WorldWideScience

Sample records for tanzania method provider

  1. Unsafe abortion in urban and rural Tanzania: method, provider and consequences

    DEFF Research Database (Denmark)

    Rasch, Vibeke; Kipingili, Rose

    2009-01-01

    OBJECTIVE: To describe unsafe abortion methods and associated health consequences in Tanzania, where induced abortion is restricted by law but common and known to account for a disproportionate share of hospital admissions. METHOD: Cross-sectional study of women admitted with alleged miscarriage...

  2. Mixed Methods Survey of Zoonotic Disease Awareness and Practice among Animal and Human Healthcare Providers in Moshi, Tanzania.

    Directory of Open Access Journals (Sweden)

    Helen L Zhang

    2016-03-01

    Full Text Available Zoonoses are common causes of human and livestock illness in Tanzania. Previous studies have shown that brucellosis, leptospirosis, and Q fever account for a large proportion of human febrile illness in northern Tanzania, yet they are infrequently diagnosed. We conducted this study to assess awareness and knowledge regarding selected zoonoses among healthcare providers in Moshi, Tanzania; to determine what diagnostic and treatment protocols are utilized; and obtain insights into contextual factors contributing to the apparent under-diagnosis of zoonoses.We conducted a questionnaire about zoonoses knowledge, case reporting, and testing with 52 human health practitioners and 10 livestock health providers. Immediately following questionnaire administration, we conducted semi-structured interviews with 60 of these respondents, using the findings of a previous fever etiology study to prompt conversation. Sixty respondents (97% had heard of brucellosis, 26 (42% leptospirosis, and 20 (32% Q fever. Animal sector respondents reported seeing cases of animal brucellosis (4, rabies (4, and anthrax (3 in the previous 12 months. Human sector respondents reported cases of human brucellosis (15, 29%, rabies (9, 18% and anthrax (6, 12%. None reported leptospirosis or Q fever cases. Nineteen respondents were aware of a local diagnostic test for human brucellosis. Reports of tests for human leptospirosis or Q fever, or for any of the study pathogens in animals, were rare. Many respondents expressed awareness of malaria over-diagnosis and zoonoses under-diagnosis, and many identified low knowledge and testing capacity as reasons for zoonoses under-diagnosis.This study revealed differences in knowledge of different zoonoses and low case report frequencies of brucellosis, leptospirosis, and Q fever. There was a lack of known diagnostic services for leptospirosis and Q fever. These findings emphasize a need for improved diagnostic capacity alongside healthcare

  3. Perceptions on diabetes care provision among health providers in rural Tanzania: a qualitative study.

    Science.gov (United States)

    Mwangome, Mary; Geubbels, Eveline; Klatser, Paul; Dieleman, Marjolein

    2017-04-01

    Diabetes prevalence in Tanzania was estimated at 9.1% in 2012 among adults aged 24-65 years - higher than the HIV prevalence in the general population at that time. Health systems in lower- and middle-income countries are not designed for chronic health care, yet the rising burden of non-communicable diseases such as diabetes demands chronic care services. To inform policies on diabetes care, we conducted a study on the health services in place to diagnose, treat and care for diabetes patients in rural Tanzania. The study was an exploratory and descriptive study involving qualitative methods (in-depth interviews, observations and document reviews) and was conducted in a rural district in Tanzania. Fifteen health providers in four health facilities at different levels of the health care system were interviewed. The health care organization elements of the Innovative Care for Chronic Conditions (ICCC) framework were used to guide assessment of the diabetes services in the district. We found that diabetes care in this district was centralized at the referral and district facilities, with unreliable supply of necessary commodities for diabetes care and health providers who had some knowledge of what was expected of them but felt ill-prepared for diabetes care. Facility and district level guidance was lacking and the continuity of care was broken within and between facilities. The HMIS could not produce reliable data on diabetes. Support for self-management to patients and their families was weak at all levels. In conclusion, the rural district we studied did not provide diabetes care close to the patients. Guidance on diabetes service provision and human resource management need strengthening and policies related to task-shifting need adjustment to improve quality of service provision for diabetes patients in rural settings. © The Author 2016. Published by Oxford University Press in association with The London School of Hygiene and Tropical Medicine.

  4. Tanzania.

    Science.gov (United States)

    1992-05-01

    Background notes on Tanzania present a profile of nationality, population count of 26 million, growth rate of 3.5%, ethnic groups (130), religions (33% Muslim, 33% animist, 33% Christian), languages, education (86% primary), literacy (79%), health (infant mortality of 106/1000), and work force (90% agriculture). Geographic data are given for the area, cities, terrain, and climate. The Tanzanian government is a republic with executive, legislative, and judicial branches of government. There is 1 political party and everyone 18 years is eligible to vote. 4% of the gross domestic product (GDP) ($5.9 billion) is devoted to defense. Economic growth is 4.3%/year and person income is $240/capita. Natural resources, agriculture, industry, and trade are identified. $400 million has been received between 1970-92 in US economic aid. The 1992 official exchange rate is 300 Tanzanian shillings to the US dollar. Descriptive text is given for the population, the history of Tanganyika and Zanzibar, the government, principal government officials (President, 1st Vice President [VP], 2nd VP and President of Zanzibar, Prime Minister, Foreign Affairs Minister, Ambassador to the US, Ambassador to the UN, and US embassy address and phone number), political conditions, the economy, the defense, foreign relations, and US-Tanzanian relations. Principal US officials are identified for the Ambassador, Deputy Chief of Mission, USAID Director, and Public Affairs Officer; the US embassy address is given also. The population is 80% rural with a density of 1/sq km in arid areas, 51/sq km on the mainland, and 134/sq km on Zanzibar. The new capital will be Dodoma in central Tanzania. Most residents are of Bantu stock; nomadic groups are the Masai and the Luo. 1% are non-Africans. Government has a strong central executive. The current President is Ali Hassan Mwinyi. The Revolutionary Party is in the primary policymaking body and provides all government leaders. The government seeks to foster the

  5. Work experience, job-fulfillment and burnout among VMMC providers in Kenya, South Africa, Tanzania and Zimbabwe.

    Directory of Open Access Journals (Sweden)

    Linnea Perry

    Full Text Available BACKGROUND: Human resource capacity is vital to the scale-up of voluntary medical male circumcision (VMMC services. VMMC providers are at risk of "burnout" from performing a single task repeatedly in a high volume work environment that produces long work hours and intense work effort. METHODS AND FINDINGS: The Systematic Monitoring of the Voluntary Medical Male Circumcision Scale-up (SYMMACS surveyed VMMC providers in Kenya, South Africa, Tanzania, and Zimbabwe in 2011 (n = 357 and 2012 (n = 591. Providers self-reported on their training, work experience, levels of job-fulfillment and work fatigue/burnout. Data analysis included a descriptive analysis of VMMC provider characteristics, and both bivariate and multivariate analyses of factors associated with provider work fatigue/burnout. In 2012, Kenyan providers had worked in VMMC for a median of 31 months compared to South Africa (10 months, Tanzania (15 months, and Zimbabwe (11 months. More than three-quarters (78 - 99% of providers in all countries in 2012 reported that VMMC is a personally fulfilling job. However, 67% of Kenyan providers reported starting to experience work fatigue/burnout compared to South Africa (33%, Zimbabwe (17%, and Tanzania (15%. Despite the high level of work fatigue/burnout in Kenya, none of the measured factors (i.e., gender, age, full-time versus part-time status, length of service, number of operations performed, or cadre were significantly associated with work fatigue/burnout in 2011. In 2012, logistic regression found increases in age (p<.05 and number of months working in VMMC (p<.01 were associated with an increased likelihood of experiencing work fatigue/burnout, while higher career total VMMCs decreased the likelihood of experiencing burnout. CONCLUSION: Given cross-country differences, further elucidation of cultural and other contextual factors that may influence provider burnout is required. Continuing to emphasize the contribution that providers make in

  6. Unsafe abortion in rural Tanzania ¿ the use of traditional medicine from a patient and a provider perspective

    DEFF Research Database (Denmark)

    Rasch, Vibeke; Sørensen, Pernille H; Wang, Anna R

    2014-01-01

    BackgroundThe circumstances under which women obtain unsafe abortion vary and depend on the traditional methods known and the type of providers present. In rural Tanzania women often resort to traditional providers who use plant species as abortion remedies. Little is known about how these plants...... a remarkable strong uterine contractive effect. To further understand the consequences of unsafe abortion there is a need for further analyses of the plants¿ potential toxicity and mutagenicity.......BackgroundThe circumstances under which women obtain unsafe abortion vary and depend on the traditional methods known and the type of providers present. In rural Tanzania women often resort to traditional providers who use plant species as abortion remedies. Little is known about how these plants...... the traditional methods used to induce abortion, in-depths interviews and focus group discussions were performed among traditional providers and nurses. Finally, the plant specimen¿s effectiveness as abortion remedies was assessed through pharmacological analyses.ResultsAmong women admitted with incomplete...

  7. Unsafe abortion in rural Tanzania - the use of traditional medicine from a patient and a provider perspective.

    Science.gov (United States)

    Rasch, Vibeke; Sørensen, Pernille H; Wang, Anna R; Tibazarwa, Flora; Jäger, Anna K

    2014-12-19

    The circumstances under which women obtain unsafe abortion vary and depend on the traditional methods known and the type of providers present. In rural Tanzania women often resort to traditional providers who use plant species as abortion remedies. Little is known about how these plants are used and their potential effect. Data were obtained among women admitted with incomplete abortion at Kagera Regional Hospital during the period January - June, 2006. The women underwent an empathetic interview to determine if they had experienced an unsafe abortion prior to their admission. In all 125/187 women revealed having had an unsafe abortion. The women identified as having had an unsafe abortion underwent a questionnaire interview where information about abortion provider and abortion method used was obtained through open-ended questions. To get more detailed information about the traditional methods used to induce abortion, in-depths interviews and focus group discussions were performed among traditional providers and nurses. Finally, the plant specimen's effectiveness as abortion remedies was assessed through pharmacological analyses. Among women admitted with incomplete abortions, 67% had had an unsafe abortion. Almost half of the women who had experienced an unsafe abortion had resorted to traditional providers and plant species were in these cases often used as abortion remedies. In all 21 plant species were identified as potential abortion remedies and analysed, 16 of the species were found to have a uterine contractive effect; they significantly increased the force of contraction, increased the frequency of contractions or did both. Unsafe abortion is common in rural Tanzania where many women use plant species to terminate an unwanted pregnancy. The plants have a remarkable strong uterine contractive effect. To further understand the consequences of unsafe abortion there is a need for further analyses of the plants' potential toxicity and mutagenicity.

  8. Challenges Addressing Unmet Need for Contraception: Voices of Family Planning Service Providers in Rural Tanzania.

    Science.gov (United States)

    Baraka, Jitihada; Rusibamayila, Asinath; Kalolella, Admirabilis; Baynes, Colin

    2015-12-01

    Provider perspectives have been overlooked in efforts to address the challenges of unmet need for family planning (FP). This qualitative study was undertaken in Tanzania, using 22 key informant interviews and 4 focus group discussions. The research documents perceptions of healthcare managers and providers in a rural district on the barriers to meeting latent demand for contraception. Social-ecological theory is used to interpret the findings, illustrating how service capability is determined by the social, structural and organizational environment. Providers' efforts to address unmet need for FP services are constrained by unstable reproductive preferences, low educational attainment, and misconceptions about contraceptive side effects. Societal and organizational factors--such as gender dynamics, economic conditions, religious and cultural norms, and supply chain bottlenecks, respectively--also contribute to an adverse environment for meeting needs for care. Challenges that healthcare providers face interact and produce an effect which hinders efforts to address unmet need. Interventions to address this are not sufficient unless the supply of services is combined with systems strengthening and social engagement strategies in a way that reflects the multi-layered, social institutional problems.

  9. Community violence in Dar es Salaam, Tanzania: A mixed methods ...

    African Journals Online (AJOL)

    Most homicide deaths in Dar es Salaam, Tanzania (DSM) are a result of violence arising from within the community. This type of violence is commonly called, by perpetrators and victims, “mob justice”. Unilateral non-state collective violence can take four forms: lynching, vigilantism, rioting, and terrorism. The purpose of this ...

  10. Incentives and provider payment methods.

    Science.gov (United States)

    Barnum, H; Kutzin, J; Saxenian, H

    1995-01-01

    The mode of payment creates powerful incentives affecting provider behavior and the efficiency, equity and quality outcomes of health finance reforms. This article examines provider incentives as well as administrative costs, and institutional conditions for successful implementation associated with provider payment alternatives. The alternatives considered are budget reforms, capitation, fee-for-service, and case-based reimbursement. We conclude that competition, whether through a regulated private sector or within a public system, has the potential to improve the performance of any payment method. All methods generate both adverse and beneficial incentives. Systems with mixed forms of provider payment can provide tradeoffs to offset the disadvantages of individual modes. Low-income countries should avoid complex payment systems requiring higher levels of institutional development.

  11. Provider attitudes toward the voluntary medical male circumcision scale-up in Kenya, South Africa, Tanzania and Zimbabwe.

    Directory of Open Access Journals (Sweden)

    Webster Mavhu

    Full Text Available BACKGROUND: Countries participating in voluntary medical male circumcision (VMMC scale-up have adopted most of six elements of surgical efficiency, depending on national policy. However, effective implementation of these elements largely depends on providers' attitudes and subsequent compliance. We explored the concordance between recommended practices and providers' perceptions toward the VMMC efficiency elements, in part to inform review of national policies. METHODS AND FINDINGS: As part of Systematic Monitoring of the VMMC Scale-up (SYMMACS, we conducted a survey of VMMC providers in Kenya, South Africa, Tanzania, and Zimbabwe. SYMMACS assessed providers' attitudes and perceptions toward these elements in 2011 and 2012. A restricted analysis using 2012 data to calculate unadjusted odds ratios and 95% confidence intervals for the country effect on each attitudinal outcome was done using logistic regression. As only two countries allow more than one cadre to perform the surgical procedure, odds ratios looking at country effect were adjusted for cadre effect for these two countries. Qualitative data from open-ended responses were used to triangulate with quantitative analyses. This analysis showed concordance between each country's policies and provider attitudes toward the efficiency elements. One exception was task-shifting, which is not authorized in South Africa or Zimbabwe; providers across all countries approved this practice. CONCLUSIONS: The decision to adopt efficiency elements is often based on national policies. The concordance between the policies of each country and provider attitudes bodes well for compliance and effective implementation. However, study findings suggest that there may be need to consult providers when developing national policies.

  12. Assessment of health facility capacity to provide newborn care in Bangladesh, Haiti, Malawi, Senegal, and Tanzania.

    Science.gov (United States)

    Winter, Rebecca; Yourkavitch, Jennifer; Wang, Wenjuan; Mallick, Lindsay

    2017-12-01

    Despite the importance of health facility capacity to provide comprehensive care, the most widely used indicators for global monitoring of maternal and child health remain contact measures which assess women's use of services only and not the capacity of health facilities to provide those services; there is a gap in monitoring health facilities' capacity to provide newborn care services in low and middle income countries. In this study we demonstrate a measurable framework for assessing health facility capacity to provide newborn care using open access, nationally-representative Service Provision Assessment (SPA) data from the Demographic Health Surveys Program. In particular, we examine whether key newborn-related services are available at the facility (ie, service availability, measured by the availability of basic emergency obstetric care (BEmOC) signal functions, newborn signal functions, and routine perinatal services), and whether the facility has the equipment, medications, training and knowledge necessary to provide those services (ie, service readiness, measured by general facility requirements, equipment, medicines and commodities, and guidelines and staffing) in five countries with high levels of neonatal mortality and recent SPA data: Bangladesh, Haiti, Malawi, Senegal, and Tanzania. In each country, we find that key services and commodities needed for comprehensive delivery and newborn care are missing from a large percentage of facilities with delivery services. Of three domains of service availability examined, scores for routine care availability are highest, while scores for newborn signal function availability are lowest. Of four domains of service readiness examined, scores for general requirements and equipment are highest, while scores for guidelines and staffing are lowest. Both service availability and readiness tend to be highest in hospitals and facilities in urban areas, pointing to substantial equity gaps in the availability of essential

  13. Preparing investigation of methods for surveying tree seed demands among farmers in Tanzania

    DEFF Research Database (Denmark)

    Aabæk, Anders

    demand pattern in Tanzania, Uganda and Nicaragua are discussed and a choice of strategy for an extensive survey of seed demand and supply in Tanzania is made. Different data collection methods and tools, e.g. quantitative and qualitative surveys and rapid rural appraisals, are described in detail......Insufficient seed supplies is often a major constraint on tree planting activities in developing countries. A central problem is to assess the actual demands for tree seed. This report shall, as a part of a PhD-study, prepare an investigation of different methods for surveying tree seed demands...... and preferences among private farmers in Tanzania. A framework for investigating seed demand and supply is outlined. The role of a national tree seed project in a seed supply sector is discussed and data requirements for strategy on seed procurement and tree improvement are outlined. Earlier surveys on seed...

  14. The determinants of traditional medicine use in Northern Tanzania: a mixed-methods study.

    Directory of Open Access Journals (Sweden)

    John W Stanifer

    Full Text Available Traditional medicines are an important part of healthcare in sub-Saharan Africa, and building successful disease treatment programs that are sensitive to traditional medicine practices will require an understanding of their current use and roles, including from a biomedical perspective. Therefore, we conducted a mixed-method study in Northern Tanzania in order to characterize the extent of and reasons for the use of traditional medicines among the general population so that we can better inform public health efforts in the region.Between December 2013 and June 2014 in Kilimanjaro, Tanzania, we conducted 5 focus group discussions and 27 in-depth interviews of key informants. The data from these sessions were analyzed using an inductive framework method with cultural insider-outsider coding. From these results, we developed a structured survey designed to test different aspects of traditional medicine use and administered it to a random sample of 655 adults from the community. The results were triangulated to explore converging and diverging themes.Most structured survey participants (68% reported knowing someone who frequently used traditional medicines, and the majority (56% reported using them themselves in the previous year. The most common uses were for symptomatic ailments (42%, chronic diseases (15%, reproductive problems (11%, and malaria/febrile illnesses (11%. We identified five major determinants for traditional medicine use in Northern Tanzania: biomedical healthcare delivery, credibility of traditional practices, strong cultural identities, individual health status, and disease understanding.In order to better formulate effective local disease management programs that are sensitive to TM practices, we described the determinants of TM use. Additionally, we found TM use to be high in Northern Tanzania and that its use is not limited to lower-income areas or rural settings. After symptomatic ailments, chronic diseases were reported as

  15. Knowledge and Practices Relating to Acute Pesticide Poisoning Among Health Care Providers in Selected Regions of Tanzania

    Directory of Open Access Journals (Sweden)

    Elikana Lekei

    2017-02-01

    Full Text Available Background: Acute pesticide poisoning (APP is commonly underdiagnosed in Tanzania. Studies in developing countries suggest that a lack of diagnostic skills among health care providers (HCPs undermines surveillance for APP. This study aimed at characterizing experience and skills of Tanzanian HCPs regarding APP diagnosis and management. Methodology: The population included HCPs responsible for managing APP in Kilimanjaro and Arusha regions (n = 91. The resulting sample included 66 respondents (response rate: 73%. The data were collected in 2005 using a standardized questionnaire. Results: Half of all respondents (50% reported handling at least 1 APP case with 15% reporting handling more than 5 cases in the past. Reported experience of handling an APP case was marginally higher in respondents who reported ⩾4 years of work experience in the health sector compared with those with <4 years of work experience (odds ratio = 1.32; 95% confidence interval = 0.9-1.5. Most of the respondents had high knowledge of exposure routes, reporting awareness of oral (98.5%, inhalational (93.9%, and dermal (77% routes. The study revealed low awareness of pesticide classification by chemical groups (29% or World Health Organization hazard (0% and weak knowledge on pesticide label instructions (55%. Organophosphates accounted for 35% of the pesticide products reported by respondents as being responsible for poisoning. Some treatment options were incorrectly reported as first aid options, and some reported first aid options were wrong or inappropriate. Conclusions: The study revealed that HCPs in northern Tanzania lack adequate skills to diagnose and manage APP. For effective surveillance of APP, there is a need to include training on hazards, classification, diagnosis, and health effects in the training programmes for all HCPs in Tanzania.

  16. Using contraceptives to delay first birth: a qualitative study of individual, community and health provider perceptions in southern Tanzania

    Directory of Open Access Journals (Sweden)

    Yovitha Sedekia

    2017-10-01

    Full Text Available Abstract Background Young adolescents and unmarried women in low and middle income countries face challenges in accessing family planning services. One factor likely to limit contraceptive use is the attitude and opinion of local stakeholders such as community leaders and health workers. Much of the existing evidence on this topic focuses on women who have already started childbearing. Using primary qualitative data, we explored individual, community and health provider’s perceptions about using modern contraceptives to delay the first birth in a high fertility setting. Methods A descriptive qualitative study was conducted in Tandahimba district in southern Tanzania between December 2014 and March 2015. We conducted 8 focus group discussions with men and women and 25 in-depth interviews (18 with women, 4 with family planning service providers and 3 with district-level staff. Participants were purposively sampled. Data transcripts were managed and coded using Nvivo 11 software and we employed a thematic framework analysis. Results Three main themes emerged about using modern contraceptives to delay first birth: (1 the social and biological status of the woman (2 the type of contraceptive and (3 non-alignment among national policies for adolescents. Use of modern contraceptives to delay first birth was widely acceptable for women who were students, young, unmarried and women in unstable marriage. But long-acting reversible methods such as implants and intrauterine devices were perceived as inappropriate methods for delaying first birth, partly because of fears around delayed return to fecundity, discontinuation once woman’s marital status changes and permanently limiting future fertility. The support for use of modern contraceptives to delay a first pregnancy was not unanimous. A small number of participants from both rural and urban areas did not approve the use of contraceptive methods before the birth of a first baby at all, not even for

  17. Comparing Methods of Assessing Dog Rabies Vaccination Coverage in Rural and Urban Communities in Tanzania

    Science.gov (United States)

    Sambo, Maganga; Johnson, Paul C. D.; Hotopp, Karen; Changalucha, Joel; Cleaveland, Sarah; Kazwala, Rudovick; Lembo, Tiziana; Lugelo, Ahmed; Lushasi, Kennedy; Maziku, Mathew; Mbunda, Eberhard; Mtema, Zacharia; Sikana, Lwitiko; Townsend, Sunny E.; Hampson, Katie

    2017-01-01

    Rabies can be eliminated by achieving comprehensive coverage of 70% of domestic dogs during annual mass vaccination campaigns. Estimates of vaccination coverage are, therefore, required to evaluate and manage mass dog vaccination programs; however, there is no specific guidance for the most accurate and efficient methods for estimating coverage in different settings. Here, we compare post-vaccination transects, school-based surveys, and household surveys across 28 districts in southeast Tanzania and Pemba island covering rural, urban, coastal and inland settings, and a range of different livelihoods and religious backgrounds. These approaches were explored in detail in a single district in northwest Tanzania (Serengeti), where their performance was compared with a complete dog population census that also recorded dog vaccination status. Post-vaccination transects involved counting marked (vaccinated) and unmarked (unvaccinated) dogs immediately after campaigns in 2,155 villages (24,721 dogs counted). School-based surveys were administered to 8,587 primary school pupils each representing a unique household, in 119 randomly selected schools approximately 2 months after campaigns. Household surveys were conducted in 160 randomly selected villages (4,488 households) in July/August 2011. Costs to implement these coverage assessments were $12.01, $66.12, and $155.70 per village for post-vaccination transects, school-based, and household surveys, respectively. Simulations were performed to assess the effect of sampling on the precision of coverage estimation. The sampling effort required to obtain reasonably precise estimates of coverage from household surveys is generally very high and probably prohibitively expensive for routine monitoring across large areas, particularly in communities with high human to dog ratios. School-based surveys partially overcame sampling constraints, however, were also costly to obtain reasonably precise estimates of coverage. Post

  18. Knowledge, attitudes and acceptability to provider-initiated HIV testing and counseling: patients' perspectives in Moshi and Rombo Districts, Tanzania.

    Science.gov (United States)

    Manongi, Rachel; Mahande, Michael; Njau, Bernard

    2014-10-01

    Provider-initiated HIV testing and counseling (PITC) is referred to as routine testing in a clinical setting as part of a standard programme of medical services. PITC is initiated in order to avoid missed opportunities for people to get tested for HIV. While advocated as a strategy, there is dearth of information on patients' views on PITC in a number of districts in Tanzania. The objective of this study was to assess the knowledge, attitude and acceptability to PITC services among patients attending health care facilities in rural and urban settings in Kilimanjaro region A total of 12 focus group discussions (FGDs) were conducted with 99 (73 female and 26 male) patients enrolled into out-patient clinics in 8 (2 hospitals and 6 primary care centers) health facilities in Moshi Urban and Rombo districts in northern Tanzania. The study explored on knowledge, attitudes and acceptability of PITC, perceived benefits and barriers of PITC, and ethical issues related to PITC. Interviews were audio taped, transcribed, translated, and analyzed using Non-numerical Unstructured Data Indexing and Theorizing (NUDIST) software. Knowledge about PITC services was generally low. Compared to men, women had a more positive attitude towards PITC services, because of its ability to identify and treat undiagnosed HIV cases. HIV stigma was regarded as a major barrier to patients' uptake of PITC. Institutional factors such as lack of supplies and human resources were identified as barriers to successful provision of PITC. In conclusion, the findings highlight both opportunities and potential barriers in the successful uptake of PITC, and underscore the importance of informed consent, counseling and confidentiality and the need for specific strategies on advocacy for the service.

  19. "Every method seems to have its problems"- Perspectives on side effects of hormonal contraceptives in Morogoro Region, Tanzania.

    Science.gov (United States)

    Chebet, Joy J; McMahon, Shannon A; Greenspan, Jesse A; Mosha, Idda H; Callaghan-Koru, Jennifer A; Killewo, Japhet; Baqui, Abdullah H; Winch, Peter J

    2015-11-03

    Family planning has been shown to be an effective intervention for promoting maternal, newborn and child health. Despite family planning's multiple benefits, women's experiences of - or concerns related to - side effects present a formidable barrier to the sustained use of contraceptives, particularly in the postpartum period. This paper presents perspectives of postpartum, rural, Tanzanian women, their partners, public opinion leaders and community and health facility providers related to side effects associated with contraceptive use. Qualitative interviews were conducted with postpartum women (n = 34), their partners (n = 23), community leaders (n = 12) and health providers based in both facilities (n = 12) and communities (n = 19) across Morogoro Region, Tanzania. Following data collection, digitally recorded data were transcribed, translated and coded using thematic analysis. Respondents described family planning positively due to the health and economic benefits associated with limiting and spacing births. However, side effects were consistently cited as a reason that women and their partners choose to forgo family planning altogether, discontinue methods, switch methods or use methods in an intermittent (and ineffective) manner. Respondents detailed side effects including excessive menstrual bleeding, missed menses, weight gain and fatigue. Women, their partners and community leaders also described concerns that contraceptives could induce sterility in women, or harm breastfeeding children via contamination of breast milk. Use of family planning during the postpartum period was viewed as particularly detrimental to a newborn's health in the first months of life. To meet Tanzania's national target of increasing contraceptive use from 34 to 60 % by 2015, appropriate counseling and dialogue on contraceptive side effects that speaks to pressing concerns outlined by women, their partners, communities and service providers are needed.

  20. Health care provider communication training in rural Tanzania empowers HIV-infected patients on antiretroviral therapy to discuss adherence problems.

    Science.gov (United States)

    Erb, S; Letang, E; Glass, T R; Natamatungiro, A; Mnzava, D; Mapesi, H; Haschke, M; Duthaler, U; Berger, B; Muri, L; Bader, J; Marzolini, C; Elzi, L; Klimkait, T; Langewitz, W; Battegay, M

    2017-10-01

    Self-reported adherence assessment in HIV-infected patients on antiretroviral therapy (ART) is challenging and may overestimate adherence. The aim of this study was to improve the ability of health care providers to elicit patients' reports of nonadherence using a "patient-centred" approach in a rural sub-Saharan African setting. A prospective interventional cohort study of HIV-infected patients on ART for ≥ 6 months attending an HIV clinic in rural Tanzania was carried out. The intervention consisted of a 2-day workshop for health care providers on patient-centred communication and the provision of an adherence assessment checklist for use in the consultations. Patients' self-reports of nonadherence (≥ 1 missed ART dose/4 weeks), subtherapeutic plasma ART concentrations (communication can successfully be implemented with a simple intervention in rural Africa. It increases the likelihood of HIV-infected patients reporting problems with adherence to ART; however, sustainability remains a challenge. © 2017 The Authors HIV Medicine published by John Wiley & Sons Ltd on behalf of British HIV Association.

  1. Assessing healthcare providers' knowledge and practices relating to insecticide-treated nets and the prevention of malaria in Ghana, Laos, Senegal and Tanzania

    Directory of Open Access Journals (Sweden)

    Hoffman Steven J

    2011-12-01

    Full Text Available Abstract Background Research evidence is not always being disseminated to healthcare providers who need it to inform their clinical practice. This can result in the provision of ineffective services and an inefficient use of resources, the implications of which might be felt particularly acutely in low- and middle-income countries. Malaria prevention is a particularly compelling domain to study evidence/practice gaps given the proven efficacy, cost-effectiveness and disappointing utilization of insecticide-treated nets (ITNs. Methods This study compares what is known about ITNs to the related knowledge and practices of healthcare providers in four low- and middle-income countries. A new questionnaire was developed, pilot tested, translated and administered to 497 healthcare providers in Ghana (140, Laos (136, Senegal (100 and Tanzania (121. Ten questions tested participants' knowledge and clinical practice related to malaria prevention. Additional questions addressed their individual characteristics, working context and research-related activities. Ordinal logistic regressions with knowledge and practices as the dependent variable were conducted in addition to descriptive statistics. Results The survey achieved a 75% response rate (372/497 across Ghana (107/140, Laos (136/136, Senegal (51/100 and Tanzania (78/121. Few participating healthcare providers correctly answered all five knowledge questions about ITNs (13% or self-reported performing all five clinical practices according to established evidence (2%. Statistically significant factors associated with higher knowledge within each country included: 1 training in acquiring systematic reviews through the Cochrane Library (OR 2.48, 95% CI 1.30-4.73; and 2 ability to read and write English well or very well (OR 1.69, 95% CI 1.05-2.70. Statistically significant factors associated with better clinical practices within each country include: 1 reading scientific journals from their own country (OR

  2. Performance and self-perceived competencies of enrolled nurse/midwives: a mixed methods study from rural Tanzania.

    Science.gov (United States)

    Tarimo, Edith A M; Moyo, Gustav; Masenga, Happy; Magesa, Paul; Mzava, Dafroza

    2018-04-11

    Tanzania is experiencing a severe shortage of human resources for health, which poses a serious threat to the quality of health care services particularly in rural areas. Task shifting has been considered a way to address this problem. However, since a large percentage of health care providers in rural setting is comprised of Enrolled Nurse/Midwives (ENMs), most of the health care tasks are shifted to them. This article analyzes the performance and self-perceived competencies of ENMs at the dispensary level; the lowest health facility in Tanzania. Performance refers to routine duties performed by ENMs, and self-perceived competence means self-perceived proficiency in performing nursing/midwifery and medical duties. This was a mixed methods study conducted in rural Tanzania. A purposeful sample of twelve (12) informants (six ENMs; two Community Leaders [CLs] and four Dispensary In-charges [DIs]) was recruited for semi-structured interviews. The interviews were supplemented with quantitative data from 59 ENMs. Both thematic and descriptive analysis approaches were used. Three themes emerged: (1) 'Approval of the performances of ENMs in meeting community health needs' underscores important services the community members got from ENMs at dispensaries. (2) 'Experienced difficulties of meeting community health needs' indicate the problems ENMs encountered while providing services to the community. In striving to serve a large number of demanding clients without adequate medical equipment and supplies, sometimes the ENMs ended up with prescription errors (3) 'Appreciating the performances and competencies of ENMs' shows the acknowledgement of community members towards ENMs' performance and competencies within and beyond their scope of practice. The community members as well as ENMs and their supervisors knew that ENMs must sometimes provide care that is outside their scope of training and competency. Overall, the performance among ENMs above 38 years of age (P

  3. Maternal and Newborn Healthcare Providers in Rural Tanzania: In-depth Interviews Exploring Influences on Motivation, Performance and Job Satisfaction.

    OpenAIRE

    Prytherch, H; Kakoko, D C V; Leshabari, M T; Sauerborn, R; Marx, M

    2012-01-01

    Major improvements in maternal and neonatal health (MNH) remain elusive in Tanzania. The causes are closely related to the health system and overall human resource policy. Just 35% of the required workforce is actually in place and 43% of available staff consists of lower-level cadres such as auxiliaries. Staff motivation is also a challenge. In rural areas the problems of recruiting and retaining health staff are most pronounced. Yet, it is here that the majority of the population continues ...

  4. Maternal and newborn healthcare providers in rural Tanzania: in-depth interviews exploring influences on motivation, performance and job satisfaction.

    Science.gov (United States)

    Prytherch, H; Kakoko, D C V; Leshabari, M T; Sauerborn, R; Marx, M

    2012-01-01

    Major improvements in maternal and neonatal health (MNH) remain elusive in Tanzania. The causes are closely related to the health system and overall human resource policy. Just 35% of the required workforce is actually in place and 43% of available staff consists of lower-level cadres such as auxiliaries. Staff motivation is also a challenge. In rural areas the problems of recruiting and retaining health staff are most pronounced. Yet, it is here that the majority of the population continues to reside. A detailed understanding of the influences on the motivation, performance and job satisfaction of providers at rural, primary level facilities was sought to inform a research project in its early stages. The providers approached were those found to be delivering MNH care on the ground, and thus include auxiliary staff. Much of the previous work on motivation has focused on defined professional groups such as physicians and nurses. While attention has recently broadened to also include mid-level providers, the views of auxiliary health workers have seldom been explored. In-depth interviews were the methodology of choice. An interview guideline was prepared with the involvement of Tanzanian psychologists, sociologists and health professionals to ensure the instrument was rooted in the socio-cultural setting of its application. Interviews were conducted with 25 MNH providers, 8 facility and district managers, and 2 policy-makers. Key sources of encouragement for all the types of respondents included community appreciation, perceived government and development partner support for MNH, and on-the-job learning. Discouragements were overwhelmingly financial in nature, but also included facility understaffing and the resulting workload, malfunction of the promotion system as well as health and safety, and security issues. Low-level cadres were found to be particularly discouraged. Difficulties and weaknesses in the management of rural facilities were revealed. Basic steps

  5. “Experiences with disclosure of HIV-positive status to the infected child”: Perspectives of healthcare providers in Dar es Salaam, Tanzania

    Directory of Open Access Journals (Sweden)

    Adellah Sariah

    2016-10-01

    Full Text Available Abstract Background The specific age to which an HIV infected child can be disclosed to is stipulated to begin between ages 4 and 6 years. It has also been documented that before disclosure of HIV positive status to the infected child. Health care providers should consider children’s cognitive-developmental ability. However, observation and situation analysis show that, health care providers still feel uncomfortable disclosing the HIV positive status to the infected child. The aim of the study was to explore healthcare providers’ experiences in disclosure of HIV-positive status to the infected child. Methods A qualitative study involving 20 health care providers who attend HIV-positive children was conducted in September, 2014 in Dar es Salaam, Tanzania. Participants were selected from ten HIV care and treatment clinics (CTC by purposive sampling. An interview guide, translated into participants’ national language (Kiswahili was used during in-depth interviews. Sampling followed the principle of data saturation. The interviews focused on perspectives of health-care providers regarding their experience with paediatric HIV disclosure. Data from in-depth interviews were transcribed into text; data analysis followed qualitative content analysis. Results The results show how complex the process of disclosure to children living with HIV can be to healthcare providers. Confusion was noted among healthcare providers about their role and responsibility in the process of disclosing to the HIV infected child. This was reported to be largely due to unclear guidelines and lack of standardized training in paediatric HIV disclosure. Furthermore, healthcare providers were concerned about parental hesitancy to disclose early to the child due to lack of disclosure skills and fear of stigma. In order to improve the disclosure process in HIV infected children, healthcare providers recommended further standardized training on paediatric HIV disclosure with

  6. Bioenergy options. Multidisciplinary participatory method for assessing bioenergy options for rural villages in Tanzania

    Energy Technology Data Exchange (ETDEWEB)

    Kauzeni, A.S.; Masao, H.P.; Sawe, E.N.; Shechambo, F.C. [Dar Es Salaam Univ. (Tanzania). Inst. of Resource Assessment; Ellegaard, A. [Stockholm Environment Inst. (Sweden)

    1998-12-31

    In Tanzania, like in many other developing countries in Southern and Eastern Africa, bioenergy planning has received relatively little attention, compared to planning for `modern` energy sources, although it accounts for about 90% of the country`s energy supply. As a result there is less understanding of the complexity and diversity of bioenergy systems. There is a lack of reliable data and information on bio-resources, their consumption and interaction with social, economic, institutional and environmental factors. This is largely due to lack of adequately developed and easily understood methods of data and information development, analysis and methods of evaluating available bioenergy options. In order to address the above constraints a project was initiated where the general objective was to develop and test a multi-disciplinary research method for identifying bioenergy options that can contribute to satisfying the energy needs of the rural household, agricultural and small scale industrial sectors, promote growth and facilitate sustainable development. The decision on the development and testing of a multidisciplinary research method was based on the fact that in Tanzania several bioenergy programmes have been introduced e.g. tree planting, improved cookstoves, biogas, improved charcoal making kilns etc. for various purposes including combating deforestation; promoting economic growth, substitution of imported petroleum fuels, health improvement, and raising standards of living. However efforts made in introducing these programmes or interventions have met with limited success. This situation prevails because developed bioenergy technologies are not being adopted in adequate numbers by the target groups. There are some indications from the study that some of the real barriers to effective bioenergy interventions or adoption of bioenergy technologies lie at the policy level and not at the project level. After the development and testing of the methodology

  7. Systems and Methods for Providing Insulation

    Science.gov (United States)

    Golden, Johnny L. (Inventor)

    2015-01-01

    Systems and methods provide a multi-layer insulation (MLI) that includes a plurality of sealed metalized volumes in a stacked arrangement, wherein the plurality of sealed metalized volumes encapsulate a gas therein, with the gas having one of a thermal insulating property, an acoustic insulating property, or a combination insulating property thereof. The MLI also includes at least one spacer between adjacent sealed metalized volumes of the plurality of sealed metalized volumes and a protective cover surrounding the plurality of sealed metalized volumes.

  8. Improvements in access to malaria treatment in Tanzania after switch to artemisinin combination therapy and the introduction of accredited drug dispensing outlets - a provider perspective

    Directory of Open Access Journals (Sweden)

    Dillip Angel

    2010-06-01

    Full Text Available Abstract Background To improve access to treatment in the private retail sector a new class of outlets known as accredited drug dispensing outlets (ADDO was created in Tanzania. Tanzania changed its first-line treatment for malaria from sulphadoxine-pyrimethamine (SP to artemether-lumefantrine (ALu in 2007. Subsidized ALu was made available in both health facilities and ADDOs. The effect of these interventions on access to malaria treatment was studied in rural Tanzania. Methods The study was carried out in the villages of Kilombero and Ulanga Demographic Surveillance System (DSS and in Ifakara town. Data collection consisted of: 1 yearly censuses of shops selling drugs; 2 collection of monthly data on availability of anti-malarials in public health facilities; and 3 retail audits to measure anti-malarial sales volumes in all public, mission and private outlets. The data were complemented with DSS population data. Results Between 2004 and 2008 access to malaria treatment greatly improved and the number of anti-malarial treatment doses dispensed increased by 78%. Particular improvements were observed in the availability (from 0.24 shops per 1,000 people in 2004 to 0.39 in 2008 and accessibility (from 71% of households within 5 km of a shop in 2004 to 87% in 2008 of drug shops. Despite no improvements in affordability this resulted in an increase of the market share from 49% of anti-malarial sales 2005 to 59% in 2008. The change of treatment policy from SP to ALu led to severe stock-outs of SP in health facilities in the months leading up to the introduction of ALu (only 40% months in stock, but these were compensated by the wide availability of SP in shops. After the introduction of ALu stock levels of the drug were relatively high in public health facilities (over 80% months in stock, but the drug could only be found in 30% of drug shops and in no general shops. This resulted in a low overall utilization of the drug (19% of all anti

  9. AgriSense-STARS: Advancing Methods of Agricultural Monitoring for Food Security in Smallholder Regions - the Case for Tanzania

    Science.gov (United States)

    Dempewolf, J.; Becker-Reshef, I.; Nakalembe, C. L.; Tumbo, S.; Maurice, S.; Mbilinyi, B.; Ntikha, O.; Hansen, M.; Justice, C. J.; Adusei, B.; Kongo, V.

    2015-12-01

    In-season monitoring of crop conditions provides critical information for agricultural policy and decision making and most importantly for food security planning and management. Nationwide agricultural monitoring in countries dominated by smallholder farming systems, generally relies on extensive networks of field data collectors. In Tanzania, extension agents make up this network and report on conditions across the country, approaching a "near-census". Data is collected on paper which is resource and time intensive, as well as prone to errors. Data quality is ambiguous and there is a general lack of clear and functional feedback loops between farmers, extension agents, analysts and decision makers. Moreover, the data are not spatially explicit, limiting the usefulness for analysis and quality of policy outcomes. Despite significant advances in remote sensing and information communication technologies (ICT) for monitoring agriculture, the full potential of these new tools is yet to be realized in Tanzania. Their use is constrained by the lack of resources, skills and infrastructure to access and process these data. The use of ICT technologies for data collection, processing and analysis is equally limited. The AgriSense-STARS project is developing and testing a system for national-scale in-season monitoring of smallholder agriculture using a combination of three main tools, 1) GLAM-East Africa, an automated MODIS satellite image processing system, 2) field data collection using GeoODK and unmanned aerial vehicles (UAVs), and 3) the Tanzania Crop Monitor, a collaborative online portal for data management and reporting. These tools are developed and applied in Tanzania through the National Food Security Division of the Ministry of Agriculture, Food Security and Cooperatives (MAFC) within a statistically representative sampling framework (area frame) that ensures data quality, representability and resource efficiency.

  10. Job satisfaction and turnover intentions among health care staff providing services for prevention of mother-to-child transmission of HIV in Dar es Salaam, Tanzania.

    Science.gov (United States)

    Naburi, Helga; Mujinja, Phares; Kilewo, Charles; Orsini, Nicola; Bärnighausen, Till; Manji, Karim; Biberfeld, Gunnel; Sando, David; Geldsetzer, Pascal; Chalamila, Guerino; Ekström, Anna Mia

    2017-09-06

    Option B+ for the prevention of mother-to-child transmission (PMTCT) of HIV (i.e., lifelong antiretroviral treatment for all pregnant and breastfeeding mothers living with HIV) was initiated in Tanzania in 2013. While there is evidence that this policy has benefits for the health of the mother and the child, Option B+ may also increase the workload for health care providers in resource-constrained settings, possibly leading to job dissatisfaction and unwanted workforce turnover. From March to April 2014, a questionnaire asking about job satisfaction and turnover intentions was administered to all nurses at 36 public-sector health facilities offering antenatal and PMTCT services in Dar es Salaam, Tanzania. Multivariable logistic regression models were used to identify factors associated with job dissatisfaction and intention to quit one's job. Slightly over half (54%, 114/213) of the providers were dissatisfied with their current job, and 35% (74/213) intended to leave their job. Most of the providers were dissatisfied with low salaries and high workload, but satisfied with workplace harmony and being able to follow their moral values. The odds of reporting to be globally dissatisfied with one's job were high if the provider was dissatisfied with salary (adjusted odds ratio (aOR) 5.6, 95% CI 1.2-26.8), availability of protective gear (aOR 4.0, 95% CI 1.5-10.6), job description (aOR 4.3, 95% CI 1.2-14.7), and working hours (aOR 3.2, 95% CI 1.3-7.6). Perceiving clients to prefer PMTCT Option B+ reduced job dissatisfaction (aOR 0.2, 95% CI 0.1-0.8). The following factors were associated with providers' intention to leave their current job: job stability dissatisfaction (aOR 3.7, 95% CI 1.3-10.5), not being recognized by one's superior (aOR 3.6, 95% CI 1.7-7.6), and poor feedback on the overall unit performance (aOR 2.7, 95% CI 1.3-5.8). Job dissatisfaction and turnover intentions are comparatively high among nurses in Dar es Salaam's public-sector maternal care

  11. Social reactions to rape: experiences and perceptions of women rape survivors and their potential support providers in Dar es Salaam, Tanzania.

    Science.gov (United States)

    Muganyizi, Projestine S; Hogan, Nora; Emmelin, Maria; Lindmark, Gunilla; Massawe, Siriel; Nystrom, Lennarth; Axemo, Pia

    2009-01-01

    Social reactions to rape are socioculturally determined and have a strong influence on the coping and recovery of the survivor. The existing knowledge on social reactions emanates from Western countries with limited research attention on non-Western populations, particularly sub-Saharan Africa. We aimed to establish the types and perceptions of social reactions that are expressed to rape survivors and people's intentions to express them to survivors of varied social backgrounds in Tanzania. Using triangulation of research methods, experiences of social reactions among rape survivors (n = 50) and nurses (n = 44) from a community in Tanzania were explored, and the intentions to express typical social reactions to rape survivors of different social backgrounds were established from a representative community sample (n = 1,505). Twelve typical social reactions were identified with the positive reactions more commonly mentioned than the negative reactions. Nondisclosure of rape events and distracting the survivor from the event were perceived as both positive and negative. A commercial sex worker was most vulnerable to negative reactions. The cultural influences of social reactions and implications for practical applicability of the results are discussed.

  12. Evaluation of a Smartphone-Based Training Strategy Among Health Care Workers Screening for Cervical Cancer in Northern Tanzania: The Kilimanjaro Method

    Science.gov (United States)

    Sleeth, Jessica; Hopman, Wilma; Ginsburg, Ophira; Heus, Katharine; Andrews, Linda; Giattas, Mary Rose; Yuma, Safina; Macheku, Godwin; Msuya, Aziz; Oneko, Olola

    2016-01-01

    Purpose Almost nine of 10 deaths resulting from cervical cancer occur in low-income countries. Visual inspection under acetic acid (VIA) is an evidence-based, cost-effective approach to cervical cancer screening (CCS), but challenges to effective implementation include health provider training costs, provider turnover, and skills retention. We hypothesized that a smartphone camera and use of cervical image transfer for real-time mentorship by experts located distantly across a closed user group through a commercially available smartphone application would be both feasible and effective in enhancing VIA skills among CCS providers in Tanzania. Methods We trained five nonphysician providers in semirural Tanzania to perform VIA enhanced by smartphone cervicography with real-time trainee support from regional experts. Deidentified images were sent through a free smartphone application on the available mobile telephone networks. Our primary outcomes were feasibility of using a smartphone camera to perform smartphone-enhanced VIA and level of agreement in diagnosis between the trainee and expert reviewer over time. Results Trainees screened 1,072 eligible women using our methodology. Within 1 month of training, the agreement rate between trainees and expert reviewers was 96.8%. Providers received a response from expert reviewers within 1 to 5 minutes 48.4% of the time, and more than 60% of the time, feedback was provided by regional expert reviewers in less than 10 minutes. Conclusion Our method was found to be feasible and effective in increasing health care workers’ skills and accuracy. This method holds promise for improved quality of VIA-based CCS programs among health care providers in low-income countries. PMID:28717721

  13. northern Tanzania

    African Journals Online (AJOL)

    Department of Zoology and Marine Biology, University of Dar es Salaam,. P O Box 35064, Dar es Salaam, Tanzania ... National Parks and neighbouring villages in northern Tanzania between 1993 and l996 (Kabigumila 1998a). Most of ..... International Congress ofChelonian Conservation. SOPTOM,. Gonfaron France. pp: ...

  14. The implementation of an external quality assurance method for point- of- care tests for HIV and syphilis in Tanzania.

    Science.gov (United States)

    Smit, Pieter W; Mabey, David; van der Vlis, Thomas; Korporaal, Hans; Mngara, Julius; Changalucha, John; Todd, Jim; Peeling, Rosanna W

    2013-11-09

    External quality assurance (EQA) programmes, which are routinely used in laboratories, have not been widely implemented for point-of- care tests (POCTs). A study was performed in ten health centres in Tanzania, to implement the use of dried blood spots (DBS) as an EQA method for HIV and syphilis (POCTs). DBS samples were collected for retesting at a reference laboratory and the results compared to the POCT results obtained at the clinic. In total, 2341 DBS samples were collected from 10 rural health facilities over a period of nine months, of which 92.5% were correctly collected and spotted. The EQA method was easily implemented by healthcare workers under routine conditions in Northern Tanzania. For HIV, 967 out of 972 samples (99.5%) were concordant between DBS and POCT results. For syphilis, the sensitivity of syphilis tests varied between clinics with a median of 96% (25th and 75th quartile; 95-98%). The specificity of syphilis POCT was consistent compared to laboratory based test using DBS, with a median of 96% (25th and 75th quartiles; 95-98%). Overall, the quality of testing varied at clinics and EQA results can be used to identify clinics where healthcare workers require remedial training, suggesting the necessity for stringent quality assurance programmes for POC testing. As Tanzania embarks on scaling up HIV and syphilis testing, DBS can be a useful and robust tool to monitor the quality of testing performed by healthcare workers and trigger corrective action to ensure accuracy of test results.

  15. Evaluating the impact of continuous quality improvement methods at hospitals in Tanzania: a cluster-randomized trial.

    Science.gov (United States)

    Kamiya, Yusuke; Ishijma, Hisahiro; Hagiwara, Akiko; Takahashi, Shizu; Ngonyani, Henook A M; Samky, Eleuter

    2017-02-01

    To evaluate the impact of implementing continuous quality improvement (CQI) methods on patient's experiences and satisfaction in Tanzania. Cluster-randomized trial, which randomly allocated district-level hospitals into treatment group and control group, was conducted. Sixteen district-level hospitals in Kilimanjaro and Manyara regions of Tanzania. Outpatient exit surveys targeting totally 3292 individuals, 1688 in the treatment and 1604 in the control group, from 3 time-points between September 2011 and September 2012. Implementation of the 5S (Sort, Set, Shine, Standardize, Sustain) approach as a CQI method at outpatient departments over 12 months. Cleanliness, waiting time, patient's experience, patient's satisfaction. The 5S increased cleanliness in the outpatient department, patients' subjective waiting time and overall satisfaction. However, negligible effects were confirmed for patient's experiences on hospital staff behaviours. The 5S as a CQI method is effective in enhancing hospital environment and service delivery; that are subjectively assessed by outpatients even during the short intervention period. Nevertheless, continuous efforts will be needed to connect CQI practices with the further improvement in the delivery of quality health care. © The Author 2016. Published by Oxford University Press in association with the International Society for Quality in Health Care. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

  16. Supply-related drivers of staff motivation for providing intermittent preventive treatment of malaria during pregnancy in Tanzania: evidence from two rural districts

    Directory of Open Access Journals (Sweden)

    Mubyazi Godfrey M

    2012-02-01

    Full Text Available Abstract Background Since its introduction in the national antenatal care (ANC system in Tanzania in 2001, little evidence is documented regarding the motivation and performance of health workers (HWs in the provision of intermittent preventive treatment of malaria during pregnancy (IPTp services in the national ANC clinics and the implications such motivation and performance might have had on HWs and services' compliance with the recommended IPTp delivery guidelines. This paper describes the supply-related drivers of motivation and performance of HWs in administering IPTp doses among other ANC services delivered in public and private health facilities (HFs in Tanzania, using a case study of Mkuranga and Mufindi districts. Methods Interviews were conducted with 78 HWs participating in the delivery of ANC services in private and public HFs and were supplemented by personal communications with the members of the district council health management team. The research instrument used in the data collection process contained a mixture of closed and open-ended questions. Some of the open-ended questions had to be coded in the form that allowed their analysis quantitatively. Results In both districts, respondents acknowledged IPTp as an essential intervention, but expressed dissatisfaction with their working environments constraining their performance, including health facility (HF unit understaffing; unsystematic and unfriendly supervision by CHMT members; limited opportunities for HW career development; and poor (HF infrastructure and staff houses. Data also suggest that poor working conditions negatively affect health workers' motivation to perform for ANC (including IPTp services. Similarities and differences were noted in terms of motivational factors for ANC service delivery between the HWs employed in private HFs and those in public HFs: those in private facilities were more comfortable with staff residential houses, HF buildings, equipment

  17. Supply-related drivers of staff motivation for providing intermittent preventive treatment of malaria during pregnancy in Tanzania: evidence from two rural districts

    Science.gov (United States)

    2012-01-01

    Background Since its introduction in the national antenatal care (ANC) system in Tanzania in 2001, little evidence is documented regarding the motivation and performance of health workers (HWs) in the provision of intermittent preventive treatment of malaria during pregnancy (IPTp) services in the national ANC clinics and the implications such motivation and performance might have had on HWs and services' compliance with the recommended IPTp delivery guidelines. This paper describes the supply-related drivers of motivation and performance of HWs in administering IPTp doses among other ANC services delivered in public and private health facilities (HFs) in Tanzania, using a case study of Mkuranga and Mufindi districts. Methods Interviews were conducted with 78 HWs participating in the delivery of ANC services in private and public HFs and were supplemented by personal communications with the members of the district council health management team. The research instrument used in the data collection process contained a mixture of closed and open-ended questions. Some of the open-ended questions had to be coded in the form that allowed their analysis quantitatively. Results In both districts, respondents acknowledged IPTp as an essential intervention, but expressed dissatisfaction with their working environments constraining their performance, including health facility (HF) unit understaffing; unsystematic and unfriendly supervision by CHMT members; limited opportunities for HW career development; and poor (HF) infrastructure and staff houses. Data also suggest that poor working conditions negatively affect health workers' motivation to perform for ANC (including IPTp) services. Similarities and differences were noted in terms of motivational factors for ANC service delivery between the HWs employed in private HFs and those in public HFs: those in private facilities were more comfortable with staff residential houses, HF buildings, equipment, availability of water

  18. Impacts of Deforestation on Sustainability in Tanzania

    OpenAIRE

    Ndyamukama, Fred

    2015-01-01

    The aim of this thesis was to summarize and analyze some of the main causes and consequences of the rapid and continuing deforestation in Tanzania, and to illustrate the impacts of the problem on the social, economic and environmental systems of the country. It also suggests the best methods for overcoming deforestation in Tanzania. The thesis is structured to critique previous methods proposed in other research studies, mainly those conducted by the Tanzania National Forest Programme. ...

  19. "Experiences with disclosure of HIV-positive status to the infected child": Perspectives of healthcare providers in Dar es Salaam, Tanzania.

    Science.gov (United States)

    Sariah, Adellah; Rugemalila, Joan; Somba, Magreat; Minja, Anna; Makuchilo, Margareth; Tarimo, Edith; Urassa, David; Siril, Helen

    2016-10-13

    The specific age to which an HIV infected child can be disclosed to is stipulated to begin between ages 4 and 6 years. It has also been documented that before disclosure of HIV positive status to the infected child. Health care providers should consider children's cognitive-developmental ability. However, observation and situation analysis show that, health care providers still feel uncomfortable disclosing the HIV positive status to the infected child. The aim of the study was to explore healthcare providers' experiences in disclosure of HIV-positive status to the infected child. A qualitative study involving 20 health care providers who attend HIV-positive children was conducted in September, 2014 in Dar es Salaam, Tanzania. Participants were selected from ten HIV care and treatment clinics (CTC) by purposive sampling. An interview guide, translated into participants' national language (Kiswahili) was used during in-depth interviews. Sampling followed the principle of data saturation. The interviews focused on perspectives of health-care providers regarding their experience with paediatric HIV disclosure. Data from in-depth interviews were transcribed into text; data analysis followed qualitative content analysis. The results show how complex the process of disclosure to children living with HIV can be to healthcare providers. Confusion was noted among healthcare providers about their role and responsibility in the process of disclosing to the HIV infected child. This was reported to be largely due to unclear guidelines and lack of standardized training in paediatric HIV disclosure. Furthermore, healthcare providers were concerned about parental hesitancy to disclose early to the child due to lack of disclosure skills and fear of stigma. In order to improve the disclosure process in HIV infected children, healthcare providers recommended further standardized training on paediatric HIV disclosure with more emphasis on practical skills and inclusion of disclosure

  20. The challenges of developing an instrument to assess health provider motivation at primary care level in rural Burkina Faso, Ghana and Tanzania

    Science.gov (United States)

    Prytherch, Helen; Leshabari, Melkidezek T.; Wiskow, Christiane; Aninanya, Gifty A.; Kakoko, Deodatus C.V.; Kagoné, Moubassira; Burghardt, Juliane; Kynast-Wolf, Gisela; Marx, Michael; Sauerborn, Rainer

    2012-01-01

    Background The quality of health care depends on the competence and motivation of the health workers that provide it. In the West, several tools exist to measure worker motivation, and some have been applied to the health sector. However, none have been validated for use in sub-Saharan Africa. The complexity of such tools has also led to concerns about their application at primary care level. Objective To develop a common instrument to monitor any changes in maternal and neonatal health (MNH) care provider motivation resulting from the introduction of pilot interventions in rural, primary level facilities in Ghana, Burkina Faso, and Tanzania. Design Initially, a conceptual framework was developed. Based upon this, a literature review and preliminary qualitative research, an English-language instrument was developed and validated in an iterative process with experts from the three countries involved. The instrument was then piloted in Ghana. Reliability testing and exploratory factor analysis were used to produce a final, parsimonious version. Results and discussion This paper describes the actual process of developing the instrument. Consequently, the concepts and items that did not perform well psychometrically at pre-test are first presented and discussed. The final version of the instrument, which comprises 42 items for self-assessment and eight for peer-assessment, is then shown. This is followed by a presentation and discussion of the findings from first use of the instrument with MNH providers from 12 rural, primary level facilities in each of the three countries. Conclusions It is possible to undertake work of this nature at primary health care level, particularly if the instruments are kept as straightforward as possible and well introduced. However, their development requires very lengthy preparatory periods. The effort needed to adapt such instruments for use in different countries within the region of sub-Saharan Africa should not be underestimated. PMID

  1. The challenges of developing an instrument to assess health provider motivation at primary care level in rural Burkina Faso, Ghana, and Tanzania

    Directory of Open Access Journals (Sweden)

    Helen Prytherch

    2012-10-01

    Full Text Available Background: The quality of health care depends on the competence and motivation of the health workers that provide it. In the West, several tools exist to measure worker motivation, and some have been applied to the health sector. However, none have been validated for use in sub-Saharan Africa. The complexity of such tools has also led to concerns about their application at primary care level. Objective: To develop a common instrument to monitor any changes in maternal and neonatal health (MNH care provider motivation resulting from the introduction of pilot interventions in rural, primary level facilities in Ghana, Burkina Faso, and Tanzania. Design: Initially, a conceptual framework was developed. Based upon this, a literature review and preliminary qualitative research, an English-language instrument was developed and validated in an iterative process with experts from the three countries involved. The instrument was then piloted in Ghana. Reliability testing and exploratory factor analysis were used to produce a final, parsimonious version. Results and discussion: This paper describes the actual process of developing the instrument. Consequently, the concepts and items that did not perform well psychometrically at pre-test are first presented and discussed. The final version of the instrument, which comprises 42 items for self-assessment and eight for peer-assessment, is then shown. This is followed by a presentation and discussion of the findings from first use of the instrument with MNH providers from 12 rural, primary level facilities in each of the three countries. Conclusions: It is possible to undertake work of this nature at primary health care level, particularly if the instruments are kept as straightforward as possible and well introduced. However, their development requires very lengthy preparatory periods. The effort needed to adapt such instruments for use in different countries within the region of sub-Saharan Africa should not

  2. Tanzania Corre

    African Journals Online (AJOL)

    DELL

    aspiration are cough, difficulty in breathing, wheezing and unresolved pulmonary infection. If these problems are noticed in time, the child will be immediately taken to hospital for further diagnosis and treatment accordingly. In Tanzania, there are no ENT doctors at the district or regional hospitals. The few available ENT ...

  3. Patient and provider determinants for receipt of three dimensions of respectful maternity care in Kigoma Region, Tanzania-April-July, 2016.

