)

    Dupret, Katia

    2018-01-01

    static nor neutral. It has performative effects. Silencing as an act, rather than a noun, is conceptualised as a central ‘configurating actor’ of change. Through the description of minute details from a videotaped supervision session in the mental healthcare sector, it is shown how different performative...... configurations of silence makes people relate to each other in new ways and influence new work practices. In spite of its somewhat immaterial connotations, using an Actor-Network Theory approach to organization studies, silencing is conceptualised as both a means and an effect of change efforts, which are socio...

  20. Surface coating of siRNA-peptidomimetic nano-self-assemblies with anionic lipid bilayers: enhanced gene silencing and reduced adverse effects in vitro

    Science.gov (United States)

    Zeng, Xianghui; de Groot, Anne Marit; Sijts, Alice J. A. M.; Broere, Femke; Oude Blenke, Erik; Colombo, Stefano; van Eden, Willem; Franzyk, Henrik; Nielsen, Hanne Mørck; Foged, Camilla

    2015-11-01

    Cationic vectors have demonstrated the potential to facilitate intracellular delivery of therapeutic oligonucleotides. However, enhanced transfection efficiency is usually associated with adverse effects, which also proves to be a challenge for vectors based on cationic peptides. In this study a series of proteolytically stable palmitoylated α-peptide/β-peptoid peptidomimetics with a systematically varied number of repeating lysine and homoarginine residues was shown to self-assemble with small interfering RNA (siRNA). The resulting well-defined nanocomplexes were coated with anionic lipids giving rise to net anionic liposomes. These complexes and the corresponding liposomes were optimized towards efficient gene silencing and low adverse effects. The optimal anionic liposomes mediated a high silencing effect, which was comparable to that of the control (cationic Lipofectamine 2000), and did not display any noticeable cytotoxicity and immunogenicity in vitro. In contrast, the corresponding nanocomplexes mediated a reduced silencing effect with a more narrow safety window. The surface coating with anionic lipid bilayers led to partial decomplexation of the siRNA-peptidomimetic nanocomplex core of the liposomes, which facilitated siRNA release. Additionally, the optimal anionic liposomes showed efficient intracellular uptake and endosomal escape. Therefore, these findings suggest that a more efficacious and safe formulation can be achieved by surface coating of the siRNA-peptidomimetic nano-self-assemblies with anionic lipid bilayers.Cationic vectors have demonstrated the potential to facilitate intracellular delivery of therapeutic oligonucleotides. However, enhanced transfection efficiency is usually associated with adverse effects, which also proves to be a challenge for vectors based on cationic peptides. In this study a series of proteolytically stable palmitoylated α-peptide/β-peptoid peptidomimetics with a systematically varied number of repeating lysine

  1. A new electrospray method for targeted gene delivery.

    Science.gov (United States)

    Boehringer, Stephan; Ruzgys, Paulius; Tamò, Luca; Šatkauskas, Saulius; Geiser, Thomas; Gazdhar, Amiq; Hradetzky, David

    2018-03-05

    A challenge for gene therapy is absence of safe and efficient local delivery of therapeutic genetic material. An efficient and reproducible physical method of electrospray for localized and targeted gene delivery is presented. Electrospray works on the principle of coulombs repulsion, under influence of electric field the liquid carrying genetic material is dispersed into micro droplets and is accelerated towards the targeted tissue, acting as a counter electrode. The accelerated droplets penetrate the targeted cells thus facilitating the transfer of genetic material into the cell. The work described here presents the principle of electrospray for gene delivery, the basic instrument design, and the various optimized parameters to enhance gene transfer in vitro. We estimate a transfection efficiency of up to 60% was achieved. We describe an efficient gene transfer method and a potential electrospray-mediated gene transfer mechanism.

  2. Epigenetic Alteration by DNA Promoter Hypermethylation of Genes Related to Transforming Growth Factor-β (TGF-β) Signaling in Cancer

    Energy Technology Data Exchange (ETDEWEB)

    Khin, Sann Sanda [Kobe University Graduate School of Medicine, Division of Diagnostic Molecular Pathology, Kobe 650-0017 (Japan); Pathology Research Unit, Department of Medical Research (Central Myanmar), Naypyitaw, Union of (Myanmar); Kitazawa, Riko [Kobe University Graduate School of Medicine, Division of Diagnostic Molecular Pathology, Kobe 650-0017 (Japan); Ehime University Graduate School of Medicine, Toon 791-0295, Ehime (Japan); Kondo, Takeshi; Idei, Yuka; Fujimoto, Masayo [Kobe University Graduate School of Medicine, Division of Diagnostic Molecular Pathology, Kobe 650-0017 (Japan); Haraguchi, Ryuma [Ehime University Graduate School of Medicine, Toon 791-0295, Ehime (Japan); Mori, Kiyoshi [Kobe University Graduate School of Medicine, Division of Diagnostic Molecular Pathology, Kobe 650-0017 (Japan); Kitazawa, Sohei, E-mail: kitazawa@m.ehime-u.ac.jp [Kobe University Graduate School of Medicine, Division of Diagnostic Molecular Pathology, Kobe 650-0017 (Japan); Ehime University Graduate School of Medicine, Toon 791-0295, Ehime (Japan)

    2011-03-03

    Epigenetic alterations in cancer, especially DNA methylation and histone modification, exert a significant effect on the deregulated expression of cancer-related genes and lay an epigenetic pathway to carcinogenesis and tumor progression. Global hypomethylation and local hypermethylation of CpG islands in the promoter region, which result in silencing tumor suppressor genes, constitute general and major epigenetic modification, the hallmark of the neoplastic epigenome. Additionally, methylation-induced gene silencing commonly affects a number of genes and increases with cancer progression. Indeed, cancers with a high degree of methylation (CpG island methylator phenotype/CIMP) do exist and represent a distinct subset of certain cancers including colorectal, bladder and kidney. On the other hand, signals from the microenvironment, especially those from transforming growth factor-β (TGF-β), induce targeted de novo epigenetic alterations of cancer-related genes. While TGF-β signaling has been implicated in two opposite roles in cancer, namely tumor suppression and tumor promotion, its deregulation is also partly induced by epigenetic alteration itself. Although the epigenetic pathway to carcinogenesis and cancer progression has such reciprocal complexity, the important issue is to identify genes or signaling pathways that are commonly silenced in various cancers in order to find early diagnostic and therapeutic targets. In this review, we focus on the epigenetic alteration by DNA methylation and its role in molecular modulations of the TGF-β signaling pathway that cause or underlie altered cancer-related gene expression in both phases of early carcinogenesis and late cancer progression.

  3. Epigenetic Alteration by DNA Promoter Hypermethylation of Genes Related to Transforming Growth Factor-β (TGF-β) Signaling in Cancer

    International Nuclear Information System (INIS)

    Khin, Sann Sanda; Kitazawa, Riko; Kondo, Takeshi; Idei, Yuka; Fujimoto, Masayo; Haraguchi, Ryuma; Mori, Kiyoshi; Kitazawa, Sohei

    2011-01-01

    Epigenetic alterations in cancer, especially DNA methylation and histone modification, exert a significant effect on the deregulated expression of cancer-related genes and lay an epigenetic pathway to carcinogenesis and tumor progression. Global hypomethylation and local hypermethylation of CpG islands in the promoter region, which result in silencing tumor suppressor genes, constitute general and major epigenetic modification, the hallmark of the neoplastic epigenome. Additionally, methylation-induced gene silencing commonly affects a number of genes and increases with cancer progression. Indeed, cancers with a high degree of methylation (CpG island methylator phenotype/CIMP) do exist and represent a distinct subset of certain cancers including colorectal, bladder and kidney. On the other hand, signals from the microenvironment, especially those from transforming growth factor-β (TGF-β), induce targeted de novo epigenetic alterations of cancer-related genes. While TGF-β signaling has been implicated in two opposite roles in cancer, namely tumor suppression and tumor promotion, its deregulation is also partly induced by epigenetic alteration itself. Although the epigenetic pathway to carcinogenesis and cancer progression has such reciprocal complexity, the important issue is to identify genes or signaling pathways that are commonly silenced in various cancers in order to find early diagnostic and therapeutic targets. In this review, we focus on the epigenetic alteration by DNA methylation and its role in molecular modulations of the TGF-β signaling pathway that cause or underlie altered cancer-related gene expression in both phases of early carcinogenesis and late cancer progression

  4. Phenotypic changes associated with RNA interference silencing of chalcone synthase in apple (Malus × domestica).

    Science.gov (United States)

    Dare, Andrew P; Tomes, Sumathi; Jones, Midori; McGhie, Tony K; Stevenson, David E; Johnson, Ross A; Greenwood, David R; Hellens, Roger P

    2013-05-01

    We have identified in apple (Malus × domestica) three chalcone synthase (CHS) genes. In order to understand the functional redundancy of this gene family RNA interference knockout lines were generated where all three of these genes were down-regulated. These lines had no detectable anthocyanins and radically reduced concentrations of dihydrochalcones and flavonoids. Surprisingly, down-regulation of CHS also led to major changes in plant development, resulting in plants with shortened internode lengths, smaller leaves and a greatly reduced growth rate. Microscopic analysis revealed that these phenotypic changes extended down to the cellular level, with CHS-silenced lines showing aberrant cellular organisation in the leaves. Fruit collected from one CHS-silenced line was smaller than the 'Royal Gala' controls, lacked flavonoids in the skin and flesh and also had changes in cell morphology. Auxin transport experiments showed increased rates of auxin transport in a CHS-silenced line compared with the 'Royal Gala' control. As flavonoids are well known to be key modulators of auxin transport, we hypothesise that the removal of almost all flavonoids from the plant by CHS silencing creates a vastly altered environment for auxin transport to occur and results in the observed changes in growth and development. © 2013 The Authors The Plant Journal © 2013 Blackwell Publishing Ltd.

  5. Elicitation of hypersensitive responses in Nicotiana glutinosa by the suppressor of RNA silencing protein P0 from poleroviruses.

    Science.gov (United States)

    Wang, Ken-Der; Empleo, Roman; Nguyen, Tan Tri V; Moffett, Peter; Sacco, Melanie Ann

    2015-06-01

    Plant disease resistance (R) proteins that confer resistance to viruses recognize viral gene products with diverse functions, including viral suppressors of RNA silencing (VSRs). The P0 protein from poleroviruses is a VSR that targets the ARGONAUTE1 (AGO1) protein for degradation, thereby disrupting RNA silencing and antiviral defences. Here, we report resistance against poleroviruses in Nicotiana glutinosa directed against Turnip yellows virus (TuYV) and Potato leafroll virus (PLRV). The P0 proteins from TuYV (P0(T) (u) ), PLRV (P0(PL) ) and Cucurbit aphid-borne yellows virus (P0(CA) ) were found to elicit a hypersensitive response (HR) in N. glutinosa accession TW59, whereas other accessions recognized P0(PL) only. Genetic analysis showed that recognition of P0(T) (u) by a resistance gene designated RPO1 (Resistance to POleroviruses 1) is inherited as a dominant allele. Expression of P0 from a Potato virus X (PVX) expression vector transferred recognition to the recombinant virus on plants expressing RPO1, supporting P0 as the unique Polerovirus factor eliciting resistance. The induction of HR required a functional P0 protein, as P0(T) (u) mutants with substitutions in the F-box motif that abolished VSR activity were unable to elicit HR. We surmised that the broad P0 recognition seen in TW59 and the requirement for the F-box protein motif could indicate detection of P0-induced AGO1 degradation and disruption of RNA silencing; however, other viral silencing suppressors, including the PVX P25 that also causes AGO1 degradation, failed to elicit HR in N. glutinosa. Investigation of P0 elicitation of RPO1 could provide insight into P0 activities within the cell that trigger resistance. © 2014 BSPP AND JOHN WILEY & SONS LTD.

  6. Silencing of a Germin-Like Protein Gene (CchGLP in Geminivirus-Resistant Pepper (Capsicum chinense Jacq. BG-3821 Increases Susceptibility to Single and Mixed Infections by Geminiviruses PHYVV and PepGMV

    Directory of Open Access Journals (Sweden)

    Laura Mejía-Teniente

    2015-11-01

    Full Text Available Germin-like proteins (GLPs are encoded by a family of genes found in all plants, and in terms of function, the GLPs are implicated in the response of plants to biotic and abiotic stresses. CchGLP is a gene encoding a GLP identified in a geminivirus-resistant Capsicum chinense Jacq accession named BG-3821, and it is important in geminivirus resistance when transferred to susceptible tobacco in transgenic experiments. To characterize the role of this GLP in geminivirus resistance in the original accession from which this gene was identified, this work aimed at demonstrating the possible role of CchGLP in resistance to geminiviruses in Capsicum chinense Jacq. BG-3821. Virus-induced gene silencing studies using a geminiviral vector based in PHYVV component A, displaying that silencing of CchGLP in accession BG-3821, increased susceptibility to geminivirus single and mixed infections. These results suggested that CchGLP is an important factor for geminivirus resistance in C. chinense BG-3821 accession.

  7. Silencing of a Germin-Like Protein Gene (CchGLP) in Geminivirus-Resistant Pepper (Capsicum chinense Jacq.) BG-3821 Increases Susceptibility to Single and Mixed Infections by Geminiviruses PHYVV and PepGMV.

    Science.gov (United States)

    Mejía-Teniente, Laura; Joaquin-Ramos, Ahuizolt de Jesús; Torres-Pacheco, Irineo; Rivera-Bustamante, Rafael F; Guevara-Olvera, Lorenzo; Rico-García, Enrique; Guevara-Gonzalez, Ramon G

    2015-11-25

    Germin-like proteins (GLPs) are encoded by a family of genes found in all plants, and in terms of function, the GLPs are implicated in the response of plants to biotic and abiotic stresses. CchGLP is a gene encoding a GLP identified in a geminivirus-resistant Capsicum chinense Jacq accession named BG-3821, and it is important in geminivirus resistance when transferred to susceptible tobacco in transgenic experiments. To characterize the role of this GLP in geminivirus resistance in the original accession from which this gene was identified, this work aimed at demonstrating the possible role of CchGLP in resistance to geminiviruses in Capsicum chinense Jacq. BG-3821. Virus-induced gene silencing studies using a geminiviral vector based in PHYVV component A, displaying that silencing of CchGLP in accession BG-3821, increased susceptibility to geminivirus single and mixed infections. These results suggested that CchGLP is an important factor for geminivirus resistance in C. chinense BG-3821 accession.

  8. Alfalfa dwarf cytorhabdovirus P protein is a local and systemic RNA silencing supressor which inhibits programmed RISC activity and prevents transitive amplification of RNA silencing.

    Science.gov (United States)

    Bejerman, Nicolás; Mann, Krin S; Dietzgen, Ralf G

    2016-09-15

    Plants employ RNA silencing as an innate defense mechanism against viruses. As a counter-defense, plant viruses have evolved to express RNA silencing suppressor proteins (RSS), which target one or more steps of the silencing pathway. In this study, we show that the phosphoprotein (P) encoded by the negative-sense RNA virus alfalfa dwarf virus (ADV), a species of the genus Cytorhabdovirus, family Rhabdoviridae, is a suppressor of RNA silencing. ADV P has a relatively weak local RSS activity, and does not prevent siRNA accumulation. On the other hand, ADV P strongly suppresses systemic RNA silencing, but does not interfere with the short-distance spread of silencing, which is consistent with its lack of inhibition of siRNA accumulation. The mechanism of suppression appears to involve ADV P binding to RNA-induced silencing complex proteins AGO1 and AGO4 as shown in protein-protein interaction assays when ectopically expressed. In planta, we demonstrate that ADV P likely functions by inhibiting miRNA-guided AGO1 cleavage and prevents transitive amplification by repressing the production of secondary siRNAs. As recently described for lettuce necrotic yellows cytorhabdovirus P, but in contrast to other viral RSS known to disrupt AGO activity, ADV P sequence does not contain any recognizable GW/WG or F-box motifs, which suggests that cytorhabdovirus P proteins may use alternative motifs to bind to AGO proteins. Crown Copyright © 2016. Published by Elsevier B.V. All rights reserved.

  9. Silencing the Girdin gene enhances radio-sensitivity of hepatocellular carcinoma via suppression of glycolytic metabolism.

    Science.gov (United States)

    Yu, Li; Sun, Yifan; Li, Jingjing; Wang, Yan; Zhu, Yuxing; Shi, Yong; Fan, Xiaojun; Zhou, Jianda; Bao, Ying; Xiao, Jie; Cao, Ke; Cao, Peiguo

    2017-08-15

    Radiotherapy has been used increasingly to treat primary hepatocellular carcinoma. Clinically, the main cause of radiotherapy failure is cellular radioresistance, conferred via glycolytic metabolism. Our previous study demonstrated that Girdin is upregulated in primary hepatocellular carcinoma and promotes the invasion and metastasis of tumor cells. However, whether Girdin underlies the radio-sensitivity of hepatocellular carcinoma remains unclear. A short hairpin RNA (shRNA) was used to silence CCDC88A (encoding Girdin), and real-time PCR was performed to determine CCDC88A mRNA expression. Then, cell proliferation, colony formation, flow cytometric, scratch, and transwell assays were to examine the influence of Girdin silencing on cellular radiosensitivity. Glycolysis assays were conducted to exam cell glycolysis process. Western blotting was performed to explore the signaling pathway downstream of Girdin. Finally, animal experiments were performed to demonstrate the effect of CCDC88A silencing on the radiosensitivity of hepatoma in vivo. shRNA-induced Girdin silencing suppressed glycolysis and enhanced the radio-sensitivity of hepatic cell lines, HepG2 and Huh-7. Furthermore, silencing of Girdin inhibited the PI3K/AKT/HIF-1α signaling pathway, which is a central regulator of glycolysis. Girdin can regulate glycolysis in hepatocellular carcinoma cells through the PI3K/AKT/HIF-1α signaling pathway, which decreases the sensitivity of tumor cells to radiotherapy.

