WorldWideScience

Sample records for tanzania method provider

  1. Unsafe abortion in urban and rural Tanzania: method, provider and consequences

    DEFF Research Database (Denmark)

    Rasch, Vibeke; Kipingili, Rose

    2009-01-01

    OBJECTIVE: To describe unsafe abortion methods and associated health consequences in Tanzania, where induced abortion is restricted by law but common and known to account for a disproportionate share of hospital admissions. METHOD: Cross-sectional study of women admitted with alleged miscarriage...

  2. Mixed Methods Survey of Zoonotic Disease Awareness and Practice among Animal and Human Healthcare Providers in Moshi, Tanzania.

    Directory of Open Access Journals (Sweden)

    Helen L Zhang

    2016-03-01

    Full Text Available Zoonoses are common causes of human and livestock illness in Tanzania. Previous studies have shown that brucellosis, leptospirosis, and Q fever account for a large proportion of human febrile illness in northern Tanzania, yet they are infrequently diagnosed. We conducted this study to assess awareness and knowledge regarding selected zoonoses among healthcare providers in Moshi, Tanzania; to determine what diagnostic and treatment protocols are utilized; and obtain insights into contextual factors contributing to the apparent under-diagnosis of zoonoses.We conducted a questionnaire about zoonoses knowledge, case reporting, and testing with 52 human health practitioners and 10 livestock health providers. Immediately following questionnaire administration, we conducted semi-structured interviews with 60 of these respondents, using the findings of a previous fever etiology study to prompt conversation. Sixty respondents (97% had heard of brucellosis, 26 (42% leptospirosis, and 20 (32% Q fever. Animal sector respondents reported seeing cases of animal brucellosis (4, rabies (4, and anthrax (3 in the previous 12 months. Human sector respondents reported cases of human brucellosis (15, 29%, rabies (9, 18% and anthrax (6, 12%. None reported leptospirosis or Q fever cases. Nineteen respondents were aware of a local diagnostic test for human brucellosis. Reports of tests for human leptospirosis or Q fever, or for any of the study pathogens in animals, were rare. Many respondents expressed awareness of malaria over-diagnosis and zoonoses under-diagnosis, and many identified low knowledge and testing capacity as reasons for zoonoses under-diagnosis.This study revealed differences in knowledge of different zoonoses and low case report frequencies of brucellosis, leptospirosis, and Q fever. There was a lack of known diagnostic services for leptospirosis and Q fever. These findings emphasize a need for improved diagnostic capacity alongside healthcare

  3. District health manager and mid-level provider perceptions of practice environments in acute obstetric settings in Tanzania: a mixed-method study.

    Science.gov (United States)

    Ng'ang'a, Njoki; Byrne, Mary Woods; Kruk, Margaret E; Shemdoe, Aloisia; de Pinho, Helen

    2016-08-08

    In sub-Saharan Africa, the capacity of human resources for health (HRH) managers to create positive practice environments that enable motivated, productive, and high-performing HRH is weak. We implemented a unique approach to examining HRH management practices by comparing perspectives offered by mid-level providers (MLPs) of emergency obstetric care (EmOC) in Tanzania to those presented by local health authorities, known as council health management teams (CHMTs). This study was guided by the basic strategic human resources management (SHRM) component model. A convergent mixed-method design was utilized to assess qualitative and quantitative data from the Health Systems Strengthening for Equity: The Power and Potential of Mid-Level Providers project. Survey data was obtained from 837 mid-level providers, 83 of whom participated in a critical incident interview whose aim was to elicit negative events in the practice environment that induced intention to leave their job. HRH management practices were assessed quantitatively in 48 districts with 37 members of CHMTs participating in semi-structured interviews. The eight human resources management practices enumerated in the basic SHRM component model were implemented unevenly. On the one hand, members of CHMTs and mid-level providers agreed that there were severe shortages of health workers, deficient salaries, and an overwhelming workload. On the other hand, members of CHMTs and mid-level providers differed in their perspectives on rewards and allocation of opportunities for in-service training. Although written standards of performance and supervision requirements were available in most districts, they did not reflect actual duties. Members of CHMTs reported high levels of autonomy in key HRH management practices, but mid-level providers disputed the degree to which the real situation on the ground was factored into job-related decision-making by CHMTs. The incongruence in perspectives offered by members of CHMTs

  4. Cancer Training for Frontline Healthcare Providers in Tanzania.

    Science.gov (United States)

    Rick, Tara J; Deming, Cassondra M; Helland, Janey R; Hartwig, Kari A

    2017-08-16

    Cervical and breast cancer are responsible for the highest cancer-related mortality in Tanzania, although both are preventable or curable if diagnosed at an early stage. Limited knowledge of cervical cancer by clinic and dispensary level healthcare providers in Tanzania is a barrier for prevention and control strategies. The purpose of the study was to provide basic oncology training to frontline healthcare workers with a focus on cervical and breast cancer in order to increase knowledge. A 1-day cancer training symposium was conducted in Arusha, Tanzania, with 43 clinicians. Pre- and post-intervention surveys assessed cancer knowledge and confidence of clinicians in risk assessment. Sixty-nine percent of the participants reported never receiving any cervical cancer training in the past. A significant difference was found between the pre- and post-test in a majority of knowledge questions and in reported confidence recognizing signs and symptoms of breast and cervical cancer (p < 0.05). The 1-day community oncology training symposium was effective in delivering and increasing basic knowledge about cervical and breast cancers to these healthcare providers. The low level of baseline cancer knowledge among frontline medical providers in Tanzania illustrates the need for increased training around the country.

  5. Unsafe abortion in rural Tanzania ¿ the use of traditional medicine from a patient and a provider perspective

    DEFF Research Database (Denmark)

    Rasch, Vibeke; Sørensen, Pernille H; Wang, Anna R

    2014-01-01

    BackgroundThe circumstances under which women obtain unsafe abortion vary and depend on the traditional methods known and the type of providers present. In rural Tanzania women often resort to traditional providers who use plant species as abortion remedies. Little is known about how these plants...

  6. Tanzania.

    Science.gov (United States)

    1992-05-01

    Background notes on Tanzania present a profile of nationality, population count of 26 million, growth rate of 3.5%, ethnic groups (130), religions (33% Muslim, 33% animist, 33% Christian), languages, education (86% primary), literacy (79%), health (infant mortality of 106/1000), and work force (90% agriculture). Geographic data are given for the area, cities, terrain, and climate. The Tanzanian government is a republic with executive, legislative, and judicial branches of government. There is 1 political party and everyone 18 years is eligible to vote. 4% of the gross domestic product (GDP) ($5.9 billion) is devoted to defense. Economic growth is 4.3%/year and person income is $240/capita. Natural resources, agriculture, industry, and trade are identified. $400 million has been received between 1970-92 in US economic aid. The 1992 official exchange rate is 300 Tanzanian shillings to the US dollar. Descriptive text is given for the population, the history of Tanganyika and Zanzibar, the government, principal government officials (President, 1st Vice President [VP], 2nd VP and President of Zanzibar, Prime Minister, Foreign Affairs Minister, Ambassador to the US, Ambassador to the UN, and US embassy address and phone number), political conditions, the economy, the defense, foreign relations, and US-Tanzanian relations. Principal US officials are identified for the Ambassador, Deputy Chief of Mission, USAID Director, and Public Affairs Officer; the US embassy address is given also. The population is 80% rural with a density of 1/sq km in arid areas, 51/sq km on the mainland, and 134/sq km on Zanzibar. The new capital will be Dodoma in central Tanzania. Most residents are of Bantu stock; nomadic groups are the Masai and the Luo. 1% are non-Africans. Government has a strong central executive. The current President is Ali Hassan Mwinyi. The Revolutionary Party is in the primary policymaking body and provides all government leaders. The government seeks to foster the

  7. Tanzania Telecommunication Company Limited as a Mobile Service Provider

    OpenAIRE

    Ndyamukama, Edna

    2014-01-01

    This bachelor’s thesis was researched and written under the consent and authority of Tanzania Telecommunication Company Limited (TTCL), with the purpose to find out ways of improving sales and profits of its mobile service department. The mobile service department of TTCL is performing poorly as compared to its competitors despite being managed by a strategically positioned and experienced company in tele-communication services. It was also meant to find out the positive contribution of compe...

  8. Work experience, job-fulfillment and burnout among VMMC providers in Kenya, South Africa, Tanzania and Zimbabwe.

    Directory of Open Access Journals (Sweden)

    Linnea Perry

    Full Text Available BACKGROUND: Human resource capacity is vital to the scale-up of voluntary medical male circumcision (VMMC services. VMMC providers are at risk of "burnout" from performing a single task repeatedly in a high volume work environment that produces long work hours and intense work effort. METHODS AND FINDINGS: The Systematic Monitoring of the Voluntary Medical Male Circumcision Scale-up (SYMMACS surveyed VMMC providers in Kenya, South Africa, Tanzania, and Zimbabwe in 2011 (n = 357 and 2012 (n = 591. Providers self-reported on their training, work experience, levels of job-fulfillment and work fatigue/burnout. Data analysis included a descriptive analysis of VMMC provider characteristics, and both bivariate and multivariate analyses of factors associated with provider work fatigue/burnout. In 2012, Kenyan providers had worked in VMMC for a median of 31 months compared to South Africa (10 months, Tanzania (15 months, and Zimbabwe (11 months. More than three-quarters (78 - 99% of providers in all countries in 2012 reported that VMMC is a personally fulfilling job. However, 67% of Kenyan providers reported starting to experience work fatigue/burnout compared to South Africa (33%, Zimbabwe (17%, and Tanzania (15%. Despite the high level of work fatigue/burnout in Kenya, none of the measured factors (i.e., gender, age, full-time versus part-time status, length of service, number of operations performed, or cadre were significantly associated with work fatigue/burnout in 2011. In 2012, logistic regression found increases in age (p<.05 and number of months working in VMMC (p<.01 were associated with an increased likelihood of experiencing work fatigue/burnout, while higher career total VMMCs decreased the likelihood of experiencing burnout. CONCLUSION: Given cross-country differences, further elucidation of cultural and other contextual factors that may influence provider burnout is required. Continuing to emphasize the contribution that providers make in

  9. Healthcare Provider Views on Transitioning From Task Shifting to Advanced Practice Nursing in Tanzania.

    Science.gov (United States)

    Mboineki, Joanes Faustine; Zhang, Weihong

    The Tanzanian health sector suffers from shortages of healthcare workers as well as uneven distribution of healthcare workers in urban and rural areas. Task shifting-delegation of tasks from professionals to other healthcare team members with less training, such as medical attendants-is practiced, compromising quality of care. Advanced practice nursing is underutilized. The purpose of this study was to explore the views of nurses and physicians on current responses to shortages of healthcare workers and the potential for utilization of advanced practice nurses. A descriptive, qualitative design was used. Purposeful sampling was used to select 20 participants. An in-depth interview guide was used to obtain information. Interviews were conducted in Swahili or English. Content analysis was used to identify themes. Shortage of human resources in rural primary healthcare facilities was identified as a major rationale for implementation of the advanced practice nurse practitioner role because the current health providers in rural health facilities are less trained and doctors are not ready to work in these settings. Opposition from physicians is expected during the course of implementing the nurse practitioner role. Professional bodies and government should reach consensus before the implementation of this role in such a way that they should agree on scope and standards of practice of nurse practitioners in Tanzania. Shortage of human resources for health is greater in rural primary healthcare facilities. Task shifting in Tanzania is neither effective nor legally recognized. Transition to advanced practice nursing roles-particularly the nurse practitioner role-can facilitate provision of optimal care. Nurse practitioners should be prepared to work in rural primary healthcare facilities.

  10. Challenges Addressing Unmet Need for Contraception: Voices of Family Planning Service Providers in Rural Tanzania.

    Science.gov (United States)

    Baraka, Jitihada; Rusibamayila, Asinath; Kalolella, Admirabilis; Baynes, Colin

    2015-12-01

    Provider perspectives have been overlooked in efforts to address the challenges of unmet need for family planning (FP). This qualitative study was undertaken in Tanzania, using 22 key informant interviews and 4 focus group discussions. The research documents perceptions of healthcare managers and providers in a rural district on the barriers to meeting latent demand for contraception. Social-ecological theory is used to interpret the findings, illustrating how service capability is determined by the social, structural and organizational environment. Providers' efforts to address unmet need for FP services are constrained by unstable reproductive preferences, low educational attainment, and misconceptions about contraceptive side effects. Societal and organizational factors--such as gender dynamics, economic conditions, religious and cultural norms, and supply chain bottlenecks, respectively--also contribute to an adverse environment for meeting needs for care. Challenges that healthcare providers face interact and produce an effect which hinders efforts to address unmet need. Interventions to address this are not sufficient unless the supply of services is combined with systems strengthening and social engagement strategies in a way that reflects the multi-layered, social institutional problems.

  11. Community violence in Dar es Salaam, Tanzania: A mixed methods ...

    African Journals Online (AJOL)

    Most homicide deaths in Dar es Salaam, Tanzania (DSM) are a result of violence arising from within the community. This type of violence is commonly called, by perpetrators and victims, “mob justice”. Unilateral non-state collective violence can take four forms: lynching, vigilantism, rioting, and terrorism. The purpose of this ...

  12. Preparing investigation of methods for surveying tree seed demands among farmers in Tanzania

    DEFF Research Database (Denmark)

    Aabæk, Anders

    Insufficient seed supplies is often a major constraint on tree planting activities in developing countries. A central problem is to assess the actual demands for tree seed. This report shall, as a part of a PhD-study, prepare an investigation of different methods for surveying tree seed demands...... and preferences among private farmers in Tanzania. A framework for investigating seed demand and supply is outlined. The role of a national tree seed project in a seed supply sector is discussed and data requirements for strategy on seed procurement and tree improvement are outlined. Earlier surveys on seed...... demand pattern in Tanzania, Uganda and Nicaragua are discussed and a choice of strategy for an extensive survey of seed demand and supply in Tanzania is made. Different data collection methods and tools, e.g. quantitative and qualitative surveys and rapid rural appraisals, are described in detail...

  13. Assessment of health facility capacity to provide newborn care in Bangladesh, Haiti, Malawi, Senegal, and Tanzania.

    Science.gov (United States)

    Winter, Rebecca; Yourkavitch, Jennifer; Wang, Wenjuan; Mallick, Lindsay

    2017-12-01

    Despite the importance of health facility capacity to provide comprehensive care, the most widely used indicators for global monitoring of maternal and child health remain contact measures which assess women's use of services only and not the capacity of health facilities to provide those services; there is a gap in monitoring health facilities' capacity to provide newborn care services in low and middle income countries. In this study we demonstrate a measurable framework for assessing health facility capacity to provide newborn care using open access, nationally-representative Service Provision Assessment (SPA) data from the Demographic Health Surveys Program. In particular, we examine whether key newborn-related services are available at the facility (ie, service availability, measured by the availability of basic emergency obstetric care (BEmOC) signal functions, newborn signal functions, and routine perinatal services), and whether the facility has the equipment, medications, training and knowledge necessary to provide those services (ie, service readiness, measured by general facility requirements, equipment, medicines and commodities, and guidelines and staffing) in five countries with high levels of neonatal mortality and recent SPA data: Bangladesh, Haiti, Malawi, Senegal, and Tanzania. In each country, we find that key services and commodities needed for comprehensive delivery and newborn care are missing from a large percentage of facilities with delivery services. Of three domains of service availability examined, scores for routine care availability are highest, while scores for newborn signal function availability are lowest. Of four domains of service readiness examined, scores for general requirements and equipment are highest, while scores for guidelines and staffing are lowest. Both service availability and readiness tend to be highest in hospitals and facilities in urban areas, pointing to substantial equity gaps in the availability of essential

  14. Incentives and provider payment methods.

    Science.gov (United States)

    Barnum, H; Kutzin, J; Saxenian, H

    1995-01-01

    The mode of payment creates powerful incentives affecting provider behavior and the efficiency, equity and quality outcomes of health finance reforms. This article examines provider incentives as well as administrative costs, and institutional conditions for successful implementation associated with provider payment alternatives. The alternatives considered are budget reforms, capitation, fee-for-service, and case-based reimbursement. We conclude that competition, whether through a regulated private sector or within a public system, has the potential to improve the performance of any payment method. All methods generate both adverse and beneficial incentives. Systems with mixed forms of provider payment can provide tradeoffs to offset the disadvantages of individual modes. Low-income countries should avoid complex payment systems requiring higher levels of institutional development.

  15. The determinants of traditional medicine use in Northern Tanzania: a mixed-methods study.

    Directory of Open Access Journals (Sweden)

    John W Stanifer

    Full Text Available Traditional medicines are an important part of healthcare in sub-Saharan Africa, and building successful disease treatment programs that are sensitive to traditional medicine practices will require an understanding of their current use and roles, including from a biomedical perspective. Therefore, we conducted a mixed-method study in Northern Tanzania in order to characterize the extent of and reasons for the use of traditional medicines among the general population so that we can better inform public health efforts in the region.Between December 2013 and June 2014 in Kilimanjaro, Tanzania, we conducted 5 focus group discussions and 27 in-depth interviews of key informants. The data from these sessions were analyzed using an inductive framework method with cultural insider-outsider coding. From these results, we developed a structured survey designed to test different aspects of traditional medicine use and administered it to a random sample of 655 adults from the community. The results were triangulated to explore converging and diverging themes.Most structured survey participants (68% reported knowing someone who frequently used traditional medicines, and the majority (56% reported using them themselves in the previous year. The most common uses were for symptomatic ailments (42%, chronic diseases (15%, reproductive problems (11%, and malaria/febrile illnesses (11%. We identified five major determinants for traditional medicine use in Northern Tanzania: biomedical healthcare delivery, credibility of traditional practices, strong cultural identities, individual health status, and disease understanding.In order to better formulate effective local disease management programs that are sensitive to TM practices, we described the determinants of TM use. Additionally, we found TM use to be high in Northern Tanzania and that its use is not limited to lower-income areas or rural settings. After symptomatic ailments, chronic diseases were reported as

  16. Knowledge and Practices Relating to Acute Pesticide Poisoning Among Health Care Providers in Selected Regions of Tanzania

    Directory of Open Access Journals (Sweden)

    Elikana Lekei

    2017-02-01

    Full Text Available Background: Acute pesticide poisoning (APP is commonly underdiagnosed in Tanzania. Studies in developing countries suggest that a lack of diagnostic skills among health care providers (HCPs undermines surveillance for APP. This study aimed at characterizing experience and skills of Tanzanian HCPs regarding APP diagnosis and management. Methodology: The population included HCPs responsible for managing APP in Kilimanjaro and Arusha regions (n = 91. The resulting sample included 66 respondents (response rate: 73%. The data were collected in 2005 using a standardized questionnaire. Results: Half of all respondents (50% reported handling at least 1 APP case with 15% reporting handling more than 5 cases in the past. Reported experience of handling an APP case was marginally higher in respondents who reported ⩾4 years of work experience in the health sector compared with those with <4 years of work experience (odds ratio = 1.32; 95% confidence interval = 0.9-1.5. Most of the respondents had high knowledge of exposure routes, reporting awareness of oral (98.5%, inhalational (93.9%, and dermal (77% routes. The study revealed low awareness of pesticide classification by chemical groups (29% or World Health Organization hazard (0% and weak knowledge on pesticide label instructions (55%. Organophosphates accounted for 35% of the pesticide products reported by respondents as being responsible for poisoning. Some treatment options were incorrectly reported as first aid options, and some reported first aid options were wrong or inappropriate. Conclusions: The study revealed that HCPs in northern Tanzania lack adequate skills to diagnose and manage APP. For effective surveillance of APP, there is a need to include training on hazards, classification, diagnosis, and health effects in the training programmes for all HCPs in Tanzania.

  17. Using contraceptives to delay first birth: a qualitative study of individual, community and health provider perceptions in southern Tanzania

    Directory of Open Access Journals (Sweden)

    Yovitha Sedekia

    2017-10-01

    Full Text Available Abstract Background Young adolescents and unmarried women in low and middle income countries face challenges in accessing family planning services. One factor likely to limit contraceptive use is the attitude and opinion of local stakeholders such as community leaders and health workers. Much of the existing evidence on this topic focuses on women who have already started childbearing. Using primary qualitative data, we explored individual, community and health provider’s perceptions about using modern contraceptives to delay the first birth in a high fertility setting. Methods A descriptive qualitative study was conducted in Tandahimba district in southern Tanzania between December 2014 and March 2015. We conducted 8 focus group discussions with men and women and 25 in-depth interviews (18 with women, 4 with family planning service providers and 3 with district-level staff. Participants were purposively sampled. Data transcripts were managed and coded using Nvivo 11 software and we employed a thematic framework analysis. Results Three main themes emerged about using modern contraceptives to delay first birth: (1 the social and biological status of the woman (2 the type of contraceptive and (3 non-alignment among national policies for adolescents. Use of modern contraceptives to delay first birth was widely acceptable for women who were students, young, unmarried and women in unstable marriage. But long-acting reversible methods such as implants and intrauterine devices were perceived as inappropriate methods for delaying first birth, partly because of fears around delayed return to fecundity, discontinuation once woman’s marital status changes and permanently limiting future fertility. The support for use of modern contraceptives to delay a first pregnancy was not unanimous. A small number of participants from both rural and urban areas did not approve the use of contraceptive methods before the birth of a first baby at all, not even for

  18. Knowledge, attitudes and acceptability to provider-initiated HIV testing and counseling: patients' perspectives in Moshi and Rombo Districts, Tanzania.

    Science.gov (United States)

    Manongi, Rachel; Mahande, Michael; Njau, Bernard

    2014-10-01

    Provider-initiated HIV testing and counseling (PITC) is referred to as routine testing in a clinical setting as part of a standard programme of medical services. PITC is initiated in order to avoid missed opportunities for people to get tested for HIV. While advocated as a strategy, there is dearth of information on patients' views on PITC in a number of districts in Tanzania. The objective of this study was to assess the knowledge, attitude and acceptability to PITC services among patients attending health care facilities in rural and urban settings in Kilimanjaro region A total of 12 focus group discussions (FGDs) were conducted with 99 (73 female and 26 male) patients enrolled into out-patient clinics in 8 (2 hospitals and 6 primary care centers) health facilities in Moshi Urban and Rombo districts in northern Tanzania. The study explored on knowledge, attitudes and acceptability of PITC, perceived benefits and barriers of PITC, and ethical issues related to PITC. Interviews were audio taped, transcribed, translated, and analyzed using Non-numerical Unstructured Data Indexing and Theorizing (NUDIST) software. Knowledge about PITC services was generally low. Compared to men, women had a more positive attitude towards PITC services, because of its ability to identify and treat undiagnosed HIV cases. HIV stigma was regarded as a major barrier to patients' uptake of PITC. Institutional factors such as lack of supplies and human resources were identified as barriers to successful provision of PITC. In conclusion, the findings highlight both opportunities and potential barriers in the successful uptake of PITC, and underscore the importance of informed consent, counseling and confidentiality and the need for specific strategies on advocacy for the service.

  19. "Every method seems to have its problems"- Perspectives on side effects of hormonal contraceptives in Morogoro Region, Tanzania.

    Science.gov (United States)

    Chebet, Joy J; McMahon, Shannon A; Greenspan, Jesse A; Mosha, Idda H; Callaghan-Koru, Jennifer A; Killewo, Japhet; Baqui, Abdullah H; Winch, Peter J

    2015-11-03

    Family planning has been shown to be an effective intervention for promoting maternal, newborn and child health. Despite family planning's multiple benefits, women's experiences of - or concerns related to - side effects present a formidable barrier to the sustained use of contraceptives, particularly in the postpartum period. This paper presents perspectives of postpartum, rural, Tanzanian women, their partners, public opinion leaders and community and health facility providers related to side effects associated with contraceptive use. Qualitative interviews were conducted with postpartum women (n = 34), their partners (n = 23), community leaders (n = 12) and health providers based in both facilities (n = 12) and communities (n = 19) across Morogoro Region, Tanzania. Following data collection, digitally recorded data were transcribed, translated and coded using thematic analysis. Respondents described family planning positively due to the health and economic benefits associated with limiting and spacing births. However, side effects were consistently cited as a reason that women and their partners choose to forgo family planning altogether, discontinue methods, switch methods or use methods in an intermittent (and ineffective) manner. Respondents detailed side effects including excessive menstrual bleeding, missed menses, weight gain and fatigue. Women, their partners and community leaders also described concerns that contraceptives could induce sterility in women, or harm breastfeeding children via contamination of breast milk. Use of family planning during the postpartum period was viewed as particularly detrimental to a newborn's health in the first months of life. To meet Tanzania's national target of increasing contraceptive use from 34 to 60 % by 2015, appropriate counseling and dialogue on contraceptive side effects that speaks to pressing concerns outlined by women, their partners, communities and service providers are needed.

  20. Assessing healthcare providers' knowledge and practices relating to insecticide-treated nets and the prevention of malaria in Ghana, Laos, Senegal and Tanzania

    Directory of Open Access Journals (Sweden)

    Hoffman Steven J

    2011-12-01

    Full Text Available Abstract Background Research evidence is not always being disseminated to healthcare providers who need it to inform their clinical practice. This can result in the provision of ineffective services and an inefficient use of resources, the implications of which might be felt particularly acutely in low- and middle-income countries. Malaria prevention is a particularly compelling domain to study evidence/practice gaps given the proven efficacy, cost-effectiveness and disappointing utilization of insecticide-treated nets (ITNs. Methods This study compares what is known about ITNs to the related knowledge and practices of healthcare providers in four low- and middle-income countries. A new questionnaire was developed, pilot tested, translated and administered to 497 healthcare providers in Ghana (140, Laos (136, Senegal (100 and Tanzania (121. Ten questions tested participants' knowledge and clinical practice related to malaria prevention. Additional questions addressed their individual characteristics, working context and research-related activities. Ordinal logistic regressions with knowledge and practices as the dependent variable were conducted in addition to descriptive statistics. Results The survey achieved a 75% response rate (372/497 across Ghana (107/140, Laos (136/136, Senegal (51/100 and Tanzania (78/121. Few participating healthcare providers correctly answered all five knowledge questions about ITNs (13% or self-reported performing all five clinical practices according to established evidence (2%. Statistically significant factors associated with higher knowledge within each country included: 1 training in acquiring systematic reviews through the Cochrane Library (OR 2.48, 95% CI 1.30-4.73; and 2 ability to read and write English well or very well (OR 1.69, 95% CI 1.05-2.70. Statistically significant factors associated with better clinical practices within each country include: 1 reading scientific journals from their own country (OR

  1. Performance and self-perceived competencies of enrolled nurse/midwives: a mixed methods study from rural Tanzania.

    Science.gov (United States)

    Tarimo, Edith A M; Moyo, Gustav; Masenga, Happy; Magesa, Paul; Mzava, Dafroza

    2018-04-11

    Tanzania is experiencing a severe shortage of human resources for health, which poses a serious threat to the quality of health care services particularly in rural areas. Task shifting has been considered a way to address this problem. However, since a large percentage of health care providers in rural setting is comprised of Enrolled Nurse/Midwives (ENMs), most of the health care tasks are shifted to them. This article analyzes the performance and self-perceived competencies of ENMs at the dispensary level; the lowest health facility in Tanzania. Performance refers to routine duties performed by ENMs, and self-perceived competence means self-perceived proficiency in performing nursing/midwifery and medical duties. This was a mixed methods study conducted in rural Tanzania. A purposeful sample of twelve (12) informants (six ENMs; two Community Leaders [CLs] and four Dispensary In-charges [DIs]) was recruited for semi-structured interviews. The interviews were supplemented with quantitative data from 59 ENMs. Both thematic and descriptive analysis approaches were used. Three themes emerged: (1) 'Approval of the performances of ENMs in meeting community health needs' underscores important services the community members got from ENMs at dispensaries. (2) 'Experienced difficulties of meeting community health needs' indicate the problems ENMs encountered while providing services to the community. In striving to serve a large number of demanding clients without adequate medical equipment and supplies, sometimes the ENMs ended up with prescription errors (3) 'Appreciating the performances and competencies of ENMs' shows the acknowledgement of community members towards ENMs' performance and competencies within and beyond their scope of practice. The community members as well as ENMs and their supervisors knew that ENMs must sometimes provide care that is outside their scope of training and competency. Overall, the performance among ENMs above 38 years of age (P

  2. Provider perspectives on PrEP for adolescent girls and young women in Tanzania: The role of provider biases and quality of care.

    Directory of Open Access Journals (Sweden)

    Nanlesta Pilgrim

    Full Text Available Oral pre-exposure prophylaxis (PrEP has the potential to reduce HIV acquisition among adolescent girls and young women (AGYW in sub-Saharan Africa. However, health care providers' (HCPs perspectives and interactions with potential clients can substantially influence effective provision of quality health services. We examine if HCPs' knowledge, attitude, and skills, as well as their perceptions of facility readiness to provide PrEP are associated with their willingness to provide PrEP to AGYW at high risk of HIV in Tanzania.A self-administered questionnaire was given to 316 HCPs from 74 clinics in two districts and 24 HCPs participated in follow-up in-depth interviews (IDIs. We conducted bivariate and multivariable Poisson regression to assess factors associated with willingness to provide PrEP to AGYW. Thematic content analysis was used to analyze the IDIs, which expanded upon the quantitative results.Few HCPs (3.5% had prior PrEP knowledge, but once informed, 61.1% were willing to prescribe PrEP to AGYW. Higher negative attitudes toward adolescent sexuality and greater concerns about behavioral disinhibition due to PrEP use were associated with lower willingness to prescribe PrEP. Qualitatively, HCPs acknowledged that biases, rooted in cultural norms, often result in stigmatizing and discriminatory care toward AGYW, a potential barrier for PrEP provision. However, better training to provide HIV services was associated with greater willingness to prescribe PrEP. Conversely, HCPs feared the potential negative impact of PrEP on the provision of existing HIV services (e.g., overburdened staff, and suggested the integration of PrEP into non-HIV services and the use of paramedical professionals to facilitate PrEP provision.Preparing for PrEP introduction requires more than solely training HCPs on the clinical aspects of providing PrEP. It requires a two-pronged strategy: addressing HCPs' biases regarding sexual health services to AGYW; and preparing

  3. Maternal and newborn healthcare providers in rural Tanzania: in-depth interviews exploring influences on motivation, performance and job satisfaction.

    Science.gov (United States)

    Prytherch, H; Kakoko, D C V; Leshabari, M T; Sauerborn, R; Marx, M

    2012-01-01

    Major improvements in maternal and neonatal health (MNH) remain elusive in Tanzania. The causes are closely related to the health system and overall human resource policy. Just 35% of the required workforce is actually in place and 43% of available staff consists of lower-level cadres such as auxiliaries. Staff motivation is also a challenge. In rural areas the problems of recruiting and retaining health staff are most pronounced. Yet, it is here that the majority of the population continues to reside. A detailed understanding of the influences on the motivation, performance and job satisfaction of providers at rural, primary level facilities was sought to inform a research project in its early stages. The providers approached were those found to be delivering MNH care on the ground, and thus include auxiliary staff. Much of the previous work on motivation has focused on defined professional groups such as physicians and nurses. While attention has recently broadened to also include mid-level providers, the views of auxiliary health workers have seldom been explored. In-depth interviews were the methodology of choice. An interview guideline was prepared with the involvement of Tanzanian psychologists, sociologists and health professionals to ensure the instrument was rooted in the socio-cultural setting of its application. Interviews were conducted with 25 MNH providers, 8 facility and district managers, and 2 policy-makers. Key sources of encouragement for all the types of respondents included community appreciation, perceived government and development partner support for MNH, and on-the-job learning. Discouragements were overwhelmingly financial in nature, but also included facility understaffing and the resulting workload, malfunction of the promotion system as well as health and safety, and security issues. Low-level cadres were found to be particularly discouraged. Difficulties and weaknesses in the management of rural facilities were revealed. Basic steps

  4. “Experiences with disclosure of HIV-positive status to the infected child”: Perspectives of healthcare providers in Dar es Salaam, Tanzania

    Directory of Open Access Journals (Sweden)

    Adellah Sariah

    2016-10-01

    Full Text Available Abstract Background The specific age to which an HIV infected child can be disclosed to is stipulated to begin between ages 4 and 6 years. It has also been documented that before disclosure of HIV positive status to the infected child. Health care providers should consider children’s cognitive-developmental ability. However, observation and situation analysis show that, health care providers still feel uncomfortable disclosing the HIV positive status to the infected child. The aim of the study was to explore healthcare providers’ experiences in disclosure of HIV-positive status to the infected child. Methods A qualitative study involving 20 health care providers who attend HIV-positive children was conducted in September, 2014 in Dar es Salaam, Tanzania. Participants were selected from ten HIV care and treatment clinics (CTC by purposive sampling. An interview guide, translated into participants’ national language (Kiswahili was used during in-depth interviews. Sampling followed the principle of data saturation. The interviews focused on perspectives of health-care providers regarding their experience with paediatric HIV disclosure. Data from in-depth interviews were transcribed into text; data analysis followed qualitative content analysis. Results The results show how complex the process of disclosure to children living with HIV can be to healthcare providers. Confusion was noted among healthcare providers about their role and responsibility in the process of disclosing to the HIV infected child. This was reported to be largely due to unclear guidelines and lack of standardized training in paediatric HIV disclosure. Furthermore, healthcare providers were concerned about parental hesitancy to disclose early to the child due to lack of disclosure skills and fear of stigma. In order to improve the disclosure process in HIV infected children, healthcare providers recommended further standardized training on paediatric HIV disclosure with

  5. Bioenergy options. Multidisciplinary participatory method for assessing bioenergy options for rural villages in Tanzania

    Energy Technology Data Exchange (ETDEWEB)

    Kauzeni, A S; Masao, H P; Sawe, E N; Shechambo, F C [Dar Es Salaam Univ. (Tanzania). Inst. of Resource Assessment; Ellegaard, A [Stockholm Environment Inst. (Sweden)

    1999-12-31

    In Tanzania, like in many other developing countries in Southern and Eastern Africa, bioenergy planning has received relatively little attention, compared to planning for `modern` energy sources, although it accounts for about 90% of the country`s energy supply. As a result there is less understanding of the complexity and diversity of bioenergy systems. There is a lack of reliable data and information on bio-resources, their consumption and interaction with social, economic, institutional and environmental factors. This is largely due to lack of adequately developed and easily understood methods of data and information development, analysis and methods of evaluating available bioenergy options. In order to address the above constraints a project was initiated where the general objective was to develop and test a multi-disciplinary research method for identifying bioenergy options that can contribute to satisfying the energy needs of the rural household, agricultural and small scale industrial sectors, promote growth and facilitate sustainable development. The decision on the development and testing of a multidisciplinary research method was based on the fact that in Tanzania several bioenergy programmes have been introduced e.g. tree planting, improved cookstoves, biogas, improved charcoal making kilns etc. for various purposes including combating deforestation; promoting economic growth, substitution of imported petroleum fuels, health improvement, and raising standards of living. However efforts made in introducing these programmes or interventions have met with limited success. This situation prevails because developed bioenergy technologies are not being adopted in adequate numbers by the target groups. There are some indications from the study that some of the real barriers to effective bioenergy interventions or adoption of bioenergy technologies lie at the policy level and not at the project level. After the development and testing of the methodology

  6. Bioenergy options. Multidisciplinary participatory method for assessing bioenergy options for rural villages in Tanzania

    Energy Technology Data Exchange (ETDEWEB)

    Kauzeni, A.S.; Masao, H.P.; Sawe, E.N.; Shechambo, F.C. [Dar Es Salaam Univ. (Tanzania). Inst. of Resource Assessment; Ellegaard, A. [Stockholm Environment Inst. (Sweden)

    1998-12-31

    In Tanzania, like in many other developing countries in Southern and Eastern Africa, bioenergy planning has received relatively little attention, compared to planning for `modern` energy sources, although it accounts for about 90% of the country`s energy supply. As a result there is less understanding of the complexity and diversity of bioenergy systems. There is a lack of reliable data and information on bio-resources, their consumption and interaction with social, economic, institutional and environmental factors. This is largely due to lack of adequately developed and easily understood methods of data and information development, analysis and methods of evaluating available bioenergy options. In order to address the above constraints a project was initiated where the general objective was to develop and test a multi-disciplinary research method for identifying bioenergy options that can contribute to satisfying the energy needs of the rural household, agricultural and small scale industrial sectors, promote growth and facilitate sustainable development. The decision on the development and testing of a multidisciplinary research method was based on the fact that in Tanzania several bioenergy programmes have been introduced e.g. tree planting, improved cookstoves, biogas, improved charcoal making kilns etc. for various purposes including combating deforestation; promoting economic growth, substitution of imported petroleum fuels, health improvement, and raising standards of living. However efforts made in introducing these programmes or interventions have met with limited success. This situation prevails because developed bioenergy technologies are not being adopted in adequate numbers by the target groups. There are some indications from the study that some of the real barriers to effective bioenergy interventions or adoption of bioenergy technologies lie at the policy level and not at the project level. After the development and testing of the methodology

  7. AgriSense-STARS: Advancing Methods of Agricultural Monitoring for Food Security in Smallholder Regions - the Case for Tanzania

    Science.gov (United States)

    Dempewolf, J.; Becker-Reshef, I.; Nakalembe, C. L.; Tumbo, S.; Maurice, S.; Mbilinyi, B.; Ntikha, O.; Hansen, M.; Justice, C. J.; Adusei, B.; Kongo, V.

    2015-12-01

    In-season monitoring of crop conditions provides critical information for agricultural policy and decision making and most importantly for food security planning and management. Nationwide agricultural monitoring in countries dominated by smallholder farming systems, generally relies on extensive networks of field data collectors. In Tanzania, extension agents make up this network and report on conditions across the country, approaching a "near-census". Data is collected on paper which is resource and time intensive, as well as prone to errors. Data quality is ambiguous and there is a general lack of clear and functional feedback loops between farmers, extension agents, analysts and decision makers. Moreover, the data are not spatially explicit, limiting the usefulness for analysis and quality of policy outcomes. Despite significant advances in remote sensing and information communication technologies (ICT) for monitoring agriculture, the full potential of these new tools is yet to be realized in Tanzania. Their use is constrained by the lack of resources, skills and infrastructure to access and process these data. The use of ICT technologies for data collection, processing and analysis is equally limited. The AgriSense-STARS project is developing and testing a system for national-scale in-season monitoring of smallholder agriculture using a combination of three main tools, 1) GLAM-East Africa, an automated MODIS satellite image processing system, 2) field data collection using GeoODK and unmanned aerial vehicles (UAVs), and 3) the Tanzania Crop Monitor, a collaborative online portal for data management and reporting. These tools are developed and applied in Tanzania through the National Food Security Division of the Ministry of Agriculture, Food Security and Cooperatives (MAFC) within a statistically representative sampling framework (area frame) that ensures data quality, representability and resource efficiency.

  8. The Challenges of Providing Postpartum Education in Dar es Salaam, Tanzania: Narratives of Nurse-Midwives and Obstetricians.

    Science.gov (United States)

    Mselle, Lilian Teddy; Aston, Megan; Kohi, Thecla W; Mbekenga, Columba; Macdonald, Danielle; White, Maureen; Price, Sheri; Tomblin Murphy, Gail; O'Hearn, Shawna; Jefferies, Keisha

    2017-10-01

    Postpartum education can save lives of mothers and babies in developing countries, and the World Health Organization recommends all mothers receive three postpartum consultations. More information is needed to better understand how postpartum education is delivered and ultimately improves postpartum health outcomes. The purpose of this qualitative study was to examine how postpartum care was delivered in three postnatal hospital clinics in Dar es Salaam, Tanzania. Semistructured interviews with 10 nurse-midwives and three obstetricians were conducted. Feminist poststructuralism guided the research process. Postpartum education was seen to be an urgent matter; there was a lack of supportive resources and infrastructure in the hospital clinics, and nurse-midwives and obstetricians had to negotiate conflicting health and traditional discourses using various strategies. Nurse-midwives and obstetricians are well positioned to deliver life-saving postpartum education; however, improvements are required including increased number of nurse-midwives and obstetricians.

  9. Job satisfaction and turnover intentions among health care staff providing services for prevention of mother-to-child transmission of HIV in Dar es Salaam, Tanzania.

    Science.gov (United States)

    Naburi, Helga; Mujinja, Phares; Kilewo, Charles; Orsini, Nicola; Bärnighausen, Till; Manji, Karim; Biberfeld, Gunnel; Sando, David; Geldsetzer, Pascal; Chalamila, Guerino; Ekström, Anna Mia

    2017-09-06

    Option B+ for the prevention of mother-to-child transmission (PMTCT) of HIV (i.e., lifelong antiretroviral treatment for all pregnant and breastfeeding mothers living with HIV) was initiated in Tanzania in 2013. While there is evidence that this policy has benefits for the health of the mother and the child, Option B+ may also increase the workload for health care providers in resource-constrained settings, possibly leading to job dissatisfaction and unwanted workforce turnover. From March to April 2014, a questionnaire asking about job satisfaction and turnover intentions was administered to all nurses at 36 public-sector health facilities offering antenatal and PMTCT services in Dar es Salaam, Tanzania. Multivariable logistic regression models were used to identify factors associated with job dissatisfaction and intention to quit one's job. Slightly over half (54%, 114/213) of the providers were dissatisfied with their current job, and 35% (74/213) intended to leave their job. Most of the providers were dissatisfied with low salaries and high workload, but satisfied with workplace harmony and being able to follow their moral values. The odds of reporting to be globally dissatisfied with one's job were high if the provider was dissatisfied with salary (adjusted odds ratio (aOR) 5.6, 95% CI 1.2-26.8), availability of protective gear (aOR 4.0, 95% CI 1.5-10.6), job description (aOR 4.3, 95% CI 1.2-14.7), and working hours (aOR 3.2, 95% CI 1.3-7.6). Perceiving clients to prefer PMTCT Option B+ reduced job dissatisfaction (aOR 0.2, 95% CI 0.1-0.8). The following factors were associated with providers' intention to leave their current job: job stability dissatisfaction (aOR 3.7, 95% CI 1.3-10.5), not being recognized by one's superior (aOR 3.6, 95% CI 1.7-7.6), and poor feedback on the overall unit performance (aOR 2.7, 95% CI 1.3-5.8). Job dissatisfaction and turnover intentions are comparatively high among nurses in Dar es Salaam's public-sector maternal care

  10. Evaluation of a Smartphone-Based Training Strategy Among Health Care Workers Screening for Cervical Cancer in Northern Tanzania: The Kilimanjaro Method

    Science.gov (United States)

    Sleeth, Jessica; Hopman, Wilma; Ginsburg, Ophira; Heus, Katharine; Andrews, Linda; Giattas, Mary Rose; Yuma, Safina; Macheku, Godwin; Msuya, Aziz; Oneko, Olola

    2016-01-01

    Purpose Almost nine of 10 deaths resulting from cervical cancer occur in low-income countries. Visual inspection under acetic acid (VIA) is an evidence-based, cost-effective approach to cervical cancer screening (CCS), but challenges to effective implementation include health provider training costs, provider turnover, and skills retention. We hypothesized that a smartphone camera and use of cervical image transfer for real-time mentorship by experts located distantly across a closed user group through a commercially available smartphone application would be both feasible and effective in enhancing VIA skills among CCS providers in Tanzania. Methods We trained five nonphysician providers in semirural Tanzania to perform VIA enhanced by smartphone cervicography with real-time trainee support from regional experts. Deidentified images were sent through a free smartphone application on the available mobile telephone networks. Our primary outcomes were feasibility of using a smartphone camera to perform smartphone-enhanced VIA and level of agreement in diagnosis between the trainee and expert reviewer over time. Results Trainees screened 1,072 eligible women using our methodology. Within 1 month of training, the agreement rate between trainees and expert reviewers was 96.8%. Providers received a response from expert reviewers within 1 to 5 minutes 48.4% of the time, and more than 60% of the time, feedback was provided by regional expert reviewers in less than 10 minutes. Conclusion Our method was found to be feasible and effective in increasing health care workers’ skills and accuracy. This method holds promise for improved quality of VIA-based CCS programs among health care providers in low-income countries. PMID:28717721

  11. Evaluating the impact of continuous quality improvement methods at hospitals in Tanzania: a cluster-randomized trial.

    Science.gov (United States)

    Kamiya, Yusuke; Ishijma, Hisahiro; Hagiwara, Akiko; Takahashi, Shizu; Ngonyani, Henook A M; Samky, Eleuter

    2017-02-01

    To evaluate the impact of implementing continuous quality improvement (CQI) methods on patient's experiences and satisfaction in Tanzania. Cluster-randomized trial, which randomly allocated district-level hospitals into treatment group and control group, was conducted. Sixteen district-level hospitals in Kilimanjaro and Manyara regions of Tanzania. Outpatient exit surveys targeting totally 3292 individuals, 1688 in the treatment and 1604 in the control group, from 3 time-points between September 2011 and September 2012. Implementation of the 5S (Sort, Set, Shine, Standardize, Sustain) approach as a CQI method at outpatient departments over 12 months. Cleanliness, waiting time, patient's experience, patient's satisfaction. The 5S increased cleanliness in the outpatient department, patients' subjective waiting time and overall satisfaction. However, negligible effects were confirmed for patient's experiences on hospital staff behaviours. The 5S as a CQI method is effective in enhancing hospital environment and service delivery; that are subjectively assessed by outpatients even during the short intervention period. Nevertheless, continuous efforts will be needed to connect CQI practices with the further improvement in the delivery of quality health care. © The Author 2016. Published by Oxford University Press in association with the International Society for Quality in Health Care. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

  12. Motivation and incentives of rural maternal and neonatal health care providers: a comparison of qualitative findings from Burkina Faso, Ghana and Tanzania.

    Science.gov (United States)

    Prytherch, Helen; Kagoné, Moubassira; Aninanya, Gifty A; Williams, John E; Kakoko, Deodatus C V; Leshabari, Melkidezek T; Yé, Maurice; Marx, Michael; Sauerborn, Rainer

    2013-04-25

    In Burkina Faso, Ghana and Tanzania strong efforts are being made to improve the quality of maternal and neonatal health (MNH) care. However, progress is impeded by challenges, especially in the area of human resources. All three countries are striving not only to scale up the number of available health staff, but also to improve performance by raising skill levels and enhancing provider motivation. In-depth interviews were used to explore MNH provider views about motivation and incentives at primary care level in rural Burkina Faso, Ghana and Tanzania. Interviews were held with 25 MNH providers, 8 facility and district managers, and 2 policy-makers in each country. Across the three countries some differences were found in the reasons why people became health workers. Commitment to remaining a health worker was generally high. The readiness to remain at a rural facility was far less, although in all settings there were some providers that were willing to stay. In Burkina Faso it appeared to be particularly difficult to recruit female MNH providers to rural areas. There were indications that MNH providers in all the settings sometimes failed to treat their patients well. This was shown to be interlinked with differences in how the term 'motivation' was understood, and in the views held about remuneration and the status of rural health work. Job satisfaction was shown to be quite high, and was particularly linked to community appreciation. With some important exceptions, there was a strong level of agreement regarding the financial and non-financial incentives that were suggested by these providers, but there were clear country preferences as to whether incentives should be for individuals or teams. Understandings of the terms and concepts pertaining to motivation differed between the three countries. The findings from Burkina Faso underline the importance of gender-sensitive health workforce planning. The training that all levels of MNH providers receive in

  13. Assessing healthcare providers' knowledge and practices relating to insecticide-treated nets and the prevention of malaria in Ghana, Laos, Senegal and Tanzania.

    Science.gov (United States)

    Hoffman, Steven J; Guindon, G Emmanuel; Lavis, John N; Ndossi, Godwin D; Osei, Eric J A; Sidibe, Mintou Fall; Boupha, Boungnong

    2011-12-13

    Research evidence is not always being disseminated to healthcare providers who need it to inform their clinical practice. This can result in the provision of ineffective services and an inefficient use of resources, the implications of which might be felt particularly acutely in low- and middle-income countries. Malaria prevention is a particularly compelling domain to study evidence/practice gaps given the proven efficacy, cost-effectiveness and disappointing utilization of insecticide-treated nets (ITNs). This study compares what is known about ITNs to the related knowledge and practices of healthcare providers in four low- and middle-income countries. A new questionnaire was developed, pilot tested, translated and administered to 497 healthcare providers in Ghana (140), Laos (136), Senegal (100) and Tanzania (121). Ten questions tested participants' knowledge and clinical practice related to malaria prevention. Additional questions addressed their individual characteristics, working context and research-related activities. Ordinal logistic regressions with knowledge and practices as the dependent variable were conducted in addition to descriptive statistics. The survey achieved a 75% response rate (372/497) across Ghana (107/140), Laos (136/136), Senegal (51/100) and Tanzania (78/121). Few participating healthcare providers correctly answered all five knowledge questions about ITNs (13%) or self-reported performing all five clinical practices according to established evidence (2%). Statistically significant factors associated with higher knowledge within each country included: 1) training in acquiring systematic reviews through the Cochrane Library (OR 2.48, 95% CI 1.30-4.73); and 2) ability to read and write English well or very well (OR 1.69, 95% CI 1.05-2.70). Statistically significant factors associated with better clinical practices within each country include: 1) reading scientific journals from their own country (OR 1.67, 95% CI 1.10-2.54); 2) working

  14. Is Development Assistance for Health fungible? Findings from a mixed methods case study in Tanzania.

    Science.gov (United States)

    Martínez Álvarez, Melisa; Borghi, Josephine; Acharya, Arnab; Vassall, Anna

    2016-06-01

    The amount of Development Assistance for Health (DAH) available to low- and middle-income countries has increased exponentially over the past decade. However, there are concerns that DAH increases have not resulted in increased spending on health at the country level. This is because DAH may be fungible, resulting from the recipient government decreasing its contribution to the health sector as a result of external funding. The aim of this research is to assess whether DAH funds in Tanzania are fungible, by exploring government substitution of its own resources across sectors and within the health sector. A database containing 28140 projects of DAH expenditure between 2000 and 2010 was compiled from the Organisation for Economic Co-operation and Development's Creditor Reporting System (OECD-CRS) and AidData databases. Government health expenditure data for the same period were obtained from the Government of Tanzania, World Bank, public expenditure reviews and budget speeches and analysed to assess the degree of government substitution. 22 semi-structured interviews were conducted with Development Partners (DPs), government and non-government stakeholders between April and June 2012 to explore stakeholder perceptions of fungibility. We found some evidence of substitution of government funds at the health sector and sub-sector levels and two mechanisms through which it takes place: the resource allocation process and macro-economic factors. We found fungibility of external funds may not necessarily be detrimental to Tanzania's development (as evidence suggests the funds displaced may be reallocated to education) and the mechanisms used by DPs to prevent substitution were largely ineffective. We recommend DPs engage more effectively in the priority-setting process, not just with the Ministry of Health and Social Welfare (MoHSW), but also with the Ministry of Finance, to agree on priorities and mutual funding responsibilities at a macroeconomic level. We also call for

  15. Supply-related drivers of staff motivation for providing intermittent preventive treatment of malaria during pregnancy in Tanzania: evidence from two rural districts

    Directory of Open Access Journals (Sweden)

    Mubyazi Godfrey M

    2012-02-01

    Full Text Available Abstract Background Since its introduction in the national antenatal care (ANC system in Tanzania in 2001, little evidence is documented regarding the motivation and performance of health workers (HWs in the provision of intermittent preventive treatment of malaria during pregnancy (IPTp services in the national ANC clinics and the implications such motivation and performance might have had on HWs and services' compliance with the recommended IPTp delivery guidelines. This paper describes the supply-related drivers of motivation and performance of HWs in administering IPTp doses among other ANC services delivered in public and private health facilities (HFs in Tanzania, using a case study of Mkuranga and Mufindi districts. Methods Interviews were conducted with 78 HWs participating in the delivery of ANC services in private and public HFs and were supplemented by personal communications with the members of the district council health management team. The research instrument used in the data collection process contained a mixture of closed and open-ended questions. Some of the open-ended questions had to be coded in the form that allowed their analysis quantitatively. Results In both districts, respondents acknowledged IPTp as an essential intervention, but expressed dissatisfaction with their working environments constraining their performance, including health facility (HF unit understaffing; unsystematic and unfriendly supervision by CHMT members; limited opportunities for HW career development; and poor (HF infrastructure and staff houses. Data also suggest that poor working conditions negatively affect health workers' motivation to perform for ANC (including IPTp services. Similarities and differences were noted in terms of motivational factors for ANC service delivery between the HWs employed in private HFs and those in public HFs: those in private facilities were more comfortable with staff residential houses, HF buildings, equipment

  16. Supply-related drivers of staff motivation for providing intermittent preventive treatment of malaria during pregnancy in Tanzania: evidence from two rural districts

    Science.gov (United States)

    2012-01-01

    Background Since its introduction in the national antenatal care (ANC) system in Tanzania in 2001, little evidence is documented regarding the motivation and performance of health workers (HWs) in the provision of intermittent preventive treatment of malaria during pregnancy (IPTp) services in the national ANC clinics and the implications such motivation and performance might have had on HWs and services' compliance with the recommended IPTp delivery guidelines. This paper describes the supply-related drivers of motivation and performance of HWs in administering IPTp doses among other ANC services delivered in public and private health facilities (HFs) in Tanzania, using a case study of Mkuranga and Mufindi districts. Methods Interviews were conducted with 78 HWs participating in the delivery of ANC services in private and public HFs and were supplemented by personal communications with the members of the district council health management team. The research instrument used in the data collection process contained a mixture of closed and open-ended questions. Some of the open-ended questions had to be coded in the form that allowed their analysis quantitatively. Results In both districts, respondents acknowledged IPTp as an essential intervention, but expressed dissatisfaction with their working environments constraining their performance, including health facility (HF) unit understaffing; unsystematic and unfriendly supervision by CHMT members; limited opportunities for HW career development; and poor (HF) infrastructure and staff houses. Data also suggest that poor working conditions negatively affect health workers' motivation to perform for ANC (including IPTp) services. Similarities and differences were noted in terms of motivational factors for ANC service delivery between the HWs employed in private HFs and those in public HFs: those in private facilities were more comfortable with staff residential houses, HF buildings, equipment, availability of water

  17. The challenges of developing an instrument to assess health provider motivation at primary care level in rural Burkina Faso, Ghana, and Tanzania

    Directory of Open Access Journals (Sweden)

    Helen Prytherch

    2012-10-01

    Full Text Available Background: The quality of health care depends on the competence and motivation of the health workers that provide it. In the West, several tools exist to measure worker motivation, and some have been applied to the health sector. However, none have been validated for use in sub-Saharan Africa. The complexity of such tools has also led to concerns about their application at primary care level. Objective: To develop a common instrument to monitor any changes in maternal and neonatal health (MNH care provider motivation resulting from the introduction of pilot interventions in rural, primary level facilities in Ghana, Burkina Faso, and Tanzania. Design: Initially, a conceptual framework was developed. Based upon this, a literature review and preliminary qualitative research, an English-language instrument was developed and validated in an iterative process with experts from the three countries involved. The instrument was then piloted in Ghana. Reliability testing and exploratory factor analysis were used to produce a final, parsimonious version. Results and discussion: This paper describes the actual process of developing the instrument. Consequently, the concepts and items that did not perform well psychometrically at pre-test are first presented and discussed. The final version of the instrument, which comprises 42 items for self-assessment and eight for peer-assessment, is then shown. This is followed by a presentation and discussion of the findings from first use of the instrument with MNH providers from 12 rural, primary level facilities in each of the three countries. Conclusions: It is possible to undertake work of this nature at primary health care level, particularly if the instruments are kept as straightforward as possible and well introduced. However, their development requires very lengthy preparatory periods. The effort needed to adapt such instruments for use in different countries within the region of sub-Saharan Africa should not

  18. The challenges of developing an instrument to assess health provider motivation at primary care level in rural Burkina Faso, Ghana and Tanzania

    Science.gov (United States)

    Prytherch, Helen; Leshabari, Melkidezek T.; Wiskow, Christiane; Aninanya, Gifty A.; Kakoko, Deodatus C.V.; Kagoné, Moubassira; Burghardt, Juliane; Kynast-Wolf, Gisela; Marx, Michael; Sauerborn, Rainer

    2012-01-01

    Background The quality of health care depends on the competence and motivation of the health workers that provide it. In the West, several tools exist to measure worker motivation, and some have been applied to the health sector. However, none have been validated for use in sub-Saharan Africa. The complexity of such tools has also led to concerns about their application at primary care level. Objective To develop a common instrument to monitor any changes in maternal and neonatal health (MNH) care provider motivation resulting from the introduction of pilot interventions in rural, primary level facilities in Ghana, Burkina Faso, and Tanzania. Design Initially, a conceptual framework was developed. Based upon this, a literature review and preliminary qualitative research, an English-language instrument was developed and validated in an iterative process with experts from the three countries involved. The instrument was then piloted in Ghana. Reliability testing and exploratory factor analysis were used to produce a final, parsimonious version. Results and discussion This paper describes the actual process of developing the instrument. Consequently, the concepts and items that did not perform well psychometrically at pre-test are first presented and discussed. The final version of the instrument, which comprises 42 items for self-assessment and eight for peer-assessment, is then shown. This is followed by a presentation and discussion of the findings from first use of the instrument with MNH providers from 12 rural, primary level facilities in each of the three countries. Conclusions It is possible to undertake work of this nature at primary health care level, particularly if the instruments are kept as straightforward as possible and well introduced. However, their development requires very lengthy preparatory periods. The effort needed to adapt such instruments for use in different countries within the region of sub-Saharan Africa should not be underestimated. PMID

  19. Antiproliferation effects of selected Tanzania plants | Choi | African ...

    African Journals Online (AJOL)

    Background: Plants still remain a prime source of drugs for the treatment of cancer and can provide leads for the development of novel anticancer agents. Our screening of indigenous medicinal plants from Tanzania has led to the identification of the number of anticancer activity. Material and methods: The current study ...

  20. Patient and provider determinants for receipt of three dimensions of respectful maternity care in Kigoma Region, Tanzania-April-July, 2016.

    Science.gov (United States)

    Dynes, M M; Twentyman, E; Kelly, L; Maro, G; Msuya, A A; Dominico, S; Chaote, P; Rusibamayila, R; Serbanescu, F

    2018-03-05

    Lack of respectful maternity care (RMC) is increasingly recognized as a human rights issue and a key deterrent to women seeking facility-based deliveries. Ensuring facility-based RMC is essential for improving maternal and neonatal health, especially in sub-Saharan African countries where mortality and non-skilled delivery care remain high. Few studies have attempted to quantitatively identify patient and delivery factors associated with RMC, and none has modeled the influence of provider characteristics on RMC. This study aims to help fill these gaps through collection and analysis of interviews linked between clients and providers, allowing for description of both patient and provider characteristics and their association with receipt of RMC. We conducted cross-sectional surveys across 61 facilities in Kigoma Region, Tanzania, from April to July 2016. Measures of RMC were developed using 21-items in a Principal Components Analysis (PCA). We conducted multilevel, mixed effects generalized linear regression analyses on matched data from 249 providers and 935 post-delivery clients. The outcomes of interest included three dimensions of RMC-Friendliness/Comfort/Attention; Information/Consent; and Non-abuse/Kindness-developed from the first three components of PCA. Significance level was set at p perception of fair pay (Perceives fair pay versus unfair pay: Coef 0.46), cadre (Nurses/midwives versus Clinicians: Coef - 0.46), and number of deliveries in the last month (11-20 versus perception of fair pay (Perceives fair pay versus unfair: Coef 0.37), weekly work hours (Coef 0.01), and age (30-39 versus 20-29 years: Coef - 0.34; 40-49 versus 20-29 years: Coef - 0.58). Significant provider-level determinants for Non-abuse/Kindness RMC included the predictors of age (age 50+ versus 20-29 years: Coef 0.34) and access to electronic mentoring (Access to two mentoring types versus none: Coef 0.37). These findings illustrate the value of including both client and

  1. The internal migration between public and faith-based health providers: a cross-sectional, retrospective and multicentre study from southern Tanzania.

    Science.gov (United States)

    Tabatabai, Patrik; Prytherch, Helen; Baumgarten, Inge; Kisanga, Oberlin M E; Schmidt-Ehry, Bergis; Marx, Michael

    2013-07-01

    To assess the magnitude, direction and underlying dynamics of internal health worker migration between public and faith-based health providers from a hospital perspective. Two complementary tools were implemented in 10 public and six faith-based hospitals in southern Tanzania. A hospital questionnaire assessed magnitude and direction of staff migration between January 2006 and June 2009. Interviews with 42 public and 20 faith-based maternity nurses evaluated differences in staff perspectives and motives for the observed migration patterns. The predominant direction of staff movement was from the faith-based to the public sector: 69.1% (n = 105/152) of hospital staff exits and 60.6% (n = 60/99) of hospital staff gains. Nurses were the largest group among the migrating health workforce. Faith-based hospitals lost 59.3% (n = 86/145) of nurses and 90.6% (n = 77/85) of registered nurses to the public sector, whereby public hospitals reported 13.5% (n = 59/436) of nurses and 24.4% (n = 41/168) of registered nurses being former faith-based employees. Interviews revealed significantly inferior staff perspectives among faith-based respondents than their public colleagues. Main differences were identified regarding career development and training, management support, employee engagement and workload. This study revealed considerable internal health worker migration from the faith-based to the public sector. Staff retention and motivation within faith-based hospitals are not restricted to financial considerations, and salary gaps can no longer uniquely explain this movement pattern. The consequences for the catchment area of faith-based hospitals are potentially severe and erode cooperation potential between the public and private health sector.