    Science.gov (United States)

    Dynes, M M; Twentyman, E; Kelly, L; Maro, G; Msuya, A A; Dominico, S; Chaote, P; Rusibamayila, R; Serbanescu, F

    2018-03-05

    Lack of respectful maternity care (RMC) is increasingly recognized as a human rights issue and a key deterrent to women seeking facility-based deliveries. Ensuring facility-based RMC is essential for improving maternal and neonatal health, especially in sub-Saharan African countries where mortality and non-skilled delivery care remain high. Few studies have attempted to quantitatively identify patient and delivery factors associated with RMC, and none has modeled the influence of provider characteristics on RMC. This study aims to help fill these gaps through collection and analysis of interviews linked between clients and providers, allowing for description of both patient and provider characteristics and their association with receipt of RMC. We conducted cross-sectional surveys across 61 facilities in Kigoma Region, Tanzania, from April to July 2016. Measures of RMC were developed using 21-items in a Principal Components Analysis (PCA). We conducted multilevel, mixed effects generalized linear regression analyses on matched data from 249 providers and 935 post-delivery clients. The outcomes of interest included three dimensions of RMC-Friendliness/Comfort/Attention; Information/Consent; and Non-abuse/Kindness-developed from the first three components of PCA. Significance level was set at p perception of fair pay (Perceives fair pay versus unfair pay: Coef 0.46), cadre (Nurses/midwives versus Clinicians: Coef - 0.46), and number of deliveries in the last month (11-20 versus perception of fair pay (Perceives fair pay versus unfair: Coef 0.37), weekly work hours (Coef 0.01), and age (30-39 versus 20-29 years: Coef - 0.34; 40-49 versus 20-29 years: Coef - 0.58). Significant provider-level determinants for Non-abuse/Kindness RMC included the predictors of age (age 50+ versus 20-29 years: Coef 0.34) and access to electronic mentoring (Access to two mentoring types versus none: Coef 0.37). These findings illustrate the value of including both client and

  4. The internal migration between public and faith-based health providers: a cross-sectional, retrospective and multicentre study from southern Tanzania.

    Science.gov (United States)

    Tabatabai, Patrik; Prytherch, Helen; Baumgarten, Inge; Kisanga, Oberlin M E; Schmidt-Ehry, Bergis; Marx, Michael

    2013-07-01

    To assess the magnitude, direction and underlying dynamics of internal health worker migration between public and faith-based health providers from a hospital perspective. Two complementary tools were implemented in 10 public and six faith-based hospitals in southern Tanzania. A hospital questionnaire assessed magnitude and direction of staff migration between January 2006 and June 2009. Interviews with 42 public and 20 faith-based maternity nurses evaluated differences in staff perspectives and motives for the observed migration patterns. The predominant direction of staff movement was from the faith-based to the public sector: 69.1% (n = 105/152) of hospital staff exits and 60.6% (n = 60/99) of hospital staff gains. Nurses were the largest group among the migrating health workforce. Faith-based hospitals lost 59.3% (n = 86/145) of nurses and 90.6% (n = 77/85) of registered nurses to the public sector, whereby public hospitals reported 13.5% (n = 59/436) of nurses and 24.4% (n = 41/168) of registered nurses being former faith-based employees. Interviews revealed significantly inferior staff perspectives among faith-based respondents than their public colleagues. Main differences were identified regarding career development and training, management support, employee engagement and workload. This study revealed considerable internal health worker migration from the faith-based to the public sector. Staff retention and motivation within faith-based hospitals are not restricted to financial considerations, and salary gaps can no longer uniquely explain this movement pattern. The consequences for the catchment area of faith-based hospitals are potentially severe and erode cooperation potential between the public and private health sector.

  5. Evaluation of collection methods for Culex quinquefasciatus, Aedes aegypti, and Aedes simpsoni in northeastern Tanzania.

    Science.gov (United States)

    Thornton, Jonathan Harold; Batengana, Bernard Malongo; Eiras, Alvaro Eduardo; Irish, Seth Robert

    2016-12-01

    In East Africa, significant morbidity and mortality are caused by infections spread by Culex quinquefasciatus and Aedes aegypti. Sticky traps have been shown to be effective tools for sampling populations of Aedes mosquitoes and have been found to catch Cx. quinquefasciatus. Thus, they could potentially be used to sample populations of this species. This study compared Sticky ovitraps (SO) and MosquiTraps (MQT) with the CDC Gravid trap (CDC-GT) for collection of Culex and Aedes mosquito populations in Tanzania. A follow-up experiment was carried out using traps set for a 24-h period to accommodate the oviposition habits of Aedes aegypti and Ae. simpsoni s.l. mosquitoes. The results showed that the CDC-GT caught significantly more Cx. quinquefasciatus and Ae. aegypti than the SO or MQT, but there was no significant difference in the number of mosquitoes caught between the two sticky traps or of Ae. simpsoni s.l. caught among the three trap types. The results suggest that CDC-GTs are the most appropriate in sampling of Cx. quinquefasciatus. Although CDC-GTs collected more Ae. aegypti than the sticky traps, the simplicity and cost benefit of sticky traps facilitates large scale studies. All three trap types should be considered for monitoring Aedes mosquitoes. © 2016 The Society for Vector Ecology.

  6. Antiproliferation effects of selected Tanzania plants | Choi | African ...

    African Journals Online (AJOL)

    Background: Plants still remain a prime source of drugs for the treatment of cancer and can provide leads for the development of novel anticancer agents. Our screening of indigenous medicinal plants from Tanzania has led to the identification of the number of anticancer activity. Material and methods: The current study ...

  7. Improved salt iodation methods for small-scale salt producers in low-resource settings in Tanzania

    Directory of Open Access Journals (Sweden)

    Assey Vincent D

    2009-06-01

    Full Text Available Abstract Background Universal salt iodation will prevent iodine deficiency disorders (IDD. Globally, salt-iodation technologies mostly target large and medium-scale salt-producers. Since most producers in low-income countries are small-scale, we examined and improved the performance of hand and knapsack-sprayers used locally in Tanzania. Methods We studied three salt facilities on the Bagamoyo coast, investigating procedures for preparing potassium-iodate solution, salt spraying and mixing. Different concentrations of solution were prepared and tested using different iodation methods, with the aim of attaining correct and homogeneous iodine levels under real-life conditions. Levels achieved by manual mixing were compared to those achieved by machine mixing. Results The overall median iodation level in samples of salt iodated using previously existing methods was 10.6 ppm (range 1.1 – 110.0 ppm, with much higher levels in the top than the bottom layers of the salt bags, p Conclusion Supervised, standardized salt iodation procedures adapted to local circumstances can yield homogeneous iodine levels within the required range, overcoming a major obstacle to universal salt iodation.

  8. Does training on performance based financing make a difference in performance and quality of health care delivery? Health care provider's perspective in Rungwe Tanzania.

    Science.gov (United States)

    Manongi, Rachel; Mushi, Declare; Kessy, Joachim; Salome, Saria; Njau, Bernard

    2014-04-04

    In recent years, Performance Based Financing (PBF); a form of result based financing, has attracted a global attention in health systems in developing countries. PBF promotes autonomous health facilities, motivates and introduces financial incentives to motivate health facilities and health workers to attain pre-determined targets. To achieve this, the Tanzanian government through the Christian Social Services Commission initiated a PBF pilot project in Rungwe district, Mbeya region. Kilimanjaro Christian Medical Center was given the role of training health workers on PBF principles in Rungwe. The aim of this study was to explore health care providers' perception on a three years training on PBF principles in a PBF pilot project at Rungwe District in Mbeya, Tanzania. This was an explorative qualitative study, which took place at Rungwe PBF pilot area in October 2012. Twenty six (26) participants were purposively selected. Six took part in- depth interviews (IDIs) and twenty (20) in the group discussions. Both the IDIs and the GDs explored the perceived benefit and challenges of implementing PBF in their workplace. Data were manually analyzed using content analysis approach. Overall informants had positive perspectives on PBF training. Most of the health facilities were able to implement some of the PBF concepts in their work places after the training, such as developing job descriptions for their staff, creating quarterly business plans for their facilities, costing for their services and entering service agreement with the government, improved record keeping, customer care and involving community as partners in running their facilities. The most common principle of paying individual performance bonuses was mentioned as a major challenge due to inadequate funding and poor design of Rungwe PBF pilot project. Despite poor design and inadequate funding, our findings have shown some promising results after PBF training in the study area. The findings have highlighted

  9. Vouchers for scaling up insecticide-treated nets in Tanzania: Methods for monitoring and evaluation of a national health system intervention

    Directory of Open Access Journals (Sweden)

    Bruce Jane

    2008-06-01

    Full Text Available Abstract Background The Tanzania National Voucher Scheme (TNVS uses the public health system and the commercial sector to deliver subsidised insecticide-treated nets (ITNs to pregnant women. The system began operation in October 2004 and by May 2006 was operating in all districts in the country. Evaluating complex public health interventions which operate at national level requires a multidisciplinary approach, novel methods, and collaboration with implementers to support the timely translation of findings into programme changes. This paper describes this novel approach to delivering ITNs and the design of the monitoring and evaluation (M&E. Methods A comprehensive and multidisciplinary M&E design was developed collaboratively between researchers and the National Malaria Control Programme. Five main domains of investigation were identified: (1 ITN coverage among target groups, (2 provision and use of reproductive and child health services, (3 "leakage" of vouchers, (4 the commercial ITN market, and (5 cost and cost-effectiveness of the scheme. Results The evaluation plan combined quantitative (household and facility surveys, voucher tracking, retail census and cost analysis and qualitative (focus groups and in-depth interviews methods. This plan was defined in collaboration with implementing partners but undertaken independently. Findings were reported regularly to the national malaria control programme and partners, and used to modify the implementation strategy over time. Conclusion The M&E of the TNVS is a potential model for generating information to guide national and international programmers about options for delivering priority interventions. It is independent, comprehensive, provides timely results, includes information on intermediate processes to allow implementation to be modified, measures leakage as well as coverage, and measures progress over time.

  10. Determinants of antiretroviral adherence among HIV positive children and teenagers in rural Tanzania: a mixed methods study.

    Science.gov (United States)

    Nyogea, Daniel; Mtenga, Sally; Henning, Lars; Franzeck, Fabian C; Glass, Tracy R; Letang, Emilio; Tanner, Marcel; Geubbels, Eveline

    2015-01-31

    Around 3.3 million children worldwide are infected with HIV and 90% of them live in sub-Saharan Africa. Our study aimed to estimate adherence levels and find the determinants, facilitators and barriers of ART adherence among children and teenagers in rural Tanzania. We applied a sequential explanatory mixed method design targeting children and teenagers aged 2-19 years residing in Ifakara. We conducted a quantitative cross sectional study followed by a qualitative study combining focus group discussions (FGDs) and in-depth interviews (IDIs). We used pill count to measure adherence and defined optimal adherence as > =80% of pills being taken. We analysed determinants of poor adherence using logistic regression. We held eight FGDs with adolescent boys and girls on ART and with caretakers. We further explored issues emerging in the FGDs in four in-depth interviews with patients and health workers. Qualitative data was analysed using thematic content analysis. Out of 116 participants available for quantitative analysis, 70% had optimal adherence levels and the average adherence level was 84%. Living with a non-parent caretaker predicted poor adherence status. From the qualitative component, unfavorable school environment, timing of the morning ART dose, treatment longevity, being unaware of HIV status, non-parental (biological) care, preference for traditional medicine (herbs) and forgetfulness were seen to be barriers for optimal adherence. The study has highlighted specific challenges in ART adherence faced by children and teenagers. Having a biological parent as a caretaker remains a key determinant of adherence among children and teenagers. To achieve optimal adherence, strategies targeting the caretakers, the school environment, and the health system need to be designed.

  11. Providing Automatic Support for Heuristic Rules of Methods

    NARCIS (Netherlands)

    Tekinerdogan, B.; Aksit, Mehmet; Demeyer, Serge; Bosch, H.G.P.; Bosch, Jan

    In method-based software development, software engineers create artifacts based on the heuristic rules of the adopted method. Most CASE tools, however, do not actively assist software engineers in applying the heuristic rules. To provide an active support, the rules must be formalized, implemented

  12. Beyond antimalarial stock-outs: implications of health provider compliance on out-of-pocket expenditure during care-seeking for fever in South East Tanzania.

    Science.gov (United States)

    Mikkelsen-Lopez, Inez; Tediosi, Fabrizio; Abdallah, Gumi; Njozi, Mustafa; Amuri, Baraka; Khatib, Rashid; Manzi, Fatuma; de Savigny, Don

    2013-10-27

    To better understand how stock-outs of the first line antimalarial, Artemisinin-based Combination Therapy (ACT) and other non-compliant health worker behaviour, influence household expenditures during care-seeking for fever in the Ulanga District in Tanzania. We combined weekly ACT stock data for the period 2009-2011 from six health facilities in the Ulanga District in Tanzania, together with household data from 333 respondents on the cost of fever care-seeking in Ulanga during the same time period to establish how health seeking behaviour and expenditure might vary depending on ACT availability in their nearest health facility. Irrespective of ACT stock-outs, more than half (58%) of respondents sought initial care in the public sector, the remainder seeking care in the private sector where expenditure was higher by 19%. Over half (54%) of respondents who went to the public sector reported incidences of non-compliant behaviour by the attending health worker (e.g. charging those who were eligible for free service or referring patients to the private sector despite ACT stock), which increased household expenditure per fever episode from USD0.14 to USD1.76. ACT stock-outs were considered to be the result of non-compliant behaviour of others in the health system and increased household expenditure by 21%; however we lacked sufficient statistical power to confirm this finding. System design and governance challenges in the Tanzanian health system have resulted in numerous ACT stock-outs and frequent non-compliant public sector health worker behaviour, both of which increase out-of-pocket health expenditure. Interventions are urgently needed to ensure a stable supply of ACT in the public sector and increase health worker accountability.

  13. Methods employed by public libraries in providing services to ...

    African Journals Online (AJOL)

    The study is on methods employed by public libraries in providing services to PLWHA in Benue State, Nigeria. The study area is Benue State , while the study design is descriptive survey. The population comprise d of 14 public librarians. A set of quest ionnaire was structured with 25 items for public librarians. Data was ...

  14. Conventialization of Numerals in Tanzania

    Science.gov (United States)

    Kajoro, Peter

    2012-01-01

    The supposed pre-eminence of an external examination can exert a disproportionate influence on a curriculum and the associated learning and teaching. Teaching can easily subordinate learning and understanding to curriculum coverage if the society develops a culture that appears to make such demands. This study focuses on Tanzania and provides the…

  15. Prioritization of intervention methods for prevention of communicable diseases in Tanzania

    Science.gov (United States)

    Mayo, A. W.

    Water, sanitation, housing and hygienic behavior plays dominant role in the transmission and intensification of diseases. To effectively utilize limited financial resources, it is important to prioritize disease intervention methods in order to minimize mortality and morbidity cases. Realization of the environmental health components that respond to the practical effects of their contribution to transmission of diseases has greater chances of effectively enhancing health. Data of frequency of diseases and mortality rate were collected from four municipal hospitals from districts of Ilala, Kinondoni, Temeke and Kibaha in Dar es Salaam and Coast Regions. The populations at risk were sub-categorized in relation to age; below five years and above five years. The age parameter assists on envisaging the major causes to be either in-house or in public domain. Data were analyzed to assess the role of water quality, water quantity, excreta disposal, waste disposal and hygiene education on spreading the diseases in order to come up with scientifically evaluated information. Scores were given to each intervention method depending on its importance in controlling a particular disease. The results indicate that incidences of malaria, skin and eye infections, pneumonia and diarrhea are frequent in these districts. Children under 5 years are particularly affected by pneumonia and diarrhea more than adults. Malaria, tuberculosis and pneumonia are the major causes of mortality rates in these districts. Fatality cases are caused largely by malaria, pneumonia and diarrhea for children less than 5 years, but malaria, tuberculosis and pneumonia are responsible for mortality rates in adults and children over 5 years. Statistical analysis revealed that in all districts, hygiene education is the major factor responsible for transmission of diseases accounting for 32-39%. Other factors, which are the major contributors to the incidences of diseases, are inadequacy of water (15.6-22.5%) and

  16. Evaluation of detection methods for Campylobacter infections among under-fives in Mwanza City, Tanzania.

    Science.gov (United States)

    Mushi, Martha Fidelis; Paterno, Laurent; Tappe, Dennis; Deogratius, Anna Pendo; Seni, Jeremiah; Moremi, Nyambura; Mirambo, Mariam Mwijuma; Mshana, Stephen Eliatosha

    2014-01-01

    Campylobacter species are recognized as a major cause of acute gastroenteritis in humans throughout the world. The diagnosis is mainly based on stool culture. This study was done to evaluate the effectiveness of staining methods (Gram stain using 0.3% carbol fuchsin as counter stain and 1% carbol fuchsin direct stain) versus culture as the gold standard. A total of 300 children attending Bugando Medical Centre (BMC) and the Sekou Toure regional hospital with acute watery diarrhea were enrolled. Two sets of slides were prepared stained with 1% carbol fuchsin for 30 seconds first set, and the second set stained with Gram's stain using 0.3% carbol fuchsin as counter stain for five minutes. Concurrently, stool samples were inoculated on Preston Agar selective. Of 300 stool specimens, 14(4.7%) showed positive culture after 48 hours of incubation and 28 (9.3%) shows typical morphology of Campylobacter species by both Gram stain and direct stain. The sensitivity of the Gram stain using 0.3% carbol fuchsin as counter stain and 1% carbol fuchsin simple stain versus culture as gold standard was 64.3%, with a specificity of 93.4%. The positive predictive value and negative predictive value were 32.1% and 98.2% respectively. The detection of Campylobacter by 1% carbol fuchsin is simple, inexpensive, and fast, with both a high sensitivity and specificity. Laboratories in settings with high prevalence of campylobacteriosis and/or limited resources can employ 1% carbol fuchsin direct stain in detecting campylobacter infections.

  17. A METHOD OF PROVIDING BURR-FREE BORES

    DEFF Research Database (Denmark)

    2004-01-01

    from vaporised and/or ionised material. As a result, vaporised melt material is sprayed to the sides or upwards along the sides of a drilled hole. These squirts can either damage the surface around the processed area or result in an upward burr. The method according to the invention provides...... an additional local steam/plasma pressure causing the ejected material to change direction in such a manner that the surface of the material is not damaged or a stricking burr is not formed. The local steam/plasma pressure can, for instance, be provided by an intense secondary laser beam being emitted downwards...

  18. REPLICATION TOOL AND METHOD OF PROVIDING A REPLICATION TOOL

    DEFF Research Database (Denmark)

    2016-01-01

    structured master surface (3a, 3b, 3c, 3d) having a lateral master pattern and a vertical master profile. The microscale structured master surface (3a, 3b, 3c, 3d) has been provided by localized pulsed laser treatment to generate microscale phase explosions. A method for producing a part with microscale...... protrusions. The microscale protrusions may be provided on a flange portion of a first part and are configured to act as energy directors when forming an ultrasonic joint with a cooperating flange portion of a second part....

  19. The costs of providing antiretroviral therapy services to HIV-infected individuals presenting with advanced HIV disease at public health centres in Dar es Salaam, Tanzania: Findings from a randomised trial evaluating different health care strategies.

    Directory of Open Access Journals (Sweden)

    Godfather Dickson Kimaro

    Full Text Available Understanding the costs associated with health care delivery strategies is essential for planning. There are few data on health service resources used by patients and their associated costs within antiretroviral (ART programmes in Africa.The study was nested within a large trial, which evaluated screening for cryptococcal meningitis and tuberculosis and a short initial period of home-based adherence support for patients initiating ART with advanced HIV disease in Tanzania and Zambia. The economic evaluation was done in Tanzania alone. We estimated costs of providing routine ART services from the health service provider's perspective using a micro-costing approach. Incremental costs for the different novel components of service delivery were also estimated. All costs were converted into US dollars (US$ and based on 2012 prices.Of 870 individuals enrolled in Tanzania, 434 were enrolled in the intervention arm and 436 in the standard care/control arm. Overall, the median (IQR age and CD4 cell count at enrolment were 38 [31, 44] years and 52 [20, 89] cells/mm3, respectively. The mean per patient costs over the first three months and over a one year period of follow up following ART initiation in the standard care arm were US$ 107 (95%CI 101-112 and US$ 265 (95%CI 254-275 respectively. ART drugs, clinic visits and hospital admission constituted 50%, 19%, and 19% of the total cost per patient year, while diagnostic tests and non-ART drugs (co-trimoxazole accounted for 10% and 2% of total per patient year costs. The incremental costs of the intervention to the health service over the first three months was US$ 59 (p<0.001; 95%CI 52-67 and over a one year period was US$ 67(p<0.001; 95%CI 50-83. This is equivalent to an increase of 55% (95%CI 51%-59% in the mean cost of care over the first three months, and 25% (95%CI 20%-30% increase over one year of follow up.

  20. Assessment of parental perception of malaria vaccine in Tanzania

    OpenAIRE

    Romore, Idda; Ali, Ali Mohamed; Semali, Innocent; Mshinda, Hassan; Tanner, Marcel; Abdulla, Salim

    2015-01-01

    Background Clinical trials of the RTS,S malaria vaccine have completed Phase III and the vaccine is on track for registration. Before making decisions about implementation, it is essential to prepare the ground for introducing the vaccine by assessing awareness and willingness to use malaria vaccines and to provide policy makers with evidence-based information on the best strategies to engage communities to manage the introduction of malaria vaccine in Tanzania. Methods In November 2011, as p...

  1. Malaria control in Tanzania

    Energy Technology Data Exchange (ETDEWEB)

    Yhdego, M.; Majura, P. (Ardhi Institute, Dar es Salaam (Tanzania))

    1988-01-01

    A review of the malaria control programs and the problem encountered in the United Republic of Tanzania since 1945 to the year 1986 is discussed. Buguruni, one of the squatter areas in the city of Dar es Salaam, is chosen as a case study in order to evaluate the economic advantage of engineering methods for the control of malaria infection. Although the initial capital cost of engineering methods may be high, the cost effectiveness requires a much lower financial burden of only about Tshs. 3 million compared with the conventional methods of larviciding and insecticiding which requires more than Tshs. 10 million. Finally, recommendations for the adoption of engineering methods are made concerning the upgrading of existing roads and footpaths in general with particular emphasis on drainage of large pools of water which serve as breeding sites for mosquitoes.

  2. Method for Providing Semiconductors Having Self-Aligned Ion Implant

    Science.gov (United States)

    Neudeck, Philip G. (Inventor)

    2014-01-01

    A method is disclosed that provides a self-aligned nitrogen-implant particularly suited for a Junction Field Effect Transistor (JFET) semiconductor device preferably comprised of a silicon carbide (SiC). This self-aligned nitrogen-implant allows for the realization of durable and stable electrical functionality of high temperature transistors such as JFETs. The method implements the self-aligned nitrogen-implant having predetermined dimensions, at a particular step in the fabrication process, so that the SiC junction field effect transistors are capable of being electrically operating continuously at 500.degree. C. for over 10,000 hours in an air ambient with less than a 10% change in operational transistor parameters.

  3. Method for providing a low density high strength polyurethane foam

    Science.gov (United States)

    Whinnery, Jr., Leroy L.; Goods, Steven H.; Skala, Dawn M.; Henderson, Craig C.; Keifer, Patrick N.

    2013-06-18

    Disclosed is a method for making a polyurethane closed-cell foam material exhibiting a bulk density below 4 lbs/ft.sup.3 and high strength. The present embodiment uses the reaction product of a modified MDI and a sucrose/glycerine based polyether polyol resin wherein a small measured quantity of the polyol resin is "pre-reacted" with a larger quantity of the isocyanate in a defined ratio such that when the necessary remaining quantity of the polyol resin is added to the "pre-reacted" resin together with a tertiary amine catalyst and water as a blowing agent, the polymerization proceeds slowly enough to provide a stable foam body.

  4. Method for providing oxygen ion vacancies in lanthanide oxides

    Science.gov (United States)

    Kay, D. Alan R.; Wilson, William G.

    1989-12-05

    A method for desulfurization of fuel gases resulting from the incomplete combustion of sulfur containing hydrocarbons whereby the gases are treated with lanthanide oxides containing large numbers of oxygen-ion vacancies providing ionic porosity which enhances the ability of the lanthanide oxides to react more rapidly and completely with the sulfur in the fuel gases whereby the sulfur in such gases is reduced to low levels suitable for fuels for firing into boilers of power plants generating electricity with steam turbine driven generators, gas turbines, fuel cells and precursors for liquid fuels such as methanol and the like.

  5. Sexual practices among unmarried adolescents in Tanzania

    OpenAIRE

    Kazaura, Method R; Masatu, Melkiory C

    2009-01-01

    Abstract Background Sexual activities are increasingly changing from the cultural point of view what they used to be. Knowledge of these practices among adolescents may be a basis to create awareness among adolescents on practices that involve risks. This study aims to assess sexual practices among unmarried adolescents in Tanzania. Methods A cross-sectional survey was conducted among in-school and out-of-school but unmarried adolescents aged 10 to 19 in five locations in Tanzania. A question...

  6. An Optical WDM Network Concept for Tanzania

    OpenAIRE

    S. Pazi; C. Chatwin; R. Young; P. Birch

    2009-01-01

    Tanzania is a developing country, which significantly lags behind the rest of the world in information communications technology (ICT), especially for the Internet. Internet connectivity to the rest of the world is via expensive satellite links, thus leaving the majority of the population unable to access the Internet due to the high cost. This paper introduces the concept of an optical WDM network for Internet infrastructure in Tanzania, so as to reduce Internet connection costs, and provide...

  7. An estimation of inguinal hernia epidemiology adjusted for population age structure in Tanzania.

    Science.gov (United States)

    Beard, J H; Oresanya, L B; Akoko, L; Mwanga, A; Dicker, R A; Harris, H W

    2014-04-01

    Surgical conditions represent a significant source of global disease burden. Little is known about the epidemiology of inguinal hernia in resource-poor settings. We present a method to estimate inguinal hernia disease burden in Tanzania. Using data from the United States National Health and Nutrition Examination Survey (NHANES) prospective cohort study and Tanzanian demographic figures, we calculated inguinal hernia incidence and prevalence in Tanzanian adults under three surgical rate scenarios. Gender-specific incidence figures from NHANES data were adjusted according to Tanzanian population age structure. Hernia duration was adjusted for Tanzanian life expectancy within each age group. The prevalence of inguinal hernia in Tanzanian adults is 5.36% while an estimated 12.09% of men had hernias. Today, 683,904 adults suffer from symptomatic inguinal hernia in Tanzania. The annual incidence of symptomatic hernias in Tanzanian adults is 163 per 100,000 population. At Tanzania's current hernia repair rate, a backlog of 995,874 hernias in need of repair will develop over 10 years. 4.4 million disability-adjusted life-years would be averted with repair of prevalent symptomatic hernias in Tanzania. Our data indicate the extent of inguinal hernia disease burden in Tanzania. By adjusting our figures for the age structure of Tanzania, we have demonstrated that while the incidence of symptomatic cases may be lower than previously thought, prevalence of inguinal hernia in Tanzania remains high. This approach provides an update to our previously described methodology for calculation of inguinal hernia epidemiology in resource-poor settings that may be used in multiple country contexts.

  8. Archives: Tanzania Veterinary Journal

    African Journals Online (AJOL)

    Items 1 - 15 of 15 ... Archives: Tanzania Veterinary Journal. Journal Home > Archives: Tanzania Veterinary Journal. Log in or Register to get access to full text downloads. Username, Password, Remember me, or Register · Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue · Archives. 1 - 15 of 15 Items ...

  9. Male condom use in Tanzania: results from a national survey ...

    African Journals Online (AJOL)

    Objective: To determine factors associated with male condom use in Tanzania. Methods: Data from the 1996 Tanzania Demographic and Health Survey (TDHS) was used. In this survey, a national representative sample of sexually active men (N= 1898) and women (N=7027) were interviewed to obtain information about ...

  10. MALE CONDOM USE IN TANZANIA: RESULTS FROM A NATIONAL ...

    African Journals Online (AJOL)

    Kateee

    2003-04-01

    Apr 1, 2003 ... Objective: To determine factors associated with male condom use in Tanzania. Methods: Data from the 1996 Tanzania Demographic and Health Survey (TDHS) was used. In this survey, a national representative sample of sexually active men (N= 1898) and women. (N=7027) were interviewed to obtain ...

  11. Sixty Years of Special Needs Education in Tanzania: Celebrating ...

    African Journals Online (AJOL)

    This study traces the development of special needs education in Tanzania from 1950, and discusses the achievements and the persistent challenges that Tanzania is facing as we celebrate 60 years since the first special education school was started. Both documentation and interview methods were used to collect ...

  12. Training Teachers in Special Needs Education in Tanzania: A Long ...

    African Journals Online (AJOL)

    This study examined the training of special education teachers in Tanzania. Specifically it aimed at providing in brief, the history and the challenges that Tanzania is facing in the training of special education teachers. Fifteen special education teachers, five females and ten males, were interviewed. The results showed that ...

  13. The Book Industry in Tanzania. Occasional Paper No. 15.

    Science.gov (United States)

    Kaungamno, E. E.

    This comprehensive treatment of the state of the publishing industry in Tanzania provides a general description of the book trade in Africa, including discussions of the types of publishers active in Africa and of the recording of African publishing output, and a review of publishing activities in Tanzania, which covers the history of Tanzanian…

  14. A method for calculating active feedback system to provide vertical ...

    Indian Academy of Sciences (India)

    the control of plasma vertical position with active feedback system. Calculation of feed- back control parameters is formulated as an optimization problem and an approximate method to solve the problem is suggested. Numerical simulations are performed with parameters of the T-15M tokamak in order to justify the ...

  15. SERS substrate and a method of providing a SERS substrate

    DEFF Research Database (Denmark)

    2011-01-01

    Source: US2011116089A A substrate primarily for SERS determination, the substrate has a number of elongate elements with a density of at least 1x108 elongate elements per cm2 and having metal coated tips. When the elements may be made to lean toward each other, such as by providing a drop...

  16. Tanzania Medical Journal

    African Journals Online (AJOL)

    reviewed, medical and health science journal published three times a year in January-April, May-August and September – December, by the Medical Association of Tanzania (MAT). The journal publishes any contribution that advances medical ...

  17. information in Tanzania

    African Journals Online (AJOL)

    The TV programmes presented included news, entertainment, advertisements, announcements, health and other educational ... Tanzania was slow in adopting technological changes that was taking place worldwide partly ..... of a Workshop on Science and Technology. Communication Networks in Africa August 2 7-.

  18. Tanzania - Water Supply & Expansion

    Data.gov (United States)

    Millennium Challenge Corporation — Social Impact (SI) has been contracted by MCC to carry out an impact evaluation (IE) of the Tanzania Water Sector Project. This IE examines the effect of the WSP...

  19. Does DFT-SAPT method provide spectroscopic accuracy?

    Energy Technology Data Exchange (ETDEWEB)

    Shirkov, Leonid; Makarewicz, Jan, E-mail: jama@amu.edu.pl [Faculty of Chemistry, Adam Mickiewicz University, Umultowska 89b, 61-614 Poznań (Poland)

    2015-02-14

    Ground state potential energy curves for homonuclear and heteronuclear dimers consisting of noble gas atoms from He to Kr were calculated within the symmetry adapted perturbation theory based on the density functional theory (DFT-SAPT). These potentials together with spectroscopic data derived from them were compared to previous high-precision coupled cluster with singles and doubles including the connected triples theory calculations (or better if available) as well as to experimental data used as the benchmark. The impact of midbond functions on DFT-SAPT results was tested to study the convergence of the interaction energies. It was shown that, for most of the complexes, DFT-SAPT potential calculated at the complete basis set (CBS) limit is lower than the corresponding benchmark potential in the region near its minimum and hence, spectroscopic accuracy cannot be achieved. The influence of the residual term δ(HF) on the interaction energy was also studied. As a result, we have found that this term improves the agreement with the benchmark in the repulsive region for the dimers considered, but leads to even larger overestimation of potential depth D{sub e}. Although the standard hybrid exchange-correlation (xc) functionals with asymptotic correction within the second order DFT-SAPT do not provide the spectroscopic accuracy at the CBS limit, it is possible to adjust empirically basis sets yielding highly accurate results.

  20. Evolution of Elections Management in Tanzania

    Science.gov (United States)

    Norman, A. S.; Mdegella, O. M.; Lubawa, R. M.

    2011-01-01

    This paper provides a discussion on the evolution of elections management in Tanzania with a focus on technological advancement in administering registration of voters. The paper provides the merits that permanent voters register has brought over the thumb practice. It traces the management of elections during colonialism, after independence…

  1. "It is like that, we didn't understand each other": exploring the influence of patient-provider interactions on prevention of mother-to-child transmission of HIV service use in rural Tanzania.

    Directory of Open Access Journals (Sweden)

    Annabelle Gourlay

    Full Text Available Interactions between patients and service providers frequently influence uptake of prevention of mother-to-child transmission (PMTCT HIV services in sub-Saharan Africa, but this process has not been examined in depth. This study explores how patient-provider relations influence PMTCT service use in four government facilities in Kisesa, Tanzania. Qualitative data were collected in 2012 through participatory group activities with community members (3 male, 3 female groups, in-depth interviews with 21 women who delivered recently (16 HIV-positive, 9 health providers, and observations in antenatal clinics. Data were transcribed, translated into English and analysed with NVIVO9 using an adapted theoretical model of patient-centred care. Three themes emerged: decision-making processes, trust, and features of care. There were few examples of shared decision-making, with a power imbalance in favour of providers, although they offered substantial psycho-social support. Unclear communication by providers, and patients not asking questions, resulted in missed services. Omission of pre-HIV test counselling was often noted, influencing women's ability to opt-out of HIV testing. Trust in providers was limited by confidentiality concerns, and some HIV-positive women were anxious about referrals to other facilities after establishing trust in their original provider. Good care was recounted by some women, but many (HIV-positive and negative described disrespectful staff including discrimination of HIV-positive patients and scolding, particularly during delivery; exacerbated by lack of materials (gloves, sheets and associated costs, which frustrated staff. Experienced or anticipated negative staff behaviour influenced adherence to subsequent PMTCT components. Findings revealed a pivotal role for patient-provider relations in PMTCT service use. Disrespectful treatment and lack of informed consent for HIV testing require urgent attention by PMTCT programme

  2. The potential role of mother-in-law in prevention of mother-to-child transmission of HIV: a mixed methods study from the Kilimanjaro region, northern Tanzania

    Directory of Open Access Journals (Sweden)

    Leshabari Sebalda

    2011-07-01

    Full Text Available Abstract Background In the Kilimanjaro region the mother-in-law has traditionally had an important role in matters related to reproduction and childcare. The aim of this study was to explore the role of the mothers-in-law in prevention of mother-to-child transmission (PMTCT service utilization and adherence to infant feeding guidelines. Methods The study was conducted during 2007-2008 in rural and urban areas of Moshi district in the Kilimanjaro region of Tanzania. Mixed methods were used and included focus group discussions with mothers-in-law, mothers and fathers; in-depth interviews with mothers-in-law, mothers, fathers and HIV-infected mothers, and a survey of 446 mothers bringing their four-week-old infants for immunisation at five reproductive and child health clinics. Results The study demonstrated that the mother-in-law saw herself as responsible for family health issues in general and child care in particular. However she received limited trust, and couples, in particular couples living in urban areas, tended to exclude her from decisions related to childbearing and infant feeding. Mothers-in-law expected their daughters-in-law to breastfeed in a customary manner and were generally negative towards the infant feeding methods recommended for HIV-infected mothers; exclusive replacement feeding and exclusive breastfeeding. Conclusions Decreasing influence of the mother-in-law and increasing prominence of the conjugal couples in issues related to reproduction and child care, reinforce the importance of continued efforts to include male partners in the PMTCT programme. The potential for involving mothers-in-law in the infant feeding component, where she still has influence in some areas, should be further explored.

  3. Tanzania River Scoring System (TARISS): a macroinvertebrate ...

    African Journals Online (AJOL)

    The biological assessment of rivers using aquatic macroinvertebrates is an internationally recognised approach for the determination of riverine ecological conditions. In this study a Tanzanian macroinvertebrate-based biotic method, Tanzania River Scoring System (TARISS), was developed in 2012, based on the South ...

  4. Country programme review. United Republic of Tanzania

    International Nuclear Information System (INIS)

    Cuaron, A.; Hance, R.; Yurtsever, Y.; Maudarbocus, V.

    1992-01-01

    This document provides a review of past and present IAEA Technical Co-operation Activities in Tanzania and gives descriptions of the current status of nuclear applications in food and agriculture, human health, water resources and industrial applications/nuclear instrumentation

  5. Review of the State of Health in Tanzania 2004

    OpenAIRE

    Lorenz, Nicolaus; Mpemba, Cyprian

    2005-01-01

    The Ministry of Health has mandated an independent review of the State of Health in Tanzania for there the year 2004. The objective was to provide an overview on the health situation in Tanzania, to assess if have been improvements in public health service delivery, to comment on the Tanzanian’s perception of health services, discuss equity in accessing health care, to identify successes and challenges and to provide. The methodology was to utilise existing documented data and other availabl...

  6. Use of Modern Technologies in Improving Astronomy Education in Tanzania

    Science.gov (United States)

    Jiwaji, N. T.

    2006-08-01

    With only the most basic astronomy content officially included in the Physics syllabus of Secondary Schools in Tanzania and a one semester Astrophysics option course offered in the Physics Department of one University, the reasons for apathy towards astronomy education in Tanzania are discussed. Using the current focus on introducing ICT into Primary and Secondary schools in Tanzania, the potential for advancing astronomy education per se and natural sciences in general is presented. Limiting factors such as teachers in general and science and astronomy literate teachers in particular, infrastructure and running costs of providing ICT based education, cultural impediments need to be overcome.

  7. Combination of Insecticide Treated Nets and Indoor Residual Spraying in Northern Tanzania Provides Additional Reduction in Vector Population Density and Malaria Transmission Rates Compared to Insecticide Treated Nets Alone: A Randomised Control Trial.

    Science.gov (United States)

    Protopopoff, Natacha; Wright, Alexandra; West, Philippa A; Tigererwa, Robinson; Mosha, Franklin W; Kisinza, William; Kleinschmidt, Immo; Rowland, Mark

    2015-01-01

    Indoor residual spraying (IRS) combined with insecticide treated nets (ITN) has been implemented together in several sub-Saharan countries with inconclusive evidence that the combined intervention provides added benefit. The impact on malaria transmission was evaluated in a cluster randomised trial comparing two rounds of IRS with bendiocarb plus universal coverage ITNs, with ITNs alone in northern Tanzania. From April 2011 to December 2012, eight houses in 20 clusters per study arm were sampled monthly for one night with CDC light trap collections. Anopheles gambiae s.l. were identified to species using real time PCR Taq Man and tested for the presence of Plasmodium falciparum circumsporozoite protein. ITN and IRS coverage was estimated from household surveys. IRS coverage was more than 85% in two rounds of spraying in January and April 2012. Household coverage with at least one ITN per house was 94.7% after the universal coverage net campaign in the baseline year and the proportion of household with all sleeping places covered by LLIN was 50.1% decreasing to 39.1% by the end of the intervention year. An.gambiae s.s. comprised 80% and An.arabiensis 18.3% of the anopheline collection in the baseline year. Mean An.gambiae s.l. density in the ITN+IRS arm was reduced by 84% (95%CI: 56%-94%, p = 0.001) relative to the ITN arm. In the stratum of clusters categorised as high anopheline density at baseline EIR was lower in the ITN+IRS arm compared to the ITN arm (0.5 versus 5.4 per house per month, Incidence Rate Ratio: 0.10, 95%CI: 0.01-0.66, p-value for interaction <0.001). This trial provides conclusive evidence that combining carbamate IRS and ITNs produces major reduction in Anopheles density and entomological inoculation rate compared to ITN alone in an area of moderate coverage of LLIN and high pyrethroid resistance in An.gambiae s.s.

  8. Factors affecting adoption, implementation fidelity, and sustainability of the Redesigned Community Health Fund in Tanzania: a mixed methods protocol for process evaluation in the Dodoma region

    Directory of Open Access Journals (Sweden)

    Albino Kalolo

    2015-12-01

    Full Text Available Background: Despite the implementation of various initiatives to address low enrollment in voluntary micro health insurance (MHI schemes in sub-Saharan Africa, the problem of low enrollment remains unresolved. The lack of process evaluations of such interventions makes it difficult to ascertain whether their poor results are because of design failures or implementation weaknesses. Objective: In this paper, we describe a process evaluation protocol aimed at opening the ‘black box’ to evaluate the implementation processes of the Redesigned Community Health Fund (CHF program in the Dodoma region of Tanzania. Design: The study employs a cross-sectional mixed methods design and is being carried out 3 years after the launch of the Redesigned CHF program. The study is grounded in a conceptual framework which rests on the Diffusion of Innovation Theory and the Implementation Fidelity Framework. The study utilizes a mixture of quantitative and qualitative data collection tools (questionnaires, focus group discussions, in-depth interviews, and document review, and aligns the evaluation to the Theory of Intervention developed by our team. Quantitative data will be used to measure program adoption, implementation fidelity, and their moderating factors. Qualitative data will be used to explore the responses of stakeholders to the intervention, contextual factors, and moderators of adoption, implementation fidelity, and sustainability. Discussion: This protocol describes a systematic process evaluation in relation to the implementation of a reformed MHI. We trust that the theoretical approaches and methodologies described in our protocol may be useful to inform the design of future process evaluations focused on the assessment of complex interventions, such as MHI schemes.

  9. Tanzania Veterinary Journal

    African Journals Online (AJOL)

    The Tanzania Veterinary Journal (The Tropical Veterinarian) is a biannual Journal, which publishes original contribution to knowledge on Veterinary Science, Animal Science and Production, and allied sciences including new techniques and developments in Veterinary Medicine. The target readers of the Journal are the ...

  10. IDRC in Tanzania

    International Development Research Centre (IDRC) Digital Library (Canada)

    areas, as well as in food security, has contributed to significant ... Our support is helping. I Communities achieve food security ... Funding: $1,338,300. Other donor: Government of Canada. Fast-Start Financing. Duration: 2011–2014. Grantee: Sokoine University of. Agriculture, Tanzania. The Horn of Africa is enduring more ...

  11. IDRC in Tanzania

    International Development Research Centre (IDRC) Digital Library (Canada)

    Current farming practices in rural Tanzania limit the production and nutritional value of goat milk. To increase the milk's benefits and enhance food security, Canadian and. Tanzanian researchers are testing new approaches, including growing improved root crop varieties, for consumption by both livestock and people.

  12. IDRC in Tanzania

    International Development Research Centre (IDRC) Digital Library (Canada)

    Management Trust, United Kingdom. In many developing countries, lack of resources for public records administration can lead to inefficiency and lack of transparency. Researchers are studying judicial records management in Kenya, Tanzania, and Uganda to improve the administration of justice. I Agricultural innovation.

  13. Tanzania Journal of Science

    African Journals Online (AJOL)

    The Tanzania Journal of Science (Tanz. J. Sci.) was established in 1975 as a forum for communication and co-ordination between and among scientists and allied professionals. It is also intended as a medium for dissemination of scientific knowledge among scientists and the public at large to promote the advancement of ...

  14. Tanzania Medical Journal: Submissions

    African Journals Online (AJOL)

    The Tanzania Medical Journal is a multi – disciplinary journal published two times a year in March - June and September – December. ... To achieve its objectives the journal invites papers on original scientific research, short communications, case reports and letters to the editor, in any branch of medical science. Original ...

  15. Crater Highlands, Tanzania

    Science.gov (United States)

    2006-01-01

    The Shuttle Radar Topography Mission (SRTM), flown aboard Space Shuttle Endeavour in February 2000, acquired elevation measurements for nearly all of Earth's landmass between 60oN and 56oS latitudes. For many areas of the world SRTM data provide the first detailed three-dimensional observation of landforms at regional scales. SRTM data were used to generate this view of the Crater Highlands along the East African Rift in Tanzania. Landforms are depicted with colored height and shaded relief, using a vertical exaggeration of 2X and a southwestwardly look direction. Lake Eyasi is depicted in blue at the top of the image, and a smaller lake occurs in Ngorongoro Crater. Near the image center, elevations peak at 3648 meters (11,968 feet) at Mount Loolmalasin, which is south of Ela Naibori Crater. Kitumbeine (left) and Gelai (right) are the two broad mountains rising from the rift lowlands. Mount Longido is seen in the lower left, and the Meto Hills are in the right foreground. Tectonics, volcanism, landslides, erosion and deposition -- and their interactions -- are all very evident in this view. The East African Rift is a zone of spreading between the African (on the west) and Somali (on the east) crustal plates. Two branches of the rift intersect here in Tanzania, resulting in distinctive and prominent landforms. One branch trends nearly parallel the view and includes Lake Eyasi and the very wide Ngorongoro Crater. The other branch is well defined by the lowlands that trend left-right across the image (below center, in green). Volcanoes are often associated with spreading zones where magma, rising to fill the gaps, reaches the surface and builds cones. Craters form if a volcano explodes or collapses. Later spreading can fracture the volcanoes, which is especially evident on Kitumbeine and Gelai Mountains (left and right, respectively, lower center). The Crater Highlands rise far above the adjacent savannas, capture moisture from passing air masses, and host rain

  16. Long-acting reversible contraception method use among Title X providers and non-Title X providers in California.

    Science.gov (United States)

    Park, Hye-Youn; Rodriguez, Maria I; Hulett, Denis; Darney, Philip D; Thiel de Bocanegra, Heike

    2012-11-01

    Publicly funded family planning services play an important role in reducing unintended pregnancy by providing access to effective contraception. We assessed whether California family planning providers receiving federal Title X funds are more likely to offer on-site long-acting reversible contraception (LARC) methods than those who do not receive these funds. Using 2009 administrative data, we examined on-site utilization of LARC by clinic type (Title X public, non-Title X public, or private) and constructed beta-binomial logistic regression models. The odds of on-site LARC services in non-Title X public and private providers were decreased by 35% [Odds Ratio (OR)=0.65, 95% confidence interval (CI) 0.54-0.79] and 61% [OR=0.39, 95% CI 0.32-0.47], respectively, compared to those of Title X providers after controlling for clinic size, urban/rural location, and proportion of teen, African-American, and Latina clients. On-site utilization of LARC is a potential quality indicator for family planning programs. Title X resources are associated with increased use of LARC. Published by Elsevier Inc.

  17. Tanzania country study

    Energy Technology Data Exchange (ETDEWEB)

    Meena, H.E. [Centre for Energy, Environment, Science and Technology, Dar es Salaam (Tanzania, United Republic of)

    1998-10-01

    An objective of this study is to analyse the role of the land use sectors of Tanzania (especially forestry) on mitigation of greenhouse gases. Specific emphasis is placed on the relationship between forestry and energy supply from biomass. This is a follow up study on an earlier effort which worked on mitigation options in the country without an in-depth analysis of the forestry and land use sectors. (au)

  18. Tanzania country study

    International Nuclear Information System (INIS)

    Meena, H.E.

    1998-01-01

    An objective of this study is to analyse the role of the land use sectors of Tanzania (especially forestry) on mitigation of greenhouse gases. Specific emphasis is placed on the relationship between forestry and energy supply from biomass. This is a follow up study on an earlier effort which worked on mitigation options in the country without an in-depth analysis of the forestry and land use sectors. (au)

  19. Tanzania's healthcare breakthrough | IDRC - International ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    2010-11-18

    Nov 18, 2010 ... ... recalls Hassan Mshinda, a former health researcher and now director general of the Tanzania Commission for Science and Technology. Since then, Tanzania has rolled out these health reforms nationwide. The result: dramatic improvements in health for children and adults throughout the entire country.

  20. Verbal Autopsies in Rural Tanzania

    African Journals Online (AJOL)

    Maternal mortality rates in rural Tanzania are high. In preparation for the introduction of an intervention to reduce maternal deaths by distribution of misoprostol and erythromycin to women living in rural Rorya District, Mara Region, Tanzania, we conducted a limited verbal autopsy by surveying family members of women ...

  1. Corporal Punishment in Tanzania's Schools

    Science.gov (United States)

    Feinstein, Sheryl; Mwahombela, Lucas

    2010-01-01

    The purpose of this survey was to acquire descriptive information regarding corporal punishment in Tanzania's O-level secondary schools. 448 individuals participated in the study: 254 teachers and 194 students, all from government or private secondary schools in the Iringa Region of Tanzania. In addition, 14 students and 14 teachers were…

  2. Archives: Tanzania Journal of Science

    African Journals Online (AJOL)

    Items 1 - 26 of 26 ... Archives: Tanzania Journal of Science. Journal Home > Archives: Tanzania Journal of Science. Log in or Register to get access to full text downloads. Username, Password, Remember me, or Register · Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue · Archives. 1 - 26 of 26 Items ...

  3. A novel method of providing a library of n-mers or biopolymers

    DEFF Research Database (Denmark)

    2012-01-01

    The present invention relates to a method of providing a library of n-mer sequences, wherein the library is composed of an n-mer sequence. Also the invention concerns a method of providing a library of biopolymer sequences having one or more n-mers in common. Further provided are specific primers...

  4. Exposure to Aflatoxin and Fumonisin in Children at Risk for Growth Impairment in Rural Tanzania

    Science.gov (United States)

    Background. Stunted growth is a major public health issue for children in Tanzania. We examined dietary exposures to aflatoxin and fumonisin and their potential roles in growth impairment in children under 36 months of age in Haydom, Tanzania. Methods. Plasma samples collected at 24 months of age ...

  5. Early Child Development and Care in Tanzania: Challenges for the Future

    Science.gov (United States)

    Mtahabwa, Lyabwene

    2009-01-01

    Much remains unknown about the status of early child development and care in Tanzania. The little information available has never been put together to provide a holistic picture of the progress so far made in this important area. This paper intends to synchronise the information available in Tanzania for the purpose of depicting the country's…

  6. Present health situation in Tanzania.

    Science.gov (United States)

    Dominicus, D A; Todoriki, H; Akamatsu, T; Gunshin, H

    1990-02-01

    This article discusses the present health situation in Tanzania, however, health system before independence, the colonial health system, has been the foundation on which the present health services in Tanzania are built upon. The population growth in Tanzania is high (3.2% in 1986), and projected to be 3.7% by the year 2,000. This high growth explains why it is difficult to achieve health objectives on the long term basis. Compounded to this is the economical crisis in the country. Child population in Tanzania account for about 47% of the total population in 1986. Maternal and Child Health Care services (MCHC) are discussed, with much emphasis on the child health care problems, and different programmes involved in improving child health care in the country. Problems of poor environmental sanitation are discussed including possible solutions for Tanzania. Tanzania, in this article, is urged to strengthen the existing health services in terms of staff, drugs, other supplies and equipment in order to give adequate health care to its people. Tanzania should also balance the distribution of resources between urban and rural so as to comply with the objective of the national health policy of comprehensive basic health services equitably to all within the limited available resources and to be able to reach the ultimate goal of health for all the people in the country by the year 2,000.

  7. Country Presentation Tanzania

    International Nuclear Information System (INIS)

    KIFANGA, L.D.; GYIMBI, H.; MLOWOLA, V.; KASONGWA, M.

    2010-01-01

    Discusses overview of incidents and developments involving illicit trafficking of nuclear and other radioactive materials in Tanzania.13 cases have been recorded between 1996 and 2008. All cases occurred in Dar Es Salam. Police, customs and security staff intercepted the sources and culprits arrested. The latest incident occurred in May 2008 and involved illegal possession of a capsule labelled nuclear material (U-238). A total of 14 sources were seized . Types of sources seized were u-238, Caesium-137, Strontium-90 and Radium-226.

  8. Sleeping sickness situation in Tanzania | Kibona | Tanzania Journal ...

    African Journals Online (AJOL)

    Tanzania Journal of Health Research. Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue · Archives · Journal Home > Vol 4, No 2 (2002) >. Log in or Register to get access to full text downloads.

  9. The current status of radiological protection infraestructures in Tanzania

    International Nuclear Information System (INIS)

    Ngalie, J.E.; Mompome, W.K.; Meza, L.H.

    2008-01-01

    Without adequate and sustainable radiation protection infrastructure, the benefits associated with safe use of nuclear technology and atomic energy might be jeopardized. In the United Republic of Tanzania, the Atomic Energy Act No. 7 of 2003 established the Tanzania Atomic Energy Commission as sole regulatory body responsible for regulating and controlling the safe and peaceful utilization of nuclear technology in the country. The Atomic Energy (Protection from ionizing radiation) Regulations, 2004 further specifies practices designed to ensure that unnecessary exposure of persons to ionizing radiation is avoided, that all exposures are kept as low as reasonably achievable and that all the dose limits specified in the radiation protection standards are not exceeded. This is achieved through the systems of notification, authorizations through registration and licensing, safety and security of radiation sources as well as regulatory inspections and enforcements. These activities are performed by the Commission with operational funds allocated by the Government of Tanzania. The Commission further provides other services namely individual monitoring; calibration services; education and training to radiation workers, public as well as law enforcers; and safe management of radioactive waste. Despite such achievement, still there are a lot to be done in order to strengthen the radiation protection infrastructure in Tanzania. These include issues such as gaps in our legislations, regulations and guidance, security of sources, enforcement of laws, etc. This paper describes and discusses the current status of the regulatory control activities and radiation protection services provided by the Commission and suggestions for further improvement of radiological protection infrastructure in Tanzania. (author)

  10. A method of providing a barrier in a fracture-containing system

    DEFF Research Database (Denmark)

    2014-01-01

    The present invention relates to a method of providing a barrier in a fracture-containing system, comprising: i) Providing a treatment fluid comprising: a) a base fluid; b) an elastomeric material, wherein said elastomeric material comprises at least one polymer capable of crosslinking into an el......The present invention relates to a method of providing a barrier in a fracture-containing system, comprising: i) Providing a treatment fluid comprising: a) a base fluid; b) an elastomeric material, wherein said elastomeric material comprises at least one polymer capable of crosslinking...

  11. Tanzania Journal of Development Studies

    African Journals Online (AJOL)

    The Role of Leadership in Urban Development: Reflections from Selected Urban Centers in Tanzania · EMAIL FULL TEXT EMAIL FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Colman T. Msoka, 134-155 ...

  12. Tanzania Journal of Agricultural Sciences

    African Journals Online (AJOL)

    Tanzania Journal of Agricultural Science (TAJAS) is a peer reviewed scientific journal that publishes original and scholarly research articles dealing with fundamental and applied aspects of agriculture, Food, Aquaculture and Wildlife. Occasionally invited review articles are published.

  13. System and Method for Providing Vertical Profile Measurements of Atmospheric Gases

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — A system and method for using an air collection device to collect a continuous air sample as the device descends through the atmosphere are provided. The air...

  14. Malaria entomological profile in Tanzania from 1950 to 2010: a ...

    African Journals Online (AJOL)

    Malaria entomological profile in Tanzania from 1950 to 2010: a review of mosquito distribution, vectorial capacity and insecticide resistance. ... Details recorded for each data source were the locality, latitude/longitude, time/period of study, species, abundance, sampling/collection methods, species identification methods, ...

  15. The electric subsector in Tanzania

    Energy Technology Data Exchange (ETDEWEB)

    Mosha, S. (Tanzania Electric Supply Company Ltd., Dar es Salaam (TZ))

    1991-01-01

    In Tanzania the Tanzania Electric Supply Company Limited (TANESCO) is a parastatal organisation charged with the responsibility of generation, transmission and distribution of electricity in mainland Tanzania. TANESCO also sells bulk power to the Zanzibar State Fuel and Power Corporation. The first power supply in mainland Tanzania was established by the Germans in 1908 in Dar es Salaam. Since then the power system has been extended to all the 20 regional headquarters and about half the district headquarters in mainland Tanzania. However, the population that has access to electricity is relatively small. Only about 6% of the households are electrified and the per capita electricity consumption is of the order of 60 kWh compared to approximately 3000 kWh for European countries. The scope for expansion of the service is, therefore, very large. The ultimate goal is to ensure that all of the over 8000 villages in mainland Tanzania are electrified. The present power system consists of an interconnected grid network covering 14 of the 20 mainland regions, and several isolated systems supplying the remainder of the system. The total national installed generating capacity is 480 MW consisting of 333 MW of hydro and the remainder are diesel powered generating units. 1989, total generation nationwide was 1503 GWh of which 1443 GWh were generated by hydroelectric generating stations.

  16. Systems and methods for providing power to a load based upon a control strategy

    Science.gov (United States)

    Perisic, Milun; Kajouke, Lateef A; Ransom, Ray M

    2013-12-24

    Systems and methods are provided for an electrical system. The electrical system includes a load, an interface configured to receive a voltage from a voltage source, and a controller configured to receive the voltage from the voltage source through the interface and to provide a voltage and current to the load. Wherein, when the controller is in a constant voltage mode, the controller provides a constant voltage to the load, when the controller is in a constant current mode, the controller provides a constant current to the load, and when the controller is in a constant power mode, the controller provides a constant power to the load.

  17. Method and Apparatus Providing Deception and/or Altered Operation in an Information System Operating System

    Science.gov (United States)

    Cohen, Fred; Rogers, Deanna T.; Neagoe, Vicentiu

    2008-10-14

    A method and/or system and/or apparatus providing deception and/or execution alteration in an information system. In specific embodiments, deceptions and/or protections are provided by intercepting and/or modifying operation of one or more system calls of an operating system.

  18. 47 CFR 51.329 - Notice of network changes: Methods for providing notice.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 3 2010-10-01 2010-10-01 false Notice of network changes: Methods for providing notice. 51.329 Section 51.329 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED...) Filing a public notice with the Commission; or (2) Providing public notice through industry fora...

  19. System and Method for Providing a Climate Data Analytic Services Application Programming Interface Distribution Package

    Science.gov (United States)

    Schnase, John L. (Inventor); Duffy, Daniel Q. (Inventor); Tamkin, Glenn S. (Inventor)

    2016-01-01

    A system, method and computer-readable storage devices for providing a climate data analytic services application programming interface distribution package. The example system can provide various components. The system provides a climate data analytic services application programming interface library that enables software applications running on a client device to invoke the capabilities of a climate data analytic service. The system provides a command-line interface that provides a means of interacting with a climate data analytic service by issuing commands directly to the system's server interface. The system provides sample programs that call on the capabilities of the application programming interface library and can be used as templates for the construction of new client applications. The system can also provide test utilities, build utilities, service integration utilities, and documentation.

  20. Determinants of demand: method selection and provider preference among US women seeking abortion services.

    Science.gov (United States)

    Shochet, Tara; Trussell, James

    2008-06-01

    Medication abortion has the potential to increase abortion availability, primarily through new provider networks; however, without a better understanding of how and why women make decisions regarding both their abortion method and their provider, expansion efforts may be misguided and valuable resources may be wasted. We undertook an exploratory study to investigate method and provider preferences. Semistructured one-on-one interviews were conducted with 205 abortion clients at three family planning clinics. Study participants greatly preferred the clinic setting for their abortion; the majority of women in the study would not have gone to their regular physician if they had been given the option. In addition, method choice trumps provider choice for the majority of women who would have preferred their regular provider. Participants who chose the aspiration procedure were more likely to have previous knowledge about the medication method. Travel time was not a predictor of preferring one's regular physician over the clinic. Expanding provider networks via the private sector is unlikely to be a panacea. In addition to these efforts, more attention may need to be paid to addressing logistic barriers to access. Physicians offering abortion services need to let their patients know they offer such services prior to their patients' need for them. Questions remain regarding the information being circulated about medication abortion.

  1. Newspaper coverage of agricultural information in Tanzania ...

    African Journals Online (AJOL)

    A.S.Sife

    Newspaper coverage of agricultural information in Tanzania. Catherine M. Ogessa camaongo@yahoo.ca. &. Alfred S. Sife asife@suanet.ac.tz. Sokoine University of Agriculture, Tanzania. Abstract. This study examined the coverage of agricultural information in Tanzania's newspapers published between 2009 and 2013.

  2. Interconnection blocks: a method for providing reusable, rapid, multiple, aligned and planar microfluidic interconnections

    International Nuclear Information System (INIS)

    Sabourin, D; Snakenborg, D; Dufva, M

    2009-01-01

    In this paper a method is presented for creating 'interconnection blocks' that are re-usable and provide multiple, aligned and planar microfluidic interconnections. Interconnection blocks made from polydimethylsiloxane allow rapid testing of microfluidic chips and unobstructed microfluidic observation. The interconnection block method is scalable, flexible and supports high interconnection density. The average pressure limit of the interconnection block was near 5.5 bar and all individual results were well above the 2 bar threshold considered applicable to most microfluidic applications

  3. Interconnection blocks: a method for providing reusable, rapid, multiple, aligned and planar microfluidic interconnections

    DEFF Research Database (Denmark)

    Sabourin, David; Snakenborg, Detlef; Dufva, Hans Martin

    2009-01-01

    In this paper a method is presented for creating 'interconnection blocks' that are re-usable and provide multiple, aligned and planar microfluidic interconnections. Interconnection blocks made from polydimethylsiloxane allow rapid testing of microfluidic chips and unobstructed microfluidic...... observation. The interconnection block method is scalable, flexible and supports high interconnection density. The average pressure limit of the interconnection block was near 5.5 bar and all individual results were well above the 2 bar threshold considered applicable to most microfluidic applications....