  10. Problem-Solving Test: Targeted Gene Disruption

    Science.gov (United States)

    Szeberenyi, Jozsef

    2008-01-01

    Mutational inactivation of a specific gene is the most powerful technique to analyze the biological function of the gene. This approach has been used for a long time in viruses, bacteria, yeast, and fruit fly, but looked quite hopeless in more complex organisms. Targeted inactivation of specific genes (also known as knock-out mutation) in mice is…

  11. In silico analysis and DHPLC screening strategy identifies novel apoptotic gene targets of aberrant promoter hypermethylation in prostate cancer.

    LENUS (Irish Health Repository)

    Murphy, Therese M

    2011-01-01

    Aberrant DNA methylation has been implicated as a key survival mechanism in cancer, whereby promoter hypermethylation silences genes essential for many cellular processes including apoptosis. Limited data is available on the methylation profile of apoptotic genes in prostate cancer (CaP). The aim of this study was to profile methylation of apoptotic-related genes in CaP using denaturing high performance liquid chromatography (DHPLC).

  12. Silencing glypican-3 expression induces apoptosis in human hepatocellular carcinoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Shiyuan [The Second Hospital of Lanzhou University, Lanzhou 730030, Gansu (China); Key Laboratory of Digestive System Tumors of Gansu Province, Lanzhou 730030, Gansu (China); Li, Yumin, E-mail: liym@lzu.edu.cn [The Second Hospital of Lanzhou University, Lanzhou 730030, Gansu (China); Key Laboratory of Digestive System Tumors of Gansu Province, Lanzhou 730030, Gansu (China); Chen, Wei [Department of Biochemistry and Molecular Biology, School of Basic Medical Science, Lanzhou University, Lanzhou 730000, Gansu (China); Zheng, Pengfei [The Second Hospital of Lanzhou University, Lanzhou 730030, Gansu (China); Key Laboratory of Digestive System Tumors of Gansu Province, Lanzhou 730030, Gansu (China); Liu, Tao; He, Wenting; Zhang, Junqiang; Zeng, Xiangting [Key Laboratory of Digestive System Tumors of Gansu Province, Lanzhou 730030, Gansu (China)

    2012-03-23

    Highlights: Black-Right-Pointing-Pointer RNA interference GPC3 induces apoptosis in human hepatocellular carcinoma cell. Black-Right-Pointing-Pointer Silencing GPC3 resulted in the release of cytochrome c and activation of caspase-3. Black-Right-Pointing-Pointer GPC3 modulates the Bax/Bcl-2/cytochrome c/caspase-3 apoptotic signaling pathway. Black-Right-Pointing-Pointer Knockdown of GPC3 is a novel approach to HCC treatment. -- Abstract: Hepatocellular carcinoma (HCC) is one of the most common internal malignant tumors. Glypican-3 (GPC3) is involved in the biological and molecular events in the tumorigenesis of HCC. We used RNA interference to evaluate the molecular effects of GPC3 suppression at the translational level and demonstrated for the first time that GPC3 silencing results in a significant elevation of the Bax/Bcl-2 ratio, the release of cytochrome c from mitochondria and the activation of caspase-3. The results suggest that GPC3 regulates cell proliferation by enhancing the resistance to apoptosis through the dysfunction of the Bax/Bcl-2/cytochrome c/caspase-3 signaling pathway and therefore plays a critical role in the tumorigenesis of HCC. Thus, the knockdown of GPC3 should be further investigated as an attractive novel approach for the targeted gene therapy of HCC.

  13. Computational sequence analysis of predicted long dsRNA transcriptomes of major crops reveals sequence complementarity with human genes.

    Science.gov (United States)

    Jensen, Peter D; Zhang, Yuanji; Wiggins, B Elizabeth; Petrick, Jay S; Zhu, Jin; Kerstetter, Randall A; Heck, Gregory R; Ivashuta, Sergey I

    2013-01-01

    Long double-stranded RNAs (long dsRNAs) are precursors for the effector molecules of sequence-specific RNA-based gene silencing in eukaryotes. Plant cells can contain numerous endogenous long dsRNAs. This study demonstrates that such endogenous long dsRNAs in plants have sequence complementarity to human genes. Many of these complementary long dsRNAs have perfect sequence complementarity of at least 21 nucleotides to human genes; enough complementarity to potentially trigger gene silencing in targeted human cells if delivered in functional form. However, the number and diversity of long dsRNA molecules in plant tissue from crops such as lettuce, tomato, corn, soy and rice with complementarity to human genes that have a long history of safe consumption supports a conclusion that long dsRNAs do not present a significant dietary risk.

  14. Strand Analysis, a free online program for the computational identification of the best RNA interference (RNAi targets based on Gibbs free energy

    Directory of Open Access Journals (Sweden)

    Tiago Campos Pereira

    2007-01-01

    Full Text Available The RNA interference (RNAi technique is a recent technology that uses double-stranded RNA molecules to promote potent and specific gene silencing. The application of this technique to molecular biology has increased considerably, from gene function identification to disease treatment. However, not all small interfering RNAs (siRNAs are equally efficient, making target selection an essential procedure. Here we present Strand Analysis (SA, a free online software tool able to identify and classify the best RNAi targets based on Gibbs free energy (deltaG. Furthermore, particular features of the software, such as the free energy landscape and deltaG gradient, may be used to shed light on RNA-induced silencing complex (RISC activity and RNAi mechanisms, which makes the SA software a distinct and innovative tool.

  15. Silencing of Foxp3 enhances the antitumor efficacy of GM-CSF genetically modified tumor cell vaccine against B16 melanoma

    Directory of Open Access Journals (Sweden)

    Miguel A

    2017-01-01

    Full Text Available Antonio Miguel,1 Luis Sendra,1 Verónica Noé,2 Carles J Ciudad,2 Francisco Dasí,3,4 David Hervas,5 María José Herrero,1,6 Salvador F Aliño17 1Department of Pharmacology, Faculty of Medicine, University of Valencia, 2Department of Biochemistry and Molecular Biology, Faculty of Pharmacy, University of Barcelona, 3Research University Hospital of Valencia, INCLIVA Health Research Institute, 4Department of Physiology, Faculty of Medicine, University of Valencia Foundation, 5Biostatistics Unit, 6Pharmacogenetics Unit, Instituto de Investigación Sanitaria La Fe (IIS La Fe, 7Clinical Pharmacology Unit, ACM Hospital Universitario y Politécnico La Fe, Valencia, Spain Abstract: The antitumor response after therapeutic vaccination has a limited effect and seems to be related to the presence of T regulatory cells (Treg, which express the immunoregulatory molecules CTLA4 and Foxp3. The blockage of CTLA4 using antibodies has shown an effective antitumor response conducing to the approval of the human anti-CTLA4 antibody ipilimumab by the US Food and Drug Administration. On the other hand, Foxp3 is crucial for Treg development. For this reason, it is an attractive target for cancer treatment. This study aims to evaluate whether combining therapeutic vaccination with CTLA4 or Foxp3 gene silencing enhances the antitumor response. First, the “in vitro” cell entrance and gene silencing efficacy of two tools, 2'-O-methyl phosphorotioate-modified oligonucleotides (2'-OMe-PS-ASOs and polypurine reverse Hoogsteen hairpins (PPRHs, were evaluated in EL4 cells and cultured primary lymphocytes. Following B16 tumor transplant, C57BL6 mice were vaccinated with irradiated B16 tumor cells engineered to produce granulocyte-macrophage colony-stimulating factor (GM-CSF and were intraperitoneally treated with CTLA4 and Foxp3 2'-OMe-PS-ASO before and after vaccination. Tumor growth, mice survival, and CTLA4 and Foxp3 expression in blood cells were measured. The following

  16. Targeting caspase-3 as dual therapeutic benefits by RNAi facilitating brain-targeted nanoparticles in a rat model of Parkinson's disease.

    Science.gov (United States)

    Liu, Yang; Guo, Yubo; An, Sai; Kuang, Yuyang; He, Xi; Ma, Haojun; Li, Jianfeng; Lu, Jing; Lv, Jing; Zhang, Ning; Jiang, Chen

    2013-01-01

    The activation of caspase-3 is an important hallmark in Parkinson's disease. It could induce neuron death by apoptosis and microglia activation by inflammation. As a result, inhibition the activation of caspase-3 would exert synergistic dual effect in brain in order to prevent the progress of Parkinson's disease. Silencing caspase-3 genes by RNA interference could inhibit the activation of caspase-3. We developed a brain-targeted gene delivery system based on non-viral gene vector, dendrigraft poly-L-lysines. A rabies virus glycoprotein peptide with 29 amino-acid linked to dendrigraft poly-L-lysines could render gene vectors the ability to get across the blood brain barrier by specific receptor mediated transcytosis. The resultant brain-targeted vector was complexed with caspase-3 short hairpin RNA coding plasmid DNA, yielding nanoparticles. In vivo imaging analysis indicated the targeted nanoparticles could accumulate in brain more efficiently than non-targeted ones. A multiple dosing regimen by weekly intravenous administration of the nanoparticles could reduce activated casapse-3 levels, significantly improve locomotor activity and rescue dopaminergic neuronal loss and in Parkinson's disease rats' brain. These results indicated the rabies virus glycoprotein peptide modified brain-targeted nanoparticles were promising gene delivery system for RNA interference to achieve anti-apoptotic and anti-inflammation synergistic therapeutic effects by down-regulation the expression and activation of caspase-3.

  17. Targeting caspase-3 as dual therapeutic benefits by RNAi facilitating brain-targeted nanoparticles in a rat model of Parkinson's disease.

    Directory of Open Access Journals (Sweden)

    Yang Liu

    Full Text Available The activation of caspase-3 is an important hallmark in Parkinson's disease. It could induce neuron death by apoptosis and microglia activation by inflammation. As a result, inhibition the activation of caspase-3 would exert synergistic dual effect in brain in order to prevent the progress of Parkinson's disease. Silencing caspase-3 genes by RNA interference could inhibit the activation of caspase-3. We developed a brain-targeted gene delivery system based on non-viral gene vector, dendrigraft poly-L-lysines. A rabies virus glycoprotein peptide with 29 amino-acid linked to dendrigraft poly-L-lysines could render gene vectors the ability to get across the blood brain barrier by specific receptor mediated transcytosis. The resultant brain-targeted vector was complexed with caspase-3 short hairpin RNA coding plasmid DNA, yielding nanoparticles. In vivo imaging analysis indicated the targeted nanoparticles could accumulate in brain more efficiently than non-targeted ones. A multiple dosing regimen by weekly intravenous administration of the nanoparticles could reduce activated casapse-3 levels, significantly improve locomotor activity and rescue dopaminergic neuronal loss and in Parkinson's disease rats' brain. These results indicated the rabies virus glycoprotein peptide modified brain-targeted nanoparticles were promising gene delivery system for RNA interference to achieve anti-apoptotic and anti-inflammation synergistic therapeutic effects by down-regulation the expression and activation of caspase-3.

  18. Effect of the linkers between the zinc fingers in zinc finger protein 809 on gene silencing and nuclear localization

    Energy Technology Data Exchange (ETDEWEB)

    Ichida, Yu, E-mail: ichida-y@ncchd.go.jp; Utsunomiya, Yuko; Onodera, Masafumi

    2016-03-18

    Zinc finger protein 809 (ZFP809) belongs to the Kruppel-associated box-containing zinc finger protein (KRAB-ZFP) family and functions in repressing the expression of Moloney murine leukemia virus (MoMLV). ZFP809 binds to the primer-binding site (PBS)located downstream of the MoMLV-long terminal repeat (LTR) and induces epigenetic modifications at integration sites, such as repressive histone modifications and de novo DNA methylation. KRAB-ZFPs contain consensus TGEKP linkers between C2H2 zinc fingers. The phosphorylation of threonine residues within linkers leads to the inactivation of zinc finger binding to target sequences. ZFP809 also contains consensus linkers between zinc fingers. However, the function of ZFP809 linkers remains unknown. In the present study, we constructed ZFP809 proteins containing mutated linkers and examined their ability to silence transgene expression driven by MLV, binding ability to MLV PBS, and cellular localization. The results of the present study revealed that the linkers affected the ability of ZFP809 to silence transgene expression. Furthermore, this effect could be partly attributed to changes in the localization of ZFP809 proteins containing mutated linkers. Further characterization of ZFP809 linkers is required for understanding the functions and features of KRAB-ZFP-containing linkers. - Highlights: • ZFP809 has three consensus linkers between the zinc fingers. • Linkers are required for ZFP809 to silence transgene expression driven by MLV-LTR. • Linkers affect the precise nuclear localization of ZFP809.

  19. 5-Azacytidine mediated reactivation of silenced transgenes in potato (Solanum tuberosum) at the whole plant level.

    Science.gov (United States)

    Tyč, Dimitrij; Nocarová, Eva; Sikorová, Lenka; Fischer, Lukáš

    2017-08-01

    Transient 5-azacytidine treatment of leaf explants from potato plants with transcriptionally silenced transgenes allows de novo regeneration of plants with restored transgene expression at the whole plant level. Transgenes introduced into plant genomes frequently become silenced either at the transcriptional or the posttranscriptional level. Transcriptional silencing is usually associated with DNA methylation in the promoter region. Treatments with inhibitors of maintenance DNA methylation were previously shown to allow reactivation of transcriptionally silenced transgenes in single cells or tissues, but not at the whole plant level. Here we analyzed the effect of DNA methylation inhibitor 5-azacytidine (AzaC) on the expression of two silenced reporter genes encoding green fluorescent protein (GFP) and neomycin phosphotransferase (NPTII) in potato plants. Whereas no obvious reactivation was observed in AzaC-treated stem cuttings, transient treatment of leaf segments with 10 μM AzaC and subsequent de novo regeneration of shoots on the selective medium with kanamycin resulted in the production of whole plants with clearly reactivated expression of previously silenced transgenes. Reactivation of nptII expression was accompanied by a decrease in cytosine methylation in the promoter region of the gene. Using the plants with reactivated GFP expression, we found that re-silencing of this transgene can be accidentally triggered by de novo regeneration. Thus, testing the incidence of transgene silencing during de novo regeneration could be a suitable procedure for negative selection of transgenic lines (insertion events) which have an inclination to be silenced. Based on our analysis of non-specific inhibitory effects of AzaC on growth of potato shoots in vitro, we estimated that AzaC half-life in the culture media is approximately 2 days.

  20. Silencing of DNase Colicin E8 Gene Expression by a Complex Nucleoprotein Assembly Ensures Timely Colicin Induction.

    Directory of Open Access Journals (Sweden)

    Simona Kamenšek

    2015-06-01

    Full Text Available Colicins are plasmid-encoded narrow spectrum antibiotics that are synthesized by strains of Escherichia coli and govern intraspecies competition. In a previous report, we demonstrated that the global transcriptional factor IscR, co dependently with the master regulator of the DNA damage response, LexA, delays induction of the pore forming colicin genes after SOS induction. Here we show that IscR is not involved in the regulation of nuclease colicins, but that the AsnC protein is. We report that AsnC, in concert with LexA, is the key controller of the temporal induction of the DNA degrading colicin E8 gene (cea8, after DNA damage. We demonstrate that a large AsnC nucleosome-like structure, in conjunction with two LexA molecules, prevent cea8 transcription initiation and that AsnC binding activity is directly modulated by L asparagine. We show that L-asparagine is an environmental factor that has a marked impact on cea8 promoter regulation. Our results show that AsnC also modulates the expression of several other DNase and RNase colicin genes but does not substantially affect pore-forming colicin K gene expression. We propose that selection pressure has "chosen" highly conserved regulators to control colicin expression in E. coli strains, enabling similar colicin gene silencing among bacteria upon exchange of colicinogenic plasmids.

  1. H ferritin silencing induces protein misfolding in K562 cells: A Raman analysis

    KAUST Repository

    Zolea, Fabiana

    2015-10-09

    The redox state of the cell is involved in the regulation of many physiological functions as well as in the pathogenesis of several diseases, and is strictly dependent on the amount of iron in its catalytically active state. Alterations of iron homeostasis determine increased steady-state concentrations of Reactive Oxygen Species (ROS) that cause lipid peroxidation, DNA damage and altered protein folding. Ferritin keeps the intracellular iron in a non-toxic and readily available form and consequently plays a central role in iron and redox homeostasis. The protein is composed by 24 subunits of the H- and L-type, coded by two different genes, with structural and functional differences. The aim of this study was to shed light on the role of the single H ferritin subunit (FHC) in keeping the native correct protein three-dimensional structure. To this, we performed Raman spectroscopy on protein extracts from K562 cells subjected to FHC silencing. The results show a significant increase in the percentage of disordered structures content at a level comparable to that induced by H2O2 treatment in control cells. ROS inhibitor and iron chelator were able to revert protein misfolding. This integrated approach, involving Raman spectroscopy and targeted-gene silencing, indicates that an imbalance of the heavy-to-light chain ratio in the ferritin composition is able to induce severe but still reversible modifications in protein folding and uncovers new potential pathogenetic mechanisms associated to intracellular iron perturbation.