  2. Tanzania | IDRC - International Development Research Centre

    International Development Research Centre (IDRC) Digital Library (Canada)

    We have a rich history of supporting research in Tanzania, a politically stable democracy. ... importance of improving health and agriculture in order to reduce poverty. ... For more than a decade, we have provided grants that foster the capacity to ... fellowships and foster links between researchers and institutions in Tanzania ...

  3. Scaling up postabortion contraceptive service--results from a study conducted among women having unwanted pregnancies in urban and rural Tanzania

    DEFF Research Database (Denmark)

    Rasch, Vibeke; Yambesi, Fortunata; Kipingili, Rose

    2005-01-01

    Tanzania and 42% in rural Tanzania stated that their pregnancy was unwanted. Contraceptive acceptance among women with unwanted pregnancies was high; 93% in urban Tanzania and 71% in rural Tanzania left with a contraceptive method. CONCLUSION: The high proportion of women with unwanted pregnancies in urban...... and rural Tanzania underlines the need of scaling up postabortion contraceptive service....

  4. Tanzania : Productive Jobs Wanted

    OpenAIRE

    World Bank Group

    2014-01-01

    Over the past 18 months, the World Bank has been working on a comprehensive plan to address the challenge of productive jobs in Tanzania. This study represents a step towards a better understanding of how to promote job creation in Tanzania. Indeed, the growth of productive jobs is vital for alleviating poverty and promoting shared prosperity - two important goals of Tanzania's economic st...

  5. Regional Dermatology Training Centre in Moshi, Tanzania ...

    African Journals Online (AJOL)

    because, in many parts of the world, there ... Annual prizes are awarded for the student achieving the highest mark in the overall assessment ... 31 No. 7. Dermatology in Tanzania prize). A second training programme (MMed) provides 4-year.

  6. Read full report, Youth employment in Tanzania

    International Development Research Centre (IDRC) Digital Library (Canada)

    But the quality of formal education in Tanzania is poor. Less than 12 percent ... NGOs offer a broad range of services and training for youth, including fostering ..... Service workers. 20.6 ..... customer/market validation training provided by profes-.

  7. A feasibility study of an educational program on obstetric danger signs among pregnant adolescents in Tanzania: A mixed-methods study

    Directory of Open Access Journals (Sweden)

    Beatrice Mwilike

    Full Text Available Background: In Tanzania, adolescents have a high lifetime risk of dying from pregnancy and childbirth complications. Objective: To determine the feasibility of an education program in improving knowledge of obstetric danger signs and promoting appropriate healthcare-seeking behavior, as well as encouraging the development of a peer network support group. Methods: An embedded mixed-methods design was used. This research was a pilot study conducted in a health facility in rural Tanzania. Quantitative data was collected before and after the education program using questionnaires. Focus group discussion was used to collect qualitative data. Results: 15 pregnant adolescents between 15 and 19 years of age participated. Their median age was 18.0 years (SD ± 1.19, and 66.7% were ≤18 years. There was a significant increase in the scores of knowledge of danger signs during pregnancy between the pre-test (M = 7.20, SD = 2.83 and the post-test (M = 9.07, SD = 1.67; t = 2.168, p = 0.048. There was a significant strong positive correlation between the healthcare-seeking behavior score and social support score variables [r = 0.654, p = 0.008]. The education program was feasible in terms of implementation, acceptability, and demand as indicated by its >84% score. Four categories were identified from the qualitative data: “supportive family”, “rejection and abortion”, “support from peers”, and “potential barriers to seek care”. Conclusion: The development of an education program particularly on obstetric danger signs was feasible and helpful for pregnant adolescents in Tanzania. Keywords: Pregnancy, Adolescent, Obstetric danger signs, Social support, Healthcare-seeking behavior, Antenatal care

  8. Methods for providing intermediates in the synthesis of atorvastatin.

    NARCIS (Netherlands)

    Dömling, Alexander Stephan Siegfried

    2016-01-01

    The invention relates to the field of medicinal chemistry, In particular, it relates to methods for providing intermediates in the synthesis of Atorvastatin, a competitive inhibitor of HMG-Co A reductase. Provided is a process for providing a compound having a Formula (I) or a pharmaceutically

  9. Developing a Pictorial Sisterhood Method in collaboration with illiterate Maasai traditional birth attendants in northern Tanzania

    NARCIS (Netherlands)

    Roggeveen, Yadira; Schreuder, Renske; Zweekhorst, Marjolein; Manyama, Mange; Hatfield, Jennifer; Scheele, Fedde; van Roosmalen, Jos

    2016-01-01

    Objective To study whether data on maternal mortality can be gathered while maintaining local ownership of data in a pastoralist setting where a scarcity of data sources and a culture of silence around maternal death amplifies limited awareness of the magnitude of maternal mortality. Methods As part

  10. Developing a Pictorial Sisterhood Method in collaboration with illiterate Maasai traditional birth attendants in northern Tanzania.

    Science.gov (United States)

    Roggeveen, Yadira; Schreuder, Renske; Zweekhorst, Marjolein; Manyama, Mange; Hatfield, Jennifer; Scheele, Fedde; van Roosmalen, Jos

    2016-10-01

    To study whether data on maternal mortality can be gathered while maintaining local ownership of data in a pastoralist setting where a scarcity of data sources and a culture of silence around maternal death amplifies limited awareness of the magnitude of maternal mortality. As part of a participatory action research project, investigators and illiterate traditional birth attendants (TBAs) collaboratively developed a quantitative participatory tool-the Pictorial Sisterhood Method-that was pilot-tested between March 12 and May 30, 2011, by researchers and TBAs in a cross-sectional study. Fourteen TBAs interviewed 496 women (sample), which led to 2241 sister units of risk and a maternal mortality ratio of 689 deaths per 100000 live births (95% confidence interval 419-959). Researchers interviewed 474 women (sample), leading to 1487 sister units of risk and a maternal mortality ratio of 484 (95% confidence interval 172-795). The Pictorial Sisterhood Method is an innovative application that might increase the participation of illiterate individuals in maternal health research and advocacy. It offers interesting opportunities to increase maternal mortality data ownership and awareness, and warrants further study and validation. Copyright © 2016 International Federation of Gynecology and Obstetrics. Published by Elsevier Ireland Ltd. All rights reserved.

  11. Supply-related drivers of staff motivation for providing intermittent preventive treatment of malaria during pregnancy in Tanzania: evidence from two rural districts.

    Science.gov (United States)

    Mubyazi, Godfrey M; Bloch, Paul; Byskov, Jens; Magnussen, Pascal; Bygbjerg, Ib C; Hansen, Kristian S

    2012-02-18

    Since its introduction in the national antenatal care (ANC) system in Tanzania in 2001, little evidence is documented regarding the motivation and performance of health workers (HWs) in the provision of intermittent preventive treatment of malaria during pregnancy (IPTp) services in the national ANC clinics and the implications such motivation and performance might have had on HWs and services' compliance with the recommended IPTp delivery guidelines. This paper describes the supply-related drivers of motivation and performance of HWs in administering IPTp doses among other ANC services delivered in public and private health facilities (HFs) in Tanzania, using a case study of Mkuranga and Mufindi districts. Interviews were conducted with 78 HWs participating in the delivery of ANC services in private and public HFs and were supplemented by personal communications with the members of the district council health management team. The research instrument used in the data collection process contained a mixture of closed and open-ended questions. Some of the open-ended questions had to be coded in the form that allowed their analysis quantitatively. In both districts, respondents acknowledged IPTp as an essential intervention, but expressed dissatisfaction with their working environments constraining their performance, including health facility (HF) unit understaffing; unsystematic and unfriendly supervision by CHMT members; limited opportunities for HW career development; and poor (HF) infrastructure and staff houses. Data also suggest that poor working conditions negatively affect health workers' motivation to perform for ANC (including IPTp) services. Similarities and differences were noted in terms of motivational factors for ANC service delivery between the HWs employed in private HFs and those in public HFs: those in private facilities were more comfortable with staff residential houses, HF buildings, equipment, availability of water, electricity and cups for

  12. Prioritization of intervention methods for prevention of communicable diseases in Tanzania

    Science.gov (United States)

    Mayo, A. W.

    Water, sanitation, housing and hygienic behavior plays dominant role in the transmission and intensification of diseases. To effectively utilize limited financial resources, it is important to prioritize disease intervention methods in order to minimize mortality and morbidity cases. Realization of the environmental health components that respond to the practical effects of their contribution to transmission of diseases has greater chances of effectively enhancing health. Data of frequency of diseases and mortality rate were collected from four municipal hospitals from districts of Ilala, Kinondoni, Temeke and Kibaha in Dar es Salaam and Coast Regions. The populations at risk were sub-categorized in relation to age; below five years and above five years. The age parameter assists on envisaging the major causes to be either in-house or in public domain. Data were analyzed to assess the role of water quality, water quantity, excreta disposal, waste disposal and hygiene education on spreading the diseases in order to come up with scientifically evaluated information. Scores were given to each intervention method depending on its importance in controlling a particular disease. The results indicate that incidences of malaria, skin and eye infections, pneumonia and diarrhea are frequent in these districts. Children under 5 years are particularly affected by pneumonia and diarrhea more than adults. Malaria, tuberculosis and pneumonia are the major causes of mortality rates in these districts. Fatality cases are caused largely by malaria, pneumonia and diarrhea for children less than 5 years, but malaria, tuberculosis and pneumonia are responsible for mortality rates in adults and children over 5 years. Statistical analysis revealed that in all districts, hygiene education is the major factor responsible for transmission of diseases accounting for 32-39%. Other factors, which are the major contributors to the incidences of diseases, are inadequacy of water (15.6-22.5%) and

  13. Sexual practices among unmarried adolescents in Tanzania

    OpenAIRE

    Kazaura, Method R; Masatu, Melkiory C

    2009-01-01

    Abstract Background Sexual activities are increasingly changing from the cultural point of view what they used to be. Knowledge of these practices among adolescents may be a basis to create awareness among adolescents on practices that involve risks. This study aims to assess sexual practices among unmarried adolescents in Tanzania. Methods A cross-sectional survey was conducted among in-school and out-of-school but unmarried adolescents aged 10 to 19 in five locations in Tanzania. A question...

  14. The costs of providing antiretroviral therapy services to HIV-infected individuals presenting with advanced HIV disease at public health centres in Dar es Salaam, Tanzania: Findings from a randomised trial evaluating different health care strategies.

    Science.gov (United States)

    Kimaro, Godfather Dickson; Mfinanga, Sayoki; Simms, Victoria; Kivuyo, Sokoine; Bottomley, Christian; Hawkins, Neil; Harrison, Thomas S; Jaffar, Shabbar; Guinness, Lorna

    2017-01-01

    Understanding the costs associated with health care delivery strategies is essential for planning. There are few data on health service resources used by patients and their associated costs within antiretroviral (ART) programmes in Africa. The study was nested within a large trial, which evaluated screening for cryptococcal meningitis and tuberculosis and a short initial period of home-based adherence support for patients initiating ART with advanced HIV disease in Tanzania and Zambia. The economic evaluation was done in Tanzania alone. We estimated costs of providing routine ART services from the health service provider's perspective using a micro-costing approach. Incremental costs for the different novel components of service delivery were also estimated. All costs were converted into US dollars (US$) and based on 2012 prices. Of 870 individuals enrolled in Tanzania, 434 were enrolled in the intervention arm and 436 in the standard care/control arm. Overall, the median (IQR) age and CD4 cell count at enrolment were 38 [31, 44] years and 52 [20, 89] cells/mm3, respectively. The mean per patient costs over the first three months and over a one year period of follow up following ART initiation in the standard care arm were US$ 107 (95%CI 101-112) and US$ 265 (95%CI 254-275) respectively. ART drugs, clinic visits and hospital admission constituted 50%, 19%, and 19% of the total cost per patient year, while diagnostic tests and non-ART drugs (co-trimoxazole) accounted for 10% and 2% of total per patient year costs. The incremental costs of the intervention to the health service over the first three months was US$ 59 (p<0.001; 95%CI 52-67) and over a one year period was US$ 67(p<0.001; 95%CI 50-83). This is equivalent to an increase of 55% (95%CI 51%-59%) in the mean cost of care over the first three months, and 25% (95%CI 20%-30%) increase over one year of follow up.

  15. Comparison of Overnight Pooled and Standard Sputum Collection Method for Patients with Suspected Pulmonary Tuberculosis in Northern Tanzania

    Directory of Open Access Journals (Sweden)

    Stellah G. Mpagama

    2012-01-01

    Full Text Available In Tanzania sputum culture for tuberculosis (TB is resource intensive and available only at zonal facilities. In this study overnight pooled sputum collection technique was compared with standard spot morning collection among pulmonary TB suspects at Kibong’oto National TB Hospital in Tanzania. A spot sputum specimen performed at enrollment, an overnight pooled sputum, and single morning specimen were collected from 50 subjects and analyzed for quality, quantity, and time to detection in Bactec MGIT system. Forty-six (92% subjects’ overnight pooled specimens had a volume ≥5 mls compared to 37 (37% for the combination of spot and single morning specimens (P<0.001. Median time to detection was 96 hours (IQR 87–131 for the overnight pooled specimens compared to 110.5 hours (IQR is 137 right 137–180 for the combination of both spot and single morning specimens (P=0.001. In our setting of limited TB culture capacity, we recommend a single pooled sputum to maximize yield and speed time to diagnosis.

  16. Method for providing uranium with a protective copper coating

    Science.gov (United States)

    Waldrop, Forrest B.; Jones, Edward

    1981-01-01

    The present invention is directed to a method for providing uranium metal with a protective coating of copper. Uranium metal is subjected to a conventional cleaning operation wherein oxides and other surface contaminants are removed, followed by etching and pickling operations. The copper coating is provided by first electrodepositing a thin and relatively porous flash layer of copper on the uranium in a copper cyanide bath. The resulting copper-layered article is then heated in an air or inert atmosphere to volatilize and drive off the volatile material underlying the copper flash layer. After the heating step an adherent and essentially non-porous layer of copper is electro-deposited on the flash layer of copper to provide an adherent, multi-layer copper coating which is essentially impervious to corrosion by most gases.

  17. System and Method for Providing a Climate Data Persistence Service

    Science.gov (United States)

    Schnase, John L. (Inventor); Ripley, III, William David (Inventor); Duffy, Daniel Q. (Inventor); Thompson, John H. (Inventor); Strong, Savannah L. (Inventor); McInerney, Mark (Inventor); Sinno, Scott (Inventor); Tamkin, Glenn S. (Inventor); Nadeau, Denis (Inventor)

    2018-01-01

    A system, method and computer-readable storage devices for providing a climate data persistence service. A system configured to provide the service can include a climate data server that performs data and metadata storage and management functions for climate data objects, a compute-storage platform that provides the resources needed to support a climate data server, provisioning software that allows climate data server instances to be deployed as virtual climate data servers in a cloud computing environment, and a service interface, wherein persistence service capabilities are invoked by software applications running on a client device. The climate data objects can be in various formats, such as International Organization for Standards (ISO) Open Archival Information System (OAIS) Reference Model Submission Information Packages, Archive Information Packages, and Dissemination Information Packages. The climate data server can enable scalable, federated storage, management, discovery, and access, and can be tailored for particular use cases.

  18. 24 STATUS OF LIBRARY AUTOMATION IN TANZANIA'S PUBLIC ...

    African Journals Online (AJOL)

    Dr A.S. Samzugi

    universities. Kasulwa's (2008) report has mentioned the automation efforts in Tanzania, ... System (EMIS) and E-Library system for All Higher Education and Research Institutions in. Tanzania. ... Both telephone and face-to-face methods were used. ... Qualitative data collected from interviews with directors of libraries, on the.

  19. Sixty Years of Special Needs Education in Tanzania: Celebrating ...

    African Journals Online (AJOL)

    This study traces the development of special needs education in Tanzania from 1950, and discusses the achievements and the persistent challenges that Tanzania is facing as we celebrate 60 years since the first special education school was started. Both documentation and interview methods were used to collect ...

  20. Coral Reefs and Their Management in Tanzania | Wagner | Western ...

    African Journals Online (AJOL)

    management approaches and strategies implemented by various ICM programs, conservation areas and marine parks in Tanzania. It also provides recommendations for further research and coral reef management strategies. Keywords: coral reefs, threats, management, recent initiatives, Tanzania West Indian Ocean ...

  1. Method for Providing Semiconductors Having Self-Aligned Ion Implant

    Science.gov (United States)

    Neudeck, Philip G. (Inventor)

    2014-01-01

    A method is disclosed that provides a self-aligned nitrogen-implant particularly suited for a Junction Field Effect Transistor (JFET) semiconductor device preferably comprised of a silicon carbide (SiC). This self-aligned nitrogen-implant allows for the realization of durable and stable electrical functionality of high temperature transistors such as JFETs. The method implements the self-aligned nitrogen-implant having predetermined dimensions, at a particular step in the fabrication process, so that the SiC junction field effect transistors are capable of being electrically operating continuously at 500.degree. C. for over 10,000 hours in an air ambient with less than a 10% change in operational transistor parameters.

  2. Method for providing a low density high strength polyurethane foam

    Science.gov (United States)

    Whinnery, Jr., Leroy L.; Goods, Steven H.; Skala, Dawn M.; Henderson, Craig C.; Keifer, Patrick N.

    2013-06-18

    Disclosed is a method for making a polyurethane closed-cell foam material exhibiting a bulk density below 4 lbs/ft.sup.3 and high strength. The present embodiment uses the reaction product of a modified MDI and a sucrose/glycerine based polyether polyol resin wherein a small measured quantity of the polyol resin is "pre-reacted" with a larger quantity of the isocyanate in a defined ratio such that when the necessary remaining quantity of the polyol resin is added to the "pre-reacted" resin together with a tertiary amine catalyst and water as a blowing agent, the polymerization proceeds slowly enough to provide a stable foam body.

  3. Popular soap opera helps raise contraceptive use. Tanzania.

    Science.gov (United States)

    1996-01-01

    The latest Demographic and Health Surveys Report on Knowledge, Attitudes, and Practice documents an increase in the level of use of modern contraceptive methods in Tanzania between 1991 and 1994 from 5.9% to 11.3% of reproductive-age women. 53.2% of all women of reproductive age were exposed to mass media messages about family planning, which large majorities of men and women consider acceptable. 48.3% were exposed through radio, 22.9% reported listening to the US Agency for International Development-funded family planning promotional radio soap opera "Zinduka]", 22.5% read newspaper items, 17.5% saw posters, and 7.3% saw leaflets. 4.5% were visited by a family planning worker, 24.7% discussed family planning with a friend or relative, and 24.7% discussed family planning with health facility personnel. Zinduka], a popular 52-episode soap opera, depicts how the lives of Bomu wa Kabuma's family, in Msongano Town and Tawanya village in Tanzania, are affected because he is unable to provide for his eight children, parents, wife, mistress, and the mistress's child. The soap was produced with technical assistance from the Johns Hopkins University Center for Communication Programs Population Communication Services project. The 15-minute episodes were first broadcast in Swahili on Radio Tanzania from October 1993 through October 1994. The series was then resumed in September 1995 for another 12 months.

  4. Tanzania - Water Supply & Expansion

    Data.gov (United States)

    Millennium Challenge Corporation — Social Impact (SI) has been contracted by MCC to carry out an impact evaluation (IE) of the Tanzania Water Sector Project. This IE examines the effect of the WSP...

  5. Tanzania Medical Journal

    African Journals Online (AJOL)

    The journal publishes any contribution that advances medical science or ... these core objectives the journal publishes papers on original scientific research, short ... The Tanzania Medical Journal is an international Journal - ISSN: 0856-0719 ...

  6. Transcultural nursing course in Tanzania, Africa.

    Science.gov (United States)

    Owens, Rhoda

    2012-06-01

    A transcultural nursing course in Tanzania was offered in fall 2010 at Williston State College, located in North Dakota. Madeleine Leininger's Culture Care: Diversity and Universality Theory (Principles of Developing Cultural Competence) was the framework used for the experience. The course provided nursing students the opportunity to learn about the culture, health, and illness beliefs of Tanzanians; their values and practices; the prevalence of HIV/AIDS; and the differences and similarities between the healthcare systems, hospice/palliative care, and home visits in Tanzania as compared to the United States.

  7. Assessing healthcare providers' knowledge and practices relating to insecticide-treated nets and the prevention of malaria in Ghana, Laos, Senegal and Tanzania

    OpenAIRE

    Hoffman, Steven J; Guindon, G Emmanuel; Lavis, John N; Ndossi, Godwin D; Osei, Eric JA; Sidibe, Mintou Fall; Boupha, Boungnong

    2011-01-01

    Abstract Background Research evidence is not always being disseminated to healthcare providers who need it to inform their clinical practice. This can result in the provision of ineffective services and an inefficient use of resources, the implications of which might be felt particularly acutely in low- and middle-income countries. Malaria prevention is a particularly compelling domain to study evidence/practice gaps given the proven efficacy, cost-effectiveness and disappointing utilization ...

  8. Socio-economic comparison between traditional and improved cultivation methods in agroforestry systems, East Usambara Mountains, Tanzania.

    Science.gov (United States)

    Reyes, Teija; Quiroz, Roberto; Msikula, Shija

    2005-11-01

    The East Usambara Mountains, recognized as one of the 25 most important biodiversity hot spots in the world, have a high degree of species diversity and endemism that is threatened by increasing human pressure on resources. Traditional slash and burn cultivation in the area is no longer sustainable. However, it is possible to maintain land productivity, decrease land degradation, and improve rural people's livelihood by ameliorating cultivation methods. Improved agroforestry seems to be a very convincing and suitable method for buffer zones of conservation areas. Farmers could receive a reasonable net income from their farm with little investment in terms of time, capital, and labor. By increasing the diversity and production of already existing cultivations, the pressure on natural forests can be diminished. The present study shows a significant gap between traditional cultivation methods and improved agroforestry systems in socio-economic terms. Improved agroforestry systems provide approximately double income per capita in comparison to traditional methods. More intensified cash crop cultivation in the highlands of the East Usambara also results in double income compared to that in the lowlands. However, people are sensitive to risks of changing farming practices. Encouraging farmers to apply better land management and practice sustainable cultivation of cash crops in combination with multipurpose trees would be relevant in improving their economic situation in the relatively short term. The markets of most cash crops are already available. Improved agroforestry methods could ameliorate the living conditions of the local population and protect the natural reserves from human disturbance.

  9. Country programme review. United Republic of Tanzania

    International Nuclear Information System (INIS)

    Cuaron, A.; Hance, R.; Yurtsever, Y.; Maudarbocus, V.

    1992-01-01

    This document provides a review of past and present IAEA Technical Co-operation Activities in Tanzania and gives descriptions of the current status of nuclear applications in food and agriculture, human health, water resources and industrial applications/nuclear instrumentation

  10. Tanzania | Page 35 | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Researchers working in Tanzania's Morogoro and Dodoma districts have made an important discovery. By fortifying hay with cassava tops and sweet potato vines, they provided dairy goats with a cheap, protein-rich feed that enabled them to produce more milk. Read more about Better feed for animals means better food for ...

  11. CHECKLIST OF THE MILLIPEDES (DIPLOPODA) OF TANZANIA

    African Journals Online (AJOL)

    However, these many-legged animals are not insects (which have three .... Simon Stuart, who was carrying out studies on birds, contributed many specimens ... Diversity Project of November 1994 provided a series of millipede specimens. ... Tanzania records: Morogoro Region, Morogoro Rural Distr., Uluguru Mts, Lupanga.

  12. Preliminary observations of birds of Songo Songo Island, Tanzania

    African Journals Online (AJOL)

    Materials and methods ... The island rises some 10 m above sea level and is c. ... PM a. Greater Sandplover Charadrius leschenaultii. Obs. Littoral. PM a .... terrestrial birds on Pemba Island (Tanzania), with particular reference to six endemic ...

  13. Factors associated with child sexual abuse in Tanzania: a qualitative ...

    African Journals Online (AJOL)

    user

    Tanzania Journal of Health Research ... Methods: Key informant interviews were conducted among adults including parents of the ... factors for child sexual abuse, the type of perpetrators and the context into which these abuses take place.

  14. 32 CFR 199.14 - Provider reimbursement methods.

    Science.gov (United States)

    2010-07-01

    ... physicians. (6) All services provided by nurse anesthetists. (7) All services related to discharges involving... more accurate data became available. (v) No update for inflation. The children's hospital differential... considered lower volume hospitals. (B) Hospitals that subsequently become higher volume hospitals. In any...

  15. Sustainability Partnerships for the Governance of Coastal Resources in Tanzania

    DEFF Research Database (Denmark)

    Katikiro, Robert; Kweka, Opportuna; Namkesa, Faraja

    The paper examines the experience of sustainability partnerships for the management of coastal resources in Tanzania. It identifies key actors and governance dynamics, with focus on decentralization processes, legitimacy-building and participation of local communities. The paper first provides a ...... of ongoing research under the New Partnerships for Sustainability project (NEPSUS), it provides guidance on research gaps in specific relation to the Mnazi Bay Ruvuma Estuary Marine Park (MBREMP) and selected BMUs in Mtwara region, Southern Tanzania....

  16. Methodical Approaches to Communicative Providing of Retailer Branding

    Directory of Open Access Journals (Sweden)

    Andrey Kataev

    2017-07-01

    Full Text Available The thesis is devoted to the rationalization of methodical approaches for provision of branding of retail trade enterprises. The article considers the features of brand perception by retail consumers and clarifies the specifics of customer reviews of stores for the procedures accompanying brand management. It is proved that besides traditional communication mix, the most important tool of communicative influence on buyers is the store itself as a place for comfortable shopping. The shop should have a stimulating effect on all five human senses, including sight, smell, hearing, touch, and taste, which shall help maximize consumer integration into the buying process.

  17. The potential role of mother-in-law in prevention of mother-to-child transmission of HIV: a mixed methods study from the Kilimanjaro region, northern Tanzania

    Directory of Open Access Journals (Sweden)

    Leshabari Sebalda

    2011-07-01

    Full Text Available Abstract Background In the Kilimanjaro region the mother-in-law has traditionally had an important role in matters related to reproduction and childcare. The aim of this study was to explore the role of the mothers-in-law in prevention of mother-to-child transmission (PMTCT service utilization and adherence to infant feeding guidelines. Methods The study was conducted during 2007-2008 in rural and urban areas of Moshi district in the Kilimanjaro region of Tanzania. Mixed methods were used and included focus group discussions with mothers-in-law, mothers and fathers; in-depth interviews with mothers-in-law, mothers, fathers and HIV-infected mothers, and a survey of 446 mothers bringing their four-week-old infants for immunisation at five reproductive and child health clinics. Results The study demonstrated that the mother-in-law saw herself as responsible for family health issues in general and child care in particular. However she received limited trust, and couples, in particular couples living in urban areas, tended to exclude her from decisions related to childbearing and infant feeding. Mothers-in-law expected their daughters-in-law to breastfeed in a customary manner and were generally negative towards the infant feeding methods recommended for HIV-infected mothers; exclusive replacement feeding and exclusive breastfeeding. Conclusions Decreasing influence of the mother-in-law and increasing prominence of the conjugal couples in issues related to reproduction and child care, reinforce the importance of continued efforts to include male partners in the PMTCT programme. The potential for involving mothers-in-law in the infant feeding component, where she still has influence in some areas, should be further explored.

  18. Tanzania Dental Association

    African Journals Online (AJOL)

    Committee of Tanzania Dental. Association would like to Thank. [fUfNJfNJU[[j)~ for its magnanimity towards meeting the cost of this Journal ... ceps is token out of the dental kit and the tooth is removed out of its socket. The tooth is dropped into the waste bucket. The fareceps is placed in the water basin. The socket site is ...

  19. YOUTH EMPLOYMENTin Tanzania

    International Development Research Centre (IDRC) Digital Library (Canada)

    Some 17.5 millionTanzanians are between 15 and 34 years of age. This number is expected to almost double by 2035. For more information, please refer to Haji, Mahjabeen (2015) Tanzania: Skills and youth employment, a scoping paper commissioned by IDRC and the MasterCard Foundation. Young self-employed.

  20. IDRC in Tanzania

    International Development Research Centre (IDRC) Digital Library (Canada)

    worth CA$60 million since 1973. By identifying the major causes of death and disease, IDRC-supported research has helped to significantly reduced child and adult mortality rates in ... mental conditions in communities in. Tanzania and Malawi. Researchers and com- munity members will use the survey results to design ...

  1. Tanzania Journal of Science

    African Journals Online (AJOL)

    The Tanzania Journal of Science (Tanz. J. Sci.) was established in 1975 as a forum for communication and co-ordination between and among scientists and allied professionals. It is also intended as a medium for dissemination of scientific knowledge among scientists and the public at large to promote the advancement of ...

  2. Tanzania Medical Journal: Submissions

    African Journals Online (AJOL)

    The Tanzania Medical Journal is a multi – disciplinary journal published two times a year in March - June and September – December. ... To achieve its objectives the journal invites papers on original scientific research, short communications, case reports and letters to the editor, in any branch of medical science. Original ...

  3. The incidence of local government allocations in Tanzania

    OpenAIRE

    Jameson Boex

    2003-01-01

    Since 1999, Tanzania has been actively pursuing reforms of the way in which the central government finances local government activities. This paper looks at the current incidence of central government allocations to local authorities in Tanzania through: 1) examining of potential problems with the current financing method, 2) showing large variations between local government allocations, and 3) finding that surprisingly what drives t his distribution of resources maybe substantial pro-wealthy...

  4. Factors affecting adoption, implementation fidelity, and sustainability of the Redesigned Community Health Fund in Tanzania: a mixed methods protocol for process evaluation in the Dodoma region

    Directory of Open Access Journals (Sweden)

    Albino Kalolo

    2015-12-01

    Full Text Available Background: Despite the implementation of various initiatives to address low enrollment in voluntary micro health insurance (MHI schemes in sub-Saharan Africa, the problem of low enrollment remains unresolved. The lack of process evaluations of such interventions makes it difficult to ascertain whether their poor results are because of design failures or implementation weaknesses. Objective: In this paper, we describe a process evaluation protocol aimed at opening the ‘black box’ to evaluate the implementation processes of the Redesigned Community Health Fund (CHF program in the Dodoma region of Tanzania. Design: The study employs a cross-sectional mixed methods design and is being carried out 3 years after the launch of the Redesigned CHF program. The study is grounded in a conceptual framework which rests on the Diffusion of Innovation Theory and the Implementation Fidelity Framework. The study utilizes a mixture of quantitative and qualitative data collection tools (questionnaires, focus group discussions, in-depth interviews, and document review, and aligns the evaluation to the Theory of Intervention developed by our team. Quantitative data will be used to measure program adoption, implementation fidelity, and their moderating factors. Qualitative data will be used to explore the responses of stakeholders to the intervention, contextual factors, and moderators of adoption, implementation fidelity, and sustainability. Discussion: This protocol describes a systematic process evaluation in relation to the implementation of a reformed MHI. We trust that the theoretical approaches and methodologies described in our protocol may be useful to inform the design of future process evaluations focused on the assessment of complex interventions, such as MHI schemes.

  5. Factors affecting adoption, implementation fidelity, and sustainability of the Redesigned Community Health Fund in Tanzania: a mixed methods protocol for process evaluation in the Dodoma region

    Science.gov (United States)

    Kalolo, Albino; Radermacher, Ralf; Stoermer, Manfred; Meshack, Menoris; De Allegri, Manuela

    2015-01-01

    Background Despite the implementation of various initiatives to address low enrollment in voluntary micro health insurance (MHI) schemes in sub-Saharan Africa, the problem of low enrollment remains unresolved. The lack of process evaluations of such interventions makes it difficult to ascertain whether their poor results are because of design failures or implementation weaknesses. Objective In this paper, we describe a process evaluation protocol aimed at opening the ‘black box’ to evaluate the implementation processes of the Redesigned Community Health Fund (CHF) program in the Dodoma region of Tanzania. Design The study employs a cross-sectional mixed methods design and is being carried out 3 years after the launch of the Redesigned CHF program. The study is grounded in a conceptual framework which rests on the Diffusion of Innovation Theory and the Implementation Fidelity Framework. The study utilizes a mixture of quantitative and qualitative data collection tools (questionnaires, focus group discussions, in-depth interviews, and document review), and aligns the evaluation to the Theory of Intervention developed by our team. Quantitative data will be used to measure program adoption, implementation fidelity, and their moderating factors. Qualitative data will be used to explore the responses of stakeholders to the intervention, contextual factors, and moderators of adoption, implementation fidelity, and sustainability. Discussion This protocol describes a systematic process evaluation in relation to the implementation of a reformed MHI. We trust that the theoretical approaches and methodologies described in our protocol may be useful to inform the design of future process evaluations focused on the assessment of complex interventions, such as MHI schemes. PMID:26679408

  6. Marine fisheries in Tanzania.

    Science.gov (United States)

    Jiddawi, Narriman S; Ohman, Marcus C

    2002-12-01

    Fishery resources are a vital source of food and make valuable economic contributions to the local communities involved in fishery activities along the 850 km stretch of the Tanzania coastline and numerous islands. Small-scale artisanal fishery accounts for the majority of fish catch produced by more than 43 000 fishermen in the country, mainly operating in shallow waters within the continental shelf, using traditional fishing vessels including small boats, dhows, canoes, outrigger canoes and dinghys. Various fishing techniques are applied using uncomplicated passive fishing gears such as basket traps, fence traps, nets as well as different hook and line techniques. Species composition and size of the fish varies with gear type and location. More than 500 species of fish are utilized for food with reef fishes being the most important category including emperors, snappers, sweetlips, parrotfish, surgeonfish, rabbitfish, groupers and goatfish. Most of the fish products are used for subsistence purposes. However, some are exported. Destructive fishing methods such as drag nets and dynamite fishing pose a serious problem as they destroy important habitats for fish and other organisms, and there is a long-term trend of overharvested fishery resources. However, fishing pressure varies within the country as fishery resources are utilized in a sustainable manner in some areas. For this report more than 340 references about Tanzanian fishery and fish ecology were covered. There are many gaps in terms of information needed for successful fishery management regarding both basic and applied research. Most research results have been presented as grey literature (57%) with limited distribution; only one-fifth were scientific publications in international journals.

  7. Crater Highlands, Tanzania

    Science.gov (United States)

    2006-01-01

    The Shuttle Radar Topography Mission (SRTM), flown aboard Space Shuttle Endeavour in February 2000, acquired elevation measurements for nearly all of Earth's landmass between 60oN and 56oS latitudes. For many areas of the world SRTM data provide the first detailed three-dimensional observation of landforms at regional scales. SRTM data were used to generate this view of the Crater Highlands along the East African Rift in Tanzania. Landforms are depicted with colored height and shaded relief, using a vertical exaggeration of 2X and a southwestwardly look direction. Lake Eyasi is depicted in blue at the top of the image, and a smaller lake occurs in Ngorongoro Crater. Near the image center, elevations peak at 3648 meters (11,968 feet) at Mount Loolmalasin, which is south of Ela Naibori Crater. Kitumbeine (left) and Gelai (right) are the two broad mountains rising from the rift lowlands. Mount Longido is seen in the lower left, and the Meto Hills are in the right foreground. Tectonics, volcanism, landslides, erosion and deposition -- and their interactions -- are all very evident in this view. The East African Rift is a zone of spreading between the African (on the west) and Somali (on the east) crustal plates. Two branches of the rift intersect here in Tanzania, resulting in distinctive and prominent landforms. One branch trends nearly parallel the view and includes Lake Eyasi and the very wide Ngorongoro Crater. The other branch is well defined by the lowlands that trend left-right across the image (below center, in green). Volcanoes are often associated with spreading zones where magma, rising to fill the gaps, reaches the surface and builds cones. Craters form if a volcano explodes or collapses. Later spreading can fracture the volcanoes, which is especially evident on Kitumbeine and Gelai Mountains (left and right, respectively, lower center). The Crater Highlands rise far above the adjacent savannas, capture moisture from passing air masses, and host rain

  8. Position detectors, methods of detecting position, and methods of providing positional detectors

    Science.gov (United States)

    Weinberg, David M.; Harding, L. Dean; Larsen, Eric D.

    2002-01-01

    Position detectors, welding system position detectors, methods of detecting various positions, and methods of providing position detectors are described. In one embodiment, a welding system positional detector includes a base that is configured to engage and be moved along a curved surface of a welding work piece. At least one position detection apparatus is provided and is connected with the base and configured to measure angular position of the detector relative to a reference vector. In another embodiment, a welding system positional detector includes a weld head and at least one inclinometer mounted on the weld head. The one inclinometer is configured to develop positional data relative to a reference vector and the position of the weld head on a non-planar weldable work piece.

  9. Tanzania country study

    Energy Technology Data Exchange (ETDEWEB)

    Meena, H E [Centre for Energy, Environment, Science and Technology, Dar es Salaam (Tanzania, United Republic of)

    1998-10-01

    An objective of this study is to analyse the role of the land use sectors of Tanzania (especially forestry) on mitigation of greenhouse gases. Specific emphasis is placed on the relationship between forestry and energy supply from biomass. This is a follow up study on an earlier effort which worked on mitigation options in the country without an in-depth analysis of the forestry and land use sectors. (au)

  10. Tanzania country study

    International Nuclear Information System (INIS)

    Meena, H.E.

    1998-01-01

    An objective of this study is to analyse the role of the land use sectors of Tanzania (especially forestry) on mitigation of greenhouse gases. Specific emphasis is placed on the relationship between forestry and energy supply from biomass. This is a follow up study on an earlier effort which worked on mitigation options in the country without an in-depth analysis of the forestry and land use sectors. (au)

  11. Corporal Punishment in Tanzania's Schools

    Science.gov (United States)

    Feinstein, Sheryl; Mwahombela, Lucas

    2010-01-01

    The purpose of this survey was to acquire descriptive information regarding corporal punishment in Tanzania's O-level secondary schools. 448 individuals participated in the study: 254 teachers and 194 students, all from government or private secondary schools in the Iringa Region of Tanzania. In addition, 14 students and 14 teachers were…

  12. Verbal Autopsies in Rural Tanzania

    African Journals Online (AJOL)

    Maternal mortality rates in rural Tanzania are high. In preparation for the introduction of an intervention to reduce maternal deaths by distribution of misoprostol and erythromycin to women living in rural Rorya District, Mara Region, Tanzania, we conducted a limited verbal autopsy by surveying family members of women ...

  13. Exposure to Aflatoxin and Fumonisin in Children at Risk for Growth Impairment in Rural Tanzania

    Science.gov (United States)

    Background. Stunted growth is a major public health issue for children in Tanzania. We examined dietary exposures to aflatoxin and fumonisin and their potential roles in growth impairment in children under 36 months of age in Haydom, Tanzania. Methods. Plasma samples collected at 24 months of age ...

  14. Early Child Development and Care in Tanzania: Challenges for the Future

    Science.gov (United States)

    Mtahabwa, Lyabwene

    2009-01-01

    Much remains unknown about the status of early child development and care in Tanzania. The little information available has never been put together to provide a holistic picture of the progress so far made in this important area. This paper intends to synchronise the information available in Tanzania for the purpose of depicting the country's…

  15. Country Presentation Tanzania

    International Nuclear Information System (INIS)

    KIFANGA, L.D.; GYIMBI, H.; MLOWOLA, V.; KASONGWA, M.

    2010-01-01

    Discusses overview of incidents and developments involving illicit trafficking of nuclear and other radioactive materials in Tanzania.13 cases have been recorded between 1996 and 2008. All cases occurred in Dar Es Salam. Police, customs and security staff intercepted the sources and culprits arrested. The latest incident occurred in May 2008 and involved illegal possession of a capsule labelled nuclear material (U-238). A total of 14 sources were seized . Types of sources seized were u-238, Caesium-137, Strontium-90 and Radium-226.

  16. Sleeping sickness situation in Tanzania | Kibona | Tanzania Journal ...

    African Journals Online (AJOL)

    Tanzania Journal of Health Research. Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue · Archives · Journal Home > Vol 4, No 2 (2002) >. Log in or Register to get access to full text downloads.

  17. Spatial Heterogeneity of Habitat Suitability for Rift Valley Fever Occurrence in Tanzania: An Ecological Niche Modelling Approach

    Science.gov (United States)

    Sindato, Calvin; Stevens, Kim B.; Karimuribo, Esron D.; Mboera, Leonard E. G.; Paweska, Janusz T.; Pfeiffer, Dirk U.

    2016-01-01

    Background Despite the long history of Rift Valley fever (RVF) in Tanzania, extent of its suitable habitat in the country remains unclear. In this study we investigated potential effects of temperature, precipitation, elevation, soil type, livestock density, rainfall pattern, proximity to wild animals, protected areas and forest on the habitat suitability for RVF occurrence in Tanzania. Materials and Methods Presence-only records of 193 RVF outbreak locations from 1930 to 2007 together with potential predictor variables were used to model and map the suitable habitats for RVF occurrence using ecological niche modelling. Ground-truthing of the model outputs was conducted by comparing the levels of RVF virus specific antibodies in cattle, sheep and goats sampled from locations in Tanzania that presented different predicted habitat suitability values. Principal Findings Habitat suitability values for RVF occurrence were higher in the northern and central-eastern regions of Tanzania than the rest of the regions in the country. Soil type and precipitation of the wettest quarter contributed equally to habitat suitability (32.4% each), followed by livestock density (25.9%) and rainfall pattern (9.3%). Ground-truthing of model outputs revealed that the odds of an animal being seropositive for RVFV when sampled from areas predicted to be most suitable for RVF occurrence were twice the odds of an animal sampled from areas least suitable for RVF occurrence (95% CI: 1.43, 2.76, p < 0.001). Conclusion/Significance The regions in the northern and central-eastern Tanzania were more suitable for RVF occurrence than the rest of the regions in the country. The modelled suitable habitat is characterised by impermeable soils, moderate precipitation in the wettest quarter, high livestock density and a bimodal rainfall pattern. The findings of this study should provide guidance for the design of appropriate RVF surveillance, prevention and control strategies which target areas with

  18. The current status of radiological protection infraestructures in Tanzania

    International Nuclear Information System (INIS)

    Ngalie, J.E.; Mompome, W.K.; Meza, L.H.

    2008-01-01

    Without adequate and sustainable radiation protection infrastructure, the benefits associated with safe use of nuclear technology and atomic energy might be jeopardized. In the United Republic of Tanzania, the Atomic Energy Act No. 7 of 2003 established the Tanzania Atomic Energy Commission as sole regulatory body responsible for regulating and controlling the safe and peaceful utilization of nuclear technology in the country. The Atomic Energy (Protection from ionizing radiation) Regulations, 2004 further specifies practices designed to ensure that unnecessary exposure of persons to ionizing radiation is avoided, that all exposures are kept as low as reasonably achievable and that all the dose limits specified in the radiation protection standards are not exceeded. This is achieved through the systems of notification, authorizations through registration and licensing, safety and security of radiation sources as well as regulatory inspections and enforcements. These activities are performed by the Commission with operational funds allocated by the Government of Tanzania. The Commission further provides other services namely individual monitoring; calibration services; education and training to radiation workers, public as well as law enforcers; and safe management of radioactive waste. Despite such achievement, still there are a lot to be done in order to strengthen the radiation protection infrastructure in Tanzania. These include issues such as gaps in our legislations, regulations and guidance, security of sources, enforcement of laws, etc. This paper describes and discusses the current status of the regulatory control activities and radiation protection services provided by the Commission and suggestions for further improvement of radiological protection infrastructure in Tanzania. (author)

  19. Tanzania Journal of Health Research

    African Journals Online (AJOL)

    Tanzania Journal of Health Research (TJHR) aims to facilitate the advance of health sciences by publishing high quality research and review articles that communicate new ideas and developments in biomedical and health research. TJHR is ...

  20. Tanzania's healthcare breakthrough | IDRC - International ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    2010-11-18

    Nov 18, 2010 ... A model for success. The effects have ... health systems. Globally, there is a growing acceptance of the TEHIP lessons. ... has ended." — Hassan Mshinda, Director General, Tanzania Commission for Science and Technology ...

  1. Effectiveness of a nutrition education package in improving feeding practices, dietary adequacy and growth of infants and young children in rural Tanzania: rationale, design and methods of a cluster randomised trial.

    Science.gov (United States)

    Kulwa, Kissa B M; Verstraeten, Roosmarijn; Bouckaert, Kimberley P; Mamiro, Peter S; Kolsteren, Patrick W; Lachat, Carl

    2014-10-16

    intervention and context at 8 and 15 months. Results of the trial will provide evidence of the effectiveness of the nutrition education package in community settings of rural Tanzania. They will provide recommendations for strengthening the nutrition component of health education in child health services. ClinicalTrials.gov Identifier: NCT02249754, September 25, 2014.

  2. Cost of microbial larviciding for malaria control in rural Tanzania.

    Science.gov (United States)

    Rahman, Rifat; Lesser, Adriane; Mboera, Leonard; Kramer, Randall

    2016-11-01

    Microbial larviciding may be a potential supplement to conventional malaria vector control measures, but scant information on its relative implementation costs and effectiveness, especially in rural areas, is an impediment to expanding its uptake. We perform a costing analysis of a seasonal microbial larviciding programme in rural Tanzania. We evaluated the financial and economic costs from the perspective of the public provider of a 3-month, community-based larviciding intervention implemented in twelve villages in the Mvomero District of Tanzania in 2012-2013. Cost data were collected from financial reports and invoices and through discussion with programme administrators. Sensitivity analysis explored the robustness of our results to varying key parameters. Over the 2-year study period, approximately 6873 breeding sites were treated with larvicide. The average annual economic costs of the larviciding intervention in rural Tanzania are estimated at 2014 US$ 1.44 per person protected per year (pppy), US$ 6.18 per household and US$ 4481.88 per village, with the larvicide and staffing accounting for 14% and 58% of total costs, respectively. We found the costs pppy of implementing a seasonal larviciding programme in rural Tanzania to be comparable to the costs of other larviciding programmes in urban Tanzania and rural Kenya. Further research should evaluate the cost-effectiveness of larviciding relative to, and in combination with, other vector control strategies in rural settings. © 2016 John Wiley & Sons Ltd.

  3. A novel method of providing a library of n-mers or biopolymers

    DEFF Research Database (Denmark)

    2012-01-01

    The present invention relates to a method of providing a library of n-mer sequences, wherein the library is composed of an n-mer sequence. Also the invention concerns a method of providing a library of biopolymer sequences having one or more n-mers in common. Further provided are specific primers...

  4. Advanced Life Support in Obstetrics (ALSO) and postpartum hemorrhage: A prospective intervention study in Tanzania

    DEFF Research Database (Denmark)

    Sorensen, Bjarke Lund; Rasch, Vibeke; Massawe, Siriel

    2011-01-01

    Objective. To evaluate the impact of Advanced Life Support in Obstetrics (ALSO) training on staff performance and the incidences of postpartum hemorrhage (PPH) at a regional hospital in Tanzania. Design. Prospective intervention study. Setting. A regional, referral hospital. Population. A total...... of 510 delivered women before and 505 after the intervention. Methods. All high- and midlevel providers involved in childbirth at the hospital attended a two day ALSO provider course. Staff management was observed and postpartum bleeding assessed at all vaginal deliveries for seven weeks before and seven...

  5. THE USE OF UAS FOR ASSESSING AGRICULTURAL SYSTEMS IN AN WETLAND IN TANZANIA IN THE DRY- AND WET-SEASON FOR SUSTAINABLE AGRICULTURE AND PROVIDING GROUND TRUTH FOR TERRA-SAR X DATA

    Directory of Open Access Journals (Sweden)

    H.-P. Thamm

    2013-08-01

    Full Text Available The paper describes the assessment of the vegetation and the land use systems of the Malinda Wetland in the Usambara Mountains in Tanzania with the parachute UAS (unmanned aerial system SUSI 62. The area of investigation was around 8 km2. In two campaigns, one in the wet season and one in the dry season, approximately 2600 aerial photos of the wetland were taken using the parachute UAS SUSI 62; of these images, ortho-photos with a spatial resolution of 20 cm x 20 cm, were computed with an advanced block bundle approach. The block bundles were geo-referenced using control points taken with differential GPS. As well a digital surface model (DSM of the wetland was created out of the UAS photos. Using the ortho-photos it is possible to assess the different land use systems; the differences in the phenology of the vegetation between wet and dry season can be investigated. In addition, the regionalisation of bio mass samples on smaller test plots was possible. The ortho-photos and the DSM derived from the UAS proved to be a valuable ground truth for the interpretation of Terra-SAR X images. The campaigns demonstrated that SUSI 62 was a suitable, robust tool to obtain the valuable information under harsh conditions.

  6. Urban agriculture in Tanzania : issues of sustainability

    NARCIS (Netherlands)

    Foeken, D.W.J.

    2004-01-01

    This book, the result of a collaborative study carried out by researchers from Tanzania, Israel and the Netherlands, assesses the sustainability of urban agriculture in two medium-sized towns in Tanzania: Morogoro and Mbeya. It first gives an overview of urban agriculture in Tanzania and a

  7. Institutional Support : African Technology Policy Studies - Tanzania ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    African Technology Policy Studies - Tanzania (ATPS-Tanzania) was registered as a national nongovernmental organization in 2001. ... While resource flows to ATPS-Tanzania from ATPS headquarters in Nairobi were reliable, the organization produced a larger volume of research outputs than most other ATPS national ...

  8. Implementation of a national anti-tuberculosis drug resistance survey in Tanzania

    NARCIS (Netherlands)

    Chonde, Timothy M.; Doulla, Basra; van Leth, Frank; Mfinanga, Sayoki G. M.; Range, Nyagosya; Lwilla, Fred; Mfaume, Saidi M.; van Deun, Armand; Zignol, Matteo; Cobelens, Frank G.; Egwaga, Saidi M.

    2008-01-01

    BACKGROUND: A drug resistance survey is an essential public health management tool for evaluating and improving the performance of National Tuberculosis control programmes. The current manuscript describes the implementation of the first national drug resistance survey in Tanzania. METHODS:

  9. Cost analysis of large-scale implementation of the 'Helping Babies Breathe' newborn resuscitation-training program in Tanzania.

    Science.gov (United States)

    Chaudhury, Sumona; Arlington, Lauren; Brenan, Shelby; Kairuki, Allan Kaijunga; Meda, Amunga Robson; Isangula, Kahabi G; Mponzi, Victor; Bishanga, Dunstan; Thomas, Erica; Msemo, Georgina; Azayo, Mary; Molinier, Alice; Nelson, Brett D

    2016-12-01

    Helping Babies Breathe (HBB) has become the gold standard globally for training birth-attendants in neonatal resuscitation in low-resource settings in efforts to reduce early newborn asphyxia and mortality. The purpose of this study was to do a first-ever activity-based cost-analysis of at-scale HBB program implementation and initial follow-up in a large region of Tanzania and evaluate costs of national scale-up as one component of a multi-method external evaluation of the implementation of HBB at scale in Tanzania. We used activity-based costing to examine budget expense data during the two-month implementation and follow-up of HBB in one of the target regions. Activity-cost centers included administrative, initial training (including resuscitation equipment), and follow-up training expenses. Sensitivity analysis was utilized to project cost scenarios incurred to achieve countrywide expansion of the program across all mainland regions of Tanzania and to model costs of program maintenance over one and five years following initiation. Total costs for the Mbeya Region were $202,240, with the highest proportion due to initial training and equipment (45.2%), followed by central program administration (37.2%), and follow-up visits (17.6%). Within Mbeya, 49 training sessions were undertaken, involving the training of 1,341 health providers from 336 health facilities in eight districts. To similarly expand the HBB program across the 25 regions of mainland Tanzania, the total economic cost is projected to be around $4,000,000 (around $600 per facility). Following sensitivity analyses, the estimated total for all Tanzania initial rollout lies between $2,934,793 to $4,309,595. In order to maintain the program nationally under the current model, it is estimated it would cost $2,019,115 for a further one year and $5,640,794 for a further five years of ongoing program support. HBB implementation is a relatively low-cost intervention with potential for high impact on perinatal

  10. Prospects, achievements, challenges and opportunities for scaling-up malaria chemoprevention in pregnancy in Tanzania

    DEFF Research Database (Denmark)

    Mubyazi, Godfrey M.; Bygbjerg, Ib Christian; Magnussen, Pascal

    2008-01-01

    To describe the prospects, achievements, challenges and opportunities for implementing intermittent preventive treatment for malaria in pregnancy (IPTp) in Tanzania in light of national antenatal care (ANC) guidelines and ability of service providers to comply with them....

  11. Coping with inadequacy : understanding the effects of central teacher recruitment in six ward secondary schools in Tanzania

    NARCIS (Netherlands)

    Mafuru, W.L.

    2011-01-01

    Decentralization by devolution is the means to transfer the responsibilities for service provision to the grassroots levels in Tanzania. The aim of this policy is to deal with the stagnation in the development of, among other things, secondary education. Despite this policy, Tanzania still provides

  12. Poverty, partner discord, and divergent accounts; a mixed methods account of births before arrival to health facilities in Morogoro Region, Tanzania.

    Science.gov (United States)

    McMahon, Shannon A; Chase, Rachel P; Winch, Peter J; Chebet, Joy J; Besana, Giulia V R; Mosha, Idda; Sheweji, Zaina; Kennedy, Caitlin E

    2016-09-27

    Births before arrival (BBA) to health care facilities are associated with higher rates of perinatal morbidity and mortality compared to facility deliveries or planned home births. Research on such births has been conducted in several high-income countries, but there are almost no studies from low-income settings where a majority of maternal and newborn deaths occur. Drawing on a household survey of women and in-depth interviews with women and their partners, we examined the experience of BBA in rural districts of Morogoro Region, Tanzania. Among survey respondents, 59 births (4 %) were classified as BBAs. Most of these births occurred in the presence of a family member (47 %) or traditional birth attendant (24 %). Low socioeconomic status was the strongest predictor of BBA. After controlling for wealth via matching, high parity and a low number of antenatal care (ANC) visits retained statistical significance. While these variables are useful indicators of which women are at greater risk of BBA, their predictive power is limited in a context where many women are poor, multiparous, and make multiple ANC visits. In qualitative interviews, stories of BBAs included themes of partner disagreement regarding when to depart for facilities and financial or logistical constraints that underpinned departure delays. Women described wanting to depart earlier to facilities than partners. As efforts continue to promote facility birth, we highlight the financial demands associated with facility delivery and the potential for these demands to place women at a heightened risk for BBAs.

  13. Tanzania country study

    Energy Technology Data Exchange (ETDEWEB)

    1999-09-01

    Objectives of this study are to analyse the role of the land use sectors of Tanzania (especially forestry) on mitigation of greenhouse gases. Specific emphasis is placed on the relationship between forestry and energy supply from biomass, as well as other forestry products. This is a follow up study on an earlier effort which worked on mitigation options in the country without and in-depth analysis of the forestry and land use sectors. Analysis of the mitigation scenario has been based on Comprehensive Mitigation Analysis (COMAP). This study has analysed the forestry and land use sector behaviour on the basis of the current policies on land and environment. Furthermore three scenarios have been developed on the basis of what is expected to happen in the sectors, the worse scenario being a catastrophic one where if things takes the business as usual trend then the forest resources will easily be depleted. The TFAP scenario takes into account the implementation of the current plans as scheduled while the mitigation scenario takes into account the GHG mitigation in the implementation of the plans. A Comprehensive Mitigation Analysis Process (COMAP) has been used to analyse the GHG and cost implications of the various programmes under the mitigation scenario. (au) 30 refs.

  14. System and Method for Providing Vertical Profile Measurements of Atmospheric Gases

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — A system and method for using an air collection device to collect a continuous air sample as the device descends through the atmosphere are provided. The air...

  15. Interconnection blocks: a method for providing reusable, rapid, multiple, aligned and planar microfluidic interconnections

    DEFF Research Database (Denmark)

    Sabourin, David; Snakenborg, Detlef; Dufva, Hans Martin

    2009-01-01

    In this paper a method is presented for creating 'interconnection blocks' that are re-usable and provide multiple, aligned and planar microfluidic interconnections. Interconnection blocks made from polydimethylsiloxane allow rapid testing of microfluidic chips and unobstructed microfluidic observ...

  16. Surveillance of antimicrobial resistance at a tertiary hospital in Tanzania

    Directory of Open Access Journals (Sweden)

    Mashurano Marcellina

    2004-10-01

    Full Text Available Abstract Background Antimicrobial resistance is particularly harmful to infectious disease management in low-income countries since expensive second-line drugs are not readily available. The objective of this study was to implement and evaluate a computerized system for surveillance of antimicrobial resistance at a tertiary hospital in Tanzania. Methods A computerized surveillance system for antimicrobial susceptibility (WHONET was implemented at the national referral hospital in Tanzania in 1998. The antimicrobial susceptibilities of all clinical bacterial isolates received during an 18 months' period were recorded and analyzed. Results The surveillance system was successfully implemented at the hospital. This activity increased the focus on antimicrobial resistance issues and on laboratory quality assurance issues. The study identified specific nosocomial problems in the hospital and led to the initiation of other prospective studies on prevalence and antimicrobial susceptibility of bacterial infections. Furthermore, the study provided useful data on antimicrobial patterns in bacterial isolates from the hospital. Gram-negative bacteria displayed high rates of resistance to common inexpensive antibiotics such as ampicillin, tetracycline and trimethoprim-sulfamethoxazole, leaving fluoroquinolones as the only reliable oral drugs against common Gram-negative bacilli. Gentamicin and third generation cephalosporins remain useful for parenteral therapy. Conclusion The surveillance system is a low-cost tool to generate valuable information on antimicrobial resistance, which can be used to prepare locally applicable recommendations on antimicrobial use. The system pinpoints relevant nosocomial problems and can be used to efficiently plan further research. The surveillance system also functions as a quality assurance tool, bringing attention to methodological issues in identification and susceptibility testing.

  17. Systems and methods for providing power to a load based upon a control strategy

    Science.gov (United States)

    Perisic, Milun; Kajouke, Lateef A; Ransom, Ray M

    2013-12-24

    Systems and methods are provided for an electrical system. The electrical system includes a load, an interface configured to receive a voltage from a voltage source, and a controller configured to receive the voltage from the voltage source through the interface and to provide a voltage and current to the load. Wherein, when the controller is in a constant voltage mode, the controller provides a constant voltage to the load, when the controller is in a constant current mode, the controller provides a constant current to the load, and when the controller is in a constant power mode, the controller provides a constant power to the load.

  18. Method and Apparatus Providing Deception and/or Altered Operation in an Information System Operating System

    Science.gov (United States)

    Cohen, Fred; Rogers, Deanna T.; Neagoe, Vicentiu

    2008-10-14

    A method and/or system and/or apparatus providing deception and/or execution alteration in an information system. In specific embodiments, deceptions and/or protections are provided by intercepting and/or modifying operation of one or more system calls of an operating system.

  19. Provider Payment Trends and Methods in the Massachusetts Health Care System

    OpenAIRE

    Allison Barrett; Timothy Lake

    2010-01-01

    This report investigates provider payment methods in Massachusetts. Payments include fee-for-service, the predominant model; global payments, which pay providers a single fee for all or most required services during a contract period; and pay-for-performance models, which layer quality incentives onto payments.

  20. 47 CFR 51.329 - Notice of network changes: Methods for providing notice.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 3 2010-10-01 2010-10-01 false Notice of network changes: Methods for providing notice. 51.329 Section 51.329 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED...) Filing a public notice with the Commission; or (2) Providing public notice through industry fora...

  1. Pig Production in Tanzania: a Critical Review

    Directory of Open Access Journals (Sweden)

    Wilson, RT.

    2014-01-01

    Full Text Available Tanzania's 1.58 million pigs represent 3.7 per cent of the national population of quadruped meat-producing animals. Some 99.5 per cent of pigs are kept by small producers in units averaging 3.04 animals (range 2-48. About 18 per cent of households with livestock own pigs, 93.7 per cent of these having a herd of less than 19 and 69.2 per cent own 9 or fewer head. Scavenging is the main feed source. Maize bran is the principle supplement but some owners provide oilseed cakes and minerals. Domestic pigs are not indigenous to Tanzania and derive mainly from late 19th/early 20th century introductions. There have been few imports of breeding stock since 1961. Poor management, in-breeding, inadequate nutrition and rudimentary veterinary attention lead to low output from late ages at first farrowing, long inter-birth intervals, small litters, slow growth and high mortality. Government policy is not applied in practice. Animals are slaughtered in primitive private facilities or household compounds with little concern for welfare or hygiene, often with no official inspection. Pigs can make a greater contribution to society but public and private sectors must provide additional support with particular attention to management, nutrition, health, welfare and food safety to achieve this.