  4. Method of immobilizing weapons plutonium to provide a durable, disposable waste product

    Science.gov (United States)

    Ewing, Rodney C.; Lutze, Werner; Weber, William J.

    1996-01-01

    A method of atomic scale fixation and immobilization of plutonium to provide a durable waste product. Plutonium is provided in the form of either PuO.sub.2 or Pu(NO.sub.3).sub.4 and is mixed with and SiO.sub.2. The resulting mixture is cold pressed and then heated under pressure to form (Zr,Pu)SiO.sub.4 as the waste product.

  5. Configurable memory system and method for providing atomic counting operations in a memory device

    Science.gov (United States)

    Bellofatto, Ralph E.; Gara, Alan G.; Giampapa, Mark E.; Ohmacht, Martin

    2010-09-14

    A memory system and method for providing atomic memory-based counter operations to operating systems and applications that make most efficient use of counter-backing memory and virtual and physical address space, while simplifying operating system memory management, and enabling the counter-backing memory to be used for purposes other than counter-backing storage when desired. The encoding and address decoding enabled by the invention provides all this functionality through a combination of software and hardware.

  6. Poverty, partner discord, and divergent accounts; a mixed methods account of births before arrival to health facilities in Morogoro Region, Tanzania.

    Science.gov (United States)

    McMahon, Shannon A; Chase, Rachel P; Winch, Peter J; Chebet, Joy J; Besana, Giulia V R; Mosha, Idda; Sheweji, Zaina; Kennedy, Caitlin E

    2016-09-27

    Births before arrival (BBA) to health care facilities are associated with higher rates of perinatal morbidity and mortality compared to facility deliveries or planned home births. Research on such births has been conducted in several high-income countries, but there are almost no studies from low-income settings where a majority of maternal and newborn deaths occur. Drawing on a household survey of women and in-depth interviews with women and their partners, we examined the experience of BBA in rural districts of Morogoro Region, Tanzania. Among survey respondents, 59 births (4 %) were classified as BBAs. Most of these births occurred in the presence of a family member (47 %) or traditional birth attendant (24 %). Low socioeconomic status was the strongest predictor of BBA. After controlling for wealth via matching, high parity and a low number of antenatal care (ANC) visits retained statistical significance. While these variables are useful indicators of which women are at greater risk of BBA, their predictive power is limited in a context where many women are poor, multiparous, and make multiple ANC visits. In qualitative interviews, stories of BBAs included themes of partner disagreement regarding when to depart for facilities and financial or logistical constraints that underpinned departure delays. Women described wanting to depart earlier to facilities than partners. As efforts continue to promote facility birth, we highlight the financial demands associated with facility delivery and the potential for these demands to place women at a heightened risk for BBAs.

  7. mercury contamination in domestic ducks in geita, northwest tanzania

    African Journals Online (AJOL)

    Mgina

    environment through seepage and leakage. This method is very common in most of artisanal and small scale gold mining camps in Tanzania (MEM 1996, van Straaten 2000,. UNIDO 2003). Mercury is of particular apprehension owing to its persistence in the environment, which threatens both ecological and human health.

  8. The Effect of Inflation on Economic Growth in Tanzania | Shitundu ...

    African Journals Online (AJOL)

    In this study, use is made of the Least Trimmed Squares (LTS) method, as introduced by Rousseeuw and Leroy (1987), which detects regression outliers and produces robust regression, to examine the impact of inflation on economic growth in Tanzania. The empirical results obtained suggest that inflation has been harmful ...

  9. - 1 - Key considerations in scaling up male circumcision in Tanzania ...

    African Journals Online (AJOL)

    1National Institute for Medical Research, Mwanza Research Centre, Mwanza, Tanzania ... health clinics are likely to promote early medical male circumcision. .... children. 67. (21.5). Lack of advice on child circumcision. 60. (19.2). Methods of enhancing male circumcision. Participants ranked different strategies that can be ...

  10. Tanzania Journal of Health Research - Vol 14, No 1 (2012)

    African Journals Online (AJOL)

    Understanding the link between trafficking in persons and HIV and AIDS risk in Tanzania · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Switbert R. Kamazima, Mangi J. Ezekiel, Method R. Kazaura, Bennet Fimbo. http://dx.doi.org/10.4314/thrb.v14i1.12 ...

  11. Sexual and reproductive health and HIV in border districts affected by migration and poverty in Tanzania

    DEFF Research Database (Denmark)

    Obel, Josephine; Larsson, Markus; Sodemann, Morten

    2014-01-01

    Objectives To assess HIV knowledge, attitudes, sexual practices and sexual and reproductive health (SRH) service delivery in border areas of Tanzania, with a view to support the prioritisation of SRH interventions in border areas. Methods The target sample comprised randomly selected people living......); and (iii) semi-structured interviews with service providers (n = 37). Results The mean number of sexual partners, frequency of multiple concurrent partnerships and engagement in transactional sex were significantly higher in the border community than in the national population. Knowledge about HIV...

  12. Coral Reefs and Their Management in Tanzania | Wagner | Western ...

    African Journals Online (AJOL)

    communities in reef monitoring, restoration and ecotourism. This paper examines the management approaches and strategies implemented by various ICM programs, conservation areas and marine parks in Tanzania. It also provides recommendations for further research and coral reef management strategies. Keywords: ...

  13. Clinician perceptions of providing natural family planning methods in Title X funded clinics.

    Science.gov (United States)

    Kelly, Patricia J; Witt, Jacki; McEvers, Kimberly; Enriquez, Maithe; Abshier, Patricia; Vasquez, Magda; McGee, Eve

    2012-01-01

    Natural family planning (NFP) methods are effective for contraception with proper and consistent use. However, only 1% of patients at federally funded Title X family planning clinics select NFP as a contraceptive method. The goal of this study was to understand from clinicians' perspectives the barriers and facilitators to providing NFP methods. Six telephone focus groups were conducted with 29 clinicians from Title X clinics across the United States and Puerto Rico. A hermeneutic method was used to analyze data for related themes. The overarching theme from the study was that participants had a strong desire to teach their patients how their bodies work and to empower them to learn to control fertility. Four subthemes emerged: patient misinformation and misunderstanding about fertility; provider ideas about ideal types of candidates for NFP; inconsistent patient teaching strategies; and lack of time to teach NFP methods. There is a need for increased NFP training for providers and efficient NFP patient teaching strategies to meet the needs of patients with limited knowledge about fertility. © 2011 by the American College of Nurse-Midwives.

  14. CMS: Mangrove Canopy Characteristics and Land Cover Change, Tanzania, 1990-2014

    Data.gov (United States)

    National Aeronautics and Space Administration — This data set provides canopy height, land cover change, and stand age estimates for mangrove forests in the Rufiji River Delta in Tanzania. The estimates were...

  15. Comparison of four methods used in determination of secondary shielding requirements for a teletherapy facility: a case study of 137Cs room in Tanzania

    International Nuclear Information System (INIS)

    Muhogora, W.E.; Nyanda, A.M.; Ngoye, W.M.

    2004-01-01

    The performance of four methods often used to calculate the secondary barrier requirements is evaluated for a typical 137 Cs-therapy room as a case study. The first two methods are provided by the NCRP49 and IAEA and both consider the influence of the primary, leakage and scattered radiation at a point as corrected for the workload, use and occupancy factors. A different shielding model encompasses the third method, which determines the doses as corrected for build-up effects assuming the narrow beam geometry. The fourth method is based on the calculation of the dose rates from the source activity with a relevant gamma constant. In all four methods, an appropriate transmission factor for the protective barrier in question is applied. The results show that for controlled area, the similarity in the calculated thicknesses using all four methods was nearly within 50%. For uncontrolled areas, a significant difference of magnitude up to a factor of 2.4 was found, which is mainly attributed to the non-consideration of occupancy factors in the latter two methods. Nevertheless, the non-agreement is useful to validate the specific assumptions taken for the employed shielding method. Despite being slightly high, it is concluded that the current shielding methods based on NCRP fundamentals are satisfactorily optimal in planning new therapy facilities. However for existing facilities, such as those undesigned according to the standard requirements, the combination of the four different methods with the dose rate measurements tend to offer a better cost effective shielding option. Retrospectively, additional 41-cm thick concrete is recommended for the unshielded southern barrier of the 137 Cs room. Interestingly, the recommended thickness agrees to within ±5% with that estimated by using the recently recommended method by IAEA

  16. Prospects, achievements, challenges and opportunities for scaling-up malaria chemoprevention in pregnancy in Tanzania

    DEFF Research Database (Denmark)

    Mubyazi, Godfrey M.; Bygbjerg, Ib Christian; Magnussen, Pascal

    2008-01-01

    To describe the prospects, achievements, challenges and opportunities for implementing intermittent preventive treatment for malaria in pregnancy (IPTp) in Tanzania in light of national antenatal care (ANC) guidelines and ability of service providers to comply with them.......To describe the prospects, achievements, challenges and opportunities for implementing intermittent preventive treatment for malaria in pregnancy (IPTp) in Tanzania in light of national antenatal care (ANC) guidelines and ability of service providers to comply with them....

  17. Method and apparatus for providing high bandwidth, low noise mechanical I/O for computer systems

    Science.gov (United States)

    Rosenberg, Louis B.

    1998-01-01

    A method and apparatus for providing high bandwidth and low noise mechanical input and output for computer systems. A gimbal mechanism provides two revolute degrees of freedom to an object about two axes of rotation. A linear axis member is coupled to the gimbal mechanism at the intersection of the two axes of rotation. The linear axis member is capable of being translated along a third axis to provide a third degree of freedom. The user object is coupled to the linear axis member and is thus translatable along the third axis so that the object can be moved along all three degrees of freedom. Transducers associated with the provided degrees of freedom include sensors and actuators and provide an electromechanical interface between the object and a digital processing system. Capstan drive mechanisms transmit forces between the transducers and the object. The linear axis member can also be rotated about its lengthwise axis to provide a fourth degree of freedom, and, optionally, a floating gimbal mechanism is coupled to the linear axis member to provide fifth and sixth degrees of freedom to an object. Transducer sensors are associated with the fourth, fifth, and sixth degrees of freedom. The interface is well suited for simulations of medical procedures and simulations in which an object such as a stylus or a joystick is moved and manipulated by the user.

  18. Country watch. Tanzania.

    Science.gov (United States)

    Rajani, R; Kudrati, M

    1994-01-01

    The Kuleana Center for Children's Rights in Mwanza, Tanzania, is using peer education, focus group discussions, and individual counseling to decrease high-risk sexual behavior on the part of street children. These program activities seek to raise the children's self-esteem, engage them in trusting and respectful relationships, and teach sex-related negotiation skills. The Center is also involved in advocacy work to build compassion and respect for these children within the community, thereby decreasing their harassment on the streets and isolation. Incidents of street children being held in police custody or prison, where they are frequently sexually assaulted, have significantly decreased as a result. To promote the health of these children at high risk of sexually transmitted diseases, the Center operates a small clinic to address basic health problems and runs training sessions for health workers on the special needs of this population. The Center's future goals include formation of a street children's mobile theater group, activities designed to promote group identity and solidarity, and research on the physical and sexual abuse of young girls working as domestic laborers.

  19. Tanzania country study

    Energy Technology Data Exchange (ETDEWEB)

    1999-09-01

    Objectives of this study are to analyse the role of the land use sectors of Tanzania (especially forestry) on mitigation of greenhouse gases. Specific emphasis is placed on the relationship between forestry and energy supply from biomass, as well as other forestry products. This is a follow up study on an earlier effort which worked on mitigation options in the country without and in-depth analysis of the forestry and land use sectors. Analysis of the mitigation scenario has been based on Comprehensive Mitigation Analysis (COMAP). This study has analysed the forestry and land use sector behaviour on the basis of the current policies on land and environment. Furthermore three scenarios have been developed on the basis of what is expected to happen in the sectors, the worse scenario being a catastrophic one where if things takes the business as usual trend then the forest resources will easily be depleted. The TFAP scenario takes into account the implementation of the current plans as scheduled while the mitigation scenario takes into account the GHG mitigation in the implementation of the plans. A Comprehensive Mitigation Analysis Process (COMAP) has been used to analyse the GHG and cost implications of the various programmes under the mitigation scenario. (au) 30 refs.

  20. A method of providing a barrier in a fracture-containing system

    DEFF Research Database (Denmark)

    2014-01-01

    The present invention relates to a method of providing a barrier in a fracture-containing system, comprising: i) Providing a treatment fluid comprising: a) a base fluid; b) an elastomeric material, wherein said elastomeric material comprises at least one polymer capable of crosslinking into an el...... are of neutral buoyancy with regard to the base fluid. The invention is contemplated to having utility not only in the oil-drilling industry but also in the plugging of fractures in sewer drains, pipelines etc.......The present invention relates to a method of providing a barrier in a fracture-containing system, comprising: i) Providing a treatment fluid comprising: a) a base fluid; b) an elastomeric material, wherein said elastomeric material comprises at least one polymer capable of crosslinking...... into an elastomer, and c) at least one crosslinking agent; ii) Placing the treatment fluid in a fracture-containing system; iii) Allowing the elastomeric material to crosslink with itself to form a barrier in said fracture-containing system; wherein the elastomeric material and/or the crosslinking agent...

  1. THIRD PARTY LOGISTIC SERVICE PROVIDER SELECTION USING FUZZY AHP AND TOPSIS METHOD

    Directory of Open Access Journals (Sweden)

    Golam Kabir

    2012-03-01

    Full Text Available The use of third party logistic(3PL services providers is increasing globally to accomplish the strategic objectives. In the increasingly competitive environment, logistics strategic management requires systematic and structured approach to have cutting edge over the rival. Logistics service provider selection is a complex multi-criteria decision making process; in which, decision makers have to deals with the optimization of conflicting objectives such as quality, cost, and delivery time. In this paper, fuzzy analytic hierarchy process (FAHP approach based on technique for order preference by similarity to ideal solution (TOPSIS method has been proposed for evaluating and selecting an appropriate logistics service provider, where the ratings of each alternative and importance weight of each criterion are expressed in triangular fuzzy numbers.

  2. Tsetse distribution in Tanzania: 2012 status | Daffa | Tanzania ...

    African Journals Online (AJOL)

    Results further show that the seven species of Glossina that had been recorded earlier still occur in Tanzania, although unevenly distributed due to different ecological features, climatic change, human development activities and tsetse control interventions. This paper highlights current status of tsetse distribution in ...

  3. Pig Production in Tanzania: a Critical Review

    Directory of Open Access Journals (Sweden)

    Wilson, RT.

    2014-01-01

    Full Text Available Tanzania's 1.58 million pigs represent 3.7 per cent of the national population of quadruped meat-producing animals. Some 99.5 per cent of pigs are kept by small producers in units averaging 3.04 animals (range 2-48. About 18 per cent of households with livestock own pigs, 93.7 per cent of these having a herd of less than 19 and 69.2 per cent own 9 or fewer head. Scavenging is the main feed source. Maize bran is the principle supplement but some owners provide oilseed cakes and minerals. Domestic pigs are not indigenous to Tanzania and derive mainly from late 19th/early 20th century introductions. There have been few imports of breeding stock since 1961. Poor management, in-breeding, inadequate nutrition and rudimentary veterinary attention lead to low output from late ages at first farrowing, long inter-birth intervals, small litters, slow growth and high mortality. Government policy is not applied in practice. Animals are slaughtered in primitive private facilities or household compounds with little concern for welfare or hygiene, often with no official inspection. Pigs can make a greater contribution to society but public and private sectors must provide additional support with particular attention to management, nutrition, health, welfare and food safety to achieve this.

  4. ELV Recycling Service Provider Selection Using the Hybrid MCDM Method: A Case Application in China

    Directory of Open Access Journals (Sweden)

    Fuli Zhou

    2016-05-01

    Full Text Available With the rapid depletion of natural resources and undesired environmental changes globally, more interest has been shown in the research of green supply chain practices, including end-of-life vehicle (ELV recycling. The ELV recycling is mandatory for auto-manufacturers by legislation for the purpose of minimizing potential environmental damages. The purpose of the present research is to determine the best choice of ELV recycling service provider by employing an integrating hybrid multi-criteria decision making (MCDM method. In this research, economic, environmental and social factors are taken into consideration. The linguistic variables and trapezoidal fuzzy numbers (TFNs are applied into this evaluation to deal with the vague and qualitative information. With the combined weight calculation of criteria based on fuzzy aggregation and Shannon Entropy techniques, the normative multi-criteria optimization technique (FVIKOR method is applied to explore the best solution. An application was performed based on the proposed hybrid MCDM method, and sensitivity analysis was conducted on different decision making scenarios. The present study provides a decision-making approach on ELV recycling business selection under sustainability and green philosophy with high robustness and easy implementation.

  5. Tanzania Veterinary Journal: Editorial Policies

    African Journals Online (AJOL)

    The Tanzania Veterinary Journal (The Tropical Veterinarian) is a biannual Journal, which publishes original contribution to knowledge on Veterinary Science, Animal Science and Production, and allied sciences including new techniques and ... Checked Open Submissions, Checked Indexed, Checked Peer Reviewed ...

  6. Tanzania Medical Journal: Editorial Policies

    African Journals Online (AJOL)

    J. Massaga National Institute of Medical Research Dar es Salaam,Tanzania. E. Sandstrom Karolinska Institutet and Southern Hospital Stockholm, Sweden. W. Fawzi Harvard School of Public Health Boston, USA. B. Bloomberg University of Bergen Bergen, Norway. ISSN: 0856-0714. AJOL African Journals Online. HOW TO ...

  7. Reforming Teacher Education in Tanzania

    Science.gov (United States)

    Hardman, Frank; Abd-Kadir, Jan; Tibuhinda, Audax

    2012-01-01

    It is widely acknowledged that in order to improve the quality of education in primary schools in developing countries there is a need to place pedagogy and its training implications at the centre of teacher education reform. Like many countries in Eastern and Southern Africa, Tanzania has introduced various initiatives and reforms to improve the…

  8. Tanzania Journal of Health Research

    African Journals Online (AJOL)

    Tanzania Journal of Health Research (TJHR) aims to facilitate the advance of health sciences by publishing high quality research and review articles that communicate new ideas and developments in biomedical and health research. TJHR is a peer reviewed journal and is open to contributions from both the national and ...

  9. Discussion of a method for providing general risk information by linking with the nuclear information

    International Nuclear Information System (INIS)

    Shobu, Nobuhiro; Yokomizo, Shirou; Umezawa, Sayaka

    2004-06-01

    'Risk information navigator (http://www.ricotti.jp/risknavi/)', an internet tool for arousing public interest and fostering people's risk literacy, has been developed as the contents for the official website of Techno Community Square 'RICOTTI' (http://www.ricotti.jp) at TOKAI village. In this report we classified the risk information into the fields, Health/Daily Life', 'Society/Crime/Disaster' and Technology/Environment/Energy', for the internet tool contents. According to these categories we discussed a method for providing various risk information on general fields by linking with the information on nuclear field. The web contents are attached to this report with the CD-R media. (author)

  10. Greenhouse gases mitigation options and strategies for Tanzania

    Energy Technology Data Exchange (ETDEWEB)

    Mwandosya, M.J.; Meena, H.E.

    1996-12-31

    Tanzania became a party to the United Nations Framework on Climate Change (UN FCCC) when she ratified the Convention in March, 1996. Now that Tanzania and other developing countries are Parties to the UN FCCC, compliance with its provisions is mandatory. The legal requirements therefore provide a basis for their participation in climate change studies and policy formulation. All parties to the Convention are required by Article 4.1 of the United Nations Convention on Climate Change (UN FCCC) to develop, periodically update, publish, and make available national inventories of anthropogenic emissions and removal of greenhouse gases that are not controlled by the Montreal Protocol. This study on possible options for the mitigation of greenhouse gases in Tanzania is a preliminary effort towards the fulfilment of the obligation. In order to fulfil their obligations under the UN FCCC and have a meaningful mitigation assessment, identification and quantification of anthropogenic sources of atmospheric emissions of greenhouse gases in the country was undertaken. In this respect, the study of anthropogenic emissions by source and removals by sink of GHGs in Tanzania was done with the main objective of increasing the quantity and quality of base-line data available in order to further scientific understanding of the relationship of greenhouse gas emissions to climate change. Furthermore, the study facilitated identification of national policy and technological options that could reduce the level of emissions in the country.

  11. Health Libraries and Information Services in Tanzania: A Strategic Assessment.

    Science.gov (United States)

    Haruna, Hussein; Mtoroki, Majaliwa; Gerendasy, Dan D; Detlefsen, Ellen G

    The intention of the Government of Tanzania is to establish more health information resource canters in all health facilities. With this regard, health information science personnel are needed to provide adequate and accurate health information services. However, availability of these personnel remains to be a challenge because of their non-existence. To identify the current status and local impact of health sciences libraries and user perception of these libraries, as a prerequisite to the development of a competence-based curriculum for health information science training in Tanzania. A needs assessment was carried out using a convenience sample of local respondents, including librarians, trainers, academicians, students, health care providers, and patients and families, drawn from national, referral, regional, district hospitals, health training institutions, and universities from both government and nongovernment entities in Tanzania. A focus group approach was used to gather data from respondents. Results from this assessment revealed that health science libraries in Tanzania are faced with the challenges of insufficient infrastructure, old technology, limited facilities and furniture, inadequate and incompetent library staff, lack of health sciences librarians, outdated and insufficient resources, and low knowledge and use of information technologies by library clients. Most respondents would prefer to have both physical and electronic libraries, as well as librarians with specialized health information science skills, to cope with changing nature of the medical field. The findings obtained from this assessment are strong enough to guide the development of a curriculum and training strategy and an operational plan and training packages for health information professionals. The development of a training curriculum for health information science professionals will mean better health information service delivery for Tanzania. Copyright © 2016 Icahn School of

  12. Sexual practices among unmarried adolescents in Tanzania

    Directory of Open Access Journals (Sweden)

    Masatu Melkiory C

    2009-10-01

    Full Text Available Abstract Background Sexual activities are increasingly changing from the cultural point of view what they used to be. Knowledge of these practices among adolescents may be a basis to create awareness among adolescents on practices that involve risks. This study aims to assess sexual practices among unmarried adolescents in Tanzania. Methods A cross-sectional survey was conducted among in-school and out-of-school but unmarried adolescents aged 10 to 19 in five locations in Tanzania. A questionnaire was used to collect information and to characterize sexual practices among these adolescents. Results About 32% of adolescents reported being sexually active; a higher proportion being males than females. The only inquired and reported sexual practices include vaginal sex, masturbation, oral and anal sex. About 15% of sexually active adolescents reported having multiple sexual partners. Significantly more males reported having multiple partners than females. Nearly 42% of sexually active adolescents reported having used a condom during most recent sexual act. Females reported older partners at first sexual act. Conclusion Adolescents experience several sexual practices that include penetrative and non-penetrative. More males reported being sexually active than females. Despite adolescents reporting having multiple sexual partners, reported condom use during the most recent sexual act was low. We advocate for a more enhanced approach of reproductive health education that includes safer sex to adolescents without forgetting those in-schools.

  13. Foreign land deals in Tanzania: an update and a critical view on the challenges of data (re)production

    OpenAIRE

    Locher, Martina; Sulle, Emmanuel

    2013-01-01

    In the absence of an easily available source of reliable up-to-date data on foreign land deals in Tanzania, many reports have been published that attempt to provide an overview of these deals. While providing this overview is challenging due to the dynamic and non-transparent nature of the 'land grab' phenomenon itself, it has become even more debatable due to certain questionable methods of using and quoting existing data. This leads to several flaws including the "virtual survival" of cance...

  14. Assessment of parental perception of malaria vaccine in Tanzania.

    Science.gov (United States)

    Romore, Idda; Ali, Ali Mohamed; Semali, Innocent; Mshinda, Hassan; Tanner, Marcel; Abdulla, Salim

    2015-09-17

    Clinical trials of the RTS,S malaria vaccine have completed Phase III and the vaccine is on track for registration. Before making decisions about implementation, it is essential to prepare the ground for introducing the vaccine by assessing awareness and willingness to use malaria vaccines and to provide policy makers with evidence-based information on the best strategies to engage communities to manage the introduction of malaria vaccine in Tanzania. In November 2011, as part of a large cross-sectional study of all 23 regions of Tanzania (mainland Tanzania and Zanzibar) was conducted during Tanzanian Integrated Measles Campaign (IMC) survey. In this study, the variables of interests were awareness and willingness to use a malaria vaccine. The main outcome measure was willingness to use a malaria vaccine. Logistic regression was used to examine the influence of predictive factors. A representative sample of 5502 (out of 6210) women, aged 18 years or older and with children under 11 months old, was selected to participate, using random sampling probability. Awareness of the forthcoming malaria vaccine, 11.8 % of participants in mainland Tanzania responded affirmatively, compared to 3.4 % in Zanzibar (p value Tanzania (94.3 %) and Zanzibar (96.8 %) (p value = 0.0167). Although mothers had low awareness and high willingness to use malaria vaccine, still availability of malaria vaccine RTS,S will compliment other existing malaria interventions and it will be implemented through the Immunization, Vaccines and Biologicals (IVB) programme (formerly EPI). The information generated from this study can aid policy makers in planning and setting priorities for introducing and implementing the malaria vaccine.

  15. Method for providing slip energy control in permanent magnet electrical machines

    Science.gov (United States)

    Hsu, John S.

    2006-11-14

    An electric machine (40) has a stator (43), a permanent magnet rotor (38) with permanent magnets (39) and a magnetic coupling uncluttered rotor (46) for inducing a slip energy current in secondary coils (47). A dc flux can be produced in the uncluttered rotor when the secondary coils are fed with dc currents. The magnetic coupling uncluttered rotor (46) has magnetic brushes (A, B, C, D) which couple flux in through the rotor (46) to the secondary coils (47c, 47d) without inducing a current in the rotor (46) and without coupling a stator rotational energy component to the secondary coils (47c, 47d). The machine can be operated as a motor or a generator in multi-phase or single-phase embodiments and is applicable to the hybrid electric vehicle. A method of providing a slip energy controller is also disclosed.

  16. Apparatus and method for treating a cathode material provided on a thin-film substrate

    Science.gov (United States)

    Hanson, Eric J.; Kooyer, Richard L.

    2001-01-01

    An apparatus and method for treating a cathode material provided on a surface of a continuous thin-film substrate and a treated thin-film cathode having increased smoothness are disclosed. A web of untreated cathode material is moved between a feed mechanism and a take-up mechanism, and passed through a treatment station. The web of cathode material typically includes areas having surface defects, such as prominences extending from the surface of the cathode material. The surface of the cathode material is treated with an abrasive material to reduce the height of the prominences so as to increase an 85 degree gloss value of the cathode material surface by at least approximately 10. The web of cathode material may be subjected to a subsequent abrasive treatment at the same or other treatment station. Burnishing or lapping film is employed at a treatment station to process the cathode material. An abrasive roller may alternatively be used to process the web of cathode material. The apparatus and method of the present invention may also be employed to treat the surface of a lithium anode foil so as to cleanse and reduce the roughness of the anode foil surface.

  17. Violence Against Health Care Providers: A Mixed-Methods Study from Karachi, Pakistan.

    Science.gov (United States)

    Baig, Lubna Ansari; Shaikh, Shiraz; Polkowski, Maciej; Ali, Syeda Kausar; Jamali, Seemin; Mazharullah, Lubna; Soomro, Marium; Kumari, Bhavita; Memon, Sobia; Maheshwari, Greesh; Arif, Saleema

    2018-02-12

    Violence against health care providers (HCPs) remains a significant public health problem in developing countries, affecting their performance and motivation. To report the quantity and perceived causes of violence committed upon HCPs and identify strategies intended to prevent and de-escalate it. This was a mixed-methods concurrent study design (QUAN-QUAL). A structured questionnaire was filled in on-site by trained data collectors for quantitative study. Sites were tertiary care hospitals, local nongovernmental organizations (NGOs) providing health services, and ambulance services. Qualitative data were collected through in-depth interviews and focus group discussions at these same sites, as well as with other stakeholders including media and law enforcement agencies. One-third of the participants had experienced some form of violence in the last 12 months. Verbal violence was experienced more frequently (30.5%) than physical violence (14.6%). Persons who accompanied patients (58.1%) were found to be the chief perpetrators. Security staff and ambulance staff were significantly more likely to report physical violence (p = 0.001). Private hospitals and local NGOs providing health services were significantly less likely to report physical violence (p = 0.002). HCPs complained about poor facilities, heavy workload, and lack of preparedness to deal with violence. The deficiencies highlighted predominantly included inadequate security and lack of training to respond effectively to violence. Most stakeholders thought that poor quality of services and low capacity of HCPs contributed significantly to violent incidents. There is a great need to design interventions that can help in addressing the behavioral, institutional, and sociopolitical factors promoting violence against HCPs. Future projects should focus on designing interventions to prevent and mitigate violence at multiple levels. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Chest radiography for predicting the cause of febrile illness among inpatients in Moshi, Tanzania

    International Nuclear Information System (INIS)

    Fiorillo, S.P.; Diefenthal, H.C.; Goodman, P.C.; Ramadhani, H.O.; Njau, B.N.; Morrissey, A.B.; Maro, V.P.; Saganda, W.; Kinabo, G.D.; Mwako, M.S.; Bartlett, J.A.

    2013-01-01

    Aim: To describe chest radiographic abnormalities and assess their usefulness for predicting causes of fever in a resource-limited setting. Materials and methods: Febrile patients were enrolled in Moshi, Tanzania, and chest radiographs were evaluated by radiologists in Tanzania and the United States. Radiologists were blinded to the results of extensive laboratory evaluations to determine the cause of fever. Results: Of 870 febrile patients, 515 (59.2%) had a chest radiograph available; including 268 (66.5%) of the adolescents and adults, the remainder were infants and children. One hundred and nineteen (44.4%) adults and 51 (20.6%) children were human immunodeficiency virus (HIV)-infected. Among adults, radiographic abnormalities were present in 139 (51.9%), including 77 (28.7%) with homogeneous and heterogeneous lung opacities, 26 (9.7%) with lung nodules, 25 (9.3%) with pleural effusion, 23 (8.6%) with cardiomegaly, and 13 (4.9%) with lymphadenopathy. Among children, radiographic abnormalities were present in 87 (35.2%), including 76 (30.8%) with homogeneous and heterogeneous lung opacities and six (2.4%) with lymphadenopathy. Among adolescents and adults, the presence of opacities was predictive of Streptococcus pneumoniae and Coxiella burnetii, whereas the presence of pulmonary nodules was predictive of Histoplasma capsulatum and Cryptococcus neoformans. Conclusions: Chest radiograph abnormalities among febrile inpatients are common in northern Tanzania. Chest radiography is a useful adjunct for establishing an aetiologic diagnosis of febrile illness and may provide useful information for patient management, in particular for pneumococcal disease, Q fever, and fungal infections

  19. Why do health workers in rural Tanzania prefer public sector employment?

    Directory of Open Access Journals (Sweden)

    Songstad Nils Gunnar

    2012-04-01

    Full Text Available Abstract Background Severe shortages of qualified health workers and geographical imbalances in the workforce in many low-income countries require the national health sector management to closely monitor and address issues related to the distribution of health workers across various types of health facilities. This article discusses health workers' preferences for workplace and their perceptions and experiences of the differences in working conditions in the public health sector versus the church-run health facilities in Tanzania. The broader aim is to generate knowledge that can add to debates on health sector management in low-income contexts. Methods The study has a qualitative study design to elicit in-depth information on health workers' preferences for workplace. The data comprise ten focus group discussions (FGDs and 29 in-depth interviews (IDIs with auxiliary staff, nursing staff, clinicians and administrators in the public health sector and in a large church-run hospital in a rural district in Tanzania. The study has an ethnographic backdrop based on earlier long-term fieldwork in Tanzania. Results The study found a clear preference for public sector employment. This was associated with health worker rights and access to various benefits offered to health workers in government service, particularly the favourable pension schemes providing economic security in old age. Health workers acknowledged that church-run hospitals generally were better equipped and provided better quality patient care, but these concerns tended to be outweighed by the financial assets of public sector employment. In addition to the sector specific differences, family concerns emerged as important in decisions on workplace. Conclusions The preference for public sector employment among health workers shown in this study seems to be associated primarily with the favourable pension scheme. The overall shortage of health workers and the distribution between health

  20. Introducing payment for performance in the health sector of Tanzania- the policy process.

    Science.gov (United States)

    Chimhutu, Victor; Tjomsland, Marit; Songstad, Nils Gunnar; Mrisho, Mwifadhi; Moland, Karen Marie

    2015-09-02

    Prompted by the need to achieve progress in health outcomes, payment for performance (P4P) schemes are becoming popular policy options in the health systems in many low income countries. This paper describes the policy process behind the introduction of a payment for performance scheme in the health sector of Tanzania illuminating in particular the interests of and roles played by the Government of Norway, the Government of Tanzania and the other development partners. The study employed a qualitative research design using in-depth interviews (IDIs), observations and document reviews. Thirteen IDIs with key-informants representing the views of ten donor agencies and government departments influential in the process of introducing the P4P scheme in Tanzania were conducted in Dar es Salaam, Tanzania and Oslo, Norway. Data was collected on the main trends and thematic priorities in development aid policy, countries and actors perceived to be proponents and opponents to the P4P scheme, and P4P agenda setting in Tanzania. The initial introduction of P4P in the health sector of Tanzania was controversial. The actors involved including the bilateral donors in the Health Basket Fund, the World Bank, the Tanzanian Government and high level politicians outside the Health Basket Fund fought for their values and interests and formed alliances that shifted in the course of the process. The process was characterized by high political pressure, conflicts, changing alliances, and, as it evolved, consensus building. The P4P policy process was highly political with external actors playing a significant role in influencing the agenda in Tanzania, leaving less space for the Government of Tanzania to provide leadership in the process. Norway in particular, took a leading role in setting the agenda. The process of introducing P4P became long and frustrating causing mistrust among partners in the Health Basket Fund.

  1. Teaching quality improvement in Tanzania: a model of inter-professional partnership for global health development

    Directory of Open Access Journals (Sweden)

    John Kvasnicka

    2017-01-01

    Full Text Available Background: Education is a universal need in health care and a tool for quality improvement. We developed a two-day medical education conference in Iringa, Tanzania, that has now evolved to teach the basics of quality improvement to an inter-professional audience from the 28 hospitals in the southern zone of the Tanzania Christian Social Services Commission (CSSC. Methods: We describe the planning, budget, implementation, evolution and evaluation of this on-going medical education conference. Representatives from medicine, nursing, pharmacy and administration from all 28 hospitals were invited to attend. Attendees evaluated the conference and individual lectures on a 5 point scale. In addition, attendees were asked to rate the most important learning aspect of the conference. Results: Over 100 Tanzanian health professionals and administrators from the 28 hospitals in the southern zone of the CSSC attended. Evaluation forms were completed by 82 attendees. The 2016 conference received an overall rating of 4.0 on a 5 point scale. The individual lectures received an overall rating of 4.2 on a 5 point scale. Quality improvement techniques and co-leadership topics were rated as most useful by attendees. Conclusion: We provide a framework for developing a medical education conference that can be replicated in other settings. Teaching the basics of quality improvement by having hospital leadership teams develop individual quality improvement projects is a highly useful method of instruction.

  2. Stakeholders' opinions and questions regarding the anticipated malaria vaccine in Tanzania.

    Science.gov (United States)

    Mtenga, Sally; Kimweri, Angela; Romore, Idda; Ali, Ali; Exavery, Amon; Sicuri, Elisa; Tanner, Marcel; Abdulla, Salim; Lusingu, John; Kafuruki, Shubi

    2016-04-05

    Within the context of combined interventions, malaria vaccine may provide additional value in malaria prevention. Stakeholders' perspectives are thus critical for informed recommendation of the vaccine in Tanzania. This paper presents the views of stakeholders with regards to malaria vaccine in 12 Tanzanian districts. Quantitative and qualitative methods were employed. A structured questionnaire was administered to 2123 mothers of under five children. Forty-six in-depth interviews and 12 focus group discussions were conducted with teachers, religious leaders, community health workers, health care professionals, and scientists. Quantitative data analysis involved frequency distributions and cross tabulations using Chi square test to determine the association between malaria vaccine acceptability and independent variables. Qualitative data were analysed thematically. Overall, 84.2% of the mothers had perfect acceptance of malaria vaccine. Acceptance varied significantly according to religion, occupation, tribe and region (p Stakeholders had high acceptance and positive opinions towards the combined use of the anticipated malaria vaccine and ITNs, and that their acceptance remains high even when the vaccine may not provide full protection, this is a crucial finding for malaria vaccine policy decisions in Tanzania. An inclusive communication strategy should be designed to address the stakeholders' questions through a process that should engage and be implemented by communities and health care professionals. Social cultural aspects associated with vaccine acceptance should be integrated in the communication strategy.

  3. Radioactive waste management in Tanzania

    International Nuclear Information System (INIS)

    Banzi, F.P.; Bundala, F.M.; Nyanda, A.M.; Msaki, P.

    2002-01-01

    Radioactive waste, like many other hazardous wastes, is of great concern in Tanzania because of its undesirable health effects. The stochastic effects due to prolonged exposure to ionizing radiation produce cancer and hereditary effects. The deterministic effects due to higher doses cause vomiting, skin reddening, leukemia, and death to exposed victims. The aim of this paper is to give an overview of the status of radioactive wastes in Tanzania, how they are generated and managed to protect humans and the environment. As Tanzania develops, it is bound to increase the use of ionizing radiation in research and teaching, industry, health and agriculture. Already there are more than 42 Centers which use one form of radioisotopes or another for these purposes: Teletherapy (Co-60), Brach-therapy (Cs-137, Sr-89), Nuclear Medicine (P-32, Tc-99m, 1-131, 1-125, Ga-67, In-111, Tl-206), Nuclear gauge (Am-241, Cs- 137, Sr-90, Kr-85), Industrial radiography (Am-241, C-137, Co-60, lr-92), Research and Teaching (1-125, Am241/Be, Co-60, Cs-137, H-3 etc). According to IAEA definition, these radioactive sources become radioactive waste if they meet the following criteria: if they have outlived their usefulness, if they have been abandoned, if they have been displaced without authorization, and if they contaminate other substances. Besides the origin of radioactive wastes, special emphasis will also be placed on the existing radiation regulations that guide disposal of radioactive waste, and the radioactive infrastructure Tanzania needs for ultimate radioactive waste management. Specific examples of incidences (theft, loss, abandonment and illegal possession) of radioactive waste that could have led to serious deterministic radiation effects to humans will also be presented. (author)

  4. Small Cages with Insect Couples Provide a Simple Method for a Preliminary Assessment of Mating Disruption

    Directory of Open Access Journals (Sweden)

    Françoise Briand

    2012-01-01

    Full Text Available Mating disruption by sex pheromones is a sustainable, effective and widely used pest management scheme. A drawback of this technique is its challenging assessment of effectiveness in the field (e.g., spatial scale, pest density. The aim of this work was to facilitate the evaluation of field-deployed pheromone dispensers. We tested the suitability of small insect field cages for a pre-evaluation of the impact of sex pheromones on mating using the grape moths Eupoecilia ambiguella and Lobesia botrana, two major pests in vineyards. Cages consisted of a cubic metal frame of 35 cm sides, which was covered with a mosquito net of 1500 μm mesh size. Cages were installed in the centre of pheromone-treated and untreated vineyards. In several trials, 1 to 20 couples of grape moths per cage were released for one to three nights. The proportion of mated females was between 15 to 70% lower in pheromone-treated compared to untreated vineyards. Overall, the exposure of eight couples for one night was adequate for comparing different control schemes. Small cages may therefore provide a fast and cheap method to compare the effectiveness of pheromone dispensers under standardised semi-field conditions and may help predict the value of setting-up large-scale field trials.

  5. Protected area gap analysis of important bird areas in Tanzania

    DEFF Research Database (Denmark)

    Sritharan, Shakthi; Burgess, Neil David

    2012-01-01

    Analyses of gaps in protected area (PA) coverage of species distributions have been carried out extensively for the past two decades, aiming to better locate new PAs and conserve species. In this study, progress to close gaps in the protection of the Important Bird Areas (IBAs) of Tanzania...... that there has been a 5.3% increase (7615.1 km2) in protection of IBAs between 2007 and 2009. Of the 27 remaining IBA protection gaps, three are of high, nine of medium and fifteen of low priority for action. The current IBA "gap area" of 17,133.3 km2 contains around 26% forest, 13% shrubland, 9% grassland, 36......% wetland and 12% agricultural land. This analysis provides a simple template for defining where further action to protect remaining IBA sites in Tanzania would lead to enhanced conservation of avian biodiversity in that country and provides a methodology for analysis leading to conservation action...

  6. Tanzania | Page 41 | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Alexander Soucy is correct to identify insecticide-treated bednets and inexpensive anti-malarial drugs as crucial to the global fight against malaria ('An easy way to save three million lives,' April 26). Read more about Tanzania ... Legislation on competition brings productivity and business investment to Tanzania. Increasing ...

  7. Tanzania | Page 22 | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Language French. Read more about Quality Improvement for Maternal and Newborn Health in Mtwara Region, Tanzania (IMCHA). Language English. Read more about Building an Enhanced Cadre of Community Health Workers to Improve Maternal and Newborn Health in Rural Tanzania (IMCHA). Language English.

  8. Water resources management in Tanzania: identifying research ...

    African Journals Online (AJOL)

    This paper aims at identifying research gaps and needs and recommendations for a research agenda on water resources management in Tanzania. We reviewed published literature on water resources management in Tanzania in order to highlight what is currently known, and to identify knowledge gaps, and suggest ...

  9. Archives: Tanzania Journal of Health Research

    African Journals Online (AJOL)

    Items 1 - 50 of 57 ... Archives: Tanzania Journal of Health Research. Journal Home > Archives: Tanzania Journal of Health Research. Log in or Register to get access to full text downloads. Username, Password, Remember me, or Register · Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue · Archives ...

  10. Archives: Tanzania Journal of Agricultural Sciences

    African Journals Online (AJOL)

    Items 1 - 25 of 25 ... Archives: Tanzania Journal of Agricultural Sciences. Journal Home > Archives: Tanzania Journal of Agricultural Sciences. Log in or Register to get access to full text downloads. Username, Password, Remember me, or Register · Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue ...

  11. Archives: Tanzania Journal of Development Studies

    African Journals Online (AJOL)

    Items 1 - 9 of 9 ... Archives: Tanzania Journal of Development Studies. Journal Home > Archives: Tanzania Journal of Development Studies. Log in or Register to get access to full text downloads. Username, Password, Remember me, or Register · Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue ...

  12. Toward a nitrogen footprint calculator for Tanzania

    NARCIS (Netherlands)

    Hutton, Mary Olivia; Leach, A.M.; Leip, Adrian; Galloway, J.N.; Bekunda, M.; Sullivan, C.; Lesschen, J.P.

    2017-01-01

    We present the first nitrogen footprint model for a developing country: Tanzania. Nitrogen (N) is a crucial element for agriculture and human nutrition, but in excess it can cause serious environmental damage. The Sub-Saharan African nation of Tanzania faces a two-sided nitrogen problem: while there

  13. Industrializing Secondary Schools in Tanzania through Scientific ...

    African Journals Online (AJOL)

    Industrializing Secondary Schools in Tanzania through Scientific Innovations. ... Huria: Journal of the Open University of Tanzania ... Through review of various innovations developed by universities including SUA, it was established that there are several innovations in different fields especially in crop cultivation, animal ...

  14. Boosting youth employment prospects in Tanzania | IDRC ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    2015-12-16

    Dec 16, 2015 ... Read the brief, Boosting youth employment prospects: Tanzania, (PDF, 999 KB); Read full report, Youth employment in Tanzania: Taking stock of the evidence and knowledge gaps, (1.14 MB); For a visual representation of the key findings see the infographic poster (PDF, 296 KB). Return to main page, ...

  15. Lymphatic filariasis control in Tanga Region, Tanzania

    DEFF Research Database (Denmark)

    Simonsen, Paul Erik; Derua, Yahya A.; Magesa, Stephen M.

    2014-01-01

    BackgroundLymphatic filariasis (LF) control started in Tanga Region of Tanzania in 2004, with annual ivermectin/albendazole mass drug administration (MDA). Since then, the current project has monitored the effect in communities and schools in rural areas of Tanga District. In 2013, after 8 rounds...... of MDA, spot check surveys were added in the other 7 districts of Tanga Region, to assess the regional LF status.MethodsLF vector and transmission surveillance, and human cross sectional surveys in communities and schools, continued in Tanga District as previously reported. In each of the other 7......-examined for microfilariae (mf).ResultsThe downward trend in LF transmission and human infection previously reported for Tanga District continued, with prevalences after MDA 8 reaching 15.5% and 3.5% for CFA and mf in communities (decrease by 75.5% and 89.6% from baseline) and 2.3% for CFA in schoolchildren (decrease by 90...

  16. The Effect of Health Information Technology on Health Care Provider Communication: A Mixed-Method Protocol.

    Science.gov (United States)

    Manojlovich, Milisa; Adler-Milstein, Julia; Harrod, Molly; Sales, Anne; Hofer, Timothy P; Saint, Sanjay; Krein, Sarah L

    2015-06-11

    Communication failures between physicians and nurses are one of the most common causes of adverse events for hospitalized patients, as well as a major root cause of all sentinel events. Communication technology (ie, the electronic medical record, computerized provider order entry, email, and pagers), which is a component of health information technology (HIT), may help reduce some communication failures but increase others because of an inadequate understanding of how communication technology is used. Increasing use of health information and communication technologies is likely to affect communication between nurses and physicians. The purpose of this study is to describe, in detail, how health information and communication technologies facilitate or hinder communication between nurses and physicians with the ultimate goal of identifying how we can optimize the use of these technologies to support effective communication. Effective communication is the process of developing shared understanding between communicators by establishing, testing, and maintaining relationships. Our theoretical model, based in communication and sociology theories, describes how health information and communication technologies affect communication through communication practices (ie, use of rich media; the location and availability of computers) and work relationships (ie, hierarchies and team stability). Therefore we seek to (1) identify the range of health information and communication technologies used in a national sample of medical-surgical acute care units, (2) describe communication practices and work relationships that may be influenced by health information and communication technologies in these same settings, and (3) explore how differences in health information and communication technologies, communication practices, and work relationships between physicians and nurses influence communication. This 4-year study uses a sequential mixed-methods design, beginning with a

  17. Poor People’s Experiences of Health Services in Tanzania

    OpenAIRE

    Mamdani, Masuma; Bangser, Maggie

    2004-01-01

    Tanzania faces serious challenges to improving the health and well-being of its people. The Ministry of Health and its partners in government, the donor community and civil society have responded with concerted action, in many cases achieving significant gains. Services for prevention of mother-to child transmission of HIV are being expanded, a new protocol for malaria treatment is being implemented and evaluated, hundreds of service providers are now trained in life-saving skills for childbi...

  18. A method for analyzing the business case for provider participation in the National Cancer Institute's Community Clinical Oncology Program and similar federally funded, provider-based research networks.

    Science.gov (United States)

    Reiter, Kristin L; Song, Paula H; Minasian, Lori; Good, Marjorie; Weiner, Bryan J; McAlearney, Ann Scheck

    2012-09-01

    The Community Clinical Oncology Program (CCOP) plays an essential role in the efforts of the National Cancer Institute (NCI) to increase enrollment in clinical trials. Currently, there is little practical guidance in the literature to assist provider organizations in analyzing the return on investment (ROI), or business case, for establishing and operating a provider-based research network (PBRN) such as the CCOP. In this article, the authors present a conceptual model of the business case for PBRN participation, a spreadsheet-based tool and advice for evaluating the business case for provider participation in a CCOP organization. A comparative, case-study approach was used to identify key components of the business case for hospitals attempting to support a CCOP research infrastructure. Semistructured interviews were conducted with providers and administrators. Key themes were identified and used to develop the financial analysis tool. Key components of the business case included CCOP start-up costs, direct revenue from the NCI CCOP grant, direct expenses required to maintain the CCOP research infrastructure, and incidental benefits, most notably downstream revenues from CCOP patients. The authors recognized the value of incidental benefits as an important contributor to the business case for CCOP participation; however, currently, this component is not calculated. The current results indicated that providing a method for documenting the business case for CCOP or other PBRN involvement will contribute to the long-term sustainability and expansion of these programs by improving providers' understanding of the financial implications of participation. Copyright © 2011 American Cancer Society.

  19. Barriers to conducting effective obstetric audit in Ifakara: a qualitative assessment in an under-resourced setting in Tanzania

    NARCIS (Netherlands)

    van Hamersveld, K.T.; Bakker, E.; Nyamtema, A.S.; van den Akker, T.; Mfinanga, E.H.; van Elteren, M.; van Roosmalen, J.

    2012-01-01

    Objective To explore barriers to and solutions for effective implementation of obstetric audit at Saint Francis Designated District Hospital in Ifakara, Tanzania, where audit results have been disappointing 2years after its introduction. Methods Qualitative study involving participative observation

  20. Agricultural Development, Land Change, and Livelihoods in Tanzania's Kilombero Valley

    Science.gov (United States)

    Connors, John Patrick

    The Kilombero Valley lies at the intersection of a network of protected areas that cross Tanzania. The wetlands and woodlands of the Valley, as well as the forest of surrounding mountains are abundant in biodiversity and are considered to be critical areas for conservation. This area, however, is also the home to more than a half million people, primarily poor smallholder farmers. In an effort to support the livelihoods and food security of these farmers and the larger Tanzanian population, the country has recently targeted a series of programs to increase agricultural production in the Kilombero Valley and elsewhere in the country. Bridging concepts and methods from land change science, political ecology, and sustainable livelihoods, I present an integrated assessment of the linkages between development and conservation efforts in the Kilombero Valley and the implications for food security. This dissertation uses three empirical studies to understand the process of development in the Kilombero Valley and to link the priorities and perceptions of conservation and development efforts to the material outcomes in food security and land change. The first paper of this dissertation examines the changes in land use in the Kilombero Valley between 1997 and 2014 following the privatization of agriculture and the expansion of Tanzania's Kilimo Kwanza program. Remote sensing analysis reveals a two-fold increase in agricultural area during this short time, largely at the expense of forest. Protected areas in some parts of the Valley appear to be deterring deforestation, but rapid agricultural growth, particularly surrounding a commercial rice plantation, has led to loss of extant forest and sustained habitat fragmentation. The second paper focuses examines livelihood strategies in the Valley and claims regarding the role of agrobiodiversity in food security. The results of household survey reveal no difference or lower food security among households that diversify their

  1. Delivery, immediate newborn and cord care practices in Pemba Tanzania: a qualitative study of community, hospital staff and community level care providers for knowledge, attitudes, belief systems and practices.

    Science.gov (United States)

    Dhingra, Usha; Gittelsohn, Joel; Suleiman, Atifa Moh'd; Suleiman, Shekhia Moh'd; Dutta, Arup; Ali, Said Mohammed; Gupta, Shilpi; Black, Robert E; Sazawal, Sunil

    2014-05-22

    Deaths during the neonatal period account for almost two-thirds of all deaths in the first year of life and 40 percent of deaths before the age of five. Most of these deaths could be prevented through proven cost-effective interventions. Although there are some recent data from sub-Saharan Africa, but there is paucity of qualitative data from Zanzibar and cord care practices data from most of East Africa. We undertook a qualitative study in Pemba Island as a pilot to explore the attitudes, beliefs and practices of the community and health workers related to delivery, newborn and cord care with the potential to inform the main chlorhexidine (CHX) trial. 80 in-depth interviews (IDI) and 11 focus group discussions (FGD) involving mothers, grandmothers, fathers, traditional birth attendants and other health service providers from the community were undertaken. All IDIs and FGDs were audio taped, transcribed and analyzed using ATLAS ti 6.2. Poor transportation, cost of delivery at hospitals, overcrowding and ill treatment by hospital staff are some of the obstacles for achieving higher institutional delivery. TBAs and health professionals understand the need of using sterilized equipments to reduce risk of infection to both mothers and their babies during delivery. Despite this knowledge, use of gloves during delivery and hand washing before delivery were seldom reported. Early initiation of breastfeeding and feeding colostrum was almost universal. Hospital personnel and trained TBAs understood the importance of keeping babies warm after birth and delayed baby's first bath. The importance of cord care was well recognized in the community. Nearly all TBAs counseled the mothers to protect the cord from dust, flies and mosquitoes or any other kind of infections by covering it with cloth. There was consensus among respondents that CHX liquid cord cleansing could be successfully implemented in the community with appropriate education and awareness. The willingness of

  2. An analysis of pre-service family planning teaching in clinical and nursing education in Tanzania.

    Science.gov (United States)

    Muganyizi, Projestine S; Ishengoma, Joyce; Kanama, Joseph; Kikumbih, Nassoro; Mwanga, Feddy; Killian, Richard; McGinn, Erin

    2014-07-12

    Promoting family planning (FP) is a key strategy for health, economic and population growth. Sub-Saharan Africa, with one of the lowest contraceptive prevalence and highest fertility rates globally, contributes half of the global maternal deaths. Improving the quality of FP services, including enhancing pre-service FP teaching, has the potential to improve contraceptive prevalence. In efforts to improve the quality of FP services in Tanzania, including provider skills, this study sought to identify gaps in pre-service FP teaching and suggest opportunities for strengthening the training. Data were collected from all medical schools and a representative sample of pre-service nursing, Assistant Medical Officer (AMO), Clinical Officer (CO) and assistant CO schools in mainland Tanzania. Teachers responsible for FP teaching at the schools were interviewed using a semi-structured questionnaire. Observations on availability of teaching resources and other evidence of FP teaching and evaluation were documented. Relevant approved teaching documents were assessed for their suitability as competency-based FP teaching tools against predefined criteria. Quantitative data were analyzed using EPI Info 6 and qualitative data were manually analyzed using content analysis. A total of 35 pre-service schools were evaluated for FP teaching including 30 technical education and five degree offering schools. Of the assessed 11 pre-service curricula, only one met the criteria for suitability of FP teaching. FP teaching was typically theoretical with only 22.9% of all the schools having systems in place to produce graduates who could skillfully provide FP methods. Across schools, the target skills were the same level of competence and skewed toward short acting methods of contraception. Only 23.3% (n = 7) of schools had skills laboratories, 76% (n = 22) were either physically connected or linked to FP clinics. None of the degree providing schools practiced FP at its own teaching hospital

  3. Are Healthcare Providers Asking about Environmental Exposures? A Community-Based Mixed Methods Study

    Directory of Open Access Journals (Sweden)

    Kristina M. Zierold

    2015-01-01

    Full Text Available People living near environmental hazards may develop symptoms and health conditions that require specialized monitoring and treatment by healthcare providers. One emerging environmental hazard is coal ash. Coal ash is comprised of small particles containing heavy metals, polycyclic aromatic hydrocarbons, and radioactive elements. The overall purpose of this study was to explore whether healthcare providers ask patients if they live near an environmental hazard like coal ash storage sites and to assess what health conditions prompt a provider inquiry. Focus groups were conducted in 2012 and a cross-sectional survey was administered in 2013. Overall, 61% of survey respondents reported that their healthcare providers never asked if they lived near an environmental hazard. One focus group member stated “No, they don’t ask that. They just always blame stuff on you….” Respondents with asthma and other lung conditions were significantly more likely to be asked by a healthcare provider if they lived near an environmental hazard. Due to the unique exposures from environmental hazards and the low prevalence of patients being asked about environmental hazards, we recommend that healthcare providers take environmental health histories in order to understand patients’ exposures, to monitor symptoms of exposure, and to assist with education about reducing exposure.

  4. Implementing Modular Interactive Tiles for Rehabilitation in Tanzania – a pilot study

    DEFF Research Database (Denmark)

    Lund, Henrik Hautop; Jensen, Line Steiness Dejnbjerg; Ssessanga, Yusuf

    2014-01-01

    The pilot study in the Iringa region, Tanzania, indicates how the modular interactive tiles can be used for playful physical rehabilitation for many diverse patient groups (handicapped children, stroke, cardiac, diabetic patients, etc.) in both urban and rural areas, and how it motivates the user...... and adaptive playful technology for rehabilitation in sub-Saharan Africa....... through play to perform the physical rehabilitative actions. The system can be easily used by rehabilitation workers, and through the modularity it is robust to failure (e.g. power failure) in remote areas. The analyses of the use by many different user groups was condensed to a higher abstraction level...... to provide insight on the generalisation over the different user groups, and to provide pointers of opportunities and the means to meet these opportunities through subsequent development in the next cycles in the iterative research method. The pilot study indicates that the system can be a flexible...

  5. Provider imposed restrictions to clients’ access to family planning in urban Uttar Pradesh, India: a mixed methods study

    Science.gov (United States)

    2013-01-01

    Background Medical barriers refer to unnecessary policies or procedures imposed by health care providers that are not necessarily medically advised; these restrictions impede clients’ access to family planning (FP). This mixed methods study investigates provider imposed barriers to provision of FP using recent quantitative and qualitative data from urban Uttar Pradesh, India. Methods Baseline quantitative data were collected in six cities in Uttar Pradesh, India from service delivery points (SDP), using facility audits, exit interviews, and provider surveys; for this study, the focus is on the provider surveys. More than 250 providers were surveyed in each city. Providers were asked about the FP methods they provide, and if they restrict clients’ access to each method based on age, parity, partner consent, or marital status. For the qualitative research, we conducted one-on-one interviews with 21 service providers in four of the six cities in Uttar Pradesh. Each interview lasted approximately 45 minutes. Results The quantitative findings show that providers restrict clients’ access to spacing and long-acting and permanent methods of FP based on age, parity, partner consent and marital status. Qualitative findings reinforce that providers, at times, make judgments about their clients’ education, FP needs and ability to understand FP options thereby imposing unnecessary barriers to FP methods. Conclusions Provider restrictions on FP methods are common in these urban Uttar Pradesh sites. This means that women who are young, unmarried, have few or no children, do not have the support of their partner, or are less educated may not be able to access or use FP or their preferred method. These findings highlight the need for in-service training for staff, with a focus on reviewing current guidelines and eligibility criteria for provision of methods. PMID:24365015

  6. NMR system and method having a permanent magnet providing a rotating magnetic field

    Science.gov (United States)

    Schlueter, Ross D [Berkeley, CA; Budinger, Thomas F [Berkeley, CA

    2009-05-19

    Disclosed herein are systems and methods for generating a rotating magnetic field. The rotating magnetic field can be used to obtain rotating-field NMR spectra, such as magic angle spinning spectra, without having to physically rotate the sample. This result allows magic angle spinning NMR to be conducted on biological samples such as live animals, including humans.

  7. The duty to provide information in the case of neuroradiological examination methods

    International Nuclear Information System (INIS)

    Deutsch, E.

    1987-01-01

    The author gives a survey on the judicial decisions concerning the obligation to give information in the case of neuroradiological examination methods. The scope and content of the medical explanation depends inter alia on the urgency and the necessity of the medical diagnosis and on the understanding of the patient. (WG) [de

  8. Vehicle Tracking System, Vehicle Infrastructure Provided with Vehicle Tracking System and Method for Tracking

    NARCIS (Netherlands)

    Papp, Z.; Doodeman, G.J.N.; Nelisse, M.W.; Sijs, J.; Theeuwes, J.A.C.; Driessen, B.J.F.

    2010-01-01

    A vehicle tracking system is described comprising - a plurality of sensor nodes (10) that each provide a message (D) indicative for an occupancy status of a detection area of an vehicle infrastructure monitored by said sensor node, said sensor nodes (10) being arranged in the vehicle infrastructure

  9. A Statistical Method for Aggregated Wind Power Plants to Provide Secondary Frequency Control

    DEFF Research Database (Denmark)

    Hu, Junjie; Ziras, Charalampos; Bindner, Henrik W.

    2017-01-01

    curtailment for aggregated wind power plants providing secondary frequency control (SFC) to the power system. By using historical SFC signals and wind speed data, we calculate metrics for the reserve provision error as a function of the scheduled wind power. We show that wind curtailment can be significantly...