  2. H ferritin silencing induces protein misfolding in K562 cells: A Raman analysis

    KAUST Repository

    Zolea, Fabiana; Biamonte, Flavia; Candeloro, Patrizio; Di Sanzo, Maddalena; Cozzi, Anna; Di Vito, Anna; Quaresima, Barbara; Lobello, Nadia; Trecroci, Francesca; Di Fabrizio, Enzo M.; Levi, Sonia; Cuda, Giovanni; Costanzo, Francesco

    2015-01-01

    The redox state of the cell is involved in the regulation of many physiological functions as well as in the pathogenesis of several diseases, and is strictly dependent on the amount of iron in its catalytically active state. Alterations of iron homeostasis determine increased steady-state concentrations of Reactive Oxygen Species (ROS) that cause lipid peroxidation, DNA damage and altered protein folding. Ferritin keeps the intracellular iron in a non-toxic and readily available form and consequently plays a central role in iron and redox homeostasis. The protein is composed by 24 subunits of the H- and L-type, coded by two different genes, with structural and functional differences. The aim of this study was to shed light on the role of the single H ferritin subunit (FHC) in keeping the native correct protein three-dimensional structure. To this, we performed Raman spectroscopy on protein extracts from K562 cells subjected to FHC silencing. The results show a significant increase in the percentage of disordered structures content at a level comparable to that induced by H2O2 treatment in control cells. ROS inhibitor and iron chelator were able to revert protein misfolding. This integrated approach, involving Raman spectroscopy and targeted-gene silencing, indicates that an imbalance of the heavy-to-light chain ratio in the ferritin composition is able to induce severe but still reversible modifications in protein folding and uncovers new potential pathogenetic mechanisms associated to intracellular iron perturbation.

  3. Gene targeting in adult rhesus macaque fibroblasts

    Directory of Open Access Journals (Sweden)

    Wolf Don P

    2008-03-01

    Full Text Available Abstract Background Gene targeting in nonhuman primates has the potential to produce critical animal models for translational studies related to human diseases. Successful gene targeting in fibroblasts followed by somatic cell nuclear transfer (SCNT has been achieved in several species of large mammals but not yet in primates. Our goal was to establish the protocols necessary to achieve gene targeting in primary culture of adult rhesus macaque fibroblasts as a first step in creating nonhuman primate models of genetic disease using nuclear transfer technology. Results A primary culture of adult male fibroblasts was transfected with hTERT to overcome senescence and allow long term in vitro manipulations. Successful gene targeting of the HPRT locus in rhesus macaques was achieved by electroporating S-phase synchronized cells with a construct containing a SV40 enhancer. Conclusion The cell lines reported here could be used for the production of null mutant rhesus macaque models of human genetic disease using SCNT technology. In addition, given the close evolutionary relationship and biological similarity between rhesus macaques and humans, the protocols described here may prove useful in the genetic engineering of human somatic cells.

  4. Keap1 silencing boosts lipopolysaccharide-induced transcription of interleukin 6 via activation of nuclear factor κB in macrophages

    International Nuclear Information System (INIS)

    Lv, Peng; Xue, Peng; Dong, Jian; Peng, Hui; Clewell, Rebecca; Wang, Aiping; Wang, Yue; Peng, Shuangqing; Qu, Weidong; Zhang, Qiang; Andersen, Melvin E.; Pi, Jingbo

    2013-01-01

    Interleukin-6 (IL6) is a multifunctional cytokine that regulates immune and inflammatory responses. Multiple transcription factors, including nuclear factor κB (NF-κB) and nuclear factor E2-related factor 2 (Nrf2), regulate IL6 transcription. Kelch-like ECH-associated protein 1 (Keap1) is a substrate adaptor protein for the Cullin 3-dependent E3 ubiquitin ligase complex, which regulates the degradation of many proteins, including Nrf2 and IκB kinase β (IKKβ). Here, we found that stable knockdown of Keap1 (Keap1-KD) in RAW 264.7 (RAW) mouse macrophages and human monocyte THP-1 cells significantly increased expression of Il6, and Nrf2-target genes, under basal and lipopolysaccharide (LPS, 0.001–0.1 μg/ml)-challenged conditions. However, Nrf2 activation alone, by tert-butylhydroquinone treatment of RAW cells, did not increase expression of Il6. Compared to cells transduced with scrambled non-target negative control shRNA, Keap1-KD RAW cells showed enhanced protein levels of IKKβ and increased expression and phosphorylation of NF-κB p65 under non-stressed and LPS-treated conditions. Because the expression of Il6 in Keap1-KD RAW cells was significantly attenuated by silencing of Ikkβ, but not Nrf2, it appears that stabilized IKKβ is responsible for the enhanced transactivation of Il6 in Keap1-KD cells. This study demonstrated that silencing of Keap1 in macrophages boosts LPS-induced transcription of Il6 via NF-κB activation. Given the importance of IL6 in the inflammatory response, the Keap1–IKKβ–NF-κB pathway may be a novel target for treatment and prevention of inflammation and associated disorders. - Highlights: • Knockdown of Keap1 increases expression of Il6 in macrophages. • Silencing of Keap1 results in protein accumulation of IKKβ and NF-κB p65. • Induction of Il6 resulting from Keap1 silencing is attributed to NF-κB activation

  5. Keap1 silencing boosts lipopolysaccharide-induced transcription of interleukin 6 via activation of nuclear factor κB in macrophages

    Energy Technology Data Exchange (ETDEWEB)

    Lv, Peng [Institute of Materia Medica, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing (China); Institute for Chemical Safety Sciences, The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC 27709 (United States); Xue, Peng; Dong, Jian [Institute for Chemical Safety Sciences, The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC 27709 (United States); Peng, Hui [Institute for Chemical Safety Sciences, The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC 27709 (United States); Evaluation and Research Center for Toxicology, Institute of Disease Control and Prevention, Academy of Military Medical Sciences (China); Clewell, Rebecca [Institute for Chemical Safety Sciences, The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC 27709 (United States); Wang, Aiping [Institute of Materia Medica, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing (China); Wang, Yue [Institute for Medical Device Standardization Administration, National Institutes for Food and Drug Control, Beijing (China); Peng, Shuangqing [Evaluation and Research Center for Toxicology, Institute of Disease Control and Prevention, Academy of Military Medical Sciences (China); Qu, Weidong [Key Laboratory of the Public Health Safety, Ministry of Education, School of Public Health, Fudan University, Shanghai (China); Zhang, Qiang; Andersen, Melvin E. [Institute for Chemical Safety Sciences, The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC 27709 (United States); Pi, Jingbo, E-mail: jpi@thehamner.org [Institute for Chemical Safety Sciences, The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC 27709 (United States)

    2013-11-01

    Interleukin-6 (IL6) is a multifunctional cytokine that regulates immune and inflammatory responses. Multiple transcription factors, including nuclear factor κB (NF-κB) and nuclear factor E2-related factor 2 (Nrf2), regulate IL6 transcription. Kelch-like ECH-associated protein 1 (Keap1) is a substrate adaptor protein for the Cullin 3-dependent E3 ubiquitin ligase complex, which regulates the degradation of many proteins, including Nrf2 and IκB kinase β (IKKβ). Here, we found that stable knockdown of Keap1 (Keap1-KD) in RAW 264.7 (RAW) mouse macrophages and human monocyte THP-1 cells significantly increased expression of Il6, and Nrf2-target genes, under basal and lipopolysaccharide (LPS, 0.001–0.1 μg/ml)-challenged conditions. However, Nrf2 activation alone, by tert-butylhydroquinone treatment of RAW cells, did not increase expression of Il6. Compared to cells transduced with scrambled non-target negative control shRNA, Keap1-KD RAW cells showed enhanced protein levels of IKKβ and increased expression and phosphorylation of NF-κB p65 under non-stressed and LPS-treated conditions. Because the expression of Il6 in Keap1-KD RAW cells was significantly attenuated by silencing of Ikkβ, but not Nrf2, it appears that stabilized IKKβ is responsible for the enhanced transactivation of Il6 in Keap1-KD cells. This study demonstrated that silencing of Keap1 in macrophages boosts LPS-induced transcription of Il6 via NF-κB activation. Given the importance of IL6 in the inflammatory response, the Keap1–IKKβ–NF-κB pathway may be a novel target for treatment and prevention of inflammation and associated disorders. - Highlights: • Knockdown of Keap1 increases expression of Il6 in macrophages. • Silencing of Keap1 results in protein accumulation of IKKβ and NF-κB p65. • Induction of Il6 resulting from Keap1 silencing is attributed to NF-κB activation.

  6. Specific degradation of 3' regions of GUS mRNA in posttranscriptionally silenced tobacco lines may be related to 5'-3' spreading of silencing

    DEFF Research Database (Denmark)

    Braunstein, Thomas Hartig; Moury, Benoit; Johannessen, Marina

    2002-01-01

    background, we have performed detailed analyses of target regions in three spontaneously beta-glucuronidase (GUS) silencing tobacco lines of different origin. From quantitative cosuppression experiments, we show that the main target region in all three tobacco lines is found within the 3' half of the GUS...... VIGS. Surprisingly, only evidence for spreading of the target region in the 5'-3' direction was obtained. This finding may help explain why the majority of target regions examined to date lie within the 3' region of transgenes....

  7. The Research Progress of SiRNA Targeting Notch1 on Tumor Cells: A Mini Review of the State of the Art

    Directory of Open Access Journals (Sweden)

    Lanfen Huo

    2016-09-01

    Full Text Available Notch signaling is a highly conserved signaling pathway, playing an important role in a variety of cell differentiation, development and regulation. Notch signaling includes Notch1-4; Notch1 gene encodes Notch1 signaling that can shorten cell cycle, enhance cell proliferation, inhibit cell differentiation, and promote apoptosis. Mutation and overexpression of the Notch1 gene may induce tumorigenesis, which plays an important role in the development of tumors across a variety of signaling pathways. Currently, using RNA interference technology (RNAi synthesizing small interference RNA (siRNA targeting Notch1 gene(siNotch1)has become a hot topic, and clinical application of gene silencing has also obtained a certain therapeutic effect. In this paper, the application of Notch1 gene silencing in tumor progress was reviewed.

  8. Sumoylation of Sir2 differentially regulates transcriptional silencing in yeast.

    Science.gov (United States)

    Hannan, Abdul; Abraham, Neethu Maria; Goyal, Siddharth; Jamir, Imlitoshi; Priyakumar, U Deva; Mishra, Krishnaveni

    2015-12-02

    Silent information regulator 2 (Sir2), the founding member of the conserved sirtuin family of NAD(+)-dependent histone deacetylase, regulates several physiological processes including genome stability, gene silencing, metabolism and life span in yeast. Within the nucleus, Sir2 is associated with telomere clusters in the nuclear periphery and rDNA in the nucleolus and regulates gene silencing at these genomic sites. How distribution of Sir2 between telomere and rDNA is regulated is not known. Here we show that Sir2 is sumoylated and this modification modulates the intra-nuclear distribution of Sir2. We identify Siz2 as the key SUMO ligase and show that multiple lysines in Sir2 are subject to this sumoylation activity. Mutating K215 alone counteracts the inhibitory effect of Siz2 on telomeric silencing. SUMO modification of Sir2 impairs interaction with Sir4 but not Net1 and, furthermore, SUMO modified Sir2 shows predominant nucleolar localization. Our findings demonstrate that sumoylation of Sir2 modulates distribution between telomeres and rDNA and this is likely to have implications for Sir2 function in other loci as well. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. Double-stranded RNA delivery through soaking mediates silencing of the muscle protein 20 and increases mortality to the Asian citrus psyllid, Diaphorina citri.

    Science.gov (United States)

    Yu, Xiudao; Gowda, Siddarame; Killiny, Nabil

    2017-09-01

    Asian citrus psyllid, Diaphorina citri Kuwayama, is the most important economic pest of citrus because it transmits Candidatus Liberibacter asiaticus (CLas), the causal agent of huanglongbing (HLB). Silencing genes by RNA interference (RNAi) is a promising approach for controlling D. citri. RNAi-based insect management strategies depend on the selection of suitable target genes. The muscle protein 20 gene DcMP20 was characterized from D. citri in an effort to impair proper muscle development through RNAi. Phylogenetic analysis showed that DcMP20 was more closely related to MP20 from Drosophila compared with its counterpart from other insect species. Developmental expression analysis revealed that transcription of DcMP20 was development dependent and reached a maximum level in the last instar (fourth-fifth) of the nymphal stage. The extent of RNAi in D. citri was dose dependent, with dsRNA-DcMP20 at 75 ng µL -1 being sufficient to knock down endogenous DcMP20 expression, which resulted in significant mortality and reduced body weight that positively correlated with the silencing of DcMP20. No effect was found when dsRNA-GFP or water was used, indicating the specific effect of dsRNA-DcMP20. Our results suggest that dsRNA can be delivered to D. citri through soaking, and DcMP20 is an effective RNAi target to be used in the management of D. citri. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  10. Novel targeted therapy for neuroblastoma: silencing the MXD3 gene using siRNA.

    Science.gov (United States)

    Duong, Connie; Yoshida, Sakiko; Chen, Cathy; Barisone, Gustavo; Diaz, Elva; Li, Yueju; Beckett, Laurel; Chung, Jong; Antony, Reuben; Nolta, Jan; Nitin, Nitin; Satake, Noriko

    2017-09-01

    BackgroundNeuroblastoma is the second most common extracranial cancer in children. Current therapies for neuroblastoma, which use a combination of chemotherapy drugs, have limitations for high-risk subtypes and can cause significant long-term adverse effects in young patients. Therefore, a new therapy is needed. In this study, we investigated the transcription factor MXD3 as a potential therapeutic target in neuroblastoma.MethodsMXD3 expression was analyzed in five neuroblastoma cell lines by immunocytochemistry and quantitative real-time reverse transcription PCR, and in 18 primary patient tumor samples by immunohistochemistry. We developed nanocomplexes using siRNA and superparamagnetic iron oxide nanoparticles to target MXD3 in neuroblastoma cell lines in vitro as a single-agent therapeutic and in combination with doxorubicin, vincristine, cisplatin, or maphosphamide-common drugs used in current neuroblastoma treatment.ResultsMXD3 was highly expressed in neuroblastoma cell lines and in patient tumors that had high-risk features. Neuroblastoma cells treated in vitro with the MXD3 siRNA nanocomplexes showed MXD3 protein knockdown and resulted in cell apoptosis. Furthermore, on combining MXD3 siRNA nanocomplexes with each of the four drugs, all showed additive efficacy.ConclusionThese results indicate that MXD3 is a potential new target and that the use of MXD3 siRNA nanocomplexes is a novel therapeutic approach for neuroblastoma.

  11. Down-regulation of Fusarium oxysporum endogenous genes by Host-Delivered RNA interference enhances disease resistance

    Directory of Open Access Journals (Sweden)

    Zongli eHu

    2015-01-01

    Full Text Available Fusarium oxysporum is a devastating pathogen causing extensive yield losses in a variety of crops and development of sustainable, environmentally friendly methods to improve crop resistance is crucial. We have used Host-Derived RNA interference (HD-RNAi technology to partially silence three different genes (FOW2, FRP1 and OPR in the hemi-biotrophic fungus Fusarium oxysporum f. sp. conglutinans. Expression of double stranded RNA molecules targeting fungal pathogen genes was achieved in a number of transgenic Arabidopsis lines. F. oxysporum infecting the transgenic lines displayed substantially reduced mRNA levels on all three targeted genes, with an average of 75%, 83% and 72% reduction for FOW2, FRP1 and OPR respectively. The silencing of pathogen genes had a clear positive effect on the ability of the transgenic lines to fight infection. All transgenic lines displayed enhanced resistance to F. oxysporum with delayed disease symptom development, especially FRP1 and OPR lines. Survival rates after fungal infection were higher in the transgenic lines compared to control wild type plants which consistently showed survival rates of 10%, with FOW2 lines showing 25% survival; FRP1 lines 30-50% survival and FOW2 between 45-70% survival. The down-regulation effect was specific for the targeted genes without unintended effects in related genes. In addition to producing resistant crops, HD-RNAi can provide a useful tool to rapidly screen candidate fungal pathogenicity genes without the need to produce fungal knockout mutants.

  12. Down-regulation of Fusarium oxysporum endogenous genes by Host-Delivered RNA interference enhances disease resistance

    Science.gov (United States)

    Hu, Zongli; Parekh, Urvi; Maruta, Natsumi; Trusov, Yuri; Botella, Jimmy

    2015-01-01

    Fusarium oxysporum is a devastating pathogen causing extensive yield losses in a variety of crops and development of sustainable, environmentally friendly methods to improve crop resistance is crucial. We have used Host-Derived RNA interference (HD-RNAi) technology to partially silence three different genes (FOW2, FRP1 and OPR) in the hemi-biotrophic fungus Fusarium oxysporum f. sp. conglutinans. Expression of double stranded RNA molecules targeting fungal pathogen genes was achieved in a number of transgenic Arabidopsis lines. F. oxysporum infecting the transgenic lines displayed substantially reduced mRNA levels on all three targeted genes, with an average of 75%, 83% and 72% reduction for FOW2, FRP1 and OPR respectively. The silencing of pathogen genes had a clear positive effect on the ability of the transgenic lines to fight infection. All transgenic lines displayed enhanced resistance to F. oxysporum with delayed disease symptom development, especially FRP1 and OPR lines. Survival rates after fungal infection were higher in the transgenic lines compared to control wild type plants which consistently showed survival rates of 10%, with FOW2 lines showing 25% survival; FRP1 lines 30-50% survival and FOW2 between 45-70% survival. The down-regulation effect was specific for the targeted genes without unintended effects in related genes. In addition to producing resistant crops, HD-RNAi can provide a useful tool to rapidly screen candidate fungal pathogenicity genes without the need to produce fungal knockout mutants.