  2. System and Method for Providing a Climate Data Analytic Services Application Programming Interface Distribution Package

    Science.gov (United States)

    Schnase, John L. (Inventor); Duffy, Daniel Q. (Inventor); Tamkin, Glenn S. (Inventor)

    2016-01-01

    A system, method and computer-readable storage devices for providing a climate data analytic services application programming interface distribution package. The example system can provide various components. The system provides a climate data analytic services application programming interface library that enables software applications running on a client device to invoke the capabilities of a climate data analytic service. The system provides a command-line interface that provides a means of interacting with a climate data analytic service by issuing commands directly to the system's server interface. The system provides sample programs that call on the capabilities of the application programming interface library and can be used as templates for the construction of new client applications. The system can also provide test utilities, build utilities, service integration utilities, and documentation.

  3. Tanzania Journal of Agricultural Sciences

    African Journals Online (AJOL)

    Agricultural Policy Analysis Studies in Tanzania: A Historical and Thematic Perspective with Implications on Future Policy Research for Crop Production and Marketing · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. A.C. Isinika, G.M. Mibavu, J.J. VanSickle ...

  4. Tanzania : Country Procurement Assessment Report

    OpenAIRE

    World Bank

    2003-01-01

    This Country Procurement Assessment Report (CPAR)intends to determine the compatibility of national procurement law, and practices, with the principles of economy, and with international procurement practices. This CPAR, the second of its kind in Tanzania, looks at the legislative framework, the performance of regulatory functions, the enforcement regime, and the capacity of public sector ...

  5. Tanzania Veterinary Journal: Editorial Policies

    African Journals Online (AJOL)

    Focus and Scope. The Tanzania Veterinary Journal (The Tropical Veterinarian) is a biannual Journal, which publishes original contribution to knowledge on Veterinary Science, Animal Science and Production, and allied sciences including new techniques and developments in Veterinary Medicine. The target readers of the ...

  6. Greenhouse gases mitigation options and strategies for Tanzania

    Energy Technology Data Exchange (ETDEWEB)

    Mwandosya, M.J.; Meena, H.E.

    1996-12-31

    Tanzania became a party to the United Nations Framework on Climate Change (UN FCCC) when she ratified the Convention in March, 1996. Now that Tanzania and other developing countries are Parties to the UN FCCC, compliance with its provisions is mandatory. The legal requirements therefore provide a basis for their participation in climate change studies and policy formulation. All parties to the Convention are required by Article 4.1 of the United Nations Convention on Climate Change (UN FCCC) to develop, periodically update, publish, and make available national inventories of anthropogenic emissions and removal of greenhouse gases that are not controlled by the Montreal Protocol. This study on possible options for the mitigation of greenhouse gases in Tanzania is a preliminary effort towards the fulfilment of the obligation. In order to fulfil their obligations under the UN FCCC and have a meaningful mitigation assessment, identification and quantification of anthropogenic sources of atmospheric emissions of greenhouse gases in the country was undertaken. In this respect, the study of anthropogenic emissions by source and removals by sink of GHGs in Tanzania was done with the main objective of increasing the quantity and quality of base-line data available in order to further scientific understanding of the relationship of greenhouse gas emissions to climate change. Furthermore, the study facilitated identification of national policy and technological options that could reduce the level of emissions in the country.

  7. Health Libraries and Information Services in Tanzania: A Strategic Assessment.

    Science.gov (United States)

    Haruna, Hussein; Mtoroki, Majaliwa; Gerendasy, Dan D; Detlefsen, Ellen G

    The intention of the Government of Tanzania is to establish more health information resource canters in all health facilities. With this regard, health information science personnel are needed to provide adequate and accurate health information services. However, availability of these personnel remains to be a challenge because of their non-existence. To identify the current status and local impact of health sciences libraries and user perception of these libraries, as a prerequisite to the development of a competence-based curriculum for health information science training in Tanzania. A needs assessment was carried out using a convenience sample of local respondents, including librarians, trainers, academicians, students, health care providers, and patients and families, drawn from national, referral, regional, district hospitals, health training institutions, and universities from both government and nongovernment entities in Tanzania. A focus group approach was used to gather data from respondents. Results from this assessment revealed that health science libraries in Tanzania are faced with the challenges of insufficient infrastructure, old technology, limited facilities and furniture, inadequate and incompetent library staff, lack of health sciences librarians, outdated and insufficient resources, and low knowledge and use of information technologies by library clients. Most respondents would prefer to have both physical and electronic libraries, as well as librarians with specialized health information science skills, to cope with changing nature of the medical field. The findings obtained from this assessment are strong enough to guide the development of a curriculum and training strategy and an operational plan and training packages for health information professionals. The development of a training curriculum for health information science professionals will mean better health information service delivery for Tanzania. Copyright © 2016 Icahn School of

  8. Sexual practices among unmarried adolescents in Tanzania

    Directory of Open Access Journals (Sweden)

    Masatu Melkiory C

    2009-10-01

    Full Text Available Abstract Background Sexual activities are increasingly changing from the cultural point of view what they used to be. Knowledge of these practices among adolescents may be a basis to create awareness among adolescents on practices that involve risks. This study aims to assess sexual practices among unmarried adolescents in Tanzania. Methods A cross-sectional survey was conducted among in-school and out-of-school but unmarried adolescents aged 10 to 19 in five locations in Tanzania. A questionnaire was used to collect information and to characterize sexual practices among these adolescents. Results About 32% of adolescents reported being sexually active; a higher proportion being males than females. The only inquired and reported sexual practices include vaginal sex, masturbation, oral and anal sex. About 15% of sexually active adolescents reported having multiple sexual partners. Significantly more males reported having multiple partners than females. Nearly 42% of sexually active adolescents reported having used a condom during most recent sexual act. Females reported older partners at first sexual act. Conclusion Adolescents experience several sexual practices that include penetrative and non-penetrative. More males reported being sexually active than females. Despite adolescents reporting having multiple sexual partners, reported condom use during the most recent sexual act was low. We advocate for a more enhanced approach of reproductive health education that includes safer sex to adolescents without forgetting those in-schools.

  9. Quantitative market survey of non-woody plants sold at Kariakoo Market in Dar es Salaam, Tanzania.

    Science.gov (United States)

    Posthouwer, Chantal; Veldman, Sarina; Abihudi, Siri; Otieno, Joseph N; van Andel, Tinde R; de Boer, Hugo J

    2018-04-30

    In Tanzania, traditional medicine plays a significant role in health care and local economies based on the harvesting, trade and sale of medicinal plant products. The majority of this plant material is said to originate from wild sources, and both traditional healers and vendors are concerned about the increasing scarcity of certain species. A market survey of non-powdered, non-woody medicinal plants was conducted at Kariakoo Market in Dar es Salaam, the major hub for medicinal plant trade in Tanzania, to assess sustainability of traded herbal medicine. For this study, fresh and dried herbs, seeds and fruits were collected and interviews were conducted to obtain information on vernacular names, preparation methods, monthly sales, uses and prices. Bundles of herbal medicine offered for sale were weighed and counted to calculate the value and volumes of daily stock at the market. A total of 71 medicinal plant products belonging to 62 to 67 different species from at least 41 different plant families were identified. We identified 45 plant products to species level, 20 products to genus level and four to family level. Plant species most encountered at the market were Suregada zanzibariensis, Myrothamnus flabellifolia and Sclerocarya birrea. The major use categories reported by the vendors were ritual purposes, digestive disorders and women's health. Annual sales are estimated to be in excess of 30 t and close to 200,000 USD, and trade in herbal medicine at Kariakoo Market provides subsistence income to many local vendors. A large diversity of wild-harvested plant species is traded as medicinal products in Tanzania, including species listed on CITES Appendices. Identifying and monitoring temporal changes in availability per season and from year to year will reveal which species are most affected by this trade, and help relevant authorities in Tanzania to find alternative sources of income for dependent stakeholders and initiate targeted efforts to protect threatened

  10. Interconnection blocks: a method for providing reusable, rapid, multiple, aligned and planar microfluidic interconnections

    International Nuclear Information System (INIS)

    Sabourin, D; Snakenborg, D; Dufva, M

    2009-01-01

    In this paper a method is presented for creating 'interconnection blocks' that are re-usable and provide multiple, aligned and planar microfluidic interconnections. Interconnection blocks made from polydimethylsiloxane allow rapid testing of microfluidic chips and unobstructed microfluidic observation. The interconnection block method is scalable, flexible and supports high interconnection density. The average pressure limit of the interconnection block was near 5.5 bar and all individual results were well above the 2 bar threshold considered applicable to most microfluidic applications

  11. Configurable memory system and method for providing atomic counting operations in a memory device

    Science.gov (United States)

    Bellofatto, Ralph E.; Gara, Alan G.; Giampapa, Mark E.; Ohmacht, Martin

    2010-09-14

    A memory system and method for providing atomic memory-based counter operations to operating systems and applications that make most efficient use of counter-backing memory and virtual and physical address space, while simplifying operating system memory management, and enabling the counter-backing memory to be used for purposes other than counter-backing storage when desired. The encoding and address decoding enabled by the invention provides all this functionality through a combination of software and hardware.

  12. Method of immobilizing weapons plutonium to provide a durable, disposable waste product

    Science.gov (United States)

    Ewing, Rodney C.; Lutze, Werner; Weber, William J.

    1996-01-01

    A method of atomic scale fixation and immobilization of plutonium to provide a durable waste product. Plutonium is provided in the form of either PuO.sub.2 or Pu(NO.sub.3).sub.4 and is mixed with and SiO.sub.2. The resulting mixture is cold pressed and then heated under pressure to form (Zr,Pu)SiO.sub.4 as the waste product.

  13. Cloud Service Provider Methods for Managing Insider Threats: Analysis Phase 1

    Science.gov (United States)

    2013-11-01

    of Standards and Technology (NIST) Special Publication 800-145 (NIST SP 800-145) defines three types of cloud services : Software as a Service ( SaaS ...among these three models. NIST SP 800-145 describes the three service models as follows: SaaS —The capability provided to the consumer is to use the...Cloud Service Provider Methods for Managing Insider Threats: Analysis Phase I Greg Porter November 2013 TECHNICAL NOTE CMU/SEI-2013-TN-020

  14. Chest radiography for predicting the cause of febrile illness among inpatients in Moshi, Tanzania

    International Nuclear Information System (INIS)

    Fiorillo, S.P.; Diefenthal, H.C.; Goodman, P.C.; Ramadhani, H.O.; Njau, B.N.; Morrissey, A.B.; Maro, V.P.; Saganda, W.; Kinabo, G.D.; Mwako, M.S.; Bartlett, J.A.

    2013-01-01

    Aim: To describe chest radiographic abnormalities and assess their usefulness for predicting causes of fever in a resource-limited setting. Materials and methods: Febrile patients were enrolled in Moshi, Tanzania, and chest radiographs were evaluated by radiologists in Tanzania and the United States. Radiologists were blinded to the results of extensive laboratory evaluations to determine the cause of fever. Results: Of 870 febrile patients, 515 (59.2%) had a chest radiograph available; including 268 (66.5%) of the adolescents and adults, the remainder were infants and children. One hundred and nineteen (44.4%) adults and 51 (20.6%) children were human immunodeficiency virus (HIV)-infected. Among adults, radiographic abnormalities were present in 139 (51.9%), including 77 (28.7%) with homogeneous and heterogeneous lung opacities, 26 (9.7%) with lung nodules, 25 (9.3%) with pleural effusion, 23 (8.6%) with cardiomegaly, and 13 (4.9%) with lymphadenopathy. Among children, radiographic abnormalities were present in 87 (35.2%), including 76 (30.8%) with homogeneous and heterogeneous lung opacities and six (2.4%) with lymphadenopathy. Among adolescents and adults, the presence of opacities was predictive of Streptococcus pneumoniae and Coxiella burnetii, whereas the presence of pulmonary nodules was predictive of Histoplasma capsulatum and Cryptococcus neoformans. Conclusions: Chest radiograph abnormalities among febrile inpatients are common in northern Tanzania. Chest radiography is a useful adjunct for establishing an aetiologic diagnosis of febrile illness and may provide useful information for patient management, in particular for pneumococcal disease, Q fever, and fungal infections

  15. Introducing payment for performance in the health sector of Tanzania- the policy process.

    Science.gov (United States)

    Chimhutu, Victor; Tjomsland, Marit; Songstad, Nils Gunnar; Mrisho, Mwifadhi; Moland, Karen Marie

    2015-09-02

    Prompted by the need to achieve progress in health outcomes, payment for performance (P4P) schemes are becoming popular policy options in the health systems in many low income countries. This paper describes the policy process behind the introduction of a payment for performance scheme in the health sector of Tanzania illuminating in particular the interests of and roles played by the Government of Norway, the Government of Tanzania and the other development partners. The study employed a qualitative research design using in-depth interviews (IDIs), observations and document reviews. Thirteen IDIs with key-informants representing the views of ten donor agencies and government departments influential in the process of introducing the P4P scheme in Tanzania were conducted in Dar es Salaam, Tanzania and Oslo, Norway. Data was collected on the main trends and thematic priorities in development aid policy, countries and actors perceived to be proponents and opponents to the P4P scheme, and P4P agenda setting in Tanzania. The initial introduction of P4P in the health sector of Tanzania was controversial. The actors involved including the bilateral donors in the Health Basket Fund, the World Bank, the Tanzanian Government and high level politicians outside the Health Basket Fund fought for their values and interests and formed alliances that shifted in the course of the process. The process was characterized by high political pressure, conflicts, changing alliances, and, as it evolved, consensus building. The P4P policy process was highly political with external actors playing a significant role in influencing the agenda in Tanzania, leaving less space for the Government of Tanzania to provide leadership in the process. Norway in particular, took a leading role in setting the agenda. The process of introducing P4P became long and frustrating causing mistrust among partners in the Health Basket Fund.

  16. Molecular Characterization of Foot-and-Mouth Disease Viruses Collected in Tanzania Between 1967 and 2009.

    Science.gov (United States)

    Kasanga, C J; Wadsworth, J; Mpelumbe-Ngeleja, C A R; Sallu, R; Kivaria, F; Wambura, P N; Yongolo, M G S; Rweyemamu, M M; Knowles, N J; King, D P

    2015-10-01

    This paper describes the molecular characterization of foot-and-mouth disease viruses (FMDV) recovered from outbreaks in Tanzania that occurred between 1967 and 2009. A total of 44 FMDV isolates, containing representatives of serotypes O, A, SAT 1 and SAT 2 from 13 regions of Tanzania, were selected from the FAO World Reference Laboratory for FMD (WRLFMD) virus collection. VP1 nucleotide sequences were determined for RT-PCR amplicons, and phylogenetic reconstructions were determined by maximum likelihood and neighbour-joining methods. These analyses showed that Tanzanian type O viruses fell into the EAST AFRICA 2 (EA-2) topotype, type A viruses fell into the AFRICA topotype (genotype I), type SAT 1 viruses into topotype I and type SAT 2 viruses into topotype IV. Taken together, these findings reveal that serotypes O, A, SAT 1 and SAT 2 that caused FMD outbreaks in Tanzania were genetically related to lineages and topotypes occurring in the East African region. The close genetic relationship of viruses in Tanzania to those from other countries suggests that animal movements can contribute to virus dispersal in sub-Saharan Africa. This is the first molecular description of viruses circulating in Tanzania and highlights the need for further sampling of representative viruses from the region so as to elucidate the complex epidemiology of FMD in Tanzania and sub-Saharan Africa. © 2014 The Authors. Transboundary and Emerging Diseases Published by Blackwell Verlag GmbH.

  17. Radioactive waste management in Tanzania

    International Nuclear Information System (INIS)

    Banzi, F.P.; Bundala, F.M.; Nyanda, A.M.; Msaki, P.

    2002-01-01

    Radioactive waste, like many other hazardous wastes, is of great concern in Tanzania because of its undesirable health effects. The stochastic effects due to prolonged exposure to ionizing radiation produce cancer and hereditary effects. The deterministic effects due to higher doses cause vomiting, skin reddening, leukemia, and death to exposed victims. The aim of this paper is to give an overview of the status of radioactive wastes in Tanzania, how they are generated and managed to protect humans and the environment. As Tanzania develops, it is bound to increase the use of ionizing radiation in research and teaching, industry, health and agriculture. Already there are more than 42 Centers which use one form of radioisotopes or another for these purposes: Teletherapy (Co-60), Brach-therapy (Cs-137, Sr-89), Nuclear Medicine (P-32, Tc-99m, 1-131, 1-125, Ga-67, In-111, Tl-206), Nuclear gauge (Am-241, Cs- 137, Sr-90, Kr-85), Industrial radiography (Am-241, C-137, Co-60, lr-92), Research and Teaching (1-125, Am241/Be, Co-60, Cs-137, H-3 etc). According to IAEA definition, these radioactive sources become radioactive waste if they meet the following criteria: if they have outlived their usefulness, if they have been abandoned, if they have been displaced without authorization, and if they contaminate other substances. Besides the origin of radioactive wastes, special emphasis will also be placed on the existing radiation regulations that guide disposal of radioactive waste, and the radioactive infrastructure Tanzania needs for ultimate radioactive waste management. Specific examples of incidences (theft, loss, abandonment and illegal possession) of radioactive waste that could have led to serious deterministic radiation effects to humans will also be presented. (author)

  18. Teaching quality improvement in Tanzania: a model of inter-professional partnership for global health development

    Directory of Open Access Journals (Sweden)

    John Kvasnicka

    2017-01-01

    Full Text Available Background: Education is a universal need in health care and a tool for quality improvement. We developed a two-day medical education conference in Iringa, Tanzania, that has now evolved to teach the basics of quality improvement to an inter-professional audience from the 28 hospitals in the southern zone of the Tanzania Christian Social Services Commission (CSSC. Methods: We describe the planning, budget, implementation, evolution and evaluation of this on-going medical education conference. Representatives from medicine, nursing, pharmacy and administration from all 28 hospitals were invited to attend. Attendees evaluated the conference and individual lectures on a 5 point scale. In addition, attendees were asked to rate the most important learning aspect of the conference. Results: Over 100 Tanzanian health professionals and administrators from the 28 hospitals in the southern zone of the CSSC attended. Evaluation forms were completed by 82 attendees. The 2016 conference received an overall rating of 4.0 on a 5 point scale. The individual lectures received an overall rating of 4.2 on a 5 point scale. Quality improvement techniques and co-leadership topics were rated as most useful by attendees. Conclusion: We provide a framework for developing a medical education conference that can be replicated in other settings. Teaching the basics of quality improvement by having hospital leadership teams develop individual quality improvement projects is a highly useful method of instruction.

  19. Stakeholders' opinions and questions regarding the anticipated malaria vaccine in Tanzania.

    Science.gov (United States)

    Mtenga, Sally; Kimweri, Angela; Romore, Idda; Ali, Ali; Exavery, Amon; Sicuri, Elisa; Tanner, Marcel; Abdulla, Salim; Lusingu, John; Kafuruki, Shubi

    2016-04-05

    Within the context of combined interventions, malaria vaccine may provide additional value in malaria prevention. Stakeholders' perspectives are thus critical for informed recommendation of the vaccine in Tanzania. This paper presents the views of stakeholders with regards to malaria vaccine in 12 Tanzanian districts. Quantitative and qualitative methods were employed. A structured questionnaire was administered to 2123 mothers of under five children. Forty-six in-depth interviews and 12 focus group discussions were conducted with teachers, religious leaders, community health workers, health care professionals, and scientists. Quantitative data analysis involved frequency distributions and cross tabulations using Chi square test to determine the association between malaria vaccine acceptability and independent variables. Qualitative data were analysed thematically. Overall, 84.2% of the mothers had perfect acceptance of malaria vaccine. Acceptance varied significantly according to religion, occupation, tribe and region (p Stakeholders had high acceptance and positive opinions towards the combined use of the anticipated malaria vaccine and ITNs, and that their acceptance remains high even when the vaccine may not provide full protection, this is a crucial finding for malaria vaccine policy decisions in Tanzania. An inclusive communication strategy should be designed to address the stakeholders' questions through a process that should engage and be implemented by communities and health care professionals. Social cultural aspects associated with vaccine acceptance should be integrated in the communication strategy.

  20. THIRD PARTY LOGISTIC SERVICE PROVIDER SELECTION USING FUZZY AHP AND TOPSIS METHOD

    Directory of Open Access Journals (Sweden)

    Golam Kabir

    2012-03-01

    Full Text Available The use of third party logistic(3PL services providers is increasing globally to accomplish the strategic objectives. In the increasingly competitive environment, logistics strategic management requires systematic and structured approach to have cutting edge over the rival. Logistics service provider selection is a complex multi-criteria decision making process; in which, decision makers have to deals with the optimization of conflicting objectives such as quality, cost, and delivery time. In this paper, fuzzy analytic hierarchy process (FAHP approach based on technique for order preference by similarity to ideal solution (TOPSIS method has been proposed for evaluating and selecting an appropriate logistics service provider, where the ratings of each alternative and importance weight of each criterion are expressed in triangular fuzzy numbers.

  1. A method of providing a barrier in a fracture-containing system

    DEFF Research Database (Denmark)

    2014-01-01

    The present invention relates to a method of providing a barrier in a fracture-containing system, comprising: i) Providing a treatment fluid comprising: a) a base fluid; b) an elastomeric material, wherein said elastomeric material comprises at least one polymer capable of crosslinking into an el......The present invention relates to a method of providing a barrier in a fracture-containing system, comprising: i) Providing a treatment fluid comprising: a) a base fluid; b) an elastomeric material, wherein said elastomeric material comprises at least one polymer capable of crosslinking...... into an elastomer, and c) at least one crosslinking agent; ii) Placing the treatment fluid in a fracture-containing system; iii) Allowing the elastomeric material to crosslink with itself to form a barrier in said fracture-containing system; wherein the elastomeric material and/or the crosslinking agent...... are of neutral buoyancy with regard to the base fluid. The invention is contemplated to having utility not only in the oil-drilling industry but also in the plugging of fractures in sewer drains, pipelines etc....

  2. Micro Level Perspectives on Growth (Tanzania) | IDRC ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Poverty reduction through growth is the idea behind the market-oriented reforms that Tanzania has undertaken since the mid-1980s. However, poverty is still ... Outputs. Papers. Private sector development in Tanzania : opportunities, challenges and strategic interventions to enhance competitiveness; final report. 42201.

  3. Tanzania | Page 41 | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Alexander Soucy is correct to identify insecticide-treated bednets and inexpensive anti-malarial drugs as crucial to the global fight against malaria ('An easy way to save three million lives,' April 26). Read more about Tanzania ... Legislation on competition brings productivity and business investment to Tanzania. Increasing ...

  4. Water resources management in Tanzania: identifying research ...

    African Journals Online (AJOL)

    This paper aims at identifying research gaps and needs and recommendations for a research agenda on water resources management in Tanzania. We reviewed published literature on water resources management in Tanzania in order to highlight what is currently known, and to identify knowledge gaps, and suggest ...

  5. Tanzania | Page 22 | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Language French. Read more about Quality Improvement for Maternal and Newborn Health in Mtwara Region, Tanzania (IMCHA). Language English. Read more about Building an Enhanced Cadre of Community Health Workers to Improve Maternal and Newborn Health in Rural Tanzania (IMCHA). Language English.

  6. WILDLIFE-BASED DOMESTIC TOURISM IN TANZANIA ...

    African Journals Online (AJOL)

    Dr Osondu

    WILDLIFE-BASED DOMESTIC TOURISM IN TANZANIA: EXPERIENCES FROM. NORTHERN ... affecting domestic tourism was carried out in northern Tanzania tourist circuit. .... Serengeti Plains are shared by NCA and the SNP. Normally, in .... communication network) and social services .... motivation to conserve nature.

  7. Industrializing Secondary Schools in Tanzania through Scientific ...

    African Journals Online (AJOL)

    Industrializing Secondary Schools in Tanzania through Scientific Innovations. ... Huria: Journal of the Open University of Tanzania ... Through review of various innovations developed by universities including SUA, it was established that there are several innovations in different fields especially in crop cultivation, animal ...

  8. ELV Recycling Service Provider Selection Using the Hybrid MCDM Method: A Case Application in China

    Directory of Open Access Journals (Sweden)

    Fuli Zhou

    2016-05-01

    Full Text Available With the rapid depletion of natural resources and undesired environmental changes globally, more interest has been shown in the research of green supply chain practices, including end-of-life vehicle (ELV recycling. The ELV recycling is mandatory for auto-manufacturers by legislation for the purpose of minimizing potential environmental damages. The purpose of the present research is to determine the best choice of ELV recycling service provider by employing an integrating hybrid multi-criteria decision making (MCDM method. In this research, economic, environmental and social factors are taken into consideration. The linguistic variables and trapezoidal fuzzy numbers (TFNs are applied into this evaluation to deal with the vague and qualitative information. With the combined weight calculation of criteria based on fuzzy aggregation and Shannon Entropy techniques, the normative multi-criteria optimization technique (FVIKOR method is applied to explore the best solution. An application was performed based on the proposed hybrid MCDM method, and sensitivity analysis was conducted on different decision making scenarios. The present study provides a decision-making approach on ELV recycling business selection under sustainability and green philosophy with high robustness and easy implementation.

  9. Women, donors and land administration: The Tanzania case

    OpenAIRE

    Pedersen, Rasmus Hundsbæk; Haule, Scholastica

    2013-01-01

    Tanzania's land reform from 1999 has been evaluated as among the most gender-sensitive of its kind in Sub-Saharan Africa. However, there is a gap between the legal framework and what is happening on the ground. This working paper analyses the challenges related to the protection of women's rights to land in rural areas. It provides detailed information on reform implementation experiences so far by analysing a number of government and NGO interventions. It furthermore discusses the ambiguous ...

  10. Barriers to conducting effective obstetric audit in Ifakara: a qualitative assessment in an under-resourced setting in Tanzania

    NARCIS (Netherlands)

    van Hamersveld, K.T.; Bakker, E.; Nyamtema, A.S.; van den Akker, T.; Mfinanga, E.H.; van Elteren, M.; van Roosmalen, J.

    2012-01-01

    Objective To explore barriers to and solutions for effective implementation of obstetric audit at Saint Francis Designated District Hospital in Ifakara, Tanzania, where audit results have been disappointing 2years after its introduction. Methods Qualitative study involving participative observation

  11. System and method of providing quick thermal comfort with reduced energy by using directed spot conditioning

    Science.gov (United States)

    Wang, Mingyu; Kadle, Prasad S.; Ghosh, Debashis; Zima, Mark J.; Wolfe, IV, Edward; Craig, Timothy D

    2016-10-04

    A heating, ventilation, and air conditioning (HVAC) system and a method of controlling a HVAC system that is configured to provide a perceived comfortable ambient environment to an occupant seated in a vehicle cabin. The system includes a nozzle configured to direct an air stream from the HVAC system to the location of a thermally sensitive portion of the body of the occupant. The system also includes a controller configured to determine an air stream temperature and an air stream flow rate necessary to establish the desired heat supply rate for the sensitive portion and provide a comfortable thermal environment by thermally isolating the occupant from the ambient vehicle cabin temperature. The system may include a sensor to determine the location of the sensitive portion. The nozzle may include a thermoelectric device to heat or cool the air stream.

  12. Method of App Selection for Healthcare Providers Based on Consumer Needs.

    Science.gov (United States)

    Lee, Jisan; Kim, Jeongeun

    2018-01-01

    Mobile device applications can be used to manage health. However, healthcare providers hesitate to use them because selection methods that consider the needs of health consumers and identify the most appropriate application are rare. This study aimed to create an effective method of identifying applications that address user needs. Women experiencing dysmenorrhea and premenstrual syndrome were the targeted users. First, we searched for related applications from two major sources of mobile applications. Brainstorming, mind mapping, and persona and scenario techniques were used to create a checklist of relevant criteria, which was used to rate the applications. Of the 2784 applications found, 369 were analyzed quantitatively. Of those, five of the top candidates were evaluated by three groups: application experts, clinical experts, and potential users. All three groups ranked one application the highest; however, the remaining rankings differed. The results of this study suggest that the method created is useful because it considers not only the needs of various users but also the knowledge of application and clinical experts. This study proposes a method for finding and using the best among existing applications and highlights the need for nurses who can understand and combine opinions of users and application and clinical experts.

  13. Discussion of a method for providing general risk information by linking with the nuclear information

    International Nuclear Information System (INIS)

    Shobu, Nobuhiro; Yokomizo, Shirou; Umezawa, Sayaka

    2004-06-01

    'Risk information navigator (http://www.ricotti.jp/risknavi/)', an internet tool for arousing public interest and fostering people's risk literacy, has been developed as the contents for the official website of Techno Community Square 'RICOTTI' (http://www.ricotti.jp) at TOKAI village. In this report we classified the risk information into the fields, Health/Daily Life', 'Society/Crime/Disaster' and Technology/Environment/Energy', for the internet tool contents. According to these categories we discussed a method for providing various risk information on general fields by linking with the information on nuclear field. The web contents are attached to this report with the CD-R media. (author)

  14. Discharge measurements of the River Rufiji (Tanzania) using artificial tritium

    International Nuclear Information System (INIS)

    Dincer, T.; Florkowski, T.; Salamba, S.

    1984-01-01

    The use of chemical or radioactive tracers for measuring stream flow is now the established method for discharges up to about 200 m 3 /s. For larger flows and higher suspended load the chemical tracers and also gamma-emitting radioactive tracers become cumbersome if not impossible to use when good accuracy is required. Tritiated water proved to be a good and safe tracer, provided care is taken in handling (no contamination of samples) and the experiments are adequately planned (good estimation of mixing lengths, water velocity and sampling duration). The paper describes discharge measurements performed in 1982 and 1983 in the river Rufiji (Tanzania). Flow rates up to 2000 m 3 /s have been measured, with estimated errors varying between 2 and 4%. Because of high river turbulence in the measurement section, good mixing has been observed over a distance of 7 km (this is much shorter than the distance recommended by various formulae for calculating the mixing length). The problem of selecting the mixing length is discussed and recommendations are given for planning future experiments. Sample contamination as experienced during the first phase of measurements in the river Rufiji is also treated. It is concluded that, technically and economically, the tritium tracer method is feasible for calibrating rating curves (water stage/flow relationship) in turbulent large rivers, also in remote areas. (author)

  15. A method to provide rapid in situ determination of tip radius in dynamic atomic force microscopy

    International Nuclear Information System (INIS)

    Santos, Sergio; Guang Li; Souier, Tewfik; Gadelrab, Karim; Chiesa, Matteo; Thomson, Neil H.

    2012-01-01

    We provide a method to characterize the tip radius of an atomic force microscopy in situ by monitoring the dynamics of the cantilever in ambient conditions. The key concept is that the value of free amplitude for which transitions from the attractive to repulsive force regimes are observed, strongly depends on the curvature of the tip. In practice, the smaller the value of free amplitude required to observe a transition, the sharper the tip. This general behavior is remarkably independent of the properties of the sample and cantilever characteristics and shows the strong dependence of the transitions on the tip radius. The main advantage of this method is rapid in situ characterization. Rapid in situ characterization enables one to continuously monitor the tip size during experiments. Further, we show how to reproducibly shape the tip from a given initial size to any chosen larger size. This approach combined with the in situ tip size monitoring enables quantitative comparison of materials measurements between samples. These methods are set to allow quantitative data acquisition and make direct data comparison readily available in the community.

  16. An analysis of pre-service family planning teaching in clinical and nursing education in Tanzania.

    Science.gov (United States)

    Muganyizi, Projestine S; Ishengoma, Joyce; Kanama, Joseph; Kikumbih, Nassoro; Mwanga, Feddy; Killian, Richard; McGinn, Erin

    2014-07-12

    Promoting family planning (FP) is a key strategy for health, economic and population growth. Sub-Saharan Africa, with one of the lowest contraceptive prevalence and highest fertility rates globally, contributes half of the global maternal deaths. Improving the quality of FP services, including enhancing pre-service FP teaching, has the potential to improve contraceptive prevalence. In efforts to improve the quality of FP services in Tanzania, including provider skills, this study sought to identify gaps in pre-service FP teaching and suggest opportunities for strengthening the training. Data were collected from all medical schools and a representative sample of pre-service nursing, Assistant Medical Officer (AMO), Clinical Officer (CO) and assistant CO schools in mainland Tanzania. Teachers responsible for FP teaching at the schools were interviewed using a semi-structured questionnaire. Observations on availability of teaching resources and other evidence of FP teaching and evaluation were documented. Relevant approved teaching documents were assessed for their suitability as competency-based FP teaching tools against predefined criteria. Quantitative data were analyzed using EPI Info 6 and qualitative data were manually analyzed using content analysis. A total of 35 pre-service schools were evaluated for FP teaching including 30 technical education and five degree offering schools. Of the assessed 11 pre-service curricula, only one met the criteria for suitability of FP teaching. FP teaching was typically theoretical with only 22.9% of all the schools having systems in place to produce graduates who could skillfully provide FP methods. Across schools, the target skills were the same level of competence and skewed toward short acting methods of contraception. Only 23.3% (n = 7) of schools had skills laboratories, 76% (n = 22) were either physically connected or linked to FP clinics. None of the degree providing schools practiced FP at its own teaching hospital

  17. Method for providing slip energy control in permanent magnet electrical machines

    Science.gov (United States)

    Hsu, John S.

    2006-11-14

    An electric machine (40) has a stator (43), a permanent magnet rotor (38) with permanent magnets (39) and a magnetic coupling uncluttered rotor (46) for inducing a slip energy current in secondary coils (47). A dc flux can be produced in the uncluttered rotor when the secondary coils are fed with dc currents. The magnetic coupling uncluttered rotor (46) has magnetic brushes (A, B, C, D) which couple flux in through the rotor (46) to the secondary coils (47c, 47d) without inducing a current in the rotor (46) and without coupling a stator rotational energy component to the secondary coils (47c, 47d). The machine can be operated as a motor or a generator in multi-phase or single-phase embodiments and is applicable to the hybrid electric vehicle. A method of providing a slip energy controller is also disclosed.

  18. Væksten i Tanzania

    OpenAIRE

    Haagen Larsen, Pernille; Schack Wiedenbeien, Emma; Nørreager Christensen, Martin; Høj Brunn, Christoffer; Ferklov, Vladik

    2014-01-01

    In our group, it has been decided to write about the growth in Africa. We believe a conflict can be seen between the year of focus to effort an improvement in Africa’s growth and the lack of change. However it is to be seen that there is a noticeable change compared to the time minimal effort spent. As case we have chosen to look at the conditions of establishing further expanding, development and growth of one of the poorest countries in the world, Tanzania. We have chosen to look into the e...

  19. Providing the physical basis of SCS curve number method and its proportionality relationship from Richards' equation

    Science.gov (United States)

    Hooshyar, M.; Wang, D.

    2016-12-01

    The empirical proportionality relationship, which indicates that the ratio of cumulative surface runoff and infiltration to their corresponding potentials are equal, is the basis of the extensively used Soil Conservation Service Curve Number (SCS-CN) method. The objective of this paper is to provide the physical basis of the SCS-CN method and its proportionality hypothesis from the infiltration excess runoff generation perspective. To achieve this purpose, an analytical solution of Richards' equation is derived for ponded infiltration in shallow water table environment under the following boundary conditions: 1) the soil is saturated at the land surface; and 2) there is a no-flux boundary which moves downward. The solution is established based on the assumptions of negligible gravitational effect, constant soil water diffusivity, and hydrostatic soil moisture profile between the no-flux boundary and water table. Based on the derived analytical solution, the proportionality hypothesis is a reasonable approximation for rainfall partitioning at the early stage of ponded infiltration in areas with a shallow water table for coarse textured soils.

  20. Content and Methods used to Train Tobacco Cessation Treatment Providers: An International Survey.

    Science.gov (United States)

    Kruse, Gina R; Rigotti, Nancy A; Raw, Martin; McNeill, Ann; Murray, Rachael; Piné-Abata, Hembadoon; Bitton, Asaf; McEwen, Andy

    2017-12-01

    There are limited existing data describing the training methods used to educate tobacco cessation treatment providers around the world. To measure the prevalence of tobacco cessation treatment content, skills training and teaching methods reported by tobacco treatment training programs across the world. Web-based survey in May-September 2013 among tobacco cessation training experts across six geographic regions and four World Bank income levels. Response rate was 73% (84 of 115 countries contacted). Of 104 individual programs from 84 countries, most reported teaching brief advice (78%) and one-to-one counseling (74%); telephone counseling was uncommon (33%). Overall, teaching of knowledge topics was more commonly reported than skills training. Programs in lower income countries less often reported teaching about medications, behavioral treatments and biomarkers and less often reported skills-based training about interviewing clients, medication management, biomarker measurement, assessing client outcomes, and assisting clients with co-morbidities. Programs reported a median 15 hours of training. Face-to-face training was common (85%); online programs were rare (19%). Almost half (47%) included no learner assessment. Only 35% offered continuing education. Nearly all programs reported teaching evidence-based treatment modalities in a face-to-face format. Few programs delivered training online or offered continuing education. Skills-based training was less common among low- and middle-income countries (LMICs). There is a large unmet need for tobacco treatment training protocols which emphasize practical skills, and which are more rapidly scalable than face-to-face training in LMICs.

  1. Implementing Modular Interactive Tiles for Rehabilitation in Tanzania – a pilot study

    DEFF Research Database (Denmark)

    Lund, Henrik Hautop; Jensen, Line Steiness Dejnbjerg; Ssessanga, Yusuf

    2014-01-01

    The pilot study in the Iringa region, Tanzania, indicates how the modular interactive tiles can be used for playful physical rehabilitation for many diverse patient groups (handicapped children, stroke, cardiac, diabetic patients, etc.) in both urban and rural areas, and how it motivates the user...... and adaptive playful technology for rehabilitation in sub-Saharan Africa....... through play to perform the physical rehabilitative actions. The system can be easily used by rehabilitation workers, and through the modularity it is robust to failure (e.g. power failure) in remote areas. The analyses of the use by many different user groups was condensed to a higher abstraction level...... to provide insight on the generalisation over the different user groups, and to provide pointers of opportunities and the means to meet these opportunities through subsequent development in the next cycles in the iterative research method. The pilot study indicates that the system can be a flexible...

  2. Development and Climate Change in Tanzania. Focus on Mount Kilimanjaro

    International Nuclear Information System (INIS)

    Agrawala, S.; Moehner, A.; Van Aalst, M.; Smith, J.; Hitz, S.; Hemp, A.; Meena, H.; Mwakifwamba, S.M.; Hyera, T.; Mwaipopo, O.U.

    2003-01-01

    This document is an output from the OECD Development and Climate Change project, an activity jointly overseen by the EPOC Working Party on Global and Structural Policies (WPGSP), and the DAC Network on Environment and Development Co-operation (ENVIRONET). The overall objective of the project is to provide guidance on how to mainstream responses to climate change within economic development planning and assistance policies, with natural resource management as an overarching theme. This report presents the integrated case study for Tanzania carried out under an OECD project on Development and Climate Change. The report is structured around a three-tiered framework. First, recent climate trends and climate change scenarios for Tanzania are assessed, and key sectoral impacts are identified and ranked along multiple indicators to establish priorities for adaptation. Second, donor portfolios in Tanzania are analyzed to examine the proportion of donor activities affected by climate risks. A desk analysis of donor strategies and project documents as well as national plans is conducted to assess the degree of attention to climate change concerns in development planning and assistance. Third, an in-depth analysis is conducted for climate change impacts and response strategies for Mount Kilimanjaro - a critical ecosystem, biodiversity hotspot, and source of freshwater. This part of the analysis draws upon extended field research by a case study consultant in collaboration with national and international partners

  3. Protecting the rights of people with HIV. Tanzania.

    Science.gov (United States)

    Temba, P

    1997-04-01

    In Tanzania, preliminary efforts are underway to protect the human rights of people with HIV/AIDS. Tanzania, which has been criticized for failing to recognize human rights abuses against people with HIV/AIDS, is the 15th country in sub-Saharan Africa to establish a regional network of physicians, lawyers, and nongovernmental organizations seeking to protect the rights of people with HIV/AIDS and those vulnerable to the infection with appropriate legislation and policies. Discrimination, which hastens spread of the disease by forcing it underground, is found even among medical personnel who disclose patient information without consent or refuse to treat patients with HIV/AIDS. Certain laws also compromise the rights of infected people by requiring physicians to tender medical reports before the courts, permitting employers to force employees to undergo HIV testing, or requiring rape victims to provide an excessive burden of proof. Participants at a recent workshop recommended a review of national AIDS policy and changes in the law. A computer database will be used to track HIV/AIDS-related human rights abuses in Tanzania.

  4. Community Based Nutrition Rehabilitation in Tanzania: Challenges and Lessons Learned

    International Nuclear Information System (INIS)

    Urio, Elisaphinate Moses; Jeje, Benedict; Ndossi, Godwin

    2014-01-01

    Full text: Malnutrition among children under the age of five continues to be a significant public health problem in Tanzania. Despite numerous nutritional interventions that have been implemented, the country still experiences high rates of malnutrition. According to Tanzania Demographic and Health Survey of 2010 the prevalence of underweight was estimated to be 16%, wasting 5% and stunting 42 %. Factors contributing to causes of malnutrition include immediate, underlying and basic causes. All these factors are interlinked and operate synergistically and not independently. Approaches for managing malnourished children in Tanzania evolved from facility based Nutrition Rehabilitation Units (NURU) in the late 1960s to Community Based Nutrition Rehabilitation (CBNR) in late 1980s. In the latter approach, malnourished children are rehabilitated in the same environment (village, home) that precipitated the condition, using resources and infrastructures available in the community. Mothers are taught about child feeding using family foods to make good food mixtures and of the importance of feeding frequency for the young child. Limitations for this approach include inadequate advocacy to leaders from districts down to the community level, few trained health providers and community health workers on knowledge and skills on community based nutrition rehabilitation, inadequate equipment and supplies for identification and categorization of malnutrition, low awareness of parents, care givers and community leaders on home rehabilitation of malnourished children. Nonetheless, Community Based Nutrition Rehabilitation approach has the potential to address malnutrition in children given political will and resources. (author)

  5. Managing nuclear information in Tanzania

    International Nuclear Information System (INIS)

    Sawe, S.F.; Sungita, Y.Y.

    2004-01-01

    Nuclear information management and the applications of nuclear technology in Tanzania are limited to medical, agriculture, research and some industrial applications. It is demanding that the National database for nuclear information be established to keep the track of the information on radiation facilities, manpower development, radiation sources and radioactive waste management. In this paper the current status of nuclear information management in Tanzania is presented. The development, setbacks and future plans for establishment of national database with consequent improvement of nuclear information management are discussed. The National Radiation Commission (NRC) which is an official government body responsible for atomic energy matters in collaboration with other institutions applying nuclear technology keeps the records and inventory of facilities, manpower development and projects related to the nuclear field. The available information about nuclear application activities has been obtained through possessors' declaration, monitoring at entry/exit points, periodic reports from the licensees, radiation safety inspections, and the available link with the International Atomic Energy Agency (IAEA). In order to facilitate the dissemination of information, five ICT centres to serve in the fields of research, nuclear instrumentation, human health and agriculture have been established. The inventory of radiation facilities/materials and human resource is being build up as an initial input to the National database. Establishment of INIS centre is expected to improve the nuclear information management system in the country. The government and the IAEA are encouraged to support nuclear information management especially by strengthening ICT centres and facilitating the establishment of INIS National centre. (author)

  6. Managing nuclear information in Tanzania

    International Nuclear Information System (INIS)

    Sawe, S.F.; Sungita, Y.Y.

    2004-01-01

    Full text: Nuclear information management and the applications of nuclear technology in Tanzania are limited to medical, agriculture, research and some industrial applications. It is demanding that the National database for nuclear information be established to keep the track of the information on radiation facilities, manpower development, radiation sources and radioactive waste management. In this paper the current status of nuclear information management in Tanzania is presented. The development, setbacks and future plans for establishment of national database with consequent improvement of nuclear information management are discussed. The National Radiation Commission (NRC) which is an official government body responsible for atomic energy matters in collaboration with other institutions applying nuclear technology, keeps the records and inventory of facilities, manpower development and projects related to the nuclear field. The available information about nuclear application activities has been obtained through possessors' declaration, monitoring at entry/exit points, periodic reports from the licensees, radiation safety inspections, and the available link with the International Atomic Agency (IAEA). In order to facilitate the dissemination of information, five ICT centers to serve in the fields of research, nuclear instrumentation, human health and agriculture have been established. The inventory of radiation facilities/materials and human resource is being build up as an initial input to the National database. Establishment of INIS center is expected to improve the nuclear information management system in the country. The government and the IAEA are encouraged to support nuclear information management especially by strengthening ICT centers and facilitating the establishment of INIS National center. (author)

  7. Development of guidance and methodical documents for providing the decommissioning of radiation-hazardous objects

    International Nuclear Information System (INIS)

    Ermakov, A.

    2015-01-01

    Federal Center for Nuclear and Radiation Safety (JSC FCNRS) developed and approbated guidance and methodical documents for providing the facility to radiologically safe status in the course of Building B decommissioning activity at JSC VNIINM (A.A. Bochvar High-Technology Scientific Research Institute for Inorganic Materials). The scope of application of the documents developed is as follows: - preliminary segregation of radwaste into streams during its collection and preparation for removal from facilities/sites under decommissioning; - express assessment of specific activity (activity) of radwaste generated in the course of dismantling and decontamination activities; - radiological survey of premises and building structures following completion of dismantling and decontamination activities; - SRW processing (compaction, reduction in size), packaging, characterisation and containerisation in order to reduce risks of spread of radioactive contamination. Documents that have been developed can be used both at nuclear facilities/ sites similar to the JSC VNIINM Building B in terms of work stages and types of waste to be generated, and other facilities/ sites taking into consideration their peculiarities. (author)

  8. Abyssinian Scimitarbill Rhinopomastus minor cabanisi in Tanzania ...

    African Journals Online (AJOL)

    2013-12-27

    Dec 27, 2013 ... in Tanzania: a breeding record in a traditional beehive ... Scimitarbills Rhinopomastus minor entering a hole on the bottom of one of the bee- ... resident of open bushed and wooded habitats in lower rainfall areas east of Lake.

  9. Financial Institutions And Poverty Alleviation In Tanzania ...

    African Journals Online (AJOL)

    Financial institutions in Tanzania have operated under a competitive financial system ... to move away from the tenets of a centrally planned economy towards free-market orientation. ... They have also favored traders rather than producers.

  10. WILDLIFE-BASED DOMESTIC TOURISM IN TANZANIA ...

    African Journals Online (AJOL)

    Dr Osondu

    industry in Tanzania economy, it has been shown repeatedly ... What factors restrain faster growth of domestic .... needs (i.e. food, clothing and shelter) is no longer ... communication network) and social services ..... Advertising, Promotion and.

  11. Tanzania Journal of Science: Editorial Policies

    African Journals Online (AJOL)

    Tanzania Journal of Science (TJS), is professional, peer reviewed journal, published in ... Optics, Thin films, Zoography, Military sciences, Biological sciences, Biodiversity, ... animal and veterinary sciences, Geology, Agricultural Sciences, Cytology, ... available to the public supports a greater global exchange of knowledge.

  12. Water Resources Management in Tanzania: Identifying Research ...

    African Journals Online (AJOL)

    by human-induced activities. Over the past ... Review of water resources management in Tanzania; Global literature review on water resources ..... requirements for biodiversity and human health. .... Global warming is altering regional climates.

  13. Tanzania's Revealed Comparative Advantage and Structural ...

    African Journals Online (AJOL)

    example, the contribution from vegetable products fell by 7%, and that from textiles .... 43 -‐ Furskins and artificial fur, manufactures thereof ... example, while Tanzania has comparative advantage in raw hides and skins (see Figure 6), it.

  14. african indigenous and traditional vegetables in tanzania

    African Journals Online (AJOL)

    ACSS

    A questionnaire-based survey was conducted in four regions of Tanzania with a total of 160 sellers ... washing; and (iii) marketing: retail markup, price variation by season, year and region, ..... and endosulfan and metalaxyl/mencozeb mix as.

  15. Tanzania Monitoring and Evaluation Management Services

    Data.gov (United States)

    US Agency for International Development — MEMS II is a two-year project to enable USAID/Tanzania and a number of its partners to meet their multifold performance reporting responsibilities; upgrade,...

  16. Antenatal care in practice: an exploratory study in antenatal care clinics in the Kilombero Valley, south-eastern Tanzania

    Directory of Open Access Journals (Sweden)

    Kessy Flora

    2011-05-01

    Full Text Available Abstract Background The potential of antenatal care for reducing maternal morbidity and improving newborn survival and health is widely acknowledged. Yet there are worrying gaps in knowledge of the quality of antenatal care provided in Tanzania. In particular, determinants of health workers' performance have not yet been fully understood. This paper uses ethnographic methods to document health workers' antenatal care practices with reference to the national Focused Antenatal Care guidelines and identifies factors influencing health workers' performance. Potential implications for improving antenatal care provision in Tanzania are discussed. Methods Combining different qualitative techniques, we studied health workers' antenatal care practices in four public antenatal care clinics in the Kilombero Valley, south-eastern Tanzania. A total of 36 antenatal care consultations were observed and compared with the Focused Antenatal Care guidelines. Participant observation, informal discussions and in-depth interviews with the staff helped to identify and explain health workers' practices and contextual factors influencing antenatal care provision. Results The delivery of antenatal care services to pregnant women at the selected antenatal care clinics varied widely. Some services that are recommended by the Focused Antenatal Care guidelines were given to all women while other services were not delivered at all. Factors influencing health workers' practices were poor implementation of the Focused Antenatal Care guidelines, lack of trained staff and absenteeism, supply shortages and use of working tools that are not consistent with the Focused Antenatal Care guidelines. Health workers react to difficult working conditions by developing informal practices as coping strategies or "street-level bureaucracy". Conclusions Efforts to improve antenatal care should address shortages of trained staff through expanding training opportunities, including health worker

  17. The Effect of Health Information Technology on Health Care Provider Communication: A Mixed-Method Protocol.

    Science.gov (United States)

    Manojlovich, Milisa; Adler-Milstein, Julia; Harrod, Molly; Sales, Anne; Hofer, Timothy P; Saint, Sanjay; Krein, Sarah L

    2015-06-11

    Communication failures between physicians and nurses are one of the most common causes of adverse events for hospitalized patients, as well as a major root cause of all sentinel events. Communication technology (ie, the electronic medical record, computerized provider order entry, email, and pagers), which is a component of health information technology (HIT), may help reduce some communication failures but increase others because of an inadequate understanding of how communication technology is used. Increasing use of health information and communication technologies is likely to affect communication between nurses and physicians. The purpose of this study is to describe, in detail, how health information and communication technologies facilitate or hinder communication between nurses and physicians with the ultimate goal of identifying how we can optimize the use of these technologies to support effective communication. Effective communication is the process of developing shared understanding between communicators by establishing, testing, and maintaining relationships. Our theoretical model, based in communication and sociology theories, describes how health information and communication technologies affect communication through communication practices (ie, use of rich media; the location and availability of computers) and work relationships (ie, hierarchies and team stability). Therefore we seek to (1) identify the range of health information and communication technologies used in a national sample of medical-surgical acute care units, (2) describe communication practices and work relationships that may be influenced by health information and communication technologies in these same settings, and (3) explore how differences in health information and communication technologies, communication practices, and work relationships between physicians and nurses influence communication. This 4-year study uses a sequential mixed-methods design, beginning with a

  18. Toward a nitrogen footprint calculator for Tanzania

    Science.gov (United States)

    Hutton, Mary Olivia; Leach, Allison M.; Leip, Adrian; Galloway, James N.; Bekunda, Mateete; Sullivan, Clare; Lesschen, Jan Peter

    2017-03-01

    We present the first nitrogen footprint model for a developing country: Tanzania. Nitrogen (N) is a crucial element for agriculture and human nutrition, but in excess it can cause serious environmental damage. The Sub-Saharan African nation of Tanzania faces a two-sided nitrogen problem: while there is not enough soil nitrogen to produce adequate food, excess nitrogen that escapes into the environment causes a cascade of ecological and human health problems. To identify, quantify, and contribute to solving these problems, this paper presents a nitrogen footprint tool for Tanzania. This nitrogen footprint tool is a concept originally designed for the United States of America (USA) and other developed countries. It uses personal resource consumption data to calculate a per-capita nitrogen footprint. The Tanzania N footprint tool is a version adapted to reflect the low-input, integrated agricultural system of Tanzania. This is reflected by calculating two sets of virtual N factors to describe N losses during food production: one for fertilized farms and one for unfertilized farms. Soil mining factors are also calculated for the first time to address the amount of N removed from the soil to produce food. The average per-capita nitrogen footprint of Tanzania is 10 kg N yr-1. 88% of this footprint is due to food consumption and production, while only 12% of the footprint is due to energy use. Although 91% of farms in Tanzania are unfertilized, the large contribution of fertilized farms to N losses causes unfertilized farms to make up just 83% of the food production N footprint. In a developing country like Tanzania, the main audiences for the N footprint tool are community leaders, planners, and developers who can impact decision-making and use the calculator to plan positive changes for nitrogen sustainability in the developing world.

  19. A method for analyzing the business case for provider participation in the National Cancer Institute's Community Clinical Oncology Program and similar federally funded, provider-based research networks.

    Science.gov (United States)

    Reiter, Kristin L; Song, Paula H; Minasian, Lori; Good, Marjorie; Weiner, Bryan J; McAlearney, Ann Scheck

    2012-09-01

    The Community Clinical Oncology Program (CCOP) plays an essential role in the efforts of the National Cancer Institute (NCI) to increase enrollment in clinical trials. Currently, there is little practical guidance in the literature to assist provider organizations in analyzing the return on investment (ROI), or business case, for establishing and operating a provider-based research network (PBRN) such as the CCOP. In this article, the authors present a conceptual model of the business case for PBRN participation, a spreadsheet-based tool and advice for evaluating the business case for provider participation in a CCOP organization. A comparative, case-study approach was used to identify key components of the business case for hospitals attempting to support a CCOP research infrastructure. Semistructured interviews were conducted with providers and administrators. Key themes were identified and used to develop the financial analysis tool. Key components of the business case included CCOP start-up costs, direct revenue from the NCI CCOP grant, direct expenses required to maintain the CCOP research infrastructure, and incidental benefits, most notably downstream revenues from CCOP patients. The authors recognized the value of incidental benefits as an important contributor to the business case for CCOP participation; however, currently, this component is not calculated. The current results indicated that providing a method for documenting the business case for CCOP or other PBRN involvement will contribute to the long-term sustainability and expansion of these programs by improving providers' understanding of the financial implications of participation. Copyright © 2011 American Cancer Society.

  20. Electronic Field Data Collection in Support of Satellite-Based Food Security Monitoring in Tanzania

    Science.gov (United States)

    Nakalembe, C. L.; Dempewolf, J.; Justice, C. J.; Becker-Reshef, I.; Tumbo, S.; Maurice, S.; Mbilinyi, B.; Ibrahim, K.; Materu, S.

    2016-12-01

    In Tanzania agricultural extension agents traditionally collect field data on agriculture and food security on paper, covering most villages throughout the country. The process is expensive, slow and cumbersome and prone to data transcription errors when the data get entered at the district offices into electronic spreadsheets. Field data on the status and condition of agricultural crops, the population's nutritional status, food storage levels and other parameters are needed in near realtime for early warning to make critical but most importantly timely and appropriate decisions that are informed with verified data from the ground. With the ubiquitous distribution of cell phones, which are now used by the vast majority of the population in Tanzania including most farmers, new, efficient and cost-effective methods for field data collection have become available. Using smartphones and tablets data on crop conditions, pest and diseases, natural disasters and livelihoods can be collected and made available and easily accessible in near realtime. In this project we implemented a process for obtaining high quality electronic field data using the GeoODK application with a large network of field extension agents in Tanzania and Uganda. These efforts contribute to work being done on developing an advanced agriculture monitoring system for Tanzania, incorporating traditional data collection with satellite information and field data. The outcomes feed directly into the National Food Security Bulletin for Tanzania produced by the Ministry of Agriculture as well as a form a firm evidence base and field scale monitoring of the disaster risk financing in Uganda.

  1. The status of occupational safety among health service providers in ...

    African Journals Online (AJOL)

    identify and bring under control at workplaces all health risks; provide ... on the status of occupational safety among hospital workers in Tanzania. ..... The assistance from the IPC/IS. National ... tions of the Healthcare Infection Prevention.

  2. A mixed methods study of patient-provider communication about opioid analgesics.

    Science.gov (United States)

    Hughes, Helen Kinsman; Korthuis, Philip Todd; Saha, Somnath; Eggly, Susan; Sharp, Victoria; Cohn, Jonathan; Moore, Richard; Beach, Mary Catherine

    2015-04-01

    To describe patient-provider communication about opioid pain medicine and explore how these discussions affect provider attitudes toward patients. We audio-recorded 45 HIV providers and 423 patients in routine outpatient encounters at four sites across the country. Providers completed post-visit questionnaires assessing their attitudes toward patients. We identified discussions about opioid pain management and analyzed them qualitatively. We used logistic regression to assess the association between opioid discussion and providers' attitudes toward patients. 48 encounters (11% of the total sample) contained substantive discussion of opioid-related pain management. Most conversations were initiated by patients (n=28, 58%) and ended by the providers (n=36, 75%). Twelve encounters (25%) contained dialog suggesting a difference of opinion or conflict. Providers more often agreed than disagreed to give the prescription (50% vs. 23%), sometimes reluctantly; in 27% (n=13) of encounters, no decision was made. Fewer than half of providers (n=20, 42%) acknowledged the patient's experience of pain. Providers had a lower odds of positive regard for the patient (adjusted OR=0.51, 95% CI: 0.27-0.95) when opioids were discussed. Pain management discussions are common in routine outpatient HIV encounters and providers may regard patients less favorably if opioids are discussed during visits. The sometimes-adversarial nature of these discussions may negatively affect provider attitudes toward patients. Empathy and pain acknowledgment are tools that clinicians can use to facilitate productive discussions of pain management. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  3. Impediments of E-Learning Adoption in Higher Learning Institutions of Tanzania: An Empirical Review

    Science.gov (United States)

    Mwakyusa, Wilson Pholld; Mwalyagile, Neema Venance

    2016-01-01

    It is experienced that most of the Higher Learning Institutions (HLIs) in developing countries including Tanzania fails to fully implement e-learning system as a an alternative method of delivering education to a large population in the universities. However, some of HLIs are practicing the blended method by which both elearning and traditional…

  4. Three years of HIV/AIDS care and treatment services in Tanzania ...

    African Journals Online (AJOL)

    The Tanzania HIV Care and Treatment Plan was launched in October 2004 aiming at providing 440,000 AIDS patients with antiretroviral drugs (ARVs) and track disease progression in 1.2 million HIV+ persons by the end of the 2008. This paper is intended to provide information to stake holders of the achievements and ...

  5. Relationships matter: contraceptive choices among HIV-positive women in Tanzania.

    Science.gov (United States)

    Nyanja, Tabitha Alexandria Njeri; Tulinius, Charlotte

    2017-07-01

    Efforts to eliminate mother-to-child transmission of HIV in Tanzania are guided by a four-prong strategy advocated by the World Health Organization (WHO). Prong 2, prevention of unintended pregnancies among women living with HIV, has, however, received the least attention and contraceptive use to prevent unintended pregnancies remains low. This study explored the perceived barriers to the use of modern methods of contraception, and factors influencing contraceptive choice among HIV-positive women in urban Dar-es-Salaam, Tanzania. A qualitative multi-site study was conducted, utilising in-depth interviews and focus group discussions with 37 sexually active HIV-positive women aged between 20 and 44 years, attending three health facilities within Dar-es-Salaam. The theoretical framework was a patient centred model. Four barriers were identified: the influence of the women's spousal relationships; personal beliefs and the relationship of these in understanding her disease; the influence of the social demands on the woman and her relationships; and the importance of a woman's relationship with her healthcare provider/healthcare system. Being the bearers of bad news (HIV-positive status) the pregnant women experienced conflicts, violence, abandonment and rejection. The loss in negotiating power for the women was in relation to their intimate partners, but also in the patient-healthcare provider relationship. The role of the male partner as a barrier to contraceptive use cannot be understated. Therefore, the results suggest that healthcare providers should ensure patient-focused education and provide support that encompasses the importance of their relationships. Additional research is required to elucidate the functional association between contraceptive choices and personal and social relationships.