  10. Beyond the Repository: A Mixed Method Approach to Providing Access to Collections Online

    Science.gov (United States)

    Garrison, Brian Wade

    2013-01-01

    After providing access to over 100 video interviews conducted by a professor with notable entertainers and personalities from film through an institutional repository, an experiment was conducted to discover whether a larger audience could be gained by adding a subset of 32 of these videos to YouTube. The results, over 400,000 views, indicate that…

  11. Compositions and methods for providing plants with tolerance to abiotic stress conditions

    KAUST Repository

    Hirt, Heribert

    2017-07-27

    It has been discovered that the desert endophytic bacterium SA187 SA187 can provide resistance or tolerance to abiotic stress conditions to seeds or plants. Compositions containing SA187 can be used to enhance plant development and yield under environmental stress conditions.

  12. Environmental Law in Tanzania; How Far Have We Gone?

    Directory of Open Access Journals (Sweden)

    Daniel Mirisho Pallangyo

    2007-06-01

    Full Text Available Over the past few decades, environmental protection has emerged from a point of obscurity to one of the important issues of our time. Both at the international and national planes, the dominant theme of the environmental protection movement is the achievement of sustainable development. This paper analyses environmental law and institutions in Tanzania. The study develops an understanding of various environmental laws and institutions (both the old and current laws and policies for the purposes of looking at the extent in which Tanzania has advanced in the protection of environment. The major discussion evolves around the Tanzanian environmental policy, laws and institutions and how the same covers the major environmental issues today. The author concludes that although the Constitution of the United Republic of Tanzania provides for the ‘right to health environment’, the major environmental issues are not adequately addressed by Tanzanian environmental laws. The Environmental Management Act, 20 of 2004 serves as a framework Act and can only be effective after the promulgation of the regulations to implement it by the Minister. This has not been done yet.

  13. Community Based Nutrition Rehabilitation in Tanzania: Challenges and Lessons Learned

    International Nuclear Information System (INIS)

    Urio, Elisaphinate Moses; Jeje, Benedict; Ndossi, Godwin

    2014-01-01

    Full text: Malnutrition among children under the age of five continues to be a significant public health problem in Tanzania. Despite numerous nutritional interventions that have been implemented, the country still experiences high rates of malnutrition. According to Tanzania Demographic and Health Survey of 2010 the prevalence of underweight was estimated to be 16%, wasting 5% and stunting 42 %. Factors contributing to causes of malnutrition include immediate, underlying and basic causes. All these factors are interlinked and operate synergistically and not independently. Approaches for managing malnourished children in Tanzania evolved from facility based Nutrition Rehabilitation Units (NURU) in the late 1960s to Community Based Nutrition Rehabilitation (CBNR) in late 1980s. In the latter approach, malnourished children are rehabilitated in the same environment (village, home) that precipitated the condition, using resources and infrastructures available in the community. Mothers are taught about child feeding using family foods to make good food mixtures and of the importance of feeding frequency for the young child. Limitations for this approach include inadequate advocacy to leaders from districts down to the community level, few trained health providers and community health workers on knowledge and skills on community based nutrition rehabilitation, inadequate equipment and supplies for identification and categorization of malnutrition, low awareness of parents, care givers and community leaders on home rehabilitation of malnourished children. Nonetheless, Community Based Nutrition Rehabilitation approach has the potential to address malnutrition in children given political will and resources. (author)

  14. Evaluation of Two Malaria Rapid Diagnostic Tests Quality Assurance (mRDT’s QA) Methods in Peripheral Health Facilities, Rural Tanzania.

    OpenAIRE

    Masanja, Irene; Maganga, Musa; Sumari, Debora; Lucchi, Naomi; Udhayakumar, Venkatachalam; McMorrow, Meredith; Kachur, Patrick

    2012-01-01

    WHO recommends confirming suspected malaria cases before initiation of treatment. Due to the imited availability of quality microscopy services, this recommendation has been followed with increased use of antigen-detecting malaria rapid diagnostic tests (mRDTs) in many malaria endemic countries. With the increased use of mRDTs, the need for a thorough mRDT quality assurance (RDT QA) method has become more apparent. One of the WHO recommendations for RDT QA is to monitor the tests in field use...

  15. Provider imposed restrictions to clients' access to family planning in urban Uttar Pradesh, India: a mixed methods study.

    Science.gov (United States)

    Calhoun, Lisa M; Speizer, Ilene S; Rimal, Rajiv; Sripad, Pooja; Chatterjee, Nilesh; Achyut, Pranita; Nanda, Priya

    2013-12-23

    Medical barriers refer to unnecessary policies or procedures imposed by health care providers that are not necessarily medically advised; these restrictions impede clients' access to family planning (FP). This mixed methods study investigates provider imposed barriers to provision of FP using recent quantitative and qualitative data from urban Uttar Pradesh, India. Baseline quantitative data were collected in six cities in Uttar Pradesh, India from service delivery points (SDP), using facility audits, exit interviews, and provider surveys; for this study, the focus is on the provider surveys. More than 250 providers were surveyed in each city. Providers were asked about the FP methods they provide, and if they restrict clients' access to each method based on age, parity, partner consent, or marital status. For the qualitative research, we conducted one-on-one interviews with 21 service providers in four of the six cities in Uttar Pradesh. Each interview lasted approximately 45 minutes. The quantitative findings show that providers restrict clients' access to spacing and long-acting and permanent methods of FP based on age, parity, partner consent and marital status. Qualitative findings reinforce that providers, at times, make judgments about their clients' education, FP needs and ability to understand FP options thereby imposing unnecessary barriers to FP methods. Provider restrictions on FP methods are common in these urban Uttar Pradesh sites. This means that women who are young, unmarried, have few or no children, do not have the support of their partner, or are less educated may not be able to access or use FP or their preferred method. These findings highlight the need for in-service training for staff, with a focus on reviewing current guidelines and eligibility criteria for provision of methods.

  16. Statistical Physics Methods Provide the Exact Solution to a Long-Standing Problem of Genetics

    Science.gov (United States)

    Samal, Areejit; Martin, Olivier C.

    2015-06-01

    Analytic and computational methods developed within statistical physics have found applications in numerous disciplines. In this Letter, we use such methods to solve a long-standing problem in statistical genetics. The problem, posed by Haldane and Waddington [Genetics 16, 357 (1931)], concerns so-called recombinant inbred lines (RILs) produced by repeated inbreeding. Haldane and Waddington derived the probabilities of RILs when considering two and three genes but the case of four or more genes has remained elusive. Our solution uses two probabilistic frameworks relatively unknown outside of physics: Glauber's formula and self-consistent equations of the Schwinger-Dyson type. Surprisingly, this combination of statistical formalisms unveils the exact probabilities of RILs for any number of genes. Extensions of the framework may have applications in population genetics and beyond.

  17. A Novel Resource Management Method of Providing Operating System as a Service for Mobile Transparent Computing

    Directory of Open Access Journals (Sweden)

    Yonghua Xiong

    2014-01-01

    Full Text Available This paper presents a framework for mobile transparent computing. It extends the PC transparent computing to mobile terminals. Since resources contain different kinds of operating systems and user data that are stored in a remote server, how to manage the network resources is essential. In this paper, we apply the technologies of quick emulator (QEMU virtualization and mobile agent for mobile transparent computing (MTC to devise a method of managing shared resources and services management (SRSM. It has three layers: a user layer, a manage layer, and a resource layer. A mobile virtual terminal in the user layer and virtual resource management in the manage layer cooperate to maintain the SRSM function accurately according to the user’s requirements. An example of SRSM is used to validate this method. Experiment results show that the strategy is effective and stable.

  18. A novel resource management method of providing operating system as a service for mobile transparent computing.

    Science.gov (United States)

    Xiong, Yonghua; Huang, Suzhen; Wu, Min; Zhang, Yaoxue; She, Jinhua

    2014-01-01

    This paper presents a framework for mobile transparent computing. It extends the PC transparent computing to mobile terminals. Since resources contain different kinds of operating systems and user data that are stored in a remote server, how to manage the network resources is essential. In this paper, we apply the technologies of quick emulator (QEMU) virtualization and mobile agent for mobile transparent computing (MTC) to devise a method of managing shared resources and services management (SRSM). It has three layers: a user layer, a manage layer, and a resource layer. A mobile virtual terminal in the user layer and virtual resource management in the manage layer cooperate to maintain the SRSM function accurately according to the user's requirements. An example of SRSM is used to validate this method. Experiment results show that the strategy is effective and stable.

  19. Managing nuclear information in Tanzania

    International Nuclear Information System (INIS)

    Sawe, S.F.; Sungita, Y.Y.

    2004-01-01

    Nuclear information management and the applications of nuclear technology in Tanzania are limited to medical, agriculture, research and some industrial applications. It is demanding that the National database for nuclear information be established to keep the track of the information on radiation facilities, manpower development, radiation sources and radioactive waste management. In this paper the current status of nuclear information management in Tanzania is presented. The development, setbacks and future plans for establishment of national database with consequent improvement of nuclear information management are discussed. The National Radiation Commission (NRC) which is an official government body responsible for atomic energy matters in collaboration with other institutions applying nuclear technology keeps the records and inventory of facilities, manpower development and projects related to the nuclear field. The available information about nuclear application activities has been obtained through possessors' declaration, monitoring at entry/exit points, periodic reports from the licensees, radiation safety inspections, and the available link with the International Atomic Energy Agency (IAEA). In order to facilitate the dissemination of information, five ICT centres to serve in the fields of research, nuclear instrumentation, human health and agriculture have been established. The inventory of radiation facilities/materials and human resource is being build up as an initial input to the National database. Establishment of INIS centre is expected to improve the nuclear information management system in the country. The government and the IAEA are encouraged to support nuclear information management especially by strengthening ICT centres and facilitating the establishment of INIS National centre. (author)

  20. Managing nuclear information in Tanzania

    International Nuclear Information System (INIS)

    Sawe, S.F.; Sungita, Y.Y.

    2004-01-01

    Full text: Nuclear information management and the applications of nuclear technology in Tanzania are limited to medical, agriculture, research and some industrial applications. It is demanding that the National database for nuclear information be established to keep the track of the information on radiation facilities, manpower development, radiation sources and radioactive waste management. In this paper the current status of nuclear information management in Tanzania is presented. The development, setbacks and future plans for establishment of national database with consequent improvement of nuclear information management are discussed. The National Radiation Commission (NRC) which is an official government body responsible for atomic energy matters in collaboration with other institutions applying nuclear technology, keeps the records and inventory of facilities, manpower development and projects related to the nuclear field. The available information about nuclear application activities has been obtained through possessors' declaration, monitoring at entry/exit points, periodic reports from the licensees, radiation safety inspections, and the available link with the International Atomic Agency (IAEA). In order to facilitate the dissemination of information, five ICT centers to serve in the fields of research, nuclear instrumentation, human health and agriculture have been established. The inventory of radiation facilities/materials and human resource is being build up as an initial input to the National database. Establishment of INIS center is expected to improve the nuclear information management system in the country. The government and the IAEA are encouraged to support nuclear information management especially by strengthening ICT centers and facilitating the establishment of INIS National center. (author)

  1. Evaluation of Two Statistical Methods Provides Insights into the Complex Patterns of Alternative Polyadenylation Site Switching

    Science.gov (United States)

    Li, Jie; Li, Rui; You, Leiming; Xu, Anlong; Fu, Yonggui; Huang, Shengfeng

    2015-01-01

    Switching between different alternative polyadenylation (APA) sites plays an important role in the fine tuning of gene expression. New technologies for the execution of 3’-end enriched RNA-seq allow genome-wide detection of the genes that exhibit significant APA site switching between different samples. Here, we show that the independence test gives better results than the linear trend test in detecting APA site-switching events. Further examination suggests that the discrepancy between these two statistical methods arises from complex APA site-switching events that cannot be represented by a simple change of average 3’-UTR length. In theory, the linear trend test is only effective in detecting these simple changes. We classify the switching events into four switching patterns: two simple patterns (3’-UTR shortening and lengthening) and two complex patterns. By comparing the results of the two statistical methods, we show that complex patterns account for 1/4 of all observed switching events that happen between normal and cancerous human breast cell lines. Because simple and complex switching patterns may convey different biological meanings, they merit separate study. We therefore propose to combine both the independence test and the linear trend test in practice. First, the independence test should be used to detect APA site switching; second, the linear trend test should be invoked to identify simple switching events; and third, those complex switching events that pass independence testing but fail linear trend testing can be identified. PMID:25875641

  2. Physicians' opinions about partner notification methods: case reporting, patient referral, and provider referral.

    Science.gov (United States)

    Hogben, M; St Lawrence, J S; Montaño, D E; Kasprzyk, D; Leichliter, J S; Phillips, W R

    2004-02-01

    The United States has relied upon partner notification strategies to help break the chain of infection and re-infection for sexually transmitted diseases (STD). Physicians are a vital link in the system of STD control, but little is known of physician opinions about partner notification strategies. We collected opinions about partner notification from a national probability sample of physicians in specialties diagnosing STDs. Physicians responded to 17 questions about three relevant forms of STD partner notification: patient based referral, provider based referral, and case reporting. Exploratory factor analyses showed that responses for each form of partner notification could be grouped into four categories: perceived practice norms, infection control, patient relationships, and time/money. Multivariate analyses of the factors showed that physicians endorsed patient based referral most favourably and provider based referral least favourably. Physicians' opinions about partner notification strategies appear to reflect objective reality in some areas, but not in others. Strategies that improve the fit between physicians' opinions and effective notification are needed: some are discussed here.

  3. Antenatal care in practice: an exploratory study in antenatal care clinics in the Kilombero Valley, south-eastern Tanzania

    Directory of Open Access Journals (Sweden)

    Kessy Flora

    2011-05-01

    Full Text Available Abstract Background The potential of antenatal care for reducing maternal morbidity and improving newborn survival and health is widely acknowledged. Yet there are worrying gaps in knowledge of the quality of antenatal care provided in Tanzania. In particular, determinants of health workers' performance have not yet been fully understood. This paper uses ethnographic methods to document health workers' antenatal care practices with reference to the national Focused Antenatal Care guidelines and identifies factors influencing health workers' performance. Potential implications for improving antenatal care provision in Tanzania are discussed. Methods Combining different qualitative techniques, we studied health workers' antenatal care practices in four public antenatal care clinics in the Kilombero Valley, south-eastern Tanzania. A total of 36 antenatal care consultations were observed and compared with the Focused Antenatal Care guidelines. Participant observation, informal discussions and in-depth interviews with the staff helped to identify and explain health workers' practices and contextual factors influencing antenatal care provision. Results The delivery of antenatal care services to pregnant women at the selected antenatal care clinics varied widely. Some services that are recommended by the Focused Antenatal Care guidelines were given to all women while other services were not delivered at all. Factors influencing health workers' practices were poor implementation of the Focused Antenatal Care guidelines, lack of trained staff and absenteeism, supply shortages and use of working tools that are not consistent with the Focused Antenatal Care guidelines. Health workers react to difficult working conditions by developing informal practices as coping strategies or "street-level bureaucracy". Conclusions Efforts to improve antenatal care should address shortages of trained staff through expanding training opportunities, including health worker

  4. Method for providing uranium articles with a corrosion-resistant anodized coating

    Science.gov (United States)

    Waldrop, F.B.; Washington, C.A.

    1981-01-07

    Uranium articles are provided with anodized oxide coatings in an aqueous solution of an electrolyte selected from the group consisting of potassium phosphate, potassium hydroxide, ammonium hydroxide, and a mixture of potassium tetraborate and boric acid. The uranium articles are anodized at a temperature greater than about 75/sup 0/C with a current flow of less than about 0.036 A/cm/sup 2/ of surface area while the pH of the solution is maintained in a range of about 2 to 11.5. The pH values of the aqueous solution and the low current density utilized during the electrolysis prevent excessive dissolution of the uranium and porosity in the film or watering. The relatively high temperature of the electrolyte bath inhibits hydration and the attendant deleterious pitting so as to enhance corrosion resistance of the anodized coating.

  5. Method for providing uranium articles with a corrosion resistant anodized coating

    Science.gov (United States)

    Waldrop, Forrest B.; Washington, Charles A.

    1982-01-01

    Uranium articles are provided with anodized oxide coatings in an aqueous solution of an electrolyte selected from the group consisting of potassium phosphate, potassium hydroxide, ammonium hydroxide, and a mixture of potassium tetraborate and boric acid. The uranium articles are anodized at a temperature greater than about 75.degree. C. with a current flow of less than about 0.036 A/cm.sup.2 of surface area while the pH of the solution is maintained in a range of about 2 to 11.5. The pH values of the aqueous solution and the low current density utilized during the electrolysis prevent excessive dissolution of the uranium and porosity in the film or watering. The relatively high temperature of the electrolyte bath inhibits hydration and the attendant deleterious pitting so as to enhance corrosion resistance of the anodized coating.

  6. Method for providing uranium articles with a corrosion resistant anodized coating

    International Nuclear Information System (INIS)

    Waldrop, F.B.; Washington, C.A.

    1982-01-01

    Uranium articles are provided with anodized oxide coatings in an aqueous solution of an electrolyte selected from the group consisting of potassium phosphate, potassium hydroxide, ammonium hydroxide, and a mixture of potassium tetraborate and boric acid. The uranium articles are anodized at a temperature greater than about 75 degrees C. With a current flow of less than about 0.036 A/cm2 of surface area while the Ph of the solution is maintained in a range of about 2 to 11.5. The Ph values of the aqueous solution and the low current density utilized during the electrolysis prevent excessive dissolution of the uranium and porosity in the film or watering. The relatively high temperature of the electrolyte bath inhibits hydration and the attendant deleterious pitting so as to enhance corrosion resistance of the anodized coating

  7. Pediatric primary care providers' perspectives regarding hospital discharge communication: a mixed methods analysis.

    Science.gov (United States)

    Leyenaar, JoAnna K; Bergert, Lora; Mallory, Leah A; Engel, Richard; Rassbach, Caroline; Shen, Mark; Woehrlen, Tess; Cooperberg, David; Coghlin, Daniel

    2015-01-01

    Effective communication between inpatient and outpatient providers may mitigate risks of adverse events associated with hospital discharge. However, there is an absence of pediatric literature defining effective discharge communication strategies at both freestanding children's hospitals and general hospitals. The objectives of this study were to assess associations between pediatric primary care providers' (PCPs) reported receipt of discharge communication and referral hospital type, and to describe PCPs' perspectives regarding effective discharge communication and areas for improvement. We administered a questionnaire to PCPs referring to 16 pediatric hospital medicine programs nationally. Multivariable models were developed to assess associations between referral hospital type and receipt and completeness of discharge communication. Open-ended questions asked respondents to describe effective strategies and areas requiring improvement regarding discharge communication. Conventional qualitative content analysis was performed to identify emergent themes. Responses were received from 201 PCPs, for a response rate of 63%. Although there were no differences between referral hospital type and PCP-reported receipt of discharge communication (relative risk 1.61, 95% confidence interval 0.97-2.67), PCPs referring to general hospitals more frequently reported completeness of discharge communication relative to those referring to freestanding children's hospitals (relative risk 1.78, 95% confidence interval 1.26-2.51). Analysis of free text responses yielded 4 major themes: 1) structured discharge communication, 2) direct personal communication, 3) reliability and timeliness of communication, and 4) communication for effective postdischarge care. This study highlights potential differences in the experiences of PCPs referring to general hospitals and freestanding children's hospitals, and presents valuable contextual data for future quality improvement initiatives

  8. Tanzania Journal of Science: Editorial Policies

    African Journals Online (AJOL)

    Tanzania Journal of Science would welcome manuscripts on: Biology, Zoology, Ecology, Botany, Chemistry, Earth sciences, Marine sciences, Physics, Life sciences, Applied Mathematics, Computer sciences, Logic, Mathematics, Systems science, Applied Physics, biomedical sciences, Computational biology, Electronics, ...

  9. New Uropodine mites from Tanzania (Acari: Mesostigmata)

    Czech Academy of Sciences Publication Activity Database

    Kontschán, J.; Starý, Josef

    2013-01-01

    Roč. 3683, č. 3 (2013), s. 267-279 ISSN 1175-5326 Institutional support: RVO:60077344 Keywords : Acari * Mesostigmata * Uropodina * new genus * new species * Tanzania Subject RIV: EG - Zoology Impact factor: 1.060, year: 2013

  10. Tanzania Monitoring and Evaluation Management Services

    Data.gov (United States)

    US Agency for International Development — MEMS II is a two-year project to enable USAID/Tanzania and a number of its partners to meet their multifold performance reporting responsibilities; upgrade,...

  11. SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

    Directory of Open Access Journals (Sweden)

    Mehmet AYBEKE

    2015-12-01

    Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

  12. Analysis of methods of providing anonymity in facial photographs; a randomised controlled study.

    LENUS (Irish Health Repository)

    Clover, A J P

    2010-09-01

    Clinical images are invaluable in medical teaching and research publications. In the past efforts to conceal patient identity, if any, were limited to a black bar concealing the eyes. However, there is no consensus on this among major journals and publishing houses. This research analyses the effectiveness of blacking out the eyes in facial photographs and evaluates alternative techniques. 126 questionnaires were completed. The average numbers of correct responses out of 30 was 24.64 (82.13%) in the control group, 20.59 (68.63%) in the eyes, 20.42 (68.07%) in the eyes and nose group, and 17.53 (58.43%) in the T-shaped group (eyes, nose and mouth). The traditional method of covering the eyes does significantly decrease recognition, however it is only as effective as covering the nose and mouth. The more of the face that is covered the less likely it is that the person is recognised. However, there are people who remain identifiable no matter how much of the face is covered. This work highlights the importance of obtaining consent prior to publication as well as attempting to hide identity.

  13. Toward a nitrogen footprint calculator for Tanzania

    Science.gov (United States)

    Hutton, Mary Olivia; Leach, Allison M.; Leip, Adrian; Galloway, James N.; Bekunda, Mateete; Sullivan, Clare; Lesschen, Jan Peter

    2017-03-01

    We present the first nitrogen footprint model for a developing country: Tanzania. Nitrogen (N) is a crucial element for agriculture and human nutrition, but in excess it can cause serious environmental damage. The Sub-Saharan African nation of Tanzania faces a two-sided nitrogen problem: while there is not enough soil nitrogen to produce adequate food, excess nitrogen that escapes into the environment causes a cascade of ecological and human health problems. To identify, quantify, and contribute to solving these problems, this paper presents a nitrogen footprint tool for Tanzania. This nitrogen footprint tool is a concept originally designed for the United States of America (USA) and other developed countries. It uses personal resource consumption data to calculate a per-capita nitrogen footprint. The Tanzania N footprint tool is a version adapted to reflect the low-input, integrated agricultural system of Tanzania. This is reflected by calculating two sets of virtual N factors to describe N losses during food production: one for fertilized farms and one for unfertilized farms. Soil mining factors are also calculated for the first time to address the amount of N removed from the soil to produce food. The average per-capita nitrogen footprint of Tanzania is 10 kg N yr-1. 88% of this footprint is due to food consumption and production, while only 12% of the footprint is due to energy use. Although 91% of farms in Tanzania are unfertilized, the large contribution of fertilized farms to N losses causes unfertilized farms to make up just 83% of the food production N footprint. In a developing country like Tanzania, the main audiences for the N footprint tool are community leaders, planners, and developers who can impact decision-making and use the calculator to plan positive changes for nitrogen sustainability in the developing world.

  14. Gamma Knife radiosurgery of olfactory groove meningiomas provides a method to preserve subjective olfactory function.

    Science.gov (United States)

    Gande, Abhiram; Kano, Hideyuki; Bowden, Gregory; Mousavi, Seyed H; Niranjan, Ajay; Flickinger, John C; Lunsford, L Dade

    2014-02-01

    Anosmia is a common outcome after resection of olfactory groove meningioma(s) (OGM) and for some patients represents a significant disability. To evaluate long term tumor control rates and preservation of subjective olfaction after Gamma Knife (GK) stereotactic radiosurgery (SRS) of OGM. We performed a retrospective chart review and telephone assessments of 41 patients who underwent GK SRS between 1987 and 2008. Clinical outcomes were stratified by full, partial or no subjective olfaction, whereas tumor control was assessed by changes in volume greater or lesser than 25%. The median clinical and imaging follow-up were 76 and 65 months, respectively. Prior to SRS, 19 (46%) patients had surgical resections and two (5%) had received fractionated radiation therapy. Twenty four patients (59%) reported a normal sense of smell, 12 (29%) reported a reduced sense of smell and five (12%) had complete anosmia. The median tumor volume was 8.5 cm(3) (range 0.6-56.1), the mean radiation dose at the tumor margin was 13 Gy (range 10-20) and the median estimated dose to the olfactory nerve was 5.1 Gy (range 1.1-18.1). At follow-up, 27 patients (66%) reported intact olfaction (three (7%) described return to a normal sense of smell), nine (22%) described partial anosmia, and five (12%) had complete anosmia. No patient reported deterioration in olfaction after SRS. Thirteen patients (32%) showed significant tumor regression, 26 (63%) had no further growth and two (5%) had progressed. The progression free tumor control rates were 97% at 1 year and 95% at 2, 10 and 20 years. Symptomatic adverse radiation effects occurred in three (7%) patients. Stereotactic radiosurgery provided both long term tumor control and preservation of olfaction.

  15. Electronic Field Data Collection in Support of Satellite-Based Food Security Monitoring in Tanzania

    Science.gov (United States)

    Nakalembe, C. L.; Dempewolf, J.; Justice, C. J.; Becker-Reshef, I.; Tumbo, S.; Maurice, S.; Mbilinyi, B.; Ibrahim, K.; Materu, S.

    2016-12-01

    In Tanzania agricultural extension agents traditionally collect field data on agriculture and food security on paper, covering most villages throughout the country. The process is expensive, slow and cumbersome and prone to data transcription errors when the data get entered at the district offices into electronic spreadsheets. Field data on the status and condition of agricultural crops, the population's nutritional status, food storage levels and other parameters are needed in near realtime for early warning to make critical but most importantly timely and appropriate decisions that are informed with verified data from the ground. With the ubiquitous distribution of cell phones, which are now used by the vast majority of the population in Tanzania including most farmers, new, efficient and cost-effective methods for field data collection have become available. Using smartphones and tablets data on crop conditions, pest and diseases, natural disasters and livelihoods can be collected and made available and easily accessible in near realtime. In this project we implemented a process for obtaining high quality electronic field data using the GeoODK application with a large network of field extension agents in Tanzania and Uganda. These efforts contribute to work being done on developing an advanced agriculture monitoring system for Tanzania, incorporating traditional data collection with satellite information and field data. The outcomes feed directly into the National Food Security Bulletin for Tanzania produced by the Ministry of Agriculture as well as a form a firm evidence base and field scale monitoring of the disaster risk financing in Uganda.

  16. Impediments of E-Learning Adoption in Higher Learning Institutions of Tanzania: An Empirical Review

    Science.gov (United States)

    Mwakyusa, Wilson Pholld; Mwalyagile, Neema Venance

    2016-01-01

    It is experienced that most of the Higher Learning Institutions (HLIs) in developing countries including Tanzania fails to fully implement e-learning system as a an alternative method of delivering education to a large population in the universities. However, some of HLIs are practicing the blended method by which both elearning and traditional…

  17. Social security systems in Tanzania: Phase II: Co-operatives and ...

    African Journals Online (AJOL)

    In the 1950s and 1960s Tanzania had the third largest co-operative movement in the world. These co-operatives provided economic and social protection to members so that poor peasants could sell their crops even in years of bad world market prices. The services provided by co-operatives, like education and trusteeship ...

  18. Building an Agricultural Extension Services System Supported by ICTs in Tanzania: Progress Made, Challenges Remain

    Science.gov (United States)

    Sanga, C.; Kalungwizi, V. J.; Msuya, C. P.

    2013-01-01

    The conventional agricultural extension service in Tanzania is mainly provided by extension officers visiting farmers to provide agricultural advisory service. This system of extension service provision faces a number of challenges including the few number of extension officers and limited resources. This article assesses the effectiveness of an…

  19. Three years of HIV/AIDS care and treatment services in Tanzania ...

    African Journals Online (AJOL)

    The Tanzania HIV Care and Treatment Plan was launched in October 2004 aiming at providing 440,000 AIDS patients with antiretroviral drugs (ARVs) and track disease progression in 1.2 million HIV+ persons by the end of the 2008. This paper is intended to provide information to stake holders of the achievements and ...

  20. Relationships matter: contraceptive choices among HIV-positive women in Tanzania.

    Science.gov (United States)

    Nyanja, Tabitha Alexandria Njeri; Tulinius, Charlotte

    2017-07-01

    Efforts to eliminate mother-to-child transmission of HIV in Tanzania are guided by a four-prong strategy advocated by the World Health Organization (WHO). Prong 2, prevention of unintended pregnancies among women living with HIV, has, however, received the least attention and contraceptive use to prevent unintended pregnancies remains low. This study explored the perceived barriers to the use of modern methods of contraception, and factors influencing contraceptive choice among HIV-positive women in urban Dar-es-Salaam, Tanzania. A qualitative multi-site study was conducted, utilising in-depth interviews and focus group discussions with 37 sexually active HIV-positive women aged between 20 and 44 years, attending three health facilities within Dar-es-Salaam. The theoretical framework was a patient centred model. Four barriers were identified: the influence of the women's spousal relationships; personal beliefs and the relationship of these in understanding her disease; the influence of the social demands on the woman and her relationships; and the importance of a woman's relationship with her healthcare provider/healthcare system. Being the bearers of bad news (HIV-positive status) the pregnant women experienced conflicts, violence, abandonment and rejection. The loss in negotiating power for the women was in relation to their intimate partners, but also in the patient-healthcare provider relationship. The role of the male partner as a barrier to contraceptive use cannot be understated. Therefore, the results suggest that healthcare providers should ensure patient-focused education and provide support that encompasses the importance of their relationships. Additional research is required to elucidate the functional association between contraceptive choices and personal and social relationships.

  1. Private providers' knowledge, attitudes and misconceptions related to long-acting and permanent contraceptive methods: a case study in Bangladesh.

    Science.gov (United States)

    Ugaz, Jorge; Banke, Kathryn; Rahaim, Stephen; Chowdhury, Wahiduzzaman; Williams, Julie

    2016-11-01

    In Bangladesh, use of long-acting and permanent methods of contraception (LAPMs) remains stagnant. Providers' limited knowledge and biases may be a factor. We assessed private providers' knowledge, misconceptions and general attitudes towards LAPM in two urban areas. The ultimate goal is to shape programs and interventions to overcome these obstacles and improve full method choice in Bangladesh. Trained data collectors interviewed a convenience sample of 235 female doctors (obstetricians-gynecologists and general practitioners) and 150 female nurses from 194 commercial (for-profit) health care facilities in Chittagong City Corporation and Dhaka district. Data were collected on the nature of the practice, training received, knowledge about modern contraceptives and attitudes towards LAPM [including intrauterine device (IUDs), implants, female and male sterilization]. All providers, and especially doctors, lacked adequate knowledge regarding side effects for all LAPMs, particularly female and male sterilization. Providers had misconceptions about the effectiveness and convenience of LAPMs compared to short-acting contraceptive methods. Implants and IUDs were generally perceived more negatively than other methods. The majority of providers believed that husbands favor short-acting methods rather than LAPMs and that women should not use a method that their husbands do not approve of. Our findings document knowledge and attitudinal barriers among private for-profit providers in urban areas affecting their provision of accurate information about LAPM choices. Practitioners should be offered the necessary tools to provide women full access to all modern methods, especially LAPMs, in order to contribute to decreasing unmet need and improving full method choice in Bangladesh. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. Archives: Tanzania Journal of Forestry and Nature Conservation

    African Journals Online (AJOL)

    Items 1 - 18 of 18 ... Archives: Tanzania Journal of Forestry and Nature Conservation. Journal Home > Archives: Tanzania Journal of Forestry and Nature Conservation. Log in or Register to get access to full text downloads.

  3. Tanzania Journal of Forestry and Nature Conservation: Journal ...

    African Journals Online (AJOL)

    Tanzania Journal of Forestry and Nature Conservation: Journal Sponsorship. Journal Home > About the Journal > Tanzania Journal of Forestry and Nature Conservation: Journal Sponsorship. Log in or Register to get access to full text downloads.

  4. Key considerations in scaling up male circumcision in Tanzania ...

    African Journals Online (AJOL)

    Key considerations in scaling up male circumcision in Tanzania: views of the urban residents in Tanzania. Joel Msafiri Francis, Deodatus Kakoko, Edith A.M Tarimo, Patricia Munseri, Muhammad Bakari, Eric Sandstrom ...

  5. The projected and perceived image of the United Republic of Tanzania

    OpenAIRE

    Koerte, Tammy Reiko

    2009-01-01

    While Tanzania has enjoyed increasing popularity as a tourism destination, there is a lack of research on Tanzania's tourism image. Tanzania 's tourism growth, however, depends upon the congruency of its projected and perceived images. This research examines the government's projected image of Tanzania and measures its congruency with the image perceived by past visitors to Tanzania. The study utilized the Tanzania Tourist Board and Tanzania Travel and Tourism Online websites as well as 36...

  6. Back to Office Report. Mission no.1 to Tanzania as counterpart institution to Cleaner Production Centre of Tanzania

    DEFF Research Database (Denmark)

    Jørgensen, Michael Søgaard

    1996-01-01

    A presentation of some important actors and institutions in the capacity building within cleaner production in Tanzania......A presentation of some important actors and institutions in the capacity building within cleaner production in Tanzania...

  7. Globalisation and Job Insecurity in Tanzania's Manufacturing Sector ...

    African Journals Online (AJOL)

    Globalisation and Job Insecurity in Tanzania's Manufacturing Sector. ... Tanzania Journal of Development Studies ... This paper examines the effects of globalization on job security using a number of indicators from the Regional Programme on Enterprise Development (RPED) and Tanzania Manufacturing Enterprise ...

  8. Method and apparatus for use in harnessing solar energy to provide initial acceleration and propulsion of devices

    Energy Technology Data Exchange (ETDEWEB)

    Gutsche, G.E.

    1983-09-13

    The present invention relates to a method of providing thrust and added lift to a vehicle by accelerating fluid heated by solar energy. The present invention also relates to apparatus for carrying out the aforementioned method. Accordingly, the present invention relates to a method of providing initial acceleration and propulsion or enhancing the initial acceleration and propulsion of a vehicle in an environment having at least some fluid, the vehicle being of the type having at least one member, at least a portion of which is treated for absorbing solar radiation for heating fluid adjacent the member for use in propelling the vehicle through the environment. By use of direct and/or focused solar radiation, fluid is heated, accelerated and deflected away from a vehicle by natural or forced convection to provide thrust and lift of the vehicle.

  9. Malaria risk factors in north-east Tanzania

    Directory of Open Access Journals (Sweden)

    Mtove George

    2011-04-01

    Full Text Available Abstract Background Understanding the factors which determine a household's or individual's risk of malaria infection is important for targeting control interventions at all intensities of transmission. Malaria ecology in Tanzania appears to have reduced over recent years. This study investigated potential risk factors and clustering in face of changing infection dynamics. Methods Household survey data were collected in villages of rural Muheza district. Children aged between six months and thirteen years were tested for presence of malaria parasites using microscopy. A multivariable logistic regression model was constructed to identify significant risk factors for children. Geographical information systems combined with global positioning data and spatial scan statistic analysis were used to identify clusters of malaria. Results Using an insecticide-treated mosquito net of any type proved to be highly protective against malaria (OR 0.75, 95% CI 0.59-0.96. Children aged five to thirteen years were at higher risk of having malaria than those aged under five years (OR 1.71, 95% CI 1.01-2.91. The odds of malaria were less for females when compared to males (OR 0.62, 95% CI 0.39-0.98. Two spatial clusters of significantly increased malaria risk were identified in two out of five villages. Conclusions This study provides evidence that recent declines in malaria transmission and prevalence may shift the age groups at risk of malaria infection to older children. Risk factor analysis provides support for universal coverage and targeting of long-lasting insecticide-treated nets (LLINs to all age groups. Clustering of cases indicates heterogeneity of risk. Improved targeting of LLINs or additional supplementary control interventions to high risk clusters may improve outcomes and efficiency as malaria transmission continues to fall under intensified control.

  10. Tanzania.

    African Journals Online (AJOL)

    variation (Seebeck, 1973: Mackinnon-e't ar: 1990): Majority of paststlidies"on' reproductive performance from' tropicar-are'as have been' largely limited to'the assessment of effects of>. ·no'n.,genetk factors and breed difference's : '(Galiila. and Arthur, 1989), Genetic parameter es-, timates and infonnation. on the'extent of ...

  11. tanzania

    African Journals Online (AJOL)

    Mean total lengths of O. urolepis caught in gillnets of legal mesh sizes (ranging from 88 mm and 114 mm), ranged between 22.0 cm and 27 cm. Their mean weights were between ..... fishermen at Chamsisiri and Changarawe fish camps for their hospitality and assistance during the study period. Ms G. Kang'oma and Mr. V.

  12. Tanzania.

    African Journals Online (AJOL)

    As) in the environment. Metallic mercury is used for purification of gold ores by small-. Scale miners, therefore, is also released to the environment. Mercury is mixed with the concentrate in a pan to form a Hg-Au amalgam. Finally Au is recovered through the process of amalgam roasting in open air. (or by the use of a retort), ...

  13. Sustaining Ecotourism in Tanzania through Community

    Directory of Open Access Journals (Sweden)

    Liliane Pasape

    2014-06-01

    Full Text Available This study explores the contribution of community empowerment to the sustainability of ecotourism in Tanzania using education programmes, access to information and language. Through the survey approach data was collected from Tanzania’s ecotourism stakeholders (N=250 in the eight selected regions of Dar es Salaam, Pwani, Morogoro, Tanga and Zanzibar (for the eastern tourism circuit and Arusha, Kilimanjaro and Manyara (for the northern circuit and thereafter a qualitative analysis was employed complemented by estimation of the multinomial logistic regression model. The findings show that tourism stakeholders lack sufficient knowledge on ecotourism conservation and preservation. Likewise community members have poor access to information due to insufficient ecotourism publications, tourist information centres, a reliable mechanism for communicating with stakeholders and the use of foreign languages in most of the publications. It is therefore the study’s recommendation that community members be empowered through being provided with adequate education programmes and access to relevant information and the use of a language that is understood by them in order to broaden their level of understanding, enhance their management skills and contribute significantly to ecotourism-related activities.

  14. Where there is no morphine: The challenge and hope of palliative care delivery in Tanzania

    Directory of Open Access Journals (Sweden)

    Kristopher Hartwig

    2014-01-01

    Full Text Available Background: In Tanzania, a country of 42 million, access to oral morphine is rare.Aim: To demonstrate the effectiveness of palliative care teams in reducing patients’ pain and in increasing other positive life qualities in the absence of morphine; and to document the psychological burden experienced by their clinical providers, trained in morphine delivery, as they observed their patients suffering and in extreme pain.Setting: One hundred and forty-fie cancer patients were included from 13 rural hospitals spread across Tanzania.Method: A mixed method study beginning with a retrospective quantitative analysis of cancer patients who were administered the APCA African POS tool four times. Bivariate analyses of the scores at time one and four were compared across the domains. The qualitative arm included an analysis of interviews with six nurses, each with more than fie years’ palliative care experience and no access to strong opioids.Results: Patients and their family caregivers identifid statistically signifiant (p < 0.001 improvements in all of the domains. Thematic analysis of nurse interviews described the patient and family benefis from palliative care but also their great distress when ‘bad cases’ arose who would likely benefi only from oral morphine.Conclusion: People living with chronic cancer-related pain who receive palliative care experience profound physical, spiritual and emotional benefis even without oral morphine. These results demonstrate the need for continued advocacy to increase the availability of oral morphine in these settings in addition to palliative care services.

  15. Children’s Medicines in Tanzania: A National Survey of Administration Practices and Preferences

    Science.gov (United States)

    Adams, Lisa V.; Craig, Sienna R.; Mmbaga, Elia John; Naburi, Helga; Lahey, Timothy; Nutt, Cameron T.; Kisenge, Rodrick; Noel, Gary J.; Spielberg, Stephen P.

    2013-01-01

    Objective The dearth of age-appropriate formulations of many medicines for children poses a major challenge to pediatric therapeutic practice, adherence, and health care delivery worldwide. We provide information on current administration practices of pediatric medicines and describe key stakeholder preferences for new formulation characteristics. Patients and Methods We surveyed children aged 6–12 years, parents/caregivers over age 18 with children under age 12, and healthcare workers in 10 regions of Tanzania to determine current pediatric medicine prescription and administration practices as well as preferences for new formulations. Analyses were stratified by setting, pediatric age group, parent/caregiver education, and healthcare worker cadre. Results Complete data were available for 206 children, 202 parents/caregivers, and 202 healthcare workers. Swallowing oral solid dosage forms whole or crushing/dissolving them and mixing with water were the two most frequently reported methods of administration. Children frequently reported disliking medication taste, and many had vomited doses. Healthcare workers reported medicine availability most significantly influences prescribing practices. Most parents/caregivers and children prefer sweet-tasting medicine. Parents/caregivers and healthcare workers prefer oral liquid dosage forms for young children, and had similar thresholds for the maximum number of oral solid dosage forms children at different ages can take. Conclusions There are many impediments to acceptable and accurate administration of medicines to children. Current practices are associated with poor tolerability and the potential for under- or over-dosing. Children, parents/caregivers, and healthcare workers in Tanzania have clear preferences for tastes and formulations, which should inform the development, manufacturing, and marketing of pediatric medications for resource-limited settings. PMID:23484012

  16. Children's medicines in Tanzania: a national survey of administration practices and preferences.

    Directory of Open Access Journals (Sweden)

    Lisa V Adams

    Full Text Available OBJECTIVE: The dearth of age-appropriate formulations of many medicines for children poses a major challenge to pediatric therapeutic practice, adherence, and health care delivery worldwide. We provide information on current administration practices of pediatric medicines and describe key stakeholder preferences for new formulation characteristics. PATIENTS AND METHODS: We surveyed children aged 6-12 years, parents/caregivers over age 18 with children under age 12, and healthcare workers in 10 regions of Tanzania to determine current pediatric medicine prescription and administration practices as well as preferences for new formulations. Analyses were stratified by setting, pediatric age group, parent/caregiver education, and healthcare worker cadre. RESULTS: Complete data were available for 206 children, 202 parents/caregivers, and 202 healthcare workers. Swallowing oral solid dosage forms whole or crushing/dissolving them and mixing with water were the two most frequently reported methods of administration. Children frequently reported disliking medication taste, and many had vomited doses. Healthcare workers reported medicine availability most significantly influences prescribing practices. Most parents/caregivers and children prefer sweet-tasting medicine. Parents/caregivers and healthcare workers prefer oral liquid dosage forms for young children, and had similar thresholds for the maximum number of oral solid dosage forms children at different ages can take. CONCLUSIONS: There are many impediments to acceptable and accurate administration of medicines to children. Current practices are associated with poor tolerability and the potential for under- or over-dosing. Children, parents/caregivers, and healthcare workers in Tanzania have clear preferences for tastes and formulations, which should inform the development, manufacturing, and marketing of pediatric medications for resource-limited settings.

  17. Management, Growth, and Carbon Storage in Miombo Woodlands of Tanzania

    Directory of Open Access Journals (Sweden)

    Z. J. Lupala

    2014-01-01

    Full Text Available Despite the local livelihoods support function provided by miombo woodlands of Tanzania under participatory forest management, its growth still has potential for carbon storage and sequestration attractive to REDD+ initiatives. This study has revealed the average growth to be significant, despite the local community livelihoods support function. However, climate change mitigation strategy needs to be more innovative to optimize carbon storage and local livelihoods’ potentials in forest-dependent communities like miombo woodlands. Carbon credits resulting from the increased carbon stock and sequestration should contribute to sustainable development. This should also help promote participatory forest management and secure miombo woodland products and services upon which billions of people depend.

  18. Students' Attitudes towards School-Based Sex and Relationships Education in Tanzania

    Science.gov (United States)

    Mkumbo, Kitila A. K.

    2014-01-01

    Objective: The objective of this paper was to assess students' attitudes towards school-based sex and relationships education (SRE). Design: This study featured a cross-sectional survey design. Method: A sample of 715 students from two districts in Tanzania completed a survey questionnaire assessing various aspects related to their attitudes…

  19. Results of Co-Teaching Instruction to Special Education Teacher Candidates in Tanzania

    Science.gov (United States)

    Frey, Laura M.; Kaff, Marilyn S.

    2014-01-01

    This mixed-method descriptive pilot investigation addressed co-teaching as an inclusive school practice for special education teacher candidates at Sebastian Kolowa Memorial University (SEKOMU) in Tanzania. The investigation results, though preliminary, indicate that course content and instruction in co-teaching had a positive impact on the…

  20. Barriers to restorative care as perceived by dental patients attending government hospitals in Tanzania.

    NARCIS (Netherlands)

    Kikwilu, E.N.; Frencken, J.E.F.M.; Mulder, J.; Masalu, J.R.

    2009-01-01

    OBJECTIVES: Perceptions of dental patients in Tanzania regarding barriers to restorative care were examined. METHODS: A total of 1138 dental patients aged 15 years and above, attending 12 selected government dental clinics in January 2005, completed a pre-tested questionnaire. anova and logistic

  1. Family planning decisions, perceptions and gender dynamics among couples in Mwanza, Tanzania: a qualitative study

    NARCIS (Netherlands)

    Mosha, I.H.; Ruben, R.; Kakoko, D.C.

    2013-01-01

    Background: Contraceptive use is low in developing countries which are still largely driven by male dominated culture and patriarchal values. This study explored family planning (FP) decisions, perceptions and gender dynamics among couples in Mwanza region of Tanzania. Methods: Twelve focus group

  2. Tanzania Dental Journal Vol. 14 No. 1, May 2007 Birth prevalence ...

    African Journals Online (AJOL)

    user

    Abstract. Aim: The aim of the study was to determine the prevalence of cleft lip, cleft palate and cleft lip and palate in hospital live births in Dar es salaam, Tanzania. Study design: this was a retrospective study using hospital data. Materials and methods: The records of 75336 live births delivered at three public hospitals in ...

  3. Alcohol consumption in the rural population of Misungwi subdistrict in Mwanza Region, Tanzania

    NARCIS (Netherlands)

    Rijken, T; Velema, JP; Dijkstra, R

    Objective: This study was undertaken to investigate the frequency and quantity of alcohol consumption in four villages on the southern shores of Lake Victoria, Tanzania. Method: Study participants were 148 men and 162 women selected by cluster sampling from the population (N = 9,243) of four

  4. Teachers' Commitment To, and Experiences of, the Teaching Profession in Tanzania: Findings of Focus Group Research

    Science.gov (United States)

    Mkumbo, Kitila A. K.

    2012-01-01

    This qualitative study examined teachers' commitment to, and experiences of, the teaching profession in six regions of Tanzania. The study used focus group discussions as research method and data collection tool. Twenty four groups were conducted, with group membership ranging from five to nine participants. The results show that the teachers'…

  5. Narrowing Maize Yield Gaps Under Rain-fed conditions in Tanzania ...

    African Journals Online (AJOL)

    Tanzania Journal of Agricultural Sciences (2014) Vol. 12 No. 2, 55-64 were collected from the experimental site using regular grid method (Paetz and Wilke, 2005) for physical and chemical characterisation. Samples were collected from depths of 10, 40 and 65 cm and from depths of 10, 30, 50 and 75 cm during the dry and.

  6. Basic Education in Tanzania: A Slight Touch on the Views of ...

    African Journals Online (AJOL)

    The objective of this paper is to visualize what basic education is. To provide a focus to the paper, from 1997-2003, 198 primary seven leavers from Nachingwea and Tandahimba districts in the southern regions of Tanzania were sampled. Six simple questions from six conventional primary school subjects (Kiswahili, ...

  7. Impacts of Electricity Access to Rural Enterprises in Bolivia, Tanzania and Vietnam

    NARCIS (Netherlands)

    van Dijk, Annemarije; Clancy, Joy S.

    2010-01-01

    There is little empirical evidence to underpin strategies of poverty reduction through income generation in small scale rural enterprises through supplying energy. This paper reports on research findings from a three country study in Bolivia, Tanzania and Vietnam which aimed to provide insights into

  8. Clusters and Factors Associated with Complementary Basic Education in Tanzania Mainland

    Science.gov (United States)

    Edwin, Paul; Amina, Msengwa S.; Godwin, Naimani M.

    2017-01-01

    Complimentary Basic Education in Tanzania (COBET) is a community-based programme initiated in 1999 to provide formal education system opportunity to over aged children or children above school age. The COBET program was analyzed using secondary data collected from 21 regions from 2008 to 2012. Cluster analysis was applied to classify the 21…

  9. THE SIMULATION DIAGNOSTIC METHODS AND REGENERATION WAYS OF REINFORCED - CONCRETE CONSTRUCTIONS OF BRIDGES IN PROVIDING THEIR OPERATING RELIABILITY AND LONGEVITY

    Directory of Open Access Journals (Sweden)

    B. V. Savchinskiy

    2010-03-01

    Full Text Available On the basis of analysis of existing diagnostic methods and regeneration ways of reinforced-concrete constructions of bridges the recommendations on introduction of new modern technologies of renewal of reinforced-concrete constructions of bridges in providing their operating reliability and longevity are offered.

  10. 29 CFR 4000.14 - What is the safe-harbor method for providing an issuance by electronic media?

    Science.gov (United States)

    2010-07-01

    ... electronic media? 4000.14 Section 4000.14 Labor Regulations Relating to Labor (Continued) PENSION BENEFIT... § 4000.14 What is the safe-harbor method for providing an issuance by electronic media? (a) In general... by electronic media to any person described in paragraph (c) or (d) of this section. (b) Issuance...

  11. Perceptions of vaginal microbicides as an HIV prevention method among health care providers in KwaZulu-Natal, South Africa

    Directory of Open Access Journals (Sweden)

    Mantell Joanne E

    2007-03-01

    Full Text Available Abstract Background The promise of microbicides as an HIV prevention method will not be realized if not supported by health care providers. They are the primary source of sexual health information for potential users, in both the public and private health sectors. Therefore, the aim of this study was to determine perceptions of vaginal microbicides as a potential HIV prevention method among health care providers in Durban and Hlabisa, South Africa, using a combination of quantitative and qualitative methods. Results During 2004, semi structured interviews with 149 health care providers were conducted. Fifty seven percent of hospital managers, 40% of pharmacists and 35% of nurses possessed some basic knowledge of microbicides, such as the product being used intra-vaginally before sex to prevent HIV infection. The majority of them were positive about microbicides and were willing to counsel users regarding potential use. Providers from both public and private sectors felt that an effective microbicide should be available to all people, regardless of HIV status. Providers felt that the product should be accessed over-the-counter in pharmacies and in retail stores. They also felt a need for potential microbicides to be available free of charge, and packaged with clear instructions. The media was seen by health care providers as being an effective strategy for promoting microbicides. Conclusion Overall, health care providers were very positive about the possible introduction of an effective microbicide for HIV prevention. The findings generated by this study illustrated the need for training health care providers prior to making the product accessible, as well as the importance of addressing the potential barriers to use of the product by women. These are important concerns in the health care community, and this study also served to educate them for the day when research becomes reality.

  12. Safer Conception Methods and Counseling: Psychometric Evaluation of New Measures of Attitudes and Beliefs Among HIV Clients and Providers.

    Science.gov (United States)

    Woldetsadik, Mahlet Atakilt; Goggin, Kathy; Staggs, Vincent S; Wanyenze, Rhoda K; Beyeza-Kashesya, Jolly; Mindry, Deborah; Finocchario-Kessler, Sarah; Khanakwa, Sarah; Wagner, Glenn J

    2016-06-01

    With data from 400 HIV clients with fertility intentions and 57 HIV providers in Uganda, we evaluated the psychometrics of new client and provider scales measuring constructs related to safer conception methods (SCM) and safer conception counselling (SCC). Several forms of validity (i.e., content, face, and construct validity) were examined using standard methods including exploratory and confirmatory factor analysis. Internal consistency was established using Cronbach's alpha correlation coefficient. The final scales consisted of measures of attitudes towards use of SCM and delivery of SCC, including measures of self-efficacy and motivation to use SCM, and perceived community stigma towards childbearing. Most client and all provider measures had moderate to high internal consistency (alphas 0.60-0.94), most had convergent validity (associations with other SCM or SCC-related measures), and client measures had divergent validity (poor associations with depression). These findings establish preliminary psychometric properties of these scales and should facilitate future studies of SCM and SCC.

  13. Perceived unfairness in working conditions: The case of public health services in Tanzania

    Directory of Open Access Journals (Sweden)

    Massay Deodatus

    2011-02-01

    Full Text Available Abstract Background The focus on the determinants of the quality of health services in low-income countries is increasing. Health workers' motivation has emerged as a topic of substantial interest in this context. The main objective of this article is to explore health workers' experience of working conditions, linked to motivation to work. Working conditions have been pointed out as a key factor in ensuring a motivated and well performing staff. The empirical focus is on rural public health services in Tanzania. The study aims to situate the results in a broader historical context in order to enhance our understanding of the health worker discourse on working conditions. Methods The study has a qualitative study design to elicit detailed information on health workers' experience of their working conditions. The data comprise focus group discussions (FGDs and in-depth interviews (IDIs with administrators, clinicians and nursing staff in the public health services in a rural district in Tanzania. The study has an ethnographic backdrop based on earlier long-term fieldwork in the same part of Tanzania. Results The article provides insights into health workers' understanding and assessment of their working conditions. An experience of unsatisfactory working conditions as well as a perceived lack of fundamental fairness dominated the FGDs and IDIs. Informants reported unfairness with reference to factors such as salary, promotion, recognition of work experience, allocation of allowances and access to training as well as to human resource management. The study also revealed that many health workers lack information or knowledge about factors that influence their working conditions. Conclusions The article calls for attention to the importance of locating the discourse of unfairness related to working conditions in a broader historical/political context. Tanzanian history has been characterised by an ambiguous and shifting landscape of state regulation

  14. Type 1 diabetes care updates: Tanzania

    Directory of Open Access Journals (Sweden)

    Kandi Catherine Muze

    2015-01-01

    Full Text Available Tanzania is located in east Africa with a population of 45 million. The country′s population is growing at 2.5% annually. The International Diabetes Federation Child Sponsorship Program was launched in Tanzania in 2005. The number of type 1 diabetes mellitus children enrolled in the changing diabetes in children program in Tanzania has augmented from almost below 50 in 2005 to over 1200 in 2014. The country had an overall trend of HbA1c value of 14% in 2005 while the same has reduced over the years to 10% in 2012-13. The program has been able to reduce the proportion of patients with HbA1c values of 11-14%; from 71.9% in 2008 to 49.8% in 2012-13. The challenges, which CDiC faces are misdiagnosis, low public awareness, and stigma especially in the reproductive age/adolescent groups.

  15. A combined usage of stochastic and quantitative risk assessment methods in the worksites: Application on an electric power provider

    International Nuclear Information System (INIS)

    Marhavilas, P.K.; Koulouriotis, D.E.

    2012-01-01

    An individual method cannot build either a realistic forecasting model or a risk assessment process in the worksites, and future perspectives should focus on the combined forecasting/estimation approach. The main purpose of this paper is to gain insight into a risk prediction and estimation methodological framework, using the combination of three different methods, including the proportional quantitative-risk-assessment technique (PRAT), the time-series stochastic process (TSP), and the method of estimating the societal-risk (SRE) by F–N curves. In order to prove the usefulness of the combined usage of stochastic and quantitative risk assessment methods, an application on an electric power provider industry is presented to, using empirical data.

  16. Linkage into care among newly diagnosed HIV-positive individuals tested through outreach and facility-based HIV testing models in Mbeya, Tanzania: a prospective mixed-method cohort study.

    Science.gov (United States)

    Sanga, Erica Samson; Lerebo, Wondwossen; Mushi, Adiel K; Clowes, Petra; Olomi, Willyhelmina; Maboko, Leonard; Zarowsky, Christina

    2017-04-12

    Linkage to care is the bridge between HIV testing and HIV treatment, care and support. In Tanzania, mobile testing aims to address historically low testing rates. Linkage to care was reported at 14% in 2009 and 28% in 2014. The study compares linkage to care of HIV-positive individuals tested at mobile/outreach versus public health facility-based services within the first 6 months of HIV diagnosis. Rural communities in four districts of Mbeya Region, Tanzania. A total of 1012 newly diagnosed HIV-positive adults from 16 testing facilities were enrolled into a two-armed cohort and followed for 6 months between August 2014 and July 2015. 840 (83%) participants completed the study. We compared the ratios and time variance in linkage to care using the Kaplan-Meier estimator and Log rank tests. Cox proportional hazards regression models to evaluate factors associated with time variance in linkage. At the end of 6 months, 78% of all respondents had linked into care, with differences across testing models. 84% (CI 81% to 87%, n=512) of individuals tested at facility-based site were linked to care compared to 69% (CI 65% to 74%, n=281) of individuals tested at mobile/outreach. The median time to linkage was 1 day (IQR: 1-7.5) for facility-based site and 6 days (IQR: 3-11) for mobile/outreach sites. Participants tested at facility-based site were 78% more likely to link than those tested at mobile/outreach when other variables were controlled (AHR=1.78; 95% CI 1.52 to 2.07). HIV status disclosure to family/relatives was significantly associated with linkage to care (AHR=2.64; 95% CI 2.05 to 3.39). Linkage to care after testing HIV positive in rural Tanzania has increased markedly since 2014, across testing models. Individuals tested at facility-based sites linked in significantly higher proportion and modestly sooner than mobile/outreach tested individuals. Mobile/outreach testing models bring HIV testing services closer to people. Strategies to improve linkage

  17. Occupational dose trends in Tanzania

    International Nuclear Information System (INIS)

    Muhogora, W.E.; Nyanda, A.M.; Ngaile, J.E.; Lema, U.S.

    1998-01-01

    This paper describes the present status of occupational radiation exposure of monitored workers in Tanzania from 1986 to 1997. The analysis of dose records observes over this period, a fluctuating trend both in the individual and collective doses. The trend is more related to the fluctuations of the number of radiation workers than to the possible radiation safety changes of the working conditions. It has been found that, the maximum annual dose for the worker in all work categories was about 18 mSv y -1 . This suggests that the occupational radiation exposure in all practices satisfies the current dose limitation system. The national exposure summary shows that, the highest collective dose of 12.8 man-Sv which is 90% of the total collective dose, was due to medical applications. The applications in industry and research had a contribution of nearly 0.8 and 0.7 man-Sv respectively. From the professional point of view, the medical diagnostic radiographers received the highest collective dose of 11.2 man-Sv. Although the medical physicists recorded the minimum collective dose of nearly 0.07 man-Sv, the data shows that this profession received the highest mean dose of about 33 mSv in 12 years. Some achievements of the personnel monitoring services and suggestions for future improvement are pointed out. (author)

  18. Spatial and Temporal Climatic Variation in Coastal Tanzania

    Science.gov (United States)

    Rohli, R. V.; Ates, S.; Rivera-Monroy, V. H.; Polito, M. J.; Midway, S. R.; Gold, A.; Castañeda-Moya, E.; Uchida, E.; Suwa, M.; Mangora, M. M.

    2017-12-01

    Climatic controls are particularly important to the natural and human systems in coastal Tanzania, where mangrove vegetation is a major component of world-renowned biodiversity. This research provides an improved understanding of the climatic features and forcing mechanisms that support the critical mangroves of Tanzania and the livelihoods of its populace, using updated and complete datasets. Updated data confirm that coastal Tanzania falls in the tropical wet-dry Köppen-Geiger climatic type, except for the extreme north, where tropical rain forest exists north of Pangani. The northeast monsoon, known as the kaskazi, largely corresponds to the rainy November-December and March-May months. The southeast monsoon - known as the kusi - overlaps with the drier June-September. Results suggest that El Niño-Southern Oscillation (ENSO) and Indian Ocean Dipole (IOD) are key modulators of precipitation variability in the entire area. More specifically, September-November positive precipitation anomalies occur during positive IOD, especially when combined with El Niño, with slightly negative anomalies during negative IOD, especially when combined with La Niña. The rest of the year tends to show similar precipitation during both IOD phases (March-August) or less precipitation during the positive phase (December-February). Because the literature suggests likelihood of more frequent positive IOD mode and a strengthened relationship of these events to warm-ENSO events, changes to the hydrologic cycle in east Africa may be likely in the future, with a potential for an expanded secondary rainy season and a drier "saddle" between the secondary and primary rainy seasons (i.e., December-February). Therefore, future research should investigate in more detail the influence of the IOD and ENSO on various components of the climatic water balance. Results may be useful to earth, environmental, and social scientists as they seek further understanding of the drivers of ecological and

  19. Does school attendance reduce the risk of youth homelessness in Tanzania?

    Directory of Open Access Journals (Sweden)

    Mueller Mario

    2010-11-01

    Full Text Available Abstract Background This paper is based on data gathered from a 2006 survey of 1,098 "street children" in Northern Tanzania. It examines the role that school may play in preventing the migration of vulnerable youth to become homeless "street children". Specific focus is placed on the correlations found between children's attendance in school, their reports of abuse or support in their family, and their status of living "on the street" full-time or part-time. Methods This study is from quantitative interview data gathered from 1,098 children and youth between 5 and 24 years old on the streets of Moshi and Arusha, Tanzania, over a 48-hour period during the school year on October 26th and 27th, 2006. Respondents were given survey questions about their home, school and street life experiences, in order to measure the impact of outreach work being performed by a Tanzanian NGO. Interviewers used purposive sampling, approaching all young people who appeared to be under the age of 25 years within a number of precincts in each town known to be where 'street children' were known to congregate. Results Results suggest that regular attendance in school may be a significant protective factor for children in preventing migration to the street life. Statistical analysis revealed that those young people who dropped out of school had nearly 8 times higher chances for ending up on the streets permanently than those who attended school daily. Conclusions This study supports the new concept of "multi-layered social resilience", providing evidence from research completed by one NGO on how community-based organizations can help enhance resilience in a broader social context, spanning individuals, households and community structures.