  13. Application of gene targeting to designed mutation breeding of high-tryptophan rice.

    Science.gov (United States)

    Saika, Hiroaki; Oikawa, Akira; Matsuda, Fumio; Onodera, Haruko; Saito, Kazuki; Toki, Seiichi

    2011-07-01

    Site-directed mutagenesis via gene targeting (GT) based on homologous recombination is the ultimate mutation breeding technology because it enables useful information acquired from structural- and computational-based protein engineering to be applied directly to molecular breeding, including metabolic engineering, of crops. Here, we employed this rationale to introduce precise mutations in OASA2--an α-subunit of anthranilate synthase that is a key enzyme of tryptophan (Trp) biosynthesis in rice (Oryza sativa)--via GT, with subsequent selection of GT cells using a Trp analog. The expression level of OASA2 in plants homozygous and heterozygous for modified OASA2 was similar to that of nontransformants, suggesting that OASA2 transcription in GT plants was controlled in the same manner as endogenous OASA2, and that GT could lead to a lower risk of gene silencing than in conventional overexpression approaches. Moreover, we showed that enzymatic properties deduced from protein engineering or in vitro analysis could be reproduced in GT plants as evidenced by Trp accumulation levels. Interestingly, mature seeds of homozygous GT plants accumulated Trp levels 230-fold higher than in nontransformants without any apparent morphological or developmental changes. Thus, we have succeeded in producing a novel rice plant of great potential nutritional benefit for both man and livestock that could not have been selected using conventional mutagenesis approaches. Our results demonstrate the effectiveness of directed crop improvement by combining precision mutagenesis via GT with a knowledge of protein engineering.

  14. Tobacco rattle virus (TRV) based silencing of cotton enoyl-CoA reductase (ECR) gene and the role of very long chain fatty acids in normal leaf development and resistance to wilt disease

    Science.gov (United States)

    A Tobacco rattle virus (TRV) based virus-induced gene silencing (VIGS) assay was employed as a reverse genetic approach to study gene function in cotton (Gossypium hirsutum). This approach was used to investigate the function of Enoyl-CoA reductase (GhECR) in pathogen defense. Amino acid sequence al...

  15. Newer Gene Editing Technologies toward HIV Gene Therapy

    Directory of Open Access Journals (Sweden)

    Premlata Shankar

    2013-11-01

    Full Text Available Despite the great success of highly active antiretroviral therapy (HAART in ameliorating the course of HIV infection, alternative therapeutic approaches are being pursued because of practical problems associated with life-long therapy. The eradication of HIV in the so-called “Berlin patient” who received a bone marrow transplant from a CCR5-negative donor has rekindled interest in genome engineering strategies to achieve the same effect. Precise gene editing within the cells is now a realistic possibility with recent advances in understanding the DNA repair mechanisms, DNA interaction with transcription factors and bacterial defense mechanisms. Within the past few years, four novel technologies have emerged that can be engineered for recognition of specific DNA target sequences to enable site-specific gene editing: Homing Endonuclease, ZFN, TALEN, and CRISPR/Cas9 system. The most recent CRISPR/Cas9 system uses a short stretch of complementary RNA bound to Cas9 nuclease to recognize and cleave target DNA, as opposed to the previous technologies that use DNA binding motifs of either zinc finger proteins or transcription activator-like effector molecules fused to an endonuclease to mediate sequence-specific DNA cleavage. Unlike RNA interference, which requires the continued presence of effector moieties to maintain gene silencing, the newer technologies allow permanent disruption of the targeted gene after a single treatment. Here, we review the applications, limitations and future prospects of novel gene-editing strategies for use as HIV therapy.

  16. Senataxin plays an essential role with DNA damage response proteins in meiotic recombination and gene silencing.

    Directory of Open Access Journals (Sweden)

    Olivier J Becherel

    2013-04-01

    Full Text Available Senataxin, mutated in the human genetic disorder ataxia with oculomotor apraxia type 2 (AOA2, plays an important role in maintaining genome integrity by coordination of transcription, DNA replication, and the DNA damage response. We demonstrate that senataxin is essential for spermatogenesis and that it functions at two stages in meiosis during crossing-over in homologous recombination and in meiotic sex chromosome inactivation (MSCI. Disruption of the Setx gene caused persistence of DNA double-strand breaks, a defect in disassembly of Rad51 filaments, accumulation of DNA:RNA hybrids (R-loops, and ultimately a failure of crossing-over. Senataxin localised to the XY body in a Brca1-dependent manner, and in its absence there was incomplete localisation of DNA damage response proteins to the XY chromosomes and ATR was retained on the axial elements of these chromosomes, failing to diffuse out into chromatin. Furthermore persistence of RNA polymerase II activity, altered ubH2A distribution, and abnormal XY-linked gene expression in Setx⁻/⁻ revealed an essential role for senataxin in MSCI. These data support key roles for senataxin in coordinating meiotic crossing-over with transcription and in gene silencing to protect the integrity of the genome.

  17. Targeting trichothecene biosynthetic genes

    NARCIS (Netherlands)

    Wei, Songhong; Lee, van der Theo; Verstappen, Els; Gent, van Marga; Waalwijk, Cees

    2017-01-01

    Biosynthesis of trichothecenes requires the involvement of at least 15 genes, most of which have been targeted for PCR. Qualitative PCRs are used to assign chemotypes to individual isolates, e.g., the capacity to produce type A and/or type B trichothecenes. Many regions in the core cluster

  18. Multi-targeted priming for genome-wide gene expression assays

    Directory of Open Access Journals (Sweden)

    Adomas Aleksandra B

    2010-08-01

    Full Text Available Abstract Background Complementary approaches to assaying global gene expression are needed to assess gene expression in regions that are poorly assayed by current methodologies. A key component of nearly all gene expression assays is the reverse transcription of transcribed sequences that has traditionally been performed by priming the poly-A tails on many of the transcribed genes in eukaryotes with oligo-dT, or by priming RNA indiscriminately with random hexamers. We designed an algorithm to find common sequence motifs that were present within most protein-coding genes of Saccharomyces cerevisiae and of Neurospora crassa, but that were not present within their ribosomal RNA or transfer RNA genes. We then experimentally tested whether degenerately priming these motifs with multi-targeted primers improved the accuracy and completeness of transcriptomic assays. Results We discovered two multi-targeted primers that would prime a preponderance of genes in the genomes of Saccharomyces cerevisiae and Neurospora crassa while avoiding priming ribosomal RNA or transfer RNA. Examining the response of Saccharomyces cerevisiae to nitrogen deficiency and profiling Neurospora crassa early sexual development, we demonstrated that using multi-targeted primers in reverse transcription led to superior performance of microarray profiling and next-generation RNA tag sequencing. Priming with multi-targeted primers in addition to oligo-dT resulted in higher sensitivity, a larger number of well-measured genes and greater power to detect differences in gene expression. Conclusions Our results provide the most complete and detailed expression profiles of the yeast nitrogen starvation response and N. crassa early sexual development to date. Furthermore, our multi-targeting priming methodology for genome-wide gene expression assays provides selective targeting of multiple sequences and counter-selection against undesirable sequences, facilitating a more complete and

  19. A viral microRNA down-regulates multiple cell cycle genes through mRNA 5'UTRs.

    Directory of Open Access Journals (Sweden)

    Finn Grey

    2010-06-01

    Full Text Available Global gene expression data combined with bioinformatic analysis provides strong evidence that mammalian miRNAs mediate repression of gene expression primarily through binding sites within the 3' untranslated region (UTR. Using RNA induced silencing complex immunoprecipitation (RISC-IP techniques we have identified multiple cellular targets for a human cytomegalovirus (HCMV miRNA, miR-US25-1. Strikingly, this miRNA binds target sites primarily within 5'UTRs, mediating significant reduction in gene expression. Intriguingly, many of the genes targeted by miR-US25-1 are associated with cell cycle control, including cyclin E2, BRCC3, EID1, MAPRE2, and CD147, suggesting that miR-US25-1 is targeting genes within a related pathway. Deletion of miR-US25-1 from HCMV results in over expression of cyclin E2 in the context of viral infection. Our studies demonstrate that a viral miRNA mediates translational repression of multiple cellular genes by targeting mRNA 5'UTRs.

  20. Silencing of HaAce1 gene by host-delivered artificial microRNA disrupts growth and development of Helicoverpa armigera.

    Science.gov (United States)

    Saini, Ravi Prakash; Raman, Venkat; Dhandapani, Gurusamy; Malhotra, Era Vaidya; Sreevathsa, Rohini; Kumar, Polumetla Ananda; Sharma, Tilak R; Pattanayak, Debasis

    2018-01-01

    The polyphagous insect-pest, Helicoverpa armigera, is a serious threat to a number of economically important crops. Chemical application and/or cultivation of Bt transgenic crops are the two strategies available now for insect-pest management. However, environmental pollution and long-term sustainability are major concerns against these two options. RNAi is now considered as a promising technology to complement Bt to tackle insect-pests menace. In this study, we report host-delivered silencing of HaAce1 gene, encoding the predominant isoform of H. armigera acetylcholinesterase, by an artificial microRNA, HaAce1-amiR1. Arabidopsis pre-miRNA164b was modified by replacing miR164b/miR164b* sequences with HaAce1-amiR1/HaAce1-amiR1* sequences. The recombinant HaAce1-preamiRNA1 was put under the control of CaMV 35S promoter and NOS terminator of plant binary vector pBI121, and the resultant vector cassette was used for tobacco transformation. Two transgenic tobacco lines expressing HaAce1-amiR1 was used for detached leaf insect feeding bioassays. Larval mortality of 25% and adult deformity of 20% were observed in transgenic treated insect group over that control tobacco treated insect group. The reduction in the steady-state level of HaAce1 mRNA was 70-80% in the defective adults compared to control. Our results demonstrate promise for host-delivered amiRNA-mediated silencing of HaAce1 gene for H. armigera management.

  1. Genome-wide analysis of histone H3 acetylation patterns in AML identifies PRDX2 as an epigenetically silenced tumor suppressor gene

    DEFF Research Database (Denmark)

    Agrawal-Singh, Shuchi; Isken, Fabienne; Agelopoulos, Konstantin

    2012-01-01

    to have lower H3Ac levels in AML compared with progenitor cells, which suggested that a large number of genes are epigenetically silenced in AML. Intriguingly, we identified peroxiredoxin 2 (PRDX2) as a novel potential tumor suppressor gene in AML. H3Ac was decreased at the PRDX2 gene promoter in AML......With the use of ChIP on microarray assays in primary leukemia samples, we report that acute myeloid leukemia (AML) blasts exhibit significant alterations in histone H3 acetylation (H3Ac) levels at > 1000 genomic loci compared with CD34+ progenitor cells. Importantly, core promoter regions tended......, which correlated with low mRNA and protein expression. We also observed DNA hypermethylation at the PRDX2 promoter in AML. Low protein expression of the antioxidant PRDX2 gene was clinically associated with poor prognosis in patients with AML. Functionally, PRDX2 acted as inhibitor of myeloid cell...

  2. Epigenetic Alteration by DNA Promoter Hypermethylation of Genes Related to Transforming Growth Factor-β (TGF-β Signaling in Cancer

    Directory of Open Access Journals (Sweden)

    Kiyoshi Mori

    2011-03-01

    Full Text Available Epigenetic alterations in cancer, especially DNA methylation and histone modification, exert a significant effect on the deregulated expression of cancer-related genes and lay an epigenetic pathway to carcinogenesis and tumor progression. Global hypomethylation and local hypermethylation of CpG islands in the promoter region, which result in silencing tumor suppressor genes, constitute general and major epigenetic modification, the hallmark of the neoplastic epigenome. Additionally, methylation-induced gene silencing commonly affects a number of genes and increases with cancer progression. Indeed, cancers with a high degree of methylation (CpG island methylator phenotype/CIMP do exist and represent a distinct subset of certain cancers including colorectal, bladder and kidney. On the other hand, signals from the microenvironment, especially those from transforming growth factor-β (TGF-β, induce targeted de novo epigenetic alterations of cancer-related genes. While TGF-β signaling has been implicated in two opposite roles in cancer, namely tumor suppression and tumor promotion, its deregulation is also partly induced by epigenetic alteration itself. Although the epigenetic pathway to carcinogenesis and cancer progression has such reciprocal complexity, the important issue is to identify genes or signaling pathways that are commonly silenced in various cancers in order to find early diagnostic and therapeutic targets. In this review, we focus on the epigenetic alteration by DNA methylation and its role in molecular modulations of the TGF-β signaling pathway that cause or underlie altered cancer-related gene expression in both phases of early carcinogenesis and late cancer progression.

  3. "Listening Silence" and Its Discursive Effects

    Science.gov (United States)

    Applebaum, Barbara

    2016-01-01

    While researchers have studied how white silence protects white innocence and white ignorance, in this essay Barbara Applebaum explores a form of white silence that she refers to as "listening silence" in which silence protects white innocence but does not necessarily promote resistance to learning. White listening silence can appear to…

  4. Advances in sarcoma gene mutations and therapeutic targets.

    Science.gov (United States)

    Gao, Peng; Seebacher, Nicole A; Hornicek, Francis; Guo, Zheng; Duan, Zhenfeng

    2018-01-01

    Sarcomas are rare and complex malignancies that have been associated with a poor prognostic outcome. Over the last few decades, traditional treatment with surgery and/or chemotherapy has not significantly improved outcomes for most types of sarcomas. In recent years, there have been significant advances in the understanding of specific gene mutations that are important in driving the pathogenesis and progression of sarcomas. Identification of these new gene mutations, using next-generation sequencing and advanced molecular techniques, has revealed a range of potential therapeutic targets. This, in turn, may lead to the development of novel agents targeted to different sarcoma subtypes. In this review, we highlight the advances made in identifying sarcoma gene mutations, including those of p53, RB, PI3K and IDH genes, as well as novel therapeutic strategies aimed at utilizing these mutant genes. In addition, we discuss a number of preclinical studies and ongoing early clinical trials in sarcoma targeting therapies, as well as gene editing technology, which may provide a better choice for sarcoma patient management. Published by Elsevier Ltd.

  5. Development of Gold Nanoparticle towards Radioenhancement Therapy, Renal Clearance, siRNA Delivery and Light-Controlled Gene Silencing

    Science.gov (United States)

    Wang, Jianxin

    Gold nanoparticles (GNPs) have been widely studied and used in research for diagnostic, prophylactic or therapeutic purposes. However, they still face many technical challenges before they can be used to effectively address unmet biomedical needs. The theme of this dissertation is focused on addressing challenges of GNPs in clinical translation, and to improve their potential for application in radioenhancement therapy and siRNA delivery. We demonstrate the facile self-assembly of micellar gold nanocapsules using zwitterionic surfactants, with hydrodynamic diameters below 10 nm, which holds promise for good renal clearance to promote the excretion of GNPs in human body. We also prepared PEI- and PEG-coated GNPs and demonstrated their uptake into HeLa cells with exposure to soft X-rays (120 kVp), based on the consideration that the proximity of GNPs to nuclear DNA may be beneficial for enhancing low-energy ionizing radiotherapy. GNP-mediated siRNA delivery may be challenged by nonspecific siRNA desorption during circulation, which can cause off-target effects and immunogenicity. The use of gold nanorods (GNRs) for siRNA delivery also faces challenges like reduced dispersion stability during siRNA functionalization. We developed an effective way to load siRNA onto GNRs at high density, using oleylsulfobetaine (OSB) as an intermediate surfactant and dithiocarbamates (DTCs) as desorption-resistant anchors for siRNA. The GNR?siRNA complexes provided excellent control for laser-triggered gene silencing.

  6. SoMART, a web server for miRNA, tasiRNA and target gene analysis in Solanaceae plants

    Science.gov (United States)

    Plant micro(mi)RNAs and trans-acting small interfering (tasi)RNAs mediate posttranscriptional silencing of genes and play important roles in a variety of biological processes. Although bioinformatics prediction and small (s)RNA cloning are the key approaches used for identification of miRNAs, tasiRN...

  7. Pnc1p-mediated nicotinamide clearance modifies the epigenetic properties of rDNA silencing in Saccharomyces cerevisiae.

    Science.gov (United States)

    McClure, Julie M; Gallo, Christopher M; Smith, Daniel L; Matecic, Mirela; Hontz, Robert D; Buck, Stephen W; Racette, Frances G; Smith, Jeffrey S

    2008-10-01

    The histone deacetylase activity of Sir2p is dependent on NAD(+) and inhibited by nicotinamide (NAM). As a result, Sir2p-regulated processes in Saccharomyces cerevisiae such as silencing and replicative aging are susceptible to alterations in cellular NAD(+) and NAM levels. We have determined that high concentrations of NAM in the growth medium elevate the intracellular NAD(+) concentration through a mechanism that is partially dependent on NPT1, an important gene in the Preiss-Handler NAD(+) salvage pathway. Overexpression of the nicotinamidase, Pnc1p, prevents inhibition of Sir2p by the excess NAM while maintaining the elevated NAD(+) concentration. This growth condition alters the epigenetics of rDNA silencing, such that repression of a URA3 reporter gene located at the rDNA induces growth on media that either lacks uracil or contains 5-fluoroorotic acid (5-FOA), an unusual dual phenotype that is reminiscent of telomeric silencing (TPE) of URA3. Despite the similarities to TPE, the modified rDNA silencing phenotype does not require the SIR complex. Instead, it retains key characteristics of typical rDNA silencing, including RENT and Pol I dependence, as well as a requirement for the Preiss-Handler NAD(+) salvage pathway. Exogenous nicotinamide can therefore have negative or positive impacts on rDNA silencing, depending on the PNC1 expression level.

  8. Breaking an epigenetic chromatin switch: curious features of hysteresis in Saccharomyces cerevisiae telomeric silencing.

    Directory of Open Access Journals (Sweden)

    Vijayalakshmi H Nagaraj

    Full Text Available In addition to gene network switches, local epigenetic modifications to DNA and histones play an important role in all-or-none cellular decision-making. Here, we study the dynamical design of a well-characterized epigenetic chromatin switch: the yeast SIR system, in order to understand the origin of the stability of epigenetic states. We study hysteresis in this system by perturbing it with a histone deacetylase inhibitor. We find that SIR silencing has many characteristics of a non-linear bistable system, as observed in conventional genetic switches, which are based on activities of a few promoters affecting each other through the abundance of their gene products. Quite remarkably, our experiments in yeast telomeric silencing show a very distinctive pattern when it comes to the transition from bistability to monostability. In particular, the loss of the stable silenced state, upon increasing the inhibitor concentration, does not seem to show the expected saddle node behavior, instead looking like a supercritical pitchfork bifurcation. In other words, the 'off' state merges with the 'on' state at a threshold concentration leading to a single state, as opposed to the two states remaining distinct up to the threshold and exhibiting a discontinuous jump from the 'off' to the 'on' state. We argue that this is an inevitable consequence of silenced and active regions coexisting with dynamic domain boundaries. The experimental observations in our study therefore have broad implications for the understanding of chromatin silencing in yeast and beyond.