  6. All projects related to Tanzania | Page 4 | IDRC - International ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Across Africa, postharvest losses along the food chain from farm to fork jeopardize the food ... Region: North of Sahara, South of Sahara, Benin, Ghana, Kenya, Malawi, Mozambique, Tanzania ... Integrated crop and goat breeding in Tanzania.

  7. Archives: Tanzania Journal of Forestry and Nature Conservation

    African Journals Online (AJOL)

    Items 1 - 18 of 18 ... Archives: Tanzania Journal of Forestry and Nature Conservation. Journal Home > Archives: Tanzania Journal of Forestry and Nature Conservation. Log in or Register to get access to full text downloads.

  8. Tanzania Journal of Forestry and Nature Conservation: Journal ...

    African Journals Online (AJOL)

    Tanzania Journal of Forestry and Nature Conservation: Journal Sponsorship. Journal Home > About the Journal > Tanzania Journal of Forestry and Nature Conservation: Journal Sponsorship. Log in or Register to get access to full text downloads.

  9. Tanzania Veterinary Journal - Vol 32, No 1 (2017)

    African Journals Online (AJOL)

    Tanzania Veterinary Journal - Vol 32, No 1 (2017) ... factors for porcine cysticercosis transmission and animal welfare in selected villages in Nyasa, Tanzania ... Thoracic radiographic anatomy in sheep · EMAIL FULL TEXT EMAIL FULL TEXT

  10. Socio-economic Status and Women Empowerment in Rural Tanzania

    African Journals Online (AJOL)

    Socio-economic Status and Women Empowerment in Rural Tanzania: A Case of Onion ... Tanzania Journal of Development Studies ... Therefore the government, nongovernmental organisations and development programmes espousing to ...

  11. Intensification of Shifting Cultivation in Tanzania: Degree, Drivers and Effects on Vegetation and Soils

    DEFF Research Database (Denmark)

    Kilawe, Charles Joseph

    The aim of the present study was to provide a better understanding of the degree and drivers of intensification of shifting cultivation and its effects on vegetation and soils. The study was conducted in uplands and low lands agro-ecological zones of Kilosa District, eastern central Tanzania. Data...... and intensive short fallow systems. They also adopted intensive land preparation methods that involved deep cultivation and burying of vegetation. Intensification in upland was driven by adoption and enforcement of land tenure policies which restrict shifting cultivation whereas in the lowlands, it was driven...... that sustainable intensification of shifting cultivation be sought to prevent further adverse effects on the environment. The present restrictive policy driven approach of intensification of shifting cultivation seems to cause more negative environmental consequences. I recommend development and promotion...

  12. Sexual and reproductive health and HIV in border districts affected by migration and poverty in Tanzania

    DEFF Research Database (Denmark)

    Obel, Josephine; Larsson, Markus; Sodemann, Morten

    2014-01-01

    Objectives To assess HIV knowledge, attitudes, sexual practices and sexual and reproductive health (SRH) service delivery in border areas of Tanzania, with a view to support the prioritisation of SRH interventions in border areas. Methods The target sample comprised randomly selected people living...... near the border, aged 15 to 49 years. To gather information, we utilised: (i) a standardised questionnaire (n = 86; 42 men and 44 women) previously used in national household surveys conducted by the Tanzanian government; (ii) focus group discussions (ten male groups, n = 47; ten female groups, n = 51......); and (iii) semi-structured interviews with service providers (n = 37). Results The mean number of sexual partners, frequency of multiple concurrent partnerships and engagement in transactional sex were significantly higher in the border community than in the national population. Knowledge about HIV...

  13. Devices and methods of operation thereof for providing stable flow for centrifugal compressors

    Science.gov (United States)

    Skoch, Gary J. (Inventor); Stevens, Mark A. (Inventor); Jett, Thomas A. (Inventor)

    2008-01-01

    Centrifugal compressor flow stabilizing devices and methods of operation thereof are disclosed that act upon the flow field discharging from the impeller of a centrifugal compressor and modify the flow field ahead of the diffuser vanes such that flow conditions contributing to rotating stall and surge are reduced or even eliminated. In some embodiments, shaped rods and methods of operation thereof are disclosed, whereas in other embodiments reverse-tangent air injection devices and methods are disclosed.

  14. Back to Office Report. Mission no.1 to Tanzania as counterpart institution to Cleaner Production Centre of Tanzania

    DEFF Research Database (Denmark)

    Jørgensen, Michael Søgaard

    1996-01-01

    A presentation of some important actors and institutions in the capacity building within cleaner production in Tanzania......A presentation of some important actors and institutions in the capacity building within cleaner production in Tanzania...

  15. Compositions and methods for providing plants with tolerance to abiotic stress conditions

    KAUST Repository

    Hirt, Heribert; De Zelicourt, Axel; Saad, Maged

    2017-01-01

    It has been discovered that the desert endophytic bacterium SA187 SA187 can provide resistance or tolerance to abiotic stress conditions to seeds or plants. Compositions containing SA187 can be used to enhance plant development and yield under

  16. NMR system and method having a permanent magnet providing a rotating magnetic field

    Science.gov (United States)

    Schlueter, Ross D [Berkeley, CA; Budinger, Thomas F [Berkeley, CA

    2009-05-19

    Disclosed herein are systems and methods for generating a rotating magnetic field. The rotating magnetic field can be used to obtain rotating-field NMR spectra, such as magic angle spinning spectra, without having to physically rotate the sample. This result allows magic angle spinning NMR to be conducted on biological samples such as live animals, including humans.

  17. The duty to provide information in the case of neuroradiological examination methods

    International Nuclear Information System (INIS)

    Deutsch, E.

    1987-01-01

    The author gives a survey on the judicial decisions concerning the obligation to give information in the case of neuroradiological examination methods. The scope and content of the medical explanation depends inter alia on the urgency and the necessity of the medical diagnosis and on the understanding of the patient. (WG) [de

  18. Vehicle Tracking System, Vehicle Infrastructure Provided with Vehicle Tracking System and Method for Tracking

    NARCIS (Netherlands)

    Papp, Z.; Doodeman, G.J.N.; Nelisse, M.W.; Sijs, J.; Theeuwes, J.A.C.; Driessen, B.J.F.

    2010-01-01

    A vehicle tracking system is described comprising - a plurality of sensor nodes (10) that each provide a message (D) indicative for an occupancy status of a detection area of an vehicle infrastructure monitored by said sensor node, said sensor nodes (10) being arranged in the vehicle infrastructure

  19. Compositions and methods for providing plants with tolerance to abiotic stress conditions

    KAUST Repository

    Hirt, Heribert

    2017-07-27

    It has been discovered that the desert endophytic bacterium SA187 SA187 can provide resistance or tolerance to abiotic stress conditions to seeds or plants. Compositions containing SA187 can be used to enhance plant development and yield under environmental stress conditions.

  20. Potential profitability of pearl culture in coastal communities in Tanzania

    Directory of Open Access Journals (Sweden)

    Ismail Saidi

    2017-02-01

    Full Text Available Artisanal half-pearl culture has been shown to provide livelihood and economic opportunities for coastal communities in Tanzania that depend directly on exploitation of marine resources. However, these pilot research studies have been supported by donor organisations and the economic feasibility of such development has not yet been assessed. Furthermore, there is little understanding of the costs required to establish pearl farms and the relative impacts of farm size on production, running costs, profitability and risks involved in production. The aim of this study was to develop economic models for subsistence level half-pearl culture in Tanzania. Models were generated for various scenarios relating to farm size and products (i.e. half-pearls and juvenile oyster or ‘spat’ collection and they give detail on infrastructure costs, operational costs and income generated for various levels of operation. We concluded that the most profitable model for community-based pearl farming is to culture at least 600 oysters for half-pearl production. However, for communities to be able to run a sustainable and profitable enterprise, development of a sustainable source of oysters is crucial. Farmers can also generate income from collection of juvenile oysters and their subsequent sale to pearl farmers, but this is less profitable than half-pearl farming and requires a longer operational period before profits are made. Like pearl farming, there were major benefits or economies of scale with the largest farms tested providing greatest profit and/or a shorter time required to reach profitability. Our results provide a valuable source of information for prospective pearl farmers, donors, funding bodies and other stakeholders, and valuable extension information supporting further development of pearl culture in Tanzania.

  1. Tanzania.

    African Journals Online (AJOL)

    variation (Seebeck, 1973: Mackinnon-e't ar: 1990): Majority of paststlidies"on' reproductive performance from' tropicar-are'as have been' largely limited to'the assessment of effects of>. ·no'n.,genetk factors and breed difference's : '(Galiila. and Arthur, 1989), Genetic parameter es-, timates and infonnation. on the'extent of ...

  2. A Novel Resource Management Method of Providing Operating System as a Service for Mobile Transparent Computing

    Directory of Open Access Journals (Sweden)

    Yonghua Xiong

    2014-01-01

    Full Text Available This paper presents a framework for mobile transparent computing. It extends the PC transparent computing to mobile terminals. Since resources contain different kinds of operating systems and user data that are stored in a remote server, how to manage the network resources is essential. In this paper, we apply the technologies of quick emulator (QEMU virtualization and mobile agent for mobile transparent computing (MTC to devise a method of managing shared resources and services management (SRSM. It has three layers: a user layer, a manage layer, and a resource layer. A mobile virtual terminal in the user layer and virtual resource management in the manage layer cooperate to maintain the SRSM function accurately according to the user’s requirements. An example of SRSM is used to validate this method. Experiment results show that the strategy is effective and stable.

  3. A novel resource management method of providing operating system as a service for mobile transparent computing.

    Science.gov (United States)

    Xiong, Yonghua; Huang, Suzhen; Wu, Min; Zhang, Yaoxue; She, Jinhua

    2014-01-01

    This paper presents a framework for mobile transparent computing. It extends the PC transparent computing to mobile terminals. Since resources contain different kinds of operating systems and user data that are stored in a remote server, how to manage the network resources is essential. In this paper, we apply the technologies of quick emulator (QEMU) virtualization and mobile agent for mobile transparent computing (MTC) to devise a method of managing shared resources and services management (SRSM). It has three layers: a user layer, a manage layer, and a resource layer. A mobile virtual terminal in the user layer and virtual resource management in the manage layer cooperate to maintain the SRSM function accurately according to the user's requirements. An example of SRSM is used to validate this method. Experiment results show that the strategy is effective and stable.

  4. METHODS OF PROVIDING NOISE IMMUNITY IN AUTOMOBILE ANTI-THEFT SYSTEM CONTROL

    Directory of Open Access Journals (Sweden)

    Frolov, V.

    2013-06-01

    Full Text Available In modern ani-theft systems they use frequency and phase modulation. Since the width of the signal is limited, it is possible to intercept the signal and then switch off the alarm at the right time.To ensure the noise immunity and secrecy manufacturers use more sophisticated codes using the methods of cryptography. Significant increase in noise immunity in modern ani-theft systems is possible using broadband signals.

  5. System and Method for Providing Web-Based Remote Application Service

    OpenAIRE

    Shuen-Tai Wang; Yu-Ching Lin; Hsi-Ya Chang

    2017-01-01

    With the development of virtualization technologies, a new type of service named cloud computing service is produced. Cloud users usually encounter the problem of how to use the virtualized platform easily over the web without requiring the plug-in or installation of special software. The object of this paper is to develop a system and a method enabling process interfacing within an automation scenario for accessing remote application by using the web browser. To meet this challenge, we have ...

  6. Cloud Service Provider Methods for Managing Insider Threats: Analysis Phase 2, Expanded Analysis and Recommendations

    Science.gov (United States)

    2014-01-01

    and software as a service ( SaaS )) for staff’s abnormal behavior that may indicate an insider incident. As mentioned above, combining SIEM data...Mellon Software Engineering Institute, contacted commercial and government cloud service providers (CSPs) to better understand the administrative and...availability services . We have observed a number of scenarios in which a customer leaves a CSP’s IaaS, PaaS, or SaaS , but its data remains online for some

  7. Sustaining Ecotourism in Tanzania through Community

    Directory of Open Access Journals (Sweden)

    Liliane Pasape

    2014-06-01

    Full Text Available This study explores the contribution of community empowerment to the sustainability of ecotourism in Tanzania using education programmes, access to information and language. Through the survey approach data was collected from Tanzania’s ecotourism stakeholders (N=250 in the eight selected regions of Dar es Salaam, Pwani, Morogoro, Tanga and Zanzibar (for the eastern tourism circuit and Arusha, Kilimanjaro and Manyara (for the northern circuit and thereafter a qualitative analysis was employed complemented by estimation of the multinomial logistic regression model. The findings show that tourism stakeholders lack sufficient knowledge on ecotourism conservation and preservation. Likewise community members have poor access to information due to insufficient ecotourism publications, tourist information centres, a reliable mechanism for communicating with stakeholders and the use of foreign languages in most of the publications. It is therefore the study’s recommendation that community members be empowered through being provided with adequate education programmes and access to relevant information and the use of a language that is understood by them in order to broaden their level of understanding, enhance their management skills and contribute significantly to ecotourism-related activities.

  8. Prices and availability of locally produced and imported medicines in Ethiopia and Tanzania

    NARCIS (Netherlands)

    Ewen, M.; Kaplan, W.; Gedif, T.; Justin-Temu, M.; Vialle-Valentin, C.; Mirza, Z.; Regeer, B.; Zweekhorst, M.; Laing, Richard

    2017-01-01

    Background: To assess the effect of policies supporting local medicine production to improve access to medicines. Methods: We adapted the WHO/HAI instruments measuring medicines availability and prices to differentiate local from imported products, then pilot tested in Ethiopia and Tanzania. In each

  9. Basic Density and Strength Properties Variations in Cordia Africana (Lam) Grown Under Agroforestry in Arumeru, Tanzania

    NARCIS (Netherlands)

    Mahonge, C.P.I.

    2007-01-01

    Variations in basic density and strength properties of Cordia africana (lam) grown under agroforestry in Arumeru district Arusha Tanzania were determined. Tree sampling procedure and data collection based on standard methods (ISO 3129.of 1975). The main results indicated that basic density increased

  10. Mob justice in Tanzania: a medico-social problem | Ng'walali ...

    African Journals Online (AJOL)

    Objective: To investigate the magnitude of mob justice and associated factors. Background: Mob justice is a social and public health problem that has grown in Tanzania in recent decades that has negative effects on social and health of the country, communities, and families. Materials and Methods: A four-year autopsy ...

  11. Alcohol consumption in the rural population of Misungwi subdistrict in Mwanza Region, Tanzania

    NARCIS (Netherlands)

    Rijken, T; Velema, JP; Dijkstra, R

    Objective: This study was undertaken to investigate the frequency and quantity of alcohol consumption in four villages on the southern shores of Lake Victoria, Tanzania. Method: Study participants were 148 men and 162 women selected by cluster sampling from the population (N = 9,243) of four

  12. Teachers' Commitment To, and Experiences of, the Teaching Profession in Tanzania: Findings of Focus Group Research

    Science.gov (United States)

    Mkumbo, Kitila A. K.

    2012-01-01

    This qualitative study examined teachers' commitment to, and experiences of, the teaching profession in six regions of Tanzania. The study used focus group discussions as research method and data collection tool. Twenty four groups were conducted, with group membership ranging from five to nine participants. The results show that the teachers'…

  13. Basic Education in Tanzania: A Slight Touch on the Views of ...

    African Journals Online (AJOL)

    The objective of this paper is to visualize what basic education is. To provide a focus to the paper, from 1997-2003, 198 primary seven leavers from Nachingwea and Tandahimba districts in the southern regions of Tanzania were sampled. Six simple questions from six conventional primary school subjects (Kiswahili, ...

  14. Impacts of Electricity Access to Rural Enterprises in Bolivia, Tanzania and Vietnam

    NARCIS (Netherlands)

    van Dijk, Annemarije; Clancy, Joy S.

    2010-01-01

    There is little empirical evidence to underpin strategies of poverty reduction through income generation in small scale rural enterprises through supplying energy. This paper reports on research findings from a three country study in Bolivia, Tanzania and Vietnam which aimed to provide insights into

  15. Clusters and Factors Associated with Complementary Basic Education in Tanzania Mainland

    Science.gov (United States)

    Edwin, Paul; Amina, Msengwa S.; Godwin, Naimani M.

    2017-01-01

    Complimentary Basic Education in Tanzania (COBET) is a community-based programme initiated in 1999 to provide formal education system opportunity to over aged children or children above school age. The COBET program was analyzed using secondary data collected from 21 regions from 2008 to 2012. Cluster analysis was applied to classify the 21…

  16. Children's medicines in Tanzania: a national survey of administration practices and preferences.

    Directory of Open Access Journals (Sweden)

    Lisa V Adams

    Full Text Available OBJECTIVE: The dearth of age-appropriate formulations of many medicines for children poses a major challenge to pediatric therapeutic practice, adherence, and health care delivery worldwide. We provide information on current administration practices of pediatric medicines and describe key stakeholder preferences for new formulation characteristics. PATIENTS AND METHODS: We surveyed children aged 6-12 years, parents/caregivers over age 18 with children under age 12, and healthcare workers in 10 regions of Tanzania to determine current pediatric medicine prescription and administration practices as well as preferences for new formulations. Analyses were stratified by setting, pediatric age group, parent/caregiver education, and healthcare worker cadre. RESULTS: Complete data were available for 206 children, 202 parents/caregivers, and 202 healthcare workers. Swallowing oral solid dosage forms whole or crushing/dissolving them and mixing with water were the two most frequently reported methods of administration. Children frequently reported disliking medication taste, and many had vomited doses. Healthcare workers reported medicine availability most significantly influences prescribing practices. Most parents/caregivers and children prefer sweet-tasting medicine. Parents/caregivers and healthcare workers prefer oral liquid dosage forms for young children, and had similar thresholds for the maximum number of oral solid dosage forms children at different ages can take. CONCLUSIONS: There are many impediments to acceptable and accurate administration of medicines to children. Current practices are associated with poor tolerability and the potential for under- or over-dosing. Children, parents/caregivers, and healthcare workers in Tanzania have clear preferences for tastes and formulations, which should inform the development, manufacturing, and marketing of pediatric medications for resource-limited settings.

  17. Evaluation of Two Statistical Methods Provides Insights into the Complex Patterns of Alternative Polyadenylation Site Switching

    Science.gov (United States)

    Li, Jie; Li, Rui; You, Leiming; Xu, Anlong; Fu, Yonggui; Huang, Shengfeng

    2015-01-01

    Switching between different alternative polyadenylation (APA) sites plays an important role in the fine tuning of gene expression. New technologies for the execution of 3’-end enriched RNA-seq allow genome-wide detection of the genes that exhibit significant APA site switching between different samples. Here, we show that the independence test gives better results than the linear trend test in detecting APA site-switching events. Further examination suggests that the discrepancy between these two statistical methods arises from complex APA site-switching events that cannot be represented by a simple change of average 3’-UTR length. In theory, the linear trend test is only effective in detecting these simple changes. We classify the switching events into four switching patterns: two simple patterns (3’-UTR shortening and lengthening) and two complex patterns. By comparing the results of the two statistical methods, we show that complex patterns account for 1/4 of all observed switching events that happen between normal and cancerous human breast cell lines. Because simple and complex switching patterns may convey different biological meanings, they merit separate study. We therefore propose to combine both the independence test and the linear trend test in practice. First, the independence test should be used to detect APA site switching; second, the linear trend test should be invoked to identify simple switching events; and third, those complex switching events that pass independence testing but fail linear trend testing can be identified. PMID:25875641

  18. Physicians' opinions about partner notification methods: case reporting, patient referral, and provider referral.

    Science.gov (United States)

    Hogben, M; St Lawrence, J S; Montaño, D E; Kasprzyk, D; Leichliter, J S; Phillips, W R

    2004-02-01

    The United States has relied upon partner notification strategies to help break the chain of infection and re-infection for sexually transmitted diseases (STD). Physicians are a vital link in the system of STD control, but little is known of physician opinions about partner notification strategies. We collected opinions about partner notification from a national probability sample of physicians in specialties diagnosing STDs. Physicians responded to 17 questions about three relevant forms of STD partner notification: patient based referral, provider based referral, and case reporting. Exploratory factor analyses showed that responses for each form of partner notification could be grouped into four categories: perceived practice norms, infection control, patient relationships, and time/money. Multivariate analyses of the factors showed that physicians endorsed patient based referral most favourably and provider based referral least favourably. Physicians' opinions about partner notification strategies appear to reflect objective reality in some areas, but not in others. Strategies that improve the fit between physicians' opinions and effective notification are needed: some are discussed here.

  19. Neural interface methods and apparatus to provide artificial sensory capabilities to a subject

    Energy Technology Data Exchange (ETDEWEB)

    Buerger, Stephen P.; Olsson, III, Roy H.; Wojciechowski, Kenneth E.; Novick, David K.; Kholwadwala, Deepesh K.

    2017-01-24

    Embodiments of neural interfaces according to the present invention comprise sensor modules for sensing environmental attributes beyond the natural sensory capability of a subject, and communicating the attributes wirelessly to an external (ex-vivo) portable module attached to the subject. The ex-vivo module encodes and communicates the attributes via a transcutaneous inductively coupled link to an internal (in-vivo) module implanted within the subject. The in-vivo module converts the attribute information into electrical neural stimuli that are delivered to a peripheral nerve bundle within the subject, via an implanted electrode. Methods and apparatus according to the invention incorporate implantable batteries to power the in-vivo module allowing for transcutaneous bidirectional communication of low voltage (e.g. on the order of 5 volts) encoded signals as stimuli commands and neural responses, in a robust, low-error rate, communication channel with minimal effects to the subjects' skin.

  20. Perceived unfairness in working conditions: The case of public health services in Tanzania

    Directory of Open Access Journals (Sweden)

    Massay Deodatus

    2011-02-01

    Full Text Available Abstract Background The focus on the determinants of the quality of health services in low-income countries is increasing. Health workers' motivation has emerged as a topic of substantial interest in this context. The main objective of this article is to explore health workers' experience of working conditions, linked to motivation to work. Working conditions have been pointed out as a key factor in ensuring a motivated and well performing staff. The empirical focus is on rural public health services in Tanzania. The study aims to situate the results in a broader historical context in order to enhance our understanding of the health worker discourse on working conditions. Methods The study has a qualitative study design to elicit detailed information on health workers' experience of their working conditions. The data comprise focus group discussions (FGDs and in-depth interviews (IDIs with administrators, clinicians and nursing staff in the public health services in a rural district in Tanzania. The study has an ethnographic backdrop based on earlier long-term fieldwork in the same part of Tanzania. Results The article provides insights into health workers' understanding and assessment of their working conditions. An experience of unsatisfactory working conditions as well as a perceived lack of fundamental fairness dominated the FGDs and IDIs. Informants reported unfairness with reference to factors such as salary, promotion, recognition of work experience, allocation of allowances and access to training as well as to human resource management. The study also revealed that many health workers lack information or knowledge about factors that influence their working conditions. Conclusions The article calls for attention to the importance of locating the discourse of unfairness related to working conditions in a broader historical/political context. Tanzanian history has been characterised by an ambiguous and shifting landscape of state regulation

  1. Method for providing uranium articles with a corrosion resistant anodized coating

    International Nuclear Information System (INIS)

    Waldrop, F.B.; Washington, C.A.

    1982-01-01

    Uranium articles are provided with anodized oxide coatings in an aqueous solution of an electrolyte selected from the group consisting of potassium phosphate, potassium hydroxide, ammonium hydroxide, and a mixture of potassium tetraborate and boric acid. The uranium articles are anodized at a temperature greater than about 75 degrees C. With a current flow of less than about 0.036 A/cm2 of surface area while the Ph of the solution is maintained in a range of about 2 to 11.5. The Ph values of the aqueous solution and the low current density utilized during the electrolysis prevent excessive dissolution of the uranium and porosity in the film or watering. The relatively high temperature of the electrolyte bath inhibits hydration and the attendant deleterious pitting so as to enhance corrosion resistance of the anodized coating

  2. A Statistical Method for Aggregated Wind Power Plants to Provide Secondary Frequency Control

    DEFF Research Database (Denmark)

    Hu, Junjie; Ziras, Charalampos; Bindner, Henrik W.

    2017-01-01

    curtailment for aggregated wind power plants providing secondary frequency control (SFC) to the power system. By using historical SFC signals and wind speed data, we calculate metrics for the reserve provision error as a function of the scheduled wind power. We show that wind curtailment can be significantly......The increasing penetration of wind power brings significant challenges to power system operators due to the wind’s inherent uncertainty and variability. Traditionally, power plants and more recently demand response have been used to balance the power system. However, the use of wind power...... as a balancing-power source has also been investigated, especially for wind power dominated power systems such as Denmark. The main drawback is that wind power must be curtailed by setting a lower operating point, in order to offer upward regulation. We propose a statistical approach to reduce wind power...

  3. Pediatric primary care providers' perspectives regarding hospital discharge communication: a mixed methods analysis.

    Science.gov (United States)

    Leyenaar, JoAnna K; Bergert, Lora; Mallory, Leah A; Engel, Richard; Rassbach, Caroline; Shen, Mark; Woehrlen, Tess; Cooperberg, David; Coghlin, Daniel

    2015-01-01

    Effective communication between inpatient and outpatient providers may mitigate risks of adverse events associated with hospital discharge. However, there is an absence of pediatric literature defining effective discharge communication strategies at both freestanding children's hospitals and general hospitals. The objectives of this study were to assess associations between pediatric primary care providers' (PCPs) reported receipt of discharge communication and referral hospital type, and to describe PCPs' perspectives regarding effective discharge communication and areas for improvement. We administered a questionnaire to PCPs referring to 16 pediatric hospital medicine programs nationally. Multivariable models were developed to assess associations between referral hospital type and receipt and completeness of discharge communication. Open-ended questions asked respondents to describe effective strategies and areas requiring improvement regarding discharge communication. Conventional qualitative content analysis was performed to identify emergent themes. Responses were received from 201 PCPs, for a response rate of 63%. Although there were no differences between referral hospital type and PCP-reported receipt of discharge communication (relative risk 1.61, 95% confidence interval 0.97-2.67), PCPs referring to general hospitals more frequently reported completeness of discharge communication relative to those referring to freestanding children's hospitals (relative risk 1.78, 95% confidence interval 1.26-2.51). Analysis of free text responses yielded 4 major themes: 1) structured discharge communication, 2) direct personal communication, 3) reliability and timeliness of communication, and 4) communication for effective postdischarge care. This study highlights potential differences in the experiences of PCPs referring to general hospitals and freestanding children's hospitals, and presents valuable contextual data for future quality improvement initiatives

  4. SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

    Directory of Open Access Journals (Sweden)

    Mehmet AYBEKE

    2015-12-01

    Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

  5. Exploring Foreign Tourists’ Image of Tanzania

    DEFF Research Database (Denmark)

    Nandonde, Felix Adamu

    2015-01-01

    In the last decade, the economy of African continent and Tanzania in particular has witnessed a business boom of the tourism sector. While the sector has continued to grow and become a dependable source of direct and indirect employment to youths in urban and rural areas, the sector has been awash...... with challenges. These challenges include terrorism attacks, energy crises and poor infrastructure. However, the impact of these challenges on the image of Tanzania as a tourist destination has not received the deserved attention. This study explores the perception of visitors towards Tanzania as a tourist....... Front line employees, various tourist sites and access to services emerged to be strong tourist destination image factors. This implies that the efforts of marketing tourism destination should focus on promoting all the sites the country has....

  6. Type 1 diabetes care updates: Tanzania

    Directory of Open Access Journals (Sweden)

    Kandi Catherine Muze

    2015-01-01

    Full Text Available Tanzania is located in east Africa with a population of 45 million. The country′s population is growing at 2.5% annually. The International Diabetes Federation Child Sponsorship Program was launched in Tanzania in 2005. The number of type 1 diabetes mellitus children enrolled in the changing diabetes in children program in Tanzania has augmented from almost below 50 in 2005 to over 1200 in 2014. The country had an overall trend of HbA1c value of 14% in 2005 while the same has reduced over the years to 10% in 2012-13. The program has been able to reduce the proportion of patients with HbA1c values of 11-14%; from 71.9% in 2008 to 49.8% in 2012-13. The challenges, which CDiC faces are misdiagnosis, low public awareness, and stigma especially in the reproductive age/adolescent groups.

  7. Analysis of methods of providing anonymity in facial photographs; a randomised controlled study.

    LENUS (Irish Health Repository)

    Clover, A J P

    2010-09-01

    Clinical images are invaluable in medical teaching and research publications. In the past efforts to conceal patient identity, if any, were limited to a black bar concealing the eyes. However, there is no consensus on this among major journals and publishing houses. This research analyses the effectiveness of blacking out the eyes in facial photographs and evaluates alternative techniques. 126 questionnaires were completed. The average numbers of correct responses out of 30 was 24.64 (82.13%) in the control group, 20.59 (68.63%) in the eyes, 20.42 (68.07%) in the eyes and nose group, and 17.53 (58.43%) in the T-shaped group (eyes, nose and mouth). The traditional method of covering the eyes does significantly decrease recognition, however it is only as effective as covering the nose and mouth. The more of the face that is covered the less likely it is that the person is recognised. However, there are people who remain identifiable no matter how much of the face is covered. This work highlights the importance of obtaining consent prior to publication as well as attempting to hide identity.

  8. Gamma Knife radiosurgery of olfactory groove meningiomas provides a method to preserve subjective olfactory function.

    Science.gov (United States)

    Gande, Abhiram; Kano, Hideyuki; Bowden, Gregory; Mousavi, Seyed H; Niranjan, Ajay; Flickinger, John C; Lunsford, L Dade

    2014-02-01

    Anosmia is a common outcome after resection of olfactory groove meningioma(s) (OGM) and for some patients represents a significant disability. To evaluate long term tumor control rates and preservation of subjective olfaction after Gamma Knife (GK) stereotactic radiosurgery (SRS) of OGM. We performed a retrospective chart review and telephone assessments of 41 patients who underwent GK SRS between 1987 and 2008. Clinical outcomes were stratified by full, partial or no subjective olfaction, whereas tumor control was assessed by changes in volume greater or lesser than 25%. The median clinical and imaging follow-up were 76 and 65 months, respectively. Prior to SRS, 19 (46%) patients had surgical resections and two (5%) had received fractionated radiation therapy. Twenty four patients (59%) reported a normal sense of smell, 12 (29%) reported a reduced sense of smell and five (12%) had complete anosmia. The median tumor volume was 8.5 cm(3) (range 0.6-56.1), the mean radiation dose at the tumor margin was 13 Gy (range 10-20) and the median estimated dose to the olfactory nerve was 5.1 Gy (range 1.1-18.1). At follow-up, 27 patients (66%) reported intact olfaction (three (7%) described return to a normal sense of smell), nine (22%) described partial anosmia, and five (12%) had complete anosmia. No patient reported deterioration in olfaction after SRS. Thirteen patients (32%) showed significant tumor regression, 26 (63%) had no further growth and two (5%) had progressed. The progression free tumor control rates were 97% at 1 year and 95% at 2, 10 and 20 years. Symptomatic adverse radiation effects occurred in three (7%) patients. Stereotactic radiosurgery provided both long term tumor control and preservation of olfaction.

  9. Occupational dose trends in Tanzania

    International Nuclear Information System (INIS)

    Muhogora, W.E.; Nyanda, A.M.; Ngaile, J.E.; Lema, U.S.

    1998-01-01

    This paper describes the present status of occupational radiation exposure of monitored workers in Tanzania from 1986 to 1997. The analysis of dose records observes over this period, a fluctuating trend both in the individual and collective doses. The trend is more related to the fluctuations of the number of radiation workers than to the possible radiation safety changes of the working conditions. It has been found that, the maximum annual dose for the worker in all work categories was about 18 mSv y -1 . This suggests that the occupational radiation exposure in all practices satisfies the current dose limitation system. The national exposure summary shows that, the highest collective dose of 12.8 man-Sv which is 90% of the total collective dose, was due to medical applications. The applications in industry and research had a contribution of nearly 0.8 and 0.7 man-Sv respectively. From the professional point of view, the medical diagnostic radiographers received the highest collective dose of 11.2 man-Sv. Although the medical physicists recorded the minimum collective dose of nearly 0.07 man-Sv, the data shows that this profession received the highest mean dose of about 33 mSv in 12 years. Some achievements of the personnel monitoring services and suggestions for future improvement are pointed out. (author)

  10. Spatial and Temporal Climatic Variation in Coastal Tanzania

    Science.gov (United States)

    Rohli, R. V.; Ates, S.; Rivera-Monroy, V. H.; Polito, M. J.; Midway, S. R.; Gold, A.; Castañeda-Moya, E.; Uchida, E.; Suwa, M.; Mangora, M. M.

    2017-12-01

    Climatic controls are particularly important to the natural and human systems in coastal Tanzania, where mangrove vegetation is a major component of world-renowned biodiversity. This research provides an improved understanding of the climatic features and forcing mechanisms that support the critical mangroves of Tanzania and the livelihoods of its populace, using updated and complete datasets. Updated data confirm that coastal Tanzania falls in the tropical wet-dry Köppen-Geiger climatic type, except for the extreme north, where tropical rain forest exists north of Pangani. The northeast monsoon, known as the kaskazi, largely corresponds to the rainy November-December and March-May months. The southeast monsoon - known as the kusi - overlaps with the drier June-September. Results suggest that El Niño-Southern Oscillation (ENSO) and Indian Ocean Dipole (IOD) are key modulators of precipitation variability in the entire area. More specifically, September-November positive precipitation anomalies occur during positive IOD, especially when combined with El Niño, with slightly negative anomalies during negative IOD, especially when combined with La Niña. The rest of the year tends to show similar precipitation during both IOD phases (March-August) or less precipitation during the positive phase (December-February). Because the literature suggests likelihood of more frequent positive IOD mode and a strengthened relationship of these events to warm-ENSO events, changes to the hydrologic cycle in east Africa may be likely in the future, with a potential for an expanded secondary rainy season and a drier "saddle" between the secondary and primary rainy seasons (i.e., December-February). Therefore, future research should investigate in more detail the influence of the IOD and ENSO on various components of the climatic water balance. Results may be useful to earth, environmental, and social scientists as they seek further understanding of the drivers of ecological and

  11. Private providers' knowledge, attitudes and misconceptions related to long-acting and permanent contraceptive methods: a case study in Bangladesh.

    Science.gov (United States)

    Ugaz, Jorge; Banke, Kathryn; Rahaim, Stephen; Chowdhury, Wahiduzzaman; Williams, Julie

    2016-11-01

    In Bangladesh, use of long-acting and permanent methods of contraception (LAPMs) remains stagnant. Providers' limited knowledge and biases may be a factor. We assessed private providers' knowledge, misconceptions and general attitudes towards LAPM in two urban areas. The ultimate goal is to shape programs and interventions to overcome these obstacles and improve full method choice in Bangladesh. Trained data collectors interviewed a convenience sample of 235 female doctors (obstetricians-gynecologists and general practitioners) and 150 female nurses from 194 commercial (for-profit) health care facilities in Chittagong City Corporation and Dhaka district. Data were collected on the nature of the practice, training received, knowledge about modern contraceptives and attitudes towards LAPM [including intrauterine device (IUDs), implants, female and male sterilization]. All providers, and especially doctors, lacked adequate knowledge regarding side effects for all LAPMs, particularly female and male sterilization. Providers had misconceptions about the effectiveness and convenience of LAPMs compared to short-acting contraceptive methods. Implants and IUDs were generally perceived more negatively than other methods. The majority of providers believed that husbands favor short-acting methods rather than LAPMs and that women should not use a method that their husbands do not approve of. Our findings document knowledge and attitudinal barriers among private for-profit providers in urban areas affecting their provision of accurate information about LAPM choices. Practitioners should be offered the necessary tools to provide women full access to all modern methods, especially LAPMs, in order to contribute to decreasing unmet need and improving full method choice in Bangladesh. Copyright © 2016 Elsevier Inc. All rights reserved.

  12. Adaptive livelihood strategies for coping with water scarcity in the drylands of central Tanzania

    Science.gov (United States)

    Liwenga, Emma T.

    In this paper, it is argued that local knowledge for adapting to water scarcity is important for integrated resource management by taking into consideration both the natural and social constraints in a particular setting based on accumulated experience. The paper examines the relevance of local knowledge in sustaining agricultural production in the semiarid areas of central Tanzania. The paper specifically focuses on how water scarcity, as the major limiting factor, is addressed in the study area using local knowledge to sustain livelihoods of its people. The study was conducted in four villages; Mzula, Ilolo, Chanhumba and Ngahelezi, situation in Mvumi Division in Dodoma Region. The study mainly employed qualitative data collection techniques. Participatory methods provided a means of exploring perceptions and gaining deeper insights regarding natural resource utilization in terms of problems and opportunities. The main data sources drawn upon in this study were documentation, group interviews and field observations. Group interviews involved discussions with a group of 6-12 people selected on the basis of gender, age and socio-economic groups. Data analysis entailed structural and content analysis within the adaptive livelihood framework in relation to management of water scarcity using local knowledge. The findings confirm that rainfall is the main limiting factor for agricultural activities in the drylands of Central Tanzania. As such, local communities have developed, through time, indigenous knowledge to cope with such environments utilizing seasonality and diversity of landscapes. Use of this local knowledge is therefore effective in managing water scarcity by ensuring a continuous production of crops throughout the year. This practice implies increased food availability and accessibility through sales of such agricultural products. Local innovations for water management, such as cultivation in sandy rivers, appear to be very important means of accessing

  13. The make or buy debate: Considering the limitations of domestic production in Tanzania

    Directory of Open Access Journals (Sweden)

    Wilson Kinsley

    2012-06-01

    Full Text Available Abstract Background In order to ensure their population’s regular access to essential medicines, many least developed countries and developing countries are faced with the policy question of whether to import or manufacture drugs locally, in particular for life-saving antiretroviral medicines for HIV/AIDS patients. In order for domestic manufacturing to be viable and cost-effective, the local industry must be able to compete with international suppliers of medicines by producing sufficiently low cost ARVs. Methods This paper considers the ‘make-or-buy’ dilemma by using Tanzania as a case study. Key informant interviews, event-driven observation, and purposive sampling of documents were used to evaluate the case study. The case study focused on Tanzania’s imitation technology transfer agreement to locally manufacture a first-line ARV (3TC + d4T + NVP, reverse engineering the ARV. Results Tanzania is limited by weak political support for the use of TRIPS flexibilities, limited production capacity for ARVs and limited competitiveness in both domestic and regional markets. The Ministry of Health and Social Welfare encourages the use of flexibilities while others push for increased IP protection. Insufficient production capacity and lack of access to donor-financed tenders make it difficult to obtain economies of scale and provide competitive prices. Conclusions Within the “make-or-buy” context, it was determined that there are significant limitations in domestic manufacturing for developing countries. The case study highlights the difficulty of governments to make use of economies of scale and produce low-cost medicines, attract technology transfer, and utilize the flexibilities of the WTO Agreement on Trade-Related Aspects of Intellectual Property Rights (TRIPS. The results demonstrate the importance of evaluating barriers to the use of TRIPS flexibilities and long-term planning across sectors in future technology transfer and

  14. Children's medicines in Tanzania: a national survey of administration practices and preferences.

    Science.gov (United States)

    Adams, Lisa V; Craig, Sienna R; Mmbaga, Elia John; Naburi, Helga; Lahey, Timothy; Nutt, Cameron T; Kisenge, Rodrick; Noel, Gary J; Spielberg, Stephen P

    2013-01-01

    The dearth of age-appropriate formulations of many medicines for children poses a major challenge to pediatric therapeutic practice, adherence, and health care delivery worldwide. We provide information on current administration practices of pediatric medicines and describe key stakeholder preferences for new formulation characteristics. We surveyed children aged 6-12 years, parents/caregivers over age 18 with children under age 12, and healthcare workers in 10 regions of Tanzania to determine current pediatric medicine prescription and administration practices as well as preferences for new formulations. Analyses were stratified by setting, pediatric age group, parent/caregiver education, and healthcare worker cadre. Complete data were available for 206 children, 202 parents/caregivers, and 202 healthcare workers. Swallowing oral solid dosage forms whole or crushing/dissolving them and mixing with water were the two most frequently reported methods of administration. Children frequently reported disliking medication taste, and many had vomited doses. Healthcare workers reported medicine availability most significantly influences prescribing practices. Most parents/caregivers and children prefer sweet-tasting medicine. Parents/caregivers and healthcare workers prefer oral liquid dosage forms for young children, and had similar thresholds for the maximum number of oral solid dosage forms children at different ages can take. There are many impediments to acceptable and accurate administration of medicines to children. Current practices are associated with poor tolerability and the potential for under- or over-dosing. Children, parents/caregivers, and healthcare workers in Tanzania have clear preferences for tastes and formulations, which should inform the development, manufacturing, and marketing of pediatric medications for resource-limited settings.

  15. The societal cost of Taenia solium cysticercosis in Tanzania.

    Science.gov (United States)

    Trevisan, Chiara; Devleesschauwer, Brecht; Schmidt, Veronika; Winkler, Andrea Sylvia; Harrison, Wendy; Johansen, Maria Vang

    2017-01-01

    Taenia solium is a zoonotic parasite prevalent in many low income countries throughout Latin America, Asia and sub-Saharan Africa, including Tanzania. The parasite is recognized as a public health threat; however the burden it poses on populations of Tanzania is unknown. The aim of this study was to estimate the societal cost of T. solium cysticercosis in Tanzania, by assessing both the health and economic burden. The societal cost of T. solium cysticercosis was assessed in humans and pigs based on data obtained by a systematic review. Experts' opinion was sought in cases where data were not retrievable. The health burden was assessed in terms of annual number of neurocysticercosis (NCC) associated epilepsy incident cases, deaths and disability-adjusted life years (DALYs), while the economic burden was assessed in terms of direct and indirect costs imposed by NCC-associated epilepsy and potential losses due to porcine cysticercosis. Based on data retrieved from the systematic review and burden assessments, T. solium cysticercosis contributed to a significant societal cost for the population. The annual number of NCC-associated epilepsy incident cases and deaths were 17,853 (95% Uncertainty Interval (UI), 5666-36,227) and 212 (95% UI, 37-612), respectively. More than 11% (95% UI, 6.3-17) of the pig population was infected with the parasite when using tongue examination as diagnostic method. For the year 2012 the number of DALYs per thousand person-years for NCC-associated epilepsy was 0.7 (95% UI, 0.2-1.6). Around 5 million USD (95% UI, 797,535-16,933,477) were spent due to NCC-associated epilepsy and nearly 3 million USD (95% UI, 1,095,960-5,366,038) were potentially lost due to porcine cysticercosis. Our results show that T. solium imposes a serious public health, agricultural and economic threat for Tanzania. We urge that a One Health approach, which involves the joint collaboration and effort of veterinarians, medical doctors, agricultural extension officers

  16. Construction and Demolition Waste Characteristics in Tanzania ...

    African Journals Online (AJOL)

    The construction industry generates a lot of construction and demolition (C&D) waste which puts some challenges to its management. For example, currently, in many towns in Tanzania, there are no landfill sites for solid waste disposal; and as a consequence open air dumping sites are used. Dumping C&D waste puts ...

  17. Marketing Dental Services | Tuominen | Tanzania Dental Journal

    African Journals Online (AJOL)

    Tanzania Dental Journal. Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue · Archives · Journal Home > Vol 9, No 1 (2000) >. Log in or Register to get access to full text downloads. Username, Password, Remember me, or Register. Marketing Dental Services. R Tuominen. Abstract. No Abstract.

  18. Boosting youth employment prospects in Tanzania | IDRC ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    2015-12-16

    Dec 16, 2015 ... Return to main page, Addressing the youth employment challenge in Africa. Related links: Youth Employment Promotion a Priority Agenda for Tanzania, The Guardian; Report: National Stakeholders Consultative Workshop on Youth Employment (PDF, 1.74 MB); Watch the workshop video on YouTube ...

  19. Tanzania | Page 26 | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Home · South of Sahara. Tanzania. Tanzanie. Read more about Community Based Adaptation to Climate Change in Africa. Language English. Read more about Free and Open Source Management Information Systems and Microfinance - Phase II. Language English. Read more about La microfinance et les TIC : systèmes ...

  20. Teaching 'natural product chemistry' in Tanzania | Buchanan ...

    African Journals Online (AJOL)

    Natural products 'historically' and 'today' have vast importance. This article describes the course 'Natural Product Chemistry', a new course in the 2011/2012 academic year in the Faculty of Natural and Applied Sciences at St. John's University of Tanzania. It reveals how the course has been applied to the African and ...

  1. Tanzania | Page 29 | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Corn, cassava and pulses are the main food sources in rural Tanzania. Meat is scarce for rural populations, and don't expect to find carrots, kale or squash at the local market! Animal products – particularly offal –, green vegetables and orange fruits and vegetables are the best sources of vitamin A. As a result, Tanzanians ...

  2. Tanzania | Page 30 | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Introducing dairy goats in semi-arid regions of Tanzania has led to farmers earning US$160 from milk sales during the first lactation, as well as an increase in household milk consumption. In these trials led by Canadian and Tanzanian researchers, cassava and sweet potato leaves are a significant feed supplement.

  3. AIDS in dentistry | Muya | Tanzania Dental Journal

    African Journals Online (AJOL)

    Tanzania Dental Journal. Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue · Archives · Journal Home > Vol 4, No 1 (1989) >. Log in or Register to get access to full text downloads. Username, Password, Remember me, or Register. AIDS in dentistry. RJ Muya. Abstract. No Abstract. Full Text:.

  4. AIDS in dentistry | Muya | Tanzania Dental Journal

    African Journals Online (AJOL)

    Tanzania Dental Journal. Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue · Archives · Journal Home > Vol 4, No 1 (1989) >. Log in or Register to get access to full text downloads. Username, Password, Remember me, or Register · Download this PDF file. The PDF file you selected should load ...

  5. Tanzania | Page 2 | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Read more about ​Promoting locally fortified sunflower oil using e-vouchers. Language English. Read more about ​Affordable natural product reduces fruit losses, increases incomes. Language English. Read more about Integrated crop and goat breeding in Tanzania. Language English. Read more about Élevage de la ...

  6. Newspaper coverage of agricultural information in Tanzania ...

    African Journals Online (AJOL)

    A.S.Sife

    Introduction. Agriculture is a key sector of economy in Tanzania. ... media to reach a wide audience, newspapers have additional advantages of being in permanent form ... advertisements, politics, entertainment, and crime events while ignoring developmental topics such as ..... Social Sciences, 3(8): 578–582. Kayode, J.

  7. Tanzania Journal of Forestry and Nature Conservation

    African Journals Online (AJOL)

    The Tanzania Journal of Forestry and Nature Conservation accommodates the current diverse and multidisciplinary approaches towards ecosystem conservation at national and global levels. The journal is published biannually and accepts research and review papers covering technological, physical, biological, social and ...

  8. Tanzania : Country Procurement Assessment Report, Executive Summary

    OpenAIRE

    World Bank

    2004-01-01

    This Country Procurement Assessment Report (CPAR)intends to determine the compatibility of national procurement law, and practices, with the principles of economy, and with international procurement practices. This CPAR, the second of its kind in Tanzania, looks at the legislative framework, the performance of regulatory functions, the enforcement regime, and the capacity of public sector ...

  9. Biofuel investment in Tanzania: Omissions in implementation

    International Nuclear Information System (INIS)

    Habib-Mintz, Nazia

    2010-01-01

    Increasing demand for biofuels as a component of climate change mitigation, energy security, and a fossil fuel alternative attracts investors to developing countries like Tanzania. Ample unused land is critical for first generation biofuels production and an important feature to attract foreign direct investments that can contribute towards agricultural modernization and poverty reduction initiatives. Despite the economic justifications, the existing institutional and infrastructural capacities dictate the impacts of biofuels market penetrations. Furthermore, exogenous factors like global recessionary pressure depressed oil prices below the level at which biofuel production were profitable in 2007, making Tanzania's competitiveness and potential benefits questionable. This paper investigates the extent that first generation, jatropha-based biofuels industry development in Tanzania observed during fieldwork in Kisarawe and Bahi may fulfill policy objectives. This paper argues that without strong regulatory frameworks for land, investment management, and rural development, biofuel industrialization could further exacerbate poverty and food insecurity in Tanzania. The paper concludes with policy recommendations for first generation biofuel development while keeping in mind implications of second generation production. Since the topic is broad and multifaceted, a multidisciplinary approach is used that includes political, institutional, and agricultural economics to analyze and conceptualize biofuel industry development and food security.

  10. Cigarette Taxation in Tanzania | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Tobacco consumption in Tanzania rose by 20% between 2002 and 2007, and is predicted to increase by a further 46% by 2016. The impact of this increase in consumption on public health and economic development is likely to be serious. Experience elsewhere has shown that the single most effective way to reverse this ...

  11. Tanzania | Page 28 | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Language English. Read more about Taxes sur les cigarettes en Tanzanie. Language French. Read more about Cigarette Taxation in Tanzania. Language English. Read more about Réseau des développeurs - logiciels d'exploitation libre pour assistants numériques personnels utilisés dans la collecte de données sur la ...

  12. Tanzania | Page 19 | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Language English. Read more about Bourses de recherche pour la lutte antitabac en Afrique. Language French. Read more about Tobacco Control Research Scholarships in Africa. Language English. Read more about Leveraging Indigenous Knowledge to Create Jobs for Women in Rural Areas of Tanzania and Rwanda.

  13. Opalescence: Tooth Whitening Systems | Fischer | Tanzania Dental ...

    African Journals Online (AJOL)

    Tanzania Dental Journal. Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue · Archives · Journal Home > Vol 15, No 2 (2009) >. Log in or Register to get access to full text downloads. Username, Password, Remember me, or Register · Download this PDF file. The PDF file you selected should load ...

  14. Tanzania | Page 36 | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    The Kenyan sociologist and gender specialist at the International Livestock Research Institute (ILRI) has heard the stories first-hand from her work in hundreds of communities throughout Kenya, Tanzania, and southern Africa. Read more about Empowering African women and communities through agriculture. Language ...

  15. Deficiency within pavement Maintenance Organization in Tanzania ...

    African Journals Online (AJOL)

    In addition, the rules and regulations of the public administrative system do not allow for an effective and efficient management of road maintenance. Lack of equipment and adequate qualified personnel in the field of road maintenance is too an added deficiency. As a consequence, Tanzania has started to put road ...

  16. Lymphatic filariasis control in Tanga Region, Tanzania

    DEFF Research Database (Denmark)

    Simonsen, Paul Erik; Derua, Yahya A.; Magesa, Stephen M.

    2014-01-01

    BackgroundLymphatic filariasis (LF) control started in Tanga Region of Tanzania in 2004, with annual ivermectin/albendazole mass drug administration (MDA). Since then, the current project has monitored the effect in communities and schools in rural areas of Tanga District. In 2013, after 8 rounds...

  17. Spatial clustering of porcine cysticercosis in Mbulu district, northern Tanzania.

    Directory of Open Access Journals (Sweden)

    Helena A Ngowi

    Full Text Available BACKGROUND: Porcine cysticercosis is caused by a zoonotic tapeworm, Taenia solium, which causes serious disease syndromes in human. Effective control of the parasite requires knowledge on the burden and pattern of the infections in order to properly direct limited resources. The objective of this study was to establish the spatial distribution of porcine cysticercosis in Mbulu district, northern Tanzania, to guide control strategies. METHODOLOGY/PRINCIPAL FINDINGS: This study is a secondary analysis of data collected during the baseline and follow-up periods of a randomized community trial aiming at reducing the incidence rate of porcine cysticercosis through an educational program. At baseline, 784 randomly selected pig-keeping households located in 42 villages in 14 wards were included. Lingual examination of indigenous pigs aged 2-12 (median 8 months, one randomly selected from each household, were conducted. Data from the control group of the randomized trial that included 21 of the 42 villages were used for the incidence study. A total of 295 pig-keeping households were provided with sentinel pigs (one each and reassessed for cysticercosis incidence once or twice for 2-9 (median 4 months using lingual examination and antigen ELISA. Prevalence of porcine cysticercosis was computed in Epi Info 3.5. The prevalence and incidence of porcine cysticercosis were mapped at household level using ArcView 3.2. K functions were computed in R software to assess general clustering of porcine cysticercosis. Spatial scan statistics were computed in SatScan to identify local clusters of the infection. The overall prevalence of porcine cysticercosis was 7.3% (95% CI: 5.6, 9.4; n = 784. The K functions revealed a significant overall clustering of porcine cysticercosis incidence for all distances between 600 m and 5 km from a randomly chosen case household based on Ag-ELISA. Lingual examination revealed clustering from 650 m to 6 km and between 7.5 and 10 km

  18. Individual Local Farmers’ Perceptions of Environmental Change in Tanzania

    Directory of Open Access Journals (Sweden)

    Lina Röschel

    2018-04-01

    Full Text Available Climatic and environmental changes are expected to affect in particular those regions where the economy is primarily based on the agricultural sector and where the dependency on water availability is high. This study examines how smallholder farmers in rural Tanzania perceived climatic and environmental changes over the past 20 years and the resulting effects on water availability and food security. The study is based on a household survey of 899 farmers in a semi-arid and a sub-humid region in Tanzania. It was found that (a significant differences in perceptions of the environment by farmers can be attributed to agro-climatic location, while the distance to a water source has less impact on individual perception; (b differently perceived changes affect individual water availability and food security; and (c the farm level adaptation methods applied are linked to vulnerability to changes and the household dependence on the immediate environment. The authors conclude that the specific environmental surroundings paired with socio-economic factors can severely compound the negative effects of water scarcity on rural farmers.

  19. Human migration, protected areas, and conservation outreach in Tanzania.

    Science.gov (United States)

    Salerno, Jonathan D; Borgerhoff Mulder, Monique; Kefauver, Shawn C

    2014-06-01

    A recent discussion debates the extent of human in-migration around protected areas (PAs) in the tropics. One proposed argument is that rural migrants move to bordering areas to access conservation outreach benefits. A counter proposal maintains that PAs have largely negative effects on local populations and that outreach initiatives even if successful present insufficient benefits to drive in-migration. Using data from Tanzania, we examined merits of statistical tests and spatial methods used previously to evaluate migration near PAs and applied hierarchical modeling with appropriate controls for demographic and geographic factors to advance the debate. Areas bordering national parks in Tanzania did not have elevated rates of in-migration. Low baseline population density and high vegetation productivity with low interannual variation rather than conservation outreach explained observed migration patterns. More generally we argue that to produce results of conservation policy significance, analyses must be conducted at appropriate scales, and we caution against use of demographic data without appropriate controls when drawing conclusions about migration dynamics. © 2014 Society for Conservation Biology.

  20. Increasing the availability and quality of caesarean section in Tanzania.

    Science.gov (United States)

    Nyamtema, A; Mwakatundu, N; Dominico, S; Mohamed, H; Shayo, A; Rumanyika, R; Kairuki, C; Nzabuhakwa, C; Issa, O; Lyimo, C; Kasiga, I; van Roosmalen, J

    2016-09-01

    To describe the results of increasing availability and quality of caesarean deliveries and anaesthesia in rural Tanzania. Before-after intervention study design. Rural Tanzania. Ten health centres located in rural areas were upgraded to provide comprehensive emergency obstetric care (CEmOC) and the four related district hospitals were supported. Upgrading entailed constructing and equipping maternity blocks, operation rooms and laboratories; installing solar systems, backup generators and water supply systems. Associate clinicians were trained in anaesthesia and in CEmOC. Mentoring and audit of reasons for caesarean section (CS) and maternal deaths were carried out. Measures of interest were compared using analysis of variance (ANOVA) statistical tests. Trends in CS rates, proportion of unjustified CS, use of spinal anaesthesia, and the risk of death from complications related to CS and anaesthesia. During the audit period (2012-2014), 5868 of 58 751 deliveries were by CS (10%). The proportion of CS considered to be unjustified decreased from 30 to 17% in health centres (P = 0.02) and from 37 to 20% in hospitals (P availability and quality of CS by improving infrastructure, training and audit of reasons for CS is feasible, acceptable and required in low resource settings. Increasing availability and quality of CS in rural Africa is feasible. © 2016 Royal College of Obstetricians and Gynaecologists.

  1. Determinants of Leather and Leather products Exports in Tanzania

    Directory of Open Access Journals (Sweden)

    Francis Lwesya

    2018-03-01

    Full Text Available This study examines the determinants of Leather and Leather products Exports in Tanzania. We apply Ordinary Least Square (OLS analysis on time series data from 1980 to 2015. The findings show that export of raw hides and skins, and high costs of production are among the deterring factors to leather and leather products export in Tanzania. Export of raw hides and skins and costs of production recorded negative and significant relationship with leather exports. On the other hand, hides and skins collection recorded insignificant relationship while leather price in the world market had negative and significant relationship with leather exports. This suggests that other factors such as low quality of leather and leather products exported, inadequate capital investment, stiff competition with foreign companies for hides and skins and inadequate market information explain the state of current Tanzania’s leather exports. Thus, attracting local and Foreign Direct Investment (FDI in the leather subsector by providing friendly investment climate and addressing the supply side constraints will enable increased high quality leather and leather products diversification and exports

  2. The perceptions on male circumcision as a preventive measure against HIV infection and considerations in scaling up of the services: a qualitative study among police officers in Dar es Salaam, Tanzania

    Directory of Open Access Journals (Sweden)

    Tarimo Edith AM

    2012-07-01

    Full Text Available Abstract Background In recent randomized controlled trials, male circumcision has been proven to complement the available biomedical interventions in decreasing HIV transmission from infected women to uninfected men. Consequently, Tanzania is striving to scale-up safe medical male circumcision to reduce HIV transmission. However, there is a need to investigate the perceptions of male circumcision in Tanzania using specific populations. The purpose of the present study was to assess the perceptions of male circumcision in a cohort of police officers that also served as a source of volunteers for a phase I/II HIV vaccine (HIVIS-03 trial in Dar es Salaam, Tanzania. Methods In-depth interviews with 24 men and 10 women were conducted. Content analysis informed by the socio-ecological model was used to analyze the data. Results Informants perceived male circumcision as a health-promoting practice that may prevent HIV transmission and other sexually transmitted infections. They reported male circumcision promotes sexual pleasure, confidence and hygiene or sexual cleanliness. They added that it is a religious ritual and a cultural practice that enhances the recognition of manhood in the community. However, informants were concerned about the cost involved in male circumcision and cleanliness of instruments used in medical and traditional male circumcision. They also expressed confusion about the shame of undergoing circumcision at an advanced age and pain that could emanate after circumcision. The participants advocated for health policies that promote medical male circumcision at childhood, specifically along with the vaccination program. Conclusions The perceived benefit of male circumcision as a preventive strategy to HIV and other sexually transmitted infections is important. However, there is a need to ensure that male circumcision is conducted under hygienic conditions. Integrating male circumcision service in the routine childhood vaccination

  3. How much time do health services spend on antenatal care? Implications for the introduction of the focused antenatal care model in Tanzania

    Directory of Open Access Journals (Sweden)

    Mpembeni Rose

    2006-06-01

    Full Text Available Abstract Background Antenatal care (ANC is a widely used strategy to improve the health of pregnant women and to encourage skilled care during childbirth. In 2002, the Ministry of Health of the United Republic of Tanzania developed a national adaptation plan based on the new model of the World Health Organisation (WHO. In this study we assess the time health workers currently spent on providing ANC services and compare it to the requirements anticipated for the new ANC model in order to identify the implications of Focused ANC on health care providers' workload. Methods Health workers in four dispensaries in Mtwara Urban District, Southern Tanzania, were observed while providing routine ANC. The time used for the overall activity as well as for the different, specific components of 71 ANC service provisions was measured in detail; 28 of these were first visits and 43 revisits. Standard time requirements for the provision of focused ANC were assessed through simulated consultations based on the new guidelines. Results The average time health workers currently spend for providing ANC service to a first visit client was found to be 15 minutes; the provision of ANC according to the focused ANC model was assessed to be 46 minutes. For a revisiting client the difference between current practise and the anticipated standard of the new model was 27 minutes (9 vs. 36 min.. The major discrepancy between the two procedures was related to counselling. On average a first visit client was counselled for 1:30 minutes, while counselling in revisiting clients did hardly take place at all. The simulation of focused ANC revealed that proper counselling would take about 15 minutes per visit. Conclusion While the introduction of focused ANC has the potential to improve the health of pregnant women and to raise the number of births attended by skilled staff in Tanzania, it may need additional investment in human resources. The generally anticipated saving effect of

  4. THE SIMULATION DIAGNOSTIC METHODS AND REGENERATION WAYS OF REINFORCED - CONCRETE CONSTRUCTIONS OF BRIDGES IN PROVIDING THEIR OPERATING RELIABILITY AND LONGEVITY

    Directory of Open Access Journals (Sweden)

    B. V. Savchinskiy

    2010-03-01

    Full Text Available On the basis of analysis of existing diagnostic methods and regeneration ways of reinforced-concrete constructions of bridges the recommendations on introduction of new modern technologies of renewal of reinforced-concrete constructions of bridges in providing their operating reliability and longevity are offered.