  20. The make or buy debate: Considering the limitations of domestic production in Tanzania

    Directory of Open Access Journals (Sweden)

    Wilson Kinsley

    2012-06-01

    Full Text Available Abstract Background In order to ensure their population’s regular access to essential medicines, many least developed countries and developing countries are faced with the policy question of whether to import or manufacture drugs locally, in particular for life-saving antiretroviral medicines for HIV/AIDS patients. In order for domestic manufacturing to be viable and cost-effective, the local industry must be able to compete with international suppliers of medicines by producing sufficiently low cost ARVs. Methods This paper considers the ‘make-or-buy’ dilemma by using Tanzania as a case study. Key informant interviews, event-driven observation, and purposive sampling of documents were used to evaluate the case study. The case study focused on Tanzania’s imitation technology transfer agreement to locally manufacture a first-line ARV (3TC + d4T + NVP, reverse engineering the ARV. Results Tanzania is limited by weak political support for the use of TRIPS flexibilities, limited production capacity for ARVs and limited competitiveness in both domestic and regional markets. The Ministry of Health and Social Welfare encourages the use of flexibilities while others push for increased IP protection. Insufficient production capacity and lack of access to donor-financed tenders make it difficult to obtain economies of scale and provide competitive prices. Conclusions Within the “make-or-buy” context, it was determined that there are significant limitations in domestic manufacturing for developing countries. The case study highlights the difficulty of governments to make use of economies of scale and produce low-cost medicines, attract technology transfer, and utilize the flexibilities of the WTO Agreement on Trade-Related Aspects of Intellectual Property Rights (TRIPS. The results demonstrate the importance of evaluating barriers to the use of TRIPS flexibilities and long-term planning across sectors in future technology transfer and

  1. A method of providing engaging formative feedback to large cohort first-year physiology and anatomy students.

    Science.gov (United States)

    Weston-Green, Katrina; Wallace, Margaret

    2016-09-01

    A growing body of evidence demonstrates a critical role for effective, meaningful feedback to enhance student learning. Effective feedback can become part of the learning cycle that is not only a learning opportunity for the student but can also be used to inform the teacher and ongoing curriculum development. Feedback is considered particularly important during the first year of university and can even be viewed as a retention strategy that can help attenuate student performance anxieties and solidify perceptions of academic support. Unfortunately, the provision of individualized, timely feedback can be particularly challenging in first-year courses as they tend to be large and diverse cohort classes that pose challenges of time and logistics. Various forms of generic feedback can provide rapid and cost-effect feedback to large cohorts but may be of limited benefit to students other than signaling weaknesses in knowledge. The present study describes a method that was used to provide formative task-related feedback to a large cohort of first-year physiology and anatomy students. Based on student evaluations presented in this study, this method provided feedback in a manner that engaged students, uncovered underlying misconceptions, facilitated peer discussion, and provided opportunity for new instruction while allowing the lecturer to recognize common gaps in knowledge and inform ongoing curriculum development. Copyright © 2016 The American Physiological Society.

  2. A review on prevalence, control measure, and tolerance of Tanzania Shorthorn Zebu cattle to East Coast fever in Tanzania.

    Science.gov (United States)

    Laisser, E L K; Chenyambuga, S W; Karimuribo, E D; Msalya, G; Kipanyula, M J; Mwilawa, A J; Mdegela, R H; Kusiluka, L J M

    2017-04-01

    In Tanzania, control of East Coast fever (ECF) has predominantly relied on tick control using acaricides and chemotherapy, little on ECF vaccination, and very little on dissemination regarding animal immunization. In this paper, the prevalence, control measure, and tolerance of Tanzania Shorthorn Zebu (TSHZ) cattle to ECF are reviewed. In addition, the opportunities available for reducing the use of acaricides for the benefit of the farmers in terms of reduction of costs of purchasing acaricides and environmental pollution are described. The tick distribution and epidemiological factors for ECF such as the agro-ecological zones (AEZ), livestock production systems (LPS), strain, and age of the animals are also described. These factors influence the epidemiology of ECF and the distribution of TSHZ strains in different geographic locations of Tanzania. We have further showed that there is a tendency of farmers to select among the strains of TSHZ for animals which can tolerate ticks and ECF and crossbreed them with their local strains with the aim of benefiting from the inherent characteristics of the most tolerant strains. Generally, many strains of TSHZ cattle are tolerant to tick infestation and ECF infection and can be bred to respond to the needs of the people. In this review paper, we recommend that in future, ECF epidemiological studies should account for factors such as livestock production system, agro-climate, breed of animal, tick control strategy, and the dynamic interactions between them. In conclusion, we have demonstrated that an integrated control method involving use of acaricides, immunization, and ECF-tolerant/-resistant animals is required.

  3. The societal cost of Taenia solium cysticercosis in Tanzania.

    Science.gov (United States)

    Trevisan, Chiara; Devleesschauwer, Brecht; Schmidt, Veronika; Winkler, Andrea Sylvia; Harrison, Wendy; Johansen, Maria Vang

    2017-01-01

    Taenia solium is a zoonotic parasite prevalent in many low income countries throughout Latin America, Asia and sub-Saharan Africa, including Tanzania. The parasite is recognized as a public health threat; however the burden it poses on populations of Tanzania is unknown. The aim of this study was to estimate the societal cost of T. solium cysticercosis in Tanzania, by assessing both the health and economic burden. The societal cost of T. solium cysticercosis was assessed in humans and pigs based on data obtained by a systematic review. Experts' opinion was sought in cases where data were not retrievable. The health burden was assessed in terms of annual number of neurocysticercosis (NCC) associated epilepsy incident cases, deaths and disability-adjusted life years (DALYs), while the economic burden was assessed in terms of direct and indirect costs imposed by NCC-associated epilepsy and potential losses due to porcine cysticercosis. Based on data retrieved from the systematic review and burden assessments, T. solium cysticercosis contributed to a significant societal cost for the population. The annual number of NCC-associated epilepsy incident cases and deaths were 17,853 (95% Uncertainty Interval (UI), 5666-36,227) and 212 (95% UI, 37-612), respectively. More than 11% (95% UI, 6.3-17) of the pig population was infected with the parasite when using tongue examination as diagnostic method. For the year 2012 the number of DALYs per thousand person-years for NCC-associated epilepsy was 0.7 (95% UI, 0.2-1.6). Around 5 million USD (95% UI, 797,535-16,933,477) were spent due to NCC-associated epilepsy and nearly 3 million USD (95% UI, 1,095,960-5,366,038) were potentially lost due to porcine cysticercosis. Our results show that T. solium imposes a serious public health, agricultural and economic threat for Tanzania. We urge that a One Health approach, which involves the joint collaboration and effort of veterinarians, medical doctors, agricultural extension officers

  4. A Similarity-Ranking Method on Semantic Computing for Providing Information-Services in Station-Concierge System

    Directory of Open Access Journals (Sweden)

    Motoki Yokoyama

    2017-07-01

    Full Text Available The prevalence of smartphones and wireless broadband networks have been progressing as a new Railway infomration environment. According to the spread of such devices and information technology, various types of information can be obtained from databases connected to the Internet. One scenario of obtaining such a wide variety of information resources is in the phase of user’s transportation. This paper proposes an information provision system, named the Station Concierge System that matches the situation and intention of passengers. The purpose of this system is to estimate the needs of passengers like station staff or hotel concierge and to provide information resources that satisfy user’s expectations dynamically. The most important module of the system is constructed based on a new information ranking method for passenger intention prediction and service recommendation. This method has three main features, which are (1 projecting a user to semantic vector space by using her current context, (2 predicting the intention of a user based on selecting a semantic vector subspace, and (3 ranking the services by a descending order of relevant scores to the user’ intention. By comparing the predicted results of our method with those of two straightforward computation methods, the experimental studies show the effectiveness and efficiency of the proposed method. Using this system, users can obtain transit information and service map that dynamically matches their context.

  5. Use of social network analysis methods to study professional advice and performance among healthcare providers: a systematic review

    Directory of Open Access Journals (Sweden)

    Kate Sabot

    2017-10-01

    Full Text Available Abstract Background Social network analysis quantifies and visualizes relationships between and among individuals or organizations. Applications in the health sector remain underutilized. This systematic review seeks to analyze what social network methods have been used to study professional communication and performance among healthcare providers. Methods Ten databases were searched from 1990 through April 2016, yielding 5970 articles screened for inclusion by two independent reviewers who extracted data and critically appraised each study. Inclusion criteria were study of health care worker professional communication, network methods used, and patient outcomes measured. The search identified 10 systematic reviews. The final set of articles had their citations prospectively and retrospectively screened. We used narrative synthesis to summarize the findings. Results The six articles meeting our inclusion criteria described unique health sectors: one at primary healthcare level and five at tertiary level; five conducted in the USA, one in Australia. Four studies looked at multidisciplinary healthcare workers, while two focused on nurses. Two studies used mixed methods, four quantitative methods only, and one involved an experimental design. Four administered network surveys, one coded observations, and one used an existing survey to extract network data. Density and centrality were the most common network metrics although one study did not calculate any network properties and only visualized the network. Four studies involved tests of significance, and two used modeling methods. Social network analysis software preferences were evenly split between ORA and UCINET. All articles meeting our criteria were published in the past 5 years, suggesting that this remains in clinical care a nascent but emergent research area. There was marked diversity across all six studies in terms of research questions, health sector area, patient outcomes, and network

  6. Construction and Demolition Waste Characteristics in Tanzania ...

    African Journals Online (AJOL)

    The construction industry generates a lot of construction and demolition (C&D) waste which puts some challenges to its management. For example, currently, in many towns in Tanzania, there are no landfill sites for solid waste disposal; and as a consequence open air dumping sites are used. Dumping C&D waste puts ...

  7. Sympatric Occurrence of 3 Arenaviruses, Tanzania

    DEFF Research Database (Denmark)

    de Bellocq, Joëlle Goüy; Borremans, Benny; Katakweba, Abdul

    2010-01-01

    To determine the specificity of Morogoro virus for its reservoir host, we studied its host range and genetic diversity in Tanzania. We found that 2 rodent species other than Mastomys natalensis mice carry arenaviruses. Analysis of 340 nt of the viral RNA polymerase gene showed sympatric occurrence...

  8. HIV and schistosomiasis : studies in Tanzania

    NARCIS (Netherlands)

    Downs, J.A.

    2016-01-01

    Schistosomiasis is a helminthic worm infection that affects 260 million people worldwide, 90% of whom live in sub-Saharan Africa. In Tanzania, where the research in this thesis was conducted, two species of schistosomes are highly endemic (Schistosoma haematobium and S. mansoni), with more than 50%

  9. Tanzania | Page 11 | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Increasing competition within an economy is no easy task. People often fear for their futures when free-market policies are introduced. Tanzania, however, has shown that promoting fair play through competition policy improves the performance of manufacturing firms. This translates into gains for the overall economy.

  10. Abyssinian Scimitarbill Rhinopomastus minor cabanisi in Tanzania ...

    African Journals Online (AJOL)

    On 27 December 2013, between the Tarangire National Park entrance and Makuyuni,. Tanzania, at 3°33´ S, 36°04´ E, altitude 1073 m, I stopped at 11:00 to photograph an aca- cia tree with nine traditional beehives in it. To my amazement I saw two Abyssinian. Scimitarbills Rhinopomastus minor entering a hole on the ...

  11. Tanzania Journal of Agricultural Sciences: Editorial Policies

    African Journals Online (AJOL)

    Focus and Scope. Tanzania Journal of Agricultural Science (TAJAS) is a peer reviewed scientific journal that publishes original and scholarly research articles dealing with fundamental and applied aspects of agriculture, Food, Aquaculture and Wildlife. Occasionally invited review articles are published ...

  12. TANZANIA'S 2002 RECORDS AND ARCHIVES MANAGEMENT ACT

    African Journals Online (AJOL)

    The paper critically assesses the strengths and weaknesses of the Tanzania's Records and Archives Management Act of 2002. The Act repeals the 1931 Records Disposal Ordinance 9 (Cap.9), the 1965 National Archives Act no. 33 and the Presidential Circular no.7 of 1963 on the Care and Disposal of Public Records.

  13. Marketing Dental Services | Tuominen | Tanzania Dental Journal

    African Journals Online (AJOL)

    Tanzania Dental Journal. Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue · Archives · Journal Home > Vol 9, No 1 (2000) >. Log in or Register to get access to full text downloads. Username, Password, Remember me, or Register. Marketing Dental Services. R Tuominen. Abstract. No Abstract.

  14. Financial Institutions And Poverty Alleviation In Tanzania ...

    African Journals Online (AJOL)

    Financial institutions in Tanzania have operated under a competitive financial system between 1961 and 1967. The same institutions faced a turnaround in 1967 into financial repression. It was a highly regulated and specialized financial system with government intervention in the context of a centrally planned system.

  15. Tanzania Journal of Science - Vol 30 (2004)

    African Journals Online (AJOL)

    Total mercury concentration in common fish species of Lake Victoria, Tanzania · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT ... and meat weight between population of the bivalve Anadara antiquata (Linnaeus 1758) from four sites experiencing different levels of exploitation pressure in Zanzibar · EMAIL FREE FULL ...

  16. Tanzania | Page 36 | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    In Uganda, Tanzania, and Kenya, a decentralized approach to land administration promises more accessible dispute resolution and a better deal for women. But the new systems face significant challenges. Among them are old social attitudes that pre-empt any real discussion about women's right to control land.

  17. Governance challenges in Tanzania's environmental impact ...

    African Journals Online (AJOL)

    EJIRO

    Cap 191. This Act promotes Environmental Assessment, gives it the legal support and defines the institutional set up for the management of the environment. However, Tanzania still grapples with EIA ineffectiveness in guiding development decisions and environmental management arising from various projects. Numerous ...

  18. Coping with rainfall variability in northern Tanzania

    DEFF Research Database (Denmark)

    Trærup, Sara Lærke Meltofte

    2012-01-01

    This chapter explores a potential relationship between rainfall data and household self-reported harvest shocks and local (spatial) variability of harvest shocks and coping strategies based on a survey of 2700 rural households in the Kagera region of northern Tanzania. In addition, correlations...

  19. Tanzania | IDRC - International Development Research Centre

    International Development Research Centre (IDRC) Digital Library (Canada)

    Successive Tanzanian governments have recognized the importance of improving health and agriculture in order to reduce poverty. ... and Tanzanian researchers are joining forces with local health policymakers to develop community-based practical health interventions to reach mothers and children in rural Tanzania.

  20. Tanzania's Revealed Comparative Advantage and Structural ...

    African Journals Online (AJOL)

    ... agricultural products dominate Tanzania's comparative advantage for both years, although minerals assume the first rank in 2011. Specifically, 70% of the product groups are agricultural, with the rest being mineral products. These findings suggest that no structural transformation has occurred in the Tanzanian economy ...

  1. Strengthening Local Agricultural Innovation Systems in Tanzania ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Strengthening Local Agricultural Innovation Systems in Tanzania and Malawi. In many sub-Saharan African countries, poverty is linked to low agricultural productivity, which climate change threatens to aggravate. This action-research project aims to bring together institutions and individuals from the research, policymaking ...

  2. Tanzania Journal of Health Research: Editorial Policies

    African Journals Online (AJOL)

    Gibson Kabiki, Kilimanjaro Clinical Research Institute. Dr. Gabriel Shirima, Tanzania Veterinary Laboratory Agency. Prof. Dominic Kambarage, Sokoine University of Agriculture. Dr. Said Kapiga, Mwanza Intervention Trial Unit. Prof. Mainen J. Moshi, Muhimbili University of Health and Allied Sciences. Prof. Paul Gwakisa ...

  3. Coral Reefs and Their Management in Tanzania

    African Journals Online (AJOL)

    extensive, mangrove stands (IUCN Conservation. Monitoring Center ... CORAL REEFS AND THEIR MANAGEMENT IN TANZANIA 229. 23. 06 00. N. A. Avinternational Boundary. /\\!/ River. /\\/Main Road of 00 A-Z Railway. Land. Mangrove. Ocean. G 20 40 60 80 .... centers, deforestation and poor agricultural practices lead to ...

  4. Tanzania's Revealed Comparative Advantage and Structural ...

    African Journals Online (AJOL)

    This study examines Tanzania's structural transformation by using the revealed comparative approach using export data for 2001, 2002 and 2011, at the second level of the Harmonised. System (HS). Using global data, the study finds that for 2002 and 2011, agricultural products, fish and minerals have comparative ...

  5. Tanzania Journal of Forestry and Nature Conservation

    African Journals Online (AJOL)

    The Tanzania Journal of Forestry and Nature Conservation accommodates the current diverse and multidisciplinary approaches towards ecosystem conservation at national and global levels. The journal is published biannually and accepts research and review papers covering technological, physical, biological, social and ...

  6. Cigarette Taxation in Tanzania | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Tobacco consumption in Tanzania rose by 20% between 2002 and 2007, and is predicted to increase by a further 46% by 2016. The impact of this increase in consumption on public health and economic development is likely to be serious. Experience elsewhere has shown that the single most effective way to reverse this ...

  7. Tanzania Journal of Science - Vol 37 (2011)

    African Journals Online (AJOL)

    Classification of Plants According to Their Heavy Metal Content around North Mara Gold Mine, Tanzania: Implication for Phytoremediation · EMAIL FREE FULL TEXT ... Evaluation of Single-Step Steam Pyrolysis-Activated Carbons from Lesotho Agro-Forestry Residues · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT

  8. Tanzania | Page 2 | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Read more about ​Promoting locally fortified sunflower oil using e-vouchers. Language English. Read more about ​Affordable natural product reduces fruit losses, increases incomes. Language English. Read more about Integrated crop and goat breeding in Tanzania. Language English. Read more about Élevage de la ...

  9. Multidimensional Assessment of Child Welfare for Tanzania

    DEFF Research Database (Denmark)

    Arndt, Channing; Leyaro, Vincent; Mahrt, Kristi

    2017-01-01

    Identifying trends in living standards in Tanzania has been a subject of considerable interest. Analysis of a household budget survey conducted in 2007 revealed consumption poverty rates approximately similar to the rates calculated from a comparable survey conducted in 2001. This stagnation in c...

  10. Tanzania | Page 26 | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Home · South of Sahara. Tanzania. Tanzanie. Read more about Community Based Adaptation to Climate Change in Africa. Language English. Read more about Free and Open Source Management Information Systems and Microfinance - Phase II. Language English. Read more about La microfinance et les TIC : systèmes ...

  11. Tanzania: A Hierarchical Cluster Analysis Approach | Ngaruko ...

    African Journals Online (AJOL)

    Using survey data from Kibondo district, west Tanzania, we use hierarchical cluster analysis to classify borrower farmers according to their borrowing behaviour into four distinctive clusters. The appreciation of the existence of heterogeneous farmer clusters is vital in forging credit delivery policies that are not only ...

  12. Prawns of Bagamoyo Coastal Waters, Tanzania

    African Journals Online (AJOL)

    2013-01-01

    Jan 1, 2013 ... Abstract—The coastal waters of Bagamoyo in Tanzania constitute an important penaeid prawn trawling ground. Despite the high economic value attached to this resource, the biological information necessary for its sustainable exploitation is scanty and fragmented. The present study was therefore ...

  13. Deficiency within pavement Maintenance Organization in Tanzania ...

    African Journals Online (AJOL)

    The paper discusses the current state of the road network, funding acquisition for maintenance, the institutional framework within the maintenance and management system and finally concludes with a recommendation of initiatives for the improvement of the maintenance system in Tanzania. Journal of Civil Engineering ...

  14. Tanzania | Page 28 | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Language English. Read more about Taxes sur les cigarettes en Tanzanie. Language French. Read more about Cigarette Taxation in Tanzania. Language English. Read more about Réseau des développeurs - logiciels d'exploitation libre pour assistants numériques personnels utilisés dans la collecte de données sur la ...

  15. Tanzania | Page 19 | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Language English. Read more about Bourses de recherche pour la lutte antitabac en Afrique. Language French. Read more about Tobacco Control Research Scholarships in Africa. Language English. Read more about Leveraging Indigenous Knowledge to Create Jobs for Women in Rural Areas of Tanzania and Rwanda.

  16. Water Resources Management in Tanzania: Identifying Research ...

    African Journals Online (AJOL)

    The Tanzanian economy is highly dependent on water resources. Nearly half of. Tanzania's GDP comes from the agriculture and livestock sectors (Salami et al., 2010), which are highly dependent on water resources. However, these water resources are currently vulnerable to climate change and variability. In recent years ...

  17. Biofuel investment in Tanzania: Omissions in implementation

    International Nuclear Information System (INIS)

    Habib-Mintz, Nazia

    2010-01-01

    Increasing demand for biofuels as a component of climate change mitigation, energy security, and a fossil fuel alternative attracts investors to developing countries like Tanzania. Ample unused land is critical for first generation biofuels production and an important feature to attract foreign direct investments that can contribute towards agricultural modernization and poverty reduction initiatives. Despite the economic justifications, the existing institutional and infrastructural capacities dictate the impacts of biofuels market penetrations. Furthermore, exogenous factors like global recessionary pressure depressed oil prices below the level at which biofuel production were profitable in 2007, making Tanzania's competitiveness and potential benefits questionable. This paper investigates the extent that first generation, jatropha-based biofuels industry development in Tanzania observed during fieldwork in Kisarawe and Bahi may fulfill policy objectives. This paper argues that without strong regulatory frameworks for land, investment management, and rural development, biofuel industrialization could further exacerbate poverty and food insecurity in Tanzania. The paper concludes with policy recommendations for first generation biofuel development while keeping in mind implications of second generation production. Since the topic is broad and multifaceted, a multidisciplinary approach is used that includes political, institutional, and agricultural economics to analyze and conceptualize biofuel industry development and food security.

  18. AIDS in dentistry | Muya | Tanzania Dental Journal

    African Journals Online (AJOL)

    Tanzania Dental Journal. Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue · Archives · Journal Home > Vol 4, No 1 (1989) >. Log in or Register to get access to full text downloads. Username, Password, Remember me, or Register · Download this PDF file. The PDF file you selected should load ...

  19. AIDS in dentistry | Muya | Tanzania Dental Journal

    African Journals Online (AJOL)

    Tanzania Dental Journal. Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue · Archives · Journal Home > Vol 4, No 1 (1989) >. Log in or Register to get access to full text downloads. Username, Password, Remember me, or Register. AIDS in dentistry. RJ Muya. Abstract. No Abstract. Full Text:.

  20. Tanzania Journal of Science - Vol 31 (2005)

    African Journals Online (AJOL)

    Environmental risks for gemstone miners with reference to Merelani tanzanite mining area, Northeastern Tanzania · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. EP Malisa, CP Kinabo, 1-12. http://dx.doi.org/10.4314/tjs.v31i1.18404 ...

  1. Newspaper coverage of agricultural information in Tanzania ...

    African Journals Online (AJOL)

    This study examined the coverage of agricultural information in Tanzania's newspapers published between 2009 and 2013. Four newspapers—Mwananchi, Habari Leo, The Guardian and Daily News—comprising 840 editions were selected for the study. Data were collected using a checklist and analysed using Microsoft ...

  2. Tanzania | IDRC - International Development Research Centre

    International Development Research Centre (IDRC) Digital Library (Canada)

    Home · South of Sahara. Tanzania. Tanzanie. Read more about Youth employment and women's economic empowerment in Africa: The role of small and medium enterprises in the tourism sector. Language English. Read more about Leadership and managerial capacity strengthening for quality pregnancy and newborn ...

  3. FDI policy statements | Kikwilu | Tanzania Dental Journal

    African Journals Online (AJOL)

    Tanzania Dental Journal. Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue · Archives · Journal Home > Vol 19 (2017) >. Log in or Register to get access to full text downloads. Username, Password, Remember me, or Register. FDI policy statements. Emil N. Kikwilu. Abstract. No Abstract. Full Text:.

  4. Teaching 'natural product chemistry' in Tanzania | Buchanan ...

    African Journals Online (AJOL)

    Natural products 'historically' and 'today' have vast importance. This article describes the course 'Natural Product Chemistry', a new course in the 2011/2012 academic year in the Faculty of Natural and Applied Sciences at St. John's University of Tanzania. It reveals how the course has been applied to the African and ...

  5. Spatial clustering of porcine cysticercosis in Mbulu district, northern Tanzania.

    Science.gov (United States)

    Ngowi, Helena A; Kassuku, Ayub A; Carabin, Hélène; Mlangwa, James E D; Mlozi, Malongo R S; Mbilinyi, Boniface P; Willingham, Arve L

    2010-04-06

    Porcine cysticercosis is caused by a zoonotic tapeworm, Taenia solium, which causes serious disease syndromes in human. Effective control of the parasite requires knowledge on the burden and pattern of the infections in order to properly direct limited resources. The objective of this study was to establish the spatial distribution of porcine cysticercosis in Mbulu district, northern Tanzania, to guide control strategies. This study is a secondary analysis of data collected during the baseline and follow-up periods of a randomized community trial aiming at reducing the incidence rate of porcine cysticercosis through an educational program. At baseline, 784 randomly selected pig-keeping households located in 42 villages in 14 wards were included. Lingual examination of indigenous pigs aged 2-12 (median 8) months, one randomly selected from each household, were conducted. Data from the control group of the randomized trial that included 21 of the 42 villages were used for the incidence study. A total of 295 pig-keeping households were provided with sentinel pigs (one each) and reassessed for cysticercosis incidence once or twice for 2-9 (median 4) months using lingual examination and antigen ELISA. Prevalence of porcine cysticercosis was computed in Epi Info 3.5. The prevalence and incidence of porcine cysticercosis were mapped at household level using ArcView 3.2. K functions were computed in R software to assess general clustering of porcine cysticercosis. Spatial scan statistics were computed in SatScan to identify local clusters of the infection. The overall prevalence of porcine cysticercosis was 7.3% (95% CI: 5.6, 9.4; n = 784). The K functions revealed a significant overall clustering of porcine cysticercosis incidence for all distances between 600 m and 5 km from a randomly chosen case household based on Ag-ELISA. Lingual examination revealed clustering from 650 m to 6 km and between 7.5 and 10 km. The prevalence study did not reveal any significant

  6. Spatial clustering of porcine cysticercosis in Mbulu district, northern Tanzania.

    Directory of Open Access Journals (Sweden)

    Helena A Ngowi

    Full Text Available BACKGROUND: Porcine cysticercosis is caused by a zoonotic tapeworm, Taenia solium, which causes serious disease syndromes in human. Effective control of the parasite requires knowledge on the burden and pattern of the infections in order to properly direct limited resources. The objective of this study was to establish the spatial distribution of porcine cysticercosis in Mbulu district, northern Tanzania, to guide control strategies. METHODOLOGY/PRINCIPAL FINDINGS: This study is a secondary analysis of data collected during the baseline and follow-up periods of a randomized community trial aiming at reducing the incidence rate of porcine cysticercosis through an educational program. At baseline, 784 randomly selected pig-keeping households located in 42 villages in 14 wards were included. Lingual examination of indigenous pigs aged 2-12 (median 8 months, one randomly selected from each household, were conducted. Data from the control group of the randomized trial that included 21 of the 42 villages were used for the incidence study. A total of 295 pig-keeping households were provided with sentinel pigs (one each and reassessed for cysticercosis incidence once or twice for 2-9 (median 4 months using lingual examination and antigen ELISA. Prevalence of porcine cysticercosis was computed in Epi Info 3.5. The prevalence and incidence of porcine cysticercosis were mapped at household level using ArcView 3.2. K functions were computed in R software to assess general clustering of porcine cysticercosis. Spatial scan statistics were computed in SatScan to identify local clusters of the infection. The overall prevalence of porcine cysticercosis was 7.3% (95% CI: 5.6, 9.4; n = 784. The K functions revealed a significant overall clustering of porcine cysticercosis incidence for all distances between 600 m and 5 km from a randomly chosen case household based on Ag-ELISA. Lingual examination revealed clustering from 650 m to 6 km and between 7.5 and 10 km

  7. Seroprevalence of dengue infection: a cross-sectional survey in mainland Tanzania and on Pemba Island, Zanzibar.

    Science.gov (United States)

    Vairo, Francesco; Nicastri, Emanuele; Meschi, Silvia; Schepisi, Monica Sanè; Paglia, Maria Grazia; Bevilacqua, Nazario; Mangi, Sabina; Sciarrone, Maria Rosaria; Chiappini, Roberta; Mohamed, Jape; Racalbuto, Vincenzo; Di Caro, Antonino; Capobianchi, Maria Rosaria; Ippolito, Giuseppe

    2012-01-01

    Evidence available to date indicates that dengue viruses 1, 2, and 3 could be among the causes of acute fever in eastern Africa. Recently, four reports on dengue infection in travelers and residents have raised concerns over the occurrence of dengue fever in mainland Tanzania and in Zanzibar. The objective of this study was to provide seroprevalence data on dengue infection in Tanzania. This study was conducted in 2007 at two peripheral hospitals, one on Pemba Island, Zanzibar and one in Tosamaganga, Iringa Region, mainland Tanzania. Two hundred and two consecutive febrile outpatients were studied for antibodies and viral RNA to assess the circulation of dengue virus in Tanzania. A seroprevalence of 7.7% was found on Pemba Island and of 1.8% was found in Tosamaganga. No acute cases and no previous infections among patients under 11 years of age were detected. These findings provide the first baseline data on dengue seroprevalence in the country. No recent dengue virus circulation in Tanzania and in the Zanzibar archipelago up until the early 1990s is reported. © 2011 International Society for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  8. Use of social network analysis methods to study professional advice and performance among healthcare providers: a systematic review.

    Science.gov (United States)

    Sabot, Kate; Wickremasinghe, Deepthi; Blanchet, Karl; Avan, Bilal; Schellenberg, Joanna

    2017-10-23

    Social network analysis quantifies and visualizes relationships between and among individuals or organizations. Applications in the health sector remain underutilized. This systematic review seeks to analyze what social network methods have been used to study professional communication and performance among healthcare providers. Ten databases were searched from 1990 through April 2016, yielding 5970 articles screened for inclusion by two independent reviewers who extracted data and critically appraised each study. Inclusion criteria were study of health care worker professional communication, network methods used, and patient outcomes measured. The search identified 10 systematic reviews. The final set of articles had their citations prospectively and retrospectively screened. We used narrative synthesis to summarize the findings. The six articles meeting our inclusion criteria described unique health sectors: one at primary healthcare level and five at tertiary level; five conducted in the USA, one in Australia. Four studies looked at multidisciplinary healthcare workers, while two focused on nurses. Two studies used mixed methods, four quantitative methods only, and one involved an experimental design. Four administered network surveys, one coded observations, and one used an existing survey to extract network data. Density and centrality were the most common network metrics although one study did not calculate any network properties and only visualized the network. Four studies involved tests of significance, and two used modeling methods. Social network analysis software preferences were evenly split between ORA and UCINET. All articles meeting our criteria were published in the past 5 years, suggesting that this remains in clinical care a nascent but emergent research area. There was marked diversity across all six studies in terms of research questions, health sector area, patient outcomes, and network analysis methods. Network methods are underutilized for

  9. An assessment of orofacial clefts in Tanzania

    Directory of Open Access Journals (Sweden)

    Mazyala Erick

    2011-02-01

    Full Text Available Abstract Background Clefts of the lip (CL, the palate (CP, or both (CLP are the most common orofacial congenital malformations found among live births, accounting for 65% of all head and neck anomalies. The frequency and pattern of orofacial clefts in different parts of the world and among different human groups varies widely. Generally, populations of Asian or Native American origin have the highest prevalence, while Caucasian populations show intermediate prevalence and African populations the lowest. To date, little is known regarding the epidemiology and pattern of orofacial clefts in Tanzania. Methods A retrospective descriptive study was conducted at Bugando Medical Centre to identify all children with orofacial clefts that attended or were treated during a period of five years. Cleft lip and/or palate records were obtained from patient files in the Hospital's Departments of Surgery, Paediatrics and medical records. Age at presentation, sex, region of origin, type and laterality of the cleft were recorded. In addition, presence of associated congenital anomalies or syndromes was recorded. Results A total of 240 orofacial cleft cases were seen during this period. Isolated cleft lip was the most common cleft type followed closely by cleft lip and palate (CLP. This is a departure from the pattern of clefting reported for Caucasian and Asian populations, where CLP or isolated cleft palate is the most common type. The distribution of clefts by side showed a statistically significant preponderance of the left side (43.7% (χ2 = 92.4, p Conclusions Unilateral orofacial clefts were significantly more common than bilateral clefts; with the left side being the most common affected side. Most of the other findings did not show marked differences with orofacial cleft distributions in other African populations.

  10. Behavioural responses to hypoxia provide a non-invasive method for distinguishing between stress coping styles in fish

    DEFF Research Database (Denmark)

    Laursen, Danielle Caroline; Olsén, Hanna L.; Ruiz-Gomez, Maria de Lourdes

    2011-01-01

    Two divergent behavioural and physiological response patterns to challenges have been identified in mammals and birds, frequently termed the proactive and reactive coping styles. In recent years, individually distinct coping styles have also been observed in several species of fish. These individ......Two divergent behavioural and physiological response patterns to challenges have been identified in mammals and birds, frequently termed the proactive and reactive coping styles. In recent years, individually distinct coping styles have also been observed in several species of fish......, these fish provided an opportunity for verifying a method for sorting fish with respect to coping style by exposure to hypoxia. Groups consisting of 24 individually tagged fish, 12 HR and 12 LR were exposed to hypoxia in a two choice system. The system consisted of a “home” tank provided with cover connected...

  11. The paradox of compassionate work: a mixed-methods study of satisfying and fatiguing experiences of animal health care providers.

    Science.gov (United States)

    Polachek, Alicia J; Wallace, Jean E

    2018-03-01

    Compassionate work appears paradoxical as it may provide great rewards, but may also come at great costs to care providers. This paper explores the paradox of compassionate work by examining what interactions contribute to compassion satisfaction and what interactions contribute to compassion fatigue. This mixed-methods, cross-sectional study uses qualitative interview data from animal health care providers (N = 20) to identify work interactions that they find satisfying or stressful. Quantitative survey data (N = 572) are used to test hypotheses generated from the interviews regarding predictors of compassion satisfaction and compassion fatigue. Interview transcripts were analyzed using a directed content analysis approach. Survey data were analyzed using ordinary least squares regression. The results highlight the complex nature of compassionate work. As hypothesized, making a difference to animals and building relationships with animal patients and human clients relate to greater compassion satisfaction. Human client barriers to animal care and witnessing client grief relate to greater compassion fatigue, as predicted. None of the predictors relate to less compassion fatigue, but forming relationships with animal patients relates to both greater compassion satisfaction and compassion fatigue. This paper enhances our understanding of provider-client-patient interactions and highlights the paradox of compassionate work.

  12. DETECTION OF REPORTS FALSIFICATION PROVIDED TO A BANK BY A BORROWER USING THE METHOD OF DYNAMIC PARAMETERS ANALYSIS

    Directory of Open Access Journals (Sweden)

    M. S. Lyuft

    2015-01-01

    Full Text Available Summary. The main stop-factors in a landing were formed in the article according to the procedure of the European Bank for Reconstruction and Development by the means of questioning the leading Russian banks that finance small-scale business. It is given the description of this method, also it is identified the main weaknesses of the EBRD methodology. There is a description of the main methods of the borrowing company’s analytical balance and thereupon it is made the conclusion about the necessity of the analysis of the balance’s principal factors across time. The analysis of indicators and factors in the dynamics enables us to see trends in the development of the company, and to identify deviations in the coefficients. Either materiality or difference from normal values of these coefficients may indicate the factors of the borrowers’ misconduct, and in particular it gives evidence concerning falsification of reports provided to a bank. There are stages of information processing for falsification’s detection, excluding the interest from decision-makers about the possibility of lending in the results of a transaction. The formula that determinates the value of net profit falsification has been made on basis of dynamic parameters of the analytical balance and the connection with the administrative profit-and-loss report. Further, the article provides the second method of a determination of the net profit falsification already based on data of the parameters in dynamics namely business profitability rate. The process of calculation Payment To Income - payment to income - an indicator, in order to obtain good data on who falsify net income. Are key strengths of this method of identifying and conclusions paragraph article.

  13. A livelihood perspective on natural ressource management and environmental change in semi-arid Tanzania

    DEFF Research Database (Denmark)

    Birch-Thomsen, Torben; Frederiksen, Pia; Sano, Hans-Otto

    2001-01-01

    livelihood strategies, environmental change, land degredation, land use, intensification, Tanzania......livelihood strategies, environmental change, land degredation, land use, intensification, Tanzania...

  14. Modeling solutions to Tanzania's physician workforce challenge

    Directory of Open Access Journals (Sweden)

    Alex J. Goodell

    2016-06-01

    Full Text Available Background: There is a great need for physicians in Tanzania. In 2012, there were approximately 0.31 physicians per 10,000 individuals nationwide, with a lower ratio in the rural areas, where the majority of the population resides. In response, universities across Tanzania have greatly increased the enrollment of medical students. Yet evidence suggests high attrition of medical graduates to other professions and emigration from rural areas where they are most needed. Objective: To estimate the future number of physicians practicing in Tanzania and the potential impact of interventions to improve retention, we built a model that tracks medical students from enrollment through clinical practice, from 1990 to 2025. Design: We designed a Markov process with 92 potential states capturing the movement of 25,000 medical students and physicians from medical training through employment. Work possibilities included clinical practice (divided into rural or urban, public or private, non-clinical work, and emigration. We populated and calibrated the model using a national 2005/2006 physician mapping survey, as well as graduation records, graduate tracking surveys, and other available data. Results: The model projects massive losses to clinical practice between 2016 and 2025, especially in rural areas. Approximately 56% of all medical school students enrolled between 2011 and 2020 will not be practicing medicine in Tanzania in 2025. Even with these losses, the model forecasts an increase in the physician-to-population ratio to 1.4 per 10,000 by 2025. Increasing the absorption of recent graduates into the public sector and/or developing a rural training track would ameliorate physician attrition in the most underserved areas. Conclusions: Tanzania is making significant investments in the training of physicians. Without linking these doctors to employment and ensuring their retention, the majority of this investment in medical education will be jeopardized.

  15. How much time do health services spend on antenatal care? Implications for the introduction of the focused antenatal care model in Tanzania

    Directory of Open Access Journals (Sweden)

    Mpembeni Rose

    2006-06-01

    Full Text Available Abstract Background Antenatal care (ANC is a widely used strategy to improve the health of pregnant women and to encourage skilled care during childbirth. In 2002, the Ministry of Health of the United Republic of Tanzania developed a national adaptation plan based on the new model of the World Health Organisation (WHO. In this study we assess the time health workers currently spent on providing ANC services and compare it to the requirements anticipated for the new ANC model in order to identify the implications of Focused ANC on health care providers' workload. Methods Health workers in four dispensaries in Mtwara Urban District, Southern Tanzania, were observed while providing routine ANC. The time used for the overall activity as well as for the different, specific components of 71 ANC service provisions was measured in detail; 28 of these were first visits and 43 revisits. Standard time requirements for the provision of focused ANC were assessed through simulated consultations based on the new guidelines. Results The average time health workers currently spend for providing ANC service to a first visit client was found to be 15 minutes; the provision of ANC according to the focused ANC model was assessed to be 46 minutes. For a revisiting client the difference between current practise and the anticipated standard of the new model was 27 minutes (9 vs. 36 min.. The major discrepancy between the two procedures was related to counselling. On average a first visit client was counselled for 1:30 minutes, while counselling in revisiting clients did hardly take place at all. The simulation of focused ANC revealed that proper counselling would take about 15 minutes per visit. Conclusion While the introduction of focused ANC has the potential to improve the health of pregnant women and to raise the number of births attended by skilled staff in Tanzania, it may need additional investment in human resources. The generally anticipated saving effect of

  16. Determinants of Leather and Leather products Exports in Tanzania

    Directory of Open Access Journals (Sweden)

    Francis Lwesya

    2018-03-01

    Full Text Available This study examines the determinants of Leather and Leather products Exports in Tanzania. We apply Ordinary Least Square (OLS analysis on time series data from 1980 to 2015. The findings show that export of raw hides and skins, and high costs of production are among the deterring factors to leather and leather products export in Tanzania. Export of raw hides and skins and costs of production recorded negative and significant relationship with leather exports. On the other hand, hides and skins collection recorded insignificant relationship while leather price in the world market had negative and significant relationship with leather exports. This suggests that other factors such as low quality of leather and leather products exported, inadequate capital investment, stiff competition with foreign companies for hides and skins and inadequate market information explain the state of current Tanzania’s leather exports. Thus, attracting local and Foreign Direct Investment (FDI in the leather subsector by providing friendly investment climate and addressing the supply side constraints will enable increased high quality leather and leather products diversification and exports

  17. The perceptions on male circumcision as a preventive measure against HIV infection and considerations in scaling up of the services: a qualitative study among police officers in Dar es Salaam, Tanzania

    Directory of Open Access Journals (Sweden)

    Tarimo Edith AM

    2012-07-01

    Full Text Available Abstract Background In recent randomized controlled trials, male circumcision has been proven to complement the available biomedical interventions in decreasing HIV transmission from infected women to uninfected men. Consequently, Tanzania is striving to scale-up safe medical male circumcision to reduce HIV transmission. However, there is a need to investigate the perceptions of male circumcision in Tanzania using specific populations. The purpose of the present study was to assess the perceptions of male circumcision in a cohort of police officers that also served as a source of volunteers for a phase I/II HIV vaccine (HIVIS-03 trial in Dar es Salaam, Tanzania. Methods In-depth interviews with 24 men and 10 women were conducted. Content analysis informed by the socio-ecological model was used to analyze the data. Results Informants perceived male circumcision as a health-promoting practice that may prevent HIV transmission and other sexually transmitted infections. They reported male circumcision promotes sexual pleasure, confidence and hygiene or sexual cleanliness. They added that it is a religious ritual and a cultural practice that enhances the recognition of manhood in the community. However, informants were concerned about the cost involved in male circumcision and cleanliness of instruments used in medical and traditional male circumcision. They also expressed confusion about the shame of undergoing circumcision at an advanced age and pain that could emanate after circumcision. The participants advocated for health policies that promote medical male circumcision at childhood, specifically along with the vaccination program. Conclusions The perceived benefit of male circumcision as a preventive strategy to HIV and other sexually transmitted infections is important. However, there is a need to ensure that male circumcision is conducted under hygienic conditions. Integrating male circumcision service in the routine childhood vaccination

  18. Scaling up postabortion contraceptive service--results from a study conducted among women having unwanted pregnancies in urban and rural Tanzania

    DEFF Research Database (Denmark)

    Rasch, Vibeke; Yambesi, Fortunata; Kipingili, Rose

    2005-01-01

    INTRODUCTION: It is well recognized that unwanted pregnancies and unsafe abortion are significant public health problems in sub-Saharan Africa. At the International Conference on Population and Development held in Cairo in 1994, postabortion care was prioritized as a means to reduce maternal...... morbidity and mortality associated with unsafe abortion. However, only a few postabortion care programs have been implemented and most of them have been confined to urban settings. The present study describes the magnitude of the problem of unwanted pregnancies among women with incomplete abortion in urban...... Tanzania and 42% in rural Tanzania stated that their pregnancy was unwanted. Contraceptive acceptance among women with unwanted pregnancies was high; 93% in urban Tanzania and 71% in rural Tanzania left with a contraceptive method. CONCLUSION: The high proportion of women with unwanted pregnancies in urban...

  19. Extra petals in the buttercup (Ranunculus repens) provide a quick method to estimate the age of meadows

    Science.gov (United States)

    Warren, John

    2009-01-01

    Background and Aims There is a widely used crude method to estimate the age of hedgerows (Hooper's rule) based on species' richness. The aim of this study was to try and establish a similar field method for estimating the age of grasslands based on the accumulation of macro-somatic mutations. Methods A countrywide survey was carried out by the British public to investigate the relationship between grassland age and the number of Ranunculus repens (creeping buttercup) plants with extra petals. In addition the relationship between grassland age and R. repens pollen viability was also investigated. Key Results Each plant with flowers with additional petals in a sample of 100 was found to equate to approx. 7 years. A higher significant correlation was observed between pollen viability and population age; however, this is not amenable to providing field estimates. Conclusions The age of British grasslands can be easily and reliably estimated in the field by counting the number flowers with additional petals in R. repens in meadows up to 200 years old. An attempt to estimate the heritability of extra petals suggests that the phenotype results from the slow accumulation of somatic mutations in a species that primarily reproduces vegetatively. PMID:19491088

  20. A SWOT Analysis of the Integration of E-Learning at a University in Uganda and a University in Tanzania

    Science.gov (United States)

    Zhu, Chang; Justice Mugenyi, Kintu

    2015-01-01

    This research examines the strengths, weaknesses, opportunities and threats (SWOT) to integrating e-learning perceived by academic staff at a university in Uganda and a university in Tanzania. Mixed-methods research was used in which a main qualitative study was complemented by a quantitative method. The sample participants were academic staff…

  1. Impact of ALSO training on the management of prolonged labor and neonatal care at Kagera Regional Hospital, Tanzania

    DEFF Research Database (Denmark)

    Sorensen, Bjarke Lund; Rasch, Vibeke; Massawe, Siriel

    2010-01-01

    OBJECTIVE: To evaluate the management of prolonged labor and neonatal care before and after Advanced Life Support in Obstetrics (ALSO) training. METHODS: Staff involved in childbirth at Kagera Regional Hospital, Tanzania, attended a 2-day ALSO provider course. In this prospective intervention study...... conducted between July and November 2008, the management and outcomes of 558 deliveries before and 550 after the training were observed. RESULTS: There was no significant difference in the rate of cesarean deliveries owing to prolonged labor, and vacuum delivery was not practiced after the intervention...... 5.6% to 71.5% (RR 12.71; 95% CI, 9.04-17.88). There was a significant decrease from 6 to 0 neonatal deaths before discharge among those born with an Apgar score after 1minute of 4 or more (P=0.03). CONCLUSION: ALSO training had no effect on the management of prolonged labor. Early contact between...

  2. The use of nominal group technique in identifying community health priorities in Moshi rural district, northern Tanzania

    DEFF Research Database (Denmark)

    Makundi, E A; Manongi, R; Mushi, A K

    2005-01-01

    larger samples. We found a high level of agreement across groups, that malaria remains the leading health problem in Moshi rural district in Tanzania both in the highland and lowland areas. Our findings also indicate that 'non-medical' issues including lack of water, hunger and poverty heralded priority......This article highlights issues pertaining to identification of community health priorities in a resource poor setting. Community involvement is discussed by drawing experience of involving lay people in identifying priorities in health care through the use of Nominal Group Technique. The identified...... in the list implying that priorities should not only be focused on diseases, but should also include health services and social cultural issues. Indeed, methods which are easily understood and applied thus able to give results close to those provided by the burden of disease approaches should be adopted...

  3. Family building using embryo adoption: relationships and contact arrangements between provider and recipient families-a mixed-methods study.

    Science.gov (United States)

    Frith, Lucy; Blyth, Eric; Lui, Steve

    2017-05-01

    What contact arrangements are established between providers and recipients of embryos using Snowflakes® Embryo Adoption Program? Contact arrangements varied considerably and were generally positively described, although some challenges were acknowledged. Reproductive technologies create new and diverse family forms, and the ways in which families created by embryo adoption are negotiated in practice have not been extensively investigated. This exploratory, mixed-methods study had two phases: (i) an online survey (open May-September 2013) and (ii) qualitative semi-structured interviews by email (conducted between 2014 and 2015), exploring participants' experiences of contact with their embryo provider or recipient. Phase I included 17 providers (14 women and 3 men) and 28 recipients (27 women and 1 man). Phase II included 8 providers (5 women and 3 men) and 12 recipients (10 women and 2 men). All participants, except one, were located in the US. This study illustrates how embryo adoption in the US, as a form of conditional donation, can operate and how the participants define and negotiate these emerging relationships. All families were open with their children about how they were conceived and early contact between recipients and providers (frequently before birth) was valued. On the whole, participants were happy with the amount and type of contact they had, and where the current contact did not involve the children, it was seen as a way of keeping the channels open for future contact when the children were older. Participants often portrayed the opportunities for contact as being in the best interests of the child. The study participants are a particular group who had chosen to either receive or give their embryos via a conditional embryo adoption agency in the US and had established contact. Therefore, this is not a representative sample of those who provide or receive embryos for family building. This embryo adoption model clearly fulfils a need; some people

  4. An early warning system for IPM-based rodent control in smallholder farming systems in Tanzania

    DEFF Research Database (Denmark)

    Mwanjabe, Patrick S.; Leirs, Herwig

    1997-01-01

    We conducted a four-year study in Tanzania to test a method for predicting outbreaks of Mastomys natalensis rats and verify whether such method, based on rainfall variability, could be used in an integrated Pest Management strategy for rodent control. Temporal fluctuations in rodent numbers and b...... outbreaks, to warn farmers and the government of the outbreaks, and to organise control measures in advance....

  5. Public health concern and initiatives on the priority action towards non-communicable diseases in Tanzania.

    Science.gov (United States)

    Mfinangai, Sayoki G M; Kivuyo, Sokoine L; Ezekiel, Linda; Ngadaya, Esther; Mghamba, Janneth; Ramaiya, Kaushik

    2011-12-01

    Tanzania is already facing challenges caused by existing burden of communicable diseases, and the growing trend of nonconununicable diseases (NCDs), which raises a lot of concerns and challenges. The objective of this review is to provide broad insight of the "silent epidemic" of NCDs, existing policies, strategies and interventions, and recommendations on prioritized actions. A review of existing literature including published articles, technical reports, and proceedings from national and international NCDs meetings was carried out. The burden, existing interventions, socio-economic impact, lessons learnt, and potential for expanding cost effective interventions in Tanzania were explored. Challenges to catch up with global momentum on NCD agenda were identified and discussed. The review has indicated that the burden of NCDs and its underlying risk factors in Tanzania is alarming, and affects people of all socio-economic status. The costs of health care for managing NCDs are high, and thus impoverishing the already poor people. The country leadership has a high political commitment; there are policies and strategies, which need to be implemented to address the growing NCD burden. In conclusion, NCDs in Tanzania are a silent rising health burden and has enormous impact on an individual and country's social-economical status. From the experience of other countries, interventions for NCDs are affordable, feasible and some are income generating. Multisectoral approach, involving national and international partners has a unique role in intensifying action on NCDs. Tanzania should strategize on implementation research on how to adapt the interventions and apply multi-sectoral approach to control and prevent NCDs in the country.

  6. Traditions, beliefs and indigenous technologies in connection with the edible longhorn grasshopper Ruspolia differens (Serville 1838) in Tanzania.

    Science.gov (United States)

    Mmari, Mercy W; Kinyuru, John N; Laswai, Henry S; Okoth, Judith K

    2017-11-13

    Edible insects are an important source of food to many African populations. The longhorn grasshopper, Ruspolia differens (Serville 1838), commonly known as senene in Tanzania is one of the most appreciated edible insects by societies around Lake Victoria crescent. Senene is primarily an essential treat for the tribes around the lake, e.g., the Haya of Tanzania, Luo of Kenya and Baganda of Uganda. Despite its importance as a food item and appreciation as a delicacy, there are few studies dealing with culture, beliefs and indigenous technology in connection with the senene. The main objective of this study was to survey indigenous technologies, processing methods and traditions in relation to senene consumption among the Haya tribe in Kagera region of Tanzania. Our ethnographic study was conducted through semi-structured interviews. A total of 51 locals, 26 females and 25 males aged 21 to 60 years were interviewed (with 3 female and 7 male key informants among them). Questions focused on cultures, beliefs and traditions towards senene consumption. Processing, preservation and shelf-life as well as nutritional knowledge were also investigated. Harvesting for household consumption was mainly done through wild collection. Traditionally made traps were mostly used for commercial harvesting. Deep frying was the most preferred processing method while smoking was the most preferred preservation method, with shelf-life of up to 12 months. Interesting traditions and taboos associated with senene consumption were identified, with men monopolising the insects as food by declaring the insects taboo for women and children. Deep fried senene in locally packed containers were mostly sold by street vendors, but also available from a variety of stores and supermarkets. Beyond being just an important traditional delicacy, senene is becoming increasingly popular, providing opportunity for local businesses. Indigenous technologies for harvesting, processing and preserving senene exist

  7. Evaluating the impact of healthcare provider training to improve tuberculosis management: a systematic review of methods and outcome indicators used.

    Science.gov (United States)

    Wu, Shishi; Roychowdhury, Imara; Khan, Mishal

    2017-03-01

    Developing human resources capacity is vital for tuberculosis (TB) control in low- and middle-income countries. Although investments in TB healthcare provider (HCP) training programmes have increased, it is unclear whether these are robustly evaluated. The objective of this systematic review was to synthesize the methods and outcome indicators used to assess TB HCP training programmes. A systematic scoping review of publications reporting on evaluations of training programmes for TB HCPs - including doctors, nurses, paramedics, and lay health workers - was conducted through a search in three electronic databases, Google Scholar, and five websites of non-profit organizations. Data on the study location, population trained, outcomes assessed, and evaluation approach were extracted. After screening 499 unique publications, 21 were eligible for inclusion in the analysis. The majority of evaluations were conducted in Africa. The most common evaluation methods were a review of patient records (n=8, 38%) and post-training interview with trainees (n=7, 33%). In terms of outcomes, more than half of the studies (n=12, 57%) evaluated knowledge acquisition of trainees, with only six (29%) assessing on-the-job behaviour change. Even though more funds have been invested in TB HCP training, publications from robust evaluations assessing the impact on quality of care and behaviour change are limited. Copyright © 2016. Published by Elsevier Ltd.

  8. Extra petals in the buttercup (Ranunculus repens) provide a quick method to estimate the age of meadows.

    Science.gov (United States)

    Warren, John

    2009-09-01

    There is a widely used crude method to estimate the age of hedgerows (Hooper's rule) based on species' richness. The aim of this study was to try and establish a similar field method for estimating the age of grasslands based on the accumulation of macro-somatic mutations. A countrywide survey was carried out by the British public to investigate the relationship between grassland age and the number of Ranunculus repens (creeping buttercup) plants with extra petals. In addition the relationship between grassland age and R. repens pollen viability was also investigated. Each plant with flowers with additional petals in a sample of 100 was found to equate to approx. 7 years. A higher significant correlation was observed between pollen viability and population age; however, this is not amenable to providing field estimates. The age of British grasslands can be easily and reliably estimated in the field by counting the number flowers with additional petals in R. repens in meadows up to 200 years old. An attempt to estimate the heritability of extra petals suggests that the phenotype results from the slow accumulation of somatic mutations in a species that primarily reproduces vegetatively.

  9. Use of Lagrange Multipliers to Provide an Approximate Method for the Optimisation of a Shield Radius and Contents

    Science.gov (United States)

    Warner, Paul

    2017-09-01

    For any appreciable radiation source, such as a nuclear reactor core or radiation physics accelerator, there will be the safety requirement to shield operators from the effects of the radiation from the source. Both the size and weight of the shield need to be minimised to reduce costs (and to increase the space available for the maintenance envelope on a plant). This needs to be balanced against legal radiation dose safety limits and the requirement to reduce the dose to operators As Low As Reasonably Practicable (ALARP). This paper describes a method that can be used, early in a shield design, to scope the design and provide a practical estimation of the size of the shield by optimising the shield internals. In particular, a theoretical model representative of a small reactor is used to demonstrate that the primary shielding radius, thickness of the primary shielding inner wall and the thicknesses of two steel inner walls, can be set using the Lagrange multiplier method with a constraint on the total flux on the outside of the shielding. The results from the optimisation are presented and an RZ finite element transport theory calculation is used to demonstrate that, using the optimised geometry, the constraint is achieved.

  10. Use of Lagrange Multipliers to Provide an Approximate Method for the Optimisation of a Shield Radius and Contents

    Directory of Open Access Journals (Sweden)

    Warner Paul

    2017-01-01

    Full Text Available For any appreciable radiation source, such as a nuclear reactor core or radiation physics accelerator, there will be the safety requirement to shield operators from the effects of the radiation from the source. Both the size and weight of the shield need to be minimised to reduce costs (and to increase the space available for the maintenance envelope on a plant. This needs to be balanced against legal radiation dose safety limits and the requirement to reduce the dose to operators As Low As Reasonably Practicable (ALARP. This paper describes a method that can be used, early in a shield design, to scope the design and provide a practical estimation of the size of the shield by optimising the shield internals. In particular, a theoretical model representative of a small reactor is used to demonstrate that the primary shielding radius, thickness of the primary shielding inner wall and the thicknesses of two steel inner walls, can be set using the Lagrange multiplier method with a constraint on the total flux on the outside of the shielding. The results from the optimisation are presented and an RZ finite element transport theory calculation is used to demonstrate that, using the optimised geometry, the constraint is achieved.

  11. Modelling and mapping the topsoil organic carbon content for Tanzania

    Science.gov (United States)

    Kempen, Bas; Kaaya, Abel; Ngonyani Mhaiki, Consolatha; Kiluvia, Shani; Ruiperez-Gonzalez, Maria; Batjes, Niels; Dalsgaard, Soren

    2014-05-01

    Soil organic carbon (SOC), held in soil organic matter, is a key indicator of soil health and plays an important role in the global carbon cycle. The soil can act as a net source or sink of carbon depending on land use and management. Deforestation and forest degradation lead to the release of vast amounts of carbon from the soil in the form of greenhouse gasses, especially in tropical countries. Tanzania has a high deforestation rate: it is estimated that the country loses 1.1% of its total forested area annually. During 2010-2013 Tanzania has been a pilot country under the UN-REDD programme. This programme has supported Tanzania in its initial efforts towards reducing greenhouse gas emission from forest degradation and deforestation and towards preserving soil carbon stocks. Formulation and implementation of the national REDD strategy requires detailed information on the five carbon pools among these the SOC pool. The spatial distribution of SOC contents and stocks was not available for Tanzania. The initial aim of this research, was therefore to develop high-resolution maps of the SOC content for the country. The mapping exercise was carried out in a collaborative effort with four Tanzanian institutes and data from the Africa Soil Information Service initiative (AfSIS). The mapping exercise was provided with over 3200 field observations on SOC from four sources; this is the most comprehensive soil dataset collected in Tanzania so far. The main source of soil samples was the National Forest Monitoring and Assessment (NAFORMA). The carbon maps were generated by means of digital soil mapping using regression-kriging. Maps at 250 m spatial resolution were developed for four depth layers: 0-10 cm, 10-20 cm, 20-30 cm, and 0-30 cm. A total of 37 environmental GIS data layers were prepared for use as covariates in the regression model. These included vegetation indices, terrain parameters, surface temperature, spectral reflectances, a land cover map and a small

  12. Team dynamics, clinical work satisfaction, and patient care coordination between primary care providers: A mixed methods study.