  9. Igf2/H19 Imprinting Control Region (ICR: An Insulator or a Position-Dependent Silencer?

    Directory of Open Access Journals (Sweden)

    Subhasis Banerjee

    2001-01-01

    Full Text Available The imprinting control region (ICR located far upstream of the H19 gene, in conjunction with enhancers, modulates the transcription of Igf2 and H19 genes in an allele-specific manner. On paternal inheritance, the methylated ICR silences the H19 gene and indirectly facilitates transcription from the distant Igf2 promoter, whereas on the maternal chromosome the unmethylated ICR, together with enhancers, activates transcription of the H19 gene and thereby contributes to the repression of Igf2. This repression of maternal Igf2 has recently been postulated to be due to a chromatin boundary or insulator function of the unmethylated ICR. Central to the insulator model is the site-specific binding of a ubiquitous nuclear factor CTCF which exhibits remarkable flexibility in functioning as transcriptional activator or silencer. We suggest that the ICR positioned close to the enhancers in an episomal context might function as a transcriptional silencer by virtue of interaction of CTCF with its modifiers such as SIN3A and histone deacetylases. Furthermore, a localised folded chromatin structure resulting from juxtaposition of two disparate regulatory sequences (enhancer ICR could be the mechanistic basis of ICR-mediated position-dependent (ICR-promoter transcriptional repression in transgenic Drosophila.

  10. Ribosomal Stalk Protein Silencing Partially Corrects the ΔF508-CFTR Functional Expression Defect.

    Directory of Open Access Journals (Sweden)

    Guido Veit

    2016-05-01

    Full Text Available The most common cystic fibrosis (CF causing mutation, deletion of phenylalanine 508 (ΔF508 or Phe508del, results in functional expression defect of the CF transmembrane conductance regulator (CFTR at the apical plasma membrane (PM of secretory epithelia, which is attributed to the degradation of the misfolded channel at the endoplasmic reticulum (ER. Deletion of phenylalanine 670 (ΔF670 in the yeast oligomycin resistance 1 gene (YOR1, an ABC transporter of Saccharomyces cerevisiae phenocopies the ΔF508-CFTR folding and trafficking defects. Genome-wide phenotypic (phenomic analysis of the Yor1-ΔF670 biogenesis identified several modifier genes of mRNA processing and translation, which conferred oligomycin resistance to yeast. Silencing of orthologues of these candidate genes enhanced the ΔF508-CFTR functional expression at the apical PM in human CF bronchial epithelia. Although knockdown of RPL12, a component of the ribosomal stalk, attenuated the translational elongation rate, it increased the folding efficiency as well as the conformational stability of the ΔF508-CFTR, manifesting in 3-fold augmented PM density and function of the mutant. Combination of RPL12 knockdown with the corrector drug, VX-809 (lumacaftor restored the mutant function to ~50% of the wild-type channel in primary CFTRΔF508/ΔF508 human bronchial epithelia. These results and the observation that silencing of other ribosomal stalk proteins partially rescue the loss-of-function phenotype of ΔF508-CFTR suggest that the ribosomal stalk modulates the folding efficiency of the mutant and is a potential therapeutic target for correction of the ΔF508-CFTR folding defect.

  11. Epigenetics: beyond genes

    CSIR Research Space (South Africa)

    Fossey, A

    2009-06-01

    Full Text Available in forestry breeding. Keywords Gene regulation; chromatin; histone code hyporthesis; RNA silencing; post transcriptional gene silencing; forestry. Introduction to epigenetic phenomena Most living organisms share a vast amount of genetic information... (Rapp and Wendel, 2005). Epigenetic phenomena pervade all aspects of cell proliferation and plant development and are often in conflict with Mendelian models of genetics (Grant-Downton and Dickinson, 2005). A key element in many epigenetic effects...

  12. Silencing of the HER2/neu Gene by siRNA Inhibits Proliferation and Induces Apoptosis in HER2/neu-Overexpressing Breast Cancer Cells

    Directory of Open Access Journals (Sweden)

    Timo Faltus

    2004-11-01

    Full Text Available In eukaryotes, double-stranded (ds RNA induces sequence-specific inhibition of gene expression referred to as RNA interference (RNAi. We exploited RNAi to define the role of HER2/neu in the neoplastic proliferation of human breast cancer cells. We transfected SK-BR-3, BT-474, MCF-7, and MDA-MB-468 breast cancer cells with short interfering RNA (siRNA targeted against human HER2/neu and analyzed the specific inhibition of HER2/neu expression by Northern and Western blots. Transfection with HER2/neu-specific siRNA resulted in a sequence-specific decrease in HER2/neu mRNA and protein levels. Moreover, transfection with HER2/neu siRNA caused cell cycle arrest at G0/G1 in the breast cancer cell lines SKBR-3 and BT-474, consistent with a powerful RNA silencing effect. siRNA treatment resulted in an antiproliferative and apoptotic response in cells overexpressing HER2/neu, but had no influence in cells with almost no expression of HER2/neu proteins like MDA-MB-468 cells. These data indicate that HER2/neu function is essential for the proliferation of HER2/neuoverexpressing breast cancer cells. Our observations suggest that siRNA targeted against human HER2/neu may be valuable tools as anti proliferative agents that display activity against neoplastic cells at very low doses.

  13. A viral suppressor protein inhibits host RNA silencing by hooking up with Argonautes

    KAUST Repository

    Jin, Hailing; Zhu, Jian-Kang

    2010-01-01

    RNA viruses are particularly vulnerable to RNAi-based defenses in the host, and thus have evolved specific proteins, known as viral suppressors of RNA silencing (VSRs), as a counterdefense. In this issue of Genes & Development, Azevedo and colleagues (pp. 904-915) discovered that P38, the VSR of Turnip crinkle virus, uses its glycine/tryptophane (GW) motifs as an ARGONAUTE (AGO) hook to attract and disarm the host's essential effector of RNA silencing. Several GW motif-containing cellular proteins are known to be important partners of AGOs in RNA silencing effector complexes in yeast, plants, and animals. The GW motif appears to be a versatile and effective tool for regulating the activities of RNA silencing pathways, and the use of GW mimicry to compete for and inhibit host AGOs may be a strategy used by many pathogens to counteract host RNAi-based defenses. © 2010 by Cold Spring Harbor Laboratory Press.

  14. MPEG-CS/Bmi-1RNAi Nanoparticles Synthesis and Its Targeted Inhibition Effect on CD133+ Laryngeal Stem Cells.

    Science.gov (United States)

    Wei, Xudong; He, Jian; Wang, Jingyu; Wang, Wei

    2018-03-01

    Previous studies have confirmed that CD133+ cells in laryngeal tumor tissue have the characteristics of cancer stem cells. Bmi-1 gene expression is central to the tumorigenicity of CD133+ cells. In this study, we tried to develop a new siRNA carrier system using chitosan-methoxypolyethylene nanoparticles (CS-mPEG-NPs) that exhibit higher tumor-targeting ability and enhanced gene silencing efficacy in CD133+ tumor stem cells. It is hoped to block the self-renewal and kill the stem cells of laryngeal carcinoma. The mPEG-CS-Bmi-1RNAi-NPs were synthesized and their characters were checked. The changes in invasion ability and sensitivity to radiotherapy and chemotherapy of CD133+Hep-2 tumor cells were observed after Bmi-1 gene silencing. The mPEG-CS-Bmi-1RNAi-NPs synthesized in this experiment have a regular spherical form, a mean size of 139.70 ±6.40 nm, an encapsulation efficiency of 85.21 ± 1.94%, with drug loading capacity of 18.47 ± 1.83%, as well as low cytotoxicity, providing good protection to the loaded gene, strong resistance to nuclease degradation and high gene transfection efficiency. After Bmi-1 gene silencing, the invasion ability of CD133+ cells was weakened. Co-cultured with paclitaxel, the survival rates of CD133+Bmi-1RNAi cells were lower. After radiotherapy, the mean growth inhibition rate of CD133+/Bmi-1RNAi cells was significantly lower than CD133+ cells. In conclusion, the mPEG-CS nano-carrier is an ideal vector in gene therapy, while silencing the Bmi-1 gene can enhance the sensitivity of CD133+ tumor stem cells to chemoradiotherapy and abate their invasion ability.

  15. E(y)2/Sus1 is required for blocking PRE silencing by the Wari insulator in Drosophila melanogaster.

    Science.gov (United States)

    Erokhin, Maksim; Parshikov, Alexander; Georgiev, Pavel; Chetverina, Darya

    2010-06-01

    Chromatin insulators affect interactions between promoters and enhancers/silencers and function as barriers to the spread of repressive chromatin. Recently, we have found an insulator, named Wari, located on the 3' side of the white gene. Here, we show that the previously identified 368-bp core of this insulator is sufficient for blocking Polycomb response element-mediated silencing. Although Wari does not contain binding sites for known insulator proteins, the E(y)2 and CP190 proteins bind to Wari as well as to the Su(Hw)-containing insulators in vivo. It may well be that these proteins are recruited to the insulator by as yet unidentified DNA-binding protein. Partial inactivation of E(y)2 in a weak e(y)2 ( u1 ) mutation impairs only the anti-silencing but not the enhancer-blocking activity of the Wari insulator. Thus, the E(y)2 protein in different Drosophila insulators serves to protect gene expression from silencing.

  16. Metabolic engineering of potato tuber carotenoids through tuber-specific silencing of lycopene epsilon cyclase

    Directory of Open Access Journals (Sweden)

    Papacchioli Velia

    2006-06-01

    Full Text Available Abstract Background Potato is a major staple food, and modification of its provitamin content is a possible means for alleviating nutritional deficiencies. beta-carotene is the main dietary precursor of vitamin A. Potato tubers contain low levels of carotenoids, composed mainly of the xanthophylls lutein, antheraxanthin, violaxanthin, and of xanthophyll esters. None of these carotenoids have provitamin A activity. Results We silenced the first dedicated step in the beta-epsilon- branch of carotenoid biosynthesis, lycopene epsilon cyclase (LCY-e, by introducing, via Agrobacterium-mediated transformation, an antisense fragment of this gene under the control of the patatin promoter. Real Time measurements confirmed the tuber-specific silencing of Lcy-e. Antisense tubers showed significant increases in beta-beta-carotenoid levels, with beta-carotene showing the maximum increase (up to 14-fold. Total carotenoids increased up to 2.5-fold. These changes were not accompanied by a decrease in lutein, suggesting that LCY-e is not rate-limiting for lutein accumulation. Tuber-specific changes in expression of several genes in the pathway were observed. Conclusion The data suggest that epsilon-cyclization of lycopene is a key regulatory step in potato tuber carotenogenesis. Upon tuber-specific silencing of the corresponding gene, beta-beta-carotenoid and total carotenoid levels are increased, and expression of several other genes in the pathway is modified.

  17. Silencing of the CaCP Gene Delays Salt- and Osmotic-Induced Leaf Senescence in Capsicum annuum L.

    Directory of Open Access Journals (Sweden)

    Huai-Juan Xiao

    2014-05-01

    Full Text Available Cysteine proteinases have been known to participate in developmental processes and in response to stress in plants. Our present research reported that a novel CP gene, CaCP, was involved in leaf senescence in pepper (Capsicum annuum L.. The full-length CaCP cDNA is comprised of 1316 bp, contains 1044 nucleotides in open reading frame (ORF, and encodes a 347 amino acid protein. The deduced protein belongs to the papain-like cysteine proteases (CPs superfamily, containing a highly conserved ERFNIN motif, a GCNGG motif and a conserved catalytic triad. This protein localized to the vacuole of plant cells. Real-time quantitative PCR analysis revealed that the expression level of CaCP gene was dramatically higher in leaves and flowers than that in roots, stems and fruits. Moreover, CaCP transcripts were induced upon during leaf senescence. CaCP expression was upregulated by plant hormones, especially salicylic acid. CaCP was also significantly induced by abiotic and biotic stress treatments, including high salinity, mannitol and Phytophthora capsici. Loss of function of CaCP using the virus-induced gene-silencing technique in pepper plants led to enhanced tolerance to salt- and osmotic-induced stress. Taken together, these results suggest that CaCP is a senescence-associated gene, which is involved in developmental senescence and regulates salt- and osmotic-induced leaf senescence in pepper.

  18. Silencing of the CaCP Gene Delays Salt- and Osmotic-Induced Leaf Senescence in Capsicum annuum L.

    Science.gov (United States)

    Xiao, Huai-Juan; Yin, Yan-Xu; Chai, Wei-Guo; Gong, Zhen-Hui

    2014-01-01

    Cysteine proteinases have been known to participate in developmental processes and in response to stress in plants. Our present research reported that a novel CP gene, CaCP, was involved in leaf senescence in pepper (Capsicum annuum L.). The full-length CaCP cDNA is comprised of 1316 bp, contains 1044 nucleotides in open reading frame (ORF), and encodes a 347 amino acid protein. The deduced protein belongs to the papain-like cysteine proteases (CPs) superfamily, containing a highly conserved ERFNIN motif, a GCNGG motif and a conserved catalytic triad. This protein localized to the vacuole of plant cells. Real-time quantitative PCR analysis revealed that the expression level of CaCP gene was dramatically higher in leaves and flowers than that in roots, stems and fruits. Moreover, CaCP transcripts were induced upon during leaf senescence. CaCP expression was upregulated by plant hormones, especially salicylic acid. CaCP was also significantly induced by abiotic and biotic stress treatments, including high salinity, mannitol and Phytophthora capsici. Loss of function of CaCP using the virus-induced gene-silencing technique in pepper plants led to enhanced tolerance to salt- and osmotic-induced stress. Taken together, these results suggest that CaCP is a senescence-associated gene, which is involved in developmental senescence and regulates salt- and osmotic-induced leaf senescence in pepper. PMID:24823878

  19. Small RNAs were involved in homozygous state-associated silencing of a marker gene (Neomycin phosphotransferase II: nptII) in transgenic tomato plants.

    Science.gov (United States)

    Deng, Lei; Pan, Yu; Chen, Xuqing; Chen, Guoping; Hu, Zongli

    2013-07-01

    Homozygous state-associated co-suppression is not a very common phenomenon. In our experiments, two transgenic plants 3A29 and 1195A were constructed by being transformed with the constructs pBIN-353A and pBIN119A containing nptII gene as a marker respectively. The homozygous progeny from these two independent transgenic lines 3A29 and 1195A, displayed kanamycin-sensitivity and produced a short main root without any lateral roots as untransformed control (wild-type) seedlings when germinated on kanamycin media. For the seedlings derived from putative hemizygous plants, the percentage of the seedlings showing normal growth on kanamycin media was about 50% and lower than the expected percentage (75%). Southern analysis of the genomic DNA confirmed that the homozygous and hemizygous plants derived from the same lines contained the same multiple nptII transgenes, which were located on the same site of chromosome. Northern analysis suggested that the marker nptII gene was expressed in the primary and the hemizygous transformants, but it was silenced in the homozygous transgenic plants. Further Northern analysis indicated that antisense and sense small nptII-derived RNAs were present in the transgenic plants and the blotting signal of nptII-derived small RNA was much higher in the homozygous transgenic plants than that of hemizygous transgenic plants. Additionally, read-through transcripts from the TRAMP gene to the nptII gene were detected. These results suggest that the read-through transcripts may be involved in homozygous state-associated silencing of the nptII transgene in transgenic tomato plants and a certain threshold level of the nptII-derived small RNAs is required for the homozygous state-associated co-suppression of the nptII transgene. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  20. Telomeric trans-silencing: an epigenetic repression combining RNA silencing and heterochromatin formation.

    Directory of Open Access Journals (Sweden)

    Thibaut Josse

    2007-09-01

    Full Text Available The study of P-element repression in Drosophila melanogaster led to the discovery of the telomeric Trans-Silencing Effect (TSE, a repression mechanism by which a transposon or a transgene inserted in subtelomeric heterochromatin (Telomeric Associated Sequence or TAS has the capacity to repress in trans in the female germline, a homologous transposon, or transgene located in euchromatin. TSE shows variegation among egg chambers in ovaries when silencing is incomplete. Here, we report that TSE displays an epigenetic transmission through meiosis, which involves an extrachromosomal maternally transmitted factor. We show that this silencing is highly sensitive to mutations affecting both heterochromatin formation (Su(var205 encoding Heterochromatin Protein 1 and Su(var3-7 and the repeat-associated small interfering RNA (or rasiRNA silencing pathway (aubergine, homeless, armitage, and piwi. In contrast, TSE is not sensitive to mutations affecting r2d2, which is involved in the small interfering RNA (or siRNA silencing pathway, nor is it sensitive to a mutation in loquacious, which is involved in the micro RNA (or miRNA silencing pathway. These results, taken together with the recent discovery of TAS homologous small RNAs associated to PIWI proteins, support the proposition that TSE involves a repeat-associated small interfering RNA pathway linked to heterochromatin formation, which was co-opted by the P element to establish repression of its own transposition after its recent invasion of the D. melanogaster genome. Therefore, the study of TSE provides insight into the genetic properties of a germline-specific small RNA silencing pathway.