  5. THE SIMULATION DIAGNOSTIC METHODS AND REGENERATION WAYS OF REINFORCED - CONCRETE CONSTRUCTIONS OF BRIDGES IN PROVIDING THEIR OPERATING RELIABILITY AND LONGEVITY

    OpenAIRE

    B. V. Savchinskiy

    2010-01-01

    On the basis of analysis of existing diagnostic methods and regeneration ways of reinforced-concrete constructions of bridges the recommendations on introduction of new modern technologies of renewal of reinforced-concrete constructions of bridges in providing their operating reliability and longevity are offered.

  6. A Mixed-Methods Investigation of Early Childhood Professional Development for Providers and Recipients in the United States

    Science.gov (United States)

    Linder, Sandra M.; Rembert, Kellye; Simpson, Amber; Ramey, M. Deanna

    2016-01-01

    This multi-phase mixed-methods study explores provider and recipient perceptions of the current state of early childhood professional development in a southeastern area of the United States. Professional development for the early childhood workforce has been shown to positively influence the quality of early childhood classrooms. This study…

  7. Perceptions of vaginal microbicides as an HIV prevention method among health care providers in KwaZulu-Natal, South Africa

    Directory of Open Access Journals (Sweden)

    Mantell Joanne E

    2007-03-01

    Full Text Available Abstract Background The promise of microbicides as an HIV prevention method will not be realized if not supported by health care providers. They are the primary source of sexual health information for potential users, in both the public and private health sectors. Therefore, the aim of this study was to determine perceptions of vaginal microbicides as a potential HIV prevention method among health care providers in Durban and Hlabisa, South Africa, using a combination of quantitative and qualitative methods. Results During 2004, semi structured interviews with 149 health care providers were conducted. Fifty seven percent of hospital managers, 40% of pharmacists and 35% of nurses possessed some basic knowledge of microbicides, such as the product being used intra-vaginally before sex to prevent HIV infection. The majority of them were positive about microbicides and were willing to counsel users regarding potential use. Providers from both public and private sectors felt that an effective microbicide should be available to all people, regardless of HIV status. Providers felt that the product should be accessed over-the-counter in pharmacies and in retail stores. They also felt a need for potential microbicides to be available free of charge, and packaged with clear instructions. The media was seen by health care providers as being an effective strategy for promoting microbicides. Conclusion Overall, health care providers were very positive about the possible introduction of an effective microbicide for HIV prevention. The findings generated by this study illustrated the need for training health care providers prior to making the product accessible, as well as the importance of addressing the potential barriers to use of the product by women. These are important concerns in the health care community, and this study also served to educate them for the day when research becomes reality.

  8. Calculation of the energy provided by a PV generator. Comparative study: Conventional methods vs. artificial neural networks

    International Nuclear Information System (INIS)

    Almonacid, F.; Rus, C.; Perez-Higueras, P.; Hontoria, L.

    2011-01-01

    The use of photovoltaics for electricity generation purposes has recorded one of the largest increases in the field of renewable energies. The energy production of a grid-connected PV system depends on various factors. In a wide sense, it is considered that the annual energy provided by a generator is directly proportional to the annual radiation incident on the plane of the generator and to the installed nominal power. However, a range of factors is influencing the expected outcome by reducing the generation of energy. The aim of this study is to compare the results of four different methods for estimating the annual energy produced by a PV generator: three of them are classical methods and the fourth one is based on an artificial neural network developed by the R and D Group for Solar and Automatic Energy at the University of Jaen. The results obtained shown that the method based on an artificial neural network provides better results than the alternative classical methods in study, mainly due to the fact that this method takes also into account some second order effects, such as low irradiance, angular and spectral effects. -- Research highlights: → It is considered that the annual energy provided by a PV generator is directly proportional to the annual radiation incident on the plane of the generator and to the installed nominal power. → A range of factors are influencing the expected outcome by reducing the generation of energy (mismatch losses, dirt and dust, Ohmic losses,.). → The aim of this study is to compare the results of four different methods for estimating the annual energy produced by a PV generator: three of them are classical methods and the fourth one is based on an artificial neural network. → The results obtained shown that the method based on an artificial neural network provides better results than the alternative classical methods in study. While classical methods have only taken into account temperature losses, the method based in

  9. Knowledge, attitudes and practice pertaining to depression among primary health care workers in Tanzania

    Directory of Open Access Journals (Sweden)

    Shah Ajit

    2009-02-01

    Full Text Available Abstract Background Examination of consultation data in a variety of primary care settings in Tanzania shows that, while psychoses are routinely diagnosed and treated at primary care level, depression is rarely recorded as a reason for consultation. Since, epidemiological studies elswhere show that depression is a much more common disorder than psychosis, a series of studies were undertaken to elucidate this apparent paradox in Tanzania and inform mental health policy; firstly, a household prevalence study to ascertain the prevalence of common mental disorders at community level in Tanzania; secondly, a study to ascertain the prevalence of common mental disorders in primary care attenders; and thirdly, a study to ascertain the current status of the knowledge, attitude and practice pertaining to depression among primary health care workers. This paper reports the findings of the latter study. Methods All the primary health care workers (N = 14 in four primary health care centres in Tanzania were asked to complete the Depression Attitude Questionnaire, which assesses the health worker's knowledge and attitude towards the causes, consequences and treatment of depression. Results The majority of respondents felt that rates of depression had increased in recent years, believed that life events were important in the aetiology of depression, and generally held positive views about pharmacological and psychological treatments of depression, prognosis and their own involvement in the treatment of depressed patients. However, the majority of respondents felt that becoming depressed is a way that people with poor stamina deal with life difficulties. Conclusion The findings suggest a need to strengthen the training of primary health care workers in Tanzania about the detection of depression, pharmacological and psychological treatments, and psychosocial interventions.

  10. Knowledge, attitudes and practice pertaining to depression among primary health care workers in Tanzania

    Science.gov (United States)

    Mbatia, Joseph; Shah, Ajit; Jenkins, Rachel

    2009-01-01

    Background Examination of consultation data in a variety of primary care settings in Tanzania shows that, while psychoses are routinely diagnosed and treated at primary care level, depression is rarely recorded as a reason for consultation. Since, epidemiological studies elswhere show that depression is a much more common disorder than psychosis, a series of studies were undertaken to elucidate this apparent paradox in Tanzania and inform mental health policy; firstly, a household prevalence study to ascertain the prevalence of common mental disorders at community level in Tanzania; secondly, a study to ascertain the prevalence of common mental disorders in primary care attenders; and thirdly, a study to ascertain the current status of the knowledge, attitude and practice pertaining to depression among primary health care workers. This paper reports the findings of the latter study. Methods All the primary health care workers (N = 14) in four primary health care centres in Tanzania were asked to complete the Depression Attitude Questionnaire, which assesses the health worker's knowledge and attitude towards the causes, consequences and treatment of depression. Results The majority of respondents felt that rates of depression had increased in recent years, believed that life events were important in the aetiology of depression, and generally held positive views about pharmacological and psychological treatments of depression, prognosis and their own involvement in the treatment of depressed patients. However, the majority of respondents felt that becoming depressed is a way that people with poor stamina deal with life difficulties. Conclusion The findings suggest a need to strengthen the training of primary health care workers in Tanzania about the detection of depression, pharmacological and psychological treatments, and psychosocial interventions. PMID:19243596

  11. A SWOT Analysis of the Integration of E-Learning at a University in Uganda and a University in Tanzania

    Science.gov (United States)

    Zhu, Chang; Justice Mugenyi, Kintu

    2015-01-01

    This research examines the strengths, weaknesses, opportunities and threats (SWOT) to integrating e-learning perceived by academic staff at a university in Uganda and a university in Tanzania. Mixed-methods research was used in which a main qualitative study was complemented by a quantitative method. The sample participants were academic staff…

  12. A combined usage of stochastic and quantitative risk assessment methods in the worksites: Application on an electric power provider

    International Nuclear Information System (INIS)

    Marhavilas, P.K.; Koulouriotis, D.E.

    2012-01-01

    An individual method cannot build either a realistic forecasting model or a risk assessment process in the worksites, and future perspectives should focus on the combined forecasting/estimation approach. The main purpose of this paper is to gain insight into a risk prediction and estimation methodological framework, using the combination of three different methods, including the proportional quantitative-risk-assessment technique (PRAT), the time-series stochastic process (TSP), and the method of estimating the societal-risk (SRE) by F–N curves. In order to prove the usefulness of the combined usage of stochastic and quantitative risk assessment methods, an application on an electric power provider industry is presented to, using empirical data.

  13. Impact of ALSO training on the management of prolonged labor and neonatal care at Kagera Regional Hospital, Tanzania

    DEFF Research Database (Denmark)

    Sorensen, Bjarke Lund; Rasch, Vibeke; Massawe, Siriel

    2010-01-01

    OBJECTIVE: To evaluate the management of prolonged labor and neonatal care before and after Advanced Life Support in Obstetrics (ALSO) training. METHODS: Staff involved in childbirth at Kagera Regional Hospital, Tanzania, attended a 2-day ALSO provider course. In this prospective intervention study...... conducted between July and November 2008, the management and outcomes of 558 deliveries before and 550 after the training were observed. RESULTS: There was no significant difference in the rate of cesarean deliveries owing to prolonged labor, and vacuum delivery was not practiced after the intervention...... 5.6% to 71.5% (RR 12.71; 95% CI, 9.04-17.88). There was a significant decrease from 6 to 0 neonatal deaths before discharge among those born with an Apgar score after 1minute of 4 or more (P=0.03). CONCLUSION: ALSO training had no effect on the management of prolonged labor. Early contact between...

  14. Modelling and mapping the topsoil organic carbon content for Tanzania

    Science.gov (United States)

    Kempen, Bas; Kaaya, Abel; Ngonyani Mhaiki, Consolatha; Kiluvia, Shani; Ruiperez-Gonzalez, Maria; Batjes, Niels; Dalsgaard, Soren

    2014-05-01

    Soil organic carbon (SOC), held in soil organic matter, is a key indicator of soil health and plays an important role in the global carbon cycle. The soil can act as a net source or sink of carbon depending on land use and management. Deforestation and forest degradation lead to the release of vast amounts of carbon from the soil in the form of greenhouse gasses, especially in tropical countries. Tanzania has a high deforestation rate: it is estimated that the country loses 1.1% of its total forested area annually. During 2010-2013 Tanzania has been a pilot country under the UN-REDD programme. This programme has supported Tanzania in its initial efforts towards reducing greenhouse gas emission from forest degradation and deforestation and towards preserving soil carbon stocks. Formulation and implementation of the national REDD strategy requires detailed information on the five carbon pools among these the SOC pool. The spatial distribution of SOC contents and stocks was not available for Tanzania. The initial aim of this research, was therefore to develop high-resolution maps of the SOC content for the country. The mapping exercise was carried out in a collaborative effort with four Tanzanian institutes and data from the Africa Soil Information Service initiative (AfSIS). The mapping exercise was provided with over 3200 field observations on SOC from four sources; this is the most comprehensive soil dataset collected in Tanzania so far. The main source of soil samples was the National Forest Monitoring and Assessment (NAFORMA). The carbon maps were generated by means of digital soil mapping using regression-kriging. Maps at 250 m spatial resolution were developed for four depth layers: 0-10 cm, 10-20 cm, 20-30 cm, and 0-30 cm. A total of 37 environmental GIS data layers were prepared for use as covariates in the regression model. These included vegetation indices, terrain parameters, surface temperature, spectral reflectances, a land cover map and a small

  15. Prevalence and risk factors associated with female anal sex in the context of HIV/AIDS in the selected districts of Tanzania.

    Science.gov (United States)

    Shayo, Elizabeth H; Kalinga, Akili A; Senkoro, Kesheni P; Msovela, Judith; Mgina, Erick J; Shija, Angela E; Materu, Godlisten; Kilima, Stella P; Mboera, Leonard E G; Massaga, Julius J

    2017-03-27

    Female anal sex is a receptive type of sexual practice among heterosexual couples where the penis is inserted into the anus of a female partner. In the Western world, a number of studies and interventions have been carried out on anal sex among men due to its potential risks to HIV transmission. In African countries, including Tanzania, there is dearth of information on the risks inherent in practices associated with female anal sex in the general population. The objective of this study was to determine the prevalence and risk factors associated with female anal sex in fuelling HIV transmission in selected districts of Tanzania. This study was conducted in four districts of Tanzania of Kinondoni, Tanga Urban, Makete and Siha. Both quantitative and qualitative methods i.e. household interviews and focus group discussions were employed in data collection. Study participants included community members of aged 15 and above such as heads of the household, adolescents, bar workers and commercial sex workers. A total of 903 individuals were interviewed, 60.6% of whom were females. When respondents were asked to indicate whether they had ever been tempted to practise FAS, 167 (18.5%) reported to have been tempted in the past 12 months. Of these, 44 (26.3%) respondents had at least practised FAS. Risky practices associated with FAS were forced sex, multiple partners, frequency of engaging in FAS, low use of condoms during FAS, low rates of HIV testing among partakers, poor perception of the risks to acquire HIV through FAS and use of lubricants. In this population, the frequency of FAS practice was rather low. And yet, FAS practice attendant risk factors are likely to exacerbate HIV transmission. As such, there is a need for further exploratory studies to determine and document drivers of FAS. In addition, public health education should be provided with regard to the risks of contracting HIV associated with FAS practices.

  16. Evaluation of protection factors provided by full-face masks using man-test method at workplace

    International Nuclear Information System (INIS)

    Izumi, Yukio; Kinouchi, Nobuyuki; Ikezawa, Yoshio.

    1994-01-01

    From a practical angle of view to estimate the protection factors (PFs) provided by full-face masks, a number of protection factors were measured with a man-test apparatus just before the wearers started to do radiation work in radiation controlled area. PFs of the total number of 2,279 cases were measured under five simulated working conditions. The measured PFs were widely distributed from 2.3 to 6,700. About 95% of workers obtained PFs more than 50, and about 64% showed much higher PFs more than 1,000 due to good fitting. In the case of some persons, the measured PFs irregularly varied and changed to a large degree. This method is a reliable technique that has been confirmed to protect unexpected internal exposure. From the results obtained, the method should be necessary to provide a better mask and higher PF for each worker. (author)

  17. A METHOD AND AN APPARATUS FOR PROVIDING TIMING SIGNALS TO A NUMBER OF CIRCUITS, AN INTEGRATED CIRCUIT AND A NODE

    DEFF Research Database (Denmark)

    2006-01-01

    A method of providing or transporting a timing signal between a number of circuits, electrical or optical, where each circuit is fed by a node. The nodes forward timing signals between each other, and at least one node is adapted to not transmit a timing signal before having received a timing...... signal from at least two nodes. In this manner, the direction of the timing skew between nodes and circuits is known and data transport between the circuits made easier....

  18. Understanding the strategies employed to cope with increased numbers of AIDS-orphaned children in families in rural settings: a case of Mbeya Rural District, Tanzania.

    Science.gov (United States)

    Fauk, Nelsensius Klau; Mwakinyali, Silivano Edson; Putra, Sukma; Mwanri, Lillian

    2017-02-07

    The purpose of this study was to understand the strategies employed by families that adopt Acquired Immune Deficiency Syndrome (AIDS)-orphaned children (Adoptive families) for coping with and mitigating the impact of AIDS in Mbeya Rural District, Tanzania. High numbers of AIDS-orphaned children aged below 18 years in Mbeya Region have led to increasing the burden of families caring for them. Understanding the coping strategies and impact mitigation activities employed by adoptive families is important in order to develop programmes to help them. This study employed a qualitative method for data collection (one-on-one in-depth interviews). The respondents included 12 male and 8 female heads of families that provide essential care for AIDS-orphaned children in Mbeya Rural District in Tanzania. The framework approach was used to analyse the data that were collected from 15 July to 15 August 2010. The study findings revealed that adoptive families faced several challenges including financial constraints due to increased needs for basic essentials such as health care expenses, school fees and food. Further impacts on adoptive families included shortage of work opportunities and limited time to address these challenges. To mitigate these challenges, adoptive families employed a range of coping strategies including selling family assets and renting out parts of cultivable land for extra cash. Task reallocation which involved the AIDS-orphaned children entering the labour force was also employed as a strategy to mitigate challenges and involved de-enrolling of children from schools so they could take part in income-generating activities in order to earn supplementary family income. The creation of additional income-generating activities such as poultry farming were other coping mechanisms employed, and these received support from both non-governmental organisations (NGOs) and governmental organisations, including the Isangati Agricultural Development Organization (local

  19. Tanzania | Page 12 | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    It is 2002. Parents and babies wait patiently to see the community health worker in Mvomero, Tanzania. “People have faith in the services. They are treated well and diagnosed properly,” says Samuel Hassain, here with his sick grandson. Health worker Y.E. Kapito marvels that “it has been six to eight months since I heard of ...

  20. Australian nursing and midwifery educators delivering evidence-based education in Tanzania: A qualitative study.

    Science.gov (United States)

    Gower, Shelley; van den Akker, Jose; Jones, Mark; Dantas, Jaya A R; Duggan, Ravani

    2016-05-01

    Since 2011, Western Australian nursing and midwifery educators have been providing evidence-based continuing education to Tanzanian health professionals. Despite thorough preparation before departure, differences in local resource levels and available facilities have necessitated impromptu adaptation of curriculum content and delivery methods to ensure an effective program was delivered. This study explored the personal, cultural and teaching strategies utilised by Western Australian nursing and midwifery educators in Tanzania and examined if the transferability of education packages was influenced by the educators' cultural competence. Using a qualitative exploratory approach, data was collected from 15 Western Australian nursing and midwifery educators using a demographic survey and in-depth individual semi-structured interviews. The core themes identified from the analysis were Determination to learn, Assessing needs, Communication skills and Greater understanding. These findings are described using the conceptual framework of Campinha-Bacote's The Process of Cultural Competence in the Delivery of Healthcare Services. With appropriate levels of cultural competence, international health professionals can be effective at providing ongoing professional development to colleagues in developing country contexts, which may help address difficulties with retention and motivation of staff. It is essential that prior to departure cultural competence training is provided to educators to enhance their teaching capacity and effectiveness in international settings. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. Voluntary medical male circumcision: matching demand and supply with quality and efficiency in a high-volume campaign in Iringa Region, Tanzania.

    Science.gov (United States)

    Mahler, Hally R; Kileo, Baldwin; Curran, Kelly; Plotkin, Marya; Adamu, Tigistu; Hellar, Augustino; Koshuma, Sifuni; Nyabenda, Simeon; Machaku, Michael; Lukobo-Durrell, Mainza; Castor, Delivette; Njeuhmeli, Emmanuel; Fimbo, Bennett

    2011-11-01

    The government of Tanzania has adopted voluntary medical male circumcision (VMMC) as an important component of its national HIV prevention strategy and is scaling up VMMC in eight regions nationwide, with the goal of reaching 2.8 million uncircumcised men by 2015. In a 2010 campaign lasting six weeks, five health facilities in Tanzania's Iringa Region performed 10,352 VMMCs, which exceeded the campaign's target by 72%, with an adverse event (AE) rate of 1%. HIV testing was almost universal during the campaign. Through the adoption of approaches designed to improve clinical efficiency-including the use of the forceps-guided surgical method, the use of multiple beds in an assembly line by surgical teams, and task shifting and task sharing-the campaign matched the supply of VMMC services with demand. Community mobilization and bringing client preparation tasks (such as counseling, testing, and client scheduling) out of the facility and into the community helped to generate demand. This case study suggests that a campaign approach can be used to provide high-volume quality VMMC services without compromising client safety, and provides a model for matching supply and demand for VMMC services in other settings.

  2. Some Experience with Illicit Trafficking of Radioactive Materials in Tanzania

    International Nuclear Information System (INIS)

    Ngaile, J.E.; Banzi, F.P.; Kifanga, L.D.

    2008-01-01

    Illicit trafficking of radioactive materials (orphan sources or disuse sources) is of global concern. Reports on the IAEA Illicit Trafficking Data Base (ITDB) indicates increasing trend of incidents recorded in more than 40 countries on six continents[1]. It is suspected that nuclear trafficking is fueled by nuclear terrorism and is a threat for increasing illegal trade in nuclear and radioactive materials to manufacture Radiological Disposal Devices (RDD)- dirty bombs. As such, the international co-operative efforts are needed to uncover and combat nuclear trafficking in order to minimize its consequences such as external radiation exposure of persons from source to various radiation levels during illicit movement and after seizure; rupture of source leading to internal exposure of persons and environmental contamination. Although accidents with radioactive materials have not occurred in the United Republic of Tanzania (URT), incidents of illicit trafficking and unauthorized possession of radioactive materials has occurred thus prompting the Tanzania Atomic Energy Commission (TAEC) to strengthen its nuclear security of nuclear and radioactive material in the URT. Nuclear faclities and radioactive sources lacks adequate physical protection against theft, fire or different forms of unauthorized access. Tanzaniaia has recorded about thirteen (13) illicit trafficking incidents of radioactive between 1996-2006. Caesium-137, Uranium-238; and Uranium oxide standard and Radium-226 with activity ranging from low to significantly high were among the radiounuclides which were intercepted. Most of these incidents had their original outside Tanzania. The incidents were uncovered by informers in cooperation with the police. Despite the fact that the management of these incidents by the police were adequate, it was observed that there is an inadequate radiation protection arrangements during transport of seized sources; lack of precautions for safety when handling seized

  3. A Similarity-Ranking Method on Semantic Computing for Providing Information-Services in Station-Concierge System

    Directory of Open Access Journals (Sweden)

    Motoki Yokoyama

    2017-07-01

    Full Text Available The prevalence of smartphones and wireless broadband networks have been progressing as a new Railway infomration environment. According to the spread of such devices and information technology, various types of information can be obtained from databases connected to the Internet. One scenario of obtaining such a wide variety of information resources is in the phase of user’s transportation. This paper proposes an information provision system, named the Station Concierge System that matches the situation and intention of passengers. The purpose of this system is to estimate the needs of passengers like station staff or hotel concierge and to provide information resources that satisfy user’s expectations dynamically. The most important module of the system is constructed based on a new information ranking method for passenger intention prediction and service recommendation. This method has three main features, which are (1 projecting a user to semantic vector space by using her current context, (2 predicting the intention of a user based on selecting a semantic vector subspace, and (3 ranking the services by a descending order of relevant scores to the user’ intention. By comparing the predicted results of our method with those of two straightforward computation methods, the experimental studies show the effectiveness and efficiency of the proposed method. Using this system, users can obtain transit information and service map that dynamically matches their context.

  4. Spatially continuous dataset at local scale of Taita Hills in Kenya and Mount Kilimanjaro in Tanzania

    Directory of Open Access Journals (Sweden)

    Sizah Mwalusepo

    2016-09-01

    Full Text Available Climate change is a global concern, requiring local scale spatially continuous dataset and modeling of meteorological variables. This dataset article provided the interpolated temperature, rainfall and relative humidity dataset at local scale along Taita Hills and Mount Kilimanjaro altitudinal gradients in Kenya and Tanzania, respectively. The temperature and relative humidity were recorded hourly using automatic onset THHOBO data loggers and rainfall was recorded daily using GENERALR wireless rain gauges. Thin plate spline (TPS was used to interpolate, with the degree of data smoothing determined by minimizing the generalized cross validation. The dataset provide information on the status of the current climatic conditions along the two mountainous altitudinal gradients in Kenya and Tanzania. The dataset will, thus, enhance future research. Keywords: Spatial climate data, Climate change, Modeling, Local scale

  5. Creating Fiscal Space for Social Sectors Development in Tanzania ...

    African Journals Online (AJOL)

    This paper discusses fiscal space creation and use in the context of development of social sectors in Tanzania. The paper observes that Tanzania is making good progress in creating and using her fiscal space. The priority being accorded to social sectors, especially in education and health is in the right direction. However ...

  6. All projects related to tanzania | Page 2 | IDRC - International ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    In Tanzania, the maternal mortality rate of 454 deaths per 100,000 live births means that ... and employment options in poor rural communities in Rwanda and Tanzania. ... of fruit results in post-harvest losses of nearly 40% in tropical countries.

  7. All projects related to tanzania | Page 4 | IDRC - International ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Topic: ACCESS TO HEALTH CARE, HEALTH EXPENDITURE, HEALTH FINANCING. Region: South of Sahara, Ghana, Kenya, Uganda, Tanzania, Zambia, South Africa. Program: Maternal and Child Health. Total Funding: CA$ 366,015.00. Food Security, Adequate Care and Environment (Tanzania and Malawi). Project.

  8. Social security systems in Tanzania: Phase I Overview of social ...

    African Journals Online (AJOL)

    The paper starts by examining the concept of social security in Tanzania, showing that there are three key issues in social security which have not been adequately addressed by existing social security schemes and need immediate attention. The paper then examines the nature and forms of social security in Tanzania in a ...

  9. Planning a Family: Priorities and Concerns in Rural Tanzania ...

    African Journals Online (AJOL)

    Planning a Family: Priorities and Concerns in Rural Tanzania. T Marchant, AK Mushi, R Nathan, O Mukasa, S Abdulla, C Lengeler, JRM Armstrong Schellenberg. Abstract. A fertility survey using qualitative and quantitative techniques described a high fertility setting (TFR 5.8) in southern Tanzania where family planning use ...

  10. tanzania : tous les projets | Page 3 | CRDI - Centre de recherches ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Sujet: HIV, MATERNAL AND CHILD HEALTH, PREGNANCY, VIRUSES, TANZANIA, ZAMBIA, BOTSWANA, DISEASE TRANSMISSION, Gender. Région: North of Sahara, South of Sahara, Botswana, Tanzania, Zambia. Programme: Santé des mères et des enfants. Financement total : CA$ 55,000.00. Les pertes après ...

  11. Tanzania Journal of Health Research - Vol 14, No 1 (2012)

    African Journals Online (AJOL)

    Clinical manifestations and outcomes of severe malaria among children admitted to Rungwe and Kyela district hospitals in south-western Tanzania · EMAIL FREE FULL ... Dermatological malignancies at a University teaching Hospital in Northwestern Tanzania: A retrospective review of 154 cases · EMAIL FREE FULL TEXT ...

  12. A telemedicine network to support paediatric care in small hospitals in rural Tanzania.

    Science.gov (United States)

    Krüger, Carsten; Niemi, Mauri

    2012-01-01

    We reviewed our experience with the Tanzanian Telemedicine Network in supporting paediatric care at 40 small, rural hospitals in the country. The network began operating in 2008. Store and forward telemedicine was provided via the open source software iPath. The 33 volunteer consultants were based in several countries, although most of them had practical experience in Tanzania. During the first three years of network operation there were 533 referrals. There were 159 paediatric cases (median age five years). Three paediatric specialists provided most consultations (64%), but other specialists provided recommendations when required. The response time was usually less than two days (median 6 h; inter-quartile range 2-24 h). A precise recommendation was not always provided, but since all consultants had an intimate knowledge of the state of health services in Tanzania, their advice was usually well adapted to the local circumstances of the hospitals. Referral to a higher level of care was recommended in 26 cases (16%). A simple web-based telemedicine system combined with email alerts is feasible in remote locations in Tanzania, even where fast Internet connections are not available. Copyright © 2012 by the Royal Society of Medicine Press Ltd

  13. Risk distribution across multiple health insurance funds in rural Tanzania

    DEFF Research Database (Denmark)

    Chomi, Eunice Nahyuha; Mujinja, Phares Gamba; Enemark, Ulrika

    2014-01-01

    cross-subsidisation across the funds. This paper analyses whether the risk distribution varies across the Community Health Fund (CHF) and National Health Insurance Fund (NHIF) in two districts in Tanzania. Specifically we aim to 1) identify risk factors associated with increased utilisation of health...... services and 2) compare the distribution of identified risk factors among the CHF, NHIF and non-member households. METHODS: Data was collected from a survey of 695 households. A multivariate logisitic regression model was used to identify risk factors for increased health care utilisation. Chi-square tests...... were performed to test whether the distribution of identified risk factors varied across the CHF, NHIF and non-member households. RESULTS: There was a higher concentration of identified risk factors among CHF households compared to those of the NHIF. Non-member households have a similar wealth status...

  14. Conservation biology: lion attacks on humans in Tanzania.

    Science.gov (United States)

    Packer, Craig; Ikanda, Dennis; Kissui, Bernard; Kushnir, Hadas

    2005-08-18

    Large carnivores inspire opposition to conservation efforts owing to their impact on livestock and human safety. Here we analyse the pattern of lion attacks over the past 15 years on humans in Tanzania, which has the largest population of lions in Africa, and find that they have killed more than 563 Tanzanians since 1990 and injured at least 308. Attacks have increased dramatically during this time: they peak at harvest time each year and are most frequent in areas with few prey apart from bush pigs (Potamochoerus larvatus), the most common nocturnal crop pest. Our findings provide an important starting point for devising strategies to reduce the risk to rural Tanzanians of lion attacks.

  15. An analysis of pre-service family planning teaching in clinical and nursing education in Tanzania

    OpenAIRE

    Muganyizi, Projestine S; Ishengoma, Joyce; Kanama, Joseph; Kikumbih, Nassoro; Mwanga, Feddy; Killian, Richard; McGinn, Erin

    2014-01-01

    Background Promoting family planning (FP) is a key strategy for health, economic and population growth. Sub-Saharan Africa, with one of the lowest contraceptive prevalence and highest fertility rates globally, contributes half of the global maternal deaths. Improving the quality of FP services, including enhancing pre-service FP teaching, has the potential to improve contraceptive prevalence. In efforts to improve the quality of FP services in Tanzania, including provider skills, this study s...

  16. Adoption of Free Open Source Geographic Information System Solution for Health Sector in Zanzibar Tanzania

    OpenAIRE

    BAKAR, Abubakar D.; KIMARO, Honest C.; SULTAN, Abu Bakar MD; HAMIAR, S.

    2014-01-01

    The study aims at developing in-depth understanding on how Open Source Geographic Information System technology is used to provide solutions for data visualization in the health sector of Zanzibar, Tanzania. The study focuses on implementing the health visualization solutions for the purpose of bridging the gap during the transition period from proprietary software to the Free Open-Source Software using Key Indicator Data System. The developed tool facilitates data integration between the two...

  17. Behavioural responses to hypoxia provide a non-invasive method for distinguishing between stress coping styles in fish

    DEFF Research Database (Denmark)

    Laursen, Danielle Caroline; Olsén, Hanna L.; Ruiz-Gomez, Maria de Lourdes

    2011-01-01

    . These individual differences may result in suboptimal production and compromised welfare in aquaculture. An approach to overcome these problems could be to sort fish and optimise rearing conditions according to coping style. It has been previously demonstrated that the proactive and reactive coping styles in fish......, these fish provided an opportunity for verifying a method for sorting fish with respect to coping style by exposure to hypoxia. Groups consisting of 24 individually tagged fish, 12 HR and 12 LR were exposed to hypoxia in a two choice system. The system consisted of a “home” tank provided with cover connected...... to a second brightly “illuminated” tank via a closable doorway. During the experiment, the doorway between the two tanks was opened and hypoxic conditions were gradually induced in the “home” tank by bubbling with nitrogen. The latency time to move away from hypoxic conditions to normoxic conditions...

  18. How long-distance truck drivers and villagers in rural southeastern Tanzania think about heterosexual anal sex: a qualitative study

    NARCIS (Netherlands)

    Mtenga, S.; Shamba, D.; Wamoyi, J.; Kakoko, D.; Haafkens, J.; Mongi, A.; Kapiga, S.; Geubbels, E.

    2015-01-01

    Objective: To explore ideas of truck drivers and villagers from rural Tanzania about heterosexual anal sex (HAS) and the associated health risks. Methods: Qualitative study using 8 in-depth interviews (IDIs) and 2 focus group discussions (FGDs) with truck drivers and 16 IDIs and 4 FGDs with

  19. Owner-manager motives and the growth of SMEs in developing countries: Evidence from the furniture industry in Tanzania

    NARCIS (Netherlands)

    Isaga, N.; Masurel, E.; van Montfort, C.A.G.M.

    2015-01-01

    Purpose – This paper aims to contribute to the understanding of the motives of individuals in Tanzania to start their own businesses on the one hand and the growth of their firms on the other hand. Design/methodology/approach – A survey method was used to gather data from 300 small business owners

  20. Information, Affect and Action: Motivating Reduction of Risk Behaviors for HIV/AIDS in Kenya and Tanzania

    Science.gov (United States)

    Hardre, Patricia L.; Garcia, Fe; Apamo, Peter; Mutheu, Lucy; Ndege, Monica

    2012-01-01

    This study reports assessment of motivational and perceptual components of a youth and community AIDS awareness education program, focusing on effectiveness across program sites. The design of this investigation was quasi-experimental, with two intervention districts and one control each, in Kenya and Tanzania. Methods included questionnaires…

  1. Content Analysis of the Status and Place of Sexuality Education in the National School Policy and Curriculum in Tanzania

    Science.gov (United States)

    Mkumbo, Kitila A.

    2009-01-01

    In Tanzania, sexuality education in schools is not provided as a standalone subject; rather it is mainstreamed in other subjects, namely Social Studies, Science, Civics and Biology. However, it is not clear how much sexuality education is covered in these subjects. The purpose of this study was to examine the status of sexuality education in the…

  2. The paradox of compassionate work: a mixed-methods study of satisfying and fatiguing experiences of animal health care providers.

    Science.gov (United States)

    Polachek, Alicia J; Wallace, Jean E

    2018-03-01

    Compassionate work appears paradoxical as it may provide great rewards, but may also come at great costs to care providers. This paper explores the paradox of compassionate work by examining what interactions contribute to compassion satisfaction and what interactions contribute to compassion fatigue. This mixed-methods, cross-sectional study uses qualitative interview data from animal health care providers (N = 20) to identify work interactions that they find satisfying or stressful. Quantitative survey data (N = 572) are used to test hypotheses generated from the interviews regarding predictors of compassion satisfaction and compassion fatigue. Interview transcripts were analyzed using a directed content analysis approach. Survey data were analyzed using ordinary least squares regression. The results highlight the complex nature of compassionate work. As hypothesized, making a difference to animals and building relationships with animal patients and human clients relate to greater compassion satisfaction. Human client barriers to animal care and witnessing client grief relate to greater compassion fatigue, as predicted. None of the predictors relate to less compassion fatigue, but forming relationships with animal patients relates to both greater compassion satisfaction and compassion fatigue. This paper enhances our understanding of provider-client-patient interactions and highlights the paradox of compassionate work.

  3. runjags: An R Package Providing Interface Utilities, Model Templates, Parallel Computing Methods and Additional Distributions for MCMC Models in JAGS

    Directory of Open Access Journals (Sweden)

    Matthew J. Denwood

    2016-07-01

    Full Text Available The runjags package provides a set of interface functions to facilitate running Markov chain Monte Carlo models in JAGS from within R. Automated calculation of appropriate convergence and sample length diagnostics, user-friendly access to commonly used graphical outputs and summary statistics, and parallelized methods of running JAGS are provided. Template model specifications can be generated using a standard lme4-style formula interface to assist users less familiar with the BUGS syntax. Automated simulation study functions are implemented to facilitate model performance assessment, as well as drop-k type cross-validation studies, using high performance computing clusters such as those provided by parallel. A module extension for JAGS is also included within runjags, providing the Pareto family of distributions and a series of minimally-informative priors including the DuMouchel and half-Cauchy priors. This paper outlines the primary functions of this package, and gives an illustration of a simulation study to assess the sensitivity of two equivalent model formulations to different prior distributions.

  4. DETECTION OF REPORTS FALSIFICATION PROVIDED TO A BANK BY A BORROWER USING THE METHOD OF DYNAMIC PARAMETERS ANALYSIS

    Directory of Open Access Journals (Sweden)

    M. S. Lyuft

    2015-01-01

    Full Text Available Summary. The main stop-factors in a landing were formed in the article according to the procedure of the European Bank for Reconstruction and Development by the means of questioning the leading Russian banks that finance small-scale business. It is given the description of this method, also it is identified the main weaknesses of the EBRD methodology. There is a description of the main methods of the borrowing company’s analytical balance and thereupon it is made the conclusion about the necessity of the analysis of the balance’s principal factors across time. The analysis of indicators and factors in the dynamics enables us to see trends in the development of the company, and to identify deviations in the coefficients. Either materiality or difference from normal values of these coefficients may indicate the factors of the borrowers’ misconduct, and in particular it gives evidence concerning falsification of reports provided to a bank. There are stages of information processing for falsification’s detection, excluding the interest from decision-makers about the possibility of lending in the results of a transaction. The formula that determinates the value of net profit falsification has been made on basis of dynamic parameters of the analytical balance and the connection with the administrative profit-and-loss report. Further, the article provides the second method of a determination of the net profit falsification already based on data of the parameters in dynamics namely business profitability rate. The process of calculation Payment To Income - payment to income - an indicator, in order to obtain good data on who falsify net income. Are key strengths of this method of identifying and conclusions paragraph article.

  5. IAEA responds to cancer crisis in Tanzania

    International Nuclear Information System (INIS)

    2006-01-01

    Full text: On the occasion of World Cancer Day (4 February), the IAEA announced that its Programme of Action for Cancer Therapy (PACT) will establish its first Centre of Excellence in Dar Es Salaam, Tanzania. This low-income East African country has one of the continent's highest cancer rates and only one cancer treatment centre. 'Cancer is a growing crisis all across the developing world,' explains IAEA Director General and Nobel Laureate Mohammed ElBaradei. 'We can save thousands of lives if we put together the tools, the knowledge and the political will to fight cancer effectively,' he said. Cancer is the second most common cause of death worldwide after cardiovascular disease. Over 7 million people died of cancer in 2005, and close to 11 million new cancer cases were diagnosed, according to the World Health Organization (WHO). More than 70 percent of cancer deaths now occur in low and middle income countries - the very countries least able to address this growing burden. Cancer-related deaths are projected to increase to more than 9 million people annually by 2015. Already cancer claims twice the number of lives worldwide as AIDS. Low income nations now face a dual burden of communicable and chronic diseases such as cancer. The IAEA spends about 12 million dollars each year for improving cancer treatment in the developing world. Last year, it established the Programme of Action for Cancer Therapy (PACT), to build partnerships with the WHO and other organizations dedicated to controlling cancer. Much of the IAEA's share of the 2005 Nobel Peace Prize Award has been dedicated to helping the developing world deal with the dramatic rise in cancer that is overwhelming limited health resources and equipment. The harsh reality of developing nations is one of overburdened health systems with little cancer screening and unnecessarily late cancer diagnosis and non-curative treatment. The IAEA estimates that approximately 5,000 cancer care centres and systems - plus the

  6. The costs of introducing artemisinin-based combination therapy: evidence from district-wide implementation in rural Tanzania

    Directory of Open Access Journals (Sweden)

    Abdulla Salim

    2008-01-01

    Full Text Available Abstract Background The development of antimalarial drug resistance has led to increasing calls for the introduction of artemisinin-based combination therapy (ACT. However, little evidence is available on the full costs associated with changing national malaria treatment policy. This paper presents findings on the actual drug and non-drug costs associated with deploying ACT in one district in Tanzania, and uses these data to estimate the nationwide costs of implementation in a setting where identification of malaria cases is primarily dependant on clinical diagnosis. Methods Detailed data were collected over a three year period on the financial costs of providing ACT in Rufiji District as part of a large scale effectiveness evaluation, including costs of drugs, distribution, training, treatment guidelines and other information, education and communication (IEC materials and publicity. The district-level costs were scaled up to estimate the costs of nationwide implementation, using four scenarios to extrapolate variable costs. Results The total district costs of implementing ACT over the three year period were slightly over one million USD, with drug purchases accounting for 72.8% of this total. The composite (best estimate of nationwide costs for the first three years of ACT implementation was 48.3 million USD (1.29 USD per capita, which varied between 21 and 67.1 million USD in the sensitivity analysis (2003 USD. In all estimates drug costs constituted the majority of total costs. However, non-drug costs such as IEC materials, drug distribution, communication, and health worker training were also substantial, accounting for 31.4% of overall ACT implementation costs in the best estimate scenario. Annual implementation costs are equivalent to 9.5% of Tanzania's recurrent health sector budget, and 28.7% of annual expenditure on medical supplies, implying a 6-fold increase in the national budget for malaria treatment. Conclusion The costs of

  7. Digital photography provides a fast, reliable, and noninvasive method to estimate anthocyanin pigment concentration in reproductive and vegetative plant tissues.

    Science.gov (United States)

    Del Valle, José C; Gallardo-López, Antonio; Buide, Mª Luisa; Whittall, Justen B; Narbona, Eduardo

    2018-03-01

    Anthocyanin pigments have become a model trait for evolutionary ecology as they often provide adaptive benefits for plants. Anthocyanins have been traditionally quantified biochemically or more recently using spectral reflectance. However, both methods require destructive sampling and can be labor intensive and challenging with small samples. Recent advances in digital photography and image processing make it the method of choice for measuring color in the wild. Here, we use digital images as a quick, noninvasive method to estimate relative anthocyanin concentrations in species exhibiting color variation. Using a consumer-level digital camera and a free image processing toolbox, we extracted RGB values from digital images to generate color indices. We tested petals, stems, pedicels, and calyces of six species, which contain different types of anthocyanin pigments and exhibit different pigmentation patterns. Color indices were assessed by their correlation to biochemically determined anthocyanin concentrations. For comparison, we also calculated color indices from spectral reflectance and tested the correlation with anthocyanin concentration. Indices perform differently depending on the nature of the color variation. For both digital images and spectral reflectance, the most accurate estimates of anthocyanin concentration emerge from anthocyanin content-chroma ratio, anthocyanin content-chroma basic, and strength of green indices. Color indices derived from both digital images and spectral reflectance strongly correlate with biochemically determined anthocyanin concentration; however, the estimates from digital images performed better than spectral reflectance in terms of r 2 and normalized root-mean-square error. This was particularly noticeable in a species with striped petals, but in the case of striped calyces, both methods showed a comparable relationship with anthocyanin concentration. Using digital images brings new opportunities to accurately quantify the

  8. Development of quality indicators for low-risk labor care provided by midwives using a RAND-modified Delphi method.

    Science.gov (United States)

    Ueda, Kayo; Ohtera, Shosuke; Kaso, Misato; Nakayama, Takeo

    2017-09-22

    In childbirth, most deliveries are low-risk, defined as spontaneous labor at full term without special high-risk facts or complications, especially in high-resource countries where maternal and perinatal mortality rates are very low. Indeed, the majority of mothers and infants have no serious conditions during labor. However, the quality of care provided is not assured, and performance may vary by birthing facility and provider. The overuse of technology in childbirth in some parts of the world is almost certainly based on assumptions like, "something can go wrong at any minute." There is a need to assess the quality of care provided for mothers and infants in low-risk labor. We aimed to develop specific quality indicators for low-risk labor care provided primarily by midwives in Japan. We used a RAND-modified Delphi method, which integrates evidence review with expert consensus development. The procedure comprises five steps: (1) literature review, including clinical practice guidelines, to extract and develop quality indicator candidates; (2) formation of a multidisciplinary panel; (3) independent panel ratings (Round 1); (4) panel meeting and independent panel ratings (Round 2); and (5) independent panel ratings (Round 3). The three independent panel ratings (Rounds 1-3) were held between July and December 2012. The assembled multidisciplinary panel comprised eight clinicians (two pediatricians, three obstetricians, and three midwives) and three mothers who were nonclinicians. Evidentiary review extracted 166 key recommendations from 32 clinical practice guidelines, and 31 existing quality indicators were added. After excluding duplicate recommendations and quality indicators, the panel discussed 25 candidate indicators. Of these, 18 were adopted, one was modified, six were not adopted, and four were added during the meeting, respectively. We established 23 quality indicators for low-risk labor care provided by midwives in labor units in Japan.

  9. A mixed-methods examination of communication between oncologists and primary care providers among primary care physicians in underserved communities.

    Science.gov (United States)

    Shen, Megan Johnson; Binz-Scharf, Maria; D'Agostino, Tom; Blakeney, Natasha; Weiss, Elisa; Michaels, Margo; Patel, Shilpa; McKee, M Diane; Bylund, Carma L

    2015-03-15

    Research has demonstrated that communication and care coordination improve cancer patient outcomes. To improve communication and care coordination, it is important to understand primary care providers' (PCPs') perceptions of communication with oncologists as well as PCPs' communication needs. A mixed-methods approach was used in the present study. In the qualitative phase of the study, 18 PCPs practicing in underserved, minority communities were interviewed about their experiences communicating with oncologists. In the quantitative phase of the study, 128 PCPs completed an online survey about their preferences, experiences, and satisfaction with communication with oncologists. Results indicated a PCP-oncologist gap in communication occurred between diagnosis and treatment. PCPs wanted more communication with oncologists, updates on their patients' prognosis throughout treatment, and to be contacted via telephone or email and saw their role as crucial in providing supportive care for their patients. Although PCPs recognize that they play a critical, proactive role in supporting patients throughout the continuum of their cancer care experience, existing norms regarding postreferral engagement and oncologist-PCP communication often hinder activation of this role among PCPs. Expected standards regarding the method, frequency, and quality of postreferral communication should be jointly articulated and made accountable between PCPs and oncologists to help improve cancer patients' quality of care, particularly in minority communities. © 2014 American Cancer Society.

  10. Mapping of Mycobacterium tuberculosis Complex Genetic Diversity Profiles in Tanzania and Other African Countries.

    Directory of Open Access Journals (Sweden)

    Erasto V Mbugi

    Full Text Available The aim of this study was to assess and characterize Mycobacterium tuberculosis complex (MTBC genotypic diversity in Tanzania, as well as in neighbouring East and other several African countries. We used spoligotyping to identify a total of 293 M. tuberculosis clinical isolates (one isolate per patient collected in the Bunda, Dar es Salaam, Ngorongoro and Serengeti areas in Tanzania. The results were compared with results in the SITVIT2 international database of the Pasteur Institute of Guadeloupe. Genotyping and phylogeographical analyses highlighted the predominance of the CAS, T, EAI, and LAM MTBC lineages in Tanzania. The three most frequent Spoligotype International Types (SITs were: SIT21/CAS1-Kili (n = 76; 25.94%, SIT59/LAM11-ZWE (n = 22; 7.51%, and SIT126/EAI5 tentatively reclassified as EAI3-TZA (n = 18; 6.14%. Furthermore, three SITs were newly created in this study (SIT4056/EAI5 n = 2, SIT4057/T1 n = 1, and SIT4058/EAI5 n = 1. We noted that the East-African-Indian (EAI lineage was more predominant in Bunda, the Manu lineage was more common among strains isolated in Ngorongoro, and the Central-Asian (CAS lineage was more predominant in Dar es Salaam (p-value<0.0001. No statistically significant differences were noted when comparing HIV status of patients vs. major lineages (p-value = 0.103. However, when grouping lineages as Principal Genetic Groups (PGG, we noticed that PGG2/3 group (Haarlem, LAM, S, T, and X was more associated with HIV-positive patients as compared to PGG1 group (Beijing, CAS, EAI, and Manu (p-value = 0.03. This study provided mapping of MTBC genetic diversity in Tanzania (containing information on isolates from different cities and neighbouring East African and other several African countries highlighting differences as regards to MTBC genotypic distribution between Tanzania and other African countries. This work also allowed underlining of spoligotyping patterns tentatively grouped within the newly designated EAI3

  11. Mapping of Mycobacterium tuberculosis Complex Genetic Diversity Profiles in Tanzania and Other African Countries.

    Science.gov (United States)

    Mbugi, Erasto V; Katale, Bugwesa Z; Streicher, Elizabeth M; Keyyu, Julius D; Kendall, Sharon L; Dockrell, Hazel M; Michel, Anita L; Rweyemamu, Mark M; Warren, Robin M; Matee, Mecky I; van Helden, Paul D; Couvin, David; Rastogi, Nalin

    2016-01-01

    The aim of this study was to assess and characterize Mycobacterium tuberculosis complex (MTBC) genotypic diversity in Tanzania, as well as in neighbouring East and other several African countries. We used spoligotyping to identify a total of 293 M. tuberculosis clinical isolates (one isolate per patient) collected in the Bunda, Dar es Salaam, Ngorongoro and Serengeti areas in Tanzania. The results were compared with results in the SITVIT2 international database of the Pasteur Institute of Guadeloupe. Genotyping and phylogeographical analyses highlighted the predominance of the CAS, T, EAI, and LAM MTBC lineages in Tanzania. The three most frequent Spoligotype International Types (SITs) were: SIT21/CAS1-Kili (n = 76; 25.94%), SIT59/LAM11-ZWE (n = 22; 7.51%), and SIT126/EAI5 tentatively reclassified as EAI3-TZA (n = 18; 6.14%). Furthermore, three SITs were newly created in this study (SIT4056/EAI5 n = 2, SIT4057/T1 n = 1, and SIT4058/EAI5 n = 1). We noted that the East-African-Indian (EAI) lineage was more predominant in Bunda, the Manu lineage was more common among strains isolated in Ngorongoro, and the Central-Asian (CAS) lineage was more predominant in Dar es Salaam (p-value<0.0001). No statistically significant differences were noted when comparing HIV status of patients vs. major lineages (p-value = 0.103). However, when grouping lineages as Principal Genetic Groups (PGG), we noticed that PGG2/3 group (Haarlem, LAM, S, T, and X) was more associated with HIV-positive patients as compared to PGG1 group (Beijing, CAS, EAI, and Manu) (p-value = 0.03). This study provided mapping of MTBC genetic diversity in Tanzania (containing information on isolates from different cities) and neighbouring East African and other several African countries highlighting differences as regards to MTBC genotypic distribution between Tanzania and other African countries. This work also allowed underlining of spoligotyping patterns tentatively grouped within the newly designated EAI3-TZA

  12. Mapping of Mycobacterium tuberculosis Complex Genetic Diversity Profiles in Tanzania and Other African Countries

    Science.gov (United States)

    Mbugi, Erasto V.; Katale, Bugwesa Z.; Streicher, Elizabeth M.; Keyyu, Julius D.; Kendall, Sharon L.; Dockrell, Hazel M.; Michel, Anita L.; Rweyemamu, Mark M.; Warren, Robin M.; Matee, Mecky I.; van Helden, Paul D.; Couvin, David; Rastogi, Nalin

    2016-01-01

    The aim of this study was to assess and characterize Mycobacterium tuberculosis complex (MTBC) genotypic diversity in Tanzania, as well as in neighbouring East and other several African countries. We used spoligotyping to identify a total of 293 M. tuberculosis clinical isolates (one isolate per patient) collected in the Bunda, Dar es Salaam, Ngorongoro and Serengeti areas in Tanzania. The results were compared with results in the SITVIT2 international database of the Pasteur Institute of Guadeloupe. Genotyping and phylogeographical analyses highlighted the predominance of the CAS, T, EAI, and LAM MTBC lineages in Tanzania. The three most frequent Spoligotype International Types (SITs) were: SIT21/CAS1-Kili (n = 76; 25.94%), SIT59/LAM11-ZWE (n = 22; 7.51%), and SIT126/EAI5 tentatively reclassified as EAI3-TZA (n = 18; 6.14%). Furthermore, three SITs were newly created in this study (SIT4056/EAI5 n = 2, SIT4057/T1 n = 1, and SIT4058/EAI5 n = 1). We noted that the East-African-Indian (EAI) lineage was more predominant in Bunda, the Manu lineage was more common among strains isolated in Ngorongoro, and the Central-Asian (CAS) lineage was more predominant in Dar es Salaam (p-value<0.0001). No statistically significant differences were noted when comparing HIV status of patients vs. major lineages (p-value = 0.103). However, when grouping lineages as Principal Genetic Groups (PGG), we noticed that PGG2/3 group (Haarlem, LAM, S, T, and X) was more associated with HIV-positive patients as compared to PGG1 group (Beijing, CAS, EAI, and Manu) (p-value = 0.03). This study provided mapping of MTBC genetic diversity in Tanzania (containing information on isolates from different cities) and neighbouring East African and other several African countries highlighting differences as regards to MTBC genotypic distribution between Tanzania and other African countries. This work also allowed underlining of spoligotyping patterns tentatively grouped within the newly designated EAI3-TZA

  13. New Anillina from South Africa, Tanzania, Madagascar and Seychelles Islands (Coleoptera: Carabidae, Bembidiini

    Directory of Open Access Journals (Sweden)

    Pier Mauro Giachino

    2015-06-01

    Full Text Available The Author describes two new genera of Bembidiini Anillina (Carabidae: Afranillus gen. n. of the Paranillus phyletic lineage and Afrodipnus gen. n. of the Microtyphlus phyletic lineage and the following new species: Paranillus madecassus sp. n. from Ankarafantsika N.P. (NW Madagascar; Paranillus banari sp. n. from Ranomafana N.P. (Madagascar; Afranillus schuelei sp. n. from Silaka Nat. Res. (Eastern Cape, RSA; Argiloborus praslinicus sp. n. from Praslin Is. (Seychelles; Caeconannus bulirschi sp. n. from Franschhoek pass (Western Cape, RSA; Caeconannus occidentalis sp. n. from Koloniesbos (Western Cape, RSA; Caeconannus orientalis sp. n. from Amatola Mts (Eastern Cape, RSA; Microdipnites zicsii sp. n. from Kwamkoro (Tanga reg., Tanzania; Pelonomites mahunkai sp. n. from Kwamsambia For. (Tanga reg., Tanzania; Afrodipnus transvaalianus sp. n. from Roberts Drift (S. Transvaal, RSA. Comparative morphological data are provided and discussed.

  14. Water supply development and tariffs in Tanzania: From free water policy towards cost recovery

    Science.gov (United States)

    Mashauri, Damas A.; Katko, Tapio S.

    1993-01-01

    The article describes the historical development of water tariff policy in Tanzania from the colonial times to present. After gaining independence, the country introduced “free” water policy in its rural areas. Criticism against this policy was expressed already in the 1970s, but it was not until the late 1980s that change became unavoidable. All the while urban water tariffs continued to decline in real terms. In rural and periurban areas of Tanzania consumers often have to pay substantial amounts of money for water to resellers and vendors since the public utilities are unable to provide operative service. Besides, only a part of the water bills are actually collected. Now that the free water supply policy has been officially abandoned, the development of water tariffs and the institutions in general are a great challenge for the country.

  15. The Costs of Climate Change: A Study of Cholera in Tanzania

    DEFF Research Database (Denmark)

    Trærup, Sara Lærke Meltofte; Ortiz, Ramon A.; Markandya, Anil

    2011-01-01

    Increased temperatures and changes in rainfall patterns as a result of climate change are widely recognized to entail potentially serious consequences for human health, including an increased risk of diarrheal diseases. This study integrates historical data on temperature and rainfall...... to climate change are shown to be in the range of 0.32 to 1.4 percent of GDP in Tanzania 2030. The results provide useful insights into national-level estimates of the implications of climate change on the health sector and offer information which can feed into both national and international debates...... risk of cholera increases by 15 to 29 percent. Based on the modeling results, we project the number and costs of additional cases of cholera that can be attributed to climate change by 2030 in Tanzania for a 1 and 2 degree increase in temperatures, respectively. The total costs of cholera attributable...

  16. Family building using embryo adoption: relationships and contact arrangements between provider and recipient families-a mixed-methods study.

    Science.gov (United States)

    Frith, Lucy; Blyth, Eric; Lui, Steve

    2017-05-01

    What contact arrangements are established between providers and recipients of embryos using Snowflakes® Embryo Adoption Program? Contact arrangements varied considerably and were generally positively described, although some challenges were acknowledged. Reproductive technologies create new and diverse family forms, and the ways in which families created by embryo adoption are negotiated in practice have not been extensively investigated. This exploratory, mixed-methods study had two phases: (i) an online survey (open May-September 2013) and (ii) qualitative semi-structured interviews by email (conducted between 2014 and 2015), exploring participants' experiences of contact with their embryo provider or recipient. Phase I included 17 providers (14 women and 3 men) and 28 recipients (27 women and 1 man). Phase II included 8 providers (5 women and 3 men) and 12 recipients (10 women and 2 men). All participants, except one, were located in the US. This study illustrates how embryo adoption in the US, as a form of conditional donation, can operate and how the participants define and negotiate these emerging relationships. All families were open with their children about how they were conceived and early contact between recipients and providers (frequently before birth) was valued. On the whole, participants were happy with the amount and type of contact they had, and where the current contact did not involve the children, it was seen as a way of keeping the channels open for future contact when the children were older. Participants often portrayed the opportunities for contact as being in the best interests of the child. The study participants are a particular group who had chosen to either receive or give their embryos via a conditional embryo adoption agency in the US and had established contact. Therefore, this is not a representative sample of those who provide or receive embryos for family building. This embryo adoption model clearly fulfils a need; some people

  17. Health and self-reliance: the experience of Tanzania.

    Science.gov (United States)

    Tarimo, E

    1978-01-01

    Since its independence, Tanzania has consistently followed a socialist policy with a strong emphasis on the development of the rural areas and on an equal distribution of goods and services. In the health field, this policy has taken the form of establishing a network of rural health centers, training auxiliaries, and involving the communities through mass mobilization campaigns. Community participation in health care services is hindered by 3 sets of problems related to lack of cohesion, lack of structure, and the autonomous and sometimes paternalist attitude of the health profession. In Tanzania much emphasis is placed on self-reliance. It is in the field of education that policies of self-reliance have been most successfully implemented. Traditional practitioners represent 1 of the health resources that can be tapped. The medical profession cannot claim credit for the major improvements in health, for at times it has even blocked health development. Health standards and quality are important in the 3rd world. Staff must be properly trained to function at a particular level, supplies must be provided regularly, and there must be constant supervision. A health care system that is appropriate to the 3rd world must also emphasize disease prevention. To increase health coverage there must be a program of health service that is within reach of the people, including the rural population. Health cannot be furthered by the health services as tradtionally conceived; an intersectoral approach is essential. It is important that a commitment to an integrated development of the rural areas, with health as a component, be made.

  18. Inter-epidemic abundance and distribution of potential mosquito vectors for Rift Valley fever virus in Ngorongoro district, Tanzania

    Directory of Open Access Journals (Sweden)

    Clement N. Mweya

    2015-01-01

    Full Text Available Background: Rift Valley fever (RVF is a mosquito-borne viral zoonosis that primarily affects ruminants but also has the capacity to infect humans. Objective: To determine the abundance and distribution of mosquito vectors in relation to their potential role in the virus transmission and maintenance in disease epidemic areas of Ngorongoro district in northern Tanzania. Methods: A cross-sectional entomological investigation was carried out before the suspected RVF outbreak in October 2012. Mosquitoes were sampled both outdoors and indoors using the Centre for Disease Control (CDC light traps and Mosquito Magnets baited with attractants. Outdoor traps were placed in proximity with breeding sites and under canopy in banana plantations close to the sleeping places of animals. Results: A total of 1,823 mosquitoes were collected, of which 87% (N=1,588 were Culex pipiens complex, 12% (N=226 Aedes aegypti, and 0.5% (N=9 Anopheles species. About two-thirds (67%; N=1,095 of C. pipiens complex and nearly 100% (N=225 of A. aegypti were trapped outdoors using Mosquito Magnets. All Anopheles species were trapped indoors using CDC light traps. There were variations in abundance of C. pipiens complex and A. aegypti among different ecological and vegetation habitats. Over three quarters (78% of C. pipiens complex and most (85% of the A. aegypti were trapped in banana and maize farms. Both C. pipiens complex and A. aegypti were more abundant in proximity with cattle and in semi-arid thorn bushes and lower Afro-montane. The highest number of mosquitoes was recorded in villages that were most affected during the RVF epidemic of 2007. Of the tested 150 pools of C. pipiens complex and 45 pools of A. aegypti, none was infected with RVF virus. Conclusions: These results provide insights into unique habitat characterisation relating to mosquito abundances and distribution in RVF epidemic-prone areas of Ngorongoro district in northern Tanzania.

  19. An analytical solution of Richards' equation providing the physical basis of SCS curve number method and its proportionality relationship

    Science.gov (United States)

    Hooshyar, Milad; Wang, Dingbao

    2016-08-01

    The empirical proportionality relationship, which indicates that the ratio of cumulative surface runoff and infiltration to their corresponding potentials are equal, is the basis of the extensively used Soil Conservation Service Curve Number (SCS-CN) method. The objective of this paper is to provide the physical basis of the SCS-CN method and its proportionality hypothesis from the infiltration excess runoff generation perspective. To achieve this purpose, an analytical solution of Richards' equation is derived for ponded infiltration in shallow water table environment under the following boundary conditions: (1) the soil is saturated at the land surface; and (2) there is a no-flux boundary which moves downward. The solution is established based on the assumptions of negligible gravitational effect, constant soil water diffusivity, and hydrostatic soil moisture profile between the no-flux boundary and water table. Based on the derived analytical solution, the proportionality hypothesis is a reasonable approximation for rainfall partitioning at the early stage of ponded infiltration in areas with a shallow water table for coarse textured soils.