    Science.gov (United States)

    Song, Hummy; Ryan, Molly; Tendulkar, Shalini; Fisher, Josephine; Martin, Julia; Peters, Antoinette S; Frolkis, Joseph P; Rosenthal, Meredith B; Chien, Alyna T; Singer, Sara J

    Team-based care is essential for delivering high-quality, comprehensive, and coordinated care. Despite considerable research about the effects of team-based care on patient outcomes, few studies have examined how team dynamics relate to provider outcomes. The aim of this study was to examine relationships among team dynamics, primary care provider (PCP) clinical work satisfaction, and patient care coordination between PCPs in 18 Harvard-affiliated primary care practices participating in Harvard's Academic Innovations Collaborative. First, we administered a cross-sectional survey to all 548 PCPs (267 attending clinicians, 281 resident physicians) working at participating practices; 65% responded. We assessed the relationship of team dynamics with PCPs' clinical work satisfaction and perception of patient care coordination between PCPs, respectively, and the potential mediating effect of patient care coordination on the relationship between team dynamics and work satisfaction. In addition, we embedded a qualitative evaluation within the quantitative evaluation to achieve a convergent mixed methods design to help us better understand our findings and illuminate relationships among key variables. Better team dynamics were positively associated with clinical work satisfaction and quality of patient care coordination between PCPs. Coordination partially mediated the relationship between team dynamics and satisfaction for attending clinicians, suggesting that higher satisfaction depends, in part, on better teamwork, yielding more coordinated patient care. We found no mediating effects for resident physicians. Qualitative results suggest that sources of satisfaction from positive team dynamics for PCPs may be most relevant to attending clinicians. Improving primary care team dynamics could improve clinical work satisfaction among PCPs and patient care coordination between PCPs. In addition to improving outcomes that directly concern health care providers, efforts to

  13. Prevalence and risk factors associated with female anal sex in the context of HIV/AIDS in the selected districts of Tanzania.

    Science.gov (United States)

    Shayo, Elizabeth H; Kalinga, Akili A; Senkoro, Kesheni P; Msovela, Judith; Mgina, Erick J; Shija, Angela E; Materu, Godlisten; Kilima, Stella P; Mboera, Leonard E G; Massaga, Julius J

    2017-03-27

    Female anal sex is a receptive type of sexual practice among heterosexual couples where the penis is inserted into the anus of a female partner. In the Western world, a number of studies and interventions have been carried out on anal sex among men due to its potential risks to HIV transmission. In African countries, including Tanzania, there is dearth of information on the risks inherent in practices associated with female anal sex in the general population. The objective of this study was to determine the prevalence and risk factors associated with female anal sex in fuelling HIV transmission in selected districts of Tanzania. This study was conducted in four districts of Tanzania of Kinondoni, Tanga Urban, Makete and Siha. Both quantitative and qualitative methods i.e. household interviews and focus group discussions were employed in data collection. Study participants included community members of aged 15 and above such as heads of the household, adolescents, bar workers and commercial sex workers. A total of 903 individuals were interviewed, 60.6% of whom were females. When respondents were asked to indicate whether they had ever been tempted to practise FAS, 167 (18.5%) reported to have been tempted in the past 12 months. Of these, 44 (26.3%) respondents had at least practised FAS. Risky practices associated with FAS were forced sex, multiple partners, frequency of engaging in FAS, low use of condoms during FAS, low rates of HIV testing among partakers, poor perception of the risks to acquire HIV through FAS and use of lubricants. In this population, the frequency of FAS practice was rather low. And yet, FAS practice attendant risk factors are likely to exacerbate HIV transmission. As such, there is a need for further exploratory studies to determine and document drivers of FAS. In addition, public health education should be provided with regard to the risks of contracting HIV associated with FAS practices.

  14. Australian nursing and midwifery educators delivering evidence-based education in Tanzania: A qualitative study.

    Science.gov (United States)

    Gower, Shelley; van den Akker, Jose; Jones, Mark; Dantas, Jaya A R; Duggan, Ravani

    2016-05-01

    Since 2011, Western Australian nursing and midwifery educators have been providing evidence-based continuing education to Tanzanian health professionals. Despite thorough preparation before departure, differences in local resource levels and available facilities have necessitated impromptu adaptation of curriculum content and delivery methods to ensure an effective program was delivered. This study explored the personal, cultural and teaching strategies utilised by Western Australian nursing and midwifery educators in Tanzania and examined if the transferability of education packages was influenced by the educators' cultural competence. Using a qualitative exploratory approach, data was collected from 15 Western Australian nursing and midwifery educators using a demographic survey and in-depth individual semi-structured interviews. The core themes identified from the analysis were Determination to learn, Assessing needs, Communication skills and Greater understanding. These findings are described using the conceptual framework of Campinha-Bacote's The Process of Cultural Competence in the Delivery of Healthcare Services. With appropriate levels of cultural competence, international health professionals can be effective at providing ongoing professional development to colleagues in developing country contexts, which may help address difficulties with retention and motivation of staff. It is essential that prior to departure cultural competence training is provided to educators to enhance their teaching capacity and effectiveness in international settings. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. Voluntary medical male circumcision: matching demand and supply with quality and efficiency in a high-volume campaign in Iringa Region, Tanzania.

    Science.gov (United States)

    Mahler, Hally R; Kileo, Baldwin; Curran, Kelly; Plotkin, Marya; Adamu, Tigistu; Hellar, Augustino; Koshuma, Sifuni; Nyabenda, Simeon; Machaku, Michael; Lukobo-Durrell, Mainza; Castor, Delivette; Njeuhmeli, Emmanuel; Fimbo, Bennett

    2011-11-01

    The government of Tanzania has adopted voluntary medical male circumcision (VMMC) as an important component of its national HIV prevention strategy and is scaling up VMMC in eight regions nationwide, with the goal of reaching 2.8 million uncircumcised men by 2015. In a 2010 campaign lasting six weeks, five health facilities in Tanzania's Iringa Region performed 10,352 VMMCs, which exceeded the campaign's target by 72%, with an adverse event (AE) rate of 1%. HIV testing was almost universal during the campaign. Through the adoption of approaches designed to improve clinical efficiency-including the use of the forceps-guided surgical method, the use of multiple beds in an assembly line by surgical teams, and task shifting and task sharing-the campaign matched the supply of VMMC services with demand. Community mobilization and bringing client preparation tasks (such as counseling, testing, and client scheduling) out of the facility and into the community helped to generate demand. This case study suggests that a campaign approach can be used to provide high-volume quality VMMC services without compromising client safety, and provides a model for matching supply and demand for VMMC services in other settings.

  16. Child sexual abuse in Tanzania and Kenya.

    Science.gov (United States)

    Lalor, Kevin

    2004-08-01

    Most research on child abuse in Tanzania and Kenya is unpublished in the international literature. The purpose of this paper is to examine the various commentaries and reports extant, toward an overview of the nature and frequency of child sexual abuse in Tanzania and Kenya. Contacts were made with academics, government departments, NGOs, and UN agencies. This was followed by a field trip in the summer of 2001 where all available reports were examined and a wide range of interviews conducted. Little empirical data exist on child sexual abuse in Tanzania. It is widely perceived that it may be increasing as a result of AIDS sufferers' attempts to "cleanse" themselves. The breakdown of traditional childcare systems, foreign influences, poverty, and the lowly position of girls in society are also implicated. More research has been conducted in Kenya. It is clear that first coitus occurs at a young age for many Kenyan children and adolescents. Also, a degree of force, trickery, or material exchange is not uncommon in adolescent sexual relations. Child sexual abuse is under-researched in Tanzania and Kenya. Studies by UN agencies such as United Nations Children's Fund (UNICEF) and the International Labour Organisation (ILO) have focused on the commercial sexual exploitation of children, to the neglect of more pervasive abuse in children's own communities by family, relatives, and neighbors. Nationwide surveys of the general population are required for an empirical understanding of this topic. Given the high incidence of AIDS/HIV in both countries, it is important to know if the epidemic is increasing the risk of rape or incest for children.

  17. Tanzania | Page 12 | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    It is 2002. Parents and babies wait patiently to see the community health worker in Mvomero, Tanzania. “People have faith in the services. They are treated well and diagnosed properly,” says Samuel Hassain, here with his sick grandson. Health worker Y.E. Kapito marvels that “it has been six to eight months since I heard of ...

  18. Evidence-based practice beliefs and behaviors of nurses providing cancer pain management: a mixed-methods approach.

    Science.gov (United States)

    Eaton, Linda H; Meins, Alexa R; Mitchell, Pamela H; Voss, Joachim; Doorenbos, Ardith Z

    2015-03-01

    To describe evidence-based practice (EBP) beliefs and behaviors of nurses who provide cancer pain management. Descriptive, cross-sectional with a mixed-methods approach. Two inpatient oncology units in the Pacific Northwest. 40 RNs.
 Data collected by interviews and web-based surveys. EBP beliefs, EBP implementation, evidence-based pain management. Nurses agreed with the positive aspects of EBP and their implementation ability, although implementation level was low. They were satisfied with their pain management practices. Oncology nursing certification was associated with innovativeness, and innovativeness was associated with EBP beliefs. Themes identified were (a) limited definition of EBP, (b) varied evidence-based pain management decision making, (c) limited identification of evidence-based pain management practices, and (d) integration of nonpharmacologic interventions into patient care. Nurses' low level of EBP implementation in the context of pain management was explained by their trust that standards of care and medical orders were evidence-based. Nurses' EBP beliefs and behaviors should be considered when developing strategies for sustaining evidence-based pain management practices. Implementation of the EBP process by nurses may not be realistic in the inpatient setting; therefore, hospital pain management policies need to be evidence-based and reinforced with nurses.

  19. Assessment of the Growing Season Regime Region of Tanzania ...

    African Journals Online (AJOL)

    Centra\\,. Tanzania is 'a semi - arid region with some, parts .' receiving annual rainf~fl of less than 400 mm. The major annual crops: grown in the unimodal. 17. rainfall region include cereals (maize, millet, . and sorghum) and Jmlses(beans). Millet and sorghum are .grown in semi-arid areas of central Tanzania, where 0.

  20. Hunting in Tanzania: Has Science Played Its Role? Abstract

    African Journals Online (AJOL)

    buffalo, lion, leopard, elephant and hippo, commonly known to trophy hunters in Tanzania as the, Big Five." This' source of data is supplemented by data collected from other sources especially,the various reports on trophy hunting'in Tanzania and Selous Game Re'serve in particular. The statistical software used for the.

  1. Dynamics of Revenue Generation in Tanzania, Kenya and Uganda ...

    African Journals Online (AJOL)

    The dynamics of revenue generation in Tanzania, Kenya and Uganda are explored. Results demonstrate that revenue generation is sluggish in Tanzania compared to Kenya and Uganda. Macroeconomic environment, economic structure, and level of development are fundamental at explaining these differences. Results ...

  2. LM6000s bring fast track power to Tanzania

    Energy Technology Data Exchange (ETDEWEB)

    Lukas, R. [Stone and Webster Canada Ltd., Toronto, ON (Canada); Sutcliffe, K. [Stewart and Stevenson Services, Houston, TX (United States); Oosthuizen, P. [Roshcon, Johannesburg (South Africa)

    1996-06-01

    Like many developing countries, Tanzania is in urgent need of power. To ease the situation, the Tanzanian government utility, Tanzania Electric Supply Company (Tanesco) recently began operating a power plant using two LM6000 aeroderivative gas turbines at a facility in Ubungo. The plant began operation just 165 days after the order was placed. (author)

  3. Tanzania Journal of Health Research - Vol 17, No 1 (2015)

    African Journals Online (AJOL)

    Youth unemployment, community violence, creating opportunities in Dar es Salaam, Tanzania: a qualitative study · EMAIL FREE FULL TEXT EMAIL FREE FULL ... Mob justice as an emerging medico-legal, social and public health problem in north-western Tanzania: a need for immediate attention · EMAIL FREE FULL ...

  4. Counselling at the Workplace in Tanzania What can Distance ...

    African Journals Online (AJOL)

    his paper examines practice in counselling at workplaces. It draws examples from Tanzania. Authors define counselling as a collaborative approach towards problem solving. It is a step-by-step process of self-actualization guided by a counsellor. The authors are of the view that in most workplaces in Tanzania, for instance, ...

  5. Creating Fiscal Space for Social Sectors Development in Tanzania ...

    African Journals Online (AJOL)

    This paper discusses fiscal space creation and use in the context of development of social sectors in Tanzania. The paper observes that Tanzania is making good progress in creating and using her fiscal space. The priority being accorded to social sectors, especially in education and health is in the right direction. However ...

  6. Insecticide resistance testing in malaria vectors in Tanzania ...

    African Journals Online (AJOL)

    Insecticide resistance testing in malaria vectors in Tanzania: Challenges in mosquito sampling and rearing under field conditions. Basiliana Emidi1,2*, Bilali Kabula4,Patrick Tungu3, Julius Massaga2, William Kisinza3. 1Kilimanjaro Christian Medical College of Tumaini University, Moshi, Tanzania. 2National Institute for ...

  7. Malaria in Bulambya, Ileje district, south-west Tanzania

    African Journals Online (AJOL)

    Senkoro, K.P. & Mwingira, V. (2005) Malaria among the pastoral communities of the. Ngorongoro Crater area, northern Tanzania. Tanzania Health Research Bulletin 7, 79-87. Minja, S.H. & Matola, Y. G. (1982) Kyela district: malaria in the human population. Annual. Report of the National Institute for Medical. Research 1, 14 ...

  8. Social security systems in Tanzania: Phase I Overview of social ...

    African Journals Online (AJOL)

    The paper starts by examining the concept of social security in Tanzania, showing that there are three key issues in social security which have not been adequately addressed by existing social security schemes and need immediate attention. The paper then examines the nature and forms of social security in Tanzania in a ...

  9. Tanzania Veterinary Journal - Vol 29, No 2 (2014)

    African Journals Online (AJOL)

    Dynamics and driving forces of hides, skins, leather and leather goods production and trade in Tanzania · EMAIL FULL TEXT EMAIL FULL TEXT ... Reproductive performance of artificially inseminated dairy cows under smallholder production system in selected areas of Rwanda and Tanzania · EMAIL FULL TEXT EMAIL ...

  10. Huria: Journal of the Open University of Tanzania: Editorial Policies

    African Journals Online (AJOL)

    Mr. Neville Reuben, Institute of Continuing Education, The Open University of Tanzania Dr. Salim Mohamed Faculty of Business Management, The Open University of Tanzania Dr. Clarence Mgina University of Dar es Salaam Prof. B. Lembariti, Deputy Vice-Chancellor (Administration), Muhimbili University of Health and ...

  11. Maternal health in fifty years of Tanzania independence: Challenges ...

    African Journals Online (AJOL)

    Maternal health in fifty years of Tanzania independence: Challenges and opportunities of reducing maternal mortality. ... Tanzania Journal of Health Research ... maternal death audit; coordination and integration of different programs including maternal and child health services, family planning, malaria interventions, ...

  12. community awareness for archives in tanzania: a case study of ...

    African Journals Online (AJOL)

    Walter

    World, as well as records on the famous East African Slave Trade,. Explorers and ... Problem Statement. Most studies that have been conducted in Tanzania have mainly concentrated on issues related to the management and conservation ... studies in Tanzania and Zanzibar have totally ignored the aspects of archives.

  13. Factors influencing the Use of Mobile Payments in Tanzania ...

    African Journals Online (AJOL)

    Frederick Iraki

    M-payment services to access cash through automated teller machine (ATMs), investment in state of the art ... Several co-existing factors have contributed to the rapid growth of mobile phone subscribers in. Tanzania. ... payments in Tanzania, an East African and low-income nation and below are the research questions ...

  14. Molecular characterization of Pseudomonas syringae pv. tomato isolates from Tanzania

    DEFF Research Database (Denmark)

    Shenge, K.C.; Stephan, D.; Mabagala, R. B.

    2008-01-01

    Bacterial speck caused by Pseudomonas syringae pv. tomato is an emerging disease of tomato in Tanzania. Following reports of outbreaks of the disease in many locations in Tanzania, 56 isolates of P. syringae pv. tomato were collected from four tomato- producing areas and characterized using patho...

  15. Planning a Family: Priorities and Concerns in Rural Tanzania ...

    African Journals Online (AJOL)

    Planning a Family: Priorities and Concerns in Rural Tanzania. T Marchant, AK Mushi, R Nathan, O Mukasa, S Abdulla, C Lengeler, JRM Armstrong Schellenberg. Abstract. A fertility survey using qualitative and quantitative techniques described a high fertility setting (TFR 5.8) in southern Tanzania where family planning use ...

  16. Tafsiri za Riwaya za Kigeni kwa Kiswahili nchini Tanzania | Traore ...

    African Journals Online (AJOL)

    Tafsiri za Riwaya za Kigeni kwa Kiswahili nchini Tanzania. Flavia Aiello Traore. Abstract. Makala hii inazingatia tafsiri ya kifasihi nchini Tanzania enzi za baada ya kujipatia uhuru. Inaeleza baadhi ya mbinu zilizotumiwa na wafasiri wa Kiswahili wakati wakishughulika na kazi za fasihi ya kigeni, hususani jinsi ya kukabiliana ...

  17. All projects related to tanzania | Page 7 | IDRC - International ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Topic: TAXATION, TOBACCO, SMOKING, PREVENTIVE MEDICINE. Region: Tanzania, North of Sahara, South of Sahara. Program: Food, Environment, and Health. Total Funding: CA$ 42,300.00. Decentralization, Local Politics and the Construction of Women's Citizenship (Uganda, Kenya and Tanzania) - Phase I. Project.

  18. Quality of HIV laboratory testing in Tanzania: a situation analysis

    African Journals Online (AJOL)

    in Good Laboratory Practice and poor laboratory quality control process for HIV testing reagents, internal and external quality control. Keywords: HIV, diagnosis, laboratory tests, quality control, Tanzania. Introduction. In 2005 the estimated number of adults aged ≥15 years in Tanzania living with HIV was approximately 1.3.

  19. Birds of Golden Pride Project area, Nzega District, central Tanzania ...

    African Journals Online (AJOL)

    Summary. In Tanzania, the success of habitat restoration in mining areas to create suitable environmental conditions for wildlife is poorly understood. Between March 2010 and. December 2014 bird species were recorded at the Golden Pride Project area, a gold mine in Nzega District, central Tanzania. The aims of this ...

  20. The Southern Black Tit Melaniparus niger in Tanzania with ...

    African Journals Online (AJOL)

    ern Tanzania we checked all records in the Tanzania Atlas database. We are now of the opinion that the following records all relate to M. niger and these are included as such in the species maps (Maps 1 & 2). Masasi; September 1939 C.J.P. Ionides (might a specimen exist?) Nachingwea; October 1966 (R.J. Stjernstedt).

  1. Conservation biology: lion attacks on humans in Tanzania.

    Science.gov (United States)

    Packer, Craig; Ikanda, Dennis; Kissui, Bernard; Kushnir, Hadas

    2005-08-18

    Large carnivores inspire opposition to conservation efforts owing to their impact on livestock and human safety. Here we analyse the pattern of lion attacks over the past 15 years on humans in Tanzania, which has the largest population of lions in Africa, and find that they have killed more than 563 Tanzanians since 1990 and injured at least 308. Attacks have increased dramatically during this time: they peak at harvest time each year and are most frequent in areas with few prey apart from bush pigs (Potamochoerus larvatus), the most common nocturnal crop pest. Our findings provide an important starting point for devising strategies to reduce the risk to rural Tanzanians of lion attacks.

  2. Decentralized health care priority-setting in Tanzania

    DEFF Research Database (Denmark)

    Maluka, Stephen; Kamuzora, Peter; Sebastiån, Miguel San

    2010-01-01

    care priorities in Mbarali district, Tanzania, and evaluates the descriptions against Accountability for Reasonableness. Key informant interviews were conducted with district health managers, local government officials and other stakeholders using a semi-structured interview guide. Relevant documents......Priority-setting has become one of the biggest challenges faced by health decision-makers worldwide. Fairness is a key goal of priority-setting and Accountability for Reasonableness has emerged as a guiding framework for fair priority-setting. This paper describes the processes of setting health...... not satisfy all four conditions of Accountability for Reasonableness; namely relevance, publicity, appeals and revision, and enforcement. This paper aims to make two important contributions to this problematic situation. First, it provides empirical analysis of priority-setting at the district level...

  3. Rape against Women in Tanzania : Studies of Social Reactions and Barriers to Disclosure

    OpenAIRE

    Muganyizi, c

    2010-01-01

    This thesis assessed responses toward rape against women as experienced by the victims and victim supporters in the context of the interaction between victims, supporters, and formal agencies in Tanzania. The overall research design was based on triangulation with a combination of qualitative and quantitative methods. A semi-qualitative study, in which free listings and semi-structured questionnaires were used, explored social reactions from 44 community nurses and 50 rape victims (Paper I). ...

  4. Social representation and practices related to dementia in Hai District of Tanzania

    OpenAIRE

    Mushi, Declare; Rongai, Amen; Paddick, Stella-Maria; Dotchin, Catherine; Mtuya, Chauka; Walker, Richard

    2014-01-01

    Background With the increasing number of people surviving into old age in Africa, dementia is becoming an important public health problem. Understanding the social dynamics of dementia in resource-poor settings is critical for developing effective interventions. We explored the socio-cultural beliefs surrounding dementia and the life experience of people with dementia (PWD) and their caregivers in the Hai District of Kilimanjaro, Tanzania. Methods Cross-sectional qualitative design. Forty one...

  5. Recurrence of Preeclampsia in Northern Tanzania: A Registry-Based Cohort Study

    OpenAIRE

    Mahande, Michael Johnson; Daltveit, Anne Kjersti; Mmbaga, Blandina T.; Masenga, Gileard; Obure, Joseph; Manongi, Rachel; Lie, Rolv Terje

    2013-01-01

    Objective: Preeclampsia occurs in about 4 per cent of pregnancies worldwide, and may have particularly serious consequences for women in Africa. Studies in western countries have shown that women with preeclampsia in one pregnancy have a substantially increased risk of preeclampsia in subsequent pregnancies. We estimate the recurrence risks of preeclampsia in data from Northern Tanzania.Methods: A prospective cohort study was designed using 19,811 women who delivered singleton infant...

  6. Plants used in traditional medicine in eastern Tanzania. V. Angiosperms (Passifloraceae to Sapindaceae).

    Science.gov (United States)

    Chhabra, S C; Mahunnah, R L; Mshiu, E N

    1991-01-01

    Sixty-one Angiosperms (Passifloraceae to Sapindaceae) are listed, which are used by traditional healers in five regions of Eastern Tanzania, namely, Coast, Dar es Salaam, Kilimanjaro, Morogoro and Tanga. For each species listed, the botanical name, vernacular name, collection number, locality, habit, distribution and medicinal uses are given. Additionally, information from the literature on medicinal uses, chemical constituents and pharmacological effects are also provided.

  7. An analysis of pre-service family planning teaching in clinical and nursing education in Tanzania

    OpenAIRE

    Muganyizi, Projestine S; Ishengoma, Joyce; Kanama, Joseph; Kikumbih, Nassoro; Mwanga, Feddy; Killian, Richard; McGinn, Erin

    2014-01-01

    Background Promoting family planning (FP) is a key strategy for health, economic and population growth. Sub-Saharan Africa, with one of the lowest contraceptive prevalence and highest fertility rates globally, contributes half of the global maternal deaths. Improving the quality of FP services, including enhancing pre-service FP teaching, has the potential to improve contraceptive prevalence. In efforts to improve the quality of FP services in Tanzania, including provider skills, this study s...

  8. Tanzania State of the Coast Report 2003: The National ICM Strategy and Prospects for Poverty Reduction

    OpenAIRE

    2003-01-01

    This section provides an overview of the diversity and abundance of natural resources and globally important ecosystems along TanzaniaÕs coastlineÑincluding coral reefs, mangrove forests and marine fisheries. Additionally, the effects of water quality and shoreline change are examined in depth. The human pressures that threaten the long-term integrity of these natural endowments and management actions to address them are highlighted. These include overfishing and over-harvestin...

  9. How long-distance truck drivers and villagers in rural southeastern Tanzania think about heterosexual anal sex: a qualitative study

    NARCIS (Netherlands)

    Mtenga, S.; Shamba, D.; Wamoyi, J.; Kakoko, D.; Haafkens, J.; Mongi, A.; Kapiga, S.; Geubbels, E.

    2015-01-01

    Objective: To explore ideas of truck drivers and villagers from rural Tanzania about heterosexual anal sex (HAS) and the associated health risks. Methods: Qualitative study using 8 in-depth interviews (IDIs) and 2 focus group discussions (FGDs) with truck drivers and 16 IDIs and 4 FGDs with

  10. Efavirenz is related to neuropsychiatric symptoms among adults, but not among adolescents living with HIV in Kilimanjaro, Tanzania

    NARCIS (Netherlands)

    Sumari-de Boer, I.M.; Schellekens, A.F.A.; Duinmaijer, A.; Lalashowi, J.M.; Swai, H.J.; Mast, Q. de; Ven, A.J.A.M. van der; Kinabo, G.

    2018-01-01

    Objectives: To explore the relationship between Efavirenz (EFV) and neuropsychiatric symptoms among adults and adolescents living with HIV in Kilimanjaro, Tanzania. Methods: Cross-sectional study among HIV-infected adults (age 18-65) and adolescents (age 12-17) on ART, attending Kilimanjaro

  11. Effect of a+ -thalassaemia on episodes of fever due to malaria and other causes: a communitybased cohort study in Tanzania

    NARCIS (Netherlands)

    Veenemans, J.; Jansen, E.J.S.; Baidjoe, A.Y.; Mbugi, E.V.; Demir, A.Y.; Kraaijenhagen, R.J.; Savelkoul, H.F.J.; Verhoef, H.

    2011-01-01

    Background It is controversial to what degree a+-thalassaemia protects against episodes of uncomplicated malaria and febrile disease due to infections other than Plasmodium. Methods In Tanzania, in children aged 6-60 months and height-for-age z-score <-1.5 SD (n = 612), rates of fevers due to

  12. Owner-manager motives and the growth of SMEs in developing countries: Evidence from the furniture industry in Tanzania

    NARCIS (Netherlands)

    Isaga, N.; Masurel, E.; van Montfort, C.A.G.M.

    2015-01-01

    Purpose – This paper aims to contribute to the understanding of the motives of individuals in Tanzania to start their own businesses on the one hand and the growth of their firms on the other hand. Design/methodology/approach – A survey method was used to gather data from 300 small business owners

  13. Content Analysis of the Status and Place of Sexuality Education in the National School Policy and Curriculum in Tanzania

    Science.gov (United States)

    Mkumbo, Kitila A.

    2009-01-01

    In Tanzania, sexuality education in schools is not provided as a standalone subject; rather it is mainstreamed in other subjects, namely Social Studies, Science, Civics and Biology. However, it is not clear how much sexuality education is covered in these subjects. The purpose of this study was to examine the status of sexuality education in the…

  14. IAEA responds to cancer crisis in Tanzania

    International Nuclear Information System (INIS)

    2006-01-01

    Full text: On the occasion of World Cancer Day (4 February), the IAEA announced that its Programme of Action for Cancer Therapy (PACT) will establish its first Centre of Excellence in Dar Es Salaam, Tanzania. This low-income East African country has one of the continent's highest cancer rates and only one cancer treatment centre. 'Cancer is a growing crisis all across the developing world,' explains IAEA Director General and Nobel Laureate Mohammed ElBaradei. 'We can save thousands of lives if we put together the tools, the knowledge and the political will to fight cancer effectively,' he said. Cancer is the second most common cause of death worldwide after cardiovascular disease. Over 7 million people died of cancer in 2005, and close to 11 million new cancer cases were diagnosed, according to the World Health Organization (WHO). More than 70 percent of cancer deaths now occur in low and middle income countries - the very countries least able to address this growing burden. Cancer-related deaths are projected to increase to more than 9 million people annually by 2015. Already cancer claims twice the number of lives worldwide as AIDS. Low income nations now face a dual burden of communicable and chronic diseases such as cancer. The IAEA spends about 12 million dollars each year for improving cancer treatment in the developing world. Last year, it established the Programme of Action for Cancer Therapy (PACT), to build partnerships with the WHO and other organizations dedicated to controlling cancer. Much of the IAEA's share of the 2005 Nobel Peace Prize Award has been dedicated to helping the developing world deal with the dramatic rise in cancer that is overwhelming limited health resources and equipment. The harsh reality of developing nations is one of overburdened health systems with little cancer screening and unnecessarily late cancer diagnosis and non-curative treatment. The IAEA estimates that approximately 5,000 cancer care centres and systems - plus the

  15. District health managers' perceptions of supervision in Malawi and Tanzania.

    Science.gov (United States)

    Bradley, Susan; Kamwendo, Francis; Masanja, Honorati; de Pinho, Helen; Waxman, Rachel; Boostrom, Camille; McAuliffe, Eilish

    2013-09-05

    Mid-level cadres are being used to address human resource shortages in many African contexts, but insufficient and ineffective human resource management is compromising their performance. Supervision plays a key role in performance and motivation, but is frequently characterised by periodic inspection and control, rather than support and feedback to improve performance. This paper explores the perceptions of district health management teams in Tanzania and Malawi on their role as supervisors and on the challenges to effective supervision at the district level. This qualitative study took place as part of a broader project, "Health Systems Strengthening for Equity: The Power and Potential of Mid-Level Providers". Semi-structured interviews were conducted with 20 district health management team personnel in Malawi and 37 council health team members in Tanzania. The interviews covered a range of human resource management issues, including supervision and performance assessment, staff job descriptions and roles, motivation and working conditions. Participants displayed varying attitudes to the nature and purpose of the supervision process. Much of the discourse in Malawi centred on inspection and control, while interviewees in Tanzania were more likely to articulate a paradigm characterised by support and improvement. In both countries, facility level performance metrics dominated. The lack of competency-based indicators or clear standards to assess individual health worker performance were considered problematic. Shortages of staff, at both district and facility level, were described as a major impediment to carrying out regular supervisory visits. Other challenges included conflicting and multiple responsibilities of district health team staff and financial constraints. Supervision is a central component of effective human resource management. Policy level attention is crucial to ensure a systematic, structured process that is based on common understandings of the

  16. Patient satisfaction with health care services provided at HIV clinics ...

    African Journals Online (AJOL)

    Background: Since the establishment of free HIV/AIDS care and treatment services in Tanzania a lot of research has been done to assess how health care providers discharge their duties in these clinics. Little research however has been done regarding satisfaction of HIV patients with free health care services provided.

  17. Where do Peer Providers Fit into Newly Integrated Mental Health and Primary Care Teams? A Mixed Method Study.

    Science.gov (United States)

    Siantz, Elizabeth; Rice, Eric; Henwood, Benjamin; Palinkas, Lawrence

    2017-12-21

    Little is known about the involvement of peer providers in integrated behavioral health teams. This study asks where peer providers fit within integrated care teams in Los Angeles County. Social network analysis combined with qualitative fieldwork was used to understand the network positions of peer providers in 14 integrated pilot programs. Four programs' peer providers were highly central, while 3 programs' were on the network's periphery. Positional variation appeared to be related to the peers' mental health status. Targeted efforts are needed to support the implementation of peer providers on integrated teams at the program and system levels.

  18. Mapping of Mycobacterium tuberculosis Complex Genetic Diversity Profiles in Tanzania and Other African Countries.

    Directory of Open Access Journals (Sweden)

    Erasto V Mbugi

    Full Text Available The aim of this study was to assess and characterize Mycobacterium tuberculosis complex (MTBC genotypic diversity in Tanzania, as well as in neighbouring East and other several African countries. We used spoligotyping to identify a total of 293 M. tuberculosis clinical isolates (one isolate per patient collected in the Bunda, Dar es Salaam, Ngorongoro and Serengeti areas in Tanzania. The results were compared with results in the SITVIT2 international database of the Pasteur Institute of Guadeloupe. Genotyping and phylogeographical analyses highlighted the predominance of the CAS, T, EAI, and LAM MTBC lineages in Tanzania. The three most frequent Spoligotype International Types (SITs were: SIT21/CAS1-Kili (n = 76; 25.94%, SIT59/LAM11-ZWE (n = 22; 7.51%, and SIT126/EAI5 tentatively reclassified as EAI3-TZA (n = 18; 6.14%. Furthermore, three SITs were newly created in this study (SIT4056/EAI5 n = 2, SIT4057/T1 n = 1, and SIT4058/EAI5 n = 1. We noted that the East-African-Indian (EAI lineage was more predominant in Bunda, the Manu lineage was more common among strains isolated in Ngorongoro, and the Central-Asian (CAS lineage was more predominant in Dar es Salaam (p-value<0.0001. No statistically significant differences were noted when comparing HIV status of patients vs. major lineages (p-value = 0.103. However, when grouping lineages as Principal Genetic Groups (PGG, we noticed that PGG2/3 group (Haarlem, LAM, S, T, and X was more associated with HIV-positive patients as compared to PGG1 group (Beijing, CAS, EAI, and Manu (p-value = 0.03. This study provided mapping of MTBC genetic diversity in Tanzania (containing information on isolates from different cities and neighbouring East African and other several African countries highlighting differences as regards to MTBC genotypic distribution between Tanzania and other African countries. This work also allowed underlining of spoligotyping patterns tentatively grouped within the newly designated EAI3

  19. Mapping of Mycobacterium tuberculosis Complex Genetic Diversity Profiles in Tanzania and Other African Countries.

    Science.gov (United States)

    Mbugi, Erasto V; Katale, Bugwesa Z; Streicher, Elizabeth M; Keyyu, Julius D; Kendall, Sharon L; Dockrell, Hazel M; Michel, Anita L; Rweyemamu, Mark M; Warren, Robin M; Matee, Mecky I; van Helden, Paul D; Couvin, David; Rastogi, Nalin

    2016-01-01

    The aim of this study was to assess and characterize Mycobacterium tuberculosis complex (MTBC) genotypic diversity in Tanzania, as well as in neighbouring East and other several African countries. We used spoligotyping to identify a total of 293 M. tuberculosis clinical isolates (one isolate per patient) collected in the Bunda, Dar es Salaam, Ngorongoro and Serengeti areas in Tanzania. The results were compared with results in the SITVIT2 international database of the Pasteur Institute of Guadeloupe. Genotyping and phylogeographical analyses highlighted the predominance of the CAS, T, EAI, and LAM MTBC lineages in Tanzania. The three most frequent Spoligotype International Types (SITs) were: SIT21/CAS1-Kili (n = 76; 25.94%), SIT59/LAM11-ZWE (n = 22; 7.51%), and SIT126/EAI5 tentatively reclassified as EAI3-TZA (n = 18; 6.14%). Furthermore, three SITs were newly created in this study (SIT4056/EAI5 n = 2, SIT4057/T1 n = 1, and SIT4058/EAI5 n = 1). We noted that the East-African-Indian (EAI) lineage was more predominant in Bunda, the Manu lineage was more common among strains isolated in Ngorongoro, and the Central-Asian (CAS) lineage was more predominant in Dar es Salaam (p-value<0.0001). No statistically significant differences were noted when comparing HIV status of patients vs. major lineages (p-value = 0.103). However, when grouping lineages as Principal Genetic Groups (PGG), we noticed that PGG2/3 group (Haarlem, LAM, S, T, and X) was more associated with HIV-positive patients as compared to PGG1 group (Beijing, CAS, EAI, and Manu) (p-value = 0.03). This study provided mapping of MTBC genetic diversity in Tanzania (containing information on isolates from different cities) and neighbouring East African and other several African countries highlighting differences as regards to MTBC genotypic distribution between Tanzania and other African countries. This work also allowed underlining of spoligotyping patterns tentatively grouped within the newly designated EAI3-TZA

  20. Mapping of Mycobacterium tuberculosis Complex Genetic Diversity Profiles in Tanzania and Other African Countries

    Science.gov (United States)

    Mbugi, Erasto V.; Katale, Bugwesa Z.; Streicher, Elizabeth M.; Keyyu, Julius D.; Kendall, Sharon L.; Dockrell, Hazel M.; Michel, Anita L.; Rweyemamu, Mark M.; Warren, Robin M.; Matee, Mecky I.; van Helden, Paul D.; Couvin, David; Rastogi, Nalin

    2016-01-01

    The aim of this study was to assess and characterize Mycobacterium tuberculosis complex (MTBC) genotypic diversity in Tanzania, as well as in neighbouring East and other several African countries. We used spoligotyping to identify a total of 293 M. tuberculosis clinical isolates (one isolate per patient) collected in the Bunda, Dar es Salaam, Ngorongoro and Serengeti areas in Tanzania. The results were compared with results in the SITVIT2 international database of the Pasteur Institute of Guadeloupe. Genotyping and phylogeographical analyses highlighted the predominance of the CAS, T, EAI, and LAM MTBC lineages in Tanzania. The three most frequent Spoligotype International Types (SITs) were: SIT21/CAS1-Kili (n = 76; 25.94%), SIT59/LAM11-ZWE (n = 22; 7.51%), and SIT126/EAI5 tentatively reclassified as EAI3-TZA (n = 18; 6.14%). Furthermore, three SITs were newly created in this study (SIT4056/EAI5 n = 2, SIT4057/T1 n = 1, and SIT4058/EAI5 n = 1). We noted that the East-African-Indian (EAI) lineage was more predominant in Bunda, the Manu lineage was more common among strains isolated in Ngorongoro, and the Central-Asian (CAS) lineage was more predominant in Dar es Salaam (p-value<0.0001). No statistically significant differences were noted when comparing HIV status of patients vs. major lineages (p-value = 0.103). However, when grouping lineages as Principal Genetic Groups (PGG), we noticed that PGG2/3 group (Haarlem, LAM, S, T, and X) was more associated with HIV-positive patients as compared to PGG1 group (Beijing, CAS, EAI, and Manu) (p-value = 0.03). This study provided mapping of MTBC genetic diversity in Tanzania (containing information on isolates from different cities) and neighbouring East African and other several African countries highlighting differences as regards to MTBC genotypic distribution between Tanzania and other African countries. This work also allowed underlining of spoligotyping patterns tentatively grouped within the newly designated EAI3-TZA

  1. Method for producing microstructured templates and their use in providing pinning enhancements in superconducting films deposited thereon

    Science.gov (United States)

    Aytug, Tolga; Paranthaman, Mariappan Parans; Polat, Ozgur

    2013-07-16

    The present invention relates to a method for producing a phase-separated layer useful as a flux pinning substrate for a superconducting film, wherein the method includes subjecting at least a first and a second target material to a sputtering deposition technique in order that a phase-separated layer is deposited epitaxially on a primary substrate containing an ordered surface layer. The invention is also directed to a method for producing a superconducting tape containing pinning defects therein by depositing a superconducting film on a phase-separated layer produced by the method described above.

  2. Surveillance of artemether-lumefantrine associated Plasmodium falciparum multidrug resistance protein-1 gene polymorphisms in Tanzania

    DEFF Research Database (Denmark)

    Kavishe, Reginald A; Paulo, Petro; Kaaya, Robert D

    2014-01-01

    ) is the recommended first-line drug in treatment of uncomplicated malaria. This study surveyed the distribution of the Plasmodium falciparum multidrug resistance protein-1 single nucleotide polymorphisms (SNPs) associated with increased parasite tolerance to ALu, in Tanzania. METHODS: A total of 687 Plasmodium...... in all regions, ranging from 17% - 26%. CONCLUSION: This is the first country-wide survey on Pfmdr1 mutations associated with ACT resistance. Distribution of individual Pfmdr1 mutations at codons 86, 184 and 1246 varies throughout Tanzanian regions. There is a general homogeneity in distribution......BACKGROUND: Resistance to anti-malarials is a major public health problem worldwide. After deployment of artemisinin-based combination therapy (ACT) there have been reports of reduced sensitivity to ACT by malarial parasites in South-East Asia. In Tanzania, artemether-lumefantrine (ALu...

  3. Individual and environmental risk factors for dengue and chikungunya seropositivity in North-Eastern Tanzania

    DEFF Research Database (Denmark)

    Kajeguka, Debora C.; Msonga, Maulid; Schiøler, Karin L.

    2017-01-01

    Background: Dengue and chikungunya are mosquito-borne viral diseases of major global health concern. In Tanzania, information on risk factors for dengue and chikungunya is limited. We investigated individual, household, socio-economic, demographic and environmental risk factors for dengue...... and chikungunya seropositivity. Methods: A cross sectional study was undertaken which included a total of 1003 participants from North-Eastern Tanzania, to determine the sero-prevalence of dengue and chikungunya and to investigate associated risk factors. Logistic regression models were used to determine the risk...... factors for dengue and chikungunya seropositivity. Results: Environmental factors such as living in a house with uncovered containers within the compound had higher odds of being chikungunya IgM seropositive (OR = 2.89; 95% CI: 1.76–4.76). Also, participants who kept hoofed animals in their home and who...

  4. Local level service delivery, decentralisation and governance: A comparative study of Uganda, Kenya and Tanzania

    Directory of Open Access Journals (Sweden)

    Per Tidemand

    2009-05-01

    Full Text Available This paper summarises key findings from a comprehensive analysis commissioned by the Japan International Cooperation Agency (JICA of the nature of decentralisation in the three East African countries: Kenya, Uganda and Tanzania. The specific objectives of the study were: • Provide a basic comparative analysis of the forms and processes of decentralisation reforms in the three countries • Analyse the specific modalities in the three countries for local service delivery planning and provision within the three sectors of basic education, primary health care and agricultural extension, with a particular emphasis on rural areas. TIDEMAND: Local level service delivery, decentralisation and governance: A comparative study of Uganda, Kenya and Tanzania CJLG May 2009 145 • Explore the impact of the specific forms of decentralisation and local level service delivery arrangements in terms of efficiency, accountability (transparency and democratic process (participation.

  5. Improving motivation among primary health care workers in Tanzania: a health worker perspective

    DEFF Research Database (Denmark)

    Manongi, Rachel N; Marchant, Tanya C; Bygbjerg, Ib Christian

    2006-01-01

    In Tanzania access to urban and rural primary health care is relatively widespread, yet there is evidence of considerable bypassing of services; questions have been raised about how to improve functionality.The aim of this study was to explore the experiences of health workers working...... identified in the results and suggests that some of the preferences presented by the health workers be discussed at policy level with a view to adding value to most services with minimum additional resources....... in the primary health care facilities in Kilimanjaro Region, Tanzania, in terms of their motivation to work, satisfaction and frustration, and to identify areas for sustainable improvement to the services they provide.The primary issues arising pertain to complexities of multitasking in an environment of staff...

  6. Multisite exploration of clinical decision making for antibiotic use by emergency medicine providers using quantitative and qualitative methods.

    Science.gov (United States)

    May, Larissa; Gudger, Glencora; Armstrong, Paige; Brooks, Gillian; Hinds, Pamela; Bhat, Rahul; Moran, Gregory J; Schwartz, Lisa; Cosgrove, Sara E; Klein, Eili Y; Rothman, Richard E; Rand, Cynthia

    2014-09-01

    To explore current practices and decision making regarding antimicrobial prescribing among emergency department (ED) clinical providers. We conducted a survey of ED providers recruited from 8 sites in 3 cities. Using purposeful sampling, we then recruited 21 providers for in-depth interviews. Additionally, we observed 10 patient-provider interactions at one of the ED sites. SAS 9.3 was used for descriptive and predictive statistics. Interviews were audio recorded, transcribed, and analyzed using a thematic, constructivist approach with consensus coding using NVivo 10.0. Field and interview notes collected during the observational study were aligned with themes identified through individual interviews. Of 150 survey respondents, 76% agreed or strongly agreed that antibiotics are overused in the ED, while half believed they personally did not overprescribe. Eighty-nine percent used a smartphone or tablet in the ED for antibiotic prescribing decisions. Several significant differences were found between attending and resident physicians. Interview analysis identified 42 codes aggregated into the following themes: (1) resource and environmental factors that affect care; (2) access to and quality of care received outside of the ED consult; (3) patient-provider relationships; (4) clinical inertia; and (5) local knowledge generation. The observational study revealed limited patient understanding of antibiotic use. Providers relied heavily upon diagnostics and provided limited education to patients. Most patients denied a priori expectations of being prescribed antibiotics. Patient, provider, and healthcare system factors should be considered when designing interventions to improve antimicrobial stewardship in the ED setting.

  7. Inter-epidemic abundance and distribution of potential mosquito vectors for Rift Valley fever virus in Ngorongoro district, Tanzania

    Directory of Open Access Journals (Sweden)

    Clement N. Mweya

    2015-01-01

    Full Text Available Background: Rift Valley fever (RVF is a mosquito-borne viral zoonosis that primarily affects ruminants but also has the capacity to infect humans. Objective: To determine the abundance and distribution of mosquito vectors in relation to their potential role in the virus transmission and maintenance in disease epidemic areas of Ngorongoro district in northern Tanzania. Methods: A cross-sectional entomological investigation was carried out before the suspected RVF outbreak in October 2012. Mosquitoes were sampled both outdoors and indoors using the Centre for Disease Control (CDC light traps and Mosquito Magnets baited with attractants. Outdoor traps were placed in proximity with breeding sites and under canopy in banana plantations close to the sleeping places of animals. Results: A total of 1,823 mosquitoes were collected, of which 87% (N=1,588 were Culex pipiens complex, 12% (N=226 Aedes aegypti, and 0.5% (N=9 Anopheles species. About two-thirds (67%; N=1,095 of C. pipiens complex and nearly 100% (N=225 of A. aegypti were trapped outdoors using Mosquito Magnets. All Anopheles species were trapped indoors using CDC light traps. There were variations in abundance of C. pipiens complex and A. aegypti among different ecological and vegetation habitats. Over three quarters (78% of C. pipiens complex and most (85% of the A. aegypti were trapped in banana and maize farms. Both C. pipiens complex and A. aegypti were more abundant in proximity with cattle and in semi-arid thorn bushes and lower Afro-montane. The highest number of mosquitoes was recorded in villages that were most affected during the RVF epidemic of 2007. Of the tested 150 pools of C. pipiens complex and 45 pools of A. aegypti, none was infected with RVF virus. Conclusions: These results provide insights into unique habitat characterisation relating to mosquito abundances and distribution in RVF epidemic-prone areas of Ngorongoro district in northern Tanzania.

  8. Why give birth in health facility? Users’ and providers’ accounts of poor quality of birth care in Tanzania

    Science.gov (United States)

    2013-01-01

    Background In Tanzania, half of all pregnant women access a health facility for delivery. The proportion receiving skilled care at birth is even lower. In order to reduce maternal mortality and morbidity, the government has set out to increase health facility deliveries by skilled care. The aim of this study was to describe the weaknesses in the provision of acceptable and adequate quality care through the accounts of women who have suffered obstetric fistula, nurse-midwives at both BEmOC and CEmOC health facilities and local community members. Methods Semi-structured interviews involving 16 women affected by obstetric fistula and five nurse-midwives at maternity wards at both BEmOC and CEmOC health facilities, and Focus Group Discussions with husbands and community members were conducted between October 2008 and February 2010 at Comprehensive Community Based Rehabilitation in Tanzania and Temeke hospitals in Dar es Salaam, and Mpwapwa district in Dodoma region. Results Health care users and health providers experienced poor quality caring and working environments in the health facilities. Women in labour lacked support, experienced neglect, as well as physical and verbal abuse. Nurse-midwives lacked supportive supervision, supplies and also seemed to lack motivation. Conclusions There was a consensus among women who have suffered serious birth injuries and nurse midwives staffing both BEmOC and CEmOC maternity wards that the quality of care offered to women in birth was inadequate. While the birth accounts of women pointed to failure of care, the nurses described a situation of disempowerment. The bad birth care experiences of women undermine the reputation of the health care system, lower community expectations of facility birth, and sustain high rates of home deliveries. The only way to increase the rate of skilled attendance at birth in the current Tanzanian context is to make facility birth a safer alternative than home birth. The findings from this study

  9. The Tanzania Field Epidemiology and Laboratory Training Program: building and transforming the public health workforce

    Science.gov (United States)

    Mmbuji, Peter; Mukanga, David; Mghamba, Janeth; Ahly, Mohamed; Mosha, Fausta; Azima, Simba; Senga, Sembuche; Moshiro, Candida; Semali, Innocent; Rolle, Italia; Wiktor, Stefan; McQueen, Suzzane; McElroy, Peter; Nsubuga, Peter

    2011-01-01

    The Tanzania Field Epidemiology and Laboratory Training Program (TFELTP) was established in 2008 as a partnership among the Ministry of Health and Social Welfare (MOHSW), Muhimbili University of Health and Allied Sciences, National Institute for Medical Research, and local and international partners. TFELTP was established to strengthen the capacity of MOHSW to conduct public health surveillance and response, manage national disease control and prevention programs, and to enhance public health laboratory support for surveillance, diagnosis, treatment and disease monitoring. TFELTP is a 2-year full-time training program with approximately 25% time spent in class, and 75% in the field. TFELTP offers two tracks leading to an MSc degree in either Applied Epidemiology or, Epidemiology and Laboratory Management. Since 2008, the program has enrolled a total of 33 trainees (23 males, 10 females). Of these, 11 were enrolled in 2008 and 100% graduated in 2010. All 11 graduates of cohort 1 are currently employed in public health positions within the country. Demand for the program as measured by the number of applicants has grown from 28 in 2008 to 56 in 2011. While training the public health leaders of the country, TFELTP has also provided essential service to the country in responding to high-profile disease outbreaks, and evaluating and improving its public health surveillance systems and diseases control programs. TFELTP was involved in the country assessment of the revised International Health Regulations (IHR) core capabilities, development of the Tanzania IHR plan, and incorporation of IHR into the revised Tanzania Integrated Disease Surveillance and Response (IDSR) guidelines. TFELTP is training a competent core group of public health leaders for Tanzania, as well as providing much needed service to the MOHSW in the areas of routine surveillance, outbreak detection and response, and disease program management. However, the immediate challenges that the program must

  10. The Tanzania Field Epidemiology and Laboratory Training Program: building and transforming the public health workforce.

    Science.gov (United States)

    Mmbuji, Peter; Mukanga, David; Mghamba, Janeth; Ahly, Mohamed; Mosha, Fausta; Azima, Simba; Senga, Sembuche; Moshiro, Candida; Semali, Innocent; Rolle, Italia; Wiktor, Stefan; McQueen, Suzzane; McElroy, Peter; Nsubuga, Peter

    2011-01-01

    The Tanzania Field Epidemiology and Laboratory Training Program (TFELTP) was established in 2008 as a partnership among the Ministry of Health and Social Welfare (MOHSW), Muhimbili University of Health and Allied Sciences, National Institute for Medical Research, and local and international partners. TFELTP was established to strengthen the capacity of MOHSW to conduct public health surveillance and response, manage national disease control and prevention programs, and to enhance public health laboratory support for surveillance, diagnosis, treatment and disease monitoring. TFELTP is a 2-year full-time training program with approximately 25% time spent in class, and 75% in the field. TFELTP offers two tracks leading to an MSc degree in either Applied Epidemiology or, Epidemiology and Laboratory Management. Since 2008, the program has enrolled a total of 33 trainees (23 males, 10 females). Of these, 11 were enrolled in 2008 and 100% graduated in 2010. All 11 graduates of cohort 1 are currently employed in public health positions within the country. Demand for the program as measured by the number of applicants has grown from 28 in 2008 to 56 in 2011. While training the public health leaders of the country, TFELTP has also provided essential service to the country in responding to high-profile disease outbreaks, and evaluating and improving its public health surveillance systems and diseases control programs. TFELTP was involved in the country assessment of the revised International Health Regulations (IHR) core capabilities, development of the Tanzania IHR plan, and incorporation of IHR into the revised Tanzania Integrated Disease Surveillance and Response (IDSR) guidelines. TFELTP is training a competent core group of public health leaders for Tanzania, as well as providing much needed service to the MOHSW in the areas of routine surveillance, outbreak detection and response, and disease program management. However, the immediate challenges that the program must

  11. Biomass Energy Systems and Resources in Tropical Tanzania

    Energy Technology Data Exchange (ETDEWEB)

    Wilson, Lugano (KTH, School of Industrial Engineering and Management (ITM), Materials Science and Engineering, Energy and Furnace Technology (Sweden))

    2010-07-01

    establishing characteristic properties of selected biomass feedstock from Tanzania. The characteristic properties are necessary input to thermochemical process designers and researchers. Furthermore, since the properties are origin-specific, this will provide baseline data for technology transfer from north to south. The characteristic properties that were established were chemical composition, and thermal degradation behaviour. Furthermore, laboratory scale high temperature gasification of the biomasses was undertaken. Chemical composition characteristics was established to palm waste, coffee husks, cashew nut shells (CNS), rice husks and bran, bagasse, sisal waste, jatropha seeds, and mango stem. Results showed that the oxygen content ranged from 27.40 to 42.70% where as that of carbon and hydrogen ranged from 35.60 to 56.90% and 4.50 to 7.50% respectively. On the other hand, the elemental composition of nitrogen, sulphur and chlorine was marginal. These properties are comparable to findings from other researchers. Based on the results of thermal degradation characteristics, it was evident that the cashew nut shells (CNS) was the most reactive amongst the analyzed materials since during the devolatilization stage the first derivative TG (DTG) peak due to hemicellulose degradation reached (-5.52%/minute) compared palm stem whose first peak was -4.81%/minute. DTG first peak for the remaining materials was indistinct. Results from the laboratory gasification experiments that were done to the coffee husks showed that gasification at higher temperature (900 deg C) had an overall higher gasification rate. For instance, during the inert nitrogen condition, 7% of coffee husk remained for the case of 900 deg C whereas the residue mass for the gasification at 800 and 700 deg C was 10 and 17% respectively. Steam injection to the biomass under high temperature gasification evolved the highest volumetric concentration of carbon monoxide. The CO peak evolution at 900 deg C steam only was

  12. Size-specific dose estimate (SSDE) provides a simple method to calculate organ dose for pediatric CT examinations

    Energy Technology Data Exchange (ETDEWEB)

    Moore, Bria M.; Brady, Samuel L., E-mail: samuel.brady@stjude.org; Kaufman, Robert A. [Department of Radiological Sciences, St Jude Children' s Research Hospital, Memphis, Tennessee 38105 (United States); Mirro, Amy E. [Department of Biomedical Engineering, Washington University, St Louis, Missouri 63130 (United States)

    2014-07-15

    Purpose: To investigate the correlation of size-specific dose estimate (SSDE) with absorbed organ dose, and to develop a simple methodology for estimating patient organ dose in a pediatric population (5–55 kg). Methods: Four physical anthropomorphic phantoms representing a range of pediatric body habitus were scanned with metal oxide semiconductor field effect transistor (MOSFET) dosimeters placed at 23 organ locations to determine absolute organ dose. Phantom absolute organ dose was divided by phantom SSDE to determine correlation between organ dose and SSDE. Organ dose correlation factors (CF{sub SSDE}{sup organ}) were then multiplied by patient-specific SSDE to estimate patient organ dose. The CF{sub SSDE}{sup organ} were used to retrospectively estimate individual organ doses from 352 chest and 241 abdominopelvic pediatric CT examinations, where mean patient weight was 22 kg ± 15 (range 5–55 kg), and mean patient age was 6 yrs ± 5 (range 4 months to 23 yrs). Patient organ dose estimates were compared to published pediatric Monte Carlo study results. Results: Phantom effective diameters were matched with patient population effective diameters to within 4 cm; thus, showing appropriate scalability of the phantoms across the entire pediatric population in this study. IndividualCF{sub SSDE}{sup organ} were determined for a total of 23 organs in the chest and abdominopelvic region across nine weight subcategories. For organs fully covered by the scan volume, correlation in the chest (average 1.1; range 0.7–1.4) and abdominopelvic region (average 0.9; range 0.7–1.3) was near unity. For organ/tissue that extended beyond the scan volume (i.e., skin, bone marrow, and bone surface), correlation was determined to be poor (average 0.3; range: 0.1–0.4) for both the chest and abdominopelvic regions, respectively. A means to estimate patient organ dose was demonstrated. Calculated patient organ dose, using patient SSDE and CF{sub SSDE}{sup organ}, was compared to

  13. Improving smallholder livelihoods: Dairy production in Tanzania

    Directory of Open Access Journals (Sweden)

    Edward Ulicky

    2013-12-01

    Full Text Available Tanzania is primarily an agro-based economy, characterized by subsistence agricultural production that employs more than 80% of the population and contributes up to 45% of the GDP (2005. This country is endowed with a cattle population of 21.3 M, composed mainly of indigenous Zebu breeds and about 680 000 improved dairy animals. About 70% of the milk produced comes from the traditional sector (indigenous cattle kept in rural areas, while the remaining 30% comes from improved cattle, mainly kept by smallholder producers. In Northern Tanzania and particularly in Hai district of Kilimanjaro Region, some dairy farmers organize themselves into small producer groups for the purpose of milk collecting, marketing and general promotion of the dairy sector in their community. Nronga Women Dairy Cooperative Society (NWDCS Limited is one of such organizations dedicated to improve the well-being of the Nronga village community through promoting small-scale dairy farming and its flow-on benefits. Milk flows out of the village, and services for investment and dairy production flow into the village, ensuring a sustainable financial circulation necessary for poverty reduction, rural development and better life for the rural community. In 2001 NWDCS introduced a school milk feeding program that has attracted Australian donors since 2005. Guided by Global Development Group, a multi-faceted project, integrating micro-enterprises, business, education and child health/nutrition, was proposed and initiated by building a dairy plant in Hai District headquarters, the Boma plant. In March 2013, the Australian High Commission to East Africa approved Direct Aid Program funding of AUD 30 000 towards the NWDCS - Biogas Pilot Project in Tanzania, which included the renovation of zero-grazing cow shade units, the construction of 6-m3 biodigester plants on each farm, and encouragement of the use of bioslurry for pasture production and home gardens.

  14. Vejforvaltning i Etiopien, Tanzania og Malawi

    DEFF Research Database (Denmark)

    Kristiansen, Jørgen

    2004-01-01

    Som beskrevet i Dansk Vejtidsskrift nr. 5 2004 blev der under det såkaldte "Road Management Initiative" påbegyndt en række institutionelle reformer i vejsektoren i flere afrikanske lande syd for Sahara. I denne artikel drøftes nogle af de konkrete erfaringer, som siden 1995 er opnået med gennemfø...... gennemførelse af reformprocessen i Etiopien, Tanzania og Malawi. Artiklen er baseret på forfatterens arbejde med monitorering og evaluering af EU´s udviklingsprojekter i de pågældende lande....

  15. The Patient-Provider Relationship Is Associated with Hepatitis C Treatment Eligibility: A Prospective Mixed-Methods Cohort Study.

    Directory of Open Access Journals (Sweden)

    Shari S Rogal

    Full Text Available Hepatitis C virus (HCV treatment has the potential to cure the leading cause of cirrhosis and hepatocellular carcinoma. However, only those deemed eligible for treatment have the possibility of this cure. Therefore, understanding the determinants of HCV treatment eligibility is critical. Given that effective communication with and trust in healthcare providers significantly influences treatment eligibility decisions in other diseases, we aimed to understand patient-provider interactions in the HCV treatment eligibility process. This prospective cohort study was conducted in the VA Pittsburgh Healthcare System. Patients were recruited after referral for gastroenterology consultation for HCV treatment with interferon and ribavirin. Consented patients completed semi-structured interviews and validated measures of depression, substance and alcohol use, and HCV knowledge. Two coders analyzed the semi-structured interviews. Factors associated with patient eligibility for interferon-based therapy were assessed using multivariate logistic regression. Of 339 subjects included in this analysis, only 56 (16.5% were deemed eligible for HCV therapy by gastroenterology (GI providers. In the multivariate logistic regression, patients who were older (OR = 0.96, 95%CI = 0.92-0.99, p = .049, reported concerns about the GI provider (OR = 0.40, 95%CI = 0.10-0.87, p = 0.02 and had depression symptoms (OR = 0.32, 95%CI = 0.17-0.63, p = 0.001 were less likely to be eligible. Patients described barriers that included feeling stigmatized and poor provider interpersonal or communication skills. In conclusion, we found that patients' perceptions of the relationship with their GI providers were associated with treatment eligibility. Establishing trust and effective communication channels between patients and providers may lower barriers to potential HCV cure.

  16. Hands and water as vectors of diarrheal pathogens in Bagamoyo, Tanzania.

    Science.gov (United States)

    Mattioli, Mia Catharine; Pickering, Amy J; Gilsdorf, Rebecca J; Davis, Jennifer; Boehm, Alexandria B

    2013-01-02

    Diarrheal disease is a leading cause of under-five childhood mortality worldwide, with at least half of these deaths occurring in sub-Saharan Africa. Transmission of diarrheal pathogens occurs through several exposure routes including drinking water and hands, but the relative importance of each route is not well understood. Using molecular methods, this study examines the relative importance of different exposure routes by measuring enteric bacteria (pathogenic Escherichia coli) and viruses (rotavirus, enterovirus, adenovirus) in hand rinses, stored water, and source waters in Bagamoyo, Tanzania. Viruses were most frequently found on hands, suggesting that hands are important vectors for viral illness. The occurrence of E. coli virulence genes (ECVG) was equivalent across all sample types, indicating that both water and hands are important for bacterial pathogen transmission. Fecal indicator bacteria and turbidity were good predictors of ECVG, whereas turbidity and human-specific Bacteroidales were good predictors of viruses. ECVG were more likely found in unimproved water sources, but both ECVG and viral genes were detected in improved water sources. ECVG were more likely found in stored water of households with unimproved sanitation facilities. The results provide insights into the distribution of pathogens in Tanzanian households and offer evidence that hand-washing and improved water management practices could alleviate viral and bacterial diarrhea.