  1. TargetMine, an integrated data warehouse for candidate gene prioritisation and target discovery.

    Directory of Open Access Journals (Sweden)

    Yi-An Chen

    Full Text Available Prioritising candidate genes for further experimental characterisation is a non-trivial challenge in drug discovery and biomedical research in general. An integrated approach that combines results from multiple data types is best suited for optimal target selection. We developed TargetMine, a data warehouse for efficient target prioritisation. TargetMine utilises the InterMine framework, with new data models such as protein-DNA interactions integrated in a novel way. It enables complicated searches that are difficult to perform with existing tools and it also offers integration of custom annotations and in-house experimental data. We proposed an objective protocol for target prioritisation using TargetMine and set up a benchmarking procedure to evaluate its performance. The results show that the protocol can identify known disease-associated genes with high precision and coverage. A demonstration version of TargetMine is available at http://targetmine.nibio.go.jp/.

  2. Biochemical and single-molecule analyses of the RNA silencing suppressing activity of CrPV-1A.

    Science.gov (United States)

    Watanabe, Mariko; Iwakawa, Hiro-Oki; Tadakuma, Hisashi; Tomari, Yukihide

    2017-10-13

    Viruses often encode viral silencing suppressors (VSSs) to counteract the hosts' RNA silencing activity. The cricket paralysis virus 1A protein (CrPV-1A) is a unique VSS that binds to a specific Argonaute protein (Ago)-the core of the RNA-induced silencing complex (RISC)-in insects to suppress its target cleavage reaction. However, the precise molecular mechanism of CrPV-1A action remains unclear. Here we utilized biochemical and single-molecule imaging approaches to analyze the effect of CrPV-1A during target recognition and cleavage by Drosophila Ago2-RISC. Our results suggest that CrPV-1A obstructs the initial target searching by Ago2-RISC via base pairing in the seed region. The combination of biochemistry and single-molecule imaging may help to pave the way for mechanistic understanding of VSSs with diverse functions. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. RNA interference: learning gene knock-down from cell physiology

    Directory of Open Access Journals (Sweden)

    Provenzano Maurizio

    2004-11-01

    Full Text Available Summary Over the past decade RNA interference (RNAi has emerged as a natural mechanism for silencing gene expression. This ancient cellular antiviral response can be exploited to allow specific inhibition of the function of any chosen target gene. RNAi is proving to be an invaluable research tool, allowing much more rapid characterization of the function of known genes. More importantly, RNAi technology considerably bolsters functional genomics to aid in the identification of novel genes involved in disease processes. This review briefly describes the molecular principles underlying the biology of RNAi phenomenon and discuss the main technical issues regarding optimization of RNAi experimental design.

  4. RNA interference: learning gene knock-down from cell physiology

    Science.gov (United States)

    Mocellin, Simone; Provenzano, Maurizio

    2004-01-01

    Over the past decade RNA interference (RNAi) has emerged as a natural mechanism for silencing gene expression. This ancient cellular antiviral response can be exploited to allow specific inhibition of the function of any chosen target gene. RNAi is proving to be an invaluable research tool, allowing much more rapid characterization of the function of known genes. More importantly, RNAi technology considerably bolsters functional genomics to aid in the identification of novel genes involved in disease processes. This review briefly describes the molecular principles underlying the biology of RNAi phenomenon and discuss the main technical issues regarding optimization of RNAi experimental design. PMID:15555080

  5. DICER-LIKE2 plays a primary role in transitive silencing of transgenes in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Sizolwenkosi Mlotshwa

    2008-03-01

    Full Text Available Dicer-like (DCL enzymes play a pivotal role in RNA silencing in plants, processing the long double-stranded RNA (dsRNA that triggers silencing into the primary short interfering RNAs (siRNAs that mediate it. The siRNA population can be augmented and silencing amplified via transitivity, an RNA-dependent RNA polymerase (RDR-dependent pathway that uses the target RNA as substrate to generate secondary siRNAs. Here we report that Arabidopsis DCL2-but not DCL4-is required for transitivity in cell-autonomous, post-transcriptional silencing of transgenes. An insertion mutation in DCL2 blocked sense transgene-induced silencing and eliminated accumulation of the associated RDR-dependent siRNAs. In hairpin transgene-induced silencing, the dcl2 mutation likewise eliminated accumulation of secondary siRNAs and blocked transitive silencing, but did not block silencing mediated by primary siRNAs. Strikingly, in all cases, the dcl2 mutation eliminated accumulation of all secondary siRNAs, including those generated by other DCL enzymes. In contrast, mutations in DCL4 promoted a dramatic shift to transitive silencing in the case of the hairpin transgene and enhanced silencing induced by the sense transgene. Suppression of hairpin and sense transgene silencing by the P1/HC-Pro and P38 viral suppressors was associated with elimination of secondary siRNA accumulation, but the suppressors did not block processing of the stem of the hairpin transcript into primary siRNAs. Thus, these viral suppressors resemble the dcl2 mutation in their effects on siRNA biogenesis. We conclude that DCL2 plays an essential, as opposed to redundant, role in transitive silencing of transgenes and may play a more important role in silencing of viruses than currently thought.

  6. CRISPR/Cas9-mediated gene targeting in Arabidopsis using sequential transformation.

    Science.gov (United States)

    Miki, Daisuke; Zhang, Wenxin; Zeng, Wenjie; Feng, Zhengyan; Zhu, Jian-Kang

    2018-05-17

    Homologous recombination-based gene targeting is a powerful tool for precise genome modification and has been widely used in organisms ranging from yeast to higher organisms such as Drosophila and mouse. However, gene targeting in higher plants, including the most widely used model plant Arabidopsis thaliana, remains challenging. Here we report a sequential transformation method for gene targeting in Arabidopsis. We find that parental lines expressing the bacterial endonuclease Cas9 from the egg cell- and early embryo-specific DD45 gene promoter can improve the frequency of single-guide RNA-targeted gene knock-ins and sequence replacements via homologous recombination at several endogenous sites in the Arabidopsis genome. These heritable gene targeting can be identified by regular PCR. Our approach enables routine and fine manipulation of the Arabidopsis genome.

  7. Insulators target active genes to transcription factories and polycomb-repressed genes to polycomb bodies.

    Directory of Open Access Journals (Sweden)

    Hua-Bing Li

    2013-04-01

    Full Text Available Polycomb bodies are foci of Polycomb proteins in which different Polycomb target genes are thought to co-localize in the nucleus, looping out from their chromosomal context. We have shown previously that insulators, not Polycomb response elements (PREs, mediate associations among Polycomb Group (PcG targets to form Polycomb bodies. Here we use live imaging and 3C interactions to show that transgenes containing PREs and endogenous PcG-regulated genes are targeted by insulator proteins to different nuclear structures depending on their state of activity. When two genes are repressed, they co-localize in Polycomb bodies. When both are active, they are targeted to transcription factories in a fashion dependent on Trithorax and enhancer specificity as well as the insulator protein CTCF. In the absence of CTCF, assembly of Polycomb bodies is essentially reduced to those representing genomic clusters of Polycomb target genes. The critical role of Trithorax suggests that stable association with a specialized transcription factory underlies the cellular memory of the active state.

  8. Targeted gene therapy and cell reprogramming in Fanconi anemia

    Science.gov (United States)

    Rio, Paula; Baños, Rocio; Lombardo, Angelo; Quintana-Bustamante, Oscar; Alvarez, Lara; Garate, Zita; Genovese, Pietro; Almarza, Elena; Valeri, Antonio; Díez, Begoña; Navarro, Susana; Torres, Yaima; Trujillo, Juan P; Murillas, Rodolfo; Segovia, Jose C; Samper, Enrique; Surralles, Jordi; Gregory, Philip D; Holmes, Michael C; Naldini, Luigi; Bueren, Juan A

    2014-01-01

    Gene targeting is progressively becoming a realistic therapeutic alternative in clinics. It is unknown, however, whether this technology will be suitable for the treatment of DNA repair deficiency syndromes such as Fanconi anemia (FA), with defects in homology-directed DNA repair. In this study, we used zinc finger nucleases and integrase-defective lentiviral vectors to demonstrate for the first time that FANCA can be efficiently and specifically targeted into the AAVS1 safe harbor locus in fibroblasts from FA-A patients. Strikingly, up to 40% of FA fibroblasts showed gene targeting 42 days after gene editing. Given the low number of hematopoietic precursors in the bone marrow of FA patients, gene-edited FA fibroblasts were then reprogrammed and re-differentiated toward the hematopoietic lineage. Analyses of gene-edited FA-iPSCs confirmed the specific integration of FANCA in the AAVS1 locus in all tested clones. Moreover, the hematopoietic differentiation of these iPSCs efficiently generated disease-free hematopoietic progenitors. Taken together, our results demonstrate for the first time the feasibility of correcting the phenotype of a DNA repair deficiency syndrome using gene-targeting and cell reprogramming strategies. PMID:24859981

  9. RISC-Target Interaction: Cleavage and Translational Suppression

    Science.gov (United States)

    van den Berg, Arjen; Mols, Johann; Han, Jiahuai

    2008-01-01

    Summary Small RNA molecules have been known and utilized to suppress gene expression for more than a decade. The discovery that these small RNA molecules are endogenously expressed in many organisms and have a critical role in controlling gene expression have led to the arising of a whole new field of research. Termed small interfering RNA (siRNA) or microRNA (miRNA) these ~22 nt RNA molecules have the capability to suppress gene expression through various mechanisms once they are incorporated in the multi-protein RNA-Induced Silencing Complex (RISC) and interact with their target mRNA. This review introduces siRNAs and microRNAs in a historical perspective and focuses on the key molecules in RISC, structural properties and mechanisms underlying the process of small RNA regulated post-transcriptional suppression of gene expression. PMID:18692607

  10. Pre-clinical Safety and Off-Target Studies to Support Translation of AAV-Mediated RNAi Therapy for FSHD.

    Science.gov (United States)

    Wallace, Lindsay M; Saad, Nizar Y; Pyne, Nettie K; Fowler, Allison M; Eidahl, Jocelyn O; Domire, Jacqueline S; Griffin, Danielle A; Herman, Adam C; Sahenk, Zarife; Rodino-Klapac, Louise R; Harper, Scott Q

    2018-03-16

    RNAi emerged as a prospective molecular therapy nearly 15 years ago. Since then, two major RNAi platforms have been under development: oligonucleotides and gene therapy. Oligonucleotide-based approaches have seen more advancement, with some promising therapies that may soon reach market. In contrast, vector-based approaches for RNAi therapy have remained largely in the pre-clinical realm, with limited clinical safety and efficacy data to date. We are developing a gene therapy approach to treat the autosomal-dominant disorder facioscapulohumeral muscular dystrophy. Our strategy involves silencing the myotoxic gene DUX4 using adeno-associated viral vectors to deliver targeted microRNA expression cassettes (miDUX4s). We previously demonstrated proof of concept for this approach in mice, and we are now taking additional steps here to assess safety issues related to miDUX4 overexpression and sequence-specific off-target silencing. In this study, we describe improvements in vector design and expansion of our miDUX4 sequence repertoire and report differential toxicity elicited by two miDUX4 sequences, of which one was toxic and the other was not. This study provides important data to help advance our goal of translating RNAi gene therapy for facioscapulohumeral muscular dystrophy.

  11. [On the role of selective silencer Freud-1 in the regulation of the brain 5-HT(1A) receptor gene expression].

    Science.gov (United States)

    Naumenko, V S; Osipova, D V; Tsybko, A S

    2010-01-01

    Selective 5-HT(1A) receptor silencer (Freud-1) is known to be one of the main factors for transcriptional regulation of brain serotonin 5-HT(1A) receptor. However, there is a lack of data on implication of Freud-1 in the mechanisms underlying genetically determined and experimentally altered 5-HT(1A) receptor system state in vivo. In the present study we have found a difference in the 5-HT(1A) gene expression in the midbrain of AKR and CBA inbred mouse strains. At the same time no distinction in Freud-1 expression was observed. We have revealed 90.3% of homology between mouse and rat 5-HT(1A) receptor DRE-element, whereas there was no difference in DRE-element sequence between AKR and CBA mice. This indicates the absence of differences in Freud-1 binding site in these mouse strains. In the model of 5-HT(1A) receptor desensitization produced by chronic 5-HT(1A) receptor agonist administration, a significant reduction of 5-HT(1A) receptor gene expression together with considerable increase of Freud-1 expression were found. These data allow us to conclude that the selective silencer of 5-HT(1A) receptor, Freud-1, is involved in the compensatory mechanisms that modulate the functional state of brain serotonin system, although it is not the only factor for 5-HT(1A) receptor transcriptional regulation.

  12. A viral suppressor protein inhibits host RNA silencing by hooking up with Argonautes

    KAUST Repository

    Jin, Hailing

    2010-05-01

    RNA viruses are particularly vulnerable to RNAi-based defenses in the host, and thus have evolved specific proteins, known as viral suppressors of RNA silencing (VSRs), as a counterdefense. In this issue of Genes & Development, Azevedo and colleagues (pp. 904-915) discovered that P38, the VSR of Turnip crinkle virus, uses its glycine/tryptophane (GW) motifs as an ARGONAUTE (AGO) hook to attract and disarm the host\\'s essential effector of RNA silencing. Several GW motif-containing cellular proteins are known to be important partners of AGOs in RNA silencing effector complexes in yeast, plants, and animals. The GW motif appears to be a versatile and effective tool for regulating the activities of RNA silencing pathways, and the use of GW mimicry to compete for and inhibit host AGOs may be a strategy used by many pathogens to counteract host RNAi-based defenses. © 2010 by Cold Spring Harbor Laboratory Press.

  13. Silencing of beta-carotene hydroxylase increases total carotenoid and beta-carotene levels in potato tubers

    Directory of Open Access Journals (Sweden)

    Pizzichini Daniele

    2007-03-01

    Full Text Available Abstract Background Beta-carotene is the main dietary precursor of vitamin A. Potato tubers contain low levels of carotenoids, composed mainly of the xanthophylls lutein (in the beta-epsilon branch and violaxanthin (in the beta-beta branch. None of these carotenoids have provitamin A activity. We have previously shown that tuber-specific silencing of the first step in the epsilon-beta branch, LCY-e, redirects metabolic flux towards beta-beta carotenoids, increases total carotenoids up to 2.5-fold and beta-carotene up to 14-fold. Results In this work, we silenced the non-heme beta-carotene hydroxylases CHY1 and CHY2 in the tuber. Real Time RT-PCR measurements confirmed the tuber-specific silencing of both genes . CHY silenced tubers showed more dramatic changes in carotenoid content than LCY-e silenced tubers, with beta-carotene increasing up to 38-fold and total carotenoids up to 4.5-fold. These changes were accompanied by a decrease in the immediate product of beta-carotene hydroxylation, zeaxanthin, but not of the downstream xanthophylls, viola- and neoxanthin. Changes in endogenous gene expression were extensive and partially overlapping with those of LCY-e silenced tubers: CrtISO, LCY-b and ZEP were induced in both cases, indicating that they may respond to the balance between individual carotenoid species. Conclusion Together with epsilon-cyclization of lycopene, beta-carotene hydroxylation is another regulatory step in potato tuber carotenogenesis. The data are consistent with a prevalent role of CHY2, which is highly expressed in tubers, in the control of this step. Combination of different engineering strategies holds good promise for the manipulation of tuber carotenoid content.

  14. Targeting the human lysozyme gene on bovine αs1- casein gene ...

    African Journals Online (AJOL)

    ajl yemi

    2011-11-28

    Nov 28, 2011 ... Targeting an exogenous gene into a favorable gene locus and for expression under endogenous regulators is ... case, the expression of human lysozyme could be regulated by the endogenous cis-element of αs1- casein gene in .... Mouse mammary epithelial C127 cells (Cell Bank, Chinese. Academy of ...

  15. Co-factors necessary for PPAR mediated transactivation of endogenous target genes

    DEFF Research Database (Denmark)

    Grøntved, Lars; Nielsen, Ronni; Stunnenberg, Henk

    of endogenous target gene in different cell types are elusive. To mutually compare the ability of the PPAR subtypes to activate endogenous target genes in a given cell, PPARa, PPARb/d and PPARg2 were HA tagged and rapidly, equally and synchronously expressed using adenoviral delivery. Within a few hours after...... subtype specific activation of target genes. Accumulating evidence suggests that transcriptional co-factors can function as master regulators for nuclear receptors and impose promoter selectivity. To study co-factor necessity for PPAR mediated transactivation of endogenous target genes, specific co...

  16. Phytophthora effector targets a novel component of small RNA pathway in plants to promote infection.

    Science.gov (United States)

    Qiao, Yongli; Shi, Jinxia; Zhai, Yi; Hou, Yingnan; Ma, Wenbo

    2015-05-05

    A broad range of parasites rely on the functions of effector proteins to subvert host immune response and facilitate disease development. The notorious Phytophthora pathogens evolved effectors with RNA silencing suppression activity to promote infection in plant hosts. Here we report that the Phytophthora Suppressor of RNA Silencing 1 (PSR1) can bind to an evolutionarily conserved nuclear protein containing the aspartate-glutamate-alanine-histidine-box RNA helicase domain in plants. This protein, designated PSR1-Interacting Protein 1 (PINP1), regulates the accumulation of both microRNAs and endogenous small interfering RNAs in Arabidopsis. A null mutation of PINP1 causes embryonic lethality, and silencing of PINP1 leads to developmental defects and hypersusceptibility to Phytophthora infection. These phenotypes are reminiscent of transgenic plants expressing PSR1, supporting PINP1 as a direct virulence target of PSR1. We further demonstrate that the localization of the Dicer-like 1 protein complex is impaired in the nucleus of PINP1-silenced or PSR1-expressing cells, indicating that PINP1 may facilitate small RNA processing by affecting the assembly of dicing complexes. A similar function of PINP1 homologous genes in development and immunity was also observed in Nicotiana benthamiana. These findings highlight PINP1 as a previously unidentified component of RNA silencing that regulates distinct classes of small RNAs in plants. Importantly, Phytophthora has evolved effectors to target PINP1 in order to promote infection.