  20. Evaluating the impact of healthcare provider training to improve tuberculosis management: a systematic review of methods and outcome indicators used.

    Science.gov (United States)

    Wu, Shishi; Roychowdhury, Imara; Khan, Mishal

    2017-03-01

    Developing human resources capacity is vital for tuberculosis (TB) control in low- and middle-income countries. Although investments in TB healthcare provider (HCP) training programmes have increased, it is unclear whether these are robustly evaluated. The objective of this systematic review was to synthesize the methods and outcome indicators used to assess TB HCP training programmes. A systematic scoping review of publications reporting on evaluations of training programmes for TB HCPs - including doctors, nurses, paramedics, and lay health workers - was conducted through a search in three electronic databases, Google Scholar, and five websites of non-profit organizations. Data on the study location, population trained, outcomes assessed, and evaluation approach were extracted. After screening 499 unique publications, 21 were eligible for inclusion in the analysis. The majority of evaluations were conducted in Africa. The most common evaluation methods were a review of patient records (n=8, 38%) and post-training interview with trainees (n=7, 33%). In terms of outcomes, more than half of the studies (n=12, 57%) evaluated knowledge acquisition of trainees, with only six (29%) assessing on-the-job behaviour change. Even though more funds have been invested in TB HCP training, publications from robust evaluations assessing the impact on quality of care and behaviour change are limited. Copyright © 2016. Published by Elsevier Ltd.

  1. Team dynamics, clinical work satisfaction, and patient care coordination between primary care providers: A mixed methods study.

    Science.gov (United States)

    Song, Hummy; Ryan, Molly; Tendulkar, Shalini; Fisher, Josephine; Martin, Julia; Peters, Antoinette S; Frolkis, Joseph P; Rosenthal, Meredith B; Chien, Alyna T; Singer, Sara J

    Team-based care is essential for delivering high-quality, comprehensive, and coordinated care. Despite considerable research about the effects of team-based care on patient outcomes, few studies have examined how team dynamics relate to provider outcomes. The aim of this study was to examine relationships among team dynamics, primary care provider (PCP) clinical work satisfaction, and patient care coordination between PCPs in 18 Harvard-affiliated primary care practices participating in Harvard's Academic Innovations Collaborative. First, we administered a cross-sectional survey to all 548 PCPs (267 attending clinicians, 281 resident physicians) working at participating practices; 65% responded. We assessed the relationship of team dynamics with PCPs' clinical work satisfaction and perception of patient care coordination between PCPs, respectively, and the potential mediating effect of patient care coordination on the relationship between team dynamics and work satisfaction. In addition, we embedded a qualitative evaluation within the quantitative evaluation to achieve a convergent mixed methods design to help us better understand our findings and illuminate relationships among key variables. Better team dynamics were positively associated with clinical work satisfaction and quality of patient care coordination between PCPs. Coordination partially mediated the relationship between team dynamics and satisfaction for attending clinicians, suggesting that higher satisfaction depends, in part, on better teamwork, yielding more coordinated patient care. We found no mediating effects for resident physicians. Qualitative results suggest that sources of satisfaction from positive team dynamics for PCPs may be most relevant to attending clinicians. Improving primary care team dynamics could improve clinical work satisfaction among PCPs and patient care coordination between PCPs. In addition to improving outcomes that directly concern health care providers, efforts to

  2. Improving smallholder livelihoods: Dairy production in Tanzania

    Directory of Open Access Journals (Sweden)

    Edward Ulicky

    2013-12-01

    Full Text Available Tanzania is primarily an agro-based economy, characterized by subsistence agricultural production that employs more than 80% of the population and contributes up to 45% of the GDP (2005. This country is endowed with a cattle population of 21.3 M, composed mainly of indigenous Zebu breeds and about 680 000 improved dairy animals. About 70% of the milk produced comes from the traditional sector (indigenous cattle kept in rural areas, while the remaining 30% comes from improved cattle, mainly kept by smallholder producers. In Northern Tanzania and particularly in Hai district of Kilimanjaro Region, some dairy farmers organize themselves into small producer groups for the purpose of milk collecting, marketing and general promotion of the dairy sector in their community. Nronga Women Dairy Cooperative Society (NWDCS Limited is one of such organizations dedicated to improve the well-being of the Nronga village community through promoting small-scale dairy farming and its flow-on benefits. Milk flows out of the village, and services for investment and dairy production flow into the village, ensuring a sustainable financial circulation necessary for poverty reduction, rural development and better life for the rural community. In 2001 NWDCS introduced a school milk feeding program that has attracted Australian donors since 2005. Guided by Global Development Group, a multi-faceted project, integrating micro-enterprises, business, education and child health/nutrition, was proposed and initiated by building a dairy plant in Hai District headquarters, the Boma plant. In March 2013, the Australian High Commission to East Africa approved Direct Aid Program funding of AUD 30 000 towards the NWDCS - Biogas Pilot Project in Tanzania, which included the renovation of zero-grazing cow shade units, the construction of 6-m3 biodigester plants on each farm, and encouragement of the use of bioslurry for pasture production and home gardens.

  3. Concentration and drug prices in the retail market for malaria treatment in rural Tanzania.

    Science.gov (United States)

    Goodman, Catherine; Kachur, S Patrick; Abdulla, Salim; Bloland, Peter; Mills, Anne

    2009-06-01

    The impact of market concentration has been little studied in markets for ambulatory care in the developing world, where the retail sector often accounts for a high proportion of treatments. This study begins to address this gap through an analysis of the consumer market for malaria treatment in rural areas of three districts in Tanzania. We developed methods for investigating market definition, sales volumes and concentration, and used these to explore the relationship between antimalarial retail prices and competition.The market was strongly geographically segmented and highly concentrated in terms of antimalarial sales. Antimalarial prices were positively associated with market concentration. High antimalarial prices were likely to be an important factor in the low proportion of care-seekers obtaining appropriate treatment.Retail sector distribution of subsidised antimalarials has been proposed to increase the coverage of effective treatment, but this analysis indicates that local market power may prevent such subsidies from being passed on to rural customers. Policymakers should consider the potential to maintain lower retail prices by decreasing concentration among antimalarial providers and recommending retail price levels. Copyright (c) 2009 John Wiley & Sons, Ltd.

  4. Malaria treatment in the retail sector: Knowledge and practices of drug sellers in rural Tanzania

    Directory of Open Access Journals (Sweden)

    Makemba Ahmed M

    2008-05-01

    Full Text Available Abstract Background Throughout Africa, the private retail sector has been recognised as an important source of antimalarial treatment, complementing formal health services. However, the quality of advice and treatment at private outlets is a widespread concern, especially with the introduction of artemisinin-based combination therapies (ACTs. As a result, ACTs are often deployed exclusively through public health facilities, potentially leading to poorer access among parts of the population. This research aimed at assessing the performance of the retail sector in rural Tanzania. Such information is urgently required to improve and broaden delivery channels for life-saving drugs. Methods During a comprehensive shop census in the districts of Kilombero and Ulanga, Tanzania, we interviewed 489 shopkeepers about their knowledge of malaria and malaria treatment. A complementary mystery shoppers study was conducted in 118 retail outlets in order to assess the vendors' drug selling practices. Both studies included drug stores as well as general shops. Results Shopkeepers in drug stores were able to name more malaria symptoms and were more knowledgeable about malaria treatment than their peers in general shops. In drug stores, 52% mentioned the correct child-dosage of sulphadoxine-pyrimethamine (SP compared to only 3% in general shops. In drug stores, mystery shoppers were more likely to receive an appropriate treatment (OR = 9.6, but at an approximately seven times higher price. Overall, adults were more often sold an antimalarial than children (OR = 11.3. On the other hand, general shopkeepers were often ready to refer especially children to a higher level if they felt unable to manage the case. Conclusion The quality of malaria case-management in the retail sector is not satisfactory. Drug stores should be supported and empowered to provide correct malaria-treatment with drugs they are allowed to dispense. At the same time, the role of general shops

  5. Exploring local knowledge and perceptions on zoonoses among pastoralists in northern and eastern Tanzania.

    Directory of Open Access Journals (Sweden)

    Peter Ernest Mangesho

    2017-02-01

    Full Text Available Zoonoses account for the most commonly reported emerging and re-emerging infectious diseases in Sub-Saharan Africa. However, there is limited knowledge on how pastoral communities perceive zoonoses in relation to their livelihoods, culture and their wider ecology. This study was carried out to explore local knowledge and perceptions on zoonoses among pastoralists in Tanzania.This study involved pastoralists in Ngorongoro district in northern Tanzania and Kibaha and Bagamoyo districts in eastern Tanzania. Qualitative methods of focus group discussions, participatory epidemiology and interviews were used. A total of 223 people were involved in the study. Among the pastoralists, there was no specific term in their local language that describes zoonosis. Pastoralists from northern Tanzania possessed a higher understanding on the existence of a number of zoonoses than their eastern districts' counterparts. Understanding of zoonoses could be categorized into two broad groups: a local syndromic framework, whereby specific symptoms of a particular illness in humans concurred with symptoms in animals, and the biomedical framework, where a case definition is supported by diagnostic tests. Some pastoralists understand the possibility of some infections that could cross over to humans from animals but harm from these are generally tolerated and are not considered as threats. A number of social and cultural practices aimed at maintaining specific cultural functions including social cohesion and rites of passage involve animal products, which present zoonotic risk.These findings show how zoonoses are locally understood, and how epidemiology and biomedicine are shaping pastoralists perceptions to zoonoses. Evidence is needed to understand better the true burden and impact of zoonoses in these communities. More studies are needed that seek to clarify the common understanding of zoonoses that could be used to guide effective and locally relevant interventions

  6. Exploring local knowledge and perceptions on zoonoses among pastoralists in northern and eastern Tanzania.

    Science.gov (United States)

    Mangesho, Peter Ernest; Neselle, Moses Ole; Karimuribo, Esron D; Mlangwa, James E; Queenan, Kevin; Mboera, Leonard E G; Rushton, Jonathan; Kock, Richard; Häsler, Barbara; Kiwara, Angwara; Rweyemamu, Mark

    2017-02-01

    Zoonoses account for the most commonly reported emerging and re-emerging infectious diseases in Sub-Saharan Africa. However, there is limited knowledge on how pastoral communities perceive zoonoses in relation to their livelihoods, culture and their wider ecology. This study was carried out to explore local knowledge and perceptions on zoonoses among pastoralists in Tanzania. This study involved pastoralists in Ngorongoro district in northern Tanzania and Kibaha and Bagamoyo districts in eastern Tanzania. Qualitative methods of focus group discussions, participatory epidemiology and interviews were used. A total of 223 people were involved in the study. Among the pastoralists, there was no specific term in their local language that describes zoonosis. Pastoralists from northern Tanzania possessed a higher understanding on the existence of a number of zoonoses than their eastern districts' counterparts. Understanding of zoonoses could be categorized into two broad groups: a local syndromic framework, whereby specific symptoms of a particular illness in humans concurred with symptoms in animals, and the biomedical framework, where a case definition is supported by diagnostic tests. Some pastoralists understand the possibility of some infections that could cross over to humans from animals but harm from these are generally tolerated and are not considered as threats. A number of social and cultural practices aimed at maintaining specific cultural functions including social cohesion and rites of passage involve animal products, which present zoonotic risk. These findings show how zoonoses are locally understood, and how epidemiology and biomedicine are shaping pastoralists perceptions to zoonoses. Evidence is needed to understand better the true burden and impact of zoonoses in these communities. More studies are needed that seek to clarify the common understanding of zoonoses that could be used to guide effective and locally relevant interventions. Such studies should

  7. A Modernized System for Agricultural Monitoring for Food Security in Tanzania

    Science.gov (United States)

    Dempewolf, J.; Nakalembe, C. L.; Becker-Reshef, I.; Justice, C. J.; Tumbo, S.; Mbilinyi, B.; Maurice, S.; Mtalo, M.

    2016-12-01

    Accurate and timely information on agriculture, particularly in many countries dominated by complex smallholder, subsistence agricultural systems is often difficult to obtain or not available. This includes up-to-date information during the growing season on crop type, crop area and crop condition such as developmental stage, damage from pests and diseases, drought or flooding. These data are critical for government decision making on production forecasts, planning for commodity market transactions, food aid delivery, responding to disease outbreaks and for implementing agricultural extension and development efforts. In Tanzania we have been working closely with the National Food Security Division (NFSD) at the Ministry of Agriculture, Livestock and Fisheries (MALF) on designing and implementing an advanced agricultural monitoring system, utilizing satellite remote sensing, smart phone and internet technologies. Together with our local implementing partner, the Sokoine University of Agriculture we trained a large number of agricultural extension agents in different regions of Tanzania to deliver field data in near-realtime. Using our collaborative internet portal (Crop Monitor) the team of analysts compiles pertinent information on current crop and weather conditions from throughout the country in a standardized, consistent manner. Using the portal traditionally collected data are combined with electronically collected field data and MODIS satellite image time series from GLAM East-Africa (Global Agricultural Monitoring System, customized for stakeholders in East Africa). The main outcome of this work has been the compilation of the National Food Security Bulletin for Tanzania with plans for a public release and the intention for it to become the main avenue to dispense current updates and analysis on agriculture in the country. The same information is also a potential contribution to the international Early Warning Crop Monitor, which currently covers Tanzania

  8. Diagnosis of human fascioliasis in Arusha region, northern Tanzania by microscopy and clinical manifestations in patients.

    Science.gov (United States)

    Lukambagire, Abdul-Hamid Settenda; Mchaile, Deborah N; Nyindo, Mramba

    2015-12-23

    Human fascioliasis (HF) is a zoonotic disease that has been identified in many countries worldwide. This report concerns the identification and clinical management of cases of human fascioliasis in the suburbs of Arusha city, northern Tanzania in 2013. Fascioliasis is included among the WHO's Neglected Tropical Diseases as a plant transmitted trematode infection. Human fascioliasis has not been described before in the East Africa region, including Tanzania. Patients presenting at a primary healthcare centre in Arusha Region, northern Tanzania provided fresh stool samples for routine ova and parasite screening (saline and iodine preparations). Subsequent stool samples were preserved in 5 % formalin in saline and subjected to ether sedimentation for examination. Out of 1460 patients, 305 (21 %) were diagnosed positive for fascioliasis based on the demonstration of brownish, oval eggs with inconspicuous opercula in stool. Two distinct egg sizes were identified; large 170-212.5 by 115-150 μm (mean 194.5 by 130.5 μm) and smaller eggs 120-150 by 87.5 - 112.5 μm (mean 138.8 by 101 μm). Clinically, patients presented with fever (39 - 40 °C) and abdominal pain. Some patients had pruritis around the mouth and their lips were swollen. 3 patients were treated and cured with single dose Triclabendazole. The remaining 302 patients were treated with Nitazoxanide and 122 (40 %) were cleared of infection with a single course. Snails of the genus Lymnaea were found in the surroundings. This report serves to remind medical professionals in East Africa that HF is a probable differential diagnosis in patients presenting with similar symptoms. It is possible to diagnose fascioliasis by light microscopy although specific antigen tests are required for confirmation. Human fascioliasis however, has not been described or reported in Tanzania before and begs further investigation.

  9. Gender differences in the factors influencing consistent condom use among young people in Tanzania.

    Science.gov (United States)

    Babalola, Stella

    2006-01-01

    AIDS has become a major cause of death in Tanzania and young people represent the most vulnerable group. Recent HIV prevalence data showed that young women are more likely than young men to become infected. This paper examined commonalties and differences in the sociodemographic and ideational predictors of condom use among young men and women in Tanzania. The data derive from a 2004 sample survey among young people aged 15-24 years in five regions of Tanzania. The sample on which the analyses were based included 1,523 single women and 1,200 single men. An ideation framework guided the analyses of the predictors of consistent condom use. Logistic regression was the main analytic method used and separate models were estimated for men and women. The most significant correlates of consistent condom use for men included perceived self-efficacy for correct condom use, discussing condom use with friends, and perceived self-efficacy for using condoms with a long-term partner. Discussing condom use with a sex partner and the perceived self-efficacy to refuse sex if the sex partner refused to use a condom were the most significant predictors for women. One implication of the findings is that for men, effective interventions should emphasize correct condom use know-how and address the issue of negative peer pressure and group norms around condom use. For women, interventions should focus on sexual empowerment.

  10. SU-E-E-03: Developing Solutions to Critical Radiation Oncology Challenges in Tanzania

    Energy Technology Data Exchange (ETDEWEB)

    Kenton, O [University of Pennsylvania, School of Arts and Sciences, College of Liberal and Professional Studies, Philadelphia, PA (United States); Dachi, J [Ocean Road Cancer Institute, Dar Es Salaam (Tanzania, United Republic of); Metz, J [University of Pennsylvania, Perelman School of Medicine, Department of Radiation Oncology, Philadelphia, PA (United States); Avery, S [University of Pennsylvania, School of Arts and Sciences, College of Liberal and Professional Studies, Philadelphia, PA (United States); University of Pennsylvania, Perelman School of Medicine, Department of Radiation Oncology, Philadelphia, PA (United States)

    2014-06-01

    Purpose: Develop solutions to critical medical physics challenges in Tanzania. Methods: In September of 2013 we began working with Jumaa Bin Dachi, a Therapy Physicist at the Ocean Road Cancer Institute in Dar es Salaam, Tanzania. We developed a bi-lateral learning partnership over the course of eight qualitative Skype meetings with Jumaa. From these meetings we have ascertained that there is a gap between the installation of new equipment and treating patients. This gap has often been overlooked by international partners attempting to improve radiation therapy access. Relationships with academic institutions abroad can fill these gaps, and lead to sustained care of patients needing radiation. Results: Our efforts are best given in a supporting role to help develop solutions and new technology that can reduce the burden on the Medical Physicist. Solutions may include: training material, support for radiation therapy classes, development of appropriate local protocols, and peer-review on documents being produced. New technology needs to focus around simple and easy field shaping, improved patient imaging systems, and systems for patient set-up. We believe our work can help alleviate some of the burdens faced by this institute. Conclusion: While we are just in the beginning stage of this partnership, we believe there is great potential for success between both parties. We hope that the Ocean Road Cancer Institute will benefit from potential funding and resources by partnering with a High Income Country to develop affordable solutions to clinical problems in Tanzania.

  11. SU-E-E-03: Developing Solutions to Critical Radiation Oncology Challenges in Tanzania

    International Nuclear Information System (INIS)

    Kenton, O; Dachi, J; Metz, J; Avery, S

    2014-01-01

    Purpose: Develop solutions to critical medical physics challenges in Tanzania. Methods: In September of 2013 we began working with Jumaa Bin Dachi, a Therapy Physicist at the Ocean Road Cancer Institute in Dar es Salaam, Tanzania. We developed a bi-lateral learning partnership over the course of eight qualitative Skype meetings with Jumaa. From these meetings we have ascertained that there is a gap between the installation of new equipment and treating patients. This gap has often been overlooked by international partners attempting to improve radiation therapy access. Relationships with academic institutions abroad can fill these gaps, and lead to sustained care of patients needing radiation. Results: Our efforts are best given in a supporting role to help develop solutions and new technology that can reduce the burden on the Medical Physicist. Solutions may include: training material, support for radiation therapy classes, development of appropriate local protocols, and peer-review on documents being produced. New technology needs to focus around simple and easy field shaping, improved patient imaging systems, and systems for patient set-up. We believe our work can help alleviate some of the burdens faced by this institute. Conclusion: While we are just in the beginning stage of this partnership, we believe there is great potential for success between both parties. We hope that the Ocean Road Cancer Institute will benefit from potential funding and resources by partnering with a High Income Country to develop affordable solutions to clinical problems in Tanzania

  12. Incidence of Induced Abortion and Post-Abortion Care in Tanzania.

    Science.gov (United States)

    Keogh, Sarah C; Kimaro, Godfather; Muganyizi, Projestine; Philbin, Jesse; Kahwa, Amos; Ngadaya, Esther; Bankole, Akinrinola

    2015-01-01

    Tanzania has one of the highest maternal mortality ratios in the world, and unsafe abortion is one of its leading causes. Yet little is known about its incidence. To provide the first ever estimates of the incidence of unsafe abortion in Tanzania, at the national level and for each of the 8 geopolitical zones (7 in Mainland plus Zanzibar). A nationally representative survey of health facilities was conducted to determine the number of induced abortion complications treated in facilities. A survey of experts on abortion was conducted to estimate the likelihood of women experiencing complications and obtaining treatment. These surveys were complemented with population and fertility data to obtain abortion numbers, rates and ratios, using the Abortion Incidence Complications Methodology. In Tanzania, women obtained just over 405,000 induced abortions in 2013, for a national rate of 36 abortions per 1,000 women age 15-49 and a ratio of 21 abortions per 100 live births. For each woman treated in a facility for induced abortion complications, 6 times as many women had an abortion but did not receive care. Abortion rates vary widely by zone, from 10.7 in Zanzibar to 50.7 in the Lake zone. The abortion rate is similar to that of other countries in the region. Variations by zone are explained mainly by differences in fertility and contraceptive prevalence. Measures to reduce the incidence of unsafe abortion and associated maternal mortality include expanding access to post-abortion care and contraceptive services to prevent unintended pregnancies.

  13. The Emergence of Hospital Accreditation Programs in East Africa: Lessons from Uganda, Kenya, and Tanzania

    Directory of Open Access Journals (Sweden)

    Jeffrey Lane

    2014-01-01

    Full Text Available The objective of this manuscript was to examine existing hospital accreditation systems in three East African countries (Uganda, Kenya and Tanzania, assess attitudes and opinions of key stakeholders regarding hospital accreditation systems in the region, and identify lessons regarding sustainable and effective implementation of hospital accreditation systems in resource-limited countries. National hospital accreditation systems were found in Kenya and Tanzania. Uganda’s accreditation system, known as Yellow Star, had been suspended. Attitudes and opinions of key stakeholders almost unanimously supported the idea of establishing new national hospital accreditation programs, but opinions differed regarding whether that system should be operated by the government or a private independent organization. Our analysis supports the following lessons regarding accreditation systems in the region: (1 self-funding mechanisms are critical to long-term success; (2 external assessments occurred more frequently in our focus countries than accreditation systems in developed countries; (3 Kenya has established framework for providing financial incentives to highly performing hospitals, but these links need to be strengthened; and (4 automatic accreditation of governmental health facilities in Kenya and Tanzania illustrate the potential hazard of public authorities overseeing accreditation programs.

  14. The Emergence of Hospital Accreditation Programs in East Africa: Lessons from Uganda, Kenya, and Tanzania

    Directory of Open Access Journals (Sweden)

    Jeffrey Lane

    2014-03-01

    Full Text Available The objective of this manuscript was to examine existing hospital accreditation systems in three East African countries (Uganda, Kenya and Tanzania, assess attitudes and opinions of key stakeholders regarding hospital accreditation systems in the region, and identify lessons regarding sustainable and effective implementation of hospital accreditation systems in resource-limited countries. National hospital accreditation systems were found in Kenya and Tanzania. Uganda’s accreditation system, known as Yellow Star, had been suspended. Attitudes and opinions of key stakeholders almost unanimously supported the idea of establishing new national hospital accreditation programs, but opinions differed regarding whether that system should be operated by the government or a private independent organization. Our analysis supports the following lessons regarding accreditation systems in the region: (1 self--‐funding mechanisms are critical to long-term success; (2 external assessments occurred more frequently in our focus countries than accreditation systems in developed countries; (3 Kenya has established framework for providing financial incentives to highly performing hospitals, but these links need to be strengthened; and (4 automatic accreditation of governmental health facilities in Kenya and Tanzania illustrate the potential hazard of public authorities overseeing accreditation programs.

  15. A categorization of water system breakdowns: Evidence from Liberia, Nigeria, Tanzania, and Uganda.

    Science.gov (United States)

    Klug, Tori; Cronk, Ryan; Shields, Katherine F; Bartram, Jamie

    2018-04-01

    In rural sub-Saharan Africa, one in three handpumps are non-functional at any time. While there is some evidence describing factors associated with non-functional water systems, there is little evidence describing the categories of water system breakdowns that commonly occur. Insufficient water availability from broken down systems can force people to use unimproved water sources, which undermines the health benefits of an improved water source. We categorized common water system breakdowns using quantitative and qualitative monitoring data from Liberia, Nigeria, Tanzania, and Uganda (each N>3600 water systems) and examined how breakdown category varies by water system type and management characteristics. Specific broken parts were mentioned more frequently than all other reasons for breakdown; hardware parts frequently found at fault for breakdown were aprons (Liberia), pipes (Tanzania and Uganda), taps/spouts (Tanzania and Uganda), and lift mechanisms (Nigeria). Statistically significant differences in breakdown category were identified based on system type, age, management type, and fee collection type. Categorization can help to identify common reasons for water system breakdown. The analysis of these data can be used to develop improved monitoring instruments to inform actors of different breakdown types and provide reasons for system non-functionality. Improved monitoring instruments would enable actors to target appropriate resources to address specific breakdowns likely to arise based on system type and management characteristics in order to inform improved implementation of and post-construction support for water systems in sub-Saharan Africa. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. High Prevalence of Faecal Carriage of ESBL-Producing Enterobacteriaceae among Children in Dar es Salaam, Tanzania.

    Science.gov (United States)

    Tellevik, Marit G; Blomberg, Bjørn; Kommedal, Øyvind; Maselle, Samuel Y; Langeland, Nina; Moyo, Sabrina J

    2016-01-01

    Faecal carriage of ESBL-producing bacteria is a potential risk for transmission and infection. Little is known about faecal carriage of antibiotic resistance in Tanzania. This study aimed to investigate the prevalence of faecal carriage of ESBL-producing Enterobacteriaceae and to identify risk factors for carriage among young children in Tanzania. From August 2010 to July 2011, children below 2 years of age were recruited in Dar es Salaam, including healthy community children (n = 250) and children hospitalized due to diarrhoea (n = 250) or other diseases (n = 103). ChromID ESBL agar and ChromID CARBA SMART agar were used for screening. Antimicrobial susceptibility testing was performed by the disk diffusion method. ESBL genotypes were identified by Real-Time PCR and sequencing. The overall prevalence of ESBL carriage was 34.3% (207/ 603). The prevalence of ESBL carriage was significantly higher among hospitalized children (50.4%), compared to community children (11.6%; P Enterobacteriaceae among children below 2 years of age in Tanzania, particularly those with HIV-infection. Resistance to a majority of the available antimicrobials commonly used for children in Tanzania leaves few treatment options for infections when caused by these bacteria.

  17. Foot-and-mouth disease virus serotypes detected in Tanzania from 2003 to 2010: Conjectured status and future prospects

    Directory of Open Access Journals (Sweden)

    Christopher J. Kasanga

    2012-06-01

    Full Text Available This study was conducted to investigate the presence of foot-and-mouth disease virus (FMDV in different geographic locations of Tanzania. Epithelial tissues and fluids (n = 364 were collected from cattle exhibiting oral and foot vesicular lesions suggestive of FMD and submitted for routine FMD diagnosis. The analysis of these samples collected during the period of 2002 and 2010 was performed by serotype-specific antigen capture ELISA to determine the presence of FMDV. The results of this study indicated that 167 out of 364 (46.1% of the samples contained FMDV antigen. Of the 167 positive samples, 37 (28.4% were type O, 7 (4.1% type A, 45 (21.9% SAT 1 and 79 (45.6% SAT 2. Two FMDV serotypes (O and SAT 2 were widely distributed throughout Tanzania whilst SAT 1 and A types were only found in the Eastern zone. Our findings suggest that serotypes A, O, SAT 1 and SAT 2 prevail in Tanzania and are associated with the recent FMD outbreaks. The lack of comprehensive animal movement records and inconsistent vaccination programmes make it difficult to determine the exact source of FMD outbreaks or to trace the transmission of the disease over time. Therefore, further collection and analysis of samples from domestic and wild animals are being undertaken to investigate the genetic and antigenic characteristics of the circulating strains, so that a rational method to control FMD in Tanzania and the neighbouring countries can be recommended.

  18. Evidence-based practice beliefs and behaviors of nurses providing cancer pain management: a mixed-methods approach.

    Science.gov (United States)

    Eaton, Linda H; Meins, Alexa R; Mitchell, Pamela H; Voss, Joachim; Doorenbos, Ardith Z

    2015-03-01

    To describe evidence-based practice (EBP) beliefs and behaviors of nurses who provide cancer pain management. Descriptive, cross-sectional with a mixed-methods approach. Two inpatient oncology units in the Pacific Northwest. 40 RNs.
 Data collected by interviews and web-based surveys. EBP beliefs, EBP implementation, evidence-based pain management. Nurses agreed with the positive aspects of EBP and their implementation ability, although implementation level was low. They were satisfied with their pain management practices. Oncology nursing certification was associated with innovativeness, and innovativeness was associated with EBP beliefs. Themes identified were (a) limited definition of EBP, (b) varied evidence-based pain management decision making, (c) limited identification of evidence-based pain management practices, and (d) integration of nonpharmacologic interventions into patient care. Nurses' low level of EBP implementation in the context of pain management was explained by their trust that standards of care and medical orders were evidence-based. Nurses' EBP beliefs and behaviors should be considered when developing strategies for sustaining evidence-based pain management practices. Implementation of the EBP process by nurses may not be realistic in the inpatient setting; therefore, hospital pain management policies need to be evidence-based and reinforced with nurses.

  19. Sexual practices among unmarried adolescents in Tanzania.

    Science.gov (United States)

    Kazaura, Method R; Masatu, Melkiory C

    2009-10-06

    Sexual activities are increasingly changing from the cultural point of view what they used to be. Knowledge of these practices among adolescents may be a basis to create awareness among adolescents on practices that involve risks. This study aims to assess sexual practices among unmarried adolescents in Tanzania. A cross-sectional survey was conducted among in-school and out-of-school but unmarried adolescents aged 10 to 19 in five locations in Tanzania. A questionnaire was used to collect information and to characterize sexual practices among these adolescents. About 32% of adolescents reported being sexually active; a higher proportion being males than females. The only inquired and reported sexual practices include vaginal sex, masturbation, oral and anal sex. About 15% of sexually active adolescents reported having multiple sexual partners. Significantly more males reported having multiple partners than females. Nearly 42% of sexually active adolescents reported having used a condom during most recent sexual act. Females reported older partners at first sexual act. Adolescents experience several sexual practices that include penetrative and non-penetrative. More males reported being sexually active than females. Despite adolescents reporting having multiple sexual partners, reported condom use during the most recent sexual act was low. We advocate for a more enhanced approach of reproductive health education that includes safer sex to adolescents without forgetting those in-schools.

  20. Mosquito abundance, bed net coverage and other factors associated with variations in sporozoite infectivity rates in four villages of rural Tanzania

    DEFF Research Database (Denmark)

    Kweka, Eliningaya J; Nkya, Watoky M M; Mahande, Aneth M

    2008-01-01

    . Sporozoite infectivity rates, mosquito host blood meal source, bed net coverage and mosquito abundance were assessed in this study. METHODOLOGY: A longitudinal survey was conducted in four villages in two regions of Tanzania. Malaria vectors were sampled using the CDC light trap and pyrethrum spray catch...... methods. In each village, ten paired houses were selected for mosquitoes sampling. Sampling was done in fortnight case and study was undertaken for six months in both Kilimanjaro (Northern Tanzania) and Dodoma (Central Tanzania) regions. RESULTS: A total of 6,883 mosquitoes were collected including: 5......,628 (81.8%) Anopheles arabiensis, 1,100 (15.9%) Culex quinquefasciatus, 89 (1.4%) Anopheles funestus, and 66 (0.9%) Anopheles gambiae s.s. Of the total mosquitoes collected 3,861 were captured by CDC light trap and 3,022 by the pyrethrum spray catch method. The overall light trap: spray catch ratio was 1...

  1. An evaluation of a family planning mobile job aid for community health workers in Tanzania.

    Science.gov (United States)

    Braun, Rebecca; Lasway, Christine; Agarwal, Smisha; L'Engle, Kelly; Layer, Erica; Silas, Lucy; Mwakibete, Anna; Kudrati, Mustafa

    2016-07-01

    The global rapid growth in mobile technology provides unique opportunities to support community health workers (CHWs) in providing family planning (FP) services. FHI 360, Pathfinder International and D-tree International developed an evidence-based mobile job aid to support CHW counseling, screening, service provision and referrals, with mobile forms for client and service data, and text-message reporting and reminders. The purpose of this study is to evaluate the acceptability and potential benefits to service quality from the perspective of CHWs and their clients. The mobile job aid was piloted in Dar es Salaam, Tanzania. Data collection tools included a demographic survey of all 25 CHWs trained to use the mobile job aid, in-depth interviews with 20 of the CHWs after 3 months and a survey of 176 clients who received FP services from a CHW using the mobile job aid after 6 months. Both CHWs and their clients reported that the mobile job aid was a highly acceptable FP support tool. CHWs perceived benefits to service quality, including timelier and more convenient care; better quality of information; increased method choice; and improved privacy, confidentiality and trust with clients. Most clients discussed multiple FP methods with CHWs; only 1 in 10 clients reported discussion of all 9 methods. This research suggests that mobile phones can be effective tools to support CHWs with FP counseling, screening and referrals, data collection and reporting, and communication. Challenges remain to support informed contraceptive choice. Future research should focus on implementation, including scale-up and sustainability. Mobile job aids can uniquely enhance FP service provision at the community level through adherence to standard protocols, real-time feedback and technical assistance, and provision of confidential care. This study can inform future efforts to support and expand the role of CHWs in increasing FP access and informed contraceptive choice. Copyright © 2016

  2. Integrated crop and goat breeding in Tanzania | IDRC - International ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    English · Français ... Researchers will test improved cassava and sweet potato varieties to ... Integrating improved goat breeds with new varieties of sweetpotatoes and cassava in the agro-pastoral systems of Tanzania : a gendered analysis.

  3. Stigma and discrimination on HIV/AIDS in Tanzania | Kisinza ...

    African Journals Online (AJOL)

    Stigma and discrimination on HIV/AIDS in Tanzania. W Kisinza, E MakundI, A Mwisongo, G Mubyazi, SM Magesa, H Malebo, J Mcharo, K Senkoro, P Hiza, K Pallangyo, Y Ipuge, AY Kitua, M Malecela-Lazaro ...

  4. The forgotten 'coastal forests' of Mtwara, Tanzania: a biologically ...

    African Journals Online (AJOL)

    ... of Mtwara, Tanzania: a biologically impoverished and yet important ecosystem. ... and endemism values in these forests, and high levels of forest disturbance. ... of modest biological importance within the context of the Eastern Arc Mountains ...

  5. Civic Participation in the Democratisation Process in Tanzania ...

    African Journals Online (AJOL)

    , village and chiefdom levels were prevalent throughout Tanzania even before the advent of colonialism. The scope, size and focus of civic societies have increased and changed over time from being primary agents for social service delivery ...

  6. Tanzania Journal of Health Research - Vol 9, No 3 (2007)

    African Journals Online (AJOL)

    -school adolescents in Kilimanjaro, Tanzania · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. S Siziya, P R Ntata, E Rudatsikira, C M Makupe, E Umar, A S Muula, 190-195.

  7. Growth aspirations of women entrepreneurs in tourism in Tanzania

    NARCIS (Netherlands)

    Lugalla, Irene Mkini

    2018-01-01

    Dit proefschrift presenteert empirische resultaten op basis van een kwalitatieve en kwantitatieve studie van vrouwelijke ondernemers in de toerismesector in Tanzania. Door Bourdieu's praktijktheorie en de institutionele theorie van Scott toe te passen, analyseren we de relatie tussen de

  8. Climate Change and Food Security in Tanzania: Analysis of Current ...

    African Journals Online (AJOL)

    Food systems in Tanzania are highly vulnerable to climate change and variability due to poor adaptive capacity of ... available GCMs and downscaling techniques ... water for hydroelectric power generation ... for farm-level decision making.

  9. Extension Systems in Tanzania: Identifying Gaps in Research

    African Journals Online (AJOL)

    in Tanzania on agricultural extension systems; review research globally on agricultural ... cal techniques, unique results and major recommendations. .... participation in decision-making, natural .... soil and water management technologies in.

  10. Agrochemicals use in horticulture industry in Tanzania and their ...

    African Journals Online (AJOL)

    International Journal of Biological and Chemical Sciences ... It is apparent that most of the horticultural farms in Northern Tanzania are located on gently ... Thus discharges of wastewaters from horticulture farms may affect the quality of water ...

  11. Agrochemicals use in horticulture industry in Tanzania and their ...

    African Journals Online (AJOL)

    hp

    (Fertilizers and Pesticides) in the Tanzanian horticulture industry especially the Northern regions ... It is apparent that most of the horticultural farms in Northern Tanzania are located on gently .... evaluate any potential for polluting such water.

  12. Tanzania Journal of Science - Vol 38, No 1 (2012)

    African Journals Online (AJOL)

    Human-wildlife interaction in Serengeti and Ngorongoro districts of Tanzania: A case study on small mammals · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. FJ Magige, 95-103 ...

  13. Factors associated with child sexual abuse in Tanzania: a qualitative ...

    African Journals Online (AJOL)

    Factors associated with child sexual abuse in Tanzania: a qualitative study. Mangi J. Ezekiel, Felix Kisanga, Idda H. Mosha, Amani Anaeli, Switbert R. Kamazima, Rose Mpembeni, Eustace P. Muhondwa ...

  14. A new genus and species of Ceratocanthidae from Tanzania ...

    African Journals Online (AJOL)

    Coleoptera: Scarabaeoidea) from the Usambara Mountains (Tanzania), is described. The morphology of the clypeus and mesoepisternum is discussed, also with reference to other Ceratocanthidae. The affinities of the genus are discussed, and ...

  15. Training Teachers in Special Needs Education in Tanzania: A Long ...

    African Journals Online (AJOL)

    This study examined the training of special education teachers in Tanzania. ... learning materials, few trained teachers, teacher attrition, negative attitudes, barrier to ... Keywords: Special needs education, disability, inclusive education, teacher ...

  16. Attitudes of Community to Urban Traffic Noise in Morogoro, Tanzania

    African Journals Online (AJOL)

    Attitudes of Community to Urban Traffic Noise in Morogoro, Tanzania. ... which is the daytime governmentally prescribed noise limit for residential-commercial areas. ... The main impacts of exposure to noise were reported to be headache, ...

  17. Tanzania Journal of Health Research - Vol 8, No 3 (2006)

    African Journals Online (AJOL)

    Urine carcinoembryonic antigen determination in urinary bladder bilharziasis predicts carcinoma in patients with premalignant lesions: Observation of 43 cases ... Participatory involvement of farming communities and public sectors in determining malaria control strategies in Mvomero District, Tanzania · EMAIL FREE FULL ...

  18. All projects related to tanzania | Page 3 | IDRC - International ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Leveraging Indigenous Knowledge to Create Jobs for Women in Rural Areas ... Region: India, Kenya, Sri Lanka, Tanzania, Trinidad and Tobago, West Indies, Canada ... growth rates in East Africa, the effects of growth on poverty reduction and ...

  19. How much time is available for antenatal care consultations? Assessment of the quality of care in rural Tanzania

    Directory of Open Access Journals (Sweden)

    Cousens Simon

    2011-09-01

    Full Text Available Abstract Background Many women in Sub-Saharan African countries do not receive key recommended interventions during routine antenatal care (ANC including information on pregnancy, related complications, and importance of skilled delivery attendance. We undertook a process evaluation of a successful cluster randomized trial testing the effectiveness of birth plans in increasing utilization of skilled delivery and postnatal care in Ngorongoro district, rural Tanzania, to document the time spent by health care providers on providing the recommended components of ANC. Methods The study was conducted in 16 health units (eight units in each arm of the trial. We observed, timed, and audio-recorded ANC consultations to assess the total time providers spent with each woman and the time spent for the delivery of each component of care. T-test statistics were used to compare the total time and time spent for the various components of ANC in the two arms of the trial. We also identified the topics discussed during the counselling and health education sessions, and examined the quality of the provider-woman interaction. Results The mean total duration for initial ANC consultations was 40.1 minutes (range 33-47 in the intervention arm versus 19.9 (range 12-32 in the control arm p Conclusion Although the implementation of birth plans in the intervention health units improved provider-women dialogue on skilled delivery attendance, most recommended topics critical to improving maternal and newborn survival were rarely covered.

  20. Sustainability and Long Term-Tenure: Lion Trophy Hunting in Tanzania.

    Directory of Open Access Journals (Sweden)

    Henry Brink

    Full Text Available It is argued that trophy hunting of large, charismatic mammal species can have considerable conservation benefits but only if undertaken sustainably. Social-ecological theory suggests such sustainability only results from developing governance systems that balance financial and biological requirements. Here we use lion (Panthera leo trophy hunting data from Tanzania to investigate how resource ownership patterns influence hunting revenue and offtake levels. Tanzania contains up to half of the global population of free-ranging lions and is also the main location for lion trophy hunting in Africa. However, there are concerns that current hunting levels are unsustainable. The lion hunting industry in Tanzania is run by the private sector, although the government leases each hunting block to companies, enforces hunting regulation, and allocates them a species-specific annual quota per block. The length of these leases varies and theories surrounding property rights and tenure suggest hunting levels would be less sustainable in blocks experiencing a high turnover of short-term leases. We explored this issue using lion data collected from 1996 to 2008 in the Selous Game Reserve (SGR, the most important trophy hunting destination in Tanzania. We found that blocks in SGR with the highest lion hunting offtake were also those that experienced the steepest declines in trophy offtake. In addition, we found this high hunting offtake and the resultant offtake decline tended to be in blocks under short-term tenure. In contrast, lion hunting levels in blocks under long-term tenure matched more closely the recommended sustainable offtake of 0.92 lions per 1000 km2. However, annual financial returns were higher from blocks under short-term tenure, providing $133 per km2 of government revenue as compared to $62 per km2 from long-term tenure blocks. Our results provide evidence for the importance of property rights in conservation, and support calls for an overhaul

  1. Sustainability and Long Term-Tenure: Lion Trophy Hunting in Tanzania.

    Science.gov (United States)

    Brink, Henry; Smith, Robert J; Skinner, Kirsten; Leader-Williams, Nigel

    2016-01-01

    It is argued that trophy hunting of large, charismatic mammal species can have considerable conservation benefits but only if undertaken sustainably. Social-ecological theory suggests such sustainability only results from developing governance systems that balance financial and biological requirements. Here we use lion (Panthera leo) trophy hunting data from Tanzania to investigate how resource ownership patterns influence hunting revenue and offtake levels. Tanzania contains up to half of the global population of free-ranging lions and is also the main location for lion trophy hunting in Africa. However, there are concerns that current hunting levels are unsustainable. The lion hunting industry in Tanzania is run by the private sector, although the government leases each hunting block to companies, enforces hunting regulation, and allocates them a species-specific annual quota per block. The length of these leases varies and theories surrounding property rights and tenure suggest hunting levels would be less sustainable in blocks experiencing a high turnover of short-term leases. We explored this issue using lion data collected from 1996 to 2008 in the Selous Game Reserve (SGR), the most important trophy hunting destination in Tanzania. We found that blocks in SGR with the highest lion hunting offtake were also those that experienced the steepest declines in trophy offtake. In addition, we found this high hunting offtake and the resultant offtake decline tended to be in blocks under short-term tenure. In contrast, lion hunting levels in blocks under long-term tenure matched more closely the recommended sustainable offtake of 0.92 lions per 1000 km2. However, annual financial returns were higher from blocks under short-term tenure, providing $133 per km2 of government revenue as compared to $62 per km2 from long-term tenure blocks. Our results provide evidence for the importance of property rights in conservation, and support calls for an overhaul of the system in

  2. Petroleum fund in Tanzania? Other alternatives may be better

    OpenAIRE

    Torvik, Ragnar

    2016-01-01

    The Government of Tanzania is looking for the best policies and institutional designs to turn future petroleum revenues into welfare, development and jobs. This Brief argues that the Tanzanian society will benefit more by investing in infrastructure, health and education, rather than establishing a petroleum sovereign wealth fund and investing in foreign assets. Exploration for oil and gas in Tanzania started in the 1950s. The first discoveries were made in the 1970s, and commercial prod...

  3. Maternal and neonatal colonisation of group B streptococcus at Muhimbili National Hospital in Dar es Salaam, Tanzania: prevalence, risk factors and antimicrobial resistance

    Directory of Open Access Journals (Sweden)

    Lyamuya Eligius F

    2009-12-01

    Full Text Available Abstract Background Group B streptococcus (GBS, which asymptomatically colonises the vaginal and rectal areas of women, is the leading cause of septicemia, meningitis and pneumonia in neonates. In Tanzania no studies have been done on GBS colonisation of pregnant women and neonates. This study was conducted in Dar es Salaam, Tanzania to determine the prevalence of GBS colonisation among pregnant women, the neonatal colonisation rate and the antimicrobial susceptibility, thus providing essential information to formulate a policy for treatment and prevention regarding perinatal GBS diseases. Methods This cross sectional study involved 300 pregnant women attending antenatal clinic and their newborns delivered at Muhimbili National Hospital (MNH between October 2008 and March 2009. High vaginal, rectal, nasal, ear and umbilical swabs were cultured on Todd Hewitt Broth and in 5% sheep blood agar followed by identification of isolates using conventional methods and testing for their susceptibility to antimicrobial agents using the Kirby-Bauer method. Results GBS colonisation was confirmed in 23% of pregnant women and 8.9% of neonates. A higher proportion of GBS were isolated from the vagina (12.3% as compared to the rectum (5%. Prolonged duration of labour (>12 hrs was significantly shown to influence GBS colonisation in neonates P Conclusion Our findings seem to suggest that a quarter of pregnant women attending ANC clinic at MNH and approximately 10% of their newborns are colonised with GBS. All isolates were found to be sensitive to vancomycin and ampicillin which seem to be the most effective antibiotics for the time being. However there is a need for continuous antibiotics surveillance of GBS to monitor trend of resistance. The high isolation frequency of GBS among pregnant women suggests routine antenatal screening at 35 to 37 weeks of gestation in order to provide antibiotic prophylaxis to GBS carrier.

  4. Measuring client satisfaction and the quality of family planning services: a comparative analysis of public and private health facilities in Tanzania, Kenya and Ghana.

    Science.gov (United States)

    Hutchinson, Paul L; Do, Mai; Agha, Sohail

    2011-08-24

    Public and private family planning providers face different incentive structures, which may affect overall quality and ultimately the acceptability of family planning for their intended clients. This analysis seeks to quantify differences in the quality of family planning (FP) services at public and private providers in three representative sub-Saharan African countries (Tanzania, Kenya and Ghana), to assess how these quality differentials impact upon FP clients' satisfaction, and to suggest how quality improvements can improve contraceptive continuation rates. Indices of technical, structural and process measures of quality are constructed from Service Provision Assessments (SPAs) conducted in Tanzania (2006), Kenya (2004) and Ghana (2002) using direct observation of facility attributes and client-provider interactions. Marginal effects from multivariate regressions controlling for client characteristics and the multi-stage cluster sample design assess the relative importance of different measures of structural and process quality at public and private facilities on client satisfaction. Private health facilities appear to be of higher (interpersonal) process quality than public facilities but not necessarily higher technical quality in the three countries, though these differentials are considerably larger at lower level facilities (clinics, health centers, dispensaries) than at hospitals. Family planning client satisfaction, however, appears considerably higher at private facilities - both hospitals and clinics - most likely attributable to both process and structural factors such as shorter waiting times and fewer stockouts of methods and supplies. Because the public sector represents the major source of family planning services in developing countries, governments and Ministries of Health should continue to implement and to encourage incentives, perhaps performance-based, to improve quality at public sector health facilities, as well as to strengthen regulatory

  5. Science-based health innovation in Tanzania: bednets and a base for invention

    Directory of Open Access Journals (Sweden)

    Daar Abdallah S

    2010-12-01

    Full Text Available Abstract Background Tanzania is East Africa’s largest country. Although it is socially diverse, it has experienced general political stability since independence in 1964. Despite gradual economic development and Tanzania’s status as one of the biggest recipients of aid in Africa, health status remains poor. This paper explores Tanzania’s science-based health innovation system, and highlights areas which can be strengthened. Methods Qualitative case study research methodology was used. Data were collected through reviews of academic literature and policy documents, and through open-ended, face-to-face interviews with 52 people from across the science-based health innovation system over two visits to Tanzania from July to October 2007. Results and discussion Tanzania has a rich but complex S&T governance landscape, with the public sector driving the innovation agenda through a series of different bodies which are not well-coordinated. It has some of the leading health research on the continent at the University of Dar es Salaam, Muhimbili University of Health and Applied Sciences, the National Institute for Medical Research and the Ifakara Medical Institute, with strong donor support. Tanzania has found developing an entrepreneurial culture difficult; nevertheless projects such as the clusters initiative at the University of Dar es Salaam are encouraging low-tech innovation and overcoming knowledge-sharing barriers. In the private sector, one generics company has developed a South-South collaboration to enable technology transfer and hence the local production of anti-retrovirals. Local textile company A to Z Textiles is now manufacturing 30 million insecticide impregnated bednets a year. Conclusions To have a coherent vision for innovation, Tanzania may wish to address some key issues: coordination across stakeholders involved with health research, increasing graduates in health-related disciplines, and building capabilities in biological

  6. Prospects, achievements, challenges and opportunities for scaling-up malaria chemoprevention in pregnancy in Tanzania: the perspective of national level officers

    DEFF Research Database (Denmark)

    Mubyazi, Godfrey; Bygbjerg, Ib; Magnussen, Pascal

    2008-01-01

    skills of most HWs and their poor motivation. Other problems were unreliable supply of free SP at private clinics, clean and safe water shortage at many government ANC clinics limiting direct observation treatment and occasionally pregnant women asked to pay for ANC services. Finally, supervision......Objectives: To describe the prospects, achievements, challenges and opportunities for implementing intermittent preventive treatment for malaria in pregnancy (IPTp) in Tanzania in light of national antenatal care (ANC) guidelines and ability of service providers to comply with them. Methods: In...... of peripheral health facilities has been inadequate and national guidelines on district budgeting for health services have been inflexible. IPTp coverage is generally low partly because IPTp is not systematically enforced like programmes on immunization, tuberculosis, leprosy and other infectious diseases...

  7. Do Management and Leadership Practices in the Context of Decentralisation Influence Performance of Community Health Fund? Evidence From Iramba and Iringa Districts in Tanzania

    Directory of Open Access Journals (Sweden)

    Chakupewa Joseph

    2017-05-01

    Full Text Available Background In early 1990s, Tanzania like other African countries, adopted health sector reform (HSR. The most strongly held centralisation system that informed the nature of services provision including health was, thus, disintegrated giving rise to decentralisation system. It was within the realm of HSR process, user fees were introduced in the health sector. Along with user fees, various types of health insurances, including the Community Health Fund (CHF, were introduced. While the country’s level of enrolment in the CHF is low, there are marked variations among districts. This paper highlights the role of decentralised health management and leadership practices in the uptake of the CHF in Tanzania. Methods A comparative exploratory case study of high and low performing districts was carried out. In-depth interviews were conducted with the members of the Council Health Service Board (CHSB, Council Health Management Team (CHMT, Health Facility Committees (HFCs, in-charges of health facilities, healthcare providers, and Community Development Officers (CDOs. Minutes of the meetings of the committees and district annual health plans and district annual implementation reports were also used to verify and triangulate the data. Thematic analysis was adopted to analyse the collected data. We employed both inductive and deductive (mixed coding to arrive to the themes. Results There were no differences in the level of education and experience of the district health managers in the two study districts. Almost all district health managers responsible for the management of the CHF had attended some training on management and leadership. However, there were variations in the personal initiatives of the top-district health leaders, particularly the district health managers, the council health services board and local government officials. Similarly, there were differences in the supervision mechanisms, and incentives available for the health providers

  8. Plague and the Human Flea, Tanzania

    DEFF Research Database (Denmark)

    Laudisoit, Anne; Leirs, Herwig; Makundi, Rhodes H

    2007-01-01

    Domestic fleas were collected in 12 villages in the western Usambara Mountains in Tanzania. Of these, 7 are considered villages with high plague frequency, where human plague was recorded during at least 6 of the 17 plague seasons between 1986 and 2004. In the remaining 5 villages with low plague...... frequency, plague was either rare or unrecorded. Pulex irritans, known as the human flea, was the predominant flea species (72.4%) in houses. The density of P. irritans, but not of other domestic fleas, was significantly higher in villages with a higher plague frequency or incidence. Moreover, the P....... irritans index was strongly positively correlated with plague frequency and with the logarithmically transformed plague incidence. These observations suggest that in Lushoto District human fleas may play a role in plague epidemiology. These findings are of immediate public health relevance because...

  9. Coping with Rainfall Variability in Northern Tanzania

    DEFF Research Database (Denmark)

    Trærup, Sara Lærke Meltofte

    2012-01-01

    This paper explores a potential relationship between rainfall data and household self-reported harvest shocks and local (spatial) variability of harvest shocks and coping strategies based on a survey of 2700 rural households in the Kagera region of northern Tanzania. In addition, correlations...... of household reported harvest shocks differs significantly between districts and correspond to the observed variability in local climate patterns. Coping strategies are focused on spreading risks and include reduced consumption, casual employment, new crops, external support and the selling of assets....... There are no large differences in applied coping strategies across the region, but district-level data demonstrate how local strategies differ between localities within the districts. The results emphasize that in order to target rural policies and make them efficient, it is important to take into account the local...

  10. Size-specific dose estimate (SSDE) provides a simple method to calculate organ dose for pediatric CT examinations

    Energy Technology Data Exchange (ETDEWEB)

    Moore, Bria M.; Brady, Samuel L., E-mail: samuel.brady@stjude.org; Kaufman, Robert A. [Department of Radiological Sciences, St Jude Children' s Research Hospital, Memphis, Tennessee 38105 (United States); Mirro, Amy E. [Department of Biomedical Engineering, Washington University, St Louis, Missouri 63130 (United States)

    2014-07-15

    Purpose: To investigate the correlation of size-specific dose estimate (SSDE) with absorbed organ dose, and to develop a simple methodology for estimating patient organ dose in a pediatric population (5–55 kg). Methods: Four physical anthropomorphic phantoms representing a range of pediatric body habitus were scanned with metal oxide semiconductor field effect transistor (MOSFET) dosimeters placed at 23 organ locations to determine absolute organ dose. Phantom absolute organ dose was divided by phantom SSDE to determine correlation between organ dose and SSDE. Organ dose correlation factors (CF{sub SSDE}{sup organ}) were then multiplied by patient-specific SSDE to estimate patient organ dose. The CF{sub SSDE}{sup organ} were used to retrospectively estimate individual organ doses from 352 chest and 241 abdominopelvic pediatric CT examinations, where mean patient weight was 22 kg ± 15 (range 5–55 kg), and mean patient age was 6 yrs ± 5 (range 4 months to 23 yrs). Patient organ dose estimates were compared to published pediatric Monte Carlo study results. Results: Phantom effective diameters were matched with patient population effective diameters to within 4 cm; thus, showing appropriate scalability of the phantoms across the entire pediatric population in this study. IndividualCF{sub SSDE}{sup organ} were determined for a total of 23 organs in the chest and abdominopelvic region across nine weight subcategories. For organs fully covered by the scan volume, correlation in the chest (average 1.1; range 0.7–1.4) and abdominopelvic region (average 0.9; range 0.7–1.3) was near unity. For organ/tissue that extended beyond the scan volume (i.e., skin, bone marrow, and bone surface), correlation was determined to be poor (average 0.3; range: 0.1–0.4) for both the chest and abdominopelvic regions, respectively. A means to estimate patient organ dose was demonstrated. Calculated patient organ dose, using patient SSDE and CF{sub SSDE}{sup organ}, was compared to

  11. Struggles over patriarchal structural adjustment in Tanzania.

    Science.gov (United States)

    Mbilinyi, M

    1993-10-01

    Within the space of 7 years (1986-93), structural adjustment policies have contributed to a reversal of the gains in economic development achieved in Tanzania in the 1960s and 1970s. Structural adjustment policies have helped large-scale producers and ordinary citizens but have led to a decline in social services which is reflected in drops in primary school enrollment and increases in medical costs. Government revenues are absorbed by foreign debt servicing. The reduction of support for social services has increased women's work; bolstered gender division of labor; and reduced women's access to education, formal employment, and health services. On the other hand, increased participation in market-oriented activities has increased women's mobility and exposure to modern ideas. This has led to changing gender relations which on the positive side can lead to shared decision-making but on the negative side may cause men to abdicate their familial responsibilities. Women suffer, however, from a lack of investment in ways to lighten their household responsibilities and have lost their ability to control food production because of the shift to cash crop production for export. The combination of hard work, low income, and stress has taken a toll on women's health, and both the maternal mortality rate and incidence of HIV infections among teenage girls has increased. In response to this situation, Tanzanian women have formed the Tanzania Gender Networking Programme (TGNP) which seeks to empower women and transform society through such activities as education and training, research, and lobbying and networking. Workshops sponsored by the TGNP have resulted in recommendations for adoption of a people-centered development strategy.

  12. Waiting for attention and care: birthing accounts of women in rural Tanzania who developed obstetric fistula as an outcome of labour

    Directory of Open Access Journals (Sweden)

    Mselle Lilian T

    2011-10-01

    Full Text Available Abstract Background Obstetric fistula is a physically and socially disabling obstetric complication that affects about 3,000 women in Tanzania every year. The fistula, an opening that forms between the vagina and the bladder and/or the rectum, is most frequently caused by unattended prolonged labour, often associated with delays in seeking and receiving appropriate and adequate birth care. Using the availability, accessibility, acceptability and quality of care (AAAQ concept and the three delays model, this article provides empirical knowledge on birth care experiences of women who developed fistula after prolonged labour. Methods We used a mixed methods approach to explore the birthing experiences of women affected by fistula and the barriers to access adequate care during labour and delivery. Sixteen women were interviewed for the qualitative study and 151 women were included in the quantitative survey. All women were interviewed at the Comprehensive Community Based Rehabilitation Tanzania in Dar es Salaam and Bugando Medical Centre in Mwanza. Results Women experienced delays both before and after arriving at a health facility. Decisions on where to seek care were most often taken by husbands and mothers-in-law (60%. Access to health facilities providing emergency obstetric care was inadequate and transport was a major obstacle. About 20% reported that they had walked or were carried to the health facility. More than 50% had reported to a health facility after two or more days of labour at home. After arrival at a health facility women experienced lack of supportive care, neglect, poor assessment of labour and lack of supervision. Their birth accounts suggest unskilled birth care and poor referral routines. Conclusions This study reveals major gaps in access to and provision of emergency obstetric care. It illustrates how poor quality of care at health facilities contributes to delays that lead to severe birth injuries, highlighting the need

  13. Waiting for attention and care: birthing accounts of women in rural Tanzania who developed obstetric fistula as an outcome of labour

    Science.gov (United States)

    2011-01-01

    Background Obstetric fistula is a physically and socially disabling obstetric complication that affects about 3,000 women in Tanzania every year. The fistula, an opening that forms between the vagina and the bladder and/or the rectum, is most frequently caused by unattended prolonged labour, often associated with delays in seeking and receiving appropriate and adequate birth care. Using the availability, accessibility, acceptability and quality of care (AAAQ) concept and the three delays model, this article provides empirical knowledge on birth care experiences of women who developed fistula after prolonged labour. Methods We used a mixed methods approach to explore the birthing experiences of women affected by fistula and the barriers to access adequate care during labour and delivery. Sixteen women were interviewed for the qualitative study and 151 women were included in the quantitative survey. All women were interviewed at the Comprehensive Community Based Rehabilitation Tanzania in Dar es Salaam and Bugando Medical Centre in Mwanza. Results Women experienced delays both before and after arriving at a health facility. Decisions on where to seek care were most often taken by husbands and mothers-in-law (60%). Access to health facilities providing emergency obstetric care was inadequate and transport was a major obstacle. About 20% reported that they had walked or were carried to the health facility. More than 50% had reported to a health facility after two or more days of labour at home. After arrival at a health facility women experienced lack of supportive care, neglect, poor assessment of labour and lack of supervision. Their birth accounts suggest unskilled birth care and poor referral routines. Conclusions This study reveals major gaps in access to and provision of emergency obstetric care. It illustrates how poor quality of care at health facilities contributes to delays that lead to severe birth injuries, highlighting the need to ensure women's rights to

  14. Perceived improvement in integrated management of childhood illness implementation through use of mobile technology: qualitative evidence from a pilot study in Tanzania.