  17. Challenging HIV vulnerability discourse: the case of professional and entrepreneurial women in Dar Es Salaam, Tanzania.

    Science.gov (United States)

    Jangu, Neema William; Tam, Ailie; Maticka-Tyndale, Eleanor

    2017-05-01

    A poverty-HIV narrative has dominated many HIV prevention strategies in Africa despite epidemiological data showing higher prevalence of infection among educated and wealthier women in several African countries. This paper examines the perspectives of professional and entrepreneurial women on HIV risk and vulnerability based on their knowledge and lived experiences, comparing this to the HIV discourse evident in five strategic documents that shape intervention in Tanzania. The purpose is to uncover the confluence and dissonance between the discourses of government and those of professional women themselves. Qualitative research methods included critical discourse analysis of five strategic documents and thematic analysis of 37 in-depth interviews with women. The findings challenge fixed representations of women and notions of vulnerability embedded in the poverty-HIV discourse. Women described using their sexuality and sexual agency as a means to elevate their position in ways that made them vulnerable to sexual harassment and coercion. This is explored through two intersecting themes: non-marital sexual exchanges to gain an education or employment, and marriage. The intersecting social positions and constructions of female sexuality and agency expressed by the women in this study provide insights into other avenues and forms of HIV vulnerability.

  18. Graduates’ perceptions of prosthetic and orthotic education and clinical practice in Tanzania and Malawi

    Science.gov (United States)

    Shangali, Harold G.; Ahlström, Gerd

    2016-01-01

    Background Maintaining and improving the quality of prosthetics and orthotics education at the Tanzania Training Centre for Orthopaedic Technologists is essential for the provision of appropriate prosthetics and orthotics services in African countries. Objectives To describe how Tanzanian and Malawian graduates’ of the Diploma in Orthopaedic Technology perceive their education and how it could be improved or supplemented to facilitate clinical practice of graduates. Methods Nineteen graduates from the diploma course in orthopaedic technology were interviewed and phenomenographic analysis was applied to the data. Results Seven descriptive categories emerged, namely varied awareness of the profession before starting education, well-equipped teaching facilities, aspects lacking in the learning context, need for changes in the curriculum, enabling people to walk is motivating, obstacles in working conditions and the need for continuous professional development. All participants perceived possible improvements to the content and learning environment. Conclusions Prosthetic and orthotic education can be better provided by modifying the content of the diploma programme by dedicating more time to the clinical management of different patient groups and applied biomechanics as well as reducing the programme content focusing on technical aspects of prosthetic and orthotic practice. Graduates were not prepared for the rural working conditions and the graduates desired continued training. PMID:28730039

  19. The unmet need for Emergency Obstetric Care in Tanga Region, Tanzania

    Directory of Open Access Journals (Sweden)

    Mtatifikolo Ferdinand

    2007-08-01

    Full Text Available Abstract Background Improving maternal health by reducing maternal mortality constitutes the fifth Millennium Development Goal and represents a key public health challenge in the United Republic of Tanzania. In response to the need to evaluate and monitor safe motherhood interventions, this study aims at assessing the coverage of obstetric care according to the Unmet Obstetric Need (UON concept by obtaining information on indications for, and outcomes of, major obstetric interventions. Furthermore, we explore whether this concept can be operationalised at district level. Methods A two year study using the Unmet Obstetric Need concept was carried out in three districts in Tanga Region, Tanzania. Data was collected prospectively at all four hospitals in the region for every woman undergoing a major obstetric intervention, including indication and outcome. The concept was adapted to address differentials in access to emergency obstetric care between districts and between rural and urban areas. Based upon literature and expert consensus, a threshold of 2% of all deliveries was used to define the expected minimum requirement of major obstetric interventions performed for absolute maternal indications. Results Protocols covering 1,260 complicated deliveries were analysed. The percentage of major obstetric interventions carried out in response to an absolute maternal indication was only 71%; most major obstetric interventions (97% were caesarean sections. The most frequent indication was cephalo-pelvic-disproportion (51%. The proportion of major obstetric interventions for absolute maternal indications performed amongst women living in urban areas was 1.8% of all deliveries, while in rural areas it was only 0.7%. The high proportion (8.3% of negative maternal outcomes in terms of morbidity and mortality, as well as the high perinatal mortality of 9.1% (still birth 6.9%, dying within 24 hours 1.7%, dying after 24 hours 0.5% raise concern about the

  20. Malaria treatment in the retail sector: Knowledge and practices of drug sellers in rural Tanzania

    Directory of Open Access Journals (Sweden)

    Makemba Ahmed M

    2008-05-01

    Full Text Available Abstract Background Throughout Africa, the private retail sector has been recognised as an important source of antimalarial treatment, complementing formal health services. However, the quality of advice and treatment at private outlets is a widespread concern, especially with the introduction of artemisinin-based combination therapies (ACTs. As a result, ACTs are often deployed exclusively through public health facilities, potentially leading to poorer access among parts of the population. This research aimed at assessing the performance of the retail sector in rural Tanzania. Such information is urgently required to improve and broaden delivery channels for life-saving drugs. Methods During a comprehensive shop census in the districts of Kilombero and Ulanga, Tanzania, we interviewed 489 shopkeepers about their knowledge of malaria and malaria treatment. A complementary mystery shoppers study was conducted in 118 retail outlets in order to assess the vendors' drug selling practices. Both studies included drug stores as well as general shops. Results Shopkeepers in drug stores were able to name more malaria symptoms and were more knowledgeable about malaria treatment than their peers in general shops. In drug stores, 52% mentioned the correct child-dosage of sulphadoxine-pyrimethamine (SP compared to only 3% in general shops. In drug stores, mystery shoppers were more likely to receive an appropriate treatment (OR = 9.6, but at an approximately seven times higher price. Overall, adults were more often sold an antimalarial than children (OR = 11.3. On the other hand, general shopkeepers were often ready to refer especially children to a higher level if they felt unable to manage the case. Conclusion The quality of malaria case-management in the retail sector is not satisfactory. Drug stores should be supported and empowered to provide correct malaria-treatment with drugs they are allowed to dispense. At the same time, the role of general shops

  1. Method of operating a molten carbonate fuel cell, a fuel cell, a fuel cell stack and an apparatus provided therewith

    NARCIS (Netherlands)

    Hemmes, K.; Dijkema, G.P.J.

    1998-01-01

    A method of operating a molten carbonate fuel cell having an anode and a cathode and in between a matrix comprising molten carbonate. Carbon dioxide is introduced into the matrix at a distance from the cathode. This greatly reduces the cathode's deterioration and in the system design increases the

  2. New Technologies Provide Quantum Changes in the Scale, Speed, and Success of SELEX Methods and Aptamer Characterization

    Directory of Open Access Journals (Sweden)

    Abdullah Ozer

    2014-01-01

    Full Text Available Single-stranded oligonucleotide aptamers have attracted great attention in the past decade because of their diagnostic and therapeutic potential. These versatile, high affinity and specificity reagents are selected by an iterative in vitro process called SELEX, Systematic Evolution of Ligands by Exponential Enrichment. Numerous SELEX methods have been developed for aptamer selections; some that are simple and straightforward, and some that are specialized and complicated. The method of SELEX is crucial for selection of an aptamer with desired properties; however, success also depends on the starting aptamer library, the target molecule, aptamer enrichment monitoring assays, and finally, the analysis and characterization of selected aptamers. Here, we summarize key recent developments in aptamer selection methods, as well as other aspects of aptamer selection that have significant impact on the outcome. We discuss potential pitfalls and limitations in the selection process with an eye to aid researchers in the choice of a proper SELEX strategy, and we highlight areas where further developments and improvements are desired. We believe carefully designed multiplexed selection methods, when complemented with high-throughput downstream analysis and characterization assays, will yield numerous high-affinity aptamers to protein and small molecule targets, and thereby generate a vast array of reagents for probing basic biological mechanisms and implementing new diagnostic and therapeutic applications in the near future.

  3. An optical device capable of providing a structural color, and a corresponding method of manufacturing such a device

    DEFF Research Database (Denmark)

    2014-01-01

    ) with respect to the average surface positions. The position, size, and randomness of the protrusions are arranged so as to provide, at least up to a maximum angle of incidence (A_in) with respect to a normal to the surface, an angle-independent substantially homogeneous structural color perception for a normal...

  4. Exploring local knowledge and perceptions on zoonoses among pastoralists in northern and eastern Tanzania.

    Science.gov (United States)

    Mangesho, Peter Ernest; Neselle, Moses Ole; Karimuribo, Esron D; Mlangwa, James E; Queenan, Kevin; Mboera, Leonard E G; Rushton, Jonathan; Kock, Richard; Häsler, Barbara; Kiwara, Angwara; Rweyemamu, Mark

    2017-02-01

    Zoonoses account for the most commonly reported emerging and re-emerging infectious diseases in Sub-Saharan Africa. However, there is limited knowledge on how pastoral communities perceive zoonoses in relation to their livelihoods, culture and their wider ecology. This study was carried out to explore local knowledge and perceptions on zoonoses among pastoralists in Tanzania. This study involved pastoralists in Ngorongoro district in northern Tanzania and Kibaha and Bagamoyo districts in eastern Tanzania. Qualitative methods of focus group discussions, participatory epidemiology and interviews were used. A total of 223 people were involved in the study. Among the pastoralists, there was no specific term in their local language that describes zoonosis. Pastoralists from northern Tanzania possessed a higher understanding on the existence of a number of zoonoses than their eastern districts' counterparts. Understanding of zoonoses could be categorized into two broad groups: a local syndromic framework, whereby specific symptoms of a particular illness in humans concurred with symptoms in animals, and the biomedical framework, where a case definition is supported by diagnostic tests. Some pastoralists understand the possibility of some infections that could cross over to humans from animals but harm from these are generally tolerated and are not considered as threats. A number of social and cultural practices aimed at maintaining specific cultural functions including social cohesion and rites of passage involve animal products, which present zoonotic risk. These findings show how zoonoses are locally understood, and how epidemiology and biomedicine are shaping pastoralists perceptions to zoonoses. Evidence is needed to understand better the true burden and impact of zoonoses in these communities. More studies are needed that seek to clarify the common understanding of zoonoses that could be used to guide effective and locally relevant interventions. Such studies should

  5. Exploring local knowledge and perceptions on zoonoses among pastoralists in northern and eastern Tanzania.

    Directory of Open Access Journals (Sweden)

    Peter Ernest Mangesho

    2017-02-01

    Full Text Available Zoonoses account for the most commonly reported emerging and re-emerging infectious diseases in Sub-Saharan Africa. However, there is limited knowledge on how pastoral communities perceive zoonoses in relation to their livelihoods, culture and their wider ecology. This study was carried out to explore local knowledge and perceptions on zoonoses among pastoralists in Tanzania.This study involved pastoralists in Ngorongoro district in northern Tanzania and Kibaha and Bagamoyo districts in eastern Tanzania. Qualitative methods of focus group discussions, participatory epidemiology and interviews were used. A total of 223 people were involved in the study. Among the pastoralists, there was no specific term in their local language that describes zoonosis. Pastoralists from northern Tanzania possessed a higher understanding on the existence of a number of zoonoses than their eastern districts' counterparts. Understanding of zoonoses could be categorized into two broad groups: a local syndromic framework, whereby specific symptoms of a particular illness in humans concurred with symptoms in animals, and the biomedical framework, where a case definition is supported by diagnostic tests. Some pastoralists understand the possibility of some infections that could cross over to humans from animals but harm from these are generally tolerated and are not considered as threats. A number of social and cultural practices aimed at maintaining specific cultural functions including social cohesion and rites of passage involve animal products, which present zoonotic risk.These findings show how zoonoses are locally understood, and how epidemiology and biomedicine are shaping pastoralists perceptions to zoonoses. Evidence is needed to understand better the true burden and impact of zoonoses in these communities. More studies are needed that seek to clarify the common understanding of zoonoses that could be used to guide effective and locally relevant interventions

  6. A Modernized System for Agricultural Monitoring for Food Security in Tanzania

    Science.gov (United States)

    Dempewolf, J.; Nakalembe, C. L.; Becker-Reshef, I.; Justice, C. J.; Tumbo, S.; Mbilinyi, B.; Maurice, S.; Mtalo, M.

    2016-12-01

    Accurate and timely information on agriculture, particularly in many countries dominated by complex smallholder, subsistence agricultural systems is often difficult to obtain or not available. This includes up-to-date information during the growing season on crop type, crop area and crop condition such as developmental stage, damage from pests and diseases, drought or flooding. These data are critical for government decision making on production forecasts, planning for commodity market transactions, food aid delivery, responding to disease outbreaks and for implementing agricultural extension and development efforts. In Tanzania we have been working closely with the National Food Security Division (NFSD) at the Ministry of Agriculture, Livestock and Fisheries (MALF) on designing and implementing an advanced agricultural monitoring system, utilizing satellite remote sensing, smart phone and internet technologies. Together with our local implementing partner, the Sokoine University of Agriculture we trained a large number of agricultural extension agents in different regions of Tanzania to deliver field data in near-realtime. Using our collaborative internet portal (Crop Monitor) the team of analysts compiles pertinent information on current crop and weather conditions from throughout the country in a standardized, consistent manner. Using the portal traditionally collected data are combined with electronically collected field data and MODIS satellite image time series from GLAM East-Africa (Global Agricultural Monitoring System, customized for stakeholders in East Africa). The main outcome of this work has been the compilation of the National Food Security Bulletin for Tanzania with plans for a public release and the intention for it to become the main avenue to dispense current updates and analysis on agriculture in the country. The same information is also a potential contribution to the international Early Warning Crop Monitor, which currently covers Tanzania

  7. Esperanza Window Traps for the collection of anthropophilic blackflies (Diptera: Simuliidae in Uganda and Tanzania.

    Directory of Open Access Journals (Sweden)

    Adam Hendy

    2017-06-01

    Full Text Available There is an increasing need to evaluate the impact of chemotherapeutic and vector-based interventions as onchocerciasis affected countries work towards eliminating the disease. The Esperanza Window Trap (EWT provides a possible alternative to human landing collections (HLCs for the collection of anthropophilic blackflies, yet it is not known whether current designs will prove effective for onchocerciasis vectors throughout sub-Saharan Africa. EWTs were deployed for 41 days in northern Uganda and south eastern Tanzania where different Simulium damnosum sibling species are responsible for disease transmission. The relative efficacy of EWTs and HLCs was compared, and responses of host-seeking blackflies to odour baits, colours, and yeast-produced CO2 were investigated. Blue EWTs baited with CO2 and worn socks collected 42.3% (2,393 of the total S. damnosum s.l. catch in northern Uganda. Numbers were comparable with those collected by HLCs (32.1%, 1,817, and higher than those collected on traps baited with CO2 and BG-Lure (25.6%, 1,446, a synthetic human attractant. Traps performed less well for the collection of S. damnosum s.l. in Tanzania where HLCs (72.5%, 2,432 consistently outperformed both blue (16.8%, 563 and black (10.7%, 360 traps baited with CO2 and worn socks. HLCs (72.3%, 361 also outperformed sock-baited (6.4%, 32 and BG-Lure-baited (21.2%, 106 traps for the collection of anthropophilic Simulium bovis in northern Uganda. Contrasting blackfly distributions were observed on traps in Uganda and Tanzania, indicating differences in behaviour in each area. The success of EWT collections of S. damnosum s.l. in northern Uganda was not replicated in Tanzania, or for the collection of anthropophilic S. bovis. Further research to improve the understanding of behavioural responses of vector sibling species to traps and their attractants should be encouraged.

  8. Esperanza Window Traps for the collection of anthropophilic blackflies (Diptera: Simuliidae) in Uganda and Tanzania.

    Science.gov (United States)

    Hendy, Adam; Sluydts, Vincent; Tushar, Taylor; De Witte, Jacobus; Odonga, Patrick; Loum, Denis; Nyaraga, Michael; Lakwo, Thomson; Dujardin, Jean-Claude; Post, Rory; Kalinga, Akili; Echodu, Richard

    2017-06-01

    There is an increasing need to evaluate the impact of chemotherapeutic and vector-based interventions as onchocerciasis affected countries work towards eliminating the disease. The Esperanza Window Trap (EWT) provides a possible alternative to human landing collections (HLCs) for the collection of anthropophilic blackflies, yet it is not known whether current designs will prove effective for onchocerciasis vectors throughout sub-Saharan Africa. EWTs were deployed for 41 days in northern Uganda and south eastern Tanzania where different Simulium damnosum sibling species are responsible for disease transmission. The relative efficacy of EWTs and HLCs was compared, and responses of host-seeking blackflies to odour baits, colours, and yeast-produced CO2 were investigated. Blue EWTs baited with CO2 and worn socks collected 42.3% (2,393) of the total S. damnosum s.l. catch in northern Uganda. Numbers were comparable with those collected by HLCs (32.1%, 1,817), and higher than those collected on traps baited with CO2 and BG-Lure (25.6%, 1,446), a synthetic human attractant. Traps performed less well for the collection of S. damnosum s.l. in Tanzania where HLCs (72.5%, 2,432) consistently outperformed both blue (16.8%, 563) and black (10.7%, 360) traps baited with CO2 and worn socks. HLCs (72.3%, 361) also outperformed sock-baited (6.4%, 32) and BG-Lure-baited (21.2%, 106) traps for the collection of anthropophilic Simulium bovis in northern Uganda. Contrasting blackfly distributions were observed on traps in Uganda and Tanzania, indicating differences in behaviour in each area. The success of EWT collections of S. damnosum s.l. in northern Uganda was not replicated in Tanzania, or for the collection of anthropophilic S. bovis. Further research to improve the understanding of behavioural responses of vector sibling species to traps and their attractants should be encouraged.

  9. Gender differences in the factors influencing consistent condom use among young people in Tanzania.

    Science.gov (United States)

    Babalola, Stella

    2006-01-01

    AIDS has become a major cause of death in Tanzania and young people represent the most vulnerable group. Recent HIV prevalence data showed that young women are more likely than young men to become infected. This paper examined commonalties and differences in the sociodemographic and ideational predictors of condom use among young men and women in Tanzania. The data derive from a 2004 sample survey among young people aged 15-24 years in five regions of Tanzania. The sample on which the analyses were based included 1,523 single women and 1,200 single men. An ideation framework guided the analyses of the predictors of consistent condom use. Logistic regression was the main analytic method used and separate models were estimated for men and women. The most significant correlates of consistent condom use for men included perceived self-efficacy for correct condom use, discussing condom use with friends, and perceived self-efficacy for using condoms with a long-term partner. Discussing condom use with a sex partner and the perceived self-efficacy to refuse sex if the sex partner refused to use a condom were the most significant predictors for women. One implication of the findings is that for men, effective interventions should emphasize correct condom use know-how and address the issue of negative peer pressure and group norms around condom use. For women, interventions should focus on sexual empowerment.

  10. SU-E-E-03: Developing Solutions to Critical Radiation Oncology Challenges in Tanzania

    International Nuclear Information System (INIS)

    Kenton, O; Dachi, J; Metz, J; Avery, S

    2014-01-01

    Purpose: Develop solutions to critical medical physics challenges in Tanzania. Methods: In September of 2013 we began working with Jumaa Bin Dachi, a Therapy Physicist at the Ocean Road Cancer Institute in Dar es Salaam, Tanzania. We developed a bi-lateral learning partnership over the course of eight qualitative Skype meetings with Jumaa. From these meetings we have ascertained that there is a gap between the installation of new equipment and treating patients. This gap has often been overlooked by international partners attempting to improve radiation therapy access. Relationships with academic institutions abroad can fill these gaps, and lead to sustained care of patients needing radiation. Results: Our efforts are best given in a supporting role to help develop solutions and new technology that can reduce the burden on the Medical Physicist. Solutions may include: training material, support for radiation therapy classes, development of appropriate local protocols, and peer-review on documents being produced. New technology needs to focus around simple and easy field shaping, improved patient imaging systems, and systems for patient set-up. We believe our work can help alleviate some of the burdens faced by this institute. Conclusion: While we are just in the beginning stage of this partnership, we believe there is great potential for success between both parties. We hope that the Ocean Road Cancer Institute will benefit from potential funding and resources by partnering with a High Income Country to develop affordable solutions to clinical problems in Tanzania

  11. SU-E-E-03: Developing Solutions to Critical Radiation Oncology Challenges in Tanzania

    Energy Technology Data Exchange (ETDEWEB)

    Kenton, O [University of Pennsylvania, School of Arts and Sciences, College of Liberal and Professional Studies, Philadelphia, PA (United States); Dachi, J [Ocean Road Cancer Institute, Dar Es Salaam (Tanzania, United Republic of); Metz, J [University of Pennsylvania, Perelman School of Medicine, Department of Radiation Oncology, Philadelphia, PA (United States); Avery, S [University of Pennsylvania, School of Arts and Sciences, College of Liberal and Professional Studies, Philadelphia, PA (United States); University of Pennsylvania, Perelman School of Medicine, Department of Radiation Oncology, Philadelphia, PA (United States)

    2014-06-01

    Purpose: Develop solutions to critical medical physics challenges in Tanzania. Methods: In September of 2013 we began working with Jumaa Bin Dachi, a Therapy Physicist at the Ocean Road Cancer Institute in Dar es Salaam, Tanzania. We developed a bi-lateral learning partnership over the course of eight qualitative Skype meetings with Jumaa. From these meetings we have ascertained that there is a gap between the installation of new equipment and treating patients. This gap has often been overlooked by international partners attempting to improve radiation therapy access. Relationships with academic institutions abroad can fill these gaps, and lead to sustained care of patients needing radiation. Results: Our efforts are best given in a supporting role to help develop solutions and new technology that can reduce the burden on the Medical Physicist. Solutions may include: training material, support for radiation therapy classes, development of appropriate local protocols, and peer-review on documents being produced. New technology needs to focus around simple and easy field shaping, improved patient imaging systems, and systems for patient set-up. We believe our work can help alleviate some of the burdens faced by this institute. Conclusion: While we are just in the beginning stage of this partnership, we believe there is great potential for success between both parties. We hope that the Ocean Road Cancer Institute will benefit from potential funding and resources by partnering with a High Income Country to develop affordable solutions to clinical problems in Tanzania.

  12. The Costs of Climate Change: A Study of Cholera in Tanzania

    Science.gov (United States)

    Trærup, Sara L. M.; Ortiz, Ramon A.; Markandya, Anil

    2011-01-01

    Increased temperatures and changes in rainfall patterns as a result of climate change are widely recognized to entail potentially serious consequences for human health, including an increased risk of diarrheal diseases. This study integrates historical data on temperature and rainfall with the burden of disease from cholera in Tanzania and uses socioeconomic data to control for the impacts of general development on the risk of cholera. The results show a significant relationship between temperature and the incidence of cholera. For a 1 degree Celsius temperature increase the initial relative risk of cholera increases by 15 to 29 percent. Based on the modeling results, we project the number and costs of additional cases of cholera that can be attributed to climate change by 2030 in Tanzania for a 1 and 2 degree increase in temperatures, respectively. The total costs of cholera attributable to climate change are shown to be in the range of 0.32 to 1.4 percent of GDP in Tanzania 2030. The results provide useful insights into national-level estimates of the implications of climate change on the health sector and offer information which can feed into both national and international debates on financing and planning adaptation. PMID:22408580

  13. The Emergence of Hospital Accreditation Programs in East Africa: Lessons from Uganda, Kenya, and Tanzania

    Directory of Open Access Journals (Sweden)

    Jeffrey Lane

    2014-01-01

    Full Text Available The objective of this manuscript was to examine existing hospital accreditation systems in three East African countries (Uganda, Kenya and Tanzania, assess attitudes and opinions of key stakeholders regarding hospital accreditation systems in the region, and identify lessons regarding sustainable and effective implementation of hospital accreditation systems in resource-limited countries. National hospital accreditation systems were found in Kenya and Tanzania. Uganda’s accreditation system, known as Yellow Star, had been suspended. Attitudes and opinions of key stakeholders almost unanimously supported the idea of establishing new national hospital accreditation programs, but opinions differed regarding whether that system should be operated by the government or a private independent organization. Our analysis supports the following lessons regarding accreditation systems in the region: (1 self-funding mechanisms are critical to long-term success; (2 external assessments occurred more frequently in our focus countries than accreditation systems in developed countries; (3 Kenya has established framework for providing financial incentives to highly performing hospitals, but these links need to be strengthened; and (4 automatic accreditation of governmental health facilities in Kenya and Tanzania illustrate the potential hazard of public authorities overseeing accreditation programs.

  14. The Emergence of Hospital Accreditation Programs in East Africa: Lessons from Uganda, Kenya, and Tanzania

    Directory of Open Access Journals (Sweden)

    Jeffrey Lane

    2014-03-01

    Full Text Available The objective of this manuscript was to examine existing hospital accreditation systems in three East African countries (Uganda, Kenya and Tanzania, assess attitudes and opinions of key stakeholders regarding hospital accreditation systems in the region, and identify lessons regarding sustainable and effective implementation of hospital accreditation systems in resource-limited countries. National hospital accreditation systems were found in Kenya and Tanzania. Uganda’s accreditation system, known as Yellow Star, had been suspended. Attitudes and opinions of key stakeholders almost unanimously supported the idea of establishing new national hospital accreditation programs, but opinions differed regarding whether that system should be operated by the government or a private independent organization. Our analysis supports the following lessons regarding accreditation systems in the region: (1 self--‐funding mechanisms are critical to long-term success; (2 external assessments occurred more frequently in our focus countries than accreditation systems in developed countries; (3 Kenya has established framework for providing financial incentives to highly performing hospitals, but these links need to be strengthened; and (4 automatic accreditation of governmental health facilities in Kenya and Tanzania illustrate the potential hazard of public authorities overseeing accreditation programs.

  15. Prevalence of chronic kidney disease in diabetic adult out-patients in Tanzania.

    Science.gov (United States)

    Janmohamed, Mubarakali N; Kalluvya, Samuel E; Mueller, Andreas; Kabangila, Rodrick; Smart, Luke R; Downs, Jennifer A; Peck, Robert N

    2013-08-31

    The number of adults with diabetes mellitus is increasing worldwide, particularly in Asia and Africa. In sub-Saharan Africa, renal complications of diabetes may go unrecognized due to limited diagnostic resources. The prevalence of chronic kidney disease (CKD) among adult diabetics in sub-Saharan Africa has not been well described. This study was conducted at the diabetes mellitus clinic of Bugando Medical Centre in Mwanza, Tanzania. A total 369 consecutive adult diabetic patients were enrolled and interviewed. Each patient provided a urine sample for microalbuminuria and proteinuria and a blood sample for serum creatinine level. Estimated glomerular filtration rate (eGFR) was calculated using the Cockroft-Gault equation. CKD was staged according to the Kidney Disease Improving Global Outcomes system. A total of 309 (83.7%) study participants had CKD; 295 (80.0%) had significant albuminuria and 91 (24.7%) had eGFR patients were aware of their renal disease, and only 5 (1.3%) had a diagnosis of diabetic nephropathy recorded in their file. Older age was significantly associated with CKD in this population [OR 1.03, p = 0.03, 95%CI (1.00-1.05)]. Chronic kidney disease is highly prevalent among adult diabetic outpatients attending our clinic in Tanzania, but is usually undiagnosed. Nearly ¼ of patients had an eGFR low enough to require dose adjustment of diabetic medications. More diagnostic resources are needed for CKD screening among adults in Tanzania in order to slow progression and prevent complications.

  16. The impact of colonialism on health and health services in Tanzania.

    Science.gov (United States)

    Turshen, M

    1977-01-01

    This article is about the problems of malnutrition and disease in a rural area of an underdeveloped country, Tanzania. The particular way in which health problems were conceptualized during the colonial era, the structure of the medical services established, and the effects of health care on the health status and size of the rural population of Songea District in Tanzania are shown in the article to have been determined by the economic, social, and political requirements of German and British colonial rulers rather than by the health needs of the African population. Colonial economic policy emphasized the production of cash crops for export, whether by African peasant farmers or by European plantation owners. To provide workers for the plantations, a system of labor migration was instituted. Songea District became an area that supplied male workers to other parts of the country, with grave consequences to the health and nutrition of the women and children left behind. Domestic food production was neglected by Africans forced to migrate in search of cash to pay taxes and by those enganged in the cultivation of cash crops. Extensive malnutrition and persistent ill health related to poor diet are thus traced directly to capitalist underdevelopment of th Tanzanian economy and the structural distortions of a dependent relationship between Tanzania and the metropolitan power.

  17. Incidence of Induced Abortion and Post-Abortion Care in Tanzania.

    Science.gov (United States)

    Keogh, Sarah C; Kimaro, Godfather; Muganyizi, Projestine; Philbin, Jesse; Kahwa, Amos; Ngadaya, Esther; Bankole, Akinrinola

    2015-01-01

    Tanzania has one of the highest maternal mortality ratios in the world, and unsafe abortion is one of its leading causes. Yet little is known about its incidence. To provide the first ever estimates of the incidence of unsafe abortion in Tanzania, at the national level and for each of the 8 geopolitical zones (7 in Mainland plus Zanzibar). A nationally representative survey of health facilities was conducted to determine the number of induced abortion complications treated in facilities. A survey of experts on abortion was conducted to estimate the likelihood of women experiencing complications and obtaining treatment. These surveys were complemented with population and fertility data to obtain abortion numbers, rates and ratios, using the Abortion Incidence Complications Methodology. In Tanzania, women obtained just over 405,000 induced abortions in 2013, for a national rate of 36 abortions per 1,000 women age 15-49 and a ratio of 21 abortions per 100 live births. For each woman treated in a facility for induced abortion complications, 6 times as many women had an abortion but did not receive care. Abortion rates vary widely by zone, from 10.7 in Zanzibar to 50.7 in the Lake zone. The abortion rate is similar to that of other countries in the region. Variations by zone are explained mainly by differences in fertility and contraceptive prevalence. Measures to reduce the incidence of unsafe abortion and associated maternal mortality include expanding access to post-abortion care and contraceptive services to prevent unintended pregnancies.

  18. An overview of filtration methods that can provide protection from the macrofouling zebra mussel at hydroelectric facilities

    Energy Technology Data Exchange (ETDEWEB)

    Smythe, A.G.; Short, T.M. [Acres International Corp., Amherst, NY (United States)

    1995-12-31

    The non-indigenous freshwater zebra and quagga mussels (Dreissena, spp.) threaten to foul freshwater conduits throughout much of the United States and southern Canada. Initially, many electric facilities within the lower Great Lakes drainage were fouled. More recently, other systems both in and out of the Great Lakes, have been exposed to infested water facilitated by canals and boat traffic and impacted by the mussels. Mussels have clogged conduits and fouled equipment and monitoring sensors in relatively distant regions including the Hudson River, the Mississippi River south to New Orleans, and the Arkansas River into Oklahoma. Chemicals can effectively control the mussels, however, filtration methods promise to be a relatively cost effective, environmentally safe alternative control approach. Information on traditional filtration methods will be presented in this paper along with recent research results for in-line filters.

  19. Minimally Invasive Endourological Techniques may Provide a Novel Method for Relieving Urinary Obstruction due to Ureterosciatic Herniation

    Science.gov (United States)

    Kato, Tomonori; Komiya, Akira; Ikeda, Ryoichi; Nakamura, Takeshi; Akakura, Koichiro

    2015-01-01

    Ureterosciatic herniation, the protrusion of the hernia sac through the sciatic foramen, is an extremely rare cause of ureteral obstruction. We describe a case revealed by severe left back pain in a 72-year-old female. She was referred to our hospital for urological assessment of left hydronephrosis observed by ultrasonography. Intravenous ureterography (IVU) showed findings compatible with a left sciatic ureter, a dilated ureter with a fixed kinking, which is known as the ‘curlicue’ sign. We decided to attempt recovery of the herniated ureter using a retrograde approach. Ureteral stent placement was performed to decompress the dilated upper urinary tract. The ureterosciatic hernia was relieved with the passage of a flexible guide wire and a double-pigtail stent. Three months after ureteral stenting, she refused continuing to have an indwelling stent and the stent was removed. Thereafter, IVU revealed recurrent ureterosciatic hernia; however, there was no hydroureter or hydronephrosis. The patient is currently being under observation for 6 years after stenting and continues to be without hydronephrosis or symptoms. Placement of an internal stent possibly provides the rigidity to the ureter, thereby reducing the hernia and urinary obstruction. In the previous reports, most symptomatic patients have been treated surgically, with conservative therapy reserved for asymptomatic patients. For the patient who is elderly or a poor surgical candidate, retrograde stenting may provide safe reduction and efficacious treatment. This endourological approach provides a minimally invasive means for the management of urinary obstruction caused by ureterosciatic herniation. PMID:25849669

  20. Exploring Foreign Tourists’ Image of Tanzania

    DEFF Research Database (Denmark)

    Nandonde, Felix Adamu

    2015-01-01

    In the last decade, the economy of African continent and Tanzania in particular has witnessed a business boom of the tourism sector. While the sector has continued to grow and become a dependable source of direct and indirect employment to youths in urban and rural areas, the sector has been awas....... Front line employees, various tourist sites and access to services emerged to be strong tourist destination image factors. This implies that the efforts of marketing tourism destination should focus on promoting all the sites the country has.......In the last decade, the economy of African continent and Tanzania in particular has witnessed a business boom of the tourism sector. While the sector has continued to grow and become a dependable source of direct and indirect employment to youths in urban and rural areas, the sector has been awash...... destination after they have completed their tourist visit. This study employs factor analysis technique to explore country destination image. Questionnaires were administered to visitors at some of the tourists’ hotels and Julius Kamabarage Nyerere International Airport (as a major exit point) in the country...

  1. Micronutrient Deficiencies among Breastfeeding Infants in Tanzania

    Directory of Open Access Journals (Sweden)

    Alexandra L. Bellows

    2017-11-01

    Full Text Available Infant mortality accounts for the majority of child deaths in Tanzania, and malnutrition is an important underlying cause. The objectives of this cross-sectional study were to describe the micronutrient status of infants in Tanzania and assess predictors of infant micronutrient deficiency. We analyzed serum vitamin D, vitamin B12, folate, and ferritin levels from 446 infants at two weeks of age, 408 infants at three months of age, and 427 mothers three months post-partum. We used log-Poisson regression to estimate relative risk of being deficient in vitamin D and vitamin B12 for infants in each age group. The prevalence of vitamin D and vitamin B12 deficiency decreased from 60% and 30% at two weeks to 9% and 13% at three months respectively. Yet, the prevalence of insufficiency at three months was 49% for vitamin D and 17% for vitamin B12. Predictors of infant vitamin D deficiency were low birthweight, urban residence, maternal education, and maternal vitamin D status. Maternal vitamin B12 status was the main predictor for infant vitamin B12 deficiency. The majority of infants had sufficient levels of folate or ferritin. Further research is necessary to examine the potential benefits of improving infants’ nutritional status through vitamin D and B12 supplements.

  2. Foot-and-mouth disease virus serotypes detected in Tanzania from 2003 to 2010: Conjectured status and future prospects

    Directory of Open Access Journals (Sweden)

    Christopher J. Kasanga

    2012-06-01

    Full Text Available This study was conducted to investigate the presence of foot-and-mouth disease virus (FMDV in different geographic locations of Tanzania. Epithelial tissues and fluids (n = 364 were collected from cattle exhibiting oral and foot vesicular lesions suggestive of FMD and submitted for routine FMD diagnosis. The analysis of these samples collected during the period of 2002 and 2010 was performed by serotype-specific antigen capture ELISA to determine the presence of FMDV. The results of this study indicated that 167 out of 364 (46.1% of the samples contained FMDV antigen. Of the 167 positive samples, 37 (28.4% were type O, 7 (4.1% type A, 45 (21.9% SAT 1 and 79 (45.6% SAT 2. Two FMDV serotypes (O and SAT 2 were widely distributed throughout Tanzania whilst SAT 1 and A types were only found in the Eastern zone. Our findings suggest that serotypes A, O, SAT 1 and SAT 2 prevail in Tanzania and are associated with the recent FMD outbreaks. The lack of comprehensive animal movement records and inconsistent vaccination programmes make it difficult to determine the exact source of FMD outbreaks or to trace the transmission of the disease over time. Therefore, further collection and analysis of samples from domestic and wild animals are being undertaken to investigate the genetic and antigenic characteristics of the circulating strains, so that a rational method to control FMD in Tanzania and the neighbouring countries can be recommended.

  3. How much time is available for antenatal care consultations? Assessment of the quality of care in rural Tanzania

    Directory of Open Access Journals (Sweden)

    Cousens Simon

    2011-09-01

    Full Text Available Abstract Background Many women in Sub-Saharan African countries do not receive key recommended interventions during routine antenatal care (ANC including information on pregnancy, related complications, and importance of skilled delivery attendance. We undertook a process evaluation of a successful cluster randomized trial testing the effectiveness of birth plans in increasing utilization of skilled delivery and postnatal care in Ngorongoro district, rural Tanzania, to document the time spent by health care providers on providing the recommended components of ANC. Methods The study was conducted in 16 health units (eight units in each arm of the trial. We observed, timed, and audio-recorded ANC consultations to assess the total time providers spent with each woman and the time spent for the delivery of each component of care. T-test statistics were used to compare the total time and time spent for the various components of ANC in the two arms of the trial. We also identified the topics discussed during the counselling and health education sessions, and examined the quality of the provider-woman interaction. Results The mean total duration for initial ANC consultations was 40.1 minutes (range 33-47 in the intervention arm versus 19.9 (range 12-32 in the control arm p Conclusion Although the implementation of birth plans in the intervention health units improved provider-women dialogue on skilled delivery attendance, most recommended topics critical to improving maternal and newborn survival were rarely covered.

  4. Stigma and discrimination on HIV/AIDS in Tanzania | Kisinza ...

    African Journals Online (AJOL)

    Stigma and discrimination on HIV/AIDS in Tanzania. W Kisinza, E MakundI, A Mwisongo, G Mubyazi, SM Magesa, H Malebo, J Mcharo, K Senkoro, P Hiza, K Pallangyo, Y Ipuge, AY Kitua, M Malecela-Lazaro ...

  5. Tanzania Journal of Science - Vol 38, No 1 (2012)

    African Journals Online (AJOL)

    Human-wildlife interaction in Serengeti and Ngorongoro districts of Tanzania: A case study on small mammals · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. FJ Magige, 95-103 ...

  6. Climate Change, Agriculture and Food Security in Tanzania

    DEFF Research Database (Denmark)

    Arndt, Channing; Farmer, William; Strzepek, Kenneth

    2012-01-01

    Due to their reliance on rain-fed agriculture, both as a source of income and consumption, many low-income countries are considered to be the most vulnerable to climate change. Here, we estimate the impact of climate change on food security in Tanzania. Representative climate projections are used...... in calibrated crop models to predict crop yield changes for 110 districts in Tanzania. These results are in turn imposed on a highly disaggregated, recursive dynamic economy-wide model of Tanzania. We find that, relative to a no-climate-change baseline and considering domestic agricultural production...... as the channel of impact, food security in Tanzania appears likely to deteriorate as a consequence of climate change. The analysis points to a high degree of diversity of outcomes (including some favorable outcomes) across climate scenarios, sectors, and regions. Noteworthy differences in impacts across...

  7. Essential Oil of Brachylaena hutchinsii Hutch from Tanzania ...

    African Journals Online (AJOL)

    Quimicas y Naturales,. Universidad Nacional de Rio Cuarto, Argentina. 2 Faculty of Pharmacy, Muhimbili University College of Health Sciences, University of Dar es Salaam,. P. 0. Box 65013, Dar es Salaam. Tanzania. 3 Institute of Traditional ...

  8. All projects related to Tanzania | Page 8 | IDRC - International ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Topic: ECONOMIC REFORM, ECONOMIC LIBERALIZATION, ECONOMIC GROWTH, ECONOMIC BEHAVIOUR, MICROECONOMICS, Poverty alleviation. Region: Tanzania, North of Sahara, South of Sahara. Program: Employment and Growth. Total Funding: CA$ 193,000.00. Poverty and Information and Communication ...

  9. Civic Participation in the Democratisation Process in Tanzania ...

    African Journals Online (AJOL)

    , village and chiefdom levels were prevalent throughout Tanzania even before the advent of colonialism. The scope, size and focus of civic societies have increased and changed over time from being primary agents for social service delivery ...

  10. Tanzania Journal of Health Research - Vol 18, No 3 (2016)

    African Journals Online (AJOL)

    Group A Streptococcus pharyngitis among schoolchildren in Mbulu District, Tanzania · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Fatuma Makuka, Steven Mwakalinga, Hassan Mattaka, Maulilio Kipanyula, Alphaxard Manjurano ...

  11. A new genus and species of Ceratocanthidae from Tanzania ...

    African Journals Online (AJOL)

    Coleoptera: Scarabaeoidea) from the Usambara Mountains (Tanzania), is described. The morphology of the clypeus and mesoepisternum is discussed, also with reference to other Ceratocanthidae. The affinities of the genus are discussed, and ...

  12. Tanzania Journal of Agricultural Sciences - Vol 2, No 1 (1999)

    African Journals Online (AJOL)

    arid parts of Tanzania and their implications on sustainable agriculture · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. JP Moberg, C Szilas, KE Jensen, T Midtgaard ...

  13. Tanzania Journal of Health Research - Vol 8, No 3 (2006)

    African Journals Online (AJOL)

    Urine carcinoembryonic antigen determination in urinary bladder bilharziasis predicts carcinoma in patients with premalignant lesions: Observation of 43 cases ... Participatory involvement of farming communities and public sectors in determining malaria control strategies in Mvomero District, Tanzania · EMAIL FREE FULL ...

  14. Eruption pattern of permanent teeth in Tanzania children and ...

    African Journals Online (AJOL)

    Tanzania Dental Journal. Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue · Archives · Journal Home > Vol 6, No 1 (1996) >. Log in or Register to get access to full text downloads.

  15. Factors associated with child sexual abuse in Tanzania: a qualitative ...

    African Journals Online (AJOL)

    Factors associated with child sexual abuse in Tanzania: a qualitative study. Mangi J. Ezekiel, Felix Kisanga, Idda H. Mosha, Amani Anaeli, Switbert R. Kamazima, Rose Mpembeni, Eustace P. Muhondwa ...

  16. All projects related to tanzania | Page 5 | IDRC - International ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Topic: HEALTH SURVEYS, HEALTH STATISTICS, DATA COLLECTING, INFORMATION TECHNOLOGY, COMPUTERS. Region: Bangladesh, India, Viet Nam, Tanzania, Canada. Program: Foundations for Innovation. Total Funding: CA$ 65,200.00. Free and Open Source Management Information Systems and ...

  17. Forest and woodland cover and change in coastal Tanzania and ...

    African Journals Online (AJOL)

    Inhambane biogeographical region of Tanzania and Kenya from ~1990 to ~2000. A cover and change map was derived from high-resolution satellite imagery from Landsat and supplemental data from aerial overflights, field surveys, and local ...

  18. Pentecostalism and the Encounter with Traditional Religion in Tanzania

    DEFF Research Database (Denmark)

    Lindhardt, Martin

    2017-01-01

    This research article explores how expressions of Pentecostal/Charismatic Christianity in Tanzania have taken shape through a complex entanglement with African traditional religion and traditional healing. On the one hand, Tanzanian Pentecostals/Charismatics conceive of figures associated...

  19. Mosasauroid phylogeny under multiple phylogenetic methods provides new insights on the evolution of aquatic adaptations in the group.

    Directory of Open Access Journals (Sweden)

    Tiago R Simões

    Full Text Available Mosasauroids were a successful lineage of squamate reptiles (lizards and snakes that radiated during the Late Cretaceous (95-66 million years ago. They can be considered one of the few lineages in the evolutionary history of tetrapods to have acquired a fully aquatic lifestyle, similarly to whales, ichthyosaurs and plesiosaurs. Despite a long history of research on this group, their phylogenetic relationships have only been tested so far using traditional (unweighted maximum parsimony. However, hypotheses of mosasauroid relationships and the recently proposed multiple origins of aquatically adapted pelvic and pedal features in this group can be more thoroughly tested by methods that take into account variation in branch lengths and evolutionary rates. In this study, we present the first mosasauroid phylogenetic analysis performed under different analytical methods, including maximum likelihood, Bayesian inference, and implied weighting maximum parsimony. The results indicate a lack of congruence in the topological position of halisaurines and Dallasaurus. Additionally, the genus Prognathodon is paraphyletic under all hypotheses. Interestingly, a number of traditional mosasauroid clades become weakly supported, or unresolved, under Bayesian analyses. The reduced resolutions in some consensus trees create ambiguities concerning the evolution of fully aquatic pelvic/pedal conditions under many analyses. However, when enough resolution was obtained, reversals of the pelvic/pedal conditions were favoured by parsimony and likelihood ancestral state reconstructions instead of independent origins of aquatic features in mosasauroids. It is concluded that most of the observed discrepancies among the results can be associated with different analytical procedures, but also due to limited postcranial data on halisaurines, yaguarasaurines and Dallasaurus.

  20. Mosasauroid phylogeny under multiple phylogenetic methods provides new insights on the evolution of aquatic adaptations in the group

    Science.gov (United States)

    Vernygora, Oksana; Paparella, Ilaria; Jimenez-Huidobro, Paulina; Caldwell, Michael W.

    2017-01-01

    Mosasauroids were a successful lineage of squamate reptiles (lizards and snakes) that radiated during the Late Cretaceous (95–66 million years ago). They can be considered one of the few lineages in the evolutionary history of tetrapods to have acquired a fully aquatic lifestyle, similarly to whales, ichthyosaurs and plesiosaurs. Despite a long history of research on this group, their phylogenetic relationships have only been tested so far using traditional (unweighted) maximum parsimony. However, hypotheses of mosasauroid relationships and the recently proposed multiple origins of aquatically adapted pelvic and pedal features in this group can be more thoroughly tested by methods that take into account variation in branch lengths and evolutionary rates. In this study, we present the first mosasauroid phylogenetic analysis performed under different analytical methods, including maximum likelihood, Bayesian inference, and implied weighting maximum parsimony. The results indicate a lack of congruence in the topological position of halisaurines and Dallasaurus. Additionally, the genus Prognathodon is paraphyletic under all hypotheses. Interestingly, a number of traditional mosasauroid clades become weakly supported, or unresolved, under Bayesian analyses. The reduced resolutions in some consensus trees create ambiguities concerning the evolution of fully aquatic pelvic/pedal conditions under many analyses. However, when enough resolution was obtained, reversals of the pelvic/pedal conditions were favoured by parsimony and likelihood ancestral state reconstructions instead of independent origins of aquatic features in mosasauroids. It is concluded that most of the observed discrepancies among the results can be associated with different analytical procedures, but also due to limited postcranial data on halisaurines, yaguarasaurines and Dallasaurus. PMID:28467456

  1. Maternal and neonatal colonisation of group B streptococcus at Muhimbili National Hospital in Dar es Salaam, Tanzania: prevalence, risk factors and antimicrobial resistance

    Directory of Open Access Journals (Sweden)

    Lyamuya Eligius F

    2009-12-01

    Full Text Available Abstract Background Group B streptococcus (GBS, which asymptomatically colonises the vaginal and rectal areas of women, is the leading cause of septicemia, meningitis and pneumonia in neonates. In Tanzania no studies have been done on GBS colonisation of pregnant women and neonates. This study was conducted in Dar es Salaam, Tanzania to determine the prevalence of GBS colonisation among pregnant women, the neonatal colonisation rate and the antimicrobial susceptibility, thus providing essential information to formulate a policy for treatment and prevention regarding perinatal GBS diseases. Methods This cross sectional study involved 300 pregnant women attending antenatal clinic and their newborns delivered at Muhimbili National Hospital (MNH between October 2008 and March 2009. High vaginal, rectal, nasal, ear and umbilical swabs were cultured on Todd Hewitt Broth and in 5% sheep blood agar followed by identification of isolates using conventional methods and testing for their susceptibility to antimicrobial agents using the Kirby-Bauer method. Results GBS colonisation was confirmed in 23% of pregnant women and 8.9% of neonates. A higher proportion of GBS were isolated from the vagina (12.3% as compared to the rectum (5%. Prolonged duration of labour (>12 hrs was significantly shown to influence GBS colonisation in neonates P Conclusion Our findings seem to suggest that a quarter of pregnant women attending ANC clinic at MNH and approximately 10% of their newborns are colonised with GBS. All isolates were found to be sensitive to vancomycin and ampicillin which seem to be the most effective antibiotics for the time being. However there is a need for continuous antibiotics surveillance of GBS to monitor trend of resistance. The high isolation frequency of GBS among pregnant women suggests routine antenatal screening at 35 to 37 weeks of gestation in order to provide antibiotic prophylaxis to GBS carrier.

  2. Sustainability and Long Term-Tenure: Lion Trophy Hunting in Tanzania.

    Directory of Open Access Journals (Sweden)

    Henry Brink

    Full Text Available It is argued that trophy hunting of large, charismatic mammal species can have considerable conservation benefits but only if undertaken sustainably. Social-ecological theory suggests such sustainability only results from developing governance systems that balance financial and biological requirements. Here we use lion (Panthera leo trophy hunting data from Tanzania to investigate how resource ownership patterns influence hunting revenue and offtake levels. Tanzania contains up to half of the global population of free-ranging lions and is also the main location for lion trophy hunting in Africa. However, there are concerns that current hunting levels are unsustainable. The lion hunting industry in Tanzania is run by the private sector, although the government leases each hunting block to companies, enforces hunting regulation, and allocates them a species-specific annual quota per block. The length of these leases varies and theories surrounding property rights and tenure suggest hunting levels would be less sustainable in blocks experiencing a high turnover of short-term leases. We explored this issue using lion data collected from 1996 to 2008 in the Selous Game Reserve (SGR, the most important trophy hunting destination in Tanzania. We found that blocks in SGR with the highest lion hunting offtake were also those that experienced the steepest declines in trophy offtake. In addition, we found this high hunting offtake and the resultant offtake decline tended to be in blocks under short-term tenure. In contrast, lion hunting levels in blocks under long-term tenure matched more closely the recommended sustainable offtake of 0.92 lions per 1000 km2. However, annual financial returns were higher from blocks under short-term tenure, providing $133 per km2 of government revenue as compared to $62 per km2 from long-term tenure blocks. Our results provide evidence for the importance of property rights in conservation, and support calls for an overhaul

  3. Career development expectations and challenges of midwives in Urban Tanzania: a preliminary study.

    Science.gov (United States)

    Tanaka, Nao; Horiuchi, Shigeko; Shimpuku, Yoko; Leshabari, Sebalda

    2015-01-01

    Approaches to addressing the shortage of midwives are a great need especially in Sub-Saharan Africa including Tanzania. The midwifery shortage in Tanzania consists of two major causes; the first is the shortage of pre-service nursing training and the second is the low rate of retention as it is difficult to sustain midwives' career motivations. Lack of opportunities for career development, is one of the most related problems to keep midwives motivated. Continuing education as an approach to career development can heighten midwives' motivation and cultivate more skilled midwives who can educate other midwives or students and who could raise the status of midwives. Effective continuing education is ongoing, interactive, contextually relevant and based on needs assessment, however there is very limited research that describes Tanzanian midwives perspective of expectations for career development; hence this research is significant for revealing important and meaningful professional desires of midwives in Tanzania. This was a preliminary qualitative study, using snowball sampling to recruit 16 midwives in Tanzania. The researchers used a semi-structured interview including probing questions with both a focus group and several individuals. The data were collected from July to December 2013 and coded into categories and sub-categories. There were 14 midwives in the focus group interview and two midwives in the individual interviews. Through data analysis, four major categories (with subcategories) emerged: (1) motivation for learning (to achieve the MDGs, and to raise reproductive health), (2) knowledge is power (to provide good practice based on knowledge, to be a role model, knowledge gives higher position and courage, and knowledge enables one to approach to the government), (3) there is no end to learning (hunger for learning, and ripple effect). From findings, four major categories plainly showed midwives' desire for learning, however they experienced a number of

  4. Sustainability and Long Term-Tenure: Lion Trophy Hunting in Tanzania.

    Science.gov (United States)

    Brink, Henry; Smith, Robert J; Skinner, Kirsten; Leader-Williams, Nigel

    2016-01-01

    It is argued that trophy hunting of large, charismatic mammal species can have considerable conservation benefits but only if undertaken sustainably. Social-ecological theory suggests such sustainability only results from developing governance systems that balance financial and biological requirements. Here we use lion (Panthera leo) trophy hunting data from Tanzania to investigate how resource ownership patterns influence hunting revenue and offtake levels. Tanzania contains up to half of the global population of free-ranging lions and is also the main location for lion trophy hunting in Africa. However, there are concerns that current hunting levels are unsustainable. The lion hunting industry in Tanzania is run by the private sector, although the government leases each hunting block to companies, enforces hunting regulation, and allocates them a species-specific annual quota per block. The length of these leases varies and theories surrounding property rights and tenure suggest hunting levels would be less sustainable in blocks experiencing a high turnover of short-term leases. We explored this issue using lion data collected from 1996 to 2008 in the Selous Game Reserve (SGR), the most important trophy hunting destination in Tanzania. We found that blocks in SGR with the highest lion hunting offtake were also those that experienced the steepest declines in trophy offtake. In addition, we found this high hunting offtake and the resultant offtake decline tended to be in blocks under short-term tenure. In contrast, lion hunting levels in blocks under long-term tenure matched more closely the recommended sustainable offtake of 0.92 lions per 1000 km2. However, annual financial returns were higher from blocks under short-term tenure, providing $133 per km2 of government revenue as compared to $62 per km2 from long-term tenure blocks. Our results provide evidence for the importance of property rights in conservation, and support calls for an overhaul of the system in

  5. Local Responses to Marine Conservation in Zanzibar, Tanzania

    OpenAIRE

    Levine, A.

    2004-01-01

    Although terrestrial parks and reserves have existed in Tanzania since colonial times, marine protected areas are a much newer endeavor in natural resource conservation. As the importance of marine conservation came to the international forefront in the 1990s, Tanzania experienced a rapid establishment and expansion of marine parks and protected areas. These efforts were crucial to protecting the country’s marine resource base, but they also had significant implications for the lives and fish...

  6. Tanzania Economic Update, October 2012 : Spreading the Wings

    OpenAIRE

    World Bank

    2012-01-01

    Tanzania continues to stand out as a model of sound economic performance in the African continent, with a growth rate of over six per cent in 2011 and 2012, surpassing other regional economies and demonstrating impressive resilience to the global economic crisis. This is the second issue of the Tanzania economic update series. The series aim to engage a broad audience in a discussion of th...

  7. A new method of providing pulsatile flow in a centrifugal pump: assessment of pulsatility using a mock circulatory system.

    Science.gov (United States)

    Herreros, Jesús; Berjano, Enrique J; Sales-Nebot, Laura; Más, Pedro; Calvo, Irene; Mastrobuoni, Stefano; Mercé, Salvador

    2008-06-01

    Previous studies have demonstrated the potential advantages of pulsatile flow as compared with continuous flow. However, to date, physiologic pumps have been technically complex and their application has therefore remained in the experimental field. We have developed a new type of centrifugal pump, which can provide pulsatile as well as continuous flow. The inner wall of a centrifugal pump is pulsed by means of a flexible membrane, which can be accurately controlled by means of either a hydraulic or pneumatic driver. The aim of this study was to assess the hydraulic behavior of the new pump in terms of surplus hemodynamic energy (SHE). We conducted experiments using a mock circulatory system including a membrane oxygenator. No differences were found in the pressure-flow characteristics between the new pump and a conventional centrifugal pump, suggesting that the inclusion of the flexible membrane does not alter hydraulic performance. The value of SHE rose when systolic volume was increased. However, SHE dropped when the percentage of ejection time was reduced and also when the continuous flow (programmed by the centrifugal console) increased. Mean flow matched well with the continuous flow set by the centrifugal console, that is, the pulsatile component of the flow was exclusively controlled by the pulsatile console, and was therefore independent of the continuous flow programmed by the centrifugal console. The pulsatility of the new pump was approximately 25% of that created with a truly pulsatile pump.

  8. Size-specific dose estimate (SSDE) provides a simple method to calculate organ dose for pediatric CT examinations.

    Science.gov (United States)

    Moore, Bria M; Brady, Samuel L; Mirro, Amy E; Kaufman, Robert A

    2014-07-01

    patient size in their dose calculation, and was found to agree in the chest to better than an average of 5% (27.6/26.2) and in the abdominopelvic region to better than 2% (73.4/75.0). For organs fully covered within the scan volume, the average correlation of SSDE and organ absolute dose was found to be better than ± 10%. In addition, this study provides a complete list of organ dose correlation factors (CF(organ)(SSDE)) for the chest and abdominopelvic regions, and describes a simple methodology to estimate individual pediatric patient organ dose based on patient SSDE.

  9. Prospects, achievements, challenges and opportunities for scaling-up malaria chemoprevention in pregnancy in Tanzania: the perspective of national level officers

    DEFF Research Database (Denmark)

    Mubyazi, Godfrey; Bygbjerg, Ib; Magnussen, Pascal

    2008-01-01

    skills of most HWs and their poor motivation. Other problems were unreliable supply of free SP at private clinics, clean and safe water shortage at many government ANC clinics limiting direct observation treatment and occasionally pregnant women asked to pay for ANC services. Finally, supervision......Objectives: To describe the prospects, achievements, challenges and opportunities for implementing intermittent preventive treatment for malaria in pregnancy (IPTp) in Tanzania in light of national antenatal care (ANC) guidelines and ability of service providers to comply with them. Methods: In...... of peripheral health facilities has been inadequate and national guidelines on district budgeting for health services have been inflexible. IPTp coverage is generally low partly because IPTp is not systematically enforced like programmes on immunization, tuberculosis, leprosy and other infectious diseases...

  10. Hospital Epidemiology of Methicillin-Resistant Staphylococcus aureus in a Tertiary Care Hospital in Moshi, Tanzania, as Determined by Whole Genome Sequencing

    DEFF Research Database (Denmark)

    Kumburu, Happiness H.; Sonda, Tolbert; Leekitcharoenphon, Pimlapas

    2018-01-01

    Objective. To determine molecular epidemiology of methicillin-resistant S. aureus in Tanzania using whole genome sequencing. Methods. DNA from 33 Staphylococcus species was recovered from subcultured archived Staphylococcus isolates. Whole genome sequencing was performed on IlluminaMiseq using pa...... in Moshi are highly diverse and epidemiologically unrelated. Temporal phylogenetic analysis provided better resolution on transmission and introduction of MRSA and it may be important to include this in future routines....... paired-end 2x250 bp protocol. Raw sequence data were analyzed using online tools. Results. Full susceptibility to vancomycin and chloramphenicol was observed. Thirteen isolates (43.3%) resisted cefoxitin and other antimicrobials tested. Multilocus sequence typing revealed 13 different sequence types...

  11. Science-based health innovation in Tanzania: bednets and a base for invention

    Directory of Open Access Journals (Sweden)

    Daar Abdallah S

    2010-12-01

    Full Text Available Abstract Background Tanzania is East Africa’s largest country. Although it is socially diverse, it has experienced general political stability since independence in 1964. Despite gradual economic development and Tanzania’s status as one of the biggest recipients of aid in Africa, health status remains poor. This paper explores Tanzania’s science-based health innovation system, and highlights areas which can be strengthened. Methods Qualitative case study research methodology was used. Data were collected through reviews of academic literature and policy documents, and through open-ended, face-to-face interviews with 52 people from across the science-based health innovation system over two visits to Tanzania from July to October 2007. Results and discussion Tanzania has a rich but complex S&T governance landscape, with the public sector driving the innovation agenda through a series of different bodies which are not well-coordinated. It has some of the leading health research on the continent at the University of Dar es Salaam, Muhimbili University of Health and Applied Sciences, the National Institute for Medical Research and the Ifakara Medical Institute, with strong donor support. Tanzania has found developing an entrepreneurial culture difficult; nevertheless projects such as the clusters initiative at the University of Dar es Salaam are encouraging low-tech innovation and overcoming knowledge-sharing barriers. In the private sector, one generics company has developed a South-South collaboration to enable technology transfer and hence the local production of anti-retrovirals. Local textile company A to Z Textiles is now manufacturing 30 million insecticide impregnated bednets a year. Conclusions To have a coherent vision for innovation, Tanzania may wish to address some key issues: coordination across stakeholders involved with health research, increasing graduates in health-related disciplines, and building capabilities in biological

  12. An early warning system for IPM-based rodent control in smallholder farming systems in Tanzania

    DEFF Research Database (Denmark)

    Mwanjabe, Patrick S.; Leirs, Herwig

    1997-01-01

    We conducted a four-year study in Tanzania to test a method for predicting outbreaks of Mastomys natalensis rats and verify whether such method, based on rainfall variability, could be used in an integrated Pest Management strategy for rodent control. Temporal fluctuations in rodent numbers...... that the effects of a single control action undertaken at planting time do not persist long enough to protect seedlings, probably due to quick reinvasion of the treated fields by rodents from the surroundings. These observations are formulated into a rodent control package whose steps are to predict rodent...... outbreaks, to warn farmers and the government of the outbreaks, and to organise control measures in advance....