  17. FHL2 silencing reduces Wnt signaling and osteosarcoma tumorigenesis in vitro and in vivo.

    Directory of Open Access Journals (Sweden)

    Julia Brun

    Full Text Available BACKGROUND: The molecular mechanisms that are involved in the growth and invasiveness of osteosarcoma, an aggressive and invasive primary bone tumor, are not fully understood. The transcriptional co-factor FHL2 (four and a half LIM domains protein 2 acts as an oncoprotein or as a tumor suppressor depending on the tissue context. In this study, we investigated the role of FHL2 in tumorigenesis in osteosarcoma model. METHODOLOGY/PRINCIPAL FINDINGS: Western blot analyses showed that FHL2 is expressed above normal in most human and murine osteosarcoma cells. Tissue microarray analysis revealed that FHL2 protein expression is high in human osteosarcoma and correlates with osteosarcoma aggressiveness. In murine osteosarcoma cells, FHL2 silencing using shRNA decreased canonical Wnt/β-catenin signaling and reduced the expression of Wnt responsive genes as well as of the key Wnt molecules Wnt5a and Wnt10b. This effect resulted in inhibition of osteosarcoma cell proliferation, invasion and migration in vitro. Using xenograft experiments, we showed that FHL2 silencing markedly reduced tumor growth and lung metastasis occurence in mice. The anti-oncogenic effect of FHL2 silencing in vivo was associated with reduced cell proliferation and decreased Wnt signaling in the tumors. CONCLUSION/SIGNIFICANCE: Our findings demonstrate that FHL2 acts as an oncogene in osteosarcoma cells and contributes to tumorigenesis through Wnt signaling. More importantly, FHL2 depletion greatly reduces tumor cell growth and metastasis, which raises the potential therapeutic interest of targeting FHL2 to efficiently impact primary bone tumors.

  18. Epigenetic silencing of apoptosis-inducing gene expression can be efficiently overcome by combined SAHA and TRAIL treatment in uterine sarcoma cells.

    Directory of Open Access Journals (Sweden)

    Leopold F Fröhlich

    Full Text Available The lack of knowledge about molecular pathology of uterine sarcomas with a representation of 3-7% of all malignant uterine tumors prevents the establishment of effective therapy protocols. Here, we explored advanced therapeutic options to the previously discovered antitumorigenic effects of the histone deacetylase (HDAC inhibitor suberoylanilide hydroxamic acid (SAHA by combined treatment with the tumor necrosis factor-related apoptosis-inducing ligand (TRAIL/Apo-2L. In addition, we investigated the uterine sarcoma cell lines, MES-SA and ESS-1, regarding the underlying molecular mechanisms of SAHA and TRAIL-induced apoptosis and their resistance towards TRAIL. Compared to single SAHA or TRAIL treatment, the combination of SAHA with TRAIL led to complete cell death of both tumor cell lines after 24 to 48 hours. In contrast to single SAHA treatment, apoptosis occured faster and was more pronounced in ESS-1 cells than in MES-SA cells. Induction of SAHA- and TRAIL-induced apoptosis was accompanied by upregulation of the intrinsic apoptotic pathway via reduction of mitochondrial membrane potential, caspase-3, -6, and -7 activation, and PARP cleavage, but was also found to be partially caspase-independent. Apoptosis resistance was caused by reduced expression of caspase-8 and DR 4/TRAIL-R1 in ESS-1 and MES-SA cells, respectively, due to epigenetic silencing by DNA hypermethylation of gene promoter sequences. Treatment with the demethylating agent 5-Aza-2'-deoxycytidine or gene transfer therefore restored gene expression and increased the sensitivity of both cell lines against TRAIL-induced apoptosis. Our data provide evidence that deregulation of epigenetic silencing by histone acetylation and DNA hypermethylation might play a fundamental role in the origin of uterine sarcomas. Therefore, tumor growth might be efficiently overcome by a cytotoxic combinatorial treatment of HDAC inhibitors with TRAIL.

  19. Silence of the Genes

    Indian Academy of Sciences (India)

    Srimath

    a gene in the opposite orientation in a cultured plant cell line and observed that the ..... started emerging in early 1990s from the work carried out by the. It is believed that ... cause human diseases such as cervical cancer, hepatitis, measles.

  20. Claudin-1 is a p63 target gene with a crucial role in epithelial development.

    Directory of Open Access Journals (Sweden)

    Teresa Lopardo

    2008-07-01

    Full Text Available The epidermis of the skin is a self-renewing, stratified epithelium that functions as the interface between the human body and the outer environment, and acts as a barrier to water loss. Components of intercellular junctions, such as Claudins, are critical to maintain tissue integrity and water retention. p63 is a transcription factor essential for proliferation of stem cells and for stratification in epithelia, mutated in human hereditary syndromes characterized by ectodermal dysplasia. Both p63 and Claudin-1 null mice die within few hours from birth due to dehydration from severe skin abnormalities. These observations suggested the possibility that these two genes might be linked in one regulatory pathway with p63 possibly regulating Claudin-1 expression. Here we show that silencing of DeltaNp63 in primary mouse keratinocytes results in a marked down-regulation of Claudin-1 expression (-80%. DeltaNp63alpha binds in vivo to the Claudin-1 promoter and activates both the endogenous Claudin-1 gene and a reporter vector containing a -1.4 Kb promoter fragment of the Claudin-1 gene. Accordingly, Claudin-1 expression was absent in the skin of E15.5 p63 null mice and natural p63 mutant proteins, specifically those found in Ankyloblepharon-Ectodermal dysplasia-Clefting (AEC patients, were indeed altered in their capacity to regulate Claudin-1 transcription. This correlates with deficient Claudin-1 expression in the epidermis of an AEC patient carrying the I537T p63 mutation. Notably, AEC patients display skin fragility similar to what observed in the epidermis of Claudin-1 and p63 null mice. These findings reinforce the hypothesis that these two genes might be linked in a common regulatory pathway and that Claudin-1 may is an important p63 target gene involved in the pathogenesis of ectodermal dysplasias.

  1. Identification of the interleukin 4 receptor alpha gene as a direct target for p73.

    Science.gov (United States)

    Sasaki, Yasushi; Mita, Hiroaki; Toyota, Minoru; Ishida, Setsuko; Morimoto, Ichiro; Yamashita, Toshiharu; Tanaka, Toshihiro; Imai, Kohzoh; Nakamura, Yusuke; Tokino, Takashi

    2003-12-01

    p73 has a high degree of structural homology to p53 and can activate transcription of p53-responsive genes. However, analysis of p73-deficient mice revealed a marked divergence in the physiological activities of p53 family genes and distinguishes p73 from p53. Mice deficient for p73 exhibit profound defects, including hippocampal dysgenesis, chronic infection, and inflammation, as well as abnormalities in pheromone sensory pathways. p73 plays important roles in neurogenesis, sensory pathways, and homeostatic regulation. Here, we found that the interleukin 4 receptor alpha (IL-4Ralpha) gene is up-regulated by p73 but not significantly by p53 in several human cancer cell lines. IL-4Ralphatranscription is also activated in response to cisplatin, a DNA-damaging agent known to induce p73. By using small interference RNA designed to target p73, we demonstrated that silencing endogenous p73 abrogates the induction of the IL-4Ralpha gene after cisplatin treatment. Furthermore, we identified a p73-binding site in the first intron of the IL-4Ralpha gene that can directly interact with the p73 protein in vivo. This p73-binding site consists of eight copies of a 10-bp consensus p53-binding motif and is a functional response element that is relatively specific for p73 among the p53 family. p73beta promoted localized nucleosomal acetylation through recruitment of coactivator p300, indicating that p73 regulates transcription of IL-4Ralpha through the unique p73-binding site. We also found that p73beta-transfected tumor cells are sensitive to IL-4-mediated apoptosis. Our data suggest that IL-4Ralpha could mediate, in part, certain immune responses and p73-dependent cell death.

  2. Targeted gene therapy and cell reprogramming in Fanconi anemia.

    Science.gov (United States)

    Rio, Paula; Baños, Rocio; Lombardo, Angelo; Quintana-Bustamante, Oscar; Alvarez, Lara; Garate, Zita; Genovese, Pietro; Almarza, Elena; Valeri, Antonio; Díez, Begoña; Navarro, Susana; Torres, Yaima; Trujillo, Juan P; Murillas, Rodolfo; Segovia, Jose C; Samper, Enrique; Surralles, Jordi; Gregory, Philip D; Holmes, Michael C; Naldini, Luigi; Bueren, Juan A

    2014-06-01

    Gene targeting is progressively becoming a realistic therapeutic alternative in clinics. It is unknown, however, whether this technology will be suitable for the treatment of DNA repair deficiency syndromes such as Fanconi anemia (FA), with defects in homology-directed DNA repair. In this study, we used zinc finger nucleases and integrase-defective lentiviral vectors to demonstrate for the first time that FANCA can be efficiently and specifically targeted into the AAVS1 safe harbor locus in fibroblasts from FA-A patients. Strikingly, up to 40% of FA fibroblasts showed gene targeting 42 days after gene editing. Given the low number of hematopoietic precursors in the bone marrow of FA patients, gene-edited FA fibroblasts were then reprogrammed and re-differentiated toward the hematopoietic lineage. Analyses of gene-edited FA-iPSCs confirmed the specific integration of FANCA in the AAVS1 locus in all tested clones. Moreover, the hematopoietic differentiation of these iPSCs efficiently generated disease-free hematopoietic progenitors. Taken together, our results demonstrate for the first time the feasibility of correcting the phenotype of a DNA repair deficiency syndrome using gene-targeting and cell reprogramming strategies. © 2014 The Authors. Published under the terms of the CC BY 4.0 license.

  3. Specific genetic modifications of domestic animals by gene targeting and animal cloning

    Directory of Open Access Journals (Sweden)

    Zhou Jiangfeng

    2003-11-01

    Full Text Available Abstract The technology of gene targeting through homologous recombination has been extremely useful for elucidating gene functions in mice. The application of this technology was thought impossible in the large livestock species until the successful creation of the first mammalian clone "Dolly" the sheep. The combination of the technologies for gene targeting of somatic cells with those of animal cloning made it possible to introduce specific genetic mutations into domestic animals. In this review, the principles of gene targeting in somatic cells and the challenges of nuclear transfer using gene-targeted cells are discussed. The relevance of gene targeting in domestic animals for applications in bio-medicine and agriculture are also examined.

  4. E-cadherin is transcriptionally activated via suppression of ZEB1 transcriptional repressor by small RNA-mediated gene silencing.

    Directory of Open Access Journals (Sweden)

    Minami Mazda

    Full Text Available RNA activation has been reported to be induced by small interfering RNAs (siRNAs that act on the promoters of several genes containing E-cadherin. In this study, we present an alternative mechanism of E-cadherin activation in human PC-3 cells by siRNAs previously reported to possess perfect-complementary sequences to E-cadherin promoter. We found that activation of E-cadherin can be also induced via suppression of ZEB1, which is a transcriptional repressor of E-cadherin, by seed-dependent silencing mechanism of these siRNAs. The functional seed-complementary sites of the siRNAs were found in the coding region in addition to the 3' untranslated region of ZEB1 mRNA. Promoter analyses indicated that E-boxes, which are ZEB1-binding sites, in the upstream promoter region are indispensable for E-cadherin transcription by the siRNAs. Thus, the results caution against ignoring siRNA seed-dependent silencing effects in genome-wide transcriptional regulation. In addition, members of miR-302/372/373/520 family, which have the same seed sequences with one of the siRNAs containing perfect-complementarity to E-cadherin promoter, are also found to activate E-cadherin transcription. Thus, E-cadherin could be upregulated by the suppression of ZEB1 transcriptional repressor by miRNAs in vivo.

  5. Gene Silencing Triggers Polycomb Repressive Complex 2 Recruitment to CpG Islands Genome Wide

    DEFF Research Database (Denmark)

    Riising, Eva Madi; Vacher-Comet, Itys; Leblanc, Benjamin Olivier

    2014-01-01

    -wide ectopic PRC2 recruitment to endogenous PcG target genes found in other tissues. PRC2 binding analysis shows that it is restricted to nucleosome-free CpG islands (CGIs) of untranscribed genes. Our results show that it is the transcriptional state that governs PRC2 binding, and we propose that it binds...

  6. Demethylation by 5-aza-2'-deoxycytidine in colorectal cancer cells targets genomic DNA whilst promoter CpG island methylation persists

    International Nuclear Information System (INIS)

    Mossman, David; Kim, Kyu-Tae; Scott, Rodney J

    2010-01-01

    DNA methylation and histone acetylation are epigenetic modifications that act as regulators of gene expression. Aberrant epigenetic gene silencing in tumours is a frequent event, yet the factors which dictate which genes are targeted for inactivation are unknown. DNA methylation and histone acetylation can be modified with the chemical agents 5-aza-2'-deoxycytidine (5-aza-dC) and Trichostatin A (TSA) respectively. The aim of this study was to analyse de-methylation and re-methylation and its affect on gene expression in colorectal cancer cell lines treated with 5-aza-dC alone and in combination with TSA. We also sought to identify methylation patterns associated with long term reactivation of previously silenced genes. Colorectal cancer cell lines were treated with 5-aza-dC, with and without TSA, to analyse global methylation decreases by High Performance Liquid Chromatography (HPLC). Re-methylation was observed with removal of drug treatments. Expression arrays identified silenced genes with differing patterns of expression after treatment, such as short term reactivation or long term reactivation. Sodium bisulfite sequencing was performed on the CpG island associated with these genes and expression was verified with real time PCR. Treatment with 5-aza-dC was found to affect genomic methylation and to a lesser extent gene specific methylation. Reactivated genes which remained expressed 10 days post 5-aza-dC treatment featured hypomethylated CpG sites adjacent to the transcription start site (TSS). In contrast, genes with uniformly hypermethylated CpG islands were only temporarily reactivated. These results imply that 5-aza-dC induces strong de-methylation of the genome and initiates reactivation of transcriptionally inactive genes, but this does not require gene associated CpG island de-methylation to occur. In addition, for three of our selected genes, hypomethylation at the TSS of an epigenetically silenced gene is associated with the long term reversion of

  7. Silêncios Silences

    Directory of Open Access Journals (Sweden)

    Luciano Marcondes Godoy

    1999-01-01

    Full Text Available Muitas são as vivências que se expressarão em SILÊNCIOS. Muitos são os silêncios. No Bloco A, o silêncio denuncia a retirada para um outro mundo, a queda num abismo. No bloco B, o silêncio é controlador, exigindo a fala do analista, um jogo em que o que é falado não tem a menor importância. Surge ainda como expressão da necessidade de discriminar-se do analista e, na sua evolução, como um enfrentamento a um estado sem sentido. No Bloco C, o silêncio é agressivo, e a sobrevivência do analisando e analista ao mesmo criará um espaço que propiciará sonhos que surgirão no Bloco D. Esses momentos de silêncio-sonho são situações em que não há discriminação eu-não eu.Many are the experiences which are expressed through silences. Many are the silences. In Block A, silence denounces a pretreatment to another world, a fall into an abysm. In Block B, silence is a controlling factor, demanding the words of the analyst, a game where what is said does not have any importance what so ever. It emerges also as an expression of the analyst's necessity to discriminate himself, and within his evolution the revision of a senseless state. In Block C, the silence is aggressive. As a response, the survival of the patient and of the analyst will create a place in which dreams will come up. Block D analyses these moments of dream-silence situations, where there aren't any forms of self-non self discrimination.

  8. Voice and silence in organizations

    Directory of Open Access Journals (Sweden)

    Moaşa, H.

    2011-01-01

    Full Text Available Unlike previous research on voice and silence, this article breaksthe distance between the two and declines to treat them as opposites. Voice and silence are interrelated and intertwined strategic forms ofcommunication which presuppose each other in such a way that the absence of one would minimize completely the other’s presence. Social actors are not voice, or silence. Social actors can have voice or silence, they can do both because they operate at multiple levels and deal with multiple issues at different moments in time.

  9. The Mediator Complex MED15 Subunit Mediates Activation of Downstream Lipid-Related Genes by the WRINKLED1 Transcription Factor.

    Science.gov (United States)

    Kim, Mi Jung; Jang, In-Cheol; Chua, Nam-Hai

    2016-07-01

    The Mediator complex is known to be a master coordinator of transcription by RNA polymerase II, and this complex is recruited by transcription factors (TFs) to target promoters for gene activation or repression. The plant-specific TF WRINKLED1 (WRI1) activates glycolysis-related and fatty acid biosynthetic genes during embryogenesis. However, no Mediator subunit has yet been identified that mediates WRI1 transcriptional activity. Promoter-β-glucuronidase fusion experiments showed that MEDIATOR15 (MED15) is expressed in the same cells in the embryo as WRI1. We found that the Arabidopsis (Arabidopsis thaliana) MED15 subunit of the Mediator complex interacts directly with WRI1 in the nucleus. Overexpression of MED15 or WRI1 increased transcript levels of WRI1 target genes involved in glycolysis and fatty acid biosynthesis; these genes were down-regulated in wild-type or WRI1-overexpressing plants by silencing of MED15 However, overexpression of MED15 in the wri1 mutant also increased transcript levels of WRI1 target genes, suggesting that MED15 also may act with other TFs to activate downstream lipid-related genes. Chromatin immunoprecipitation assays confirmed the association of MED15 with six WRI1 target gene promoters. Additionally, silencing of MED15 resulted in reduced fatty acid content in seedlings and mature seeds, whereas MED15 overexpression increased fatty acid content in both developmental stages. Similar results were found in wri1 mutant and WRI1 overexpression lines. Together, our results indicate that the WRI1/MED15 complex transcriptionally regulates glycolysis-related and fatty acid biosynthetic genes during embryogenesis. © 2016 American Society of Plant Biologists. All Rights Reserved.