    Science.gov (United States)

    Mitchell, Marc; Getchell, Maya; Nkaka, Melania; Msellemu, Daniel; Van Esch, Jan; Hedt-Gauthier, Bethany

    2012-01-01

    This study examined health care provider and caretaker perceptions of electronic Integrated Management of Childhood Illness (eIMCI) in diagnosing and treating childhood illnesses. The authors conducted semi-structured interviews among caretakers (n = 20) and health care providers (n = 11) in the Pwani region of Tanzania. This qualitative study was nested within a larger quantitative study measuring impact of eIMCI on provider adherence to IMCI protocols. Caretakers and health care workers involved in the larger study provided their perceptions of eIMCI in comparison with the conventional paper forms. One health care provider from each participating health center participated in qualitative interviews; 20 caretakers were selected from 1 health center involved in the quantitative study. Interviews were conducted in Swahili and lasted 5-10 min each. Providers expressed positive opinions of eIMCI, noting that the personal digital assistants were faster and easier to use than were the paper forms and encouraged adherence to IMCI procedures. Caretakers also held a positive view of eIMCI, noting improved service from providers, more thorough examination of their child, and a perception that providers who used the personal digital assistants were more knowledgeable. Research indicates widespread nonadherence to IMCI guidelines, suggesting improved methods for implementing IMCI are necessary. The authors conclude that eIMCI represents a promising method for improving health care delivery because it improves health care provider and caretaker perception of the clinical encounter. Further investigation into this technology is warranted.

  15. The Patient-Provider Relationship Is Associated with Hepatitis C Treatment Eligibility: A Prospective Mixed-Methods Cohort Study.

    Directory of Open Access Journals (Sweden)

    Shari S Rogal

    Full Text Available Hepatitis C virus (HCV treatment has the potential to cure the leading cause of cirrhosis and hepatocellular carcinoma. However, only those deemed eligible for treatment have the possibility of this cure. Therefore, understanding the determinants of HCV treatment eligibility is critical. Given that effective communication with and trust in healthcare providers significantly influences treatment eligibility decisions in other diseases, we aimed to understand patient-provider interactions in the HCV treatment eligibility process. This prospective cohort study was conducted in the VA Pittsburgh Healthcare System. Patients were recruited after referral for gastroenterology consultation for HCV treatment with interferon and ribavirin. Consented patients completed semi-structured interviews and validated measures of depression, substance and alcohol use, and HCV knowledge. Two coders analyzed the semi-structured interviews. Factors associated with patient eligibility for interferon-based therapy were assessed using multivariate logistic regression. Of 339 subjects included in this analysis, only 56 (16.5% were deemed eligible for HCV therapy by gastroenterology (GI providers. In the multivariate logistic regression, patients who were older (OR = 0.96, 95%CI = 0.92-0.99, p = .049, reported concerns about the GI provider (OR = 0.40, 95%CI = 0.10-0.87, p = 0.02 and had depression symptoms (OR = 0.32, 95%CI = 0.17-0.63, p = 0.001 were less likely to be eligible. Patients described barriers that included feeling stigmatized and poor provider interpersonal or communication skills. In conclusion, we found that patients' perceptions of the relationship with their GI providers were associated with treatment eligibility. Establishing trust and effective communication channels between patients and providers may lower barriers to potential HCV cure.

  16. A Post-Final Assignment for the Methods Course: Providing an Incentive to Professional Growth for Future Teachers.

    Science.gov (United States)

    Bentley, Michael L.

    This paper describes J. Rosengren's post-final assignment and M. Harmin's truth signs activity that were incorporated into a secondary science methods course for preservice teachers. The strength of the post-final assignment is that it is a strategy for extending student learning past the end of a course and even beyond the initial teaching…

  17. New Technologies Provide Quantum Changes in the Scale, Speed, and Success of SELEX Methods and Aptamer Characterization

    Directory of Open Access Journals (Sweden)

    Abdullah Ozer

    2014-01-01

    Full Text Available Single-stranded oligonucleotide aptamers have attracted great attention in the past decade because of their diagnostic and therapeutic potential. These versatile, high affinity and specificity reagents are selected by an iterative in vitro process called SELEX, Systematic Evolution of Ligands by Exponential Enrichment. Numerous SELEX methods have been developed for aptamer selections; some that are simple and straightforward, and some that are specialized and complicated. The method of SELEX is crucial for selection of an aptamer with desired properties; however, success also depends on the starting aptamer library, the target molecule, aptamer enrichment monitoring assays, and finally, the analysis and characterization of selected aptamers. Here, we summarize key recent developments in aptamer selection methods, as well as other aspects of aptamer selection that have significant impact on the outcome. We discuss potential pitfalls and limitations in the selection process with an eye to aid researchers in the choice of a proper SELEX strategy, and we highlight areas where further developments and improvements are desired. We believe carefully designed multiplexed selection methods, when complemented with high-throughput downstream analysis and characterization assays, will yield numerous high-affinity aptamers to protein and small molecule targets, and thereby generate a vast array of reagents for probing basic biological mechanisms and implementing new diagnostic and therapeutic applications in the near future.

  18. 47 CFR 52.31 - Deployment of long-term database methods for number portability by CMRS providers.

    Science.gov (United States)

    2010-10-01

    ... require software but not hardware changes to provide portability (“Hardware Capable Switches”), within 60... queries, so that they can deliver calls from their networks to any party that has retained its number after switching from one telecommunications carrier to another. (c) [Reserved] (d) In the event a...

  19. An optical device capable of providing a structural color, and a corresponding method of manufacturing such a device

    DEFF Research Database (Denmark)

    2014-01-01

    ) with respect to the average surface positions. The position, size, and randomness of the protrusions are arranged so as to provide, at least up to a maximum angle of incidence (A_in) with respect to a normal to the surface, an angle-independent substantially homogeneous structural color perception for a normal...

  20. Malignant lymphomas (ML and HIV infection in Tanzania

    Directory of Open Access Journals (Sweden)

    Mwakigonja Amos R

    2008-06-01

    Full Text Available Abstract Background HIV infection is reported to be associated with some malignant lymphomas (ML so called AIDS-related lymphomas (ARL, with an aggressive behavior and poor prognosis. The ML frequency, pathogenicity, clinical patterns and possible association with AIDS in Tanzania, are not well documented impeding the development of preventive and therapeutic strategies. Methods Sections of 176 archival formalin-fixed paraffin-embedded biopsies of ML patients at Muhimbili National Hospital (MNH/Muhimbili University of Health and Allied Sciences (MUHAS, Tanzania from 1996–2001 were stained for hematoxylin and eosin and selected (70 cases for expression of pan-leucocytic (CD45, B-cell (CD20, T-cell (CD3, Hodgkin/RS cell (CD30, histiocyte (CD68 and proliferation (Ki-67 antigen markers. Corresponding clinical records were also evaluated. Available sera from 38 ML patients were screened (ELISA for HIV antibodies. Results The proportion of ML out of all diagnosed tumors at MNH during the 6 year period was 4.2% (176/4200 comprising 77.84% non-Hodgkin (NHL including 19.32% Burkitt's (BL and 22.16% Hodgkin's disease (HD. The ML tumors frequency increased from 0.42% (1997 to 0.70% (2001 and 23.7% of tested sera from these patients were HIV positive. The mean age for all ML was 30, age-range 3–91 and peak age was 1–20 years. The male:female ratio was 1.8:1. Supra-diaphragmatic presentation was commonest and histological sub-types were mostly aggressive B-cell lymphomas however, no clear cases of primary effusion lymphoma (PEL and primary central nervous system lymphoma (PCNSL were diagnosed. Conclusion Malignant lymphomas apparently, increased significantly among diagnosed tumors at MNH between 1996 and 2001, predominantly among the young, HIV infected and AIDS patients. The frequent aggressive clinical and histological presentation as well as the dominant B-immunophenotype and the HIV serology indicate a pathogenic association with AIDS. Therefore

  1. Malaria entomological profile in Tanzania from 1950 to 2010: a review of mosquito distribution, vectorial capacity and insecticide resistance.

    Science.gov (United States)

    Kabula, Bilali; Derua, Yahya A; Tungui, Patrick; Massue, Dennis J; Sambu, Edward; Stanley, Grades; Mosha, Franklin W; Kisinza, William N

    2011-12-01

    In Sub Saharan Africa where most of the malaria cases and deaths occur, members of the Anopheles gambiae species complex and Anophelesfunestus species group are the important malaria vectors. Control efforts against these vectors in Tanzania like in most other Sub Saharan countries have failed to achieve the set objectives of eliminating transmission due to scarcity of information about the enormous diversity of Anopheles mosquito species and their susceptibility status to insecticides used for malaria vector control. Understanding the diversity and insecticide susceptibility status of these vectors and other factors relating to their importance as vectors (such as malaria transmission dynamics, vector biology, ecology, behaviour and population genetics) is crucial to developing a better and sound intervention strategies that will reduce man-vector contact and also manage the emergency of insecticide resistance early and hence .a success in malaria control. The objective of this review was therefore to obtain the information from published and unpublished documents on spatial distribution and composition of malaria vectors, key features of their behaviour, transmission indices and susceptibility status to insecticides in Tanzania. All data available were collated into a database. Details recorded for each data source were the locality, latitude/longitude, time/period of study, species, abundance, sampling/collection methods, species identification methods, insecticide resistance status, including evidence of the kdr allele, and Plasmodium falciparum sporozoite rate. This collation resulted in a total of 368 publications, encompassing 806,273 Anopheles mosquitoes from 157 georeferenced locations being collected and identified across Tanzania from 1950s to 2010. Overall, the vector species most often reported included An. gambiae complex (66.8%), An. funestus complex (21.8%), An. gambiae s.s. (2.1%) and An. arabiensis (9%). A variety of sampling/ collection and

  2. An overview of filtration methods that can provide protection from the macrofouling zebra mussel at hydroelectric facilities

    Energy Technology Data Exchange (ETDEWEB)

    Smythe, A.G.; Short, T.M. [Acres International Corp., Amherst, NY (United States)

    1995-12-31

    The non-indigenous freshwater zebra and quagga mussels (Dreissena, spp.) threaten to foul freshwater conduits throughout much of the United States and southern Canada. Initially, many electric facilities within the lower Great Lakes drainage were fouled. More recently, other systems both in and out of the Great Lakes, have been exposed to infested water facilitated by canals and boat traffic and impacted by the mussels. Mussels have clogged conduits and fouled equipment and monitoring sensors in relatively distant regions including the Hudson River, the Mississippi River south to New Orleans, and the Arkansas River into Oklahoma. Chemicals can effectively control the mussels, however, filtration methods promise to be a relatively cost effective, environmentally safe alternative control approach. Information on traditional filtration methods will be presented in this paper along with recent research results for in-line filters.

  3. Spatial variation and socio-economic determinants of Plasmodium falciparum infection in northeastern Tanzania

    DEFF Research Database (Denmark)

    Mmbando, Bruno P; Kamugisha, Mathias L; Lusingu, John P

    2011-01-01

    system (GPS) unit. The effects of risk factors were determined using generalized estimating equation and spatial risk of P. falciparum infection was modelled using a kernel (non-parametric) method. RESULTS: There was a significant spatial variation of P. falciparum infection, and urban areas were......ABSTRACT: BACKGROUND: Malaria due to Plasmodium falciparum is the leading cause of morbidity and mortality in Tanzania. According to health statistics, malaria accounts for about 30% and 15% of hospital admissions and deaths, respectively. The risk of P. falciparum infection varies across...... the country. This study describes the spatial variation and socio-economic determinants of P. falciparum infection in northeastern Tanzania. METHODS: The study was conducted in 14 villages located in highland, lowland and urban areas of Korogwe district. Four cross-sectional malaria surveys involving...

  4. Evaluation of Effective Factors on e-Loyalty in Organizations Providing Electronic Services using Fuzzy AHP Method

    Directory of Open Access Journals (Sweden)

    fatemeh mohammadi

    2012-12-01

    Full Text Available In today's business world, proper identification of customer’s requirements and a quick response to these requirements is a key to commercial success. Increasing customer loyalty affects the profitability and organizations can ensure their long-term interests by means of planning. In today's competitive world, the services provided by the competing company have to be more similar to each other and can be hard to surprise customers within completely new service in the long term, because the newest services are quickly imitated by competitors and marketed. Hence investment in customer loyalty is an effective and profitable investment for companies. One criticism that has entered into the e-service is customer loyalty. In order to study the causes of e-loyalty for organization providing e-services, this research identified the factors affecting customer loyalty in e-services and with questionnaire prepared and by using fuzzy hierarchical decision-making process acquires the weight of each factor and ultimately rank them. The results show that the quality of service provided to e-services customers is the most important factor in creating e-loyalty.

  5. The Art and Skill of Delivering Culturally Responsive TF-CBT in Tanzania and Kenya

    Science.gov (United States)

    Kava, Christine M.; Akiba, Christopher F.; Lucid, Leah; Dorsey, Shannon

    2016-01-01

    Objective This study explored the facilitators, barriers, and strategies used to deliver a child mental health evidence-based treatment (EBT), trauma-focused cognitive behavioral therapy (TF-CBT), in a culturally responsive manner. In low- and middle-income countries most individuals with mental health problems do not receive treatment due to a shortage of mental health professionals. One approach to addressing this problem is task-sharing, in which lay counselors are trained to deliver mental health treatment. Combining this approach with a focus on EBT provides a strategy for bridging the mental health treatment gap. However, little is known how about western-developed EBTs are delivered in a culturally responsive manner. Method Semistructured qualitative interviews were conducted with 12 TF-CBT lay counselors involved in a large randomized controlled trial of TF-CBT in Kenya and Tanzania. An inductive approach was used to analyze the data. Results Lay counselors described the importance of being responsive to TF-CBT participants’ customs, beliefs, and socioeconomic conditions and highlighted the value of TF-CBT for their community. They also discussed the importance of partnering with other organizations to address unmet socioeconomic needs. Conclusion The findings from this study provide support for the acceptability and appropriateness of TF-CBT as a treatment approach for improving child mental health. Having a better understanding of the strategies used by lay counselors to ensure that treatment is relevant to the cultural and socioeconomic context of participants can help to inform the implementation of future EBTs. PMID:27414470

  6. Does size matter? An investigation of habitat use across a carnivore assemblage in the Serengeti, Tanzania.

    Science.gov (United States)

    Durant, Sarah M; Craft, Meggan E; Foley, Charles; Hampson, Katie; Lobora, Alex L; Msuha, Maurus; Eblate, Ernest; Bukombe, John; McHetto, John; Pettorelli, Nathalie

    2010-09-01

    1. This study utilizes a unique data set covering over 19 000 georeferenced records of species presence collected between 1993 and 2008, to explore the distribution and habitat selectivity of an assemblage of 26 carnivore species in the Serengeti-Ngorongoro landscape in northern Tanzania. 2. Two species, the large-spotted genet and the bushy-tailed mongoose, were documented for the first time within this landscape. Ecological Niche Factor Analysis (ENFA) was used to examine habitat selectivity for 18 of the 26 carnivore species for which there is sufficient data. Eleven ecogeographical variables (EGVs), such as altitude and habitat type, were used for these analyses. 3. The ENFA demonstrated that species differed in their habitat selectivity, and supported the limited ecological information already available for these species, such as the golden jackals' preference for grassland and the leopards' preference for river valleys. 4. Two aggregate scores, marginality and tolerance, are generated by the ENFA, and describe each species' habitat selectivity in relation to the suite of EGVs. These scores were used to test the hypothesis that smaller species are expected to be more selective than larger species [Science, 1989, 243, 1145]. Two predictions were tested: Marginality should decrease with body mass; and tolerance should increase with body mass. Our study provided no evidence for either prediction. 5. Our results not only support previous analyses of carnivore diet breadth, but also represent a novel approach to the investigation of habitat selection across species assemblages. Our method provides a powerful tool to explore similar questions in other systems and for other taxa.

  7. Determinants of antiretroviral therapy adherence in northern Tanzania: a comprehensive picture from the patient perspective

    Directory of Open Access Journals (Sweden)

    Lyimo Ramsey A

    2012-08-01

    Full Text Available Abstract Background To design effective, tailored interventions to support antiretroviral therapy (ART adherence, a thorough understanding of the barriers and facilitators of ART adherence is required. Factors at the individual and interpersonal level, ART treatment characteristics and health care factors have been proposed as important adherence determinants. Methods To identify the most relevant determinants of adherence in northern Tanzania, in-depth interviews were carried out with 61 treatment-experienced patients from four different clinics. The interviews were ad-verbatim transcribed and recurrent themes were coded. Results Coding results showed that the majority of patients had basic understanding of adherence, but also revealed misconceptions about taking medication after alcohol use. Adherence motivating beliefs were the perception of improved health and the desire to live like others, as well as the desire to be a good parent. A de-motivating belief was that stopping ART after being prayed for was an act of faith. Facilitators of adherence were support from friends and family, and assistance of home based care (HBC providers. Important barriers to ART adherence were the use of alcohol, unavailability of food, stigma and disclosure concerns, and the clinics dispensing too few pills. Strategies recommended by the patients to improve adherence included better Care and Treatment Centre (CTC services, recruitment of patients to become Home Based Care ( HBC providers, and addressing the problem of stigma through education. Conclusion This study underscores the importance of designing tailored, patient-centered adherence interventions to address challenges at the patient, family, community and health care level.

  8. Gender and performance of community treatment assistants in Tanzania.

    Science.gov (United States)

    Jenson, Alexander; Gracewello, Catherine; Mkocha, Harran; Roter, Debra; Munoz, Beatriz; West, Sheila

    2014-10-01

    To examine the effects of gender and demographics of community treatment assistants (CTAs) on their performance of assigned tasks and quantity of speech during mass drug administration of azithromycin for trachoma in rural Tanzania. Surveys of CTAs and audio recordings of interactions between CTAs and villagers during drug distribution. Mass drug administration program in rural Kongwa district. Fifty-seven randomly selected CTAs, and 3122 residents of villages receiving azithromycin as part of the Kongwa Trachoma Project. None. Speech quantity graded by Roter interaction analysis system, presence of culturally appropriate greeting and education on facial hygiene for trachoma prevention from coded analysis of audio-recorded interactions. At sites with all female CTAs, each CTA spent more time and spoke more in each interaction in comparison with CTAs at sites with only male CTAs and CTAs at 'mixed gender' sites (sites with both male and female CTAs). At 'mixed gender' sites, males spoke significantly more than females. Female CTAs mentioned trachoma prevention with facial cleanliness more than twice as often as male CTAs; however, both genders mentioned hygiene in genders had culturally appropriate greetings in Gender dynamics affect the amount of time that CTAs spend with villagers during drug distribution, and the relative amount of speech when both genders work together. Both genders are not meeting expectations for trachoma prevention education and greeting villagers, and novel training methods are necessary. © The Author 2014. Published by Oxford University Press in association with the International Society for Quality in Health Care; all rights reserved.

  9. Oral manifestations among people living with HIV/AIDS in Tanzania

    DEFF Research Database (Denmark)

    Fabian, F M; Kahabuka, F K; Petersen, P E

    2009-01-01

    BACKGROUND: This study aimed to determine the prevalence of various oral and peri-oral manifestations in people living with HIV/AIDS in Tanzania. METHODS: A cross sectional study. A total of 187 persons with HIV infection were recruited from non-governmental organisations serving people living...... associated with low body mass index (BMI). CONCLUSION: This community survey carried out in an African sub-Saharan country showed that oral lesions are frequent among people living with HIV/AIDS. As emphasised by the World Health Organization Global Oral Health Programme, national HIV/AIDS programmes should...

  10. Wuchereria bancrofti in Tanzania: microfilarial periodicity and effect of blood sampling time on microfilarial intensities

    DEFF Research Database (Denmark)

    Simonsen, Poul Erik; Niemann, L.; Meyrowitsch, Dan Wolf

    1997-01-01

    The circadian periodicity of Wuchereria bancrofti microfilarial (mf) intensities in peripheral blood was analysed in a group of infected individuals from an endemic community in north-eastern Tanzania. The mf density was quantified at two-hourly intervals for 24 hours. A clear nocturnal periodic...... of blood sampling before peak time is discussed, and the importance of taking sampling time into consideration when analysing data from epidemiological studies is emphasized. A simple method is devised which can be used to adjust for the influence of time on mf intensities, in studies where accurate...... information on mf intensities is necessary, and where it is impossible to obtain all samples at peak time....

  11. Health and social support services to HIV/AIDS infected individuals in Tanzania: employees and employers perceptions.

    Science.gov (United States)

    Kassile, Telemu; Anicetus, Honest; Kukula, Raphael; Mmbando, Bruno P

    2014-06-20

    HIV is a major public health problem in the world, especially in sub-Saharan Africa. It often leads to loss of productive labour and disruption of existing social support system which results in deterioration of population health. This poses a great challenge to infected people in meeting their essential goods and services. This paper examines health and social support services provided by employers to HIV/AIDS infected employees in Tanzania. This was a cross-sectional study, which employed qualitative and quantitative methods in data collection and analysis. Structured questionnaires and in-depth interviews were used to assess the health and social support services provision at employers and employees perspectives. The study participants were employees and employers from public and private organizations. A total of 181 employees and 23 employers from 23 workplaces aged between 18-68 years were involved. The results show that 23.8% (i.e., 20.4% males and 27.3% females) of the employees had at least one member of the family or close relatives living with HIV at the time of the study. Fifty six percent of the infected employees reported to have been receiving health or social support from their employers. Employees' responses were consistent with those reported by their employers. A total of 12(52.2%) and 11(47.8%) employers reported to have been providing health and social supports respectively. Female employees (58.3%) from the private sector (60.0%) were more likely to receive supports than male employees (52.6%) and than those from the public sector (46.2%). The most common health and social support received by the employees were treatment, and nutritional support and reduction of workload, respectively. HIV/AIDS infected employees named treatment and nutritional support, and soft loans and reduced workload respectively, as the most important health and social supports they needed from their employers. This study provides baseline information for further studies

  12. Acute care in Tanzania: Epidemiology of acute care in a small community medical centre

    Directory of Open Access Journals (Sweden)

    Rachel M. Little

    2013-12-01

    Discussion: Respiratory infections, malaria, and skin or soft tissue infections are leading reasons for seeking medical care at a small community medical centre in Arusha, Tanzania, highlighting the burden of infectious diseases in this type of facility. Males may be more likely to present with trauma, burns, and laceration injuries than females. Many patients required one or no procedures to determine their diagnosis, most treatments administered were inexpensive, and most patients were discharged home, suggesting that providing acute care in this setting could be accomplished with limited resources.

  13. ANALYSIS OF METHODS PROVIDING ACCURACY FOR TOOLS AND TECHNIQUES VIBRATION MEASUREMENT IN THE PROCESS OF MAINTAINING AIRWORTHINESS OF AIRCRAFT

    Directory of Open Access Journals (Sweden)

    Anatoliy Alexandrovich Bogoyavlenskiy

    2017-01-01

    Full Text Available On the basis of system approach the structure of the aviation activity areas on air transport related to monitoring and measurements of vibration parameters is presented.The technology analysis of laboratory tests of the onboard equipment control of vibration parameters is carried out. The issues related to ensuring the unity of measurements of vibration parameters are researched and summarized.While dealing with the works on metrological certification described in the article, the risks arising from aviation activity on air transport are taken into account. The certification methods of measuring channels of vibration parametersused on stands for testing GTE at the repairing of aircraft engines are developed. The methods are implemented when con- ducting initial and periodic certifications of test benches for twelve types of aircraft GTE in repair organizations. The reliability of the results of the conducted research due to the fact that they were carried out with the use of certified measure- ment equipment, included in the State register of measuring instruments. The research is conducted for a sufficiently high statistical confidence level with the boundaries 0.95. The studies have shown that running on air transport measurements of vibration parameters are metrologically se- cured, the unity of measurements and their traceability from the national primary reference to special measuring instru- ments, test equipment, and onboard controls of the aircraft is maintained.

  14. The Relative Patient Costs and Availability of Dental Services, Materials and Equipment in Public Oral Care Facilities in Tanzania.

    OpenAIRE

    Nyamuryekung'e, Kasusu K; Lahti, Satu M; Tuominen, Risto J

    2015-01-01

    Background Patient charges and availability of dental services influence utilization of dental services. There is little available information on the cost of dental services and availability of materials and equipment in public dental facilities in Africa. This study aimed to determine the relative cost and availability of dental services, materials and equipment in public oral care facilities in Tanzania. The local factors affecting availability were also studied. Methods A survey of all dis...

  15. A qualitative study of HPV vaccine acceptability among health workers, teachers, parents, female pupils, and religious leaders in northwest Tanzania

    OpenAIRE

    Remes, Pieter; Selestine, Veronica; Changalucha, John; Ross, David A.; Wight, Daniel; de Sanjosé, Silvia; Kapiga, Saidi; Hayes, Richard J.; Watson-Jones, Deborah

    2012-01-01

    Background As human papillomavirus (HPV) vaccines become available in developing countries, acceptability studies can help to better understand potential barriers and facilitators of HPV vaccination and guide immunisation programs. Methods Prior to a cluster-randomised phase IV trial of HPV vaccination delivery strategies in Mwanza Region, Tanzania, qualitative research was conducted to assess attitudes and knowledge about cervical cancer and HPV, and acceptability of and potential barriers t...

  16. Inter-epidemic abundance and distribution of potential mosquito vectors for Rift Valley fever virus in Ngorongoro district, Tanzania

    OpenAIRE

    Mweya, Clement N.; Kimera, Sharadhuli I.; Mellau, Lesakit S. B.; Mboera, Leonard E. G.

    2015-01-01

    Background: Rift Valley fever (RVF) is a mosquito-borne viral zoonosis that primarily affects ruminants but also has the capacity to infect humans. Objective: To determine the abundance and distribution of mosquito vectors in relation to their potential role in the virus transmission and maintenance in disease epidemic areas of Ngorongoro district in northern Tanzania. Methods: A cross-sectional entomological investigation was carried out before the suspected RVF outbreak in October 2012. Mos...

  17. Determinants of the probability of adopting quality protein maize (QPM) technology in Tanzania: A logistic regression analysis

    OpenAIRE

    Gregory, T.; Sewando, P.

    2013-01-01

    Adoption of technology is an important factor in economic development. The thrust of this study was to establish factors affecting adoption of QPM technology in Northern zone of Tanzania. Primary data was collected from a random sample of 120 smallholder maize farmers in four villages. Data collected were analysed using descriptive and quantitative methods. Logit model was used to determine factors that influence adoption of QPM technology. The regression results indicated that education of t...

  18. Mobility and maternal position during childbirth in Tanzania: an exploratory study at four government hospitals

    Directory of Open Access Journals (Sweden)

    Smith Helen

    2004-02-01

    Full Text Available Abstract Background Emerging research evidence suggests a potential benefit in being upright in the first stage of labour and a systematic review of trials suggests both benefits and harmful effects associated with being upright in the second stage of labour. Implementing evidence-based obstetric care in African countries with scarce resources is particularly challenging, and requires an understanding of the cumulative nature of science and commitment to applying the most up to date evidence to clinical decisions. In this study, we documented current practice rates, explored the barriers and opportunities to implementing these procedures from the provider perspective, and documented women's preferences and satisfaction with care. Methods This was an exploratory study using quantitative and qualitative methods. Practice rates were determined by exit interviews with a consecutive sample of postnatal women. Provider views were explored using semi-structured interviews (with doctors and traditional birth attendants and focus group discussions (with midwives. The study was conducted at four government hospitals, two in Dar es Salaam and two in the neighbouring Coast region, Tanzania. Main outcome measures Practice rates for mobility during labour and delivery position; women's experiences, preferences and views about the care provided; and provider views of current practice and barriers and opportunities to evidence-based obstetric practice. Results Across all study sites more women were mobile at home (15.0% than in the labour ward (2.9%, but movement was quite restricted at home before women were admitted to labour ward (51.6% chose to rest with little movement. Supine position for delivery was used routinely at all four hospitals; this was consistent with women's preferred choice of position, although very few women are aware of other positions. Qualitative findings suggest obstetricians and midwives favoured confining to bed during the first

  19. testing a consensus conference method by discussing

    African Journals Online (AJOL)

    hi-tech

    2000-10-10

    Oct 10, 2000 ... Objectives: To test the recommended consensus conference methods in Tanzania by discussing the management ... “wrong”, based on recommendations advocated in western ..... future scenarios sponsored the conference.

  20. Improving the Quality of Basic Education through the Use of Gender-Sensitive Student Councils: Experience of Six Selected Districts in Tanzania

    Science.gov (United States)

    Mnubi, Godfrey Magoti

    2017-01-01

    This paper analyses whether the gender-sensitive and democratically elected student councils helped in strengthening school leadership and providing a platform for increased awareness and advocacy for male and female students to address their needs and rights in primary and secondary schools in Tanzania. The data were collected through qualitative…

  1. Waiting for attention and care: birthing accounts of women in rural Tanzania who developed obstetric fistula as an outcome of labour.

    Science.gov (United States)

    Mselle, Lilian T; Kohi, Thecla W; Mvungi, Abu; Evjen-Olsen, Bjørg; Moland, Karen Marie

    2011-10-21

    Obstetric fistula is a physically and socially disabling obstetric complication that affects about 3,000 women in Tanzania every year. The fistula, an opening that forms between the vagina and the bladder and/or the rectum, is most frequently caused by unattended prolonged labour, often associated with delays in seeking and receiving appropriate and adequate birth care. Using the availability, accessibility, acceptability and quality of care (AAAQ) concept and the three delays model, this article provides empirical knowledge on birth care experiences of women who developed fistula after prolonged labour. We used a mixed methods approach to explore the birthing experiences of women affected by fistula and the barriers to access adequate care during labour and delivery. Sixteen women were interviewed for the qualitative study and 151 women were included in the quantitative survey. All women were interviewed at the Comprehensive Community Based Rehabilitation Tanzania in Dar es Salaam and Bugando Medical Centre in Mwanza. Women experienced delays both before and after arriving at a health facility. Decisions on where to seek care were most often taken by husbands and mothers-in-law (60%). Access to health facilities providing emergency obstetric care was inadequate and transport was a major obstacle. About 20% reported that they had walked or were carried to the health facility. More than 50% had reported to a health facility after two or more days of labour at home. After arrival at a health facility women experienced lack of supportive care, neglect, poor assessment of labour and lack of supervision. Their birth accounts suggest unskilled birth care and poor referral routines. This study reveals major gaps in access to and provision of emergency obstetric care. It illustrates how poor quality of care at health facilities contributes to delays that lead to severe birth injuries, highlighting the need to ensure women's rights to accessible, acceptable and adequate

  2. Reliability and validity of using telephone calls for post-discharge surveillance of surgical site infection following caesarean section at a tertiary hospital in Tanzania

    Directory of Open Access Journals (Sweden)

    Boniface Nguhuni

    2017-05-01

    Full Text Available Abstract Background Surgical site infection (SSI is a common post-operative complication causing significant morbidity and mortality. Many SSI occur after discharge from hospital. Post-discharge SSI surveillance in low and middle income countries needs to be improved. Methodology We conducted an observational cohort study in Dodoma, Tanzania to examine the sensitivity and specificity of telephone calls to detect SSI after discharge from hospital in comparison to a gold standard of clinician review. Women undergoing caesarean section were enrolled and followed up for 30 days. Women providing a telephone number were interviewed using a structured questionnaire at approximately days 5, 12 and 28 post-surgery. Women were then invited for out-patient review by a clinician blinded to the findings of telephone interview. Results A total of 374 women were enrolled and an overall SSI rate of 12% (n = 45 was observed. Three hundred and sixteen (84% women provided a telephone number, of which 202 had at least one telephone interview followed by a clinical review within 48 h, generating a total of 484 paired observations. From the clinical reviews, 25 SSI were diagnosed, of which telephone interview had correctly identified 18 infections; telephone calls did not incorrectly identify SSI in any patients. The overall sensitivity and specificity of telephone interviews as compared to clinician evaluation was 72 and 100%, respectively. Conclusion The use of telephone interview as a diagnostic tool for post-discharge surveillance of SSI had moderate sensitivity and high specificity in Tanzania. Telephone-based detection may be a useful method for SSI surveillance in low-income settings with high penetration of mobile telephones.

  3. Mosasauroid phylogeny under multiple phylogenetic methods provides new insights on the evolution of aquatic adaptations in the group.

    Directory of Open Access Journals (Sweden)

    Tiago R Simões

    Full Text Available Mosasauroids were a successful lineage of squamate reptiles (lizards and snakes that radiated during the Late Cretaceous (95-66 million years ago. They can be considered one of the few lineages in the evolutionary history of tetrapods to have acquired a fully aquatic lifestyle, similarly to whales, ichthyosaurs and plesiosaurs. Despite a long history of research on this group, their phylogenetic relationships have only been tested so far using traditional (unweighted maximum parsimony. However, hypotheses of mosasauroid relationships and the recently proposed multiple origins of aquatically adapted pelvic and pedal features in this group can be more thoroughly tested by methods that take into account variation in branch lengths and evolutionary rates. In this study, we present the first mosasauroid phylogenetic analysis performed under different analytical methods, including maximum likelihood, Bayesian inference, and implied weighting maximum parsimony. The results indicate a lack of congruence in the topological position of halisaurines and Dallasaurus. Additionally, the genus Prognathodon is paraphyletic under all hypotheses. Interestingly, a number of traditional mosasauroid clades become weakly supported, or unresolved, under Bayesian analyses. The reduced resolutions in some consensus trees create ambiguities concerning the evolution of fully aquatic pelvic/pedal conditions under many analyses. However, when enough resolution was obtained, reversals of the pelvic/pedal conditions were favoured by parsimony and likelihood ancestral state reconstructions instead of independent origins of aquatic features in mosasauroids. It is concluded that most of the observed discrepancies among the results can be associated with different analytical procedures, but also due to limited postcranial data on halisaurines, yaguarasaurines and Dallasaurus.

  4. Mosasauroid phylogeny under multiple phylogenetic methods provides new insights on the evolution of aquatic adaptations in the group

    Science.gov (United States)

    Vernygora, Oksana; Paparella, Ilaria; Jimenez-Huidobro, Paulina; Caldwell, Michael W.

    2017-01-01

    Mosasauroids were a successful lineage of squamate reptiles (lizards and snakes) that radiated during the Late Cretaceous (95–66 million years ago). They can be considered one of the few lineages in the evolutionary history of tetrapods to have acquired a fully aquatic lifestyle, similarly to whales, ichthyosaurs and plesiosaurs. Despite a long history of research on this group, their phylogenetic relationships have only been tested so far using traditional (unweighted) maximum parsimony. However, hypotheses of mosasauroid relationships and the recently proposed multiple origins of aquatically adapted pelvic and pedal features in this group can be more thoroughly tested by methods that take into account variation in branch lengths and evolutionary rates. In this study, we present the first mosasauroid phylogenetic analysis performed under different analytical methods, including maximum likelihood, Bayesian inference, and implied weighting maximum parsimony. The results indicate a lack of congruence in the topological position of halisaurines and Dallasaurus. Additionally, the genus Prognathodon is paraphyletic under all hypotheses. Interestingly, a number of traditional mosasauroid clades become weakly supported, or unresolved, under Bayesian analyses. The reduced resolutions in some consensus trees create ambiguities concerning the evolution of fully aquatic pelvic/pedal conditions under many analyses. However, when enough resolution was obtained, reversals of the pelvic/pedal conditions were favoured by parsimony and likelihood ancestral state reconstructions instead of independent origins of aquatic features in mosasauroids. It is concluded that most of the observed discrepancies among the results can be associated with different analytical procedures, but also due to limited postcranial data on halisaurines, yaguarasaurines and Dallasaurus. PMID:28467456

  5. Antimicrobial Resistance and Genotypic Diversity of Campylobacter Isolated from Pig, Dairy and Beef Cattle in Tanzania

    Directory of Open Access Journals (Sweden)

    Isaac eKashoma

    2015-11-01

    Full Text Available Foodborne Campylobacter infections pose a serious threat to public health worldwide. However, the occurrence and characteristics of Campylobacter in food animals and products remain largely unknown in Tanzania. The objective of this study was to determine the prevalence, antibiotic resistance, and genetic profiles (sequence types, STs of Campylobacter isolated from feces of pigs and dairy and beef cattle in Tanzania. Overall, 259 (~ 30% of 864 samples were positive for Campylobacter spp, which were detected in 32.5%, 35.4%, and 19.6% of the pig, dairy, and beef cattle samples, respectively. Multiplex PCR analysis identified 64.5% and 29.3% of the Campylobacter isolates as C. coli and C. jejuni, respectively. The majority (91.9% of the isolates from pig samples were identified as C. coli, while C. jejuni accounted for 65.5% of the isolates from cattle. Antimicrobial susceptibility testing using the disk diffusion assay and the broth microdilution method revealed resistance to: ampicillin (70% and 76%, gentamicin (1.8% and 12.6%, respectively, streptomycin (65.8% and 74.8%, erythromycin (41.4% and 48.7%, tetracycline (18.9% and 23.4%, and ciprofloxacin (14.4% and 7.2%. Resistance to nalidixic acid (39.6%, azithromycin (13.5%, and chloramphenicol (4.5% was determined using the disk diffusion assay only, while resistance to tylosin (38.7% was quantified using the broth microdilution method. Multilocus sequence typing of 111 Campylobacter isolates resulted in the identification of 48 STs (26 C. jejuni and 22 C. coli of which 7 were novel (6 C. jejuni and 1 C. coli. Taken together, this study revealed the high prevalence, genetic diversity and antimicrobial resistance of Campylobacter in important food animals in Tanzania, which highlights the urgent need for the surveillance and control of Campylobacter in this country.

  6. Tetanus in adult males, Bugando Medical Centre, United Republic of Tanzania.

    Science.gov (United States)

    Aziz, Riaz; Peck, Robert N; Kalluvya, Samuel; Kenemo, Bernard; Chandika, Alphonce; Downs, Jennifer A

    2017-11-01

    In the United Republic of Tanzania, the incidence of non-neonatal circumcision-related tetanus is probably underreported. We analysed charts and extracted information on outcome and wound location for non-neonatal cases of tetanus admitted to the intensive care unit of Bugando Medical Centre between 2001 and 2016. Bugando Medical Centre, which is one of four teaching referral hospitals in the United Republic of Tanzania, has a 13-bed intensive care unit that manages all admitted patients with tetanus. Within the United Republic of Tanzania, formal programmes of tetanus immunization are targeted at infants or women. From our inpatient logs, we identified six patients with non-neonatal tetanus among male patients with a recent history of circumcision. Only one of these patients had been circumcised within a subnational programme of voluntary medical male circumcision. The other five had been circumcised outside of the programme - e.g. at small rural dispensaries or by a traditional provider with no formal medical training. The six patients were aged 11-55 years and five (83%) of them died in hospital - all of overwhelming sepsis. Within the Tanzanian programme of voluntary medical male circumcision, education on wound hygiene probably helps to reduce the incidence of non-neonatal circumcision-related tetanus. The corresponding incidence among the boys and men who are circumcised beyond this subnational programme is probably higher. The training of all circumcision providers in wound care and a vaccination programme to ensure that male Tanzanians receive tetanus immunization post-infancy are recommended.

  7. Status of Occupational Health and Safety and Related Challenges in Expanding Economy of Tanzania.

    Science.gov (United States)

    Mrema, Ezra J; Ngowi, Aiwerasia V; Mamuya, Simon H D

    2015-01-01

    Occupational health and safety is related with economic activities undertaken in the country. As the economic activities grow and expand, occupational injuries and diseases are more likely to increase among workers in different sectors of economy such as agriculture, mining, transport, and manufacture. This may result in high occupational health and safety services demand, which might be difficult to meet by developing countries that are prioritizing economic expansion without regard to their impact on occupational health and safety. To describe the status of occupational health and safety in Tanzania and outline the challenges in provision of occupational health services under the state of an expanding economy. Tanzania's economy is growing steadily, with growth being driven by communications, transport, financial intermediation, construction, mining, agriculture, and manufacturing. Along with this growth, hazards emanating from work in all sectors of the economy have increased and varied. The workers exposed to these hazards suffer from illness and injuries and yet they are not provided with adequate occupational health services. Services are scanty and limited to a few enterprises that can afford it. Existing laws and regulations are not comprehensive enough to cover the entire population. Implementation of legislation is weak and does not protect the workers. Most Tanzanians are not covered by the occupational health and safety law and do not access occupational health services. Thus an occupational health and safety services strategy, backed by legislations and provided with the necessary resources (competent experts, financial and technological resources), is a necessity in Tanzania. The existing legal provisions require major modifications to meet international requirements and standards. OHS regulations and legislations need refocusing, revision, and strengthening to cover all working population. Capacities should be improved through training and research

  8. Evaluation of an E-Learning Course for Clubfoot Treatment in Tanzania: A Multicenter Study.

    Science.gov (United States)

    Vaca, Silvia D; Warstadt, Nicholus M; Ngayomela, Isidor H; Nungu, Rachel; Kowero, Emmanuel S; Srivastava, Sakti

    2018-01-01

    In total, 80% of clubfoot cases occur in low- and middle-income countries, where lack of clinical knowledge of the Ponseti method of treatment presents as a major barrier to treatment. This study aims to determine the effectiveness of an electronic learning course to teach clinicians in Tanzania Ponseti method theory. A total of 30 clinicians were recruited from clinics with high referral rates for clubfoot patients and invited to 1 of 3 training sites: Mbeya (n = 15), Zanzibar (n = 10), and Mwanza (n = 5). Baseline knowledge, measured through a pretest, was compared to performance on a posttest after e-learning course completion. Scores for Mbeya and Zanzibar participants improved from 44 ± 12.5 to 69.8 ± 16.5 ( P  e-learning course may be an effective method of disseminating Ponseti method theory in Tanzania. Successful implementation requires an understanding of the device availability and technology literacy of the users.

  9. Leveraging long read sequencing from a single individual to provide a comprehensive resource for benchmarking variant calling methods.

    Science.gov (United States)

    Mu, John C; Tootoonchi Afshar, Pegah; Mohiyuddin, Marghoob; Chen, Xi; Li, Jian; Bani Asadi, Narges; Gerstein, Mark B; Wong, Wing H; Lam, Hugo Y K

    2015-09-28

    A high-confidence, comprehensive human variant set is critical in assessing accuracy of sequencing algorithms, which are crucial in precision medicine based on high-throughput sequencing. Although recent works have attempted to provide such a resource, they still do not encompass all major types of variants including structural variants (SVs). Thus, we leveraged the massive high-quality Sanger sequences from the HuRef genome to construct by far the most comprehensive gold set of a single individual, which was cross validated with deep Illumina sequencing, population datasets, and well-established algorithms. It was a necessary effort to completely reanalyze the HuRef genome as its previously published variants were mostly reported five years ago, suffering from compatibility, organization, and accuracy issues that prevent their direct use in benchmarking. Our extensive analysis and validation resulted in a gold set with high specificity and sensitivity. In contrast to the current gold sets of the NA12878 or HS1011 genomes, our gold set is the first that includes small variants, deletion SVs and insertion SVs up to a hundred thousand base-pairs. We demonstrate the utility of our HuRef gold set to benchmark several published SV detection tools.

  10. The societal cost of Taenia solium cysticercosis in Tanzania

    DEFF Research Database (Denmark)

    Trevisan, Chiara; Devleesschauwer, Brecht; Schmidt, Veronika

    2017-01-01

    was to estimate the societal cost of T. solium cysticercosis in Tanzania, by assessing both the health and economic burden. The societal cost of T. solium cysticercosis was assessed in humans and pigs based on data obtained by a systematic review. Experts' opinion was sought in cases where data were...... losses due to porcine cysticercosis. Based on data retrieved from the systematic review and burden assessments, T. solium cysticercosis contributed to a significant societal cost for the population. The annual number of NCC-associated epilepsy incident cases and deaths were 17,853 (95% Uncertainty......Taenia solium is a zoonotic parasite prevalent in many low income countries throughout Latin America, Asia and sub-Saharan Africa, including Tanzania. The parasite is recognized as a public health threat; however the burden it poses on populations of Tanzania is unknown. The aim of this study...

  11. Submicroscopic Plasmodium falciparum gametocyte carriage is common in an area of low and seasonal transmission in Tanzania

    DEFF Research Database (Denmark)

    Shekalaghe, Seif A; Bousema, J Teun; Kunei, Karaine K

    2007-01-01

    . In this study, we investigated submicroscopic asexual parasitaemia and gametocytaemia in inhabitants of an area of hypoendemic and seasonal malaria in Tanzania. METHODS: Two cross-sectional malariometric surveys were conducted in the dry and wet seasons of 2005 in villages in lower Moshi, Tanzania. Finger prick...... blood samples were taken to determine the prevalence of P. falciparum parasites by microscopy, rapid diagnostic test and real-time nucleic acid sequence-based amplification (QT-NASBA). RESULTS: 2752 individuals participated in the surveys, of whom 1.9% (51/2721) had microscopically confirmed asexual...... reveal that carriage of submicroscopic asexual parasite and gametocyte densities is relatively common in this low transmission area. Submicroscopic gametocytaemia is likely to be responsible for maintaining malarial transmission in the study area....

  12. Increased level of acute phase reactants in patients infected with modern Mycobacterium tuberculosis genotypes in Mwanza, Tanzania

    DEFF Research Database (Denmark)

    Stavrum, Ruth; PrayGod, George; Range, Nyagosya

    2014-01-01

    a distinct genetic ancestry. This study describes the genetic biodiversity of M. tuberculosis genotypes in Mwanza city, Tanzania and the clinical presentation of the disease caused by isolates of different lineages. METHODS: Two-hundred-fifty-two isolates from pulmonary TB patients in Mwanza, Tanzania were......BACKGROUND: There is increasing evidence to suggest that different Mycobacterium tuberculosis lineages cause variations in the clinical presentation of tuberculosis (TB). Certain M. tuberculosis genotypes/lineages have been shown to be more likely to cause active TB in human populations from....... tuberculosis lineage of the infectious agent for each patient. RESULTS: The most frequent genotype was ST59 (48 out of 248 [19.4%]), belonging to the Euro-American lineage LAM11_ZWE, followed by ST21 (CAS_KILI lineage [44 out of 248 [17.7%]). A low degree of diversity (15.7% [39 different ST's out of 248...

  13. Health policy for sickle cell disease in Africa: experience from Tanzania on interventions to reduce under-five mortality.

    Science.gov (United States)

    Makani, Julie; Soka, Deogratias; Rwezaula, Stella; Krag, Marlene; Mghamba, Janneth; Ramaiya, Kaushik; Cox, Sharon E; Grosse, Scott D

    2015-02-01

    Tanzania has made considerable progress towards reducing childhood mortality, achieving a 57% decrease between 1980 and 2011. This epidemiological transition will cause a reduction in the contribution of infectious diseases to childhood mortality and increase in contribution from non-communicable diseases (NCDs). Haemoglobinopathies are amongst the most common childhood NCDs, with sickle cell disease (SCD) being the commonest haemoglobinopathy in Africa. In Tanzania, 10,313 children with SCD under 5 years of age (U5) are estimated to die every year, contributing an estimated 7% of overall deaths in U5 children. Key policies that governments in Africa are able to implement would reduce mortality in SCD, focusing on newborn screening and comprehensive SCD care programmes. Such programmes would ensure that interventions such as prevention of infections using penicillin plus prompt diagnosis and treatment of complications are provided to all individuals with SCD. © 2014 The Authors. Tropical Medicine & International Health Published by John Wiley & Sons Ltd.

  14. 24 CFR 1000.54 - What procedures apply to complaints arising out of any of the methods of providing for Indian...

    Science.gov (United States)

    2010-04-01

    ... 24 Housing and Urban Development 4 2010-04-01 2010-04-01 false What procedures apply to complaints arising out of any of the methods of providing for Indian preference? 1000.54 Section 1000.54 Housing and... ACTIVITIES General § 1000.54 What procedures apply to complaints arising out of any of the methods of...

  15. Some experiences from radiation protection of patients undergoing X-ray examinations in Tanzania

    International Nuclear Information System (INIS)

    Ngaile, J.E.; Muhogora, W.E.; Nyanda, A.M.

    2001-01-01

    A study of patient entrance surface dose (ESD) received by adult patients was undertaken in five major diagnostic facilities in Tanzania. Five selected X-ray projections for chest PA; abdomen AP; lumbar spine AP; lumbar spine LAT and pelvis AP were done in the study. The mean ESDs after introduction of dose reduction methods were 0.34 mGy, 5.41 mGy, 3.7 mGy, 4.8 mGy and 8.8 mGy for chest PA; abdomen AP; pelvis AP; lumbar spine AP and lumbar spine LAT, respectively. The variations of doses observed in the study were influenced by performance characteristic of X-ray equipment, patient shape and size, type of image receptor, radiographic techniques as well as skills employed. The results show that increasing the tube voltage reduced the ESD by 35.5%, while lowering of mAs reduced ESD in the range from 15% to 60%. The reduction of ESD by increasing the filtration ranged from 11% to 58% while increasing of speed class of film-screen combination reduced the ESD in the range from 33% to 57%. The corresponding results of image quality show that out of 1064 scores of image criteria 298,481 and 285 were rated for good, satisfactory and poor respectively. The results of this study provide an evidence of existing potential for dose reduction in the diagnostic radiology facilities and the most important factor for improvement is to increase awareness, both from reality of harm from unnecessary radiation exposure and with relative ease doses can be reduced. The study should therefore be implemented on the national scale as an approach to establish guidance levels of patient entrance surface dose for good medical practice and regular monitoring purposes. (author)

  16. The Origins of the Acheulean at Olduvai Gorge (Tanzania: A New Paleoanthropological Project in East Africa

    Directory of Open Access Journals (Sweden)

    Ignacio de la Torre

    2012-12-01

    Full Text Available The disappearance of the earliest human culture, the Oldowan, and its substitution by a new technology, the Acheulean, is one of the main topics in modern Paleoanthropology. Recent research has established that the Acheulean emerged originally in East Africa around 1.7–1.6 million years ago, and from that area expanded across the rest of Africa, Europe and parts of Asia. Despite the great relevance of the Oldowan-Acheulean transition, little is known about the biological and cultural evolutionary mechanisms underlying this process. Traditionally, it has been assumed that this major cultural change was ignited by the emergence of a new human species, Homo ergaster/erectus, and that there was a steady technological evolution during the Oldowan that eventually led to the emergence of the Acheulean handaxes. However, these assumptions are not grounded in the current available evidence, but rooted in cultural-history paradigms that should now be superseded. Olduvai Gorge (Tanzania is the site where the traditional view of the Oldowan-Acheulean transition was established. The aim of the recently launched Olduvai Geochronology and Archaeology Project is to tackle this question by conducting a comprehensive research program at Olduvai, based on the retrieval of fresh data derived from new laboratory and fieldwork research. The multidisciplinary character of this ongoing study is providing an integrative perspective to the analysis of the paleoecology, archaeology, geology and geochronology of the transition to the Acheulean at Olduvai. Using an innovative theoretical perspective that combines interests in cultural change, ecological adaptations, and biological evolution, and state-of-the-art methods in archaeology, geology and taphonomy, this project aims to make Olduvai one of the world’s best references for the understanding of the evolutionary processes that led to the emergence of the Acheulean, the longest lasting culture in the history of

  17. Nutritional Deficiencies and Food Insecurity Among HIV-infected Children in Tanzania

    Directory of Open Access Journals (Sweden)

    Chelsea E. Modlin, BA

    2014-09-01

    Full Text Available Background: Poor nutrition has been associated with impaired immunity and accelerated disease progression in HIV- infected children. The aim of this study was to quantify the levels of nutrient intake in HIV-infected children and compare these to standard recommendations. Methods: We surveyed HIV-infected Tanzanian children enrolled in a pediatric care program that provided routine nutritional counseling and vitamin supplementation. We obtained anthropometric measurements and determined 24-hour macronutrient and micronutrient intakes and food insecurity. Values were compared to recommended nutrient intakes based on age and gender. Results: We interviewed 48 pairs of children and their caregiver(s. The age of the child ranged from 2-14 years; median age 6 and 60% female. The median weight-for-height z-score for children ≤ 5 years was 0.69 and BMI-for-age z-scores for children >5 was -0.84. Macronutrient evaluation showed that 29 (60% children were deficient in dietary intake of energy; deficiency was more common in older children (p=0.004. Micronutrient evaluation shows that over half of study subjects were deficient in dietary intake of vitamin A, vitamin D, vitamin E, thiamine, riboflavin, niacin, folate, vitamin B12, and calcium. Food insecurity was reported by 20 (58% caregivers. Conclusions and Public Health Implications: The diets of many HIV-infected children at a specialized treatment center in Tanzania do not meet recommended levels of macro- and micro-nutrients. Food insecurity was a contributory factor. Enhanced dietary counseling and provision of macro- and micro-nutrient supplements will be necessary to achieve optimal nutrition for most HIV-infected children in resource-poor regions.

  18. Microbial Efficacy of Waterless Hand Hygiene in Dar es Salaam, Tanzania

    Science.gov (United States)

    Pickering, A.; Boehm, A.; Davis, J.

    2008-12-01

    Millions of people die from diarrheal and respiratory diseases every year due to lack of proper sanitation, hygiene, and access to clean water. The act of handwashing with soap has been found to effectively reduce both diarrheal and respiratory illness, however, handwashing at critical times (i.e. after using the toilet, before preparing food) remains infrequent around the world. This research investigates the potential for alcohol- based hand sanitizer (ABHS) to be an effective and appropriate hand hygiene option in developing countries. A study was conducted to assess the microbiological effectiveness of ABHS, as compared to handwashing with soap and water, in field conditions in Dar es Salaam, Tanzania. A total of 205 participants, including mothers, nurses, students, and teachers, were introduced to ABHS, given a standardized amount (2ml) of product, and instructed on how to use the product correctly. Hand samples were obtained using the hand rinse method before and after the use of ABHS from 152 participants. The other 53 participants were hand sampled before and after handwashing with a non-antimicrobial liquid soap and clean water (prior to using ABHS). Visual inspections of the hands were performed before hand sampling to record the level of dirt on the hands. All hand samples were processed and analyzed by membrane filtration for concentrations of two microbial indicators, enterococci and E. coli. User perceptions of the product and willingness to pay are also documented. The results of this study provide valuable insight on the prospective of promoting ABHS in developing countries and water scarce areas.

  19. Understanding informal payments in health care: motivation of health workers in Tanzania

    Directory of Open Access Journals (Sweden)

    Bidwell Posy

    2009-06-01

    Full Text Available Abstract Background There is growing evidence that informal payments for health care are fairly common in many low- and middle-income countries. Informal payments are reported to have a negative consequence on equity and quality of care; it has been suggested, however, that they may contribute to health worker motivation and retention. Given the significance of motivation and retention issues in human resources for health, a better understanding of the relationships between the two phenomena is needed. This study attempts to assess whether and in what ways informal payments occur in Kibaha, Tanzania. Moreover, it aims to assess how informal earnings might help boost health worker motivation and retention. Methods Nine focus groups were conducted in three health facilities of different levels in the health system. In total, 64 health workers participated in the focus group discussions (81% female, 19% male and where possible, focus groups were divided by cadre. All data were processed and analysed by means of the NVivo software package. Results The use of informal payments in the study area was confirmed by this study. Furthermore, a negative relationship between informal payments and job satisfaction and better motivation is suggested. Participants mentioned that they felt enslaved by patients as a result of being bribed and this resulted in loss of self-esteem. Furthermore, fear of detection was a main demotivating factor. These factors seem to counterbalance the positive effect of financial incentives. Moreover, informal payments were not found to be related to retention of health workers in the public health system. Other factors such as job security seemed to be more relevant for retention. Conclusion This study suggests that the practice of informal payments contributes to the general demotivation of health workers and negatively affects access to health care services and quality of the health system. Policy action is needed that not only

  20. Tanzania national survey on iodine deficiency: impact after twelve years of salt iodation

    Directory of Open Access Journals (Sweden)

    Kimboka Sabas

    2009-09-01

    Full Text Available Abstract Background In many low-income countries, children are at high risk of iodine deficiency disorders, including brain damage. In the early 1990s, Tanzania, a country that previously suffered from moderate to severe iodine deficiency, adopted universal salt iodation (USI as an intervention strategy, but its impact remained unknown. Methods We report on the first national survey in mainland Tanzania, conducted in 2004 to assess the extent to which iodated salt was used and its apparent impact on the total goitre prevalence (TGP and urinary iodine concentrations (UIC among the schoolchildren after USI was initiated. In 2004, a cross-sectional goitre survey was conducted; covering 140,758 schoolchildren aged 6 - 18 years were graded for goitre according to new WHO goitre classification system. Comparisons were made with district surveys conducted throughout most of the country during the 1980s and 90s. 131,941 salt samples from households were tested for iodine using rapid field test kits. UIC was determined spectrophotometrically using the ammonium persulfate digestion method in 4523 sub-sampled children. Results 83.6% (95% CI: 83.4 - 83.8 of salt samples tested positive for iodine. Whereas the TGP was about 25% on average in the earlier surveys, it was 6.9% (95%CI: 6.8-7.0 in 2004. The TGP for the younger children, 6-9 years old, was 4.2% (95%CI: 4.0-4.4, n = 41,965. In the 27 goitre-endemic districts, TGP decreased from 61% (1980s to 12.3% (2004. The median UIC was 204 (95% CF: 192-215 μg/L. Only 25% of children had UIC Conclusion Our study demonstrates a marked improvement in iodine nutrition in Tanzania, twelve years after the initiation of salt iodation programme. The challenge in sustaining IDD elimination in Tanzania is now two-fold: to better reach the areas with low coverage of iodated salt, and to reduce iodine intake in areas where it is excessive. Particular attention is needed in improving quality control at production level and

  1. Why do health workers in rural Tanzania prefer public sector employment?

    Science.gov (United States)

    Songstad, Nils Gunnar; Moland, Karen Marie; Massay, Deodatus Amadeus; Blystad, Astrid

    2012-04-05

    Severe shortages of qualified health workers and geographical imbalances in the workforce in many low-income countries require the national health sector management to closely monitor and address issues related to the distribution of health workers across various types of health facilities. This article discusses health workers' preferences for workplace and their perceptions and experiences of the differences in working conditions in the public health sector versus the church-run health facilities in Tanzania. The broader aim is to generate knowledge that can add to debates on health sector management in low-income contexts. The study has a qualitative study design to elicit in-depth information on health workers' preferences for workplace. The data comprise ten focus group discussions (FGDs) and 29 in-depth interviews (IDIs) with auxiliary staff, nursing staff, clinicians and administrators in the public health sector and in a large church-run hospital in a rural district in Tanzania. The study has an ethnographic backdrop based on earlier long-term fieldwork in Tanzania. The study found a clear preference for public sector employment. This was associated with health worker rights and access to various benefits offered to health workers in government service, particularly the favourable pension schemes providing economic security in old age. Health workers acknowledged that church-run hospitals generally were better equipped and provided better quality patient care, but these concerns tended to be outweighed by the financial assets of public sector employment. In addition to the sector specific differences, family concerns emerged as important in decisions on workplace. The preference for public sector employment among health workers shown in this study seems to be associated primarily with the favourable pension scheme. The overall shortage of health workers and the distribution between health facilities is a challenge in a resource constrained health system

  2. Winners and losers of IWRM in Tanzania

    Directory of Open Access Journals (Sweden)

    Barbara van Koppen,

    2016-10-01

    Full Text Available This paper focuses on the application of the concept of Integrated Water Resources Management (IWRM in Tanzania. It asks: how did IWRM affect the rural and fast-growing majority of smallholder farmersʼ access to water which contributes directly to poverty alleviation and employment creation in a country where poverty and joblessness are high? Around 1990, there were both a strong government-led infrastructure development agenda and IWRM ingredients in place, including cost-recovery of state services aligning with the Structural Adjustment Programmes, water management according to basin boundaries and the dormant colonial water rights (permits system. After the 1990s, the World Bank and other donors promoted IWRM with a strong focus on hydroelectric power development, River Basin Water Boards, transformation of the water right system into a taxation tool, and assessment of environmental flows. These practices became formalised in the National Water Policy (2002 and in the Water Resources Management Act (2009. Activities in the name of IWRM came to be closely associated with the post-2008 surge in large-scale land and water deals. Analysing 25 years of IWRM, the paper identifies the processes and identities of the losers (smallholders and – at least partially – the government and the winners (large-scale water users, including recent investors. We conclude that, overall, IWRM harmed smallholdersʼ access to water and rendered them more vulnerable to poverty and unemployment.

  3. Climate Change, Agriculture and Food Security in Tanzania

    DEFF Research Database (Denmark)

    Arndt, Channing; Farmer, William; Strzepek, Kenneth

    2012-01-01

    Due to their reliance on rain-fed agriculture, both as a source of income and consumption, many low-income countries are considered to be the most vulnerable to climate change. Here, we estimate the impact of climate change on food security in Tanzania. Representative climate projections are used...... as the channel of impact, food security in Tanzania appears likely to deteriorate as a consequence of climate change. The analysis points to a high degree of diversity of outcomes (including some favorable outcomes) across climate scenarios, sectors, and regions. Noteworthy differences in impacts across...