  13. Nutritional composition and micronutrient status of home made and commercial weaning foods consumed in Tanzania.

    Science.gov (United States)

    Mosha TCE; Laswai, H S; Tetens, I

    2000-01-01

    About 50% of young children in Tanzania suffer from protein-energy undernutrition (PEU) while more than 45% of children under the age of five suffer from various micronutrient deficiency disorders. The immediate cause of these conditions is inadequate intake and poor utilization of nutrients, which begins in the weaning period and amplifies in the subsequent years. This study was conducted to assess the potential of some home made and commercial weaning foods commonly consumed in Tanzania to supply adequate amounts of both macro- and micronutrients as recommended in the Tanzania and FAO/WHO Codex Alimentarius Standards for cereal/milk-based weaning foods. Six types of home made weaning foods, maize, cassava, millet, sorghum and millet-sardine-peanut composite gruels and plantain pap, and four types of commercial weaning foods, Cerelac- 1, Cerelac-2, Lactogen-1 and Lactogen-2, popularly consumed in Tanzania, were chemically assayed for proximate composition, energy and mineral density. Results of the study indicated that, both the home made and commercial weaning foods were good sources of macro- and micronutrients. When compared with the Codex Alimentarius and Tanzania Bureau of Standards specifications for weaning foods, both home made and commercial weaning foods had some shortcomings in terms of nutrient composition and energy balance. Many of the foods were low in fat. Fe, Ca, Zn and P but high in crude fiber, carbohydrate and magnesium. Ca, Fe and Zn were the most common deficient macro/micronutrients in the home made weaning foods. In spite of these shortcomings, most of the home made and commercial weaning foods were nutritionally sound since they could provide reasonable percentages of the recommended daily allowances for macro/micronutrients and energy. It is suggested that, more efforts must be directed towards increasing the concentration of Ca, Fe and Zn in the home made weaning foods through supplementation of the starchy staples with mineral rich

  14. Helping Babies Breathe implementation in Zanzibar, Tanzania.

    Science.gov (United States)

    Wilson, Gina Marie; Ame, Ame Masemo; Khatib, Maimuna Mohamed; Rende, Elizabeth K; Hartman, Ann Michelle; Blood-Siegfried, Jane

    2017-08-01

    To assess the efficacy and feasibility of implementing Helping Babies Breathe, a neonatal resuscitation programme for resource-limited environments. This quality improvement project focused on training midwives on Helping Babies Breathe to address high rates of neonatal mortality secondary to birth asphyxia. The convenience sample was 33 midwives in Zanzibar, Tanzania. The train-the-trainer strategy with repeated measures design was used to assess knowledge and skills at 3 time points. Observations were completed during "real-time" deliveries, and a focused interview generated feedback regarding satisfaction and sustainability. Knowledge scores and resuscitation skills significantly improved and were sustained, P < .05. Of the 62 birth observations, 19% needed intervention. All were appropriately resuscitated and survived. Results indicate that participants retained knowledge and skills and used them in clinical practice. Observations demonstrated that participants took appropriate actions when presented with a baby who was not breathing. © 2017 John Wiley & Sons Australia, Ltd.

  15. Coping with Rainfall Variability in Northern Tanzania

    DEFF Research Database (Denmark)

    Trærup, Sara Lærke Meltofte

    2012-01-01

    This paper explores a potential relationship between rainfall data and household self-reported harvest shocks and local (spatial) variability of harvest shocks and coping strategies based on a survey of 2700 rural households in the Kagera region of northern Tanzania. In addition, correlations...... of household reported harvest shocks differs significantly between districts and correspond to the observed variability in local climate patterns. Coping strategies are focused on spreading risks and include reduced consumption, casual employment, new crops, external support and the selling of assets....... There are no large differences in applied coping strategies across the region, but district-level data demonstrate how local strategies differ between localities within the districts. The results emphasize that in order to target rural policies and make them efficient, it is important to take into account the local...

  16. Plague and the Human Flea, Tanzania

    DEFF Research Database (Denmark)

    Laudisoit, Anne; Leirs, Herwig; Makundi, Rhodes H

    2007-01-01

    Domestic fleas were collected in 12 villages in the western Usambara Mountains in Tanzania. Of these, 7 are considered villages with high plague frequency, where human plague was recorded during at least 6 of the 17 plague seasons between 1986 and 2004. In the remaining 5 villages with low plague...... frequency, plague was either rare or unrecorded. Pulex irritans, known as the human flea, was the predominant flea species (72.4%) in houses. The density of P. irritans, but not of other domestic fleas, was significantly higher in villages with a higher plague frequency or incidence. Moreover, the P....... irritans index was strongly positively correlated with plague frequency and with the logarithmically transformed plague incidence. These observations suggest that in Lushoto District human fleas may play a role in plague epidemiology. These findings are of immediate public health relevance because...

  17. Waiting for attention and care: birthing accounts of women in rural Tanzania who developed obstetric fistula as an outcome of labour

    Science.gov (United States)

    2011-01-01

    Background Obstetric fistula is a physically and socially disabling obstetric complication that affects about 3,000 women in Tanzania every year. The fistula, an opening that forms between the vagina and the bladder and/or the rectum, is most frequently caused by unattended prolonged labour, often associated with delays in seeking and receiving appropriate and adequate birth care. Using the availability, accessibility, acceptability and quality of care (AAAQ) concept and the three delays model, this article provides empirical knowledge on birth care experiences of women who developed fistula after prolonged labour. Methods We used a mixed methods approach to explore the birthing experiences of women affected by fistula and the barriers to access adequate care during labour and delivery. Sixteen women were interviewed for the qualitative study and 151 women were included in the quantitative survey. All women were interviewed at the Comprehensive Community Based Rehabilitation Tanzania in Dar es Salaam and Bugando Medical Centre in Mwanza. Results Women experienced delays both before and after arriving at a health facility. Decisions on where to seek care were most often taken by husbands and mothers-in-law (60%). Access to health facilities providing emergency obstetric care was inadequate and transport was a major obstacle. About 20% reported that they had walked or were carried to the health facility. More than 50% had reported to a health facility after two or more days of labour at home. After arrival at a health facility women experienced lack of supportive care, neglect, poor assessment of labour and lack of supervision. Their birth accounts suggest unskilled birth care and poor referral routines. Conclusions This study reveals major gaps in access to and provision of emergency obstetric care. It illustrates how poor quality of care at health facilities contributes to delays that lead to severe birth injuries, highlighting the need to ensure women's rights to

  18. Safety Assessment Of The Centralized Storage Facility For Disused Sealed Radioactive Sources In United Republic Of Tanzania

    Energy Technology Data Exchange (ETDEWEB)

    Abel, Vitus [Korea Advanced Institute of Science and Technology, Daejeon (Korea, Republic of); Lee, JaeSeong [Korea Institute of Nuclear Safety, Daejeon (Korea, Republic of)

    2014-10-15

    SRS are no longer in use, they are declared as disused, and they are transferred to the central radioactive management facility (CRMF) belonging to Tanzania Atomic Energy Commission (regulatory body) and managed as radioactive waste. In order to reduce the risk associated with disused sealed radioactive sources (DSRS), the first priority would be to bring them to appropriate controls under the regulatory body. When DSRS are safely managed, regulatory body need to make assessment of the likelihood and potential impact of incidents, accidents and hazards for proper management plan. The paper applies Analytical Hierarchy Process (AHP) for assessing and allocating weights and priorities for solving the problem of mult criteria consideration for management plan. Using pairwise comparisons, the relative importance of one criterion over another can be expressed. The method allows decision makers to provide judgments about the relative importance of each criterion and to estimate radiological risk by using expert's judgments or probability of occurrence. AHP is the step by step manner where the resulting priorities are shown and the possible inconsistencies are determined. The Information provided by experts helps to rank hazards according to probability of occurrence, potential impact and mitigation cost. The strength of the AHP method lies in its ability to incorporate both qualitative and quantitative data in decision making. AHP present a powerful tool for weighting and prioritizing hazards in terms of occurrence probability. However, AHP also has some weak points. AHP requires data based on experience, knowledge and judgment which are subjective for each decision-maker.

  19. Struggles over patriarchal structural adjustment in Tanzania.

    Science.gov (United States)

    Mbilinyi, M

    1993-10-01

    Within the space of 7 years (1986-93), structural adjustment policies have contributed to a reversal of the gains in economic development achieved in Tanzania in the 1960s and 1970s. Structural adjustment policies have helped large-scale producers and ordinary citizens but have led to a decline in social services which is reflected in drops in primary school enrollment and increases in medical costs. Government revenues are absorbed by foreign debt servicing. The reduction of support for social services has increased women's work; bolstered gender division of labor; and reduced women's access to education, formal employment, and health services. On the other hand, increased participation in market-oriented activities has increased women's mobility and exposure to modern ideas. This has led to changing gender relations which on the positive side can lead to shared decision-making but on the negative side may cause men to abdicate their familial responsibilities. Women suffer, however, from a lack of investment in ways to lighten their household responsibilities and have lost their ability to control food production because of the shift to cash crop production for export. The combination of hard work, low income, and stress has taken a toll on women's health, and both the maternal mortality rate and incidence of HIV infections among teenage girls has increased. In response to this situation, Tanzanian women have formed the Tanzania Gender Networking Programme (TGNP) which seeks to empower women and transform society through such activities as education and training, research, and lobbying and networking. Workshops sponsored by the TGNP have resulted in recommendations for adoption of a people-centered development strategy.

  20. A study of the super-abundant Bemisia tabaci (Gennadius) species complex (Hemiptera: Aleyrodidae) in cassava Mosaic disease pandemic areas in Tanzania

    DEFF Research Database (Denmark)

    Tajebe, Lensa Sefera

    and forcing some farmers to abandon the cultivation of the crop. The severe CMD pandemic is mainly characterized by high severity and incidence of the disease dominated by whitefly-borne infection and super-abundant populations of B. tabaci. All Bemisia tabaci individuals harbour a primary bacterial symbiont...... with the pandemic; (ii) to establish the prevalence of endosymbionts among B. tabaci populations on cassava and nearby plants, to assess if there is a unique  endosymbiont that is associated with super-abundant whitefly populations and to provide baseline information on endosymbionts of whiteflies for Tanzania......; and (iii) to investigate the population structure of and the possibilities of gene flow between B. tabaci populations found in CMD pandemic affected and not yet affected parts of Tanzania. Hence, several field surveys were conducted in CMD pandemic-affected and unaffected areas in Tanzania and whiteflies...

  1. Sickle cell disease in Africa: an overview of the integrated approach to health, research, education and advocacy in Tanzania, 2004-2016.

    Science.gov (United States)

    Tluway, Furahini; Makani, Julie

    2017-06-01

    Sickle cell disease (SCD) is the single most important genetic cause of childhood mortality globally. Tanzania has one of the highest annual births of SCD individuals in the world, estimated to reach 11 000 births a year. Without intervention, 50-90% of children will die in childhood. However, cost-effective interventions have the potential to reduce childhood mortality by up to 70%. The effects of SCD are multi-dimensional, ranging from causing high morbidity and mortality, and reducing the quality of life, to imposing a high socio-economic burden on individuals, families and health systems. In the past 12 years, the SCD programme in Tanzania has developed, with local and global partnerships, a systematic framework for comprehensive research that is integrated into providing healthcare, training and advocacy in SCD. This report outlines the approach and achievements of collective initiatives for management and control of SCD in Tanzania. © 2017 John Wiley & Sons Ltd.

  2. testing a consensus conference method by discussing

    African Journals Online (AJOL)

    hi-tech

    2000-10-10

    Oct 10, 2000 ... TESTING A CONSENSUS CONFERENCE METHOD BY DISCUSSING THE MANAGEMENT OF TRAUMATIC DENTAL INJURIES IN TANZANIA ... treatment modalities of traumatic dental injuries recommended in western countries in the. Tanzanian situation. ..... fractured crown, leave alone a fractured.

  3. Perceptions of methicillin-resistant Staphylococcus aureus and hand hygiene provider training and patient education: results of a mixed method study of health care providers in Department of Veterans Affairs spinal cord injury and disorder units.

    Science.gov (United States)

    Hill, Jennifer N; Hogan, Timothy P; Cameron, Kenzie A; Guihan, Marylou; Goldstein, Barry; Evans, Martin E; Evans, Charlesnika T

    2014-08-01

    The goal of this study was to assess current practices for training of spinal cord injury and disorder (SCI/D) health care workers and education of veterans with SCI/D in Department of Veterans Affairs (VA) spinal cord injury (SCI) centers on methicillin-resistant Staphylococcus aureus (MRSA) prevention. Mixed methods. A Web-based survey was distributed to 673 VA SCI/D providers across 24 SCI centers; 21 acute care and 1 long-term care facility participated. There were 295 that responded, 228 had complete data and were included in this analysis. Semistructured interviews were conducted with 30 SCI/D providers across 9 SCI centers. Nurses, physicians, and therapists represent most respondents (92.1%, n = 210); over half (56.6%, n = 129) were nurses. Of providers, 75.9% (n = 173) reported receiving excellent or good training on how to educate patients about MRSA. However, nurses were more likely to report having excellent or good training for how to educate patients about MRSA (P = .005). Despite this, only 63.6% (n = 82) of nurses perceived the education they provide patients on how MRSA is transmitted as excellent or good. Despite health care workers reporting receiving excellent or good training on MRSA-related topics, this did not translate to excellent or good education for patients, suggesting that health care workers need additional training for educating patients. Population-specific MRSA prevention educational materials may also assist providers in educating patients about MRSA prevention for individuals with SCI/D. Published by Mosby, Inc.

  4. Care-seeking patterns for fatal malaria in Tanzania.

    Science.gov (United States)

    de Savigny, Don; Mayombana, Charles; Mwageni, Eleuther; Masanja, Honorati; Minhaj, Abdulatif; Mkilindi, Yahya; Mbuya, Conrad; Kasale, Harun; Reid, Graham

    2004-07-28

    Once malaria occurs, deaths can be prevented by prompt treatment with relatively affordable and efficacious drugs. Yet this goal is elusive in Africa. The paradox of a continuing but easily preventable cause of high mortality raises important questions for policy makers concerning care-seeking and access to health systems. Although patterns of care-seeking during uncomplicated malaria episodes are well known, studies in cases of fatal malaria are rare. Care-seeking behaviours may differ between these groups. This study documents care-seeking events in 320 children less than five years of age with fatal malaria seen between 1999 and 2001 during over 240,000 person-years of follow-up in a stable perennial malaria transmission setting in southern Tanzania. Accounts of care-seeking recorded in verbal autopsy histories were analysed to determine providers attended and the sequence of choices made as the patients' condition deteriorated. As first resort to care, 78.7% of malaria-attributable deaths used modern biomedical care in the form of antimalarial pharmaceuticals from shops or government or non-governmental heath facilities, 9.4% used initial traditional care at home or from traditional practitioners and 11.9% sought no care of any kind. There were no differences in patterns of choice by sex of the child, sex of the head of the household, socioeconomic status of the household or presence or absence of convulsions. In malaria deaths of all ages who sought care more than once, modern care was included in the first or second resort to care in 90.0% and 99.4% with and without convulsions respectively. In this study of fatal malaria in southern Tanzania, biomedical care is the preferred choice of an overwhelming majority of suspected malaria cases, even those complicated by convulsions. Traditional care is no longer a significant delaying factor. To reduce mortality further will require greater emphasis on recognizing danger signs at home, prompter care

  5. Does size matter? An investigation of habitat use across a carnivore assemblage in the Serengeti, Tanzania.

    Science.gov (United States)

    Durant, Sarah M; Craft, Meggan E; Foley, Charles; Hampson, Katie; Lobora, Alex L; Msuha, Maurus; Eblate, Ernest; Bukombe, John; McHetto, John; Pettorelli, Nathalie

    2010-09-01

    1. This study utilizes a unique data set covering over 19 000 georeferenced records of species presence collected between 1993 and 2008, to explore the distribution and habitat selectivity of an assemblage of 26 carnivore species in the Serengeti-Ngorongoro landscape in northern Tanzania. 2. Two species, the large-spotted genet and the bushy-tailed mongoose, were documented for the first time within this landscape. Ecological Niche Factor Analysis (ENFA) was used to examine habitat selectivity for 18 of the 26 carnivore species for which there is sufficient data. Eleven ecogeographical variables (EGVs), such as altitude and habitat type, were used for these analyses. 3. The ENFA demonstrated that species differed in their habitat selectivity, and supported the limited ecological information already available for these species, such as the golden jackals' preference for grassland and the leopards' preference for river valleys. 4. Two aggregate scores, marginality and tolerance, are generated by the ENFA, and describe each species' habitat selectivity in relation to the suite of EGVs. These scores were used to test the hypothesis that smaller species are expected to be more selective than larger species [Science, 1989, 243, 1145]. Two predictions were tested: Marginality should decrease with body mass; and tolerance should increase with body mass. Our study provided no evidence for either prediction. 5. Our results not only support previous analyses of carnivore diet breadth, but also represent a novel approach to the investigation of habitat selection across species assemblages. Our method provides a powerful tool to explore similar questions in other systems and for other taxa.

  6. Women's determinant factors for preferred place of delivery in Dodoma region Tanzania: a cross sectional study.

    Science.gov (United States)

    Ngowi, Agatha Fabian; Kamazima, Switbert R; Kibusi, Steven; Gesase, Ainory; Bali, Theodora

    2017-09-06

    Skilled birth attendance is one of the key factors in improving maternal health but less than 50% of women in sub-Saharan African countries do not have the opportunity to be attended to by skilled personnel during childbirth. The aim of the study was to assess the factors determining women's preference for a place to give birth in Dodoma Region, Tanzania. This study employed a cross-sectional survey design using quantitative data collection and analysis methods. Data were collected using structured questionnaire administered to 800 women obtained through multistage random sampling. Multivariable logistic regression model was applied to determine the predictors of place of delivery. More than three quarters 629(78.6%) respondents had their last delivery in the health facilities while 171(21.4%) had their last delivery at home/on the way to hospital. Reasons for delivering at home include: abrupt occurrence of labour pain, long distance to the health facilities, lack of money to pay for transport and unfriendly experience with the health care providers. Simple logistic regression model indicate that mothers' education level, number of children, cost of transport the estimated distance to the nearby health facility and occupation were strong predictors of the preferred place of delivery. However, after controlling the potential confounder, the multivariable logistic regression model demonstrated a significant association between delivery at the health facility and the number of children and transport cost. Our findings suggest a need for health care providers to enhance health education to women and their spouses about birth preparedness and the importance of delivering at the health facility. There is also a need for the government to increase the number of health facilities including maternity waiting homes and well trained health workers in both rural and urban areas.

  7. The Art and Skill of Delivering Culturally Responsive TF-CBT in Tanzania and Kenya

    Science.gov (United States)

    Kava, Christine M.; Akiba, Christopher F.; Lucid, Leah; Dorsey, Shannon

    2016-01-01

    Objective This study explored the facilitators, barriers, and strategies used to deliver a child mental health evidence-based treatment (EBT), trauma-focused cognitive behavioral therapy (TF-CBT), in a culturally responsive manner. In low- and middle-income countries most individuals with mental health problems do not receive treatment due to a shortage of mental health professionals. One approach to addressing this problem is task-sharing, in which lay counselors are trained to deliver mental health treatment. Combining this approach with a focus on EBT provides a strategy for bridging the mental health treatment gap. However, little is known how about western-developed EBTs are delivered in a culturally responsive manner. Method Semistructured qualitative interviews were conducted with 12 TF-CBT lay counselors involved in a large randomized controlled trial of TF-CBT in Kenya and Tanzania. An inductive approach was used to analyze the data. Results Lay counselors described the importance of being responsive to TF-CBT participants’ customs, beliefs, and socioeconomic conditions and highlighted the value of TF-CBT for their community. They also discussed the importance of partnering with other organizations to address unmet socioeconomic needs. Conclusion The findings from this study provide support for the acceptability and appropriateness of TF-CBT as a treatment approach for improving child mental health. Having a better understanding of the strategies used by lay counselors to ensure that treatment is relevant to the cultural and socioeconomic context of participants can help to inform the implementation of future EBTs. PMID:27414470

  8. Factors for change in maternal and perinatal audit systems in Dar es Salaam hospitals, Tanzania

    Directory of Open Access Journals (Sweden)

    Kisanga Felix

    2010-06-01

    Full Text Available Abstract Background Effective maternal and perinatal audits are associated with improved quality of care and reduction of severe adverse outcome. Although audits at the level of care were formally introduced in Tanzania around 25 years ago, little information is available about their existence, performance, and practical barriers to their implementation. This study assessed the structure, process and impacts of maternal and perinatal death audit systems in clinical practice and presents a detailed account on how they could be improved. Methods A cross sectional descriptive study was conducted in eight major hospitals in Dar es Salaam in January 2009. An in-depth interview guide was used for 29 health managers and members of the audit committees to investigate the existence, structure, process and outcome of such audits in clinical practice. A semi-structured questionnaire was used to interview 30 health care providers in the maternity wards to assess their awareness, attitude and practice towards audit systems. The 2007 institutional pregnancy outcome records were reviewed. Results Overall hospital based maternal mortality ratio was 218/100,000 live births (range: 0 - 385 and perinatal mortality rate was 44/1000 births (range: 17 - 147. Maternal and perinatal audit systems existed only in 4 and 3 hospitals respectively, and key decision makers did not take part in audit committees. Sixty percent of care providers were not aware of even a single action which had ever been implemented in their hospitals because of audit recommendations. There were neither records of the key decision points, action plan, nor regular analysis of the audit reports in any of the facilities where such audit systems existed. Conclusions Maternal and perinatal audit systems in these institutions are poorly established in structure and process; and are less effective to improve the quality of care. Fundamental changes are urgently needed for successful audit systems in

  9. Medicare Provider Data - Hospice Providers

    Data.gov (United States)

    U.S. Department of Health & Human Services — The Hospice Utilization and Payment Public Use File provides information on services provided to Medicare beneficiaries by hospice providers. The Hospice PUF...

  10. Review of short-term demand forecasting methods and selection of ...

    African Journals Online (AJOL)

    Review of short-term demand forecasting methods and selection of the appropriate model for softwood sawmills in Tanzania. ... Tanzania Journal of Forestry and Nature Conservation. Journal Home ... This paper reviewed and tested forecasting methods for use-appropriateness in forecasting lumber demands in the sawmill

  11. Table of contents, structure and methodical providing of preparation of future trainers-teachers to development of professional presentations of educational material

    Directory of Open Access Journals (Sweden)

    Svatyev А.V.

    2012-03-01

    Full Text Available In the article maintenance, structure and methodical providing of preparation of future trainers-teachers to development of professional presentations of educational material is analysed. The authors approach near lining up the stages of work with students in relation to the input of information technologies in an educational process is offered. The variants of combination of the program of studies and methodical providing of scientific process of future specialists are thoroughly considered. 100 respondents-students of 4 and 5 courses of physical education department were polled. A term "presentation" is exposed, it kinds are certain and classification of presentations is offered. Modern technologies of development of presentation are analysed.

  12. Taxonomy of Late Jurassic diplodocid sauropods from Tendaguru (Tanzania

    Directory of Open Access Journals (Sweden)

    K. Remes

    2009-02-01

    Full Text Available The Late Jurassic (Tithonian Tendaguru Beds of Tanzania yielded one of the richest sauropod faunas known, including the diplodocines Tornieria africana (Fraas, 1908 and Australodocus bohetii Remes, 2007, the only known representatives of their group on the southern continents. Historically, the holotypes and referred material of both taxa plus dozens of additional specimens had been subsumed under the term "Barosaurus africanus" (Fraas, 1908. Here, the taxonomic status of the referred elements is reviewed by evaluating the phylogenetic information content of their anatomical characters, in order to provide a firm footing for further studies (e.g. of morphometrics, histology, and phylogeny of the Tendaguru sauropods. Some of the material shows diplodocine synapomorphies and may belong to either Tornieria or Australodocus, while other specimens are diagnostic only on higher taxonomic levels (Diplodocidae, Flagellicaudata, or Diplodocoidea indet.. The isolated limb elements in most cases lack phylogenetically diagnostic characters. Generally, the "Barosaurus africanus" sample shows a substantial grade of morphological variation, and it cannot be ruled out that there are more flagellicaudatans represented in the Tendaguru material than the diplodocines and dicraeosaurids already known. doi:10.1002/mmng.200800008

  13. Human and animal Campylobacteriosis in Tanzania: A review.

    Science.gov (United States)

    Komba, Erick V G; Mdegela, Robinson H; Msoffe, Peter L M; Ingmer, Hanne

    2013-01-01

    The thermotolerant species of Campylobacter have become very important in public health, particularly as agents of infectious diarrhoea in human beings. Though the mechanism by which they cause disease is yet to be fully explained, they have been recognized as the leading cause of bacterial enteritis in both developed and developing countries. The organisms colonize different animal species without causing any symptoms of disease; and humans acquire infections through contact with or consumption of contaminated meat especially raw/undercooked poultry meat. The growing trend of antibiotic resistant Campylobacter isolates continues to pose significant public health challenges. In this review we present the available information generated in Tanzania about Campylobacter infections in humans and animals. We conducted a structured literature search of PUBMED and ScienceDirect electronic databases and identified 15 articles. Studies on humans reported Campylobacter infections in both symptomatic and asymptomatic subjects; with higher prevalence in children under the age of five years. Studies on animals found colonization of both domestic and wild species. Among isolates, some demonstrated antimicrobial resistance. The available information for both human and animal Campylobacteriosis in the country is sparse. It however provides an insight of the bacteriological and epidemiological aspects of Campylobacter infections in the country and eventually creates more awareness on the need to develop control strategies. Since the organism is zoonotic its control strategies should adopt the "One Health" approach involving collaborative efforts from veterinary and human medicine.

  14. Local production of pharmaceuticals in Africa and access to essential medicines: 'urban bias’ in access to imported medicines in Tanzania and its policy implications

    Science.gov (United States)

    2014-01-01

    Background International policy towards access to essential medicines in Africa has focused until recently on international procurement of large volumes of medicines, mainly from Indian manufacturers, and their import and distribution. This emphasis is now being challenged by renewed policy interest in the potential benefits of local pharmaceutical production and supply. However, there is a shortage of evidence on the role of locally produced medicines in African markets, and on potential benefits of local production for access to medicines. This article contributes to filling that gap. Methods This article uses WHO/HAI data from Tanzania for 2006 and 2009 on prices and sources of a set of tracer essential medicines. It employs innovative graphical methods of analysis alongside conventional statistical testing. Results Medicines produced in Tanzania were equally likely to be found in rural and in urban areas. Imported medicines, especially those imported from countries other than Kenya (mainly from India) displayed 'urban bias’: that is, they were significantly more likely to be available in urban than in rural areas. This finding holds across the range of sample medicines studied, and cannot be explained by price differences alone. While different private distribution networks for essential medicines may provide part of the explanation, this cannot explain why the urban bias in availability of imported medicines is also found in the public sector. Conclusions The findings suggest that enhanced local production may improve rural access to medicines. The potential benefits of local production and scope for their improvement are an important field for further research, and indicate a key policy area in which economic development and health care objectives may reinforce each other. PMID:24612518

  15. Reliability and validity of using telephone calls for post-discharge surveillance of surgical site infection following caesarean section at a tertiary hospital in Tanzania

    Directory of Open Access Journals (Sweden)

    Boniface Nguhuni

    2017-05-01

    Full Text Available Abstract Background Surgical site infection (SSI is a common post-operative complication causing significant morbidity and mortality. Many SSI occur after discharge from hospital. Post-discharge SSI surveillance in low and middle income countries needs to be improved. Methodology We conducted an observational cohort study in Dodoma, Tanzania to examine the sensitivity and specificity of telephone calls to detect SSI after discharge from hospital in comparison to a gold standard of clinician review. Women undergoing caesarean section were enrolled and followed up for 30 days. Women providing a telephone number were interviewed using a structured questionnaire at approximately days 5, 12 and 28 post-surgery. Women were then invited for out-patient review by a clinician blinded to the findings of telephone interview. Results A total of 374 women were enrolled and an overall SSI rate of 12% (n = 45 was observed. Three hundred and sixteen (84% women provided a telephone number, of which 202 had at least one telephone interview followed by a clinical review within 48 h, generating a total of 484 paired observations. From the clinical reviews, 25 SSI were diagnosed, of which telephone interview had correctly identified 18 infections; telephone calls did not incorrectly identify SSI in any patients. The overall sensitivity and specificity of telephone interviews as compared to clinician evaluation was 72 and 100%, respectively. Conclusion The use of telephone interview as a diagnostic tool for post-discharge surveillance of SSI had moderate sensitivity and high specificity in Tanzania. Telephone-based detection may be a useful method for SSI surveillance in low-income settings with high penetration of mobile telephones.

  16. Lymphocyte subset enumeration in HIV seronegative and HIV-1 seropositive adults in Dar es Salaam, Tanzania: determination of reference values in males and females and comparison of two flow cytometric methods.

    Science.gov (United States)

    Urassa, W K; Mbena, E M; Swai, A B; Gaines, H; Mhalu, F S; Biberfeld, G

    2003-06-01

    The level of CD4(+) T-lymphocytes represents a useful marker with which to monitor the progression of HIV infection. Sex and geographical differences in the reference values of lymphocyte subsets have been reported. We have compared two flow cytometric methods (MultiSET and SimulSET) for the quantification of lymphocyte subsets using whole blood from 92 HIV seropositive and 241 seronegative adults, and determined the reference values of lymphocyte subsets in HIV seronegative Tanzanian subjects. In seronegative Tanzanian subjects, the percentages of CD3(+) and CD4(+) T-lymphocytes and the CD4(+):CD8(+) T-lymphocyte ratios were lower while the percentage of natural killer cells was higher compared to the levels of the corresponding parameters reported for Europeans. Seronegative Tanzanian females had significantly higher levels of CD3(+) and CD4(+) T-lymphocytes and CD4(+):CD8(+) T-lymphocyte ratios compared to seronegative males. The correlation coefficients of CD3(+), CD4(+) and CD8(+) T lymphocyte counts and percentages obtained by the two flow cytometric methods were high. The median values of the number of CD4(+) T-lymphocytes obtained by the two methods were not significantly different. In conclusion, determination of the reference values of lymphocyte subsets in HIV seronegative Tanzanian adults showed significant sex differences and differences in percentage values compared to those reported in certain other geographical areas. There was acceptable agreement in the levels of CD4(+) T-lymphocyte values obtained by the two flow cytometric methods.

  17. Acute care in Tanzania: Epidemiology of acute care in a small community medical centre

    Directory of Open Access Journals (Sweden)

    Rachel M. Little

    2013-12-01

    Discussion: Respiratory infections, malaria, and skin or soft tissue infections are leading reasons for seeking medical care at a small community medical centre in Arusha, Tanzania, highlighting the burden of infectious diseases in this type of facility. Males may be more likely to present with trauma, burns, and laceration injuries than females. Many patients required one or no procedures to determine their diagnosis, most treatments administered were inexpensive, and most patients were discharged home, suggesting that providing acute care in this setting could be accomplished with limited resources.

  18. Inter-epidemic abundance and distribution of potential mosquito vectors for Rift Valley fever virus in Ngorongoro district, Tanzania

    OpenAIRE

    Mweya, Clement N.; Kimera, Sharadhuli I.; Mellau, Lesakit S. B.; Mboera, Leonard E. G.

    2015-01-01

    Background: Rift Valley fever (RVF) is a mosquito-borne viral zoonosis that primarily affects ruminants but also has the capacity to infect humans. Objective: To determine the abundance and distribution of mosquito vectors in relation to their potential role in the virus transmission and maintenance in disease epidemic areas of Ngorongoro district in northern Tanzania. Methods: A cross-sectional entomological investigation was carried out before the suspected RVF outbreak in October 2012. Mos...

  19. The Relative Patient Costs and Availability of Dental Services, Materials and Equipment in Public Oral Care Facilities in Tanzania.

    OpenAIRE

    Nyamuryekung'e, Kasusu K; Lahti, Satu M; Tuominen, Risto J

    2015-01-01

    Background Patient charges and availability of dental services influence utilization of dental services. There is little available information on the cost of dental services and availability of materials and equipment in public dental facilities in Africa. This study aimed to determine the relative cost and availability of dental services, materials and equipment in public oral care facilities in Tanzania. The local factors affecting availability were also studied. Methods A survey of all dis...

  20. Pattern of Occurrence and Treatment of Impacted Teeth at the Muhimbili National Hospital, Dar es Salaam, Tanzania.

    OpenAIRE

    Msagati, Farizana; Simon, Elison Nm; Owibingire, Sira

    2013-01-01

    Background Impacted teeth predispose to periodontal disease and dental caries of adjacent teeth resulting in pain, discomfort and loss of function. This study analyzed the pattern of occurrence of impacted teeth, associated symptoms, treatment and complications of treatment in patients who presented at the Muhimbili National Hospital, Tanzania. Method This was a crossectional descriptive study which utilized notes and x rays of patients who were treated for impacted teeth at the Oral and Maxi...

  1. A qualitative study of HPV vaccine acceptability among health workers, teachers, parents, female pupils, and religious leaders in northwest Tanzania

    OpenAIRE

    Remes, Pieter; Selestine, Veronica; Changalucha, John; Ross, David A.; Wight, Daniel; de Sanjosé, Silvia; Kapiga, Saidi; Hayes, Richard J.; Watson-Jones, Deborah

    2012-01-01

    Background As human papillomavirus (HPV) vaccines become available in developing countries, acceptability studies can help to better understand potential barriers and facilitators of HPV vaccination and guide immunisation programs. Methods Prior to a cluster-randomised phase IV trial of HPV vaccination delivery strategies in Mwanza Region, Tanzania, qualitative research was conducted to assess attitudes and knowledge about cervical cancer and HPV, and acceptability of and potential barriers t...

  2. Spatial rainfall variability and runoff response during an extreme event in a semi-arid catchment in the South Pare Mountains, Tanzania

    NARCIS (Netherlands)

    Mul, M.L.; Savenije, H.H.G.; Uhlenbrook, S.

    2009-01-01

    OA fund TU Delft This paper describes an extreme flood event that occurred in the South Pare Mountains in northern Tanzania. A high spatial and temporal resolution data set has been gathered in a previously ungauged catchment. This data was analysed using a multi-method approach, to gather

  3. Improving the Quality of Basic Education through the Use of Gender-Sensitive Student Councils: Experience of Six Selected Districts in Tanzania

    Science.gov (United States)

    Mnubi, Godfrey Magoti

    2017-01-01

    This paper analyses whether the gender-sensitive and democratically elected student councils helped in strengthening school leadership and providing a platform for increased awareness and advocacy for male and female students to address their needs and rights in primary and secondary schools in Tanzania. The data were collected through qualitative…

  4. Antimicrobial Resistance and Genotypic Diversity of Campylobacter Isolated from Pig, Dairy and Beef Cattle in Tanzania

    Directory of Open Access Journals (Sweden)

    Isaac eKashoma

    2015-11-01

    Full Text Available Foodborne Campylobacter infections pose a serious threat to public health worldwide. However, the occurrence and characteristics of Campylobacter in food animals and products remain largely unknown in Tanzania. The objective of this study was to determine the prevalence, antibiotic resistance, and genetic profiles (sequence types, STs of Campylobacter isolated from feces of pigs and dairy and beef cattle in Tanzania. Overall, 259 (~ 30% of 864 samples were positive for Campylobacter spp, which were detected in 32.5%, 35.4%, and 19.6% of the pig, dairy, and beef cattle samples, respectively. Multiplex PCR analysis identified 64.5% and 29.3% of the Campylobacter isolates as C. coli and C. jejuni, respectively. The majority (91.9% of the isolates from pig samples were identified as C. coli, while C. jejuni accounted for 65.5% of the isolates from cattle. Antimicrobial susceptibility testing using the disk diffusion assay and the broth microdilution method revealed resistance to: ampicillin (70% and 76%, gentamicin (1.8% and 12.6%, respectively, streptomycin (65.8% and 74.8%, erythromycin (41.4% and 48.7%, tetracycline (18.9% and 23.4%, and ciprofloxacin (14.4% and 7.2%. Resistance to nalidixic acid (39.6%, azithromycin (13.5%, and chloramphenicol (4.5% was determined using the disk diffusion assay only, while resistance to tylosin (38.7% was quantified using the broth microdilution method. Multilocus sequence typing of 111 Campylobacter isolates resulted in the identification of 48 STs (26 C. jejuni and 22 C. coli of which 7 were novel (6 C. jejuni and 1 C. coli. Taken together, this study revealed the high prevalence, genetic diversity and antimicrobial resistance of Campylobacter in important food animals in Tanzania, which highlights the urgent need for the surveillance and control of Campylobacter in this country.

  5. Antimicrobial Resistance and Genotypic Diversity of Campylobacter Isolated from Pigs, Dairy, and Beef Cattle in Tanzania

    Science.gov (United States)

    Kashoma, Isaac P.; Kassem, Issmat I.; Kumar, Anand; Kessy, Beda M.; Gebreyes, Wondwossen; Kazwala, Rudovick R.; Rajashekara, Gireesh

    2015-01-01

    Foodborne Campylobacter infections pose a serious threat to public health worldwide. However, the occurrence and characteristics of Campylobacter in food animals and products remain largely unknown in Tanzania. The objective of this study was to determine the prevalence, antibiotic resistance, and genetic profiles (sequence types, STs) of Campylobacter isolated from feces of pigs and dairy and beef cattle in Tanzania. Overall, 259 (~30%) of 864 samples were positive for Campylobacter spp, which were detected in 32.5, 35.4, and 19.6% of the pig, dairy, and beef cattle samples, respectively. Multiplex PCR analysis identified 64.5 and 29.3% of the Campylobacter isolates as C. coli and C. jejuni, respectively. The majority (91.9%) of the isolates from pig samples were identified as C. coli, while C. jejuni accounted for 65.5% of the isolates from cattle. Antimicrobial susceptibility testing using the disk diffusion assay and the broth microdilution method revealed resistance to: ampicillin (Amp) (70.3% and 75.7%, respectively), gentamicin (Gen) (1.8% and 12.6%), streptomycin (Str) (65.8 and 74.8%), erythromycin (Ery) (41.4 and 48.7%), tetracycline (Tet) (18.9 and 23.4%), and ciprofloxacin (Cip) (14.4 and 7.2%). Resistance to nalidixic acid (Nal) (39.6%), azithromycin (Azm) (13.5%), and chloramphenicol (Chl) (4.5%) was determined using the disk diffusion assay only, while resistance to tylosin (Tyl) (38.7%) was quantified using the broth microdilution method. Multilocus sequence typing of 111 Campylobacter isolates resulted in the identification of 48 STs (26 C. jejuni and 22 C. coli) of which seven were novel (six C. jejuni and one C. coli). Taken together, this study revealed the high prevalence, genetic diversity and antimicrobial resistance of Campylobacter in important food animals in Tanzania, which highlights the urgent need for the surveillance and control of Campylobacter in this country. PMID:26617582

  6. Status of Occupational Health and Safety and Related Challenges in Expanding Economy of Tanzania.

    Science.gov (United States)

    Mrema, Ezra J; Ngowi, Aiwerasia V; Mamuya, Simon H D

    2015-01-01

    Occupational health and safety is related with economic activities undertaken in the country. As the economic activities grow and expand, occupational injuries and diseases are more likely to increase among workers in different sectors of economy such as agriculture, mining, transport, and manufacture. This may result in high occupational health and safety services demand, which might be difficult to meet by developing countries that are prioritizing economic expansion without regard to their impact on occupational health and safety. To describe the status of occupational health and safety in Tanzania and outline the challenges in provision of occupational health services under the state of an expanding economy. Tanzania's economy is growing steadily, with growth being driven by communications, transport, financial intermediation, construction, mining, agriculture, and manufacturing. Along with this growth, hazards emanating from work in all sectors of the economy have increased and varied. The workers exposed to these hazards suffer from illness and injuries and yet they are not provided with adequate occupational health services. Services are scanty and limited to a few enterprises that can afford it. Existing laws and regulations are not comprehensive enough to cover the entire population. Implementation of legislation is weak and does not protect the workers. Most Tanzanians are not covered by the occupational health and safety law and do not access occupational health services. Thus an occupational health and safety services strategy, backed by legislations and provided with the necessary resources (competent experts, financial and technological resources), is a necessity in Tanzania. The existing legal provisions require major modifications to meet international requirements and standards. OHS regulations and legislations need refocusing, revision, and strengthening to cover all working population. Capacities should be improved through training and research

  7. Sources of community health worker motivation: a qualitative study in Morogoro Region, Tanzania.

    Science.gov (United States)

    Greenspan, Jesse A; McMahon, Shannon A; Chebet, Joy J; Mpunga, Maurus; Urassa, David P; Winch, Peter J

    2013-10-10

    There is a renewed interest in community health workers (CHWs) in Tanzania, but also a concern that low motivation of CHWs may decrease the benefits of investments in CHW programs. This study aimed to explore sources of CHW motivation to inform programs in Tanzania and similar contexts. We conducted semi-structured interviews with 20 CHWs in Morogoro Region, Tanzania. Interviews were digitally recorded, transcribed, and coded prior to translation and thematic analysis. The authors then conducted a literature review on CHW motivation and a framework that aligned with our findings was modified to guide the presentation of results. Sources of CHW motivation were identified at the individual, family, community, and organizational levels. At the individual level, CHWs are predisposed to volunteer work and apply knowledge gained to their own problems and those of their families and communities. Families and communities supplement other sources of motivation by providing moral, financial, and material support, including service fees, supplies, money for transportation, and help with farm work and CHW tasks. Resistance to CHW work exhibited by families and community members is limited. The organizational level (the government and its development partners) provides motivation in the form of stipends, potential employment, materials, training, and supervision, but inadequate remuneration and supplies discourage CHWs. Supervision can also be dis-incentivizing if perceived as a sign of poor performance. Tanzanian CHWs who work despite not receiving a salary have an intrinsic desire to volunteer, and their motivation often derives from support received from their families when other sources of motivation are insufficient. Policy-makers and program managers should consider the burden that a lack of remuneration imposes on the families of CHWs. In addition, CHWs' intrinsic desire to volunteer does not preclude a desire for external rewards. Rather, adequate and formal financial

  8. “I may not say we really have a method, it is gambling work”: Knowledge and acceptability of safer conception methods among providers and HIV clients in Uganda

    Science.gov (United States)

    Finocchario-Kessler, Sarah; Wanyenze, Rhoda; Mindry, Deborah; Beyeza-Kashesya, Jolly; Goggin, Kathy; Nabiryo, Christine; Wagner, Glenn

    2014-01-01

    In this qualitative study, researchers assessed knowledge, acceptability and feasibility of safer conception methods [SCM; timed unprotected intercourse (TUI), manual self-insemination, and sperm washing] among various healthcare providers (n=33) and 48 HIV clients with recent or current childbearing intentions in Uganda. While several clients and providers had heard of SCM, (especially TUI); few fully understood how to use the methods. All provider types expressed a desire to incorporate SCM into their practice; however, this will require training and counseling protocols, sensitization to overcome cultural norms that pose obstacles to these methods, and partner engagement (particularly men) in safer conception counseling. PMID:24902120

  9. Efficacy of early neonatal vitamin A supplementation in reducing mortality during infancy in Ghana, India and Tanzania: study protocol for a randomized controlled trial

    Directory of Open Access Journals (Sweden)

    Bahl Rajiv

    2012-02-01

    Full Text Available Abstract Background Vitamin A supplementation of 6-59 month old children is currently recommended by the World Health Organization based on evidence that it reduces mortality. There has been considerable interest in determining the benefits of neonatal vitamin A supplementation, but the results of existing trials are conflicting. A technical consultation convened by WHO pointed to the need for larger scale studies in Asia and Africa to inform global policy on the use of neonatal vitamin A supplementation. Three trials were therefore initiated in Ghana, India and Tanzania to determine if vitamin A supplementation (50,000 IU given to neonates once orally on the day of birth or within the next two days will reduce mortality in the period from supplementation to 6 months of age compared to placebo. Methods/Design The trials are individually randomized, double masked, and placebo controlled. The required sample size is 40,200 in India and 32,000 each in Ghana and Tanzania. The study participants are neonates who fulfil age eligibility, whose families are likely to stay in the study area for the next 6 months, who are able to feed orally, and whose parent(s provide informed written consent to participate in the study. Neonates randomized to the intervention group receive 50,000 IU vitamin A and the ones randomized to the control group receive placebo at the time of enrolment. Mortality and morbidity information are collected through periodic home visits by a study worker during infancy. The primary outcome of the study is mortality from supplementation to 6 months of age. The secondary outcome of the study is mortality from supplementation to 12 months of age. The three studies will be analysed independent of each other. Subgroup analysis will be carried out to determine the effect by birth weight, sex, and timing of DTP vaccine, socioeconomic groups and maternal large-dose vitamin A supplementation. Discussion The three ongoing studies are the

  10. Implementation of an insecticide-treated net subsidy scheme under a public-private partnership for malaria control in Tanzania – challenges in implementation

    Directory of Open Access Journals (Sweden)

    Gilson Lucy

    2009-08-01

    Full Text Available Abstract Background In the past decade there has been increasing visibility of malaria control efforts at the national and international levels. The factors that have enhanced this scenario are the availability of proven interventions such as artemisinin-based combination therapy, the wide scale use of insecticide-treated nets (ITNs and a renewed emphasis in indoor residual house-spraying. Concurrently, there has been a window of opportunity of financial commitments from organizations such as the Global Fund for HIV/AIDS, Tuberculosis and Malaria (GFATM, the President's Malaria Initiative and the World Bank Booster programme. Methods The case study uses the health policy analysis framework to analyse the implementation of a public-private partnership approach embarked upon by the government of Tanzania in malaria control – 'The Tanzania National Voucher Scheme'- and in this synthesis, emphasis is on the challenges faced by the scheme during the pre-implementation (2001 – 2004 and implementation phases (2004 – 2005. Qualitative research tools used include: document review, interview with key informants, stakeholder's analysis, force-field analysis, time line of events, policy characteristic analysis and focus group discussions. The study is also complemented by a cross-sectional survey, which was conducted at the Rufiji Health Demographic Surveillance Site, where a cohort of women of child-bearing age were followed up regarding access and use of ITNs. Results The major challenges observed include: the re-introduction of taxes on mosquito nets and related products, procurement and tendering procedures in the implementation of the GFATM, and organizational arrangements and free delivery of mosquito nets through a Presidential initiative. Conclusion The lessons gleaned from this synthesis include: (a the consistency of the stakeholders with a common vision, was an important strength in overcoming obstacles, (b senior politicians often steered

  11. The societal cost of Taenia solium cysticercosis in Tanzania

    DEFF Research Database (Denmark)

    Trevisan, Chiara; Devleesschauwer, Brecht; Schmidt, Veronika

    2017-01-01

    Taenia solium is a zoonotic parasite prevalent in many low income countries throughout Latin America, Asia and sub-Saharan Africa, including Tanzania. The parasite is recognized as a public health threat; however the burden it poses on populations of Tanzania is unknown. The aim of this study...... was to estimate the societal cost of T. solium cysticercosis in Tanzania, by assessing both the health and economic burden. The societal cost of T. solium cysticercosis was assessed in humans and pigs based on data obtained by a systematic review. Experts' opinion was sought in cases where data were...... not retrievable. The health burden was assessed in terms of annual number of neurocysticercosis (NCC) associated epilepsy incident cases, deaths and disability-adjusted life years (DALYs), while the economic burden was assessed in terms of direct and indirect costs imposed by NCC-associated epilepsy and potential...

  12. Nutritional Deficiencies and Food Insecurity Among HIV-infected Children in Tanzania

    Directory of Open Access Journals (Sweden)

    Chelsea E. Modlin, BA

    2014-09-01

    Full Text Available Background: Poor nutrition has been associated with impaired immunity and accelerated disease progression in HIV- infected children. The aim of this study was to quantify the levels of nutrient intake in HIV-infected children and compare these to standard recommendations. Methods: We surveyed HIV-infected Tanzanian children enrolled in a pediatric care program that provided routine nutritional counseling and vitamin supplementation. We obtained anthropometric measurements and determined 24-hour macronutrient and micronutrient intakes and food insecurity. Values were compared to recommended nutrient intakes based on age and gender. Results: We interviewed 48 pairs of children and their caregiver(s. The age of the child ranged from 2-14 years; median age 6 and 60% female. The median weight-for-height z-score for children ≤ 5 years was 0.69 and BMI-for-age z-scores for children >5 was -0.84. Macronutrient evaluation showed that 29 (60% children were deficient in dietary intake of energy; deficiency was more common in older children (p=0.004. Micronutrient evaluation shows that over half of study subjects were deficient in dietary intake of vitamin A, vitamin D, vitamin E, thiamine, riboflavin, niacin, folate, vitamin B12, and calcium. Food insecurity was reported by 20 (58% caregivers. Conclusions and Public Health Implications: The diets of many HIV-infected children at a specialized treatment center in Tanzania do not meet recommended levels of macro- and micro-nutrients. Food insecurity was a contributory factor. Enhanced dietary counseling and provision of macro- and micro-nutrient supplements will be necessary to achieve optimal nutrition for most HIV-infected children in resource-poor regions.

  13. Understanding informal payments in health care: motivation of health workers in Tanzania

    Directory of Open Access Journals (Sweden)

    Bidwell Posy

    2009-06-01

    Full Text Available Abstract Background There is growing evidence that informal payments for health care are fairly common in many low- and middle-income countries. Informal payments are reported to have a negative consequence on equity and quality of care; it has been suggested, however, that they may contribute to health worker motivation and retention. Given the significance of motivation and retention issues in human resources for health, a better understanding of the relationships between the two phenomena is needed. This study attempts to assess whether and in what ways informal payments occur in Kibaha, Tanzania. Moreover, it aims to assess how informal earnings might help boost health worker motivation and retention. Methods Nine focus groups were conducted in three health facilities of different levels in the health system. In total, 64 health workers participated in the focus group discussions (81% female, 19% male and where possible, focus groups were divided by cadre. All data were processed and analysed by means of the NVivo software package. Results The use of informal payments in the study area was confirmed by this study. Furthermore, a negative relationship between informal payments and job satisfaction and better motivation is suggested. Participants mentioned that they felt enslaved by patients as a result of being bribed and this resulted in loss of self-esteem. Furthermore, fear of detection was a main demotivating factor. These factors seem to counterbalance the positive effect of financial incentives. Moreover, informal payments were not found to be related to retention of health workers in the public health system. Other factors such as job security seemed to be more relevant for retention. Conclusion This study suggests that the practice of informal payments contributes to the general demotivation of health workers and negatively affects access to health care services and quality of the health system. Policy action is needed that not only

  14. Microbial Efficacy of Waterless Hand Hygiene in Dar es Salaam, Tanzania

    Science.gov (United States)

    Pickering, A.; Boehm, A.; Davis, J.

    2008-12-01

    Millions of people die from diarrheal and respiratory diseases every year due to lack of proper sanitation, hygiene, and access to clean water. The act of handwashing with soap has been found to effectively reduce both diarrheal and respiratory illness, however, handwashing at critical times (i.e. after using the toilet, before preparing food) remains infrequent around the world. This research investigates the potential for alcohol- based hand sanitizer (ABHS) to be an effective and appropriate hand hygiene option in developing countries. A study was conducted to assess the microbiological effectiveness of ABHS, as compared to handwashing with soap and water, in field conditions in Dar es Salaam, Tanzania. A total of 205 participants, including mothers, nurses, students, and teachers, were introduced to ABHS, given a standardized amount (2ml) of product, and instructed on how to use the product correctly. Hand samples were obtained using the hand rinse method before and after the use of ABHS from 152 participants. The other 53 participants were hand sampled before and after handwashing with a non-antimicrobial liquid soap and clean water (prior to using ABHS). Visual inspections of the hands were performed before hand sampling to record the level of dirt on the hands. All hand samples were processed and analyzed by membrane filtration for concentrations of two microbial indicators, enterococci and E. coli. User perceptions of the product and willingness to pay are also documented. The results of this study provide valuable insight on the prospective of promoting ABHS in developing countries and water scarce areas.

  15. The Origins of the Acheulean at Olduvai Gorge (Tanzania: A New Paleoanthropological Project in East Africa

    Directory of Open Access Journals (Sweden)

    Ignacio de la Torre

    2012-12-01

    Full Text Available The disappearance of the earliest human culture, the Oldowan, and its substitution by a new technology, the Acheulean, is one of the main topics in modern Paleoanthropology. Recent research has established that the Acheulean emerged originally in East Africa around 1.7–1.6 million years ago, and from that area expanded across the rest of Africa, Europe and parts of Asia. Despite the great relevance of the Oldowan-Acheulean transition, little is known about the biological and cultural evolutionary mechanisms underlying this process. Traditionally, it has been assumed that this major cultural change was ignited by the emergence of a new human species, Homo ergaster/erectus, and that there was a steady technological evolution during the Oldowan that eventually led to the emergence of the Acheulean handaxes. However, these assumptions are not grounded in the current available evidence, but rooted in cultural-history paradigms that should now be superseded. Olduvai Gorge (Tanzania is the site where the traditional view of the Oldowan-Acheulean transition was established. The aim of the recently launched Olduvai Geochronology and Archaeology Project is to tackle this question by conducting a comprehensive research program at Olduvai, based on the retrieval of fresh data derived from new laboratory and fieldwork research. The multidisciplinary character of this ongoing study is providing an integrative perspective to the analysis of the paleoecology, archaeology, geology and geochronology of the transition to the Acheulean at Olduvai. Using an innovative theoretical perspective that combines interests in cultural change, ecological adaptations, and biological evolution, and state-of-the-art methods in archaeology, geology and taphonomy, this project aims to make Olduvai one of the world’s best references for the understanding of the evolutionary processes that led to the emergence of the Acheulean, the longest lasting culture in the history of

  16. Coming to Grips with Farmers' variety Selection- the Case of New Improved Rice Varieties under Irrigation in South East Tanzania

    Directory of Open Access Journals (Sweden)

    Kafiriti, EM.

    2003-01-01

    Full Text Available In collaboration with farmers, rice varieties were evaluated under small-scale irrigation in two villages of south east Tanzania for two consecutive cropping seasons (1999/2000 –2000/2001. The objectives were to give farmers access to new improved rice varieties; to identify the selection criteria farmers consider important in irrigated rice production; and to come to grips with their arguments. Farmers were provided with eleven improved varieties, which they compared with their own ones. Farmers' preferred varieties with short to medium maturity period, which produce many tillers and mature uniformly; and with long translucent aromatic grains for their own use and marketing. This study identified qualitative and quantitative evaluation criteria which farmers are using for selecting rice varieties. The implication for further research on rice in south east Tanzania is that the breeding programme should incorporate these attributes to address farmers' preferences, rather than to go for absolute maximum yield levels.

  17. Organizational and provider level factors in implementation of trauma-informed care after a city-wide training: an explanatory mixed methods assessment

    Directory of Open Access Journals (Sweden)

    April Joy Damian

    2017-11-01

    Full Text Available Abstract Background While there is increasing support for training youth-serving providers in trauma-informed care (TIC as a means of addressing high prevalence of U.S. childhood trauma, we know little about the effects of TIC training on organizational culture and providers’ professional quality of life. This mixed-methods study evaluated changes in organizational- and provider-level factors following participation in a citywide TIC training. Methods Government workers and nonprofit professionals (N = 90 who participated in a nine-month citywide TIC training completed a survey before and after the training to assess organizational culture and professional quality of life. Survey data were analyzed using multiple regression analyses. A subset of participants (n = 16 was interviewed using a semi-structured format, and themes related to organizational and provider factors were identified using qualitative methods. Results Analysis of survey data indicated significant improvements in participants’ organizational culture and professional satisfaction at training completion. Participants’ perceptions of their own burnout and secondary traumatic stress also increased. Four themes emerged from analysis of the interview data, including “Implementation of more flexible, less-punitive policies towards clients,” “Adoption of trauma-informed workplace design,” “Heightened awareness of own traumatic stress and need for self-care,” and “Greater sense of camaraderie and empathy for colleagues.” Conclusion Use of a mixed-methods approach provided a nuanced understanding of the impact of TIC training and suggested potential benefits of the training on organizational and provider-level factors associated with implementation of trauma-informed policies and practices. Future trainings should explicitly address organizational factors such as safety climate and morale, managerial support, teamwork climate and collaboration, and

  18. Dermatophilus congolensis infection in goats in Tanzania.

    Science.gov (United States)

    Msami, H M; Khaschabi, D; Schöpf, K; Kapaga, A M; Shibahara, T

    2001-10-01

    When goats in Eastern Tanzania were screened for skin diseases, Dermatophilus congolensis was isolated from the skin lesions in 8 of 484 animals examined. In one severely affected case, the disease was also characterized by histological studies (Gram stain, Giemsa stain and routine HE studies) and electron microscopy. The histological picture was characterized by hyperkeratosis, parakeratosis, acanthosis, folliculitis and an inflammatory cellular reaction involving the epidermis. Gram stain and Giemsa stain revealed longitudinal and transverse branching filaments in the deeper layers of the epidermis. Ultrastructural studies demonstrated D. congolensis in various morphological forms, ranging from filamentous to tuber-shaped structures, mixed with numerous coccoid bodies of variable size. In some instances, the organisms were geometrically arranged in parallel rows of beading and were present in and among the degenerated epithelial cells. Several host cells showed degenerative changes. Ticks present on the goats were Amblyomma variegatum, Rhipicephalus evertsi, Rhipicephalus pravus and Boophilus sp. The clinical signs, pathological lesions, diagnosis, epidemiology and pathogenesis of the disease are discussed.

  19. The sedimentary basins of Tanzania - reviewed

    Science.gov (United States)

    Mbede, E. I.

    The sedimentary basins of Tanzania have been classified into four morphotectonic groups: the coastal basin, the Karoo rift basins, basins found within the present East African rift valley and the cratonic sag basins. Except for the cratonic sag basins, each of these basin group has been affected by rifting at one time or another. The geology of each basin is discussed, structural evolution is evaluated and the prospectivity is thence looked into. Coal is exploited at Songwe-Kiwira coalfield and is found in potentially economic quantities in other Karoo basins. Prospecting for hydrocarbon resources has been going on since the 50s. Gas has been discovered in Songosongo and Mnazi bay fields, uneconomical quantities of oil have also been reported in Songosongo. Being basically rift basins which have reached different stages of development, source rocks normally associated with Initial-rifting, synrifting as well as post-rifting processes are probably well developed. Reservoir rocks, traps and cap rocks are normally not rare in such tectonic environments. Thermal gradients associated with the rifting stage are normaly high to effect maturation of source rocks even at low sedimentary thicknesses. Studies done so far are still inconclusive, because while testing has mainly been focused on structural traps stratigraphic traps seems to be more promising.

  20. Winners and losers of IWRM in Tanzania

    Directory of Open Access Journals (Sweden)

    Barbara van Koppen,

    2016-10-01

    Full Text Available This paper focuses on the application of the concept of Integrated Water Resources Management (IWRM in Tanzania. It asks: how did IWRM affect the rural and fast-growing majority of smallholder farmersʼ access to water which contributes directly to poverty alleviation and employment creation in a country where poverty and joblessness are high? Around 1990, there were both a strong government-led infrastructure development agenda and IWRM ingredients in place, including cost-recovery of state services aligning with the Structural Adjustment Programmes, water management according to basin boundaries and the dormant colonial water rights (permits system. After the 1990s, the World Bank and other donors promoted IWRM with a strong focus on hydroelectric power development, River Basin Water Boards, transformation of the water right system into a taxation tool, and assessment of environmental flows. These practices became formalised in the National Water Policy (2002 and in the Water Resources Management Act (2009. Activities in the name of IWRM came to be closely associated with the post-2008 surge in large-scale land and water deals. Analysing 25 years of IWRM, the paper identifies the processes and identities of the losers (smallholders and – at least partially – the government and the winners (large-scale water users, including recent investors. We conclude that, overall, IWRM harmed smallholdersʼ access to water and rendered them more vulnerable to poverty and unemployment.