  10. Positive-negative-selection-mediated gene targeting in rice

    Directory of Open Access Journals (Sweden)

    Zenpei eShimatani

    2015-01-01

    Full Text Available Gene targeting (GT refers to the designed modification of genomic sequence(s through homologous recombination (HR. GT is a powerful tool both for the study of gene function and for molecular breeding. However, in transformation of higher plants, non-homologous end joining (NHEJ occurs overwhelmingly in somatic cells, masking HR-mediated GT. Positive-negative selection (PNS is an approach for finding HR-mediated GT events because it can eliminate NHEJ effectively by expression of a negative-selection marker gene. In rice—a major crop worldwide—reproducible PNS-mediated GT of endogenous genes has now been successfully achieved. The procedure is based on strong PNS using diphtheria toxin A-fragment as a negative marker, and has succeeded in the directed modification of several endogenous rice genes in various ways. In addition to gene knock-outs and knock-ins, a nucleotide substitution in a target gene was also achieved recently. This review presents a summary of the development of the rice PNS system, highlighting its advantages. Different types of gene modification and gene editing aimed at developing new plant breeding technology (NPBT based on PNS are discussed.

  11. Cancer gene therapy with targeted adenoviruses.

    Science.gov (United States)

    Bachtarzi, Houria; Stevenson, Mark; Fisher, Kerry

    2008-11-01

    Clinical experience with adenovirus vectors has highlighted the need for improved delivery and targeting. This manuscript aims to provide an overview of the techniques currently under development for improving adenovirus delivery to malignant cells in vivo. Primary research articles reporting improvements in adenoviral gene delivery are described. Strategies include genetic modification of viral coat proteins, non-genetic modifications including polymer encapsulation approaches and pharmacological interventions. Reprogramming adenovirus tropism in vitro has been convincingly demonstrated using a range of genetic and physical strategies. These studies have provided new insights into our understanding of virology and the field is progressing. However, there are still some limitations that need special consideration before adenovirus-targeted cancer gene therapy emerges as a routine treatment in the clinical setting.

  12. Targeted adenovirus mediated inhibition of NF-κB-dependent inflammatory gene expression in endothelial cells in vitro and in vivo.

    Science.gov (United States)

    Kułdo, J M; Ásgeirsdóttir, S A; Zwiers, P J; Bellu, A R; Rots, M G; Schalk, J A C; Ogawara, K I; Trautwein, C; Banas, B; Haisma, H J; Molema, G; Kamps, J A A M

    2013-02-28

    In chronic inflammatory diseases the endothelium expresses mediators responsible for harmful leukocyte infiltration. We investigated whether targeted delivery of a therapeutic transgene that inhibits nuclear factor κB signal transduction could silence the proinflammatory activation status of endothelial cells. For this, an adenovirus encoding dominant-negative IκB (dnIκB) as a therapeutic transgene was employed. Selectivity for the endothelial cells was achieved by introduction of antibodies specific for inflammatory endothelial adhesion molecules E-selectin or VCAM-1 chemically linked to the virus via polyethylene glycol. In vitro, the retargeted adenoviruses selectively infected cytokine-activated endothelial cells to express functional transgene. The comparison of transductional capacity of both retargeted viruses revealed that E-selectin based transgene delivery exerted superior pharmacological effects. Targeted delivery mediated dnIκB transgene expression in endothelial cells inhibited the induced expression of several inflammatory genes, including adhesion molecules, cytokines, and chemokines. In vivo, in mice suffering from glomerulonephritis, E-selectin-retargeted adenovirus selectively homed in the kidney to microvascular glomerular endothelium. Subsequent downregulation of endothelial adhesion molecule expression 2 days after induction of inflammation demonstrated the pharmacological potential of this gene therapy approach. The data justify further studies towards therapeutic virus design and optimization of treatment schedules to investigate their capacity to interfere with inflammatory disease progression. Copyright © 2012 Elsevier B.V. All rights reserved.

  13. Remodeling of ribosomal genes in somatic cells by Xenopus egg extract

    Energy Technology Data Exchange (ETDEWEB)

    Ostrup, Olga, E-mail: osvarcova@gmail.com [Institute of Basic Animal and Veterinary Sciences, Faculty of Life Sciences, University of Copenhagen, Frederiksberg C (Denmark); Stem Cell Epigenetics Laboratory, Institute of Basic Medical Sciences, Faculty of Medicine, University of Oslo, Oslo (Norway); Norwegian Center for Stem Cell Research, Oslo (Norway); Hyttel, Poul; Klaerke, Dan A. [Institute of Basic Animal and Veterinary Sciences, Faculty of Life Sciences, University of Copenhagen, Frederiksberg C (Denmark); Collas, Philippe, E-mail: philc@medisin.uio.no [Stem Cell Epigenetics Laboratory, Institute of Basic Medical Sciences, Faculty of Medicine, University of Oslo, Oslo (Norway); Norwegian Center for Stem Cell Research, Oslo (Norway)

    2011-09-02

    Highlights: {yields} Xenopus egg extract remodels nuclei and alter cell growth characteristics. {yields} Ribosomal genes are reprogrammed within 6 h after extract exposure. {yields} rDNA reprogramming involves promoter targeting of SNF2H remodeling complex. {yields} Xenopus egg extract does not initiate stress-related response in somatic cells. {yields} Aza-cytidine elicits a stress-induced response in reprogrammed cells. -- Abstract: Extracts from Xenopus eggs can reprogram gene expression in somatic nuclei, however little is known about the earliest processes associated with the switch in the transcriptional program. We show here that an early reprogramming event is the remodeling of ribosomal chromatin and gene expression. This occurs within hours of extract treatment and is distinct from a stress response. Egg extract elicits remodeling of the nuclear envelope, chromatin and nucleolus. Nucleolar remodeling involves a rapid and stable decrease in ribosomal gene transcription, and promoter targeting of the nucleolar remodeling complex component SNF2H without affecting occupancy of the transcription factor UBF and the stress silencers SUV39H1 and SIRT1. During this process, nucleolar localization of UBF and SIRT1 is not altered. On contrary, azacytidine pre-treatment has an adverse effect on rDNA remodeling induced by extract and elicits a stress-type nuclear response. Thus, an early event of Xenopus egg extract-mediated nuclear reprogramming is the remodeling of ribosomal genes involving nucleolar remodeling complex. Condition-specific and rapid silencing of ribosomal genes may serve as a sensitive marker for evaluation of various reprogramming methods.

  14. Small interfering RNA-mediated silencing of nicotinamide phosphoribosyltransferase (NAMPT and lysosomal trafficking regulator (LYST induce growth inhibition and apoptosis in human multiple myeloma cells: A preliminary study

    Directory of Open Access Journals (Sweden)

    Ivyna Pau Ni Bong

    2016-11-01

    Full Text Available Multiple myeloma (MM is a malignancy of B lymphocytes or plasma cells. Our array-based comparative genomic hybridization findings revealed chromosomal gains at 7q22.3 and 1q42.3, where nicotinamide (NAM phosphoribosyltransferase (NAMPT and lysosomal trafficking regulator (LYST genes are localized, respectively. This led us to further study the functions of these genes in myeloma cells. NAMPT is a key enzyme involved in nicotinamide adenine dinucleotide salvage pathway, and it is frequently overexpressed in human cancers. In contrast, little is known about the function of LYST in cancer. The expression of LYST is shown to affect lysosomal size, granule size, and autophagy in human cells. In this study, the effects of small interfering RNA (siRNA-mediated silencing of NAMPT and LYST on cell proliferation and apoptosis were evaluated in RPMI 8226 myeloma cells. Transfection efficiencies were determined by quantitative real time reverse transcriptase PCR. Cell proliferation was determined using MTT assay, while apoptosis was analyzed with flow cytometry using Annexin V-fluorescein isothiocyanate/propidium iodide assay. The NAMPT protein expression in siRNA-treated cells was estimated by enzyme-linked immunosorbent assay. Our results showed that NAMPT and LYST were successfully knockdown by siRNA transfection (p < 0.05. NAMPT or LYST gene silencing significantly inhibited cell proliferation and induced apoptosis in RPMI 8226 cells (p < 0.05. Silencing of NAMPT gene also decreased NAMPT protein levels (p < 0.01. Our study demonstrated that NAMPT and LYST play pivotal roles in the molecular pathogenesis of MM. This is the first report describing the possible functions of LYST in myelomagenesis and its potential role as a therapeutic target in MM.

  15. Small interfering RNA-mediated silencing of nicotinamide phosphoribosyltransferase (NAMPT) and lysosomal trafficking regulator (LYST) induce growth inhibition and apoptosis in human multiple myeloma cells: A preliminary study

    Science.gov (United States)

    Bong, Ivyna Pau Ni; Ng, Ching Ching; Fakiruddin, Shaik Kamal; Lim, Moon Nian; Zakaria, Zubaidah

    2016-01-01

    Multiple myeloma (MM) is a malignancy of B lymphocytes or plasma cells. Our array-based comparative genomic hybridization findings revealed chromosomal gains at 7q22.3 and 1q42.3, where nicotinamide (NAM) phosphoribosyltransferase (NAMPT) and lysosomal trafficking regulator (LYST) genes are localized, respectively. This led us to further study the fprotein expression in unctions of these genes in myeloma cells. NAMPT is a key enzyme involved in nicotinamide adenine dinucleotide salvage pathway, and it is frequently overexpressed in human cancers. In contrast, little is known about the function of LYST in cancer. The expression of LYST is shown to affect lysosomal size, granule size, and autophagy in human cells. In this study, the effects of small interfering RNA (siRNA)-mediated silencing of NAMPT and LYST on cell proliferation and apoptosis were evaluated in RPMI 8226 myeloma cells. Transfection efficiencies were determined by quantitative real time reverse transcriptase PCR. Cell proliferation was determined using MTT assay, while apoptosis was analyzed with flow cytometry using Annexin V-fluorescein isothiocyanate/propidium iodide assay. The NAMPT protein expression in siRNA-treated cells was estimated by enzyme-linked immunosorbent assay. Our results showed that NAMPT and LYST were successfully knockdown by siRNA transfection (p < 0.05). NAMPT or LYST gene silencing significantly inhibited cell proliferation and induced apoptosis in RPMI 8226 cells (p < 0.05). Silencing of NAMPT gene also decreased NAMPT protein levels (p < 0.01). Our study demonstrated that NAMPT and LYST play pivotal roles in the molecular pathogenesis of MM. This is the first report describing the possible functions of LYST in myelomagenesis and its potential role as a therapeutic target in MM. PMID:27754828

  16. Direct and indirect targets of the E2A-PBX1 leukemia-specific fusion protein.

    Directory of Open Access Journals (Sweden)

    Christofer Diakos

    Full Text Available E2A-PBX1 is expressed as a result of the t(1;19 chromosomal translocation in nearly 5% of cases of childhood acute lymphoblastic leukemia. The E2A-PBX1 chimeric transcription factor contains the N-terminal transactivation domain of E2A (TCF3 fused to the C-terminal DNA-binding homeodomain of PBX1. While there is no doubt of its oncogenic potential, the mechanisms of E2A-PBX1-mediated pre-B cell transformation and the nature of direct E2A-PBX1 target genes and pathways remain largely unknown. Herein we used chromatin immunoprecipitation assays (ChIP-chip to identify direct targets of E2A-PBX1, and we used gene expression arrays of siRNA E2A-PBX1-silenced cells to evaluate changes in expression induced by the fusion protein. Combined ChIP-chip and expression data analysis gave rise to direct and functional targets of E2A-PBX1. Further we observe that the set of ChIP-chip identified E2A-PBX1 targets show a collective down-regulation trend in the E2A-PBX1 silenced samples compared to controls suggesting an activating role of this fusion transcription factor. Our data suggest that the expression of the E2A-PBX1 fusion gene interferes with key regulatory pathways and functions of hematopoietic biology. Among these are members of the WNT and apoptosis/cell cycle control pathways, and thus may comprise an essential driving force for the propagation and maintenance of the leukemic phenotype. These findings may also provide evidence of potentially attractive therapeutic targets.

  17. Direct and indirect targets of the E2A-PBX1 leukemia-specific fusion protein.

    Science.gov (United States)

    Diakos, Christofer; Xiao, Yuanyuan; Zheng, Shichun; Kager, Leo; Dworzak, Michael; Wiemels, Joseph L

    2014-01-01

    E2A-PBX1 is expressed as a result of the t(1;19) chromosomal translocation in nearly 5% of cases of childhood acute lymphoblastic leukemia. The E2A-PBX1 chimeric transcription factor contains the N-terminal transactivation domain of E2A (TCF3) fused to the C-terminal DNA-binding homeodomain of PBX1. While there is no doubt of its oncogenic potential, the mechanisms of E2A-PBX1-mediated pre-B cell transformation and the nature of direct E2A-PBX1 target genes and pathways remain largely unknown. Herein we used chromatin immunoprecipitation assays (ChIP-chip) to identify direct targets of E2A-PBX1, and we used gene expression arrays of siRNA E2A-PBX1-silenced cells to evaluate changes in expression induced by the fusion protein. Combined ChIP-chip and expression data analysis gave rise to direct and functional targets of E2A-PBX1. Further we observe that the set of ChIP-chip identified E2A-PBX1 targets show a collective down-regulation trend in the E2A-PBX1 silenced samples compared to controls suggesting an activating role of this fusion transcription factor. Our data suggest that the expression of the E2A-PBX1 fusion gene interferes with key regulatory pathways and functions of hematopoietic biology. Among these are members of the WNT and apoptosis/cell cycle control pathways, and thus may comprise an essential driving force for the propagation and maintenance of the leukemic phenotype. These findings may also provide evidence of potentially attractive therapeutic targets.

  18. DNA targeting by the type I-G and type I-A CRISPR–Cas systems of Pyrococcus furiosus

    Science.gov (United States)

    Elmore, Joshua; Deighan, Trace; Westpheling, Jan; Terns, Rebecca M.; Terns, Michael P.

    2015-01-01

    CRISPR–Cas systems silence plasmids and viruses in prokaryotes. CRISPR–Cas effector complexes contain CRISPR RNAs (crRNAs) that include sequences captured from invaders and direct CRISPR-associated (Cas) proteins to destroy corresponding invader nucleic acids. Pyrococcus furiosus (Pfu) harbors three CRISPR–Cas immune systems: a Cst (Type I-G) system with an associated Cmr (Type III-B) module at one locus, and a partial Csa (Type I-A) module (lacking known invader sequence acquisition and crRNA processing genes) at another locus. The Pfu Cmr complex cleaves complementary target RNAs, and Csa systems have been shown to target DNA, while the mechanism by which Cst complexes silence invaders is unknown. In this study, we investigated the function of the Cst as well as Csa system in Pfu strains harboring a single CRISPR–Cas system. Plasmid transformation assays revealed that the Cst and Csa systems both function by DNA silencing and utilize similar flanking sequence information (PAMs) to identify invader DNA. Silencing by each system specifically requires its associated Cas3 nuclease. crRNAs from the 7 shared CRISPR loci in Pfu are processed for use by all 3 effector complexes, and Northern analysis revealed that individual effector complexes dictate the profile of mature crRNA species that is generated. PMID:26519471

  19. α-Fetoprotein promoter-driven Cre/LoxP-switched RNA interference for hepatocellular carcinoma tissue-specific target therapy.

    Directory of Open Access Journals (Sweden)

    Yuan-Fei Peng

    Full Text Available RNA interference (RNAi has recently emerged as a potential treatment modality for hepatocellular carcinoma (HCC therapy, but the lack of cellular targets and sustained efficacy limits its application. The purpose of this study is to develop an HCC tissue-specific RNAi system and investigate its possibility for HCC treatment.Two different HCC-specific RNAi systems in which therapeutic miRNA or shRNA against target gene (Beclin 1 was directly or indirectly driven by alpha-fetoprotein promoter (AFP-miRNA and AFP-Cre/LoxP-shRNA were constructed. Human HCC cell lines (HepG2, Hep3B and HCCLM3 and non-HCC cell lines (L-02, Hela and SW1116 were infected with the systems. The effectiveness and tissue-specificity of the systems were examined by Q-PCR and western blot analysis. The efficacy of the systems was further tested in mouse model of HCC by intravenous or intratumoral administration. The feasibility of the system for HCC treatment was evaluated by applying the system as adjuvant therapy to enhance sorafenib treatment. An AFP-Cre/LoxP-shRNA system targeting Atg5 gene (AFP-Cre/LoxP-shRNA-Atg5 was constructed and its efficacy in sensitizing HCC cells (MHCC97L/PLC to sorafenib treatment was examined by apoptosis assay in vitro and tumorigenesis assay in vivo.The AFP-miRNA system could silence target gene (Beclin 1 but required a high titer which was lethal to target cells. The AFP-Cre/LoxP-shRNA system could efficiently knockdown target gene while maintain high HCC specificity. Intratumoral injection of the AFP-Cre/LoxP-shRNA system could efficiently silence target gene (Beclin 1 in vivo while intravenous administration could not. The AFP-Cre/LoxP-shRNA system target Atg5 gene could significantly sensitize MHCC97L/PLC cells to sorafenib-induced apoptosis in vitro and tumor growth suppression in vivo.An efficient HCC tissue-specific RNAi system (AFP-Cre/LoxP-shRNA was successfully established. The system provides a usable tool for HCC-specific RNAi

  20. The Ebola virus VP35 protein is a suppressor of RNA silencing

    NARCIS (Netherlands)

    Haasnoot, J.; Vries, de W.; Geutjes, E.J.; Prins, M.W.; Haan, de P.; Berkhout, B.

    2007-01-01

    RNA silencing or interference (RNAi) is a gene regulation mechanism in eukaryotes that controls cell differentiation and developmental processes via expression of microRNAs. RNAi also serves as an innate antiviral defence response in plants, nematodes, and insects. This antiviral response is