  4. Implementing farm-to-fork traceability in Tanzania

    CSIR Research Space (South Africa)

    Van Dyk, FE

    2005-08-01

    Full Text Available stream_source_info Van Dyk2_2005.pdf.txt stream_content_type text/plain stream_size 10949 Content-Encoding UTF-8 stream_name Van Dyk2_2005.pdf.txt Content-Type text/plain; charset=UTF-8 Copyright @ CSIR 2005 www....csir.co.za Implementing farm-to-fork traceability in Tanzania Esbeth van Dyk CSIR Centre for Logistics ORSSA/SAIIE August 2005 Copyright @ CSIR 2005 www.csir.co.za Structure • Why traceability? • Legislation • Tanzania project • Recordkeeping in coffee...

  5. Biomass Energy Systems and Resources in Tropical Tanzania

    Energy Technology Data Exchange (ETDEWEB)

    Wilson, Lugano (KTH, School of Industrial Engineering and Management (ITM), Materials Science and Engineering, Energy and Furnace Technology (Sweden))

    2010-07-01

    establishing characteristic properties of selected biomass feedstock from Tanzania. The characteristic properties are necessary input to thermochemical process designers and researchers. Furthermore, since the properties are origin-specific, this will provide baseline data for technology transfer from north to south. The characteristic properties that were established were chemical composition, and thermal degradation behaviour. Furthermore, laboratory scale high temperature gasification of the biomasses was undertaken. Chemical composition characteristics was established to palm waste, coffee husks, cashew nut shells (CNS), rice husks and bran, bagasse, sisal waste, jatropha seeds, and mango stem. Results showed that the oxygen content ranged from 27.40 to 42.70% where as that of carbon and hydrogen ranged from 35.60 to 56.90% and 4.50 to 7.50% respectively. On the other hand, the elemental composition of nitrogen, sulphur and chlorine was marginal. These properties are comparable to findings from other researchers. Based on the results of thermal degradation characteristics, it was evident that the cashew nut shells (CNS) was the most reactive amongst the analyzed materials since during the devolatilization stage the first derivative TG (DTG) peak due to hemicellulose degradation reached (-5.52%/minute) compared palm stem whose first peak was -4.81%/minute. DTG first peak for the remaining materials was indistinct. Results from the laboratory gasification experiments that were done to the coffee husks showed that gasification at higher temperature (900 deg C) had an overall higher gasification rate. For instance, during the inert nitrogen condition, 7% of coffee husk remained for the case of 900 deg C whereas the residue mass for the gasification at 800 and 700 deg C was 10 and 17% respectively. Steam injection to the biomass under high temperature gasification evolved the highest volumetric concentration of carbon monoxide. The CO peak evolution at 900 deg C steam only was

  6. Modelling the implications of moving towards universal coverage in Tanzania.

    Science.gov (United States)

    Borghi, Josephine; Mtei, Gemini; Ally, Mariam

    2012-03-01

    A model was developed to assess the impact of possible moves towards universal coverage in Tanzania over a 15-year time frame. Three scenarios were considered: maintaining the current situation ('the status quo'); expanded health insurance coverage (the estimated maximum achievable coverage in the absence of premium subsidies, coverage restricted to those who can pay); universal coverage to all (government revenues used to pay the premiums for the poor). The model estimated the costs of delivering public health services and all health services to the population as a proportion of Gross Domestic Product (GDP), and forecast revenue from user fees and insurance premiums. Under the status quo, financial protection is provided to 10% of the population through health insurance schemes, with the remaining population benefiting from subsidized user charges in public facilities. Seventy-six per cent of the population would benefit from financial protection through health insurance under the expanded coverage scenario, and 100% of the population would receive such protection through a mix of insurance cover and government funding under the universal coverage scenario. The expanded and universal coverage scenarios have a significant effect on utilization levels, especially for public outpatient care. Universal coverage would require an initial doubling in the proportion of GDP going to the public health system. Government health expenditure would increase to 18% of total government expenditure. The results are sensitive to the cost of health system strengthening, the level of real GDP growth, provider reimbursement rates and administrative costs. Promoting greater cross-subsidization between insurance schemes would provide sufficient resources to finance universal coverage. Alternately, greater tax funding for health could be generated through an increase in the rate of Value-Added Tax (VAT) or expanding the income tax base. The feasibility and sustainability of efforts to

  7. Pattern and Distribution of Colorectal Cancer in Tanzania: A Retrospective Chart Audit at Two National Hospitals

    Directory of Open Access Journals (Sweden)

    Leonard K. Katalambula

    2016-01-01

    Full Text Available Background. Colorectal cancer (CRC is a growing public health concern with increasing rates in countries with previously known low incidence. This study determined pattern and distribution of CRC in Tanzania and identified hot spots in case distribution. Methods. A retrospective chart audit reviewed hospital registers and patient files from two national institutions. Descriptive statistics, Chi square (χ2 tests, and regression analyses were employed and augmented by data visualization to display risk variable differences. Results. CRC cases increased sixfold in the last decade in Tanzania. There was a 1.5% decrease in incidences levels of rectal cancer and 2% increase for colon cancer every year from 2005 to 2015. Nearly half of patients listed Dar es Salaam as their primary residence. CRC was equally distributed between males (50.06% and females (49.94%, although gender likelihood of diagnosis type (i.e., rectal or colon was significantly different (P=0.027. More than 60% of patients were between 40 and 69 years. Conclusions. Age (P=0.0183 and time (P=0.004 but not gender (P=0.0864 were significantly associated with rectal cancer in a retrospective study in Tanzania. Gender (P=0.0405, age (P=0.0015, and time (P=0.0075 were all significantly associated with colon cancer in this study. This retrospective study found that colon cancer is more prevalent among males at a relatively younger age than rectal cancer. Further, our study showed that although more patients were diagnosed with rectal cancer, the trend has shown that colon cancer is increasing at a faster rate.

  8. Ending Open Defecation in Rural Tanzania: Which Factors Facilitate Latrine Adoption?

    Directory of Open Access Journals (Sweden)

    Stephen Sara

    2014-09-01

    Full Text Available Diarrheal diseases account for 7% of deaths in children under five years of age in Tanzania. Improving sanitation is an essential step towards reducing these deaths. This secondary analysis examined rural Tanzanian households’ sanitation behaviors and attitudes in order to identify barriers and drivers to latrine adoption. The analysis was conducted using results from a cross-sectional study of 1000 households in five rural districts of Tanzania. Motivating factors, perceptions, and constraints surrounding open defecation and latrine adoption were assessed using behavioral change theory. Results showed a significant association between use of improved sanitation and satisfaction with current sanitation facility (OR: 5.91; CI: 2.95–11.85; p = 0.008. Livestock-keeping was strongly associated with practicing open defecation (OR: 0.22; CI 0.063–0.75; p < 0.001. Of the 93 total households that practiced open defecation, 79 (85% were dissatisfied with the practice, 62 (67% had plans to build a latrine and 17 (18% had started saving for a latrine. Among households that planned to build a latrine, health was the primary reason stated (60%. The inability to pay for upgrading sanitation infrastructure was commonly reported among the households. Future efforts should consider methods to reduce costs and ease payments for households to upgrade sanitation infrastructure. Messages to increase demand for latrine adoption in rural Tanzania should integrate themes of privacy, safety, prestige and health. Findings indicate a need for lower cost sanitation options and financing strategies to increase household ability to adopt sanitation facilities.

  9. Induced abortion, pregnancy loss and intimate partner violence in Tanzania: a population based study

    Directory of Open Access Journals (Sweden)

    Stöckl Heidi

    2012-03-01

    Full Text Available Abstract Background Violence by an intimate partner is increasingly recognized as an important public and reproductive health issue. The aim of this study is to investigate the extent to which physical and/or sexual intimate partner violence is associated with induced abortion and pregnancy loss from other causes and to compare this with other, more commonly recognized explanatory factors. Methods This study analyzes the data of the Tanzania section of the WHO Multi-Country Study on Women's Health and Domestic Violence, a large population-based cross-sectional survey of women of reproductive age in Dar es Salaam and Mbeya, Tanzania, conducted from 2001 to 2002. All women who answered positively to at least one of the questions about specific acts of physical or sexual violence committed by a partner towards her at any point in her life were considered to have experienced intimate partner violence. Associations between self reported induced abortion and pregnancy loss with intimate partner violence were analysed using multiple regression models. Results Lifetime physical and/or sexual intimate partner violence was reported by 41% and 56% of ever partnered, ever pregnant women in Dar es Salaam and Mbeya respectively. Among the ever pregnant, ever partnered women, 23% experienced involuntary pregnancy loss, while 7% reported induced abortion. Even after adjusting for other explanatory factors, women who experienced intimate partner violence were 1.6 (95%CI: 1.06,1.60 times more likely to report an pregnancy loss and 1.9 (95%CI: 1.30,2.89 times more likely to report an induced abortion. Intimate partner violence had a stronger influence on induced abortion and pregnancy loss than women's age, socio-economic status, and number of live born children. Conclusions Intimate partner violence is likely to be an important influence on levels of induced abortion and pregnancy loss in Tanzania. Preventing intimate partner violence may therefore be beneficial

  10. Where There Is No Toilet: Water and Sanitation Environments of Domestic and Facility Births in Tanzania

    Science.gov (United States)

    Benova, Lenka; Cumming, Oliver; Gordon, Bruce A.; Magoma, Moke; Campbell, Oona M. R.

    2014-01-01

    Background Inadequate water and sanitation during childbirth are likely to lead to poor maternal and newborn outcomes. This paper uses existing data sources to assess the water and sanitation (WATSAN) environment surrounding births in Tanzania in order to interrogate whether such estimates could be useful for guiding research, policy and monitoring initiatives. Methods We used the most recent Tanzania Demographic and Health Survey (DHS) to characterise the delivery location of births occurring between 2005 and 2010. Births occurring in domestic environments were characterised as WATSAN-safe if the home fulfilled international definitions of improved water and improved sanitation access. We used the 2006 Service Provision Assessment survey to characterise the WATSAN environment of facilities that conduct deliveries. We combined estimates from both surveys to describe the proportion of all births occurring in WATSAN-safe environments and conducted an equity analysis based on DHS wealth quintiles and eight geographic zones. Results 42.9% (95% confidence interval: 41.6%–44.2%) of all births occurred in the woman's home. Among these, only 1.5% (95% confidence interval: 1.2%–2.0%) were estimated to have taken place in WATSAN-safe conditions. 74% of all health facilities conducted deliveries. Among these, only 44% of facilities overall and 24% of facility delivery rooms were WATSAN-safe. Combining the estimates, we showed that 30.5% of all births in Tanzania took place in a WATSAN-safe environment (range of uncertainty 25%–42%). Large wealth-based inequalities existed in the proportion of births occurring in domestic environments based on wealth quintile and geographical zone. Conclusion Existing data sources can be useful in national monitoring and prioritisation of interventions to improve poor WATSAN environments during childbirth. However, a better conceptual understanding of potentially harmful exposures and better data are needed in order to devise and apply

  11. Pattern and Distribution of Colorectal Cancer in Tanzania: A Retrospective Chart Audit at Two National Hospitals

    International Nuclear Information System (INIS)

    Katalambula, L. K.; Buza, J.; Mpolya, E.

    2016-01-01

    Colorectal cancer (CRC) is a growing public health concern with increasing rates in countries with previously known low incidence. This study determined pattern and distribution of CRC in Tanzania and identified hot spots in case distribution. Methods. A retrospective chart audit reviewed hospital registers and patient files from two national institutions. Descriptive statistics, Chi square (x 2 ) tests, and regression analyses were employed and augmented by data visualization to display risk variable differences. Results. CRC cases increased sixfold in the last decade in Tanzania. There was a 1.5% decrease in incidences levels of rectal cancer and 2% increase for colon cancer every year from 2005 to 2015. Nearly half of patients listed Dar es Salaam as their primary residence. CRC was equally distributed between males (50.06%) and females (49.94%), although gender likelihood of diagnosis type (i.e., rectal or colon) was significantly different ( P= 0.027). More than 60% of patients were between 40 and 69 years. Conclusions. Age ( P= 0.0183) and time () but not gender ( P = 0.0864) were significantly associated with rectal cancer in a retrospective study in Tanzania. Gender ( P = 0.0405), age ( P = 0.0015), and time ( P = 0.0075) were all significantly associated with colon cancer in this study. This retrospective study found that colon cancer is more prevalent among males at a relatively younger age than rectal cancer. Further, our study showed that although more patients were diagnosed with rectal cancer, the trend has shown that colon cancer is increasing at a faster rate.

  12. Decentralisation and health services delivery in Tanzania: Analysis of decision space in planning, allocation, and use of financial resources.

    Science.gov (United States)

    Kigume, Ramadhani; Maluka, Stephen; Kamuzora, Peter

    2018-04-01

    While decentralisation of health systems has been on the policy agenda in low-income and middle-income countries since the 1970s, many studies have focused on understanding who has more decision-making powers but less attention is paid to understand what those powers encompass. Using the decision space approach, this study aimed to understand the amount of decision-making space transferred from the central government to institutions at the periphery in the decentralised health system in Tanzania. The findings of this study indicated that the decentralisation process in Tanzania has provided authorities with a range of decision-making space. In the areas of priority setting and planning, district health authorities had moderate decision space. However, in the financial resource allocation and expenditure of funds from the central government, the districts had narrow decision-making space. The districts, nevertheless, had wider decision-making space in mobilising and using locally generated financial resources. However, the ability of the districts to allocate and use locally generated resources was constrained by bureaucratic procedures of the central government. The study concludes that decentralisation by devolution which is being promoted in the policy documents in Tanzania is yet to be realised at the district and local levels. The study recommends that the central government should provide more space to the decentralised district health systems to incorporate locally defined priorities in the district health plans. Copyright © 2018 John Wiley & Sons, Ltd.

  13. The make or buy debate: considering the limitations of domestic production in Tanzania.

    Science.gov (United States)

    Wilson, Kinsley Rose; Kohler, Jillian Clare; Ovtcharenko, Natalia

    2012-06-29

    In order to ensure their population's regular access to essential medicines, many least developed countries and developing countries are faced with the policy question of whether to import or manufacture drugs locally, in particular for life-saving antiretroviral medicines for HIV/AIDS patients. In order for domestic manufacturing to be viable and cost-effective, the local industry must be able to compete with international suppliers of medicines by producing sufficiently low cost ARVs. This paper considers the 'make-or-buy' dilemma by using Tanzania as a case study. Key informant interviews, event-driven observation, and purposive sampling of documents were used to evaluate the case study. The case study focused on Tanzania's imitation technology transfer agreement to locally manufacture a first-line ARV (3TC + d4T + NVP), reverse engineering the ARV. Tanzania is limited by weak political support for the use of TRIPS flexibilities, limited production capacity for ARVs and limited competitiveness in both domestic and regional markets. The Ministry of Health and Social Welfare encourages the use of flexibilities while others push for increased IP protection. Insufficient production capacity and lack of access to donor-financed tenders make it difficult to obtain economies of scale and provide competitive prices. Within the "make-or-buy" context, it was determined that there are significant limitations in domestic manufacturing for developing countries. The case study highlights the difficulty of governments to make use of economies of scale and produce low-cost medicines, attract technology transfer, and utilize the flexibilities of the WTO Agreement on Trade-Related Aspects of Intellectual Property Rights (TRIPS). The results demonstrate the importance of evaluating barriers to the use of TRIPS flexibilities and long-term planning across sectors in future technology transfer and manufacturing initiatives.

  14. Estimating leptospirosis incidence using hospital-based surveillance and a population-based health care utilization survey in Tanzania.

    Directory of Open Access Journals (Sweden)

    Holly M Biggs

    Full Text Available The incidence of leptospirosis, a neglected zoonotic disease, is uncertain in Tanzania and much of sub-Saharan Africa, resulting in scarce data on which to prioritize resources for public health interventions and disease control. In this study, we estimate the incidence of leptospirosis in two districts in the Kilimanjaro Region of Tanzania.We conducted a population-based household health care utilization survey in two districts in the Kilimanjaro Region of Tanzania and identified leptospirosis cases at two hospital-based fever sentinel surveillance sites in the Kilimanjaro Region. We used multipliers derived from the health care utilization survey and case numbers from hospital-based surveillance to calculate the incidence of leptospirosis. A total of 810 households were enrolled in the health care utilization survey and multipliers were derived based on responses to questions about health care seeking in the event of febrile illness. Of patients enrolled in fever surveillance over a 1 year period and residing in the 2 districts, 42 (7.14% of 588 met the case definition for confirmed or probable leptospirosis. After applying multipliers to account for hospital selection, test sensitivity, and study enrollment, we estimated the overall incidence of leptospirosis ranges from 75-102 cases per 100,000 persons annually.We calculated a high incidence of leptospirosis in two districts in the Kilimanjaro Region of Tanzania, where leptospirosis incidence was previously unknown. Multiplier methods, such as used in this study, may be a feasible method of improving availability of incidence estimates for neglected diseases, such as leptospirosis, in resource constrained settings.

  15. Estimating Leptospirosis Incidence Using Hospital-Based Surveillance and a Population-Based Health Care Utilization Survey in Tanzania

    Science.gov (United States)

    Biggs, Holly M.; Hertz, Julian T.; Munishi, O. Michael; Galloway, Renee L.; Marks, Florian; Saganda, Wilbrod; Maro, Venance P.; Crump, John A.

    2013-01-01

    Background The incidence of leptospirosis, a neglected zoonotic disease, is uncertain in Tanzania and much of sub-Saharan Africa, resulting in scarce data on which to prioritize resources for public health interventions and disease control. In this study, we estimate the incidence of leptospirosis in two districts in the Kilimanjaro Region of Tanzania. Methodology/Principal Findings We conducted a population-based household health care utilization survey in two districts in the Kilimanjaro Region of Tanzania and identified leptospirosis cases at two hospital-based fever sentinel surveillance sites in the Kilimanjaro Region. We used multipliers derived from the health care utilization survey and case numbers from hospital-based surveillance to calculate the incidence of leptospirosis. A total of 810 households were enrolled in the health care utilization survey and multipliers were derived based on responses to questions about health care seeking in the event of febrile illness. Of patients enrolled in fever surveillance over a 1 year period and residing in the 2 districts, 42 (7.14%) of 588 met the case definition for confirmed or probable leptospirosis. After applying multipliers to account for hospital selection, test sensitivity, and study enrollment, we estimated the overall incidence of leptospirosis ranges from 75–102 cases per 100,000 persons annually. Conclusions/Significance We calculated a high incidence of leptospirosis in two districts in the Kilimanjaro Region of Tanzania, where leptospirosis incidence was previously unknown. Multiplier methods, such as used in this study, may be a feasible method of improving availability of incidence estimates for neglected diseases, such as leptospirosis, in resource constrained settings. PMID:24340122

  16. Climate change induced risk analysis of Dar es Salaam city (Tanzania)

    Science.gov (United States)

    Topa, Maria Elena; Herslund, Lise; Cavan, Gina; Printz, Andreas; Simonis, Ingo; Bucchignani, Edoardo; Jean-Baptiste, Nathalie; Hellevik, Siri; Johns, Regina; Kibassa, Deusdedit; Kweka, Clara; Magina, Fredrick; Mangula, Alpha; Mbuya, Elinorata; Uhinga, Guido; Kassenga, Gabriel; Kyessi, Alphonce; Shemdoe, Riziki; Kombe, Wilbard

    2013-04-01

    CLUVA (CLimate change and Urban Vulnerability in Africa; http://www.cluva.eu/) is a 3 years project, funded by the European Commission in 2010. The main objective of CLUVA is to develop context-centered methods and knowledge to be applied to African cities to assess vulnerabilities and increase knowledge on managing climate related risks. The project estimates the impacts of climate changes in the next 40 years at urban scale and downscales IPCC climate projections to evaluate specific threats to selected African test cities. These are mainly from floods, sea-level rise, droughts, heat waves, and desertification. The project evaluates and links: social vulnerability; urban green structures and ecosystem services; urban-rural interfaces; vulnerability of urban built environment and lifelines; and related institutional and governance dimensions of adaptation. The multi-scale and multi-disciplinary qualitative, quantitative and probabilistic approach of CLUVA is currently being applied to selected African test cities (Addis Ababa - Ethiopia; Dar es Salaam - Tanzania; Douala - Cameroun; Ouagadougou - Burkina Faso; St. Louis - Senegal). In particular, the poster will present preliminary findings for the Dar es Salaam case study. Dar es Salaam, which is Tanzania's largest coastal city, is exposed to floods, coastal erosion, droughts and heat waves, and highly vulnerable to impacts as a result of ineffective urban planning (about 70% unplanned settlements), poverty and lack of basic infrastructure (e.g. lack of or poor quality storm water drainage systems). Climate change could exacerbate the current situation increasing hazard-exposure alongside the impacts of development pressures which act to increase urban vulnerability for example because of informal (unregulated) urbanization. The CLUVA research team - composed of climate and environmental scientists, risk management experts, urban planners and social scientists from both European and African institutions - has

  17. Health-seeking behaviour of human brucellosis cases in rural Tanzania

    Directory of Open Access Journals (Sweden)

    MacMillan Alastair

    2007-11-01

    Full Text Available Abstract Background Brucellosis is known to cause debilitating conditions if not promptly treated. In some rural areas of Tanzania however, practitioners give evidence of seeing brucellosis cases with symptoms of long duration. The purpose of this study was to establish health-seeking behaviour of human brucellosis cases in rural Tanzania and explore the most feasible ways to improve it. Methods This was designed as a longitudinal study. Socio-demographic, clinical and laboratory data were collected from patients who reported to selected hospitals in rural northern Tanzania between June 2002 and April 2003. All patients with conditions suspicious of brucellosis on the basis of preliminary clinical examination and history were enrolled into the study as brucellosis suspects. Blood samples were taken and tested for brucellosis using the Rose-Bengal Plate Test (RBPT and other agglutination tests available at the health facilities and the competitive ELISA (c-ELISA test at the Veterinary Laboratory Agencies (VLA in the UK. All suspects who tested positive with the c-ELISA test were regarded as brucellosis cases. A follow-up of 49 cases was made to collect data on health-seeking behaviour of human brucellosis cases. Results The majority of cases 87.7% gave a history of going to hospital as the first point of care, 10.2% purchased drugs from a nearby drug shop before going to hospital and 2% went to a local traditional healer first. Brucellosis cases delayed going to hospital with a median delay time of 90 days, and with 20% of the cases presenting to hospitals more than a year after the onset of symptoms. Distance to the hospital, keeping animals and knowledge of brucellosis were significantly associated with patient delay to present to hospital. Conclusion More efforts need to be put on improving the accessibility of health facilities to the rural poor people who succumb to most of the diseases including zoonoses. Health education on brucellosis in

  18. Sociodemographic drivers of multiple sexual partnerships among women in three rural districts of Tanzania

    Directory of Open Access Journals (Sweden)

    Exavery A

    2015-04-01

    Full Text Available Amon Exavery,1 Almamy Malick Kanté,1–3 Kassimu Tani,1 Ahmed Hingora,1 James F Phillips2 1Ifakara Health Institute, Dar es Salaam, Tanzania; 2Heilbrunn Department of Population and Family Health, Mailman School of Public Health, Columbia University, New York, NY, USA; 3Swiss Tropical and Public Health Institute, University of Basel, Basel, Switzerland Background: This study examines prevalence and correlates of multiple sexual partnerships (MSP among women aged 15+ years in Rufiji, Kilombero, and Ulanga districts of Tanzania. Materials and methods: Data were collected in a cross-sectional household survey in Rufiji, Kilombero, and Ulanga districts in Tanzania in 2011. From the survey, a total of 2,643 sexually active women ages 15+ years were selected for this analysis. While the chi-square test was used for testing association between MSP and each of the independent variables, logistic regression was used for multivariate analysis. Results: Number of sexual partners reported ranged from 1 to 7, with 7.8% of the women reporting multiple sexual partners (2+ in the past year. MSP was more likely among both ever married women (adjusted odds ratio [AOR] =3.83, 95% confidence interval [CI] 1.40–10.49 and single women (AOR =6.13, 95% CI 2.45–15.34 than currently married women. There was an interaction between marital status and education, whereby MSP was 85% less likely among single women with secondary or higher education compared to married women with no education (AOR =0.15, 95% CI 0.03–0.61. Furthermore, women aged 40+ years were 56% less likely compared to the youngest women (<20 years to report MSP (AOR =0.44, 95% CI 0.24–0.80. The odds of MSP among Muslim women was 1.56 times as high as that for Christians women (AOR =1.56, 95% CI 1.11–2.21. Ndengereko women were 67% less likely to report MSP compared to Pogoro women (AOR =0.33, 95% CI 0.18–0.59. Conclusion: Eight percent of the women aged 15+ in Rufiji, Kilombero, and Ulanga

  19. Medicare Provider Data - Hospice Providers

    Data.gov (United States)

    U.S. Department of Health & Human Services — The Hospice Utilization and Payment Public Use File provides information on services provided to Medicare beneficiaries by hospice providers. The Hospice PUF...

  20. Perceptions of methicillin-resistant Staphylococcus aureus and hand hygiene provider training and patient education: results of a mixed method study of health care providers in Department of Veterans Affairs spinal cord injury and disorder units.

    Science.gov (United States)

    Hill, Jennifer N; Hogan, Timothy P; Cameron, Kenzie A; Guihan, Marylou; Goldstein, Barry; Evans, Martin E; Evans, Charlesnika T

    2014-08-01

    The goal of this study was to assess current practices for training of spinal cord injury and disorder (SCI/D) health care workers and education of veterans with SCI/D in Department of Veterans Affairs (VA) spinal cord injury (SCI) centers on methicillin-resistant Staphylococcus aureus (MRSA) prevention. Mixed methods. A Web-based survey was distributed to 673 VA SCI/D providers across 24 SCI centers; 21 acute care and 1 long-term care facility participated. There were 295 that responded, 228 had complete data and were included in this analysis. Semistructured interviews were conducted with 30 SCI/D providers across 9 SCI centers. Nurses, physicians, and therapists represent most respondents (92.1%, n = 210); over half (56.6%, n = 129) were nurses. Of providers, 75.9% (n = 173) reported receiving excellent or good training on how to educate patients about MRSA. However, nurses were more likely to report having excellent or good training for how to educate patients about MRSA (P = .005). Despite this, only 63.6% (n = 82) of nurses perceived the education they provide patients on how MRSA is transmitted as excellent or good. Despite health care workers reporting receiving excellent or good training on MRSA-related topics, this did not translate to excellent or good education for patients, suggesting that health care workers need additional training for educating patients. Population-specific MRSA prevention educational materials may also assist providers in educating patients about MRSA prevention for individuals with SCI/D. Published by Mosby, Inc.

  1. The Fire is Coming: An HIV Prevention Intervention Contextualized to the Maasai People of Tanzania

    Directory of Open Access Journals (Sweden)

    Holly Freitas

    2014-01-01

    Full Text Available “The Fire is Coming” film is an innovative HIV-prevention intervention contextualized to the Maasai people of Tanzania through use of a traditional Maasai story. The intervention was developed and implemented in partnership with Maasai Pastoralists for Education and Development (MAPED. Although there have been numerous Knowledge-Attitude-Practice (KAP surveys conducted among the Maasai, this is the first control-group comparison study designed to measure the effectiveness of an HIV-prevention intervention contextualized specifically to the Maasai people of Tanzania. We will first discuss the background and context in which the intervention was developed and methods used to develop the intervention. We will then discuss the evaluation methods, results, and implications of a retrospective Knowledge, Attitudes, Practices (KAP two-village comparison survey (n=200 for “The Fire is Coming” HIV-prevention intervention among Maasai people. There was a significant effect for HIV-related attitudes, t(16 = 2.77, p 0.05. Implications: Belief in one’s ability to do something is often the pivotal point for behavior change. The results of the survey denote a highly effective intervention in changing HIV-related attitudes and behaviors. It is promising for replication among other Maasai communities and for adaptation with indigenous people groups in other regions.

  2. Quantifying behavioural interactions between humans and mosquitoes: Evaluating the protective efficacy of insecticidal nets against malaria transmission in rural Tanzania

    Directory of Open Access Journals (Sweden)

    Mathenge Evan

    2006-11-01

    Full Text Available Abstract Background African malaria vectors bite predominantly indoors at night so sleeping under an Insecticide-Treated Net (ITN can greatly reduce malaria risk. Behavioural adaptation by mosquitoes to increasing ITN coverage could allow vector mosquitoes to bite outside of peak sleeping hours and undermine efficacy of this key malaria prevention measure. Methods High coverage with largely untreated nets has been achieved in the Kilombero Valley, southern Tanzania through social marketing programmes. Direct surveys of nightly biting activity by An. gambiae Giles were conducted in the area before (1997 and after (2004 implementation of ITN promotion. A novel analytical model was applied to estimate the effective protection provided by an ITN, based on published experimental hut trials combined with questionnaire surveys of human sleeping behaviour and recorded mosquito biting patterns. Results An. gambiae was predominantly endophagic and nocturnal in both surveys: Approximately 90% and 80% of exposure occurred indoors and during peak sleeping hours, respectively. ITNs consistently conferred >70% protection against exposure to malaria transmission for users relative to non-users. Conclusion As ITN coverage increases, behavioural adaptation by mosquitoes remains a future possibility. The approach described allows comparison of mosquito biting patterns and ITN efficacy at multiple study sites and times. Initial results indicate ITNs remain highly effective and should remain a top-priority intervention. Combined with recently developed transmission models, this approach allows rapid, informative and cost-effective preliminary comparison of diverse control strategies in terms of protection against exposure before more costly and intensive clinical trials.

  3. Knowledge of malaria influences the use of insecticide treated nets but not intermittent presumptive treatment by pregnant women in Tanzania

    Directory of Open Access Journals (Sweden)

    Nganda Rhoida Y

    2004-11-01

    Full Text Available Abstract Background To reduce the intolerable burden of malaria in pregnancy, the Ministry of Health in Tanzania has recently adopted a policy of intermittent presumptive treatment for pregnant women using sulphadoxine-pyrimethamine (IPTp-SP. In addition, there is strong national commitment to increase distribution of insecticide treated nets (ITNs among pregnant women. This study explores the determinants of uptake for both ITNs and IPTp-SP by pregnant women and the role that individual knowledge and socio-economic status has to play for each. Methods 293 women were recruited post-partum at Kibaha District Hospital on the East African coast. The haemoglobin level of each woman was measured and a questionnaire administered. Results Use of both interventions was associated with a reduced risk of severe anaemia (Hb Conclusion Individual knowledge of malaria was an important factor for ITN uptake, but not for IPTp-SP use, which was reliant on delivery of information by MCH systems. When both these interventions were used, severe anaemia postpartum was reduced by 69% compared to use of neither, thus providing evidence of effectiveness of these interventions when used in combination.

  4. Subnational variation for care at birth in Tanzania: is this explained by place, people, money or drugs?

    Directory of Open Access Journals (Sweden)

    Corinne E. Armstrong

    2016-09-01

    Full Text Available Abstract Background Tanzania achieved the Millennium Development Goal for child survival, yet made insufficient progress for maternal and neonatal survival and stillbirths, due to low coverage and quality of services for care at birth, with rural women left behind. Our study aimed to evaluate Tanzania’s subnational (regional-level variations for rural care at birth outcomes, i.e., rural women giving birth in a facility and by Caesarean section (C-section, and associations with health systems inputs (financing, health workforce, facilities, and commodities, outputs (readiness and quality of care and context (education and GDP. Methods We undertook correlation analyses of subnational-level associations between health system inputs, outputs, context, and rural care at birth outcomes; and constructed implementation readiness barometers using benchmarks for each health system input indicator. We used geographical information system (GIS mapping to visualise subnational variations in care at birth for rural women, with a focus on service availability and readiness, and collected qualitative data to investigate financial flows from national to council level to understand variation in financing inputs. Results We found wide subnational variation for rural care at birth outcomes, health systems inputs, and contextual indicators. There was a positive association between rural women giving birth in a facility and by C-section; maternal education; workforce and facility density; and quality of care. There was a negative association between these outcomes and proportion of all births to rural women, total fertility rate, and availability of essential commodities at facilities. Per capita recurrent expenditure was positively associated with facility births (correlation coefficient = 0.43; p = 0.05 but not with C-section. Qualitative results showed that the health financing system is complex and insufficient for providing care at birth services

  5. Challenges to fair decision-making processes in the context of health care services: a qualitative assessment from Tanzania

    Directory of Open Access Journals (Sweden)

    Shayo Elizabeth H

    2012-06-01

    Full Text Available Abstract Background Fair processes in decision making need the involvement of stakeholders who can discuss issues and reach an agreement based on reasons that are justifiable and appropriate in meeting people’s needs. In Tanzania, the policy of decentralization and the health sector reform place an emphasis on community participation in making decisions in health care. However, aspects that can influence an individual’s opportunity to be listened to and to contribute to discussion have been researched to a very limited extent in low-income settings. The objective of this study was to explore challenges to fair decision-making processes in health care services with a special focus on the potential influence of gender, wealth, ethnicity and education. We draw on the principle of fairness as outlined in the deliberative democratic theory. Methods The study was carried out in the Mbarali District of Tanzania. A qualitative study design was used. In-depth interviews and focus group discussion were conducted among members of the district health team, local government officials, health care providers and community members. Informal discussion on the topics was also of substantial value. Results The study findings indicate a substantial influence of gender, wealth, ethnicity and education on health care decision-making processes. Men, wealthy individuals, members of strong ethnic groups and highly educated individuals had greater influence. Opinions varied among the study informants as to whether such differences should be considered fair. The differences in levels of influence emerged most clearly at the community level, and were largely perceived as legitimate. Conclusions Existing challenges related to individuals’ influence of decision making processes in health care need to be addressed if greater participation is desired. There is a need for increased advocacy and a strengthening of responsive practices with an emphasis on the right of all

  6. Role of condom negotiation on condom use among women of reproductive age in three districts in Tanzania

    Directory of Open Access Journals (Sweden)

    Exavery Amon

    2012-12-01

    Full Text Available Abstract Background HIV/AIDS remains being a disease of great public health concern worldwide. In regions such as sub-Saharan Africa (SSA where women are disproportionately infected with HIV, women are reportedly less likely capable of negotiating condom use. However, while knowledge of condom use for HIV prevention is extensive among men and women in many countries including Tanzania, evidence is limited about the role of condom negotiation on condom use among women in rural Tanzania. Methods Data originate from a cross-sectional survey of random households conducted in 2011 in Rufiji, Kilombero and Ulanga districts in Tanzania. The survey assessed health-seeking behaviour among women and children using a structured interviewer-administered questionnaire. A total of 2,614 women who were sexually experienced and aged 15-49 years were extracted from the main database for the current analysis. Linkage between condom negotiation and condom use at the last sexual intercourse was assessed using multivariate logistic regression. Results Prevalence of condom use at the last sexual intercourse was 22.2% overall, ranging from12.2% among married women to 54.9% among unmarried (single women. Majority of the women (73.4% reported being confident to negotiate condom use, and these women were significantly more likely than those who were not confident to have used a condom at the last sexual intercourse (OR = 3.13, 95% CI 2.22-4.41. This effect was controlled for marital status, age, education, religion, number of sexual partners, household wealth and knowledge of HIV prevention by condom use. Conclusion Confidence to negotiate condom use is a significant predictor of actual condom use among women in rural Tanzania. Women, especially unmarried ones, those in multiple partnerships or anyone needing protection should be empowered with condom negotiation skills for increased use of condoms in order to enhance their sexual and reproductive health outcomes.

  7. Comparing the job satisfaction and intention to leave of different categories of health workers in Tanzania, Malawi, and South Africa

    Science.gov (United States)

    Blaauw, Duane; Ditlopo, Prudence; Maseko, Fresier; Chirwa, Maureen; Mwisongo, Aziza; Bidwell, Posy; Thomas, Steve; Normand, Charles

    2013-01-01

    Background Job satisfaction is an important determinant of health worker motivation, retention, and performance, all of which are critical to improving the functioning of health systems in low- and middle-income countries. A number of small-scale surveys have measured the job satisfaction and intention to leave of individual health worker cadres in different settings, but there are few multi-country and multi-cadre comparative studies. Objective The objective of this study was to compare the job satisfaction and intention to leave of different categories of health workers in Tanzania, Malawi, and South Africa. Methods We undertook a cross-sectional survey of a stratified cluster sample of 2,220 health workers, 564 from Tanzania, 939 from Malawi, and 717 from South Africa. Participants completed a self-administered questionnaire, which included demographic information, a 10-item job satisfaction scale, and one question on intention to leave. Multiple regression was used to identify significant predictors of job satisfaction and intention to leave. Results There were statistically significant differences in job satisfaction and intention to leave between the three countries. Approximately 52.1% of health workers in South Africa were satisfied with their jobs compared to 71% from Malawi and 82.6% from Tanzania (χ2=140.3, pjob satisfaction is statistically related to intention to leave. Conclusions We have shown differences in the levels of job satisfaction and intention to leave between different groups of health workers from Tanzania, Malawi, and South Africa. Our results caution against generalising about the effectiveness of interventions in different contexts and highlight the need for less standardised and more targeted HRH strategies than has been practised to date. PMID:23364090

  8. Delineation of the corporate use of Environmental Information Systems (EIS: Selected cases of the Corporate Organizations in Tanzania

    Directory of Open Access Journals (Sweden)

    Felichesmi Selestine Lyakurwa

    2013-11-01

    Full Text Available Environmental information systems are essential platforms for the provision of adequate and relevant information necessary for the planning and decision making for greener production. Corporate use of Environmental Information Systems gained several benefits in the global and local markets. Nevertheless, there was no documentation to explain the extent to which corporate organizations utilize available Environmental Information Systems in Tanzania. This study used purposive sampling with informants being workers from the strategic, tactical and control functions of the corporate organization. Moreover, data collection involved survey of 50 corporate organizations in Dar es Salaam, Arusha, Moshi and Morogoro councils, with 71 respondents. The collected data includes exploration of the extent to which corporate management functions utilize available Environmental Information Systems in Tanzania. The study identified various corporate environmental management functions performed at all levels of the corporate organization, in which workers spends less than one hour on the environmental information systems available. The results also revealed that, there is adequate utilization of available Environmental Information Systems for environmental management. Therefore, the research outcomes provides inputs to corporate organization unit managers, corporate owners and other environmental stakeholders on the extent of the systems’ use as well as sharing experience on different environmental management systems used worldwide. Keywords: Environmental information system, corporate organization, Tanzania, management

  9. The impact of mobile phones on knowledge access and transfer of small-scale horticultural farmers in Tanzania

    Directory of Open Access Journals (Sweden)

    Krone, Madlen

    2014-09-01

    Full Text Available Agriculture is the main economic activity in Tanzania and the country´s largest employer, providing livelihood for at least 80 % of the economically active population. Many studies have identified key challenges facing the sector for Africa in general – among these lack of access to knowledge. For agricultural producers, access to knowledge is important for an improved productivity and competitiveness. The fast diffusion of information and communication technologies (ICT such as mobile phones across Africa in the last years has resulted in an improved access and transfer of agricultural knowledge. Studies have shown that rural actors like farmers in remote areas even use mobile phones for their farming business. Based on qualitative interviews in the Mwanza Region in northwestern Tanzania, this study aims to identify and categorise the different types of knowledge which are transferred via mobile phones. Our results show that mobile phones enlarge the ability of farmers to access business-relevant knowledge at an increasing spatial scale. However, the effects of the use depend on the type of knowledge and other factors. The results add to existing studies by deepening the understanding of the benefits of ICT on knowledge access and transfer for the context of rural small-scale framers in Tanzania.

  10. Mixed Methods for Implementation Research: Application to Evidence-Based Practice Implementation and Staff Turnover in Community Based Organizations Providing Child Welfare Services

    Science.gov (United States)

    Aarons, Gregory A.; Fettes, Danielle L.; Sommerfeld, David H.; Palinkas, Lawrence

    2013-01-01

    Many public sector services systems and provider organizations are in some phase of learning about or implementing evidence-based interventions. Child welfare service systems represent a context where implementation spans system, management, and organizational concerns. Research utilizing mixed methods that combine qualitative and quantitative design, data collection, and analytic approaches are particularly well-suited to understanding both the process and outcomes of dissemination and implementation efforts in child welfare systems. This paper describes the process of using mixed methods in implementation research and provides an applied example of an examination of factors impacting staff retention during an evidence-based intervention implementation in a statewide child welfare system. We integrate qualitative data with previously published quantitative analyses of job autonomy and staff turnover during this statewide implementation project in order to illustrate the utility of mixed method approaches in providing a more comprehensive understanding of opportunities and challenges in implementation research. PMID:22146861

  11. Mixed methods for implementation research: application to evidence-based practice implementation and staff turnover in community-based organizations providing child welfare services.

    Science.gov (United States)

    Aarons, Gregory A; Fettes, Danielle L; Sommerfeld, David H; Palinkas, Lawrence A

    2012-02-01

    Many public sector service systems and provider organizations are in some phase of learning about or implementing evidence-based interventions. Child welfare service systems represent a context where implementation spans system, management, and organizational concerns. Research utilizing mixed methods that combine qualitative and quantitative design, data collection, and analytic approaches are particularly well suited to understanding both the process and outcomes of dissemination and implementation efforts in child welfare systems. This article describes the process of using mixed methods in implementation research and provides an applied example of an examination of factors impacting staff retention during an evidence-based intervention implementation in a statewide child welfare system. The authors integrate qualitative data with previously published quantitative analyses of job autonomy and staff turnover during this statewide implementation project in order to illustrate the utility of mixed method approaches in providing a more comprehensive understanding of opportunities and challenges in implementation research.

  12. Accuracy of the visual estimation method as a predictor of food intake in Alzheimer's patients provided with different types of food.

    Science.gov (United States)

    Amano, Nobuko; Nakamura, Tomiyo

    2018-02-01

    The visual estimation method is commonly used in hospitals and other care facilities to evaluate food intake through estimation of plate waste. In Japan, no previous studies have investigated the validity and reliability of this method under the routine conditions of a hospital setting. The present study aimed to evaluate the validity and reliability of the visual estimation method, in long-term inpatients with different levels of eating disability caused by Alzheimer's disease. The patients were provided different therapeutic diets presented in various food types. This study was performed between February and April 2013, and 82 patients with Alzheimer's disease were included. Plate waste was evaluated for the 3 main daily meals, for a total of 21 days, 7 consecutive days during each of the 3 months, originating a total of 4851 meals, from which 3984 were included. Plate waste was measured by the nurses through the visual estimation method, and by the hospital's registered dietitians through the actual measurement method. The actual measurement method was first validated to serve as a reference, and the level of agreement between both methods was then determined. The month, time of day, type of food provided, and patients' physical characteristics were considered for analysis. For the 3984 meals included in the analysis, the level of agreement between the measurement methods was 78.4%. Disagreement of measurements consisted of 3.8% of underestimation and 17.8% of overestimation. Cronbach's α (0.60, P visual estimation method was within the acceptable range. The visual estimation method was found to be a valid and reliable method for estimating food intake in patients with different levels of eating impairment. The successful implementation and use of the method depends upon adequate training and motivation of the nurses and care staff involved. Copyright © 2017 European Society for Clinical Nutrition and Metabolism. Published by Elsevier Ltd. All rights reserved.

  13. Dragonflies (odonata) of Rufiji district, Tanzania with new records for ...

    African Journals Online (AJOL)

    The habitat specialists found in Ngumburuni forest and in the forests of the Kichi and Kiwengoma Hills are globally endangered species and require special attention with regard to conservation. Keywords: dragonflies; coastal forest; Tanzania; conservationJournal of East African Natural History Vol. 95 (2) 2006: pp. 139-162 ...

  14. Tanzania Journal of Science - Vol 42, No 1 (2016)

    African Journals Online (AJOL)

    Assessment of concentrations of trace and toxic heavy metals in soil and vegetables grown in the vicinity of Manyoni uranium deposit in Tanzania · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. FA Kapile, IN Makundi, 94-108 ...

  15. Are sustainable tourism policies and strategies working in Tanzania ...

    African Journals Online (AJOL)

    This article briefly explores the development of tourism in Tanzania and then focuses primarily on relevant tourism policies adopted by the Tanzanian Government in order to grow the industry in a sustainable manner. Although these policies have been effective for a decade since their introduction, indications are that they ...

  16. Tanzania Journal of Health Research - Vol 10, No 3 (2008)

    African Journals Online (AJOL)

    ... of oral amodiaquine and chloroquine in healthy volunteers with or without Plasmodium falciparum infection in northeast Tanzania · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. JJ Massaga, JP Lusingu, R Makunde, HM Malebo, MM Chile, JA Akida, MM Lemnge, ...

  17. Climate change and food security in Tanzania: analysis of current ...

    African Journals Online (AJOL)

    A review of literature was conducted in order to identify knowledge gaps in climate change and food security research in Tanzania. The review focused on published literature covering the past 20 years addressing climate change effects on various components of the food security. The review of literature reveals, among ...

  18. Genetic structure among the local chicken ecotypes of Tanzania ...

    African Journals Online (AJOL)

    A study was conducted to evaluate the genetic structure of local chicken ecotypes of Tanzania using 20 polymorphic microsatellite DNA markers. A standard PCR was followed by manual genotyping (6% native polyacrylamide gel visualized by silver staining). Phylogenetic analysis of 13 individuals from each of the nine ...

  19. Tanzania Journal of Health Research - Vol 12, No 4 (2010)

    African Journals Online (AJOL)

    Motorcycle injuries as an emerging public health problem in Mwanza city, Tanzania: A call for urgent intervention · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Phillipo L. Chalya, Joseph B. Mabula, Isidor H. Ngayomela, Emmanuel S. Kanumba, Alphonce B.

  20. Determinants of public health expenditure growth in Tanzania: an ...

    African Journals Online (AJOL)

    This paper identifies some major drivers of per capita public health expenditure growth in Tanzania using nationally representative annual data between 1995 and 2014. It used Bayesian model based on Markov Chain Monte Carlo (MCMC) simulation. The empirical result shows that both the real GDP per capita and ...

  1. Leptospira infections in freshwater fish in Morogoro Tanzania: a ...

    African Journals Online (AJOL)

    The objectives of this study were to determine presence of Leptospira in fish; the prevalent Leptospira serovars and whether are related to serovars reported in animals; and to ascertain potential public health risk. Live tilapia, catfish and eel fish (n=48) were caught in Mindu Dam in Morogoro Municipality in eastern Tanzania ...

  2. Tanzania Journal of Health Research - Vol 20, No 2 (2018)

    African Journals Online (AJOL)

    Socio-demographic determinants of dengue infection during an outbreak in Dar es Salaam City, Tanzania · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Neema Camara, Billy Ngasala, Germana Leyna, Ahmed Abade, Susan F. Rumisha, Ndekya M. Oriyo, Leonard ...

  3. Status, Impact and Management of Invasive Alien Species in Tanzania

    African Journals Online (AJOL)

    The study used three methodological approaches including documentary search, interviews with relevant stakeholders and limited field visits. Findings from the study have indicated that the awareness, trends, distribution and impacts of the invasive alien species in Tanzania are variable, and similarly are the management ...

  4. All projects related to Tanzania | Page 5 | IDRC - International ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    2009-07-02

    Project. The Economic and Social Research Foundation (ESRF) is an independent research organization that was registered in Tanzania in October 1992. Start Date: July 2, 2009 ... Five-City Network to Pioneer Climate Change Adaptation in sub-Saharan Africa. Project ... Program: Governance and Justice. Total Funding: ...

  5. Tanzania Journal of Health Research - Vol 13, No 1 (2011)

    African Journals Online (AJOL)

    Reaching the poor through community-based distributors of contraceptives: experiences from Muheza district, Tanzania · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Daudi Simba, Cordula Schuemer, Forester Kate, Merriment Hiza, 1-7.

  6. The Rock Pratincole Glareola nuchalis in Tanzania: the first ...

    African Journals Online (AJOL)

    population (Delany et al. 2009). Britton (1980) mentions only Siguri Falls in the. Selous Game Reserve for Tanzania and while suggesting that it breeds there, no breeding records were admitted in Brown & Britton (1980). Over the last three decades, a number of new observations―including the first breeding record―of this ...

  7. GROWTH-RATES OF SHRUBS ON DIFFERENT SOILS IN TANZANIA

    NARCIS (Netherlands)

    PRINS, HHT; VANDERJEUGD, HP

    1992-01-01

    Because little is known of growth rates of shrubs in East Africa, the growth rates of Acalypha fructicosa, Gardenia jovis-tonantis, Justicia cordata, Maerua triphylla, and Ocimum suave were measured in Lake Manyara National Park, northern Tanzania. Branch diameter increments and branch length

  8. Growth rates of shrubs on different soils in Tanzania.

    NARCIS (Netherlands)

    Prins, H.H.T.; Jeugd, van der H.P.

    1992-01-01

    Because little is known of growth rates of shrubs in East Africa, the growth rates of Acalypha fructicosa, Gardenia jovis-tonantis, Justicia cordata, Maerua triphylla, and Ocimum suave were measured in Lake Manyara National Park, northern Tanzania. Branch diameter increments and branch length

  9. Modes of delivery assistance in Bangladesh | Rahman | Tanzania ...

    African Journals Online (AJOL)

    Tanzania Journal of Health Research. Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue · Archives · Journal Home > Vol 10, No 4 (2008) >. Log in or Register to get access to full text downloads. Username, Password, Remember me, or Register · Download this PDF file. The PDF file you selected ...

  10. Modes of delivery assistance in Bangladesh | Rahman | Tanzania ...

    African Journals Online (AJOL)

    Tanzania Journal of Health Research. Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue · Archives · Journal Home > Vol 10, No 4 (2008) >. Log in or Register to get access to full text downloads. Username, Password, Remember me, or Register. Modes of delivery assistance in Bangladesh.

  11. Engaged Learning and Peace Corps Service in Tanzania: An Autoethnography

    Science.gov (United States)

    Darling, Brianna; Thorp, Laurie; Chung, Kimberly

    2014-01-01

    The Peace Corps Masters International program offers students the opportunity to combine their Peace Corps service with their master's education. This article demonstrates how classroom learning strengthened the author's Peace Corps service in Tanzania, which in turn strengthened her master's thesis. Peace Corps supports an approach to community…

  12. Protected area gap analysis of important bird areas in Tanzania

    DEFF Research Database (Denmark)

    Sritharan, Shakthi; Burgess, Neil David

    2012-01-01

    Analyses of gaps in protected area (PA) coverage of species distributions have been carried out extensively for the past two decades, aiming to better locate new PAs and conserve species. In this study, progress to close gaps in the protection of the Important Bird Areas (IBAs) of Tanzania...

  13. Corruption, Politics and Societal values in Tanzania: An evaluation ...

    African Journals Online (AJOL)

    Corruption, Politics and Societal values in Tanzania: An evaluation of the Mkapa administration's anti corruption efforts. Bruce Heilman, Lawrean Ndumbaro. Abstract. (Af. J. Political Science: 2001 7(1): 1-20). Full Text: EMAIL FULL TEXT EMAIL FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT.

  14. The Role of Pharmacist in Dental Care Services | Kalala | Tanzania ...

    African Journals Online (AJOL)

    Tanzania Dental Journal. Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue · Archives · Journal Home > Vol 9, No 2 (2002) >. Log in or Register to get access to full text downloads. Username, Password, Remember me, or Register · Download this PDF file. The PDF file you selected should load ...

  15. Consequences of Female Migration for Families in Tanzania

    African Journals Online (AJOL)

    associated with economic and political change in Africa, Asia and Latin America .... notes that in developing countries, internal and international migration is a result of ... 'hut tax' in Tanzania was one of the important factors behind sex differentials in migration. ... The country is located in East Africa, covering 940,000 km2.

  16. Two 'extinct' trees rediscovered near Kilwa, Tanzania | Clarke ...

    African Journals Online (AJOL)

    Preliminary botanical explorations in the little-known Namatimbili–Ngarama forest block located some 35 km inland of Kilwa in south-east Tanzania have rediscovered and further confirmed the presence of two tree species, Erythrina schliebenii Harms and Karomia gigas (Faden) Verdc., that were previously thought to have ...

  17. Tanzania Journal of Health Research - Vol 16, No 3 (2014)

    African Journals Online (AJOL)

    Human activity spaces and plague risks in three contrasting landscapes in Lushoto District, Tanzania · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Proches Hieronimo, Hubert Gulinck, Didas N. Kimaro, Loth S. Mulungu, Nganga I. Kihupi, Balthazar M. Msanya, ...

  18. Tanzania Journal of Health Research - Vol 9, No 1 (2007)

    African Journals Online (AJOL)

    Pattern and spatial distribution of plague in Lushoto, north-eastern Tanzania · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. M L Kamugisha, S Gesase, D Minja, S Mgema, T D Mlwilo, B K Mayala, 12-18. http://dx.doi.org/10.4314/thrb.v9i1.14286 ...

  19. Gestational diabetes mellitus in Tanzania : public health perspectives

    NARCIS (Netherlands)

    Mwanri, A.W.

    2015-01-01

    Gestational diabetes mellitus in Tanzania – public health perspectives

    Abstract

    Background: Gestational diabetes mellitus (GDM) is defined as carbohydrate intolerance resulting in hyperglycaemia of variable severity with onset or

  20. Field vegetable production in the Lake Zone of Tanzania

    NARCIS (Netherlands)

    Everaarts, A.P.; Putter, de H.; Maerere, A.P.; Amon, W.

    2014-01-01

    In November 2012 and in August 2014 surveys were carried out in field vegetable producing areas in the Lake Zone of Tanzania. The aim of the surveys was to learn the conditions for field vegetable production and marketing in these areas. Recommendations for the development of vegetable production

  1. Tanzania Dental Journal - Vol 17, No 2 (2012)

    African Journals Online (AJOL)

    Patient satisfaction with dental services rendered at School of Dentistry, Muhimbili University of Health and Allied Sciences, Tanzania · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. B Mwela, EN Kikwilu, 38-44 ...

  2. Tanzania Journal of Health Research - Vol 16, No 1 (2014)

    African Journals Online (AJOL)

    Seroprevalence of Leptospira infection in bats roosting in human settlements in Morogoro municipality in Tanzania · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Georgies F. Mgode, Huruma A. Mbugi, Ginethon G. Mhamphi, Dickson Ndanga, Evance L. Nkwama.

  3. Paleoseismic Investigations along the Bubu Fault, Dodoma-Tanzania

    African Journals Online (AJOL)

    2002-11-04

    The central part of Tanzania, Dodoma, was hit by an Mw= 5.5 earthquake in November 4, 2002. It was part of a swarm of moderate earthquakes that affected the area. This paper, reports the first attempt to investigate significant past earthquakes along one of the known seismically active rift faults (Bubu fault, Gonga ...

  4. The Southern Black Tit Melaniparus niger in Tanzania with ...

    African Journals Online (AJOL)

    by Friedrich Fülleborn at Undis south of Tunduru near the Tanzania – Mozambique border (11°17'S ... and was not included in any reference books or field guides. None of these ... was clearly a dark-eyed leucomelas rather than a pale-eyed.

  5. Growth and Structure of Tanzania's Industrial Sector Investment and ...

    African Journals Online (AJOL)

    ... agro-based industrial activities. Tanzania being basically an agricultural country such investment will have a multiplier effect in terms of employment generation partly due to the linkages effects which such industries might have to the rest of the economy. African Journal of Finance and Management Vol.8(2) 2000: 46-54 ...

  6. Liberalisation of the Banking Industry in Tanzania: Issues and ...

    African Journals Online (AJOL)

    In Tanzania, as in many other developing countries, banks play a predominant role in the financial sector of the country as far as mobilisation and allocation of financial resources is concerned. The question that deserves attention however, is whether and to what extent foreign banks have been playing a positive role in the ...

  7. Community-Based Wildlife Management In Tanzania: The Policy ...

    African Journals Online (AJOL)

    Community-based wildlife management (CWM) approach – known to others as community-based conservation – was first introduced in Tanzania in 1987/88. The approach intends to reconcile wildlife conservation and rural economic development. In the 1990s Tanzanians witnessed a rush by government Ministries and ...

  8. Concrete block production from construction and demolition waste in Tanzania

    NARCIS (Netherlands)

    Sabai, M.M.; Cox, M.G.D.M.; Mato, R.R.A.M.; Egmond - de Wilde De Ligny, van E.L.C.; Lichtenberg, J.J.N.

    2013-01-01

    In Tanzania, construction and demolition (C&D) waste is not recycled and knowledge on how it can be recycled especially into valuable products like building materials are still limited. This study aimed at investigating the possibility of recycling the C&D waste (mainly cementitious rubble) into

  9. Disclosure of HIV Status in Rural Tanzania: Practices, Facilitators ...

    African Journals Online (AJOL)

    In Tanzania, HIV counselling and testing practices are now widely accepted as the cornerstone of HIV prevention programmes. Within HIV testing and counselling, emphasis is placed on the importance of individuals to disclose their HIV status. Despite increasing focus on disclosure of HIV status, relatively little is known ...

  10. Integrating reproductive and child health and HIV services in Tanzania

    African Journals Online (AJOL)

    Integrating reproductive and child health and HIV services in Tanzania: Implication to policy, systems and services. ... Experts around the world recognize the central role of Sexual and Reproductive Health (SRH) services in preventing HIV infection. Evidence suggests that improving access to contraception for women to ...

  11. Schooling, Child Labor, and the Returns to Healthcare in Tanzania

    Science.gov (United States)

    Adhvaryu, Achyuta R.; Nyshadham, Anant

    2012-01-01

    We study the effects of accessing better healthcare on the schooling and labor supply decisions of sick children in Tanzania. Using variation in the cost of formal-sector healthcare to predict treatment choice, we show that accessing better healthcare decreases length of illness and changes children's allocation of time to school and work.…

  12. School Proximity and Child Labor: Evidence from Rural Tanzania

    Science.gov (United States)

    Kondylis, Florence; Manacorda, Marco

    2012-01-01

    Is improved school accessibility an effective policy tool for reducing child labor in developing countries? We address this question using microdata from rural Tanzania and a regression strategy that attempts to control for nonrandom location of households around schools as well as classical and nonclassical measurement error in self-reported…

  13. Maternal health in fifty years of Tanzania independence: Challenges ...

    African Journals Online (AJOL)

    High rate of maternal death is one of the major public health concerns in Tanzania. ... had been on a downward trend from 453 to 200 per 100,000 live births. ... Current statistics indicate that maternal mortality ratio has dropped slightly in 2010 ...

  14. Bureaucratic Blockages : Water, Civil Servants, and Community in Tanzania

    OpenAIRE

    Bailey, Juli

    2017-01-01

    How do civil servants in district water and sanitation departments address problems of water access in rural communities in Tanzania? What are the bureaucratic procedures they follow? How do the bureaucratic procedures around formulating budgets, managing money, and interacting with communities impede or enhance their ability to manage water projects? This report addresses these and related ...

  15. Tanzania Journal of Science - Vol 41, No 1 (2015)

    African Journals Online (AJOL)

    Assessment of heavy metal concentration in water around the proposed Mkuju River Uranium Project in Tanzania · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Firmi P. Banzi, Peter K. Msaki, Najat K. Mohammed, 8-18 ...

  16. Country's image as judged by international indices: Case of Tanzania

    African Journals Online (AJOL)

    This paper presented various international indices and how Tanzania is judged by them. The purpose was to reveal to different stakeholders and policy makers how this country is perceived by outsiders such as foreign donor countries, investors, tourist or international bodies. The methodology involved empirical review of ...

  17. Tanzania Journal of Health Research - Vol 15, No 3 (2013)

    African Journals Online (AJOL)

    Comparison of sampling techniques for Rift Valley Fever virus potential vectors, Aedes aegypti and Culex pipiens complex, in Ngorongoro District in northern Tanzania · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Clement N. Mweya, Sharadhuli I. Kimera, Esron D.

  18. tanzania danida dental health programme progress in prevention

    African Journals Online (AJOL)

    gramme have been reactivated. Three of these projects deal with prevention only and more specifically with dental health education of the population. These projects are the. Tanzania School Health Programme, our work. 8 with the MCH system and, the continuing educa- tion of dental personnel to reorient them towards.

  19. Insecticide resistance testing in malaria vectors in Tanzania ...

    African Journals Online (AJOL)

    mosquito survived much better and the scientists had a total of 467 mosquitoes to run the insecticide susceptibility tests. Innovative ways are necessary under field conditions for mosquito breeding in susceptibility studies. Key words: Malaria, Anopheles gambiae complex, larvae, fabric, resistance, susceptibility, Tanzania.

  20. Tanzania Journal of Agricultural Sciences - Vol 15, No 1 (2016)

    African Journals Online (AJOL)

    Agricultural Policy Analysis Studies in Tanzania: A Historical and Thematic Perspective with Implications on Future Policy Research for Crop Production and Marketing · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. A.C. Isinika, G.M. Mibavu, J.J. VanSickle ...